Multiz Alignments of 6 Nematodes

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 150 in window, 14646344 - 14646537, 194 bps 
B D   C. elegans  agttt-------------------------tgttt------------------cattgagtctttcagct
B D   C. remanei  tatataaactaggggggataaagagaagaatgtttacttatggatgggattagctctgagtcgct--act
B D  C. brenneri  ======================================================================
B D  C. briggsae  ======================================================================

      C. elegans  caattaatggaaaactccaaatgtaaaaaaaatagtaaaacttcctgggagtccagagga----tactcc
      C. remanei  cagtgaatttgaagtcctgcccaccaa-------gtgatgttagccgggtgtccgaatgaaaaatgctct
     C. brenneri  ======================================================================
     C. briggsae  ======================================================================

      C. elegans  actttc-------aaaaaaaaaaacggcgaaaaaaagtccgaaaagatataaagtgtcgcaaaacacatg
      C. remanei  tccatcgtgtaaaaacaaaaaaaacggagaaaga-------------------gtgtcgcaaaacacatg
     C. brenneri  ======================================================================
     C. briggsae  ======================================================================

      C. elegans  ggaaatgggtgatcatctcgtttagtagattgacgagc
      C. remanei  ggaaatgggtgatcatc-----aagtgaatttacgagc
     C. brenneri  ======================================
     C. briggsae  ======================================

Inserts between block 1 and 2 in window
B D  C. remanei 1529bp

Alignment block 2 of 150 in window, 14646538 - 14646598, 61 bps 
B D   C. elegans  tcgtgtcgaaaacttgaacat-ctgctgtcttctctagcccaagcaaaaaagcccccccccc
B D  C. brenneri  ---------aaaagtgaacattcagctcgcttctct----------------ctctcctctc
B D   C. remanei  ==============================================================
B D  C. briggsae  ==============================================================

Alignment block 3 of 150 in window, 14646599 - 14646817, 219 bps 
B D   C. elegans  -cccccc---cctatatgtttccccttgactgcacaattt----------------------ttaattgg
B D   C. remanei  -cccttc---cccacatttttctacttgactgcacacacataacatttggggcggggtgtacacgatttt
B D  C. brenneri  ttccgtcgaaccaaccgtttcacccttcactgcacttaca------------cagagaata-ataattat
B D  C. briggsae  ======================================================================

      C. elegans  atttgatt-----ccacaaagtgaaaagaggt---ttgaaatg-----cggacgagtgaa----------
      C. remanei  aattgatt-----tgtgaatgagaaacgaaacgtattcaaacgata--taaaagagaaaa----------
     C. brenneri  aatttattgcgactatgaagttgaaacgaaac-------aataatggttaaaagggcgtacacttagttt
     C. briggsae  ======================================================================

      C. elegans  ttgagagaattgtgaagcgcgcgcgcattgt-----cgatttgt-ataatataaacaaatttattgcaaa
      C. remanei  agaggaagaggaaggagagt-----------cataac--------ataatataaacaaatttattgcaaa
     C. brenneri  atgtgaactcaacggagagttcgggcattgacagaacgatttttaataatataaacaaatttattgc-aa
     C. briggsae  ======================================================================

      C. elegans  ac----------gtatatat-----------aatagt---tag-gtgcaggaggggcac--accgaacga
      C. remanei  acggttg-----gtataaac--------cgaaactgt---tggaggggacaaggggga---gaatagaga
     C. brenneri  gctgttgtttgaatataaacgagagaaatgaaacagttaatgaaatggacggagtacatagaaataagga
     C. briggsae  ======================================================================

      C. elegans  agttgaccaaacattttaatc
      C. remanei  agttggtcaaacattttaatc
     C. brenneri  agtttagcaaacatcttaatc
     C. briggsae  =====================

Alignment block 4 of 150 in window, 14646818 - 14647216, 399 bps 
B D   C. elegans  cgtggtatttaaaaattacgcgcgggaaactgaacaggagcttttcgattaaacataaaagtgttgttca
B D  C. briggsae  ======================================================================

      C. elegans  ggctaccttgtttcgctgatcatttcaaaagcttgaaagtacagtctattggaacgaggaacacgacatt
     C. briggsae  ======================================================================

      C. elegans  tcgaattgatcagatcttctccatcattgataattttgaatcttgtacaatgtgaaaattcaaaaattaa
     C. briggsae  ======================================================================

      C. elegans  ttgtgctttccgggtggaatttaattttttgtgtcataaaaaccacaagccaagactaatccaaagaatt
     C. briggsae  ======================================================================

      C. elegans  tacaaaaaaacctgaaaaatttcgggcaacctacgcctgacctagtccgcgtttccagagaatgtgtcgt
     C. briggsae  ======================================================================

      C. elegans  tgacaaattttttttgaaagaccagacaatttcttcaaaaattatatca
     C. briggsae  =================================================

Alignment block 5 of 150 in window, 14647217 - 14647273, 57 bps 
B D   C. elegans  aaacttgttttaataattcaaaaa----------attcattcaaatttcaaataaagccatgttgaa
B D   C. remanei  aaatttcgtccaacattccaaaatcatagaaaccattcattagaa----aatcataaagaa------
B D  C. brenneri  ----------------------------------attcattgaaa----aaatacaagtatgatcaa
B D  C. briggsae  ===================================================================

Alignment block 6 of 150 in window, 14647274 - 14647370, 97 bps 
B D   C. elegans  ----aaagataataaattatcacagatcgtggtgtttgtgtttttttttttcaaaaaatgaaaataatat
B D  C. brenneri  aagaaaagacaataaattatcacaggtc---------------atttttctctaacaatatggcttct--
B D   C. remanei  ----agaacaaataaattatcacagaag---------------tttgaaattgaaaaacattttcttttt
B D  C. briggsae  ----aaagaaaataaattatcacagaaatcg------ggcagttttgcaattgaaaaaaaaatcttct--

      C. elegans  cagaatcctacgcaatacttctaacttctcg
     C. brenneri  -------tctagttaca--------------
      C. remanei  gtaaatctctagtcacgacta-aaactctca
     C. briggsae  -agaatccaacgttgct------catcctta

Alignment block 7 of 150 in window, 14647371 - 14647411, 41 bps 

Alignment block 8 of 150 in window, 14647412 - 14647617, 206 bps 


       C. elegans  CTTTGGAGATATCAGGCACCCC--------------------------------------------GCCA
      C. briggsae  CTTTGGAAATTTCTGGAACTCC--------------------------------------------GCCC
       C. remanei  CTCGAGAAATGTCAGGGACTCC--------------------------------------------TCCA
      C. brenneri  CTCTAGCAATATCGGGGACACC--------------------------------------------TCCG
      C. japonica  TTTTGGAGATGTCTGGTACCCC--------------------------------------------GCCG


Inserts between block 8 and 9 in window
B D P. pacificus 579bp

Alignment block 9 of 150 in window, 14647618 - 14647666, 49 bps 
B D  P. pacificus  =================================================

Alignment block 10 of 150 in window, 14647667 - 14647788, 122 bps 

       C. elegans  GCAGCTCCACCACCAAGTTCGTAGct--gaa--aaataat-ttatttttaaattaga
      C. briggsae  GCAGCACCGCCGCCAAGTTCGTAGctg-gaa--aattaagatattttttgaattgga
       C. remanei  GCGGCTCCACCACCGAGCTCATATctg-gaaataattaag----ttcatggatcaga
      C. brenneri  GCAGCTCCGCCACCAAGTTCGTACctgtgga--aagtaga----------aaacaaa
      C. japonica  GCGGCACCGCCGCCGAGTTCGTAGctg-gaa--a-----------------------
     P. pacificus  GCCACTCCTCCACCCAATTCGTATcta-aaa--------------------------

Inserts between block 10 and 11 in window
B D   C. remanei 634bp
B D  C. japonica 968bp
B D P. pacificus 367bp

Alignment block 11 of 150 in window, 14647789 - 14647812, 24 bps 
B D    C. elegans  aatctg-----------------------------ttttcattgtc----aattcaa
B D   C. brenneri  -----------------------------------tatttgtttttttttattccaa
B D   C. briggsae  gaattgaaggatctcagagcttcgcaatttcaaaatcttcaaaatcttgaatttcaa
B D  P. pacificus  =========================================================
B D    C. remanei  =========================================================
B D   C. japonica  =========================================================

Inserts between block 11 and 12 in window
B D  C. briggsae 112bp

Alignment block 12 of 150 in window, 14647813 - 14647869, 57 bps 
B D    C. elegans  aaaaactca------cGAAAAGTGCAGATGC---CCATTGACAATTCCAA--------------------
B D    C. remanei  aaaaactca------cGAAAAATGCAAATGT---CCATTCACAATTCCCA--------------------
B D   C. brenneri  ---aactta------cGAAAAGTGCAAATGC---CCATTGACTATTCCAA--------------------
B D   C. japonica  aacaactta------cGAGAAATGCAAATGC---CCATTGACGATGCCCA--------------------
B D  P. pacificus  ======================================================================

       C. elegans  -----------------------CTGAT---------------------------------ATATAGTCC
       C. remanei  -----------------------CTGAA---------------------------------ATATAGTCT
      C. brenneri  -----------------------CTGAA---------------------------------ATGTAGTCC
      C. japonica  -----------------------CCGAA---------------------------------ATGTAATCC
     P. pacificus  ======================================================================

       C. elegans  TC
      C. briggsae  TC
       C. remanei  TC
      C. brenneri  TC
      C. japonica  TC
     P. pacificus  ==

Inserts between block 12 and 13 in window
B D  C. briggsae 105bp

Alignment block 13 of 150 in window, 14647870 - 14647929, 60 bps 
B D  P. pacificus  ============================================================

Alignment block 14 of 150 in window, 14647930 - 14648056, 127 bps 


Inserts between block 14 and 15 in window
B D   C. remanei 33bp
B D  C. brenneri 15bp
B D  C. japonica 19bp
B D P. pacificus 4977bp

Alignment block 15 of 150 in window, 14648057 - 14648115, 59 bps 
B D    C. elegans  atttttgtgtagactaacaattagaacagtacatccggttttactctgtaagaatattc
B D   C. briggsae  -------gggagatcaagattaag------------gctttcattcggtcggaaaattc
B D  P. pacificus  ===========================================================
B D   C. brenneri  ===========================================================
B D    C. remanei  ===========================================================
B D   C. japonica  ===========================================================

Inserts between block 15 and 16 in window
B D  C. briggsae 51bp

Alignment block 16 of 150 in window, 14648116 - 14648436, 321 bps 
B D    C. elegans  tagtagtattataaattgatatgtttttatttttaattaattttggattatgaaataagtgtttatctat
B D  P. pacificus  ======================================================================
B D   C. brenneri  ======================================================================
B D    C. remanei  ======================================================================
B D   C. japonica  ======================================================================
B D   C. briggsae  ======================================================================

       C. elegans  actttgatctctgtctgtctggcaatgtacacaaacagtcttcctgcttgctctgtgccccctcctctcg
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  tataggtcgtttttgtgagtgagaggcatttctagccataatggctagcaacggctaatggtcaccatct
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  aatcgtttttatcataacgtttttttggaccactcttatatattcttacaactggtgaatattttaaatt
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  ttttaaagaatttttttgtaagtcaaaaaccccttttttcc
     P. pacificus  =========================================
      C. brenneri  =========================================
       C. remanei  =========================================
      C. japonica  =========================================
      C. briggsae  =========================================

Alignment block 17 of 150 in window, 14648437 - 14648572, 136 bps 
B D  P. pacificus  ======================================================================

     P. pacificus  ======================================================================

       C. elegans  -----GGG-
      C. brenneri  TTATCGGG-
      C. japonica  -----TAGg
      C. briggsae  -----TGG-
       C. remanei  TCTTCCGG-
     P. pacificus  =========

Inserts between block 17 and 18 in window
B D  C. japonica 2124bp

Alignment block 18 of 150 in window, 14648573 - 14648618, 46 bps 
B D    C. elegans  TTCTTGAGTA------------------------------------------------------GAAT--
B D    C. remanei  TGCCTCTGTG------------------------------------------------------GAAA--
B D  P. pacificus  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  --------------------------------------------------------ACACATCGCCCACG
      C. briggsae  TACC-------------------------------------ATCCAC-------ACAGCTATCTTCCACT
       C. remanei  --------------------------------------------------------AGCTCTCATCCAAT
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

      C. briggsae  TTCACTTCTTCTCCA---
       C. remanei  TCAATTTCCTCAGTA---
      C. brenneri  TTAAACATTTCTTCG---
     P. pacificus  ==================
      C. japonica  ==================

Alignment block 19 of 150 in window, 14648619 - 14649379, 761 bps 
B D  P. pacificus  ======================================================================

       C. elegans  TGATAGTGGAAATCTCTTCTTCTTCGTCGCTAACATCATTTTctgaaaattataaaaattgtttaacttt
      C. brenneri  TTACATGCGCGATTTCCTCCTCCTCGTCGCTAACATCATTATctgcaattgttacgtttggtgtggttca
       C. remanei  CAATAGAAGCGATTTCTTCTTCCTCATCGCTAACGTC---------------------------------
      C. briggsae  TAACGTGAGCAATCTCGTCTTCTTCATCGCTAACGTCATTGCctgaaa--------------------cc
      C. japonica  CAACTGTTGTGACCTCATCTTCCTCGTTGCTCACGTCGGTTTctgaaa--------------------ca
     P. pacificus  ======================================================================

       C. elegans  caaat----tttagttcccctatatatcat-----------------------------ttacCTTCAAC
      C. brenneri  ctag------tcagtttttccgaacgttctatgttattgaacatgtctaatgtcataaattacCTTCGAC
       C. remanei  -------------------cgtaaggtc------------------------------------------
      C. briggsae  tcaa------cctgtacatcagagtgtccc---------------catagtccctctcaccttCTTCTAC
      C. japonica  aaaatttaatcttgttgcgccctaagtaac------------------------taggcttacC------
     P. pacificus  ======================================================================

      C. brenneri  AGGATCAGTTGGTAAGATGAGAGCT------GTTTCTGGTTCCTC---------------------AGTG
     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

       C. elegans  TCA---GTTGTAGTC---------------------------GGCTCTTCCGTCGTAGGCTCCTCAATCA
      C. brenneri  ACT---GTTGTTGTGAAC------------------------GGCTCTTGTGTAGTGGG------TTCCT
       C. remanei  TCT---GTCGTAGTTGTT---------------------TCAGGTTCCTCGCTAGTGGT-----------
     P. pacificus  ======================================================================

      C. brenneri  CTATGGTTGGCTCTTCTGTTG------------TAATGTCTTCA------ACCGAAATC-----------
      C. japonica  CTTCCGTTGGGCCTACTACTGCT------ACCACTTCCTCCTCC-------------TC-----------
     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

       C. elegans  ------atagtaa------------tgaaaaatta----------------------aagatacaaaaaa
      C. brenneri  ctttgcatgaaaaacatattaaacacgaaaaaatgtctaggttagatttcaaagtttaagttaccctgag
       C. remanei  ------atcaaaa---------------------------------------------------------
      C. briggsae  ------attgagatagaaggagagaggaagaagga----------------------gagagacggagaa
      C. japonica  ------aagaaat--------------aagagatt----------------------ataacgtcattaa
     P. pacificus  ======================================================================

       C. elegans  gggtt
      C. brenneri  aggct
       C. remanei  -----
      C. briggsae  atact
      C. japonica  aaact
     P. pacificus  =====

Inserts between block 19 and 20 in window
B D  C. brenneri 54bp
B D   C. remanei 55bp
B D  C. briggsae 43bp

Alignment block 20 of 150 in window, 14649380 - 14649513, 134 bps 
B D  P. pacificus  ======================================================================

     P. pacificus  ================================================================

Inserts between block 20 and 21 in window
B D  C. japonica 512bp

Alignment block 21 of 150 in window, 14649514 - 14649543, 30 bps 
B D    C. elegans  caaacttacaactaa-------------atttgaattaaacgt
B D   C. brenneri  gaaacatttatctga------------gacgggaagcaaatct
B D   C. briggsae  aaatctcctcctcgattttttcatatttactgatttcaaacc-
B D  P. pacificus  ===========================================
B D    C. remanei  -------------------------------------------
B D   C. japonica  ===========================================

Alignment block 22 of 150 in window, 14649544 - 14649697, 154 bps 
B D  P. pacificus  ======================================================================

     P. pacificus  ======================================================================

       C. elegans  TCTTAGTTTCATTT
      C. briggsae  ACGGAGTTTCATTT
       C. remanei  GCGGAGCTTCATTT
      C. brenneri  GCGGAGCTTCATTT
      C. japonica  --------------
     P. pacificus  ==============

Inserts between block 22 and 23 in window
B D  C. japonica 1679bp

Alignment block 23 of 150 in window, 14649698 - 14649725, 28 bps 
B D    C. elegans  TTATctgaaatgtccaaagttacagttc
B D   C. briggsae  TTATctgaa-------------------
B D    C. remanei  TTATctata--aataaaagttaaagatc
B D   C. brenneri  TTATctcaaataatgattgtttatattt
B D   C. japonica  TTATcggtaaagcgcaaaaccaagcta-
B D  P. pacificus  ============================

Inserts between block 23 and 24 in window
B D  C. briggsae 13bp
B D   C. remanei 7bp

Alignment block 24 of 150 in window, 14649726 - 14649950, 225 bps 
B D  P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

       C. elegans  tagttagttaacgtttta---------------------attaatc
      C. briggsae  taaata----------------------------------------
       C. remanei  t------------tttca---------------agtttttcgaatt
      C. brenneri  taaaaaaggtacgtatcaatactagctgatggcaattttataaacc
      C. japonica  ----------------------------------------------
     P. pacificus  ==============================================

Inserts between block 24 and 25 in window
B D  C. briggsae 1292bp
B D   C. remanei 2bp

Alignment block 25 of 150 in window, 14649951 - 14650189, 239 bps 
B D  P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  =================================

Inserts between block 25 and 26 in window
B D   C. remanei 763bp
B D  C. japonica 789bp

Alignment block 26 of 150 in window, 14650190 - 14650220, 31 bps 
B D    C. elegans  tatttccaaattttaaaggcacaaatactt-t
B D   C. brenneri  aacatgatgtttctaataacattgaaacaatt
B D   C. briggsae  -------------------------------t
B D  P. pacificus  ================================
B D    C. remanei  ================================
B D   C. japonica  ================================

Alignment block 27 of 150 in window, 14650221 - 14650488, 268 bps 
B D  P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

       C. elegans  TTTCCACAATTTctgaa----tagttttttg------taactattttaacattaacgagaaaaaaaaat
      C. briggsae  TCTCCACAATTTctgaattgaaaagtttttg------aattcattgttcttcca---------------
      C. brenneri  TTTCCACGATTTctaaa---tacaattgatgaggaacaatttataatactaaaa---------------
      C. japonica  TTTCCACGATTTctgaa----aaggtgagtg------atttgaaaaaaaaat-----------------
       C. remanei  TCTCCACGATTTctgga---ataggtatatt------gatttatattaa--------------------
     P. pacificus  =====================================================================

Inserts between block 27 and 28 in window
B D  C. japonica 621bp
B D   C. remanei 18bp

Alignment block 28 of 150 in window, 14650489 - 14650809, 321 bps 
B D  P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ================================================

Inserts between block 28 and 29 in window
B D  C. briggsae 678bp
B D  C. japonica 50bp

Alignment block 29 of 150 in window, 14650810 - 14650873, 64 bps 
B D    C. elegans  gtttataatgtttttaaattcacctgcagtttaattagaacttttataattataatagtacaaa
B D   C. brenneri  --------------------------------------aacttttgtcaagaaagtccaaaacg
B D    C. remanei  ------------------------------------------tatgaaatgatagctgataact
B D  P. pacificus  ================================================================
B D   C. japonica  ================================================================
B D   C. briggsae  ================================================================

Alignment block 30 of 150 in window, 14650874 - 14651193, 320 bps 
B D    C. elegans  aaactgtgtggctt--cagaaagt-aaaaacttacGATCCCTCATCATCTCTATGAACAGATGGAAGCAT
B D    C. remanei  aaact-------------gaaa---aacaacttacGCTCCCTCATCCTCCCTATGCACTGAAGGCAACAT
B D   C. brenneri  tgttc--------------------aagaactcacGATCCTTCATCATTTCTATGCACGGACGGTAGGAT
B D   C. japonica  aagttagacggtttgacaaaaa--tcaaaactcacGATCCCTCATCATTTCTATGCACGGGCGGAAGATG
B D   C. briggsae  -------------------------aaatactcacGATCCCTCATCATTCCTATGAACTGATGGCAGCAT
B D  P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

       C. elegans  AAGAGTCGGC---AACAGTAAAAGTGACTTGATCTTctg------aaacgcg----taagaact-ggtta
       C. remanei  GGGTGTCAGCGGTGATGGTGAATGTGACCTCGTCGTcttctgt--aaatagg-agtgagatgtt-agagg
      C. brenneri  GTGAATCCGC---AACAGTGAACGTAACTTCTTCGTcaactgg--aaatg------aatgaattcggtaa
      C. japonica  GCGGCTCGGC---AATGGTGAACG------ATTGATcggctgg--aaaagggcaagaggaggtt-agata
      C. briggsae  GAAAATCTGC---GACAGTGAATGTCACCACTTCTTcgtcggctgaaata------taggtatt-agtgg
     P. pacificus  ======================================================================

       C. elegans  gagaagcaggaaagtgaggtggctgaaaggatgagaagaggacgggaaatcgtgagg
       C. remanei  gtagtggggatgaagtggttgagtgtgtcggggtg---------gggaatcgtgagg
      C. brenneri  gcccacagtgaaaactaagattggaaaatgctgtgaa------tgggaatcgtagag
      C. japonica  gaagagtgtggaagggggctgaagag-------------------------------
      C. briggsae  gtgaaaattagaaactgatagtgagatagggcgtg---------gggaaccgtgaag
     P. pacificus  =========================================================

Inserts between block 30 and 31 in window
B D   C. remanei 1266bp
B D  C. japonica 1287bp

Alignment block 31 of 150 in window, 14651194 - 14651223, 30 bps 
B D    C. elegans  -------ggtgaggcgagaagcttgaggtaagcttat
B D   C. briggsae  ggattcgtgtgtcgtgagaggcagcaagtgattttat
B D   C. brenneri  ------------ggtggaaagtttaccgcagttttgt
B D  P. pacificus  =====================================
B D    C. remanei  =====================================
B D   C. japonica  =====================================

Inserts between block 31 and 32 in window
B D  C. briggsae 1589bp

Alignment block 32 of 150 in window, 14651224 - 14651514, 291 bps 
B D    C. elegans  tagtgagctaataaattttttatagcggttaccttgagttagggttttcatggtaggcaggcgcagttta
B D   C. brenneri  tatt------------tttttatatt------------ttagaat-------------------agttga
B D  P. pacificus  ======================================================================
B D    C. remanei  ======================================================================
B D   C. japonica  ======================================================================
B D   C. briggsae  ======================================================================

       C. elegans  agggcctgacgcctgcctcaagcttgccggcctttcaccaaattttggaatttgtatataaatttacaaa
      C. brenneri  aaa------------cctcgagatttctgaa-----acgaaaactttgtttccttttgt---ttta-aga
     P. pacificus  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  tttctaattttctgatttctatcaatttgcttttaaaaaatttgcatggcacgaattgaggcgagaggca
      C. brenneri  gttgtatttttatgaattctgttg-------ctcaaaaaattcttct---acatatt-------------
     P. pacificus  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  ggcgaaggtcgcctttaggtcaggcaggcaggcctacgtcgaagcgttaccttgagttacttaagcttta
      C. brenneri  -------------tttgg---agatccacaggatcactttgagatttttacatgagtgaa--aatctttg
     P. pacificus  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  tttcgttatat
      C. brenneri  acgcgttctct
     P. pacificus  ===========
       C. remanei  ===========
      C. japonica  ===========
      C. briggsae  ===========

Inserts between block 32 and 33 in window
B D  C. brenneri 20bp

Alignment block 33 of 150 in window, 14651515 - 14651537, 23 bps 
B D    C. elegans  ttaggtaaactggcacatcatat
B D  P. pacificus  =======================
B D   C. brenneri  =======================
B D    C. remanei  =======================
B D   C. japonica  =======================
B D   C. briggsae  =======================

Alignment block 34 of 150 in window, 14651538 - 14651911, 374 bps 
B D    C. elegans  catttttttaatgaaaaaacctgaaaaaaagtaaaaagttcagttttccgactgaaaaaattctcgggaa
B D   C. brenneri  tagttcttcaac----------------------aatgttcaggtctttgat------------------
B D  P. pacificus  ======================================================================
B D    C. remanei  ======================================================================
B D   C. japonica  ======================================================================
B D   C. briggsae  ======================================================================

       C. elegans  attttctcgtttgcaatgatattccggatgctgcccggcaaatcaatttttctcgagctaaccctattat
      C. brenneri  attttct--gttgcaactgagtt-------------------tcaatctcattcagac-------actat
     P. pacificus  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  ttttatttttcgtttcgctgtatattttagtaaaaaaataaaaattttaagatttttagttctccttttc
      C. brenneri  gtaggcttttcgatt---------ttttcataacaca--------------------------tcatatc
     P. pacificus  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  caatctttgtaacaaggttgggcggatttcaacaagt------cggaacactgccggaattgaaattt-c
      C. brenneri  cgat--tagtcgagtgatcgatcaaattcaatccggtaaaacacagcattctgacagaatcaagagctgc
     P. pacificus  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  cggcaaattggcagacctgcaatttgccgattttccacatatgttaacaaaaaaacttggcaaacgg---
      C. brenneri  aaggacattggaa------caatat-ccga---------------aaccatagaac--agcatacggata
     P. pacificus  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  caattaccgccaaaccctgctttgtacacaacgt
      C. brenneri  caat--------acatctccgttata------at
     P. pacificus  ==================================
       C. remanei  ==================================
      C. japonica  ==================================
      C. briggsae  ==================================

Alignment block 35 of 150 in window, 14651912 - 14652055, 144 bps 
B D    C. elegans  tttttaaattatgaactgcaaatccactaacttcagaaaaaactgcaaatttttggttcaggacaaaaca
B D   C. brenneri  ------------------------------------------tctttaaacttttccactga-------a
B D    C. remanei  ------------------------------ctgtaaaaaagacggacaaattttctttcag--------g
B D   C. briggsae  ttttcaaatcacaa----caaatcaatttt-tttagaa-----tttcaaactttcggaca----------
B D  P. pacificus  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  actccggtatacttctcac------------ttctgaaaaattacaaca---------attca------c
      C. brenneri  ataa-gacatattttggaaacatgtacaacaatctgtaaaatcagaacg---------ctacgatcaaag
       C. remanei  acactgacattttttttaa------------ttctgaaattccagacca---------cttcaacaatgc
      C. briggsae  actccgatacatttctaga--------aattttctgaaaaaatggacaaaggaaaaatccacatcaatcc
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  aaaacaactccacgtcaaacgtttgtgatac
      C. brenneri  aaaacgcacgtcaatcgtgtttttgtgatac
       C. remanei  aaaccagg------------------aatac
      C. briggsae  aaaatcggtgc--------tttttgtgatac
     P. pacificus  ===============================
      C. japonica  ===============================

Alignment block 36 of 150 in window, 14652056 - 14652574, 519 bps 
B D    C. elegans  cttgctagatttattg---------------------------------------aattttatcatcggt
B D   C. japonica  cttgctggattttatt---------------------------------------tattctctcatcggt
B D   C. brenneri  cttgctaaatttattg-----------------------------------ggaaatttttctcatcggt
B D    C. remanei  cttgctagatttattggaagggaagaggagggcagttgaaaaagaaaagaaggaaaattctctcatcggt
B D   C. briggsae  cttgctagatttattcggttggtgaggaa---------aaaggaagaaaaaggaaaaaacactcatcggt
B D  P. pacificus  ======================================================================

       C. elegans  acataaactcaaaaaaagttatggataa-tagttgtaagtaaa-------------------agtcgaaa
      C. japonica  acatatactcgaaatgcgatatataaaa-gagtg----------------------------ggattaga
      C. brenneri  ac--atacttgaaaagc------------aagtggggtgtgaaaacgtt-------------agaataaa
       C. remanei  acatatactcgaaaatcaagattagta--tagtaagacaaaaaaa-----------------ggaaaaaa
      C. briggsae  acatatactcgaaaattcaggtaaaaaattagtaagaaaagaaaaaagtacagaaagatacgggaagaaa
     P. pacificus  ======================================================================

       C. elegans  aggcacaa-aaattatatatcaagaaaaaaacgatgaatgt---att-tttgagcaccacagagcaagag
      C. japonica  agacacaaaaaactgc-------------------aaata----atcactgcagcaccacagaattgg--
      C. brenneri  aggcacca--gattataagt--ggaaaggtatgaaaaatgt---gtt-tttgagcaccacagagcaaa--
       C. remanei  aggcacga---attattg--------------gaaaaatgt---gttttttgagcaccacagagcaag--
      C. briggsae  aagcat-----attat------------------aaaatatagggttgtttgagcaccacagagcaag--
     P. pacificus  ======================================================================

       C. elegans  ccgaagacgacaagaat--tgggtggg----ggtgaagaaaa---------tagaagaaaaattcc----
      C. japonica  ----ggaagagggaaagattgaacgtggcaatgtaaaggaca---tcaaaagaaaaaaaaaggtca----
      C. brenneri  ----gaacgacaagagt--------------tgtgggggaaaattttttaaaatatagaaaatactaaaa
       C. remanei  ----aaacgacaagaattattgttgtg----tatgaagaaaaattgaaagaaaaaagaaaaattct--ag
      C. briggsae  ---------------------------------------------------aaaaaagaaaattct--ag
     P. pacificus  ======================================================================

       C. elegans  ---aa-attatatat----atatacgtttgggaattatgtgtaacacaccggttaccgctg--gggcagt
      C. japonica  ---ga-attatggat---------------------------aacgcaccggttaccggtt--gggcagt
      C. brenneri  gacaa-attatggat----attgga------------------acacaccggttaccggtt--gggcagt
       C. remanei  gtcaa-attatgaatgggaacggaag---ggtaacattgtaacacacaccggttaccggtt--gggcagt
      C. briggsae  aaaaacattatgatt--gaattgaaa---tgtaacacact--tacacaccggttaccggttgggggcagt
     P. pacificus  ======================================================================

       C. elegans  g------gaaaa---gaaaaaaa---gttg---------------------aaaaacaaattaaaaaatg
      C. japonica  g---gggaagaaaagaaaaagaacaatatg---------------------taaa----attagaatttg
      C. brenneri  g-----gaaaaaattgaaaaaaaaacattgaaaggaagattagaatttaaaaaaaggtcaatagaaattg
       C. remanei  gaattaaaaaaaatggaaaaaaaaacgttg---------------------gaaaaatcaataaaaattg
      C. briggsae  g------gaaaaatggaagaaaatg-ggtg---------------------gatagggttataa------
     P. pacificus  ======================================================================

       C. elegans  gttaaa----------------------------acaaaacacactcaggcacactagtttg----ttta
      C. japonica  gttaagtcagttcaaatcaaggcaaatcaattcaaatcaaatcaatcaggcacactagacgaggatgggg
      C. brenneri  gttaaa--------------------------caaaaaaaaacactcaggcacactattt----------
       C. remanei  gtt-------------------------------aaaacacacactcaggcacactattttg-------g
      C. briggsae  ----------------------------------aagacacaaaatcaggcacactatttct-------g
     P. pacificus  ======================================================================

       C. elegans  gagatactgttacattttactgttgggaggggaaccttgtatgattttttttttcaaagttttcttt---
      C. japonica  gagagat------------------------------------actctttcttatactttttttttt---
      C. brenneri  gagagat------------------------------------actcattt-----cactgttttat---
       C. remanei  gagagat------------------------------------actctgtttacggaatttttttttcgt
      C. briggsae  gagatact----ca----------------------------aaattcatttttatcgttttttttt---
     P. pacificus  ======================================================================

       C. elegans  ----------------------------aaaat---cTTAGAACCACGAGCCAAAGAGCTTGGTAGTGGT
      C. japonica  ----------gttggctggatcgatttaaaagt----CTAAAACCAAGATCCGAAAAGTTTAGTTGTGGT
      C. brenneri  ----------atgatatga--------aagaccctgtTTAGAACCAAGATCCGAAAAGTTTTGTAGTGGT
       C. remanei  caaaaaggcaataaggcaa--------aaaaat--gcTTAGAACCAGGATCCGAAAAGTTTTGTGGTGGT
      C. briggsae  ----------------------------aaaat----CTAGAACCACGATCCAAAAAGTTTAGTGGTGGT
     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ==================================

Alignment block 37 of 150 in window, 14652575 - 14652718, 144 bps 


       C. elegans  ggaa
      C. briggsae  gg-a
       C. remanei  ggaa
      C. brenneri  agaa
      C. japonica  gaaa
     P. pacificus  g---

Inserts between block 37 and 38 in window
B D  C. brenneri 129bp
B D P. pacificus 204bp

Alignment block 38 of 150 in window, 14652719 - 14652740, 22 bps 
B D    C. elegans  tatagttga-------------gctttgaatagtt
B D   C. briggsae  atttttaga------tttgggtgttaaaattgata
B D    C. remanei  atgagtagaggctttttggggtgtctgggatgggg
B D   C. japonica  -gttggaga------tttgggtgatt---------
B D  P. pacificus  ===================================
B D   C. brenneri  ===================================

Inserts between block 38 and 39 in window
B D  C. japonica 1477bp

Alignment block 39 of 150 in window, 14652741 - 14652831, 91 bps 
B D    C. elegans  tcaaaagatatcgataaata-------taaattataa---tgttgttttgtggtttgaga------agtc
B D   C. briggsae  aagggggaactgagcattcggaatacttaaaagtcga---gattgttgtattttctgtgaggtt--ggcg
B D    C. remanei  gagggagagcttgatagatga------tagaagttgaaggggtttttgtggtggtagtggtggtcaagtt
B D  P. pacificus  ======================================================================
B D   C. brenneri  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  tagcttta-------------aattccgtat------tcaaatgtggcgttcagaa--------------
      C. briggsae  tagttttatccctggtga--tgattcttt--------taggttccagaatttggaact------------
       C. remanei  ttgttttatacggaatgatttaattttttggaaatcgcggaattcgggattcggaaccgggaatgcagaa
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
      C. japonica  ======================================================================

       C. elegans  ------------------
      C. briggsae  tctgttcaattttcaaaa
       C. remanei  cctg---gagcctggaa-
     P. pacificus  ==================
      C. brenneri  ==================
      C. japonica  ==================

Inserts between block 39 and 40 in window
B D   C. remanei 36bp

Alignment block 40 of 150 in window, 14652832 - 14652853, 22 bps 
B D    C. elegans  aa--ttattttgtcggcaagtt---------cg
B D   C. briggsae  aagcctactttttcgaaaagttttcatataccg
B D  P. pacificus  =================================
B D   C. brenneri  =================================
B D    C. remanei  =================================
B D   C. japonica  =================================

Alignment block 41 of 150 in window, 14652854 - 14653230, 377 bps 
B D    C. elegans  ccgaatcgaaaaattgc---cggtttgccgatttgccgaaagtttttaga--------------------
B D    C. remanei  ccggaacgagtaaaac----tgtttttcagacatgataattactctaaaaggtcaaaaaaagaa------
B D   C. briggsae  ccgtaatgaaaggaccccagcgaatttcagaatt--tcagaatttcaaaatctcagaattgcaaaatctc
B D  P. pacificus  ======================================================================
B D   C. brenneri  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  ----------------gggatttt----ttataaattctgaaattttca---------------------
       C. remanei  ---------aaaatctgacattttcggttcttgaaa----agattcgca---------------------
      C. briggsae  caaatctcgaaagtttggaatttcgggatcataaaatctcagaatctcattttttcatattttcagaact
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
      C. japonica  ======================================================================

       C. elegans  --aatatgtgcaaa------------------cccacattttgg------------gcacttttccg---
       C. remanei  --gacacctgagaa-----------aaaactttccaaaaatttttatctaaaaat-tcactttttcgcaa
      C. briggsae  tcgaaaccgcagaattgtagaattcacaattttcagaatttcagaatttcagaatctcagtttttcatat
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
      C. japonica  ======================================================================

       C. elegans  ---------gcaaattc----aaca------------------------------------------aat
       C. remanei  tttttaacaaaaaaatcgacaaaaatccgaggaaagtgcgctctattgacaatttttgatacttgtcaat
      C. briggsae  tttc-----agaatatc----agaatctcag-------------------aatctcaga--------atc
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
      C. japonica  ======================================================================

       C. elegans  taaa---------aatttgccggtttg------ccgatttgccagaattttaaa--tgtttaattccaac
       C. remanei  taagcgcgtttaccagctgataatccg---atttcgatagagcggaattgcacagtacagtcgaaccaaa
      C. briggsae  taag---------aatctgagaatctgagaatctcagaatcacagaatctcaaa--acctcaaaacctaa
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
      C. japonica  ======================================================================

       C. elegans  aat------------ttgtc---------------------ga--------------tttgccgagaaaa
       C. remanei  aatgtagtagtcgcgctctactgatgaaaatgagttccggtagagcgcatttgcacttttcatcaaaagt
      C. briggsae  gat------------ttcta---------------------gaatctcatattttctttttttgaaacaa
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
      C. japonica  ======================================================================

       C. elegans  atcgtttgccgt---tcagatattaaaaaattgcttcattcagtaatt--aaattt-----------tga
       C. remanei  gttttttttcgg---tttattttccaagaataac----tctggaaatcgtgaattt-----------tga
      C. briggsae  atttttattgaaatttctaaaacctaaaaaaaac-------agaaattggagatttatggttctctataa
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
      C. japonica  ======================================================================

       C. elegans  a----------tatagttattcaa-------ctaataatgtttt-------------------cattat-
       C. remanei  aaaatcacaattttcgatttcaaaaaca---ttaaaa---tctctagagctcccggtttttgacgttagc
      C. briggsae  aatctcaaaatcgaagaaatctaacacaattttagaaacgtctc--------------------------
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
      C. japonica  ======================================================================

       C. elegans  --------ttttcaattatatttagatctaggc--------taaacag----ccacgttg----------
       C. remanei  atagaaagattttgaaaattttgaaaaactaccaattctagtaaaaaattacgatttttgacatcaaagt
      C. briggsae  --------attttaagaatttttaaacttagcc--ctctaatagaaga----gccctctg------gagg
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
      C. japonica  ======================================================================

       C. elegans  tagcatcaaat-----------------------taatttttgtaaaat--------aaaat--------
       C. remanei  tatgaaaaaattcaaaaaactt------------caatttttaaggcttttgctctgaaaatgtgggggg
      C. briggsae  taccatggaactagagaggcgtgcccttctaatacaggttttacgatattttttttgaaaat--------
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
      C. japonica  ======================================================================

       C. elegans  --------------------------ttccaaacttt--aacctc
       C. remanei  gaaaaattagactgaaaattaaactattctagagctttcaaactc
      C. briggsae  --------------------------ttctagaaact----actc
     P. pacificus  =============================================
      C. brenneri  =============================================
      C. japonica  =============================================

Alignment block 42 of 150 in window, 14653231 - 14653284, 54 bps 
B D    C. elegans  ---------------------------------acca--cttcacaaaacaactttc----atcatgcaa
B D   C. brenneri  ---------------------------------acca--catcacaaa--agttctc----atcatgcaa
B D    C. remanei  aaaaacccggaattcc------ggattctcataaccacacaccacaaa--aacgtttttcgaacatgcaa
B D   C. briggsae  acaaacacacaatcactatcaaaaatatatataatcatgcaaaacgga--aacgagt----gataagaag
B D  P. pacificus  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  acagaacgttgttttttttttgg
      C. brenneri  aca-------------------a
       C. remanei  aca-------------------g
      C. briggsae  ttg-------------------g
     P. pacificus  =======================
      C. japonica  =======================

Alignment block 43 of 150 in window, 14653285 - 14653509, 225 bps 
B D    C. elegans  aaaacaaactccaa------------------------------tcaactaa------ttttaaaactat
B D   C. briggsae  aaatcaactgataattaggattttttgggattttgggaattcaactaattta------tgttcagatcaa
B D    C. remanei  aaaacaa-tatcaatt----------------------------ctaactaa------tcttcaaatt--
B D   C. brenneri  aaagaaactttcaa------------------------------ccaatcga------tata--------
B D   C. japonica  aagacacaactcga------------------------------ccgactagaagggtttttgaaattat
B D  P. pacificus  ======================================================================

       C. elegans  aatcagaatcaaccgggg--aaaa-----------tcaaatta-tatcttcaaaacaat-----------
      C. briggsae  ga--aaactaaattagga--gaaaattatatttcatcaaacca-atcatttaaaatcagtcgaa--atta
       C. remanei  -----atttcaactgggaatacaaatt--------tcaaataa-aagttttgaaattaggcaaatcgtca
      C. brenneri  -----aacccaatttgag--ggaaa----------tcaaataataatttcagaaattattcaa---tcca
      C. japonica  gt---aatcgagggggaa--aaggattcag-----ccaaaaaa--------aaaatcattcgag-----a
     P. pacificus  ======================================================================

       C. elegans  aaattgatgaaaaattagaa--aacgaatag----ggg------tttggattccta--g----tcaaaa-
      C. briggsae  aaatc------aaactaaaataaatctttagggaaaggagaaattatcgattttca--ggaatttcaaaa
       C. remanei  aaattaat-caaaattaggaaaaacttatag----aggggatgtcatcatttttcagtgggattcataga
      C. brenneri  atctcgat---aaattagaac-aactcatag----agggaatcatttttgtttcga--gggttttgga--
      C. japonica  aaa--------caaccaaaa--aactcatat----ttggg-----ttcatcattca-------tcaacac
     P. pacificus  ======================================================================

       C. elegans  ---------tctcaatcactatatcttcaca-----------------acttacggtcgtgttgcaaaca
      C. briggsae  aacaaaatatctcaatcactatattcat--------------------acttacggttgtgttgcaaaca
       C. remanei  aat------tctcaatcactatattcatatatatatatattcatccaaacttacggtcgtgttgcaaaca
      C. brenneri  ---------tgtcatccactatactataaca-----------------acttacggtagtgttgcataca
      C. japonica  gat------actcaatgtttttgttgcataa-----------------acttacggtcgtgttgcaaacc
     P. pacificus  ======================================================================

       C. elegans  acgtcatgtctaagtataggatacacctgaaacc----------------gaatctcgctaggttta
      C. briggsae  acatcatgtctaagtataggatacacctgaaatccggtcttaccgtcttgtcggctttttttgagta
       C. remanei  acatcatgtctaagtataggatacacctgaaagc----------------------------ggtta
      C. brenneri  atatcatgtctaagaatagggtacacctgaaacc-------------ttggtgttttcctatgctta
      C. japonica  acgtcatgtttaagaataggatagatctgaaagc----------------gcgttacgtggcggttg
     P. pacificus  ===================================================================

Inserts between block 43 and 44 in window
B D  C. brenneri 18bp

Alignment block 44 of 150 in window, 14653510 - 14653522, 13 bps 
B D    C. elegans  ctagctgagga--------------------aa
B D    C. remanei  gcactagaaaa-------------gaaaattaa
B D   C. briggsae  gcaattgaaaaacgtttttcaatcggaaaccaa
B D   C. japonica  -gattttggga----------------------
B D  P. pacificus  =================================
B D   C. brenneri  =================================

Inserts between block 44 and 45 in window
B D   C. remanei 1bp
B D  C. briggsae 22bp

Alignment block 45 of 150 in window, 14653523 - 14653543, 21 bps 
B D    C. elegans  gaaatctgaagaaat------------ctgaaa
B D   C. briggsae  gaatttgcagggtgcagtggcctagtttcggtc
B D    C. remanei  aaagttctagaacac----tccgtttctcgttt
B D   C. brenneri  gaagtctgaaaacac------------------
B D   C. japonica  gaaatgcgaagaagg------------atgaga
B D  P. pacificus  =================================

Inserts between block 45 and 46 in window
B D  C. japonica 104bp

Alignment block 46 of 150 in window, 14653544 - 14653632, 89 bps 
B D    C. elegans  cgatgggaaacaacgat-----------------------------------------------------
B D   C. japonica  caaacgaaaaaataaaa-----------------------------------------------------
B D   C. brenneri  caggactgaacagatataga--------------------------------------------------
B D    C. remanei  caaagatggagacatatg----------------------------------------------------
B D   C. briggsae  cacggcgaaatacctatagcccggcctacgaccggccgcggccctgatccgccttgtctgaaactcaaat
B D  P. pacificus  ======================================================================

     P. pacificus  ======================================================================

       C. elegans  GATGGGTCTCCAGT
      C. japonica  GATGGATCGCCGGT
      C. brenneri  GATGGGTCCCCTGT
       C. remanei  GATGGATCTCCAGT
      C. briggsae  GATGGATCTCCGGT
     P. pacificus  ==============

Alignment block 47 of 150 in window, 14653633 - 14653730, 98 bps 

       C. elegans  ATAATAGTATCAGGTActgaaattaaat
      C. briggsae  ATGATTGTGTCGGGCActgaaa------
       C. remanei  ATGATGGTGTCGGGGActgaaa------
      C. brenneri  ATAATTGTGTCAGGGActgaaa------
      C. japonica  ATGATGGTGTCGGGTActgaaa------
     P. pacificus  ATGATCGTATCGGGCActgaaagagaat

Inserts between block 47 and 48 in window
B D   C. remanei 852bp
B D  C. japonica 666bp
B D P. pacificus 349bp

Alignment block 48 of 150 in window, 14653731 - 14653989, 259 bps 
B D    C. elegans  attgaggagatttctcgggtttacgaattgcacaacaagtactttttgaggtggaaatt-taaaaaaaat
B D   C. briggsae  --------------------------------------------------------atcataa-------
B D   C. brenneri  --------------------------------------------------------att-taa-------
B D  P. pacificus  ======================================================================
B D    C. remanei  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  tctccctttgttaaagatatttaaattcaataaaaataacttcgctactcattctaaagacagcggttca
      C. briggsae  ----------ttcagaat---------------------------------tttcgagggccgggttt--
      C. brenneri  ----------ttaataat---------------------------------ttcaagcgaaagtgtatca
     P. pacificus  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================

       C. elegans  gcttatttcctaaccgttcaatatctctttgaacgacattttttactttctatcaaaagctttaaaaaat
      C. briggsae  --------------------------------------------------------------tagaaa--
      C. brenneri  atctgaaaattaac------------------------------------------------tagaaa--
     P. pacificus  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================

       C. elegans  aattttgctatacgaaagttaagaaagtagttatacttgaaaccttttca
      C. briggsae  ---tgtg-------------------------------------------
      C. brenneri  aactttgat---------------------------------ccttctca
     P. pacificus  ==================================================
       C. remanei  ==================================================
      C. japonica  ==================================================

Alignment block 49 of 150 in window, 14653990 - 14654112, 123 bps 
B D    C. elegans  gattgaattctacaaatttcaaaatgcagcacttcagctaaaatttttagtggcctatttaaaacaccct
B D   C. briggsae  aatagagttctg-aaatttcgatat---------------------------------------------
B D  P. pacificus  ======================================================================
B D   C. brenneri  ----------------------------------------------------------------------
B D    C. remanei  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  ctttcaattggcgtagatttcatatggaagtaaatggtttccatgtcagaaaa
      C. briggsae  -----------------------------------------------------
     P. pacificus  =====================================================
      C. brenneri  -----------------------------------------------------
       C. remanei  =====================================================
      C. japonica  =====================================================

Alignment block 50 of 150 in window, 14654113 - 14654282, 170 bps 
B D  P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ==============================

Alignment block 51 of 150 in window, 14654283 - 14654364, 82 bps 

       C. elegans  TTTGAGCATctg
      C. briggsae  TTTGAGCGTctg
       C. remanei  TTTGGGCGTctg
      C. japonica  CTTGGGCTTcta
      C. brenneri  TTTGAGCATcta
     P. pacificus  TGACCGAGTctg

Inserts between block 51 and 52 in window
B D P. pacificus 96bp

Alignment block 52 of 150 in window, 14654365 - 14654489, 125 bps 
B D    C. elegans  ga--------------------------------------------------------------------
B D   C. brenneri  aaaatatgt-------------------------------------------------------------
B D   C. japonica  aagaaaacg-------------------------------------------------------------
B D    C. remanei  ----------------------------------------------------------------------
B D   C. briggsae  aaaagaagtttgagatgagtaattatgtcgtagacccataactcggcttgaaattagaattttttatttg
B D  P. pacificus  ======================================================================

       C. elegans  ------aaatgaatatg----gttcta---------------caaaact---------------------
      C. brenneri  ---------ttagtgagtgaagttcga------------------attt---------------------
      C. japonica  ------cgtttaaaa------atttta--------------------ct---------------------
       C. remanei  ------aaattataaaggtaagcatga---------------gatacct---------------------
      C. briggsae  aatcaaaaattaaaatgtaaaacttgaggtgatctacaaaacgatacctaattcgaaatgttgagttttg
     P. pacificus  ======================================================================

       C. elegans  ------------------------------tat------------------------------------a
      C. brenneri  ------------------------------ttt-------------------------------------
      C. japonica  ------------------------------att-------------------------------------
       C. remanei  ------------------------------tct-------------------------------------
      C. briggsae  gtaccacggaccgtaagacgatgttgccggtctgtggaataaacctcggaattcaaatatagttgaatta
     P. pacificus  ======================================================================

       C. elegans  gaaaaaaattt------------------------gcaatttt---------------------------
      C. brenneri  --gagagattt--------------------------tcttttcattctat-------------------
      C. japonica  --gaaaagtgt------------------------------tcca-------------------------
       C. remanei  --taaaggttt-----------------------------------------------------------
      C. briggsae  ggtaaaagtttgtagatgtcgtcatgattcgcaatttaattttcagaccatacaaaaattccgaatttga
     P. pacificus  ======================================================================

       C. elegans  ---------------------------tgt-ccgttgtgccattttctatgtca---------------t
      C. brenneri  ---------------------------tgt-ccttcaagt------ttatgcaa--------------tt
      C. japonica  ---------------------------aat-cagttgtgc------ccccgcca---------------a
       C. remanei  ---------------------------tgt-ccgttgtgtc---ttttatgcca---------------t
      C. briggsae  accgagttctgaactgattcaattctgtgtcccgttgtgtc-----taatgccatagtctaggttttttt
     P. pacificus  ======================================================================

       C. elegans  ttttcgcctaaatcctaattc------------------ctagaa-----tctcacGAGATTTGTCCTGT
      C. brenneri  tttatagtt---ttttttttcgaataaaccctgaaa--caaaactagttttctcacGAGATTTGTCCTGC
      C. japonica  atcataatt---ttatcaatt-----------taaatgcctaagaa----tctcacGAGTTTTGTCCTGT
       C. remanei  ttttcattt---ttct-----------------------ctataaatttttctcacGAGATTTGTCTTGT
      C. briggsae  tttctattt---ttcttattc-----------taga--acaatcgatttttctcacGAGATTTGTCCTGT
     P. pacificus  ======================================================================

       C. elegans  TG
      C. brenneri  TG
      C. japonica  TG
       C. remanei  TG
      C. briggsae  TG
     P. pacificus  ==

Alignment block 53 of 150 in window, 14654490 - 14654720, 231 bps 



       C. elegans  -----------aattgcttggctcaaggtttagagatttt
      C. briggsae  cttttttttttaattgtgaagctttagaattaaggatttc
       C. remanei  -----------agttattaag-------------------
      C. japonica  -----------atttttgtagcaaaatatgtgaaaatttt
      C. brenneri  -----------aatt-------------------------
     P. pacificus  -----------aa---------------------------

Inserts between block 53 and 54 in window
B D  C. japonica 1096bp
B D P. pacificus 517bp

Alignment block 54 of 150 in window, 14654721 - 14655036, 316 bps 
B D    C. elegans  ------tttatagagaatgttttttaa-----------aagatcctcttcgtgaaacttgataaactacg
B D    C. remanei  ------tttac----gatatttttaat-----------gaaat------------------aaaattac-
B D   C. briggsae  ccgaatttcat----aatatctctaatttgtcattttcaaaatttccgt----atctccgaaaaattcca
B D   C. brenneri  -------------------tctctggt-------------------------------------------
B D  P. pacificus  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  gaaccatcagt-tt--------------------------------------------------------
       C. remanei  atattttgaat-tttagtaa--------------------------------------------------
      C. briggsae  atgttctgaatattcagaaatgcacttttcttgaacttctggatatccaaatatccgaattctccgaaac
      C. brenneri  ------tgaat-tt--------------------------------------------------------
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  ----------------attctatgtatctaaatattatcctatagtgtttaaagtatttcaaactaaatt
       C. remanei  ------------caaaatttcaggtagcttaatct------------------------cagagttccaa
      C. briggsae  ctttcgcttcttcaaaattttggaaaatcgaatttt----tgaaaattttgaat--ttccaagttttcca
      C. brenneri  ------------taaaagctgaaatagataaatt------------------------------------
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  aatttttaa---atagttacaaa-------aaaat---tatgttgtcaatattt----------------
       C. remanei  aatatccaa---------------------aaaac---aaagttttcaagttttacatttcagaa-----
      C. briggsae  aattttcaatttctgaatctaaatttttttaaaatttaaaatttttcaaattctaaatatctgaatatct
      C. brenneri  -atcttcaa---------------------taatt---cagtttctgaaatttt----------------
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  -----------------------------------------------------------------atttc
       C. remanei  ----------------------------------------------------------atcagaaattcc
      C. briggsae  gaattttcgaaaaatttttgaattttggaatttccgtttttcgcaaaaaaaaagaacttttgaaaatttc
      C. brenneri  ----------------------------------------------------------tgtttacattca
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  aagtaacgtagggtttt---tcttataatttctaatt---------------------------------
       C. remanei  agccgtcttgattttttagacctcgaaatatctgagt----actgt---------------------aat
      C. briggsae  aaatatccgtaattcttgaacttcggaatatctgaatttaaacaattccaaaaagtttaaatttctgaat
      C. brenneri  aagcgtttttttttttcaaagtctaatat---taatt------------------------------gaa
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  ---tcaaaatt------------------------acgtaaaaatttttagttttcaaaagtg-------
       C. remanei  acttgaaaatc----------------------------aaaacttctgaattccggaatcttcgttttt
      C. briggsae  tcttcaaaattttgaaatatccgaatttaaagaattcggaaaaatttttaatttctgaattttcaatttc
      C. brenneri  atttgaaaagc----------------------------aa-----------tctggaatgtt-------
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  ------acaagaaaaattgtctatttt---ttgcaaaa------actcgtatatgtgttaatcaacatgt
       C. remanei  cgaaggatccgagaact-ggagatttcgagttcagaaagtttgcataataatgtgtttcagacaac----
      C. briggsae  c-aagtttccgaaaact---agatttt---ttcaaaaattctg-acttttttgtatctccgaaaattttg
      C. brenneri  ------atatggaaaat---acaatta-----------------ccaattctacatattaagcaaa----
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  atatagttaagccgtaaaagcccat-----------------------
       C. remanei  ----------agtt----agtgcatttttaagc---------------
      C. briggsae  aaataatcaaagtttccatgcttactgttaagttcccggaagccccaa
      C. brenneri  --------aaagca----------------------------------
     P. pacificus  ================================================
      C. japonica  ================================================

Inserts between block 54 and 55 in window
B D   C. remanei 19bp

Alignment block 55 of 150 in window, 14655037 - 14655204, 168 bps 
B D    C. elegans  ----------------------------------------------aagccaatcattccgcaaaa----
B D   C. brenneri  ----------------------------------------------aaactaacctttcaa-actt----
B D    C. remanei  aagccaaaagttattaaaaaatgtcccaaagctgaagctcccaagctagaaaaccgtttca-aaaa----
B D   C. briggsae  -----------------aaagcacccgaa-----aagcgcaaaaaaaaacgaaccttttca-aaaacagt
B D  P. pacificus  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  -atagcaaaatttattataaaaagcataacgaacctttgtgttaaaa-catatatagacaagtgttaaa-
      C. brenneri  -gtcatgaatcggcgttta--------------acattgagttagat-gacatatatgaacacagtaaa-
       C. remanei  -gcaaaaaacctacctgttta---cccaa--aaagacagtgttagat-gacatatagacacata--aaat
      C. briggsae  gttagaaaacttgcacatt-----------------ctgtgttaagcagacttatattcacat---aaat
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  --ata--------tgacatgaaatccacgactgtctgaagttccatctgaaataaccca-----------
      C. brenneri  -------------cagcctgaaaac----------------agccccaagacgatccta----ttctagt
       C. remanei  ccttccttgaaaagagcttgaaatctgcaa-----------tcccgccccattccccca-------tagt
      C. briggsae  ccatc--------gatcctgaaatt----------------tcccgccaaaaaaccccaaaaaattttgt
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  ------taaacc-cctgcaaaacttgttagacactt---ttt
      C. brenneri  tagttttagacg-----gaca------ctgcttttg---ttt
       C. remanei  tagttatagacactttgtacagtctgtttggttttg---gtt
      C. briggsae  tagtt-ttgacg-ttcggacaattttgttgaatttgtttttt
     P. pacificus  ==========================================
      C. japonica  ==========================================

Alignment block 56 of 150 in window, 14655205 - 14655456, 252 bps 
B D    C. elegans  gg------cacaacggacaatga--aaagttaaata-----gcgaattagtaa--acacataacCTATTG
B D   C. briggsae  ggcatagacacaacggacaagaa--taagaaaaagtg----aaaagtgagaaaatacacataacCTAGTG
B D    C. remanei  ggcatagacacaacggacaaaaa--ggagaaa---------agaagttagtatcgacacataacCTAGTG
B D   C. brenneri  agcatagacaagaaggacaaagaattaaaagaaattgataaaaatattagtgaagacacgtaacCTAGTG
B D   C. japonica  ------ggcacaacagacaaaagattaaaaaa-----------------------acacgtaacCTAGCG
B D  P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  =========================================================

Inserts between block 56 and 57 in window
B D  C. japonica 56bp

Alignment block 57 of 150 in window, 14655457 - 14655484, 28 bps 
B D    C. elegans  t--ccaagagttatgaaagagtttttgaaa-
B D   C. briggsae  aagctaactgttgctcaggcaa----gaaaa
B D    C. remanei  t------------------------------
B D   C. brenneri  t--ccacatatttcagaagtaatatttaaaa
B D  P. pacificus  ===============================
B D   C. japonica  ===============================

Inserts between block 57 and 58 in window
B D   C. remanei 46bp
B D  C. brenneri 26bp

Alignment block 58 of 150 in window, 14655485 - 14655564, 80 bps 
B D    C. elegans  catagtgtgtagtaattctcgagctcctatttaacttcaaatataccaaaaagtttttaatga--aaaca
B D   C. briggsae  aagagcgtt---------------------------------------agagttttttaaagagcaaaaa
B D  P. pacificus  ======================================================================
B D   C. brenneri  ======================================================================
B D    C. remanei  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  aaatac----aggatc
      C. briggsae  aaatattcgaaagatc
     P. pacificus  ================
      C. brenneri  ================
       C. remanei  ================
      C. japonica  ================

Alignment block 59 of 150 in window, 14655565 - 14655787, 223 bps 
B D    C. elegans  agccagccttcaatgcattttttggcttttttgtgtttctatccattttttaaaaataaatataacggaa
B D  P. pacificus  ======================================================================
B D   C. brenneri  ======================================================================
B D    C. remanei  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  aactaatatatgtagtaagcaacgtatttccaattatcagaacgttgtttacaattttttcatattatcc
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================

       C. elegans  attttaaagtaatagtacactttctaaacccggtcaaaaacatactgtgtaatttttctgataaaaactt
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================

       C. elegans  ataacataaatac
     P. pacificus  =============
      C. brenneri  =============
       C. remanei  =============
      C. japonica  =============

Alignment block 60 of 150 in window, 14655788 - 14655869, 82 bps 
B D    C. elegans  tgtagaaaaatacgtaaccaacattttgttagttgaaaatgttttgctacctatatcggtctctgagtta
B D   C. briggsae  tgtagaaaattaaatttcccacatttttttagttgaaaattttttgatagctttaacggttcgcgagata
B D  P. pacificus  ======================================================================
B D   C. brenneri  ======================================================================
B D    C. remanei  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  tggctttttaaa
      C. briggsae  tgcgcctttaaa
     P. pacificus  ============
      C. brenneri  ============
       C. remanei  ============
      C. japonica  ============

Alignment block 61 of 150 in window, 14655870 - 14655980, 111 bps 
B D    C. elegans  ctatttggactaaacacataaaccgcaaaataatggaattttggtcagaaaattgctaaacaaattgttt
B D  P. pacificus  ======================================================================
B D   C. brenneri  ======================================================================
B D    C. remanei  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  tcaatcaaccgccatttcaggtgccactcgagctctctgct
     P. pacificus  =========================================
      C. brenneri  =========================================
       C. remanei  =========================================
      C. japonica  =========================================

Alignment block 62 of 150 in window, 14655981 - 14656177, 197 bps 


       C. elegans  GAAG-------------CGATGATC--------------------------------TCGTTGTTACGGT
       C. remanei  GACG-------------CGATGATC--------------------------------TCGTTGTTACGGT
      C. briggsae  GAGG-------------CGATGATC--------------------------------TCGTTGTTTCTGT
      C. japonica  GACG-------------CGATGATC--------------------------------TCGTTGTTACGGT
      C. brenneri  GAAG-------------CAATGATT--------------------------------TCGTCGTTCCGGT


Inserts between block 62 and 63 in window
B D   C. remanei 10bp
B D  C. briggsae 375bp
B D  C. japonica 1065bp
B D  C. brenneri 8bp

Alignment block 63 of 150 in window, 14656178 - 14656223, 46 bps 
B D    C. elegans  --aagttttagaaata----ttataga-agttcaaac-actgtcaa--------agccgagc
B D   C. briggsae  --aagttttatagct--------aaca---tgccatt-aaagttag--ggttacagt-aaac
B D    C. remanei  --gaaatttatag-------------------------aatgctag--gggtctag------
B D   C. brenneri  --atttttttcagtt-----ttcaaca-tcttctgttaaatgttggttaaaaacagtaaaaa
B D  P. pacificus  agacattttcgtattatctttactagataactcaatt-at----------------------
B D   C. japonica  ==============================================================

Alignment block 64 of 150 in window, 14656224 - 14657008, 785 bps 

       C. elegans  ATCATCAAC----------------------------------------------CTTCT--------CC
      C. briggsae  ATCATCGAC----------------------------------------------CTTCT--------CC
       C. remanei  ATCGTCAAC----------------------------------------------CTTCT--------CC
      C. brenneri  ATCATCAAC----------------------------------------------CTTCT--------CC
      C. japonica  ATCATCAAC----------------------------------------------CTTCT--------CC



       C. elegans  ---------------------------------CTTCGATGTAGATGTTCTTGGTGGCAGTAGCGTGTGC
      C. briggsae  ---------------------------------CTTCGATGTAGATGTTCTTGGTGGCAGTGGCGTGAGC
       C. remanei  ---------------------------------CTTCAATGTAGATGTTCTTGGTGGCAGTAGCGTGGGC
      C. brenneri  ---------------------------------CTTCGATATATATATTCTTGGTGGCAGTAGCATGAGC
      C. japonica  ---------------------------------CCTCAATGTAAATGTTCTTGGTGGCGGTGGCGTGTGC


       C. elegans  ----------------------CATTTGGATG-----TCTGATGAACTGTTCTGAGATGGTGACTGGCTT
      C. briggsae  ----------------------CATTTGGATG-----TCTGATGAATTGTTCCGATATAGTAACTGGCTT
       C. remanei  ----------------------CATTTGGATG-----TCTGATGAACTGTTCCGAGATGGTGACTGGCTT
      C. brenneri  ----------------------CATTTGGATG-----TCTGATGAATTGTTCAGAGATCGTGACTGGTTT
      C. japonica  ----------------------CATTTGGATG-----TCTAATAAATTGCTCAGAGATGGTAACTGGTTT


       C. elegans  ------------------------------TGGCTCC---------------------------------
      C. briggsae  ------------------------------TGGCTCC---------------------------------
       C. remanei  ------------------------------TGGCTCT---------------------------------
      C. brenneri  ------------------------------TGGCTCT---------------------------------
      C. japonica  ------------------------------CGGATCC---------------------------------

       C. elegans  -----GGATCTCCTGGGG----------------------------------------------------
      C. briggsae  -----GGATCTCCTGGTG----------------------------------------------------
       C. remanei  -----GGGTCTCCTGGTG----------------------------------------------------
      C. brenneri  -----GGGTCTCCGGGGG----------------------------------------------------
      C. japonica  -----GGATCTCCTGGAG----------------------------------------------------



       C. elegans  -TAGG----------------------------------------ATTCGAAGCTGTGCAAGTGTAGTCT
      C. briggsae  -TAGG----------------------------------------GTTCGAAGCCGTGCAAGTGTACTCT
       C. remanei  -TAGG----------------------------------------GTTCGAAGCCGTGCAAGTGTACTCT
      C. brenneri  -TAGG----------------------------------------GTTCGAAGCCGTGCAAGTGTATTCT
      C. japonica  -CAGG----------------------------------------GTTCGTAGCCGTGCAAGTGTAGTCT



       C. elegans  ---------------------------------CCTGTAGTAATACATCTGAACTGATGTCGCTCTCCTG
      C. briggsae  ---------------------------------CCTGTAGTGATGCATCTGAACTGGTGTCGCTCTCCTG
       C. remanei  ---------------------------------CCTGTAGTGATACATCTGAACTGGTGACGCTCTCCTG
      C. brenneri  ---------------------------------CCTGTAGTGATACATCTGAACTGATGTCGCTCTCCTG
      C. japonica  ---------------------------------CCGGTAGTGATGCATCGGAATTGATGGCGCTCTCCTG


Inserts between block 64 and 65 in window
B D P. pacificus 33bp

Alignment block 65 of 150 in window, 14657009 - 14657048, 40 bps 
B D    C. elegans  tcaagg--------------------------ctcatgaatc----------------------atg---
B D   C. japonica  aaaatggtgg----------------------tttttgaata------tttttgagatgcagcaatt---
B D   C. brenneri  ----aggtgaatatatttaattccgataaaatattttgaatgttggataactcaaaac---gaaatttta
B D    C. remanei  gtagaggttaacgcggtcgggggtg-------aattcgaact---------ctgaaat---tgaatt---
B D   C. briggsae  gcgagggttttcttgatt--ttctg-------attcagagtt--------cctaaaat---ttaatt---
B D  P. pacificus  ======================================================================

       C. elegans  -------------------------------------------------ttatccg--------------
      C. japonica  gcgctata-----------------------------------------cggactg--------------
      C. brenneri  acaaaccatgtatccctcaagattttcctacgatttaaaaaatatacagtagcctgacaacg----tcca
       C. remanei  gcagaacatgcacggctcaa-----------------------------tggagcgcgaatgttatccta
      C. briggsae  -------------------------------------------------tagaccg----------ccta
     P. pacificus  ======================================================================

       C. elegans  -----------------------------------ttgtt----------------------atcatctt
      C. japonica  -------------------------actgcgaagcgtgcacgcggtgcgtgcgccgcgacgcaacacgcc
      C. brenneri  acatttttaaaatcaaaagatgaaaaatttcaaaaatatc----------------cactgaaatattgt
       C. remanei  atgtattcatgct------------agtccctaacttgtc-------------------cctaagattct
      C. briggsae  a------------------------agttctgagctttctaga-------atggaatagttcaatatttt
     P. pacificus  ======================================================================

       C. elegans  a
      C. japonica  c
      C. brenneri  a
       C. remanei  a
      C. briggsae  g
     P. pacificus  =

Alignment block 66 of 150 in window, 14657049 - 14657191, 143 bps 
B D    C. elegans  agt---------------------------------------------------------------tttg
B D   C. briggsae  taactttccgaccttacctgatctggaacataaggatagatttttcatgcagtatagttttttttctata
B D    C. remanei  tta---------------------------------------------------------------taga
B D   C. brenneri  tga------------ttttaatttcaatctaaaggg------------------------------ttga
B D   C. japonica  tga---------catgcattaaaagaaacgtcacaa------------------------------tagg
B D  P. pacificus  ----------------------------------ag------------------------------catt

       C. elegans  gagaaagaaaagtgaaa-ggatagattaaaaacactaggt------------------------------
      C. briggsae  gtgacaggatagtgaaa---------ggaaaacactcggtggtgggaaaatttgtgctcctggttttttt
       C. remanei  gtgaaggaatagtgaaacgaatag--agaaaacactcggt-----gaaaa---------------tcatt
      C. brenneri  gtgaaggaatagtgaaaagga-----agaaaacactcggg-------------------------tgagt
      C. japonica  tggccgggaaagaaaggaagaaag--aaagaaaaatggaa------------------------------
     P. pacificus  gaacataaataaagcaacggaaag--agtaagcgatagtt------------------------------

       C. elegans  ----aga----aaaatgtgtggtgcaaacCCTCAGTGACTTCCAGTCTGACTGGATCCG---CGACTCCG
      C. briggsae  tcgggaatcagaaaaaat---gtgcaaacCCTCTGTGACTTCCAATCGAACTGGATCCG---CGACTCCT
       C. remanei  ttgggaa----aaatagtgtagtgcgaacCCTCGGTGACTTCCAATCGAACAGGATCGG---CGACTCCG
      C. brenneri  aggggaa----aaa-------gtgcaaacCCTCAGTGACTTCCAATCGAACTGGATCAG---CAACACCG
      C. japonica  --agaaa----aaa-------gtgcaaacCCTCGGTGACTTCCAGCCGAACCGGATCAG---CGACGCCC
     P. pacificus  --agtaa----gaac------atgc-------TTATAATCTCCAGAGTGACAGTGTTAGATTTGACAGGC


Inserts between block 66 and 67 in window
B D P. pacificus 167bp

Alignment block 67 of 150 in window, 14657192 - 14657362, 171 bps 
B D  P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ===============================

Alignment block 68 of 150 in window, 14657363 - 14657471, 109 bps 
B D    C. elegans  TGGTGTGGCAACTGGACGTGGTGGAG--TGCCTTctgaa--agtgaatgtgggatagatgaga-------
B D   C. briggsae  TGGAGTGGCAACGGGGCGAGGTGGTG--CGCCTTctgaa--agtgat---aggagaagggtg--------
B D    C. remanei  TGGTGTGGCGACTGGCCGTGGTGGTG--TGCCTTctgaa--agtggtggaaggataggatag--------
B D   C. brenneri  GGGAGTGGCAACTGGACGTGGTGGTG--TGCCTTctgaaagagtgat---aggatagaataga-------
B D   C. japonica  TGGGGTGGCAACTGGACGTGGTGGAG--TGCCTTctgaa--ag-------gtgacagaggtgaggggtac
B D  P. pacificus  CGGAATGACAATGGAATGATACGGGATCTCCCTCttgga--cacgatgatgagatggagtagc-------

       C. elegans  --agtgggagtgaacaggggatt----tgaac--cgga----tttggag------aaggaaaactgaa
      C. briggsae  --gataggtgagaaggagagtt---------c--tagaaggttctggagctgttcaggaa------aa
       C. remanei  --gatagggggaaaaggga----------------agatttctttgaaa------ataaa------ta
      C. brenneri  --aataggggtggaaaata----------------tgaattgga------------------------
      C. japonica  acgctaggggtgaggggtaact-------------taa------------------------------
     P. pacificus  --aatgggaatacgagatggagcacgacgaactatggatattgttagagagatgaa------------

Inserts between block 68 and 69 in window
B D  C. brenneri 13bp
B D  C. japonica 1bp

Alignment block 69 of 150 in window, 14657472 - 14657861, 390 bps 
B D    C. elegans  gaaaggaaaaaaggcaaaaa----ggaaaaaggaaacccaaaaatcataggtgaaaagaaacaaaaggca
B D   C. briggsae  gaaaggaaagagaaaaag------gggtgaatgaac----------------------gaaaaaagacca
B D    C. remanei  gaaaaccaaaagtgagaa------ggagaaaggaaa----------------------aaacaaaggtca
B D   C. brenneri  taaaggaaagataacaaaaactgtgaacaagaaaaa----------------------aaacaaagggcg
B D   C. japonica  aaaagaacaaagaaaagagg----gaagaaagtaag----------------------aaagaaagttca
B D  P. pacificus  ggaaagaggaagggtgagtg----ggggaaaggaag----------------------gacaagaggacg

       C. elegans  a--------------------------------acCAGGTGTGACGTTCAAGGTGCTTGGGTTTG-----
      C. briggsae  a--------------------------------acCAGGTGTCACGTTCAAAGTGCTCGGATTCG-----
       C. remanei  a--------------------------------acCAGGTGTCACGTTGAGAACGCTTGGGTTGG-----
      C. brenneri  a--------------------------------acCAGGTGTAACATTCAAAACGCTTGGTCCGG-----
      C. japonica  a--------------------------------acCAGGTGTAACGTGAAGAACGCTCGGGTTGG-----
     P. pacificus  gacgaaagacggacttcattcattgtcatactcacCAGAAGTGACGGTGA----GCTTGGAGTCAGTAGA





       C. elegans  aatta-attgaaagaaacat--------gtatacaacgacacgat
      C. briggsae  aatgacatgtacatgggagt--gggacgaca----------caat
       C. remanei  aatta-atggaaaggacggtcacagacaatatcaatt--ggtaac
      C. brenneri  aatga-ttaaaacgcaacgt--------gtatacatt--cgtacc
      C. japonica  aattt-at-------------------------------------
     P. pacificus  --------tgaaagaaaa---------------------------

Inserts between block 69 and 70 in window
B D  C. japonica 431bp
B D P. pacificus 123bp

Alignment block 70 of 150 in window, 14657862 - 14657975, 114 bps 
B D    C. elegans  atgattacaca---cacg--------ccacggcaagaa----acgtgcaat-------aga-------gg
B D   C. japonica  acgaccacaca---------t-----ctataataagat----gtgcataggaaaggaaaggaaaggaaaa
B D   C. brenneri  aagattacaaaacaaacgcatgaaaaccaccgcaaaat----gtgagaaataagttgaacgtaaggatag
B D    C. remanei  accactgcaagaaacattatt-----acactgcaagaaaatcgtgcaggat-------agagagagatag
B D   C. briggsae  agaattacaag---------------acaccgcaaaaa----gtgcaga---------agatagagaaag
B D  P. pacificus  ======================================================================

       C. elegans  ata--------act--taagg----------------ataga------aatgttcaatgcaaaa------
      C. japonica  gaa--------agtggtaggg----------------gtagg---------------aaaaaaaaaaac-
      C. brenneri  atagaaaatatact--caaagcagcgcttagactctaacagaatttggagttt----ttcgaaatatggt
       C. remanei  ata--------act--taagg----------------ataga--------tgt----ttcaaaca-----
      C. briggsae  ata--------act--taagg----------------ataga---------------ttcaaaaaat-gt
     P. pacificus  ======================================================================

       C. elegans  ----------------------------------------------------------------------
      C. japonica  ----------------------------------------------------------------------
      C. brenneri  tggtcttttgctaaaagagaatgcaaaaaatccctgtagttttgaacagttacaaaaaacgtgtttcgtt
       C. remanei  ----------------------------------------------------------------------
      C. briggsae  tggtttttttc-----------------------------------------------------------
     P. pacificus  ======================================================================

       C. elegans  --------------actaacGAGCTTCGACTTGTGGTGGAGCAGCGGCGTTGGTA
      C. japonica  --------------atcaacGATAGCCAAGACGTGGCGGGGC-GCGCCCCTGGT-
      C. brenneri  ttccgtctaatagaactaacGAGCTTCGACGACAGGTGGAGCAGCGGCGCTAGTA
       C. remanei  --------------actaacGAGCATCGACGACTGGTGGTCCGGCAGCATTGGTA
      C. briggsae  --------------actaacGAGCTTCAACGACTGGTGGAGCAGCCGCACTGGTA
     P. pacificus  =======================================================

Alignment block 71 of 150 in window, 14657976 - 14658187, 212 bps 

       C. elegans  CTCCCTCGTCGGTGAG------CTCGG--------------------------------------CTCTC
      C. briggsae  CTCCCTCGTCAGAAAG------CTCAG--------------------------------------CTCTT
       C. remanei  CTCCCTCGTCGGTGAG------CTCGG--------------------------------------CACGC
      C. brenneri  CTCCTTCATCGGAAAG------TTCTG--------------------------------------CTCTT
      C. japonica  CGCCTTCGTCGGTTTC------CTCGG--------------------------------------CGCTT



Inserts between block 71 and 72 in window
B D P. pacificus 60bp

Alignment block 72 of 150 in window, 14658188 - 14658279, 92 bps 
B D  P. pacificus  ======================================================================

       C. elegans  at--aggaatagaaaaccaaaggatag--------a-agg
      C. briggsae  gtgggggaa-agaaaaccaaaggatagtagaaatgatagg
       C. remanei  atagaggaa-aggaaaacaaaag--aataga----atagg
      C. brenneri  at--aggaa-agaaaaccaaaggatag--------ataga
      C. japonica  ga--atgaaaaaaaaaacagaaaatag--------atgg-
     P. pacificus  ========================================

Inserts between block 72 and 73 in window
B D  C. japonica 1095bp

Alignment block 73 of 150 in window, 14658280 - 14658596, 317 bps 
B D    C. elegans  aaaaagttt-----catgc--atttttgggaaatttg------gaaaatcttcaaataaaaaact-----
B D   C. japonica  gaagagtttttag-catgcaggttc-------aa---------aaaaaaagtcaaa-cagtaact-----
B D   C. brenneri  aaaaggcat---g-catggaaattc-------acact------caaaccttccaaa-acaaaactcttat
B D    C. remanei  atagaatgt---gtcatgc--attc-------actcgaaatcatgaaatcatcaca-acaaaact-----
B D   C. briggsae  atagagttt---g-catgc-aaggc-------actcg------taaaaaaggcact-caaaaatt-----
B D  P. pacificus  ======================================================================

       C. elegans  ----gcaaatca--cactgaaaaaatccctgaaacgaagaagaaaaactcacGCGACTTGACGATAACTC
      C. japonica  ----gcaaatta--t-----caaacattt--------aaaatgtagactcacGAGATTTGACAATAACTC
      C. brenneri  cgatgcaaatccttc-----tcaagtttt-------aacaaaaaacacttacGTGACTTGACAATGACTC
       C. remanei  ----gcaaatct--c-----caaaacttt------------caaaaactcacGTGACTTGACAATGACTC
      C. briggsae  ------atatcc--t-----gaaaatcct------------gaaaaacttacGCGACTTGACAATAACTC
     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  =============================================================

Alignment block 74 of 150 in window, 14658597 - 14658665, 69 bps 

       C. elegans  at--------
      C. briggsae  ----------
       C. remanei  at--------
      C. brenneri  aa--------
      C. japonica  at--------
     P. pacificus  gttaaacgat

Inserts between block 74 and 75 in window
B D   C. remanei 1347bp
B D  C. brenneri 7bp
B D  C. japonica 9bp

Alignment block 75 of 150 in window, 14658666 - 14658700, 35 bps 
B D    C. elegans  aaaaacat---------------------------------gatacttc------------------cag
B D   C. brenneri  aagaaagta---------------------------gctgagaagcttca-----------acttgtcaa
B D   C. japonica  aaaatagtgattattttattgcgtgctcaaccctgcgttaagacacactatcacactgtctgcgtctcca
B D  P. pacificus  aagatcatttgaattttgcag--------------------gattattc---------------------
B D    C. remanei  ======================================================================
B D   C. briggsae  ----------------------------------------------------------------------

       C. elegans  cacagaaaagt----------------------------gaaaa
      C. brenneri  aactacaaaat-------tcataatggt-tgtgttcgaaaagaa
      C. japonica  cagcgcagagcgttgcggtcgttctgccaagcgtgcgaaaaggg
     P. pacificus  ----gtagaacggcgctgtcgctcttcgagaaggctgtgaa---
       C. remanei  ============================================
      C. briggsae  --------------------------------------------

Inserts between block 75 and 76 in window
B D  C. japonica 19bp

Alignment block 76 of 150 in window, 14658701 - 14658977, 277 bps 


       C. elegans  ---------------------------------------AGGAATCCATCTCTTTCGAGAATTCCATTTG
      C. briggsae  ---------------------------------------AAGAATCCATCTCTCTCTAAAATTCCGTTTG
       C. remanei  ---------------------------------------AAGAATCCATCTCTCTCCAAAATTCCATTCG
      C. brenneri  ---------------------------------------AAGAATCCATCTCTTTCGAGGATACCATTTG
      C. japonica  ---------------------------------------AGGAACCCATCTCTTTCTAGGACACCGCTTG



       C. elegans  ----------------------------------------------------------------------
      C. briggsae  TGCTGAAATT--------------------------------TTCACTATTATGAGT-----------AA
       C. remanei  ----------------------------------------------------------------------
      C. brenneri  GGCTGTAAATAG------------------------------GTCAGTTTAAATTTC-----------AA
     P. pacificus  ----------------------------------------------------------------------

       C. elegans  -----------------------------------------------C
      C. briggsae  AATG-----------------------------------CACTTTTGT
       C. remanei  -----------------------------------------------C
      C. brenneri  AAT--------------------------------------------T
     P. pacificus  ------------------------------------------------

Inserts between block 76 and 77 in window
B D P. pacificus 91bp

Alignment block 77 of 150 in window, 14658978 - 14658995, 18 bps 
B D    C. elegans  ACG-------TTGTG--------GTGGGGC-------TGG
B D    C. remanei  GCG-------TTGTG--------GTGGTGC-------TGG
B D  P. pacificus  ========================================

Alignment block 78 of 150 in window, 14658996 - 14659031, 36 bps 
B D    C. elegans  ATCT---------------------------------------------------CTGATGTTCAGC--T
B D   C. briggsae  ATCT---------------------------------------------------CTGATGTTAAGC--T
B D    C. remanei  ATCT---------------------------------------------------CTGATGTTTAAT--T
B D   C. brenneri  ATCC---------------------------------------------------CTGATATTGAGT--T
B D  P. pacificus  ------------------------------------------------------ATTAATGGTAATCAAC

       C. elegans  GCACTGG-----------CTCCGATTGAAG
      C. briggsae  GAACTGG-----------CTCCGATTGAAG
       C. remanei  GAACGGG-----------CTCGGATTGAAG
      C. brenneri  GAACTGG-----------CTCCGATTGAAG

Inserts between block 78 and 79 in window
B D  C. japonica 122bp

Alignment block 79 of 150 in window, 14659032 - 14659172, 141 bps 


       C. elegans  CTGGACGAGACC-----ATCTGAG
      C. briggsae  CTGGACGAGACC-----ATCTGAG
       C. remanei  CTGGGCGCGACC-----ATCTGAG
      C. brenneri  CAGGACGAGACC-----ATTTGAG
      C. japonica  CTGGTCGCGACC-----ACTTGAG

Inserts between block 79 and 80 in window
B D P. pacificus 1165bp

Alignment block 80 of 150 in window, 14659173 - 14659265, 93 bps 
B D  P. pacificus  ======================================================================

     P. pacificus  =======================

Inserts between block 80 and 81 in window
B D  C. briggsae 419bp

Alignment block 81 of 150 in window, 14659266 - 14659297, 32 bps 
B D    C. elegans  CACAGctttaaaaaat---tggaagtt--------cattttt---t--
B D   C. briggsae  TACAAttttataaaatccccaaaacatgtacagaacacttcaagctat
B D    C. remanei  TACAGctggaaaaagg---gggaagttagattaggcattccg---ttt
B D   C. brenneri  ---AActgctgaaaag---------------caaatatgttt---ttt
B D   C. japonica  GGTTGctggaaaaagg---cgg--------------------------
B D  P. pacificus  ================================================

Inserts between block 81 and 82 in window
B D  C. briggsae 33bp
B D   C. remanei 157bp
B D  C. japonica 571bp

Alignment block 82 of 150 in window, 14659298 - 14659379, 82 bps 
B D    C. elegans  gttaaattatttagggctactt---------------gcaaaagtttttaa-----acaatgaaacattg
B D   C. brenneri  --gaaaata-------ccactc-----------gaatattgaagttttcggaaatcagaataaaacgtag
B D    C. remanei  -gtgaaatttgcac--ctaattgagctattcacgtccggaaaagttttcccggacatgaatagcccatcg
B D   C. briggsae  ggtaaactacagactgcaaatt-----------gtccacaacttttttcac-----tacatagtacacag
B D  P. pacificus  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  -------------------------aatttga-------------------------aacact---atta
      C. brenneri  tatttttttaacgcaattccgtactcattgaagattctcttatctactgacataaaagatacattagtta
       C. remanei  -attc------caaaatttcata--tgtttccaattct-----------acacttataacact---atta
      C. briggsae  -at----------------------tgtttggaa-----------------------aacgctgaaattc
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  gtacacatgg---tgca----c
      C. brenneri  gtacaagaaaaa-taca---ct
       C. remanei  gcacatataaacatgtatgttt
      C. briggsae  g-aaatccaaac-tgcaaactt
     P. pacificus  ======================
      C. japonica  ======================

Alignment block 83 of 150 in window, 14659380 - 14659430, 51 bps 
B D    C. elegans  tca--acgtcaaaatttcaaaaa--------tcactcaaaaactccatttcacagcaataa
B D   C. japonica  tcaacatttaaaaacttcaaaca-aatcacaccacataaaaa-------aaaccactgca-
B D   C. brenneri  tca--ctctgaaaa---ctggaa-tcactaacaacttttgaa-----tttaaacacagcaa
B D    C. remanei  tca--ctctcaaaatctcaaaaa------agtcactcaaaaa-------gaaccacagcaa
B D   C. briggsae  tca-------aaagtctctcaaatttgttagctactcaa-----------aatcac-----
B D  P. pacificus  =============================================================

Alignment block 84 of 150 in window, 14659431 - 14659714, 284 bps 


       C. elegans  ATGTGGAAGTGGTCCACCCAGTTGCTCACGA---------------------------------------
      C. briggsae  GTGTGGAAGTGGTCCTCCCAATTGTTCACGA---------------------------------------
       C. remanei  ATGTGGAAGTGGTCCTCCCAGCTGGTCACGA---------------------------------------
      C. brenneri  ATGTGGAAGTGGTCCTCCCAATTGATCGCGA---------------------------------------
      C. japonica  GTAAGGCAGTGGTCCGCCTAGATGCTCGCGG---------------------------------------

       C. elegans  -----------------------------TGCCAGGTGATCTGGCAATCTGGTATACCTGGAACCCAACA
      C. briggsae  -----------------------------TGCCACGTGATTTGACAATCCGGAATTCCTGGAACCCAACA
       C. remanei  -----------------------------TGCCATGTAATCTGGCAATCGGGTATTCCTGGAACCCAACA
      C. brenneri  -----------------------------TGCCATGTAATTTGACAATCCGGGATTCCTGGAACCCAACA
      C. japonica  -----------------------------TGCCACGTGATTTGGCAATCTGGGATTCCGGGTACCCAGCA


       C. elegans  CC
      C. briggsae  CC
       C. remanei  CC
      C. brenneri  CC
      C. japonica  CC
     P. pacificus  CC

Inserts between block 84 and 85 in window
B D P. pacificus 1228bp

Alignment block 85 of 150 in window, 14659715 - 14659753, 39 bps 
B D    C. elegans  GCctgaataga-------------taaaaaccattcca------catgct--ttaaattt-
B D   C. briggsae  GCctgcaagga---------tggttaggaatcattccaaat---catgcttattaaatct-
B D    C. remanei  GCctagaaaga----------agttaggtaacattcaata----catgc---ttgaa----
B D   C. brenneri  GCctaaatagg--------------aacaaacatccaa------catgc---tcaaa----
B D   C. japonica  GCctaaattcaagcatacagcaagcatataacattcaaaattggcatgc---tatgattcc
B D  P. pacificus  =============================================================

Inserts between block 85 and 86 in window
B D  C. briggsae 681bp
B D  C. brenneri 1bp

Alignment block 86 of 150 in window, 14659754 - 14659831, 78 bps 
B D    C. elegans  gggggaaaaaatgttcaaatggattttc-----------aaaaagttaatttattttagtatagaaatgt
B D    C. remanei  ---gggaacact-ttcaga--gctttttttagac-----aaaaactgga-------------aaaaagat
B D   C. brenneri  -agggagataat---------gatttggctagtcaggagaacagctaaaagtaacaga-tcgagaaaaat
B D   C. japonica  ttgggaaaatat-tgtagg--g-----------------catggataaatatattttt----agtgacat
B D  P. pacificus  ======================================================================
B D   C. briggsae  ======================================================================

       C. elegans  taagtg------------------tttgtagttaaaa
       C. remanei  gaggtg-----------------------tgttagaa
      C. brenneri  aggatgctataagttcaaaagtggttagttattagaa
      C. japonica  aa---------------------------agttagaa
     P. pacificus  =====================================
      C. briggsae  =====================================

Inserts between block 86 and 87 in window
B D   C. remanei 9bp
B D  C. brenneri 1bp

Alignment block 87 of 150 in window, 14659832 - 14660081, 250 bps 
B D    C. elegans  aaccaaaaaa----aaaaaagattattaaatgtacaaacTTATTCTTTTGGAAATTGTTAGCAAAGCATC
B D   C. briggsae  agcgaaaaactacgaaaattggtcg--aaaaccacaaacTTATTTTCTTGGAAACGGTTAGCAATGCGTC
B D    C. remanei  aaccaaaa------aaaaatgacaa--aaaagaacaaacTTATTTTCTTCGAAACTGTTAGCAAAGCGTC
B D   C. brenneri  ----------aactaaagacgaaaa--aaatcaacgaacTTATTTTTTTGGAAATAGTTAACAAAGCGTC
B D   C. japonica  ----------gattagggaaactca--aaa--aaccaacTTATTCGCTTGGAAACTGTTAACCACGCGTC
B D  P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

       C. elegans  CCACGTGGATTTTTTCAGTctgaaaatgttgaga-aactcaaaaa
      C. briggsae  CTACGTGGATTTTCTCCGTctgaaaatgttatggaaactcaaaca
       C. remanei  CCACGTGGATTTTTTCGTTctgaaaatgttatgg-aactcaaaga
      C. brenneri  CTACGTGTATTTTTTCGTTctgaaaatgttatga-aactcaaaa-
      C. japonica  CCACGTGAATTGGCTCGATctgaaattgtcagaa-aactcaaaaa
     P. pacificus  =============================================

Inserts between block 87 and 88 in window
B D  C. brenneri 189bp
B D  C. japonica 15bp

Alignment block 88 of 150 in window, 14660082 - 14660299, 218 bps 
B D    C. elegans  caaaaaatgaaaatgttagtgttaa------------------tgctgaaa--------gagataggaaa
B D   C. briggsae  aaaagaaaacgaaggagagggttaaattttagtt---------ggtttgga--------aaaaaaagaaa
B D    C. remanei  aaaaagaaaaaccgggga-ggttagattttggttttgttggagggttgggagaagttggaaaaaaagaaa
B D  P. pacificus  ======================================================================
B D   C. brenneri  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  acctttaaatttagagtttc---gattagagg-----------------aattttactggctgttaattt
      C. briggsae  aa----agattcagaagttg---gtatgggtg-----------ttttgaaggttcattgg-----gattt
       C. remanei  ac----gaatgtaaattttggatgaaagggtgtgaggggatattttcagagtttcagggg-----aa---
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
      C. japonica  ======================================================================

       C. elegans  ttgctctgaccgcttgaattttggctagcaa------gcatttcacattttttatt--------------
      C. briggsae  ct-aggttacgacccaattttttctaagtcacaacccaattttctaggtcatgacccaatttttctaggt
       C. remanei  ---atgtaacaacttgaaatttgaaaaaaaa------aactgtaacagttagaattaaagactctcag--
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
      C. japonica  ======================================================================

       C. elegans  --------gattcgaaaaggagcattttaagttttca--taaagttttc---------attcagactccc
      C. briggsae  catgacctaatttt----------ttctaggtcatgatctaattttttctaggtcacgacccaattttct
       C. remanei  --------aattct---agaaacctcgggaatctggaattcaggatttctgag----aatccgcaggtac
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
      C. japonica  ======================================================================

       C. elegans  a-----------aattttgcagacttttgatggt------
      C. briggsae  aggtcatgagccaatt--------ttttctaggtcatgac
       C. remanei  aagtaaccag--aatttta-agaattctcagagt------
     P. pacificus  ========================================
      C. brenneri  ========================================
      C. japonica  ========================================

Inserts between block 88 and 89 in window
B D   C. remanei 287bp

Alignment block 89 of 150 in window, 14660300 - 14660340, 41 bps 
B D    C. elegans  ttga------------------agagttttctggaggc-----tttatttttatc---------actaaa
B D   C. briggsae  ctaattttttctaggtcacgaccgaattttttctaggtcatgatctaattttttctaggtcatgacctaa
B D  P. pacificus  ======================================================================
B D   C. brenneri  ======================================================================
B D    C. remanei  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  ttt
      C. briggsae  ttt
     P. pacificus  ===
      C. brenneri  ===
       C. remanei  ===
      C. japonica  ===

Inserts between block 89 and 90 in window
B D  C. briggsae 167bp

Alignment block 90 of 150 in window, 14660341 - 14660480, 140 bps 
B D    C. elegans  aaaattttgttaattgaaaaaatcgttcaaaatctactcgtctcaaattgcctcacagtatctgaacttc
B D  P. pacificus  ======================================================================
B D   C. brenneri  ======================================================================
B D    C. remanei  ======================================================================
B D   C. japonica  ======================================================================
B D   C. briggsae  ======================================================================

       C. elegans  agcagtcggagcttttggggagcaaacagttcaaatagctttctttagtttccaaatcagtggtgtgcgg
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================
      C. briggsae  ======================================================================

Alignment block 91 of 150 in window, 14660481 - 14660585, 105 bps 
B D    C. elegans  caaattt-------------gccgaacttgccgagt--ttggcaaattttttaaagtggatttgccgaat
B D   C. briggsae  cgaattttttctaggtcacgacccaattttctaggtcatgagccaattttttctaggtcatgacctaatt
B D  P. pacificus  ======================================================================
B D   C. brenneri  ======================================================================
B D    C. remanei  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  ttgccgagctcggaa---aattt------------agaaattggcggcacacaccacaaattggg-----
      C. briggsae  ttttcgaggtcatgacctaatttttaaaaagttcgagaaattcaaaaaattcacaaaaaatcgaaaaatc
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================

       C. elegans  ----
      C. briggsae  caac
     P. pacificus  ====
      C. brenneri  ====
       C. remanei  ====
      C. japonica  ====

Alignment block 92 of 150 in window, 14660586 - 14660912, 327 bps 
B D    C. elegans  ttttaaacaatttggccgaaactattgatttcgtt--tttaaaaaacttatagtaaaataacat-----a
B D    C. remanei  cttt----aaactactgtaagcagaaaattacggtaactgagaatac---------aactgctt-----g
B D   C. briggsae  --ttggagaaaatccgagaatcatataaattcgaaaaatccgaaaactca----aaaatagtttttaaag
B D  P. pacificus  ======================================================================
B D   C. brenneri  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  aaattgagttatttttaattttatgtaggcaa--------------------------------------
       C. remanei  gaagattaatatctagaaat-------gacagt-------------------------------------
      C. briggsae  gaggcgagacagcaaaaatttcg-ggggacagtggcgctgtacccctgagctgcctgtcatgagttcaac
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
      C. japonica  ======================================================================

       C. elegans  -------------------------aaatc----aaacttgtgctccggagtttgctc------agtacg
       C. remanei  -------------------------aaatcaggaaaagtg------------------------aaacta
      C. briggsae  ccctcatgggggttctctatgcaaaatatcaggaaaactttttttttgatgtctggtctcctttaatttt
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
      C. japonica  ======================================================================

       C. elegans  gcaaatttg---ccgaattcgccgtgtttgcagcgctcggaaaattttgagatttgccgcaaacccctgt
       C. remanei  gagaattcgaaattgaagttg----------------ctcagaattatgctatttctgaagattcagaat
      C. briggsae  aaaaacaaaaatctgaaatcggagatctcg-ataaatcataaagttctgatactaccaaaatatcagaat
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
      C. japonica  ======================================================================

       C. elegans  ------tccaaacttgaaacaacttaaaaaaaataa-----ttcaactaaccaactgaaaattgttgtat
       C. remanei  tcagaactcagaattttag-aactcagaaaaactaactgtctttgact----------agatttaaattt
      C. briggsae  ------ctcagactctgaa-aa-tctgaaaatctaa----------------------aaatttcagaat
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
      C. japonica  ======================================================================

       C. elegans  ttttttagctgaccaaaatatgagctttcaaaaacaaaaattttcagcaccaattcctccagatcaa---
       C. remanei  tacttggtcttcctaaaaag-------tcggaaatattgattt--cacac-----ccttcacaccaa--a
      C. briggsae  ttccggatttttaagaacagtaaac--ttaaaaaccccaatcg--aacac-----cttcaaattcaacca
     P. pacificus  ======================================================================
      C. brenneri  ======================================================================
      C. japonica  ======================================================================

       C. elegans  -aatc
       C. remanei  tgaat
      C. briggsae  taatt
     P. pacificus  =====
      C. brenneri  =====
      C. japonica  =====

Alignment block 93 of 150 in window, 14660913 - 14660924, 12 bps 
B D    C. elegans  ------------------atatgttaa---tt-a
B D   C. brenneri  ------------------atatgatag---ttca
B D    C. remanei  atgttaataaaaccaaaaaaactatgcatattaa
B D   C. briggsae  at----ataactctttgttaattgcac---ttaa
B D  P. pacificus  ==================================
B D   C. japonica  ==================================

Alignment block 94 of 150 in window, 14660925 - 14661059, 135 bps 
B D  P. pacificus  ======================================================================

       C. elegans  CTCCATTATCCTCACGCGAAGCActatagaaaagt-ggattaataaaaaactc--aaaaactaactca--
      C. briggsae  CTCCATAATCCTGACTCGTAATAct-gagagaag--aaaagactgtggattagatagaactcaa------
       C. remanei  TTCCATTATCCTGACGCGTAACActaaagagaag--ggattaatatgaa------aaaaaccga------
      C. brenneri  CTCCATAATCCTTACGCGTAGAActaaacagaag---gattaatatcaaaca---gaaaaccga------
      C. japonica  CTCCATTATTCTGACGCGTAACActgcgggaaattgagattagggaaaatca---aaaagtcac----ac
     P. pacificus  ======================================================================

       C. elegans  -
      C. briggsae  -
       C. remanei  -
      C. brenneri  -
      C. japonica  a
     P. pacificus  =

Inserts between block 94 and 95 in window
B D  C. japonica 640bp

Alignment block 95 of 150 in window, 14661060 - 14661090, 31 bps 
B D    C. elegans  attgtcaaaa-aaaaaatcataaa-----acagaagt------
B D   C. briggsae  ------aaaataaagaactgcaaa-tcgaactaaagt------
B D    C. remanei  ------aaaa-agaatactgcaac-------------------
B D   C. brenneri  ------aaga-----aactgcaagaaaaaactgaatttgaaat
B D  P. pacificus  ===========================================
B D   C. japonica  ===========================================

Inserts between block 95 and 96 in window
B D  C. briggsae 52bp

Alignment block 96 of 150 in window, 14661091 - 14661119, 29 bps 
B D    C. elegans  agctcatattaatctgtaact---ttttctgg
B D    C. remanei  -----aacttaattaattaattgattttctgg
B D   C. brenneri  --catattttgttttgttaat--gttttcttg
B D  P. pacificus  ================================
B D   C. japonica  ================================
B D   C. briggsae  ================================

Inserts between block 96 and 97 in window
B D   C. remanei 3bp

Alignment block 97 of 150 in window, 14661120 - 14661508, 389 bps 
B D    C. elegans  ------gac--gacgaagagacat--g------ttgggacagacttgaccagacgacaga----tagaga
B D   C. brenneri  gaccatgac--gacggacaatttttggacttgttttggacacc-------agacgacaca----------
B D    C. remanei  ------gactggacgaacacatttctg------tttggacact----------tgacacatcgaggacga
B D   C. briggsae  ------gac--gatgagcacattt---------tttagacga-----------cgacaca--gatataga
B D  P. pacificus  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  caatattac--aatatg-tttattg-----attg------------------gttttttg---ttatgtg
      C. brenneri  -----ttaacgaatacg-tttattggg---aata----------attgcgaattctgttgttattatgtg
       C. remanei  cacattgaacgaatatg-tttattgggtttaataatgcaatatattttcttgttttcttg---ttatgtg
      C. briggsae  cgtttacattgaatatgatttattg-----attattgc------ttctcttatttttttgttattatgtg
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  gcagtgtgacgacatatcataaaatatatgg----taaaatatatgaaaatgg-----aaatat---ata
      C. brenneri  gcagtgtggtatgat------agagtgaatc----atagaaagttgaaaacaacattgaattttcagata
       C. remanei  gcagtgagatatggtg--aagaaacagttccatagagagagaaaagaaaacac-----agatatcagaaa
      C. briggsae  gcagtgagat-----------agatatttct----ggggagtgatgaaacaac-----gacaattggata
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  tgtatgtag-agatttctgtgtgtgggtgggggatattttgaaacaataacaaatgataaag---aagca
      C. brenneri  gagatatgg-agacat-------------aaaactatttggaacagataacaaatcagaaaataaaagcg
       C. remanei  gagagagag-agatat-------------ggaagagaaggtaacaggtaacaaatcatagagaaaaagcg
      C. briggsae  gacagaatgaaaacat-------------tg--------------------aaatc--agaatttaagcg
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  aaacggatcaagtgattgc---------------gggaaaaatagtgtggaaattta-at-tgtt-----
      C. brenneri  aaacggatcaagtgattgcggcagctt-------gggaaaaagtataggataagaaa-gtgtacg-ataa
       C. remanei  aaacggatcaagtgattgcggcagttt-------gggattatggatgggataggata-acgtgtggagaa
      C. briggsae  aaacggatcaagtgattgcggcagtttttttctggggggaaaggatatgataggatagatgtgtt-----
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  -----------------ttttttt---ctataaatttt--cttttaaagatataaacttttgaatcactt
      C. brenneri  caggatttagaacaaaaatttttctgagtatagatttt--ctgtg------------ttttgtaacactt
       C. remanei  c----------acaagaattgttt----------tctt--ttctc------------tttta-gacactt
      C. briggsae  -----------------cttcttt----------ttttggttttt------------tcttacgattttc
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  tt---agacatgatacaaacaaacaagcacggaacggaaacat-----tgagacacacgcaaacaca-tg
      C. brenneri  ac---ggacatgat----ataaacaaacacggaacggacacaa-----gaaaacacacgcaaacacagta
       C. remanei  ac---ggacatgat----acaaacaaacacggaacggaaacatggagagaaaacacacgcaaacacaatg
      C. briggsae  acttgggacatgatacaaacaaacaaacacggaacggaaacatt----gaaaacacacgcaaacacaatg
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  attatttactagtttct
      C. brenneri  ac---------------
       C. remanei  at------------ttt
      C. briggsae  agta---------attt
     P. pacificus  =================
      C. japonica  =================

Alignment block 98 of 150 in window, 14661509 - 14661750, 242 bps 
B D    C. elegans  gtttccacgatc--attaagggctt------------------------------------ttcgataga
B D   C. japonica  gcttctaccatc--atctagacatc------------------------------------------aag
B D   C. brenneri  -----tctattc--atcaataggtt---------------------------------------ttgaaa
B D    C. remanei  gaatttctgatc--atcaatagaacgtctatactttttgggaattttcagattctagaaggttctaaaag
B D   C. briggsae  ggcttctagatcgaaacagtagatc----------------------------------------aaaaa
B D  P. pacificus  ======================================================================

     P. pacificus  ======================================================================

       C. elegans  TTG---------ACCCGACGAA----------------TTCTGGCT--------------GGGCGAGTTT
      C. japonica  TTGTTGTTGCGTCGCCGACGCG----------------CTATTGTTGGCGA---------CACCAGAT--
     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ===============================================

Alignment block 99 of 150 in window, 14661751 - 14661846, 96 bps 

       C. elegans  GGTAGCAGTCGGAGGCTCCTctgaaa-
      C. briggsae  GATAGCAGTCCGAGGCTCCTctgaaa-
       C. remanei  GGTAGCAGTCGGAGGCTCCTctggaa-
      C. brenneri  GGTAGCAATCGGAAGCTCCTctgtaa-
      C. japonica  GGTAGCAGTCGGTGGCGCCTctggaa-
     P. pacificus  GGAAGCAGTCGGATGATCCActgaaga

Inserts between block 99 and 100 in window
B D  C. briggsae 4bp
B D   C. remanei 696bp

Alignment block 100 of 150 in window, 14661847 - 14661864, 18 bps 
B D    C. elegans  ttaagagagttatggat-------------g
B D   C. briggsae  tttgtggagttgggagttctctcagaattca
B D   C. brenneri  ------------------------------a
B D   C. japonica  atggaagggaaatgaat-------------g
B D  P. pacificus  gaaagagagtgaggg----------------
B D    C. remanei  ===============================

Inserts between block 100 and 101 in window
B D  C. japonica 2514bp

Alignment block 101 of 150 in window, 14661865 - 14661927, 63 bps 
B D    C. elegans  tatataacgttaactcaatacgcagaaaaagctga----ggctccctatcta-----gcaaaa-------
B D   C. brenneri  attttcatgat----------------------------------------------gctaaa-------
B D   C. briggsae  aatttcctgatatcgcaccactt-gaatcggatga----gatac-------------gcgaaatga-att
B D  P. pacificus  -------------------tcaaaggagaagatgatattgtcacttcgtccatagttgtaaaacaataaa
B D    C. remanei  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  ---atctctcag
      C. brenneri  ---agt-tttag
      C. briggsae  ttcagc-cccat
     P. pacificus  taaatt-ctcgt
       C. remanei  ============
      C. japonica  ============

Alignment block 102 of 150 in window, 14661928 - 14662150, 223 bps 


       C. elegans  -----------------------------------------------------------AAGCATCTTCC
      C. briggsae  -----------------------------------------------------------AAGCACCGTCC
      C. brenneri  -----------------------------------------------------------AGACATCTTCC
      C. japonica  -----------------------------------------------------------AAACACCGTCC
       C. remanei  -----------------------------------------------------------AGACATCTTCC


       C. elegans  TCATTTGGAGTTCCACGACGA-------------------------------------------------
      C. briggsae  TCATTTGGTGTTCCTCGTCTG-------------------------------------------------
      C. brenneri  TCATTAGGAGTTCCACGACGA-------------------------------------------------
      C. japonica  TCATTTGGAGTTCCACGACGT-------------------------------------------------
       C. remanei  TCATTTGGAGTTCCACGACGG-------------------------------------------------
     P. pacificus  TCATGAGGAGTTCCGCGTCTGgatacatcaatttgatcacattatcaagataaaacttcatgccataact

       C. elegans  ----------------------------------
      C. briggsae  ----------------------------------
      C. brenneri  ----------------------------------
      C. japonica  ----------------------------------
       C. remanei  ----------------------------------
     P. pacificus  ctgattattatctagaatctcgagctcgtaacaa

Inserts between block 102 and 103 in window
B D P. pacificus 103bp

Alignment block 103 of 150 in window, 14662151 - 14662309, 159 bps 

       C. elegans  AATAACCGT--------------------------------------------------ACTCCTTGTCG
      C. briggsae  AATATCCGT--------------------------------------------------ATTCCTTGTCA
      C. brenneri  AATATCCGT--------------------------------------------------ACTCTTTGTCA
      C. japonica  AGTATCCGT--------------------------------------------------ACTCTTTGTCG
       C. remanei  AGTATCCGT--------------------------------------------------ATTCCTTGTCA


Inserts between block 103 and 104 in window
B D P. pacificus 212bp

Alignment block 104 of 150 in window, 14662310 - 14662388, 79 bps 

       C. elegans  CAGCAGCGG
      C. briggsae  CAGCGGCGG
      C. brenneri  CGGCAGCAG
      C. japonica  CGGCGGCGG
       C. remanei  CAGCGGCAG
     P. pacificus  ---------

Inserts between block 104 and 105 in window
B D P. pacificus 21bp

Alignment block 105 of 150 in window, 14662389 - 14662545, 157 bps 
B D    C. elegans  TGAGTCCTTGACCGTATGGTT-------------------------------------------CAGCAA
B D   C. briggsae  TGAGTCCTTGACCATATGGCT-------------------------------------------CGGCGT
B D   C. brenneri  TGAGACCTTGTCCGTATGGCT-------------------------------------------CGGCGT
B D   C. japonica  TGAGTCCGTGGGCGTATGGCT-------------------------------------------CGGCAA
B D    C. remanei  TGAGTCCTTGACCGTATGGCT-------------------------------------------CGGCGT


       C. elegans  --------------------------------------------------ACTTGATAAGAAGGGTGTCA
      C. briggsae  --------------------------------------------------ATTTGATGAGAAGAGTGTCG
      C. brenneri  --------------------------------------------------ATTTGATGAGGAGGGTATCA
      C. japonica  --------------------------------------------------ATTTGATAAGAAGGGTGTCG
       C. remanei  --------------------------------------------------ACTTGATGAGGATGGTGTCG


Inserts between block 105 and 106 in window
B D P. pacificus 1018bp

Alignment block 106 of 150 in window, 14662546 - 14663018, 473 bps 
B D    C. elegans  TTGCCAGctataaa--tagttag------------------------------------------aatta
B D   C. briggsae  TTGCCAGctggaaa---aattag------taagttaatt-------------ggcaaattctataaccta
B D   C. brenneri  TTGCCAGctggaaa---aaatgg------------------------------------------aatca
B D   C. japonica  TTGCCAGctgaaatgataaatgttggttctaagttgactataactattttaagagatgttcaacaactct
B D    C. remanei  TTGCCAA---------------------------------------------------------------
B D  P. pacificus  ======================================================================

       C. elegans  aaaa----------------taagttatggaaataaaacag-----------------------------
      C. briggsae  ggaaattaagaat-----tttacgttttacaggaccaatagggctgccatccccagcgccaatcccaaaa
      C. brenneri  gatgaactaaaat-----tttcaattgtataaatctaat------------------------------c
      C. japonica  aagaatgcactccctccgttcaagttataaaaagaaaacaa-----------------------------
       C. remanei  ----------------------------------------------------------------------
     P. pacificus  ======================================================================

       C. elegans  -----------------------------------------------tacCTAGTCTCAATAATCTTGAT
      C. briggsae  ataaaccaatcagaaaagaccgc----tttcaaaaccttcccaaactcacCTGGTCTCAAAGATCTTGAT
      C. brenneri  acaatccaatgattaatttcgtctatgttatcaaatgtttttaaacatacCTAGTTTCGAAAATCTTGAT
      C. japonica  ----------------------------------------ttgcactcacTTGGTCTCAAAGATCTTAAT
       C. remanei  --------------------------------------------------CTGGTCTCGAAGATATTGAT
     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

       C. elegans  taaaaatcacaataatatctaatttttgaaaaaggtt-----ct---------agcttacTCTAAGAATG
      C. briggsae  tgaaaaaaaccgccgaatttcgttttattttccgttt-----tc---gctagcaactcacTCTCAAAATA
      C. brenneri  tataaaat-----cg---ttgattaacaagacaagctaacaatcgaatcttgaaacaaacTCTTAGAATG
      C. japonica  ------------------------------------------tc---------------cTCTCAGAATC
       C. remanei  tgtaagta-----ttaatttaattatttttgcacctc-----tcctacttaagaactcacTCTCAAAATA
     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

     P. pacificus  ======================================================================

       C. elegans  ------aagaaag
      C. briggsae  -----------tg
      C. brenneri  agttgcaggaatg
      C. japonica  ------aag----
       C. remanei  ------aggaatg
     P. pacificus  =============

Inserts between block 106 and 107 in window
B D  C. japonica 1549bp

Alignment block 107 of 150 in window, 14663019 - 14663058, 40 bps 
B D    C. elegans  tgatggttgaacacatatttttgacaggtgaataggagaa----
B D   C. briggsae  gaacggtttggtg--------tgagatgttgttagaaggaaaat
B D    C. remanei  gaatgtttacatg---------aaaatgtt--------------
B D   C. brenneri  tgcacttttaata--------tgaca-gtt--------------
B D  P. pacificus  ============================================
B D   C. japonica  ============================================

Inserts between block 107 and 108 in window
B D   C. remanei 15bp

Alignment block 108 of 150 in window, 14663059 - 14663140, 82 bps 
B D    C. elegans  tgatcggatta---aaatattaaaaatgtatgtaatttgcaaatatt-tttctacacaaataaactaata
B D   C. briggsae  tgatcggattatatagagatta-tatagtttttgat----gattgttggttacacaagaatgaactaata
B D    C. remanei  tgatcggatta---aaatatta-aaatgtgtat------------ttggttacacaaaaatgaactaata
B D   C. brenneri  tgatcggatta---tgttatta-------------------attgttggttatacgaaaatgaactaata
B D  P. pacificus  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  cctaaagtgcaagttg
      C. briggsae  cctaaagtgcaagttg
       C. remanei  cctaaagtgcaagtca
      C. brenneri  cctagagtgcaaat--
     P. pacificus  ================
      C. japonica  ================

Alignment block 109 of 150 in window, 14663141 - 14663241, 101 bps 
B D    C. elegans  ttatcacttacatttaaaataagggtggacaacaagaatatttttagttatttctaaa---tctattaca
B D   C. brenneri  ----------------------------------------------------------------------
B D   C. briggsae  ---------aattttggagtgata---------aagaacgtttttcgaaattttttgattgttggttaca
B D  P. pacificus  ======================================================================
B D    C. remanei  ----------------------------------------------------------------------
B D   C. japonica  ======================================================================

       C. elegans  aagatggtcaag--gttcgaattgtccaccctgaat
      C. brenneri  ---------aac------------------------
      C. briggsae  caaaaaatgaactaattctcatta--agtgctgaat
     P. pacificus  ====================================
       C. remanei  ------------------------------------
      C. japonica  ====================================

Inserts between block 109 and 110 in window
B D  C. briggsae 12bp

Alignment block 110 of 150 in window, 14663242 - 14663275, 34 bps 
B D  P. pacificus  ==================================

Alignment block 111 of 150 in window, 14663276 - 14663376, 101 bps 


Inserts between block 111 and 112 in window
B D P. pacificus 698bp

Alignment block 112 of 150 in window, 14663377 - 14663463, 87 bps 
B D  P. pacificus  ======================================================================

       C. elegans  TGCTGA---TGTCTTG---GTTG
      C. brenneri  TGCTGA---TGTCTTG---GCTG
       C. remanei  TGTTGG---TGTCTTG---GCTG
      C. briggsae  TGTTGG---TGTCTTG---GTTG
     P. pacificus  =======================

Alignment block 113 of 150 in window, 14663464 - 14663582, 119 bps 


Inserts between block 113 and 114 in window
B D P. pacificus 2202bp

Alignment block 114 of 150 in window, 14663583 - 14663640, 58 bps 
B D  P. pacificus  ==========================================================

Alignment block 115 of 150 in window, 14663641 - 14664138, 498 bps 




       C. elegans  CACTGCT------ATGATGTCCGGAA----------------------------------CCGGAGAACT
      C. briggsae  CTGAAGA------ATGCGATCCTTGT----------------------------------CCGGCGAACT
       C. remanei  CGGTGCT------GTGATGTCCGGAG----------------------------------CCAGAGAACT
      C. brenneri  CTGAGCT------GTGTTGACCGGAT----------------------------------CCGGAGAACT
      C. japonica  CAGAAGA------GTGTGGTCCCGAG----------------------------------CCGGTAAACT

       C. elegans  CAATCTCAAACTCCATCTTCCCGCCGTAGGCTGTG-----------------------------------
      C. briggsae  CGATTTCGAATTCCATCTTTCCACCATACGCGGTG-----------------------------------
       C. remanei  CAATCTCGAACTCCATCTTTCCACCGTACGCGGTG-----------------------------------
      C. brenneri  CAATTTCAAACTCCATCTTTCCACCGTAGGCGGTA-----------------------------------
      C. japonica  CGATTTCAAACTCCATCTTGCCACCGTACGCGGTC-----------------------------------




       C. elegans  -----ctccgattagattttt
      C. briggsae  -----att---tcattttttt
       C. remanei  -----ttt---tgagatttt-
      C. brenneri  -------------aaaatgtt
      C. japonica  gcaagttccagttgggtttg-
     P. pacificus  -----atgaagattgatcttt

Inserts between block 115 and 116 in window
B D  C. japonica 69bp
B D P. pacificus 311bp

Alignment block 116 of 150 in window, 14664139 - 14664186, 48 bps 
B D    C. elegans  cagattggcaagatttctcttttcgg------tcgggatggatgcagggcttca
B D   C. brenneri  tct------ataatccatttctatgatatttttccgtatggatgcatgg-----
B D    C. remanei  ----------ggatggctttcaatagaacacgtc-----ggatgcgggt-----
B D   C. briggsae  tcg------agaatcttctttttaggaacattcg-----ggatgcagga-----
B D  P. pacificus  ======================================================
B D   C. japonica  ======================================================

Alignment block 117 of 150 in window, 14664187 - 14664385, 199 bps 
B D    C. elegans  ttccagggag--ca----gcatgc--aaagaacagttagaaacaaagggagttggttaata---------
B D   C. briggsae  ttccaggaagctta----gcatgc---aaataagattatcaactaaaagagttgattagta--ggggaac
B D    C. remanei  atcgggagatctcagatcgcatgctgtataaatgttagagaactaagagagttggttagtcatggggaac
B D   C. brenneri  aaagggagtcgtca----gcatgc-----ggagggttaagaactaagagagttgattaata-tagggaaa
B D   C. japonica  ggccgagaag--aa----gcatgc-----gagagatta-gaactgagggag-gatttagtg---------
B D  P. pacificus  ======================================================================

       C. elegans  ------gctttaacttaaacataaaaatataaacttcaca-------atcggaca--gggacatgaagac
      C. briggsae  aaaaaggtttcaacaga---aataaaaaagaaacttgaca--------ttggaca---gaagacggagac
       C. remanei  atggaaat--------a---aagaaaaatgaaactttaca---------cagacacatggacatgaagac
      C. brenneri  atg--ggttttaaaagaattacgaaaattgaaactttacaagattgacatggacaagacaaaatcacaac
      C. japonica  ------gttttaaaa-a---ataaactatgaaacttcacc----gggcatggaca----aaatcgacaaa
     P. pacificus  ======================================================================

       C. elegans  -aaacacttacACAAGCGGCGTCctgaa-----aca--------gtaggcatt-----------------
      C. briggsae  -aaacacttacACAAGCGGCGTCctgaaaagagatatgtggaatataagcgtt-----------------
       C. remanei  aaaacacttacACAAGCGGCGTCctgaa----------------ataagcatt-----------------
      C. brenneri  -caacacttacACAAGCGGCATCctgaa-----acatgt-----ataagcattacaacacatcgagttga
      C. japonica  acaacacttacACAAGCGGCGTCctgaa-----aca--------atgcacatt-----------------
     P. pacificus  ======================================================================

       C. elegans  --------------------------aacgtt------ttgaca--agacg---atatcacaa-------
      C. briggsae  -gatttataagaacga----------cacattggacagttcacattggaca-atatat------------
       C. remanei  --------------------------tacaatggacaaaagaca-tggacatttgtgt------------
      C. brenneri  cgatttacaaatacaaagacaatgtgcacattaggaaactaaggttagatttcagtattacagtactttt
      C. japonica  --at----------------------aacatt--ttaactgaca-cggaccacaacaa------------
     P. pacificus  ======================================================================

       C. elegans  -----------------tttgtgcaaaa---------------tat----------ttc------aaaaa
      C. briggsae  -----------------attttgtagaggtcaca---------tat------accatcc----gacaagg
       C. remanei  -----------------tttttgtgaggttc----------------------------------tagag
      C. brenneri  aatctcatcttatcaaatttctgcgaaaattgcaacaaagccttattccaagactattcacaaaataaaa
      C. japonica  -----------------taatttcaaaaataa--------------------------------------
     P. pacificus  ======================================================================

       C. elegans  --------ataa
      C. briggsae  --------atca
       C. remanei  --------gtta
      C. brenneri  ttcaacacgtta
      C. japonica  ------------
     P. pacificus  ============

Inserts between block 117 and 118 in window
B D  C. japonica 1746bp

Alignment block 118 of 150 in window, 14664386 - 14664526, 141 bps 
B D    C. elegans  cgggatgagagaat-------atgatctt----acggtattttt-agat--gaca----tgaatcatgca
B D   C. brenneri  tagccaaaaacatatgttttaaaaccattcagaacaatattcagaagat--aaca----aaaatccccta
B D    C. remanei  cggtataaaactatggtatt-atagtact----atagtgttctagtcatgcaaca----tgtactatgta
B D   C. briggsae  tgttttcaaactattttcttaatactcct----ataacccgcttcacactcaacgaaattgaattatcta
B D  P. pacificus  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  ac-a-------ctgagtttt-----cagaaaaatgtaacat--ttggatttagattca-ataccgttact
      C. brenneri  atgt-------tctactcaaacaaaaacaaaactaaaccta--taaaaata--------gaatttcaaat
       C. remanei  ac-tacaactgacttctctaacaacttgaaagttttaacagattccgaatatgatttagggactccaact
      C. briggsae  aa-t-------tttgctcta-----tagaaatttacaagggcttcaaaataatataca-acatcactact
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  tc---acatcctcaatcaccca-------aaattcagaaa------------------------------
      C. brenneri  g----aaatcacttattaccgt-------aatttctagatcc----------------------------
       C. remanei  attgcacagtaaaaaacaacgc-------aaattttcgaaac----------------------------
      C. briggsae  ttcg-atcgtgttttataccactttgtagatatttttactatctacatctctttaattggatttttgaaa
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  -----------------------------------aaaaa
      C. brenneri  -----------------------------------taaaa
       C. remanei  -----------------------------------cacag
      C. briggsae  atgacaagtttgaagcgagttatgatcctttaaaacaaag
     P. pacificus  ========================================
      C. japonica  ========================================

Alignment block 119 of 150 in window, 14664527 - 14664561, 35 bps 
B D    C. elegans  cca-------------------------------------------------ctaacCTTGGTACGGTAG
B D   C. japonica  -------------------------------------------------ccactcacCTTGGTACGGTAA
B D   C. brenneri  ctagaaaaggcccat-------------------------------ctgaatcttacCTTGGTGCGGTAG
B D    C. remanei  ctaccgtaacctc-catcccctttctcaactcgaattccttaataatccaaactaacCTTGGTACGGTAG
B D   C. briggsae  ctaccgcaacctcataaacaactgcttagttttcacttctt-----ctcaaactaacCTTGGTTCTGTAG
B D  P. pacificus  ======================================================================

       C. elegans  TGTCCACTGCTGCG
      C. japonica  TACCCGCTACTTCT
      C. brenneri  TACCCACTGCTACG
       C. remanei  TATCCACTGCTGCG
      C. briggsae  TATCCACTGCTTCT
     P. pacificus  ==============

Alignment block 120 of 150 in window, 14664562 - 14664603, 42 bps 

Inserts between block 120 and 121 in window
B D P. pacificus 514bp

Alignment block 121 of 150 in window, 14664604 - 14664675, 72 bps 
B D  P. pacificus  ======================================================================

       C. elegans  CT
      C. japonica  GA
      C. brenneri  GA
       C. remanei  GA
      C. briggsae  GA
     P. pacificus  ==

Alignment block 122 of 150 in window, 14664676 - 14664744, 69 bps 

Inserts between block 122 and 123 in window
B D P. pacificus 1053bp

Alignment block 123 of 150 in window, 14664745 - 14664906, 162 bps 


       C. elegans  GGTCGACTGGTctgaaa---------attgggatatataggttggg----
      C. briggsae  GGTCGACTGGTctggaa----------ttggaggagatatttacgatagg
       C. remanei  GGTCGACTGGTctagaa---------------------att---------
      C. brenneri  GATCGACTGGCctagaattaaaaattattgaaaaaaatgtttccag----
      C. japonica  GGTCGACTGGTctgaaaaagaaagtttttgggttttatagaatg------
     P. pacificus  GATCAACGGGTctgaaga--------------------------------

Inserts between block 123 and 124 in window
B D  C. briggsae 695bp
B D  C. brenneri 6bp
B D  C. japonica 1421bp
B D P. pacificus 1650bp

Alignment block 124 of 150 in window, 14664907 - 14664998, 92 bps 
B D    C. elegans  tgatttttcatcactgatcatctccaccttcacttttttttggtttctcagtttcccttctcttacaaga
B D   C. brenneri  caatttttcaaactgcaatagttgctc---------tttttcattcacccatttctcattttgattttat
B D    C. remanei  ---tcttttatttttttcaggttcccc-------gtttctctatccacctacatacatagtcaattaatt
B D  P. pacificus  ======================================================================
B D   C. japonica  ======================================================================
B D   C. briggsae  ======================================================================

       C. elegans  attataattctcaacggtttga
      C. brenneri  tcttttacacccattcacaacg
       C. remanei  tctgtgattcatttccaataca
     P. pacificus  ======================
      C. japonica  ======================
      C. briggsae  ======================

Alignment block 125 of 150 in window, 14664999 - 14665259, 261 bps 
B D    C. elegans  tgcagtcaattaaatgctacatacatatatctaattcataaatgaatttgattgaa--agtgttgcatga
B D    C. remanei  cacacccactt-------------atatatctaattcataaatgaatttgattgaaacagtgttgtgtgt
B D   C. brenneri  ggcaaccaatt-aattccgtatg-atatatctaattcataaatgaatttgattgag--agtgttgcccgc
B D   C. japonica  tgcggtcaattaaattcc------atataaataat------ataaatttgattgaa--agtgtt------
B D  P. pacificus  ======================================================================
B D   C. briggsae  ======================================================================

       C. elegans  gaga-------------------caatcaaaatg---------gaaccggtcctactatgccca--caca
       C. remanei  gtgt---------------------------atgaatgcgcgaaaaaaggttttcccccgccactagaaa
      C. brenneri  gccttaaaaaggttttgatgtcttattgaaaaagaattgcggagaaccggttttctttttctcagttctc
      C. japonica  ----------------------------------------tgggaaccggttcaaccgcccgttgccaga
     P. pacificus  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  ccactct---cacctctcc----tcacaatatcgctactgaaaagtgatgataaggcattggtgggggta
       C. remanei  ccggtcta--ctcctccct----tgataagag---------aaaaagggaagaagaga------------
      C. brenneri  ctggtttg--ctactcccta---tcttaacat---------aaagtggtgataaggga------------
      C. japonica  cttgtccgttttcttttctaaattctcaaca----------aaagtcgtgataagata------------
     P. pacificus  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  gggaa--gagatagctgaactgaactgatagctatc-ttttcgtcgct----gctaccgctcgtctgcta
       C. remanei  -gaga--gagatag-----ctgaactgatag------ccctattcaatttctgctgcctggctgctgcta
      C. brenneri  -aaaaagaagataa-----ctgaaccgatagctatctctttattcgat-----------------tgctg
      C. japonica  -ga----tagatag---------atagatag----------------------------------cgcta
     P. pacificus  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  ttatcacttgcgcc------c-----------cgggggcaa---tga
       C. remanei  tcatcaattgcgccacacgac--------cgacgggggcaat--tga
      C. brenneri  tcatcaatcgcaccaagaaacaaaaaaaaagaaaaaagaaatagtga
      C. japonica  tcatcaatga-------------------------------------
     P. pacificus  ===============================================
      C. briggsae  ===============================================

Inserts between block 125 and 126 in window
B D  C. brenneri 4bp

Alignment block 126 of 150 in window, 14665260 - 14665305, 46 bps 
B D    C. elegans  atgaaggtcgtaaatttacacga-----------caattgg--------------------ttt--acaa
B D   C. briggsae  atgaaggtcgtaaatttacacgac----------caattggcttt---------------tttacaatga
B D    C. remanei  atgaaggtcgtaaatttacacga-----------caattgg--------------------ttcaaacaa
B D   C. brenneri  atgaaggtcgtaaattttcgcga------------aattag--------------------ttt--acgg
B D   C. japonica  atgaaggtcgtaaatttacgcggcgcggcggtggcaattggttttgtttcgtttagattagttt--acaa
B D  P. pacificus  ======================================================================

       C. elegans  aaacattt----g
      C. briggsae  aaactttt-----
       C. remanei  aaatattt----g
      C. brenneri  caacattttctag
      C. japonica  aaacattt----g
     P. pacificus  =============

Inserts between block 126 and 127 in window
B D  C. briggsae 567bp
B D  C. japonica 201bp

Alignment block 127 of 150 in window, 14665306 - 14665337, 32 bps 
B D    C. elegans  atagtg--aatggttagatgaatg-gacagatggg
B D    C. remanei  atagtggtgatgatagggggaatg-ga---atggg
B D   C. brenneri  attgtaaaatagatgtgttcaatatga---atttg
B D  P. pacificus  ===================================
B D   C. japonica  ===================================
B D   C. briggsae  ===================================

Alignment block 128 of 150 in window, 14665338 - 14665370, 33 bps 
B D    C. elegans  atgcggggaaaatgatgaactgggatgtttttg
B D   C. brenneri  acaagtgcaaa------aaatagtatgtgtttg
B D  P. pacificus  =================================
B D    C. remanei  ---------------------------------
B D   C. japonica  =================================
B D   C. briggsae  =================================

Inserts between block 128 and 129 in window
B D  C. brenneri 128bp

Alignment block 129 of 150 in window, 14665371 - 14665499, 129 bps 
B D    C. elegans  caagatattgaggtacctctatatagatcagtaactgttcaagccatcatcaaagcttcagagaatccta
B D  P. pacificus  ======================================================================
B D   C. brenneri  ======================================================================
B D    C. remanei  ----------------------------------------------------------------------
B D   C. japonica  ======================================================================
B D   C. briggsae  ======================================================================

       C. elegans  tattcttcaagagcaataaggctcaggatgggttccattgtaataggtcactttttcac
     P. pacificus  ===========================================================
      C. brenneri  ===========================================================
       C. remanei  -----------------------------------------------------------
      C. japonica  ===========================================================
      C. briggsae  ===========================================================

Alignment block 130 of 150 in window, 14665500 - 14665530, 31 bps 
B D    C. elegans  ttttagctaccaggagactatcctcataaat
B D   C. briggsae  ----------------------------aat
B D    C. remanei  ttgtagc------------------------
B D  P. pacificus  ===============================
B D   C. brenneri  ===============================
B D   C. japonica  ===============================

Alignment block 131 of 150 in window, 14665531 - 14665847, 317 bps 


       C. elegans  GGCGACGGCCTTACAGGTCAAC-----GAGAACGTTGTT-------------------------------
       C. remanei  GGCGACAGCCTTACAGGTCAAC-----GAGAACGTGTTT-------------------------------
      C. japonica  AGCCACAGCCTTACACGTCAGC-----GAGAACGTGGAT-------------------------------
      C. briggsae  GGCGACAGCTTTGCAGGTCAGC-----GAGAAGGTGGAT-------------------------------
      C. brenneri  GGCAACGGCCTTGCATGTCAAC-----GAGAACGTGGAT-------------------------------


       C. elegans  ACCTCGTCAGAACCATCG-----------TGA------------------------------------CA
       C. remanei  ACCTCATCGGATCCGTCG-----------TGA------------------------------------CA
      C. japonica  ACCTCGTCGGAACCGTCA-----------TGA------------------------------------CA
      C. briggsae  ACCTCATCAGAACCATCA-----------TGA------------------------------------CA
      C. brenneri  ACCTCATCAGAACCATCA-----------TGA------------------------------------CA


Inserts between block 131 and 132 in window
B D P. pacificus 904bp

Alignment block 132 of 150 in window, 14665848 - 14665891, 44 bps 
B D  P. pacificus  =================================================

Inserts between block 132 and 133 in window
B D  C. brenneri 7bp
B D  C. briggsae 524bp
B D   C. remanei 13bp

Alignment block 133 of 150 in window, 14665892 - 14665932, 41 bps 
B D    C. elegans  -----agaatggcatgaagatt------ttt----------taaaagaatgaaata-------aaaatg
B D    C. remanei  -----agactcgcccgaagatcaggatatgtctcagactaacaaacattttgtgtaaacaggtcaaatg
B D   C. brenneri  -----------aattgaacattaaaaagttt----------gaaagctttcataga-------aaaaca
B D   C. japonica  gtggtggggtagc--gaacatt------ttt----------aaaaa-----------------------
B D  P. pacificus  =====================================================================
B D   C. briggsae  =====================================================================

Inserts between block 133 and 134 in window
B D   C. remanei 136bp
B D  C. brenneri 33bp
B D  C. japonica 2407bp

Alignment block 134 of 150 in window, 14665933 - 14665953, 21 bps 
B D    C. elegans  agaagat--gcactaaacccaat-
B D    C. remanei  ggaagattagcactcaaccc-agt
B D   C. briggsae  --------------------aaa-
B D  P. pacificus  ========================
B D   C. brenneri  ========================
B D   C. japonica  ========================

Inserts between block 134 and 135 in window
B D   C. remanei 140bp

Alignment block 135 of 150 in window, 14665954 - 14666042, 89 bps 


Inserts between block 135 and 136 in window
B D P. pacificus 529bp

Alignment block 136 of 150 in window, 14666043 - 14666239, 197 bps 

       C. elegans  CAGTCTGGCTCTCCGTCGCAGACATAATCGTTCTTAACGCAT----------------------------
      C. briggsae  CAATCAGGCTCACCGTCGCACACGTAGTCGTTCTTGACGCAT----------------------------
       C. remanei  CAATCGGGCTCGCCGTCGCACACGTAGTCGTTCTTCACGCAT----------------------------
      C. brenneri  CAATCTGGCTCTCCGTCACACACGTAGTCGTTTTTGACGCAT----------------------------
      C. japonica  CAATCTGGCTCACCATCGCACACGTACTCGTTCTTTACGCAC----------------------------


       C. elegans  TCC------GTTCGAGACTTCTTGGGGTCCGTctgaaaa
       C. remanei  TCC------GTTCGACACTTCTTGGGGTCCATctggaaa
      C. brenneri  TCC------GTTCGATACTTCTTGGGGTCCATctgtaag
      C. japonica  CGG------GTTCGACGCTTCTTGAGGTCCGTctgaaa-
     P. pacificus  ACC------ATTTCCAGC---------------------

Inserts between block 136 and 137 in window
B D  C. briggsae 51bp
B D   C. remanei 45bp
B D  C. brenneri 8bp
B D P. pacificus 38bp

Alignment block 137 of 150 in window, 14666240 - 14666272, 33 bps 
B D    C. elegans  tttttataattgtgaac-----------------gtgaaa---------ttttaggact
B D   C. japonica  ------------------------------gatggtcaaa---------ttttagtatg
B D   C. brenneri  tttgtttacttcgtaacctgtacttttattggtcatgaaa-----ctcattccatcaat
B D   C. briggsae  tttctatgactcggaac---------ggtctatcatcaaaattttcacatttcgtta--
B D  P. pacificus  ===========================================================
B D    C. remanei  ===========================================================

Alignment block 138 of 150 in window, 14666273 - 14666285, 13 bps 
B D    C. elegans  a-------gaaaaatgggga---
B D   C. briggsae  ---------------gagga---
B D   C. brenneri  c--------aaatcggaaaa---
B D   C. japonica  cctcctctcccatctgaa-----
B D  P. pacificus  ---------agaggaggggagta
B D    C. remanei  =======================

Inserts between block 138 and 139 in window
B D  C. briggsae 19bp
B D  C. brenneri 32bp

Alignment block 139 of 150 in window, 14666286 - 14666564, 279 bps 


       C. elegans  ------------------------------CATGAGCAGAAGATGGAAGTGGTCCACCAACACGTGCCCA
      C. briggsae  ------------------------------CGTGAGCGGACGATGGAAGTGGTCCACCGACACGAGCCCA
       C. remanei  ------------------------------CGTGGGCGGATGATGGGAGTGGTCCACCAACACGAGCCCA
      C. brenneri  ------------------------------CATGAGCGGATGATGGAAGTGGTCCACCAACACGAGCCCA
      C. japonica  ------------------------------CGTGGGCGGACGCCGGAAGTGGTCCTCCGACACGAGCCCA



Inserts between block 139 and 140 in window
B D P. pacificus 1994bp

Alignment block 140 of 150 in window, 14666565 - 14666603, 39 bps 
B D  P. pacificus  =======================================

Inserts between block 140 and 141 in window
B D  C. japonica 1529bp

Alignment block 141 of 150 in window, 14666604 - 14666653, 50 bps 
B D    C. elegans  tgat----------------tatggttatggacgaaagttgatgttctaagtt-----------------
B D   C. brenneri  caagattacgaacttcctagtgtgttttttttttcaatgtcatattatatatt-----------------
B D    C. remanei  atga----------------tatgtttcgatttattattttggactaaaaaat-----------------
B D   C. briggsae  ttgggt--------------gaaggttaggtatacagttttatagctaaaaatgtggctgcgcctttttg
B D  P. pacificus  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  -----------ctacagc----aaccga
      C. brenneri  -----------ctgagcttgc-------
       C. remanei  -agtttta---ctagacc------agga
      C. briggsae  aagttctgattctgtaccttcaaaaggc
     P. pacificus  ============================
      C. japonica  ============================

Alignment block 142 of 150 in window, 14666654 - 14666750, 97 bps 
B D    C. elegans  ca--------------------------------------------------acttacAGGTTTGTCTAT
B D   C. briggsae  cctaactcgggtcaaacttgactgttttgaaatccgactagattttcaaaaaacttacAAGTCTGTCTAT
B D    C. remanei  cc--------------------------------------------------acttacAAGTCTGTCTAT
B D   C. brenneri  ----------------------------------------------------acttacAAGTCTGTCTAT
B D   C. japonica  ca--------------------------------------------------actcacAGGTCTGTCTAT
B D  P. pacificus  ======================================================================

     P. pacificus  ======================================================================

       C. elegans  CGACCG---C
      C. briggsae  CGACCGGCTC
       C. remanei  CGACCG---C
      C. brenneri  CGACCG---C
      C. japonica  CAACCG---C
     P. pacificus  ==========

Inserts between block 142 and 143 in window
B D  C. japonica 2458bp

Alignment block 143 of 150 in window, 14666751 - 14666880, 130 bps 
B D    C. elegans  TTCATagt---tctctatattcaaaaacacgaacgacgtgtttcctactacagagatct---ttggatgc
B D   C. briggsae  TTCATcgtatctctc------------------------gtttt--------gagaaatccaaagaagag
B D    C. remanei  TTCATcgt---tctc------------------------gtttcttttttaggagaaat---gagaatcg
B D   C. brenneri  TTCATtgtgactcg-------------------------gtttctttcagaaaagagcc---gagtatgt
B D  P. pacificus  ======================================================================
B D   C. japonica  ======================================================================

       C. elegans  gggc----cgaggatttgtg----------------tgtctttggatgacccctgtgaagc---------
      C. briggsae  gcagagatcgtggatttgtggataggggggtaggtttgtgtttggatggaccctggagattttatgaata
       C. remanei  ggggcgatcgaggatgtgtgtgttgg------tttttgtgtttggatggaccctggagat----------
      C. brenneri  gcgga---cgaggatgtgtgta----------ggtttgtgtttggatggaccctgttaaa----------
     P. pacificus  ======================================================================
      C. japonica  ======================================================================

       C. elegans  gataagaagttag----atattttgaaga
      C. briggsae  gagaagagtttag----------------
       C. remanei  gagaatggt--------atatgttgagga
      C. brenneri  gaaaatgactttacaatgcatttttaaaa
     P. pacificus  =============================
      C. japonica  =============================

Inserts between block 143 and 144 in window
B D  C. briggsae 843bp
B D   C. remanei 1585bp

Alignment block 144 of 150 in window, 14666881 - 14666981, 101 bps 
B D    C. elegans  tgaaaatggtaatggcgtgtttttgagaagttaagaaataacgtagtaaaacaatgaagaaatacttact
B D   C. brenneri  gaagaatgattgagaggaattcatgg------aagaaa---------aatattatgaaaaaatcctaacc
B D  P. pacificus  ======================================================================
B D    C. remanei  ======================================================================
B D   C. japonica  ======================================================================
B D   C. briggsae  ======================================================================

       C. elegans  aggg------------tctagaaaaaaatagagaaaattttca
      C. brenneri  agaaagtttgagttttttcggaatgggctatgaaaactattca
     P. pacificus  ===========================================
       C. remanei  ===========================================
      C. japonica  ===========================================
      C. briggsae  ===========================================

Inserts between block 144 and 145 in window
B D  C. brenneri 29bp

Alignment block 145 of 150 in window, 14666982 - 14666994, 13 bps 
B D    C. elegans  agtcactatccta
B D  P. pacificus  =============
B D   C. brenneri  =============
B D    C. remanei  =============
B D   C. japonica  =============
B D   C. briggsae  =============

Alignment block 146 of 150 in window, 14666995 - 14667031, 37 bps 
B D    C. elegans  ttgaaccagtaa--aaactgcaggcgacaacttgcggga
B D   C. brenneri  ttgaaccgatcattaagtttgaagagtaaacttccggaa
B D  P. pacificus  =======================================
B D    C. remanei  =======================================
B D   C. japonica  =======================================
B D   C. briggsae  =======================================

Inserts between block 146 and 147 in window
B D  C. brenneri 50bp

Alignment block 147 of 150 in window, 14667032 - 14667080, 49 bps 
B D    C. elegans  ccccacaccaagctagatcttgttcctgctccaatgtttctattctaag
B D  P. pacificus  =================================================
B D   C. brenneri  =================================================
B D    C. remanei  =================================================
B D   C. japonica  =================================================
B D   C. briggsae  =================================================

Alignment block 148 of 150 in window, 14667081 - 14667281, 201 bps 
B D    C. elegans  ataacaaaag-agcactagaa--ggggaacacata----------aaagtgcagaatggtgattcgacaa
B D   C. brenneri  ataatagaagcacccctaaaattgaaggacccctacaatagaaggacagtacataagggggtttgaaaaa
B D  P. pacificus  ======================================================================
B D    C. remanei  ======================================================================
B D   C. japonica  ======================================================================
B D   C. briggsae  ======================================================================

       C. elegans  ttaaagccgatgcctcaaaat-------------------------------tataaaatttgtgtgtgt
      C. brenneri  tagaag--gacaccctaaaatagaaggacactctttaatagagagacactcgcataggacttccacat--
     P. pacificus  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  gtctatgtgaagacaacatgatagttttatgaccttgggaggaggaaatgagaatggcagttcgcttagg
      C. brenneri  -tctatctgatgtca--gttacagcttt------tcgcaaggtgaaattcaaaaaagca-------tagg
     P. pacificus  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  ttttggcttgttagggggtttcaatttggaattga
      C. brenneri  ttttgagtcat------attttaagttgaaaatga
     P. pacificus  ===================================
       C. remanei  ===================================
      C. japonica  ===================================
      C. briggsae  ===================================

Alignment block 149 of 150 in window, 14667282 - 14667356, 75 bps 
B D    C. elegans  gataaaac-tagt-agagatacagaatatgaaaaaaaaactaaaagagatcagtgagagataggt-ctga
B D   C. brenneri  gagaaaacgtaatcaaaagcactgaa---aggaaagaaaatagatgagatcg--gagatactggtgattg
B D  P. pacificus  ======================================================================
B D    C. remanei  ======================================================================
B D   C. japonica  ======================================================================
B D   C. briggsae  ======================================================================

       C. elegans  gttttggg
      C. brenneri  gttttggg
     P. pacificus  ========
       C. remanei  ========
      C. japonica  ========
      C. briggsae  ========

Alignment block 150 of 150 in window, 14667357 - 14667746, 390 bps 
B D    C. elegans  agaaaattgggcgtac-tgtacttaattcaaagttcgagaggaggatacttttgagatgttgattgaaga
B D   C. brenneri  tgaaaattagaaggacatgtccttctattatagtttttacg--gtatagcctaaattagatgagcgagaa
B D  P. pacificus  ======================================================================
B D    C. remanei  ======================================================================
B D   C. japonica  ======================================================================
B D   C. briggsae  ======================================================================

       C. elegans  aaaaaaattctaaattaggtcgacaaaagtaaaaaaaaa--------gacaaggaaatgaaaatttaatt
      C. brenneri  atgaagat----ggctagtgcgacaa---taaacgaagatttttatgaccttggtcttgaagatggaatt
     P. pacificus  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  ttttcaacaacgagagaaatagactgcaaaccaagaagttc------tgatact---gtgcacgtaat--
      C. brenneri  tt------agtgaagaaaatgggcgttgaat--ggcagttcggtttgtaatattagagaaaacgtaatca
     P. pacificus  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  ----------------aaaaaattggtggctttgaaccaact----atcggtc-----------------
      C. brenneri  aaagcactgaaaggaaagaaaatagatgagatcggagatactggtgattggttttgggaaaaggaaatta
     P. pacificus  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  -----------taattct-----------------aagagaaaa-gctacaagatatttgaaaaattaaa
      C. brenneri  gagaaatacagtaattctggcatgaagaaaaaaaaaagagaaaagggtataacaaatat--agaattgaa
     P. pacificus  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  ataaatatttcaaaaaac-------caaaaccatttaa----ggttcctagccccctactcaactattca
      C. brenneri  gtaa-------aaaaaacttagtttcgaagatatcttacttgggttcccaa------agtcaaacataaa
     P. pacificus  ======================================================================
       C. remanei  ======================================================================
      C. japonica  ======================================================================
      C. briggsae  ======================================================================

       C. elegans  g-ccacaccccgggacatctgtccttcaagcaaaaaaaaaaattgagagaaaagaaaaaagaaatcac
      C. brenneri  gaccacaccctgagaaatctgtccttc------------------------aaaacaaacgaaaccac
     P. pacificus  ====================================================================
       C. remanei  ====================================================================
      C. japonica  ====================================================================
      C. briggsae  ====================================================================

View table schema

Go to Conservation track controls

Data last updated at UCSC: 2008-06-22


This track shows a measure of evolutionary conservation in C. elegans, C. remanei, C. briggsae, C. brenneri, C. japonica and P. pacificus based on a phylogenetic hidden Markov model, phastCons (Siepel et al., 2005). The multiple alignments were generated using multiz and other tools in the UCSC/Penn State Bioinformatics comparative genomics alignment pipeline. The conservation measurements were created using the phastCons package from Adam Siepel at Cold Spring Harbor Laboratory.

Multiz alignments of the following assemblies were used to generate this track:
OrganismSpeciesRelease date UCSC versionalignment typerepeats masked by
C. elegans (WS190)Caenorhabditis elegans May 2008 (WS190/ce6)ce6reference species repeat masker
C. remaneiCaenorhabditis remanei May 2007caeRem3chain net window masker
C. briggsaeCaenorhabditis briggsae Jan 2007cb3chain net repeat masker
C. brenneriCaenorhabditis brenneri Feb 2008caePb2chain net window masker
C. japonicaCaenorhabditis japonica Mar 2008caeJap1chain net window masker
P. pacificusPristionchus pacificus May 2007priPac1chain net window masker

Table 1. Genome assemblies included in the 9-way Conservation track.

Display Conventions and Configuration

In full and pack display modes, conservation scores are displayed as a "wiggle" (histogram), where the height reflects the size of the score. Pairwise alignments of each species to the C. elegans genome are displayed below as a grayscale density plot (in pack mode) or as a "wiggle" (in full mode) that indicates alignment quality. In dense display mode, conservation is shown in grayscale using darker values to indicate higher levels of overall conservation as scored by phastCons.

The conservation wiggle can be configured in a variety of ways to highlight different aspects of the displayed information. Click the Graph configuration help link for an explanation of the configuration options.

Checkboxes in the track configuration section allow excluding species from the pairwise display; however, this does not remove them from the conservation score display. To view detailed information about the alignments at a specific position, zoom in the display to 30,000 or fewer bases, then click on the alignment.

Gap Annotation

The "Display chains between alignments" configuration option enables display of gaps between alignment blocks in the pairwise alignments in a manner similar to the Chain track display. The following conventions are used:

  • Single line: No bases in the aligned species. Possibly due to a lineage-specific insertion between the aligned blocks in the C. elegans genome or a lineage-specific deletion between the aligned blocks in the aligning species.
  • Double line: Aligning species has one or more unalignable bases in the gap region. Possibly due to excessive evolutionary distance between species or independent indels in the region between the aligned blocks in both species.
  • Pale yellow coloring: Aligning species has Ns in the gap region. Reflects uncertainty in the relationship between the DNA of both species, due to lack of sequence in relevant portions of the aligning species.

Genomic Breaks

Discontinuities in the genomic context (chromosome, scaffold or region) of the aligned DNA in the aligning species are shown as follows:

  • Vertical blue bar: Represents a discontinuity that persists indefinitely on either side, e.g. a large region of DNA on either side of the bar comes from a different chromosome in the aligned species due to a large scale rearrangement.
  • Green square brackets: Enclose shorter alignments consisting of DNA from one genomic context in the aligned species nested inside a larger chain of alignments from a different genomic context. The alignment within the brackets may represent a short misalignment, a lineage-specific insertion of a transposon in the C. elegans genome that aligns to a paralogous copy somewhere else in the aligned species, or other similar occurrence.

Base Level

When zoomed-in to the base-level display, the track shows the base composition of each alignment. The numbers and symbols on the Gaps line indicate the lengths of gaps in the C. elegans sequence at those alignment positions relative to the longest non-C. elegans sequence. If there is sufficient space in the display, the size of the gap is shown; if not, and if the gap size is a multiple of 3, a "*" is displayed, otherwise "+" is shown.

Codon translation is available in base-level display mode if the displayed region is identified as a coding segment. To display this annotation, select the species for translation from the pull-down menu in the Codon Translation configuration section at the top of the page. Then, select one of the following modes:

  • No codon translation: The gene annotation is not used; the bases are displayed without translation.
  • Use default species reading frames for translation: The annotations from the genome displayed in the Default species to establish reading frame pull-down menu are used to translate all the aligned species present in the alignment.
  • Use reading frames for species if available, otherwise no translation: Codon translation is performed only for those species where the region is annotated as protein coding.
  • Use reading frames for species if available, otherwise use default species: Codon translation is done on those species that are annotated as being protein coding over the aligned region using species-specific annotation; the remaining species are translated using the default species annotation.

Codon translation uses the following gene tracks as the basis for translation, depending on the species chosen:

Gene TrackSpecies
Worm Base Genes (Sanger Genes)C. elegans
C. elegans mapped GenesC. remanei
C. elegans mapped GenesC. briggsae
C. elegans mapped GenesC. brenneri
C. elegans mapped GenesC. japonica
C. elegans mapped GenesP. pacificus


Pairwise alignments with the C. elegans genome were generated for each species using blastz from repeat-masked or window-masker masked genomic sequence. Pairwise alignments were then linked into chains using a dynamic programming algorithm that finds maximally scoring chains of gapless subsections of the alignments organized in a kd-tree. The scoring matrix and parameters for pairwise alignment and chaining were tuned for each species based on phylogenetic distance from the reference. High-scoring chains were then placed along the genome, with gaps filled by lower-scoring chains, to produce an alignment net. For more information about the chaining and netting process and parameters for each species, see the description pages for the Chain and Net tracks.

The resulting best-in-genome pairwise alignments were progressively aligned using multiz/autoMZ, following the tree topology diagrammed above, to produce multiple alignments. The multiple alignments were post-processed to add annotations indicating alignment gaps, genomic breaks, and base quality of the component sequences. The annotated multiple alignments, in MAF format, are available for bulk download. An alignment summary table containing an entry for each alignment block in each species was generated to improve track display performance at large scales. Framing tables were constructed to enable visualization of codons in the multiple alignment display.

Conservation scoring was performed using the PhastCons package (A. Siepel), which computes conservation based on a two-state phylogenetic hidden Markov model (HMM). PhastCons measurements rely on a tree model containing the tree topology, branch lengths representing evolutionary distance at neutrally evolving sites, the background distribution of nucleotides, and a substitution rate matrix. The 6-way conserved tree model and 6-way non-conserved tree model for this track was constructed from the information in Kiontke et. al. (2005) with the branch length for P. pacificus arbitrarily set manually for the phastCons starting-tree model. The branch lengths in the conserved and non-conserved tree models were produced by the phastCons tuning steps using phyloBoot. The phastCons parameters used for the conservation measurement were: expected-length=15 and target-coverage=0.55

The phastCons program computes conservation scores based on a phylo-HMM, a type of probabilistic model that describes both the process of DNA substitution at each site in a genome and the way this process changes from one site to the next (Felsenstein and Churchill 1996, Yang 1995, Siepel and Haussler 2005). PhastCons uses a two-state phylo-HMM, with a state for conserved regions and a state for non-conserved regions. The value plotted at each site is the posterior probability that the corresponding alignment column was "generated" by the conserved state of the phylo-HMM. These scores reflect the phylogeny (including branch lengths) of the species in question, a continuous-time Markov model of the nucleotide substitution process, and a tendency for conservation levels to be autocorrelated along the genome (i.e., to be similar at adjacent sites). The general reversible (REV) substitution model was used. Note that, unlike many conservation-scoring programs, phastCons does not rely on a sliding window of fixed size, so short highly-conserved regions and long moderately conserved regions can both obtain high scores. More information about phastCons can be found in Siepel et al. (2005).

PhastCons currently treats alignment gaps as missing data, which sometimes has the effect of producing undesirably high conservation scores in gappy regions of the alignment. We are looking at several possible ways of improving the handling of alignment gaps.


This track was created at UCSC using the following programs:

  • Alignment tools: blastz and multiz by Minmei Hou, Scott Schwartz and Webb Miller of the Penn State Bioinformatics Group
  • Chaining and Netting: axtChain, chainNet by Jim Kent at UCSC
  • Conservation scoring: PhastCons, phyloFit, tree_doctor, msa_view by Adam Siepel while at UCSC, now at Cold Spring Harbor Laboratory
  • MAF Annotation tools: mafAddIRows by Brian Raney, UCSC; mafAddQRows by Richard Burhans, Penn State; genePredToMafFrames by Mark Diekhans, UCSC
  • Tree image generator: phyloPng by Galt Barber, UCSC
  • Conservation track display: Kate Rosenbloom, Hiram Clawson (wiggle display), and Brian Raney (gap annotation and codon framing) at UCSC

The phylogenetic tree is based on Kiontke and Fitch (2005).



Felsenstein J, Churchill GA. A Hidden Markov Model approach to variation among sites in rate of evolution. Mol Biol Evol. 1996 Jan;13(1):93-104. PMID: 8583911

Siepel A, Bejerano G, Pedersen JS, Hinrichs AS, Hou M, Rosenbloom K, Clawson H, Spieth J, Hillier LW, Richards S, et al. Evolutionarily conserved elements in vertebrate, insect, worm, and yeast genomes. Genome Res. 2005 Aug;15(8):1034-50. PMID: 16024819; PMC: PMC1182216

Siepel A, Haussler D. Phylogenetic Hidden Markov Models. In: Nielsen R, editor. Statistical Methods in Molecular Evolution. New York: Springer; 2005. pp. 325-351.

Yang Z. A space-time process model for the evolution of DNA sequences. Genetics. 1995 Feb;139(2):993-1005. PMID: 7713447; PMC: PMC1206396


Kent WJ, Baertsch R, Hinrichs A, Miller W, Haussler D. Evolution's cauldron: duplication, deletion, and rearrangement in the mouse and human genomes. Proc Natl Acad Sci U S A. 2003 Sep 30;100(20):11484-9. PMID: 14500911; PMC: PMC208784


Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, Green ED, et al. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res. 2004 Apr;14(4):708-15. PMID: 15060014; PMC: PMC383317

Harris RS. Improved pairwise alignment of genomic DNA. Ph.D. Thesis. Pennsylvania State University, USA. 2007.


Chiaromonte F, Yap VB, Miller W. Scoring pairwise genomic sequence alignments. Pac Symp Biocomput. 2002;:115-26.c Symp Biocomput. 2002:115-26. PMID: 11928468

Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W. Human-mouse alignments with BLASTZ. Genome Res. 2003 Jan;13(1):103-7. PMID: 12529312; PMC: PMC430961

Phylogenetic Tree:

Kiontke K, Fitch DH. The phylogenetic relationships of Caenorhabditis and other rhabditids. WormBook. 2005 Aug 11:1-11. PMID: 18050394