Forward: 62.4 C atggctgggaaccaacctaag Reverse: 60.2 C ctgaagccatcatcagatttagc The temperature calculations are done assuming 50 mM salt and 50 nM annealing oligo concentration. The code to calculate the melting temp comes from Primer3, the formula by Rychlik W, Spencer WJ and Rhoads RE NAR 1990, which can be activated in Primer3 with PRIMER_TM_FORMULA=0.