UCSC In-Silico PCR
  No matches to cttgatctcctgacctcgtg caccctgccctatcacagtc in Human Dec. 2013 (GRCh38/hg38)

Primer Melting Temperatures
  Forward: 58.4 C cttgatctcctgacctcgtg
Reverse: 60.5 C caccctgccctatcacagtc
The temperature calculations are done assuming 50 mM salt and 50 nM annealing oligo concentration. The code to calculate the melting temp comes from Primer3.

Help
  What is chr_alt & chr_fix?
Replicating in-Silico PCR results on local machine