UCSC In-Silico PCR
 
>chr5:35875227+35876030 804bp TTGGTGTTCCTTCCCTCTAG AATCTGGCAGTCCAGGAAAC
TTGGTGTTCCTTCCCTCTAGggctttttcccagaggtatattattgtcat
gtcttgttcacagaatggattgatatctgtggtctctggtccaacccctc
cttgaattgatagggccccgaggcccagagaaagccagtctcttgaccat
ggtcacccacctaattgtgttagagccaagactagaaatctgttcttctg
attccaagctcagaataagtgggaagactcagtgtgcctgtgccctctgc
cattcacttcatctatcaatgttctctgatttcaggattaagcctatcgt
atggcccagtctccccgatcataagaagactctggaacatctttgtaaga
aaccaagaaaagtgagtgtttttggtgcttaaaaagtgttgtgttggcaa
catcccagtggccaagaatgatattccaggacaaggaacagttgaacctc
accttttggtatttgattcatcctgtaactagggtccctcctaagaccct
agctgcagtagggaactgaaataagatacacatctcagaacttctgggct
ccctggggctggagggcacagccagtggtcacttcaagtcttgaagtgtc
tcagaagctccagaagcaaagagtccattgaggaacatgctggcaattct
gtgacattccctgtcagaaaactctatagacctactcctgaactgaacat
ttgatggtgtgtctctctggtgccatcttaataccctttctcctttttct
gtgcagaatttaaatgtgagtttcaatcctgaaaGTTTCCTGGACTGCCA
GATT

Primer Melting Temperatures
  Forward: 56.8 C ttggtgttccttccctctag
Reverse: 59.1 C aatctggcagtccaggaaac
The temperature calculations are done assuming 50 mM salt and 50 nM annealing oligo concentration. The code to calculate the melting temp comes from Primer3.

Help
  What is chr_alt & chr_fix?
Replicating in-Silico PCR results on local machine