|
Genome Browser User Guide
|
|
|
|
What does
the Genome Browser do?
|
|
| |
As vertebrate genome sequences near completion and research re-focuses on
their analysis, the issue of effective sequence display becomes critical: it is not
helpful to have 3 billion letters of genomic DNA shown as plain text! As an
alternative, the UCSC Genome Browser provides a rapid and reliable display of any
requested portion of genomes at any scale, together with dozens of
aligned annotation tracks (known genes, predicted genes, ESTs, mRNAs, CpG islands,
assembly gaps and coverage, chromosomal bands, mouse homologies, and more). Half of
the annotation tracks are computed at UCSC from publicly available
sequence data. The remaining tracks are provided by collaborators worldwide. Users can
also add their own custom tracks to the browser for educational or research
purposes.
The Genome Browser stacks annotation tracks beneath genome
coordinate positions, allowing rapid visual correlation of different types of
information. The user can look at a whole chromosome to get a feel for gene
density, open a specific cytogenetic band to see a positionally mapped disease gene
candidate, or zoom in to a particular gene to view its spliced ESTs and possible
alternative splicing. The Genome Browser itself does not draw conclusions; rather, it
collates all relevant information in one location, leaving the exploration and
interpretation to the user.
The Genome Browser supports text and sequence based searches that provide quick, precise
access to any region of specific interest. Secondary links from individual
entries within annotation tracks lead to sequence details and supplementary off-site
databases. To control information overload, tracks need not be displayed in full. Tracks
can be hidden, collapsed into a condensed or single-line display, or filtered according
to the user's criteria. Zooming and scrolling controls help to narrow or broaden the
displayed chromosomal range to focus on the exact region of interest.
Clicking on an individual item within a track opens a details page containing a
summary of properties and links to off-site repositories such as
PubMed, GenBank, Entrez, and OMIM. The page provides item-specific information on
position, cytoband, strand, data source, and encoded protein, mRNA, genomic sequence
and alignment, as appropriate to the nature of the track.
A blue navigation bar at the top of the browser provides links to several other tools
and data sources. For instance, the DNA link
enables the user to view the raw genomic DNA sequence for the coordinate range
displayed in the browser window. This DNA can encode track features via elaborate
text formatting options. Other links tie the Genome Browser to the BLAT
alignment tool, provide access to the underlying relational database via the
Table Browser, convert coordinates across different assembly dates, and open the
window at the complementary Ensembl
or NCBI Map
Viewer annotation.
The browser data represents an immense
collaborative effort
involving thousands of people from the international biomedical research community.
The UCSC Bioinformatics Group itself does no sequencing. Although it creates
the majority of the annotation tracks in-house, the annotations are based on
publicly available data contributed by many labs and research groups throughout
the world. Several of the Genome Browser annotations are generated in
collaboration with outside individuals or are contributed wholly by external
research groups. UCSC's
other major roles include building genome assemblies, creating the Genome Browser work
environment, and serving it online. The majority of the sequence data, annotation tracks, and even
software are in the public domain and are available for anyone
to download.
In addition to the Genome Browser, the UCSC Genome Bioinformatics group provides
several other tools for viewing and interpreting genome data:
| |
|
|
|
Getting Started:
Genome Browser gateways
|
|
| |
The UCSC Genome Bioinformatics home page
provides access to Genome Browsers on several different genome assemblies.
To get started, click the Browser link on the blue sidebar. This will take
you to a Gateway page where you can select which genome to display.
Opening the Genome Browser at a specific position
To get oriented in using the Genome Browser, try viewing a gene or region of
the genome with which you are already familiar, or use the default position.
To open the Genome Browser window:
| 1. |
Select the clade, genome and assembly that you wish to display from
the corresponding pull-down menus. To access older assembly versions
that are no longer available from the menu, look in the Genome
Browser archives.
|
| 2. |
Specify the genome location you'd like the Genome Browser to open to.
To select a location, enter a valid position query in the
position or search term text box at the top of the Gateway
page or accept the default position already
displayed. The search supports several different types of queries: gene
symbols, mRNA or EST accession numbers, chromosome
bands, descriptive terms likely to occur in GenBank text, or specific chromosomal
ranges. To display a region encompassed by two features on the same
chromosome, use a semi-colon, e.g. CRYBB3;CRYBB1. The Gateway page shows examples of some of the search requests supported by
the Genome Browser.
|
| 3. |
Click the submit button to open up the Genome Browser window to the
requested location. In cases where a specific term (accession, gene name,
etc.) was queried, the item will be highlighted in the display.
|
Occasionally the Gateway page returns a list of several matches in response
to a search, rather than immediately displaying the Genome Browser
window. When this occurs, click on the item in which you're interested and
the Genome Browser will open to that location.
The search mechanism is not a site-wide search engine. Instead, it
primarily searches GenBank mRNA records whose text annotations can include
gene names, gene symbols, journal title words, author names, and RefSeq
mRNAs. Searches on other selected identifiers, such as NP and NM accession
numbers, OMIM identifiers, and Entrez Gene IDs are supported. However, some
types of queries will return an error, e.g. post-assembly GenBank
entries, withdrawn gene names, and abandoned synonyms. If your initial
query is unsuccessful, try entering a different related term that
may produce the same location. For example, if a query on a gene symbol
produces no results, try entering an mRNA accession, gene ID number, or
descriptive words associated with the gene.
Finding a genome location using BLAT
If you have genomic, mRNA, or protein sequence, but don't know the name or
the location to which it maps in the genome, the
BLAT tool will rapidly locate the position by homology alignment, provided that the
region has been sequenced. This search will find close members of the gene
family, as well as assembly duplication artifacts. An entire set of query sequences can
be looked up simultaneously when provided in fasta format.
A successful BLAT search
returns a list of one or more genome locations that match the input sequence. To
view one of the alignments in the Genome Browser, click the browser link for the
match. The details link can be used to preview the alignment to determine if
it is of sufficient match quality to merit viewing in the Genome Browser. If too many BLAT hits
occur, try narrowing the search by filtering the sequence in slow mode with
RepeatMasker, then rerunning the BLAT search.
For more information
on conducting and fine-tuning BLAT searches, refer to the
BLAT section of this document.
Opening the Genome Browser with a custom annotation track
You can open the Genome Browser window with a custom annotation track displayed
by using the Add Custom Tracks feature available from the gateway and annotation
tracks pages.
For more information on creating and using custom annotation tracks, refer to
the Creating custom annotation tracks section.
Annotation track data can be entered in one of three ways:
| -- |
Enter the file name for an annotation track source file in the
Annotation File text box.
|
| -- |
Type or paste the annotation track data into the large text box.
|
| -- |
If the annotation data are accessible through a URL, enter the URL name in the
large text box.
|
Once you've entered the annotation information, click the submit button at the top of
the Gateway page to open up the Genome Browser with the annotation track
displayed.
The Genome Browser also provides a collection of custom annotation tracks contributed by the UCSC
Genome Bioinformatics group and the research community.
NOTE: If an annotation track does not display correctly when
you attempt to upload it, you may need to reset the Genome Browser to
its default settings, then reload the track. For information on
troubleshooting display problems with custom annotation tracks, refer to the
troubleshooting section in the Creating custom
annotation tracks section.
Viewing genome data as text
The
Table Browser,
a portal to the underlying open source MySQL relational database driving the Genome
Browser, displays genomic data as columns of text rather than as
graphical tracks. For more information on using the Table Browser, see the
section Getting Started: on the Table Browser.
Opening the Genome Browser from external gateways
Several external gateways provide direct links into the Genome Browser. Examples
include: Entrez Gene,
AceView,
Ensembl, SuperFamily,
and GeneCards. Journal
articles can also link to the browser and provide custom tracks. Be sure to use
the assembly date appropriate to the provided coordinates when using data from
a journal source.
Tips for Use
To facilitate your return to regions of interest within the Genome
Browser, save the coordinate range or bookmark the page of displays that you plan to
revisit or wish to share with others.
It is usually best to work with the most recent assembly even though a full
set of tracks might not yet be ready. Be aware that the coordinates of a given feature
on an unfinished chromosome may change from one assembly to the next as
gaps are filled, artifactual duplications are reduced, and strand orientations
are corrected. The Genome Browser offers multiple tools that can correctly
convert coordinates between different assembly releases. For more information
on conversion tools,
see the section Converting data between assemblies.
To ensure uninterrupted browser services for your research during UCSC server
maintenance and power outages, bookmark a
mirror site that
replicates the UCSC genome browser.
Bear in mind that the Genome Browser cannot outperform the underlying quality of
the draft genome. Assembly errors and sequence gaps may still occur well into
the sequencing process due to regions that are intrinsically difficult to sequence.
Artifactual duplications arise as unavoidable compromises during a build, causing
misleading matches in genome coordinates found by alignment.
| |
|
|
|
Interpreting and fine-tuning the
Genome Browser display
|
|
| |
The Genome Browser annotation tracks page displays a genome location
specified through a Gateway search, a BLAT search, or an uploaded
custom annotation track. There are five main features on this page: a set of
navigation controls, a
chromosome ideogram, the annotations tracks image,
display configuration buttons, and a set of track
display controls.
The first time you open the
Genome Browser, it will use the application default values to configure the
annotation tracks display. By manipulating the navigation, configuration
and display controls, you can customize the annotation tracks display to
suit your needs.
For a complete description of the annotation tracks available in all assembly
versions supported by the Genome Browser, see the
Annotation Track Descriptions section.
The Genome Browser retains user preferences from session to session within the
same web browser, although it never monitors or records user activities or
submitted data.
To restore the default settings, click the "Click here to reset"
link on the Genome Browser Gateway page. To return the display to the default
set of tracks (but retain custom tracks and other configured Genome Browser
settings), click the default tracks button on the Genome Browser page.
Display conventions
The annotation tracks displayed in the Genome Browser use a common set of
display conventions:
| -- | Annotation track
descriptions:
Each annotation track has an associated description page that contains a
discussion of the track, the methods used to create the annotation, the
data
sources and credits for the track, and (in some cases) filter and
configuration options to
fine-tune the information displayed in the track. To view the
description page, click on the mini-button to the left of a displayed
track or on the label for the track in the Track Controls section. |
| -- | Annotation track
details pages:
When an annotation track is displayed in full, pack, or squish mode,
each line item
within the track has an associated details page that can be displayed by
clicking on the item or its label. The
information contained in the details page varies by annotation track, but
may include basic position information about the item, related links
to outside sites
and databases, links to genomic alignments, or links to corresponding
mRNA, genomic, and protein sequences.
|
| -- | Gene prediction tracks:
Coding exons are represented by blocks connected by horizontal lines
representing introns. The 5' and 3' untranslated regions (UTRs) are displayed
as thinner blocks on the leading and trailing ends of the aligning
regions. In full display mode, arrowheads on
the connecting intron lines indicate the direction of transcription.
In situations where no intron is visible (e.g. single-exon genes,
extremely zoomed-in displays), the arrowheads are displayed on the exon
block itself. |
| -- | Pattern Space Layout (PSL) alignment
tracks:
Aligning regions (usually exons when the query is cDNA) are shown as black blocks. In dense display
mode, the degree of darkness corresponds to the number of features aligning to
the region or the degree of quality of the match. In pack or full display mode,
the aligning regions are connected by lines
representing gaps in the alignment (typically spliced-out introns), with arrowheads indicating
the orientation of the alignment, pointing right if the query sequence was aligned
to the forward strand of the genome and left if aligned to the reverse strand.
Two parallel lines are drawn over double-sided alignment gaps, which skip over
unalignable sequence in both target and query.
For alignments of ESTs, the arrows may be reversed to show the apparent
direction of transcription deduced from splice junction sequences.
In situations where no gap lines are
visible, the arrowheads are displayed on the block itself.
To prevent display problems, the Genome Browser imposes an upper
limit on the number of alignments that can be viewed simultaneously
within the tracks image. When this limit is exceeded, the Browser
displays the best several hundred alignments in a condensed display
mode, then lists the number of undisplayed alignments in the last
row of the track. In this situation, try zooming in to display
more entries or to return the track to full display mode.
For some PSL tracks, extra coloring
to indicate mismatching bases and query-only gaps may be available. |
| -- | "Chain" tracks
(2-species alignment):
Chain tracks display boxes joined together by either single or double
lines. The boxes represent aligning regions. Single lines indicate gaps
that are largely due to a deletion in the genome of the first species or
an insertion in the genome of the second species. Double lines represent
more complex gaps that involve substantial sequence in both species.
This may result from inversions, overlapping deletions, an abundance of
local mutation, or an unsequenced gap in one species. In cases where
there are multiple chains over a particular portion of the genome,
chains with single-lined gaps are often due to processed pseudogenes,
while chains with double-lined gaps are more often due to paralogs and
unprocessed pseudogenes. In the fuller display modes, the individual
feature names indicate the chromosome, strand, and location
(in thousands) of the match for each matching alignment. |
| -- | "Net" tracks
(2-species alignment):
Boxes represent ungapped alignments, while lines represent gaps. Clicking
on a box displays detailed information about the chain as a whole, while
clicking on a line shows information on the gap. The detailed information
is useful in determining the cause of the gap or, for lower level chains,
the genomic rearrangement. Individual items in the display are
categorized as one of four types (other than gap):
-
Top - The best, longest match. Displayed on level 1.
-
Syn - Lineups on the same chromosome as the gap in the level
above it.
-
Inv - A lineup on the same chromosome as the gap above it, but
in the opposite orientation.
-
NonSyn - A match to a chromosome different from the gap in the
level above.
|
| -- | "Wiggle"
tracks:
These tracks plot a continuous function along a chromosome. Data is
displayed in windows of a set number of base pairs in width.
The score for each window
displays as "mountain ranges". The display characteristics vary among
the tracks in this group. See the individual track descriptions for more
information on interpreting the display. If the "mountain peak" is
taller or shorter than what can be shown in the display, it is
clipped and colored magenta. |
Changing the display mode of an individual annotation track
Each annotation track within the window may have up to five display modes:
| -- | Hide: the
track is not displayed at all. To hide all the annotation tracks,
click the hide all button. This mode is useful for restricting
the display to only those tracks in which you are interested. For
example, someone who is not interested in SNPs or mouse synteny may want
to hide these tracks to reduce track clutter and improve speed. There
are a few annotation tracks that pertain only to one specific
chromosome, e.g. Sanger22, Rosetta. In these cases, the track and its
associated controller will be hidden automatically when the track window is
not open to the relevant chromosome. |
| -- | Dense: the
track is displayed with all features collapsed into a single
line. This mode is useful for reducing the amount of space used by a
track when you don't need individual line item details or when you just
want to get an overall view of an annotation. For example, by opening an
entire chromosome and setting the RefSeq Genes track to dense, you can get
a feel for the known gene density of the chromosome without displaying
excessive detail. |
| -- | Full: the
track is displayed with each annotation feature on a separate line. It is
recommended that you use this option sparingly, due to the large number
of individual track items that may potentially align at the selected position. For
example, hundreds of ESTs might align with a specified gene. When
the number of lines within a requested track location exceeds 250, the
track automatically defaults to a more tightly-packed display mode. In
this situation,
you can restore the track display to full mode by narrowing the chromosomal
range displayed or by using a track filter to reduce the number of items
displayed. On tracks that contain only hide, dense, and full modes, you
can toggle between full and dense display modes by clicking on the
track's center label. |
| -- | Squish: the
track is displayed with each annotation feature shown separately, but
at 50% the height of full mode. Features are unlabeled, and more than one
may be drawn on the same line. This mode is useful for reducing the
amount of space used by a track when you want to view a large number of
individual features and get an overall view of an annotation. It is
particularly good for displaying tracks in which a large number of
features align to a particular section of a chromosome, e.g. EST tracks.
|
| -- | Pack: the
track is displayed with each annotation feature shown separately and
labeled, but not necessarily displayed on a separate line.
This mode is useful for reducing the
amount of space used by a track when you want to view the large number of
individual features allowed by squish mode, but need the labeling and
display size provided by full mode. When the number of lines within the
requested track location exceeds 250, the track automatically defaults
to squish display mode. In this situation, you can restore the track
display to pack mode by narrowing the chromosomal range displayed or by
using a track filter to reduce the number of items
displayed. To toggle between pack and full display modes, click on
the track's center label.
|
The track display controls are grouped into categories that reflect the type
of data in the track, e.g. Gene Prediction Tracks, mRNA and EST tracks, etc.
To change the display mode for a track, find the track's controller in the
Track Controls section at the bottom of the Genome Browser page, select the desired
mode from the control's display menu, and then click the refresh button.
Alternatively, you can change the display mode by using the Genome
Browser's right-click navigation feature,
or can toggle between dense and full modes
for a displayed track (or pack mode when available) by clicking on the optional
center label for the track.
Changing the display mode for a group of tracks
Track display modes may be set individually or as a group on the Genome
Browser Track Configuration page. To access the configuration page, click the
configure button on the annotation tracks page or the
configure tracks and display button on the Gateway page. Exercise
caution when using the show all buttons on track groups or
assemblies that contain a large number tracks; this may seriously impact the
display performance of the Genome Browser or cause your Internet browser to
time out.
Hiding the track display controls
The entire set of track display controls at the bottom of the annotation
tracks page may be hidden from view by checking the Show track controls
under main graphic option in the Configure Image section of the Track
Configuration page.
Changing the display of a track by using filters and configuration options
Some tracks have additional filter and configuration capabilities,
e.g. EST tracks, mRNA tracks, NC160, etc. These options
let the user modify the color or restrict the data displayed within an annotation track.
Filters are useful for focusing attention on items relevant to the current task
in tracks that contain large amounts of data. For example, to highlight ESTs
expressed in the liver, set the EST track filter to display items in a
different color when the associated tissue keyword is "liver". Configuration
options let the user adjust the display to best show the data of interest.
For example, the min vertical viewing range value on wiggle tracks
can be used to establish a data threshold. By setting the min value to "50", only data values greater than 50 percent will display.
To access filter and configuration options for a specific annotation track, open
the tracks' description page by clicking the label for the track's control menu
under the Track Controls section, the mini-button to the left of the displayed
track, or the "Configure..." option from the Genome Browser's
right-click popup menu.
The filter and configration section is located at the top of the
description page. In most instances, more information about the configuration
options is available within the description text or through a special help link
located in the configuration section.
Filter and configuration settings are persistent from session to session on the
same web browser. To return the Genome Browser display to the default set of
tracks (but retain custom tracks and other configured Genome Browser settings),
click the
default tracks button on the Genome Browser tracks page.
To remove all user configuration settings and custom tracks, and completely
restore the defaults, click the "Click here to reset" link on the
Genome Browser Gateway page.
Zooming and scrolling the tracks display
At times you may want to adjust the amount of flanking region displayed in the
annotation tracks window or adjust the scale of the display. At a scale of 1 pixel per
base pair, the window accurately displays the width of exons and introns, and
indicates the direction of transcription (using arrowheads) for multi-exon features. At a
grosser scale, certain features - such as thin exons - may disappear. Also, some
exons may falsely appear to fall within RepeatMasker features at some scales.
Click the zoom in and zoom out buttons at the top of the
Genome Browser page to zoom in or out on the center of the annotation tracks window by 1.5, 3 or
10-fold. Alternatively, you can zoom in 3-fold on the display by clicking
anywhere on the
Base Position track. In this case, the zoom is centered on the coordinate of the
mouse click. To view the base composition of the sequence underlying the
current annotation track display, click the base button.
Quickly zoom to a specific region of interest by using the browser's
"drag-and-zoom" feature. To define the region you wish to zoom to,
click-and-hold the mouse button on one edge of the desired zoom area in the Base
Position track, drag the mouse right or left to highlight the selection area,
then release the mouse button. The annotation tracks image will automatically
zoom to the new region. To drag-and-zoom in a part of the image other
than the Base Position track, depress the shift key before clicking and dragging
the mouse.
Note that the Enable advanced javascript
features option on the Track Configuration page must be toggled on to use
this feature.
To scroll (pan) the view of the entire tracks image horizontally, click on the
image and drag the cursor to the left or right, then release the mouse button,
to shift the displayed region in the corresponding direction. The view may be
scrolled by up to one image width.
To scroll the annotation tracks horizontally by set increments of 10%, 50%, or
95% of the displayed
size (as given in base pairs), click the corresponding move arrow. It is also
possible to scroll the left or right side of the tracks by a specified number
of vertical gridlines while keeping the
position of the opposite side fixed. To do this, click the appropriate move
start or move end arrow, located under the annotation tracks window.
For example, to keep the left-hand display coordinate fixed but increase the
right-hand coordinate, you would click the right-hand move end arrow. To increase
or decrease the gridline scroll interval, edit the value in the move start or
move end text box.
Changing the displayed track position
To display a completely different position in the genome, enter the new query in
the position/search text box, then click the jump button. For more information on
valid entries for this text box, refer to the Getting
Started section.
If a chromosome image (ideogram) is available above the track display, click anywhere
on the chromosome to move to that position (the current window size will be
maintained). Select a region of any size by clicking and dragging in the image.
Finally, hold the "control" key while clicking on a chromosome band
to select the entire band.
Changing the order of the displayed tracks
To vertically reposition a track in the annotation track window, click-and-hold
the mouse button on the side label, then drag the highlighted track up or down
within the image. Release the mouse button when the track is in the desired
position. To move an entire group of associated tracks (such as all the
displayed subtracks in a composite track), click-and-hold the gray mini-button
to the left of the tracks, then drag.
Changing the width of the annotation track window
The first time the annotation track window is displayed, or after the
Genome Browser has been reset, the size of the track window is
set by default to the width that best fits your Internet browser window. If you
horizontally resize the browser window, you can automatically adjust the
annotation track image size to the new width by clicking the resize
button under the track image. To manually override the default width, enter a
new value in the image width text box on the Track Configuration page,
then click the submit button. The maximum supported width is 5000 pixels.
Changing the width of the label area to the left of the image
The item labels (or track label, when viewed in dense mode) are displayed to
the left of the annotation image. The width of this area is set to 17
characters by default. To change the width, edit the value in the label
area width text box on the Track Configuration page, then click
Submit.
Changing the text size in the annotation track image
The annotation track image may be adjusted to display text in a range of
fonts from "tiny" to "huge". To change the size of the
text, select an option from the text size pull-down menu on the
Track Configuration page, then click Submit. The text size is set to
"small" by default.
Hiding the annotation track labels
The track and element labels displayed above and to the left of the tracks
in the annotation tracks image may be hidden from view by unchecking the
Display track descriptions above each track and Display labels
to the left of items in tracks boxes, respectively, on the Track
Configuration page.
Hiding the display grid on the annotation tracks image
The light blue vertical guidelines on the annotation tracks image may be
removed by unchecking the Show light blue vertical guidelines box
on the Track Configuration page.
Hiding the chromosome ideogram
The chromosome ideogram, located just above the annotation tracks image,
provides a graphical overview of the features on the selected chromosome,
including its bands, the position of the centromere, and an indication of
the region currently displayed in the annotation tracks image.
To hide the ideogram, uncheck the Display chromosome ideogram above
main graphic box on the Tracks Configuration page.
Enabling item and exon navigation
When the Next/previous item navigation configuration option is
toggled on, on the Track Configuration page,
gray double-headed arrows display in the Genome Browser tracks image on both
sides of the track labels of gene, mRNA and EST tracks (or any standard tracks
based on BED, PSL or genePred format). Clicking on the gray arrows shifts the
image window toward that end of the chromosome so that the next item in the
track is displayed. Similarly, the
Next/previous exon navigation configuration option displays white
double-headed arrows on
both the 5' and 3' end of each track item that has exons positioned beyond the
edges of the current image. Clicking on one of the white arrows shifts the image
window to the next exon located towards that end of the feature.
Enabling the right-click navigation feature
Several of the common display and navigation operations offered on the
Genome Browser tracks page may be quickly accessed by right-clicking on
a feature on the tracks image and selecting an option from the displayed
popup menu. Depending on context, the right-click feature allows the
user to:
- change the track display mode
- zoom in or out to the exact position coordinates of the feature
- open the "Get DNA" window at the feature's coordinates
- display details about the feature
- open a popup window to configure the track's display
- display the entire tracks image in a
separate window for inclusion in spreadsheets or other documents. (Note
that the Genome Browser "PDF/PS" described below can also be
used to generate a high-quality annotation tracks image suitable for
printing.)
To use the right-click feature, make sure the Enable advanced
javascript features option on the Track Configuration page is checked,
and configure your internet browser to allow the display of popup
windows from genome.ucsc.edu. When enabled, the right-click navigation
feature replaces the default contextual popup menu typically displayed by the
internet browser when a user right-clicks on the tracks image. A few
combinations of the Mozilla Firefox browser on Mac OS do not support the
right-click menu functionality using secondary click; in these
instances, ctrl+left-click must be used to display the menu.
Printing a copy of the annotation track window
The Genome Browser provides a mechanism for saving a copy of
the currently displayed annotation tracks image to a file that can be printed
or edited. Images saved in PostScript format can be printed at high resolution
and edited by drawing programs such as Adobe Illustrator. This is useful for
generating figures intended for publication. Images can also be saved in PDF
format for viewing by Adobe Acrobat Reader.
To print or save the image to a file:
| 1. |
Click the PDF/PS link in the menu on the annotation tracks page. |
| 2. |
Click the PostScript or PDF link.
|
NOTE: If you have configured your browser image to use one of the larger
font sizes, the text in the resulting screen shot may not display correctly.
If you encounter this problem, reduce the Genome Browser font size using the
Configuration utility, then repeat the save/print
process.
| |
|
|
|
| |
BLAT (BLAST-Like Alignment Tool) is a very fast sequence alignment tool similar to
BLAST.
For more information on BLAT's internal scoring schemes and its overall n-mer
alignment seed strategy, refer to W. James Kent (2002) BLAT -
The BLAST-Like Alignment Tool, Genome Res 12:4 656-664.
On DNA queries, BLAT is designed to quickly find sequences with 95% or greater
similarity of length 25 bases or more. It may miss genomic alignments that
are more divergent or shorter than these minimums, although it will find perfect
sequence matches of 33 bases and sometimes as few as 22 bases. The tool is
capable of aligning sequences that contain large introns.
On protein queries, BLAT rapidly locates genomic sequences with 80% or greater
similarity of length 20 amino acids or more. In general, gene family members that
arose within the last 350 million years can generally be detected. More
divergent sequences can be aligned to the human genome by using NCBI's BLAST and
psi-BLAST, then using BLAT to align the resulting match onto the UCSC genome
assembly. In practice DNA BLAT works well on primates, and protein BLAT works
well on land vertebrates.
Some common uses of BLAT include:
| -- |
finding the genomic coordinates of mRNA or protein within a given assembly
|
| -- |
determining the exon structure of a gene
|
| -- |
displaying a coding region within a full-length gene
|
| -- |
isolating an EST of special interest as its own track
|
| -- |
searching for gene family members
|
| -- |
finding human homologs of a query from another species.
|
Making a BLAT query
To locate a nucleotide or protein within a genome using BLAT:
| 1. |
Open the BLAT Search Genome page by clicking the BLAT link on the top
blue menu bar of any of the Genome Browser pages. |
| 2. |
Select the genome, assembly, query type, output sort order, and output
type. To order the search results based on the closeness of the sequence
match, choose one of the score options in the Sort output menu.
The score is determined by the number of matches vs. mismatches in the
final alignment of the query to the genome.
|
| 3. |
If the sequence to be uploaded is in an unformatted plain text file, enter
the file name in the Upload sequence text box, then click the
submit file
button. Otherwise, paste the sequence or fasta-formatted list into the large
edit box, and then click the submit button. Input sequence can be
obtained from the Genome Browser as well as from a custom annotation
track. |
Header lines may be included in the input text if they are preceded by > and
contain unique names.
Multiple sequences may be submitted at the same time if they are of the
same type and are preceded by unique header lines. Numbers, spaces, and extraneous
characters are ignored:
>sequence_1
ATGCAGAGCAAGGTGCTGCTGGCCGTCGCCCTGTGGCTCTGCGTGGAGAC
CCGGGCCGCCTCTGTGGGTTTGCCTAGTGTTTCTCTTGATCTGCCCAGGC
>sequence_2
ATGTTGTTTACCGTAAGCTGTAGTAAAATGAGCTCGATTGTTGACAGAGA
TGACAGTAGTATTTTTGATGGGTTGGTGGAAGAAGATGACAAGGACAAAG
>sequence_3
ATGCTGCGAACAGAGAGCTGCCGCCCCAGGTCGCCCGCCGGACAGGTGGC
CGCGGCGTCCCCGCTCCTGCTGCTGCTGCTGCTGCTCGCCTGGTGCGCGG
BLAT limitations
DNA input sequences are limited to a maximum length of 25,000 bases. Protein or
translated input sequences must not exceed 5000 letters. As many as 25 multiple
sequences may be submitted at the same time. The maximum combined length of DNA
input for multiple sequence submissions is 50,000 bases (with a 25,000 base
limit per individual sequence). For
protein or translated input, the maximum combined input length is 12,500 letters
(with a 5000 letter limit per individual sequence).
NOTE: Program-driven BLAT use is
limited to a maximum of one hit every 15 seconds and no more than 5000 hits per
day.
BLAT query search results
If a query returns successfully, BLAT will display a flat database file that
summarizes the alignments found. A BLAT query often generates multiple
hits. This can happen when the genome contains
multiple copies of a sequence, paralogs, pseudogenes, statistical coincidences,
artifactual assembly duplications, or when the query itself contains repeats or common
retrotransposons. When too many hits occur, try resubmitting the query sequence
after filtering in slow mode with RepeatMasker.
Items in the search results list are ordered by the criteria specified in the
Sort output menu. Each line item provides links to view the details of the sequence
alignment or to open the corresponding view in the Genome Browser. The
details link gives the letter-by-letter alignment of the sequence to the
genome. It is recommended
that you first examine the details of the alignment for match quality before viewing
the sequence in the Genome Browser.
When several nearby BLAT matches occur on a single chromosome, a
simple trick can be used to quickly adjust the Genome Browser track window to display
all of them: open the Genome Browser with the match that has the lowest chromosome
start coordinate, paste in the highest chromosome end coordinate from the list of
matches, then click the jump button.
Creating a custom annotation track from BLAT output
To make a custom track directly from BLAT, select the
PSL format
output option. The resulting PSL track can be uploaded into the Genome Browser by
pasting the data into the data text box on the Genome Browser
Add Custom
Tracks page, accessed via the "add custom tracks" button on the
Browser gateway and annotation tracks pages. See the
Creating custom annotation tracks section for more
information.
Using BLAT for large batch jobs or commercial use
For large batch jobs or internal parameter changes, it is best to install
command line BLAT on your own Linux server. Sources and executables are free for
academic, personal, and non-profit purposes. BLAT source may be downloaded from
http://www.soe.ucsc.edu/~kent (look for the blatSrc*.zip file
with the most recent date). For BLAT executables, go to
http://genome-test.cse.ucsc.edu/~kent/exe/; binaries are sorted by
platform.
Non-exclusive commercial licenses are available from the
Kent Informatics
website.
BLAT documentation
For more information on the BLAT suite of programs, see the
BLAT
Program Specifications and the
Blat section of the Genome
Browser FAQ.
| |
|
|
|
Annotation track descriptions
|
|
| |
Detailed information about an individual annotation track, including display
characteristics, configuration information, and associated database tables,
may be obtained from the track description page accessed by clicking the
mini-button to the left of the displayed track in the Genome Browser, or
by selecting the "Open details..." or "Show
details..." option from the Genome Browser's
right-click menu.
Click the "View table schema" link on the track description page to
display additional information about the primary database table underlying the
track. Table schema information may also be accessed via the "describe
table schema" button in the Table Browser. For
more information on configuring and using the tracks
displayed in the Genome Browser track window, see the section
Interpreting and Fine-tuning the Genome Browser display.
Tips for viewing annotation track data
| -- |
To display a description page with more information about the track,
click on the mini-button to the left of a track. |
| -- |
To display a details page with additional information about a specific line
item within a track in full display mode, click on the item or its label. |
| -- |
A track does not appear in the browser if its display mode is set to
hide. To restrict the browser's display to only those tracks in
which you're interested, set the display mode of the unwanted tracks to
hide. |
| -- |
A track set to full display mode will default to a more tightly
packed display mode if
the total number of lines in the track exceeds 250. |
| -- |
To quickly toggle between full and dense or pack display modes, click on
the track's center label. |
| -- |
Only the most recent assemblies are fully active. Older assemblies may be archived. |
| -- |
Not all tracks appear in all assemblies. Only a basic set of tracks
appears initially in a new assembly. |
| -- |
Track data can be viewed as text tables using
the Table Browser. |
| -- |
Credit
goes to many individuals and institutions for generously contributing
the tracks. For specific information about the contributors of a given
track, look at the Credits section on a track's description page. |
| |
| |
|
Getting started on the Table Browser
|
|
| |
The Table
Browser provides text-based access to the genome assemblies and annotation
data stored in the Genome Browser database. As a flexible alternative to the
graphical-based Genome Browser, this tool offers an enhanced level of
query support that includes restrictions based on field values, free-form
SQL queries, and combined queries on multiple tables. Output can be filtered
to restrict the fields and lines returned, and may be organized into one of
several formats, including a simple tab-delimited file that can be loaded into
a spreadsheet or database as well as advanced formats that may be uploaded into
the Genome Browser as custom annotation tracks.
The Table Browser provides a convenient
alternative to downloading and manipulating the entire genome and its massive
data tracks.
(See the Downloading Genome Data section.)
For information on using the Table Browser features, refer to the Table Browser User Guide.
| |
|
|
|
Getting started using Sessions
|
|
| |
The Sessions tool
allows users to configure their browsers with specific track
combinations, including custom tracks, and save the configuration options.
Multiple sessions may be saved for future reference, for comparison of
scenarios or for sharing with colleagues. Saved sessions persist for
four months after the last access, unless deleted.
User-generated tracks
can be saved within sessions.
This tool may be accessed via the Sessions link in the top blue
navigation bar in any assembly. To ensure privacy and security, users must
login to
the genomewiki site
and create a username and password. Individual sessions
may be designated by the user as either "shared" or
"non-shared" to protect the privacy of confidential data. To
avoid having a new shared session from someone else override existing
Genome Browser settings, users are encouraged to open a new web-browser
instance or to save existing settings in a session before loading a new
shared session.
For more detailed information on using the Session tool, see the
Sessions User Guide.
| |
|
|
|
Getting started on Genome Graphs
|
|
| |
The Genome Graphs tool can
be used to display genome-wide data sets such as the results of genome-wide
SNP association studies, linkage studies, and homozygosity mapping. This tool
is not pre-loaded with any sample data; instead, you can upload your own
data for display by the tool.
Once you have uploaded your data, you can view it in a variety of ways.
You can view multiple sets of genome-wide data simultaneously either as
superimposed graphs or side-by-side graphs. Once you see an area of interest
in the Genome Graphs view, you can click on it to go directly to the
Genome Browser at that position. You can also set a significance threshold
for your data and view only regions or gene sets that meet that threshold.
For information on using the Genome Graphs features, refer to the Genome Graphs User Guide.
| |
|
|
|
Using the VisiGene Image Browser
|
|
| |
VisiGene is a browser for viewing
in situ images. It enables the user to examine cell-by-cell as well as
tissue-by-tissue expression patterns. The browser serves as a virtual
microscope, allowing users to retrieve images that meet specific search
criteria, then interactively zoom and scroll across the collection.
To start the VisiGene browser, click the VisiGene link in the left-hand
sidebar menu on the Genome Browser home page.
Images Available
The following image collections are currently available for browsing:
Searching the Image Database
The image database may be searched by gene symbols, authors, years of
publication, body parts, GenBank or UniProtKB accessions, organisms,
Theiler stages (mice), and
Nieuwkoop/Faber stages (frogs). The search returns only those
images that match all the specified criteria. For a list of sample search
strings, see the VisiGene Gateway page.
The wildcard characters * and ? are supported for gene name searches. For
example, to view the images of all genes in the Hox A cluster, search for
hoxa*. When searching on author names that include initials, use the
format Smith AJ.
Image Navigation
Following a successful search, VisiGene displays a list of thumbnails of images
matching the search criteria in the lefthand pane of the browser. By default,
the image corresponding to the first thumbnail in the list is displayed in the
main image pane. If more than 25 images meet the search criteria, links at the
bottom of the thumbnail pane allow the user to toggle among pages of search
results. To display a different image in the main browser pane, click the
thumbnail of the image you wish to view.
By default, an image is displayed at a resolution that provides optimal viewing
of the overall image. This size varies among images. The image may be zoomed in
or out, sized to match the resolution of the original image or best fit the
image display window, and moved or scrolled in any direction to focus on areas
of interest. The original full-sized image may also be downloaded.
Zooming in: To enlarge the image by 2X, click the Zoom in button
above the image or click on the image using the left mouse button.
Alternatively, the + key may be used to zoom in when the main image pane is the
active window.
Zooming out: To reduce the image by 2X, click the Zoom out
button above the image or click on the image using the right mouse button.
Alternatively, the - key may be used to zoom out when the main image pane is
the active window.
Sizing to full resolution: Click the Zoom full button above the
image to resize the image such that each pixel on the screen corresponds to a
pixel in the digitized image.
Sizing to best fit: Click the Zoom fit button above the image
to zoom the image to the size that best fits the main image pane.
Moving the image: To move the image viewing area in any direction, click
and drag the image using the mouse. Alternatively, the following keyboard
shortcuts may be used after clicking on the image:
- Scroll left in the image: Left-arrow key or Home key
- Scroll right in the image: Right-arrow key or End key
- Scroll up in the image: Up-arrow key or PgUp key
- Scroll down in the image: Down-arrow key or PgDn key
Downloading the original full-sized image: Most images may be viewed
in their original full-sized format by clicking the "download" link
at the bottom of the image caption. NOTE: due to the large size of some images,
this action may take a long time and could potentially exceed the capabilities
of some Internet browsers.
If you have an image set you would like to contribute for display in the VisiGene
Browser, contact Jim Kent.
| |
|
|
|
| |
The Genome Browser provides a feature to configure the retrieval, formatting,
and coloring of the text used to depict the DNA sequence underlying the features in the displayed
annotation tracks window. Retrieval options allow the user to add a padding of
extra bases to the upstream or downstream end of the sequence. Formatting options range from simply displaying exons in upper case to
elaborately marking up a sequence according to multiple track data. The DNA sequence covered by
various tracks can be highlighted by case, underlining, bold or italic fonts, and color.
The DNA display configuration feature can be useful to highlight features within a
genomic sequence, point out overlaps between two types of features (for example, known
genes vs. gene predictions), or mask out unwanted features.
Using the DNA text formatting feature
To access the feature, click on the DNA link on the top blue menu
bar on the Genome Browser page, or select the "Get DNA..." option
from the Genome Browser's right-click menu.
The Get DNA in Window page that appears contains
sections for configuring the retrieval and output format.
To display extra bases upstream of the 5' end of your sequence or downstream
of the 3' end of the sequence, enter the number of bases in the corresponding
text box. This option is useful in looking for regulatory regions.
The Sequence Formatting section lists several options for
adjusting the case of all or part of the DNA sequence. To choose one of these formats,
click the corresponding option button, then click the get DNA button. To access a table
of extended formatting options, click the Extended case/color options button.
The Extended DNA Case/Color page presents a table with many more format options. The page
provides instructions for using the formatting table, as well as examples of its use. The
list of tracks in the Track Name column is automatically generated from the list of tracks
available on the current genome.
Tips for Use
A few caveats mentioned on the Extended DNA Case/Color page bear repeating. Keep the formatting simple at first: it is easy to
make a display that is pretty to look at but is also completely cryptic. Also, be careful when
requesting complex formatting for a large chromosomal region: when all the HTML tags have been
added to the output page, the file size may exceed the size limits that your internet browser,
clipboard, and other software can safely display. The maximum size of genome that can be
formatted by the tool is approximately 10 Mbp.
| |
|
|
|
Converting data between assemblies
|
|
| |
Coordinates of features frequently
change from one assembly to the next as gaps are closed, strand orientations are
corrected, and duplications are reduced. Occasionally, a chunk of sequence may
be moved to an entirely different chromosome as the map is
refined. There are three different methods available for migrating data from one
assembly to another: BLAT alignment, coordinate conversion, and coordinate
lifting. The BLAT alignment tool is described in the section
Using BLAT alignments.
Coordinate conversion
The Genome Browser Convert utility is useful for
locating the position of a feature of interest in a different release of the
same genome or (in some cases) in a genome assembly of another species.
During the conversion process, portions of the genome in the coordinate range
of the original assembly are aligned to the new assembly while preserving their
order and orientation. In general, it is easier to achieve successful
conversions with shorter sequences.
When coordinate conversion is available for an assembly, a Convert link
is displayed in the top menu bar on the Genome Browser tracks page. Click this
link to convert the currently-displayed coordinate range. You will be presented
with a list of the genome/assembly conversion options
available for the
current assembly. Select the genome and assembly to which you'd like to convert
the coordinates, then click the Submit button. If the conversion is successful,
the browser will return a list of regions in the new assembly, along with
the percent of bases and span covered by that region. Click on a region to
display it in the browser. If the conversion is unsuccessful, the utility
returns a failure message.
Lifting coordinates
The liftOver tool is useful if you wish to convert a large number of
coordinate ranges between assemblies. This tool is available in both
web-based and command line forms, and supports forward/reverse conversions
as well as conversions between species.
Web-based coordinate lifting
To access the graphical version of the liftOver tool, click the Utilities link
in the left-hand sidebar on the Genome Browser home page, then select the
Batch Coordinate Conversion
(liftOver) link.
To convert one or more coordinate ranges using the default conversion settings:
-
Select the genome and assembly from which the ranges were taken
("Original"), as well as the genome and assembly to which the
coordinates should be converted ("New").
- Select the Data Format option:
Browser Extensible Data format (BED)
or position (coordinates of the form chrN:start-end).
- Enter coordinate ranges in the selected data format into the large text
box, one per line.
- Click Submit.
Alternatively, you may load the coordinate ranges from an existing data
file by entering the file name in the upload box at the bottom of the screen,
then clicking the Submit File button.
The default parameter settings are recommended for general purpose use of the
liftOver tool. However, you may want to customize settings if you have several
very large regions to convert.
Command-line coordinate lifting
The command-line version of liftOver offers the increased flexibility and
performance gained by running the tool on your local server. This utility
requires access to a Linux platform. The executable file
may be downloaded
here.
Command-line liftOver requires a UCSC-generated over.chain file as
input. Pre-generated files for a given assembly can be accessed from the
assembly's "LiftOver files" link on the
Downloads page. If the desired conversion file is not listed,
send a request to the
genome mailing list and we may be able
to generate one for you.
| |
|
|
|
| |
Most of the underlying tables containing the genomic sequence and annotation data
displayed in the Genome Browser can be downloaded. All of the tables are
freely usable for any purpose except as indicated in the README.txt file
in the download directories. This data was contributed by many researchers, as
listed on the Genome Browser
Credits page. Please
acknowledge the contributor(s) of the data you use.
Downloading the data
Genome data can be downloaded in two different ways:
| -- | Via
ftp:The UCSC Genome Bioinformatics ftp site contains download
directories for all genome versions currently accessible in the
Genome Browser. The ftp command
ftp://hgdownload.cse.ucsc.edu/goldenPath/ will take you to a
directory that contains the genome download directories. This
download method is recommended if you plan to download a large file
or multiple files from a single directory. Use the mget command
to download multiple files: mget filename1 filename2, or
mget -a (to download all the files in the directory). |
| -- | Via the Downloads link: Click the
Downloads link on the left side bar on the UCSC
Genome Bioinformatics home page to display a list of all database directories
available for
download. If the data you wish to download pre-dates the assembly
versions listed, look in the archives accessible from the
Archive link on the home page.
|
Types of data available
There may be several download directories associated with each version of a genome
assembly: the full data set (bigZips), the full data set by
chromosome (chromosome), the annotation database tables
(database), and one or more sets of comparative cross-species alignments.
BigZips contains the entire draft of the
genome in chromosome and/or contig form. Depending on the genome, this
directory may contain some or all of the following files:
| -- | chromAgp.zip:
Description of how the assembly was generated, unpacking to one file
per chromosome.
|
| -- | chromFa.zip:
The assembly sequence chromosomes, in one file per chromosome.
Repeats from RepeatMasker and Tandem Repeats Finder are shown in
lower case; non-repeating sequence is in upper case.
The main assembly is contained in the chrN.fa files, where
chrN is the name of the chromosome. The chrN_random.fa
files contain clones that are not yet finished or cannot be placed
with certainty at a specific place on the chromosome. In some
cases, including the human HLA region on chromosome 6, the
chrN_random.fa files also contain haplotypes that differ from
the main assembly.
|
| -- | chromFaMasked.zip:
The assembly sequence chromosomes, in one file per chromosome.
Repeats are masked by capital Ns; non-repeating sequence is shown in upper
case.
|
| -- | chromOut.zip:
RepeatMasker .out file for chromosomes, generated by RepeatMasker
at the -s sensitive setting.
|
| -- | chromTrf.zip:
Tandem Repeats Finder locations, filtered to keep repeats with period
less than or equal to 12, translated into one .bed file per
chromosome.
|
| -- | contigAgp.zip:
Description of how the assembly was generated from fragments at a contig
layout level.
|
| -- | contigFa.zip:
The assembly sequence contigs, in one file per contig. All
contigs are in forward orientation relative to the chromosome.
In some cases, this means that contigs will be reversed
relative to their orientation in the NCBI assembly. Repeats are
shown in lower case; non-repeating sequence is shown in upper case.
|
| -- | contigFaMasked.zip:
The assembly sequence contigs, in one file per contig.
Repeats are masked by capital Ns; non-repeating sequence is
shown in upper case.
|
| -- | contigOut.zip:
RepeatMasker .out file for contigs, generated by RepeatMasker
at the -s sensitive setting.
|
| -- | contigTrf.zip:
Tandem Repeats Finder locations, filtered to keep repeats with period
less than or equal to 12, and translated into one .bed file per
contig.
|
| -- | database.zip:
The Genome Browser database as tab-delimited files and associated
MySQL table-creation tiles (eliminated in later assemblies due to
size restrictions).
|
| -- | est.fa.zip:
Sequences of all GenBank ESTs for the selected species.
|
| -- | liftAll.zip:
The offsets of contigs within chromosomes.
|
| -- | mrna.zip:
mRNAs in GenBank from the selected species.
|
| -- | refmrna.zip:
RefSeq mRNAs from the selected species.
|
| -- | upstream1000.zip:
Sequences 1000 bases upstream of annotated transcription start of RefSeq
genes. This includes only cases where the transcription start is
annotated separately from the coding region start.
|
| -- | upstream2000.zip:
Same as upstream1000, but with 2000 bases.
|
| -- | upstream5000.zip:
Same as upstream1000, but with 5000 bases.
|
| -- | xenoMrna.zip:
All GenBank mRNAs from species other than that of the selected one.
|
Chromosomes contains the assembled sequence for the
genome in separate files for each chromosome in a zipped fasta format.
The main assembly can be found in the chrN.fa files, where N
is the name of the chromosome. The chrN_random.fa files contain clones
that are not yet finished or cannot be placed with certainty
at a specific place on the chromosome. In some cases, the chrN_random.fa
files also contain haplotypes that differ from the main assembly.
Database contains all of the
positional and non-positional tables in the genome annotation database. Each
table is represented by 2 files:
| -- | .sql file:
the MySQL commands used to create the table.
|
| -- | .txt.gz file:
the MySQL database table data in tab-delimited format and
compressed with gzip.
|
Schema descriptions for all tables in the genome annotation database may be
viewed by using the "describe table schema" button in the
Table Browser.
Cross-species alignments directories, such as the vsMm4
and humorMm3Rn3 directories in the hg16 assembly, contain pairwise
and multiple species alignments and filtered alignment files
used to produce cross-species annotations. For more information, refer to the
READMEs in these directories and the description of the
Multiple Alignment Format (MAF).
| |
|
|
|
Creating custom annotation tracks
|
|
| |
The Genome Browser provides dozens of aligned annotation tracks that have been
computed at UCSC or have been provided by outside collaborators. In addition to
these standard tracks, it is also possible for users to upload their own
annotation data for temporary display in the browser. These custom annotation
tracks are viewable only on the machine from which they were uploaded and are
automatically discarded 48 hours after the last time they are accessed, unless
they are saved in a Session.
Optionally, users can make custom annotations viewable by others as well.
Custom tracks are a wonderful tool for research scientists using the Genome
Browser. Because space is limited in the Genome Browser track window, many
excellent genome-wide tracks cannot be included in the standard set of tracks
packaged with the browser.
Other tracks of interest may be excluded from distribution because the
annotation track data is too specific to be of general interest or can't be
shared until journal publication. Many individuals and labs have contributed
custom tracks to the Genome Browser website for use by others. To view a list
of these custom annotation tracks, click the
Custom Tracks link on
the Genome Browser home page.
Custom annotation tracks are similar to standard tracks, but never become part
of the MySQL genome database. Each track has its own controller and persists
even when not displayed in the Genome Browser window, e.g. if the position
changes to a range that no longer includes the track. Typically, custom
annotation tracks are aligned under corresponding genomic sequence, but they
can also be completely unrelated to the data. For example, a track can be
displayed under a long sequence consisting of millions of Ns.
Genome Browser annotation tracks are based on files in line-oriented format.
Each line in the file defines a display characteristic for the track or defines
a data item within the track.
Annotation files contain three types of lines: browser lines, track lines,
and data lines. Empty lines and those starting with "#" are ignored.
To construct an annotation file and display it in the Genome
Browser, follow these steps:
Step 1. Format the data set
Formulate your data set as a tab-separated file using one of the formats
supported by the Genome Browser. Annotation data can be in
standard GFF format or in
a format designed specifically for the Human Genome Project or UCSC Genome
Browser, including
bedGraph,
GTF,
PSL,
BED,
bigBed, WIG,
bigWig,
BAM,
VCF,
MAF,
BED detail,
Personal Genome SNP,
and microarray
(BED15).
GFF and GTF files must be tab-delimited rather than
space-delimited to display correctly.
Chromosome references must be of the form chrN (the parsing of
chromosome names is case-sensitive).
You may include more than one data
set in your annotation file; these need not be in the same
format.
Step 2. Define the Genome Browser display characteristics
Add one or more optional browser lines to the
beginning of your formatted data file to configure the overall
display of the Genome Browser when it initially shows your annotation
data. Browser lines allow you to configure such things
as the genome position that the Genome Browser will initially open to,
the width of the display, and the configuration of the other
annotation tracks that are shown (or hidden) in the initial display.
NOTE: If the browser position is not explicitly set in the annotation
file, the initial display will default to the position setting most
recently used by the user, which may not be an
appropriate position for viewing the annotation track.
Step 3. Define the annotation track display characteristics
Following the browser lines--and immediately preceding the formatted
data--add a track line to
define the display attributes for your annotation data set. Track lines
enable you to define annotation track characteristics
such as the name, description, colors, initial display mode, use score,
etc. If you have included more than one data set in your annotation
file, insert a track line at the beginning of each new set of data.
Example 1:
Here is an example of a simple annotation file that contains a list of
chromosome coordinates.
browser position chr22:20100000-20100900
track name=coords description="Chromosome coordinates list" visibility=2
chr22 20100000 20100100
chr22 20100011 20100200
chr22 20100215 20100400
chr22 20100350 20100500
chr22 20100700 20100800
chr22 20100700 20100900
Click here to view this track in the Genome Browser.
Example 2:
Here is an example of an annotation file that defines 2 separate
annotation tracks in BED format. The first track displays blue one-base
tick marks every 10000 bases on chr 22.
The second track displays red 100-base features alternating with
blank space in the same region of chr 22.
browser position chr22:20100000-20140000
track name=spacer description="Blue ticks every 10000 bases" color=0,0,255,
chr22 20100000 20100001
chr22 20110000 20110001
chr22 20120000 20120001
track name=even description="Red ticks every 100 bases, skip 100" color=255,0,0
chr22 20100000 20100100 first
chr22 20100200 20100300 second
chr22 20100400 20100500 third
Click here to view this track in the Genome Browser.
Example 3:
This example shows an annotation file containing one data set in BED
format. The track displays features with multiple blocks, a thick end and thin
end, and hatch marks indicating the direction of transcription. The track
labels display in green (0,128,0), and the gray level of the each feature
reflects the score value of that line. NOTE: The track name line in this example
has been split over 2 lines for documentation purposes.
If you paste this example into the Genome Browser, you must remove the line
break to display the track successfully.
Click here for a copy of this
example that can be pasted into the browser without editing.
browser position chr22:1000-10000
browser hide all
track name="BED track" description="BED format custom track example" visibility=2
color=0,128,0 useScore=1
chr22 1000 5000 itemA 960 + 1100 4700 0 2 1567,1488, 0,2512
chr22 2000 7000 itemB 200 - 2200 6950 0 4 433,100,550,1500 0,500,2000,3500
Click
here to view this track in the Genome Browser.
Step 4. Display your annotation track in the Genome Browser
To view your annotation data in the Genome Browser, open the
Genome Browser home page and click the Genome
Browser link in the top menu bar. On the
Gateway page that
displays, select the genome and assembly on which your annotation data is based,
then click the "add custom tracks" button. (Note: if the Gateway
displays the "manage custom tracks" button instead, see
Displaying and Managing Custom Tracks for
information on how to display your track.)
On the Add Custom Tracks page, load the annotation track data or URL for your
custom track into the
upper text box and the track documentation (optional) into the lower text box,
then click the Submit button. Tracks may be loaded by entering text, a URL, or
a pathname on your local computer. For more information on these methods, as
well as information on creating and adding track documentation, see
Loading a Custom Track into the Genome Browser.
If you encounter difficulties displaying your annotation, read the section
Troubleshooting Annotation Display Problems.
Step 5. (Optional) Add details pages for individual track features
After you've constructed your track and have successfully displayed it in the
Genome Browser, you may wish to customize the details pages for individual track
features. The Genome Browser automatically creates a default details page for
each feature in the track containing the feature's name, position information,
and a link to the corresponding DNA sequence. To view the details page for a
feature in your custom annotation track (in full, pack, or squish display
mode), click on the item's label in the annotation track window.
You can add a link from a details page to an external web page containing
additional information about the feature by using the track line url attribute.
In the annotation file, set the url attribute in the track line to point
to a publicly available page on a web server. The url attribute
substitutes each occurrence of '$$' in the URL string with the name defined by the
name attribute. You can take advantage of this feature to provide
individualized information for each feature in your track by creating HTML anchors
that correspond to the feature names in your web page.
Example 4:
Here is an example of a file in which the url attribute has been set to
point to the file http://genome.ucsc.edu/goldenPath/help/clones.html. The '#$$'
appended to the end of the file name in the example points to the HTML NAME tag
within the file that matches the name of the feature (cloneA, cloneB, etc.).
NOTE: The track line in this example has been split over 2 lines for
documentation purposes. If you paste this example into
the browser, you must remove the line break to display the track successfully.
Click here for a copy of this
example that can be pasted into the browser without editing.
browser position chr22:10000000-10020000
browser hide all
track name=clones description="Clones" visibility=2
color=0,128,0 useScore=1
url="http://genome.ucsc.edu/goldenPath/help/clones.html#$$"
chr22 10000000 10004000 cloneA 960
chr22 10002000 10006000 cloneB 200
chr22 10005000 10009000 cloneC 700
chr22 10006000 10010000 cloneD 600
chr22 10011000 10015000 cloneE 300
chr22 10012000 10017000 cloneF 100
Click
here to display this track in the Genome Browser.
Step 6. (Optional) Share your annotation track with others
The previous steps showed you how to upload annotation data for your own use
on your own machine. However, many users would like to
share their annotation data with members of their research group on
different machines or with colleagues at other sites. To learn how
to make your Genome Browser annotation track viewable by others, read
the section Sharing Your Annotation Track with
Others.
| |
|
|
|
Loading a Custom Track into the Genome Browser
|
|
| |
Using the Genome Browser's custom track upload and management
utility, annotation tracks may be added for display in the Genome
Browser, deleted from the Genome Browser, or updated with new data
and/or display options. You may also use this interface to upload and
manage custom track sets for multiple genome assemblies.
To load a custom track into the Genome Browser:
Step 1. Open the Add Custom Tracks page
Click the "add custom tracks" button on the Genome Browser
Gateway page. (Note: if one or more tracks
have already
been uploaded during the current Browser session, additional tracks may be
loaded on the Manage Custom Tracks page. In this case, the button on the
Gateway page will be labeled "manage custom tracks" and will
automatically direct you to the track management page. See
Displaying and Managing Custom Tracks for more
information.)
Step 2. Load the custom track data
The Add Custom Tracks page contains separate
sections for uploading custom track data and optional custom track
descriptive documentation.
Load the annotation data into the upper section by one of the following
methods:
-
Enter one or more URLs for custom tracks (one per line) in the data text box.
The Genome Browser supports both the HTTP and FTP (passive-only) protocols.
-
Click the "Browse" button directly above the data text box, then
choose a custom track file from your local computer, or type the pathname of the
file into the "upload" text box adjacent to the "Browse"
button. The custom track data may be compressed by any of the following
programs: gzip (.gz), compress (.Z), or bzip2 (.bz2).
Files containing compressed data must include the appropriate suffix in their
names.
-
Paste or type the custom track data directly into the data box. Because the text
in this box will not be saved to a file, this method is not recommended unless
you have a copy of the data elsewhere.
Multiple custom tracks may be uploaded at one time on the Add Custom Tracks
page through one of the following methods:
-
Put all the tracks into the same file (rather than separate files), then
load the file via the Browse button.
-
Place your track files in a web-accessible location on your server, then
load them into the Genome Browser by pasting their URLs into the data box.
Step 3. (Optional) Load the custom track description page
If desired, you can provide optional descriptive text (in plain or HTML format) to accompany your custom track. This text will be displayed when a user clicks
the track's description button on the Genome Browser annotation tracks page.
Descriptive text may be loaded by one of the following methods:
-
Click the "Browse" button directly above the documentation text box,
then choose a text file from your local computer, or type the pathname of the
file into the "upload" text box adjacent to the "Browse"
button.
-
Paste or type the custom track data directly into the data box. Note that the
text in this box will not be saved to a file; therefore, this method is
not recommended except for temporary documentation purposes.
-
If your descriptive text is located on a website, you can reference it from
your custom track file by defining the track line attribute "htmlUrl":
htmlUrl=<external_url>.
In this case, there is no need to insert anything into the documentation text
box.
To format your description page in a style that is consistent with standard
Genome Browser tracks, click the template link below the documentation text
box for an HTML template
that may be copied and pasted into a file for editing.
If you load multiple custom tracks simultaneously using one of the
methods described in Step 2, a track description can be associated only with the
last custom track loaded, unless you upload the descriptive text using the
track line "htmlUrl" attribute described above.
Step 4. Upload the track
Click the Submit button to load your custom track data and
documentation into the Genome Browser. If the track uploads successfully, you
will be directed to the custom track management page where you can display
your track, update an uploaded track, add more tracks, or delete uploaded
tracks. If the Genome Browser encounters a problem while loading your track,
it will display an error. See the section Troubleshooting
Annotation Display Problems for help in diagnosing custom track problems.
| |
|
|
|
Displaying and Managing Custom Tracks
|
|
| |
After a custom track has been successfully loaded into the Genome Browser,
you can display it -- as well as manage your entire custom track set -- via the
options on the Manage Custom Tracks page. This page automatically displays when
a track has been uploaded into the Genome Browser (see
Loading a Custom Track into the Genome Browser).
Alternatively, you can access the track
management page by clicking the "manage custom tracks" button on the
Gateway or Genome Browser annotation tracks pages. (Note that the track
management page is available only if at least one track has been loaded during
the current browser session; otherwise, this button is labeled "add
custom tracks" and opens the Add Custom Track page.)
The table on the Manage Custom Tracks page shows the current set of uploaded
custom tracks for the genome and assembly specified at the top of the page. If
tracks have been loaded for more than one genome assembly, pulldown lists are
displayed; to view the uploaded tracks for a different assembly, select the
desired genome and assembly option from the lists.
The following track information is displayed in the Manage Custom Tracks
table:
- Name: a hyperlink to the Update Custom Track page where you can
update your track configuration and data.
- Description: the value of the "description" attribute from the track
line, if present. If no description is included in the input file, this field
contains the track name.
- Type: the track type, determined by the Browser based on the format
of the data.
- Doc: displays "Y" (Yes) if a description page has been uploaded for
the track; otherwise the field is blank.
- Items: the number of data items in the custom track file. An item
count is not displayed for tracks lacking individual items (e.g. wiggle format
data).
- Pos: the default chromosomal position defined by the track file in
either the browser line "position" attribute or the first data line. Click
this link to open the Genome Browser or Table Browser at the specified position
(Note: only the chromosome name is shown in this column). The Pos column
remains blank if the track lacks individual items (e.g. wiggle format data) and
the browser line "position" attribute hasn't been set.
Displaying a custom track in the Genome Browser
Click the "go to genome browser" button to display the entire custom
track set for the specified genome assembly in the Genome Browser. By default,
the browser will open to the position specified in the browser line
"position" attribute or first data line of the first custom track in
the table, or the last-accessed Genome Browser position if the track is in
wiggle data format. To open the display at the default position for another
track in the list, click the track's position link in the Pos column.
Viewing a custom track in the Table Browser
Click the "go to table browser" button to access the data for the
custom track set in the Table Browser. The
custom tracks will be listed in the "Custom Tracks" group pulldown
list.
Loading additional custom tracks
To load a new custom track into the currently displayed track set, click the
"add custom tracks" button. To
change the genome assembly to which the track should be added, select the
appropriate options from the pulldown lists at the top of the page. For
instructions on adding a custom track on the Add Custom Tracks page, see
Loading a Custom Track into the Genome Browser.
Removing one or more custom tracks
To remove custom tracks from the uploaded track set, click the checkboxes in the
"delete" column for all tracks you wish to remove, then click the
"delete" button. A custom track may also be removed by clicking the
"Remove custom track" button on the track's description
page. Note: removing the track from the Genome Browser does not
delete the track file from your server or local disk.
Updating a custom track
To update the stored information for a loaded custom track, click the
track's link in the "Name" column in the Manage Custom Tracks table.
A custom track may also be updated by clicking the "Update custom
track" button on the track's description page.
The Update Custom Track page provides sections for modifying the track
configuration information (the browser lines and track lines), the annotation
data, and the descriptive documentation that accompanies the track. Existing
track configuration lines are displayed in the top "Edit
configuration" text box. In the current implementation of this utility,
the existing annotation
data is not displayed. Because of this, the data cannot be incrementally
edited through this interface, but instead must be fully replaced using one of
the data entry methods described in Loading a Custom Track
into the Genome Browser. If description text has been uploaded for the
track, it will be displayed in the track documentation edit box, where it may
be edited or completely replaced. Once you have completed your updates, click
the Submit button to upload the new data into the Genome Browser.
If the data or description text for your custom track was originally loaded from
a file on your hard disk or server, you should first edit the file, then reload
it from the Update Custom Track page using the "Browse" button. Note
that edits made on this page to description text uploaded from a file will not
be saved to the original file on your computer or server. Because of this, we
recommend that you use the documentation edit box only for changes made to
text that was typed or pasted in.
| |
|
|
|
| |
Browser lines configure the overall display of the Genome Browser
window when your annotation file is uploaded. Each line defines one display
attribute. Browser lines consist of the format:
browser attribute_name attribute_value(s)
For example, if the browser line browser
position chr22:1-20000 is included in the annotation file, the Genome
Browser window will initially display the first 20000 bases of chr 22.
The following browser line attribute name/value options are available.
The value track_name must be set to the name of the primary table
on which the the track is based. To identify this table, open up the
Table Browser,
select the correct genome assembly, then select the track name from the
track list. The table list will show the primary table.
Alternatively, the primary table name can be obtained from a mouseover on the
track name in the track control section.
Note that composite track subtracks are not valid track_name
values. To find the symbolic name of a composite track, look in the
tableName field in the trackDb table, or mouseover the track
name in the track control section. It is not possible to display only a subset
of the subtracks at this time.
- position <position> - Determines the part of the genome
that the Genome Browser will initially open to, in chromosome:start-end format.
- hide all - Hides all annotation tracks except for those listed
in the custom track file.
- hide <track_name(s)> - Hides the listed tracks.
Multiple track names should be space-separated.
- dense all - Displays all tracks in dense mode. NOTE: Use the
"all" option cautiously. If the
browser display includes a large number of tracks or a large position
range, this option may overload your browser's resources and cause an
error or timeout.
- dense <track_name(s)> - Displays the specified tracks in
dense mode. Symbolic names must be used. Multiple track names should be
space-separated.
- pack all - Displays all tracks in pack mode. See NOTE for
"dense all".
- pack <track_name(s)> - Displays the specified tracks in
pack mode. Symbolic names must be used. Multiple track names should be
space-separated.
- squish all - Displays all tracks in squish mode. See NOTE for
"dense all".
- squish <track_name(s)> - Displays the specified tracks in
squish mode. Symbolic names must be used. Multiple track names should be
space-separated.
- full all - Displays all tracks in full mode. See NOTE for
"dense all".
- full <track_name(s)> - Displays the specified tracks in
full mode. Symbolic names must be used. Multiple track names should be
space-separated.
Note that the Genome Browser will open to the range defined in the
Gateway page position or search term box or the position saved as the
default unless the browser
line position attribute is defined in the annotation file. Although this
attribute is optional, it's recommended that you set this value in your
annotation file to ensure that the track will appear in the display range when
it is uploaded into the Genome Browser.
| |
|
|
|
| |
Track lines define the display attributes for all lines in an
annotation data set. If more than one data set is included in the
annotation file, each group of data must be preceded by a track line
that describes the display characteristics for that set of data.
A track line begins with the word track, followed by one or
more attribute=value pairs. Unlike browser lines - in which each
attribute is defined on a separate line - all of the track attributes for a
given set of data are listed on one line with no line
breaks. The inadvertent insertion of a line break into a track line
will generate an error when you attempt to upload the annotation track
into the Genome Browser.
The following track line attribute=value pairs are defined in the
Genome Browser:
- name=<track_label> - Defines the track label
that will be displayed to the left of the track in the Genome
Browser window, and also the label of the track control at the
bottom of the screen. The name can consist of up to 15
characters, and must be enclosed in quotes if the text contains
spaces. We recommend that the track_label be restricted to alpha-numeric
characters and spaces to avoid potential parsing problems. The default
value is "User Track".
- description=<center_label> - Defines the center label of the track
in the Genome Browser window. The description can consist of up
to 60 characters, and must be enclosed in quotes if the text contains
spaces. The default
value is "User Supplied Track".
- type=<track_type> - Defines the track type. The track type
attribute is required for
BAM,
BED detail,
bedGraph,
bigBed,
bigWig,
Microarray,
VCF and
WIG tracks.
- visibility=<display_mode> - Defines the
initial display mode of the annotation track. Values for
display_mode include: 0 - hide, 1 - dense, 2 - full, 3 - pack,
and 4 - squish. The numerical values or the words can be used, i.e.
full mode may be specified by "2" or "full". The
default is "1".
- color=<RRR,GGG,BBB> - Defines the main color
for the annotation track. The track color consists of three comma-separated
RGB values from 0-255. The default value is 0,0,0 (black).
- itemRgb=On - If this attribute is present and is set to
"On", the Genome Browser will use the RGB value shown in
the itemRgb field in each data line of
the associated BED track to determine the display color of the data on
that line.
- colorByStrand=<RRR,GGG,BBB RRR,GGG,BBB> - Sets colors for
+ and - strands, in that order. The colors consist of three comma-separated
RGB values from 0-255 each. The default is 0,0,0 0,0,0 (both black).
- useScore=<use_score> - If this attribute is
present and is set to 1, the score field in each of the track's data
lines will be used to determine the level of shading in which
the data is displayed. The track will display in shades of gray unless
the color attribute is set to 100,50,0 (shades of brown) or
0,60,120 (shades of blue). The default setting for useScore is "0".
This table shows the Genome Browser's translation of BED score values into
shades of gray:
| shade |
|
|
|
|
|
|
|
|
|
| score in range |
≤ 166 |
167-277 |
278-388 |
389-499 |
500-611 |
612-722 |
723-833 |
834-944 |
≥ 945 |
|
- group=<group> - Defines the annotation track group
in which the custom track will display in the Genome Browser window.
By default, group is set to "user", which causes
custom tracks to display at the top of the track listing in the group "Custom Tracks".
The value for "group" must be the "name" of one of the predefined track groups.
To get a list of allowable group names for an assembly, go to the table browser and select
"group: All Tables", "table: grp", and "get output". Entries in the "name" column may be used.
(Note that mirrors may define other group names in the grp table.)
- priority=<priority> - When the group
attribute is set, defines the display position of the track relative
to other tracks within the same group in the Genome Browser window.
If group is not set, the priority attribute defines
the track's order relative to other custom tracks displayed in the
default group, "user".
- db=<UCSC_assembly_name> - When set, indicates the
specific genome assembly for which the annotation data is intended;
the custom track manager will display an error if a user attempts to
load the track onto a different assembly. Any valid UCSC assembly ID
may be used (eg. hg18, mm8, felCat1, etc.). The default setting
is blank, allowing the custom track to be displayed on any assembly.
- offset=<offset> - Defines a number to be added
to all coordinates in the annotation track. The default is "0".
- maxItems=<#> - Defines the maximum number of items
the track can contain. The default value is 250. Be aware that tracks
with an extremely large number of items can cause system instability. The
Kent source utility bedItemOverlapCount can assist in analyzing base
overlap with large tracks.
- url=<external_url> - Defines a URL for an
external link associated with this track. This URL will be used
in the details page for the track. Any '$$' in this string this will be substituted
with the item name. There is no default for this attribute.
- htmlUrl=<external_url> - Defines a URL for an HTML
description page to be displayed with this track.
There is no default for this attribute. A template for a standard
format HTML track description is
here.
- bigDataUrl=<external_url> - Defines a URL to the
data file for
BAM,
bigBed,
bigWig or
VCF
tracks. This is a required attribute for those track types. There is no
default for this attribute.
| |
|
|
|
Sharing Your Annotation Track with Others
|
|
| |
To make your Genome Browser annotation track viewable by people on
other machines or at other sites, follow the steps below. (Note that
some of the URL examples in this section have been broken up into 2
lines for documentation display purposes).
Step 1.
Put your formatted annotation file on your web site. Be sure that
the file permissions allow it to be read by others.
Step 2.
Construct a URL that will link this annotation file to the Genome
Browser. The URL must contain 3 pieces of information specific
to your annotation data:
- The species or genome assembly on which your annotation data is based.
To automatically display the most recent assembly for a given organism, set
the org parameter: e.g. org=human. To specify a
particular genome assembly for an organism, use the db parameter,
db=database_name, where database_name is the UCSC code for
the genome assembly. For a list of these codes, see the Genome Browser FAQ.
Examples of this include: db=hg16 (Human July 2003 assembly), db=mm6
(Mouse Mar. 2005 assembly).
- The genome position to which the Genome Browser should initially
open. This information is of the form
position=chr_position, where chr_position is a
chromosome number, with or without a set of
coordinates. Examples of this include: position=chr22, position=chr22:15916196-31832390.
- The URL of the annotation file on your web site. This information is
of the form hgt.customText=URL, where
URL points to the annotation file on your website. An example of an
annotation file URL is http://genome.ucsc.edu/goldenPath/help/test.bed.
- If a login and password is required to access data loaded through a URL
(e.g., via https: protocol), this
information can be included in the URL using the format
protocol://user:password@server.com/somepath. Only Basic Authentication is
supported for HTTP. Note that passwords included in URLs are not protected. If a
password contains a non-alphanumeric character, such as $, the character must be
replaced by the hexadecimal representation for that character. For example, in
the password mypwd$wk, the $ character should be replaced by %24, resulting in
the modified password mypwd%24wk.
Combine the above pieces of information into a URL of the following
format (the information specific to your annotation file is highlighted):
http://genome.ucsc.edu/cgi-bin/hgTracks?org=organism_name& position=chr_position&hgt.customText=URL.
Example 10:
The following URL will open up the Genome Browser
window to display chr 22 of the latest human genome assembly
and will show the annotation track pointed to by the URL
http://genome.ucsc.edu/goldenPath/help/test.bed:
http://genome.ucsc.edu/cgi-bin/hgTracks?org=human&position=chr22& hgt.customText=http://genome.ucsc.edu/goldenPath/help/test.bed
Step 3. Provide the URL to others. To upload a custom annotation track
pointed to by a URL into the Genome Browser, paste the URL into the large text
edit box on the Add Custom Tracks page, then click the Submit button.
If you'd like to share your annotation track with a broader audience, send the
URL for your track—along with a description of the format, methods, and data
used—to the UCSC Genome mailing list
genome@soe.ucsc.edu.
Example 11:
If you would like to share a URL that your colleague can click on directly,
rather than loading it in the Custom Track tool (as in Example 10), then the URL
will need a few extra parameters. Let's assume that your data is on a server
at your institution in one of the large data formats:
bigBed,
bigWig,
BAM, or
VCF.
In this case, the URL must include an hgct_customText parameter, which
simulates the text box on the Custom Tracks page. Also, the URL must include
the bigDataUrl that points to the data file on your server.
So, a clickable URL that opens a remote bigBed track for the hg18
assembly to a certain location on chr21 would look like this:
http://genome.ucsc.edu/cgi-bin/hgTracks?db=hg18&position=chr21:33038447-33041505&hgct_customText
=track%20type=bigBed%20name=myBigBedTrack%20description=%22a%20bigBed%20track%22%20visibility=
full%20bigDataUrl=http://genome.ucsc.edu/goldenPath/help/examples/bigBedExample.bb
Tip: Multiple tracks can be placed into one custom track submission. To do so, create
a new file that contains the track lines
to each file that will be included. To submit this custom set of tracks, merely use the URL to
this new file.
| |
|
|
|
Troubleshooting Annotation Display Problems
|
|
| |
Occasionally users encounter problems when uploading annotation files to the
Genome Browser. In most cases, these problems are caused by errors in the
format of the annotation file and can be tracked down using the information
displayed in the error message. This section contains suggestions for resolving
common display problems. If you are still unable to successfully display your
data, please contact
genome@soe.ucsc.edu
for further assistance.
Messages sent to this address will be posted to the moderated genome mailing
list, which is archived on a public Web-accessible pipermail archive.
This archive may be indexed by non-UCSC sites such as Google.
Problem: When I try one of your examples by cutting and pasting
it into the Genome Browser, I get an error message.
Solution: Check that none of the browser lines, track lines, or
data lines in your annotation file contains a line break. If the example
contains GFF or GTF data lines, check that all the fields are tab-separated
rather than space-separated.
Problem: When I click the submit button, I get
the error message "line 1 of custom input:".
Solution: Check that none of the browser lines,
track lines, or data lines in your annotation file contains a line break. A
common source for this problem is the track line: all of the attribute
pairs must on the same line and must not be separated by
a line break. If you are uploading your annotation file by pasting it
into the text box on the Genome Browser Gateway page, check that the
cut-and-paste operation
did not inadvertently insert unwanted line feeds into the longer lines.
Problem: When I click the submit button, I get the
error message "line # of custom input: missing = in var/val pair".
Solution: Check for incorrect syntax in the track
lines in the annotation file. Be sure that each track line
attribute pair consists of the format attribute=attribute name.
Problem: When I click the submit button, I get the
error message "line # of custom input: BED chromStarts[i] must be in ascending order".
Solution: This is most likely caused by a logical conflict in the
Genome Browse software. It accepts custom GFF tracks that have multiple "exons" at
the same position, but not BED tracks. Because the browser translates GFF tracks
to BED format before storing the custom track data, GFF tracks with multiple
exons will case an error when the BED is read back in. To work around this
problem, remove duplicate lines in the GFF track.
Problem: When I click the submit button, the Genome Browser
track window displays OK, but my track isn't visible.
Solution: Check the browser and track lines in your annotation
file to make sure that you haven't accidentally set
the display mode for the track to hide. If you are using the
Annotation File box on the Genome Browser Gateway page to
upload the track, check that you've
entered the correct file name. If neither of these is the cause
of the problem, try resetting the Genome Browser to clear any
settings that may be preventing the annotation to display. To
reset the Genome Browser, click the Click here to reset link on the
Gateway page. If the annotation track still doesn't display, you may
need to clear the cookies in your Internet browser as well
(refer to your Internet browser's documentation for further information).
Problem: I've gotten my annotation track to display,
but now I can't make it go away! How do I remove an annotation
track from my Genome Browser display?
Solution: Reset the Genome Browser by clicking the
Click here to reset link on the Gateway page. This should reset
your Genome Browser display to its default settings and remove all your
custom tracks. To remove only one track of several, click the Manage
Custom Tracks button and delete the track using the checkbox and Delete
button.
| |
|
|
| |