UCSC In-Silico PCR

JavaScript is disabled in your web browser

You must have JavaScript enabled in your web browser to use the Genome Browser

UCSC In-Silico PCR

>chr16:50716476+50716848 373bp AGCACAGATGCTGGCACTTC TTGGACAGTGAGCACCAAATC AGCACAGATGCTGGCACTTCagggatgaatgaaagtctttttgggggatt tgtagatttttttcttgtcttactagctccattttcaaatgtatttattt tgtctctttagtttgcgcgataacaatatctcagaccgaggcatctgcaa gctcattgaatgtgctcttcactgcgagcaattgcagaagttagcgtaag tcagcctgggctgtggacaatgggctccaagtgccctggtctcaccccag gtcgtgcagcctgggaagctgtgagtgatgggctggggcaggggctgttt gcatgatggggggtgcaggtgattcctgcccagaggggaagggcaaccct ggGATTTGGTGCTCACTGTCCAA

Primer Melting Temperatures


	`Forward: 61.6 C agcacagatgctggcacttc Reverse: 61.1 C ttggacagtgagcaccaaatc`The temperature calculations are done assuming 50 mM salt and 50 nM annealing oligo concentration. The code to calculate the melting temp comes from Primer3, the formula by Rychlik W, Spencer WJ and Rhoads RE NAR 1990, which can be activated in Primer3 with PRIMER_TM_FORMULA=0.

Help


	What is chr_alt & chr_fix? Replicating in-Silico PCR results on local machine