12 Flies, Mosquito, Honeybee, Beetle Multiz Alignments & phastCons Scores
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 217 in window, 826001 - 826396, 396 bps 
B D   D. melanogaster  cgacgtgaaagaaacggctc-cggca--aaatcattaaaatttaat--tagttaaccgcaagagagcgct
B D       D. simulans  ======================================================================
B D      D. sechellia  cgacgtgaaagaaacggctc-cggcg--aaatcattaaattttaat--tagttaaccgcaagggagcgct
B D         D. yakuba  cgacgtgaaagaaacggctc-cggtg--aaatcattaaaatttaat--tagttaaccgcaagggattgct
            D. erecta  cgacgtgaaagaaacggctc-cggcg--aaatcattaaaatttaat--tagttaaccgcaagggagcgct
         D. ananassae  agacg----gaagacggctc-cggcg--aaatcgtcaaggattaa-------gaaccg------------
     D. pseudoobscura  cgacgtacaaaaaacggctcgctgcggtaaatcattaaaaattaat--taataattcgcgaatcagtgct
B D     D. persimilis  cgacgtacaaaaaacggctcgctgcggtaaatcattaaaaattaat--taataattcgcgaatcagtgct
       D. willistoni  ======================================================================
           D. virilis  cgacg---aagaagtggctc-cggta--aaattgcctaaaa-ttat--taatcaaacgcgaaataattct
        D. mojavensis  cgacg---aagaagtagctc-cggta--aaattgataaaaa-gagt--tgttcgaccgcgaaataattct
         D. grimshawi  cgacg---aagaagttgctc-cggta--gaattgttaagaa-aagtgataatcaaacgcggattattgct
        A. mellifera  ======================================================================

      D. melanogaster  gcaaaattgtgcaaaca-atttgccacttaacgcagttaacgtgtg------cggtaatcagaagcgtgg
          D. simulans  ======================================================================
         D. sechellia  gcaaaattgtgcaaaca-atttgccacttaacgcagttaacgtgtg------cggtaatcagaagcgtgg
            D. yakuba  gcaaaattgtgcaaaca-atttgccactaaacgtagttaacgtgtg------cggtgatcagaagcgtta
            D. erecta  gcaaaattgtgcaaaca-atttgccacttaacgtagttaacgtgtg------cggtgatcagaagcgtgg
         D. ananassae  ---gaatcgtaaaaagt-attaaccagcc--cgctggcaccgcg---------------cagagcc--cg
     D. pseudoobscura  tcaaaagtgtttaatag-tctcaataattgcactaattatcgtgtgcattgtcggtgttaag------ta
        D. persimilis  tcaaaagtgtttaatag-tctcaataattgcactaattatcgtgtgcattgtcggtgttaag------ta
        D. willistoni  ======================================================================
           D. virilis  tagaaattgttgaattgcatacattgaatgtaacgtagtgcggttg------cgtcattaacagcaaacg
        D. mojavensis  tagaaattattgaattgcattcattaaatacctcgaagtacggttg------cgtcattaacgataaacg
         D. grimshawi  tcaaaagttattaaatgcattaattaaatgcacaaaagtgcgctgg------cgtcctaagtaacacacg
         A. mellifera  ======================================================================

      D. melanogaster  aaaagcgttt-atttgtcaggatttg-----------tgtg---tttttcaatcgcggcagcagcata--
          D. simulans  ======================================================================
         D. sechellia  taaagcgttt-atttgccaggatttg-----------tgtg---tttttcaatcgcggcagcagcata--
            D. yakuba  aaaagcgttt-atttgcgaagatttg-----------tgtg---tttttcaatcgcggcagcagcata--
            D. erecta  aaaagcgttt-atttgccaggatttg-----------tgtg---tttttcaatcgcggcagcagcata--
         D. ananassae  aaaagagtcg-agtgccccgaggccg-----------tgtgtcattttccattccggattgcagcatt--
     D. pseudoobscura  aaaagtgttgaattagtttgctttcg-----------tgtg---tttttcgaccgccttagcagcata--
        D. persimilis  aaaactgttgaattagtttgctctcg-----------tgtg---tttttcgaccgcctcagcagcata--
        D. willistoni  ======================================================================
           D. virilis  aaaagtgtc--aaatacaagcataaa-----------agtg---attttcaacgg-gccagcgcatta--
        D. mojavensis  aaaagtgttg-aaaaaaaaacataaacgtctgtacccagtg---attttcgactg-cccaacataatata
         D. grimshawi  aaaagtgtca-aaagtgaaaagtaaaagtttgagccgactg---attttcaactg-gccagcataata--
         A. mellifera  ======================================================================

      D. melanogaster  --------------tgtacacac-------acacaggctcacccccg-----ccc---------------
          D. simulans  ======================================================================
         D. sechellia  --------------tgtacacac-------acacacgctcacccccg-----ccc---------------
            D. yakuba  --------------tgtacacac-------acacacgctcacccccg-----ccc---------------
            D. erecta  --------------tgtacacac-------acacacgctcacccccg-----ccc---------------
         D. ananassae  --------------ggtacgtgca------acccgtgcacacacacg-----cac---------------
     D. pseudoobscura  --------------tgtacatacaatacacacacaagcacacacaca-----catatcatacataaaggc
        D. persimilis  --------------tgtacatacaatacacacacaagcacacacacacacatcatatcatacataaaggc
        D. willistoni  ======================================================================
           D. virilis  --------------tatatatac-------acat------acagacg-----------------------
        D. mojavensis  tatagatatataagtatatatat-------acat------acatacg-----------------------
         D. grimshawi  --------------tatatatac-------acac----------act-----------------------
         A. mellifera  ======================================================================

      D. melanogaster  -----cactcacacacacaca------ctcacgcctagg-----------tgtatta-----------ta
          D. simulans  ======================================================================
         D. sechellia  -----cactcacacaaacaca------ctcacagctagg-----------tgtatta-----------ta
            D. yakuba  -----cactcacacacacaca------ctaacggctagg-----------tgtatta-----------ta
            D. erecta  -----cactcacacacacaca------ctaacggctagg-----------tgtatta-----------ta
         D. ananassae  -----ctccgacacacacata-------------ctagg-----------tgcgttgtgcggagtattta
     D. pseudoobscura  ttacatacatacatacatacatatgttcgcacatcggag-----------agtatta-----------ta
        D. persimilis  t----tacatacatacatacatatgttcgcacatcggag-----------agtatta-----------ta
        D. willistoni  ======================================================================
           D. virilis  -----aacagatgtatacata-----atgtacatttaatgcat---tattaatatta-----------tt
        D. mojavensis  -----aacagatgtacacata-----atgtacacttaa------------agtaata-----------tt
         D. grimshawi  -----aacagatgtacacata-----atgtacatttaaagtattagtattattatta-----------tt
         A. mellifera  ======================================================================

      D. melanogaster  attaaagtt----gtgttttaagtgtgtgtaaagtg-------caatagccca------------gtgga
          D. simulans  ======================================================================
         D. sechellia  attaaagtt----gtgttttaagtgtgtgtaaagtg-------caatagccca------------gtgga
            D. yakuba  attaaagtt----gtgtttcaagtgtgtgtaaagtg-------caatagccca------------gtgga
            D. erecta  attaaagtt----gtgttttaagtgtgtgtaaagtg-------caatagccca------------gtgga
         D. ananassae  attataatttcgagtgtgcagagtgtgtgtaaagtg-------caatagcctg------------gc-ga
     D. pseudoobscura  attataatc---------------gtgtgtaaagtg-------caataccctggattacattggtgctgc
        D. persimilis  attataatc---------------gtgtgtaaagtg-------caataccctggattacattggtgctgc
        D. willistoni  ======================================================================
           D. virilis  agtatagtg------------aacgtatgttaagtg------acaaaatagag-----------tttggc
        D. mojavensis  attacagtg------------aacgagtgttaagtg------caaatatagtg-----------tgtggc
         D. grimshawi  atcattgtg------------agagtgtgtgaagagtgcaatacaaaaatttg-----------gttggc
         A. mellifera  ======================================================================

      D. melanogaster  aagtggaagtgatatagagtgc----------gttccaggagt---tccaggagcagtg----tcttatc
          D. simulans  ======================================================================
         D. sechellia  aagtggaagtgaaatagagtgc-------------------gt---tccaggagcagtg----tcttagc
            D. yakuba  aagtggaagtgaaatagagtgc----------gttccaggagt---tccaggagcagtg----tcttagc
            D. erecta  aagtggaagtgaaatagagtgc----------gttccaggagt---tccaggagcagtg----tcttagc
         D. ananassae  aagcaggagccagaga-------------------ctggcagt---gtgaagtgcagtg-------cggg
     D. pseudoobscura  aagtacaagtgcaa----gtgc---------agctgccggagc---cgcaaggaaag---------aaag
        D. persimilis  aagtacaagtgcaa----gtgc---------agctgccggagc---cgctaggaaag---------aaag
        D. willistoni  ======================================================================
           D. virilis  aagcgcc--tgcaaaacatttg---aatatcattcgc---agt-taagtgaagaaagtgca-tttttata
        D. mojavensis  aggcgcc--tgaaaaagattgg------aatattgttcggagt-tcagtgaagaaagtg-----------
         D. grimshawi  aaacgcc--t-aaaaacatttggcaaaaaatcttgttcgcagtaaaagtgaagaaagtgcattttttata
         A. mellifera  ======================================================================

      D. melanogaster  ccatgtct----tccactcccaaatcctga--ggat-tgc------caagggttaagaccg-a
          D. simulans  ===============================================================
         D. sechellia  ccatgtct----tccactcccaaatcctga--ggat-tgc------caagggttaagaccg-a
            D. yakuba  ccacgtct----tcccgacccaaatcctga--ggat-tgc------caagggttaaggctc-a
            D. erecta  ccatgtct----tcctgtcccaaatcctga--ggat-tgc------taagggttaaggctg-a
         D. ananassae  gcgaatcc----tcctccatccaacctgggctgggc-cgctggctacaaggcataaggact-c
     D. pseudoobscura  tgaagtct------ctaccgccgatgccga--cga-----------aaggggctggggccg-c
        D. persimilis  tgaagtct------ctaccgccgatgccga--cga-----------aaggggctggggccg-c
        D. willistoni  ===============================================================
           D. virilis  tggtccct-----------------tctgc--tgctgcac------aaagggctggggccg--
        D. mojavensis  -------catttttatatggtcgcttctgc--tgctgcac------aaagggctggggccg--
         D. grimshawi  tggtcgct-----------gctgccgctgc--tgctgcac------aaagggctggggccgt-
         A. mellifera  ===============================================================

Inserts between block 1 and 2 in window
        D. grimshawi 76bp

Alignment block 2 of 217 in window, 826397 - 826497, 101 bps 
B D   D. melanogaster  gaaatacggactccg-------actt---tccggataaggatacggata---cggataaggagtgccagg
B D       D. simulans  ======================================================================
B D      D. sechellia  gaaatactgactccg-------actt---cccggataaggatacggata---cggataaggagtgccagg
B D         D. yakuba  gaaatacggtctcgg-------actt---tccggataaggatacggata---cggataaggagtgccagg
            D. erecta  gaaatacggtctagg-------actt---cccggataaggatacggata---cggataaggagtgccagg
         D. ananassae  ggcataaggactccacacagccacataggctcggatagggacaccgataaggcgagcaaggagtgccagg
     D. pseudoobscura  tggttgctg--ctag-------gcgc---accgcacacagacg-gaata---cacggaatcaggaacaag
B D     D. persimilis  tggttgctg--ctag-------gcgc---accgcacacagacg-gaata---cacggaatcaggaacaag
       D. willistoni  ======================================================================
           D. virilis  ----------------------------------------------------------------------
        D. mojavensis  ----------------------------------------------------------------------
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================

      D. melanogaster  ataaggagatccaggaggaatataggagttgccagt-------------ccaaccg--------------
          D. simulans  ======================================================================
         D. sechellia  ataagaagatccaggaggaatataggagttgccagt-------------ccaaccg--------------
            D. yakuba  ataaggagatccaggaggaatataggagttgccagt-------------ccaaccg--------------
            D. erecta  ataaggagatccaggaggaatataggagttgccagt-------------ccaaccg--------------
         D. ananassae  ------agactcggcagga--ataggagttgccacc-------------gcagtcg--------------
     D. pseudoobscura  acaagga--------------ataggagttgccgttggttgccgctcccgcagccgtgccccgttgtcat
        D. persimilis  acaagga--------------ataggagttgccgttggttgccgctcccgcagccgtgccccgttgtcat
        D. willistoni  ======================================================================
           D. virilis  -----------ttggctgctgctaggagttgccgtc-------------gtcatcg----ccgtcgtcgt
        D. mojavensis  -----------ttggctgctgctaggagttgccgtc-------------gtcatcg----c---agtcgc
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  ------------------c
          D. simulans  ===================
         D. sechellia  ------------------c
            D. yakuba  ------------------c
            D. erecta  ------------------c
         D. ananassae  ------------------c
     D. pseudoobscura  cgtctccatcgaatctctc
        D. persimilis  cgtctccatcgaatctctc
        D. willistoni  ===================
           D. virilis  cgtcgtcgtcg-------c
        D. mojavensis  cgtcgcagtcg-------c
         D. grimshawi  ===================
         A. mellifera  ===================

Inserts between block 2 and 3 in window
        D. ananassae 7bp
          D. virilis 11bp
       D. mojavensis 11bp

Alignment block 3 of 217 in window, 826498 - 826618, 121 bps 
B D   D. melanogaster  ttcgtctccggtaggtacacacaaaatattcggctgctcctttttagctcctgttcga------------
B D       D. simulans  ======================================================================
B D      D. sechellia  ttcgtctccggtaggtacacacaaaatattcggctgctcctttttagctcctgttcga------------
B D         D. yakuba  ttcgtctccggtaggtacacacaaaatattcggctgctcc-ttttagctcctgttcga------------
            D. erecta  ttcgtctccggtaggtacacacaaaatattcggctgctcctttttagctcctgttcga------------
         D. ananassae  gtcgtctccggtaggtacacacaaaatattcggctgctcc-tttcagctcctgtttggcctctctc--tc
     D. pseudoobscura  gtcgtctccggtaggtacacacaaaatattcggctgctcc-ttttagctcctgttttgtgtctctg----
B D     D. persimilis  gtcgtctccggtaggtacacacaaaatattcggctgctcc-ttttagctcctgttttgtgtctctg-ctc
       D. willistoni  ======================================================================
           D. virilis  gtcgtctccggtaggtacacacaaaatatacggctgctcctgtttagctcctgttttgtgtctcgctcat
        D. mojavensis  gtcgtctccggtaggtacacacaaaatatactgctgctcctgtttagctcctgtttcttgtctcgctctc
         D. grimshawi  ttcgtctccggtaggtacacacaaaatatacggctgctcctgtttagctcctgttatgtgtctcgctctc
        A. mellifera  ======================================================================

      D. melanogaster  -atctctcacggctc-------------------tctctctc--ggctctctc-tctctctctcttgacc
          D. simulans  ======================================================================
         D. sechellia  -atctctctcggct--------------------------------ctctctc-tctctctctcttgacc
            D. yakuba  -atctctctcggct------------------------------------ctc-tctccctctcttgacc
            D. erecta  -atctctctcggct------------------------------------ctc-tctccctctcttgacc
         D. ananassae  tctctctctctgtgtg------------------tgtctgtc-ttgctctctc-tgtcgcgccctgttcg
     D. pseudoobscura  -ctctctctc------------------------tctcacttagtggtctctcgtctctatctctctgtc
        D. persimilis  tctctctctc------------------------tctcacttagtggtctctcgtctctatctctcggtc
        D. willistoni  ======================================================================
           D. virilis  gcttactcgtgtgctccgt---------------gctccgtgctcattcactc-tccctctctct-----
        D. mojavensis  acacgttcgcgttctccgtctccatctctctctatctctgtccttttttgctc-tctctctctct-----
         D. grimshawi  tctctctctctgtctctgt---------------gtgtttctatctattactc-gcgctctcact-----
         A. mellifera  ======================================================================

      D. melanogaster  ------tgcgctctctctcttt
          D. simulans  ======================
         D. sechellia  ------tgcg--ctctctcttt
            D. yakuba  ------tgcg--ctctctctgt
            D. erecta  ------tgcgctctctctctgt
         D. ananassae  ------tgcg--ctctctctct
     D. pseudoobscura  ------tg-------tctttgc
        D. persimilis  ggtctttgca-tcgctctctct
        D. willistoni  ======================
           D. virilis  ----------------------
        D. mojavensis  ----------------------
         D. grimshawi  ----------------------
         A. mellifera  ======================

Inserts between block 3 and 4 in window
          D. virilis 4bp
       D. mojavensis 2739bp
        D. grimshawi 9bp

Alignment block 4 of 217 in window, 826619 - 826706, 88 bps 
B D   D. melanogaster  atctcgccc----tcgtc----acctggtggtgcgtagtcctttggctcggt-----ccaccaccc--gc
B D       D. simulans  ======================================================================
B D      D. sechellia  ctctcgccc----tcgtc----acctggtggtgcgtagtcctttggctcggt-----ccaccaccc--tc
B D         D. yakuba  ctcccgccc----tcgtc----acctgggggtgcggagtcctttggttcggt-----ccaccaccc--tc
            D. erecta  ctctcgccc----tcgtc----acctggtggtgttgagtcctttggttcggt-----ccaccaccc--tc
         D. ananassae  ctctcgctcctggccacc----acctggtggtgcaaaggcctcgg--tggg-------------------
     D. pseudoobscura  atcgctctc----tctct------------------------------cgcg-----ccctcactc---g
B D     D. persimilis  ctcgcgccc----tcact---ggcctgctgacagaaatccattcaatccgct-----ctctctctctttg
       D. willistoni  ======================================================================
           D. virilis  --ctggctc----tctcttaaaaatcgctcgtatttgttat----gtttggttatactattctccc----
       D. mojavensis  ======================================================================
         D. grimshawi  ttctcgctc----tctc------atttgttatgtttggtttttagtcagttg------------------
        A. mellifera  ======================================================================

      D. melanogaster  ccagtgggcg------gtgctgcaacccttagccctccg
          D. simulans  =======================================
         D. sechellia  ccagtgggcg------gtgctgcaacccttagccctccg
            D. yakuba  ccagtgggcg------gtgctgcaacccttagccctccg
            D. erecta  ccagtgggcg------gtgcagcaacccttaaccctccg
         D. ananassae  cgggtgggcgccccgtgtcctgcaacccttagcc-----
     D. pseudoobscura  cctgc------------tgactgaaatccattcaatccg
        D. persimilis  cctgtgtgtt------gtgtttgaaggctctctcctccg
        D. willistoni  =======================================
           D. virilis  ---------------------------------------
        D. mojavensis  =======================================
         D. grimshawi  ---------------------------------------
         A. mellifera  =======================================

Inserts between block 4 and 5 in window
B D    D. persimilis 949bp
          D. virilis 270bp
        D. grimshawi 5150bp

Alignment block 5 of 217 in window, 826707 - 826778, 72 bps 
B D   D. melanogaster  ctttccatcacctttttttgggtaaccatggtcgtgtttac-ggcaaactgtgccaccgatatatatgtg
B D       D. simulans  ======================================================================
B D      D. sechellia  cttctcatcaccattttttgggtaaccatggtcgtgtttac-ggctaactgtggcaccgatatatatgta
B D         D. yakuba  cttcccatcacctttttttgggtaaccatggtcgtgtttac-ggctaactgtgccaccgaagtgccagtg
            D. erecta  cttcccatcacctttttttgggtaaccatggtcgtgtttac-ggctaactgtgccaccgaaatgccagtg
         D. ananassae  ---gccgtcac--tttttcgggtaaccatggtcgtgttgac-ggctaactgtgccatcctggcacttgga
     D. pseudoobscura  -ctctctctctctttgcctgtgt-------gttgtgtttgcttgctctctcctccgtcagcac-ctggtg
B D     D. persimilis  ======================================================================
       D. willistoni  ======================================================================
           D. virilis  --ccttgtctcgcagtttttggtaaccatggtcgtcgccat-gcacaccgcccgcggctatatatgtgtg
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================

      D. melanogaster  tg-----------------------t
          D. simulans  ==========================
         D. sechellia  tg------------------------
            D. yakuba  ttgcagagctcct---------agca
            D. erecta  ttgcagagctcccaaattgcagagct
         D. ananassae  tt--------------------gtga
     D. pseudoobscura  gt--------------------gcgt
        D. persimilis  ==========================
        D. willistoni  ==========================
           D. virilis  t-------------------------
        D. mojavensis  ==========================
         D. grimshawi  ==========================
         A. mellifera  ==========================

Inserts between block 5 and 6 in window
          D. virilis 4413bp

Alignment block 6 of 217 in window, 826779 - 826807, 29 bps 
B D   D. melanogaster  acatatgtacc----ctttcccttgtctagata
B D       D. simulans  =================================
B D      D. sechellia  ---aatgcacc----atttcccttgtctagatg
B D         D. yakuba  aaagatgtacc-----ttttccttgtctagat-
            D. erecta  aaataagtacc----tttttccttgtccagatg
         D. ananassae  aataatcctgc----catcccgctatcgagcca
     D. pseudoobscura  acgcatttaccgctgctctccctcg--------
B D     D. persimilis  =================================
       D. willistoni  =================================
          D. virilis  =================================
       D. mojavensis  =================================
        D. grimshawi  =================================
        A. mellifera  =================================

Inserts between block 6 and 7 in window
        D. ananassae 43bp
    D. pseudoobscura 987bp

Alignment block 7 of 217 in window, 826808 - 826950, 143 bps 
B D   D. melanogaster  gat-----------------------gaaacagataaatcgtgaagat-----------------gcttc
B D       D. simulans  ======================================================================
B D      D. sechellia  gat-----------------------gtaacagataaatcgcgaagat-----------------gcttc
B D         D. yakuba  ggtaggattcgtcttgaatgaaccaagaaattgattaaatacaaacaagtctttaaatattaatagtttg
            D. erecta  ggttggattcgtcttgaatgaacatggaaatagattaaacataaaaatgtcgttaaatatgagtagttt-
        D. ananassae  ======================================================================
    D. pseudoobscura  ======================================================================
B D     D. persimilis  ======================================================================
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================

      D. melanogaster  acttaccataaatctat----aatatgttcattgctcaaatactactatagtaggtact--tgtgttttt
          D. simulans  ======================================================================
         D. sechellia  acttaccatagatctat--aaaatatgttccttgctccaatactaatatagtagg-----------tcga
            D. yakuba  gcttaccgtaaatagatttaaaatcaggttgttactcaaagaatactacaataggtacttgtgtaccttg
            D. erecta  -------gtagttagatctaaaattagggcgttactcaaatacctctataataggtact--tgtattttt
         D. ananassae  ======================================================================
     D. pseudoobscura  ======================================================================
        D. persimilis  ======================================================================
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  caaaagcctgtgccaggtacaaaagcttgtactcttaacaacactggga
          D. simulans  =================================================
         D. sechellia  aaataacctgtcccaggtacaaaagcttgtactcttaacaacactggga
            D. yakuba  tgtaagcctatctgaggtacaaaagctggtactcttaccaacactggcc
            D. erecta  caaaagcctatcccaggtacaagagctggtactcttatcaacactggcc
         D. ananassae  =================================================
     D. pseudoobscura  =================================================
        D. persimilis  =================================================
        D. willistoni  =================================================
           D. virilis  =================================================
        D. mojavensis  =================================================
         D. grimshawi  =================================================
         A. mellifera  =================================================

Alignment block 8 of 217 in window, 826951 - 826984, 34 bps 
B D   D. melanogaster  acgagtcctgccatcctttgcaggacgagaagtc
B D       D. simulans  ==================================
B D      D. sechellia  acga--------atcctttgcaggacgagaagtc
B D         D. yakuba  acgag--------tcctttgcaggatgagaagtt
            D. erecta  tcgagtcctgccatcctttgcaggacgagaagtc
        D. ananassae  ==================================
     D. pseudoobscura  accaaaccaaccaccgctcacagaatgcgcagc-
B D     D. persimilis  ==================================
       D. willistoni  ==================================
          D. virilis  ==================================
       D. mojavensis  ==================================
        D. grimshawi  ==================================
        A. mellifera  ==================================

Alignment block 9 of 217 in window, 826985 - 827072, 88 bps 
B D   D. melanogaster  caccctctcgctgccaaaaagccaccacctcgcagagattttgcgcag-catctctaaa-------cgaa
B D       D. simulans  ======================================================================
B D      D. sechellia  caccctctcgttgccaaaaagccaccacctcgcagagattttgcgcag-catctctgaa-------cgaa
B D         D. yakuba  caccctctcgctgccaaaaagccaccacctcgcagagattttgcgcag-caactcttta-------ggaa
            D. erecta  caccctctcgctgccaaaaagccaccacctcgctgagattttgcgcag-catctctgaa-------cgaa
         D. ananassae  catcctcctgcggcaaagccaccaccacctcctgcagattttgcgcag-cagctctatgcagctctcgcg
     D. pseudoobscura  agctctccggctctcatg----------ctctcagatattccgtgcatccatccctaca-----------
B D     D. persimilis  ======================================================================
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================

      D. melanogaster  acggccggcaaatgtcgcaaactccc
          D. simulans  ==========================
         D. sechellia  acggccggcaaatgtcgcaaactccc
            D. yakuba  acggccggcaaatgtcacaaactccc
            D. erecta  acggccggcaaatgtcacaaactccc
         D. ananassae  actctgggcacg-gccacagactccc
     D. pseudoobscura  gccacagacaca-ggcacagtccata
        D. persimilis  ==========================
        D. willistoni  ==========================
           D. virilis  ==========================
        D. mojavensis  ==========================
         D. grimshawi  ==========================
         A. mellifera  ==========================

Alignment block 10 of 217 in window, 827073 - 827145, 73 bps 
B D   D. melanogaster  tcggcaaca--aaagccaaaaaaaaaa--------tacaaaatacaaaaaac---------aaaaccgaa
B D       D. simulans  ======================================================================
B D      D. sechellia  tcggcaaca--aaagccaga------------------aaaatacaaaaaac---------aaaaccgaa
B D         D. yakuba  tcggcaaca--aaagcgag-------------------aaaatacaaaaaac---------aaaaccgaa
            D. erecta  tcggcaaca--aaagccag-------------------aaagtacaaaaaac---------aaaaccgaa
         D. ananassae  ccggcaacactacaacaacatcatcaa--------caacaacaacaacaaacacggagtggagaattaaa
     D. pseudoobscura  gccacagcc--atggccact------------------cggcaacagccaat---------actcccaaa
B D     D. persimilis  ======================================================================
        D. willistoni  tcagccaga--gaagaaacaaaaaggagttggcaccgaaaaaagcaaaaaaa---------aaaaccaaa
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
         D. grimshawi  -------ca--aaggcagcaaaaagaaaat--------aaaatacaaaaagc---------aaa---gaa
        A. mellifera  ======================================================================

      D. melanogaster  ac--------cgaaacccc---attcgaatccc
          D. simulans  =================================
         D. sechellia  ac--------cgaaacccc---attcgaatccc
            D. yakuba  actgaaa--ccgaaacccc---attcaaatccc
            D. erecta  aacgaaa---cgaaacccc---attcgaatccc
         D. ananassae  aattaaaaaaaaaaagcca---atacaaatccc
     D. pseudoobscura  at--------cgagtcccg---at-----cccc
        D. persimilis  =================================
        D. willistoni  aa--------cgaaacttt---catcgactctc
           D. virilis  =================================
        D. mojavensis  =================================
         D. grimshawi  ct--------cgagagcttgagatttgagtc--
         A. mellifera  =================================

Inserts between block 10 and 11 in window
       D. willistoni 2433bp
        D. grimshawi 4316bp

Alignment block 11 of 217 in window, 827146 - 827190, 45 bps 
B D   D. melanogaster  attccccagcaaaagcatctacttaatcaacccgggcgggagtgg
B D       D. simulans  =============================================
B D      D. sechellia  attccccagcaaaagcatctacttaatcaact----cgggagtag
B D         D. yakuba  attccccagcaaaagcatctacttaatcaactc---cgggagtaa
            D. erecta  attccccagcaaatgcatctacttaatcaact----cgggagtaa
         D. ananassae  attccc---------------cttaatcaact----cgaaatgaa
     D. pseudoobscura  aatcctccgtacaaacaaatgcttaatcaact----ctcg-----
B D     D. persimilis  =============================================
       D. willistoni  =============================================
          D. virilis  =============================================
       D. mojavensis  =============================================
        D. grimshawi  =============================================
        A. mellifera  =============================================

Inserts between block 11 and 12 in window
        D. ananassae 2bp

Alignment block 12 of 217 in window, 827191 - 827339, 149 bps 
B D   D. melanogaster  actcccagctccctgaa-------tgagtgatcttatgtaaaca--------------------------
B D       D. simulans  aatcccgtttccccgaaactcaggtgggctatcgtttgtagacg--------------------------
B D      D. sechellia  actcccagccccctgaa-------tgagtgatcttatgtaaaca--------------------------
B D         D. yakuba  acttttagcccacagaa-------tgagtgatcttatgtaaaca--------------------------
            D. erecta  actttcagcccgctgaa-------tgagtgatcttatgtaaaca--------------------------
         D. ananassae  --tcctcggccgcagaa-------tgagtgatcttatgtaaaca--------------------------
     D. pseudoobscura  aat----gcccacataa-------tgaatgatcttatataaacattgcggatgggcttcctctgacatcg
B D     D. persimilis  ======================================================================
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================

      D. melanogaster  --------ggctg-----------------ccctttgcctcc-------cacgccccgag----------
          D. simulans  --------ggatg-----------------tacattgcctca-------cagcctcgcag----------
         D. sechellia  --------ggctg-----------------ccctttgcctcc-------cacgccccgag----------
            D. yakuba  --------ggctg-----------------ccctttgcctcccacgccacacgccccaag----------
            D. erecta  --------ggctg-----------------ccctttgcctcc-------cacgccccaag----------
         D. ananassae  --------ggccg--tactgctgggatgccctctccgcctcc-------cacgacac-------------
     D. pseudoobscura  gcttctgtggctggctgctgctg-------ccctttgcctcg-------cgcgacaccagataacactgc
        D. persimilis  ======================================================================
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  ------------------------atccaga-----------------------------taagag----
          D. simulans  ------------------------agctat--------------------------------ggag----
         D. sechellia  ------------------------atccaga-----------------------------taagag----
            D. yakuba  ------------------------atccaga-----------------------------taagag----
            D. erecta  ------------------------atccaga-----------------------------taagag----
         D. ananassae  -------------------------cccaga-----------------------------taagcgcctg
     D. pseudoobscura  tcctcctcctcctcctcctcctgcactcagactctgaatccaatcccccttcagccacatttaggt----
        D. persimilis  ======================================================================
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  -------------------------tgccccactttcagtt------cctccatggctgc----------
          D. simulans  -------------------------tttggcaatcttggga------tcttcgg----------------
         D. sechellia  -------------------------tgccccacttttagtt------cctccatggctgc----------
            D. yakuba  -------------------------tgccccactttcagtt------cctccttggctgccccatccacc
            D. erecta  -------------------------tgccccactttcagtt------cctccttgcctgc----------
         D. ananassae  ccctccgccctctgcttccagcagatgccccactttcgattctccgcccccgccgactgt----------
     D. pseudoobscura  -------------------------tgccccactttctgttctgctccgttctgttctgt----------
        D. persimilis  ======================================================================
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  ----------cccatccatcca--------ccgaagtcgtaactcaa--tgttatagaccca
          D. simulans  -------------atttacctg--------accacg-cttaacccag--tttttcaggccca
         D. sechellia  ----------gccatccattca--------cccaagtcgtaactcaa--tgttatagaccca
            D. yakuba  cattcatccattcacccatcca--------cccaagtcgtaactcaa--tgttatagaccca
            D. erecta  --------------cccatcca--------cccaagtcgtaactcaa--tgttataggccca
         D. ananassae  ----------gccccttggcag--------ccagagtcgtaactcac--tcggatagaacag
     D. pseudoobscura  ---------gcccccccattcaaatcgatcccggagtcggttcgcgacttattacagagtat
        D. persimilis  ==============================================================
        D. willistoni  ==============================================================
           D. virilis  ==============================================================
        D. mojavensis  ==============================================================
         D. grimshawi  ==============================================================
         A. mellifera  ==============================================================

Alignment block 13 of 217 in window, 827340 - 827391, 52 bps 
B D   D. melanogaster  aatgctcccgt-ttcgggg-----ccaccaattcgttcgtgatggcttttcttgggga
B D       D. simulans  ==========================================================
B D      D. sechellia  aatgctcccat-ttcgggg-----ccaccgattcgttcgtggtggcttttcttgggga
B D         D. yakuba  aatgctcccat-ttcgggg-----ccaccgatttgttcgtgatggcttttcttgggga
            D. erecta  aatgctcccat-ttcgggg-----ccaccaatttgttcgtgatggcttttcttgggga
         D. ananassae  aatggcccgtt-tttggggcagccctgccagcagattggtggcagggcttcctga---
     D. pseudoobscura  aattctcctctgttttgtg-----cttccaatttgtt--ttgtgattgtttttaggg-
B D     D. persimilis  ==========================================================
       D. willistoni  ==========================================================
          D. virilis  ==========================================================
       D. mojavensis  ==========================================================
        D. grimshawi  ==========================================================
        A. mellifera  ==========================================================

Alignment block 14 of 217 in window, 827392 - 827447, 56 bps 
B D   D. melanogaster  ccaatgact---------------------------------------------atactccctcgtctgg
B D       D. simulans  ======================================================================
B D      D. sechellia  ccagtggct---------------------------------------------atactccctcgcctgg
B D         D. yakuba  ccagtggct---------------------------------------------atactccctcgcctgg
            D. erecta  ccagtggct---------------------------------------------atactccctcgcctgg
         D. ananassae  --agtggtcaca-----------------------------------------gatacgctctggaatgg
     D. pseudoobscura  cccatacatatacatatgcatgtgtgtcgtctccccttgggtgctctcttttcgctgcttcctcgaatgg
B D     D. persimilis  ccaat-----------------------------------------------------------------
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================

      D. melanogaster  aaccgatc--------------------------------------------------------------
          D. simulans  ======================================================================
         D. sechellia  aaccgatc--------------------------------------------------------------
            D. yakuba  aaccgatc--------------------------------------------------------------
            D. erecta  aaccgatc--------------------------------------------------------------
         D. ananassae  aaccgatc--------------------------------------------------------------
     D. pseudoobscura  aaccgaaccgaaccaagtgcttccgtactgcctaccgtctctctggcccatccaatcccaccccatcccc
        D. persimilis  ------------------------------cccac-----------cccatcc---------------cc
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  ---ttcaa-ccaatacacagacacagc
          D. simulans  ===========================
         D. sechellia  ---ttcaa-ccaatacgcagacacagc
            D. yakuba  ---ttcaa-gcaatacgcagacacagc
            D. erecta  ---ttcaa-ccaatacgcagacacaac
         D. ananassae  ---------------------------
     D. pseudoobscura  atctccagccccatccccatcccatcc
        D. persimilis  gtctccagccccatccccatcccatcc
        D. willistoni  ===========================
           D. virilis  ===========================
        D. mojavensis  ===========================
         D. grimshawi  ===========================
         A. mellifera  ===========================

Inserts between block 14 and 15 in window
        D. ananassae 8bp

Alignment block 15 of 217 in window, 827448 - 827489, 42 bps 
B D   D. melanogaster  acggggaaacaaactttccgcctcataaac-ttgtgggcttgt
B D       D. simulans  ===========================================
B D      D. sechellia  acggggaaacaaactttccgcctcataaac-ttgtgggcttgt
B D         D. yakuba  aaggggaaacaaactttccgcctcataaac-ttgtgggcttgt
            D. erecta  cgggggaaacaaactttccgcctcataaac-ttgtgggcttgt
        D. ananassae  ===========================================
     D. pseudoobscura  aagcagaagaaaactttccgcctcataaac-tcgtgggcttgt
B D     D. persimilis  aagcagaagaaaactttccgcctcataaac-tcgtgggcttgt
        D. willistoni  aagaggaaatcaactttacgcctcataaactttgtgg------
          D. virilis  ===========================================
       D. mojavensis  ===========================================
        D. grimshawi  ===========================================
        A. mellifera  ===========================================

Inserts between block 15 and 16 in window
    D. pseudoobscura 21bp
B D    D. persimilis 27bp

Alignment block 16 of 217 in window, 827490 - 827521, 32 bps 
B D   D. melanogaster  cccccaagcacgtgcaactctttctttctctc
B D       D. simulans  ================================
B D      D. sechellia  cccccaagcacgtgcaactctttctttctctc
B D         D. yakuba  cccccaagcacgtgcaactctttctttccctc
            D. erecta  cccccaagcacgtgcaactctttctttccctc
         D. ananassae  ccttccagcacgtgcaactctttctct-----
     D. pseudoobscura  gctccaggcacgtgcaactctttctttctttc
B D     D. persimilis  gctccaggcacgtgcaactctttctttctttc
        D. willistoni  -------gcacgtgcatttcttttcatttc--
          D. virilis  ================================
       D. mojavensis  ================================
        D. grimshawi  ================================
        A. mellifera  ================================

Inserts between block 16 and 17 in window
        D. ananassae 9bp
    D. pseudoobscura 103bp
B D    D. persimilis 107bp
       D. willistoni 1945bp

Alignment block 17 of 217 in window, 827522 - 827581, 60 bps 
B D   D. melanogaster  agcgaaaagacgaactgctgtcaggaaaacaatgaacgagtgcaccggaaaaaaacataa
B D       D. simulans  ============================================================
B D      D. sechellia  agcgaaaagacgaactgctgtcaggaaaacaatgaacgagtgcactgg--aaaaacatat
B D         D. yakuba  agcgaaaagacgaactgctgtcaggaaaacaatgagcgagtgcacgga-aaaaaatata-
            D. erecta  agcgaaaagacgaactgctgtcaagaaaacaatgagcgagtgcacggg-aaaaaacata-
        D. ananassae  ============================================================
    D. pseudoobscura  ============================================================
B D     D. persimilis  ============================================================
       D. willistoni  ============================================================
          D. virilis  ============================================================
       D. mojavensis  ============================================================
        D. grimshawi  ============================================================
        A. mellifera  ============================================================

Alignment block 18 of 217 in window, 827582 - 827678, 97 bps 
B D   D. melanogaster  atgtttgtcatac-gggaagctaagaaatcataccaca--aaga--------------------------
B D       D. simulans  atgtttgtcatacggggaagctaagaaatcataccacattaatc--------------------------
B D      D. sechellia  atgtttgtcatac-gggaagctaagaaatcataccacattggtc--------------------------
B D         D. yakuba  ---tatgtcatgc-aggaagctaacaaatcataccacattagtcatgtttacaggcagaaatcatatgac
            D. erecta  ---tatgtcatac-aggaatctaacaaatcatgacacattagtcatgtttaca-gcagaaatcatatcac
        D. ananassae  ======================================================================
    D. pseudoobscura  ======================================================================
B D     D. persimilis  ======================================================================
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================

      D. melanogaster  -----------------------attcttt--aaaa-----------atatatattcat-----------
          D. simulans  -----------------------attctttaaaaaa-----------atatatattcat-----------
         D. sechellia  -----------------------attcttt--aaaa-----------atatatattcat-----------
            D. yakuba  tcccagttgg-aaactcagtggaattctta--aaaa-----------atagataatcttgtttttcccct
            D. erecta  tcacagttggcaaagtcagtggaattccta--aaaatatacatatgtatgtatattcctttattccctgt
         D. ananassae  ======================================================================
     D. pseudoobscura  ======================================================================
        D. persimilis  ======================================================================
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  ----ttattgcagtagcagtagggaatcttatcaaa---------------------t
          D. simulans  ----ttcttgcaatagcattaatgaatcttatgaaa---------------------t
         D. sechellia  ----ttcttgcagtagcattagtgaatcttataaaa---------------------t
            D. yakuba  aatgttgttgcacccacagttgtgaatcttatcggattattcaagttcatatcttagt
            D. erecta  aatgttgttgcaccaacagtagtgaatcttatcgga---------------------t
         D. ananassae  ==========================================================
     D. pseudoobscura  ==========================================================
        D. persimilis  ==========================================================
        D. willistoni  ==========================================================
           D. virilis  ==========================================================
        D. mojavensis  ==========================================================
         D. grimshawi  ==========================================================
         A. mellifera  ==========================================================

Alignment block 19 of 217 in window, 827679 - 827771, 93 bps 
B D   D. melanogaster  cat---agttcat--aatatatttttt-gacaatttct-------------------------------c
B D       D. simulans  tattcaagttcat--ataacatttttt-gacaatttct--------------------------------
B D      D. sechellia  tattcaagttcat--attaaatttttt-gaaaatttct--------------------------------
B D         D. yakuba  aat---agcacac--attatgttttttagatcatttccaatgataagacccaagtagtttacatattctc
            D. erecta  agt---agcacacgtattatgtttttt-tatcatttctcatgataagaccaacgaatttcacttattctc
         D. ananassae  -----------------cataatttct----aatttct--------------------------------
    D. pseudoobscura  ======================================================================
B D     D. persimilis  ======================================================================
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================

      D. melanogaster  cgcgctaacg-------aacttatcagcaag-------------------------------------tt
          D. simulans  cacgataacaag----tagcttatcattaag-------------------------------------tt
         D. sechellia  cacgataacaag----tagcttatcagtaag-------------------------------------tt
            D. yakuba  cgcattaacaatacccaatcttatcagtaaattcaagatcatatcgccaacaaatgattaaattcagttt
            D. erecta  cgccctaacaaaacccaatcttatcagtaaattca-----------caaacagatgatcaaattcagttt
         D. ananassae  ----ttggcgga----tggtttcccactaaa----------------------------gagccc---cc
     D. pseudoobscura  ======================================================================
        D. persimilis  ======================================================================
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  ccttccgatttcttcggattttatcagcagtgta
          D. simulans  ccttccgatttcttcggcttttatcagcagtgta
         D. sechellia  ccttccgattttttcggcttttatcagcagtgta
            D. yakuba  ccttccgatttcgtgggcttttatcagcagtgta
            D. erecta  ccttccgatttcattggcttttataggcagtgta
         D. ananassae  tcttccaagcccaagagctttctttgtcaatgtc
     D. pseudoobscura  ==================================
        D. persimilis  ==================================
        D. willistoni  ==================================
           D. virilis  ==================================
        D. mojavensis  ==================================
         D. grimshawi  ==================================
         A. mellifera  ==================================

Alignment block 20 of 217 in window, 827772 - 828029, 258 bps 
B D   D. melanogaster  atgtc---------aatgtctcggctgttgggcttatgcaagcgc--------------------aaaca
B D       D. simulans  atgtc---------aatgtctcggctgttgggcttatgcaagcgc--------------------aaaca
B D      D. sechellia  atgtc---------aatgtctcgtctgttgggcttatgcaagcgc--------------------aaaca
B D         D. yakuba  atgtc---------aatgtctcggctgttgggcttatgcaagcgc--------------------aaaca
            D. erecta  atgtc---------aatgtctcggctggtgggcatatgcaagcgc--------------------aaaca
         D. ananassae  ttgtcttgtcttgtgttgtcttggctcttgggcttatgcaagccccaaacagaaacccaaacccaaaaca
     D. pseudoobscura  atgtc---------aatgtcttggctgtgcggctcctcaaggcaa--------------------caaaa
B D     D. persimilis  atgtc---------aatgtcttggctgtgcggctcctcaaggcaa--------------------caaaa
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================

      D. melanogaster  ataacaaaacaatcaccaagcc-aaagaaatccaaacaccgatccgaatccaacggtg--gtgcatttca
          D. simulans  ataacaaaacaatcgccaagcc-aaagaaatccaaacaccacttcgaatccgacggtg--gtgcatttca
         D. sechellia  ataacaaaacaatcgccaagcc-aaagaaatccaaacaccacttcgaatccgacggtg--gtgcatttca
            D. yakuba  ataacaaaacaatcgccaagcc-aaagaaatccaaacaccaatccgaatccaacggtg--gtgcatttca
            D. erecta  ataacaaaacaatcgccaagcc-aaggaaatccaaacaccaatccgaatccaacggtg--gtgcatttca
         D. ananassae  ataacaaaacaattgccaagcc-aaagaaa-----------atccaagccaatcggtg--gtg-----ca
     D. pseudoobscura  gt-gcaaaacaa-----aagccaaaagaaa-----------atccaaatccattgctgcatcgccgtgca
        D. persimilis  gt-gcaaaacaa-----aagcc-aaagaaa-----------atccaaatccattgctgcatcgccgtgca
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  gttcattggcagccagccagccagccaggcgtttcatg--tttaccaagtccccaagc-----gaaccga
          D. simulans  gttcattgg----cagccagccagccaggcgtttcatg--tttaccaagtccccaagc-----gaaccga
         D. sechellia  gttcattgg----cagccagccagccaggcgtttcatg--tttaccaagtccccaagc-----gaacaga
            D. yakuba  gttcattgg----cagtcagccagccaggcgtttcatg--tttaccaagtccccaacc-----aaaccga
            D. erecta  gttcattgg----cagccagccagccaggcgtttcatg--tttaccaagtccccaacctaacacaaccga
         D. ananassae  gttcattgg----caggcagccagcgaagcgtttcatg--ttcaacaacctcctcctc------------
     D. pseudoobscura  gttcattgg----cagggggccagccgaacgtttcaag-tttttcttggtggtggtgc-----------t
        D. persimilis  gttcattgg----cagggggccagccgaacgtttcaagttttttcttggtggtggtgc-----------t
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  actgaaccgcccccttatcactc-----------cagcatttgc-----ataa----atataatcttttt
          D. simulans  actgaaccgcccccttatcactc-----------gagcatttgc-----acaa----acataatcttttt
         D. sechellia  actgaaccgcccccttatcactc-----------gagcatttgc-----acaa----acataatcttttt
            D. yakuba  accgaaccgcccccttatcactc-----------gagcatttgc-----acaa----acataatcttttt
            D. erecta  accgaaccgcccccttatcactc-----------gagcattggc-----acaa----acataatcttttt
         D. ananassae  -ctcctcctcctcctcctc-ctctc----gttgggggcacccaccagagccag----gtagtacctcctt
     D. pseudoobscura  gttggtcctccccctatccgccttatcaggtgggaagcatttgc-----acaaacatacataatcttttt
        D. persimilis  gttggtcctccccctatccgccttatcaggtgggaagcatttgc-----acaaacatacataatcttttt
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  ---------cgggttctttctccg----tttctatctg----ggtt-cggttacg
          D. simulans  ---------cgggttctttctccg----tttctatctg----ggtt-cggttacg
         D. sechellia  ---------cgggttctttctccg----tttctatctg----ggtt-cggttacg
            D. yakuba  ---------cgggttctttctccg-----tgctatctg----ggtt-cggttacg
            D. erecta  ---------cgggttctttctccg-----tgctatctg----ggtt-tggttacg
         D. ananassae  atcagagaccaggttcttgctgggcgggtggccatctgtcacggttacagtttcg
     D. pseudoobscura  ---------cgaattctttcgctc----ttctgttttg----gatt-cggtttca
        D. persimilis  ---------cgaattctttcgcac----ttctgttttg----gatt-cggtttca
        D. willistoni  =======================================================
           D. virilis  =======================================================
        D. mojavensis  =======================================================
         D. grimshawi  =======================================================
         A. mellifera  =======================================================

Inserts between block 20 and 21 in window
B D        D. yakuba 18bp
           D. erecta 6bp

Alignment block 21 of 217 in window, 828030 - 828413, 384 bps 
B D   D. melanogaster  gtt------tca-----------ctcccgctttctcctctcaaaaaat----------aggg-aaaacac
B D       D. simulans  gttacggtttca-----------ctcccgctttctccgctcaaaaaat----------aggg-aaaaca-
B D      D. sechellia  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D         D. yakuba  gttacggttcca-----------ctgccgctttctccgctcaagaaat----------aggg-aaaaca-
            D. erecta  gttacggttcca-----------ctcccgctttctccgctcaagaagt----------agggaaaaacg-
         D. ananassae  gtttcagtctcag----------tttcagctttctccgcccggccagtttgtccgaaaaacg-aaaaca-
     D. pseudoobscura  gccgctggcggaacccactttctcccctcttattgccaaccaaagagt---------------gactca-
B D     D. persimilis  gccgctggcggaa----------cccctcttattgccaacgaaagaat---------------gactca-
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================

      D. melanogaster  acagacaat-tcgcacaacagtgaatcactttgcgaccaatgcttcggttaa--------------aca-
          D. simulans  ---gacaat-tcacacaatagtgaatcactttgcgaccagttctccggttga--------------acat
         D. sechellia  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. yakuba  -caaacaatagcagcgaaaagtgattcactttgcgactagttcttcagttga--------------acg-
            D. erecta  -caaacagtagcagcgaaaagtgaatcactttgtgaccagttcttcagttga--------------gca-
         D. ananassae  -aacacaacggtggct----gtgaatcact---cgcggaggtct--------------------------
     D. pseudoobscura  -caaatatt-gcac-----------ttattctgtgtctttatctccatttaatatccggcagaggcaca-
        D. persimilis  -caaatatt-gcac-----------ttattctgtgtctttatctccatttaatatccggcagaggcaca-
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  ggtacttctccgtatctctagctaacgcaaaaacctttgactaatcgatggtaaagtaaacaaaa---ac
          D. simulans  ggaacttctccgtatctctggctaacgcaaaaacctttgactaatcgatggtaaagtaaacaaaa---ac
         D. sechellia  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. yakuba  ggggctttttcgtatctctggctaatgcaa-aacttttgactaatcgatggtaaaataaacaaaa---ac
            D. erecta  ggagctcgtccgtatctc-ggctaacgcaagaatctttgactaatcgatggt-aaataaacaaaa---gc
         D. ananassae  gatattttcccatatctt-------------gcccaccagttagtcaaagg--gggtgagtggagttccc
     D. pseudoobscura  ggaac------------cgggc--acacta-aacccttgagtaatcgatgagaaaacacacaaac---aa
        D. persimilis  ggaac------------cgggc--acacta-aacccttgagtaatcgatgagaaaacacacaaac---aa
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  actcgttatcacatggagattattatggccaaaattcg-aacaggaagcacgattagaagtttaccggca
          D. simulans  actcgttatcacatggagattattatggcaacaattcg-aacaggaagctcgattagaattttaccggag
         D. sechellia  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. yakuba  actcgttatcacatggaaattattatggcagcgat-------------------tggaagtttaacggag
            D. erecta  actcgttatcacatggaaattattatggcaacgattcc-aac----agctcgactggaatttcaacggag
         D. ananassae  acttgttatcgc----------ttctaaaaagaattccaaacaggaagctcca--------tcatcgata
     D. pseudoobscura  tccagttagc-----caagctcttat-ctaatgatgac-aac----------------------------
        D. persimilis  tccagttagc-----caagctcttat-ctaatgatgac-aac----------------------------
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  aaacaaatttatgcattgcctgcatttcttattatatacgtatg---------------ggtcagttgct
          D. simulans  aaacaaattt-------gcctgcatttcttgttatatacggatg---------------ggtcagttgct
         D. sechellia  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. yakuba  aagcaaacat-------ttctgcatttctttttatacaccgatt--------ggttctaggtcagttgct
            D. erecta  aaga-----------------------tttgttatatacggatttctaaggaaactctaggtcagttgct
         D. ananassae  aagtccataa-----------------ctcataactgatacatc---------------atcttggctct
     D. pseudoobscura  ---------------------------attttgatgtgccagat---------------acccagttcct
        D. persimilis  ---------------------------attttgatgtgccagat---------------acccagttcct
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  aatagatattgcaccgaaatgccagaattgaatggcatt-------agagctctcgaaaacactttcagc
          D. simulans  aatgga-actgcaccgaactggcagaattgaatggaattgt--agtagagctctcgaaaacactttcagc
         D. sechellia  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. yakuba  agtagatatggcacagagctggaagaattgaat-gtattga----------------aaacactttcagc
            D. erecta  aataggtattgcgcagaactgcaagaattgaat-gtattgaataatacagctttcggaaacactttcagc
         D. ananassae  aagaga----gctcc-agcttaggtaat--aac-ccattaagatggagggctt----------------c
     D. pseudoobscura  ggtagg----------agatcttagattctg---ccattca-----------------gacaattatcgc
        D. persimilis  ggtagg----------agatcttagattctg---ccattca-----------------gacaattatcgc
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  tgactcagcctctcgtgtatgacctaacagtcat
          D. simulans  tgactcagcctctcgtgtatgagctaacagtcat
         D. sechellia  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. yakuba  tgactcagcctctcgtgtatgatctaacaatcat
            D. erecta  tgactcagcctctcgggtatgatctaacaatcat
         D. ananassae  ccgctcagccgccag-------------------
     D. pseudoobscura  aaggtgcgccgctggggcaaaaag----------
        D. persimilis  aaggtgcgccgctggggcaaaaag----------
        D. willistoni  ==================================
           D. virilis  ==================================
        D. mojavensis  ==================================
         D. grimshawi  ==================================
         A. mellifera  ==================================

Alignment block 22 of 217 in window, 828414 - 828568, 155 bps 
B D   D. melanogaster  tg--aaaagcgaaacca---agattggcctagagtcaaagaccga-gtagagcg--ttttc--tcaacgt
B D       D. simulans  tg--aaaagcgaaacca---agattggcctagagtcaaagaccga-gtagagcg--ttttc--tcagcgt
B D      D. sechellia  tg--aaaagcgaaacca---agattggcctagagtcaaagaccta-gtagagcg--gtttc--tcagcgt
B D         D. yakuba  tga-aaaagggaaacca---aagttggcctagagtcaaagcccga-gtagagcg--tttgc--tcagcgt
            D. erecta  ag--aaaagggaaacca---aagttggcctagagtcaaagcccga-gttgagtgttttttc--tcggcgt
         D. ananassae  --acaaaagtgaaaccacacacgggggcttagcgtcttgggccta-gccaagtc--t-------------
     D. pseudoobscura  tg--aaaaccaaagcca---a----ggcctcttgtct--gttggt-gtctggtg--gcttccatcatcat
B D     D. persimilis  tg--aaaaccaaagcca---a----ggcctcttgtct--gttggt-gtctggtg--gcttccatcatcat
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
        D. mojavensis  ----aagtgtgaaacca---cagaaaagacaaaataaaaatcaaatgtccagag--ctttt--ttattgt
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================

      D. melanogaster  ------ggcccacacttattgatttttaattatcc-aaagatgg-----ccct-----cggcta-tgaca
          D. simulans  ------ggcccacacttattgatttttaattatcc-aaagatgg-----ccct-----cggcta-tgaca
         D. sechellia  ------ggcccacactaatggatttttaattatccaaaagatgg-----ccct-----cggcta-tgaca
            D. yakuba  ------aggccactcttattgatttttaattatcc-aaagatgg-----ccct-----cggcta-tgaca
            D. erecta  ------gggccacacttattgatttttaattatcc-aaagatgg-----cccg-----cggcta-tgaca
         D. ananassae  ----------agcacttattgatttttaattacct-----gtgg-----cccttggggcggcc--tgaca
     D. pseudoobscura  ------tctgcccacttattgatttttaattattgaagagaggggcctcccct-----gggcta-tgaca
        D. persimilis  ------tgtgcccacttattgatttttaattattgaagagaggggcctcccct-----gggcta-tgaca
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ttctgggtcgcataattattgatctttaataattt-ttgtttgg-----cctc-----cggctgttgaca
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  ttgactttgattttgttg----gct--cgccaa--cctggccaacgaactc
          D. simulans  ttgactttgattttgttg----gct--cgccaa--cctggccaacgaactc
         D. sechellia  ttgactttgattttgttg----gct--cgccaa--cctgaccaacgaactc
            D. yakuba  ttgactttgattttgctggcccgct--cgccaa--cctggcccacgaactc
            D. erecta  ttgactttgattttgctg----gct--ggccaa--cctggccaacgaactc
         D. ananassae  ttgactttgattctgctg---------------------gccaacgaact-
     D. pseudoobscura  ttgactttgattttgctc----tctgccaccgaactctggccaacgaactc
        D. persimilis  ttgactttgattttgctc----tctgccaccgaactctggccaacgaactc
        D. willistoni  ===================================================
           D. virilis  ===================================================
        D. mojavensis  ttgactttggttac--------gct----------tttggccaacaacctc
         D. grimshawi  ===================================================
         A. mellifera  ===================================================

Inserts between block 22 and 23 in window
       D. mojavensis 1763bp

Alignment block 23 of 217 in window, 828569 - 828616, 48 bps 
B D   D. melanogaster  gggaagcctctctagagatctctggccgaaataaccttctgt--gccgcc---------------
B D       D. simulans  gggaagcctctctagagatctctgaacggaataaccttctct--gccgcc---------------
B D      D. sechellia  gggaagcctctctagagatctctggccggaataaccttctct--gccgcc---------------
B D         D. yakuba  gggaagcctctctagagatctgtggccggaataaccttctcc--gccgcc---------------
            D. erecta  gggaagcctctctagagatctctggccggaataaccttctcc--gccgcc---------------
         D. ananassae  --------------------gctggccaaga-------------gccg-----------------
     D. pseudoobscura  cgcca-cctttcgagaggcagccagcctctttgagcctatttgagccgcctcttatgtcatgcgg
B D     D. persimilis  cgcca-cctttcgagaggcagccagcctctttgagcctctttgagccgcctcttatgtcatgcgg
       D. willistoni  =================================================================
          D. virilis  =================================================================
       D. mojavensis  =================================================================
        D. grimshawi  =================================================================
        A. mellifera  =================================================================

Alignment block 24 of 217 in window, 828617 - 828682, 66 bps 
B D   D. melanogaster  cgctaactgc----ctta--------------tgtcactcggtaaatctcggttaagaaaccaatttccc
B D       D. simulans  cgctaactgc----ctta--------------tgtcactcggtaaatctcggccaagaaaccaatttccc
B D      D. sechellia  cgctaactgc----ctta--------------tgtcactcggtaaatctcggccaagaaaccaatttccc
B D         D. yakuba  cgctaactgc----ctta--------------tgtcactctgtaaatctcggtcgagaaaccaatttccc
            D. erecta  cgctaactgc----ctta--------------tgtcactcggcgaatctcggccaagaaaccaatttccc
         D. ananassae  ---------------------------------------gggcaaggct------agagatcag----cc
     D. pseudoobscura  ctccagctgctgctcttgcgggcgttgtggtctgtctgctgataaatctcggc-----aaccaatgt-cc
B D     D. persimilis  ctccagctgctgctcttgcgggcgttgtggtctgtctgctgataaatctcggc-----aaccaatgt-cc
        D. willistoni  cactcagttc----gttt--------------tgtc-tttgataaatctgaat-----aaccaattt-cc
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================

      D. melanogaster  aatacccccgacca
          D. simulans  aataccgccgacca
         D. sechellia  aataccgccgacca
            D. yakuba  aataccgccgacca
            D. erecta  aataccgccgacca
         D. ananassae  aatacc--------
     D. pseudoobscura  aattccactt-tga
        D. persimilis  aattccactt-tga
        D. willistoni  aatttca------a
           D. virilis  ==============
        D. mojavensis  ==============
         D. grimshawi  ==============
         A. mellifera  ==============

Alignment block 25 of 217 in window, 828683 - 828708, 26 bps 
B D   D. melanogaster  ttcacgttcgtgactcattgcggtcg
B D       D. simulans  ttcccgttcgtgactcattgcggtcg
B D      D. sechellia  ttcccgttcgtgactcattgcggtcg
B D         D. yakuba  ttcccgttcgtgactcattgcggtcg
            D. erecta  ttcccgttcgtgactcattgcggtcg
         D. ananassae  ----cgtttgtgactcattgcggtcg
     D. pseudoobscura  atcccgttcgtgactcattgcggtcg
B D     D. persimilis  atcccgttcgtgactcattgcggtcg
        D. willistoni  ttcctgttcatgactcattgcggtcg
           D. virilis  ttcaagttc--ggcttgccgcagtta
       D. mojavensis  ==========================
        D. grimshawi  ==========================
        A. mellifera  ==========================

Inserts between block 25 and 26 in window
       D. willistoni 1353bp

Alignment block 26 of 217 in window, 828709 - 828831, 123 bps 
B D   D. melanogaster  a-a-------------tgtctcagttgatttctgtgtctttctt----ggcctgaaatggc---ccggat
B D       D. simulans  a-a-------------tgtctcagttgatttctgtgtctttctt----ggcctgaaatggc---ccggat
B D      D. sechellia  a-a-------------tgtctcagttgatttctgtgtctttctt----ggcctgaaatggc---ccggat
B D         D. yakuba  a-a-------------tgtctcagttgatttctgtgtctttctt----ggcctgaaaaggt---ccggat
            D. erecta  a-a-------------tgtctcagttgatttctgtgtctttctc----ggcctgaaatggc---ccggat
         D. ananassae  gca-------------tggctcagtctctgactggcacttt-------ggcctgaattggag-gccactt
     D. pseudoobscura  c-agtcgattggtcgattggtcgattggcacccgcgttgccccgctcagatgtgtgagggaatgtctgtt
B D     D. persimilis  c-a--------gtcgattggtcgattggcacccgcgttgccccgctcagatgtgtgagggaatgtctgtt
       D. willistoni  ======================================================================
           D. virilis  a-a-------------tgttctggtttttttttttttttatttt------attgaattgaa---ttcaat
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================

      D. melanogaster  tttgagtctctggttctccagcctc---------ggtgagg------ctgcccc-----gttgaacaaat
          D. simulans  tttgagtctctggttctccagcctc---------ggtgagg------ctgcccc-----ggtgaacaaat
         D. sechellia  ttttagtctctggttctccagcctc---------ggtgagg------ctgcccc-----ggtgaacaaat
            D. yakuba  ttcgagactctggttctccagcc----------------ag------cagcttc-----ggtgaacaaat
            D. erecta  ttcgagtctctggttctccagcc----------------ag------cagcctc-----ggtgaacaaat
         D. ananassae  cttgactctccaa-----caccc----------------gg------cagcc--------gtaaacaaat
     D. pseudoobscura  atggtttccatggttctgtagcctccttagccatactgtggctgtgactgtggc-----tgtg-ccaaat
        D. persimilis  atggtttccatggttctgtagcctccttagccatactgtgg------ctgtggc-----tgtg-ccaaat
        D. willistoni  ======================================================================
           D. virilis  tacaagtttcaaatctg-----------------agtgttg------ctgccccatttgagtg---gggg
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  caat---------acccgat-----ggcca-------------cttattcg
          D. simulans  caat---------acccgat-----ggcta-------------cacattcg
         D. sechellia  caat---------acccgat-----ggcta-------------cacattcg
            D. yakuba  caat---------acccgat-----ggcca-------------ctcattcg
            D. erecta  cagt---------acccgat-----ggcca-------------ctcatttg
         D. ananassae  cgat---------aacca-------------------------------tg
     D. pseudoobscura  caatacccaatacacccaatactcaggccagcactcgccaactctcattcg
        D. persimilis  caat---------acccaatactcaggccagcactcgccaactctcattcg
        D. willistoni  ===================================================
           D. virilis  caac---------tttcact-----tggcg-------------tccattt-
        D. mojavensis  ===================================================
         D. grimshawi  ===================================================
         A. mellifera  ===================================================

Alignment block 27 of 217 in window, 828832 - 828865, 34 bps 
B D   D. melanogaster  ctc-------------------gcctggcaattggattcaattg-agtggagtc
B D       D. simulans  ctc-------------------gcctggcaattggattcaattg-agtggagtc
B D      D. sechellia  ctc-------------------gcctggcaattggattcaattg-agtggagtc
B D         D. yakuba  ctc-------------------gcctggcaattggattcaattg-agtggagtc
            D. erecta  ttc-------------------gcctggcaattggattcaattg-agtggagtc
         D. ananassae  ctg-------------------ctccggcaattggattcaattg----------
     D. pseudoobscura  attcattcaaattgaagagtcaacacagcaattgaattcaattg-gagagccag
B D     D. persimilis  attcattcaaattgaagagtcaacacagcaattgaattcaattg-gagagccag
        D. willistoni  ccc-------------------gcctgccgtctgcctttagttgtcgtcgtcgt
           D. virilis  ctc-------------------gcttggcca-------catttg---tggcc--
       D. mojavensis  ======================================================
        D. grimshawi  ======================================================
        A. mellifera  ======================================================

Alignment block 28 of 217 in window, 828866 - 829056, 191 bps 
B D   D. melanogaster  agtcgg--aggcaactttcacttgc------------acagatttta-------------attgcccc--
B D       D. simulans  aggcgg--aggcaactttcacttgt------------acagatttta-------------attgcccc--
B D      D. sechellia  aggcgg--aggcaactttcacttgc------------acagatttta-------------attgcccc--
B D         D. yakuba  aggcgg--aggcaactttcacttgc------------acagatttta-------------attgcccc--
            D. erecta  aggcgg--aggcaactttcacttgc------------acagatttta-------------attgcccc--
         D. ananassae  ---------gaaaactttcacttgc------------tcagatttta-------------attgccgc--
     D. pseudoobscura  aggctgccaggcagctttcacttgcctcaccgttgagattgttttta-------------attgcaac--
B D     D. persimilis  aggctgccaggcagctttcacttgcctcaccgttgagattgttttta-------------attgcaac--
        D. willistoni  cgacgg--aggctactttcacttgt-------ttctgttttttttta-------------attgcgtc--
           D. virilis  agccgt--tgtcagcctccaaataa----------atatgtccatca---------tcataatg------
        D. mojavensis  agttgg--gggcaactttcacttg-------------gcgtctattactcgcttggccacattgcggtca
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================

      D. melanogaster  ----acaactggaatggccagatccctcagc-------ccccatatccatctcc------cgctcatatt
          D. simulans  ----acaactggaatggccagatccctcagc-------ccccataaccatctcc------cgctcaaata
         D. sechellia  ----acaactggaatggccagatccctcagc-------ccccataaccatctcc------cgctcaaata
            D. yakuba  ----acaactggaatggccagatccctcagc-------ccccatatccacctcc------cgctcaaact
            D. erecta  ----acaactggaatggccagatccctcag--------ccccatatccatctcc------cgctcaaact
         D. ananassae  ----ctaactggaatggccag---cctccct-------ccccctctccctctcc------cattccattc
     D. pseudoobscura  ----acaactggtactggcctctgtcccagt-------cccagtcccagtcccagcccagtgctccatcc
        D. persimilis  ----acaactggtactggcatctgtctcagt-------cccagtcgcagtcct-------tgctccatcc
        D. willistoni  ------aattttgctcgccaaaacccaaga-----------------aatctca------taatctcatc
           D. virilis  ----accattgc--------------------------catcatcatcatcat-------catcatcacc
        D. mojavensis  gtctacagttgcactcggctgcaagctaaaaaaaaacataccatcatcattgc-------cattgccatc
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  ----------------atcat-catcatgatcatcacaacacaa--acactt---------------cac
          D. simulans  ----------------atcat-catcatgatcatcacaacacaa--acactc---------------cac
         D. sechellia  ----------------atcat-catcatgatcatcacaacacaa--acactc---------------cac
            D. yakuba  atcatcatca-tcatcatcat-catcatgatcatcataacacaa--acactc---------------cac
            D. erecta  ----------------aacat-catcatgatcatcataacacaa--acactc---------------cac
         D. ananassae  -------ccactccctaccatgccacatgatctcccccctccagtcacacaa---------------cac
     D. pseudoobscura  ----------------atc---tatccagacagccagtcagcca--gccatc---------------cat
        D. persimilis  ----------------atc---taaccagacagccagccagcca--gccatc---------------cat
        D. willistoni  ----------------atc---cgtccagacaagttggtctcag--tcattc---------------atc
           D. virilis  ----------------atcat-tagcattatcatcc-----cta--acacacacacacacacacaaccac
        D. mojavensis  ----------------atcat-catcatcataatcc-----cta--acacat------------------
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  tcattcatc--------ttcat---------------------------cgccggctcgctgaccccaa-
          D. simulans  tcattcatc--ttcatattcat---------------------------cgccggctcgctgaccccaa-
         D. sechellia  tcattcatc--ttcatattcat---------------------------cgccggctcgctgaccccaa-
            D. yakuba  tca--------ttcatcttcat---------------------------cgccggctcgctgaccccaa-
            D. erecta  tcattcatc--ttcatcttcat---------------------------cgccggctcgctgaccccaa-
         D. ananassae  tcactc-----ttcatcatcat-------------------------------------ctgacccaaa-
     D. pseudoobscura  ctatccatc-atccatctccatatcattgctgtctctcgctcgcacgctcgctcgcccgctgacccgaa-
        D. persimilis  ctatccatc-attcatctccatatcattgctctctctcgct----cgctcgctcgcccgctgacccgaa-
        D. willistoni  tcacacacttgctcatgttttt---------------------------tgtcaaccctccaatcatca-
           D. virilis  acacacaca--tacactgttatcagatctctctctctcata--------tcctagctcgatggcccgtt-
        D. mojavensis  ------------------tcatcag--------ctcacata--------tcctagctcgaaggcccgttt
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  --------------------------------------aaacaaacattcat---ctctcg-----gcta
          D. simulans  --------------------------------------aaacaaacattcat---ctctcg-----gcta
         D. sechellia  --------------------------------------aaacaaacattca-----tctcg-----gcta
            D. yakuba  --------------------------------------aaacaaacattcat---ctctcg-----gcta
            D. erecta  --------------------------------------aaacaaaccttcat---ctctcg-----gcta
         D. ananassae  --------------------------------------aaccagacattcaa---c-ctag-----tcta
     D. pseudoobscura  ----------taacacgaatagcaacagcaacaacaacaaacaaacaaacat---tttgtgcggatgcta
        D. persimilis  ----------taacacgaat----acagcaacaacaacaaacaaacaaacat---tttgtgcggatgcta
        D. willistoni  ----------------------------------------------------------------------
           D. virilis  -tttaattccttttacaaac------------------tatgtaaattttacttatttgtg-----ctta
        D. mojavensis  gtttattccctttca-----------------------tatgtaaatttcac---tttatg-----ctca
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  a--------tt
          D. simulans  a--------tt
         D. sechellia  a--------tt
            D. yakuba  a--------tt
            D. erecta  a--------tt
         D. ananassae  a----------
     D. pseudoobscura  a------tttt
        D. persimilis  a------tttt
        D. willistoni  ---------tt
           D. virilis  aatttggtttt
        D. mojavensis  aattttgtttt
         D. grimshawi  ===========
         A. mellifera  ===========

Alignment block 29 of 217 in window, 829057 - 829221, 165 bps 
B D   D. melanogaster  ttgagttg-atttcctatttg-------gtatttcgagtttgagtacttgcat---------tgtattt-
B D       D. simulans  ttgagttg-atttcctatttg-------gtatttcgtgtttgagtacttgcat---------tgtattt-
B D      D. sechellia  ttgagttg-atttcctatttg-------gtatttcgtgtttgagtacttgcat---------tgtattt-
B D         D. yakuba  ttgagttg-atttcctatttggattttcgtgtttcgtgtttgagtacttgcat---------tgtattg-
            D. erecta  ttgagttg-atttcctattcg-------gtatttcgtgtttgagtacttgcat---------tgtattt-
         D. ananassae  tcgcgcta-atttttagttcg----------tttggag-------------------------ggatct-
     D. pseudoobscura  ttgagttatgttttttaaacg---------------tgtataattaagtgcct---------tacgtat-
B D     D. persimilis  ttgagttatgttttttaaacg---------------tgtataattaagtgcct---------tacgtat-
        D. willistoni  gtaaa----cttttttaaata---------ttttcgag-------aatttctt---------tgcttat-
           D. virilis  tctttttt-ttttgccaaata-------tatatgtatatatagatatatatgtg--------tgtatatc
        D. mojavensis  acgcttag-cttttttgtata-------catacatatgcataggtatacgtatgtatgtaaatgtatatt
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================
         T. castaneum  tttagttg-gtttctgttttg-agtttttcagttttagttttattactttttc---------tgtattt-

      D. melanogaster  -----------------tttaagc--------taatcatttttacgctctttagcttct---tcag----
          D. simulans  -----------------tttaagc--------taatcattttcacgctctttagcttct---tcag----
         D. sechellia  -----------------tttaagc--------taatcattttcacgctctttagcttct---tcag----
            D. yakuba  -----------------tttaagc--------taatcattttcacgctttttagcttct---tgag----
            D. erecta  -----------------tttaagc--------taatcattttcacgctttttagcttct---tgag----
         D. ananassae  -----------------gttaagc--------taatca-tttcacgcttcttagccgctctcccaggcac
     D. pseudoobscura  -----------------ttgaaacg------ataatcattttca--------agcttct---tta-----
        D. persimilis  -----------------ttgaaacg------ataatcattttca--------agcttct---tta-----
        D. willistoni  -----------------atta-----------ttatgattttga------------aca---tt------
           D. virilis  t--atatttttaagta-tttaagcactagttataaatgctttcacgc-----aaatgct---tttt----
        D. mojavensis  taaatattttaaagtattttaagcactagttttaactgctttcacgc-----aaatgct---tttt----
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  -----------------tttaagc--------------ttttcacactttc-tgtcgtt---tagt----

      D. melanogaster  -------------------tgcgaaaca------------------------------------------
          D. simulans  -------------------tgctaaaca------------------------------------------
         D. sechellia  -------------------tgctaaaca------------------------------------------
            D. yakuba  -------------------tgctaaaca------------------------------------------
            D. erecta  -------------------tgctaaaca------------------------------------------
         D. ananassae  actctccgcttccatgatccgcccaaga------------------------------------------
     D. pseudoobscura  -------------------tgc-agaga------------------------------------------
        D. persimilis  -------------------tgc-agaga------------------------------------------
        D. willistoni  -------------------tgccaaacg------------------------------------------
           D. virilis  -------------------tgactaacacgcacacacacacagatacagagagacggccagacacacaca
        D. mojavensis  -------------------tgcctaata------------------------------------------
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  -------------------ttctcagtg------------------------------------------

      D. melanogaster  -----------------attaagcctaatttgca---tatat---------------------catttgc
          D. simulans  -----------------attaagcctaatttgca---tatat---------------------catttgc
         D. sechellia  -----------------attaagcctaatttgca---tatat---------------------catttgc
            D. yakuba  -----------------attaagcctaatttgca---tatat---------------------catttgc
            D. erecta  -----------------attaagcctaatttgca---tatat---------------------catttgc
         D. ananassae  -----------------tccaaccctgatttgcattttattt---------------------catcttc
     D. pseudoobscura  -----------------tttaatttcgaatttcg---t-ttt---------------------cctttct
        D. persimilis  -----------------tttaatttcgaatttcg---t-ttt---------------------cctttct
        D. willistoni  ----------------cttttaatccaatttaat---ttcat---------------------tattgat
           D. virilis  agcacacacacacgcgtattaagctaaacacaca---ttcag----------------------------
        D. mojavensis  --cacacatacactcgcgcgcacacacacacaca---cacacacactcatgcgtacatatatacatacac
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  -----------------tttcagtttactgt------tatat---------------------ttttttc

      D. melanogaster  tctc---tttttctttctttc------------------tt----cgttcgttgcttatgtt
          D. simulans  tctc---tttttctttcattc------------------tt----cgttcgttgcttatgtt
         D. sechellia  tctc---tttttgtttcattc------------------ta----cgttcgttgcttatgtt
            D. yakuba  tctc---ttttcctttttttc------------------cttctacgttcattgcttatatt
            D. erecta  tctc---tttttctttctttc------------------tt----cgttcattgcttatgtt
         D. ananassae  cttcccgctccgcttgttttt------------------tg----cgtttgctttttccatc
     D. pseudoobscura  tttc---tttttcttggttttgcgttgcattgcgttgcgtt----ctcttgttgcgcgtttt
        D. persimilis  tttc---tttttcttggttttgcgttgcattgcgttgcgtt----ctcttgttgcgcgtttt
        D. willistoni  tttt---ccttcttgtctttc------------------gt----ttttcgttttgtttttt
           D. virilis  -------ctttaatttcatct------------------tg----tttacattgtt--tctt
        D. mojavensis  aacg---ctttaatttcatct------------------tg----tttacattgtt----tt
         D. grimshawi  ==============================================================
         A. mellifera  ==============================================================
         T. castaneum  att----ttttactttctcac------------------tc----tctcactttcttatttt

Alignment block 30 of 217 in window, 829222 - 829239, 18 bps 
B D   D. melanogaster  a----------------ttgcg-ttgcttatgttt
B D       D. simulans  a----------------ttgcg-ttgcttatgttt
B D      D. sechellia  a----------------ttgcg-ttgcttatgttt
B D         D. yakuba  a----------------ttgcg-ttgcttatgttt
            D. erecta  a----------------ttgcg-ttgcttatgttt
         D. ananassae  t----------------tttta-tcgttttacttt
     D. pseudoobscura  gcattccatcttatcgtttgcg-ctgcatttctgt
B D     D. persimilis  gcattccatcttatcgtttgcg-ctgcatttctgt
        D. willistoni  g----------------ttttg-ttgtttgttttt
           D. virilis  c----------------ttcttactttttacgttt
        D. mojavensis  c----------------ttctt-ccttttacgttt
        D. grimshawi  ===================================
        A. mellifera  ===================================

Inserts between block 30 and 31 in window
          D. virilis 26bp
       D. mojavensis 24bp

Alignment block 31 of 217 in window, 829240 - 829446, 207 bps 
B D   D. melanogaster  actttgc-cacgcctacgcttccgc--ccacgctcacgc--ccattcgc--------cccctgaaaccac
B D       D. simulans  acgttgc-cacgcctgcgcttccgc--ccacgctcacgc--ccattcgc--------cccctgaaaccac
B D      D. sechellia  atgttgc-cacgcctgcgcttccgc--ccacgctcacgc--ccattcgc--------ctcctgaaaccac
B D         D. yakuba  acgttgc-cacgcctacgcttccgc--ccacgctcacgc--ccattcgc--------cccctgaaaccac
            D. erecta  acgttgc-cacgcctacgcttccgc--ccgcgctcacgc--ccattcgc--------cccttgaaaccac
         D. ananassae  ---ttgc-cacgcccacgcttacgc--tcacattcacgc--ccacgccc-----acgcccttg--accac
     D. pseudoobscura  tttttga-cttgctgccactgccactgccacgcccacgc--atatgcat--ctcacgcccatg--accat
B D     D. persimilis  tttttga-cttgctgccactgccgctgccacgcccacgc--atatgcat--ctcacgcccatg--accat
        D. willistoni  ctgtttcttatgttgccacgcccac--taaatatcacaa--aaaaacaa--------------aaaaaac
           D. virilis  ----cgc-cgcattcgta---acgt--ttaatttgctgc--ccaacaacaacaactatcacaacaacaac
        D. mojavensis  atttcgc-cgcattcgta---acga--ttaatt---tgctgctaaaaacaacaacaacaacaacaacaac
         D. grimshawi  atttagc-cacgcccacgtccacgt--ccacgttcacgc--ccattcgcacatactgtcatagctgccag
        A. mellifera  ======================================================================

      D. melanogaster  gccca------------cagc-----------------aattatgcattggctaga--------------
          D. simulans  gccca------------cagc-----------------aattatgcattggctaga--------------
         D. sechellia  gccca------------cagc-----------------aattatgcattggctaga--------------
            D. yakuba  gccca------------cagc-----------------aattatgcattggctaga--------------
            D. erecta  gccca------------cagc-----------------aattatgcattggctaga--------------
         D. ananassae  gcccc------------cagt-----------------aagaatgcatggactgaa--------------
     D. pseudoobscura  gtccagatgctgaggcttagc-----------------agaaatgcattggctggaaggccgcccagagg
        D. persimilis  gtccagatgctgaggcttagc-----------------agaaatgcattggctggaaggccgcccagagg
        D. willistoni  aaata------------caga-----------------aattatgc------------------------
           D. virilis  aacaa------------caacaacaacaacagcagcagaaatatgcgttggctgaggaagcg--------
        D. mojavensis  aacta------------caataaaaacaacaacagcagaaatatgcgttggctgaggaagaa--------
         D. grimshawi  cgctg------------ttgt---------tgttgctgtaattcattctggccgc---------------
         A. mellifera  ======================================================================

      D. melanogaster  -ggcgatttgcagcaagcttag----agtgccagcg--------------------agcaactgcaacac
          D. simulans  -ggcggtttgcagcaagcttag----agtgccagcg--------------------agcaactgcaacac
         D. sechellia  -ggcgatttgcagcaagcttag----agtgccagcg--------------------agcaactgcaacac
            D. yakuba  -ggcgatctgcagcaagcttag----agtgccagcg--------------------agcaactgcgacac
            D. erecta  -ggcgatttgcagcaagcttag----agtgccagcg--------------------agcaactgcaacac
         D. ananassae  -ggct-cctgcagccacct--------------------------------------gcagcagcgccac
     D. pseudoobscura  cagcaacttgcagcaagcatag----aatg-cggca--------------------agagact--aacag
        D. persimilis  cagcaacttgcagcaagcatag----aatg-cggca--------------------agagact--aacag
        D. willistoni  -cgccatccg-------------------------------------------------------aagag
           D. virilis  -ggcaacatgcagcaacaacaacaacaacaacagcagcaatacacagcgtaacacgaacaacaacaaca-
        D. mojavensis  -ggcaacatgcagcaacagcaacaacaacaccaacaaca----acagc--------aaccacaacaacac
         D. grimshawi  ---cccaatacaacaacttcaacaacaacaccaacaacatca-acatc--------agcaactacagca-
         A. mellifera  ======================================================================

      D. melanogaster  ataacc-----------aa-----------------ac-----------------ca------tcaaaga
          D. simulans  ataacc-----------aa-----------------ac-----------------ca------tcaaaga
         D. sechellia  ataacc-----------aa-----------------ac-----------------ca------tcaaaga
            D. yakuba  ataacc-----------aa-----------------ac-----------------ca------tcaaaga
            D. erecta  ataacc-----------aa-----------------ac-----------------ca------tcaaaga
         D. ananassae  ataacc-----------catcacgttcacgatcacgat-----------------ca------ccacatc
     D. pseudoobscura  aaaaac-----------ca-----------------a----------------------------aaaaa
        D. persimilis  aaaaac-----------ca-----------------a----------------------------aaaaa
        D. willistoni  gtcacc-----------ga-----------------a---------------------------------
           D. virilis  acaactatttaccataata-----------------acagcaacaacaacaacaacaacatcttcatcaa
        D. mojavensis  acagct-----------ta-----------------acacgaacaacaacaacaaca------tcaaata
         D. grimshawi  acaggc-----------aa-----------------acaacgaacagcgcaacgcta-------------
         A. mellifera  ======================================================================

      D. melanogaster  c-ttgttgt-------tcat----------caac----tc--caacc--------cca-actccaagtcc
          D. simulans  c-ttgttgt-------tcat----------caac----tc--caacc--------cca-actccaagtcc
         D. sechellia  c-ttgttgt-------tcat----------caac----tc--caacc--------cca-actccaagtcc
            D. yakuba  c----ttgt-------tcat----------caac----tc--ctacc--------cca-actccaagtcc
            D. erecta  c----ttgt-------tcat----------caac----tc--caacc--------cca-actccaagtcc
         D. ananassae  c-acatcat-----catcat----------catccagatc--caatctcgaaagtcca-actccaagact
     D. pseudoobscura  c-acacaaa-------ccag----------cagc----acagcagca--------gcacacgaaaagaac
        D. persimilis  c-acacaaa-------ccag----------cagc----acagcagca--------gcacacgaaaagaac
        D. willistoni  ------cgt-------tca-------------------tc--tcact--------tct---tcaaatccc
           D. virilis  catcattatcataacaacag----------caac----at--aatcatct-----tca-tcatcaacaac
        D. mojavensis  c-tcaccataatagcaacagcatcaacaaacaac----at--aatcatct-----tca-tcttcattatc
         D. grimshawi  -------gtgaaacaaacaa----------caac----ac--aagca--------aca-acaacaagaac
         A. mellifera  ======================================================================

      D. melanogaster  acc-----aacactg-------------agcc--------------------------------accgcc
          D. simulans  acc-----aacactg-------------agcc--------------------------------accgcc
         D. sechellia  acc-----aacactg-------------agcc--------------------------------accgcc
            D. yakuba  acc-----aacactg-------------agcc--------------------------------accgcc
            D. erecta  acc-----aacactg-------------agcc--------------------------------accgcc
         D. ananassae  cca-----aacactg-------------a----------------------------------------c
     D. pseudoobscura  actgaatgaatactg-------------agcccgactctcgtttgcatcttccgcatcccgcatcccgta
        D. persimilis  actgaatgaatactg-------------agcccgactctcgtttgcatcttccgcatcccgcatcccgta
        D. willistoni  acc-------------------------------------------------------------------
           D. virilis  aac-----aacaacaac-----------agca--------------------------------acaact
        D. mojavensis  aac-----aacaacaac----------aaaca--------------------------------attgct
         D. grimshawi  aac-----agcagcagcgcttcacttgaagtc--------------------------------gccgct
         A. mellifera  ======================================================================

      D. melanogaster  tc
          D. simulans  tc
         D. sechellia  tc
            D. yakuba  tc
            D. erecta  tc
         D. ananassae  tc
     D. pseudoobscura  tc
        D. persimilis  tc
        D. willistoni  --
           D. virilis  gc
        D. mojavensis  gc
         D. grimshawi  gc
         A. mellifera  ==

Inserts between block 31 and 32 in window
          D. virilis 81bp
       D. mojavensis 92bp

Alignment block 32 of 217 in window, 829447 - 829755, 309 bps 
B D   D. melanogaster  ttgcctccag-----------gagcatcaccaggagc----------------------------atcag
B D       D. simulans  ttgcctccag-----------gagcagcaccaggagc----------------------------accag
B D      D. sechellia  ttgcctccag-----------gagcagcaccaggagc----------------------------accag
B D         D. yakuba  ttgcctccag-----------gagcagcaccaggagc----------------------------accag
            D. erecta  ttgcctccag-----------gagcagcaccaggagc----------------------------atcag
         D. ananassae  ttgcctccag-----------gagcagcagctgaa-----------------------------------
     D. pseudoobscura  ttgcatccatactacgcgcccaagcagcagctggagccggccaccgctagctaggcagctagggagctag
B D     D. persimilis  ttgcatccatactacgcgcacaagcagcagctggagccggccaccgctagctaggcagctagggagctag
        D. willistoni  -taccccc------------------gcagctggagc---------------------------------
           D. virilis  gtatcttcg------------acgcagcatttggggg------------------------------gag
        D. mojavensis  ttatcttcg------------aagcagcatttggagc------------------------------cag
         D. grimshawi  ttgtctccg------------aagcagc---caggcc------------------------------cat
B D        A. gambiae  ccaccaccac-----------cagccccatcagcagc---------------------------------
        A. mellifera  ======================================================================

      D. melanogaster  ggcagtcccagctgg-----aggagcaggaatccccccgcg------------gcgga-ggagcagc---
          D. simulans  ggcagtcccagctgg-----aggagcaggaatccccccgcg------------gcgga-ggagcagc---
         D. sechellia  ggcagtctcagctgg-----aggagcaggaatccccccgcg------------gcgga-ggagcagc---
            D. yakuba  ggcagtcccagctgg-----aggagcaggaatccccccgcg------------gcgga-ggagcagc---
            D. erecta  ggcagtcccagctgg-----aggagcaggaatccccccgcg------------gtgga-ggagcagc---
         D. ananassae  -------ccaactgg-----aggaccaggtatcccccccag------------gcgga-ggagcagc---
     D. pseudoobscura  gcaagcgcccgcaggagcgaaggaggaggaggccctt----------------gtggagggaggagc---
        D. persimilis  gcaagcgcccgcaggagcgaaggaggaggaggccctt----------------gtggagggaggagc---
        D. willistoni  --cggatctaatcgg------tgaaaaggagccacatcctt------------tcgag-tga--------
           D. virilis  ggcac--atcaatag-----gaatttgtgtgccccgtcgcgcttctcaagcc-attga-ggagcc-----
        D. mojavensis  cccat----------------------tgtgccccgtcgcgcttctcaagctgattga-ggagcc-----
         D. grimshawi  tgcac--ccaaggag----------------------ctcgctgctcaggcc-ataga-ggcgccacccc
           A. gambiae  agcac--ccaaatct-----gggtgcaaga-----ctagcg------------gcac--gtagtagc---
         A. mellifera  ======================================================================

      D. melanogaster  -----cagtctggaATGTTGGAACACCCCCAGCGGTTTGTGCGCAACATCCCCGA---CTCCTCAGCCAG
          D. simulans  -----cagtctggaATGTTGGAACACCCCCAGCGGTTCGTGCGCAACATCCCCGA---CTCCTCAGCCAG
         D. sechellia  -----cagtctggaATGTTGGAACACCCCCAGCGGTTCGTGCGCAACATCCCCGA---CTCCTCAGCCAG
            D. yakuba  -----cagtctggaATGTTGGAACACCCCCAGCGGTTCGTGCGCAACATCCCCGA---CTCCTCAGCCAG
            D. erecta  -----cagtctggaATGTTGGAACACCCCCAGCGGTTCGTGCGCAACATCCCCGA---CTCCTCAGCCAG
         D. ananassae  -----cagtctggaATGTTGGAACACCCCCAGCGGTTCGTGCGCAACATCCCCGA---CTCCTCAGCCA-
     D. pseudoobscura  -----tagtctggaATGTTGGAACACCCACAGCGGTTCGCGCGTAACATCCCCGA---CTCCTCAAACA-
        D. persimilis  -----tagtctggaATGTTGGAACACCCACAGCGGTTCGCGCGTAACATCCCCGA---CTCCTCAAACA-
        D. willistoni  -----ttctgtggaATGTTGGAATATCCACAGAGATTCGCACGCAGCATCCCCGA---CTCCTCAATAA-
           D. virilis  -----cacactggaATGTTGGAATACCCACAGCGATTCGCGCGCAACATCCCCAACTCCTCCTCTGGCA-
        D. mojavensis  -----cacagtggaATGTTGGAATACCCACAGCGATTCGCGCGCAACATCCCCAA---TTCCTCTGGCA-
         D. grimshawi  gcccacccagtggaATGTTGGAATATCCACAGCGATTTGCGCGCAACATCCCCAA---TTCCTCTGGCA-
           A. gambiae  -----ggaagtagaGAGCAGCAGCAGCAGCAGCAGCACCACCACAATCACCACCT---GAACACGGTCGG
         A. mellifera  ======================================================================

      D. melanogaster  TTCGCAGCAGTATCC-------GCAGC-AGCAGCAGC----------ATCCGCCACAGCTGCCGCAGCAC
          D. simulans  TTCGCAGCAGTATCC-------GCAGC-AGCAGCAGC----------ATCCGCCACAGCTGCCGCAGCAC
         D. sechellia  TTCGCAGCAGTATCC-------GCAGC-AGCAGCAGC----------ATCCGCCACAGCTGCCGCAGCAC
            D. yakuba  TTCGCAGCAATATCC----------GC-AGCAGCAGC----------ATCCGCCACAGCTGCCGCAGCAC
            D. erecta  TTCGCAGCAATATCC----------GC-AGCAGCAGC----------ATCCGCCACAGCTGCCGCAGCAC
         D. ananassae  ---GCAGCAGCAGCA-------GCAGCTCGCAACAGT----------ATCCGCCACAGCTGCCGCAGCAC
     D. pseudoobscura  ---GCAGCAGTGCTCATCAGCAGCAGC-AGCAGCAGT----------ATCCGCCGCCGCCGCCGCAGCAT
        D. persimilis  ---GCAGCAGTGCTCATCAGCAGCAGC-AGCAGCAGT----------ATCCGCCGCCGCCGCCGCAGCAT
        D. willistoni  ---GCAGCAGTAGCA-------GCATA-AGCAGTGGCTCCCATCCATATCCGCCTCAACTGCCTCAGCAT
           D. virilis  -ACGCA---------------AATAGCTCGCCGCAGT----------ATCCGCCACAGCTGCCGCAGCAC
        D. mojavensis  -ACGCA-------------------------------------------CCGCCACAGCTGCCGCAGCAT
         D. grimshawi  -ACGCAGCAACAGCT------ACGAGCTCGCCGCAGT----------ATCCACCGCAGCTGCCGCAGCAT
           A. gambiae  TCTGCAGCACTACCA----CCATCAAC-AGCAGCAGC----------AGCAGCAGCATTTGGTAGTGCAT
         A. mellifera  ======================================================================

      D. melanogaster  CAG------AATCTGAATCTCAACCAGAATCAGAACCTGAACCAGAATCAGATCTACCAGTACCGTCCCC
          D. simulans  CAG------AATCTGAATCTCAACCAGAATCAGAACCTGAACCAGAATCAGATCTACCAGTACCGTCCCC
         D. sechellia  CAG------AATCTGAATCTCAACCAGAATCAGAACCTAAACCAGAATCAGATATACCAGTACCGTCCCC
            D. yakuba  CAG------AATCTGAATCTCAACCAGAATCAGAACCAGAACCAGAAACAGATCTACCAGTACCGTCCCC
            D. erecta  CAGAATCTTAATCTGAATCTCAACCAGAATCAGAACCAGAACCAGAATCAGATCTACCAGTACCGTCCCC
         D. ananassae  CAG------AACCTGAATCTCAACCAGAAT------------------CAGATCTACCAGTACCGCCCTC
     D. pseudoobscura  CAG------AATCTGAATCTCAATCAGAATCAAAAC------------CAGATCTACCAGTACCGTCCGC
        D. persimilis  CAG------AATCTGAATCTCAATCAGAATCAAAAC------------CAGATCTACCAGTACCGTCCGC
        D. willistoni  CAG------AATTTAAATCC------GAATCAGAACTATCAGCAGCAGCAGCAGCATCAATACCGTCCTC
           D. virilis  CAG------AA------------------------------------------CTATCAGAGCTGTCGTC
        D. mojavensis  CAG------AA------------------------------------------CTATCAGAGCTGTCGCC
         D. grimshawi  CAA------AA------------------------------------------CTATCCAAGTTGT----
           A. gambiae  CAT------CATC---------ATCAAGGTCAGCAGCAGTTGGCGCAGCAACACTACACGCTACATTCCC
         A. mellifera  ======================================================================

      D. melanogaster  AGGTGCCCGTGCCCGTTCCCGGCTCACCTGCCCATCACCAGCGGCACTCTT
          D. simulans  AGGTGCCCGTGCCCGTTCCCGGCTCACCTGCCCACCACCAGCGGCACTCTT
         D. sechellia  AGGTGCCCGTGCCCGTTCCCGGCTCACTTGCCCACCACCAGCGGCACTCTT
            D. yakuba  AGGTGCCCGTGCCCGTTCTCGGCTCACCTGCCCACCACCAGCGGCACTCTT
            D. erecta  AGGTGCCTGTGCCCGTTCCCGGCTCACCTGCCCACCACCAGCGCCACTCTT
         D. ananassae  AGGTACCAGTACCCGTACCAGGCTCTCCTGCCCACCATCAGCGGCACTCGT
     D. pseudoobscura  AGGCGCAGGCACCT------GGATCGCCGGCGCACCATCAGCGCCACTCGT
        D. persimilis  AGGCGCAGGCACCT------GGATCGCCGGCGCACCATCAGCGCCACTCGT
        D. willistoni  AG---------------------TCGCCGGCGAATCATCAGCGTCACGCAT
           D. virilis  AATTG---GCACCT------GGCTCGCCTGCTCATCATCAGCGACACTCTT
        D. mojavensis  AATTG---GCACCG------AACTCACCTGCTCATCACCAGCGTCACTCTT
         D. grimshawi  --------------------GCCTCACCAGTGCATCATCAGCGACACTCTT
           A. gambiae  AGCAG---ATTCCC------CATTATTCTGCCCAGCAACAGCAACACTTTC
         A. mellifera  ===================================================

Alignment block 33 of 217 in window, 829756 - 829939, 184 bps 
B D   D. melanogaster  CGCTCTC------CCA---------------------------GCAACAGCAGTTGCA------------
B D       D. simulans  CGCTCTC------CCA---------------------------GCAACAGCAGTTGCA------------
B D      D. sechellia  CGCTCTC------CCA---------------------------GCAACAGCAGTTGCA------------
B D         D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  CGCTCTC------CCA---------------------------GCAACAGCAGTTGCA------------
         D. ananassae  CGCTCTC------CAA---------------------------GCAGCAGCAGCAGCAGCAGCAACAGCA
     D. pseudoobscura  CGCTCTC------CCA---------------------------GCAGCAGCAGCAGCAACAGCAGCAGCA
B D     D. persimilis  CGCTCTC------CCA---------------------------GCAGCAGCAGCAGCAACAGCAGCAGCA
        D. willistoni  CGCTATC------CCA---------------------------GCAGCAGCAGCAGCA------------
           D. virilis  CGCTCTCGCATCACCAACACCAACAACAACAACAGCAGCAGCAGCAGCAGCAACTGCAACTGCAACAGCA
        D. mojavensis  CGCTGTC------CCAGCAGCAACAACAACTGCAACAGCAACTGCAACAGCAGCAGCAGCAGCAGCAGCA
         D. grimshawi  CGCTCCA------ACAGCAACAACAACAGCAACAACAACAACTGCAACAACAATTGCAACAGCAACAGCA
B D        A. gambiae  ATCACTA------CCA---------------------------GCAGCAGCAGCAGCATCTGC-------
        A. mellifera  ======================================================================

      D. melanogaster  ------------CCACCACCGCACCCTGTCCACCGCCTCCTCCTGCAGCGCC---CAGCACAAAAGTGTG
          D. simulans  ------------CCACCACCGCACCCTGTCCACCGCCTCCTCCTGCAGCGCC---CAGCACAAAAGTGTG
         D. sechellia  ------------CCACCACCGCACCCTGTCCACCGCCTCCTCCTGCAGCGCC---CAGCACAAAAGTGTG
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  ------------CCACCACCGCACCCTGTCCACCGCCTCCTCCTGCAGCGCC---CAGCACAAAAGTGTG
         D. ananassae  GCAG---CAGCTACATCACCGCACCCTGTCCACCGCCTCCTCGTGCAGTGCC---CAGCACAAAAGTGTG
     D. pseudoobscura  GCAGCTACAGCTGCACCATCGCACCCTGTCGACCGCCTCCAGCTGTAGTGCC---CAGCACAAAAGTGTG
        D. persimilis  GCAGCTACAGCTGCACCATCGCACCCTGTCGACCGCCTCCAGCTGCAGTGCC---CAGCACAAAAGTGTG
        D. willistoni  ---------------TCATCGCACCCTGTCGACGGCCTCCAGTTGCAGTGTC---CAGCACAAGAGTGTG
           D. virilis  GCACTCGCTGCAACATCATCGCACACTGTCGACCGCCTCCAGTTGCAGTGCC---CAGCACAAAAGTGTG
        D. mojavensis  GCTCTCGCTGCAGCATCATCGCACTCTGTCGACCGCCTCCAGCTGCAGTGCC---CAGCACAAAAGTGTG
         D. grimshawi  GCAATCGCTGCAGCATCATCGCACACTGTCGACAGCCTCCAGCTGCAGTGCCCAGCAGCACAAAAGTGTG
           A. gambiae  ---------------CGACGGCGGCCCATCCACC----CCAACTGCTCCATC---AGCAACAACAGTTTG
         A. mellifera  ======================================================================

      D. melanogaster  ACCTTCGGCCAGCCAG---------------------CGCTC---GACT------GCGGCGGCAACGGCA
          D. simulans  ACCTTCGGCCAGCCAG---------------------CGCTC---GACT------GCGGCGGCAACGGCA
         D. sechellia  ACCTTCGGCCAGCCAG---------------------CGCTC---GACT------GCGGCGGCAACGGCA
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  ACCTTCGGCCAGCCAG---------------------CGCTC---GACT------GCGGCGGCAACGGCA
         D. ananassae  ACCTTCGGCCAACCAG---------------------CGCTC---GACT---------GCGGCAACGGCA
     D. pseudoobscura  ACCTTCGGCCAGCCAG---------------------CGATC---GATT---------ACAGCAACGGCG
        D. persimilis  ACCTTCGGCCAGCCAG---------------------CGATC---GATT---------ACAGCAACGGCG
        D. willistoni  ACTTTTGGCCAGCCGC---------------------CCATC---GACTACATTTGCAGTGGCAACGGCA
           D. virilis  ACCTTTGGCCAGCCAGCGAGCAGCGGCTGCCCGGCGCCGATC---GACT---------ACAGCAACGGCG
        D. mojavensis  ACCTTTGGCCAGCCAGCGAGCAGCGGCTGCCCGGTGCCGATC---GACT---------ACAGCAACGGGG
         D. grimshawi  ACCTTCGGCCAGCCAGCGAACAGCGGCTGCCCGGCGCCGATCATTGACT---------ACAACAACGGCG
           A. gambiae  -CTGTGGGCGAGCCAA---------GTGGTCTG----CACCT---GAC----------GCAGCAGCAGCA
         A. mellifera  ======================================================================

      D. melanogaster  GCGGA-------AGCGCCAACGGAAGCGGTAGCG-------GCAACTCCTCCAGTGGCAGTGCCGCCG--
          D. simulans  GCGGA-------AGCGCCAACAGAAGCGGTAGCG-------GCAACTCCTCCAGTGGCAGTGCCGCCG--
         D. sechellia  GCGGA-------AGCGCCAACGGAAGCGGTAGCG-------GCAACTCCTCCAGTGGCAGTGCCGCCG--
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  GCGGT-------AGCGCCAACGGAAGCGGTAGCG-------GCAACTCCTCCAGTGGCAGTGCCGCCG--
         D. ananassae  GCGGA-------GGCGCCAACGGAAGCGGGTGCT-------ACA--------------------------
     D. pseudoobscura  GCGGC-------------------AGCAGCAGCG-------GTAACTCCTCCAGTTGCAGCGCCGCTG--
        D. persimilis  GCGGC-------------------AGCAGCAGCG-------GTAACTCCTCCAGTTGCAGCGCCGCTG--
        D. willistoni  GCGGC--------------AAAGAATCA------------------------------------------
           D. virilis  GC----------------------AGCAGCAGCG-------GTAA---CTCCAGTTGCAGCGCCGGAACT
        D. mojavensis  GC----------------------AGCAGCAGCG-------GTAA---CTCCAGTTGCA-----------
         D. grimshawi  GC----------------------AGCAGCAGCG-------GCAA---CTCCAGTTGCAGCGCCGGCACG
           A. gambiae  GCAGTACGAAGTAGCGTCGCCG--AGCGGTGGCACGGCGATACAACAGCCGCAGCAACAGCAGCAGCA--
         A. mellifera  ======================================================================

      D. melanogaster  ----GCAACGCTGG
          D. simulans  ----GCAACGCTGG
         D. sechellia  ----GCAACGCTGG
            D. yakuba  NNNNNNNNNNNNNN
            D. erecta  ----GCAACGCTGG
         D. ananassae  ----GCAACACTGG
     D. pseudoobscura  ----GCAACGCTGG
        D. persimilis  ----GCAACGCTGG
        D. willistoni  ------AACGCTGG
           D. virilis  G---GCAACGCTGG
        D. mojavensis  ----GCAACGCTGG
         D. grimshawi  GCCAACAACGCTGG
           A. gambiae  ----GCAGCACGGG
         A. mellifera  ==============

Alignment block 34 of 217 in window, 829940 - 829976, 37 bps 
B D   D. melanogaster  AAC------CCAATCAATGGCGGGCAACATGAAGCACGgtgag
B D       D. simulans  AAC------CCAATCAATGGCGGGCAACATGAAGCACGgtgag
B D      D. sechellia  AAC------CCAATCAATGGCGGGCAACATGAAGCACGgtgag
B D         D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  AAC------CCAATCAATGGCGGGCAACATGAAGCACGgtgag
         D. ananassae  AAC------CCAACCAATGGCGGGAAACATGAAGCACGgtgag
     D. pseudoobscura  ACC------CCAATCAATGGCGGGCAACATGAAGCACGgtaag
B D     D. persimilis  ACC------CCAATCAATGGCGGGCAACATGAAGCACGgtaag
        D. willistoni  ACCAACACAACAATCAATGGCGGGCAACATGAAGCACGgtaag
           D. virilis  ACA------GCAATCAATGGCGGGCAACATGAAGCACGgtgag
        D. mojavensis  ACC------ACAATCAATGGCGGGCAACATGAAGCACGgtaag
         D. grimshawi  ACA------ACAATCAATGGCGGGCAACATGAAGCACGgtgag
        A. mellifera  ===========================================

Inserts between block 34 and 35 in window
        D. ananassae 29bp
       D. mojavensis 11bp
        D. grimshawi 493bp

Alignment block 35 of 217 in window, 829977 - 830003, 27 bps 
B D   D. melanogaster  caactgcaacacaataacctcacagcg-------------
B D       D. simulans  caactgcaacacaataacctcacagcg-------------
B D      D. sechellia  caactgcaacacaataacctcacagcg-------------
B D         D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  caactgcagcacagtagcctcacagcg-------------
        D. ananassae  ========================================
    D. pseudoobscura  ----------------------------------------
B D     D. persimilis  ----------------------------------------
       D. willistoni  ----------------------------------------
           D. virilis  -------------ttctgcccacaatataccctc------
        D. mojavensis  -------------tcattatcataatata-----ccatag
        D. grimshawi  ========================================
        A. mellifera  ========================================

Inserts between block 35 and 36 in window
          D. virilis 251bp

Alignment block 36 of 217 in window, 830004 - 830077, 74 bps 
B D   D. melanogaster  agaagagcattgggtgtagtaaaaggatctaggatt----------------------------------
B D       D. simulans  agaaaagcattgggtgtagtaaaacaatctaggatt----------------------------------
B D      D. sechellia  agaaaagcattgggtgtagtaaaacaatctaggatt----------------------------------
B D         D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  agaagagcattgggcttagtataaagatctgggattcgtagagctgtttgtaaacggtgcagcggtcgac
        D. ananassae  ======================================================================
     D. pseudoobscura  ----------------------------------------------------------------------
B D     D. persimilis  ----------------------------------------------------------------------
        D. willistoni  ----------------------------------------------------------------------
           D. virilis  agaataaaattgagacaacaaaaag---------tt----------------------------------
        D. mojavensis  gggcaaacatagagcaaagaagaag---------------------------------------------
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================

      D. melanogaster  ------------------------------tgtatgctaatgaatttgtggttctatcatactggccc--
          D. simulans  ------------------------------tttatgctaacgaaattgaggttctgtcatactggccc--
         D. sechellia  ------------------------------tttatgctaacgaaattgaggttctgtcatactggccc--
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  agatacgaatgctgcaccgttaacaatcactttatgctacggaacttgaggt----tcattctggtcc--
         D. ananassae  ======================================================================
     D. pseudoobscura  --------------------------------------------cttgagg----------ctgatac--
        D. persimilis  --------------------------------------------cttgtgg----------ctgacac--
        D. willistoni  ------------------------------------------------------ggttaaatcgaccc--
           D. virilis  --------------------------------------------attagttttcgattatgttcagcca-
        D. mojavensis  --------------------------------------------attgattttaatatatatcgagcaaa
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================

      D. melanogaster  ----------------------------
          D. simulans  ----------------------------
         D. sechellia  ----------------------------
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  ----------------------------
         D. ananassae  ============================
     D. pseudoobscura  ----------------------------
        D. persimilis  ----------------------------
        D. willistoni  ----------------------------
           D. virilis  ---ttttgtgg---------acttgccc
        D. mojavensis  tggatctctagataaaacat--------
         D. grimshawi  ============================
         A. mellifera  ============================

Inserts between block 36 and 37 in window
       D. mojavensis 567bp

Alignment block 37 of 217 in window, 830078 - 830114, 37 bps 
B D   D. melanogaster  attttgcttttct-----------aactgt--gtgtgcacttggtactct----
B D       D. simulans  attttgcttttct-----------aactgt--gtgtgcacttggtgcttt----
B D      D. sechellia  attttgcttttct-----------aactgt--gtgtgcacttggtgcttt----
B D         D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  aatttgcttttct-----------tactgt--gtgtgcacttggtacttt----
        D. ananassae  ======================================================
     D. pseudoobscura  at------------------------ccat--cgggacact-------------
B D     D. persimilis  at------------------------ccat--cgggacact-------------
        D. willistoni  tccctcccttccttcctccctcgaaacatt--gtgaacatatcgaattaa----
           D. virilis  -------atatac-----------aaatacaaaaatgatctttaaacggaacac
       D. mojavensis  ======================================================
         D. grimshawi  atttattatttat-----------aaatat--ttatgtattttgcatg----ac
        A. mellifera  ======================================================

Inserts between block 37 and 38 in window
    D. pseudoobscura 1bp
B D    D. persimilis 1bp
          D. virilis 7bp
        D. grimshawi 13bp

Alignment block 38 of 217 in window, 830115 - 830130, 16 bps 
B D   D. melanogaster  t-----------------ctaacctg-------tt----cctgt
B D       D. simulans  t-----------------ctaaccc--------tt----cctgt
B D      D. sechellia  t-----------------ctaaccc--------tt----cctgt
B D         D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  tctaagagccgaaccaaactaattt--------ct----tccgt
         D. ananassae  t-----------------ctaatcc--------tt----ct---
     D. pseudoobscura  t-----------------ataaactg--t---ttc----cttct
B D     D. persimilis  t-----------------ataaactg--t---ttc----cttct
        D. willistoni  ----------------------------ttgattt----ttcat
           D. virilis  --------------------aaactgaat----tt----cttta
        D. mojavensis  --------------------aatctgttc----tt----ttttt
         D. grimshawi  --------------------aaaacgcac----ttcacacttta
        A. mellifera  ============================================

Alignment block 39 of 217 in window, 830131 - 830355, 225 bps 
B D   D. melanogaster  taatcactccgcagGCAAA---TCT---CAG-GACGACGTCTGCTACGTGGTAGCCAAGTACGACTATGC
B D       D. simulans  tactcaatccgcagGCAAA---TCT---CAG-GACGACGTCTGCTACGTGGTAGCCAAGTACGACTATGC
B D      D. sechellia  tactcaatccgcagGCAAA---TCT---CAG-GACGACGTCTGCTACGTGGTAGCCAAGTATGACTATGC
B D         D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  tatccaacccgcagGCAAA---TCT---CAG-GACGACGTCTGCTACGTGGTAGCCAAGTACGACTATGC
         D. ananassae  --ctccgttcgcagGCAAA---TCT---CAG-GAAGACGTCTGCTACGTGGTAGCCAAGTATGACTATGC
     D. pseudoobscura  tcgctgattcacagGCAAA---TCT---CAG-GAAGACGTCTGCTACGTGGTAGCCAAGTACGATTATGC
B D     D. persimilis  tcgctgattcacagGC-AA---TCT---CAGTGAAGACGTCTGCTACGTGGTAGCCAAGTACGATTATGC
        D. willistoni  tcttcatttgctagGCAAA---TCC---CAG-GAAGATGTCTGCTACGTTGTAGCCAAATATGATTATGC
           D. virilis  taa--------cagGCAAA---TCT---CAG-GAAGACGTTTGCTACGTGGTAGCCAAATATGATTATGC
        D. mojavensis  tgagtaattc-cagGCAAA---TCT---CAG-GAAGACGTTTGCTACGTAGTAGCCAAATATGATTATGC
         D. grimshawi  ttg--------cagGCAAA---TCT---CAG-GAAGACGTTTGCTACGTGGTAGCCAAATATGATTATGC
B D        A. gambiae  ----------------------TTT---TTA-GAGGATGTCTGCTACGTGGTAGCAAAGTACGATTACGA
         A. mellifera  taaccatttt-cagGCAAGACAAGT---CAA-GACGACGTATGCTATGTTGTCGCCAAATATGACTATGG
         T. castaneum  ------------agGCAAA---ACTGGGCAA-GATGACATTTGCCATGTTGTGGCCAAGTACGATTACGC

      D. melanogaster  GGCGCAGGGTGCCCAGGAGCTGGATCTGCGCAAGAACGAGCGCTACCTGCTGCTGGACGACTCCAAGCAC
          D. simulans  GGCGCAGGGTGCCCAGGAGCTGGATCTGCGCAAGAACGAGCGCTACCTGCTGCTGGACGACTCCAAGCAC
         D. sechellia  GGCGCAGGGTGCCCAGGAGCTGGATCTGCGCAAGAACGAGCGCTACCTGCTGCTGGACGACTCCAAGCAC
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  GGCGCAAGGTGCCCAGGAGCTGGATCTGCGCAAGAACGAGCGCTATCTGCTGCTAGACGACTCTAAGCAC
         D. ananassae  GGCGCAAGGGGCCCAGGAGCTGGATCTGCGCAAGAACGAGCGCTACCTGCTGCTGGACGACTCGAAGCAT
     D. pseudoobscura  GGCGCAGGGTGCCCAGGAGCTGGACCTGCGCAAGAACGAGCGCTATCTTCTGCTGGACGACTCGAAGCAC
        D. persimilis  GGCGCAGGGTGCCCAGGAGCTGGACCTGCGCAAGAACGAGCGCTATCTTCTGCTGGACGACTCGAAGCAC
        D. willistoni  CGCACAAGGAGCCCAGGAGTTGGATCTACGCAAGAATGATCGTTATCTATTGTTGGATGATTCCAAGCAT
           D. virilis  AGCCCAGGGCGCTCAGGAGTTGGATTTGCGGAAGAACGAGCGCTATTTGCTGCTGGATGATTCCAAGCAT
        D. mojavensis  AGCCCAGGGCGCTCAGGAGCTGGATTTGCGGAAGAACGAGCGCTATTTGCTGCTGGATGACTCCAAGCAC
         D. grimshawi  AGCCCAGGGTGCACAGGAGCTGGATCTGCGCAAGAATGAGCGCTATCTGCTGCTGGATGACTCCAAGCAC
           A. gambiae  GGCACAGGGTGCCCAGGAGCTAGATCTGAGGAAAAACGATCGTTATCTTCTGCTGGACGACAGCAAGCAC
         A. mellifera  AGCACAAGGTGCTCAAGAATTAGATTTACGTAAAAATGAACGTTACTTGCTTCTTGATGATTCTAAACAC
         T. castaneum  CGCACAGGGCCCCCAGGAGCTCGACCTCAGGAAGAACGAGCGCTATTTGCTCCTCGACGACTCCAAGCAT

      D. melanogaster  TGGTGGCGCGTCCAGAACAGTCGCAACCAGTCCGGCTACGTGCCAAGCAACTATGTGAAGAAGGAGAAGC
          D. simulans  TGGTGGCGCGTCCAGAACAACCGCAACCAGTCCGGCTACGTGCCAAGCAACTATGTGAAGAAGGAGAAGC
         D. sechellia  TGGTGGCGCGTCCAGAACAGTCGCAACCAGTCCGGCTACGTGCCAAGCAACTATGTGAAGAAGGAGAAGC
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  TGGTGGCGCGTCCAGAACAGCCGCAACCAGTCCGGCTACGTGCCCAGCAACTATGTGAAGAAGGAGAAAC
         D. ananassae  TGGTGGCGCGTCCAGAACAGCCGCAACCAGTCCGGCTATGTGCCCAGCAACTACGTTAAGAAGGAGAAGC
     D. pseudoobscura  TGGTGGCGTGTCCAGAACAGCCGCAACCAGTCCGGCTACGTGCCCAGCAACTATGTGAAGAAGGAGAAGC
        D. persimilis  TGGTGGCGTGTCCAGAACAGCCGCAACCAGTCCGGCTACGTGCCCAGCAACTATGTGAAGAAGGAGAAGA
        D. willistoni  TGGTGGCGAGTCCAAAACAATCGCAATCAATCCGGCTATGTGCCAAGCAATTATGTCAAAAAGGAGAAGC
           D. virilis  TGGTGGCGCGTCCAGAACAGTCGCAATCAATCCGGCTATGTGCCCAGCAACTATGTGAAGAAGGAGAAGC
        D. mojavensis  TGGTGGCGCGTCCAAAACAGTCGCAATCAGTCCGGCTATGTGCCCAGCAACTATGTGAAGAAGGAGAAGC
         D. grimshawi  TGGTGGCGTGTACAGAACAGTCGCAATCAGTCCGGCTATGTACCCAGCAATTATGTGAAGAAGGAGAAGC
           A. gambiae  TGGTGGAGGGTGCAGAATACACGCAATCAGTCGGGTTACGTGCCGAGTAACTACGTTAAGAAGGAGAAAA
         A. mellifera  TGGTGGAGAGTACAAAGTGCACGAGGGCAAGCTGGTTATGTGCCAAGTAATTATGTCAAGAAAGAAAAAC
         T. castaneum  TGGTGGAAAGTGCAGAATTCGAGAAATCAAGCCGGTTATGTGCCAAGCAACTATGTTAAGAAAGAGAAAC

      D. melanogaster  ------CCTCGCTCTTCGACAGgtgcgt
          D. simulans  ------CCTCGCTCTTCGACAGgtgcgt
         D. sechellia  ------CCTCGCTCTTCGACAGgtgcgt
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  ------CCTCGCTCTTCGACAGgtgcgt
         D. ananassae  ------CCTCGCTCTTCGACAGgtgcgt
     D. pseudoobscura  ------CCTCGCTCTTCGACAGgtgcgt
        D. persimilis  ------CCTCGCTCTTCGACAGgtgcgt
        D. willistoni  ------CTTCGCTTTTCGACAGgtgtgt
           D. virilis  ------CCTCGCTCTTCGACAGgtgcgt
        D. mojavensis  ------CCTCGCTCTTCGACAGgtgcgt
         D. grimshawi  ------CATCGCTCTTCGACAGgtgcgt
           A. gambiae  AATCTGTCTCACTGTTCGA---------
         A. mellifera  ------CATCTCTTTTTGA---------
         T. castaneum  ------CGTCACTTTTTGATAG------

Inserts between block 39 and 40 in window
    D. pseudoobscura 14bp
B D    D. persimilis 14bp
       D. willistoni 41bp
        D. grimshawi 157bp
        T. castaneum 3360bp

Alignment block 40 of 217 in window, 830356 - 830373, 18 bps 
B D   D. melanogaster  --------------------------------------------------------cagattcc------
B D       D. simulans  --------------------------------------------------------cagattcc------
B D      D. sechellia  --------------------------------------------------------c--attcc------
B D         D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  --------------------------------------------------------cagattcc------
         D. ananassae  --------------------------------------------------------ccgaatcc------
     D. pseudoobscura  --------------------------------------------------------caagcccc------
B D     D. persimilis  --------------------------------------------------------caagcccc------
        D. willistoni  --------------------------------------------------------ccaactca------
           D. virilis  gttgcccccccccggttttcggttgcagagcaattccattcagcccattcaacgagtaaaactcaaaaaa
        D. mojavensis  at-------------------gttg----------------------tccaacgtatgaacctc------
        D. grimshawi  ======================================================================
B D        A. gambiae  ----------------------------------------------------------------------
        A. mellifera  ----------------------------------------------------------------------
        T. castaneum  ======================================================================

      D. melanogaster  --------------------------------------tgg--------------cccg--act
          D. simulans  --------------------------------------tgg--------------cccg--act
         D. sechellia  --------------------------------------tgg--------------cccg--act
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  --------------------------------------tgg--------------gccg--act
         D. ananassae  --------------------------------------tggcctcggtccacgtccctg--act
     D. pseudoobscura  --------------------------------------gag--------------tccgcaact
        D. persimilis  --------------------------------------gag--------------tccgcaact
        D. willistoni  --------------------------------------acg--------------tcctgaact
           D. virilis  aaaaaaaacaagaaatgtgtatatagctatg-------aga--------------actc--act
        D. mojavensis  ------------cactgtgtataccattatgaaaaaaaaaa--------------actc--act
         D. grimshawi  ================================================================
           A. gambiae  ----------------------------------------------------------------
         A. mellifera  ----------------------------------------------------------------
         T. castaneum  ================================================================

Inserts between block 40 and 41 in window
          D. virilis 1bp
       D. mojavensis 9bp

Alignment block 41 of 217 in window, 830374 - 830398, 25 bps 
B D   D. melanogaster  aaacctaagcg------ttcttcttgctctg
B D       D. simulans  aaacctaagcg------ttcttcttgctctg
B D      D. sechellia  aaacctaagcg------ttcttcttgctctg
B D         D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  aaatctaagcg------ttcttcttgctctg
         D. ananassae  aaacctaagcg------ttcttcttgctctg
     D. pseudoobscura  aaacttaagcc------ttcttcttgctctg
B D     D. persimilis  aaacttaagcc------ttcttcttgctctg
        D. willistoni  aaatttaagtaaatttttctcttttgttccc
           D. virilis  aaatttaagta------ttctttttattccg
        D. mojavensis  aaatttaagta------ttctttttattctg
         D. grimshawi  aaattcaagta------ttctttttattctg
B D        A. gambiae  -------------------------------
        A. mellifera  -------------------------------
        T. castaneum  ===============================

Alignment block 42 of 217 in window, 830399 - 830580, 182 bps 
B D   D. melanogaster  a-tttcagcag-aattaagccctc---ta-----------------tacctgtatctgtatccg------
B D       D. simulans  a-tttcagcag-aattttgccctc---ta-----------------tatctgtatctgtatccg------
B D      D. sechellia  a-tttcagcag-aaattttccctc---ta-----------------tatctgtatctgtatccg------
B D         D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  a-tttcagcag-aattaagccctc---ta-----------------tatctgtatctgtatccg------
         D. ananassae  a-tttcagcag-aactaagctctc---ag-----------------tatctctatttgtatctg------
     D. pseudoobscura  a-tttcagcag-tattaagatctctttta-----------------tatccacaaatatatccg------
B D     D. persimilis  a-gttcagcag-tattaagatctctttta-----------------tatctacaaatatatccgtatcta
        D. willistoni  attttcagcag-aagagagaaaat---gt-----------------tgtttgcctacatttttg------
           D. virilis  a-tttcagcagaaaaaaagatacc---aaa----------------aactgaaaaatatgtcga------
        D. mojavensis  a-tttcagcag-aaataagctact---aa----------------------aaaaatatgtcga------
         D. grimshawi  a-tttcagcag-aaataagaaacc---aaaaaaaaaaaaaaaaaccaaaaaaaaaacaaaacaa------
B D        A. gambiae  ----------------------------------------------------------------------
         A. mellifera  a-ttttaaaaa-atttaaactcaa---ta-----------------tggatgaattt---ttta------
        T. castaneum  ======================================================================

      D. melanogaster  t-------------------atccgtagatgtatctgtatctct----atcgcgttcaa-a---------
          D. simulans  t-------------------atccgtagatgtatctgtatctct----atcgcgttcaa-a---------
         D. sechellia  t-------------------atccgtagatgtatctgtatctct----atcgcgttcaa-a---------
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  t-------------------atccgtagatgtatctg------t----atcgcgttcaa-a---------
         D. ananassae  tatctgtatctgaaaatttaatccgtagacgtatctgtatccgtactaaccgcctcctg-acctcctgac
     D. pseudoobscura  t-------------------atctttatctgtatctgtagaagt----atctct----------------
        D. persimilis  t-------------------atctgtatctgtatctgtagaagt----atctct----------------
        D. willistoni  c-------------------ttt----------tttgtagcatt----tttttgtttgt-a---------
           D. virilis  g--------------------------------tttgt-----t----ttctactccaact---------
        D. mojavensis  g--------------------------------tttgt-----t----ttctactccaaat---------
         D. grimshawi  g--------------------------------tttgt-----t----tccttctccta-t---------
           A. gambiae  ----------------------------------------------------------------------
         A. mellifera  t-------------------attttttcttataattattttttt----acctggtaaag-t---------
         T. castaneum  ======================================================================

      D. melanogaster  -------tacccgcctcca------ccttttgctttggctatcgtaatttaactt---------------
          D. simulans  -------tacccgcctcca------ccttttgctttggttatcgtaatttaactt---------------
         D. sechellia  -------tacccgccttca------ccttttgctttggttatcgttatttaacct---------------
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  -------tacccgcctcca------ccttttgctttggttatcgtaatttaactt---------------
         D. ananassae  ctcctgccctccacctcct------cctcctcctgcgccttcccctacttagctttggttacctacctga
     D. pseudoobscura  -------ttcccactcctt------ggttttgctttgattattgtactttatgttt--------------
        D. persimilis  -------ttcccattcctt------ggttttgctttgattattgtactttatctct--------------
        D. willistoni  -------aacatatttttg------gctttt----------------------tt---------------
           D. virilis  -------cttttgctttct--------tcttg-------------taattagttt---------------
        D. mojavensis  -------attttgctttct--------tcttgaaattagt-tctccaactgcttt---------------
         D. grimshawi  -------tttatgctttctaatctctctctcgtattatgtattgtaaattaattt---------------
           A. gambiae  ----------------------------------------------------------------------
         A. mellifera  -------ttttgaaattgg------ttttttgttctcgattttattaagt--ttt---------------
         T. castaneum  ======================================================================

      D. melanogaster  -at--------------------aactgcttt-cggct---tt--------tgtatt------------t
          D. simulans  -at--------------------aactgcttt-cggct---tt--------tgtatt------------t
         D. sechellia  -tt--------------------aactgcttt-cggct---tt--------tgtatt------------t
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  -at--------------------aactgcttt-cggct---tt--------tgtatt------------t
         D. ananassae  gat--------------------tactgcttt-cggct---tt--------tgtatt------------t
     D. pseudoobscura  -cc--------------------aactgcttt-cggct---tttgtatttctgtatt------------t
        D. persimilis  -cc--------------------aactgcttt-cggct---tttgtatttctgtatt------------t
        D. willistoni  -cc--------------------aatcatttt-ttgtt--ggt--------tttgtt------------t
           D. virilis  -ttatc-----------------aactgcttttcggct---tt--------tgtattgtataaacaaatt
        D. mojavensis  -tcggcttttgtattgtataagaaattcatttataacttaatt--------tgtatt-tacatacatact
         D. grimshawi  -tc--c-----------------aactgcttttcggct---tt--------cgtattgtatttactcatt
           A. gambiae  ----------------------------------------------------------------------
         A. mellifera  -at--------------------aattttact-cgatt---tt--------tgtact------------t
         T. castaneum  ======================================================================

      D. melanogaster  tgtattt------caaa-a--caacaaattcgttttgatttcgtt
          D. simulans  tgtattt------cgaa-a--caacaaattcgttttgatttcgtt
         D. sechellia  tgtattt------cgaa-a--caacaaattcgttttgatttcgtt
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  tgtattt------caaa-a--caacaaattcgttttgatttcgtt
         D. ananassae  tgtatttcgtatccgag-a--taacaaattcgttttgattttgtt
     D. pseudoobscura  tgtattt------tgta-----aacaaattccttttgctttcgtt
        D. persimilis  tgtattt------tgta-----aacaaattccttttgctttcgtt
        D. willistoni  tcttttt------caat-aacaaacaaaattattttgctttcaaa
           D. virilis  cgttgaa------tgct-t--tagttg---tattttagtattcat
        D. mojavensis  ttttggt------tgttcc--tagtagagtcttcttaatatctgt
         D. grimshawi  tgcttta------agtt-g--tatttttggtatttttatgtt--t
           A. gambiae  ---------------------------------------------
         A. mellifera  tattttt------caaa-t----------ttatttttattgtatt
         T. castaneum  =============================================

Alignment block 43 of 217 in window, 830581 - 830734, 154 bps 
B D   D. melanogaster  gtc-------------------tgtcgagcccc------acttgcccc----------taaaaact----
B D       D. simulans  gtc-------------------tgtcgagctct------ccctgcccc----------ttaaaact----
B D      D. sechellia  gtc-------------------tgtcgagctct------ccctgcccc----------ttaaaact----
B D         D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  gtc-------------------tgtcgagc---------ccctgcccc----------ttaaaacc----
         D. ananassae  gtc-------------------tatcgagccccgccccgccctgccccgactccgattccggagctcatt
     D. pseudoobscura  gtcactt---ttgccactcaaatgtcgagcc--------cctggaccc----------ctgaaccctact
B D     D. persimilis  gtcactt---ttgccactcaaatgtcgagcc--------cctggaccc----------ctgaaccctact
        D. willistoni  ttc------------------------------------aactgcccc----------caaaaagt----
           D. virilis  ttcgagtagaaagcctttaatatttgtccctct-------------cc----------caaaaactccgc
        D. mojavensis  tcc-------------------ttccttccacc-------------cg----------cacgaaccacac
         D. grimshawi  tctgtgtagtatgtcttcaaaatacattgccctg-----cacaatacc----------caaaaacccaac
B D        A. gambiae  ----------------------------------------------------------------------
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  ---------aaagatccactaa----------------c-----acccaaacc------aac-----tag
          D. simulans  ---------aaagatccactaa----------------c-----acccaaacc------aac-----tag
         D. sechellia  ---------aaagatccactaa----------------c-----acccaaacc------aac-----tag
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  ---------taagctccactaa----------------ccactaacccaaacc------aac-----tag
         D. ananassae  ------cggagaaccccactaa----------------c------cccgaccg------aac-----tag
     D. pseudoobscura  -----gcctggacctcaactaa----------------c-----acccaaaatgattgaaac-----tag
        D. persimilis  -----gcctggacctgaactaa----------------c-----acccaaaatgattgaaac-----tag
        D. willistoni  -------------cccctctaa----------------ctac--gcccaa---------aaa-----tta
           D. virilis  acgaaccacaaccacacacaaa---------ttgatgac-----ccact--ct------ggt-----tgc
        D. mojavensis  -----ccacacacaaaaactaaaaccccgtctggttgcc-----cctcc-act------gga-----agc
         D. grimshawi  -----acacgaatgaaaactac-------cccaacaacc-----cctccaact------ggttaaactgc
           A. gambiae  ----------------------------------------------------------------------
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ggc---tag------tctaacc--c--------------------actttaaaccg---ccaatg-----
          D. simulans  gcc---tag------tctaacc--ca-------------------acttaaaaccg---ccaatg-----
         D. sechellia  gga---tag------tctaacc--ca-------------------acttaaaaccg---ccaatg-----
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  ggc---tag------tctaacc--ca-------------------acataaaaccc---ccaatg-----
         D. ananassae  aac---tag------tctcactaaca-------------------aaacaaatccgaatcctttc-----
     D. pseudoobscura  ggctaatag------tctaacc--cc-------------------aaccaaccacg---cccct------
        D. persimilis  ggctaatag------tctaacc--cc-------------------aaccaaccacg---cccct------
        D. willistoni  ccc---tat------tctactc-tct-------------------atatagatatg---tatcca-----
           D. virilis  ccc---t--------tccactg--ca----------agcccaagaaagtagggcta---a----------
        D. mojavensis  ccc---caaattaggtctaagc--caataactctttaatctaaaaatacaaaaata---acccctccgat
         D. grimshawi  ccc---tctgccacctgaacac--ca------------------aaattaggttca---agtctt-----
           A. gambiae  ----------------------------------------------------------------------
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  -aaatct---a----acc-ataaaacttcat----------cccaata------ctgat---cgtg----
          D. simulans  -aaatcc---a----atc-atataacttcat----------cccaata------ctgat---cgta----
         D. sechellia  -aaatcc---a----atc-ataaaacttcat----------cccaata------ctgat---cgca----
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  -aaatct---a----accgaaaaaacatcat----------cccaata------ctgaa---cctg----
         D. ananassae  -aaatt---------atc-tttgaattccgt-----------acgatatcgtatctgat---cccggtct
     D. pseudoobscura  -atatgt---a----cat-aaagaaccccctagtggatagcctcgat-------ctgat---ctga----
        D. persimilis  -atatgt---a----cat-aaagaaccccctagtggatagcctcgat-------ctgat---ctga----
        D. willistoni  -atatgtggaa----agt-attaatttgtag-------------gaaa------ataat---tgtt----
           D. virilis  -aaaaaa---a----aaa-agaaaccccctttgtta---catccagta------aaaatatatgtg----
        D. mojavensis  tataaaa---c----cca-gtaaaatttggctgctaagccaactagtc------aatat-tatatt----
         D. grimshawi  -gaaaaa---ctcctctc-tgaaaaacctattgtta---aatctctta------aggat---ttta----
           A. gambiae  ----------------------------------------------------------------------
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  aatatttt----------gatttac-------------------------g-----atttct--------
          D. simulans  aatatttt----------gatctat-------------------------g-----atttc---------
         D. sechellia  aatatttt----------gatctat-------------------------g-----atttct--------
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  aatatttt----------gatttat-------------------------g-----atttct--------
         D. ananassae  atccctct----------gctctgc-------------------------t-----ctctctctc-cacc
     D. pseudoobscura  -----ttt----------gatatgt-------------------------g--------tct--------
        D. persimilis  -----ttt----------aatatgt-------------------------g--------tct--------
        D. willistoni  aatg-tct----------gtcttgt-------------------------gtctctatctctctcgctgt
           D. virilis  aatagttgaaatatatataatctatatttatactc---------------c-----atctcttgcgtatc
        D. mojavensis  aatgttta-------------ctat-ttcacaat----------------t-----atctttt---tttc
         D. grimshawi  agtcgttt-gcgttgcttaggcgat-tcaacattcaacaattaatcgaaat-----atttgtt-tggctc
           A. gambiae  ----------------------------------------------------------------------
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  --gtg
          D. simulans  ---tg
         D. sechellia  --gtg
            D. yakuba  NNNNN
            D. erecta  --gtg
         D. ananassae  ccgtg
     D. pseudoobscura  --ttg
        D. persimilis  --ttg
        D. willistoni  gtgtg
           D. virilis  tcttg
        D. mojavensis  ttttg
         D. grimshawi  tattg
           A. gambiae  -----
         A. mellifera  =====
         T. castaneum  =====

Alignment block 44 of 217 in window, 830735 - 830858, 124 bps 
B D   D. melanogaster  cagCATTAAGAAGAAGGTGAAAAAGGGCTCCGGATCGAAGACACTGC---CTAATTGTTCGCCTTCGCGA
B D       D. simulans  cagCATTAAGAAGAAGGTGAAAAAGGGCTCCGGATCGAAGACACTGC---CCAATTGTTCGCCTTCGCGA
B D      D. sechellia  cagCATTAAGAAGAAGGTGAAAAAGGGCTCCGGATCGAAGACACTGC---CCAATTGTTCGCCTTCGCGA
B D         D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  cagCATTAAGAAGAAGGTGAAAAAGGGCTCCGGATCGAAGACGCTGC---CCAATTGTTCGCCCTCGCGA
         D. ananassae  cagCATCAAGAAGAAGGTGAAAAAGGGCTCCGGATCGAAGACGCTAC---CCAACTGCTCGCCCTCGCGC
     D. pseudoobscura  cagCATCAAGAAGAAGGTGAAAAAGGGCTCCGGTTCGAAGACGCTGC---CCAACTGTTCGCCGTCCCGG
B D     D. persimilis  cagCATCAAGAAGAAGGTGAAAAAGGGCTCCGGGTCGAAGACGCTGC---CCAACTGTTCGCCGTCCCGG
        D. willistoni  tagCATCAAGAAGAAAGTTAAAAAGGGTTCAGGATCGAAGACACTGC---CCAATTGTTCGCCATCGCGA
           D. virilis  tagCATCAAGAAGAAGGTGAAAAAGGGTTCCGGCTCGAAGACTCTGC---CCAATTGTTCGCCTTCACGC
        D. mojavensis  tagCATCAAGAAGAAGGTGAAAAAGGGCTCTGGTTCAAAGACGCTGC---CCAATTGCTCGCCCTCACGC
         D. grimshawi  tagCATCAAGAAGAAGGTGAAAAAGGGTTCCGGCTCGAAGACGCTGC---CCAATTGTTCGCCCTCGCGC
B D        A. gambiae  cagCTTCAAGAAGAAGGTTAAAAAGGGTTCCGGCAGCAAAACGCTTC---CGAACTGCTCGCCTTCCAGA
         A. mellifera  tagTATCAAAAAGAAAGTCAAAAAGGGTTCTGGTTCAAAAACTCTACCATCCAGTAATTCACCATCTAGA
         T. castaneum  ------------GCAGGTAAAAAAGGGCGCCGGCTCTAAAACCCTCCCTTCGAATAACTCTCCCTCCCGG

      D. melanogaster  CAGGTCGAGAGTCCAACCATGTCGCGCCGACTTCCCCCAGATCCCGCAGAGGCCATC
          D. simulans  CAGGTCGAAAGTCCAACCATGTCGCGCCGACTGCCCCCAGATCCCGCAGAGGCCATC
         D. sechellia  CAGGTCGAGAGTCCAACCATGTCGCGCCGTCTGCCCCCAGACCCCGCAGAGGCCATC
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  CAGATCGAGAGTCCAACCATGTCGCGCCGACTGCCCCCAGATCCCGCAGAGGCCATC
         D. ananassae  CAGATCGAAAGCCCGACCATGTCCCGACGACTGCCCCCCGATCCCGCCGAGGCCATC
     D. pseudoobscura  CAGATCGAGAGTCCAACAATGTCGCGACGCTTGCCCCCCGATCCGGCCGAGGCCATT
        D. persimilis  CAGATCGAGAGTCCAACAATGTCGCGACGCTTGCCCCCCGATCCGGCCGAGGCCATT
        D. willistoni  CAAGTTGAAAGTCCTACAATGTCACGACGCTTACCACCAGATCCAGCCGAGGCCATT
           D. virilis  CAAATCGAGAGTCCAACCATGTCCCGGCGCTTGCCACCCGATCCGGCCGAGGCCATT
        D. mojavensis  CAAATCGAGAGTCCAACCATGTCGCGACGCTTGCCGCCTGATCCGGCCGAGGCCATT
         D. grimshawi  CAAATCGAGAGTCCAACCATGTCACGCCGCTTGCCCCCAGATCCGGCCGAGGCTATT
           A. gambiae  CAGGTCGATAGTCCCACAATGAGCCGAAGATTACCACCGGACCCTTCGGAGGCTATT
         A. mellifera  GCTGTGGAATCTCCTATTATGGCTAGGCGCTTACCTGCTGATCCAAGTGAAGCAATA
         T. castaneum  ACGGTGGAATCCCCCAGTATGGCGCGTCGTCAAGCCGCCGATCCCTCCGAAGCCATC

Inserts between block 44 and 45 in window
B D       A. gambiae 206bp

Alignment block 45 of 217 in window, 830859 - 831380, 522 bps 
B D   D. melanogaster  GGAACGGCTGTGGTCAAGTATAACTATCAGGCCCAGCAGCCCGATGAACTTTCGCTGACCAAGGGCACAC
B D       D. simulans  GGAACGGCTGTGGTCAAGTATAACTATCAGGCCCAGCAGCCCGATGAACTTTCGCTGACCAAGGGCACAC
B D      D. sechellia  GGAACGGCTGTGGTCAAGTATAACTATCAGGCCCAGCAGCCCGATGAACTTTCGCTGACCAAGGGCACAC
B D         D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  GGAACGGCTGTGGTCAAGTATAACTATCAGGCCCAGCAGCCCGATGAACTATCGCTAACCAAGGGCACGC
         D. ananassae  GGCTCGGCGATCGTCAAGTACAACTACCAGGCACAGCAGCCGGACGAGCTATCGCTGACCAAGGGCACCC
     D. pseudoobscura  GGCACGGCCATCGTCAAGTACAACTACCAGGCCCAGCAGCCGGACGAGCTCTCGCTGACCAAGGGCACGC
B D     D. persimilis  GGCACGGCCATCGTCAAGTACAACTACCAGGCCCAGCAGCCGGACGAGCTCTCGCTGACCAAGGGCACGC
        D. willistoni  GGCACGGCCATTGTCAAGTATAACTATCAGGCCCAGCAGCCGGATGAGTTATCCTTGACCAAGGGCACAC
           D. virilis  GGCACCGCCATTGTCAAATACAACTATCAGGCGCAACAGCCGGACGAGCTCTCCCTGACCAAGGGCACAC
        D. mojavensis  GGCACCGCCATTGTCAAATACAACTATCAGGCGCAGCAGCCGGACGAGCTATCCCTGACCAAGGGCACAC
         D. grimshawi  GGCACCGCCATTGTTAAGTACAACTATCAGGCACAGCAGCCGGATGAACTATCGCTCACCAAAGGCACAC
B D        A. gambiae  GGTACTGCCATAGTGAAGTATAACTACCAAGCTCAACAGCAGGATGAACTGTCGTTGACAAAGGGAACAC
         A. mellifera  GGCACAGCAGTTGTTAAGTACAATTATCAAGCACAACAAGCAGATGAACTATCACTTGTTAAAGGTACTA
         T. castaneum  GGCACCGCCGTCGTCAAGTACAATTATCAAGCCCAACAACCCGACGAACTTTCCCTCGTCAAAGGTTCCC

      D. melanogaster  GAATCCTCATCCTGGAGAAGTCCAACGATGGATGGTGGCGTGGACAGAGCGGCAATTCCGTCGGCTGGTT
          D. simulans  GAATCCTCATCCTGGAGAAGTCCAACGACGGATGGTGGCGTGGACAGAGCGGCAATTCCGTCGGCTGGTT
         D. sechellia  GAATCCTCATCCTGGAGAAGTCCAACGACGGATGGTGGCGTGGACAGAGCGGCAATTCCGTCGGCTGGTT
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  GTATCCTCATCCTGGAGAAGTCCAACGACGGATGGTGGCGTGGACAGAGCGGCAATTCCGTCGGCTGGTT
         D. ananassae  GGATCCTCATCCTGGAGAAGTCCAACGACGGATGGTGGCGCGGCCAGAGCGGCAACTCCGTCGGCTGGTT
     D. pseudoobscura  GCATCCTCATCCTAGAGAAGTCCAACGACGGATGGTGGCGCGGCCAGAGCGGCAATTCCGTCGGCTGGTT
        D. persimilis  GTATCCTCATCCTAGAGAAGTCCAACGACGGATGGTGGCGCGGCCAGAGCGGCAATTCCGTCGGCTGGTT
        D. willistoni  GCATCTTAATACTGGAGAAATCCAATGATGGCTGGTGGCGTGGACAAAGTGGCAATTCGGTGGGTTGGTT
           D. virilis  GCATACTCATCCTGGAGAAGTCGAACGATGGCTGGTGGCGTGGCCAGAGCGGCAATTCGGTTGGCTGGTT
        D. mojavensis  GCATACTCATACTGGAGAAGTCGAACGATGGCTGGTGGCGTGGCCAGAGCGGCAATGCGGTTGGCTGGTT
         D. grimshawi  GCATCCTCATCCTGGAGAAGTCAAATGATGGGTGGTGGCGTGGCCAGAGTGGCAACTCGGTCGGCTGGTT
           A. gambiae  GAATACTGATACTGGAGAAATCAAACGACGGCTGGTGGCGTGGCCAGAGCGGCTCAGCGACCGGCTGGTT
         A. mellifera  GAATCTTAATATTGGAAAAAAGCAACGATGGTTGGTGGAGAGGTCAAAGTGGTACACAAGCAGGCTGGTT
         T. castaneum  GAATTCTCATCTTGGAGAAGAGCAACGACGGCTGGTGGCGAGGTCAGAGCGGGAACGTCGCCGGCTGGTT

      D. melanogaster  CCCCAGCAACTACACAACGGAGGATTGTGATAACGACGGCGAGA---TCCACACCTACGCAATGGCCGAG
          D. simulans  CCCCAGCAACTACACAACGGAGGATTGTGATAACGACGGCGAGA---TCCACACCTACGCCATGGCCGAG
         D. sechellia  CCCCAGCAACTACACAACGGAGGATTGTGATAACGACGGCGAGA---TCCACACCTACGCCATGGCCGAG
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  CCCCAGCAACTACACAACGGAGGATTGTGATAACGACGGTGAGA---TCCACACCTACGCCATGGCCGAG
         D. ananassae  CCCCAGCAACTACACAACGGAAGATTGTGATAACGATGGAGAGA---TCCACACCTATGCCATGGCGGAG
     D. pseudoobscura  CCCCAGCAACTACACAACCGAGGATTGTGATAACGATGGCGAGA---TCCACACCTATGCCATGGCCGAG
        D. persimilis  CCCCAGCAACTACACAACCGAGGATTGTGATAACGATGGGGAGA---TCCACACCTATGCCATGGCCGAG
        D. willistoni  TCCCAGCAATTATACGACCGAAGATTGTGATAATGATGGCGAGA---TTCATACCTATGCCATGGCAGAG
           D. virilis  TCCCAGCAATTACACAACCGAAGATTGTGATAACGATGGCGAGA---TACACACCTATGCCATGGCGGAG
        D. mojavensis  CCCCAGCAATTACACAACCGAAGATTGTGATAACGATGGCGAAA---TACACACCTATGCCATGGCGGAG
         D. grimshawi  TCCCAGCAACTACACAACCGAAGATTGTGATAACGATGGTGAGA---TCCATACCTATGCCATGGCGGAG
           A. gambiae  TCCTAGCAACTACACGACGGAA------GAGAACGAAGACGATACACTGCATACATACGCGATGGCAGAA
         A. mellifera  TCCATCAAATTATACTCAAGAAGAAGGAGATGCAGATGATACTC---TTCATACATATGCAATGGCAGAA
         T. castaneum  CCCTTCGAACTACACCCAGGAGGAGGGCGACGCCGACGATACCC---TTCACACGTACGCGATGGCAGAA

      D. melanogaster  AACGTGCTTGATATTGTGgtgagtaa------------------ctggacgtgt---tctcaaaataaa-
          D. simulans  AACGTGCTTGATATTGTGgtgagtat------------------atcgacgtgt---tctcaaaataagt
         D. sechellia  AACGTGCTTGATATTGTGgtgagta-------------------atggacgtgt---tctcaaaataagt
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  AACGTGCTTGATATTGTGgtgagtgtacgagttaataatagagcatggacgtgt---tctcagaatgagt
         D. ananassae  AATGTGCTCGACATTGTGgtgagtc-------------------cttggca-------------------
     D. pseudoobscura  AACGTGCTCGATATTGTGgtacgctt------------------attaacg-------------atagat
        D. persimilis  AACGTGCTCGATATTGTGgtacgctt------------------attaacg-------------atagat
        D. willistoni  AATGTCCTGGATATTGTGgtaagtcga-----------------cttggtatttcaatgacaaaagaatc
           D. virilis  AATGTGCTCGACATTGTGgtgggt--------------------ctctaga------agctaacttaaat
        D. mojavensis  AACGTGCTGGATATTGTGgtaggt--------------------gtcaata-------------tcgaat
         D. grimshawi  AACGTGCTGGACATTGTGgtacgt--------------------aacaatg----------aagatcatt
           A. gambiae  AACGTGCTTGATATTGT-----------------------------------------------------
         A. mellifera  AACGTTCTTGATATTGT-----------------------------------------------------
         T. castaneum  AACGTGCTAGATATCGT-----------------------------------------------------

      D. melanogaster  -cattcacatcatctatga-gaggttgtcattattggctaataacaactatt------ttcaaata-tat
          D. simulans  ccattcacatcatct-taa-gaggttgtcattattggctaataacaattatt------ttcaacta-tat
         D. sechellia  ccattcacatcatct-taa-gaggttgtcattattggctaataacaattatt------ttcaacta-tat
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  ccattctcatca---------agatta----tatatggtaataacaattctt------ttcaccaa-tat
         D. ananassae  -cagatccctca---------agacta----aactggatagtaactccccat------cccccatc-cac
     D. pseudoobscura  tc--------------taatgtggtggcctctaatgg------acggacgtt------ctcttctcttgc
        D. persimilis  tc--------------taatgtggtggcctctaatgg------acggacgtt------ctcttctcttgc
        D. willistoni  ct--------------taacatgtctctctcta------------------t------ctctgggattgc
           D. virilis  a----------aatg-tat--accttatcttaa----------gctatcctt---tcaacgtcgct-tgc
        D. mojavensis  gc--------caagc-tat---cctcatctcaa----------tctgtcttt------atcttgct-tgc
         D. grimshawi  ac--------cacgc-gat-gggcttctcttaa----------tcactgcttaacacactcttcct-tgc
           A. gambiae  ---------------------------------------------------t------------------
         A. mellifera  ---------------------------------------------------t------------------
         T. castaneum  ---------------------------------------------------c------------------

      D. melanogaster  agGTCGCGCTGTACAGCTTCACGTCAAACAACGACCAGGAGCTCTCGTTCGAGAAGGGCGATCGCTTGGA
          D. simulans  agGTCGCGCTGTACAGCTTCACGTCGAACAACGACCAGGAGCTCTCGTTCGAGAAGGGCGATCGCTTGGA
         D. sechellia  agGTCGCCCTGTACAGCTTCACGTCGAACAACGACCAGGAGCTCTCGTTCGAGAAGGGCGATCGCTTGGA
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  agGTCGCCCTTTACAGCTTCACGTCGAACAACGACCAGGAGCTCTCGTTCGAGAAAGGCGATCGCCTGGA
         D. ananassae  agGTTGCTCTCTACAGCTTCACGTCAAACAACGACCAGGAGCTCTCGTTCGAGAAGGGCGATCGCCTGGA
     D. pseudoobscura  agGTGGCCCTCTACAGCTTCACGTCGAACAATGACCAGGAGCTGTCGTTTGAGAAGGGTGACCGGCTGGA
        D. persimilis  agGTGGCCCTCTACAGCTTCACGTCGAACAATGACCAGGAGCTGTCGTTTGAGAAGGGTGACCGGCTGGA
        D. willistoni  agGTGGCCCTCTATAGCTTCACATCGAACAACGATCAGGAGCTCTCGTTTGAAAAGGGTGATCGTTTGGA
           D. virilis  agGTGGCGCTCTATAGCTTCACGTCGAACAATGACCAGGAGCTGTCGTTTGAGAAGGGCGATCGCCTCGA
        D. mojavensis  agGTGGCGCTCTATAGCTTCACATCGAACAATGATCAGGAGCTGTCGTTTGAGAAGGGCGATCGCCTTGA
         D. grimshawi  agGTGGCGCTGTATAGCTTCACATCGAACAATGATCAGGAGCTGTCGTTTGAGAAGGGCGATCGTCTCGA
           A. gambiae  --GTGGCGCTATACTCATTCAATTCTAACAACGATACCGAGCTATCGTTTGAAAAGGGCGATCGATTGGA
         A. mellifera  --GTAGCACTTTATTCATTTTCTTCTAATAATGATCAAGAACTATCTTTTGAAAAAGGTGATCGTTTGGA
         T. castaneum  --GTGGCGTTGTATTCGTTCTCGTCGACAAACGACCAGGAGTTGTCTTTTGAAAAGGGCGACCGATTGGA

      D. melanogaster  GATCGTGGATCGGCCCGCCTCCGATCCGGACT--------------------------------------
          D. simulans  GATCGTGGATCGGCCTGCCTCCGATCCGGACT--------------------------------------
         D. sechellia  GATCGTGGATCGGCCCGCCTCCGATCCAGACT--------------------------------------
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  GATCGTGGATCGGCCCGCCTCCGATCCAGACT--------------------------------------
         D. ananassae  GATCGTGGATCGGCCAGCCTCCGATCCAGACT--------------------------------------
     D. pseudoobscura  GATCGTGGATCGGCCCGCCTCCGATCCGGACT--------------------------------------
        D. persimilis  GATCGTGGATCGGCCCGCCTCCGATCCGGACT--------------------------------------
        D. willistoni  AATTGTGGATCGCCCTGCCTCGGATCCGGATT--------------------------------------
           D. virilis  GATAGTTGACAGGCCCGCCTCCGATCCGGACT--------------------------------------
        D. mojavensis  GATTGTAGATCGGCCCGCCTCCGATCCGGACT--------------------------------------
         D. grimshawi  GATCGTTGATAGGCCCGCCTCCGATCCCGATT--------------------------------------
           A. gambiae  AATTCTTGATCGACCAGCGGCTGATCCCGAATGGTAAGAATGAACATTACAATTTAGCCACCTCACAAAT
         A. mellifera  AATCCTTGACCGTCCGCCAGCAGATCCTGAAT--------------------------------------
         T. castaneum  GATTTTAGATCGGCCTCCGAGTGATCCCGAAT--------------------------------------

      D. melanogaster  ----------------------------------------------------GGTACAAAGCTCGCAACA
          D. simulans  ----------------------------------------------------GGTACAAAGCTCGCAACA
         D. sechellia  ----------------------------------------------------GGTACAAAGCTCGCAACA
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  ----------------------------------------------------GGTACAAAGCTCGCAACA
         D. ananassae  ----------------------------------------------------GGTACAAAGCTCGCAACA
     D. pseudoobscura  ----------------------------------------------------GGTACAAGGCTCGCAACA
        D. persimilis  ----------------------------------------------------GGTACAAGGCTCGCAACA
        D. willistoni  ----------------------------------------------------GGTATAAGGCTCGCAACA
           D. virilis  ----------------------------------------------------GGTATAAGGCACGCAATA
        D. mojavensis  ----------------------------------------------------GGTATAAGGCACGCAATA
         D. grimshawi  ----------------------------------------------------GGTATAAGGCACGCAATA
           A. gambiae  ATTTAAATTGAATTCAAAAAATAATAACCAACTACTTGTTGTCTGTTTTACAGGTATAAAGCCCGAAATA
         A. mellifera  ----------------------------------------------------GGTATAAAGCACGAAACA
         T. castaneum  ----------------------------------------------------GGTACAAAGCGAGGAATG

      D. melanogaster  ATCAGGGCCAAGTCGGTTTAGTTCCACGCAATTATCTCCAAGAGTTGAACGACTACCT-GGCCACGCCCT
          D. simulans  ATCAGGGCCAAGTCGGTTTAGTTCCACGCAATTATCTCCAAGAGTTGAACGACTACCT-GGCCACGCCCT
         D. sechellia  ATCAGGGCCAAGTCGGTTTAGTTCCACGCAATTATCTCCAAGAGTTGAACGACTACCT-GGCTACGCCCT
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  ATCAGGGCCAAGTCGGTTTAGTTCCACGCAATTATCTCCAAGAGTTGAACGACTACCT-GGCCACGCCCT
         D. ananassae  ACCAGGGCCAAGTCGGTTTAGTTCCACGCAACTATCTCCAAGAGCTCAACGACTACCT-GACCACGCCGT
     D. pseudoobscura  ACCAGGGCCAAGTCGGTTTAGTTCCACGCAATTATCTCCAAGAGTTGAATGACTACCT-GGCCACGCCCT
        D. persimilis  ACCAGGGGCAAGTCGGTTTAGTTCCACGCAATTATCTCCAAGAGTTGAATGACTACCTGGGCCACGCCCT
        D. willistoni  ATCAGGGACAAGTCGGTTTAGTTCCACGCAATTATCTACAAGAATTGAATGACTACCT-GGCCACACCAT
           D. virilis  ATCAGGGTCAAGTCGGTTTAGTTCCACGCAATTATCTACAAGAGTTAAACGACTACTT-GGCCACACCCT
        D. mojavensis  ATCAGGGTCAAGTCGGTTTAGTTCCACGCAATTATCTACAAGAGTTGAACGACTACTT-GGCCACGCCCT
         D. grimshawi  ATCAAGGACAAATTGGTTTAGTTCCACGCAATTATCTACAAGAGTTGAACGACTACTT-GGCCACACCCT
           A. gambiae  ATAATGGCCAGATAGGGCTCGTACCGCGTAACTATTTACAGGAACTGTCTGAATACTT-AGCTCAACCAT
         A. mellifera  GTCAAGGTCAAATAGGTCTAGTACCACGTAATTATCTTCAAGAACTCAGTGAATATTT-GACTCAACCAT
         T. castaneum  CGCAAGGACAGGTCGGCTTGGTGCCGAGGAATTACCTGCAGGAGTTGTCCGAGTATTT-GACTCAGCCGT

      D. melanogaster  ATC---GTAATGCGAGTGCC
          D. simulans  ATC---GCAATACGAGTGCC
         D. sechellia  ATC---GCAATACGAGTGCC
            D. yakuba  NNNNNNNNNNNNNNNNNNNN
            D. erecta  ATC---GTAACACGAGTGCC
         D. ananassae  ATC---GCAACACGAGTGCC
     D. pseudoobscura  ATC---GCAATACTAGCGCC
        D. persimilis  ATC---GCAATACTAGCGCC
        D. willistoni  ATC---GTAATACGAGCGCT
           D. virilis  ATC---GCAATACCAGCGGC
        D. mojavensis  ATC---GCAATACCAGCGGC
         D. grimshawi  ATC---GCAATACAAGCGGC
           A. gambiae  TTCGGAGCAATGGAAGCGGC
         A. mellifera  ATC---GT------------
         T. castaneum  TTC---TCGA----------

Inserts between block 45 and 46 in window
B D       A. gambiae 83bp

Alignment block 46 of 217 in window, 831381 - 831493, 113 bps 
B D   D. melanogaster  AGTGCA-GGAAACGG-AAA---T--------------------------------GGAGGAGGAAGTAAT
B D       D. simulans  AGTGCA-GGAAACGG-AAA---C--------------------------------GGAGGAGGAAGTAAT
B D      D. sechellia  AGTGCA-GGAAACGG-AAA---C--------------------------------GGAGGAGGAAGTAAT
B D         D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  AGTGCA-GGAAACGG-AAA---C--------------------------------GGAGGAGGAAGTAAC
         D. ananassae  ---GCT-GGCAACGG-GAA---T--------------------------------GGCGGTAGCAACGGA
     D. pseudoobscura  ---GCC-GGCAATGG-CAA---T-GGCACTGGCAGCAACAACGGGG-CCGGTGGCGGAGGCGGCGGCGGC
B D     D. persimilis  ---GCCGGGCAATGGCCAA---TGGGCACTGGCAGCAACAACGGGGCCCGGTGGCGGAGGCGGCGGCAGC
        D. willistoni  ---GCT-GGCAATGG-CAA---C-AATACTGGCACTAATAATGGG----------GCCAGTGGCGGCGCT
           D. virilis  AATGCT-GGCAACGG-CAA---T--------------------------------GCCACCGGCAGCAAT
        D. mojavensis  AATGCT-GGCAATGG-CAA---T--------------------------------GCCACCGGCAGCAAC
         D. grimshawi  AATGCT-GGCAACGG-CAACACC--------------------------------GCCGCCAGCAGCAAC
B D        A. gambiae  ======================================================================
         A. mellifera  -----------------------------------------------------------GAAAGAGGAAT
         T. castaneum  ----CC-GAAAACAG-GAG---C-------------------------------------------CGAT

      D. melanogaster  GGCGG------------CGCAGGTGG------------TGGCGGAGGAAACGACTCCATGGAGCGGCGCA
          D. simulans  GGCGG------------CGCAGGAGG------------TGGCGGAGGAAACGACTCCATGGAGCGACGCA
         D. sechellia  GGCGG------------CGCAGGAGG------------TGTCGGAGGAAACGACTCCATGGAGCGACGCA
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  GGCGG------------AGCAGGAGG------------CGGCGGAGGAGGTGACTCCATGGAGCGACGAA
         D. ananassae  GGAGC------------CGGCGGCGG------------TGGTGGCGGCACCGACTCCATGGAGCGCCGCA
     D. pseudoobscura  GGCGG------------CGGCGGTGG------------TGGTGGCGGCGGAGACTCCATGGAACGCCGGA
        D. persimilis  GGCGG------------CGGCGGTGG------------TGGTGGCGGCGGAGACTCCATGGAACGCCGGA
        D. willistoni  GGTGG------------CGGCGGTGG------------CGGCGGCAATGGCGACTCAATGGAACGCCGCA
           D. virilis  GGTGC------CAATGCCACCGGCAACGGTGCCGGCGGCGGCGGCGGCGGCGACTCCATGGAGCGCCGCA
        D. mojavensis  GGTGC------CAACACCACCGGCAA------------------CGGCGGTGACTCCATGGAGCGACGCA
         D. grimshawi  GGTGCCAGCAACAATGCCGCCGGCAA------------CGGTGGCGGTGGTGATTCCATGGAGCGTCGTA
           A. gambiae  ======================================================================
         A. mellifera  GACAA--------------GTAGTGA------------GATTAGTACAGGAGATTCCCTTG--------A
         T. castaneum  GGAGA------------GGTCGCAAG------------TGGCAATGGG----------------------

      D. melanogaster  ATGAGGG---TAATAAGCCGGCGGCGCAATCTTCCGG
          D. simulans  ATGAGGG---TAACAAGCCGGCGGCGCAATCCTCCGG
         D. sechellia  ATGAGGG---TAACAAGCCGGCGGCGCAATCCTCCGG
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  ATGAGGG---TAATAAGCCGGCGGCGCAATCCTCCGG
         D. ananassae  ACGATGG---CAACAAGTCTGCGTCGCAGCCCTCTGG
     D. pseudoobscura  ACGAGGGCAACAACAAACCCTCATCGCAGTCTTCTAC
        D. persimilis  ACGAGGGCAACAACAAACCCTCATCGCAGTCTTCTAC
        D. willistoni  ATGAGGG---AAATAAATCCTCCACACAATCTTCCTC
           D. virilis  ACGACTGCAACAACAAAC---AAACGCAGC---CAAG
        D. mojavensis  ACGACTGCAACAACAAAC---CGACACAGC---CCAG
         D. grimshawi  ACGACTGCAACAACAAACCATCAACTCAAC---CAGC
           A. gambiae  =====================================
         A. mellifera  AAGAAGG---CCAGATCCTGGTGATA-----------
         T. castaneum  -------------------------------------

Alignment block 47 of 217 in window, 831494 - 831587, 94 bps 
B D   D. melanogaster  C---------CAGCCAATCGAGCGGCCAAATCTGGCGGGCAAGTCGTGGTATTATGGAGCCATCACCCGC
B D       D. simulans  C---------CAGCCAATCGAACGGCCAAATCTGGCGGGCAAGTCGTGGTACTATGGAGCCATCACCCGT
B D      D. sechellia  C---------CAGCCAATCGAACGGCCAAATCTGGCGGGCAAGTCGTGGTACTATGGAGCCATCACCCGT
B D         D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  C---------CAGCCAATTGAGCGGCCAAATCTGGCGGGCAAGTCGTGGTACTATGGCGCCATCACCCGT
         D. ananassae  C---------CAGCCGATCGAGCGTCCCAACTTGGCGGGCAAGTCGTGGTACTACGGAGCCATAACCCGC
     D. pseudoobscura  T---------CAGCCCATGGAGCGACCAAATTTGGCGGGCAAGACCTGGTACTACGGAGCCATCACTCGC
B D     D. persimilis  T---------CAGCCCATGGAGCGACCAAATTTGGCGGGCAAGACCTGGTACTACGGAGCCATCACTCGC
        D. willistoni  CTCGCAGCAGCAACCCATTGAACGTCCAAATTTGGCTGGCAAAACATGGTATTATGGCGCCATTACACGC
           D. virilis  T---------CAGCCCATCGAGCGACCCAATTTAGCGGGCAAATCCTGGTACTATGGCGCCATCACGCGC
        D. mojavensis  C---------CAGCCCATCGAGCGACCCAATTTAGCTGGCAAATCCTGGTACTATGGGGCCATCACGCGC
         D. grimshawi  T---------CAGCCCATCGAGCGTCCGAATTTGGCGGGCAAATCGTGGTACTATGGCGCCATCACACGC
B D        A. gambiae  T---------CAGCAACCAGAAAGACCCCATCTGACAGGGAAAAGCTGGTACTACGGTGCTATTACTCGA
         A. mellifera  -----------------------GACCACATCTTGTTGGAAAACCTTGGTACTATGGTAGCATTTCACGT
         T. castaneum  ------------------CGATAAACCCCATCTGGTGGACAAGCCGTGGTATTATGGGAGTATCACGAGG

      D. melanogaster  AGCCAGTGCGACACGGTGCTCAACGGCCACGGG
          D. simulans  AGCCAGTGCGACACGGTGCTCAACGGCCACGGG
         D. sechellia  AGCCAGTGCGACACGGTGCTCAACGGCCACGGG
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  AGCCAGTGCGACACGGTGCTCAACGGCCACGGG
         D. ananassae  AGCCAGTGCGACACGGTGCTCAACGGCCATGGC
     D. pseudoobscura  AGCCAGTGCGATACGGTGCTCAATGGCCACGGC
        D. persimilis  AGCCAGTGCGATACGGTGCTCAATGGCCACGGC
        D. willistoni  AGCCAATGCGATACAGTGCTTAATGGCCATGGC
           D. virilis  AGCCAATGCGACACGGTCCTCAATGGCCATGGA
        D. mojavensis  AGCCAGTGCGACACAGTCCTCAATGGCCATGGC
         D. grimshawi  AGCCAATGCGACACGGTGCTCAATGGCCATGGA
           A. gambiae  AGTCAATGTGATACGGTGCTAAACTCTCACGGA
         A. mellifera  TCACAATGTGACACTTTATTGAATCAACATGGT
         T. castaneum  TATATGTGTGATAATCTCCTGAATCAGAGAGGA

Alignment block 48 of 217 in window, 831588 - 831636, 49 bps 
B D   D. melanogaster  CACGATGGCGACTTCCTCATCAGAGACAGTGAGACTAACgtaag------------------tggaa
B D       D. simulans  CACGATGGCGACTTCCTCATCAGAGACAGTGAGACTAACgtgag------------------tggaa
B D      D. sechellia  CACGATGGCGACTTCCTCATCAGAGACAGTGAGACTAACgtgag------------------tggaa
B D         D. yakuba  CACGATGGCGACTTCCTCATCAGAGACAGTGAGACTAACgtgag------------------tggaa
            D. erecta  CACGATGGCGACTTCCTCATCAGAGACAGTGAGACTAACgtgag------------------tggaa
         D. ananassae  CACGACGGTGACTTCCTCATCAGAGACAGTGAGACTAACgtgag------------------tg---
     D. pseudoobscura  CACGACGGCGACTTCCTCATCAGAGACAGTGAGACTAACgtgag------------------tggaa
B D     D. persimilis  CACGACGGCGACTTCCTCATCAGAGACAGTGAGACTAACgtgag------------------tggaa
        D. willistoni  CATGATGGCGACTTCCTCATCAGAGACAGTGAGACTAATgtgag-----------------------
           D. virilis  CACGATGGTGATTTCCTCATCAGAGACAGTGAGACTAATgtgag------------------tgcca
        D. mojavensis  CACGATGGCGATTTCCTCATCAGAGACAGTGAGACTAATgtgagtgaatgaatggactgtgatgcca
         D. grimshawi  CACGACGGTGACTTCCTCATCAGAGACAGCGAGACTAATgtgag------------------t----
B D        A. gambiae  CATGATGGAGATTACTTGATTCGCGATAGTGAAACGAACgtaag------------------tggtt
         A. mellifera  CATGATGGTGACTTTTTAATTAGAGATAGTGAAACTAATgtaag------------------tatga
         T. castaneum  CACGATGGGGATTTTCTCATCAGGGATAGTGAAACGAATgtaag------------------t----

Inserts between block 48 and 49 in window
       D. willistoni 1302bp
          D. virilis 14bp
       D. mojavensis 17bp
        D. grimshawi 10bp

Alignment block 49 of 217 in window, 831637 - 831656, 20 bps 
B D   D. melanogaster  ttcgcaa-----ttgaagtgccat-a
B D       D. simulans  tccgcaa-----ttgaagtgccat-a
B D      D. sechellia  tccgcaa-----ttgaattgccat-a
B D         D. yakuba  tccacca-----ttgaaataccgc-a
            D. erecta  tccgtaa-----ttgaagtgccac-a
        D. ananassae  --------------------------
     D. pseudoobscura  agagaagaagtcttgaaaggttttga
B D     D. persimilis  agagaagaagtcttgaaaggttttga
        D. willistoni  ttcgcaa-----cgttaatgcgtt--
           D. virilis  ggggcaa-----ttccagtattta-a
        D. mojavensis  ggggtat-----aggcagcatatc-g
         D. grimshawi  gatgtaa----------------c-a
B D        A. gambiae  --------------------------
         A. mellifera  --------taataaaaattatttt-a
         T. castaneum  ---acag-----ttgaacctctat-a

Inserts between block 49 and 50 in window
        T. castaneum 3555bp

Alignment block 50 of 217 in window, 831657 - 831913, 257 bps 
B D   D. melanogaster  aca------tagt---------tccgcccgaa---------tt-------------ctt-----------
B D       D. simulans  aca------tagt---------tccgcacgaa---------tt-------------ctt-----------
B D      D. sechellia  aca------tagt---------tccgcacgaa---------tt-------------ttt-----------
B D         D. yakuba  aca------taat---------tccccacgaa---------tt-------------ttt----aactttt
            D. erecta  aca------taat---------tccccatgaattattttgttt-------------tgt----aactttt
         D. ananassae  -ct------tgat---------ttctagtcat---------tc-------------ctc-----------
     D. pseudoobscura  gtg------cagt---------caggcaacga---------tc-------------ttc-----------
B D     D. persimilis  gtg------cagt---------caggcaacgt---------tc-------------ttc-----------
        D. willistoni  ---------tcgt---------tatccctgaa---------ct-------------aat-----------
           D. virilis  gctctcgtcattt---------tattctggaa---------ttgccctttataggaatt-----------
        D. mojavensis  act-tgttaatgt---------tctcctggaa---------tcacccat-------aca-----------
         D. grimshawi  gct---------------------------aa------------------------atg-----------
B D        A. gambiae  ----ttacccttt---------tttccgtcga---------tt-------------tcaaagaaactcat
         A. mellifera  att------caattgaaactagtttatttgaa---------tt-------------att----attttac
         T. castaneum  ----------------------------------------------------------------------

      D. melanogaster  -----------------------------------tgaga---g--------------------------
          D. simulans  -----------------------------------t--gt---a--------------------------
         D. sechellia  -----------------------------------t--gt---g--------------------------
            D. yakuba  --------------------------atgaaatgtt--gt---ggcattttaccaagaaaactgccaact
            D. erecta  --------------------------atggaatggt--gt---gg-------------------------
         D. ananassae  -----------------------------------t--cc---a--------------------------
     D. pseudoobscura  -----------------------------------t--at------------------------------
        D. persimilis  -----------------------------------t--at------------------------------
        D. willistoni  -----------------------------------t--ga---aaaatgtt-------------------
           D. virilis  -----------------------------------c--ctttca--------------------------
        D. mojavensis  -----------------------------------c--ct---a--------------------------
         D. grimshawi  -----------------------------------c--ca---a--------------------------
           A. gambiae  ca-----------------------agcagaatggt--at---g--------------------------
         A. mellifera  taacaacaataaataatacatttttaataaataatt--tt---t--------------------------
         T. castaneum  ------------------------------aatgga--tt---g--------------------------

      D. melanogaster  --------tgtataaacg--------aa-------ttcatc---------ctt-------------tctt
          D. simulans  --------tgtattaacg--------aa-------ttcatc---------ctt-------------cctt
         D. sechellia  --------tgtattaacg--------aa-------ttcatc---------ctt-------------cctt
            D. yakuba  taattatacgtactaacg--------aa-------ttcatc---------ctt-------------cctt
            D. erecta  --------tgtgttaacg--------aa-------ttctct---------ctt-------------tctt
         D. ananassae  --------gattctaac---------aa-------tgtatc---------ct----------------tt
     D. pseudoobscura  --------tgtat----------------------ctcatg---------ttc-------------tctt
        D. persimilis  --------tgtat----------------------ctctcg---------ttc-------------tctt
        D. willistoni  --------tgtattgac--------------------------------------------------ttt
           D. virilis  --------ccaattacga--------gc-------ttactcatactct--ttt-------------tctt
        D. mojavensis  --------tgtattaaga--------gaggaaacgttattcataatattattt-------------gctt
         D. grimshawi  --------cggattattt--------ga-------ttaattttgttgt--ttt-------------cctt
           A. gambiae  --------tttagaaacggtggatctaa-------tcaatg---------ctt-----------tgtatt
         A. mellifera  --------tataataaaa--------ta-------ttttta---------tttctatattattataactt
         T. castaneum  --------cgcttgaatt--------tg-------atgatg---------ttt-------------tatt

      D. melanogaster  -----------gcagATGGGAGACTATTCGGTTTCGTTAAAGGCCCCAGGGCGCAACAAGCACTTCCGCG
          D. simulans  -----------gcagATGGGAGACTATTCGGTTTCGTTGAAGGCCCCAGGGCGCAACAAGCACTTCCGCG
         D. sechellia  -----------gcagATGGGAGACTATTCGGTTTCGTTGAAGGCCCCAGGGCGCAACAAGCACTTCCGCG
            D. yakuba  -----------gcagATGGGTGACTATTCGGTTTCGTTGAAGGCCCCAGGGCGCAACAAGCACTTCCGCG
            D. erecta  -----------gcagATGGGTGACTATTCGGTTTCGTTGAAGGCCCCAGGGCGCAACAAGCACTTCCGCG
         D. ananassae  -----------gcagATGGGCGATTACTCGGTTTCGTTAAAGGCACCGGGACGCAACAAGCACTTCCGCG
     D. pseudoobscura  -----------gcagATGGGCGACTACTCGGTTTCGCTGAAGGCCCCCGGCAGGAACAAGCACTTCCGCG
        D. persimilis  -----------gcagATGGGCGACTACTCGGTTTCGCTGAAGGCCCCCGGCAGGAACAAGCACTTCCGCG
        D. willistoni  -----------acagATGGGCGATTACTCGGTATCGCTAAAGGCACCTGGCCGGAACAAACATTTCCGCG
           D. virilis  -----------tcagATGGGTGATTACTCGGTTTCCCTGAAGGCGCCCGGACGCAACAAGCACTTCCGTG
        D. mojavensis  -----------acagATGGGTGATTACTCGGTTTCCCTGAAGGCGCCCGGCCGCAACAAACACTTCCGCG
         D. grimshawi  attatcacttgacagATGGGTGATTACTCGGTTTCCTTGAAGGCGCCCGGTCGCAACAAGCACTTCCGTG
           A. gambiae  -----------acagCTGGGTGACTATTCCGTTTCGCTAAAAGCTCCTGGACGCAACAAGCACTTCCGCG
         A. mellifera  -----------ttagGTGGGAGATTATTCAGTATCTTTAAAAGCTCCAGGTCGTAATAAACACTTTAGGG
         T. castaneum  -------------agGTGGGGGATTATTCGGTGTCGCTGAAGGCCCCCGGACGCAACAAGCACTTCCGCG

      D. melanogaster  TGCACGTGGAGCAGAACATGTACTGCATTGGGCAGAGGAAGTTCCACTCGCTGGACCAACTGGTCGATCA
          D. simulans  TGCACGTGGAGCAGAATATGTACTGCATTGGGCAGAGGAAGTTCCACTCGCTGGACCAACTGGTCGATCA
         D. sechellia  TGCACGTGGAGCAGAATATGTACTGCATTGGGCAGAGGAAGTTCCACTCGCTGGACCAACTGGTCGATCA
            D. yakuba  TGCACGTGGAGCAGAACATGTACTGCATTGGGCAGAGGAAGTTCCACTCGCTGGACCAACTGGTCGATCA
            D. erecta  TGCACGTGGAGCAGAATATGTACTGCATTGGGCAGAGGAAGTTCCACTCGCTGGACCAACTGGTCGATCA
         D. ananassae  TGCACGTGGAGCAGAACATGTACTGCATCGGACAGCGCAAGTTCCACTCCCTGGACCAGCTGGTCGACCA
     D. pseudoobscura  TCCACGTGGAGCAGAACATGTACTGCATTGGCCAGCGGAAGTTCCACTCACTGGACCAGCTGGTCGACCA
        D. persimilis  TCCACGTGGAGCAGAACATGTACTGCATTGGCCAGCGGAAGTTCCACTCACTGGACCAGCTGGTCGACCA
        D. willistoni  TGCATGTGGAGCAGAATATGTACTGCATTGGACAGCGTAAATTCCATTCGCTCGATCAACTGGTCGATCA
           D. virilis  TCCACGTGGAGCAGAATATGTACTGCATTGGACAGCGAAAGTTCCATTCACTGGACCAGCTGGTCGAACA
        D. mojavensis  TGCACGTGGAGCAGAACATGTATTGCATTGGACAGCGCAAGTTTCATTCGCTGGACCAGCTGGTCGATCA
         D. grimshawi  TGCATGTCGAGCAGAATATGTACTGCATTGGGCAGCGCAAGTTTCATTCGCTGGATCAGTTGGTTGAGCA
           A. gambiae  TGCACGTCGAAGGTAATATGTACTGCATCGGGCAGCGCAAATTTCACACACTGGATCAACTAGTGGACCA
         A. mellifera  TACACGTGGAAGGAGCATTATATTGTATTGGTCAAAGAAAATTTCATACATTAGACCAATTAGTAGATCA
         T. castaneum  TCCACGTCGAGGGGGCGCTGTACTGCATCGGACAACGAAAATTCCACACGTTAGACCAACTCGTCGACCA

      D. melanogaster  CTACCAAAGAGCGCCCATCTACACGAATAAGCAGGGCGAAAAGCTGTATCTGGTGCGATCGCTGCCGAAG
          D. simulans  CTACCAAAGAGCGCCCATCTACACGAACAAGCAGGGCGAAAAGCTGTATCTGGTGCGATCGCTGCCGAAA
         D. sechellia  CTACCAAAGAGCGCCCATCTACACGAACAAGCAGGGCGAAAAGCTGTATCTGGTGCGATCGCTGCCGAAA
            D. yakuba  CTACCAAAGAGCGCCCATCTACACAAACAAGCAGGGCGAAAAGCTGTATCTGGTGCGATCGCTGCCGAAG
            D. erecta  CTACCAAAGAGCGCCCATCTACACGAACAAGCAGGGCGAAAAGCTGTATCTGGTGCGATCGCTGCCGAAG
         D. ananassae  CTACCAAAGAGCGCCCATCTACACGAACAAGCAGGGCGAGAAGCTGTATCTGGTGCGGTCCCTGCCGAAG
     D. pseudoobscura  CTACCAAAGAGCGCCCATCTACACGAACAAGCAGGGCGAGAAGCTGTATCTGGTGCGGTCGCTGCCCAAG
        D. persimilis  CTACCAAAGAGCGCCCATCTACACGAACAAGCAGGGCGAGAAGCTGTATCTGGTGCGGTCGCTGCCCAAG
        D. willistoni  TTACCAAAGAGCGCCCATATATACGAACAAGCAAGGCGAGAAATTGTATCTAGTTCGGTCGTTGCCCAAG
           D. virilis  CTACCAAAGAGCGCCCATCTATACGAACAAGCAGGGCGAGAAACTGTATCTGGTGCGGTCGCTGCCAAAG
        D. mojavensis  CTACCAAAGAGCGCCCATCTATACGAACAAGCAGGGCGAGAAGCTGTATCTGGTGCGACCGCTGCCAAAG
         D. grimshawi  CTACCAAAGAGCGCCCATTTATACGAACAAGCAGGGCGAGAAGCTGTATCTGGTGCGACCGCTGCCCAAG
           A. gambiae  TTACCAAAGAGCCCCCATTTACACTAACAAGCAAGGCGAAAAACTGTATCTTGTTCGACCATTGCCGAAA
         A. mellifera  TTATCAACGAGCGCCTATTTATACTAATAAGCAGGGTGAGAAATTGTATTTGGTGCGTCCATTGCCAAAA
         T. castaneum  CTACCAGAGGGCGCCGATTTACACGAACAAACAGGGCGAAAAATTGTACCTCGTACGTCCATTACCTAAG

      D. melanogaster  GCCAA
          D. simulans  GCCAA
         D. sechellia  GCCAA
            D. yakuba  GCCAA
            D. erecta  GCCAA
         D. ananassae  GCCAA
     D. pseudoobscura  GCCAA
        D. persimilis  GCCAA
        D. willistoni  GCCAA
           D. virilis  GCCAA
        D. mojavensis  GCCAA
         D. grimshawi  GCCAA
           A. gambiae  GCAAA
         A. mellifera  GGCAA
         T. castaneum  CCAA-

Inserts between block 50 and 51 in window
        A. mellifera 2203bp
        T. castaneum 26802bp

Alignment block 51 of 217 in window, 831914 - 831966, 53 bps 
B D   D. melanogaster  TGGCACGTAAgcaggt---------------------------------------cc-aggactgga---
B D       D. simulans  TGGCACGTAAgcaggt---------------------------------------cc-aggactagg---
B D      D. sechellia  TGGCACGTAAgcaggt---------------------------------------cc-aggactagg---
B D         D. yakuba  TGGCACGTAAgcagggt----------------------------aaaag----acc-aggaccaga---
            D. erecta  TGGCACGTAAgcagggt----------------------------gaaag----gcc-aggaccaga---
         D. ananassae  TGGCACGTAAagtgtgttgcc-----------------------gaagcg----tcc-ggaatcggaatc
     D. pseudoobscura  TGGAACGTAAattgcca--------------------------------------ca-aggatgaat---
B D     D. persimilis  TGGAACGTAAattgcca--------------------------------------ca-aggatgaat---
        D. willistoni  TGGAACGTAAgcagccagttccagattgtttgtactctgtatagagaatgcctagcc-aaaaaagaa---
           D. virilis  CGGCACGTAAatggg-------------------------------------------ccacgccac---
        D. mojavensis  TGGCACGTAAagagggaaacaaa--------------------------------caaacaaacaga---
         D. grimshawi  TGGCACGTAAatggcatcccaca--------------------------------ca-aaaaacaac---
B D        A. gambiae  TGGTACCTAAaactgc---------------------------------------ga-gcaaatgga---
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  -gcaga------gaaatc-------------------------------tcagc----------------
          D. simulans  -gcaga------gaaatc-------------------------------tcagc----------------
         D. sechellia  -gcaga------gaaatc-------------------------------tcagc----------------
            D. yakuba  -gcagc------ggaatc-------------------------------tcagc----------------
            D. erecta  -gcagc------ggcatc-------------------------------tcagc----------------
         D. ananassae  tgaatt------tgaatc-------------------------------tcagc----------------
     D. pseudoobscura  -atcat------caaagg-------------------------------ggggg----------------
        D. persimilis  -atcat------caaagg-------------------------------ggggg----------------
        D. willistoni  -gaaaa------gaaaacaaaaaagaggaaggaaatcgtcgatggaaaaggagc----------------
           D. virilis  -acaac------ccaaac-------------------------------tcatcatctataggtc-----
        D. mojavensis  -aaaac------aaaaac-------------------------------tcaac----atagatc-----
         D. grimshawi  -aaaac------aaaaag-------------------------------aaaa-----atgggttggaat
           A. gambiae  -aaagtctcctggagatg-------------------------------ctagt----------------
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ----------at----------t-------catatta
          D. simulans  ----------at----------t-------catatta
         D. sechellia  ----------at----------t-------catatta
            D. yakuba  ----------at----------t-------catatta
            D. erecta  ----------at----------t-------catatta
         D. ananassae  ----------atccaaaa---cc-------catatta
     D. pseudoobscura  ----------at----------c-------attatta
        D. persimilis  ----------at----------c-------attatta
        D. willistoni  ----------atctttaacttct-------cataata
           D. virilis  ----------at----------cagtttaatatatta
        D. mojavensis  ----------at----------c----taatatatta
         D. grimshawi  gaggcccataat----------c--tcttatatatta
           A. gambiae  ----------aa----------g-------catatta
         A. mellifera  =====================================
         T. castaneum  =====================================

Alignment block 52 of 217 in window, 831967 - 832444, 478 bps 
B D   D. melanogaster  --cccgtatt-caaca----acac---acatatgcaacacaa------------aga------tatac--
B D       D. simulans  --cccgtatt-caaca----acac---acatatgcaacacaa------------aga------tatac--
B D      D. sechellia  --cccgtatt-caaca----acac---acatatgcaacacaa------------aga------tatac--
B D         D. yakuba  --cccgtatt-caaca----acac---acatatgcaacacaa------------aga------tatac--
            D. erecta  --cccgtatt-caaca----acac---acatatgcaacacaa------------aga------tatac--
         D. ananassae  --cccgtatt-cagca-aacatcc---acatatgcaacacaa------------aga------tatac-c
     D. pseudoobscura  --cccgtatt-aagca--------------tatacaacacaa------------aga------tatac--
B D     D. persimilis  --cccgtatt-aagca--------------tatacaacacaa------------aga------tatac--
        D. willistoni  ttctcgtattataacataatacat---acatgtaaaacgcaaaaacaaaagaggaaa------tatatat
           D. virilis  --ctcgtaatataact-----------aaatacaaacttaaa------------tac------aactt--
        D. mojavensis  --ctcgtaatataact----aaacaaaaaatacacaacataa------------tac------aactt--
         D. grimshawi  --ctcgtaatatacat-----------aaataccatatacaa------------cacatacagaactt--
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  -ca-aggcta---------acttgtag--------------------gcagct---c--agctcagcgc-
          D. simulans  -ca-aggcta---------acttgtag--------------------gcagct---c--agctcagcgc-
         D. sechellia  -ca-aggcta---------acttgtag--------------------gcagct---c--agctcagcgc-
            D. yakuba  -ca-aggcta---------acttgtag--------------------gcagct---c--agctcagcgc-
            D. erecta  -ca-aggcta---------acttgtag--------------------gcagct---c--agctcagcgc-
         D. ananassae  aca-aggcta---------a-ttgtag--------------------gcagct---c--agctcggcgc-
     D. pseudoobscura  -ca-aggcta---------acttatag--------------------gcagctcagc--agctcagctc-
        D. persimilis  -ca-aggcta---------acttatag--------------------gcagctcagc--agctcagctc-
        D. willistoni  ata-aaactatatatatatatatatagaaaccgcacatttaccatttgcagct---c--agctcgat-t-
           D. virilis  -gatatgata---------gagtacat--------------------acgtat---ctaaacatggcat-
        D. mojavensis  -ca-atgata---------tagtacat--------------------acgtat---t--aacatggcata
         D. grimshawi  -ca-atgata---------tagaaaat--------------------acgta-------aatacgtaact
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  -------------------------gacgtgtagttcaatatagttc----ggtttggat--atttaatt
          D. simulans  -------------------------gacgtgtagttcaatataattc----ggtttggat--attcaatt
         D. sechellia  -------------------------gacgtgtagttcaatataattc----ggtttggat--attcaatt
            D. yakuba  -------------------------gacgtgtagttcaatgtagttc----ggtttggat--attcaatt
            D. erecta  -------------------------gacgtgtagttcaacgtagttc----ggtttggat--attcaatt
         D. ananassae  -------------------------gaagtgtagtttattgtagttc----agttcgattcgattcgatt
     D. pseudoobscura  -------------------------gacgtgtagttcaatgtagtttccaagattcag----attcagtt
        D. persimilis  -------------------------gacgtgtagttcaatgtagtttccaagattcag----attcagtt
        D. willistoni  -------------------------gacatgtagttcaatatacatt------tttgttt--gtt-----
           D. virilis  -------------------------agcgcgttgaccaaattgttttctcagttttgtat--gcttcgcg
        D. mojavensis  gaacataacaaaaaaaaatgtatgcagcgcgctgtccaaatcctttcttcagttttgtat--gcttcgcg
         D. grimshawi  aaacatggctaaaacaaatgc----aacgcgttgtccacaaaaatctttcagttctt--t--gcttcgca
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  atggactcagttttg-----gatt----------------------------------------------
          D. simulans  atagactcagttttg-----gatt----------------------------------------------
         D. sechellia  atagactcagttttg-----gatt----------------------------------------------
            D. yakuba  atggactcagttttg-----gatt----------------------------------------------
            D. erecta  atggactcagttttg-----gatt----------------------------------------------
         D. ananassae  atga--ttcgttttg-----gattcaaa---------------------------------------att
     D. pseudoobscura  tcagattcagtctta-----gattcggattaagattcagattcagattcagttaaatgccaaaaccgatt
        D. persimilis  tcagattcagtctta-----gattcggattaagattcagattcagattcagttaaatgcctaaaccgatt
        D. willistoni  ----------------------tt----------------------------------------------
           D. virilis  agagaaatcgagaaaaaaaaaaag----------------------------------------------
        D. mojavensis  at------------------aagg----------------------------------------------
         D. grimshawi  acagagtatgt---------atgt----------------------------------------------
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ----------------agatcagaccagcg------tgtgtatatagatcgg-------ttggtt-----
          D. simulans  ----------------agatcagaccagcg------tgtgtatatagatcgg-------ttggtt-----
         D. sechellia  ----------------agatcagaccagcg------tgtgtatatagatcgg-------ttggtt-----
            D. yakuba  ----------------agatcagaccagcg------tgtgtatatagatcgg-------ttggtt-----
            D. erecta  ----------------agatcagaccagcg------tgtgtatatagatcgg-------ttggtt-----
         D. ananassae  ----------gagttcggatgagagcagcg------tgtgtatatagatcgg-------ttggtcggtga
     D. pseudoobscura  ccggaaccgagggttcagagcagaacttca------gttgagaacagatcggatcggaatggatc-----
        D. persimilis  ------ccgagggttcagagcagaactcca------gttaagaacagatcggaacggaatggatc-----
        D. willistoni  --------------------------------------tttctatagttcag-------ttaaat-----
           D. virilis  ----------------aaatagagagaggg------aatgtatataaatcgg-------ttaatt-----
        D. mojavensis  ----------------agagagggcgagagtatctatatgtatataaatcgg-------ttgatt-----
         D. grimshawi  ----------------atatataga-----------tatatatatatatcgg-------ttaatt-----
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  -caac--gc-g-acccg----ta-------------------------------------cgtata---g
          D. simulans  -caac--gc-g-acccg----ta-------------------------------------catata---g
         D. sechellia  -caac--gc-g-acccg----ta-------------------------------------catata---g
            D. yakuba  -caac--gc-g-acccg----ta-------------------------------------catata---g
            D. erecta  -caat--gc-g-acccgtacata-------------------------------------catata---g
         D. ananassae  acgac--ac-a-acccg----ta-------------------------------------tatagg---g
     D. pseudoobscura  -ggat--gg-g-atctg----tgtggatctgtgtacgagtgtgtgtgtgtatatagatcttatata---a
        D. persimilis  -ggat--gg-g-atctg----tgtggatctgtgtacga--gtgtgtgtgtatatagatcttatata---a
        D. willistoni  -gcat--ac-atacaca----ca-------------------------------------catatatatg
           D. virilis  tcgat--gccg-attca----tg-------------------------------------ttcgagtgcg
        D. mojavensis  catgttcgctg-attca----tg-------------------------------------ttcgaatgcg
         D. grimshawi  -gtgt--cccg-attca----cg-------------------------------------atcatgtgcg
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ---------------ccacggccaa----a---ggacc---tttttgtacttttatataa-ttgaatt--
          D. simulans  ---------------ccacggccaa----a---ggacc---tttttgtacttttatataa-ttgaatt--
         D. sechellia  ---------------ccacggccaa----a---ggacc---tttttgtacttttatataa-ttgaatt--
            D. yakuba  ---------------ccacggccaa----a---ggacc---tttttgtacttttatataa-ttgaatt--
            D. erecta  ---------------ccacggccaa----a---ggacc---tttttgtacttttatataa-ttgaatt--
         D. ananassae  c--------------ccacgagaaa----g---agaaagagtttttgtacttttatatac-ttgaatt--
     D. pseudoobscura  ---------------ccacggacaa----a---ggacc---tttttgtacttttatataa-ttaaatt--
        D. persimilis  ---------------ccacggacaa----a---ggacc---tttttgtacttttatataa-ttaaatt--
        D. willistoni  ---------------tatcagacaa----aatgaaacc---tttttatacttttataaga-attaatatt
           D. virilis  ---------------taatag--------a---cagac---tttttgtacttttataaaaattatata--
        D. mojavensis  ---------------taatagacaaacaca---cagac---tttttgtacttttataaaatttatata--
         D. grimshawi  tttttggtcaagatataatagacaa----a---cagac---tttttgtacttttataaaa-ttatgaa--
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  --aa----------------------------ct---aaattaacgcttaatt---accgcatt-ggct-
          D. simulans  --aa----------------------------ct---aaattaacgcttaatt---accgcatt-ggct-
         D. sechellia  --aa----------------------------ct---aaattaacgcttaatt---accgcatt-ggct-
            D. yakuba  --aa----------------------------ct---aaattaccgcttaatt---accgcatt-ggct-
            D. erecta  --aa----------------------------ct---aaattaccgcttaatt---accgcatt-ggct-
         D. ananassae  --aa----------------------------ct---aaattag--------------cgcatt-ggct-
     D. pseudoobscura  -aaa----------------------------tt---aaattaacgcttaatt---atcgcatt-ggct-
        D. persimilis  -aaa----------------------------tt---aaattaacgcttaatt---atcgcatt-ggct-
        D. willistoni  aaaa----------------------------atgaaaaattaaagcttaattc-aaatgcatt-ggct-
           D. virilis  --ca--------------------aattaataat---taattaatgcttaattcggcgagctttcgatt-
        D. mojavensis  --ta-----------------------tctaaat---taattaatgcataattcggctagcttt-gatta
         D. grimshawi  --aacacaaaaaagaaaatggaataattcgcgtt---taattaatagttaattcggctagcttt-tatc-
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ---------------atgttaacg----------------------------------------------
          D. simulans  ---------------atgtt--------------------------------------------------
         D. sechellia  ---------------atgtt--------------------------------------------------
            D. yakuba  ---------------atgttaacg----------------------------------------------
            D. erecta  ---------------atgttaacg----------------------------------------------
         D. ananassae  ---------------atgttggca----------------------------------------------
     D. pseudoobscura  ---------------atgttaacc----------------------------------------------
        D. persimilis  ---------------atgttaacc----------------------------------------------
        D. willistoni  ---------------a------------------------------------------------------
           D. virilis  -----cagttctttaatttcatttgtagctacctatttttgtttttg-----------------------
        D. mojavensis  ataactattttgttaacgttagtt-----cgcttccttttctttgtgaactatggagaaagatgaaagca
         D. grimshawi  -------gcctactaatttgaata--------------ttctt---------------------------
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  -------aggaacgagaaactcaagaactcat-cattgcatt----------------------------
          D. simulans  ----------aacgagaaactcaagaactcat-cattgcatt----------------------------
         D. sechellia  ----------aacgagaaactcaagaactcat-cattgcatt----------------------------
            D. yakuba  -------agaaacgtaaaactcaagaactcat-tattgcatt----------------------------
            D. erecta  -------agaaacgaaaaactcaagaactcat-aattgcatt----------------------------
         D. ananassae  -------ag-agaggataactaacgaaataat-cac----------------------------------
     D. pseudoobscura  -------agaaagtgaaagaggaacaacacacacatcacattaccgacattaccttttgtgagccgcctt
        D. persimilis  -------agaaagtgaaagaggaacaacacacacatcacattacagacattaccttttgtgagccgcctt
        D. willistoni  ------------------------aaacacac-acgcaattt----------------------------
           D. virilis  ------taaaagataaaaatgaaagaaccaaaggcttcttta----------------------------
        D. mojavensis  agcgcataagaaatataaaagaaagaaccaaaggcttctttt----------------------------
         D. grimshawi  ------ttcgatttctcaattc-----------gcttccttt----------------------------
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ------------------------cgattcaat-----ttga----------------------------
          D. simulans  ------------------------cgattcgat-----ttga----------------------------
         D. sechellia  ------------------------cgattcgat-----ttga----------------------------
            D. yakuba  ------------------------cgattcgat-----ttga----------------------------
            D. erecta  ------------------------cgattcgat-----ttga----------------------------
         D. ananassae  --------------------------attcgat-----tcga----------------------------
     D. pseudoobscura  tcgttggaggtggcaagtgagggatgagaggat-----gtga-------gaggagggagtaggggagggg
        D. persimilis  tcgttggaggtggcaagtgagggatgagaggat-----gtgagaggatggaggagggagtaggggagggg
        D. willistoni  ------------------------ggattcgat-------------------------------------
           D. virilis  ------------------------actcaaaaaac---acac----------------------------
        D. mojavensis  ------------------------tctctcgaa-----acac----------------------------
         D. grimshawi  ------------------------tgtaaacaattctatcac----------------------------
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ----------gcaaatctagatgtcaacatgcaa---tac---a-ttacatatttacat-a---------
          D. simulans  ----------gcaaatctagatgtcaacatgcaa---tac---a-taacatatttacat-a---------
         D. sechellia  ----------gcaaatctagatgtcaacatgcaa---tac---a-ttacatatttacat-a---------
            D. yakuba  ----------gcaaatctagatgtcaacatgcaa---tac---atttacatatttacat-a---------
            D. erecta  ----------gcaaatctagatgtcaacatgcaa---tac---atttacatatttacat-a---------
         D. ananassae  ----------gcaattctaggtgtcaagatgcaa---tac---a-ttacata-ttacat-a---------
     D. pseudoobscura  gattcaaagaacaattctagatgtcaacatgcagcattac---acttacataagtatat-a--------a
        D. persimilis  gattcaaagaacaattctagatgtcaacatgcagcattac---acttacataagtatat-a--------a
        D. willistoni  ----------acaattctagatgtcaacatgcat---tat---tgatagataaagaaac-aagatataga
           D. virilis  ----------tcaattctagatgtcaaaatgcat---tac---atttacatactc-----t---------
        D. mojavensis  ----------tcaattctagatgtcaacatgcat---tac---atttacatactc-tatat---------
         D. grimshawi  ----------tcaattctagatgtcaacatgcat---tatacgatttacatactc-tat-a---------
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ------------ccgtacatgtgcacata---ttata-ctatattc---taaagc-aaagttgtagcttc
          D. simulans  ------------ccgtacatgtgcacata---ttata-ctatattc---taaagc-aaagttgtagcttc
         D. sechellia  ------------ccgtacatgtgcacata---ttata-ctatattc---taaagc-aaagttgtagcttc
            D. yakuba  ------------ccgtacatgtgcacata---ttata-ctatattc---taaagc-aaagttgtagcttc
            D. erecta  ------------ccgtacatgtgcacata---ttata-ctatattc---taaagc-aaagttgtagcttc
         D. ananassae  ------------ccatacatgtgcacata---ttata-ctatactc---taacgc--aagtcgtagctga
     D. pseudoobscura  aacataccatatacatacatgtgcacata---t--ta-ctatattc---taaaacgaaagttgtagccga
        D. persimilis  aacataccatatacatacatgtgcacata---t--ta-ctatattc---taaaacgaaagttgtagccga
        D. willistoni  aatatataatatatatacatgtgcacata---acctctctacatct---aaacatctaagctatatatat
           D. virilis  ------------atatgtataaatacata---atatg-cgatattt---aaacat------tgtagccaa
        D. mojavensis  ------------atatgtataaatacata---atata-cgatattt---aaacat------tgtagccaa
         D. grimshawi  ------------atatgtataaatacataatgatata-tgatatttaacaaacac------tgtagccaa
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  cc--tatgtacacaga---------gaaaagaggc-----------------------------------
          D. simulans  cc--tatgtacacaga---------gaaaagaggc-----------------------------------
         D. sechellia  cc--tatgtacacaga---------gaaaagaggc-----------------------------------
            D. yakuba  cc--tatgtacacaga---------gaaaagaggc-----------------------------------
            D. erecta  cc--tatgtacacaga---------gaaaagaggc-----------------------------------
         D. ananassae  ct--aatgtacacagatcgcttcctgaagggagat-----------------------------------
     D. pseudoobscura  ctaaaatgtacacaga---------ggacaggagcagtagaacgaagagactagagaccgacagagagca
        D. persimilis  ctaaaatgtacacaga---------ggacaggagcagtagaacgaagagactagagaccgacagagagca
        D. willistoni  ac---atgaacatata---------ttgaagaacc--------------------------cagcaaaat
           D. virilis  gt--attgtgtacaca---------gcaaag---------------------------------------
        D. mojavensis  gt--attgtgtacaca---------gcaaag---------------------------------------
         D. grimshawi  ct--attgtgtacaca---------gcaaag---------------------------------------
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ----------------cgcttttaatc--------agaaca--ctcg------aac-atgta-------a
          D. simulans  ----------------cgcttttaatc--------agaaca--ctcg------aac-atgta-------a
         D. sechellia  ----------------cgcttttaatc--------agaaca--ctcg------aac-atgta-------a
            D. yakuba  ----------------cgcttttaatc--------agaaca--ctcg------aac-atgta-------a
            D. erecta  ----------------cgcttttaatc--------agaaca--ctcg------aac-atgta-------a
         D. ananassae  ----------------cgcttttagcc--------agaata--ctgggcatgtaac-gtgta-------a
     D. pseudoobscura  ggagatgagagatgaacgcttttaacc-----cagaacaca--cttg------aaa-atgta-------a
        D. persimilis  ggagatgagagatgaacgcttttaacc-----cagaacaca--cttg------aaa-atgta-------a
        D. willistoni  gtagcgaagaacgaaacgcttttaaaaccaaacaaaaatca--cttg------aactatgta-------a
           D. virilis  ----------------cgcttttaag---------aaactg--actt------aag-atatgtctagctc
        D. mojavensis  ----------------cgcttttaa----------aaactg--actt------aag-atatg--tagccg
         D. grimshawi  ----------------cgcttttaa----------aacccaacactt------aag-atagc-----cta
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  tatgagat-----atatg
          D. simulans  tatgag-------atatg
         D. sechellia  tatgag-------atatg
            D. yakuba  tatga------------g
            D. erecta  tatgagatatgagatatg
         D. ananassae  cacgag-------atatg
     D. pseudoobscura  tatgaa-------atatg
        D. persimilis  tatgaa-------atatg
        D. willistoni  tattcg-------at-tg
           D. virilis  tatg--------------
        D. mojavensis  tatg--------------
         D. grimshawi  tacg--------------
         A. mellifera  ==================
         T. castaneum  ==================

Inserts between block 52 and 53 in window
          D. virilis 15bp
       D. mojavensis 15bp
        D. grimshawi 429bp

Alignment block 53 of 217 in window, 832445 - 832563, 119 bps 
B D   D. melanogaster  a------------------------------------------------------tatgata-------t
B D       D. simulans  a------------------------------------------------------tatgat---------
B D      D. sechellia  a------------------------------------------------------tatgat---------
B D         D. yakuba  a------------------------------------------------------tatgata-------t
            D. erecta  a------------------------------------------------------tatgata-------c
         D. ananassae  a------------------------------------------------------tacgat---------
     D. pseudoobscura  aaccatgcatatatatatagtatttatatatatgtagtatatatgtacgggtcagtatggtacccaaatc
B D     D. persimilis  aaccatgcatatatatatagtatttatatatatgtagtatatatgtacgggtcagtatggtacccaaatc
        D. willistoni  a------------------------------------------------------tctaaa--------c
           D. virilis  ----------------------------------------------------------------------
        D. mojavensis  ----------------------------------------------------------------------
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  gatatgat-atg-----atgtcta-----t---------------tatccacgcgt-taaccat--aagc
          D. simulans  -atatgat-atg-----atgtcta-----t---------------tatccacgcgt-taaccat--aagc
         D. sechellia  -atatgat-atg-----atgtcta-----t---------------tatccacgcgt-taaccat--aagc
            D. yakuba  gatatgat-atg-----atgtcta-----t---------------tatccccgcgt-taaccat--aagc
            D. erecta  gatatgat-atg-----atgtcta-----t---------------tatccccgcgt-ttaccat--aagc
         D. ananassae  -atac-at-att-----atgtcta-----t---------------tatcc------------------gt
     D. pseudoobscura  agtatgatgatg-----atgtcta-----t---------------tatccgtgca--taacgattacatt
        D. persimilis  agtatgatgatg-----atgtcta-----t---------------tatccgtgca--taacgattacatt
        D. willistoni  gatatgat-atg-----atgtctaactatt---------------tatcaatatctgtaactat------
           D. virilis  -gtgtcat-gtgtgtgtgtgtgta-----tgtctgattgtgtgtgtatgtgtgtgt-gcactgc--aatt
        D. mojavensis  -gtgtga--gtgcgtgcgtgtatg-----tgtatgagtgtttggatatatg-gcgc-aagaaga--aatt
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  aaaatgtgta------------cgatcgtaa--ccaattcgc----------------atagata-----
          D. simulans  -aaatgtgta------------cgatcgtaa--ccaatccgc----------------atagata-----
         D. sechellia  aaaatgtgta------------cgatcgtaa--ccaatccgc----------------atagata-----
            D. yakuba  aaaatgtgta------------cgatcgtaa--ccaatccgc----------------atagata-----
            D. erecta  aaaatgtgta------------cgatcgtaa--ccaatccgc----------------atagata-----
         D. ananassae  actgtacgta------------ctatcgtag--ccaatccgc------------------agatt-----
     D. pseudoobscura  acactatgta------------taaccaaa-----agtccgc----------------aatgaag-----
        D. persimilis  acactatgta------------taaccaaa-----agtccgc----------------aatgaag-----
        D. willistoni  -atctgtgta------------tctatatat--gcattctgctcaacaacacagccagagtgaga-----
           D. virilis  --gctttgtgaacaatttataaagctcgcaatcctgagccac----------------atatatatgtat
        D. mojavensis  -cactttgtg------------cgctcacaat-cgaatccac----------------ataaatgaatat
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ----tcgatt--------------tcgtgtatgtacatacataggtga----------------gaca
          D. simulans  ----tcgatt--------------tcgtgtatgtacatacataggtga----------------gaca
         D. sechellia  ----tcgatt--------------tcgtgtatgtacatacataggtga----------------gaca
            D. yakuba  ----tcgatt--------------tcgtgtatgtacatacataggtga----------------gaca
            D. erecta  ----tcgatt--------------tcgtgtatgtacatacataggtga----------------gaca
         D. ananassae  ----tccact--------------tcgtgtctgtacatacatag--tg----------------gtcg
     D. pseudoobscura  ----ttg--t--------------ttgtgtatgtacatacataagtgatgcacagggcaaccccaaca
        D. persimilis  ----ttg--t--------------ttgtgtatgtacatacataagtgatgcacagggcaaccccaaca
        D. willistoni  ----atagct--------------ccttaaccacacacacacacac-a----------------caca
           D. virilis  ac--ccaatcatactaatatctaatcgagtatgtaaatatgtaggcgg----------------aacg
        D. mojavensis  acagccaatcataccaatatcttatcgagtatgtaaatatgtaggcag----------------aacg
         D. grimshawi  ====================================================================
         A. mellifera  ====================================================================
         T. castaneum  ====================================================================

Inserts between block 53 and 54 in window
          D. virilis 40bp

Alignment block 54 of 217 in window, 832564 - 832590, 27 bps 
B D   D. melanogaster  tcctg--------------------atcctggatcc-agg--------------cca-------------
B D       D. simulans  tcctg--------------------atcctggatcc-agg--------------aca-------------
B D      D. sechellia  tcctg--------------------atcctggatcc-agg--------------aca-------------
B D         D. yakuba  tcctg--------------------atcctggatcc-agg--------------aca-------------
            D. erecta  tcctg--------------------atcctggatcc-agg--------------aca-------------
         D. ananassae  tcctg--------------------gacctggttcc-ggttccaggaggccaacaca-------------
     D. pseudoobscura  ccatgccacacgccacacaccacacaccacagaccacaga--------------cca-------------
B D     D. persimilis  ccatgccacacgccacacaccacacaccacagacca-acc--------------aca-------------
        D. willistoni  cactg--------------------acac----tca-aac--------------aca-------------
          D. virilis  ======================================================================
        D. mojavensis  --ctt--------------------accaacaatcc-aac--------------aaaatatgtcaaaagc
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  --ctca-----a
          D. simulans  --ctca-----a
         D. sechellia  --ctca-----a
            D. yakuba  --ctca-----a
            D. erecta  --ctca-----a
         D. ananassae  --ccta-----a
     D. pseudoobscura  --accacaccca
        D. persimilis  --cccacgcaca
        D. willistoni  --ctca------
           D. virilis  ============
        D. mojavensis  tgctta-----a
         D. grimshawi  ============
         A. mellifera  ============
         T. castaneum  ============

Inserts between block 54 and 55 in window
       D. mojavensis 8bp

Alignment block 55 of 217 in window, 832591 - 832623, 33 bps 
B D   D. melanogaster  cc----cacaaagccagagtga---------ggaaaacg-------------------------------
B D       D. simulans  cc----cacaaagccagagtga---------ggaatacg-------------------------------
B D      D. sechellia  cc----cacaaagccagagtga---------ggaatacg-------------------------------
B D         D. yakuba  cc----cacaaagccagagtga---------ggaaaacg-------------------------------
            D. erecta  cc----cacaaagccagagtga---------ggaatacg-------------------------------
         D. ananassae  cccaaacacacagccagagtga---------gga--tcg-------------------------------
     D. pseudoobscura  ca----cacacagccagagtga---------gga--tcg-------------------------------
B D     D. persimilis  ca----cacacagccagagtga---------gga--tcg-------------------------------
        D. willistoni  ------catgcag-cacattca---------gaaacata-------------------------------
           D. virilis  -t----caagaaaaaaaaaaaa--------agaaaaact-----------ctaattggcaagttaaa---
        D. mojavensis  -c----caagaagatggaaaaacacaaattgtgaaaacttaattagttcgctaatttgctaataagataa
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  ------------ctcct-------ac----------------
          D. simulans  ------------ctcct-------ac----------------
         D. sechellia  ------------ctcct-------ac----------------
            D. yakuba  ------------ctcct-------ac----------------
            D. erecta  ------------ctcct-------ac----------------
         D. ananassae  ------------ctcct-------ac----------------
     D. pseudoobscura  ------------ctcct-------ac----------------
        D. persimilis  ------------atcct-------ac----------------
        D. willistoni  ------------cacattaaaaaaaa----------------
           D. virilis  ---gctgcttgtcttct-------acttccacacacagc--c
        D. mojavensis  gatgcttcatgacttca-------ac-tacacacacatccac
         D. grimshawi  ==========================================
         A. mellifera  ==========================================
         T. castaneum  ==========================================

Alignment block 56 of 217 in window, 832624 - 832751, 128 bps 
B D   D. melanogaster  agtca------------tttttgttattt---at-----ccatttaattatcgact-acgac--------
B D       D. simulans  agtca------------tttttgttattt---at-----ccatttaattatcgact-acgac--------
B D      D. sechellia  agtca------------tttttgttattt---at-----ccattgaattattcact-acgac--------
B D         D. yakuba  agtca------------tttttgttattt---at-----ccatttaattatcgact-acgac--------
            D. erecta  agtca------------tttttgttattt---at-----ccatttaattatcgact-acgac--------
         D. ananassae  agtca-------------tttcgttattc---gtaacaaccatt-aattatcgact-acgat--------
     D. pseudoobscura  agtcatt----------tttttgttattt---aa-----ccatttaattatcgact-acgat--------
B D     D. persimilis  agtcatt----------tttttgttattt---aa-----ccatttaattatcgact-acgat--------
        D. willistoni  agtcattaatttatcaatttttg-tattt---gt-----tcataaaattaac------------------
           D. virilis  agtca------------tttttt-tgtta---at-----tttcttca--attatataaacatacgcatac
        D. mojavensis  agtca------------cttttg-tattgaacat-----tttttttatcatcatctaaagataatggtat
         D. grimshawi  agtca------------tttt---tgtta---at-aca-attttaaattatcatcttaccat--------
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  --ataac-cacgcaaaa-----caaaacaaatacacttgatatctccgcgcggagtctgctcc----ccg
          D. simulans  --ataac-cacgcaaaacaaagcaaaacaaatacacttgatatctccgcgcggagtctgctcc----ccg
         D. sechellia  --ataac-cacgcaaaacaaagcaaaacaaatacacttgata---------------tgctcc----ccg
            D. yakuba  --ataac-cacg----------caaaacaaatacacttgatatctccgggcgaagtctgctcc----ccg
            D. erecta  --ataac-cacg----------caaaacaaatacacttgatatctccgggcggagtctgctcc----ccg
         D. ananassae  --ataac-cagc------------------atacactcgatatttacgggcgacgtttttccg----cta
     D. pseudoobscura  --ataac-cata--------------acaaatacaattgatatctctgggcagctctggctcc----aga
        D. persimilis  --ataac-cata--------------acaaatacaattgatatctctgggcagctctggctcc----aga
        D. willistoni  ---ttac-caga-------------aaccagttcagtttactcttctgcactaaga------g----cta
           D. virilis  ccataataaaaa----------t--aataataataattaaaataactaaagaaaagctgttctagccccg
        D. mojavensis  atattatacata----------cggaatatccacaataataatatccaaatacaaattgttctag--ccg
         D. grimshawi  --ataat-ctta----------cggaataccaataataataatatctaa--acaatctgttctag--ccg
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  cattatt-------------ataaacataatcta-atcgtttg
          D. simulans  cattatt-------------ataaacataatcta-atcgtttg
         D. sechellia  cattatt-------------ataaacataatcta-atcgtttg
            D. yakuba  cattatt-------------ataaacataatcta-atcgtttg
            D. erecta  cattatt-------------ataaacataatcta-atcgtttg
         D. ananassae  aaatattta-aaagaaaaagaaaaaaataatcta-atcgttta
     D. pseudoobscura  tgctgttcgcaaataattataaaaacataatcga-atcgtttg
        D. persimilis  tgctgttcgcaaataattataaaaacataatcga-atcgtttg
        D. willistoni  tatattc-------------ataaacatga-------------
           D. virilis  cataaat-------------ataaacataatcaacatcgtacg
        D. mojavensis  cataatt-------------ataaacataatcaacatcgtacg
         D. grimshawi  cataatt-------------ataaacataatcatcatcttacg
         A. mellifera  ===========================================
         T. castaneum  ===========================================

Inserts between block 56 and 57 in window
       D. willistoni 389bp
          D. virilis 11bp
       D. mojavensis 55bp
        D. grimshawi 16bp

Alignment block 57 of 217 in window, 832752 - 832774, 23 bps 
B D   D. melanogaster  ctgg-cgtgg------aggagggcggcgac----------
B D       D. simulans  ctgg-cgtgg------aggaggacg---------------
B D      D. sechellia  ctgg-cgtgg------aggaggacg---------------
B D         D. yakuba  ctgg-cgtgg------agaggggcggcgac----------
            D. erecta  ctgg-cgtgg------agaggggcggcgac----------
         D. ananassae  ctggccgaga------aggaggacggc-------------
     D. pseudoobscura  t--g-cgggggcaaccagggaggggaggct----------
B D     D. persimilis  t--g-cgggggcaaccagggaggggaggct----------
       D. willistoni  ========================================
           D. virilis  -----cttaa------gtggagcctccccctctaatatat
       D. mojavensis  ========================================
         D. grimshawi  -----cttaa------gtggagatccccccc------tat
        A. mellifera  ========================================
        T. castaneum  ========================================

Inserts between block 57 and 58 in window
          D. virilis 25bp
        D. grimshawi 27bp

Alignment block 58 of 217 in window, 832775 - 832856, 82 bps 
B D   D. melanogaster  t-tatacgcgtataagccatactgtacagt---tgatgcaatg-ctaaccta-------ggcactctttc
B D       D. simulans  -------gcgtattagccatactgtacagt---tgatgcaatg-ctaaccta-------ggcactctttc
B D      D. sechellia  -------gcgtattagccatactgtacagt---tgatgcaatg-ctaaccta-------ggcactctttc
B D         D. yakuba  t-tatacgcgtataagccatactgtacagt---tgatgcattg-ctaaccta-------ggcactctttc
            D. erecta  t-tatacgcgtataagccatactgtacagt---tgatgcaatg-ctaaccta-------ggcactctttc
         D. ananassae  ---attcaagcataggccatactgtacag----tgatgcgatg-ctaaccta-------ggcactctttc
     D. pseudoobscura  tatatccacatatatgccatactgtacagt---tgatgcaatg-ctaacacacctagacgacacccttt-
B D     D. persimilis  tatatccacatatatgccatactgtacagt---tgatgcaatg-ctaacacacctagacgacacccttt-
       D. willistoni  ======================================================================
           D. virilis  -tgatacgcatataagccatactgtacagttgatgatgcaatgcctaacctg-------ggcacactttc
        D. mojavensis  -tgatacgcatataagccatactgtacagttgatgatgcaatgcctaaccta-------agcacactttc
         D. grimshawi  -tgatacgcatataagccatgctgtacagttgatgatgcaatgcctaaccta-------agcacactttc
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  atctctagatata---cgtgtac-------------------------------tctt------------
          D. simulans  atctctagatata---cgtgtac-------------------------------tctt------------
         D. sechellia  atctctagatata---cgtgtac-------------------------------tctt------------
            D. yakuba  atctctagatata---cgtgtac-------------------------------tctt------------
            D. erecta  atctctagatata---cgtgtac-------------------------------tctt------------
         D. ananassae  ttctccaggcataggtcgcgtac-------------------------------tatt------------
     D. pseudoobscura  ---tcagaatata---catactc----------------------tatttaaagtttt------------
        D. persimilis  ---tcagaatata---catactc----------------------tatttaaagtttt------------
        D. willistoni  ======================================================================
           D. virilis  --------atata---tacataa-------------------------------tttctatttatacctt
        D. mojavensis  gt------atata---tacatac-------------------------------tttctatttatagttt
         D. grimshawi  --------acata---tgcatacatactttatatatatatatatatatatata-tttctatttatacttt
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ------------
          D. simulans  ------------
         D. sechellia  ------------
            D. yakuba  ------------
            D. erecta  ------------
         D. ananassae  ------------
     D. pseudoobscura  ------------
        D. persimilis  ------------
        D. willistoni  ============
           D. virilis  acacctataatt
        D. mojavensis  aatctttctatc
         D. grimshawi  actattacaatt
         A. mellifera  ============
         T. castaneum  ============

Alignment block 59 of 217 in window, 832857 - 832893, 37 bps 
B D   D. melanogaster  at------ttacgatacg---------at--tacgatta----cgagt-agaacgc----agc
B D       D. simulans  at------ttacgataag---------at--tacgatta----cgagt-agaacgc----agc
B D      D. sechellia  at------ttacga-----------------tacgatta----cgagt-agaacgc----agc
B D         D. yakuba  at------ttacg--------------at--tacgat--------agt-agaacgc----agc
            D. erecta  at------ttacgattat--------tat--tacgat--------agt-agaacgc----agc
         D. ananassae  at------ttacgattacga--t---gat--tacgatt-------agt-agaccgc----agc
     D. pseudoobscura  atttacgattacgattacga--ttacggt--tacgatta----agagtaagagcgc----agc
B D     D. persimilis  at------ttacgattacga--ttacggt--tacgatta----agagtaagagcgc----agc
        D. willistoni  at------ttacaattta-------cgat--tacgattatt-gtaagt-agaatgcagcaagc
           D. virilis  -------attattattattagttcattat--tatatttata---aagt-ag-aagc----cgc
        D. mojavensis  -------attagttgtatta--ttatta---tatatttataaagaagt-ag-aagc----agc
         D. grimshawi  -------attattattataa--ttattactatatatttatg---aagt-agtaggc----agc
        A. mellifera  ===============================================================
        T. castaneum  ===============================================================

Alignment block 60 of 217 in window, 832894 - 833117, 224 bps 
B D   D. melanogaster  gattccagctttaacttttgttttg-aattat----tgctatta----tttgtttttctaag--tttacg
B D       D. simulans  gattccagctttaacttttgttttg-aattat----tgctatta----tttgtttttctacg--tttacg
B D      D. sechellia  gattccagctttaacttttgttttg-aattat----tgctatta----tttgtttttctacg--tttacg
B D         D. yakuba  gattccagctttaacttttgttttg-aattat----tgctatta----tttgtttttctacg--tttacg
            D. erecta  gattccagctttaacttttgttttc-aattat----tgctatta----tttgttt---------------
         D. ananassae  gattccagctttaaattctgtttaataattattatatgctatta---ttttgttttcctttg-ttttaga
     D. pseudoobscura  gattccagctttaacttttgttt---aattat----tgcaattaca-ttttgtttgccttt---ttcatg
B D     D. persimilis  gattccagctttaacttttgttt---aattat----tgcaattaca-ttttgtttgccttt---ttcatg
        D. willistoni  gattccagctttaattt---tttag-ttttat----taaatctt----tttgtttgccaattatttaaga
           D. virilis  gatttcagctttaa-ttttgttttt-aattat----tac----a---tattgtttgaagttttatttttc
        D. mojavensis  gattccagctttaa-ttttgttttt-aaatat----tac----a---ttttgtttgccgtttt-ttttta
         D. grimshawi  gattccagctttaa-ttttgttttt-aattat-----------a---ttttgttcgccgtgtttttcttt
        A. mellifera  ======================================================================
         T. castaneum  ggttccgtctttataattcagttgt-gattgc----gaattttatagttttgtttctgat----tctaaa

      D. melanogaster  gttc-------------attattacaa--------ttgcgatta------------ttattttgt---tt
          D. simulans  gttc-------------attatgacaa--------atgcgatta------------ttattttgt---tt
         D. sechellia  gttc-------------attatgacaa--------ttgcgatta------------ttattttgt---tt
            D. yakuba  gttt-------attacgattattacca--------ttacgatta------------ttattttgt---tt
            D. erecta  -----------------attattacca--------ttacgatta------------ttattttgt---gt
         D. ananassae  gttc-------------attttaaccgccctacgtttacgatta------------ttgttttgt---tt
     D. pseudoobscura  gcc------------------taatca--------ttatgatta------------ttattttgt---tt
        D. persimilis  gccctctgattatgattattattatca--------ttatgatta------------ttattttgt---tt
        D. willistoni  attc-------------attttgt-----------ttatgttta------------tttttttattagtt
           D. virilis  attt-------------a-tgcaataa--------tattttgta------------ttgatttgt---tt
        D. mojavensis  attt-------------------------------tatatatta------------ttgatttgt---tt
         D. grimshawi  atat-------------------------------tat----ta------------ttgatttgt---tt
         A. mellifera  ======================================================================
         T. castaneum  ataa-------------actatatcga--------gcgaaattaggtaaagtaacttaaatttaa---tt

      D. melanogaster  tt---------atttagc---------------tctag--gaaagt--------aa---ttagcgaagg-
          D. simulans  tt---------atttagc---------------tctag--gaaagt--------aa---ttagcgaagg-
         D. sechellia  tt---------atttagc---------------tctag--gaaagt--------aa---ttagcgaagg-
            D. yakuba  tt---------atttagc---------------tctag--gaaagt--------aa---ttagcgaagg-
            D. erecta  tt---------atttagc---------------tctag--gaaagt--------aa---ttagcgaagg-
         D. ananassae  ttaactcgataatttagctattttagaagatattttag--gagagt--------aa---ttagcgaaag-
     D. pseudoobscura  tt---------atttagc---------------tctag--gaaagt--------ga---ttagagaaac-
        D. persimilis  tt---------atttagc---------------tctag--gaaagt--------ga---ttagagaaac-
        D. willistoni  ct---------ttcctgt---------------tttcg--ttagag--------ag---ttagaaaaaa-
           D. virilis  tt--------gatttagc---------------ttaag--attagtgagaagagaa---gagaagagaa-
        D. mojavensis  tt--------gatttagc---------------ctaag--atttgt-------------gagaagagaa-
         D. grimshawi  tt--------tatttagc---------------ttaagcaattagt---gagggac---gtagtgagagt
         A. mellifera  ======================================================================
         T. castaneum  ta---------atttggt---------------tattc--gtaagt--------tagctttagccaaaa-

      D. melanogaster  -----------------aacggaacgat-----------------------------------ag-----
          D. simulans  -----------------aacggaacgat-----------------------------------ag-----
         D. sechellia  -----------------aacggaacgat-----------------------------------ag-----
            D. yakuba  -----------------aacgtaacgat------------------agaagg-----------ag-----
            D. erecta  -----------------aacggaacgat-----------------------------------ag-----
         D. ananassae  -----------------gacgg-----------------------------------------ga-----
     D. pseudoobscura  -----------------gttgattcg-------------------------------------gc-----
        D. persimilis  -----------------gttgattcg-------------------------------------gc-----
        D. willistoni  -----------------aaagagaaatt-----cactgaaatttcgagttgg-----------at-----
           D. virilis  tatcaatctgataataggatggaacgct-----------------------------------gagtttt
        D. mojavensis  tatcaatctgata----gatggaccgat-----------------------------------gg-----
         D. grimshawi  tatcaatctaaaggga-gatgggacgattagagcttgaatgctttgatatgggggcgcttagagagactt
         A. mellifera  ======================================================================
         T. castaneum  ---------------------------------------------------------------ga-----

      D. melanogaster  aaaggagt-ggct--g---------------------cc------------------------agtt---
          D. simulans  gaaggagt-ggct--g---------------------cc------------------------agtt---
         D. sechellia  gaaggagt-ggct--g---------------------cc------------------------agtt---
            D. yakuba  aaaggagt-ggct--g---------------------cc------------------------agtt---
            D. erecta  aaaggagt-ggct--g---------------------cc------------------------agtt---
         D. ananassae  gaaagagt-ggct--g---------------------cc------------------------agtg---
     D. pseudoobscura  ggtggagtcggct--g---------------------cc-agacgaggaga-----aag----agtt---
        D. persimilis  ggtggagtcggct--g---------------------cc-agacgaggaga-----aag----agtt---
        D. willistoni  tagagaga-tgat--a---------------------at-ggatatgatga-----aagtggtggttcaa
           D. virilis  gaccaaaa-ggtt--ggctcgtt--------------cg-tggcaggtttaaccatagg----gttt---
        D. mojavensis  aacagaac-ggttagagctagttgctttagtaaaaggcgctgagtggtttaaccatatg----gtta---
         D. grimshawi  gaccagaa-agtt--gggt------------------ca-tggcaggtttaaccatagg----gttt---
         A. mellifera  ======================================================================
         T. castaneum  actcaaca-attt--g---------------------ct---------------------------t---

      D. melanogaster  aaatgactttcg---actttctttcccatgcgaatttt---------------taaa---ttat-aaatc
          D. simulans  aaatgactttcg---actttctttcacatgcgaatttt---------------taaa---ttat-aaatc
         D. sechellia  aaatgactttcg---actttctttcacatgcgaatttt---------------taaa---ttat-aaatc
            D. yakuba  aaatgactttagacctttttctttcacgcgcgaatttt---------------taaa---ttat-aaatc
            D. erecta  aaatgacttga----cttttctttcacacgcgaatttt---------------taaa---ttat-aaatc
         D. ananassae  aaatgactttcga--cttttctttcatacgcgaatttt---------------taaa---ttataaaatc
     D. pseudoobscura  aggtgactttcg---actttctttcatatgcgaatttt---------------taat---atat-aaatt
        D. persimilis  aggtgactttcg---actttctttcatatgcgaatttt---------------taat---atat-aaatt
        D. willistoni  aaatgacttta----aatttatttcatatgcgaatttt---------------gaat---atat-atata
           D. virilis  aaatgactttcg---actttatttcatatgcgaatttt---------------taaa---atat-ataaa
        D. mojavensis  agaggactttcg---actttatttcatatgcgaattttataacaacaaaaaaaaaaa---aaaa-atata
         D. grimshawi  aaatgactttcg---actttatttcatatgcgaatttt---------------taaatatatat-atatt
         A. mellifera  ======================================================================
         T. castaneum  aaat---tctca---aagcaatctaattggtgaatttt----------------aac---aaaa-aaatc

      D. melanogaster  tacat-tata-cgactacgt--a
          D. simulans  tacat-tata-cgactacgt--a
         D. sechellia  tacat-tata-cgactacgt--a
            D. yakuba  tacat-tata-cgactacgt--a
            D. erecta  tacat-tata-cgactacgt--a
         D. ananassae  tacat-tata-cgagtacgt--a
     D. pseudoobscura  tatatataca-cgagtacataca
        D. persimilis  tatataaaca-cgagtacataca
        D. willistoni  tatatatata-aacttatat--a
           D. virilis  tatatatata-taaatacat--a
        D. mojavensis  tatatatata-tataaacat--a
         D. grimshawi  tatatatata-tataaatat--a
         A. mellifera  =======================
         T. castaneum  tactgatatacctagta------

Inserts between block 60 and 61 in window
          D. virilis 3bp
       D. mojavensis 3bp
        D. grimshawi 11bp

Alignment block 61 of 217 in window, 833118 - 833277, 160 bps 
B D   D. melanogaster  --------------acataaaacttaaataatt---tatggtaattta-aacaa------tt------gc
B D       D. simulans  --------------acataaaacttaaataatt---tatggtaattta-aacaa------tt------gc
B D      D. sechellia  --------------acataaaacttaaataatt---tatggtaattta-aacaa------tt------gc
B D         D. yakuba  --------------acataaaacttaaataatt---tatagtaattta-aacaa------tt------gc
            D. erecta  --------------acataaaacttaaataatt---tatagtaattta-aacaa------tt------gc
         D. ananassae  --------------aaat-aaacttaaataatt---tatagtaattta-aacga------tt------gc
     D. pseudoobscura  --------------aaataaaccttaaataatt---tatggtaatttc-aacaa------tt------gc
B D     D. persimilis  --------------aaataaaccttaaataatt---tatggtaatttc-aacaa------tt------gc
        D. willistoni  --------------acactaactttcagcaatg---tacattattatc-accaaacattctt------tc
           D. virilis  --------------atataatgattatataatt---tatagtaatttc-aacaa------tt------gc
        D. mojavensis  --------------atataaagattaaataatt---tatagtaatttcaaacaa------tt------gc
         D. grimshawi  --------------atataaagattaaataatt---tatagtaatttcaaacaa------tt------gc
        A. mellifera  ======================================================================
         T. castaneum  aaataccaaaaaagaagaaaaaattaactaattttctatttaaatttg---taa------ttttttgggt

      D. melanogaster  taaa------c--c-aactagta--ctaaa------gacga--agagaac--aaactagaa----attat
          D. simulans  taaa------c--c-aactagta--ctaaa------gacga--agagaac--aaactagaa----attat
         D. sechellia  taaa------c--c-aactagta--ctaaa------gacga--agagaac--aaactagaa----attat
            D. yakuba  taaa------c--c-aactagta--ctaaa------gacga--agagaac--aaactagaa----attat
            D. erecta  taaa------c--c-aactagta--ctaaa------gacga--agagaac--aaactagaa----attat
         D. ananassae  taaa------c--c-aactagta--ctaaa------gacga--agagaac--aaactagaa----attat
     D. pseudoobscura  taaa------c--caaactagta--ctaaa------gacga--cgagaac--aaactagaa----attat
        D. persimilis  taaa------c--caaactagta--ctaaa------gacga--cgagaac--aaactagaa----attat
        D. willistoni  tcac------c--c-ccataataatctaaatttctggaaaa--tgtgaacaaaaacgaata----actat
           D. virilis  taaaaccacaa--c-aactagta--ctaaa------aacga-aagagaac--aaactagaa----attat
        D. mojavensis  taaaaac---a--c-aactagta--ctaaa------aaaaatgaaagaac--aaactagaa----attat
         D. grimshawi  taaa--c---a--c-aactagta--ct-aa------aacga-aagagaac--aaactagaa----attat
         A. mellifera  ======================================================================
         T. castaneum  tcaa------cgac-atctaaca--aaaaa------aacgt------aag--aatttaggaaatcattgc

      D. melanogaster  accgaaacg----gaaatgaataaaaatacattcaaata------aaccaaacggcctgct-tttgttac
          D. simulans  accgaaacg----gaaatgaataaaaatacattcaaata------aaccaaacggcctgct-ttcgttac
         D. sechellia  accgaaacg----gaaatgaataaaaatacattcaaata------aaccaaacggcctgct-tttgttac
            D. yakuba  accgaaacg----gaaatgaataaaaatacattcaaata------aaaccaacgcccggctctttgttac
            D. erecta  accgaaacg----gaaatgaataaaaatacattcaaata------aaacaaacgacctgctatttgttac
         D. ananassae  accgaaacg----gacatgaat-aaaatacattcaga-a------aattaaaggatctgatatt--ttac
     D. pseudoobscura  accgaaacg----gaaatgaataaaaatacattcaaata------aattaaa------------------
        D. persimilis  accgaaacg----gaaatgaataaaaatacattcaaata------aattaaa------------------
        D. willistoni  atcatatagctgtcaaagaaacaaagaaacgataaaataggttttaatttaaaggcct----tttgtgtc
           D. virilis  accgaaacg----gaaatgaataaaaataca-tcaaata------aattaaa---tgcaat-tttgtgtt
        D. mojavensis  accgaaacg----gaaatgaataaaaataca-tcaaata------aattataatctctgag-ttt-----
         D. grimshawi  accgaaacg----gaaatgaataaaaataca-tcaaata------aattataa--atcaac-tgtgtttc
         A. mellifera  ======================================================================
         T. castaneum  ttctttact----tgagaaaatagaaa---attaaaata------a----------------tttattat

      D. melanogaster  ttacccattga---aatta
          D. simulans  ttacccattgg---aatta
         D. sechellia  ttacccattgg---aatta
            D. yakuba  ttacgcattgg--aaatca
            D. erecta  ttacccattgg---aatca
         D. ananassae  ttac---------------
     D. pseudoobscura  -------------------
        D. persimilis  -------------------
        D. willistoni  gg--------------tct
           D. virilis  ttcccctttac---agcta
        D. mojavensis  -------------------
         D. grimshawi  tcctctattta---tatta
         A. mellifera  ===================
         T. castaneum  gaagtaattaccgagataa

Inserts between block 61 and 62 in window
        D. ananassae 260bp
    D. pseudoobscura 1785bp
B D    D. persimilis 1332bp
          D. virilis 1748bp
       D. mojavensis 756bp
        D. grimshawi 330bp

Alignment block 62 of 217 in window, 833278 - 833400, 123 bps 
B D   D. melanogaster  -----ccatcagtagcatacttttcgg---------agtctgtgattccattctggagtttggagatgct
B D       D. simulans  -----ccatcagtagcatacttttcgg---------agtctgtgattccattccggagtttggaaatgct
B D      D. sechellia  -----ccatcagtagtatacttttcgg---------agtctgtgattccattccggagtttggaaatgct
B D         D. yakuba  -----ctatcagtagcatacttttcgg---------agtctgcgtcttcatcctggagtctggagaagct
            D. erecta  -----ctatcagtagcatactttttgg---------agtcggcgtttccatcctggagtcaggagaagct
         D. ananassae  -----ccgcgcgaatcatattctttaa---------gaattcagattccat-----atataaaatataat
    D. pseudoobscura  ======================================================================
B D     D. persimilis  ======================================================================
        D. willistoni  -----ttacagataacacaaaatgcggaaaatattcaggtaatgacataatttttaagcttgtaaaaaac
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================
         T. castaneum  tcgggcaatgtgtcggtatgttttcgc---------aga--------acattaaaaaatt---acaaatt

      D. melanogaster  tctggttagaaacacggcagtcct---gcaccccaatc----tcctaacatgttagattgctacattgcc
          D. simulans  actgattagaaacaggaaagtcct---gtaccccaatc----tcttaacatgtcagattgctacactgtc
         D. sechellia  tctgattagaaacaggaaagtcct---gcaccccaatc----tctgaacatgttagattgctacactgtc
            D. yakuba  tttgacttggaaccggaaagtcct---gcatccccatt----tcccacttgatcagattgttacatcgcc
            D. erecta  tccgatttgaaacaggaaaatccc---gcaccccaatc----tcctacttcgttagatggctacatcgcc
         D. ananassae  tct--------atagggtagtcctaaaacatccagattct-attcttaaaggatataattctacatagtc
     D. pseudoobscura  ======================================================================
        D. persimilis  ======================================================================
        D. willistoni  tct---ttgaaa-----------t---gggtgccaatt----ttttgtcttctgccattgatataataga
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  tttgttaagaaaaagcaaaaa------taacctcagttttggtctaaaactgaagaatcaat---ttgtt

      D. melanogaster  attg
          D. simulans  attg
         D. sechellia  attg
            D. yakuba  attg
            D. erecta  attg
         D. ananassae  ctta
     D. pseudoobscura  ====
        D. persimilis  ====
        D. willistoni  ttta
           D. virilis  ====
        D. mojavensis  ====
         D. grimshawi  ====
         A. mellifera  ====
         T. castaneum  ttta

Alignment block 63 of 217 in window, 833401 - 833518, 118 bps 
B D   D. melanogaster  aagaaatg------aagcgcagtact----tttactcagtatttttt-tttttgtc--aagagact----
B D       D. simulans  aacaactg------atgcacagtact----tgtaccca------tct-tttttgtc--aagagact----
B D      D. sechellia  aacaaaag------atgcacagtact----tgtaccca------tc--tttttgtc--aagagact----
B D         D. yakuba  actaaatg------atgcacagaaat----tgtacaca------tttgttctaccccaaagaaact----
            D. erecta  acgaaatg------atgcacagtact----tgtacaca------tcttttcttgtc--aagagact----
         D. ananassae  aattagt---------------------------ccta------gat-tctatgcc--atacaactagca
    D. pseudoobscura  ======================================================================
B D     D. persimilis  ======================================================================
        D. willistoni  aataa---------------------------tgctta------act-tttttgtg--ta----------
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
         D. grimshawi  aagaaatgttttgtttacatgataag----tttgttta------ttt-gtattgct--------------
        A. mellifera  ======================================================================
         T. castaneum  ----------------gtgaaattttgtgatataattg------tgt-ttttagtt--gaaaaact----

      D. melanogaster  tcctaaaagtatgccaat-tcattaaaactatt-tg--tttttaattgggc-atag--ttgcagacaaaa
          D. simulans  tcctaaaagtatgccaat-tcattaaaaccatt-tg--tttttaattgggc-atag--ttgcagacaaaa
         D. sechellia  tcctaaaagtatgccaat-tcattaaaaccatt-tatttttttaatt-----------------------
            D. yakuba  tcctaaaagtatgccaat-tcattaaaatcatt-tg--ttttgaattgggctaaaaattcgacgacaaaa
            D. erecta  tcctaaaagtatgccaat-tcattaaaat-att-----ttttgaattgggc-atagttttgaggacaaaa
         D. ananassae  tcccaaaagtatgccaac-------aaat---------gtcaaggttaagtgacat--ttacatccaaag
     D. pseudoobscura  ======================================================================
        D. persimilis  ======================================================================
        D. willistoni  ttctagcaata-gaaaat-tgattttcattcct-ta--attttaatt-----gccacttctagtagatat
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  taatgtatgtatacacatatcatattttctact-ta--cttataaatatg--atgggttcccgaaagaga
         A. mellifera  ======================================================================
         T. castaneum  tcctaaaacttcagaaaa-tggcaaaaataattaca--ttttggatta----gtgaaatttcgtaaaaaa

      D. melanogaster  ac
          D. simulans  ac
         D. sechellia  --
            D. yakuba  ac
            D. erecta  gc
         D. ananassae  ca
     D. pseudoobscura  ==
        D. persimilis  ==
        D. willistoni  at
           D. virilis  ==
        D. mojavensis  ==
         D. grimshawi  gt
         A. mellifera  ==
         T. castaneum  ac

Alignment block 64 of 217 in window, 833519 - 833548, 30 bps 
B D   D. melanogaster  -caaggaatt--ctacaacgatctcatggttgg
B D       D. simulans  ---------------caacgatctcgtggttgg
B D      D. sechellia  ---------------------------------
B D         D. yakuba  ------------ccacaac--------------
            D. erecta  -cgaagaatt--ctacaacgatctcacgggtgg
         D. ananassae  ------------ctacaacgatcactggaaaag
    D. pseudoobscura  =================================
B D     D. persimilis  =================================
        D. willistoni  ------------cggctatgttttcattacc--
          D. virilis  =================================
       D. mojavensis  =================================
         D. grimshawi  tccaaggattgctaaaaatgatttg--------
        A. mellifera  =================================

Inserts between block 64 and 65 in window
           D. erecta 3bp
        D. ananassae 1bp
        D. grimshawi 5bp

Alignment block 65 of 217 in window, 833549 - 833654, 106 bps 
B D   D. melanogaster  actacatcaggaatc-----aaaa--gaaaacaatattaaatg--------atagcgttcttatttg---
B D       D. simulans  actacatcagaaatc-----aaaa--gaaaac-------aatt--------atagcgttcttatttg---
B D      D. sechellia  --------------------------------------------------------gttcttattta---
B D         D. yakuba  -------caggaatc-----aaga--gaaaac-------aatg--------atagcgttcttatttg---
            D. erecta  actacatcaggaatc-----aaaa--gaaaac-------aatg--------atagcgttcttatttg---
         D. ananassae  actatggctataata-----agag--acaaac-------aacg--------tcagcgttcttatttg---
     D. pseudoobscura  acttcactccaaatcaaaaaaaaa--gaagat-------aattatggac--atagcgttcttatttc---
B D     D. persimilis  acttcactccaaatt--aaaaaaa--gaagat-------aattatggac--atagcgttcttatttc---
        D. willistoni  ------------acc-----caat--aaagac-------agtcgtcagttgattgatttttcgattg---
           D. virilis  actagcacaaaagcc-----aaataggaatgc-------aacatt------acaatt-ttttgtttg---
        D. mojavensis  --------------------aaat--gaatac-------agcatca-----ataattgttttgtttggtt
         D. grimshawi  tctaataacaa---------taat--aaatac-------aacagaa-----atggttgttttgt------
        A. mellifera  ======================================================================

      D. melanogaster  --------tttttattgaaa-tttcgtagttttaaataa----ctttaaggcttc--gataa--------
          D. simulans  --------tttttattgaaa-tttcgtagttttaaataa----ctttaaggcttc--gataa--------
         D. sechellia  --------tttttattgaaa-tttcgtagttttaaataa----ctttaaggcttc--gataa--------
            D. yakuba  ---------ttttattgaaattttcgtagttttaaataa----ctttaaggcttc--gataa--------
            D. erecta  --------tttttattgaaattttcgtagttttaaataa----ctttaaggcttc--gataa--------
         D. ananassae  --------tttttattgaaa-ttccgtag-tttaaataa----agttaaggcttc--gataa--------
     D. pseudoobscura  --------tttttattgaaattttcgtag-tttaaataa----ctttaaggcttc--gataatgttgttt
        D. persimilis  --------tttttattgaaattttcgtag-tttaaataa----ctttaaggcttc--gataatgttgttt
        D. willistoni  --------tttttattgaaa-ttt------attaaataa------ttaaggcttt--gaaaa--------
           D. virilis  --tcttagtttttattgaaa--gttgtaaatttaaataatttgttttaaggcttcgagataa--------
        D. mojavensis  tttccttagttttattgaaa--tttgtaaatttaaataatttgttttaaggcttcgagataa--------
         D. grimshawi  --tcatagtttttattgaaa--cttgtaattttaaataa-ttgttttaaggcttcgagataa--------
         A. mellifera  ======================================================================

      D. melanogaster  tgtttga
          D. simulans  tgtttga
         D. sechellia  tgtttga
            D. yakuba  tgtttga
            D. erecta  tgtttga
         D. ananassae  tgtttga
     D. pseudoobscura  tgtttgt
        D. persimilis  tgtttgt
        D. willistoni  tgttttg
           D. virilis  tgtttga
        D. mojavensis  tttttgt
         D. grimshawi  tgtttga
         A. mellifera  =======

Inserts between block 65 and 66 in window
       D. willistoni 28bp

Alignment block 66 of 217 in window, 833655 - 833692, 38 bps 
B D   D. melanogaster  --cacgttaaggc-------------------------------atggg------catggac--atgtga
B D       D. simulans  --cacgttaaggct-aaaatggaaaaatt---cttgcttcttatctggg------catgggc--atgtga
B D      D. sechellia  --cacgttaaggct-aaaatggaaaaatt---cttgcttcttatctggg------catggac--atgtga
B D         D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  --cacgttaaggct-aaaatggaaaaatt---cttgcttcttatctgaa------catggac--atgtga
         D. ananassae  --cacgttaaggctaaaaatggaaaaact---cttgcttcttatc------------tggac--atgtga
     D. pseudoobscura  --------aaggctaaaaatggaaaaatt---cttgcttcttatctgggcatggacatggac--atgtga
B D     D. persimilis  --------aaggctaaaaatggaaaaatt---cttgcttcttatctggacatggacatggac--atgtga
        D. willistoni  --tttgtttagtctaaatatgggaaattt---tttgcgt-------------------------aagtgg
           D. virilis  catacgctaaagctaaatatggaaaaattcaacttgcttcttatt------------tggac--tcg-ta
        D. mojavensis  catatgttaaggctaaatatggaaaatttcatcttgcttcttatt------------tggac--ttgttg
         D. grimshawi  catacgttaaggctaaatatggaaaaattcatcttgcttcttatt------------tggacttttgttg
        A. mellifera  ======================================================================

      D. melanogaster  gc-----agtgaat
          D. simulans  gc-----agtgaat
         D. sechellia  gc-----agtgaat
            D. yakuba  NNNNNNNNNNNNNN
            D. erecta  gc-----agtgaat
         D. ananassae  gcggtgaggtgagt
     D. pseudoobscura  ag-----agtgagc
        D. persimilis  ag-----agtgagc
        D. willistoni  tt-----attgaat
           D. virilis  tt-----attcaaa
        D. mojavensis  at-----agtaagg
         D. grimshawi  gc-----attaaac
         A. mellifera  ==============

Inserts between block 66 and 67 in window
    D. pseudoobscura 7bp
B D    D. persimilis 7bp
       D. willistoni 3bp
        D. grimshawi 89bp

Alignment block 67 of 217 in window, 833693 - 833744, 52 bps 
B D   D. melanogaster  -----------------tga----gtcatggattcggggttcg------------at--ggatgggtggt
B D       D. simulans  -----------------tga----gtcatggattcggggttcg------------at--ggatgggt---
B D      D. sechellia  -----------------tga----gtcatggattcggggttcg------------at--ggatgggt---
B D         D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  -----------------tga----gtcatggattgggggttcgatcgatgcatgaat--ggatgggt---
         D. ananassae  -----------------tga----gtcatggacttggg--tcg------------at--ggatggat---
     D. pseudoobscura  -----------------tga----ttcatggatgagggatgag------------g---gtaggggt---
B D     D. persimilis  -----------------tga----ttcatggatgagggatgag------------g---gtaggggt---
        D. willistoni  -----------------tga----atcattga-----------------------at--gagcgggt---
           D. virilis  caatccctatattgttttgattctttcttttttcagcaatgat------------gtcacgctatat---
        D. mojavensis  tag----------gtattgaaataatcccgaatgagtactaat------------ac--cgatat-t---
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================

      D. melanogaster  ggg-----------gg------agtggtg------------------ttaat
          D. simulans  -gg-----------gg------agtggtg------------------ttaat
         D. sechellia  -gg-----------gg------agtggtg-----------------------
            D. yakuba  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            D. erecta  -tg-----------gg------tggggtggctggggtgggatggctgttaat
         D. ananassae  -gggcttgggctctgg------ggctctg-----------------------
     D. pseudoobscura  -tc-----------gg------ggttcgg-----------------------
        D. persimilis  -tc-----------gg------ggttcgg-----------------------
        D. willistoni  -aa-----------ggttaatcagttatc------------------tttat
           D. virilis  -ca-----------t-------------------------------------
        D. mojavensis  -ca-----------t-------------------------------------
         D. grimshawi  ====================================================
         A. mellifera  ====================================================

Alignment block 68 of 217 in window, 833745 - 833765, 21 bps 
B D   D. melanogaster  gg-----------aggtattaca--cgaggc-tta--
B D       D. simulans  gg-----------aggtattaca--cgaggc-tta--
B D      D. sechellia  ------------------ttaca--cgaggc-tca--
B D         D. yakuba  gg-----------aggtattaca--cgaggc-tta--
            D. erecta  gg-----------aggtattaca--cgaggc-tta--
         D. ananassae  ggctctgttttctgggtattaca--tggggc-tta--
     D. pseudoobscura  -----ggcagggcgggtattacatttggggc-tta--
B D     D. persimilis  -----ggcagggcgggcattacatttggggc-tta--
        D. willistoni  -------------gtatatgtct--gaaggc-tta--
           D. virilis  ------aacatatatatacttgt--tgataa-gtata
        D. mojavensis  ------tttagtcatgcgctata--tcataacatata
        D. grimshawi  =====================================
        A. mellifera  =====================================

Inserts between block 68 and 69 in window
          D. virilis 3bp
       D. mojavensis 10bp

Alignment block 69 of 217 in window, 833766 - 833793, 28 bps 
B D   D. melanogaster  caat----------------cagac---ag------------------tatatgtacaaatgtct
B D       D. simulans  caat----------------cagac---ag------------------tatatgtacaaatgtct
B D      D. sechellia  caat----------------cagac---ag------------------tatatgtacaaatgtct
B D         D. yakuba  caat----------------cagacagtag------------------tatatgtacaaatgtct
            D. erecta  caat----------------cagac---ag------------------tatatgtacaaatgtct
         D. ananassae  cgat----------------cggac---ag------------------aatatgtacagacgtcc
     D. pseudoobscura  caattataaaca------cacagac---agccagacagaccgtgtgtacgcacgtactaacgtct
B D     D. persimilis  caattataaaca------cacagac---agccagacaaaccgtgtgtacgcacgtactaacgtct
        D. willistoni  caaatgtaattagtttataacaaac---tt------------------gtcttgagcaaattcct
           D. virilis  ----------------------------ag---------------agatatatatatatatat--
        D. mojavensis  taag----------------tatat---ag---------------tgatatacatatatatgt--
         D. grimshawi  taag----------------taaat---ag---------------agatatatgtttatatat--
        A. mellifera  =================================================================

Inserts between block 69 and 70 in window
       D. willistoni 95bp

Alignment block 70 of 217 in window, 833794 - 833875, 82 bps 
B D   D. melanogaster  gcc---gtgg-------------------gtgcaaccaaaagaggc-------ttgactc--gcgagctg
B D       D. simulans  gct---gtgg-------------------gtgcaaccaaaagaggc-------ttgactc--gcgagctg
B D      D. sechellia  gcc---gtgg-------------------gtgcaaccaaaagaggc-------ttgactc--gcgatctg
B D         D. yakuba  gcc---gtgg-------------------gtgcaaccaaaagaggt-------tcgactc--gcgagctg
            D. erecta  gcc---gtgg-------------------gtgcaacc-atagaggt-------tcgactc--gcgagctg
         D. ananassae  gacgatgtggt------------------gtgcaactaa--------------------------ggttg
     D. pseudoobscura  gtt---ggtg-------------------gtgtaacaaagttaaacttttattttgtttt--ttagtttg
B D     D. persimilis  gtt---ggtg-------------------gtgtaacaaagttaaacttttattttgtttt--ttagtttg
       D. willistoni  ======================================================================
           D. virilis  ----------aaattttatttttttatcatcgcaattaa--caaac-------tttaacttcttgtgttg
        D. mojavensis  ----------a--------------------tcaattaa--caaac-------tttaact--ttgtgttg
         D. grimshawi  ----------a------------ttatcatcgcaattaa--caaac-------tttaact--ttgtgttg
        A. mellifera  ======================================================================

      D. melanogaster  agcaatctatctgcacggccgatat--cgcacgtactag--------------t--gta--------ta-
          D. simulans  agcaatctatctgcacggccgatat--cgcacgtactag--------------t--ata--------ta-
         D. sechellia  agcaatctatctgcacggccgatat--cgcacgtactat--------------t--ata--------ta-
            D. yakuba  agcaatctatctgcacggccgatat--cgcacgtactgg--------------t--ata--------ta-
            D. erecta  agcaatctatctgcacggccgatat--cgcacgtacaag--------------t--ata--------ta-
         D. ananassae  agca----atctgcacatacgatat--cgcacgtacgaaagtgttttttacgtt--ttt--------tc-
     D. pseudoobscura  agca----atctgcacgcccgatatcgcgcacgtacggc--------------t--gtggctgcggctg-
        D. persimilis  agca----atctgcacgcccgatatcgcgcacgtacggc--------------t--gtggctgcggctg-
        D. willistoni  ======================================================================
           D. virilis  agca----aactaacccttctaagt---gtgtgtg--tg--------------t--gtt--------ggt
        D. mojavensis  agca----aactaacccttctaagt---gtgtgtgtctg--------------t--gtg--------tgt
         D. grimshawi  agca----aactatccgttctaagt---gtgtgtgttgg--------------ttggtt--------ggt
         A. mellifera  ======================================================================

      D. melanogaster  -------------------
          D. simulans  -------------------
         D. sechellia  -------------------
            D. yakuba  -------------------
            D. erecta  -------------------
         D. ananassae  -------------------
     D. pseudoobscura  -------------------
        D. persimilis  -------------------
        D. willistoni  ===================
           D. virilis  tggttgtg--------gtt
        D. mojavensis  tggttgcg--------gtt
         D. grimshawi  tggttgtgattggtttatt
         A. mellifera  ===================

Alignment block 71 of 217 in window, 833876 - 834153, 278 bps 
B D   D. melanogaster  aaattagcacacgaaaagcagat-------gattagca---atggaaacaagaagcaattca--ttaggt
B D       D. simulans  aaattagcacacggaaagcagat-------gattagca---atggaaacaagaagcaattca--ttaggt
B D      D. sechellia  aaattagcacacggaaagcagat-------gattagca---atggaaacaagaagcaattca--ttaggt
B D         D. yakuba  aaattagcacacggaaagcagat-------gattagca---atggaaacaagaagctattaa--ttaggt
            D. erecta  aaattagcacacggaaagcagat-------gattagca---atgaaaacaagaagcaattca--ttaggt
         D. ananassae  cgtttagcacat----------t-------gattagca---atgaaaacaagaagcaattca--ttaggt
     D. pseudoobscura  cggctggca----gagagcag-------------agca---atgaaaacaagaagcatttca--ttaggt
B D     D. persimilis  cggctggca----gagagcag-------------agca---atgaaaacaagaagcatttca--ttaggt
        D. willistoni  aaacaagcaaaaaagaaacaaattacacgcggttgaca---atgaaaacaaaa---cattcaatttaggt
           D. virilis  tatttatca---------tagtt-------gattaacaattattaaaacaagaagcatttaa-tttaggt
        D. mojavensis  tatttatca---------tagtt-------gattaacaagtattaaaacaagaaacatttaa-tttaggt
         D. grimshawi  tatttatca---------tagtt-------gaataacaagtattaaaacaagaagcatttaa-tttaggt
        A. mellifera  ======================================================================

      D. melanogaster  acaaaagc--------gtatat------------gtatatctg----tatctgtactaact---------
          D. simulans  acaaaagc--------atatat------------gtatatctg----tatctg---taact---------
         D. sechellia  acaaaagc--------atata--------------------tg----tatctg---taact---------
            D. yakuba  acaaaagc--------atata----------------tatctg----tatctg---tgtct---------
            D. erecta  acaaaagc--------atata----------------tatctg----tgtctg---tttct---------
         D. ananassae  acaaaagc--------atat-----------------tgtata----tatctg---t-------------
     D. pseudoobscura  acaaaagc--------atatatatatatatacagatatatata----tgtata---tatctggagtcagt
        D. persimilis  acaaaagcatatatatatatatatatatatacagatatatata----tgtata---tatctggagtcagt
        D. willistoni  acaaaagc--------a-ata-------------atatatata----tttacg---cattt-----aaat
           D. virilis  acaaaagc--------atatatgtatta---------catgtactcgtatata---tagat---------
        D. mojavensis  acaaaagc--------atatatgtatt----------cgtata----tatata---tatat---------
         D. grimshawi  acaaaagc--------atatata------------------------tatatg---tatat---------
         A. mellifera  ======================================================================

      D. melanogaster  -gtgtctgaatc--tgta------tctgtatccgtata-tgt-------------atagtcg--tacgtt
          D. simulans  -gtgtctgaatc--tgta------tctgtatccgtata-tgt-------------a-------------t
         D. sechellia  -gtgtctgaatc--tgta------tctgtatccgtata-tgt-------------atagtcg--tacgtt
            D. yakuba  -gtat------c--tgaa------tctgtatccgtata-tgt-------------atagtcg--tacatt
            D. erecta  -gtatctgtagc--tgaa------tctgtatccgtata-tgt-------------atagtcg--tacgtt
         D. ananassae  ---------atc--tgta------tctatattcgtata-tgt-------------a--gtag--tacgtt
     D. pseudoobscura  agtatctgtatc-tttta------tctgtatccgtata--gt-------------a--gtag--tacgtt
        D. persimilis  agtatctgtatcttttta------tctgtatccgtata--gt-------------a--gtag--tacgtt
        D. willistoni  agtttttgtttg--tatattatgttttttttctttgtt-ttg-------------atagtag--tatttt
           D. virilis  -atatatgtata--tcat------attaggtaagtatattat-------------atgatag--ttagtt
        D. mojavensis  -atatttatata--atat------attatgtaagtatattat-------------atggtagttttagtt
         D. grimshawi  -gtgtttatata--atat------atttattatgtatgttagcattattttattaatgatag--tttagt
         A. mellifera  ======================================================================

      D. melanogaster  -----ataatatttagttttataatcttattaaggccacacaatcaata--actgac--aaag-ttctta
          D. simulans  -----ataatatttagttttataatcttattaaggccacacaatcaata--actgac--aaag-ttctta
         D. sechellia  -----ataatatttagttttataatcttattaaggccacacaatcaata--actgac--aaag-ttctta
            D. yakuba  -----ataatatttagttttataatcttattaaggccacacaatcaata--actgac--aaag-ttctta
            D. erecta  -----ataatatttag--ttataatcttattaaggccacacaatcaata--actgac--aaag-ttctta
         D. ananassae  -----atattatatagttttataatcttattaaggccacacaatcaata--actgacagagag-ttctta
     D. pseudoobscura  -----ataatttatagttttataatcttattaaggccacacaatcaataacactgac--agagtttctta
        D. persimilis  -----ataatttatagttttataatcttattaaggccacacaatcaataacactgac--agagtttctta
        D. willistoni  tttgaagattgatcagttttataatcttattaaggccaca----caata--actgat--tttt-tttttg
           D. virilis  -----ttaatgaacagttttataatcttattaaggccacacaatcaaga--actgac--aaga-gtttcg
        D. mojavensis  -----ttaatgaacagtttcataatcttattaaggccacacaatcaata--actgac--aaga-gtttcg
         D. grimshawi  -----ttaatgaacattttcataatcttattaaggccacacaatcaata--actgac--aaga-gtttcg
         A. mellifera  ======================================================================

      D. melanogaster  t---c--------------------cgcaacgaaagt-----gctaaatggga----caaa---------
          D. simulans  t---c--------------------cgcaacgaaagt-----gctaaatggga----caaa---------
         D. sechellia  t---c--------------------cgcaacgaaagt-----gctaaatggga----caaa---------
            D. yakuba  t---c--------------------cgcaacgaaagt-----gctaaatggga----caaa---------
            D. erecta  t---c--------------------cgcaacgaaagt-----gctaaatggga----caaa---------
         D. ananassae  t---c--------------------cgcaaaacaggt-----gctaaaaggga----caaacacgaaacg
     D. pseudoobscura  t---c--------------------cgcaacgaaagt-----gctaga-ggga----cagt---------
        D. persimilis  t---c--------------------cgcaacgaaagt-----gctaga-ggga----cagt---------
        D. willistoni  t---ttttgttgttcttctgccaaacgcaaacaaaattagaagcgaaagcgta----taaa---------
           D. virilis  tagag--------------------cgaaacaagcga-----gttgaaagaaaagcccaaa---------
        D. mojavensis  tacag--------------------cgaaacaagcgc-----gttgacagaaa--ctcaag---------
         D. grimshawi  tacac--------------------cgaaacaagcgcgcaaagtcgttaaaac--cccaaa---------
         A. mellifera  ======================================================================

      D. melanogaster  -----gac---------------aagtacgaggatg----g--ata-aaacaaataacagagtgtctgga
          D. simulans  -----gac---------------aagtacgaggata----g--ata-aaacaaataacagcgagtctgga
         D. sechellia  -----gac---------------aagtacgaggata----g--ata-aaacaaataacagcgagtctgga
            D. yakuba  -----gac---------------aagtacgaggaca----g--gca-aaacaaataacagagggtctgga
            D. erecta  -----gac---------------aagtacgaggaca----g--gca-aaacaa----------------a
         D. ananassae  aaacgaac---------------taggacgaggaca----agcaca-aaacaaata--------catgta
     D. pseudoobscura  -----agg---------------gacagtgctaaca----g--aca-gtgacagtgacagtgac------
        D. persimilis  -----agg---------------gacagtgctaaca----g--aca-gtgacagtgacagtgac------
        D. willistoni  -----aag---------------aag-----ggata----g--agagaaatagataa-------------
           D. virilis  -----gaaatagggcagagagctgacaacaagtatgcgatg--aca-atgctaaagatagagtat-----
        D. mojavensis  -----gga---------------tgtaacatgaata----g--aca-aa---------------------
         D. grimshawi  -----aga----------------aaaacaggtcga----a--aga-gagagagag--------------
         A. mellifera  ======================================================================

      D. melanogaster  ccaact
          D. simulans  ttaact
         D. sechellia  ttaact
            D. yakuba  ccaact
            D. erecta  ccaact
         D. ananassae  tcatgg
     D. pseudoobscura  ---att
        D. persimilis  ---att
        D. willistoni  ------
           D. virilis  ------
        D. mojavensis  ------
         D. grimshawi  ------
         A. mellifera  ======

Inserts between block 71 and 72 in window
       D. willistoni 29bp
          D. virilis 353bp
       D. mojavensis 450bp
        D. grimshawi 409bp

Alignment block 72 of 217 in window, 834154 - 834194, 41 bps 
B D   D. melanogaster  gcatcctccactaggatgag------------gattagt-------agctatgttag-------------
B D       D. simulans  gcatcctccactaggattag------------gattagt-------agctatgttag-------------
B D      D. sechellia  gcatcctccactaggattag------------gattagt-------agctatgttag-------------
B D         D. yakuba  gcatcctccactaggaccag------------gattagt-------agctatgttag-------------
            D. erecta  gcatcctccactaggatctg------------gattagt-------agctatgttag-------------
         D. ananassae  gaatcatccatgaaatcgaggctgggccactaggttagt-------agtttagttagtttgtggcggcac
     D. pseudoobscura  gaaatctccataactatagaga----------gatagag-------agagaaacgag-------------
B D     D. persimilis  gaaatctccataactatagaga----------gatagag-------agagaaacgag-------------
        D. willistoni  gaatcccttactagagtttt------------agttagtttatgtatgcaatgtata-------------
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================

      D. melanogaster  -----------------------------tgg
          D. simulans  -----------------------------tgg
         D. sechellia  -----------------------------tgg
            D. yakuba  -----------------------------tgg
            D. erecta  -----------------------------tgg
         D. ananassae  ttggcttggcccaagctcgagttagaatctgg
     D. pseudoobscura  -----------------------------aga
        D. persimilis  -----------------------------aga
        D. willistoni  -----------------------------tgt
           D. virilis  ================================
        D. mojavensis  ================================
         D. grimshawi  ================================
         A. mellifera  ================================

Alignment block 73 of 217 in window, 834195 - 834255, 61 bps 
B D   D. melanogaster  atg----------------------------aagtgttcatgggc--gc---------------------
B D       D. simulans  atg----------------------------aagtgttcatgggc--gc---------------------
B D      D. sechellia  atg----------------------------aagtgttcatgggc--gc---------------------
B D         D. yakuba  atg----------------------------aagtgttcatgggc--gc---------------------
            D. erecta  atg----------------------------aagtgttcatgggc--gc---------------------
         D. ananassae  gtg----------------------------agttctgcatgtgtgggc---------------------
     D. pseudoobscura  aag----------------------------agagctccataaga--tcggggcatctacatccccccct
B D     D. persimilis  aag----------------------------agagctccataaga--tcggggcatctgcatccccccct
        D. willistoni  atgtacatatatatcgtacatat-----tgtagtagtttatgtta--ag---------------------
           D. virilis  ----------ataaagtatatatctgtgtgtgcatatgtatgtgt--gc---------------------
        D. mojavensis  ---------------------------------gtatgcatgtgt--ga---------------------
        D. grimshawi  ======================================================================
        A. mellifera  ======================================================================

      D. melanogaster  --ttagtacaagtatagagttct----agggcaaacggcaaatacaaa
          D. simulans  --ttagtacaagtatagagttct----agggcaaacggcaaatacaaa
         D. sechellia  --ttagtacaagtatagagttct----agggcaaacggcaaatacaaa
            D. yakuba  --ttagtacaagtatagagttct----agggcaaacggcaaatacaaa
            D. erecta  --ttagtacaagtatagagttct----agggcaaacggcaaatacaaa
         D. ananassae  --ttagtacaagaagagagttct----agggagcacggcaaatacatt
     D. pseudoobscura  cactagtattagtataatg---t----agggccccccgtatgtttgga
        D. persimilis  cactagtattagtataatg---a----agggccccccgtatgtttgga
        D. willistoni  --ttttggttagtaaaaagtcctactaaaggcaaacggtaaatacaaa
           D. virilis  --ttttgcc--gtataaa------------------------------
        D. mojavensis  --atgcgac--gtataag------------------------------
         D. grimshawi  ================================================
         A. mellifera  ================================================

Alignment block 74 of 217 in window, 834256 - 834543, 288 bps 
B D   D. melanogaster  tatccgtatc--c---------gtaaacg-ttagag-tagagttac----------catgtaaaaga---
B D       D. simulans  tatccgtatc--c---------gtaaacg-ttagag-tagagttac----------catgtaaaaga---
B D      D. sechellia  tatccgtatc--c---------gtaaacg-ttagag-tagagttac----------catgtaaaaga---
B D         D. yakuba  tattcgtatc--c---------gtaaacg-ttagag-tagagttac----------catgtaaaaga---
            D. erecta  tatccgtatc--c---------gtaaacg-ttagag-tagagttac----------catgtaaaaga---
         D. ananassae  tatccggttc--cg--------gttaacg-ttagaa-tagagttac----------catataaaaga---
     D. pseudoobscura  ggggagctcc--t---------gtacaag-ttc----tagagttat----------catataaaaga---
B D     D. persimilis  ggggagctcc--t---------gtacaag-ttc----tagagttat----------catataaaagaata
        D. willistoni  tacatatctt--tgttctttatgtaaacatttagag-taaagttag----------cttgtaaaagaata
           D. virilis  ------------t---------atgcata-tgagagttagagcttt------------tgtaaaaga---
        D. mojavensis  ------------t---------atatatg-tatga--tagagatttagtaaaataatatatatattc---
         D. grimshawi  tagccgtataaat---------atttatg-ta-gagttatagcttt-gtaaaagaatata----------
        A. mellifera  ======================================================================

      D. melanogaster  ---------atatatcaacgc---c-ccagtccgcctccgcc---------------atccgcgagga--
          D. simulans  ---------atatatcaacgc---c-ccagtccgcctccgcc---------------atccgccagga--
         D. sechellia  ---------atatatcaacgc---t-ccagtccgcctccgcc---------------atccgccagga--
            D. yakuba  ---------atatatcaacgc---c-ccagtccgcctccgcc---------------atcctccagga--
            D. erecta  ---------atatatcaacgc---c-ccagtccgcctccgcc---------------atcctccagga--
         D. ananassae  ---------atatatcgacgc---cacccacccgcccccg---------------------gtcaggagc
     D. pseudoobscura  ---------atatatatatat---c-atcctgcgtctactcc----------------tgctctgaga--
        D. persimilis  t--------atatatatatat---c-atcctgcgtctactcc----------------tgctctgaga--
        D. willistoni  tatatataaatatatatatat---c-attatcaatattatat---------------atatgatcata--
           D. virilis  ---------atatatatatatacat-a-tatatgggtatatatatattgca----cgatccgttcaaa--
        D. mojavensis  ---------atatatatttctatat-attgtacgatcaatta---------------atccattaaaa--
         D. grimshawi  ---------atatgtatatgtatat-attgtacgatca--------tcgcaaatccgatccgcaaatg--
         A. mellifera  ======================================================================

      D. melanogaster  ---ctagcgt------cagcgtggag----ccttt-c------gg-gtgtacatatttgggc-tatgtac
          D. simulans  ---ctagcgt------cggcgtggag----ccttt-c------gg-gtgtacatatttgggc-tatgtac
         D. sechellia  ---ctagcgt------cggcgtggag----ccttt-c------gg-gtgtacatatttgggc-tatgtac
            D. yakuba  ---ctggcgt------cagcgtggag----ccttt-c------gg-gtgtacatatttgggc-tatgtac
            D. erecta  ---gtagcgt------cagcgtggag----ccttt-c------gg-gcgtacatatttgggc-tatgtac
         D. ananassae  cggctggag-------cggcacggag----cttgc-g------gc-gtgtacacattcgctt-tatgtac
     D. pseudoobscura  ----------------cagagtgccg----tgtc------------gtgtacacatttcacc-tatgtac
        D. persimilis  ----------------cagagtgccg----tgtc------------gtgtacacatttcacc-tatgtac
        D. willistoni  -----atcat------tatcatggggtcgatctct-c------gctatctatatatata----tatatat
           D. virilis  ---tggatac-caattcagcatgtag----cacagactacgttat-ctatataaatatatac-tatatat
        D. mojavensis  ---cggattt-atattcagcatttag----cacatac------gt-ctatataa--------------at
         D. grimshawi  ---cgaattctactttcagcatg--g----tacatac---------ctatatatatatatatatatatac
         A. mellifera  ======================================================================

      D. melanogaster  acaaaga---gtgctctccggcgtgcat-----------tatgtatac----------a-----------
          D. simulans  acaaaga---gtgctctccggcgtgcat-----------tatgtatac----------a-----------
         D. sechellia  acaaaga---gtgctctccggcgtgcat-----------tatgtatac----------a-----------
            D. yakuba  acaaaga---gtgctctccggcgtgcat-----------tatgtatac----------a-----------
            D. erecta  acaaaga---gtgctctccggcgtgcat-----------tatgtatac----------a-----------
         D. ananassae  acggaga---gtgctctccggcgtgtat-----------tatgtat------------a-----------
     D. pseudoobscura  acagcga---gt----------gtgttt-----------tatgtatat----------atactcgtatgt
        D. persimilis  acagcga---gt----------gtgttt-----------tatgtatat----------atactcgtatgt
        D. willistoni  ata----------------tgtgtgatt-----------tacat-tat----------a-----------
           D. virilis  acacatacacacacacacacatatgcatatgcctatgtatatacacat----------gtatgtatactt
        D. mojavensis  acacacacatgcacacacgtatatg--------------tatatacat----------atatatatatct
         D. grimshawi  acacacacacacacatacacatatgcatacatgtatgtctatgtatttagtatgttggatatatgtatat
         A. mellifera  ======================================================================

      D. melanogaster  --tagattaac-gctattgttagtaaaatggact-aatttcggttcggtt--------------------
          D. simulans  --tagattaac-gctattgttcgtaaaatggact-aatttcggttcggtt--------------------
         D. sechellia  --tagattaac-gctattgttcgtaaaatggact-aatttcggttcggtt--------------------
            D. yakuba  --tagattaac-gctattgttcgtaaaatggact-aatttcggttcggtt--------------------
            D. erecta  --tagattaac-gctattgttcgtaaaatggact-aatttcggttcggtt--------------------
         D. ananassae  --tagattaat-gctattgttcgttaaatggact-aatttcggttcggttccctcgcagcgc--------
     D. pseudoobscura  agtagattaat-gctattgttcgtaaaatggact-aatttcggttcggttcactcgcagcgcagcgcagt
        D. persimilis  agtagattaat-gctattgttcgtaaaatggact-aatttcggttcggttcactcgcagcgcagcgcagt
        D. willistoni  --tagattaatagctattgttcgtaaaatggactaaatttcggttcacat--------------------
           D. virilis  tatagttttatagctattgttcgtaaaatggact-aatttcgtttcactt--------------------
        D. mojavensis  tgtag-ttaatagctattgttcgtaaaatggact-aatttcggttctctt--------------------
         D. grimshawi  catag-ttaatagctattgttcgtaaaatggact-aatttcggttcactt--------------------
         A. mellifera  ======================================================================

      D. melanogaster  --------------------------------------cctccgcgtctgc-------------------
          D. simulans  --------------------------------------cctccgcgtctgc-------------------
         D. sechellia  --------------------------------------cctccgtgtctgc-------------------
            D. yakuba  --------------------------------------cctccgcttctgc-------------------
            D. erecta  --------------------------------------cctccgctgctgc-------------------
         D. ananassae  ------------------ctcctccgaggacggg---ccctccgaatccgc-------------------
     D. pseudoobscura  tgttccgtccgtttcgttctattccgtccgggggctccgctccctggctgg-------------------
        D. persimilis  tgttccgtccgtttcgttctattccgtccgggggctccgctccctggctgg-------------------
        D. willistoni  ------------------------------gggg----catccat-------------------------
           D. virilis  ----------------------------------------------tttgcttcattttttttgctttaa
        D. mojavensis  ----------------------------------------------tctgc-------------------
         D. grimshawi  ----------------------------------------------tttgc-------------------
         A. mellifera  ======================================================================

      D. melanogaster  ---tctttgttcgctggc------------------------------------------tcagcgcctc
          D. simulans  ---tctttgttcgctggc------------------------------------------tcagggcctc
         D. sechellia  ---tctttgttcgctggc------------------------------------------tcagggcctc
            D. yakuba  ---tctttgttcgctggc------------------------------------------tcagcgcctc
            D. erecta  ---tctttgttcgctggc------------------------------------------tcagcgcctc
         D. ananassae  ---tttttgttcgctggc------------------------------------------tcagcgcccc
     D. pseudoobscura  ---ctttgatcggctggc-tg---------------------------------------tcagcgcctc
        D. persimilis  ---ctttgatcggctggc-tg---------------------------------------tcagcgcctc
        D. willistoni  ---------tcagctagc-tg---------------------------------------ccgccatttc
           D. virilis  atatttttgttcagcggc-tt----------------------ttcactgttcagct---tcaacgcctc
        D. mojavensis  ---tttttgttcagcggcttt----------------------ttctctgttcaatc---tcaacgcctc
         D. grimshawi  ---attttgttcagcggcttttgatcgttctctgcttttctggttctctgctctgccttatcaacgcctc
         A. mellifera  ======================================================================

      D. melanogaster  tgcca------ggtggcgcg--------------------------------------------------
          D. simulans  tgcca------ggtggcgcg--------------------------------------------------
         D. sechellia  tgcca------ggtggcgcg--------------------------------------------------
            D. yakuba  tgcca------ggtggcgcg--------------------------------------------------
            D. erecta  tgcca------ggtggcgcg--------------------------------------------------
         D. ananassae  agcca------ctcggcgagg-------------------------------------------------
     D. pseudoobscura  agccaagtgtcggcggcgag--------------------------------------------------
        D. persimilis  agccaagtgtcggcggcgag--------------------------------------------------
        D. willistoni  cgcca------cttccggcg--------------------------------------------------
           D. virilis  agcca------tgatgtgagc-------------------------------------------------
        D. mojavensis  agcca------ggatgtgagctcctgttgctgctggtgctgccttagtttcagatcctgctcgtgctctt
         D. grimshawi  agcca------tattgtgtgctccttctgctgc-------------------------------------
         A. mellifera  ======================================================================

      D. melanogaster  -----------------------ag---------------------------------------------
          D. simulans  -----------------------tg---------------------------------------------
         D. sechellia  -----------------------tg---------------------------------------------
            D. yakuba  -----------------------tg---------------------------------------------
            D. erecta  -----------------------tg---------------------------------------------
         D. ananassae  --------ggctt----------gg---------------------------------------------
     D. pseudoobscura  -----------------------tg---------------------------------------------
        D. persimilis  -----------------------tg---------------------------------------------
        D. willistoni  -----------------------tt---------------------------------------------
           D. virilis  --------tcctg---ctgctgctgttggccctgttgcttcggctggtgctccttctgctttcgctcccg
        D. mojavensis  gttcttgttcctgcttctgcttctg------cttctgcttcctctgctgct-------------------
         D. grimshawi  --------agctgcagctgctcctt------cagctgtttctgtttttgtt-------------------
         A. mellifera  ======================================================================

      D. melanogaster  -----gcggatt---ctcccgggtt------------gagt
          D. simulans  -----gcggatt---ctcccgggtt------------gagt
         D. sechellia  -----gcggatt---ctcccgggtt------------gagt
            D. yakuba  -----gcgaatt---ctcctgggtt------------gagt
            D. erecta  -----gcgaatt---ctcctgggtt------------gagt
         D. ananassae  -----gcggctt---gttccgcgtc------------gggt
     D. pseudoobscura  -----gcgagttttgcttctgggtt------------gagt
        D. persimilis  -----gcgagttttgcttctgggtt------------gagt
        D. willistoni  -----gccgctg---ctact-------------------gc
           D. virilis  ctcccgcttttg---gtcctgtgctccacacgattctgaat
        D. mojavensis  -----gctgctg---gtcctgcgctcgcctcaagtctgaat
         D. grimshawi  -----gctgttg---gtcctgtgctctgctcgagtcggaat
         A. mellifera  =========================================

Alignment block 75 of 217 in window, 834544 - 834583, 40 bps 
B D   D. melanogaster  cTCATAAGAATGGATTGTTGGTGTTCATGGCGCCGCTGGC
B D       D. simulans  cTCATAAGAATGGATTGTTGGTGTTCATGGCGCCGCTGGC
B D      D. sechellia  cTCATAAGAATGGATTGTTGGTGTTCATGGCGCCGCTGGC
B D         D. yakuba  cTCATAAGAATGGATTGTTAGTGTTCATGGCGCCGCTGGC
            D. erecta  cTCATAAGAATGGATTGTTAGTGTTCATGGCGCCGCTGGC
         D. ananassae  cTCATAAAAATGGATTGTTGGTGTTCATGGCGCCGCTGGC
     D. pseudoobscura  cTCATAAGAATGGATTATTGGTGTTCATGGCGCCGCTCGC
B D     D. persimilis  cTCATAAGAATGGATTATTGGTGTTCATGGCGCCGCTCGC
        D. willistoni  cTCATAAGAACGGATTGTTGGTATTC--------------
           D. virilis  cTCATAAAAATGGATTATTGGTGTTCATAGCGCCGCTAGC
        D. mojavensis  cTCATAAAAATGGATTATTGGTGTTCATGGCGCCGCTGGC
         D. grimshawi  cTCATAAAAATGGATTATTGGTGTTCATAGCTCCGCTGGC
        A. mellifera  ========================================
         T. castaneum  cTCATAAAAATGGATTGTTGGAATTCACATTAGCCGTGGC

Inserts between block 75 and 76 in window
       D. willistoni 60bp
        T. castaneum 1892bp

Alignment block 76 of 217 in window, 834584 - 834605, 22 bps 
B D   D. melanogaster  ctgtggggtataa---------aggagg-aat
B D       D. simulans  ctgtgggatataa---------aggaag-aat
B D      D. sechellia  ctgtgggatataa---------aggaag-aat
B D         D. yakuba  ctgtggaatataa---------aggaag-aat
            D. erecta  ctgtgggatataa---------agaaag-aat
         D. ananassae  ctg-------caa---------gggaagcgaa
     D. pseudoobscura  ctgtgg----------------agagaa-cat
B D     D. persimilis  ctgtgg----------------agagaa-cat
       D. willistoni  ================================
           D. virilis  ctgtcgagttaaatgaataaat----------
        D. mojavensis  ctgtggagttcaa-------------------
         D. grimshawi  ctgt----------------------------
        A. mellifera  ================================
        T. castaneum  ================================

Inserts between block 76 and 77 in window
          D. virilis 602bp
       D. mojavensis 460bp

Alignment block 77 of 217 in window, 834606 - 834644, 39 bps 
B D   D. melanogaster  tgtgtct------ttagcaaatattgatgatc---tggacgcagccaa
B D       D. simulans  ggtgtct------ttagcaaatat---tgatc---tggacgcaaccaa
B D      D. sechellia  ggtgtct------ttagcaaatat---tgatc---tggacgcaaccaa
B D         D. yakuba  tgtgtct------ttagcaaatgt---tgaac---tggacggaaccaa
            D. erecta  ggtgtct------ttagcaaatat---tgaac---tggacgcaaccaa
         D. ananassae  ggtgtttaagaagtttgtatattt---tggg----taaacatagccaa
     D. pseudoobscura  tgaacat------tgaacataaaa------------------agtcaa
B D     D. persimilis  tgaacat------tgaacataaaa------------------agtcaa
       D. willistoni  ================================================
          D. virilis  ================================================
       D. mojavensis  ================================================
         D. grimshawi  ---------------aaaaaatat---gaaacattttaatgcaa--aa
        A. mellifera  ================================================
        T. castaneum  ================================================

Inserts between block 77 and 78 in window
        D. ananassae 132bp

Alignment block 78 of 217 in window, 834645 - 834664, 20 bps 
B D   D. melanogaster  tcctgtc-------------------tggattta--atgtg
B D       D. simulans  tcctgtctggaaatccaccgaccgattggattta--atgtg
B D      D. sechellia  tcctgtctggaaatccaccgaccgattggattta--atgtg
B D         D. yakuba  tcctgtctggaaatccaccgaccgtctggatttaatatgtg
            D. erecta  tcctgtctggaaatccggcgactgtctcgattta--atgtg
        D. ananassae  =========================================
     D. pseudoobscura  -------------------ttcggattgggtttg--aggtg
B D     D. persimilis  -------------------ttcggattgggtttg--aggtg
       D. willistoni  =========================================
          D. virilis  =========================================
       D. mojavensis  =========================================
         D. grimshawi  tcttaattggcaa------gaaaaat---------------
        A. mellifera  =========================================
        T. castaneum  =========================================

Alignment block 79 of 217 in window, 834665 - 834878, 214 bps 
B D   D. melanogaster  --gcaaaggaacgtgggaaacagaa-------------------tgtttgcttgattaatatttattgaa
B D       D. simulans  --gcaagggaacgtgggaaacagactaacgtgcgcatgattgcttgtttgcttgattaatatttattaaa
B D      D. sechellia  --gcaagggaacgtgggaaacagactaacgtgcgcatgattgcttgtttgcttgattaatatttattaaa
B D         D. yakuba  --gcaaaggaacgtgagaaacagactaacgtgcacatgattgcttgtttgcttgattaatatttattgaa
            D. erecta  --gcaagggaacgtgagaaacagcctaacgtgcacatgattgcttgtttgcttgattaatatttattaaa
        D. ananassae  ======================================================================
    D. pseudoobscura  ----------------------------------------------------------------------
B D     D. persimilis  ----------------------------------------------------------------------
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
         D. grimshawi  gtgcaaatg--tgcagcatacagaataatg--------------aatttacgtgtccattaatt-----a
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  gagaagaattactcagctctgtgttattgtttatcactatggacggcacacaaagttttacaattgctaa
          D. simulans  g---agaattactcagctctgtgatattgtttatcactatggacggcacacaacgttttacaattgctaa
         D. sechellia  g---agaattactcagctctgtgatattgtttatcactatggacggcacacaacgttttacaattgctaa
            D. yakuba  g---cgaattacgcagctctgtgatattgtttatcactatggtcggcacacaacgttctacaattgctaa
            D. erecta  g---agaattacgcagctctgtgatattgtttatcactatggacggcgcacaacgttctacgattgctaa
         D. ananassae  ======================================================================
     D. pseudoobscura  ----------------------------------------------------------------------
        D. persimilis  ----------------------------------------------------------------------
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  g---atagatagacag----------------------acagacga-agacag--------gatttatga
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ttagaggaatagtaagtatc----atgaatgtatctaag-gtagtgtgtgactggtgaggtccaccaaaa
          D. simulans  ttagaggaatagtaagtatc----atggacgcatctaag-gtagtgtgtgactgttgaggt---ccaaaa
         D. sechellia  ttacaggaatagtaagtatc----atggacgcatctaag-gtagtgtgtgactgttgaggt---ccaaaa
            D. yakuba  ttagaggaatcgtaagtatcatcaatggg-------gac--tgaggtg----tgttaaggt---ccaaaa
            D. erecta  ttagaggaattgtaagtatctgtcgtggatgtatctgacggtaaggtgcgactgttgaggt---ccaaaa
         D. ananassae  ======================================================================
     D. pseudoobscura  ----------------------------------------------------------------------
        D. persimilis  ----------------------------------------------------------------------
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ttaactaaattgtctgtctc----gaagac-tatcagat-ctagagattatacatacagat---acagtg
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ggg-aaactgcac--------------gtatctagaattcttaag
          D. simulans  gag-aaactgcac--------------gtatctataattcttaag
         D. sechellia  gag-aaactgcac--------------gtatctataattcttaag
            D. yakuba  gggaaaacaacac--------------gtatctagaattcttcac
            D. erecta  gggaaaacaacac--------------gtatctagaattcttcat
         D. ananassae  =============================================
     D. pseudoobscura  ---------------------------------------------
        D. persimilis  ---------------------------------------------
        D. willistoni  =============================================
           D. virilis  =============================================
        D. mojavensis  =============================================
         D. grimshawi  aag-aagtttcactaaatcgatatgctatatgtaacttccttaag
         A. mellifera  =============================================
         T. castaneum  =============================================

Alignment block 80 of 217 in window, 834879 - 834958, 80 bps 
B D   D. melanogaster  tattttatttcacttct---ccacttgca-----------acagattgcctccttgccaccactttctaa
B D       D. simulans  tattttatttcacttct---ccactttta-----------acagattgcctccttgccaccactttctaa
B D      D. sechellia  tattttatttcacttct---caactttca-----------acagattgccttcttgccaccactttctaa
B D         D. yakuba  tattttatttctctcgttcatcactttta-----------acagattaccgccttgccaccacttttcaa
            D. erecta  tattttatttcacccgt---tcactctta-----------acagattgcctccttgccaccactttccaa
        D. ananassae  ======================================================================
    D. pseudoobscura  ----------------------------------------------------------------------
B D     D. persimilis  ----------------------------------------------------------------------
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
        D. mojavensis  tattacatcatatttct---gcactagcaactacacgcttactaaaagca----tacgactagagtttga
         D. grimshawi  --------------------gaactaatagacacgga---actgattgca----------ctgggtatca
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  tttgtcgatTTAATCCAGAGG------------G---------TC
          D. simulans  tttgtcgatTTAATCCAGAGG------------G---------TC
         D. sechellia  tttgtcgatTTAATCCAGAGG------------G---------TC
            D. yakuba  tttgtcgaaTTAATCCAGAGA------------G---------TC
            D. erecta  t---tcgaaTCAGTCCAGAGA------------GTCTCTGGATTC
         D. ananassae  =============================================
     D. pseudoobscura  ---------------------------------------------
        D. persimilis  ---------------------------------------------
        D. willistoni  =============================================
           D. virilis  =============================================
        D. mojavensis  ctt------TTGCTCAACAACCTACCGCAAATG------------
         D. grimshawi  cct----agTCGAGCAATAGC------------------------
         A. mellifera  =============================================
         T. castaneum  =============================================

Alignment block 81 of 217 in window, 834959 - 835135, 177 bps 
B D   D. melanogaster  GGTTCTCATACTCACTGCAAAGGGATTGTT---------------------GGCCATCACAGGAGCGGGT
B D       D. simulans  GGTTCTCATACTCACTGCAAAGGGATTGTT---------------------GGCCATCACAGGAGCGGGT
B D      D. sechellia  GGTTCTCATACTCACTGCAAAGGGATTGTT---------------------GGCCATCACAGGAGCGGGT
B D         D. yakuba  GGCTCGCATACTCACTGCAAAGGGATTGTT---------------------GGCCATCACAGGCGCGGGT
            D. erecta  GGCTCTCATACTCACTGCAAAGGGATTGTT---------------------GGCCATCACAGGCGCGGGT
         D. ananassae  -GTCCTCATACTCACTGCAAAGGGATTGTT---------------------GGCCAGAACCGGGGCAGGT
     D. pseudoobscura  GAGTCTTCCACTTACTGCAAATGGATTGTT---------------------GGCCATAACTGGTGCCGGC
B D     D. persimilis  GAGTCTTCCACTTACTGCAAATGGATTGTT---------------------GGCCATAACTGGTGCCGGC
        D. willistoni  -------ATACTCACTGCAAAGGGATTATT---------------------GGCCA--------------
           D. virilis  ---------ACCTACCGCAAATGGATTATTAAAGCCGCCGGATATGCCGCCGGCGAGCACGGGTGCTGGC
        D. mojavensis  GGTTATTAA-----------------------AGCCGCCGGCGAGGCCGCCCGCAAGCACGGGCGCTGGT
         D. grimshawi  ---------ACTTACCGCAAATGGATTATTGAAACAGCTCGATATGCCACCGGCCATAACAGGCGCTGGT
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  TGCATGCTGCCGAAGCCGCAGCCGTTGGGCAGACCCTGCGAGATGGCGAACCCGTTGTTGTTGAAGTTGA
          D. simulans  TGCATGCTGCCGAAGCCGCAGCCGTTGGGCAGACCCTGCGAGATGGCGAACCCGTTGTTGTTGAAGTTGA
         D. sechellia  TGCATGCTGCCGAAGCCGCAGCCGTTGGGCAGACCCTGCGAGATGGCAAACCCGTTGTTGTTGAAGTTGA
            D. yakuba  TGCATGCTGCCAAAGCCGCAGCCGTTGGGCAGACCCTGCGAGATGGCGAATCCGTTGTTGTTGAAGTTGA
            D. erecta  TGCATGCTGCCAAAGCCGCAGCCATTGGGCAGACCCTGCGAGATGGCGAATCCGTTGTTGTTGAAGTTGA
         D. ananassae  TGCATGCTTCCGAAGCCACAGCCGTTGGGCAGGCCCTGGGAAATAGCGAACCCGTTGTTGTTAAAATTAA
     D. pseudoobscura  TGCATGCTGCCAAAGCCACAGCCATTGGGCAGACCCTGGGCCATGGCATATCCATTGTTATTGAAGTTAA
        D. persimilis  TGCATGCTGCCAAAGCCACAGCCATTGGGCAGACCCTGGGCCATGGCATATCCATTGTTATTGAAGTTAA
        D. willistoni  -------TGCCAAATCCACAGGCATTAGGCAGTCCCTGGCTTAAGGCGTAACCATTATTGTTAAAATTAA
           D. virilis  TGCATGCTGCCAAAGCCACAGCCATTGGGCAGTCCCTGGGCCAGGGCAAAGCCGTTGTTATTGAAATTGT
        D. mojavensis  TGCATGCTGCCAAAGCCGCAGCCATTGGGCAGGCCCTGGGCCAAGGCAAAGCCGTTGTTGTTGAAATTGT
         D. grimshawi  TGCATGCTACCAAAGCCGCAACCGTTGGGCAGGCCTTGGGTCAAGGCATAGCCATTGTTATTGAAATTGT
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  AGAAGCTC--------------------------------------------------------TGCTGT
          D. simulans  AGAAGCT--------------------------------------------------------------C
         D. sechellia  AGAAGCT-----------------------------------------------------------CTGC
            D. yakuba  AGAAGCTC---------------------------TGCT--------------------GTTGCTGCTGC
            D. erecta  AGAAGCTC---------------------------TGCT--------------------GTTGATGCTGC
         D. ananassae  AGAAACTCGT---------------------CTGGGGCT--------------------GAGACTGATGC
     D. pseudoobscura  AGAAGCTTGT---------------------CTGCTGCT--------------------GCTGTTGCTGT
        D. persimilis  AGAAGCTTGT---------------------CTGCTGC--------------------------TGCTGT
        D. willistoni  AGAAACTGGC---------------------TTGCTGCT--------------------GCTGTTGCTGC
           D. virilis  AGAAACTGTTGGCTGTCATCTGCTGTTGCTGCTGTTGCTGCTGCAGCAGCTGTTGACCTGCAGCCGCTGC
        D. mojavensis  AGAAGCTGGTG------------------------------------------------GCAGCCGCTGC
         D. grimshawi  AGAAACTTGGGGC------------------CTGTGGCT--------------------GCAACAGCTGT
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  TGCTGCTGCTGCTGCTGGAGGAGATGGTGCCCCATCT---------------GCTGCTG
          D. simulans  TGCTGCTGCTGCTGCTGGAGGAGATGGTGCCCCATCT---------------GCTGCTG
         D. sechellia  TGCTGCTGCTGCTGCTGGAGGAGATGGTGCCCCATCT---------------GCTGCTG
            D. yakuba  TGCTGCTGCTGCTGCAGA------------------T---------------GCTGCTG
            D. erecta  TGCTGCTGCTGCTGCTGGAGGAGATGGTGCCCCATCT---------------GCTGCTG
         D. ananassae  TGGTGCTGCTGCTGCTGGAGAAGATGG---CCCATCTGGAGGCCGTTCGGCGGCTGCTG
     D. pseudoobscura  TGCTGCAGATGCTGCTGGTGGAGATGG------GACG---------------ACTGCTG
        D. persimilis  TGCTGCAGATGCTGCTGGTGGAGATGG------GACG---------------ACTGCTG
        D. willistoni  TGCTGCTGCTGCTGCTGTGGATGAGGATGTGCCGCCT---------------GCTGCTG
           D. virilis  TGCTGCCGCTGCCGCCGCCGCAGCCG-----CAGCCT---------------GCTG---
        D. mojavensis  TGCCGCTGCCGCCGCCGCC--------------GCCT---------------GCTG---
         D. grimshawi  TG----TGCCACTCCTGCT--------------GCCT---------------GCTG---
         A. mellifera  ===========================================================
         T. castaneum  ===========================================================

Inserts between block 81 and 82 in window
B D        D. yakuba 33bp
       D. willistoni 6bp

Alignment block 82 of 217 in window, 835136 - 835184, 49 bps 
B D   D. melanogaster  GGAACTGCTGCCGTAGGCATTTGGTATGAGCGTCAACTGGCCATAGAGA
B D       D. simulans  GGGACTGCTGCCGTAGGCATTTGGTATGAGCGTCAACTGGCCATAGAGA
B D      D. sechellia  GGGACTGCTGCCGTAGGCATTTGGTATGAGGGTCAACTGACCATAGAGA
B D         D. yakuba  =================================================
            D. erecta  GGGACTGCTGCCGTAGGCATTTGGTATGAGCGTCAACTGGCCATAGAGA
         D. ananassae  GGGACTGCTGCCGTAGGCATTTGGTATGAGCGTCAACTGGCCGTAGAGA
     D. pseudoobscura  GGGGCTGCTGCCGTATGCATTTGGTATGAGCGTCAATTGGCCATAGAGA
B D     D. persimilis  GGGGCTGCTGCCGTATGCATTTGGTATGAGCGTCAATTGGCCATAGAGA
        D. willistoni  GGGATTGATTGCATAACCATTTGGTATGAGCGTTAGCTGGCCATAGAGA
           D. virilis  TGGACTGCTGCCGTAGCCATTTGGTATGAGCGTCAGCTGGCCATAGAGA
        D. mojavensis  TGGGCTGCTGCCATAGCCATTTGGCAAGAGCGTCAGCTGGCCGTAGAGA
         D. grimshawi  CGGACTGCTGCCGTAGCCATTTGGTATGAGCGTCAACTGGCCATAGAGA
        A. mellifera  =================================================
        T. castaneum  =================================================

Alignment block 83 of 217 in window, 835185 - 835289, 105 bps 
B D   D. melanogaster  TT---CTGCTGGTGC------------------TGCTGCTGTTGCTGCTG------CTGGAATGGATTCA
B D       D. simulans  TT---CTGCTGGTGC------------------TGCTGCTGTTGCTGCTG------CTGGAATGGATTCA
B D      D. sechellia  TT---CTGCTGGTGC------------------TGCTGCTGTTGCTGCTG------CTGGAATGGATTCA
B D         D. yakuba  ======================================================================
            D. erecta  TT---CTGCTGTTGC------------------TGC------TGCTGCTG------CTGGAATGGATTCA
         D. ananassae  TT---CTGTTGCTGC---------------------------TGCTGCTG------CTGGAATGGATTCA
     D. pseudoobscura  TT---CTGCTGCTGC------------------TGC------TGATGCTG------CTGGAATGGATTCA
B D     D. persimilis  TTCTGCTGCTGCTGC------------------TGC------TGATGCTG------CTGGAATGGATTCA
        D. willistoni  TT---CTGTTGCGAT---------------------------TGCTGTTG------CTGGAATGGATTCA
           D. virilis  TT---CTGCTGCTGC------------------TGCTGCTGCTGCAGTTGCTGTGCCTGGAATGGATTCA
        D. mojavensis  TT---CTGCTGATGCTGCTGTTGCAATTGCAATTGCTGCTGTTGCAGCTGCTGTGCCTGGAATGGATTCA
         D. grimshawi  TT---CTGCTGCTGC------------------TGTTGCTGGAGCTGCTGCTGTGCCTGGAATGGATTCA
B D        A. gambiae  ------TGCTGCTGT------------------GCATGCGGTTGCTGCTGTTGCGGTTGGAACGGATTGG
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  CCACAT--GGCTGC---------TGA---------------GCTGCTG---CTGTTG--CTGGCCCTTGA
          D. simulans  CCACAT--GGCTGC---------TGA---------------GCTGCTG---CTGTTG--ATGGCCCTTGA
         D. sechellia  CCCTAT--GGCTGC---------TGA---------------GCTGCTG---CTGTTG--ATGACCCTTGA
            D. yakuba  ======================================================================
            D. erecta  CCACAT--GGCTGC---------TGA---------------GCTGCTG---CTGTTG--CTGGCCCTTGA
         D. ananassae  CCACGT--GGTTGC---------TGA---------------GCTGCTG---CTGCTG--CTGGCCCTTGA
     D. pseudoobscura  CAACGT--GACTGC---------TTAGCA------GCTGCTGCTGCTG---CTGCTG--TTGGCTCTTAA
        D. persimilis  CAACGT--GACTGC---------TTAGCAGCTGCTGCTGCTGCTGCTG---CTGCTG--CTGGCTCTTGA
        D. willistoni  CTATGT--GATTGC---------TGA------------------GCTG---CTGCTG--CTGGCCCTTGA
           D. virilis  CCAAGT--GGCTGCTGTTGCCGTTGA---------------TGAGCAGCGCCGACTG--CTGGCTCTTGA
        D. mojavensis  CCAAGT--GGCTGC---TGCCGTTGA---------------TGAGCAG---CGACTG--CTGGCTCTTGA
         D. grimshawi  CCGCAT--GGTTGT---TGCCGTTGA---------------CGAGCAG---TGCTTG--CTGGCTCTTGA
           A. gambiae  CCGTTTTGAACGGG---------TTA---------------GCCGAGG---AAGCTGAACAGATTAGAGA
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  AGGGATTTGGATT---------------------------GTTGTT-------------------GAG--
          D. simulans  AGGGATTTGGATT---------------------------GTTGTT-------------------GAG--
         D. sechellia  AGGGATTTGGATT---------------------------GTTGTT-------------------GAG--
            D. yakuba  ======================================================================
            D. erecta  AGGGATTTGGATT---------------------------GTTGTT-------------------GAG--
         D. ananassae  AGGGATTTGGATT---------------------------GTTGTT-------------------GAGGA
     D. pseudoobscura  AGGGATTCGGATT---------------------------GTTGTTGTTCACGAGGGCTGCACACGAA--
        D. persimilis  AGGGATTCGGATT---------------------------GTTGTTGTTCACGAGGGCTGCACACGAA--
        D. willistoni  AGGGATTTGGATT---------------------------GTTGTT-------------------GT---
           D. virilis  AGGGATTGACATGAAGGTTATTGTTGTTGCTGCTGTTGTTGTTGTT-------------------GT---
        D. mojavensis  AGGGATTGACATG---------------------------GTTGTT-------------------AT---
         D. grimshawi  AAGGATTGGCATT---------------------------GTTATT-------------------G----
           A. gambiae  AAGAATTAGTTTC---------------------------ATCTCT----------------TACG----
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ----G
          D. simulans  ----G
         D. sechellia  ----G
            D. yakuba  =====
            D. erecta  ----G
         D. ananassae  TGGCG
     D. pseudoobscura  ----G
        D. persimilis  ----G
        D. willistoni  -----
           D. virilis  ---TG
        D. mojavensis  ---TG
         D. grimshawi  -----
           A. gambiae  -----
         A. mellifera  =====
         T. castaneum  =====

Inserts between block 83 and 84 in window
       D. willistoni 64bp
       D. mojavensis 43bp
        D. grimshawi 321bp

Alignment block 84 of 217 in window, 835290 - 835324, 35 bps 
B D   D. melanogaster  Gctgaaaac----aagagtccaattagtgggggcc--gcac
B D       D. simulans  Gctgaaaag----aagggtccaattagtgggcgtc--gcac
B D      D. sechellia  Gctgaaaag----aagtgtccaattagtgggggcc--gcac
B D         D. yakuba  =========================================
            D. erecta  Gctgaaaag----aagtggccaattagcggggccc--gctc
         D. ananassae  Gctgtggaggacaaaggatccaattagcgagtacttgggag
     D. pseudoobscura  Gatggagaa----cagaaaccaattagtgactgct--tcaa
B D     D. persimilis  Gatggagaa----cagaaaccaattagtgactgct--tcaa
       D. willistoni  =========================================
           D. virilis  Gctgtgaattataaaatgttttagttgcggtt---------
       D. mojavensis  =========================================
        D. grimshawi  =========================================
B D        A. gambiae  -------------cagcagtccatacgc-------------
        A. mellifera  =========================================
        T. castaneum  =========================================

Alignment block 85 of 217 in window, 835325 - 835346, 22 bps 
B D   D. melanogaster  gaa-----aaaaag----------------ctcggt-taaaagg
B D       D. simulans  gaa-----aaaatg----------------ctctgt---gaagg
B D      D. sechellia  gaa-----aaaatg----------------ctctgt---gaagg
B D         D. yakuba  ============================================
            D. erecta  gaa-----aaaa-g----------------cactgt---gaagg
         D. ananassae  gga-----aggaat----------------tcttgtcttgaagg
     D. pseudoobscura  ggactgctcgagtg----------------tcccag---cgagc
B D     D. persimilis  ggactgctcaagtg----------------tgccag---cgagc
        D. willistoni  -------------g----------------gtttgt---tta-c
           D. virilis  ------------------------------tttggt---taagg
        D. mojavensis  gaa-----agagagatagataagtttccgatgtggt---ttcag
        D. grimshawi  ============================================
B D        A. gambiae  --------------aaacacatact-----tggcgt---gatgg
        A. mellifera  ============================================
        T. castaneum  ============================================

Inserts between block 85 and 86 in window
          D. virilis 9bp
       D. mojavensis 14bp

Alignment block 86 of 217 in window, 835347 - 835454, 108 bps 
B D   D. melanogaster  actcacCTCCACCAAAGGCAT--------CTGTGGCCTG----------AACATTGCCACT--GGTGGGC
B D       D. simulans  actcacCTCCACCAAAGGCAT--------CTGTGGCCTG----------AACATTGCCGTT--GGTGGGC
B D      D. sechellia  actcacCTCCACCAAAGGCAT--------CTGTGGCCTG----------AACATTGCCGTT--GGTGGGC
B D         D. yakuba  ======================================================================
            D. erecta  actcacCTCCACCGAAGGCAT--------CTGTGGCCTG----------AACATTGCCATT--GGTGGGC
         D. ananassae  acttacCGCTGCCGAAAGCATCGGGCAAGCCGTTGCC------------GACGTTGCCGTT--GGTGGGC
     D. pseudoobscura  actcacCACTGCCAAAGGCGT--------CCGTCGCCTG-GTGGCCATTGTTGTTGCCATT--GGTGGGC
B D     D. persimilis  actcacCACTGCCAAAGGCGT--------CCGTCGCCTG-GTGGCCATTGTTGTTGCCATT--GGTGGGC
        D. willistoni  acttacCTGTGCCAAAAGTTT--------CAATAAAGTG----GCCATTGCCATTGCCGTT--GGTAGGC
           D. virilis  -cttacCCGTGCCAAAGGCAT--------CCGTCAGCTGTGT-------GAGGTTGCCATT--GGTTGGC
        D. mojavensis  acttacCCGTGCCAAAGGCAT--------CCGCCAGCTGTGT----------GTTGCCATT--GGTTGGC
         D. grimshawi  actcacCAGTGCCAAAGGCGT--------C---CAGAGGCGT-------GTTGTTGGCATT--TGTCGGC
B D        A. gambiae  -------------AATCGCTT--------ATG-----------------GTGGTTGCTGTTCCGTTTGAC
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  GTGGGCGTCT------------CT------GTGGCG---CTTTC-----GCTGGCC----TTCAGTTCTC
          D. simulans  GTGGGCGCTT------------CC------GTGGCG---CCTTC-----GCTGGCC----TTCAGTTCTC
         D. sechellia  GTGGGCGCTT------------CC------GTGGCG---CCTTC-----GCTGGCC----TTCAGTTCTC
            D. yakuba  ======================================================================
            D. erecta  GTGGGCGCTT------------CC------GGGGCG---CCTTC-----GCTGGCC----TTCAGTTCCC
         D. ananassae  GTGGGCGCCT------------CC------GAGGTG---GCCTC-----GCTGGCC----TTCAGCTCCC
     D. pseudoobscura  GTCGGTGCCT------------CG------GAGGCGGACGACTC-----ACTGGCC----TTCAGTTCGC
        D. persimilis  GTCGGTGCCT------------CG------GAGGCGGACGACTC-----ACTGGCC----TTCAGTTCGC
        D. willistoni  GTGGGTGCTTCATTTGTTACAACT------GGCGCC---GTCTC-----GCTGGCC----TTCAGCTCAC
           D. virilis  GTCGGCGCCT------------CC---------------AATTC-----GGTGGCC----TTCAGTTCGC
        D. mojavensis  GTTGGCGCCT------------CCGTGACTGTAGCT---GCCTC-----GCTGGCC----TTCAGCTCGC
         D. grimshawi  GTTGGCGCCT------------CAGTG---GCAGCT---GCCTC-----GCTGGCC----TTCAGTTCGC
           A. gambiae  GTTATTGTGT------------TA------TTATTC---GCCTCAGCCTGTTGCTCTAATTTTATCTCCC
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  GCAGCTGCTCGTCGAGAT
          D. simulans  GCAGCTGCTCGTCGAGAT
         D. sechellia  GCAGCTGCTCGTCGAGAT
            D. yakuba  ==================
            D. erecta  TTAGCTGCTCGTCGAGAT
         D. ananassae  GCAGCTGCTCGTCGAGAT
     D. pseudoobscura  GCAGCTGCTCGTCGAGGT
        D. persimilis  GCAGCTGCTCGTCGAGGT
        D. willistoni  GTAGCTGCTCGTCGAGGT
           D. virilis  GCAGCTGCTCATCGAGGT
        D. mojavensis  GCAGTTGCTCATCGAGGT
         D. grimshawi  GCAGCTGCTCATCGAGGT
           A. gambiae  GGAACTGCTCATCCAAGT
         A. mellifera  ==================
         T. castaneum  ==================

Alignment block 87 of 217 in window, 835455 - 835603, 149 bps 
B D   D. melanogaster  CCTTAAGAGCGGCATATCGATCC---------------TCACTGGGCGCCATCGCTGCATTTCCGCCCTT
B D       D. simulans  CCTTGAGAGCGGCATATCGATCC---------------TCACTGGGCGCCATCGCTGCACTTCCGCCCTT
B D      D. sechellia  CCTTGAGAGCGGCATATCGATCC---------------TCACTGGGCGCCATCGCTGCACTTCCGCCCTT
B D         D. yakuba  CCTTGAGAGTGGCGTATCTGTCC---------------TCACTGGGCGCCATCGCTGCACTTCCGCCTTT
            D. erecta  CCTTGAGAGCGGCATATCGGTCC---------------TCACTGGGCGCCATCGCTGCACTTCCGCCTTT
         D. ananassae  CCTTGAGAGCGGCATACCGGTCC---------------TCAGTGGGCGCCATACCGGAGCTGCCGTTCTT
     D. pseudoobscura  CCTTGAGGGCTGCATAGCGGTCT---------------TCGCTGGGCGCCACAGCCGGTGCACTGCTCTT
B D     D. persimilis  CCTTAAGGGCCGCATAGCGGTCC---------------TCGCTGGGCGCCACAGCCGGTGCACTGCTCTT
        D. willistoni  CCTTTAGGGCTGCATAACGGTCC---------------TCACTGGG---------------ACTGCTCTT
           D. virilis  CCTTAAGCGCCGCATAGCGATCC---------------TCGCTGGGCGCAGCGCCTGCCTGCCGTGGGCT
        D. mojavensis  CCTTCAGCGCCGCGTAGCGGTCC---------------TCGCTGGGCGCATTGCTTGC---CCGGGAGCT
         D. grimshawi  CCTTGAGCGCCGCATAGCGGTCC---------------TCGCTGGGTGCACTGC-TGCCCACC-------
B D        A. gambiae  CTTTCAGTGCGGCGTATCGATCCACGGACGGTGTTGAATTAATGGACGCGTTACTAGG---TTTGCCATT
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  GGGCGGACTG--------GTCGT---------------ATG-GCC-------------------------
          D. simulans  GGGCGGACTG--------GTCGC---------------ATG-GCC-------------------------
         D. sechellia  CGGCGGACTG--------TTCGC---------------ATG-GCC-------------------------
            D. yakuba  GGGCGGACTG--------GTCGC---------------ATG-GCC-------------------------
            D. erecta  GGGCGGACTG--------GTCGC---------------ATG-GCC-------------------------
         D. ananassae  CGGCGGACTA--------GTCGC---------------ATG-ACC-------------------------
     D. pseudoobscura  --GTGGCCTG------CCGGCGT---------------GTG-GCC-------------------------
        D. persimilis  --GTGGCCTG------CCGGCGT---------------GTG-GCC-------------------------
        D. willistoni  TGACGGCGTG--------GCCTTGCTGCCACCGTTAAGATG-TCC-------------------------
           D. virilis  CTGCTTATTT--------GTCGT---------------TTG-GCTCAGCTGATGATG-------------
        D. mojavensis  GGGCTTGTTT--------GTCGC---------------TTG-ATTCAGC---TGTTG-------------
         D. grimshawi  -------TTT--------GCCGT---------------TCG-CTTCTGCAGCTGCTGCTGCTGCTGCCCA
           A. gambiae  GGATGTTTTGCTATCCCCATTGT---------------TCGTACC-------------------------
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  --------GTTCTGCAAGGGAGCACctg-----------ca-a-----------catgggaa---gacta
          D. simulans  --------GTTCTGCAAGGGAGCACctg-----------ca-a-----------catgggaa---gacta
         D. sechellia  --------GTTCTGCAAGGGAGCACctg-----------ca-a-----------catgggaa---gacta
            D. yakuba  --------GTTCTGCAAGGGTGCACctg-----------ca-a-----------catgggga---gacca
            D. erecta  --------GTTCTGCAAGGGTGCACctg-----------ca-a-----------catgggga---gttca
         D. ananassae  --------ATTCTGCAAAGGTGCACctg------------a-a-----------aagggcat---atcca
     D. pseudoobscura  --------ATTCTGCAGCGGGGCACcta--------gaata-a-----------caaagcaaatgggtta
        D. persimilis  --------ATTCTGCAGCGGGGCGCcta--------gaata-a-----------caaagcaaatggatta
        D. willistoni  --------ATTTTGTAGTGGCGCGCcta-----------caga-----------tgtgagaa---g---a
           D. virilis  --------GCTTTGCAAGGCGGCGCctg-----------ca-a-agggttagaattataagt---gatta
        D. mojavensis  --------GCTCTGAAGCGCGGTGCctg-----------ca-agagagatcaaacagtgagc---gtatt
         D. grimshawi  AGCTGACTGCTCTGCAGCGAAGCACctg-----------ca-a-------caaacaa--------gatta
           A. gambiae  --------ATGCAGCATCGGAAGACctatgaccataaaaca-a-----------aattgaaa---g-taa
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  gttaatacactctt------------------ccggg----------atatgtcttcgca--------gt
          D. simulans  gttaatacactctt------------------ccggg----------atatgctttcgca--------gt
         D. sechellia  gttaatacactctt------------------ccggg----------atatgttttcgcg--------tt
            D. yakuba  gttaataaactctt------------------cgtgt----------ctatgtttttgta--------gt
            D. erecta  gttta-aaactctt------------------cgggg----------atatgttttcgca--------at
         D. ananassae  gttaatgaaaggat--------------------ggg----------aaagggtcatcca--------gg
     D. pseudoobscura  gtcgctggatccatgcagatgggaatgggatacgggggatacagcgtacaggatgcttca--------ac
        D. persimilis  gtcgctggatccatgcagatgaaaatgagatacgggggatacagcgtacaggatgcttca--------ac
        D. willistoni  gttaagaaaacagc---------aattagc--caagg----------atgagaggacttt--------ag
           D. virilis  gtcgaaa-------------gccagtagcaaatacgc----------aaactttatttctatattaaagt
        D. mojavensis  actgacacaagttc----ctgccactcggatgtacgc----------taa-------gcaaactaaaggc
         D. grimshawi  aataaaa-------------------------catgt----------aaa------------------aa
           A. gambiae  ggtaatgcacattt------------------tacgt----------aatattttatcca--------gc
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  aa--a---
          D. simulans  aa--a---
         D. sechellia  aa--g---
            D. yakuba  aa--a---
            D. erecta  ca--t---
         D. ananassae  gatca---
     D. pseudoobscura  ta--c---
        D. persimilis  ta--c---
        D. willistoni  ca--a---
           D. virilis  ag--g---
        D. mojavensis  aa--g---
         D. grimshawi  aa--a---
           A. gambiae  ag--caaa
         A. mellifera  ========
         T. castaneum  ========

Inserts between block 87 and 88 in window
B D       A. gambiae 1353bp

Alignment block 88 of 217 in window, 835604 - 835697, 94 bps 
B D   D. melanogaster  aaccg--------aaca--t--gaac-------ta--aac----a-aggtcaatcgatcaaaa-------
B D       D. simulans  aaccg--------aaca--t--aaac-------tg--aac----a-aggtca----attaaaa-------
B D      D. sechellia  aaccg--------aaca--t--aaac-------tg--aat----a-aggtca----attaaaa-------
B D         D. yakuba  aaccg--------aaca--c---aacaggaca-aa--aac----a-agatca----attaaaa-------
            D. erecta  aaccg--------aaca--t--aaacagggcacaa--aac----a-ggatca----attaaag-------
         D. ananassae  aaagg--------aaca--t-aaaac-------tc--aac----g-aga--a----actaaaaacacagc
     D. pseudoobscura  acaca--------aaaa--tcaaaac-------ta--aac----atagatccaagggatacaa-------
B D     D. persimilis  acaca--------aaaa--tcaaaac-------ta--aac----acagatccaagggatacaa-------
        D. willistoni  aatcatcatcatcatca--t--caac--------g--aac----a-acttgc----atctagg-------
           D. virilis  aactc--------aataggc--agcc-------caacagcacaaa-atacga----gcaacaa-------
        D. mojavensis  gaccc--------aaca--c--aaga-------tacgagc----a-acagca----gtaacaa-------
         D. grimshawi  aactt--------gact--t--cgcc-------tagaaac----a-acttaa----tctacaa-------
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  -------------gagcgag---------ccaaatgcaacagaaaccataaca---------------ga
          D. simulans  -------------gagcgag---------ccaaatgcaacagaaaccataacg---------------ga
         D. sechellia  -------------gagcgag---------ccaaatgcaacagaaaccataact---------------ga
            D. yakuba  -------------gagcgag---------ccaaatgcaacagaaaccataact---------------ga
            D. erecta  -------------gagcgag---------gcaaatgcaacagaaaccataaca---------------ga
         D. ananassae  aactggaatacggaaacgag---------ccaaacgcaaccaaaacagaaact-----------------
     D. pseudoobscura  -------------gaacaaa---------tcaact-caacggagaacg----------------------
        D. persimilis  -------------gaacaaa---------tcaact-caacggagaacg----------------------
        D. willistoni  -------------aaa---------------aactgcagtattagctaggaga---------------ga
           D. virilis  -------------caacaacaacaa----caacaacaagccaaaagtacaaac-----------------
        D. mojavensis  -------------caacaatagcaaaaagccataacaaatagaaaactcaaattgaaactcaactaaaag
         D. grimshawi  -------------aatgaac---------tcacaggcaaactaaacaacaaaa--------------aaa
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  aaact--caact-caaggc---------------aatc-aaga
          D. simulans  aaact--caact-caaggc---------------attc-aaga
         D. sechellia  aaact--caact-caaggc---------------attc-aaga
            D. yakuba  aaaca--gaact-caaggc---------------aatc-aaga
            D. erecta  aaaca--gaact-caaggc---------------aatc-aaga
         D. ananassae  caact--caact-caaggc---------------aaccgaaaa
     D. pseudoobscura  aaacg--caactgaaaggc---------------aact-gaaa
        D. persimilis  aaacg--caactgaaaggc---------------aact-gaaa
        D. willistoni  ctactagcgatt-caagaa---------------caac-aaga
           D. virilis  aaaca--caact-caactaaatggaa--------atca-aaca
        D. mojavensis  gaact--caact-caacgaaacgaaacgaaagttaacg-aaaa
         D. grimshawi  aaact--catta-caac-----------------aatt-aaca
           A. gambiae  ===========================================
         A. mellifera  ===========================================
         T. castaneum  ===========================================

Inserts between block 88 and 89 in window
       D. willistoni 213bp
        D. grimshawi 448bp

Alignment block 89 of 217 in window, 835698 - 835739, 42 bps 
B D   D. melanogaster  acttacTCCACGTAAAGAAATCATGGAAATTGGCATTTAAAA
B D       D. simulans  acttacTCCACGTAAAGAAATCATGGAAATTGGCATTTAAAA
B D      D. sechellia  acttacTCCACGTAAAGAAATCATGGAAATTGGCATTTAAAA
B D         D. yakuba  acttacTCCACGTAAAGAAATCATGGAAATTGGCATTTAAAA
            D. erecta  acttacTCCACGTAAAGAAATCATGGAAATTGGCATTTAAAA
         D. ananassae  acttacTCCAAGTAAAGAAATCATGGAAATTGGCATTTAGGA
     D. pseudoobscura  acttacTCCACGCAAAGAAATCACGGAAATTGGCATTCAATA
B D     D. persimilis  acttacTCCACGCAAAGAAATCACGGAAATTGGCATTCAATA
        D. willistoni  acttacTCCATGTGAAAATATCATGGAAATTGCCATTGAAAA
           D. virilis  aattagTGT---------------------------------
        D. mojavensis  acttacTCCACGTAAAGAAAGGATTGTAATAGGCATTTAAGA
         D. grimshawi  acttacTCCACGTAAAGAATGGATTGTAATAGGCATTTAAAA
B D        A. gambiae  ==========================================
        A. mellifera  ==========================================
        T. castaneum  ==========================================

Inserts between block 89 and 90 in window
          D. virilis 2083bp
        D. grimshawi 930bp

Alignment block 90 of 217 in window, 835740 - 835771, 32 bps 
B D   D. melanogaster  CATTCATCTCATGA--------------------------------------------------------
B D       D. simulans  CATTCATCTCATGA--------------------------------------------------------
B D      D. sechellia  CATTCATCTCATGA--------------------------------------------------------
B D         D. yakuba  TATTCATCTCACGA--------------------------------------------------------
            D. erecta  TATTCATCTCATGA--------------------------------------------------------
         D. ananassae  TATTCGACTCCTCA--------------------------------------------------------
     D. pseudoobscura  TGTCGGAATCTTGACTTTGACTTTGATTTTGAGTTGGATCTTGATCTTGATGCTCCGTTGATGATGCTGC
B D     D. persimilis  TGTCGGAATCTTGACTTTGACTTTGATTTTGAGTTGGATCTTGATCTTGATGCTCCGTTGATGATGCTGC
        D. willistoni  TATTTGTCGGTTGT--------------------------------------------------------
          D. virilis  ======================================================================
        D. mojavensis  TATTCGTATTCAAG--------------------------------------------------------
        D. grimshawi  ======================================================================
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  ----TCATCCGCCTGA---------------TCTTCT
          D. simulans  ----TCATCCGCCTGA---------------TCTTCT
         D. sechellia  ----TCATCCGCCTGA---------------TCTTCT
            D. yakuba  ----TCATCCGCCTGA---------------TCTTCT
            D. erecta  ----TCTTCCGTTTGA---------------TCTTCT
         D. ananassae  ----TCCTCCGCCTGGGCCTGGACTTGAGCCGCTTCT
     D. pseudoobscura  TGCCTCATCTGCTTGATACTCGTCTTCCTCCTCCTCT
        D. persimilis  TGCCTCATCTGCTTGATACTCGTCTTCCTCCTCCTCT
        D. willistoni  ----TCTTCAGAGTTATCATT----------GCTGCT
           D. virilis  =====================================
        D. mojavensis  ----TCGCACTCTGTA---------------TGCTCT
         D. grimshawi  =====================================
           A. gambiae  =====================================
         A. mellifera  =====================================
         T. castaneum  =====================================

Inserts between block 90 and 91 in window
       D. mojavensis 1611bp

Alignment block 91 of 217 in window, 835772 - 836211, 440 bps 
B D   D. melanogaster  TGCGAACTATTTGAT--ATGGAGCTGAACAACGAATACGA-------------AAAGG------------
B D       D. simulans  TGTGAACTATTTGAT--ATGGAGCTGAACAACGAATACGA-------------AAAGG------------
B D      D. sechellia  TGCGAACTATTTGAT--ATGGAGCTGAACAACGAATACGA-------------AAAGG------------
B D         D. yakuba  TGGGAACTATTTGAT--ATGGAGCTGAACAACGAATACGA-------------AAAGG------------
            D. erecta  TGGGAACTATTTGAT--ATGGAGCTGAACAACGAATACGA-------------AAAGG------------
         D. ananassae  TGCGAGTCGTTCGAG--ATCGAGCTAAACAACAAGTACGA-------------GTAGG------------
     D. pseudoobscura  CGGAAATTGCCCGAC--AGGGAGCTGAACAACAAATAGGAGGCTCGGCTGGGTGGAGG------------
B D     D. persimilis  CGGAAACTGCCCGAC--AGGGAGCTGAACAACAAATAGGAGGCTCGGCTGGGTGGAGG------------
        D. willistoni  GGTAAAGTAACTATTGGAAGGAAC-GAAGGACGAACAGAA-------------AGATGTCCCACTTCGAC
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  -A------------G--G----GCTTCTCTGG--------A-TGATTTCGA-TGCTGCTCCTCACTGACA
          D. simulans  -A------------G--G----GCTTCTCTGG--------A-TGATTTCGA-TGCTGCTCCTCATTGACA
         D. sechellia  -A------------G--G----GCTTCTCTGG--------A-TGATTTCGA-TGCTGCTCCTCATTGACA
            D. yakuba  -A------------G--G----GCTTCTCTGG--------G-TGATTTCGA-TGCTGCTCCTCATTGATA
            D. erecta  -A------------G--G----GCTTCTCTGG--------A-TGATTTCGA-TGCTGCTCCTCATTGATG
         D. ananassae  -AGGCGGAGGAGAGG--G----GCTCCTCGCGGAGGCGTTG-TGGCTGCGGCTGCGGCTGCTGATTCAGG
     D. pseudoobscura  -A------------GGCG----GAGGCTCTGG----------CGACTCTGA-AGACTCTGTC--------
        D. persimilis  -A------------GGCG----GAGGCTCTGG----------CGACTCTGA-AGACTCTGTC--------
        D. willistoni  TA------------G--GACCTGCTGCTGTTG--------ACCTGTTTCGC-TGCCGCCTCTCATTGTTG
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  AGGTAGGGCAGGAAGGGATTCGAAGGGGAAAGGGGCGTAGTA-GTACTAATC--GAAAAGGAGTA-----
          D. simulans  AGGTAGGGCAGGAAGGGATTCGAAGGGGAAAGGGGCGCAGTA-GTACTTTTC--GAAAAGGAGTA-----
         D. sechellia  AGGTAGGGCAGGAAGGGATTCGAAGGGGAAAGGGGCGCAGTA-GTTCTATTC--GAAAAGGAGTA-----
            D. yakuba  AGGTAGGGCAGGAAGGGATTCAAAGGGGATAGGGGCGGAGTA----CTATTC--GAAAAGGAGTA-----
            D. erecta  AGGTAGGGCAGGAAGGGATTCGTAGGGGAAAGGGGCGGAGTA----CTATTC--GAAAAGGAGTA-----
         D. ananassae  AGGTAGGGCAGGAAGGGATTCGAGGGCGACAGGGGCAACGCGGGTGCTTCCCCGGCGCTGGAGGA-----
     D. pseudoobscura  AGGTACGGCAGAAAGGGATTCAATGGCGACAGTGGTGG--------CTCTTC-GGCGCAGGAGTACCAGG
        D. persimilis  AGGTACGGCAGAAAGGGATTCAATGGCGACAGTGGTGG--------CTCTTC-GGCGCAGGAGTACCAGG
        D. willistoni  AGATAAGGTAGAAAGGGGTTCAAAGGCGACAA--------------CTGT----------GAGCA-----
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  -----GCCC------AACTCCGGCTGTTTA--GTTTGGGACTCCTTTTC---CTGCGCCTCTATTCGCAT
          D. simulans  -----GCTC------ATCTCCTGCTGTTCA--GTTTGGGAATTCTTTTC---CTGCGCCTCTATTCGCAT
         D. sechellia  -----GCTC------ATCTCCTGCGGTTCA--GTTTGGGAATTCTTTTC---CTGCTCCTCTATTCGCAT
            D. yakuba  -----GCTC------AACTCCTGCG-----------------CCTTCTC---CTGCGCCTCTATTCGCAT
            D. erecta  -----GCCC------AACTCCGGCT-----------------CCTTTTC---CTGCGCCTCTGTTCGCAT
         D. ananassae  -----GCTTGTGGGAGTGCTTTGTGAAAAA--GCGGAGTAGTCTTGCTC---TTCCGGCTCCACCTGCAT
     D. pseudoobscura  AGTTGGTCG------AGCTTGTGCGCTGAATCGTCGAGTACTCCATCTCTGGCTCTGGCTCCATCTGCAT
        D. persimilis  AGTTGGTCG------AGCTTGTGCGCTGAATCATCGAGTACTCCATCTCTGGCTCTGGCTCCATCTGCAT
        D. willistoni  -----GAAC------GCGTCTTGAT---------------------------CTTCATCATCGTCATCAT
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  CTCGTCCT-------CCCAAAAATTCC--ACGCAAGCTCTGGTTCTTCTCGGACGGTTGGCAATGGTGAT
          D. simulans  CTCCATCT-------CCCAAAAGTTCC--ACGCCAGCTCTGGTTCTTCTCGGACGGTTGGCAATGGTGAT
         D. sechellia  CTCCATCT-------CCCAAAAGTTCC--ACGCCAGCTCTGGTTCTTCTCGGACGGTTGGCAATGGTGAT
            D. yakuba  CTCCTCCT-------CCCAAAAGTTCC--ACGCCAGCTCTGGTTCCTCTCGCACGGTTGGCAATGGTGAT
            D. erecta  CTCTTCCT-------CCCAAAAGTTCC--ACGCCAGCTCTGGTTCCTCTCGGACGGTTGGCAACGGTGAT
         D. ananassae  CTCCTCCT-------GCCAGAAGTTCC--ACGCCAACTCTGGCTCCTCCCGAACGGTGGCAAGCGGTGAG
     D. pseudoobscura  CTGCTCCT-------GCCAGAAGCTCC--AGTTCAGCGCGTGCTCGTCTCTCACTCTTTTCGCCTTTGC-
        D. persimilis  CTGCTCCT-------GCCAGAAGCTCC--AGTTCAGCGCGTGCTCGTCTCTCACTCTTTTCGCCTTTGCT
        D. willistoni  CTTCTTCTTGGTGACTCCAAAAGTTACCGATGTCAATGCTAG-----------------GCATTGGTGCT
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  GA------TACTGCGGGAACTTG------AGCAGGAGCTGG------------------CGCAGGTGCTG
          D. simulans  GA------TACTGCGGGAACTTG------AGCAGGA------------------------------GCTG
         D. sechellia  GA------TACTGCGGGAACTTG------AGCAGAA------------------------------GCTG
            D. yakuba  GA------TACTGCGGGAACTGG------AGCAGAAGCTGGAACTGGAACTGAAACTGCAACTGGAACTG
            D. erecta  GA------TACTGCGGGAACTTG------AGCAGGAGCAGG------------------AGCTGGAACTG
         D. ananassae  GC------TACTGAAGAAACTGGAAGCGAAACGGCAGCTGGAGCGGAGGCTGGAGCTGGAACTGGAACTG
     D. pseudoobscura  --------TGCTGCTGG---TGG------AGCGACG------------------------------GCTG
        D. persimilis  GCTGCTGTTGCTGCTGG---TGG------AGCGACT------------------------------GCTG
        D. willistoni  GGTTCATTATCTGCGGGCG-GGG------GGCAGTA--------------------------GGGAGCAG
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  GAG-----GGCGGGC-----ACCT------GGTGGCGA---------------------------GTCAT
          D. simulans  GAG-----GACGGAC-----ACCT------GGTGGCGA---------------------------GTCAT
         D. sechellia  GAG-----GACGGAC-----ACCT------GGTGGCGA---------------------------GTCAT
            D. yakuba  GAG-----GACGGAA-----GCCT------GGTGGCGA---------------------------GTCAT
            D. erecta  GAG-----GACGGGA-----GCCT------GGTGGCGA---------------------------GTCAT
         D. ananassae  GAGGCGGAGGCGGACTTGAGACCTGA----GGCGGCGA---------------------------CTCGT
     D. pseudoobscura  CAG-----GATAAGG-----CTGTGACATTGGCGGCAG---------------------------CCAAT
        D. persimilis  CAG-----GATGAGG-----CTCTGGCATTGGCGGCAG---------------------------CCAAT
        D. willistoni  GCGGCACAGGTGGAG-----GT--------GGCGTCAAAATTTTAAAATCATTAGCATCATCAGCATCGT
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  CGCAATCGTCGAAGGGATCGTGGAAGCCCCGCCTGCTCCAGTCGCTGATCCAATCGTTAAAAGTCG----
          D. simulans  CGCAATCGTCGAAGGGATCGTGGAAGCCCCGCCTGCTCCAGTCGCTGATCCAGTCGTTAAAAGTCG----
         D. sechellia  CGCAATCGTCGAAGGGATCGTGGAAGCCCCGCCTGCTCCAGTCGCTGATCCAATCGTTAAAAGTCG----
            D. yakuba  CGCAATCGTCGAAGGGATCGTGGAAGCCCCGCCTGCTCCAGTCGCTGATCCAATCGTTAAAAGTCG----
            D. erecta  CGCAATCGTCGAAGGGATCGTGGAAGCCCCGCCTGCTCCAGTCGCTGAACCAATCGTTAAAAGTCG----
         D. ananassae  CCCAATCGTCGAAGGGATCGTGGAAGTCGCGCCTGCTCCAATCGCTGACCCAATTGTGGATGGT------
     D. pseudoobscura  TGCTATCGTCGAAGGGATCGTGAAAGTCGCGCCTGCTCCAGTCACTCACCCAACCGTTGAACACCGGCGG
        D. persimilis  TGCTATCGTCGAAAGGGTCGTGAAAGTCGCGCCTGCTCCAGTCACTCACCCAACCGTTGAACACCGGCGG
        D. willistoni  CATCATCATCAAAAGGATCATGAAACCCTCGTCTACTCCAATCGCTGATCCAATCATGGAAAGCCG----
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  -----------------GTGGAGctggattcagccaaatatt-gagata--attagaaagtggatg
          D. simulans  -----------------GTGGAGctggattcagccaaatagt-gagata--attagaaagtggaag
         D. sechellia  -----------------GTGGAGctggattcagccaaattgt-gagata--attagaaagtggaag
            D. yakuba  -----------------GTGGAGctgcgttcagccaaacagt-gagac---attagaaagtggatg
            D. erecta  -----------------GTGGAGctggattcagccaaacagt-gagat---attagaaagtggatg
         D. ananassae  ------------------TAGAGctgggatcagccggaaaac-aaagag--attagagatc-----
     D. pseudoobscura  CATCGCCGTGGCCGCCCGTAGAGctgcccgcaaagggataga-gagagattgtgagacacagaatc
        D. persimilis  CATCGCCTTGGCCGCCTGTAGAGctgcccgcaaagggataga-gagagattgtgagacacagaatc
        D. willistoni  ---------TAGCATTTGAACTGttgcttacagctaatcaccagtgaca--attggagaagaaatg
           D. virilis  ==================================================================
        D. mojavensis  ==================================================================
         D. grimshawi  ==================================================================
           A. gambiae  ==================================================================
         A. mellifera  ==================================================================
         T. castaneum  ==================================================================

Inserts between block 91 and 92 in window
       D. willistoni 1940bp

Alignment block 92 of 217 in window, 836212 - 836301, 90 bps 
B D   D. melanogaster  cgaactcttggtgtggg---gtgctccaagtggaaggcgagcgaa--gggcgcgc-aagcaagctgcagg
B D       D. simulans  cgaactcttggtgtggg---gtgctcgaagtggaaggcgagcgaa--gg--gcgc-aagcaagctgcagg
B D      D. sechellia  ccaactcttggtgtggg---gtgctcgaagtggaaggcgagcgag--gg--gcgc-aagcaagctgcagg
B D         D. yakuba  cgaactcttggtgtggg---gtgctcgaagtggaaggcgagcgga--gg--gcgc-aagcaagctgcagg
            D. erecta  cgaactcttggtgtggg---gtgctcgaagtggaaggcgagcgaa--gg--gcgc-aagcaagctgcagg
         D. ananassae  ---------------------tgctcaac---ggaggcgagcggc--ag--gcgctacggaagctgcagg
     D. pseudoobscura  catagtctggaggagagcgtatgggcggggcggcaagcgatctacatgg--gtgc-aagcatggtgcaag
B D     D. persimilis  catagtctggaggagagcgtatgggcggggcggcaagcgatctacatgg--gtac-aagcatggtgcaag
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  gtctttcagga-----------------tgc---caagccgcaggt--
          D. simulans  gtctttcggga-----------------tgc---caagccgcaggt--
         D. sechellia  gtctttcggga-----------------tgc---caagccgcaggt--
            D. yakuba  atctttcagga-----------------tgc---caagccgcaggt--
            D. erecta  atctttcagga-----------------tgc---caagctgcaggt--
         D. ananassae  atcttgaggaagccaaagcttaagccattgcgttcaagcagaaggt--
     D. pseudoobscura  cc--------g-----------------tgc-----agcggcaggttg
        D. persimilis  cc--------g-----------------tgc-----agcggcaggttg
        D. willistoni  ================================================
           D. virilis  ================================================
        D. mojavensis  ================================================
         D. grimshawi  ================================================
           A. gambiae  ================================================
         A. mellifera  ================================================
         T. castaneum  ================================================

Alignment block 93 of 217 in window, 836302 - 836440, 139 bps 
B D   D. melanogaster  gcaggagc--gaaaggatgtgtttgaacaactcatatttgaaaactactgcatttcacttagcgttca--
B D       D. simulans  gcaggagc--gaagggatgtgtttgaacaactcttatttgaaaactactgcatttcacttagcgttcggt
B D      D. sechellia  gcaggagc--aaagggatgtgtttgaacaactcttatttgaaaactactgcatttcacttagcgttcg--
B D         D. yakuba  gcaggagc--gaaggtatgtgtttgaacaactcttatttgaaaactactgcgtttcgtttagcgttcg--
            D. erecta  gcaggagc--gtagggatgtgtttgcacaactcttatttgaaaactactgcatttcgtttagcgttcg--
         D. ananassae  gcaggagc--------atgtgaatcgacaa-------------------gcatat--------gctcg--
     D. pseudoobscura  gcaggaggcagcaggcaggagg--------------------------------------agccatcg--
B D     D. persimilis  gcaggaggcagcaggcaggagg--------------------------------------agccatcg--
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
         D. grimshawi  gaaagagc--aaaaattcggcttgagccga----tgcttaaatacccttgcagatatatcatccttag--
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  atacatgta------caatttggtttgctt-cgatggatgaatgattcattcgaaaggatt-aaatac--
          D. simulans  gtacatgta------caatttggtttgctt-cgatgg----atgattcattcgaaaggatt-aaatgctg
         D. sechellia  gtacatgta------caatttggtttgctt-cgatgg----atgattcgttcgaaaggatt-aaatgctg
            D. yakuba  atacatgta------caatttggtttgctt-cgatgg----gtgattgattcagaaagtctaaagctgta
            D. erecta  ttacatgtt------caatttggtttgctt-cgatgg----gtgattggttcgaaaagact-aagctgta
         D. ananassae  gtggtattg------ggatttggaatgtttatgacgg----agtactc--tcaaaataatg---------
     D. pseudoobscura  gagcaggct------------------cct-cgaaga----gtggtgtacgcgaaagatcg-aaa-----
        D. persimilis  gagcaggct------------------cct-cgaaga----gtggtgtacgcgaaagatcg-aaa-----
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  acctatattgtgagacaatctgaatagttt-taaaat----gtga--------aaaaacaa-aaatgcaa
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  --------------actctgaatgata
          D. simulans  taaagct---gtatactctgaatgata
         D. sechellia  taaagct---gtatactttgaatgata
            D. yakuba  caatgtttaattatgttctgaataata
            D. erecta  caatgtttaattatatccagaataata
         D. ananassae  ---------------------------
     D. pseudoobscura  -----------------------gata
        D. persimilis  -----------------------gata
        D. willistoni  ===========================
           D. virilis  ===========================
        D. mojavensis  ===========================
         D. grimshawi  cta------------------------
           A. gambiae  ===========================
         A. mellifera  ===========================
         T. castaneum  ===========================

Inserts between block 93 and 94 in window
B D      D. simulans 246bp

Alignment block 94 of 217 in window, 836441 - 836488, 48 bps 
B D   D. melanogaster  -----------aatc----atatttcacaaatgttgt-gctgaatatagcctctttt-------------
B D       D. simulans  -----------aatc----atatttcaaaaa---tgt-gctgcaaatagcctctttt-------------
B D      D. sechellia  -----------aatc----atatttcaaaaatgttgt-gctgcaaatagcctctttt-------------
B D         D. yakuba  -----------aatcatg-atagtacaaaaatgttgt-gctgaacatagcttatatttgactgatggacg
            D. erecta  -----------aatcatg-ataat---------ttcg-actgaaca---------------------gcg
         D. ananassae  ----------------------------------------------------------------------
     D. pseudoobscura  ---------------------------------------------------------tatccaaccaacg
B D     D. persimilis  ---------------------------------------------------------tatccaaccaacg
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
         D. grimshawi  gaccaaatttcaatcgtgtatataagaactatgatatcactg----------------------------
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  gataaag
          D. simulans  gataaag
         D. sechellia  gataaag
            D. yakuba  gatcaag
            D. erecta  gatcaat
         D. ananassae  -attaat
     D. pseudoobscura  gatacgc
        D. persimilis  gatacgc
        D. willistoni  =======
           D. virilis  =======
        D. mojavensis  =======
         D. grimshawi  -------
           A. gambiae  =======
         A. mellifera  =======
         T. castaneum  =======

Alignment block 95 of 217 in window, 836489 - 836519, 31 bps 
B D   D. melanogaster  aaagca------------------aact--aattgaatgaa---------aaataaagaa----
B D       D. simulans  aaagca------------------aact--aattgaatgaa---------aaagaaagaa----
B D      D. sechellia  aaagca------------------aact--aactgaatgaa-------------aaagaa----
B D         D. yakuba  aaagcattttttttttttggtaaaaact--aattgaatgga-------------gaagaa----
            D. erecta  aaagca-ttttctttgttgctaaaaact--agtggaatgga-------------gtagaa----
         D. ananassae  aaagtgtcctgtgtttctg-----aact----taaaatgga-------------agacaa----
     D. pseudoobscura  aactca-----------------aaacttaaataaaacgaaagga-----agaaaaagga----
B D     D. persimilis  aactca-----------------aaacttaaataaaacgaaagga-----agaaaaagga----
       D. willistoni  ================================================================
           D. virilis  ----------------------------agggaggatcaacagga-----acagaaacagaaca
       D. mojavensis  ================================================================
         D. grimshawi  ------------------------------aaagtaacgcaagggtatatataaaaataaa---
B D        A. gambiae  ================================================================
        A. mellifera  ================================================================
        T. castaneum  ================================================================

Alignment block 96 of 217 in window, 836520 - 836539, 20 bps 
B D   D. melanogaster  agc------------cgggct------gagagatggaa--------
B D       D. simulans  agc------------cgggct------gagagatggaa--------
B D      D. sechellia  agc------------cgggct------gatagttggaa--------
B D         D. yakuba  agc------------tggact------gagagatggaa--------
            D. erecta  agc------------cgggct------gacagatggaa--------
         D. ananassae  ----------------gggctcctcccgacag--------------
     D. pseudoobscura  agcatctcccac---tagg--------ggcatcccaag--------
B D     D. persimilis  agcatctcccacacggggg--------ggaatcccagg--------
       D. willistoni  ==============================================
           D. virilis  ---------------------------aatatcctggattgaaaga
        D. mojavensis  --------------------------agcaagccagcaatttgatg
         D. grimshawi  ---------------------------agtgtgatttagtttaagg
B D        A. gambiae  ==============================================
        A. mellifera  ==============================================
        T. castaneum  ==============================================

Inserts between block 96 and 97 in window
        D. grimshawi 9bp

Alignment block 97 of 217 in window, 836540 - 836888, 349 bps 
B D   D. melanogaster  acttacCCACTG------CATTGTAGATGGGAGCGTGATCGAAGTCGGCAAAGTTCTCAGTGCC-----C
B D       D. simulans  acttacCCACTG------CATTGTAGATGGGCGCGTGATCGAAGTCGGCAAAGTTCTCAGTGCC-----C
B D      D. sechellia  acttacCCACTG------CATTGTAGATGGGCGCGTGATCGAAGTCGGCAAAGTTCTCAGTGCC-----C
B D         D. yakuba  acttacCCACGG------CATTGTAGATGGGCGCGTGATCGAAGTCGGCAAAGTTCTCAGTGCC-----C
            D. erecta  acttacCCACTG------CATTGTAGATGGGTGCGTGATCGAAGTCGGCAAAGTTCTCAGTGCC-----C
         D. ananassae  actcacCTCCTG------CATTGAAGATGGGAGCATGCTCAAAGTCCGCAAAGTTCTCCGTTCC-----C
     D. pseudoobscura  acttacCCACGC------CATTGAAGATGGGCGCATGATCAAAGTCCGCAAAGTTCTCCGCTCC-----C
B D     D. persimilis  acttacCCACGC------CATTGAAGATGGGCGCATGATCAAAGTCCGCAAAGTTCTCCGCTCC-----C
        D. willistoni  acttacCCGCTG------CATTATAGATGGGGGCATGGTCAAAGTCTGCGAAATTCTCCGTGTT-----G
           D. virilis  acttacCATTAGCGACTGCATTGTAAATGGGCGCATGCTCGAAATCCGCAAAATTCTCCGTTCC------
        D. mojavensis  acttacCATCAGCGACGCCATTATAGATTGGCGCATGCTCAAAATCCGCAAAGTTCTCAGATCC------
         D. grimshawi  acttacCACCAG------CATTATAAATGGGCGCATGCTCGAAATCCGCAAAGTTCTCCGTTCC------
B D        A. gambiae  --ttacCTGCTG------AGTTAAAGATGGGATTGTGATCGAAGTCGGCAAAATTTTCCATCTCTCGTGC
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  TGAT-------GACCATTGCCATTGAGGAGCTGC------TGCTGATGCAGCTGC---------------
          D. simulans  TGAT-------GACCATTGCCATTGAGGAGCTGC------TGCT------GCTGA---------------
         D. sechellia  TGAT-------GACCATTGCCATTGAGGAGCTGC------TGCT------GCTGA---------------
            D. yakuba  TGAT-------GGCCATTGCCATTGAGGAGCTGCTGCTGTTGCT------GCTGC---------------
            D. erecta  TGAT-------GGCCATTGCCGTTGAGGAGC---------TGCT------GCTGC---------------
         D. ananassae  TGGT-------GTCCATTTCCATTCAGGAGCTGC------TGCT------GGTGC---------------
     D. pseudoobscura  TGG-------------CTACCATTCAGCAGCTGCTGTTGCTGCT------GTTGT---------------
        D. persimilis  TGG-------------CTACCATTCAGCAGCTGCTGTTGCTGCT------GTTGT---------------
        D. willistoni  CCAT-TTGAAATGGCACTTCCATTGAGAAGGGCC------TGCT------GCTGC---------------
           D. virilis  ---------------ATTGCCATTGA--------------------------------------------
        D. mojavensis  -GGT--------GCTGTTGCCGTTGAGCATTTGC------TGCT------GTTGC---------------
         D. grimshawi  ---------------GTTGCCATTGAGCAGATGT------TGCT------GTTGCTGTTGTTGTTGCTGC
           A. gambiae  CGATACCTCCCCGTTGTTGCCATTG---------------TGCT------GCGCA---------------
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ------TGCTG-C---AACTGCTGTTGCTGCTGGAGATGAGCTGCCCGGATGGGCTGCACCTTGGCGTAG
          D. simulans  ------TGCTG-C---AACTGCTGTTGCTGCTGGAGATGAGCTGCCCGGATGGGCTGCACCTTGGCGTAG
         D. sechellia  ------TGCTG-C---AACTGCTGTTGCTGCTGGAGATGAGCTGCCCGGATGGGCTGCACCTTGGCGTAG
            D. yakuba  ------TGCTG-C---AACTGCTGTTGCTGCTGGAGATGAGCTGCCCGGATGGGCTGCACCTTGGCGTAG
            D. erecta  ------TGCTG-C---AACTGCTGTTGCTGCTGGAGATGAGCAGCCCGGAGGGGCTGCACCTTGGCGTAG
         D. ananassae  ------TGCTG-T---TGCTGCTGCTGCTGCTGGAGATGGGCCGCCCTCAGTGGCTGCACCTTGGCATAC
     D. pseudoobscura  ------TGCTG-CTGTTGTTGCTGCTGCTGGTGGAGGTGGGCCGCTCGGATGGGCTGCACCTTGGCATAT
        D. persimilis  ------TGCTG-C---TGCTGCTGCTGCTGGTGGAGGTGGGCCGCTCGGATGGGCTGCACCTTGGCATAT
        D. willistoni  ------TGTTG-C---TGTTGCTGCTGCTGCAGCAGATGGGCCGCTCTCAATGGTTGTACTTTTGCATAG
           D. virilis  ----------G-C---TGCTGCTGTTGCTGTTGGAGATGCGCCGCTCGGATGGGCTGCACCTTAGCATAG
        D. mojavensis  ---------TG-C---TGCTGCTGCTGCTGCTGGAGATGCGCCGCACGAATGGGCTGCACCTTGGCATAG
         D. grimshawi  TGTTGCTGTTG-C---TGCTGCTGCTGCTGTTGAAGATGCGCCGCTCGGATGGGCTGCACTTTGGCATAG
           A. gambiae  ------TACAATC---CGGTCCCGTTGTCGCTAA----------------------------CGGCATTA
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  CCATTGCTGGAACCCACTGAGGACACGGACGACACCGCCGGCGATCCTGTGGAACG---CGCCGATGTGG
          D. simulans  CCATTGCTGGAACCCACTGAGGACACGGACGACACCGCCGGCGATCCTGTGGAGCG---CGCCGATGTGG
         D. sechellia  CCATTGCTGGAACCCACTGAGGACACGGACGACACCGCCGGCGATCCTGTGGAGCG---CGCCGATGTGG
            D. yakuba  CCATTGCTGGAACCCACTGAGGACACGGAGGATACCGCCGGCGATCCTGTGGAGCG---CGCCGATGTGG
            D. erecta  CCATTGCTGGAGCCCACCGAGGACACGGAGGACACCGCCGGCGATCCTGTGGAGCG---CGCCGATGTGG
         D. ananassae  CCGTTGCTGGAGCCCACGGAGGACACCGACGACACAGCCGGCGATCCGGCCGAGCG---CGCCGAGGTGG
     D. pseudoobscura  CCATTCGTGGAGCTCACCGACGAGGCCGAAGAGACGGCCGGCGAGCCCGCAGATCG---GGCCGAGGTGG
        D. persimilis  CCATTCGTGGAGCTCACCGACGAGGCCGAGGAGACGGCCGGCGAGCCCGCAGATCG---GGCCGAGGTGG
        D. willistoni  CCATTGGTCGAACTAACAGACGAGGCAGAGGAGACAGCTGGCGATCCCGCTGACCT---CGCCGATGTGG
           D. virilis  CCGTTGGTGGAGCTAACCGAACTGGCCGTGGAGACGGCCGGTGAGCCTGTGGAACGCGCCGCCGAGGTGG
        D. mojavensis  CCATTGGTGGAGCTGACCGAACTGGCCGAGGAGACAGCCGGCGAGCCCGTGGAACG---TGCCGAGGTGG
         D. grimshawi  CCATTGGTGGAGCTAACCGAACTGGCCGAGGAGACAGCCGGTGAGCCCGCGGAGCG---CGCCGCGGTCG
           A. gambiae  CTGTTTTTCAAACT-ACTAGTACTTCCATAATGACTGCC------TCCGT---------TGCTGACGT--
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  CGTCGAAAATGTTGGCCGAGCCAAAGTCAGCCACAAAGTCGCAGTCCGCACCGAAGCCATT---GCTAGC
          D. simulans  CATCGAAAATGTTGGCCGAGCCAAAGTCAGCCACAAAGTCGCAGTCCGCACCGAAGCCATT---GCTGGC
         D. sechellia  CATCGAAAATGTTGGCCGAGCCAAAGTCAGCCACAAAGTCGCAGTCCGCACCGAAGCCATT---GCTGGC
            D. yakuba  CATCGAAAATGTTGGCCGAGCCAAAGTCGGCCACAAAGTCGGAGTCCGCACCGAAGCCATT---GCTGGC
            D. erecta  CATCGAAAATGTTGGCCGAGCCAAAGTCAGCCACGAAGTCGGAGTCCGCACCGAAGCCATT---GCTGGC
         D. ananassae  CATCGAAAATGGTGGCTGATCCAAAGTCGGCTACGAAGTCCGAGTCCCCGCCAAAGCCGTT---GCTGGC
     D. pseudoobscura  CATCAAATATGTTGGCCGTCCCAAAGTCGGCCACAAAGTCCGATTCCCCGGCAAAACCGTT---GCTGGC
        D. persimilis  CATCAAATATGTTGGCCGTCCCAAAGTCGGCCACAAAGTCCGATTCCCCGGCAAAACCGTT---GCTGGC
        D. willistoni  CATCAAAGATATTGGCCGAACCAAAGTCGGCCACAAAGTCGGATTCGGCGGCAAAGCCATT---GCTGGC
           D. virilis  CATCAAATATGTTCGCCGTGCCGAAATCGGCGACGAAATCTGTTTCGCCGGCAAAGCCATT---GCTGGC
        D. mojavensis  CATCGAATATGTTTGCCGACCCAAAATCGGCCACGAAATCTGATTCGCCGGCAAAGCCGTT---GCTGGC
         D. grimshawi  CATCAAATATATTCGCCGTACCAAAGTCGGCAACGAAATCGGTCTCGCCGGCAAATCCATT---GCTGGC
           A. gambiae  TATTCACTATTGTAGCGCTGCCAAAGTCAGCCACAAAGTCGGCATCAGGTGTAAACTTATTGGCGTTAAT
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ACAACTGCTGGTGTCGGAAAGAGCTCCAGTGGATGTGGAACCGGCGCTGTTCAG
          D. simulans  ACAACTGCTGGTGTCGGAAAGAGCTCCGGTGGATGTGGAACCGGCGCTGTTCAG
         D. sechellia  ACAACTGCTGGTGTCGGAAAGAGCTCCGGTGGATGTGGAACCGGCGCTGTTCAG
            D. yakuba  ACAGCTGCTGGTGTCGGAAAGGGCTCCGGTGGATGTGGAACCGGCGCTATTGAG
            D. erecta  ACAACTGCTGGTGTCGGAAAGAGCTCCGGTGGATGTGGAACCGGCGCTGTTCAG
         D. ananassae  GCAGCTGCTGGTGTCCGAGAGGGCGCCCGTGGACGTGGAGCCGGCACTGTTGAG
     D. pseudoobscura  GCAGCTACTGGTGTCCGAGAGGGCGCCCGTGGACGTCGATCCTGCGCTGTTCAG
        D. persimilis  GCAGCTACTGGTGTCCGAGAGGGCGCCCGTGGACGTCGATCCTGCGCTGTTCAG
        D. willistoni  ACAGCTGCTCGTATCGGACAATGCGCCCGTCGATGTGGAGCCGGCACTATTTAG
           D. virilis  GCAGCTGCTCGTATCGGACAGAGCGCCCGTGGATGTGGAGCCGGCGCTGTTCAG
        D. mojavensis  GCAGCTGCTCGTATCGGATAAAGCGCCCGTCGACGTGGACCCGGCGCTGTTCAG
         D. grimshawi  ACAGCTGCTCGTATCCGAGAGAGCACCCGTCGATGTGGAGCCGGCACTGTTGAG
           A. gambiae  GTCACCGCTACTTCCCGACAG----CCCG-----GTGGCGCTGCTGTTGTTCAG
         A. mellifera  ======================================================
         T. castaneum  ======================================================

Inserts between block 97 and 98 in window
B D       A. gambiae 318bp

Alignment block 98 of 217 in window, 836889 - 837083, 195 bps 
B D   D. melanogaster  GCTGCTCAA---------TCC---------GCCACCCA---GGCC------AAAGGCATCGTGATTGTTG
B D       D. simulans  GCTGCTCAG---------TCC---------GCCACTCA---GGCC------AAAGGCATCGTGATTGTTG
B D      D. sechellia  GCTGCTCAA---------TCC---------GCCACTCA---GGCC------AAAGGCATCGTGATTGTTG
B D         D. yakuba  GCTGCTCAA---------TCC---------GCCACCCA---GACC------AAAGGCATCGTGAT-----
            D. erecta  GCTGCTCAA---------TCC---------TCCGCCCA---AGCC------AAAGGCATCGTGGTTGTTG
         D. ananassae  ACTGCTCAG---------TCC---------TCCGGTCA---GCCC------GAAAGCGTCGTGGTTGTTG
     D. pseudoobscura  ACTGGTGAGTCCTCCTCCTCC---------TCCGTTCA---GCCC------GAAGGCGTCATGATTGTTG
B D     D. persimilis  ACTGGTGAG---TCCTCCTCC---------TCCGTTCA---GCCC------GAAGGCGTCATGATTGTTG
        D. willistoni  GCTAGTCAG---------ACC---------ATTTGCCAAAGAGCC------AAAAGCATCATGATGA---
           D. virilis  GCTGGTCAG---------GCCCAGGCCAATGCCGGACA---AATTATTGGAGAAGGCGTCATGATTGCCA
        D. mojavensis  GCTGGTCAG---------GCCCAGCCCAATGCCGGCCA---GATTATGCGAAAAGCCATCATGATTGCCG
         D. grimshawi  GCTAGTCAG---------TCCCAGGCCA---------A---GATT------GAAGGCATCATGATTGCCA
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  TTT----------------------TG-----GCTGTTGTTC----------TGGTGATTATAGTG---T
          D. simulans  TTT----------------------TG-----GCTGTTGTTG----------TGGTGGTTATAATG---A
         D. sechellia  TTT----------------------TG-----GCTGTTGTTG----------TGGTGGTTATAATG---T
            D. yakuba  ----------------------------------TGTTGTTG----------TGGTGATTGTACTG---T
            D. erecta  TTT----------------------TG-----GCTGTTGTTG----------TGGTGATTATAATG---T
         D. ananassae  TTGCTGCTGCTA-------------TG-----ATTGTGGTTG----------TGGTGGTGGTGGTGGCTC
     D. pseudoobscura  TTGTTATTGTTGTTGTTGTTGT---TGCTGCTGCTGTGGTTG----------TGATGGTGGTGCTG---C
        D. persimilis  TTGTTATTGTTGTTGTTGTTGTTGCTGCTGCTGCTGTGGTTG----------TGATGGTGGTGCTG---C
        D. willistoni  -------------------------TG-----CTGATTATGG----------TGATGATGGTGCTG---A
           D. virilis  TTCAGT-------------------TG-----ATTGTGATTG-TGATTCTGATGATGATGATGCTG---C
        D. mojavensis  TTCAGCTG-----------------TG-----GCTGCTGCTGTTGATTGTGATTGTGATGATGCTG---C
         D. grimshawi  TTCTGC----------------------------TGCTGCGGAAGATGATGATGATGATGATGCTG---C
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  GGCCTACTGATCGA---GGATGAGGTCTTTCCAGAAGAGTTACTCGACGAGTT-GGCCACCTTCTGCAAT
          D. simulans  GGCCTGCTGATCGA---GGAGGAGGTCTTTCCAGAAGAGTTACTCGACGAGTT-GGCCACCTTCTGCAGT
         D. sechellia  GGCCTGCTGATCGA---GGAGGAGGTCTTTCCAGAAGAGTTACTCGACGAGTT-GGCCACCTTCTGCAGT
            D. yakuba  GGCCTGCTGATCGA---AGAAGAGGACTTTCCAGAGGAGCTACTCGACGAGTT-GGCCACTTTCTGCAAT
            D. erecta  GGCCTGCTGATCGA---GGAGGAGGACTTTCCAGAAGAGTTACTCG-------------TTTTCTGCAGT
         D. ananassae  GGCCGGCTGATGGA---CGCCGAG---CTGCCGGAGGAGGAG---GAGGAGTG-GGTCATCTTCTGCAGG
     D. pseudoobscura  GGCCTGCTGATGGACGTGGCCGAGG------CTGAGGAGCTG-GCGACGGTTG-GGC--CCTTGTGCAGG
        D. persimilis  GGCCTGCTGATGGACGTGGCCGAGG------CTGAGGAGCTG-GCGACGGTTG-GGC--CCTTGTGCAGG
        D. willistoni  GGTCGACTGATTGC---CGTTGTG------CTGGACGCGGTG-GCAACCGTTGCCACTGCCTTCTGTTGG
           D. virilis  GGCCGGCTGATGGC---CG---------TTGTGGATGC----------------TCCGTTCTTGGACAGG
        D. mojavensis  GGCCGGCTGATGGC---TG---------TGCTGTTAGC----------------TACCGACTTGCTGAGG
         D. grimshawi  GGCCGACTGATCGC---CGCCGAGGATCCGGTGGATGT----------------GCCTGTCTTCGACAAA
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  CCATTGGCCGAGGTCCGCTGGGCAGCAGGAGGCGTCAAATGGATGCTGGCATACCC
          D. simulans  CCATTGGCCGAGGTCCGCTGGGCAGCAGGAGGCGTCAAATGGATGCTGGCATACCC
         D. sechellia  CCATTGGCCGAGGTCCGCTGGGCAGCAGGAGGCGTCAAATGGATGCTGGCATACCC
            D. yakuba  CCATTGGCCGAGGTCCGCTGGGCAGCTGGAGGCGTCAAATGGATGCTGGCATACCC
            D. erecta  CCATTGGCCGAGGTCCGCTGGGCAGCTGGAGGCGTCAAATGGATGCTGGCATAGCC
         D. ananassae  CCGTTGGCCGTGGTGCGCTGG------GACGGCGTCAGATGGATGCTGGCGTATCC
     D. pseudoobscura  CCATTGGCTGTGGTGCGCTGGGCGGCAGGCGGCGTCAGGTGGATGCTGGCATATCC
        D. persimilis  CCATTGGCTGTGGTGCGCTGGGCGGCAGGCGGCGTCAGGTGGATGCTGGCATATCC
        D. willistoni  CCATT---CGATGTACGCTGAGCAGCAGGAGGCGTCAGTTGAATGCTCGCATAGCC
           D. virilis  CCATTGGCAGCTGTGCGCTGGGCGGCGGGCGGTGTCAAATGGATGGTGGCATAGCC
        D. mojavensis  CCATTGGCTGTGGTGCGCTGGGCGGCGGGCGGCGTTAGGTGAATGCTGGCATAGCC
         D. grimshawi  CCATTGGCAGCGGTGCGCTGAGCGGCGGGCGGTGTCAAATGAATGCTGGCATAACC
           A. gambiae  ========================================================
         A. mellifera  ========================================================
         T. castaneum  ========================================================

Alignment block 99 of 217 in window, 837084 - 837155, 72 bps 
B D   D. melanogaster  ATT---------------------------------------TTG---------GTGGCCATTC------
B D       D. simulans  ATT---------------------------------------GTG---------GTGGCCATTC------
B D      D. sechellia  ATT---------------------------------------GTG---------GTGACCATTC------
B D         D. yakuba  ATT---------------------------------------GTG---------ATGGCCATTA------
            D. erecta  ATT---------------------------------------GTG---------GTGGCCATTC------
         D. ananassae  GTT---------------------------------------GTG---------GTGGCCGTTCTG----
     D. pseudoobscura  ATTGCTCGACAGGGTCGAGACACTCACTCCGTTGTGGTGATGGTG---------GTGGCCATTGTGGCCA
B D     D. persimilis  ATTGCTCGACAGGGTCGAGACACTCACTCCGTTGTGGTGATGGTG---------GTGGCCATTGTGGCCA
        D. willistoni  ATT-----------------------------------------G---------GTCGACATTCCTACCA
           D. virilis  ATTGCTCGAT--------------------------------ATG---------TTGCCCGTAT------
        D. mojavensis  ATTGCTCGAT--------------------------------ATG---------TTGCCCGT--------
         D. grimshawi  ATTACTCGAG--------------------------------ATGCTCGAATTATTATTAGT--------
B D        A. gambiae  ACT---------------------------------------TTC---------ATTGGCATTC------
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  -------------TGAGTGTGGTTC------GTCGCCGGAGCA---------------------------
          D. simulans  -------------TGAGTGTGGTTC------GTCGCCGGAGCA---------------------------
         D. sechellia  -------------TGAGTGTGGTTC------GTCGCCGGAGCA---------------------------
            D. yakuba  -------------TGCGTGTGGTTT------GTTGCCGGTGCA---------------------------
            D. erecta  -------------TGAGTGTGGTTT------GTCGCCGGAGCA---------------------------
         D. ananassae  ------------TTGCCCGTGGCTG------GGTGCTGGGGCG---------------------------
     D. pseudoobscura  TTGTGGCCAC-TGTGGCTGTGGCTCTCGAGGTTCGCTGGGGCG---------------------------
        D. persimilis  TTGTGGCCAC-TGTGGCTGTGGCTCTGGAGGTTCGCTGGGGCG---------------------------
        D. willistoni  AACTGACTCCATTTGGTTGATGCT-------GCTGCTGCTGCT---------------------------
           D. virilis  -----------TGTGATGATAGCC-------ATTGCTGGACGA--------TGTCGATGTCGACGCCGAC
        D. mojavensis  ---------------GTGATAGCC-------ATTGCTGGCGGA-----------------CGACGTCGAC
         D. grimshawi  ---------------GTTGTTGCT-------GTTGCTGTTGCTATTATTATTGTTGTTATTGTTGTTG-T
           A. gambiae  ----------------TTATTGCTG------CCTCCCGACAGT---------------------------
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  --------------GACGAC-----------------------TTCAGGTTGAC------CGCAT---TG
          D. simulans  --------------GACGAC-----------------------TTCAGGTTGAC------CGCAT---TG
         D. sechellia  --------------GAAGAC-----------------------TTCAGGTTGAC------CGCAT---TG
            D. yakuba  --------------GACGAC-----------------------TTCAGGTTCAC------CGCAT---TG
            D. erecta  --------------GACGAC-----------------------TTCAGGTTGAC------CGCAT---TG
         D. ananassae  -----------------GAC-----------------------TTGAGGTTCAC------CGCGT---TG
     D. pseudoobscura  -----------------GCC-----------------------TTCAGGTTG------------------
        D. persimilis  -----------------GCC-----------------------TTCAGGTTG------------------
        D. willistoni  --------------GATGATGATGATGATGATGACCATTTTGATTTGGGCGAACAGCACTCGCAT---TG
           D. virilis  GACGACGATGAT--GCCGAC-----------------------TTCAGATTT------------------
        D. mojavensis  GA--------------CGAC-----------------------TTCAGATTG------------------
         D. grimshawi  GATAACCATTGCTGGACGTC-----------------------TTCAGATTG------------------
           A. gambiae  --------------GACGTC-----------------------AGCGAGCTCGA------TGCATTCGTG
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  G---------------------------CCAGCGA
          D. simulans  G---------------------------CCAGCGA
         D. sechellia  G---------------------------CCAGCGA
            D. yakuba  G---------------------------CCAGGGA
            D. erecta  G---------------------------CCAGGGA
         D. ananassae  G---------------------------CCAGCGA
     D. pseudoobscura  ------------------------------AGCGA
        D. persimilis  ------------------------------AGCGA
        D. willistoni  GAGTTCTGTGCTGGAGATGATTTTAGATTCAATGA
           D. virilis  ------------------------------AGCGA
        D. mojavensis  ------------------------------AGCGA
         D. grimshawi  ------------------------------AGCGA
           A. gambiae  G---------------------------GCAGCGA
         A. mellifera  ===================================
         T. castaneum  ===================================

Alignment block 100 of 217 in window, 837156 - 837182, 27 bps 
B D   D. melanogaster  CTTAAGAGGACTGGCCGGCTCCAGGTA
B D       D. simulans  CTTAAGAGGACTGGCCGGCTCCAGGTA
B D      D. sechellia  CTTAAGAGGACTGGCCGGCTCCAGGTA
B D         D. yakuba  CTTAAGCGGACTAGCCGGCTCCAGGTA
            D. erecta  CTTGAGTGGACTGGCCGGCTCCAGGTA
         D. ananassae  CTTAAGCGGGCTGGCCGGCTCCAGGTA
     D. pseudoobscura  CTTGAGCGGACTGGCCGGCTCCAGGTA
B D     D. persimilis  CTTGAGCGGACTGGCCGGCTCCAGGTA
        D. willistoni  CTTTAATGGACTACCCGGCTCCAAGTA
           D. virilis  CTTAAGCGGACTGGCTGGCTCCAGATA
        D. mojavensis  CTTGAGCGGACTGGCCGGCTCCAGATA
         D. grimshawi  CTTGAGCGGACTGCCTGGCTCCAGATA
B D        A. gambiae  TTTCAACGGACTAGCAGGCTCCAGATA
        A. mellifera  ===========================
         T. castaneum  CTTGAGGGCTTGGGCCGGCTCCATGTA

Inserts between block 100 and 101 in window
B D       A. gambiae 135bp

Alignment block 101 of 217 in window, 837183 - 837386, 204 bps 
B D   D. melanogaster  GTATCGCTTCCGCTCATACTTGTCCATCATCAGTTCGCG------CTGCTCCTGC---------------
B D       D. simulans  GTATCGCTTCCTCTCATACTTGTCTATCATCAGATCGCG------TTGCTCCTGC---------------
B D      D. sechellia  GTATCGCTTCCTCTCATACTTGTCTATCATCAGATCGCG------CTGCTCCTGC---------------
B D         D. yakuba  GTATCGCTTCCTCTCGTACTTATCCATCATCAGCTCGCG------CTGCTCCTGC---------------
            D. erecta  GTACCGCTTCCTCTCATACTTGTCCATCATGAGCTCGCG------CTGCTCCTGC---------------
         D. ananassae  GTACCGCTTCCGCTCGTACTTGTCGATCATCAGCTCGCG------CTGCTCCTGC---------------
     D. pseudoobscura  GTATCGCTTCCGCTCATACTTGTCGGTCAGCAGCTCTCG------CTGGTCCTGCTGCTGCTGT---TGC
B D     D. persimilis  GTATCGCTTCCGCTCATACTTGTCGGTCAGCAGCTCTCG------CTGGTCCTGCTGCTGCTGT---TGT
        D. willistoni  GTAACGCTTTCGTTCATATTTATCGATGATTAGCTCCCG------CTGATCCTGCTGC------------
           D. virilis  GTAGCGCTTTCTTTCGTACTTATCGATCATCAGCTCGCG------CTGATCCTGCTGC------------
        D. mojavensis  ATAGCGTTTCCTCTCGTACTTATCGATCATCAGCTCCCG------CTGATCTTGCTGC------------
         D. grimshawi  GTAACGCTTGCGTTCGTACTTATCAATCATCAATTCCCG------CTGATCCTGTTGC------------
B D        A. gambiae  GTACCTTTTCCTTTCGTACTTGTCTATCATAAAGTCTCG------ATGTTCCTGC---------------
         A. mellifera  ATATCTTTTAAGTTCATATTTTGCACTCATTAAATCTTT------CATTTTTTGTTCATCTTTTGTATCT
         T. castaneum  ATACCTCTTCCTTTCGTATTTATCGACCATGAAGTCCTTGACGGCCTGTTCGTCC---------------

      D. melanogaster  TGGTGCACAGCCCGC------TTCGGATCCCACAATCCCAGCCAGGTCTTGGCACACAGCTCGTTGCCAT
          D. simulans  TGGTGCACAGCCCGT------TTCGGATCCCACAATCCCAGCCAGGTCTTGGCACACAACTCGTTGCCAT
         D. sechellia  TGGTGCACAGCCCGC------TTCGGATCCCACAATCCCAGCCAGGTCTTGGCACACAACTCGTTGCCAT
            D. yakuba  TGGTGCACAGCCCGC------TTCGGATCCCACAATCCCAGCCAGGTCTTGGCGCACAGCTCGTTGCCAT
            D. erecta  TGGTGCACAGCCCGC------TTCGGATCCCACAATCCCAGCCAGGTCTTGGCGCACAGCTCGTTGCCAT
         D. ananassae  TGGTGGACGGCCCGC------TTGGGATCCCACAGGCCCAGCCAGGTCTTGGCGCACAGCTCGTTGCCGT
     D. pseudoobscura  TGGTGGGCGGCCCGC------TTGGGGTCCCACAGGCCCAGCCAGGTCTTGCCGCAGAGCTCGTTCCCGT
        D. persimilis  TGGTGGGCGGCCCGC------TTGGGGTCCCACAGGCCCAGCCAGGTCTTGCCGCAGAGCTCGTTCCCGT
        D. willistoni  TGTTGAGAGGCACGC------TTGGGATCCCATAGACCCAGCCAGGTTTTCGAGCACAGCTCATTGCCAT
           D. virilis  TGGGCGGCTGCACGC------TTCGGATCCCACAGGCCCAGCCAGGTCTTCGCGCACAGCTCGTTCCCAT
        D. mojavensis  ---GCAGCAGCTCGC------TTTGGATCCCACAGGCCCAGCCAGGTCTTTGCACACAGCTCGTTGCCGT
         D. grimshawi  TGGGCGGCGGCACGT------TTGGGATCCCACAAGCCCAGCCACGTCTTGGCGCATAGCTCATTACCAT
           A. gambiae  ---TTAATTGCACGT------TTTGGATCCCAAAGGCCCAACCAAGTTCTGCTGCAGTTGTCGTTGCCAT
         A. mellifera  AAATTTTGAGATGAA------TTTTGATTCATCAAGCCTAACCATATTCTTCTGCAATATTCATTACCAC
         T. castaneum  CTGTACTCGGCCCCCGGTAAAGTGCCATCGTACAAGCCCAGCCACACACTCTTGCAGTAGTCGTTGCCGC

      D. melanogaster  GGCTGCGCAGGAAGTCGATCTCGTCCTGTGTGAATGTGGCCATCGATATGGATTTCACTCGATGTGGCGG
          D. simulans  GGCTGCGCAGGAAGTCGATCTCGTCCTGTGTGAATGTGGCCATCGATATGGATTTCACCCGATGTGGCGG
         D. sechellia  GGCTGCGCAGGAAGTCGATCTCGTCCTGTGTGAATGTGGCCATCGATATGGATTTCACCCGATGTGGCGG
            D. yakuba  GGCTGCGCAGGAAGTCGATTTCGTCCTGTGTGAATGTGGCCATCGATATGGATTTCACCCGATGAGGCGG
            D. erecta  GGCTGCGCAGGAAGTCGATCTCGTCCTGTGTGAATGTGGCCATCGATATGGATTTCACCCGATGAGGCGG
         D. ananassae  GTGTCCGCAGGAAGTCGATCTCGTCCTGGGTGAATGTGGCCATGGAGATGGACTTCACACGATGTGGTGG
     D. pseudoobscura  GCGCCCGCAGGAAGTCGATCTCCTCTTGTGTGAAGGTGGCCATCGATATGGATTTCACCCGATGTGGCGG
        D. persimilis  GCGCCCGCAGGAAGTCGATCTCCTCCTGTGTGAAGGTGGCCATCGATATGGATTTCACCCGATGTGGCGG
        D. willistoni  GCGATTTGAGGAAATCGATCTCATCCTGGGTAAAAGTGGCCATTGAAATCGATTTCACACGATGTGGGGG
           D. virilis  GCGCCTTCAGAAAGTCCAGCTCCTCCTGTGTGAATGTGGCCATCGATATGGATTTCACTCGATGTGGAGG
        D. mojavensis  GCGCCTTTAGGAAGTCGATCTCCTCCTGTGTAAATGTGGCCATCGATATGGACTTAACTCGATGCGGAGG
         D. grimshawi  GCGCCTTGAGAAAGTCGAGCTCGTCCTGTGTGAATGTCGCCATCGATATGGATTTCACGCGATGCGGCGG
           A. gambiae  TTTGTTTGAGAAATTCAATCTCCTCCTGGGTGAAAGTGGCCATGGAAATCGATTTTACGCGATGTGGCGG
         A. mellifera  GTTCCTTTATAAAATCTATTTCCTCTTGTGTAAATGTTGCCATAGAAATAGACTTTACTCTATGTGGTGG
         T. castaneum  GATTTTTCAACAGTTCGATCTCTTCCGACGTGAATGTGGCCATCGAGATCGATTTGACGCGATGTGGCGG

      D. melanogaster  CGTCAGACCGCGCctg---------gaa--------------aa
          D. simulans  CGTCAGACCGCGTctg---------gaa--------------aa
         D. sechellia  CGTCAGACCGCGTctg---------gaa--------------aa
            D. yakuba  TGTCAGGCCGCGTctg---------gaa--------------aa
            D. erecta  TGTCAGACCGCGTctg---------gaa--------------aa
         D. ananassae  CGTCAAGCCGCGTctg---------caa----------------
     D. pseudoobscura  CGTCAGTCCGCGTctt---------caa--------------ag
        D. persimilis  CGTCAGTCCGCGTctt---------caa--------------ag
        D. willistoni  AGTCAGTCCGCGTctg---------gaat----------gataa
           D. virilis  CGTCAGGCCGCGTctg---------caa--------------aa
        D. mojavensis  CGTCAGACCGCGTcta---------cga--------------aa
         D. grimshawi  CGTCAATCCTCGTcta---------caa--------------aa
           A. gambiae  AGTGAGTCCTCTTctgcatgtttatgaa--------------aa
         A. mellifera  TGTTAAACCTCGTctg---------taattttaaataaaattat
         T. castaneum  CGTCAAACCGCGTctg---------taa--------------aa

Inserts between block 101 and 102 in window
        T. castaneum 5005bp

Alignment block 102 of 217 in window, 837387 - 837423, 37 bps 
B D   D. melanogaster  gag-----gcaaacaga--aaga-----------------------------------------------
B D       D. simulans  gat-----gcaaacaga--aagt-----------------------------------------------
B D      D. sechellia  gat-----gcaaacaga--aagt-----------------------------------------------
B D         D. yakuba  gat-----gcaaatgga--taat-----------------------------------------------
            D. erecta  gat-----gcaaatgga--aaatattgtaataaaacatgcgtatgttcaaaacgaacttctgtaattaat
         D. ananassae  ---------cgagagga--tgtt-----------------------------------------------
     D. pseudoobscura  gga-----cagagaaag--agag-----------------------------------------------
B D     D. persimilis  gga-----cagagaaag--agag-----------------------------------------------
        D. willistoni  taa-----taaaacgaattagtt-----------------------------------------------
           D. virilis  aaa-----ttaaaagaa--ag-------------------------------------------------
        D. mojavensis  aaa-------agaagac--ggat-----------------------------------------------
         D. grimshawi  gaagagcgggaagggaa--agtc-----------------------------------------------
B D        A. gambiae  gaa-----ataagaata--acat-----------------------------------------------
         A. mellifera  taa-----ataaataaa--atat-----------------------------------------------
        T. castaneum  ======================================================================

      D. melanogaster  -------------------------------------------------tatt---------gtaatgaa
          D. simulans  -------------------------------------------------tatt---------gtaatgaa
         D. sechellia  -------------------------------------------------tatt---------gcaatgaa
            D. yakuba  -------------------------------------------------tatt---------ataatgaa
            D. erecta  attgcaacatccacaaccatcctccctaattatccaaagcatattgtaatatt---------gtaataaa
         D. ananassae  -------------------------------------------------tgtt-----------------
     D. pseudoobscura  -------------------------------------------------catt-----------aggcaa
        D. persimilis  -------------------------------------------------catt-----------aggcaa
        D. willistoni  -------------------------------------------------tgttttt---cacatgagaaa
           D. virilis  ----------------------------------------------------------------------
        D. mojavensis  -------------------------------------------------gg--------aaattaataaa
         D. grimshawi  -------------------------------------------------aatttataatcaattaaccaa
           A. gambiae  -------------------------------------------------gt-------------------
         A. mellifera  -------------------------------------------------agta-----------aataaa
         T. castaneum  ======================================================================

      D. melanogaster  aacccattt
          D. simulans  aatccattt
         D. sechellia  aatccactt
            D. yakuba  a---cac--
            D. erecta  a---cat--
         D. ananassae  ----tatt-
     D. pseudoobscura  agcacaa--
        D. persimilis  agcacaa--
        D. willistoni  agtgcac--
           D. virilis  ---------
        D. mojavensis  gt-------
         D. grimshawi  ttt------
           A. gambiae  ---------
         A. mellifera  a--------
         T. castaneum  =========

Inserts between block 102 and 103 in window
          D. virilis 340bp
        D. grimshawi 489bp
        A. mellifera 695bp

Alignment block 103 of 217 in window, 837424 - 837499, 76 bps 
B D   D. melanogaster  tctattaaggaaaaaccattcaa------tgtgcgtatgttca------tcttctctagttaata-----
B D       D. simulans  tctattaaggaaaaaccattcaa------tgtgcgtatgttcaacaataacttctccacttaata-----
B D      D. sechellia  tctattaaggaaaaaccatttaa------tgtgcgtgtgttcaacaatcacttctcaact---ta-----
B D         D. yakuba  -----------------------------------------------gaacttcactaattaatattgca
            D. erecta  --------------------------------gcgtatgttcaaaaagaacttctgtaattgatattgca
         D. ananassae  -------------------------------------------------attttttcac--agtg-----
     D. pseudoobscura  ---attaag----------------------------------------tttcgtgtaattatta-----
B D     D. persimilis  ---attaag----------------------------------------tttcgtgta---atta-----
        D. willistoni  ----ttcaggcccgactctcaag------tgtttttgtc----------attaaactattaaaca----c
          D. virilis  ======================================================================
        D. mojavensis  tatatttatacaaatttaatgaaatgcattttttttatatttttgaattatttat---------------
        D. grimshawi  ======================================================================
B D        A. gambiae  gctgttagcaaaattgtcacacg------taaatacatcgtcattgcatatctatttaatcat----aat
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  --atcaacaaccatcggctctagtt
          D. simulans  --atcaacaaccatcatctctaatt
         D. sechellia  --atcaaaaaccatca--------t
            D. yakuba  acatccacaaccatcctccctaatt
            D. erecta  acatgcacaaccatcctccctaatt
         D. ananassae  ------------------------c
     D. pseudoobscura  -------------------------
        D. persimilis  -------------------------
        D. willistoni  aaacttataaacaacttatcga--t
           D. virilis  =========================
        D. mojavensis  -------------------------
         D. grimshawi  =========================
           A. gambiae  agattatcaattattagtt------
         A. mellifera  =========================
         T. castaneum  =========================

Inserts between block 103 and 104 in window
       D. mojavensis 833bp
B D       A. gambiae 11864bp

Alignment block 104 of 217 in window, 837500 - 837569, 70 bps 
B D   D. melanogaster  ctccaaagtagttctctattctatttcggaaattg-ctcaagattagccc--aattt-------------
B D       D. simulans  ctccaaagtagttctctattctatttcggaaattg-ctcaagattagccc--aattt-------------
B D      D. sechellia  ctccaaagtggttctctattctatttcggaaattg-ttcaagattagccc--aattt-------------
B D         D. yakuba  ctcccaagtagttctctattctatttcggaaattg-cccaagattaatcc--aactt-------------
            D. erecta  atccaaagcaattctctattctatttcggaaattg-ctcaagctcagccc--aattt-------------
         D. ananassae  ctccaaagtaatttat--ttctattatggaaattg-ctcaagatttcccccaaaact-------------
     D. pseudoobscura  ------------ttattattcttttatggagattgcctcaagatttccgc--tgctt-ggagcgggagtt
B D     D. persimilis  ------------ttattattcttttatggagattgcctcaagatttccgc--tgcttgggagcgggagtg
        D. willistoni  tgacagacgattttacgtttctaatttgaaatctattttcatattg------aattt-------------
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  gtcgcccatt-tgcagt
          D. simulans  gtcgcccgtt-tgcagt
         D. sechellia  gtcgcccgtt-tgcagt
            D. yakuba  gtcgcccatt-tgcggt
            D. erecta  gtcgcccatt-cgcggt
         D. ananassae  gtcccccattccgcacc
     D. pseudoobscura  ggagccaaag-agggtg
        D. persimilis  ggggccaaag-agggtg
        D. willistoni  ----cctgtt-------
           D. virilis  =================
        D. mojavensis  =================
         D. grimshawi  =================
           A. gambiae  =================
         A. mellifera  =================
         T. castaneum  =================

Alignment block 105 of 217 in window, 837570 - 837614, 45 bps 
B D   D. melanogaster  caggtggcgaaga-----tggtggtggttgcttgacc--cacttgtac------cca--------c
B D       D. simulans  caggtggcgaaga-----tggtggtgtttgcttgacc--cacttgtac------cca--------c
B D      D. sechellia  caggtggcgaaga-----tggtggtggttgcttgacc--catttgtac------cca--------c
B D         D. yakuba  caggtggcgaaga-----tggtggtggttgcttgacc--cacttgtac------cca--------c
            D. erecta  caggtggcgaaga-----tgttggtggttgcctgacc--cacttgtag------cca--------c
         D. ananassae  aaagcagagtca-------ggtggtggttctttgacc--cacttgggc-----------------c
     D. pseudoobscura  cgagagacggagaccaggtgacggcgggtcagtgggt--cactgatgtggggtgccagaatg---c
B D     D. persimilis  cgagagacggagaccaggtggcggcgggtcagtgggt--cactgatgtggggtgccagaatg---c
        D. willistoni  -----------ga-----tgatg-----------------------ac------ccagaaaacgtt
           D. virilis  caagtgccaagca-----taattcgggttttatggccgacacttgagc------aaa--------c
       D. mojavensis  ==================================================================
        D. grimshawi  ==================================================================
B D        A. gambiae  ==================================================================
        A. mellifera  ==================================================================
        T. castaneum  ==================================================================

Inserts between block 105 and 106 in window
          D. virilis 4bp

Alignment block 106 of 217 in window, 837615 - 837774, 160 bps 
B D   D. melanogaster  cagaatgac---------ccgtcaaataggcgttcaatttcagttaattgcgcaaattaatt-gcgctgg
B D       D. simulans  cagaatgac---------ccgtcaaataggcgtttaatttcagttaattgcgcaaattaatt-gcgctgg
B D      D. sechellia  cagaatgac---------ccgtcaaataggcgttcaatttcagttaattgcgcaaattaatt-gcgctgg
B D         D. yakuba  cagaatgac---------ccgtcaaataggcgttcaatttcagttaattgcgcaaattaatt-gcgctgg
            D. erecta  cagaatgac---------ccgtcaaataggcgttcaatttcagttaattgcgcaaattaatt-gcgctgg
         D. ananassae  cggaatggc---------ccggcaaatggccgttcaattttggttaattgcgcaaatgaatt-gcgccgg
     D. pseudoobscura  cagaacgacccgccgctgccgccaaacgggcgttcaatttcagttaattgcgcaaattaattcgccctgg
B D     D. persimilis  cagaacgacccgccgctgccgccaaacgggcgttcaatttcagttaattgcgcaaattaattcgccctgg
        D. willistoni  tacaacgac---------ccatgtaatgggcattcaatttcagttaattgcgcaaattcatt-tacttgg
           D. virilis  cagaatgac---------ccgctaaatggatattcaatttcagataattgcacaaattaatt-ggctcgg
        D. mojavensis  cagaatgac---------ccgttaaatgggtattcaatttcagataattgcacaaattaatt-ggcccgg
         D. grimshawi  --gaatgac---------ccgctaaatgggtgctcaatttcagttaattgcacaaattaatt-ataccgg
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  ccttg---ggg-ca----------------------------------------gaaagcaattggagca
          D. simulans  ccttg---ggg-ca----------------------------------------gaaagcaattggagca
         D. sechellia  ccttg---ggg-ca----------------------------------------gaaagcaattggagca
            D. yakuba  ccttg---ggg-cc----------------ttgggg----------------cagaaagcaattggagca
            D. erecta  ccttg---ggg-ct----------------------------------------gaaagcaattggagca
         D. ananassae  ccttg---ggg-cc--------------------ag----------------aacgaagcgattggagca
     D. pseudoobscura  ccttg---ggt-ctggggtggggcctggggctggggctgtggctgagct--tcaggcagcaattggagca
        D. persimilis  ccttg---ggt-ctggggtggggcctggggctggggctggggctgggct--tcaggcagcaattggagca
        D. willistoni  ccttgagcggg-ca-------------------gcactgggctagtgctcgttggctagcaattagagca
           D. virilis  ccttg---ggg-ta--------------------------------------agcgctgcaattggagca
        D. mojavensis  ccttg---ggg-tg--------------------------------------agcactgcaattagagca
         D. grimshawi  ccttg---gggttg--------------------------------------agtgttgcaattagagca
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ct--------------------ttggagtgcccagaac----gccatgaaaaatgaaac----------c
          D. simulans  ct--------------------ttggagtgcccagaac----gccatgaaaaatgaaac----------c
         D. sechellia  ct--------------------ttggagtgcccagaac----gccatgaaaaatgaaac----------c
            D. yakuba  ct--------------------ttggagtgcccagaac----ggcatgaaaaatgaaac----------c
            D. erecta  ct--------------------ttggagtgcccagaac----ggcatgaaaaatgaaac----------c
         D. ananassae  c---------------------ttggagtggccagaac----ggcacggaaaatgaaac----------c
     D. pseudoobscura  ct--------------------t-------------------ggcatgaaaactgaaac----------c
        D. persimilis  ct--------------------t-------------------ggcatgaaaactgaaac----------c
        D. willistoni  ct--------------------t-gaagt-----gaaa----agtatggaaaatgaaac----------c
           D. virilis  ac--------------------tggccaaagc----------ggaggcgaatttatgac----------c
        D. mojavensis  ag--------------------tggcagagct----------aaaggcgaaactgatgc----------c
         D. grimshawi  acagtggcaggggacgacagctcggcagaagccaaagaagaaggaggcgaataagtggtggcagtaatgc
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  cataaa----caaacc-------------------------------------------------gaag-
          D. simulans  cataaa----caaacc-------------------------------------------------gaag-
         D. sechellia  cataaa----caaacc-------------------------------------------------gaag-
            D. yakuba  cataaa----caaacc-------------------------------------------------gaag-
            D. erecta  cataaa----caaacc-------------------------------------------------gaag-
         D. ananassae  cataaa---gtaaacc-------------------------------------------------gaggg
     D. pseudoobscura  cataaa----caaact-cacaag-----------agcgccagtggcaggggctggggcaggggcaggag-
        D. persimilis  cataaa----caaact-cacaag-----------agt------------ggcatggacaggggcaggag-
        D. willistoni  cataaaagcacaaaca--acaac-----------aacaacacac---------------------aaat-
           D. virilis  agaaga----agaagaagacgac-----------gac--gtcgaaacggcaaaaca-tgaaaactgaaa-
        D. mojavensis  agaggg----aagggg-------------------------------------------------gggg-
         D. grimshawi  aaagaa----gaaacagcacaacatgaaaaatgaaaccagccataaatgaaactcactcaaagcgaaaa-
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  --------aggcgccc-----------tggc----cgg-------tggagag
          D. simulans  --------aggcgccc-----------tggc----tgg-------tggagag
         D. sechellia  --------aggcgccc-----------tggc----tgg-------tggagag
            D. yakuba  --------agccgcac-----------tggc----tgg-------tggagag
            D. erecta  --------aggcgcct-----------tggc----tgg-------tggagag
         D. ananassae  gcgttgatgggcgcccggaggggcgagtggcggagtgg-------cggagag
     D. pseudoobscura  --------gggggcta-----------gggc----aggggctcaatagagag
        D. persimilis  --------gggggtta-----------gggc----aggggctcaatagagag
        D. willistoni  --------aaaaacga-----------cagc----ca--------tggagag
           D. virilis  ---------------c-----------cggc----cac-------aaaatga
        D. mojavensis  ---------------c-----------aggg----cag-------ggcaggg
         D. grimshawi  ---------------c-----------cggc-aaacag-------cacag--
           A. gambiae  ====================================================
         A. mellifera  ====================================================
         T. castaneum  ====================================================

Inserts between block 106 and 107 in window
        D. ananassae 8bp
          D. virilis 22bp
       D. mojavensis 132bp

Alignment block 107 of 217 in window, 837775 - 837856, 82 bps 
B D   D. melanogaster  t---------------tttccag----caaatttcgcccc-gc-aacg---atggctaatttcggttttt
B D       D. simulans  t---------------tttccag----caaatttcgcccc-ac-aacg---atggctaatttcggttttt
B D      D. sechellia  t---------------tttccag----caaatttcgcccc-ac-aacg---atggctaatttcggttttt
B D         D. yakuba  t---------------tttccag----caaatttcgcccc-ac-aacg---atggctaatttcggttttt
            D. erecta  t---------------tttccag----caaatttcgcccc--t-aacg---atggctaatttcggttttt
         D. ananassae  t---------------tttccag----caaa-ttcgccaa-gc-aacg---acggctaatttcggttttt
     D. pseudoobscura  t---------------tttccag----caaa-tttgcctc-gc-accg---aaagctaatttcggttttt
B D     D. persimilis  t---------------tttccag----caaa-tttgcctc-gc-accg---aaagctaatttcggttttt
        D. willistoni  tttatttttgtttttctttctag----caaa-tttgcctc-gc-cacactcaaagctaatttgtgttttt
           D. virilis  --------------------cag--caaaaa-tttgcctc-gctaacgcttaaagctaatttcagttttt
        D. mojavensis  --------------------------------tttgcctcagcaaacgcttaaagctaatttcagttttt
         D. grimshawi  ------------------cacagcacacaaa-tttgcctc-acagccgcttaaagctaatttcagttttt
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  cacgaa-tttcccgaacgaa----------acgagtacacacgggtg
          D. simulans  cacgaa-tttcccgaacgaa----------acgagtacacacgggtg
         D. sechellia  cacgaa-tttcccgaacgaa----------acgagtacacacgggtg
            D. yakuba  cacgaa-tttcccgaacgaa----------acgagtacacacgggtg
            D. erecta  cacgaa-tttcccgaacgaa----------acgagtacacacgggtg
         D. ananassae  cacgaa-tttcccgaacgaa----------acgagcacacgaacgag
     D. pseudoobscura  cacgaa-tttcccaaacgaa----------acgagcacac----gaa
        D. persimilis  cacgaa-tttcccaaacgaa----------acgagcacac----gaa
        D. willistoni  cacgaa-tttccc-aacgaaaaatgggaacacacacacacacacatg
           D. virilis  cacgaattttcccaaacgaa----------atgggcac---------
        D. mojavensis  cacgaattttcccaaacgaa----------atgggcac---------
         D. grimshawi  cacgaattttcccaaacgaa----------atgggcaca--------
           A. gambiae  ===============================================
         A. mellifera  ===============================================
         T. castaneum  ===============================================

Alignment block 108 of 217 in window, 837857 - 837947, 91 bps 
B D   D. melanogaster  gcagcaacaacttggcca--caacatggcaacagcaa---cagcaacggcaac--ggcaacagt--aaca
B D       D. simulans  gcagcaacaacttggcca--caacatggcaaca---------gcaacggcaac--ggcaacggc--aaca
B D      D. sechellia  gcagcaacaacttggcca--caacatggcaaca---------------gcaac--ggcaacggc--aaca
B D         D. yakuba  gcagcaacaacttggcca--caacatggcaacagcaa---tggcaacagcaac--agcaacagc--aaca
            D. erecta  gcagcaacaacttggcca--caacatggcaacggcaa---cggcaacagcaac--agcaacagc--aaca
         D. ananassae  ccatcagaaaaccagtaaagccccatgg-aacggccagcccagagactccaacatggcaacagccaaaca
     D. pseudoobscura  acaagaccaa----------caaca--gcaacaagaa---gagcaacaaccac--ttggacgga--caac
B D     D. persimilis  acaagaccaac--aacag--caaca--gcaacaagaa---gagcaacaaccac--ttgaacgga--caac
        D. willistoni  cagctaagagc--agtgg--caacatggcaacaacat-----tcagccacaac--atttaca----taca
           D. virilis  ----------------ag--caac----------------aaaaaacaaacac--acacagaag--ctca
        D. mojavensis  ----------------ag--ca------------------caaacacaaacat--acacacaca--caca
         D. grimshawi  -------------aatag--caa-----------------cagcaacagcaac--agcaataac--aata
B D        A. gambiae  gcttcaacgttttattcg--cgaaa---caaaattag---tagtagatgtagt--aacaacaaa--cata
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  gtaacaac--------aacagcaaccgcagaaaaacag
          D. simulans  gtaacaac--------aacagcaaccgcagaaaaacag
         D. sechellia  gtaacaac--------aacagcaaccgcagaaaaacag
            D. yakuba  acaacaac--------agca------gcagaaaaacag
            D. erecta  gcaacaac--------aacagcaaccgcagaaaaacag
         D. ananassae  acaacaac--------aaca------------------
     D. pseudoobscura  acaacaac--------a-tggcaacaggggaaaaacgg
        D. persimilis  acaacaa-------------------------------
        D. willistoni  aaaaca--------------------------------
           D. virilis  tatatg--------------------------------
        D. mojavensis  catacagc------------------------------
         D. grimshawi  tatgtatctgagtatg----------------------
           A. gambiae  aatgtatt--------aaatgaaatttccaaaacaa--
         A. mellifera  ======================================
         T. castaneum  ======================================

Inserts between block 108 and 109 in window
    D. pseudoobscura 690bp
B D    D. persimilis 2bp

Alignment block 109 of 217 in window, 837948 - 838003, 56 bps 
B D   D. melanogaster  caccaaaagtggcaaaa--gtggt--agaagagggccaaatatgcattgc---tgggggaaac
B D       D. simulans  caccaaaagtggcaaaa--gtggc--agaagagggccaaatatgcattgc---agggggaagc
B D      D. sechellia  caccaaaagtggcaaaa--gtggc--agaagagggccaaatatgcattgc---agggggaagc
B D         D. yakuba  caccaaaagtggcaaaa--gtggc--agaagagggccaaatatgcattgc---agggggaagc
            D. erecta  caccaaaagtggcaaaa--gtggc--agaagagggccaaatatgcactgc---agggggaagc
         D. ananassae  -----------------------------------------------------------agcc
    D. pseudoobscura  ===============================================================
B D     D. persimilis  tggcaacaggggaaaaa--cgggctaacaggaaaatccactatttggtgctcgaaggcgaagc
        D. willistoni  cact-------gcaaaa--gcaac--tacctacctacctattcacataga---tgtgtgtaaa
           D. virilis  ----------catatgt--acata--tatatatatacatatatattatga-------------
        D. mojavensis  ------cagtcatatattgctgtt--tgcatatgtgtgcatatgttatga-------------
         D. grimshawi  ------caagcatgtat--gtata--tgcatatgtatatata----atga-------------
B D        A. gambiae  catcaaaagtcgtgaaa--atgta--ttgtgtggggtaaaatggtatcgctatgggggaaaat
        A. mellifera  ===============================================================
        T. castaneum  ===============================================================

Inserts between block 109 and 110 in window
B D    D. persimilis 659bp
       D. willistoni 2bp
B D       A. gambiae 3647bp

Alignment block 110 of 217 in window, 838004 - 838053, 50 bps 
B D   D. melanogaster  agaaactggacgtttcacatgaacgcttcgctggctc-------cagttggt-----tgta---------
B D       D. simulans  agaaactggacgtttcacatgaacgcttcgctggctc-------cacttggt-----tgta---------
B D      D. sechellia  agaaactggacgtttcacatgaacgcttcgctggctc-------cacttggt-----tgta---------
B D         D. yakuba  agaaactggacgtttcacatgaacgcttcgctggctc-------cagttggt-----tgtaggttgttgg
            D. erecta  agaaactggacgtttcacatgaacgcttcgctggctc-------cagttggt-----tgta---------
         D. ananassae  acaaactggacgtctcacatgaacgctccactggctt-------cagttggc-----tgctagttggtag
     D. pseudoobscura  aaaaactggacgtttcacatgaacgcttcgctg-------------------------------------
B D     D. persimilis  aaaaactggacgtttcacatgaacgcttcgctg-------------------------------------
        D. willistoni  agaaactggacgtttcacatgaacgcttcgctggctt-------catctagtcagtgtata---------
           D. virilis  agaaactggacgtttcacatgaacgcttcagtggctcacagagccaattcgt-----tatg---------
        D. mojavensis  agaaactggacgtttcacatgaacgcttcagtggctc---------------------------------
         D. grimshawi  agaaactggacgtttcacatgaacgcttcagtggctcaccgagccaattcgt-----tatg---------
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  -----g
          D. simulans  -----g
         D. sechellia  -----g
            D. yakuba  atgttg
            D. erecta  -----g
         D. ananassae  atggta
     D. pseudoobscura  -----c
        D. persimilis  -----c
        D. willistoni  -----t
           D. virilis  -----g
        D. mojavensis  ------
         D. grimshawi  -----g
           A. gambiae  ======
         A. mellifera  ======
         T. castaneum  ======

Inserts between block 110 and 111 in window
          D. virilis 2463bp
       D. mojavensis 1003bp
        D. grimshawi 13bp

Alignment block 111 of 217 in window, 838054 - 838152, 99 bps 
B D   D. melanogaster  gttgttggtagctggttaactggt-------------------------tgccgcatggaaacaga-tag
B D       D. simulans  gttgttggtagctggttaactggt-------------------------tgccgcatggaaacaga-tag
B D      D. sechellia  gttgttggtagctggttaactggt-------------------------tgccgcatagaaacaga-tag
B D         D. yakuba  gttgttggtagctggttaactggt-------------------------tgccgcgtggaaaaaga-tag
            D. erecta  gttgttggtagctggttaactggt-------------------------tgccgcatggaacatga-tag
         D. ananassae  gttgctagttgtcggttaacaact-------------------------agccgggccaaaacgggccag
     D. pseudoobscura  gtttc----agttggttaactggt-------------------------tgcagaggggatggcga-tgg
B D     D. persimilis  gtttc----agttggttaactggt-------------------------tgcagaggggatggcga-tgg
        D. willistoni  gatgactggtgtggatgggctggg-------------------------aggagcatggagagggg-atg
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
         D. grimshawi  ----acggtaggtggacagagagtgggccacagagagagagagagagtgggccacagagaaggaga-aag
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  ------aacaagagg-------tatgggtctaacgactagaagataccctgcagcttaatagtaccaa
          D. simulans  ------aacaagagg-------tatggctctaac--------gataccctgcagcttaatagtaccaa
         D. sechellia  ------aacaagagg-------tatggctctaacgactagaagataccctgcagcttaatagtatcaa
            D. yakuba  ------aacaagagt-------tacgagtctaacgaccagatgataccctgcagcttaggagtaccaa
            D. erecta  ------aacaggagg-------tatgggtataacgatcagaaggtaccctgtagctcaggagtaccaa
         D. ananassae  ------aacagtctggccattacatggatgtaacaaatagggagcatc--------------------
     D. pseudoobscura  ggggacagcaggagg---aaacgatggatgt----tctagaag-----cagctactggttaatgccaa
        D. persimilis  ggggacagcaggagg-----------------------------------------------------
        D. willistoni  ------ggcaggcgc-------tactgat---------------------------------------
           D. virilis  ====================================================================
        D. mojavensis  ====================================================================
         D. grimshawi  ------agaaagaga-------gaggggagcagcgaaaag----------------------------
           A. gambiae  ====================================================================
         A. mellifera  ====================================================================
         T. castaneum  ====================================================================

Inserts between block 111 and 112 in window
        D. ananassae 56bp
    D. pseudoobscura 17bp
       D. willistoni 2907bp
        D. grimshawi 2764bp

Alignment block 112 of 217 in window, 838153 - 838287, 135 bps 
B D   D. melanogaster  ctcaacacgaggcaatgcaaaacttttaatccttttgtcctcaagaacttttgtttttcgtctgctgaaa
B D       D. simulans  atcgaaactggccaatagaaagctttcaatgcttttgtcctcaagagtttacggtttccatctcctg--a
B D      D. sechellia  ctcgaaacgagtcaatagaaagctttcaatccttttttcctcaagagtttacggtttccatctcctg--a
B D         D. yakuba  atccaatcaaaccaaaagaatgcttgcaa-------------gattaaccg---tttacatttgctg--a
            D. erecta  atgcacacgaaccaagagaatgcttgtaatgcgctagtactcaatatatcgcgtttttcatttgctg--a
        D. ananassae  ======================================================================
    D. pseudoobscura  ======================================================================
B D     D. persimilis  ----------------------------------------------------------------------
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  atcctgatgaatgaatg-------------caac-ccatattccccttctcgtactgggtatcaaaaccg
          D. simulans  atcctgctaaatgattg-------------caac-ccatataccccttctcgtactgggtatcaaaaccg
         D. sechellia  atcctgctaaatgattg-------------caac-ccatataccccttctcttacggggtatcaaaaccg
            D. yakuba  at-tggttaatttattgattgaaattagtataac-ccatatactccatctcgcacggggtatcaacaccg
            D. erecta  at-ttgttaattggttggcttaagtccataacacaacatataccccatttcgcacggggtatcaaaaccg
         D. ananassae  ======================================================================
     D. pseudoobscura  ======================================================================
        D. persimilis  ----------------------------------------------------------------------
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  gcaagctga
          D. simulans  gcaagctga
         D. sechellia  gcaagctga
            D. yakuba  gcaagctga
            D. erecta  gcaagctga
         D. ananassae  =========
     D. pseudoobscura  =========
        D. persimilis  ---------
        D. willistoni  =========
           D. virilis  =========
        D. mojavensis  =========
         D. grimshawi  =========
           A. gambiae  =========
         A. mellifera  =========
         T. castaneum  =========

Alignment block 113 of 217 in window, 838288 - 838367, 80 bps 
B D   D. melanogaster  tgtggaacatgcagtgaaaattctagaagctgctgattgctggctaatgccatt----------------
B D       D. simulans  tgtggaacatgcagcgaaaattctagaagctgctgattgctggctaatgccatt----------------
B D      D. sechellia  tgtggaacatgcagcgaaaattctagaagctgctgattgctggctaatgccatt----------------
B D         D. yakuba  tgtggaacatgcagcgaaaattctagaagctgctgattgctggctaatggcatt----------------
            D. erecta  tgtggaacatgcagcgaaaattctagaagctgctgattgctggctaatggcatt----------------
        D. ananassae  ======================================================================
     D. pseudoobscura  tgtggcac------------cgcctgtggcacc---------gccagggccctt----------------
B D     D. persimilis  --------aaacgatggatgttctagaagcagc----tactggttaatgccaatcatcagatacaccgcc
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  ----------------------acagccatctgagccaag---ggaatgac
          D. simulans  ----------------------acagccatctgagccaag---ggaatgac
         D. sechellia  ----------------------acagccatctgagccaag---ggaatgac
            D. yakuba  ----------------------acagccatctcagccaag---ggaacgac
            D. erecta  ----------------------acagccatctgagccaag---ggaatgac
         D. ananassae  ===================================================
     D. pseudoobscura  ---------gctgagtgct---gcagcagcagcagtgcagcacgagatgac
        D. persimilis  agggcccttgccgagtgctgcagcagcagcagcagtgcagcacgagatgac
        D. willistoni  ===================================================
           D. virilis  ===================================================
        D. mojavensis  ===================================================
         D. grimshawi  ===================================================
           A. gambiae  ===================================================
         A. mellifera  ===================================================
         T. castaneum  ===================================================

Alignment block 114 of 217 in window, 838368 - 838671, 304 bps 
B D   D. melanogaster  gtcctttgcca---ttgcatcccgtccattcccatgcttcttatgcaattgtgactcaatttgaggacgg
B D       D. simulans  gtcctttgtca---ttgtatcccgtccattcccatgcttcttatgcaattgtgactcaatttgaggacgg
B D      D. sechellia  gtcctttgtca---ttgtatcccgtccattcccatgcttcttatgcaattgtgactcaatttgaggacgg
B D         D. yakuba  gtcctttgtca---tttcatctcgtccattcccatgcttcttatgcaattgtgactcaatttgaggacgg
            D. erecta  gtcctttgtca---ttttatctcgtccattcccatgcttcttatgcaattgtaactcaatttgaggacgg
         D. ananassae  gtcctttgtca---tcacagcgccttcattcc--------------------ggctcatcctaatgctgg
     D. pseudoobscura  gtcctttgtcatccttttagctcgagta--------------atgcaattgagaaacaatttg-------
B D     D. persimilis  gtcctttgtcatccttttagctcgagta--------------atgcaattgagaaacaatttg-------
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  aaaatgg-aagtccctgctagagatagaaat---------agaaggaggag-gaggaggaaagcg-----
          D. simulans  aaaatgg-aa-tccctgctagagatagaaat---aggaggaggaggaggag-gaggaggaaagcg-----
         D. sechellia  aaaatgg-aa-ttcctgctagagatagaaataaaaggaggaggaggaggag-gaggaggaaagcg-----
            D. yakuba  aaagtggaag-accctggcagagatagaaac-------agcggcg-------gaggaggaaagcg-----
            D. erecta  aaaatgg-ag-tccctgttagagacagaaat-------agcgacggaggggcgaggaggaaagcg-----
         D. ananassae  aaaattg-at-tc-----taaagacaaagaa---------aagcgga-----gaaaagtgatgcgccagt
     D. pseudoobscura  ----tga-ca------------------------------------------gaggaca-----g-----
        D. persimilis  ----tga-ca------------------------------------------gaggaca-----g-----
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ---gatgtctttgagtgc--tcaccagaaaacaatcaactctcacttaagtagggctcgcagccgagcgg
          D. simulans  ---gatgtctttgagtgc--tcaccagaaaacaatcaactctcacttaagtgcggctcgcagccgagcgg
         D. sechellia  ---gatgtctttgagtgc--tcaccagaaaacaatcaactctcacttaagtgcggctcgcagccgagcgg
            D. yakuba  ---gatgtctttgagtgc--tcaccagaaaacaatcaactctcacttaagtggggctcgcagtggagcgg
            D. erecta  ---gatgtctttgagtgc--tcaccagaaaacaatcaactctcacttaagtggggctcgcagtggagcgg
         D. ananassae  gaagaagactgcgag----------gagaaacaatcaactctcacttaagtgaag---------------
     D. pseudoobscura  ---gaagtccctaagtgccgtgccctggaagcaatcaactctc----------gacccgcctct------
        D. persimilis  ---gaagtccctaagtgccgtgccctggaagcaatcaactctc----------gacccgcctct------
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  atcgaaggggattggattagagc-aactcctccacggctgac----------------------------
          D. simulans  atcgaaggggattggattagagc-aactcctccacggctgac----------------------------
         D. sechellia  atcgaaggggattggattagagc-aactcctccacggctgac----------------------------
            D. yakuba  atcgcaggggattggattagagcaaactcctccacggctgac----------------------------
            D. erecta  atcgcaggggattggattagagc-aactcctccacggctgac----------------------------
         D. ananassae  ------------tggagtggaga-gactcctcctccgccgtcgccttcgcaccaccacctaccacttcca
     D. pseudoobscura  ------------------------gcctctgcctctgcctccacct------------------------
        D. persimilis  ------------------------gcctctgccactgcctccacct------------------------
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  --ccgtgaccaacggagcacagctg-----------aacagctgaac----agcagaggacgacttccgc
          D. simulans  --ccgtgaccaacggagcacagctg-----------aacagctgaac----agcagaggacgacttccgc
         D. sechellia  --ccgtgaccaacggagc-------------------acagctgaac----agcagaggacgacttccgc
            D. yakuba  --ccgtgaccaacggagcacagctg-----------aatagctgaag----agcggaggacgacttccgc
            D. erecta  --ccgtgaccaacggagcacagctg-----------aac------------agcggaggacgacttccgc
         D. ananassae  agccgtgaccagcggagcggagcagggttaaagtaaggcagctga--------ctgaggactacttccgc
     D. pseudoobscura  --ccatctcctccttcgctctgtcg-----------ttcacttgctcgctgacccaagacggacttccgc
        D. persimilis  --ccatctcctccttcgctctgtcg-----------ttcacttgctcgctgacccaagacggacttccgc
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  cggcggctaaatgatctgtgaagc
          D. simulans  cggcggctaaatgagctgtgaagc
         D. sechellia  cggcggctaaatgagctgtgaagc
            D. yakuba  cggcggctaaatgatctgtgaagc
            D. erecta  cggcggctaaatgatctgtgaagc
         D. ananassae  cggcaactaaatgatctgtgaagc
     D. pseudoobscura  cggcagccaaaagatctgcggagc
        D. persimilis  cggcagccaaaagatctgcggagc
        D. willistoni  ========================
           D. virilis  ========================
        D. mojavensis  ========================
         D. grimshawi  ========================
           A. gambiae  ========================
         A. mellifera  ========================
         T. castaneum  ========================

Inserts between block 114 and 115 in window
        D. ananassae 178bp

Alignment block 115 of 217 in window, 838672 - 838734, 63 bps 
B D   D. melanogaster  tgcgattccgcagcggaaatcaacag--------------gaggttgtctgaccttacacggcttgtaag
B D       D. simulans  tgcgattccgcagcggaaatcaacag--------------gaggttgtctgaccttacacggcttgtaag
B D      D. sechellia  tgcgattccgcagcggaaatcaacag--------------gagtttgtctgaccttacacggcttataag
B D         D. yakuba  tgcgattccgcagcggaaatcaacag--------------gaggttgtctgaccttacacggcttgtaag
            D. erecta  tgcgattccgcggcggaaatcaacag--------------gaggttgtctggccttacacggcttgtaag
        D. ananassae  ======================================================================
     D. pseudoobscura  tgacaatccgcgacggcaacaggcga------tggcggtggcggttggatgaccttagccagc-caccag
B D     D. persimilis  tgacaatccgcgacggcaacaggcgatggcggtggcggtggcggttggatgaccttagccagc-caccag
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  ccgtctc
          D. simulans  ccatctc
         D. sechellia  ccatctc
            D. yakuba  ccatctc
            D. erecta  ccatctc
         D. ananassae  =======
     D. pseudoobscura  ctgcctc
        D. persimilis  ctgcctc
        D. willistoni  =======
           D. virilis  =======
        D. mojavensis  =======
         D. grimshawi  =======
           A. gambiae  =======
         A. mellifera  =======
         T. castaneum  =======

Inserts between block 115 and 116 in window
    D. pseudoobscura 3bp
B D    D. persimilis 3bp

Alignment block 116 of 217 in window, 838735 - 839213, 479 bps 
B D   D. melanogaster  aatacagaatggccatcgctgcacaaggagaaa---tagagctcacttgctcactttagttgaaataaat
B D       D. simulans  aatacagaaaggccatcgctgcacagtgagaaaaagaagagttcacttgctcactttagttgaattaaat
B D      D. sechellia  aatacagaaag--catcggtgcacagtgagaaa---aagagctcacttgctcactttagttgaattaaat
B D         D. yakuba  aatacagaaaggccatcgctgcacaggcagaaa---aag-------------------------------
            D. erecta  aaaacagaaaggccatcgctacacaggcagaaa---aaggtttacctctgcttcttcggtttgattgaat
        D. ananassae  ======================================================================
    D. pseudoobscura  ======================================================================
B D     D. persimilis  ======================================================================
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  aaacaattcgcaacttgctatctgttttaaaggtctgg-------------ggaagtaacaaat-agttt
          D. simulans  aaacaaatcccaacctgccttctgtattaaaggtctgg-------------tgaagtaacaaatgagttg
         D. sechellia  aaacaaataccaacttgccttctgctttaaaggtctgg-------------tgaagtaagaaat-agttt
            D. yakuba  -----------agctt-------------------------------------------------agtta
            D. erecta  aaagaaatccaagcttgccttctgtttgaaaggtgtgtgctcgaattttactggagtaacaaatagttta
         D. ananassae  ======================================================================
     D. pseudoobscura  ======================================================================
        D. persimilis  ======================================================================
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  gtatagaagg-----ctctattgctatcttatcttatcagtccgctcttgaactattactattagtaagt
          D. simulans  gtatagaaggcgtgactctatcgctatcttatcttatcactccgctcttgaactattactattagtgagt
         D. sechellia  ttatagaaggcgtgactctatcgctatcttatcttatcattcctcacttgaactattactattcgtaagt
            D. yakuba  ---------------ctctatcgttgtcttatcttatcgcaccgctcttgaactactgctattagtgagt
            D. erecta  ---------------ctgtatcgttgtcttatcttatcacaccgctcttcaatcacttctattagtaagt
         D. ananassae  ======================================================================
     D. pseudoobscura  ======================================================================
        D. persimilis  ======================================================================
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  atcttaaatcagttaaccttaaatacctaattctaacaatggtgaccacattaaaggcacttgaaagagt
          D. simulans  atcttaaatcagttaaccttaaatacctaatgcaaacaatgatgaccacatcaaaggcacttgaaagagt
         D. sechellia  atcttaaatcagttaaccttaaatacttaatgcaaacaatgatgaccacatcaaaggtacttgaaagagt
            D. yakuba  atcttaagtcagttagcctca------------acacaatggtgaccacgttaaaagcacttgaaggaag
            D. erecta  atcttaagtcagttaaccttaaatacccaatgcaaacaatggtgaccacattaacagcacttgaaag-ag
         D. ananassae  ======================================================================
     D. pseudoobscura  ======================================================================
        D. persimilis  ======================================================================
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ggcagtgtgcttgaaaccctcgaaacaccccactccttaatagacacttgattaaatcattaaataaact
          D. simulans  ggcagtgtgcttgaaaccctcgaaaca--gcactccttaatagacacttgattaaatcttgaaatgaact
         D. sechellia  ggcagtgtgcttgaaaccctcgaaaca--gcactccttaata-ccacttgattaaatcttgaaataaact
            D. yakuba  aacagtgtgcttgaaaccctcgaaaca--acactccttaatagagacttgattgaatctttaagtgaact
            D. erecta  aacagtgtgcttgaaaccctcgaaaca--acactccctaatagacacttgactagatctttaagtgaacc
         D. ananassae  ======================================================================
     D. pseudoobscura  ======================================================================
        D. persimilis  ======================================================================
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  caatttacggtgttctacttatccaatgacactttaatttccatttcgacatacaaagctaagagaagtt
          D. simulans  caatttacggtgttctacttatccaatgacacttttatttccatttc--catttcgacataagagaagtt
         D. sechellia  caatttacggtgttctacttatccaatgacacttttatttccatttc--catttcgacataagagaagtt
            D. yakuba  caatctacggtgttctacttatccaatgacactttaatttccatttc--gaaacacacagctaagaagtt
            D. erecta  caatcctcggtgttctacttatccaatgacactttaatgcacatttc--gaaacaaaaagcaacgaagtt
         D. ananassae  ======================================================================
     D. pseudoobscura  ======================================================================
        D. persimilis  ======================================================================
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  taagacgcaggaaaagctagtagctgtaaagccaataaccactgaacgaggataattttcgaataagatt
          D. simulans  taggacgcaggaaaagctagtagctgcaaagccattaaccagtgaacgagaataattttcgaataagatt
         D. sechellia  taagacgcaggaaaagctagtagctgcaaagccattaaccagtgaacgagaataattttcgaataagatt
            D. yakuba  gcaggcgcaggataagctggtagctgcaaagccataacccagtgaacgagaatcattttcgaatccgatt
            D. erecta  taaggcgcaggaaaagctagtagctt--------taacccagtgagcgagaataattttcaaatcggatt
         D. ananassae  ======================================================================
     D. pseudoobscura  ======================================================================
        D. persimilis  ======================================================================
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  taccttttaaa
          D. simulans  tacctttttaa
         D. sechellia  tacctttttaa
            D. yakuba  taccttcataa
            D. erecta  tgcctt-ataa
         D. ananassae  ===========
     D. pseudoobscura  ===========
        D. persimilis  ===========
        D. willistoni  ===========
           D. virilis  ===========
        D. mojavensis  ===========
         D. grimshawi  ===========
           A. gambiae  ===========
         A. mellifera  ===========
         T. castaneum  ===========

Alignment block 117 of 217 in window, 839214 - 839285, 72 bps 
B D   D. melanogaster  tttattccgtt--ttaatcctattaaaatatcaacatggcatttgccggactaaggcgagcacagtacgt
B D       D. simulans  tttattccgtt--ttaatcctattaaaacatcaacatggcatttgccggattaaggcgagcacggtacgt
B D      D. sechellia  tttattccgtt--ttaatcctattaaaacatcaacatggcatttgccggattaaggcgagcacggtacgt
B D         D. yakuba  tttattccgtt--tcaatcctattaaaatatcaactaggcatttgccggattaaggcgagcacggaacgt
            D. erecta  tttattccgtt--ttaatcctattaaaatatcaactaggcatttg-cggattaaggcgagcacggtacgt
        D. ananassae  ======================================================================
    D. pseudoobscura  ======================================================================
B D     D. persimilis  ======================================================================
       D. willistoni  ======================================================================
           D. virilis  tttattgagttagttagttctgtgaaattaacagca----gctttaaagtgtgaagccagcaacaaaatt
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  gatg
          D. simulans  gatg
         D. sechellia  gatg
            D. yakuba  gatg
            D. erecta  gatg
         D. ananassae  ====
     D. pseudoobscura  ====
        D. persimilis  ====
        D. willistoni  ====
           D. virilis  aaga
        D. mojavensis  ====
         D. grimshawi  ====
           A. gambiae  ====
         A. mellifera  ====
         T. castaneum  ====

Alignment block 118 of 217 in window, 839286 - 839308, 23 bps 
B D   D. melanogaster  tttt------ttttttgtgtgcg--gcaaac
B D       D. simulans  ---t------ttttttgtgtgtg--gcaaac
B D      D. sechellia  ---t------ttttttgtgtgtg--gcaaac
B D         D. yakuba  ---t------ttttttgtgtgtg--gcaaac
            D. erecta  ---tttgatgttttttgtgtgtg--ccaaac
         D. ananassae  ttac------ttttcagtgagcagtgccaac
    D. pseudoobscura  ===============================
B D     D. persimilis  ===============================
        D. willistoni  --------------------------caagc
           D. virilis  tgtt------tcttatatgtgcg--gcgcat
       D. mojavensis  ===============================
        D. grimshawi  ===============================
B D        A. gambiae  ===============================
        A. mellifera  ===============================
        T. castaneum  ===============================

Alignment block 119 of 217 in window, 839309 - 839477, 169 bps 
B D   D. melanogaster  ----accactcaagtgg---------tgcccagttttccgagtg---g-ccacatccacg----------
B D       D. simulans  ----accactcaagtgg---------tgcccagtttcccgagtg---g-ccacatccaca----------
B D      D. sechellia  ----accactgaagtgg---------tgcccagtttcccgagtg---g-ccacatccaca----------
B D         D. yakuba  ----accactcaagtgg---------tgcccagttttccgagtg---g-ccacatctaga----------
            D. erecta  ----agcactcaagtgg---------tgcccagttttccgagtg---g-ccacatccaca----------
         D. ananassae  ----accacttaagtgg---------caacca-------gagtg---gcccccatccacg----------
     D. pseudoobscura  ----accactcgagtggatggtcccagacccaggt--ccaagtgatag-ccgcggcgact----------
B D     D. persimilis  ----accactcgagtggatggtcccagacccaggt--ccaagtgatag-ccgcggcgact----------
        D. willistoni  ----aaaagtaacttag---------ttccaaatgtttcaagag---t-cgacgtcgtcggcggcggcga
           D. virilis  tgtaatctattgtgttt---------tgtttcaaatgctagatg---a-ccttgaactca----------
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  ----------------agagcacgcacaggcagttcgttag-----------ggcatcggat--------
          D. simulans  ----------------agagcacgcacaggcagttcgttag-----------ggcatcggat--------
         D. sechellia  ----------------agagcacgcacagacagttcgttag-----------ggcatcggatgaggagga
            D. yakuba  ----------------gaagcacgcacaggcagtttgttag-----------ggcatcgaag--------
            D. erecta  ----------------gaagcacgcacaggcagttcgttag-----------ggcatcggat--------
         D. ananassae  ---------------cagagcacgcacggccagttcgttag-----------aggattgg----------
     D. pseudoobscura  ----------------agagcacgcacaggcagttcgttag---------------ttgggt--------
        D. persimilis  ----------------agagcacgcacaggcagttcgttag---------------ttgggt--------
        D. willistoni  cgatggaggccaagttaaggcacgcacaggcagttcgttag---------------ttgcaa--------
           D. virilis  ----------------caagcactcaaacgcaaacacacagacgcacacacaggcattgagg--------
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  -------gaggaggaggag-tagatggggctggggttgtggatgt-------gtatgc-----------a
          D. simulans  -------gaggaggaggag-gaggagtagatggggctggggatgt-------ggatgc-----------a
         D. sechellia  ggaggaggaggaggaggag-gaggagtagatggggctggggatgt-------ggatgc-----------a
            D. yakuba  -------gaggagga----------ggagatgtggacgtggatgt-------ggatgc-----------a
            D. erecta  -------gaggagga-------gatggaggcggagatggggatgt-------ggatgc-----------a
         D. ananassae  -------gattaaga-----------cacccaaggaggagggggt-------ggctgc-----------c
     D. pseudoobscura  -------g-tgagga-------------------------------------------------------
        D. persimilis  -------g-tgagga-------------------------------------------------------
        D. willistoni  -------aagtggca----------gcaccagagaatgtggccaa-------ctattttta--------a
           D. virilis  -------aacagttatatgcgaaccgtagcttgccttgtggtcgtcttgtgggcacgcacaccttagcta
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  gatgtagctgc----agtggcagt------ggcagtggcagctgcaagtggca-----------------
          D. simulans  gatgtagct----------gcagt------ggcagtggcagctgcaagtggca-----------------
         D. sechellia  gatgtagct----------gcagt------ggcagtggcagctgcaagtggca-----------------
            D. yakuba  gatgtagctgc----agtggcagt------ggcagtggcagctgcaagtggca-----------------
            D. erecta  gatgtagctgc----agtggcagtggcagcggcagtggcagctgcaagtggca-----------------
         D. ananassae  attgcaact----------gcagt------ggcagctgcgagtggaaatggggaaaaaaaaaaaaagtaa
     D. pseudoobscura  ------------------------------ggcgg--------gtaagtggca-----------------
        D. persimilis  ------------------------------ggcgg--------gtaagtggca-----------------
        D. willistoni  agtgtaagtgttgggtgtaataga------gaaagtgaaagttgcc--ttgca-----------------
           D. virilis  gaaacagcagc----agcagcagc------gccagtggctgtaatatgcagca-----------------
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ----------aaaa
          D. simulans  ----------aaaa
         D. sechellia  ----------aaaa
            D. yakuba  ----------aaaa
            D. erecta  ----------aaaa
         D. ananassae  aaataaaaataaaa
     D. pseudoobscura  --------------
        D. persimilis  --------------
        D. willistoni  ----------acaa
           D. virilis  ----------aaaa
        D. mojavensis  ==============
         D. grimshawi  ==============
           A. gambiae  ==============
         A. mellifera  ==============
         T. castaneum  ==============

Alignment block 120 of 217 in window, 839478 - 839499, 22 bps 
B D   D. melanogaster  caaagaccgtg--gcagaataatg
B D       D. simulans  caaagaccgcg--gcagaataatg
B D      D. sechellia  caaagaccgcg--gcagaataatg
B D         D. yakuba  caaagagcacg--gcagaataatg
            D. erecta  caaagaccgag--gcagaataatg
         D. ananassae  ccaagaccgagcagcagaatgcca
     D. pseudoobscura  -------tgcg--gcaa-------
B D     D. persimilis  -------tgcg--gcag-------
        D. willistoni  caacaacaaca--actgaata---
           D. virilis  caaaaacaataacacgaca--ata
        D. mojavensis  caagtgccgca--gcggcg--gtt
        D. grimshawi  ========================
B D        A. gambiae  ========================
        A. mellifera  ========================
        T. castaneum  ========================

Inserts between block 120 and 121 in window
       D. willistoni 1944bp
          D. virilis 25bp
       D. mojavensis 2bp

Alignment block 121 of 217 in window, 839500 - 839530, 31 bps 
B D   D. melanogaster  cgccatgtggca------------gtggctatttttgaaatcc
B D       D. simulans  cgccatgtggca------------gtggctatttttgaaatcc
B D      D. sechellia  cgccatgtggca------------gtggctatttttgaaatcc
B D         D. yakuba  cgccatgtggca------------gtggctatttttgaaatcc
            D. erecta  cgccatgtggca------------gtggctatttttgaaatcc
         D. ananassae  tgccatgtggcagccagtggcagtgtggctatttttgaaatcc
     D. pseudoobscura  cggcatgtggca------------gtagctatttttgaaatcc
B D     D. persimilis  cggcatgtggca------------gtagctatttttgaaatcc
       D. willistoni  ===========================================
          D. virilis  ===========================================
        D. mojavensis  cgcaatctggcc------------acagctatttttgtaaccc
        D. grimshawi  ===========================================
B D        A. gambiae  ===========================================
        A. mellifera  ===========================================
        T. castaneum  ===========================================

Alignment block 122 of 217 in window, 839531 - 839601, 71 bps 
B D   D. melanogaster  a---gccgcggcggagaaagtgaaagttgcct---------------ctacacggaatgtaaaagcagtg
B D       D. simulans  a---gccgcggcggagaaagtgaaagttgcct---------------ccacacggaatgtaaaagcagtg
B D      D. sechellia  a---gccgcggcggagaaagtgaaagttgcct---------------ccacacggaatgtaaaagcagtg
B D         D. yakuba  a---gccgcgtcggagaaagtgaaagttgcct---------------ccgcacggaatgtaaaagcagtg
            D. erecta  a---gccgcagcggagaaagtgaaagttgcct---------------ccacacggaatgtaaaagcagcg
         D. ananassae  agc-gccactgcggagaaagtgaaagttggcc---------------gc-cacggcac-tagtggcagta
     D. pseudoobscura  actgaatgaggcggagaaagtgaaagttgccc---------------aga---ggcat-tagatgcagcg
B D     D. persimilis  actgaacgaggcggagaaagtgaaagttgccc---------------aga---ggcat-tagatgcagcg
       D. willistoni  ======================================================================
           D. virilis  ---aagagcgagcgagacagagaaag---------------------acagagagaga-gagagagagtg
        D. mojavensis  ---------gagtgaaa-agtgaaagttgcctgccccctccctgctcacactcaacac-tcacgacactc
        D. grimshawi  ======================================================================
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  gcggca---------ttagaggcactca
          D. simulans  gcggca---------ttagaggcactca
         D. sechellia  gcggca---------ttagaggcactca
            D. yakuba  gcggca---------ttagaggcactca
            D. erecta  gcggca---------ctggaggcactca
         D. ananassae  gtggca---------ttagaggcactca
     D. pseudoobscura  gcagcaagcactaccagagaggca----
        D. persimilis  gcagcaagcactaccagagaggca----
        D. willistoni  ============================
           D. virilis  gcagca---------ggagctgcaagca
        D. mojavensis  acagca--------------------ca
         D. grimshawi  ============================
           A. gambiae  ============================
         A. mellifera  ============================
         T. castaneum  ============================

Inserts between block 122 and 123 in window
       D. mojavensis 2bp

Alignment block 123 of 217 in window, 839602 - 839720, 119 bps 
B D   D. melanogaster  -------------ttcggccacgcccaccgttt--aaggcgtgcatttgaaacgctca-----gtc----
B D       D. simulans  -------------ctcggccacgcccaccgttt--aaggcgtgcatttgaaacgctcc-----gtcaaga
B D      D. sechellia  -------------ctcggccacgcccaccgttt--aaggcgtgcatttgaaacgctca-----gtcaaga
B D         D. yakuba  -------------ctctgccacgcccaccgttt--aaggcgcgcatttgaaacgcttt-----gtcaaga
            D. erecta  -------------ctctgccacgcccaccgttt--taggcgtgcatttgaagcgcttt-----gtcaaga
         D. ananassae  -------------ctgggccccgcccaccgttt------------------acgctca-----g------
     D. pseudoobscura  ---------------gagccacgcccaccgtttacaaggc------------------------------
B D     D. persimilis  ---------------gagccacgcccaccgtttacaaggc------------------------------
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
        D. mojavensis  tcaggtccaggtccactgccacgcccaccgttt--acgacaagcatttgaattgcttttggtcgtcaa--
        D. grimshawi  ======================================================================
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  ----------aaga-gggaggcggcagc--agataatt----g--acaatcaca-gccgtaatgactgca
          D. simulans  tggaaaaaacaaga-gggaggcggcagc--aggtaatt----g--acaatcaca-gccgtaatgactgca
         D. sechellia  tggaaaaaagaaga-gggaggcggcagc--aggtaatt----g--acaatcaca-gccgtaatgactgca
            D. yakuba  tggaaaaataaagaggggaggag--------ggtaatt----g--acaatcaca-gccgtaatgactgca
            D. erecta  tggaaaaattaaga-gggaggag--------ggtaatt----g--acaatcacaggccgtaatgactgcg
         D. ananassae  -----------agg-cagaggcagtggcagaggtaatt----g--acaatcgcc-acagtaatgactgca
     D. pseudoobscura  -----------agg-ggaaggggatgg----ggagattggaag--acaattgca-gctgtaatgacagca
        D. persimilis  -----------agg-agaaggggatgg----ggagattggaag--acaattgca-gctgtaatgacagca
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  -----------cga-cagcgacagcagc---agcaaca----gcagcagtagct-ggtgtaatga-----
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  aatttccatgcagctgagtcttc
          D. simulans  aatttccatgcagctgagtcttc
         D. sechellia  aatttccatgcagctgagtcttc
            D. yakuba  aatttctatgcagctgcgtcttc
            D. erecta  aatttccatgcagctgagtcttc
         D. ananassae  aatttccgc-cagctgaggccat
     D. pseudoobscura  aatttccatcaaacggaggcccc
        D. persimilis  aatttccatcaaacggaggcccc
        D. willistoni  =======================
           D. virilis  =======================
        D. mojavensis  -----------------------
         D. grimshawi  =======================
           A. gambiae  =======================
         A. mellifera  =======================
         T. castaneum  =======================

Inserts between block 123 and 124 in window
    D. pseudoobscura 422bp
B D    D. persimilis 401bp
       D. mojavensis 1392bp

Alignment block 124 of 217 in window, 839721 - 839749, 29 bps 
B D   D. melanogaster  ggttaatgcgaaaaa---aaaatccaat---------------------agcc
B D       D. simulans  tgttaatgcg--aaa---aaaatccaat---------------------agcc
B D      D. sechellia  tgttaatgcg--aaa---aaaatccaat---------------------agcc
B D         D. yakuba  ggttaatgcg--aaa---aaaacccaatatgccggggaagtgctgctccaccc
            D. erecta  tgttaatgcg--aaa---aacgcgcaatatgccagggaagtgctactccagcc
         D. ananassae  tgttagtgcg--aaaaataaaatcgaat---------------------agcc
    D. pseudoobscura  =====================================================
B D     D. persimilis  =====================================================
       D. willistoni  =====================================================
          D. virilis  =====================================================
       D. mojavensis  =====================================================
        D. grimshawi  =====================================================
B D        A. gambiae  =====================================================
        A. mellifera  =====================================================
        T. castaneum  =====================================================

Inserts between block 124 and 125 in window
        D. ananassae 39bp

Alignment block 125 of 217 in window, 839750 - 839952, 203 bps 
B D   D. melanogaster  tctttaaaagcggttctgggaaataaatcacgtagtaagtgc--------------------gccaataa
B D       D. simulans  tctttaaaagcggttctgggaaataaatcacctag---------------------------------aa
B D      D. sechellia  tttttaaaagcggttctgggaaataaatcacctag---------------------------------aa
B D         D. yakuba  tctttgaatgcggttctgggaaacaaatcacctcgaatctgccggatggaaaatatattagcgccagtaa
            D. erecta  actttgaatgcggttctgggaaagaaatcacttagaaactgccggatacaaaatatattactaccgatga
        D. ananassae  ======================================================================
    D. pseudoobscura  ======================================================================
B D     D. persimilis  ======================================================================
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  atgctaaacttccgct-----ggaaatagttctcaggaaactacaca--------------tgtcatgcg
          D. simulans  atgctaaacttccgct-----ggaaacagttctcaggaaactactca--------------tgtcatgtg
         D. sechellia  atgctaaacttccgct-----ggaaatagttctcaggaaactactca--------------tgtcatgtg
            D. yakuba  atgccacagttccgct-----gccaa-agg----atgtgactaccaa--------cttaatcatcacatg
            D. erecta  gtgctacagttccgctgttccgccaatggg----atgcgactactaagtcgccccttcaatcatcaattg
         D. ananassae  ======================================================================
     D. pseudoobscura  ======================================================================
        D. persimilis  ======================================================================
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ggttaaggacgtacaagtatatatatatttact-gcttcaagaatgatcgagaatttcgagacccgattt
          D. simulans  ggttaaggac------------atgtacttaatggcttaaagaatgatcgagaatttcgagacccgattc
         D. sechellia  ggctaaggac------------atgtacttactggctaaaagaatgatcgagaatttcgagacccgattc
            D. yakuba  t-ttaaggatattcg----------tatttcct-gcttaaagaatgatcgagaattt-------------
            D. erecta  gattacagacaccagtaaatgcatatatttact-gcttaaagaatgatcgagaatttcgagccccgattt
         D. ananassae  ======================================================================
     D. pseudoobscura  ======================================================================
        D. persimilis  ======================================================================
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  cgcgccagta---------aacaggatggatgcacgaaagca
          D. simulans  cgcggcagtg---------acca----ggatgcacaaaccca
         D. sechellia  cgcggcagtg---------acca----ggatgcacaaaccca
            D. yakuba  -gcaataatgaatcccctaaact----aaatgcatgaaagct
            D. erecta  cgcaacagcgaaccgctttaaca----ggatgcacgaaagcg
         D. ananassae  ==========================================
     D. pseudoobscura  ==========================================
        D. persimilis  ==========================================
        D. willistoni  ==========================================
           D. virilis  ==========================================
        D. mojavensis  ==========================================
         D. grimshawi  ==========================================
           A. gambiae  ==========================================
         A. mellifera  ==========================================
         T. castaneum  ==========================================

Alignment block 126 of 217 in window, 839953 - 839972, 20 bps 
B D   D. melanogaster  ttcaactagg-tctcagttgc
B D       D. simulans  tttatctagg-tctcagttgc
B D      D. sechellia  tttatctagg-tctcagttgc
B D         D. yakuba  tttatttagg-tctcagttgc
            D. erecta  tttgtctagc-tctcagttgc
         D. ananassae  tttaaccaggttcttggaagc
    D. pseudoobscura  =====================
B D     D. persimilis  =====================
       D. willistoni  =====================
          D. virilis  =====================
       D. mojavensis  =====================
        D. grimshawi  =====================
B D        A. gambiae  =====================
        A. mellifera  =====================
        T. castaneum  =====================

Inserts between block 126 and 127 in window
B D     D. sechellia 436bp
        D. ananassae 9bp

Alignment block 127 of 217 in window, 839973 - 840009, 37 bps 
B D   D. melanogaster  cagt-tt-tccaatgcaaac--tc--taagcctctttgcgctg
B D       D. simulans  cagt-tt-tccaatgcaaac--tc--taagcaactttgcgctg
B D      D. sechellia  cagt-tt-tccaatgcaaac--tc--taagaaacttggcgctg
B D         D. yakuba  caat-ttccccagtgcaaac--tc--tgagccgctttgcgcgg
            D. erecta  caat-tt-tccaatgcaaac--tc--tgagcccctttgcgctg
         D. ananassae  caatgct-tctaacacagatcatc--tatttggcttgaaagcg
    D. pseudoobscura  ===========================================
B D     D. persimilis  cacg-tc-ccccattcgaac--tccgcagatcgcgtaaagtgc
       D. willistoni  ===========================================
          D. virilis  ===========================================
       D. mojavensis  ===========================================
        D. grimshawi  ===========================================
B D        A. gambiae  ===========================================
        A. mellifera  ===========================================
        T. castaneum  ===========================================

Alignment block 128 of 217 in window, 840010 - 840296, 287 bps 
B D   D. melanogaster  tgttcaatattagcattgcaatgctaattgttatacgaacccaggcagtaaacacattcgca---ttggc
B D       D. simulans  tgttcaatattagcattgcaatgctaattgttatacgaacccagccagtaaacacattcgca---tcggc
B D      D. sechellia  tgttcaatattagcattgaaatgctaattgttatacgaacccagccagtcaacacattcgca---tcggc
B D         D. yakuba  tgttcaatattagcattgcaatgctaattgttatacgagcccagccagtaaacacactcgca---ttggt
            D. erecta  tgttcaatattagcattgcaatgctaattgttgtacgaacccagccagcaaacagattcgca---ttgga
         D. ananassae  gattgcattttagcatttcagtgataattg----aggaact------gcagatactcagata---cttag
     D. pseudoobscura  tgttcaatattagcatgggaatgctaattgagagacgaactacacatctgtacatctttgtacctctggc
B D     D. persimilis  tgttcaatattagcatgggaatgctaattgagagacgaactacacatctgtacatctttgtacctctggc
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  acacactcgtcgtcatcagcggaggaattctcatccagccacatctgca--tggc---gaga-------g
          D. simulans  acacactcgtcgtcatcagcggaggaattctcatccagccacatctgca--tgcc---gaga-------g
         D. sechellia  acacactcgtcgtcatcagcggaggaattctcatccagccacatctgca--tgcc---gaga-------g
            D. yakuba  acacactcggcgtcatcgacggaggagttctcacccagccacatctgca--ggcc---gaga-------t
            D. erecta  acacactcgtcgtcatcagc-gaggaattctcgtccagccacatctgca--tgcc---gaca-------g
         D. ananassae  atacagtc-------------tgtaagtgcttggatggc--cagctggg--agacaatggaa-------a
     D. pseudoobscura  accccttctgc--------------agctccccctcctcctcatttgcgtctgct---gagacgccgtcg
        D. persimilis  accccttctgc--------------agctccacctcctcctcatttgcgtctgct---gagacgccgtcg
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ctcgagaatggcagagtgccatgctaattgagagtcaacaaagcagc-gctggaactcgcaactggaatc
          D. simulans  ctcgagaatggcagagtgccatgctaattgagagtcaacaaagcagc-gctggaactcgcaactggaatc
         D. sechellia  ctcgagaatggcagagtgccatgctaattgagagtcaacaaagcagc-gctggaactcgcaactggaatc
            D. yakuba  cc-gagaatggcagagtgccatgctaattgagagtcaacaaagcagc-gctggaactcacagctggaatc
            D. erecta  ctagagaatgccagagtgccatgctaattgagagtcaacaaagcagc-gctggaactcacagct--catc
         D. ananassae  ccggagaatgc---attgaaatgctaattgggagtcgacaaggcagctgccagaac--------------
     D. pseudoobscura  ctcaaaga-----gaatgcaatgctaattggaagtcaacagagcagc-ggccgcgctggaaact------
        D. persimilis  ctcaaaga-----gaatgcaatgctaattggaagtcaacagagcagc-ggccgcgctggaaact------
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  ggaaaactgtgtca----cacctcgc--aggtcatggcagttcaaagggcaaagggcaaagggtacaggc
          D. simulans  ggaaaactgtgtca----cacctcgc--aggtcatggcagttcaaagggcaaaggg--------------
         D. sechellia  ggaaaactgtgtca----cacctcgc--aggtcatggcagttcaaagggcaaagag--------------
            D. yakuba  ggaaaactgtgtca----cacctcgc--aggtcatggcagttcaaagggcaaaggg--------------
            D. erecta  ggaaaactgtgtca----caccttac--aggtcatggcagttcaaagggcaaaggg--------------
         D. ananassae  -agaaactgtgtca----cacctcatggaggtca-------tcccagggcataggg--------------
     D. pseudoobscura  -ggaaactgtgtcaccaccacctcac--aggccaaggcag-gggaggggccaagag--------------
        D. persimilis  -ggaaactgtgtcaccaccacctcac--aggccaaggcag-gggaggggccaagag--------------
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  ======================================================================
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  aaaggggactgacatgactgaaaaggg-----------------------------at
          D. simulans  ------------cacgactgagaaggg-----------------------------ct
         D. sechellia  ------------catgactgagaaggg-----------------------------ct
            D. yakuba  ------------cgcaggcaaagggga-----------------------------at
            D. erecta  ------------cacgactgagtaggg-----------------------------tt
         D. ananassae  ------------gactgccaaca----------------------------------c
     D. pseudoobscura  ---------tgccaagagtgcaatgggcgcaggagagggagggagggagagggaat--
        D. persimilis  ---------tgccaagagtgcaatggg-------------------------------
        D. willistoni  ==========================================================
           D. virilis  ==========================================================
        D. mojavensis  ==========================================================
         D. grimshawi  ==========================================================
           A. gambiae  ==========================================================
         A. mellifera  ==========================================================
         T. castaneum  ==========================================================

Inserts between block 128 and 129 in window
B D        D. yakuba 10bp
           D. erecta 16bp
    D. pseudoobscura 196bp

Alignment block 129 of 217 in window, 840297 - 840401, 105 bps 
B D   D. melanogaster  tt-atccc--cctgatacaataaaccaattcacaaaattagtaatcgacttggagagtacaatttc----
B D       D. simulans  tt-at-cc--cctgatacaataaaccaattcacaaaattactaatcg--------------atttc----
B D      D. sechellia  tt-at-cc--cctgatacaataaaccaattcacaaaattagtaatcg--------------atttc----
B D         D. yakuba  ctcat-ccgctctgatacaatttaccaatttacagaaataataatcg--------------actttgctc
            D. erecta  ct-at-ccattctga---------------tacagaaataataatcc--------------agttt----
         D. ananassae  ct-ac-cc------attttatgcctcatttaa-----------------------------agctc----
    D. pseudoobscura  ======================================================================
B D     D. persimilis  ----------------------------------------------------------------------
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
       D. mojavensis  ======================================================================
        D. grimshawi  ======================================================================
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  --------------------------aacaaaggcgatactaaaatggatttctgttgaaagggaagc
          D. simulans  --------------------------aacgaaggcgcaaatgaaatggatttccgttgaaagggaagc
         D. sechellia  ------------------------------aaggcgcaaatgaaatggatttccgttgaaagggaagc
            D. yakuba  cgacttaaaagccttaatagttgcataccaaaagcg-----aaaccagctcaatgttgaaagggaaga
            D. erecta  ---------------------------------------------cag---gacggcgaaagaggagc
         D. ananassae  ------------------------------aaagtcgtacagaaatatcttc-----------gaagt
     D. pseudoobscura  ====================================================================
        D. persimilis  -----------------------------------------------------tgcaggagggggagg
        D. willistoni  ====================================================================
           D. virilis  ====================================================================
        D. mojavensis  ====================================================================
         D. grimshawi  ====================================================================
           A. gambiae  ====================================================================
         A. mellifera  ====================================================================
         T. castaneum  ====================================================================

Alignment block 130 of 217 in window, 840402 - 840413, 12 bps 
B D   D. melanogaster  aa--------acatagta----------------------------cg
B D       D. simulans  aa--------acataata------------------------------
B D      D. sechellia  aa--------aaataatcgtgaa-----------aatcatatctttag
B D         D. yakuba  ga--------gaataatcataa------------aatcag--------
            D. erecta  ga--------acgtactcataaagacgccacaagagtcag--------
         D. ananassae  ga--------ctg-----------------------------------
    D. pseudoobscura  ================================================
B D     D. persimilis  gagggagagggaatatt-------------------------------
       D. willistoni  ================================================
          D. virilis  ================================================
        D. mojavensis  aa--------acatattatc----------------------------
        D. grimshawi  ================================================
B D        A. gambiae  ================================================
        A. mellifera  ================================================
        T. castaneum  ================================================

Inserts between block 130 and 131 in window
B D      D. simulans 888bp
B D        D. yakuba 9bp
           D. erecta 8bp

Alignment block 131 of 217 in window, 840414 - 840518, 105 bps 
B D   D. melanogaster  atatttgaaatacatttatgc---------acattaact----tgcaagctagcaaataacttacttact
B D       D. simulans  gtgtttgaaatacatttatgc---------acattaact----tgcaagccagcaaataacttacttact
B D      D. sechellia  gtgtttgaaatacatttatgc---------acattaact----tgaaagccagcaaataacttactcact
B D         D. yakuba  gtgtttgaaatacatgtatgc---------acatt----------aacattggcaaataa----------
            D. erecta  gtgtttgaaatacatatatgttagctctaggtattttgc----tgcacgccagcaagtaactt----act
         D. ananassae  gcttttaaaatatctttttac-------------taatt----tgtaagcca------------------
    D. pseudoobscura  ======================================================================
B D     D. persimilis  ctatgcgaactgcatttgaga---------gcat-------------------cgattcacttgcactgc
       D. willistoni  ======================================================================
          D. virilis  ======================================================================
        D. mojavensis  atttcaatattatattcatat---------atatttatttttctaaatatatgcatataattaatttagt
        D. grimshawi  ======================================================================
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  tgcttcgactgtaatgggaattt-------------------ctttaaggat-gcatt-----------t
          D. simulans  tgcttcgactgtaatgggaatttaa----aaggcggcgacgacttcaaggat-gcatt-----------t
         D. sechellia  tgcttcgacagtaatgggaatttaa----aaggcggcgacgacttcaaggat-gcatt-----------t
            D. yakuba  --cttcgagtgtaatgggaatttaa----aaggcggcgacgacttcaaggat-gcatt-----------t
            D. erecta  tgcttcgagtgtaatgggaatttaa----aaggcggcgacgacttcaaggat-gcatt-----------t
         D. ananassae  ----tttaaagttgggtgaccttagccataaagttgggtcgaa---aaggtt-acattcattattattat
     D. pseudoobscura  ======================================================================
        D. persimilis  tgcttc--ctgtactgttcttcttc------------ccccccttccag-----cact-----------c
        D. willistoni  ======================================================================
           D. virilis  ======================================================================
        D. mojavensis  tttgttaaaccttacttaagttccg-----------------tttggggtataacaat-----------t
         D. grimshawi  ======================================================================
           A. gambiae  ======================================================================
         A. mellifera  ======================================================================
         T. castaneum  ======================================================================

      D. melanogaster  aagctaata
          D. simulans  aagctaata
         D. sechellia  aagctaata
            D. yakuba  aagctaata
            D. erecta  aagctaata
         D. ananassae  aagctaaaa
     D. pseudoobscura  =========
        D. persimilis  ccgctacaa
        D. willistoni  =========
           D. virilis  =========
        D. mojavensis  --gcta---
         D. grimshawi  =========
           A. gambiae  =========
         A. mellifera  =========
         T. castaneum  =========

Alignment block 132 of 217 in window, 840519 - 840552, 34 bps 
B D   D. melanogaster  gg---ctgagaattgtttgagattttatggaccattt
B D       D. simulans  gg---ctgagaattgtttgagattttatggaccattt
B D      D. sechellia  gg---ctgagaattgtttgagattttatggaccattt
B D         D. yakuba  ag---ctgggaattgtttgagattttatggatcgttt
            D. erecta  ag---ctgagaatcgtttgagatttgaggggccgttt
         D. ananassae  ag----taagaacag-caacgaatttatgagccactt
    D. pseudoobscura  =====================================
B D     D. persimilis  caattctcggaagcttttgagctttcacata------
       D. willistoni  =====================================
           D. virilis  gg---cttagacctgtcccgaaatgcaaaggcaattg
        D. mojavensis  -----------------------ttgaaaatcatttg
        D. grimshawi  =====================================
B D        A. gambiae  =====================================
        A. mellifera  =====================================
        T. castaneum  =====================================

Inserts between block 132 and 133 in window
        D. ananassae 27bp

Alignment block 133 of 217 in window, 840553 - 840601, 49 bps 
B D   D. melanogaster  -------------------cgaggaaggtt------------accaccggcatatatatgtacata----
B D       D. simulans  -------------------cgaggaaggtt------------accaccggcttacataca----------
B D      D. sechellia  -------------------cgaggaaggtt------------accaccggcttacatacatacatatgta
B D         D. yakuba  -------------------tgaggaaggtt------------accacaggtttacatatg----------
            D. erecta  -------------------tgaggaaggtt------------accacaggtttacatatg----------
        D. ananassae  ======================================================================
    D. pseudoobscura  ======================================================================
B D     D. persimilis  ---------------------aaaacggcc------------accccccctcgagatgctgtagtct---
       D. willistoni  ======================================================================
           D. virilis  caacaatcgtcaacagctgtgtgtgtagtt----caatgcatccaaca-------atatg----------
        D. mojavensis  --atgcgcgttaata-ttacatgtagagctgctgtaatg---ccagcatatatatataca----------
        D. grimshawi  ======================================================================
B D        A. gambiae  ======================================================================
        A. mellifera  ======================================================================
        T. castaneum  ======================================================================

      D. melanogaster  --catgtatgtacata--
          D. simulans  --tatgtatgtacata--
         D. sechellia  tgtatgtatgcacata--
            D. yakuba  --tatgaccgaccctt--
            D. erecta  --c---------------
         D. ananassae  ==================
     D. pseudoobscura  ==================
        D. persimilis  --cttttgtcgccctc--
        D. willistoni  ==================
           D. virilis  --cgaaagctgccgttca
        D. mojavensis  --catatgcactcacaca
         D. grimshawi  ==================
           A. gambiae  ==================
         A. mellifera  ==================
         T. castaneum  ==================

Inserts between block 133 and 134 in window
           D. erecta 15bp

Alignment block 134 of 217 in window, 840602 - 840634, 33 bps 
B D   D. melanogaster  cg----acgacaccccacctc---acagtttccacatagt----
B D       D. simulans  tg----acgacaccccacccc---g-agtttccacagagt----
B D      D. sechellia  tg----acgacaccccacccc---g-agtttcctcagagt----
B D         D. yakuba  ccctccacgacaccctgcgcc---g-agtttccacaacgt----
            D. erecta  ------acgacaccctgcccc---g-agtatccacaaagc----
         D. ananassae  c-------tagtcgccacttctggg-aatttccacacagc----
    D. pseudoobscura  ============================================
B D     D. persimilis  -----tgccgtagccagctgctg-g-gatttccaca--------
       D. willistoni  ============================================
           D. virilis  ----ctaattcacaatgtccc---c-ccttctctc----tt-tt
        D. mojavensis  ----catatacactcccactc---g-catttccat----tta--
        D. grimshawi  ============================================
B D        A. gambiae  ============================================
        A. mellifera  ============================================
        T. castaneum  ============================================

Alignment block 135 of 217 in window, 840635 - 840657, 23 bps 
B D   D. melanogaster  caccgtct---ccgccggatgagacc--
B D       D. simulans  ctccgtct---ccgccggatgaga----
B D      D. sechellia  ctccgtct---ccgccggatgaga----
B D         D. yakuba  cgccgtct---ccggcggatgaga----
            D. erecta  gtccgcct---ccggcggatgaga----
         D. ananassae  ctccgtccgagccaccggatg-ga----
     D. pseudoobscura  cacagttt---acgccg-----ga----
B D     D. persimilis  ----gttt---acgccg-----ga----
       D. willistoni  ============================
           D. virilis  tccctttc---tctcgggaaaagg--cc
       D. mojavensis  ============================
        D. grimshawi  ============================
B D        A. gambiae  ============================
        A. mellifera  ============================
        T. castaneum  ============================

Inserts between block 135 and 136 in window
          D. virilis 84bp

Alignment block 136 of 217 in window, 840658 - 840725, 68 bps 
B D   D. melanogaster  cg--ggacccgcgatcagagatctcggatcttgaatctcgaatc--------tcgaatctcgg---cggt
B D       D. simulans  tg--ggtcccgcgatcagagatctcggatctt-------gaatc--------tcgaatctcgg---cggt