UCSC In-Silico PCR
 
>chr16:85914289+85914636 348bp TGAAACAATGGCTCTCTGCTC CCTAGACTTCCACACCAGGTC
TGAAACAATGGCTCTCTGCTCtggtggggaaaagcactgaattcagcgga
agcctgtgctccctggagcctctggcacgccatgtgcagccttttaaggg
acttttggagaaggagcgattggggttactccctgtacaccacacctggg
tggctctgagcttgcttttctgtttctcctgcaggcgtgccgctggtgac
ggggtacaccacctacgacgcgcaccattcaggtacggggtggtccgggc
tgagaggggcgtgggcactgtttgaagacaaagcccagataacccaagca
gggttgcggggtttcgaggatgagcagGACCTGGTGTGGAAGTCTAGG
>chr16:85914289+85914678 390bp TGAAACAATGGCTCTCTGCTC CCTAGACTTCCACACCAGGTC
TGAAACAATGGCTCTCTGCTCtggtggggaaaagcactgaattcagcgga
agcctgtgctccctggagcctctggcacgccatgtgcagccttttaaggg
acttttggagaaggagcgattggggttactccctgtacaccacacctggg
tggctctgagcttgcttttctgtttctcctgcaggcgtgccgctggtgac
ggggtacaccacctacgacgcgcaccattcaggtacggggtggtccgggc
tgagaggggcgtgggcactgtttgaagacaaagcccagataacccaagca
gggttgcggggtttcgaggatgagcaggacctggtgtggaagtctaggcc
tggttccaaggatgagcagGACCTGGTGTGGAAGTCTAGG
>chr16:85914289+85914720 432bp TGAAACAATGGCTCTCTGCTC CCTAGACTTCCACACCAGGTC
TGAAACAATGGCTCTCTGCTCtggtggggaaaagcactgaattcagcgga
agcctgtgctccctggagcctctggcacgccatgtgcagccttttaaggg
acttttggagaaggagcgattggggttactccctgtacaccacacctggg
tggctctgagcttgcttttctgtttctcctgcaggcgtgccgctggtgac
ggggtacaccacctacgacgcgcaccattcaggtacggggtggtccgggc
tgagaggggcgtgggcactgtttgaagacaaagcccagataacccaagca
gggttgcggggtttcgaggatgagcaggacctggtgtggaagtctaggcc
tggttccaaggatgagcaggacctggtgtggaagtctaggctccgttccg
aggatgagcagGACCTGGTGTGGAAGTCTAGG
>chr16:85914289+85914762 474bp TGAAACAATGGCTCTCTGCTC CCTAGACTTCCACACCAGGTC
TGAAACAATGGCTCTCTGCTCtggtggggaaaagcactgaattcagcgga
agcctgtgctccctggagcctctggcacgccatgtgcagccttttaaggg
acttttggagaaggagcgattggggttactccctgtacaccacacctggg
tggctctgagcttgcttttctgtttctcctgcaggcgtgccgctggtgac
ggggtacaccacctacgacgcgcaccattcaggtacggggtggtccgggc
tgagaggggcgtgggcactgtttgaagacaaagcccagataacccaagca
gggttgcggggtttcgaggatgagcaggacctggtgtggaagtctaggcc
tggttccaaggatgagcaggacctggtgtggaagtctaggctccgttccg
aggatgagcaggacctggtgtggaagtctaggcctggttctgaggatgag
cagGACCTGGTGTGGAAGTCgAGG
>chr16:85914289+85914846 558bp TGAAACAATGGCTCTCTGCTC CCTAGACTTCCACACCAGGTC
TGAAACAATGGCTCTCTGCTCtggtggggaaaagcactgaattcagcgga
agcctgtgctccctggagcctctggcacgccatgtgcagccttttaaggg
acttttggagaaggagcgattggggttactccctgtacaccacacctggg
tggctctgagcttgcttttctgtttctcctgcaggcgtgccgctggtgac
ggggtacaccacctacgacgcgcaccattcaggtacggggtggtccgggc
tgagaggggcgtgggcactgtttgaagacaaagcccagataacccaagca
gggttgcggggtttcgaggatgagcaggacctggtgtggaagtctaggcc
tggttccaaggatgagcaggacctggtgtggaagtctaggctccgttccg
aggatgagcaggacctggtgtggaagtctaggcctggttctgaggatgag
caggacctggtgtggaagtcgaggctccgttccgaggatgagcaggacct
cgtgtggaagtctaggcccggttctgaggatgagcagGACCTGGTGTGGA
AGTCgAGG

Primer Melting Temperatures
  Forward: 60.5 C tgaaacaatggctctctgctc
Reverse: 58.7 C cctagacttccacaccaggtc
The temperature calculations are done assuming 50 mM salt and 50 nM annealing oligo concentration. The code to calculate the melting temp comes from Primer3.

Help
  What is chr_alt & chr_fix?
Replicating in-Silico PCR results on local machine