Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 27 in window, 182878005 - 182878018, 14 bps 
B D                     Human  gtgctttggacagg
B D                     Chimp  gtgctttggacagg
B D                   Gorilla  gtgctttggacagg
B D                 Orangutan  gtgctttggacagg
B D                    Gibbon  gtgctttggacagg
B D                    Rhesus  gtgctttggacagg
B D       Crab-eating macaque  gtgctttggacagg
B D                    Baboon  gtgctttggacagg
B D              Green monkey  gtgctttggacagg
B D                  Marmoset  gtgctttggacagg
B D           Squirrel monkey  gtgctttggacagg
B D                  Bushbaby  ctgcttaggttggg
           Chinese tree shrew  gtcgttaggacaga
B D                  Squirrel  atgcttagaacagg
B D                   Dolphin  gtgctcacg-----
                 Killer whale  gtgctcacg-----
             Tibetan antelope  gtgcttaca-----
B D                       Cow  gtgcttaca-----
B D                     Sheep  gtgcttaca-----
                Domestic goat  gtgcttaca-----
B D                     Horse  gtgcttacg-----
B D          White rhinoceros  atgcttagg-----
B D                       Cat  gtacttaga-----
B D                       Dog  gtgcttaga-----
B D                   Ferret   gtgcttaga-----
B D                     Panda  gtgcttaga-----
               Pacific walrus  gtgcttaga-----
                 Weddell seal  gtgcttaga-----
             Black flying-fox  gtgcttaag-----
B D                   Megabat  gtgcttaag-----
              Star-nosed mole  ----taaaa-----
B D                     Shrew  ==============
B D              Nile tilapia  ==============
                 Zebra mbuna  ==============
B D                 Tetraodon  --------------
B D               Stickleback  ==============
                 Spotted gar  ==============
         Pundamilia nyererei  ==============
       Burton's mouthbreeder  ==============
         Princess of Burundi  ==============
B D                      Fugu  ==============
B D                  Hedgehog  ==============
B D                Coelacanth  ==============
          Southern platyfish  ==============
B D              Atlantic cod  ==============
B D                    Medaka  ==============
B D                 Zebrafish  ==============
    Mexican tetra (cavefish)  ==============
      Yellowbelly pufferfish  ==============
B D             X. tropicalis  ==============
B D                      Pika  ==============
B D                    Rabbit  --------------
B D           Tasmanian devil  ==============
  D               Rock pigeon  ==============
  D    White-throated sparrow  ==============
  D             Scarlet macaw  ==============
  D                    Parrot  ==============
  D    Spiny softshell turtle  ==============
  D            Painted turtle  ==============
B D                  Platypus  ==============
               Big brown bat  ==============
B D                  Microbat  ==============
        David's myotis (bat)  ==============
B D                    Lizard  ==============
B D               Zebra finch  ==============
B D       Medium ground finch  ==============
  D       Collared flycatcher  ==============
  D  Chinese softshell turtle  ==============
  D              Saker falcon  --------------
  D           Green seaturtle  ==============
  D              Mallard duck  --------------
B D                Budgerigar  ==============
B D                    Turkey  ==============
B D                   Chicken  ==============
          Tibetan ground jay  ==============
B D                   Wallaby  ==============
B D        American alligator  ==============
B D                   Opossum  ==============
                Prairie vole  ==============
B D                    Tenrec  ==============
  D          Peregrine falcon  --------------
B D                 Armadillo  --------------
         Cape elephant shrew  ==============
                    Aardvark  --------------
            Cape golden mole  ==============
              Golden hamster  ==============
B D                       Rat  --------------
B D           Chinese hamster  ==============
              Bactrian camel  ==============
      Lesser Egyptian jerboa  --------------
B D                     Mouse  ==============
            Brush-tailed rat  ==============
B D                Guinea pig  ==============
B D            Naked mole-rat  ==============
                  Chinchilla  ==============
B D                   Manatee  ==============
B D                  Elephant  --------------
B D                    Alpaca  ==============
B D                       Pig  --------------

Inserts between block 1 and 2 in window
B D                 Bushbaby 349bp

Alignment block 2 of 27 in window, 182878019 - 182878020, 2 bps 
B D                     Human  ct
B D                     Chimp  ct
B D                   Gorilla  ct
B D                 Orangutan  ct
B D                    Gibbon  ct
B D                    Rhesus  ct
B D       Crab-eating macaque  ct
B D                    Baboon  ct
B D              Green monkey  ct
B D                  Marmoset  ct
B D           Squirrel monkey  ct
           Chinese tree shrew  tt
B D                  Squirrel  ca
B D                   Dolphin  ct
                 Killer whale  ct
             Tibetan antelope  ct
B D                       Cow  ct
B D                     Sheep  ct
                Domestic goat  ct
B D                     Horse  ct
B D          White rhinoceros  ct
B D                       Cat  ct
B D                       Dog  ct
B D                   Ferret   ct
B D                     Panda  ct
               Pacific walrus  ct
                 Weddell seal  ct
             Black flying-fox  ct
B D                   Megabat  ct
              Star-nosed mole  ca
B D                     Shrew  ==
B D              Nile tilapia  ==
                 Zebra mbuna  ==
B D                 Tetraodon  --
B D               Stickleback  ==
                 Spotted gar  ==
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                      Fugu  ==
B D                  Hedgehog  ==
B D                Coelacanth  ==
          Southern platyfish  ==
B D              Atlantic cod  ==
B D                    Medaka  ==
B D                 Zebrafish  ==
    Mexican tetra (cavefish)  ==
      Yellowbelly pufferfish  ==
B D             X. tropicalis  ==
B D                      Pika  ==
B D                    Rabbit  --
B D           Tasmanian devil  ==
  D               Rock pigeon  ==
  D    White-throated sparrow  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
  D    Spiny softshell turtle  ==
  D            Painted turtle  ==
B D                  Platypus  ==
               Big brown bat  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                    Lizard  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
  D              Saker falcon  --
  D           Green seaturtle  ==
  D              Mallard duck  --
B D                Budgerigar  ==
B D                    Turkey  ==
B D                   Chicken  ==
          Tibetan ground jay  ==
B D                   Wallaby  ==
B D        American alligator  ==
B D                   Opossum  ==
                Prairie vole  ==
B D                    Tenrec  ==
  D          Peregrine falcon  --
B D                 Armadillo  --
         Cape elephant shrew  ==
                    Aardvark  --
            Cape golden mole  ==
              Golden hamster  ==
B D                       Rat  --
B D           Chinese hamster  ==
              Bactrian camel  ==
      Lesser Egyptian jerboa  --
B D                     Mouse  ==
            Brush-tailed rat  ==
B D                Guinea pig  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
B D                   Manatee  ==
B D                  Elephant  --
B D                    Alpaca  ==
B D                       Pig  --
B D                  Bushbaby  ==

Alignment block 3 of 27 in window, 182878021 - 182878119, 99 bps 
B D                     Human  gaagaca-----ttgg------aggcagc-----acaagttgcc------------aaat-------aaa
B D                     Chimp  gaagaca-----ttgg------aggcagc-----acaagttgcc------------aaat-------aaa
B D                   Gorilla  gaagacg-----ttgg------aggcagc-----acaagttgcc------------aaat-------aaa
B D                 Orangutan  gaagaca-----ttgg------aggcagc-----acaagttgcc------------aaat-------aaa
B D                    Gibbon  gaagacg-----ttgg------aggcagg-----acaagttgcc------------aaat-------aaa
B D                    Rhesus  gaagaca-----ttgg------aggcagc-----acaagttgcc------------aaat-------aaa
B D       Crab-eating macaque  gaagaca-----ttgg------aggcagc-----acgagttgcc------------aaat-------aaa
B D                    Baboon  gaagaca-----ttgg------aggcagc-----acaagttgcc------------aaat-------aaa
B D              Green monkey  gaagaca-----ttgg------aggcagc-----acaagttgcc------------aaat-------aaa
B D                  Marmoset  gaagacg-----gtgg------agacagc-----acaaattgcc------------aaat-------aaa
B D           Squirrel monkey  gaagaca-----gtgg------agacagt-----acaaattgcc------------aaat-------aaa
B D                  Bushbaby  gaagaca-----ttgttccagcagctgga-----acaggctgc----------------t-------aaa
           Chinese tree shrew  aaagaca-----tggg------aggtagcgaggtaaaggttgaccttgtggcgtttacattttttcccaa
B D                  Squirrel  gaagaca-----ccgg-------cacagc-----ccaggtttct------------aaat----------
B D                   Dolphin  gaatgta-----ttgg------aggcagc-----agaggctgct------------aaat--------aa
                 Killer whale  gaatgta-----ttgg------aggcagc-----agaggctgct------------aaat--------aa
             Tibetan antelope  gaatgc------ctgt------agatagc-----aggggttgct------------aagt--------aa
B D                       Cow  gaatgt------ctgt------agatagc-----aggggttgcc------------aagt--------aa
B D                     Sheep  gaatgc------ctgt------agctagc-----aggggttgct------------aagt--------aa
                Domestic goat  gaatgc------ctgt------agatagc-----aggggttgct------------aagt--------aa
B D                     Horse  gaacaca-----ttgg------aggcagc-----acaggttgct------------aagt-------aaa
B D          White rhinoceros  gaaccca-----ttgg------aggcggc-----acaggttgct------------aagt-------caa
B D                       Cat  gaacaca-----ttgg------aagcagc-----aaaggttgct------------aaat-------aaa
B D                       Dog  gaacacaacatgttga------aggcagc-----acaggttgct------------aagt-------aaa
B D                   Ferret   gaacaca-----gtgg------agggagt-----acaggttgct------------aagt-------aaa
B D                     Panda  gaacaca-----ttgg------agggaac-----acaggttgct------------aagt-------aaa
               Pacific walrus  gaacgca-----ttgg------agggagc-----acaggttgct------------aagt-------aaa
                 Weddell seal  gaacgca-----tcgg------agggagc-----acaggttgct------------aagt-------aaa
             Black flying-fox  gcacata-----ttag------aggcagc-----acaggttgcc------------aagt-------aaa
B D                   Megabat  gcacata-----ttag------aggcagc-----acaggttgcc------------aagt-------aaa
              Star-nosed mole  gaagaca-----ttgg------cgaaaac-----acaggctgat------------aagc-------aaa
B D                     Shrew  ======================================================================
B D              Nile tilapia  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Tetraodon  ----------------------------------------------------------------------
B D               Stickleback  ======================================================================
                 Spotted gar  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                      Fugu  ======================================================================
B D                  Hedgehog  ======================================================================
B D                Coelacanth  ======================================================================
          Southern platyfish  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Medaka  ======================================================================
B D                 Zebrafish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                  Platypus  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                    Lizard  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Saker falcon  ----------------------------------------------------------------------
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ----------------------------------------------------------------------
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
                Prairie vole  ======================================================================
B D                    Tenrec  ======================================================================
  D          Peregrine falcon  ----------------------------------------------------------------------
B D                 Armadillo  ----------------------------------------------------------------------
         Cape elephant shrew  ======================================================================
                    Aardvark  ----------------------------------------------------------------------
            Cape golden mole  ======================================================================
              Golden hamster  ======================================================================
B D                       Rat  ----------------------------------------------------------------------
B D           Chinese hamster  ======================================================================
              Bactrian camel  ======================================================================
      Lesser Egyptian jerboa  ----------------------------------------------------------------------
B D                     Mouse  ======================================================================
            Brush-tailed rat  ======================================================================
B D                Guinea pig  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ----------------------------------------------------------------------
B D                    Alpaca  ======================================================================
B D                       Pig  ----------------------------------------------------------------------

                        Human  gtttg---------------------------------------------gccaatagggaa-gaaaa--
                        Chimp  gtttg---------------------------------------------gccaatagggaa-gaaaa--
                      Gorilla  gtttg---------------------------------------------gccaatagggaa-gaaaa--
                    Orangutan  gtttg---------------------------------------------gccaatagggaa-gaaaa--
                       Gibbon  gtttg---------------------------------------------gccaatagggaa-gaaaa--
                       Rhesus  gtttg---------------------------------------------gccaatagggaa-gaaaa--
          Crab-eating macaque  gtttg---------------------------------------------gccaatagggaa-gaaaa--
                       Baboon  gtttg---------------------------------------------gccaatagggaa-gaaaa--
                 Green monkey  gtttg---------------------------------------------gccaatagggaa-gaaaa--
                     Marmoset  gtgtg---------------------------------------------gctgatagggaa-gaaaaat
              Squirrel monkey  gtttg---------------------------------------------gccaataggaaa-gaaaaat
                     Bushbaby  gtttg---------------------------------------------gacagtagaaaa-gaaaaat
           Chinese tree shrew  gtttgtgtattccgtgaaagagggagacagagagagagaaagacacccccaacagtaaggta-ggaaa--
                     Squirrel  --------------------------------------------------------agggaa-caaaa--
                      Dolphin  gttca---------------------------------------------gccaacagggag-gaaga--
                 Killer whale  gttca---------------------------------------------gccaacagggag-gaaga--
             Tibetan antelope  gttca---------------------------------------------gccaacagagag-gaaaa--
                          Cow  gttca---------------------------------------------gccaacagagag-gaaaa--
                        Sheep  gttca---------------------------------------------gccaacagagag-gaaaa--
                Domestic goat  gttca---------------------------------------------gccaacagagag-gaaaa--
                        Horse  gtttg---------------------------------------------gccaccagggag-gaaaa--
             White rhinoceros  atttg---------------------------------------------gcctatggggag-gaaaa--
                          Cat  gtttg---------------------------------------------gccaatagggag-gaaaa--
                          Dog  gttta---------------------------------------------gccagtagggaa-gaaaa--
                      Ferret   atttg---------------------------------------------gccaatagggagaaaaaa--
                        Panda  gtttg---------------------------------------------gccaatagggag-gaaga--
               Pacific walrus  gattg---------------------------------------------accagtagggag-gaaaa--
                 Weddell seal  gattg---------------------------------------------gccagtaggtag-gaaaa--
             Black flying-fox  gtttg---------------------------------------------ccctatagggag-gaaaa--
                      Megabat  gtttg---------------------------------------------ccctatagggag-gaaaa--
              Star-nosed mole  gttgg---------------------------------------------accagtaaggaa-gaaaa--
                        Shrew  ======================================================================
                 Nile tilapia  ======================================================================
                  Zebra mbuna  ======================================================================
                    Tetraodon  ----------------------------------------------------------------------
                  Stickleback  ======================================================================
                  Spotted gar  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                         Fugu  ======================================================================
                     Hedgehog  ======================================================================
                   Coelacanth  ======================================================================
           Southern platyfish  ======================================================================
                 Atlantic cod  ======================================================================
                       Medaka  ======================================================================
                    Zebrafish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                X. tropicalis  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
                Scarlet macaw  ======================================================================
                       Parrot  ======================================================================
       Spiny softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                     Platypus  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                       Lizard  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ----------------------------------------------------------------------
              Green seaturtle  ======================================================================
                 Mallard duck  ----------------------------------------------------------------------
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
           Tibetan ground jay  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
             Peregrine falcon  ----------------------------------------------------------------------
                    Armadillo  ----------------------------------------------------------------------
          Cape elephant shrew  ======================================================================
                     Aardvark  ----------------------------------------------------------------------
             Cape golden mole  ======================================================================
               Golden hamster  ======================================================================
                          Rat  ----------------------------------------------------------------------
              Chinese hamster  ======================================================================
               Bactrian camel  ======================================================================
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
                   Guinea pig  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ----------------------------------------------------------------------
                       Alpaca  ======================================================================
                          Pig  ----------------------------------------------------------------------

                        Human  -------------------------------attgtctatataggtgttgatttcagatattggagag-t
                        Chimp  -------------------------------attgtctatataggtgttgatttcagatattggagag-t
                      Gorilla  -------------------------------attgtctatataggtgttgatttcagatattggagag-t
                    Orangutan  -------------------------------attgtctatataggtgttgatttcagatattagagag-t
                       Gibbon  -------------------------------attgtctatatagatgttgatttcagatactggagag-t
                       Rhesus  -------------------------------gtagtctatataggtgttgatttcagatattggagaa-t
          Crab-eating macaque  -------------------------------gtagtctatataggtgttgatttcagatattggagaa-t
                       Baboon  -------------------------------gtagtctatataggtgttgatttcagatattggagaa-t
                 Green monkey  -------------------------------gtagtctatataggtgttgatttcagatattggagaa-t
                     Marmoset  ctgattataaaaaatggcaaaatattgtgctatagtcaatataggtgttgattccagatattggagag-t
              Squirrel monkey  ctgattataaaaagtcataaaatattgtgctatagtcaatataggtgttgatttcagatattggagaa-t
                     Bushbaby  -------------------------------gtagtcaacataggtgttggtttcagatatgggaggc-t
           Chinese tree shrew  -------------------------------agagtcaaggta------gatttcagatataaaagaa--
                     Squirrel  -------------------------------tcagtcagcataggtgttctgtttagttattggagat-t
                      Dolphin  -------------------------------at----agtttaggtgctgattttggatattggagaa-t
                 Killer whale  -------------------------------at----agtttaggtgctgattttggatattggagaa-t
             Tibetan antelope  -------------------------------atagtcagtttagatgctgatttcgggtattggagaa-t
                          Cow  -------------------------------atagtcattttagatgctgatttcaggtattggagaa-t
                        Sheep  -------------------------------at----agtttagatgctgatttcaagtattggagaa-t
                Domestic goat  -------------------------------atagtcagtttaggtgctgatttcgggtattggagaa-t
                        Horse  -------------------------------acagtcactgtaggtgctgatttcagatattagagaa-t
             White rhinoceros  -------------------------------acagtcaatgtaggtgctgatttcagatattgaagaa-t
                          Cat  -------------------------------acagtcagtgt-ggtgttgctttcaggtacatgacaa-t
                          Dog  -------------------------------acagtcaatgt-ggtagtgctttcagatactagaaaa-t
                      Ferret   -------------------------------acagtcagtgt-ggtgttgctttcaaatactgggcaa-t
                        Panda  -------------------------------acagtcagtgt-ggtgttactctcagatactaggcaa-t
               Pacific walrus  -------------------------------acagtcaatgt-ggtgttgctttcagatactgggcaa-t
                 Weddell seal  -------------------------------acagtcaatgt-ggtgttgctttcagatactgggcaa-t
             Black flying-fox  -------------------------------acag----tgtaggtgctgatttcagatttcggagaatt
                      Megabat  -------------------------------acag----tgtaggtgctgatttcagatttcggagaa-t
              Star-nosed mole  -------------------------------aa---------------ccatttcagatattggagca-t
                        Shrew  ======================================================================
                 Nile tilapia  ======================================================================
                  Zebra mbuna  ======================================================================
                    Tetraodon  ----------------------------------------------------------------------
                  Stickleback  ======================================================================
                  Spotted gar  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                         Fugu  ======================================================================
                     Hedgehog  ======================================================================
                   Coelacanth  ======================================================================
           Southern platyfish  ======================================================================
                 Atlantic cod  ======================================================================
                       Medaka  ======================================================================
                    Zebrafish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                X. tropicalis  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
                Scarlet macaw  ======================================================================
                       Parrot  ======================================================================
       Spiny softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                     Platypus  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                       Lizard  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ----------------------------------------------------------------------
              Green seaturtle  ======================================================================
                 Mallard duck  ----------------------------------------------------------------------
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
           Tibetan ground jay  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
             Peregrine falcon  ----------------------------------------------------------------------
                    Armadillo  ----------------------------------------------------------------------
          Cape elephant shrew  ======================================================================
                     Aardvark  ----------------------------------------------------------------------
             Cape golden mole  ======================================================================
               Golden hamster  ======================================================================
                          Rat  ----------------------------------------------------------------------
              Chinese hamster  ======================================================================
               Bactrian camel  ======================================================================
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
                   Guinea pig  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ----------------------------------------------------------------------
                       Alpaca  ======================================================================
                          Pig  ----------------------------------------------------------------------

                        Human  tagt
                        Chimp  tagt
                      Gorilla  tagt
                    Orangutan  tagt
                       Gibbon  taat
                       Rhesus  tagt
          Crab-eating macaque  tagt
                       Baboon  tagt
                 Green monkey  tagt
                     Marmoset  tagt
              Squirrel monkey  tagt
                     Bushbaby  caat
           Chinese tree shrew  ----
                     Squirrel  aagt
                      Dolphin  tatt
                 Killer whale  tatt
             Tibetan antelope  tgat
                          Cow  tgat
                        Sheep  tgat
                Domestic goat  tgat
                        Horse  taat
             White rhinoceros  taat
                          Cat  taat
                          Dog  taat
                      Ferret   tgat
                        Panda  taat
               Pacific walrus  taat
                 Weddell seal  taat
             Black flying-fox  taat
                      Megabat  taat
              Star-nosed mole  tatt
                        Shrew  ====
                 Nile tilapia  ====
                  Zebra mbuna  ====
                    Tetraodon  ----
                  Stickleback  ====
                  Spotted gar  ====
          Pundamilia nyererei  ====
        Burton's mouthbreeder  ====
          Princess of Burundi  ====
                         Fugu  ====
                     Hedgehog  ====
                   Coelacanth  ====
           Southern platyfish  ====
                 Atlantic cod  ====
                       Medaka  ====
                    Zebrafish  ====
     Mexican tetra (cavefish)  ====
       Yellowbelly pufferfish  ====
                X. tropicalis  ====
                         Pika  ====
                       Rabbit  ----
              Tasmanian devil  ====
                  Rock pigeon  ====
       White-throated sparrow  ====
                Scarlet macaw  ====
                       Parrot  ====
       Spiny softshell turtle  ====
               Painted turtle  ====
                     Platypus  ====
                Big brown bat  ====
                     Microbat  ====
         David's myotis (bat)  ====
                       Lizard  ====
                  Zebra finch  ====
          Medium ground finch  ====
          Collared flycatcher  ====
     Chinese softshell turtle  ====
                 Saker falcon  ----
              Green seaturtle  ====
                 Mallard duck  ----
                   Budgerigar  ====
                       Turkey  ====
                      Chicken  ====
           Tibetan ground jay  ====
                      Wallaby  ====
           American alligator  ====
                      Opossum  ====
                 Prairie vole  ====
                       Tenrec  ====
             Peregrine falcon  ----
                    Armadillo  ----
          Cape elephant shrew  ====
                     Aardvark  ----
             Cape golden mole  ====
               Golden hamster  ====
                          Rat  ----
              Chinese hamster  ====
               Bactrian camel  ====
       Lesser Egyptian jerboa  ----
                        Mouse  ====
             Brush-tailed rat  ====
                   Guinea pig  ====
               Naked mole-rat  ====
                   Chinchilla  ====
                      Manatee  ====
                     Elephant  ----
                       Alpaca  ====
                          Pig  ----

Inserts between block 3 and 4 in window
B D                 Bushbaby 314bp

Alignment block 4 of 27 in window, 182878120 - 182878125, 6 bps 
B D                     Human  agtaat
B D                     Chimp  aataat
B D                   Gorilla  aataat
B D                 Orangutan  aataat
B D                    Gibbon  aataat
B D                    Rhesus  aataat
B D       Crab-eating macaque  aataat
B D                    Baboon  aataat
B D              Green monkey  aataat
B D                  Marmoset  cataat
B D           Squirrel monkey  cata--
B D                  Bushbaby  aataaa
B D                  Squirrel  ---aaa
B D                   Dolphin  ----aa
                 Killer whale  ----aa
             Tibetan antelope  ----aa
B D                       Cow  ----aa
B D                     Sheep  ----aa
                Domestic goat  ----aa
B D                     Horse  ----aa
B D          White rhinoceros  ----aa
B D                       Cat  ----aa
B D                       Dog  ----aa
B D                   Ferret   ----aa
B D                     Panda  ----aa
               Pacific walrus  ----aa
                 Weddell seal  ----aa
             Black flying-fox  ----aa
B D                   Megabat  ----aa
              Star-nosed mole  ----ta
B D                     Shrew  ======
B D              Nile tilapia  ======
                 Zebra mbuna  ======
B D                 Tetraodon  ------
B D               Stickleback  ======
                 Spotted gar  ======
         Pundamilia nyererei  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D                      Fugu  ======
B D                  Hedgehog  ======
B D                Coelacanth  ======
          Southern platyfish  ======
B D              Atlantic cod  ======
B D                    Medaka  ======
B D                 Zebrafish  ======
    Mexican tetra (cavefish)  ======
      Yellowbelly pufferfish  ======
B D             X. tropicalis  ======
B D                      Pika  ======
B D                    Rabbit  ------
B D           Tasmanian devil  ======
  D               Rock pigeon  ======
  D    White-throated sparrow  ======
  D             Scarlet macaw  ======
  D                    Parrot  ======
  D    Spiny softshell turtle  ======
  D            Painted turtle  ======
B D                  Platypus  ======
               Big brown bat  ======
B D                  Microbat  ======
        David's myotis (bat)  ======
B D                    Lizard  ======
B D               Zebra finch  ======
B D       Medium ground finch  ======
  D       Collared flycatcher  ======
  D  Chinese softshell turtle  ======
  D              Saker falcon  ------
  D           Green seaturtle  ======
  D              Mallard duck  ------
B D                Budgerigar  ======
B D                    Turkey  ======
B D                   Chicken  ======
          Tibetan ground jay  ======
B D                   Wallaby  ======
B D        American alligator  ======
B D                   Opossum  ======
                Prairie vole  ======
B D                    Tenrec  ======
  D          Peregrine falcon  ------
B D                 Armadillo  ------
         Cape elephant shrew  ======
                    Aardvark  ------
            Cape golden mole  ======
              Golden hamster  ======
B D                       Rat  ------
B D           Chinese hamster  ======
              Bactrian camel  ======
      Lesser Egyptian jerboa  ------
B D                     Mouse  ======
            Brush-tailed rat  ======
B D                Guinea pig  ======
B D            Naked mole-rat  ======
                  Chinchilla  ======
B D                   Manatee  ======
B D                  Elephant  ------
          Chinese tree shrew  ------
B D                    Alpaca  ======
B D                       Pig  ------

Alignment block 5 of 27 in window, 182878126 - 182878171, 46 bps 
B D                     Human  g--------aga-aaa---atacattttataa---------------aact-tt-----atggtat-aaa
B D                     Chimp  g--------aga-aaa---atacattttataa---------------aact-tt-----atggtat-aaa
B D                   Gorilla  g--------aga-aaa---atacattttataa---------------aact-tt-----atggtat-aaa
B D                 Orangutan  g--------aga-aaa---atacattttataa---------------aact-tt-----atggtgt-aaa
B D                    Gibbon  g--------aga-aaa---atacattttataa---------------aact-tt-----atggtgt-aaa
B D                    Rhesus  g--------aga-aaa---atacattttataa---------------aact-tt-----atggtgt-aaa
B D       Crab-eating macaque  g--------aga-aaa---atacattttataa---------------aact-tt-----atggtgt-aaa
B D                    Baboon  g--------aga-aaa---atacattttataa---------------aact-tt-----atggtgt-aaa
B D              Green monkey  g--------aga-aaa---atacattttataa---------------aact-tt-----atggtgt-aaa
B D                  Marmoset  g--------aga-aaa---ctacattttataa---------------aatt-gt-----atgctgt-aaa
B D           Squirrel monkey  ---------aga-aaa---ttacattttatga---------------aatt-ct-----gtgctgt-aaa
B D                  Bushbaby  t--------aaa-caa---ataaat------a---------------attt-tt-----gtgatgt-aaa
           Chinese tree shrew  g--------aaa-aaa---atacatttttaaa---------------atgtatt-----atgatgt-aaa
B D                  Squirrel  g--------gga-aaatatagacattttaaag---------------attt-tc-----atggtgt-gga
B D                   Dolphin  a--------aga-aat---atacatttttta----------------aatt-tt-----atgttgt-gaa
                 Killer whale  a--------aga-aat---atacatttttta----------------aatt-tt-----atgttgt-gaa
             Tibetan antelope  a--------gga-agt---atacatttttta----------------aaat-tt-----atattgt-aaa
B D                       Cow  a--------gga-agt---atacattttttt----------------aagt-tt-----atattgtaaaa
B D                     Sheep  a--------gga-agt---atacattttttt----------------aaat-tt-----atattgt-aaa
                Domestic goat  a--------gga-agt---atacattttttta---------------aaat-tt-----atattgt-aaa
B D                     Horse  a----gaaaaga-aaa---atatatttttaagaaatttacgtcataaaagt-tt-----atgttat-aaa
B D          White rhinoceros  a----aaaaaaagaaa---aaacatttttaag---------------aagc-tt-----atgttat-aaa
B D                       Cat  a---------ga-aaa---atacatttttgaa---------------aagt-tt-----atgttgt-aaa
B D                       Dog  a--------aga-aaa---atacattttttag---------------aatt-tt-----acattgt-aaa
B D                   Ferret   a--------aga-aaa---atacattttttaa---------------aatt-tc-----acattat-aaa
B D                     Panda  a--------ata-aaa---atacatttttaaa---------------aatt-tt-----acattgt-gaa
               Pacific walrus  c----------a-aaa---atacattttttaa---------------aatt-tt-----acattgt-aaa
                 Weddell seal  c--------aga-aaa---atacattctttaa---------------aatt-tt-----acattgt-aaa
             Black flying-fox  a-------ggaa-aaa---atacatttttaaa---------------aaat-tt-----atgttgt-aaa
B D                   Megabat  a-------ggaa-aaa---atacatttttaaa---------------aaat-tt-----atgttgt-aaa
              Star-nosed mole  aaaaaaaaaaaa-aaa---aggcctttttta----------------aagt-tt-------gttat-aaa
B D                 Armadillo  ------gagaaa-aaa---atacgttaaaaaa---------------aatt-ttcttttatgatct-aag
B D                     Shrew  ======================================================================
B D              Nile tilapia  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Tetraodon  ----------------------------------------------------------------------
B D               Stickleback  ======================================================================
                 Spotted gar  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                      Fugu  ======================================================================
B D                  Hedgehog  ======================================================================
B D                Coelacanth  ======================================================================
          Southern platyfish  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Medaka  ======================================================================
B D                 Zebrafish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                  Platypus  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                    Lizard  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Saker falcon  ----------------------------------------------------------------------
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ----------------------------------------------------------------------
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
                Prairie vole  ======================================================================
B D                    Tenrec  ======================================================================
  D          Peregrine falcon  ----------------------------------------------------------------------
         Cape elephant shrew  ======================================================================
                    Aardvark  ----------------------------------------------------------------------
            Cape golden mole  ======================================================================
              Golden hamster  ======================================================================
B D                       Rat  ----------------------------------------------------------------------
B D           Chinese hamster  ======================================================================
              Bactrian camel  ======================================================================
      Lesser Egyptian jerboa  ----------------------------------------------------------------------
B D                     Mouse  ======================================================================
            Brush-tailed rat  ======================================================================
B D                Guinea pig  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ----------------------------------------------------------------------
B D                    Alpaca  ======================================================================
B D                       Pig  ----------------------------------------------------------------------

                        Human  -gtgaattgct
                        Chimp  -gtgaattgct
                      Gorilla  -gtgaattgct
                    Orangutan  -gtgaattgct
                       Gibbon  -gtgaattgct
                       Rhesus  -gtgaattgct
          Crab-eating macaque  -gtgaattgct
                       Baboon  -gtgaattgct
                 Green monkey  -gtgaattgct
                     Marmoset  -gtgaattgct
              Squirrel monkey  -gtgaattgct
                     Bushbaby  -ctgaattagt
           Chinese tree shrew  -gtgacttgct
                     Squirrel  -atacattgcc
                      Dolphin  tg----ttgtt
                 Killer whale  tg----ttgtt
             Tibetan antelope  tgttaattgct
                          Cow  tgttcattgct
                        Sheep  tgttaattgct
                Domestic goat  tgttcattgct
                        Horse  aggcaattttt
             White rhinoceros  agtgaattggt
                          Cat  agataattgtt
                          Dog  aggtaattgtt
                      Ferret   atataatcatt
                        Panda  agataattgtt
               Pacific walrus  agataattgtt
                 Weddell seal  agataattgtt
             Black flying-fox  tgtgaattgtt
                      Megabat  tgtgaattgtt
              Star-nosed mole  agtcaattgat
                    Armadillo  -aggaattgct
                        Shrew  ===========
                 Nile tilapia  ===========
                  Zebra mbuna  ===========
                    Tetraodon  -----------
                  Stickleback  ===========
                  Spotted gar  ===========
          Pundamilia nyererei  ===========
        Burton's mouthbreeder  ===========
          Princess of Burundi  ===========
                         Fugu  ===========
                     Hedgehog  ===========
                   Coelacanth  ===========
           Southern platyfish  ===========
                 Atlantic cod  ===========
                       Medaka  ===========
                    Zebrafish  ===========
     Mexican tetra (cavefish)  ===========
       Yellowbelly pufferfish  ===========
                X. tropicalis  ===========
                         Pika  ===========
                       Rabbit  -----------
              Tasmanian devil  ===========
                  Rock pigeon  ===========
       White-throated sparrow  ===========
                Scarlet macaw  ===========
                       Parrot  ===========
       Spiny softshell turtle  ===========
               Painted turtle  ===========
                     Platypus  ===========
                Big brown bat  ===========
                     Microbat  ===========
         David's myotis (bat)  ===========
                       Lizard  ===========
                  Zebra finch  ===========
          Medium ground finch  ===========
          Collared flycatcher  ===========
     Chinese softshell turtle  ===========
                 Saker falcon  -----------
              Green seaturtle  ===========
                 Mallard duck  -----------
                   Budgerigar  ===========
                       Turkey  ===========
                      Chicken  ===========
           Tibetan ground jay  ===========
                      Wallaby  ===========
           American alligator  ===========
                      Opossum  ===========
                 Prairie vole  ===========
                       Tenrec  ===========
             Peregrine falcon  -----------
          Cape elephant shrew  ===========
                     Aardvark  -----------
             Cape golden mole  ===========
               Golden hamster  ===========
                          Rat  -----------
              Chinese hamster  ===========
               Bactrian camel  ===========
       Lesser Egyptian jerboa  -----------
                        Mouse  ===========
             Brush-tailed rat  ===========
                   Guinea pig  ===========
               Naked mole-rat  ===========
                   Chinchilla  ===========
                      Manatee  ===========
                     Elephant  -----------
                       Alpaca  ===========
                          Pig  -----------

Alignment block 6 of 27 in window, 182878172 - 182878233, 62 bps 
B D                     Human  taccactta-tagctacagtac--------aacacaacagtgattaggcatactatgaaagacattgctt
B D                     Chimp  taccactta-cagctacagtac--------aacacaacagtgattaggcatactatgaaagacattgctt
B D                   Gorilla  taccactta-cagctacagtac--------aacgcaacagtgattaggcatactatgaaagacattgctt
B D                 Orangutan  taccactta-tagctacagtac--------aacacaacagtgattaggcatactatgaaagacattgctt
B D                    Gibbon  taccactta-tagctacagtac--------aacacaacagtgattaggcatactatgaaagacattgctt
B D                    Rhesus  ------tta-tagctatagtac--------aacacaacagtgattaggcatactatgaaagacattgctt
B D       Crab-eating macaque  ------tta-tagctatagtac--------aacacaacagtgattaggcatactatgaaagacattgctt
B D                    Baboon  ------tta-tagctatagtac--------aacacaacagtgattaggcatactatgaaagacattgctt
B D              Green monkey  ------tta-tagctatagtac--------aacacaacagtgattaggcatactatgaaagacattgctt
B D                  Marmoset  taccactta-ctactgtagcac--------aacccaacagtgattaggcatcctatgaaagacatcacct
B D           Squirrel monkey  taccactta-ttactatagcac--------aacccaacagtgattaggcatactatgaaagacatcacct
B D                  Bushbaby  -------------------tgc--------cacacaagagtgattaggc-----atgaaagacaccactt
           Chinese tree shrew  taccactta-------------------------------------------ctagttaatacatccttt
B D                  Squirrel  ----------taaatgaaatgc--------aacacaataatgattagacagaatacaaaaggcatccttt
B D                   Dolphin  taccacttattagttgtagtgc--------aacacagtagttgttaggcatactgtgaaagacataattt
                 Killer whale  taccacttattagttgtagtgc--------aacacagtagttgttaggcatactatgaaagacataattt
             Tibetan antelope  ttccacttacta--tacagtac--------aacactatagttactaggcgtattgtg-aagacatcattt
B D                       Cow  ttccacttacta--tacagtgc--------aacac--tagttactaggcatattatg-aagacatcattt
B D                     Sheep  ttccacttacta--tacagtac--------aacactatagttactaggtgtactgtg-aagacatcattt
                Domestic goat  ttccacttacta--tacagtgc--------aacactatagttactaggcgtactgtg-aagacatcattt
B D                     Horse  taccactttttagttacagtgc--------aacacagcagtgattaggcatagtatgaaagacatcattt
B D          White rhinoceros  taccacttattaattacagtgc--------agtacaacagtgattaggcata-----------------t
B D                       Cat  taccacttattagttacagtgc--------aacacagtagtgattaggcatactgtgaaagacatcattt
B D                       Dog  gaccacttattagttactgtgc--------aacacagtagtgattaggcatactgtaaaagacatcattt
B D                   Ferret   gaatgcttattggttatagtgc--------aacacaatagtgataaggcatactgtgaaagacatcattt
B D                     Panda  gaccacttattagttacagtgc--------cacacaatagtgattaggcatactgtgaaagacattattt
               Pacific walrus  gaccacttattagttacagtgc--------aacacagtggtgataaggcatactgtgaaagacatcattt
                 Weddell seal  gaccacttattagttacagtgc--------aacacaatagtgataaggcatactgtgaaagacatcattt
             Black flying-fox  ta-cacttattagttacagtgc--------aacacagtagtgattaggcatactatgaaag-----attt
B D                   Megabat  ta-cacttgttagttacagtgc--------aacacagtagtgattaggcatactatgaaag-----attt
              Star-nosed mole  tatcacttattatttataatat--------gatataatggtgattaggcatactgtaaaaggcatcactt
          Cape elephant shrew  tattacctg-tggctaccttgccggtaccttcctcaatagttatgacagagactctgaaaggtactgtta
B D                 Armadillo  ---taccac-ttactgcagtgc--------------------------------------agcatagtaa
B D                     Shrew  ======================================================================
B D              Nile tilapia  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Tetraodon  ----------------------------------------------------------------------
B D               Stickleback  ======================================================================
                 Spotted gar  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                      Fugu  ======================================================================
B D                  Hedgehog  ======================================================================
B D                Coelacanth  ======================================================================
          Southern platyfish  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Medaka  ======================================================================
B D                 Zebrafish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                  Platypus  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                    Lizard  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Saker falcon  ----------------------------------------------------------------------
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ----------------------------------------------------------------------
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
                Prairie vole  ======================================================================
B D                    Tenrec  ======================================================================
  D          Peregrine falcon  ----------------------------------------------------------------------
                    Aardvark  ----------------------------------------------------------------------
            Cape golden mole  ======================================================================
              Golden hamster  ======================================================================
B D                       Rat  ----------------------------------------------------------------------
B D           Chinese hamster  ======================================================================
              Bactrian camel  ======================================================================
      Lesser Egyptian jerboa  ----------------------------------------------------------------------
B D                     Mouse  ======================================================================
            Brush-tailed rat  ======================================================================
B D                Guinea pig  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ----------------------------------------------------------------------
B D                    Alpaca  ======================================================================
B D                       Pig  ----------------------------------------------------------------------

                        Human  t
                        Chimp  t
                      Gorilla  t
                    Orangutan  t
                       Gibbon  t
                       Rhesus  t
          Crab-eating macaque  t
                       Baboon  t
                 Green monkey  t
                     Marmoset  t
              Squirrel monkey  t
                     Bushbaby  t
           Chinese tree shrew  t
                     Squirrel  t
                      Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
                          Cow  t
                        Sheep  t
                Domestic goat  t
                        Horse  t
             White rhinoceros  t
                          Cat  t
                          Dog  t
                      Ferret   t
                        Panda  a
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
                      Megabat  t
              Star-nosed mole  t
          Cape elephant shrew  t
                    Armadillo  c
                        Shrew  =
                 Nile tilapia  =
                  Zebra mbuna  =
                    Tetraodon  -
                  Stickleback  =
                  Spotted gar  =
          Pundamilia nyererei  =
        Burton's mouthbreeder  =
          Princess of Burundi  =
                         Fugu  =
                     Hedgehog  =
                   Coelacanth  =
           Southern platyfish  =
                 Atlantic cod  =
                       Medaka  =
                    Zebrafish  =
     Mexican tetra (cavefish)  =
       Yellowbelly pufferfish  =
                X. tropicalis  =
                         Pika  =
                       Rabbit  -
              Tasmanian devil  =
                  Rock pigeon  =
       White-throated sparrow  =
                Scarlet macaw  =
                       Parrot  =
       Spiny softshell turtle  =
               Painted turtle  =
                     Platypus  =
                Big brown bat  =
                     Microbat  =
         David's myotis (bat)  =
                       Lizard  =
                  Zebra finch  =
          Medium ground finch  =
          Collared flycatcher  =
     Chinese softshell turtle  =
                 Saker falcon  -
              Green seaturtle  =
                 Mallard duck  -
                   Budgerigar  =
                       Turkey  =
                      Chicken  =
           Tibetan ground jay  =
                      Wallaby  =
           American alligator  =
                      Opossum  =
                 Prairie vole  =
                       Tenrec  =
             Peregrine falcon  -
                     Aardvark  -
             Cape golden mole  =
               Golden hamster  =
                          Rat  -
              Chinese hamster  =
               Bactrian camel  =
       Lesser Egyptian jerboa  -
                        Mouse  =
             Brush-tailed rat  =
                   Guinea pig  =
               Naked mole-rat  =
                   Chinchilla  =
                      Manatee  =
                     Elephant  -
                       Alpaca  =
                          Pig  -

Inserts between block 6 and 7 in window
                Killer whale 255bp

Alignment block 7 of 27 in window, 182878234 - 182878249, 16 bps 
B D                     Human  aactt----acga-aag---tttc
B D                     Chimp  aactt----acga-aag---tttc
B D                   Gorilla  aactt----atga-aag---tttc
B D                 Orangutan  aactt----acg---ag---tttc
B D                    Gibbon  aactt----acga-aag---tttc
B D                    Rhesus  aactt----atga-aag---tttc
B D       Crab-eating macaque  aactt----atga-aag---tttc
B D                    Baboon  aactt----atga-aag---tttc
B D              Green monkey  aactt----atga-aag---tttc
B D                  Marmoset  aactt----acaa-aag---tttt
B D           Squirrel monkey  aactt----acaa-aaa---tttt
B D                  Bushbaby  aacttggtgaaaa-aaa---tttc
           Chinese tree shrew  aactt----actt-agg---tgtc
B D                  Squirrel  aactt----atga-aagatttttc
B D                   Dolphin  aactt----acagaaaa---gaat
             Tibetan antelope  aactt----acagaaaa---gatt
B D                       Cow  aactt----acagaaaa---aatt
B D                     Sheep  aactt----acag-aaa---aatt
                Domestic goat  aactt----acag-aaa---actt
B D                     Horse  aattc----aaaa-gat----ttt
B D          White rhinoceros  aactt----ataa-aac---attt
B D                       Cat  gactt----ataa-aag--ctttt
B D                       Dog  agctc---------aag---tttt
B D                   Ferret   aactc----acaa-aga---tttt
B D                     Panda  aactc------aa-aat---attt
               Pacific walrus  agctc----ataa-aag---attt
                 Weddell seal  agctg----ataa-aag---atat
             Black flying-fox  aattt----ataa-atg---tctt
B D                   Megabat  aattt----ataa-atg---tctt
              Star-nosed mole  aactt----ttc------------
          Cape elephant shrew  cattt----cag------------
B D                 Armadillo  gattt----ata------------
B D                     Shrew  ========================
B D              Nile tilapia  ========================
                 Zebra mbuna  ========================
B D                 Tetraodon  ------------------------
B D               Stickleback  ========================
                 Spotted gar  ========================
         Pundamilia nyererei  ========================
       Burton's mouthbreeder  ========================
         Princess of Burundi  ========================
B D                      Fugu  ========================
B D                  Hedgehog  ========================
B D                Coelacanth  ========================
          Southern platyfish  ========================
B D              Atlantic cod  ========================
B D                    Medaka  ========================
B D                 Zebrafish  ========================
    Mexican tetra (cavefish)  ========================
      Yellowbelly pufferfish  ========================
B D             X. tropicalis  ========================
B D                      Pika  ========================
B D                    Rabbit  ------------------------
B D           Tasmanian devil  ========================
  D               Rock pigeon  ========================
  D    White-throated sparrow  ========================
  D             Scarlet macaw  ========================
  D                    Parrot  ========================
  D    Spiny softshell turtle  ========================
  D            Painted turtle  ========================
B D                  Platypus  ========================
               Big brown bat  ========================
B D                  Microbat  ========================
        David's myotis (bat)  ========================
B D                    Lizard  ========================
B D               Zebra finch  ========================
B D       Medium ground finch  ========================
  D       Collared flycatcher  ========================
  D  Chinese softshell turtle  ========================
  D              Saker falcon  ------------------------
  D           Green seaturtle  ========================
  D              Mallard duck  ------------------------
B D                Budgerigar  ========================
B D                    Turkey  ========================
B D                   Chicken  ========================
          Tibetan ground jay  ========================
B D                   Wallaby  ========================
B D        American alligator  ========================
B D                   Opossum  ========================
                Prairie vole  ========================
B D                    Tenrec  ========================
  D          Peregrine falcon  ------------------------
                    Aardvark  ------------------------
            Cape golden mole  ========================
              Golden hamster  ========================
B D                       Rat  ------------------------
B D           Chinese hamster  ========================
              Bactrian camel  ========================
      Lesser Egyptian jerboa  ------------------------
B D                     Mouse  ========================
            Brush-tailed rat  ========================
B D                Guinea pig  ========================
B D            Naked mole-rat  ========================
                  Chinchilla  ========================
B D                   Manatee  ========================
B D                  Elephant  ------------------------
B D                    Alpaca  ========================
                Killer whale  ========================
B D                       Pig  ------------------------

Inserts between block 7 and 8 in window
B D                   Rhesus 3bp
B D      Crab-eating macaque 3bp
B D                   Baboon 3bp
B D             Green monkey 3bp
B D                 Marmoset 2bp
B D          Squirrel monkey 2bp
B D                 Bushbaby 2bp
          Chinese tree shrew 9bp
B D                 Squirrel 2bp
B D                  Dolphin 6bp
            Tibetan antelope 6bp
B D                      Cow 6bp
B D                    Sheep 6bp
               Domestic goat 6bp
B D                    Horse 8bp
B D         White rhinoceros 8bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 30bp
B D                  Megabat 30bp
             Star-nosed mole 1bp

Alignment block 8 of 27 in window, 182878250 - 182878260, 11 bps 
B D                     Human  ttat-----aagacta
B D                     Chimp  ttat-----aagacta
B D                   Gorilla  ttat-----aagacta
B D                 Orangutan  ttat-----aagacta
B D                    Gibbon  ttac-----aagacta
B D                    Rhesus  ttat-----aagacta
B D       Crab-eating macaque  ttat-----aagacta
B D                    Baboon  ttat-----aagac--
B D              Green monkey  ttat-----aagatta
B D                  Marmoset  ttat-----gagacta
B D           Squirrel monkey  ttat-----aagacta
B D                  Bushbaby  ttac-----gagacta
           Chinese tree shrew  ctct-----tagtcca
B D                  Squirrel  ttat-----aagacta
B D                   Dolphin  ttat-----aagacaa
                 Killer whale  ttat-----aagacaa
             Tibetan antelope  ttag-----gagactg
B D                       Cow  ttag-----gagactg
B D                     Sheep  ttag-----gagactg
                Domestic goat  ttag-----gagactg
B D                     Horse  ttac-----aagactg
B D          White rhinoceros  ttaa-----aagactg
B D                       Cat  ttgt-----aagacta
B D                       Dog  ttat-----aagacta
B D                   Ferret   ttat-----aagacta
B D                     Panda  ttat-----aagacta
               Pacific walrus  ttat-----aagacta
                 Weddell seal  ttat-----aagacta
             Black flying-fox  ttgg-----aagacta
B D                   Megabat  ttgg-----aagacta
              Star-nosed mole  ttta-----aaaatag
          Cape elephant shrew  ttgctccttaatatta
B D                 Armadillo  ttac-----aagacta
B D                     Shrew  ================
B D              Nile tilapia  ================
                 Zebra mbuna  ================
B D                 Tetraodon  ----------------
B D               Stickleback  ================
                 Spotted gar  ================
         Pundamilia nyererei  ================
       Burton's mouthbreeder  ================
         Princess of Burundi  ================
B D                      Fugu  ================
B D                  Hedgehog  ================
B D                Coelacanth  ================
          Southern platyfish  ================
B D              Atlantic cod  ================
B D                    Medaka  ================
B D                 Zebrafish  ================
    Mexican tetra (cavefish)  ================
      Yellowbelly pufferfish  ================
B D             X. tropicalis  ================
B D                      Pika  ================
B D                    Rabbit  ----------------
B D           Tasmanian devil  ================
  D               Rock pigeon  ================
  D    White-throated sparrow  ================
  D             Scarlet macaw  ================
  D                    Parrot  ================
  D    Spiny softshell turtle  ================
  D            Painted turtle  ================
B D                  Platypus  ================
               Big brown bat  ================
B D                  Microbat  ================
        David's myotis (bat)  ================
B D                    Lizard  ================
B D               Zebra finch  ================
B D       Medium ground finch  ================
  D       Collared flycatcher  ================
  D  Chinese softshell turtle  ================
  D              Saker falcon  ----------------
  D           Green seaturtle  ================
  D              Mallard duck  ----------------
B D                Budgerigar  ================
B D                    Turkey  ================
B D                   Chicken  ================
          Tibetan ground jay  ================
B D                   Wallaby  ================
B D        American alligator  ================
B D                   Opossum  ================
                Prairie vole  ================
B D                    Tenrec  ================
  D          Peregrine falcon  ----------------
                    Aardvark  ----------------
            Cape golden mole  ================
              Golden hamster  ================
B D                       Rat  ----------------
B D           Chinese hamster  ================
              Bactrian camel  ================
      Lesser Egyptian jerboa  ----------------
B D                     Mouse  ================
            Brush-tailed rat  ================
B D                Guinea pig  ================
B D            Naked mole-rat  ================
                  Chinchilla  ================
B D                   Manatee  ================
B D                  Elephant  ----------------
B D                    Alpaca  ================
B D                       Pig  ----------------

Inserts between block 8 and 9 in window
         Cape elephant shrew 3bp

Alignment block 9 of 27 in window, 182878261 - 182878263, 3 bps 
B D                     Human  aaa
B D                     Chimp  aaa
B D                   Gorilla  aaa
B D                 Orangutan  aac
B D                    Gibbon  aaa
B D                    Rhesus  aaa
B D       Crab-eating macaque  aaa
B D                    Baboon  aaa
B D              Green monkey  aaa
B D                  Marmoset  aaa
B D           Squirrel monkey  aaa
B D                  Bushbaby  aaa
           Chinese tree shrew  aaa
B D                  Squirrel  aaa
B D                   Dolphin  aaa
                 Killer whale  aaa
             Tibetan antelope  aaa
B D                       Cow  aaa
B D                     Sheep  aaa
                Domestic goat  aaa
B D                     Horse  aaa
B D          White rhinoceros  aaa
B D                       Cat  aaa
B D                       Dog  aaa
B D                   Ferret   aaa
B D                     Panda  aaa
               Pacific walrus  aaa
                 Weddell seal  aaa
             Black flying-fox  acg
B D                   Megabat  aca
              Star-nosed mole  aa-
          Cape elephant shrew  aga
                     Aardvark  aaa
B D                 Armadillo  aaa
B D                     Shrew  ===
B D              Nile tilapia  ===
                 Zebra mbuna  ===
B D                 Tetraodon  ---
B D               Stickleback  ===
                 Spotted gar  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                      Fugu  ===
B D                  Hedgehog  ===
B D                Coelacanth  ===
          Southern platyfish  ===
B D              Atlantic cod  ===
B D                    Medaka  ===
B D                 Zebrafish  ===
    Mexican tetra (cavefish)  ===
      Yellowbelly pufferfish  ===
B D             X. tropicalis  ===
B D                      Pika  ===
B D                    Rabbit  ---
B D           Tasmanian devil  ===
  D               Rock pigeon  ===
  D    White-throated sparrow  ===
  D             Scarlet macaw  ===
  D                    Parrot  ===
  D    Spiny softshell turtle  ===
  D            Painted turtle  ===
B D                  Platypus  ===
               Big brown bat  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
B D                    Lizard  ===
B D               Zebra finch  ===
B D       Medium ground finch  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
  D              Saker falcon  ---
  D           Green seaturtle  ===
  D              Mallard duck  ---
B D                Budgerigar  ===
B D                    Turkey  ===
B D                   Chicken  ===
          Tibetan ground jay  ===
B D                   Wallaby  ===
B D        American alligator  ===
B D                   Opossum  ===
                Prairie vole  ===
B D                    Tenrec  ===
  D          Peregrine falcon  ---
            Cape golden mole  ===
              Golden hamster  ===
B D                       Rat  ---
B D           Chinese hamster  ===
              Bactrian camel  ===
      Lesser Egyptian jerboa  ---
B D                     Mouse  ===
            Brush-tailed rat  ===
B D                Guinea pig  ===
B D            Naked mole-rat  ===
                  Chinchilla  ===
B D                   Manatee  ===
B D                  Elephant  ---
B D                    Alpaca  ===
B D                       Pig  ---

Inserts between block 9 and 10 in window
             Star-nosed mole 1189bp

Alignment block 10 of 27 in window, 182878264 - 182878311, 48 bps 
B D                     Human  tctatcaatatatgtttagct-tttat----agt---gt--------gctcattta--------------
B D                     Chimp  tctatcaatatatgtttagct-tttat----agc---gt--------gctcattta--------------
B D                   Gorilla  tctatcaatatatgtttagct-tttat----agc---gt--------gctcattta--------------
B D                 Orangutan  tctatcaatatatgtttagct-tttat----agctt-gt--------gctcattta--------------
B D                    Gibbon  tctatcaatgtatgtttagct-tttat----agctt-gt--------gctcattta--------------
B D                    Rhesus  tctatcaatgtatgtttagct-tttat----acctt-gt--------gctcattta--------------
B D       Crab-eating macaque  tctatcaatgtatgtttagct-tttat----acctt-gt--------gctcattta--------------
B D                    Baboon  tctatcaatgtatgtttagct-tttat----acctt-gt--------gctcattta--------------
B D              Green monkey  tctatcaatgtatgtttagct-tttat----acctt-gt--------gcttattta--------------
B D                  Marmoset  tctatcaatatatgtttaact-tttgt----agctt-gt--------gctcattta--------------
B D           Squirrel monkey  tctatcaatttatgtttaact-tttgt----agctt-gt--------gctcattta--------------
B D                  Bushbaby  tctatcaatatatgtttaact-tttat----agtttatt--------gctcattta--------------
           Chinese tree shrew  tctatcagtgtata--aagct-tttat----acttt-gttattagtctcttttttt--------------
B D                  Squirrel  tctctga----atggttagat-tttat----agctt-gtt-------gcttattta--------------
B D                   Dolphin  atta-cagtatttatttagtt-tttat----agctt-gtt-------gctcattta--------------
                 Killer whale  atta-cagtatttatttagtt-tttat----agctt-gtg-------gctcattta--------------
             Tibetan antelope  atcatcatta--tgtttagtt-ttcat----aactt-gtt-------gctcattta--------------
B D                       Cow  atcatcagta--tgtttagtt-ttcat----aactt-gtc-------gctcattta--------------
B D                     Sheep  atcatcatta--tgtttagtt-ttcat----aactt-gtt-------gctcattta--------------
                Domestic goat  atcatcatta--tgtttagtt-ctcat----aactt-gtt-------gctcattta--------------
B D                     Horse  tctatcaatatatatttagtt-tttat----agctt-gtt-------attcattta--------------
B D          White rhinoceros  tttatcaatatatgtttagtt-tttat----agctt-gtt-------acttattta--------------
B D                       Cat  tctatcaatatatatttagtt-tttat----agttt-gct-------gctcatttg--------------
B D                       Dog  tctgttgatacatatttagtt-tttat----agctt-gtt-------gctcagttg--------------
B D                   Ferret   tctgttgatatatatttagtt-tttat----acctt-gtt-------gctcattta--------------
B D                     Panda  tccgttggtatgtatttagtt-tttataataagctt-gtt-------gctcatttg--------------
               Pacific walrus  tctgttgatatatatttagtt-tttat----agctt-gtt-------gctcatttg--------------
                 Weddell seal  tctgttgatacatgtttagtt-tttat----agctt-gtt-------gctcatttg--------------
             Black flying-fox  tctatcaatatatgtttagtt-tttat----agatt-att-------acttattta--------------
B D                   Megabat  tctatcaatatatgtttagtt-tttaa----agatt-att-------acttattta--------------
B D                  Elephant  tctgttaatacatgtttagct-tttct----aatgt-gtt-------ggtcatgta--------------
          Cape elephant shrew  cctgataaaatgcatgtagttatagtt----attgc-act-------caccttgaaggcaaacagtttag
B D                   Manatee  tctgttaatacctgttcagtt-cttat----aatgt-gtt-------gctcatgtg--------------
                     Aardvark  tctgttagtatatatttaccc-tttat----aatgt-gtt-------gctcattta--------------
B D                 Armadillo  tctatttatatatgtttagct-tttat----agctt-gtt-------aatcattca--------------
             Star-nosed mole  ======================================================================
B D                     Shrew  ======================================================================
B D              Nile tilapia  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Tetraodon  ----------------------------------------------------------------------
B D               Stickleback  ======================================================================
                 Spotted gar  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                      Fugu  ======================================================================
B D                  Hedgehog  ======================================================================
B D                Coelacanth  ======================================================================
          Southern platyfish  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Medaka  ======================================================================
B D                 Zebrafish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                  Platypus  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                    Lizard  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Saker falcon  ----------------------------------------------------------------------
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ----------------------------------------------------------------------
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
                Prairie vole  ======================================================================
B D                    Tenrec  ======================================================================
  D          Peregrine falcon  ----------------------------------------------------------------------
            Cape golden mole  ======================================================================
              Golden hamster  ======================================================================
B D                       Rat  ----------------------------------------------------------------------
B D           Chinese hamster  ======================================================================
              Bactrian camel  ======================================================================
      Lesser Egyptian jerboa  ----------------------------------------------------------------------
B D                     Mouse  ======================================================================
            Brush-tailed rat  ======================================================================
B D                Guinea pig  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                    Alpaca  ======================================================================
B D                       Pig  ----------------------------------------------------------------------

                        Human  -----at-agtctt
                        Chimp  -----at-agtctt
                      Gorilla  -----at-agtctt
                    Orangutan  -----at-agtctt
                       Gibbon  -----at-agtctt
                       Rhesus  -----at-agtctt
          Crab-eating macaque  -----at-agtctt
                       Baboon  -----at-agtctt
                 Green monkey  -----at-agtctt
                     Marmoset  -----at-agtctt
              Squirrel monkey  -----at-agtctt
                     Bushbaby  -----at-ggactt
           Chinese tree shrew  -----gt-agcagt
                     Squirrel  -----tt-attatt
                      Dolphin  -----at-agtctt
                 Killer whale  -----at-agtctt
             Tibetan antelope  -----at-agtctt
                          Cow  -----at-agtctt
                        Sheep  -----at-agtctt
                Domestic goat  -----at-agtctt
                        Horse  -----at-ag---t
             White rhinoceros  -----ataag---t
                          Cat  -----at-agtttt
                          Dog  -----at-agtgtt
                      Ferret   -----at-agtgtt
                        Panda  -----at-agtgtt
               Pacific walrus  -----at-agtgtt
                 Weddell seal  -----at-agtgtt
             Black flying-fox  -----at-actctt
                      Megabat  -----at-actctt
                     Elephant  -----at-agtctt
          Cape elephant shrew  cgtctat-gatttt
                      Manatee  -----at-agactt
                     Aardvark  -----at-agtctt
                    Armadillo  -----at-agtttt
              Star-nosed mole  ==============
                        Shrew  ==============
                 Nile tilapia  ==============
                  Zebra mbuna  ==============
                    Tetraodon  --------------
                  Stickleback  ==============
                  Spotted gar  ==============
          Pundamilia nyererei  ==============
        Burton's mouthbreeder  ==============
          Princess of Burundi  ==============
                         Fugu  ==============
                     Hedgehog  ==============
                   Coelacanth  ==============
           Southern platyfish  ==============
                 Atlantic cod  ==============
                       Medaka  ==============
                    Zebrafish  ==============
     Mexican tetra (cavefish)  ==============
       Yellowbelly pufferfish  ==============
                X. tropicalis  ==============
                         Pika  ==============
                       Rabbit  --------------
              Tasmanian devil  ==============
                  Rock pigeon  ==============
       White-throated sparrow  ==============
                Scarlet macaw  ==============
                       Parrot  ==============
       Spiny softshell turtle  ==============
               Painted turtle  ==============
                     Platypus  ==============
                Big brown bat  ==============
                     Microbat  ==============
         David's myotis (bat)  ==============
                       Lizard  ==============
                  Zebra finch  ==============
          Medium ground finch  ==============
          Collared flycatcher  ==============
     Chinese softshell turtle  ==============
                 Saker falcon  --------------
              Green seaturtle  ==============
                 Mallard duck  --------------
                   Budgerigar  ==============
                       Turkey  ==============
                      Chicken  ==============
           Tibetan ground jay  ==============
                      Wallaby  ==============
           American alligator  ==============
                      Opossum  ==============
                 Prairie vole  ==============
                       Tenrec  ==============
             Peregrine falcon  --------------
             Cape golden mole  ==============
               Golden hamster  ==============
                          Rat  --------------
              Chinese hamster  ==============
               Bactrian camel  ==============
       Lesser Egyptian jerboa  --------------
                        Mouse  ==============
             Brush-tailed rat  ==============
                   Guinea pig  ==============
               Naked mole-rat  ==============
                   Chinchilla  ==============
                       Alpaca  ==============
                          Pig  --------------

Inserts between block 10 and 11 in window
B D          Squirrel monkey 283bp

Alignment block 11 of 27 in window, 182878312 - 182878318, 7 bps 
B D                     Human  ctc-actt
B D                     Chimp  ctc-actt
B D                   Gorilla  ctc-actt
B D                 Orangutan  ctc-actt
B D                    Gibbon  ctc-actt
B D                    Rhesus  ctc-actt
B D       Crab-eating macaque  ctc-actt
B D                    Baboon  ctc-actt
B D              Green monkey  ctc-actt
B D                  Marmoset  ctc-actt
B D           Squirrel monkey  ctc-actt
B D                  Bushbaby  ctc-actt
           Chinese tree shrew  acc-actt
B D                  Squirrel  ttt-attt
B D                   Dolphin  ctc-actt
                 Killer whale  ctc-actt
             Tibetan antelope  ctc-actt
B D                       Cow  ctt-gctt
B D                     Sheep  ctc-actt
                Domestic goat  ctc-actt
B D                     Horse  ctt-actt
B D          White rhinoceros  ctt-actt
B D                       Cat  ctc-actt
B D                       Dog  ctc-----
B D                   Ferret   ctc-actt
B D                     Panda  ctc-actt
               Pacific walrus  ctc-actt
                 Weddell seal  ctc-actt
             Black flying-fox  ctc-actt
B D                   Megabat  ctc-actt
B D                  Elephant  acc-acat
          Cape elephant shrew  acagacat
B D                   Manatee  atc-acat
                     Aardvark  agc-acat
B D                 Armadillo  ctc-actt
             Star-nosed mole  ========
B D                     Shrew  ========
B D              Nile tilapia  ========
                 Zebra mbuna  ========
B D                 Tetraodon  --------
B D               Stickleback  ========
                 Spotted gar  ========
         Pundamilia nyererei  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D                      Fugu  ========
B D                  Hedgehog  ========
B D                Coelacanth  ========
          Southern platyfish  ========
B D              Atlantic cod  ========
B D                    Medaka  ========
B D                 Zebrafish  ========
    Mexican tetra (cavefish)  ========
      Yellowbelly pufferfish  ========
B D             X. tropicalis  ========
B D                      Pika  ========
B D                    Rabbit  --------
B D           Tasmanian devil  ========
  D               Rock pigeon  ========
  D    White-throated sparrow  ========
  D             Scarlet macaw  ========
  D                    Parrot  ========
  D    Spiny softshell turtle  ========
  D            Painted turtle  ========
B D                  Platypus  ========
               Big brown bat  ========
B D                  Microbat  ========
        David's myotis (bat)  ========
B D                    Lizard  ========
B D               Zebra finch  ========
B D       Medium ground finch  ========
  D       Collared flycatcher  ========
  D  Chinese softshell turtle  ========
  D              Saker falcon  --------
  D           Green seaturtle  ========
  D              Mallard duck  --------
B D                Budgerigar  ========
B D                    Turkey  ========
B D                   Chicken  ========
          Tibetan ground jay  ========
B D                   Wallaby  ========
B D        American alligator  ========
B D                   Opossum  ========
                Prairie vole  ========
B D                    Tenrec  ========
  D          Peregrine falcon  --------
            Cape golden mole  ========
              Golden hamster  ========
B D                       Rat  --------
B D           Chinese hamster  ========
              Bactrian camel  ========
      Lesser Egyptian jerboa  --------
B D                     Mouse  ========
            Brush-tailed rat  ========
B D                Guinea pig  ========
B D            Naked mole-rat  ========
                  Chinchilla  ========
B D                    Alpaca  ========
B D                       Pig  --------

Inserts between block 11 and 12 in window
            Black flying-fox 781bp
B D                  Megabat 779bp

Alignment block 12 of 27 in window, 182878319 - 182878324, 6 bps 
B D                     Human  cttatt
B D                     Chimp  cttatt
B D                   Gorilla  cttatt
B D                 Orangutan  cttatt
B D                    Gibbon  cttatt
B D                    Rhesus  cttatt
B D       Crab-eating macaque  cttatt
B D                    Baboon  cttatt
B D              Green monkey  cttatt
B D                  Marmoset  cttatt
B D           Squirrel monkey  cttatt
B D                  Bushbaby  ctaatt
           Chinese tree shrew  cttatt
B D                  Squirrel  ctcatt
B D                   Dolphin  gtcatt
                 Killer whale  gtcatt
             Tibetan antelope  atcatt
B D                       Cow  atcatt
B D                     Sheep  atcatt
                Domestic goat  atcatt
B D                     Horse  ctcatt
B D          White rhinoceros  ctcatt
B D                       Cat  ctcact
B D                       Dog  ctcatt
B D                   Ferret   ttgatt
B D                     Panda  ttgatt
               Pacific walrus  ttgatt
                 Weddell seal  ttgatt
B D                  Elephant  cttatt
          Cape elephant shrew  cttact
B D                   Manatee  cttatt
                     Aardvark  cttatt
B D                 Armadillo  ctcatt
             Star-nosed mole  ======
B D                     Shrew  ======
B D              Nile tilapia  ======
                 Zebra mbuna  ======
B D                 Tetraodon  ------
B D               Stickleback  ======
                 Spotted gar  ======
         Pundamilia nyererei  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D                      Fugu  ======
B D                  Hedgehog  ======
B D                Coelacanth  ======
          Southern platyfish  ======
B D              Atlantic cod  ======
B D                    Medaka  ======
B D                 Zebrafish  ======
    Mexican tetra (cavefish)  ======
      Yellowbelly pufferfish  ======
B D             X. tropicalis  ======
B D                      Pika  ======
B D                    Rabbit  ------
B D           Tasmanian devil  ======
  D               Rock pigeon  ======
  D    White-throated sparrow  ======
  D             Scarlet macaw  ======
  D                    Parrot  ======
  D    Spiny softshell turtle  ======
  D            Painted turtle  ======
B D                  Platypus  ======
               Big brown bat  ======
B D                  Microbat  ======
        David's myotis (bat)  ======
B D                    Lizard  ======
B D                   Megabat  ======
            Black flying-fox  ======
B D               Zebra finch  ======
B D       Medium ground finch  ======
  D       Collared flycatcher  ======
  D  Chinese softshell turtle  ======
  D              Saker falcon  ------
  D           Green seaturtle  ======
  D              Mallard duck  ------
B D                Budgerigar  ======
B D                    Turkey  ======
B D                   Chicken  ======
          Tibetan ground jay  ======
B D                   Wallaby  ======
B D        American alligator  ======
B D                   Opossum  ======
                Prairie vole  ======
B D                    Tenrec  ======
  D          Peregrine falcon  ------
            Cape golden mole  ======
              Golden hamster  ======
B D                       Rat  ------
B D           Chinese hamster  ======
              Bactrian camel  ======
      Lesser Egyptian jerboa  ------
B D                     Mouse  ======
            Brush-tailed rat  ======
B D                Guinea pig  ======
B D            Naked mole-rat  ======
                  Chinchilla  ======
B D                    Alpaca  ======
B D                       Pig  ------

Alignment block 13 of 27 in window, 182878325 - 182878325, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
                     Aardvark  t
B D                 Armadillo  t
B D                     Shrew  =
B D              Nile tilapia  =
                 Zebra mbuna  =
B D                 Tetraodon  -
B D               Stickleback  =
                 Spotted gar  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                      Fugu  =
B D                  Hedgehog  =
B D                Coelacanth  =
          Southern platyfish  =
B D              Atlantic cod  =
B D                    Medaka  =
B D                 Zebrafish  =
    Mexican tetra (cavefish)  =
      Yellowbelly pufferfish  =
B D             X. tropicalis  =
B D                      Pika  =
B D                    Rabbit  -
B D           Tasmanian devil  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D             Scarlet macaw  =
  D                    Parrot  =
  D    Spiny softshell turtle  =
  D            Painted turtle  =
B D                  Platypus  =
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Lizard  =
B D                   Megabat  =
            Black flying-fox  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D              Saker falcon  -
  D           Green seaturtle  =
  D              Mallard duck  -
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D                   Wallaby  =
B D        American alligator  =
B D                   Opossum  =
                Prairie vole  =
B D                    Tenrec  =
  D          Peregrine falcon  -
            Cape golden mole  =
              Golden hamster  =
B D                       Rat  -
B D           Chinese hamster  =
              Bactrian camel  =
      Lesser Egyptian jerboa  -
B D                     Mouse  =
            Brush-tailed rat  =
B D                Guinea pig  =
B D            Naked mole-rat  =
                  Chinchilla  =
B D                    Alpaca  =
B D                       Pig  -

Inserts between block 13 and 14 in window
B D                  Dolphin 2bp
                Killer whale 741bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 2bp
               Domestic goat 2bp
B D                    Horse 2bp
B D         White rhinoceros 1061bp
B D                      Cat 2bp
B D                      Dog 736bp
B D                    Panda 2bp
              Pacific walrus 1302bp
                Weddell seal 1834bp

Alignment block 14 of 27 in window, 182878326 - 182878327, 2 bps 
B D                     Human  --tt
B D                     Chimp  --tt
B D                   Gorilla  --tt
B D                 Orangutan  --tt
B D                    Gibbon  --tt
B D                    Rhesus  --tt
B D       Crab-eating macaque  --tt
B D                    Baboon  --tt
B D              Green monkey  --tt
B D                  Marmoset  --tt
B D           Squirrel monkey  --tt
B D                  Bushbaby  --ga
           Chinese tree shrew  --tt
B D                  Squirrel  --ta
B D                   Ferret   --t-
              Star-nosed mole  --t-
B D                  Elephant  aa--
          Cape elephant shrew  aa--
B D                   Manatee  aa--
                     Aardvark  ag--
B D                 Armadillo  ca--
B D                     Shrew  ====
B D              Nile tilapia  ====
                 Zebra mbuna  ====
B D                 Tetraodon  ----
B D               Stickleback  ====
                 Spotted gar  ====
         Pundamilia nyererei  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D                      Fugu  ====
B D                  Hedgehog  ====
B D                Coelacanth  ====
          Southern platyfish  ====
B D              Atlantic cod  ====
B D                    Medaka  ====
B D                 Zebrafish  ====
    Mexican tetra (cavefish)  ====
      Yellowbelly pufferfish  ====
B D             X. tropicalis  ====
B D                      Pika  ====
B D                    Rabbit  ----
B D           Tasmanian devil  ====
  D               Rock pigeon  ====
  D    White-throated sparrow  ====
  D             Scarlet macaw  ====
  D                    Parrot  ====
  D    Spiny softshell turtle  ====
  D            Painted turtle  ====
B D                  Platypus  ====
               Big brown bat  ====
B D                  Microbat  ====
        David's myotis (bat)  ====
B D                    Lizard  ====
B D                   Megabat  ====
            Black flying-fox  ====
B D               Zebra finch  ====
B D       Medium ground finch  ====
  D       Collared flycatcher  ====
  D  Chinese softshell turtle  ====
  D              Saker falcon  ----
  D           Green seaturtle  ====
  D              Mallard duck  ----
B D                Budgerigar  ====
B D                    Turkey  ====
B D                   Chicken  ====
          Tibetan ground jay  ====
B D                   Wallaby  ====
B D        American alligator  ====
B D                   Opossum  ====
                Prairie vole  ====
B D                    Tenrec  ====
               Domestic goat  ====
  D          Peregrine falcon  ----
              Pacific walrus  ====
            Cape golden mole  ====
              Golden hamster  ====
B D                       Rat  ----
B D           Chinese hamster  ====
              Bactrian camel  ====
B D                     Horse  ====
B D                     Panda  ====
      Lesser Egyptian jerboa  ----
B D                     Mouse  ====
            Brush-tailed rat  ====
B D                Guinea pig  ====
B D            Naked mole-rat  ====
                  Chinchilla  ====
B D                     Sheep  ====
            Tibetan antelope  ====
                Weddell seal  ====
B D                       Cat  ====
B D                    Alpaca  ====
B D                       Cow  ====
                Killer whale  ====
B D                   Dolphin  ====
B D                       Pig  ----
B D                       Dog  ====
B D          White rhinoceros  ====

Inserts between block 14 and 15 in window
B D                  Ferret  1bp
             Star-nosed mole 1bp

Alignment block 15 of 27 in window, 182878328 - 182878330, 3 bps 
B D                     Human  aag
B D                     Chimp  aag
B D                   Gorilla  aag
B D                 Orangutan  aaa
B D                    Gibbon  aaa
B D                    Rhesus  aat
B D       Crab-eating macaque  aat
B D                    Baboon  aat
B D              Green monkey  aat
B D                  Marmoset  aaa
B D           Squirrel monkey  aaa
B D                  Bushbaby  aaa
           Chinese tree shrew  taa
B D                  Squirrel  aaa
B D                   Dolphin  -aa
                 Killer whale  aaa
             Tibetan antelope  aaa
B D                       Cow  aaa
B D                     Sheep  aaa
                Domestic goat  aaa
B D                     Horse  aaa
B D          White rhinoceros  aaa
B D                       Cat  aaa
B D                       Dog  aaa
B D                   Ferret   aaa
B D                     Panda  aaa
               Pacific walrus  aaa
                 Weddell seal  aaa
              Star-nosed mole  aaa
B D                  Elephant  aaa
          Cape elephant shrew  aaa
B D                   Manatee  aaa
                     Aardvark  aaa
B D                 Armadillo  aaa
B D                     Shrew  ===
B D              Nile tilapia  ===
                 Zebra mbuna  ===
B D                 Tetraodon  ---
B D               Stickleback  ===
                 Spotted gar  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                      Fugu  ===
B D                  Hedgehog  ===
B D                Coelacanth  ===
          Southern platyfish  ===
B D              Atlantic cod  ===
B D                    Medaka  ===
B D                 Zebrafish  ===
    Mexican tetra (cavefish)  ===
      Yellowbelly pufferfish  ===
B D             X. tropicalis  ===
B D                      Pika  ===
B D                    Rabbit  ---
B D           Tasmanian devil  ===
  D               Rock pigeon  ===
  D    White-throated sparrow  ===
  D             Scarlet macaw  ===
  D                    Parrot  ===
  D    Spiny softshell turtle  ===
  D            Painted turtle  ===
B D                  Platypus  ===
               Big brown bat  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
B D                    Lizard  ===
B D                   Megabat  ===
            Black flying-fox  ===
B D               Zebra finch  ===
B D       Medium ground finch  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
  D              Saker falcon  ---
  D           Green seaturtle  ===
  D              Mallard duck  ---
B D                Budgerigar  ===
B D                    Turkey  ===
B D                   Chicken  ===
          Tibetan ground jay  ===
B D                   Wallaby  ===
B D        American alligator  ===
B D                   Opossum  ===
                Prairie vole  ===
B D                    Tenrec  ===
  D          Peregrine falcon  ---
            Cape golden mole  ===
              Golden hamster  ===
B D                       Rat  ---
B D           Chinese hamster  ===
              Bactrian camel  ===
      Lesser Egyptian jerboa  ---
B D                     Mouse  ===
            Brush-tailed rat  ===
B D                Guinea pig  ===
B D            Naked mole-rat  ===
                  Chinchilla  ===
B D                    Alpaca  ===
B D                       Pig  ---

Inserts between block 15 and 16 in window
B D                    Horse 828bp

Alignment block 16 of 27 in window, 182878331 - 182878332, 2 bps 
B D                     Human  tg
B D                     Chimp  tg
B D                   Gorilla  tg
B D                 Orangutan  tg
B D                    Gibbon  tg
B D                    Rhesus  tg
B D       Crab-eating macaque  tg
B D                    Baboon  tg
B D              Green monkey  tg
B D                  Marmoset  tg
B D           Squirrel monkey  tg
B D                  Bushbaby  tg
           Chinese tree shrew  t-
B D                  Squirrel  tg
B D                   Dolphin  tt
                 Killer whale  tg
             Tibetan antelope  tt
B D                       Cow  tt
B D                     Sheep  tt
                Domestic goat  tt
B D                     Horse  tg
B D          White rhinoceros  tg
B D                       Cat  gg
B D                       Dog  tg
B D                   Ferret   tg
B D                     Panda  tg
               Pacific walrus  tg
                 Weddell seal  tg
              Star-nosed mole  tg
B D                  Elephant  tg
          Cape elephant shrew  ca
B D                   Manatee  tg
                     Aardvark  tg
B D                 Armadillo  ta
B D                     Shrew  ==
B D              Nile tilapia  ==
                 Zebra mbuna  ==
B D                 Tetraodon  --
B D               Stickleback  ==
                 Spotted gar  ==
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                      Fugu  ==
B D                  Hedgehog  ==
B D                Coelacanth  ==
          Southern platyfish  ==
B D              Atlantic cod  ==
B D                    Medaka  ==
B D                 Zebrafish  ==
    Mexican tetra (cavefish)  ==
      Yellowbelly pufferfish  ==
B D             X. tropicalis  ==
B D                      Pika  ==
B D                    Rabbit  --
B D           Tasmanian devil  ==
  D               Rock pigeon  ==
  D    White-throated sparrow  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
  D    Spiny softshell turtle  ==
  D            Painted turtle  ==
B D                  Platypus  ==
               Big brown bat  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                    Lizard  ==
B D                   Megabat  ==
            Black flying-fox  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
  D              Saker falcon  --
  D           Green seaturtle  ==
  D              Mallard duck  --
B D                Budgerigar  ==
B D                    Turkey  ==
B D                   Chicken  ==
          Tibetan ground jay  ==
B D                   Wallaby  ==
B D        American alligator  ==
B D                   Opossum  ==
                Prairie vole  ==
B D                    Tenrec  ==
  D          Peregrine falcon  --
            Cape golden mole  ==
              Golden hamster  ==
B D                       Rat  --
B D           Chinese hamster  ==
              Bactrian camel  ==
      Lesser Egyptian jerboa  --
B D                     Mouse  ==
            Brush-tailed rat  ==
B D                Guinea pig  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
B D                    Alpaca  ==
B D                       Pig  --

Inserts between block 16 and 17 in window
B D                    Panda 1404bp

Alignment block 17 of 27 in window, 182878333 - 182878333, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  a
B D                  Squirrel  g
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  a
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
                     Aardvark  g
B D                 Armadillo  g
B D                     Shrew  =
B D              Nile tilapia  =
                 Zebra mbuna  =
B D                 Tetraodon  -
B D               Stickleback  =
                 Spotted gar  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                      Fugu  =
B D                  Hedgehog  =
B D                Coelacanth  =
          Southern platyfish  =
B D              Atlantic cod  =
B D                    Medaka  =
B D                 Zebrafish  =
    Mexican tetra (cavefish)  =
      Yellowbelly pufferfish  =
B D             X. tropicalis  =
B D                      Pika  =
B D                    Rabbit  -
B D           Tasmanian devil  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D             Scarlet macaw  =
  D                    Parrot  =
  D    Spiny softshell turtle  =
  D            Painted turtle  =
B D                  Platypus  =
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Lizard  =
B D                   Megabat  =
            Black flying-fox  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D              Saker falcon  -
  D           Green seaturtle  =
  D              Mallard duck  -
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D                   Wallaby  =
B D        American alligator  =
B D                   Opossum  =
                Prairie vole  =
B D                    Tenrec  =
  D          Peregrine falcon  -
            Cape golden mole  =
              Golden hamster  =
B D                       Rat  -
B D           Chinese hamster  =
              Bactrian camel  =
      Lesser Egyptian jerboa  -
B D                     Mouse  =
            Brush-tailed rat  =
B D                Guinea pig  =
B D            Naked mole-rat  =
                  Chinchilla  =
          Chinese tree shrew  -
B D                    Alpaca  =
B D                       Pig  -

Inserts between block 17 and 18 in window
B D                  Ferret  1447bp

Alignment block 18 of 27 in window, 182878334 - 182878335, 2 bps 
B D                     Human  ag
B D                     Chimp  ag
B D                   Gorilla  ag
B D                 Orangutan  ag
B D                    Gibbon  ag
B D                    Rhesus  ag
B D       Crab-eating macaque  ag
B D                    Baboon  ag
B D              Green monkey  ag
B D                  Marmoset  ag
B D           Squirrel monkey  ag
B D                  Bushbaby  ag
B D                  Squirrel  ag
B D                   Dolphin  ga
                 Killer whale  at
             Tibetan antelope  ag
B D                       Cow  ag
B D                     Sheep  ag
                Domestic goat  ag
B D                     Horse  ag
B D          White rhinoceros  ag
B D                       Cat  ag
B D                       Dog  ag
B D                   Ferret   ag
B D                     Panda  ag
               Pacific walrus  gg
                 Weddell seal  ag
              Star-nosed mole  ag
B D                  Elephant  ag
          Cape elephant shrew  ag
B D                   Manatee  ag
                     Aardvark  aa
B D                 Armadillo  aa
B D                     Shrew  ==
B D              Nile tilapia  ==
                 Zebra mbuna  ==
B D                 Tetraodon  --
B D               Stickleback  ==
                 Spotted gar  ==
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                      Fugu  ==
B D                  Hedgehog  ==
B D                Coelacanth  ==
          Southern platyfish  ==
B D              Atlantic cod  ==
B D                    Medaka  ==
B D                 Zebrafish  ==
    Mexican tetra (cavefish)  ==
      Yellowbelly pufferfish  ==
B D             X. tropicalis  ==
B D                      Pika  ==
B D                    Rabbit  --
B D           Tasmanian devil  ==
  D               Rock pigeon  ==
  D    White-throated sparrow  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
  D    Spiny softshell turtle  ==
  D            Painted turtle  ==
B D                  Platypus  ==
               Big brown bat  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                    Lizard  ==
B D                   Megabat  ==
            Black flying-fox  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
  D              Saker falcon  --
  D           Green seaturtle  ==
  D              Mallard duck  --
B D                Budgerigar  ==
B D                    Turkey  ==
B D                   Chicken  ==
          Tibetan ground jay  ==
B D                   Wallaby  ==
B D        American alligator  ==
B D                   Opossum  ==
                Prairie vole  ==
B D                    Tenrec  ==
  D          Peregrine falcon  --
            Cape golden mole  ==
              Golden hamster  ==
B D                       Rat  --
B D           Chinese hamster  ==
              Bactrian camel  ==
      Lesser Egyptian jerboa  --
B D                     Mouse  ==
            Brush-tailed rat  ==
B D                Guinea pig  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
          Chinese tree shrew  --
B D                    Alpaca  ==
B D                       Pig  --

Inserts between block 18 and 19 in window
B D                  Dolphin 741bp
            Tibetan antelope 727bp
B D                      Cow 730bp
B D                    Sheep 725bp
               Domestic goat 720bp
         Cape elephant shrew 3bp

Alignment block 19 of 27 in window, 182878336 - 182878336, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
B D                  Squirrel  g
B D                Guinea pig  g
                   Chinchilla  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  a
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  a
                     Aardvark  a
B D                 Armadillo  a
B D                     Shrew  =
B D              Nile tilapia  =
                 Zebra mbuna  =
B D                 Tetraodon  -
B D               Stickleback  =
                 Spotted gar  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                      Fugu  =
B D                  Hedgehog  =
B D                Coelacanth  =
          Southern platyfish  =
B D              Atlantic cod  =
B D                    Medaka  =
B D                 Zebrafish  =
    Mexican tetra (cavefish)  =
      Yellowbelly pufferfish  =
B D             X. tropicalis  =
B D                      Pika  =
B D                    Rabbit  -
B D           Tasmanian devil  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D             Scarlet macaw  =
  D                    Parrot  =
  D    Spiny softshell turtle  =
  D            Painted turtle  =
B D                  Platypus  =
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Lizard  =
B D                   Megabat  =
            Black flying-fox  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D              Saker falcon  -
  D           Green seaturtle  =
  D              Mallard duck  -
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D                   Wallaby  =
B D        American alligator  =
B D                   Opossum  =
                Prairie vole  =
B D                    Tenrec  =
  D          Peregrine falcon  -
            Cape golden mole  =
              Golden hamster  =
B D                       Rat  -
B D           Chinese hamster  =
              Bactrian camel  =
      Lesser Egyptian jerboa  -
B D                     Mouse  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
          Chinese tree shrew  -
B D                    Alpaca  =
B D                       Pig  -

Alignment block 20 of 27 in window, 182878337 - 182878337, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  c
B D                  Squirrel  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  a
               Pacific walrus  g
                 Weddell seal  g
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  a
B D                   Manatee  g
                     Aardvark  g
B D                 Armadillo  g
B D                     Shrew  =
B D              Nile tilapia  =
                 Zebra mbuna  =
B D                 Tetraodon  -
B D               Stickleback  =
                 Spotted gar  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                      Fugu  =
B D                  Hedgehog  =
B D                Coelacanth  =
          Southern platyfish  =
B D              Atlantic cod  =
B D                    Medaka  =
B D                 Zebrafish  =
    Mexican tetra (cavefish)  =
      Yellowbelly pufferfish  =
B D             X. tropicalis  =
B D                      Pika  =
B D                    Rabbit  -
B D           Tasmanian devil  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D             Scarlet macaw  =
  D                    Parrot  =
  D    Spiny softshell turtle  =
  D            Painted turtle  =
B D                  Platypus  =
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Lizard  =
B D                   Megabat  =
            Black flying-fox  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D              Saker falcon  -
  D           Green seaturtle  =
  D              Mallard duck  -
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D                   Wallaby  =
B D        American alligator  =
B D                   Opossum  =
                Prairie vole  =
B D                    Tenrec  =
  D          Peregrine falcon  -
            Cape golden mole  =
              Golden hamster  =
B D                       Rat  -
B D           Chinese hamster  =
              Bactrian camel  =
      Lesser Egyptian jerboa  -
B D                     Mouse  =
B D            Naked mole-rat  =
          Chinese tree shrew  -
B D                    Alpaca  =
B D                       Pig  -

Inserts between block 20 and 21 in window
B D                      Cat 1088bp

Alignment block 21 of 27 in window, 182878338 - 182878353, 16 bps 
B D                     Human  atagttctcagcag-ag--
B D                     Chimp  atagttctcagcag-ag--
B D                   Gorilla  atagttctcagcag-ag--
B D                 Orangutan  atagttctcagcag-a---
B D                    Gibbon  atagttctcagcag-ag--
B D                    Rhesus  atagttctcagcag-ag--
B D       Crab-eating macaque  atagttctcagcag-ag--
B D                    Baboon  atagttctcagcag-ag--
B D              Green monkey  atagttctcagcag-ag--
B D                  Marmoset  atagttcttagcag-ag--
B D           Squirrel monkey  atagttctcagcag-ag--
B D                  Bushbaby  ctg--tctcagtag-ta--
B D                  Squirrel  atatttctcagaagcat--
B D                Guinea pig  atatttccccacagcag--
                   Chinchilla  atattttcccacagcag--
             Brush-tailed rat  atattttcccacagtga--
B D                   Dolphin  atgtttctcagtagca---
                 Killer whale  atgtttctcagtagca---
             Tibetan antelope  atgtttctcagtagca---
B D                       Cow  atgtttctcagtagca---
B D                     Sheep  atgtctctcagtagca---
                Domestic goat  atgtctctcagtagca---
B D                     Horse  atatttctctgtagca---
B D          White rhinoceros  ctatttctcagtagca---
B D                       Dog  acatttctgactagca---
B D                   Ferret   atatttctcag--gca---
B D                     Panda  atatttctcagtaaca---
               Pacific walrus  atatttctcagtagca---
                 Weddell seal  gtatttctcagtagca---
              Star-nosed mole  ttgtttttcagtagca---
B D                  Elephant  ctatgtctcaggagcagag
          Cape elephant shrew  gtctg-ctcaggagcagaa
B D                   Manatee  gttc--ttcaggagcagat
                     Aardvark  atatttctcaggtgcagaa
B D                 Armadillo  ctatttctcaggatccaaa
B D                     Shrew  ===================
B D              Nile tilapia  ===================
                 Zebra mbuna  ===================
B D                 Tetraodon  -------------------
B D               Stickleback  ===================
                 Spotted gar  ===================
         Pundamilia nyererei  ===================
       Burton's mouthbreeder  ===================
         Princess of Burundi  ===================
B D                      Fugu  ===================
B D                  Hedgehog  ===================
B D                Coelacanth  ===================
          Southern platyfish  ===================
B D              Atlantic cod  ===================
B D                    Medaka  ===================
B D                 Zebrafish  ===================
    Mexican tetra (cavefish)  ===================
      Yellowbelly pufferfish  ===================
B D             X. tropicalis  ===================
B D                      Pika  ===================
B D                    Rabbit  -------------------
B D           Tasmanian devil  ===================
  D               Rock pigeon  ===================
  D    White-throated sparrow  ===================
  D             Scarlet macaw  ===================
  D                    Parrot  ===================
  D    Spiny softshell turtle  ===================
  D            Painted turtle  ===================
B D                  Platypus  ===================
               Big brown bat  ===================
B D                  Microbat  ===================
        David's myotis (bat)  ===================
B D                    Lizard  ===================
B D                   Megabat  ===================
            Black flying-fox  ===================
B D               Zebra finch  ===================
B D       Medium ground finch  ===================
  D       Collared flycatcher  ===================
  D  Chinese softshell turtle  ===================
  D              Saker falcon  -------------------
  D           Green seaturtle  ===================
  D              Mallard duck  -------------------
B D                Budgerigar  ===================
B D                    Turkey  ===================
B D                   Chicken  ===================
          Tibetan ground jay  ===================
B D                   Wallaby  ===================
B D        American alligator  ===================
B D                   Opossum  ===================
                Prairie vole  ===================
B D                    Tenrec  ===================
  D          Peregrine falcon  -------------------
            Cape golden mole  ===================
              Golden hamster  ===================
B D                       Rat  -------------------
B D           Chinese hamster  ===================
              Bactrian camel  ===================
      Lesser Egyptian jerboa  -------------------
B D                     Mouse  ===================
B D            Naked mole-rat  ===================
          Chinese tree shrew  -------------------
B D                       Cat  ===================
B D                    Alpaca  ===================
B D                       Pig  -------------------

Inserts between block 21 and 22 in window
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
             Star-nosed mole 3bp

Alignment block 22 of 27 in window, 182878354 - 182878368, 15 bps 
B D                     Human  tc-tgatattc-tg--tga
B D                     Chimp  tc-tgatattc-tg--tga
B D                   Gorilla  tc-tgttattc-tg--tga
B D                 Orangutan  -------------g--tga
B D                    Gibbon  tc-tgctgttc-tg--tga
B D                    Rhesus  tc-tgctattc-tg--tga
B D       Crab-eating macaque  tc-tgctattc-tg--tga
B D                    Baboon  tc-tgctattc-tg--tga
B D              Green monkey  tc-tgctattc-tg--tga
B D                  Marmoset  gc-tgttgttc-tg--tga
B D           Squirrel monkey  tc-tgctgttc-tg--tga
B D                  Bushbaby  gg-gtatagag-tg--tga
           Chinese tree shrew  tc-cgtgttac-cg--tta
B D                  Squirrel  cc-tgtgaatt-tg--tag
B D                Guinea pig  tc-tgtagttt-tg--tac
                   Chinchilla  tc-tgcagttt-tg--tac
             Brush-tailed rat  tc-tatagttt-tg--tac
B D                   Dolphin  tcttgctatac-tg--tga
                 Killer whale  tcttgctatac-tg--tga
             Tibetan antelope  tcctgctatac-ta--tga
B D                       Cow  tcctgctatac-ta--tga
B D                     Sheep  tcctgctatac-ta--tga
                Domestic goat  tcctgctatac-ta--tga
B D                     Horse  tc-ttctatcc-ta--tga
B D          White rhinoceros  tc-tgctgtgc-tg--gga
B D                       Dog  tc-agttatacttg--tga
B D                   Ferret   tc-tgctatac-tg--tga
B D                     Panda  ac-tgatacac-tg--tga
               Pacific walrus  tc-tgctatac-tg--tga
                 Weddell seal  tc-tgctatac-tg--tta
B D                  Hedgehog  tc-tgctttac-tg--aga
              Star-nosed mole  cc-tgctatac-tg--tga
B D                  Elephant  cc-tgctgtac-tg--tga
          Cape elephant shrew  tc-tgctaaac-tggatgg
B D                   Manatee  cc-tgctgtag-tg--tga
                     Aardvark  tc-tgctatgc-tg--taa
B D                 Armadillo  tc-tgctatct-cg--tga
B D                     Shrew  ===================
B D              Nile tilapia  ===================
                 Zebra mbuna  ===================
B D                 Tetraodon  -------------------
B D               Stickleback  ===================
                 Spotted gar  ===================
         Pundamilia nyererei  ===================
       Burton's mouthbreeder  ===================
         Princess of Burundi  ===================
B D                      Fugu  ===================
B D                Coelacanth  ===================
          Southern platyfish  ===================
B D              Atlantic cod  ===================
B D                    Medaka  ===================
B D                 Zebrafish  ===================
    Mexican tetra (cavefish)  ===================
      Yellowbelly pufferfish  ===================
B D             X. tropicalis  ===================
B D                      Pika  ===================
B D                    Rabbit  -------------------
B D           Tasmanian devil  ===================
  D               Rock pigeon  ===================
  D    White-throated sparrow  ===================
  D             Scarlet macaw  ===================
  D                    Parrot  ===================
  D    Spiny softshell turtle  ===================
  D            Painted turtle  ===================
B D                  Platypus  ===================
               Big brown bat  ===================
B D                  Microbat  ===================
        David's myotis (bat)  ===================
B D                    Lizard  ===================
B D                   Megabat  ===================
            Black flying-fox  ===================
B D               Zebra finch  ===================
B D       Medium ground finch  ===================
  D       Collared flycatcher  ===================
  D  Chinese softshell turtle  ===================
  D              Saker falcon  -------------------
  D           Green seaturtle  ===================
  D              Mallard duck  -------------------
B D                Budgerigar  ===================
B D                    Turkey  ===================
B D                   Chicken  ===================
          Tibetan ground jay  ===================
B D                   Wallaby  ===================
B D        American alligator  ===================
B D                   Opossum  ===================
                Prairie vole  ===================
B D                    Tenrec  ===================
  D          Peregrine falcon  -------------------
            Cape golden mole  ===================
              Golden hamster  ===================
B D                       Rat  -------------------
B D           Chinese hamster  ===================
              Bactrian camel  ===================
      Lesser Egyptian jerboa  -------------------
B D                     Mouse  ===================
B D            Naked mole-rat  ===================
B D                       Cat  ===================
B D                    Alpaca  ===================
B D                       Pig  -------------------

Inserts between block 22 and 23 in window
B D                 Squirrel 141bp
B D                  Ferret  10bp

Alignment block 23 of 27 in window, 182878369 - 182878376, 8 bps 
B D                     Human  acctt--cgg-----------
B D                     Chimp  acctt--cgg-----------
B D                   Gorilla  acctt--cgg-----------
B D                 Orangutan  acctt--tgg-----------
B D                    Gibbon  acctt--tgg-----------
B D                    Rhesus  acctt--tgg-----------
B D       Crab-eating macaque  acctt--tgg-----------
B D                    Baboon  acctt--tgg-----------
B D              Green monkey  acctt--tgg-----------
B D                  Marmoset  acctg--tgg-----------
B D           Squirrel monkey  gcctg--tgg-----------
B D                  Bushbaby  acttg--cag-----------
           Chinese tree shrew  ttttt--aag-----------
B D                  Squirrel  accat--tca-----------
B D                Guinea pig  --aat--tca-----------
                   Chinchilla  --agt--ttg-----------
             Brush-tailed rat  --agt--ttg-----------
B D                   Dolphin  accca--gtg-----------
                 Killer whale  accca--gtg-----------
             Tibetan antelope  accca--gtg-----------
B D                       Cow  accca--gta-----------
B D                     Sheep  accca--gtg-----------
                Domestic goat  accca--gtg-----------
B D                     Horse  accca--atg-----------
B D          White rhinoceros  accca--gtg-----------
B D                       Dog  accca--gtg-----------
B D                     Panda  accca--gtg-----------
               Pacific walrus  accca--gtg-----------
                 Weddell seal  accca--gtg-----------
B D                  Hedgehog  cccca----------------
              Star-nosed mole  acaca--gtg-----------
B D                  Elephant  accca------------gtag
          Cape elephant shrew  atacataatggtaagctgtag
B D                   Manatee  actcg--gtggtgaactgtag
                     Aardvark  actca--gtggtaaactgtag
B D                 Armadillo  tgcct------------gtag
B D                     Shrew  =====================
B D              Nile tilapia  =====================
                 Zebra mbuna  =====================
B D                 Tetraodon  ---------------------
B D               Stickleback  =====================
                 Spotted gar  =====================
         Pundamilia nyererei  =====================
       Burton's mouthbreeder  =====================
         Princess of Burundi  =====================
B D                      Fugu  =====================
B D                Coelacanth  =====================
          Southern platyfish  =====================
B D              Atlantic cod  =====================
B D                    Medaka  =====================
B D                 Zebrafish  =====================
    Mexican tetra (cavefish)  =====================
      Yellowbelly pufferfish  =====================
B D             X. tropicalis  =====================
B D                      Pika  =====================
B D                    Rabbit  ---------------------
B D           Tasmanian devil  =====================
  D               Rock pigeon  =====================
  D    White-throated sparrow  =====================
  D             Scarlet macaw  =====================
  D                    Parrot  =====================
  D    Spiny softshell turtle  =====================
  D            Painted turtle  =====================
B D                  Platypus  =====================
               Big brown bat  =====================
B D                  Microbat  =====================
        David's myotis (bat)  =====================
B D                    Lizard  =====================
B D                   Megabat  =====================
            Black flying-fox  =====================
B D               Zebra finch  =====================
B D       Medium ground finch  =====================
  D       Collared flycatcher  =====================
  D  Chinese softshell turtle  =====================
  D              Saker falcon  ---------------------
  D           Green seaturtle  =====================
  D              Mallard duck  ---------------------
B D                Budgerigar  =====================
B D                    Turkey  =====================
B D                   Chicken  =====================
          Tibetan ground jay  =====================
B D                   Wallaby  =====================
B D        American alligator  =====================
B D                   Opossum  =====================
                Prairie vole  =====================
B D                    Tenrec  =====================
  D          Peregrine falcon  ---------------------
            Cape golden mole  =====================
              Golden hamster  =====================
B D                       Rat  ---------------------
B D           Chinese hamster  =====================
              Bactrian camel  =====================
      Lesser Egyptian jerboa  ---------------------
B D                     Mouse  =====================
B D            Naked mole-rat  =====================
B D                       Cat  =====================
B D                    Alpaca  =====================
B D                       Pig  ---------------------
B D                   Ferret   =====================

Inserts between block 23 and 24 in window
B D                  Dolphin 11bp
                Killer whale 11bp
            Tibetan antelope 11bp
B D                      Cow 11bp
B D                    Sheep 11bp
               Domestic goat 11bp
B D                    Horse 11bp
B D         White rhinoceros 11bp
B D                      Dog 13bp
B D                    Panda 11bp
              Pacific walrus 11bp
                Weddell seal 11bp
B D                 Hedgehog 6bp
             Star-nosed mole 13bp

Alignment block 24 of 27 in window, 182878377 - 182878412, 36 bps 
B D                     Human  tat-t---------------------------------------------------------------tt
B D                     Chimp  tat-t---------------------------------------------------------------tt
B D                   Gorilla  tat-t---------------------------------------------------------------tt
B D                 Orangutan  tat-t---------------------------------------------------------------tt
B D                    Gibbon  tat-t---------------------------------------------------------------tt
B D                    Rhesus  tgc-t---------------------------------------------------------------tt
B D       Crab-eating macaque  tgc-t---------------------------------------------------------------tt
B D                    Baboon  tgc-t---------------------------------------------------------------tt
B D              Green monkey  tgctt---------------------------------------------------------------tt
B D                  Marmoset  tac-tt--------------------gtggggtacctatataaaca----------------------tt
B D           Squirrel monkey  tac-tt--------------------gtggtgtacctatataaaca----------------------tt
B D                  Bushbaby  ggcat---------------------------------------------------------------tc
           Chinese tree shrew  cat-c-----------------------------------------------------------------
B D                  Squirrel  tgt-cttcatacatgtacttagagttatgaagtccatctcattccactgccattcctacccctcttcccc
B D                Guinea pig  tgc-tt--------------------------------------------------------------tc
                   Chinchilla  tac-tt--------------------------------------------------------------tc
             Brush-tailed rat  ta------------------------------------------------------------------tt
B D                   Dolphin  tat-t---------------------------------------------------------------tt
                 Killer whale  tat-t---------------------------------------------------------------tt
             Tibetan antelope  tat-t---------------------------------------------------------------tt
B D                       Cow  tat-t---------------------------------------------------------------tt
B D                     Sheep  tat-t---------------------------------------------------------------tt
                Domestic goat  tat-t---------------------------------------------------------------tt
B D                     Horse  tat-t---------------------------------------------------------------tt
B D          White rhinoceros  tgt-t---------------------------------------------------------------tt
B D                       Dog  tat-t---------------------------------------------------------------tt
B D                   Ferret   tat-t---------------------------------------------------------------tt
B D                     Panda  tat-t---------------------------------------------------------------tt
               Pacific walrus  tat-t---------------------------------------------------------------tt
                 Weddell seal  tat-t---------------------------------------------------------------ta
         David's myotis (bat)  tat-t---------------------------------------------------------------tt
B D                  Microbat  tat-t---------------------------------------------------------------tt
B D                  Hedgehog  tat-t---------------------------------------------------------------tg
              Star-nosed mole  tat-t---------------------------------------------------------------tt
B D                  Elephant  t---------------------------------------------------------------------
          Cape elephant shrew  tat-t---------------------------------------------------------------tt
B D                   Manatee  tat-t---------------------------------------------------------------tt
                     Aardvark  tat-t---------------------------------------------------------------tt
B D                 Armadillo  tat-t---------------------------------------------------------------tt
B D                     Shrew  ======================================================================
B D              Nile tilapia  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Tetraodon  ----------------------------------------------------------------------
B D               Stickleback  ======================================================================
                 Spotted gar  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                      Fugu  ======================================================================
B D                Coelacanth  ======================================================================
          Southern platyfish  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Medaka  ======================================================================
B D                 Zebrafish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                  Platypus  ======================================================================
               Big brown bat  ======================================================================
B D                    Lizard  ======================================================================
B D                   Megabat  ======================================================================
            Black flying-fox  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Saker falcon  ----------------------------------------------------------------------
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ----------------------------------------------------------------------
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
                Prairie vole  ======================================================================
B D                    Tenrec  ======================================================================
  D          Peregrine falcon  ----------------------------------------------------------------------
            Cape golden mole  ======================================================================
              Golden hamster  ======================================================================
B D                       Rat  ----------------------------------------------------------------------
B D           Chinese hamster  ======================================================================
              Bactrian camel  ======================================================================
      Lesser Egyptian jerboa  ----------------------------------------------------------------------
B D                     Mouse  ======================================================================
B D            Naked mole-rat  ======================================================================
B D                       Cat  ======================================================================
B D                    Alpaca  ======================================================================
B D                       Pig  ----------------------------------------------------------------------

                        Human  cttgt----g----gtg-------tatatagcacagtgctacac-t
                        Chimp  cttgt----g----gtg-------tatatagcacagtgctgcac-t
                      Gorilla  cttgt----g----gta-------tatatagcacagtgctgcac-t
                    Orangutan  cttgt----g----gtg-------tatatagcacagtgctgcac-t
                       Gibbon  cttgt----a----gtg-------tatatagcacagtgctgcac-t
                       Rhesus  tctgt----g----gtg-------tatatagcacagtgctgcac-t
          Crab-eating macaque  tctgt----g----gtg-------tatatagcacagtgctgcac-t
                       Baboon  tctgt----g----gtg-------tatatagcacagtgctgcac-t
                 Green monkey  tttgt----g----gtg-------tatatagcacagtgctgcac-t
                     Marmoset  tttatataag----gtg-------tatatagcacagtgctgtac-t
              Squirrel monkey  ttcatataag----gtg-------tatatagcacagtgctgcac-t
                     Bushbaby  cttgt----g----aca--------------------gctg-----
           Chinese tree shrew  ----t----g----gt---------------cacggtgcatcat-t
                     Squirrel  cttgt----a----gtactttctttatgtaacatagggttacct-t
                   Guinea pig  ttggt----g----ctg-------tgtgtacctcaaagctacct-c
                   Chinchilla  ttggt----g----gta-------tatgtacctcagggctacct-c
             Brush-tailed rat  ttggt----g----gtg-------tatgtactgcaagactacct-c
                      Dolphin  ccttt---tg----gtg-------gatttagtgcaatgctactt-t
                 Killer whale  ccttt---tg----gtg-------gatttagtgcaatgctactt-t
             Tibetan antelope  ccttt---cg----ctg-------aattgaacacagtgctactctt
                          Cow  ccttt---tg----ctg-------aattgaacacagtgctactc-t
                        Sheep  ccttt---cg----ctg-------aattgaacacaatgctactctt
                Domestic goat  ccttt---cg----ctg-------aattgaacacaatgctactctt
                        Horse  ccttg----------tg-------gatgtagcactgtgctactc-t
             White rhinoceros  ccttg----------tg-------gatgtggcacagtgctgctt-t
                          Dog  cctta----------tg-------gatgtagcacagtgctactt-t
                      Ferret   cttta----------tg-------gatgta--acaatgctactt-t
                        Panda  ccgta----------tg-------gatgtagcacagtgctactt-t
               Pacific walrus  cttta----------tg-------gatgtagcacagtgctactt-t
                 Weddell seal  cttta----------tg-------gatgtagcacagtgctactt-t
         David's myotis (bat)  atcaa----a----tta-------gatgtagcgcaatgctactt-t
                     Microbat  atcaa----a----tta-------gatgcagcgcaatgctactt-t
                     Hedgehog  cctcg---tg----gta-------aatgta-gccagtgc-------
              Star-nosed mole  ccttg---ag----gta-------gataag-cacagtgccactt-t
                     Elephant  -----------------------------------------tcc-t
          Cape elephant shrew  gtata---tt----gtg-------tatgtagcattgtactacca-t
                      Manatee  cctgg---tg----ata-------tctgtagtaccatgctgccc-t
                     Aardvark  ccttg---tgatgcatg-------tatgtagtacagtggtaccc-t
                    Armadillo  ctttg---tg----gtg-------tatgtagcacagtgctaccc-c
                        Shrew  ==============================================
                 Nile tilapia  ==============================================
                  Zebra mbuna  ==============================================
                    Tetraodon  ----------------------------------------------
                  Stickleback  ==============================================
                  Spotted gar  ==============================================
          Pundamilia nyererei  ==============================================
        Burton's mouthbreeder  ==============================================
          Princess of Burundi  ==============================================
                         Fugu  ==============================================
                   Coelacanth  ==============================================
           Southern platyfish  ==============================================
                 Atlantic cod  ==============================================
                       Medaka  ==============================================
                    Zebrafish  ==============================================
     Mexican tetra (cavefish)  ==============================================
       Yellowbelly pufferfish  ==============================================
                X. tropicalis  ==============================================
                         Pika  ==============================================
                       Rabbit  ----------------------------------------------
              Tasmanian devil  ==============================================
                  Rock pigeon  ==============================================
       White-throated sparrow  ==============================================
                Scarlet macaw  ==============================================
                       Parrot  ==============================================
       Spiny softshell turtle  ==============================================
               Painted turtle  ==============================================
                     Platypus  ==============================================
                Big brown bat  ==============================================
                       Lizard  ==============================================
                      Megabat  ==============================================
             Black flying-fox  ==============================================
                  Zebra finch  ==============================================
          Medium ground finch  ==============================================
          Collared flycatcher  ==============================================
     Chinese softshell turtle  ==============================================
                 Saker falcon  ----------------------------------------------
              Green seaturtle  ==============================================
                 Mallard duck  ----------------------------------------------
                   Budgerigar  ==============================================
                       Turkey  ==============================================
                      Chicken  ==============================================
           Tibetan ground jay  ==============================================
                      Wallaby  ==============================================
           American alligator  ==============================================
                      Opossum  ==============================================
                 Prairie vole  ==============================================
                       Tenrec  ==============================================
             Peregrine falcon  ----------------------------------------------
             Cape golden mole  ==============================================
               Golden hamster  ==============================================
                          Rat  ----------------------------------------------
              Chinese hamster  ==============================================
               Bactrian camel  ==============================================
       Lesser Egyptian jerboa  ----------------------------------------------
                        Mouse  ==============================================
               Naked mole-rat  ==============================================
                          Cat  ==============================================
                       Alpaca  ==============================================
                          Pig  ----------------------------------------------

Inserts between block 24 and 25 in window
          Chinese tree shrew 98bp

Alignment block 25 of 27 in window, 182878413 - 182878451, 39 bps 
B D                     Human  gagtactggct-ttcagcaacataaaggagc------------------------ttacatcaa
B D                     Chimp  gagtactggct-ttcagcgacataaaggagc------------------------ttacatcaa
B D                   Gorilla  gagtactggct-ttcagcgacataaaggagt------------------------ttacatcaa
B D                 Orangutan  gagtactggct-ttcaacgacataaaggagc------------------------ttacatcaa
B D                    Gibbon  gagtactggct-ttcaacgacattaaggagc------------------------ttacatcaa
B D                    Rhesus  gagtactggtt-ttcaacaacataaaggagc------------------------ttacatcaa
B D       Crab-eating macaque  gagtactggtt-ttcaacaacataaaggagc------------------------ttacatcaa
B D                    Baboon  gagtactggtt-ttcaacaacataaaggagc------------------------ttacatcaa
B D              Green monkey  gagtactggtt-ttcaacaacataaaggagc------------------------ttacatcaa
B D                  Marmoset  gagtactggct-ttcaacaacataacggagc------------------------ttatgtcaa
B D           Squirrel monkey  gagtactggct-ttcaacaacataaaggagc------------------------ttatgtcaa
B D                  Bushbaby  ------tcact-ttccacaacagaaaggagc------------------------ttgcaccag
B D                  Squirrel  gagtgccggct-ttca-caacataaaggagt------------------------gtacaccag
B D                Guinea pig  acatgctggct-ttcagcagcatgaaggagc------------------------ttgcaccag
                   Chinchilla  atgtgctgact-ttcagcgacataaaggagc------------------------ttgcaccag
             Brush-tailed rat  acatgctggct-ttcagtgacatagaggagc------------------------ttgcaccag
B D                   Dolphin  gagtgctggcc-tttagcagcata-agaagc------------------------ttgctccag
                 Killer whale  gagtgctggcc-tttagcagcata-agaagc------------------------ttgctccag
             Tibetan antelope  gagtgctggct-ttcaactgcata-agaagc------------------------ttgctccag
B D                       Cow  gagtgctggcc-ttcaactgcat----aagc------------------------ttgctccag
B D                     Sheep  gagtgctggcc-ttcaactgcata-agaagc------------------------ttgctccag
                Domestic goat  gagtgctggcc-ttcaactgcata-agaagc------------------------ttgctccag
B D                     Horse  gagtgctggcc-ttcaaaaacataaaggact------------------------ttgcaccag
B D          White rhinoceros  gagcgctggcc-ttcaacaacatgaaggagt------------------------ttgcgccag
B D                       Dog  gagtgctgacc-ttcaactatatataggagt------------------------ttgcagcag
B D                   Ferret   gagtgctggcc-ttcaactacataaagacgt------------------------ttgcagcag
B D                     Panda  gagtgctggcg-ttcaactacataaaggagt------------------------ttgctgcag
               Pacific walrus  gagtgctggcc-ttcaactacataaaggagt------------------------ttgcagcag
                 Weddell seal  gagtgctggcc-ttcaactacataaaggagt------------------------ttgcagcag
         David's myotis (bat)  gagtgctggcc-ttcaacaatatattaaagtgtctctgaataataaattcagtgcttgcaccag
B D                  Microbat  gagtgctggcc-ttcaacaatatattaaagtgtctctgaataataaatacaatgcttgcaccag
B D                  Hedgehog  ---------------------ataaaggaac------------------------ttgcactag
              Star-nosed mole  gagtgctggcc-ttcaacaaaataagggaac------------------------ttgcaa-ag
B D                  Elephant  gagtactggcc-tgc------ataaagggac------------------------atgcgccag
          Cape elephant shrew  gcatactggccttac------ataaaggaac------------------------ctgcaccag
B D                   Manatee  gagggctggcc-tgc------atacaaggac------------------------ttgccccag
                     Aardvark  gagtgctggcc-tgca-----aaaaaagaac------------------------ttgcagtag
B D                 Armadillo  aagtgctggcc-tataacaacataaaggagc------------------------ttgcaccag
B D                     Shrew  ================================================================
B D              Nile tilapia  ================================================================
                 Zebra mbuna  ================================================================
B D                 Tetraodon  ----------------------------------------------------------------
B D               Stickleback  ================================================================
                 Spotted gar  ================================================================
         Pundamilia nyererei  ================================================================
       Burton's mouthbreeder  ================================================================
         Princess of Burundi  ================================================================
B D                      Fugu  ================================================================
B D                Coelacanth  ================================================================
          Southern platyfish  ================================================================
B D              Atlantic cod  ================================================================
B D                    Medaka  ================================================================
B D                 Zebrafish  ================================================================
    Mexican tetra (cavefish)  ================================================================
      Yellowbelly pufferfish  ================================================================
B D             X. tropicalis  ================================================================
B D                      Pika  ================================================================
B D                    Rabbit  ----------------------------------------------------------------
B D           Tasmanian devil  ================================================================
  D               Rock pigeon  ================================================================
  D    White-throated sparrow  ================================================================
  D             Scarlet macaw  ================================================================
  D                    Parrot  ================================================================
  D    Spiny softshell turtle  ================================================================
  D            Painted turtle  ================================================================
B D                  Platypus  ================================================================
               Big brown bat  ================================================================
B D                    Lizard  ================================================================
B D                   Megabat  ================================================================
            Black flying-fox  ================================================================
B D               Zebra finch  ================================================================
B D       Medium ground finch  ================================================================
  D       Collared flycatcher  ================================================================
  D  Chinese softshell turtle  ================================================================
  D              Saker falcon  ----------------------------------------------------------------
  D           Green seaturtle  ================================================================
  D              Mallard duck  ----------------------------------------------------------------
B D                Budgerigar  ================================================================
B D                    Turkey  ================================================================
B D                   Chicken  ================================================================
          Tibetan ground jay  ================================================================
B D                   Wallaby  ================================================================
B D        American alligator  ================================================================
B D                   Opossum  ================================================================
                Prairie vole  ================================================================
B D                    Tenrec  ================================================================
  D          Peregrine falcon  ----------------------------------------------------------------
            Cape golden mole  ================================================================
              Golden hamster  ================================================================
B D                       Rat  ----------------------------------------------------------------
B D           Chinese hamster  ================================================================
              Bactrian camel  ================================================================
      Lesser Egyptian jerboa  ----------------------------------------------------------------
B D                     Mouse  ================================================================
B D            Naked mole-rat  ================================================================
          Chinese tree shrew  ================================================================
B D                       Cat  ================================================================
B D                    Alpaca  ================================================================
B D                       Pig  ----------------------------------------------------------------

Alignment block 26 of 27 in window, 182878452 - 182878492, 41 bps 
B D                     Human  aatgtaaatct--------aggtat-acttc-cttca--tcaagaaagta-tta
B D                     Chimp  aatgtaaatct--------aggtat-acttc-cttct--tcaagaaagta-tta
B D                   Gorilla  aatgtaaatct--------aggtat-acttc-cttca--tcaaggaagta-tta
B D                 Orangutan  aatgtaaatct--------aggtat-acttc-cttca--tcaagaaagtg-tta
B D                    Gibbon  aatgtaaatct--------aggtat-acttc-cttca--tcaagaaagtg-tta
B D                    Rhesus  aatgtaaatct--------gcgtat-acttc-cttca--tcaagaaagtg-tta
B D       Crab-eating macaque  aatgtaaatct--------gcgtat-acttc-cttca--tcaagaaagtg-tta
B D                    Baboon  aatgtaaatct--------gcgtat-acttc-cttca--tcaagaaagtg-tta
B D              Green monkey  aatgtaaatct--------gcgtat-acttc-cttca--tcaagaaagtg-tta
B D                  Marmoset  aatataaatct--------aggtat-acttc-agtca--tcaagaaagtg-tta
B D           Squirrel monkey  aatataaatct--------aggtat-acttc-attca--tcaagaaagtg-tta
B D                  Bushbaby  aatatagacct--------atgtgtgacttt-cttca--tcaagaaagtc-tta
B D                  Squirrel  aggtaaa---t--------ctgtgt-attac-ttta---tcaagaaactc-cta
B D                Guinea pig  aaggagg--tt--------gtacac-actgc-tttctgcttcagaaattg-cta
                   Chinchilla  aaggaga---c--------aaatgc-actac-tttct--tcaaaacattc-ata
             Brush-tailed rat  a-----------------------------------------------------
B D                   Dolphin  aatgtaaatctgtatatacatatactgcttc-tttca--gcgagaaactc-tta
                 Killer whale  aatgtaaatctgtatatacatatgctgcttc-tttca--gcgagaaactc-tta
             Tibetan antelope  aatgtaaatct--------atatgctgggtc-tttca--ctgagaaa----tta
B D                       Cow  aatgtaaatct--------atacactgcttc-tttca--ctgagaagttc-tta
B D                     Sheep  aatgtaaatct--------atacgctgggtc-tttca--ctgagaaa----tta
                Domestic goat  aatgtaaatct--------atacgctgggtc-tttca--ctgagaaa----tta
B D                     Horse  aatgtaaacct--------gtgcactgcttc-cttca--tcgagaaagtc-tta
B D          White rhinoceros  aatgtaaatct--------atgcactgcttc-tttca--tcgacaaagtc-tta
B D                       Dog  aatataaatct----------acactgtttc-tttta--tcaataacatc-tta
B D                   Ferret   aatataaatct--------agatgctgcttc-tttta--tcatgaaagtt----
B D                     Panda  aatatagatct--------agacactgctgcttttta--tcataaaagtc---a
               Pacific walrus  aatataaatct--------agacactgcttc-tttta--tcacaaaagtc-tta
                 Weddell seal  aatataaatct--------agacactgcttc-tttta--tcacgaaagtc-tta
             Black flying-fox  aatgtgcatct--------ctgcactgcttc-tttca--tcaagagaatc---a
B D                   Megabat  aatgtgca--t--------ctgcactgctgc-tttca--tcaagagaatcctta
         David's myotis (bat)  aatgtaaatct--------gtgtattgcttc-tttta--ccaagaaaatc---t
B D                  Microbat  aatgtaaatct--------gtgtattgcttc-tttta--ccaagaaaatc---t
B D                  Hedgehog  aaaggaaatct--------gtacattgcttc-tccca--atgagaaaga----a
              Star-nosed mole  taacagaatct--------gagcactgcttc-tttca--ttttaacggcc--ta
B D                  Elephant  aatgtagatct--------gtgcacta-----cttca--tcgagaaggcc-tca
          Cape elephant shrew  aataaaactgg--------aaacatct-----catca--ttgagaaagtt-tta
B D                   Manatee  aatgtaaatct--------atgcagta-----cttcc--tcgagaaagtc-tca
                     Aardvark  aatgtaaatct--------acacaata-----cttca--tcaagaaagtc-tta
B D                 Armadillo  aatgtaaatcc--------acacattgcttc-cttca--ttgagaaagt-----
B D                     Shrew  ======================================================
B D              Nile tilapia  ======================================================
                 Zebra mbuna  ======================================================
B D                 Tetraodon  ------------------------------------------------------
B D               Stickleback  ======================================================
                 Spotted gar  ======================================================
         Pundamilia nyererei  ======================================================
       Burton's mouthbreeder  ======================================================
         Princess of Burundi  ======================================================
B D                      Fugu  ======================================================
B D                Coelacanth  ======================================================
          Southern platyfish  ======================================================
B D              Atlantic cod  ======================================================
B D                    Medaka  ======================================================
B D                 Zebrafish  ======================================================
    Mexican tetra (cavefish)  ======================================================
      Yellowbelly pufferfish  ======================================================
B D             X. tropicalis  ======================================================
B D                      Pika  ======================================================
B D                    Rabbit  ------------------------------------------------------
B D           Tasmanian devil  ======================================================
  D               Rock pigeon  ======================================================
  D    White-throated sparrow  ======================================================
  D             Scarlet macaw  ======================================================
  D                    Parrot  ======================================================
  D    Spiny softshell turtle  ======================================================
  D            Painted turtle  ======================================================
B D                  Platypus  ======================================================
               Big brown bat  ======================================================
B D                    Lizard  ======================================================
B D               Zebra finch  ======================================================
B D       Medium ground finch  ======================================================
  D       Collared flycatcher  ======================================================
  D  Chinese softshell turtle  ======================================================
  D              Saker falcon  ------------------------------------------------------
  D           Green seaturtle  ======================================================
  D              Mallard duck  ------------------------------------------------------
B D                Budgerigar  ======================================================
B D                    Turkey  ======================================================
B D                   Chicken  ======================================================
          Tibetan ground jay  ======================================================
B D                   Wallaby  ======================================================
B D        American alligator  ======================================================
B D                   Opossum  ======================================================
                Prairie vole  ======================================================
B D                    Tenrec  ======================================================
  D          Peregrine falcon  ------------------------------------------------------
            Cape golden mole  ======================================================
              Golden hamster  ======================================================
B D                       Rat  ------------------------------------------------------
B D           Chinese hamster  ======================================================
              Bactrian camel  ======================================================
      Lesser Egyptian jerboa  ------------------------------------------------------
B D                     Mouse  ======================================================
B D            Naked mole-rat  ======================================================
          Chinese tree shrew  ======================================================
B D                       Cat  ======================================================
B D                    Alpaca  ======================================================
B D                       Pig  ------------------------------------------------------

Inserts between block 26 and 27 in window
B D                 Squirrel 210bp
B D               Guinea pig 1bp
                  Chinchilla 1bp

Alignment block 27 of 27 in window, 182878493 - 182878505, 13 bps 
B D                     Human  ttacc-aaa-ggaga
B D                     Chimp  ttacc-aaa-ggaga
B D                   Gorilla  ttacc-aaa-ggaga
B D                 Orangutan  ttacc-aaa-ggaga
B D                    Gibbon  ttacc-aaa-ggaga
B D                    Rhesus  ttacc-aa----aga
B D       Crab-eating macaque  ttacc-aa----aga
B D                    Baboon  ttacc-aa----aga
B D              Green monkey  ttacc-aa----aga
B D                  Marmoset  ttacc-aaa-ggaga
B D           Squirrel monkey  ttacc-aaa-ggaga
B D                  Bushbaby  ctacc-aaa-g-ggg
B D                  Squirrel  ttacc-aaa-ggagg
B D                Guinea pig  ccacc-aga-gggat
                   Chinchilla  ctacc-aaa-gtagt
             Brush-tailed rat  ------------agt
B D                   Dolphin  ttaccaaag-gagga
                 Killer whale  ttaccaaag-gagga
             Tibetan antelope  ttaccaaag-gggga
B D                       Cow  ttaccaaag-gcgga
B D                     Sheep  ttaccaaag-aggga
                Domestic goat  ttaccgaag-gggga
B D                     Horse  ttaccaaac-gggga
B D          White rhinoceros  ttaccaaag-gggga
B D                       Dog  ttact-aag-agaga
B D                   Ferret   ttatt-aag-agaga
B D                     Panda  ttact-aag-ggaga
               Pacific walrus  ttact-aag-ggaga
                 Weddell seal  ttact-aag-ggaga
             Black flying-fox  ttatg-aaatggaga
B D                   Megabat  ttatg-aaatggaga
         David's myotis (bat)  ttaca-aaa-ggaga
B D                  Microbat  ttaca-aaa-gggga
B D                  Hedgehog  ttactaaca-aagga
              Star-nosed mole  ttactaaag-gggga
B D                  Elephant  ---------tgggaa
          Cape elephant shrew  ---------tgagga
B D                   Manatee  ---------caggga
                     Aardvark  ---------agggga
B D                 Armadillo  -------------aa
B D                     Shrew  ===============
B D              Nile tilapia  ===============
                 Zebra mbuna  ===============
B D                 Tetraodon  ---------------
B D               Stickleback  ===============
                 Spotted gar  ===============
         Pundamilia nyererei  ===============
       Burton's mouthbreeder  ===============
         Princess of Burundi  ===============
B D                      Fugu  ===============
B D                Coelacanth  ===============
          Southern platyfish  ===============
B D              Atlantic cod  ===============
B D                    Medaka  ===============
B D                 Zebrafish  ===============
    Mexican tetra (cavefish)  ===============
      Yellowbelly pufferfish  ===============
B D             X. tropicalis  ===============
B D                      Pika  ===============
B D                    Rabbit  ---------------
B D           Tasmanian devil  ===============
  D               Rock pigeon  ===============
  D    White-throated sparrow  ===============
  D             Scarlet macaw  ===============
  D                    Parrot  ===============
  D    Spiny softshell turtle  ===============
  D            Painted turtle  ===============
B D                  Platypus  ===============
               Big brown bat  ===============
B D                    Lizard  ===============
B D               Zebra finch  ===============
B D       Medium ground finch  ===============
  D       Collared flycatcher  ===============
  D  Chinese softshell turtle  ===============
  D              Saker falcon  ---------------
  D           Green seaturtle  ===============
  D              Mallard duck  ---------------
B D                Budgerigar  ===============
B D                    Turkey  ===============
B D                   Chicken  ===============
          Tibetan ground jay  ===============
B D                   Wallaby  ===============
B D        American alligator  ===============
B D                   Opossum  ===============
                Prairie vole  ===============
B D                    Tenrec  ===============
  D          Peregrine falcon  ---------------
            Cape golden mole  ===============
              Golden hamster  ===============
B D                       Rat  ---------------
B D           Chinese hamster  ===============
              Bactrian camel  ===============
      Lesser Egyptian jerboa  ---------------
B D                     Mouse  ===============
B D            Naked mole-rat  ===============
          Chinese tree shrew  ===============
B D                       Cat  ===============
B D                    Alpaca  ===============
B D                       Pig  ---------------

View table schema

Go to Conservation track controls

Data last updated: 2015-05-06

Downloads for data in this track are available:

Description

This track shows multiple alignments of 100 vertebrate species and measurements of evolutionary conservation using two methods (phastCons and phyloP) from the PHAST package, for all species. The multiple alignments were generated using multiz and other tools in the UCSC/Penn State Bioinformatics comparative genomics alignment pipeline. Conserved elements identified by phastCons are also displayed in this track. PHAST/Multiz are built from chains ("alignable") and nets ("syntenic"), see the documentation of the Chain/Net tracks for a description of the complete alignment process.

PhastCons is a hidden Markov model-based method that estimates the probability that each nucleotide belongs to a conserved element, based on the multiple alignment. It considers not just each individual alignment column, but also its flanking columns. By contrast, phyloP separately measures conservation at individual columns, ignoring the effects of their neighbors. As a consequence, the phyloP plots have a less smooth appearance than the phastCons plots, with more "texture" at individual sites. The two methods have different strengths and weaknesses. PhastCons is sensitive to "runs" of conserved sites, and is therefore effective for picking out conserved elements. PhyloP, on the other hand, is more appropriate for evaluating signatures of selection at particular nucleotides or classes of nucleotides (e.g., third codon positions, or first positions of miRNA target sites).

Another important difference is that phyloP can measure acceleration (faster evolution than expected under neutral drift) as well as conservation (slower than expected evolution). In the phyloP plots, sites predicted to be conserved are assigned positive scores (and shown in blue), while sites predicted to be fast-evolving are assigned negative scores (and shown in red). The absolute values of the scores represent -log p-values under a null hypothesis of neutral evolution. The phastCons scores, by contrast, represent probabilities of negative selection and range between 0 and 1.

Both phastCons and phyloP treat alignment gaps and unaligned nucleotides as missing data, and both were run with the same parameters.

See also: lastz parameters and other details and chain minimum score and gap parameters used in these alignments.

UCSC has repeatmasked and aligned all genome assemblies, and provides all the sequences for download. For genome assemblies not available in the genome browser, there are alternative assembly hub genome browsers. Missing sequence in any assembly is highlighted in the track display by regions of yellow when zoomed out and by Ns when displayed at base level (see Gap Annotation, below).

Primate subset
OrganismSpeciesRelease dateUCSC versionAlignment type
BaboonPapio hamadryasMar 2012Baylor Panu_2.0/papAnu2Reciprocal best net
BushbabyOtolemur garnettiiMar 2011Broad/otoGar3Syntenic net
ChimpPan troglodytesFeb 2011CSAC 2.1.4/panTro4Syntenic net
Crab-eating macaqueMacaca fascicularisJun 2013Macaca_fascicularis_5.0/macFas5Syntenic net
GibbonNomascus leucogenysOct 2012GGSC Nleu3.0/nomLeu3Syntenic net
GorillaGorilla gorilla gorillaMay 2011gorGor3.1/gorGor3Reciprocal best net
Green monkeyChlorocebus sabaeusMar 2014Chlorocebus_sabeus 1.1/chlSab2Syntenic net
HumanHomo sapiensDec 2013GRCh38/hg38reference species
MarmosetCallithrix jacchusMar 2009WUGSC 3.2/calJac3Syntenic net
OrangutanPongo pygmaeus abeliiJuly 2007WUGSC 2.0.2/ponAbe2Reciprocal best net
RhesusMacaca mulattaOct 2010BGI CR_1.0/rheMac3Syntenic net
Squirrel monkeySaimiri boliviensisOct 2011Broad/saiBol1Syntenic net
Euarchontoglires subset
Brush-tailed ratOctodon degusApr 2012OctDeg1.0/octDeg1Syntenic net
ChinchillaChinchilla lanigeraMay 2012 ChiLan1.0/chiLan1Syntenic net
Chinese hamsterCricetulus griseusJul 2013C_griseus_v1.0/criGri1Syntenic net
Chinese tree shrewTupaia chinensisJan 2013TupChi_1.0/tupChi1Syntenic net
Golden hamsterMesocricetus auratusMar 2013MesAur1.0/mesAur1Syntenic net
Guinea pigCavia porcellusFeb 2008Broad/cavPor3Syntenic net
Lesser Egyptian jerboaJaculus jaculusMay 2012JacJac1.0/jacJac1Syntenic net
MouseMus musculusDec 2011GRCm38/mm10Syntenic net
Naked mole-ratHeterocephalus glaberJan 2012Broad HetGla_female_1.0/hetGla2Syntenic net
PikaOchotona princepsMay 2012OchPri3.0/ochPri3Syntenic net
Prairie voleMicrotus ochrogasterOct 2012MicOch1.0/micOch1Syntenic net
RabbitOryctolagus cuniculusApr 2009Broad/oryCun2Syntenic net
RatRattus norvegicusJul 2014RGSC 6.0/rn6Syntenic net
SquirrelSpermophilus tridecemlineatusNov 2011Broad/speTri2Syntenic net
Laurasiatheria subset
AlpacaVicugna pacosMar 2013Vicugna_pacos-2.0.1/vicPac2Syntenic net
Bactrian camelCamelus ferusDec 2011CB1/camFer1Syntenic net
Big brown batEptesicus fuscusJul 2012EptFus1.0/eptFus1Syntenic net
Black flying-foxPteropus alectoAug 2012ASM32557v1/pteAle1Syntenic net
CatFelis catusNov 2014ICGSC Felis_catus 8.0/felCat8Syntenic net
CowBos taurusJun 2014Bos_taurus_UMD_3.1.1/bosTau8Syntenic net
David's myotis batMyotis davidiiAug 2012ASM32734v1/myoDav1Syntenic net
DogCanis lupus familiarisSep 2011Broad CanFam3.1/canFam3Syntenic net
DolphinTursiops truncatusOct 2011Baylor Ttru_1.4/turTru2Reciprocal best net
Domestic goatCapra hircusMay 2012CHIR_1.0/capHir1Syntenic net
Ferret Mustela putorius furoApr 2011MusPutFur1.0/musFur1Syntenic net
HedgehogErinaceus europaeusMay 2012EriEur2.0/eriEur2Syntenic net
HorseEquus caballusSep 2007EquCab3.0/equCab3Syntenic net
Killer whaleOrcinus orcaJan 2013Oorc_1.1/orcOrc1Syntenic net
MegabatPteropus vampyrusJul 2008Broad/pteVam1Reciprocal best net
MicrobatMyotis lucifugusJul 2010Broad Institute Myoluc2.0/myoLuc2Syntenic net
Pacific walrusOdobenus rosmarus divergensJan 2013Oros_1.0/odoRosDiv1Syntenic net
PandaAiluropoda melanoleucaDec 2009BGI-Shenzhen 1.0/ailMel1Syntenic net
PigSus scrofaAug 2011SGSC Sscrofa10.2/susScr3Syntenic net
SheepOvis ariesAug 2012ISGC Oar_v3.1/oviAri3Syntenic net
ShrewSorex araneusAug 2008Broad/sorAra2Syntenic net
Star-nosed moleCondylura cristataMar 2012ConCri1.0/conCri1Syntenic net
Tibetan antelopePantholops hodgsoniiMay 2013PHO1.0/panHod1Syntenic net
Weddell sealLeptonychotes weddelliiMar 2013LepWed1.0/lepWed1Reciprocal best net
White rhinocerosCeratotherium simumMay 2012CerSimSim1.0/cerSim1Syntenic net
Afrotheria subset
AardvarkOrycteropus afer aferMay 2012OryAfe1.0/oryAfe1Syntenic net
Cape elephant shrewElephantulus edwardiiAug 2012EleEdw1.0/eleEdw1Syntenic net
Cape golden moleChrysochloris asiaticaAug 2012ChrAsi1.0/chrAsi1Syntenic net
ElephantLoxodonta africanaJul 2009Broad/loxAfr3Syntenic net
ManateeTrichechus manatus latirostrisOct 2011Broad v1.0/triMan1Syntenic net
TenrecEchinops telfairiNov 2012Broad/echTel2Syntenic net
Mammal subset
ArmadilloDasypus novemcinctusDec 2011Baylor/dasNov3Syntenic net
OpossumMonodelphis domesticaOct 2006Broad/monDom5Net
PlatypusOrnithorhynchus anatinusMar 2007WUGSC 5.0.1/ornAna1Reciprocal best net
Tasmanian devilSarcophilus harrisiiFeb 2011WTSI Devil_ref v7.0/sarHar1Net
WallabyMacropus eugeniiSep 2009TWGS Meug_1.1/macEug2Reciprocal best net
Aves subset
BudgerigarMelopsittacus undulatusSep 2011WUSTL v6.3/melUnd1Net
ChickenGallus gallusNov 2011ICGSC Gallus_gallus-4.0/galGal4Net
Collared flycatcherFicedula albicollisJun 2013FicAlb1.5/ficAlb2Net
Mallard duckAnas platyrhynchosApr 2013BGI_duck_1.0/anaPla1Net
Medium ground finchGeospiza fortisApr 2012GeoFor_1.0/geoFor1Net
ParrotAmazona vittataJan 2013AV1/amaVit1Net
Peregrine falconFalco peregrinusFeb 2013F_peregrinus_v1.0/falPer1Net
Rock pigeonColumba liviaFeb 2013Cliv_1.0/colLiv1Net
Saker falconFalco cherrugFeb 2013F_cherrug_v1.0/falChe1Net
Scarlet macawAra macaoJun 2013SMACv1.1/araMac1Net
Tibetan ground jayPseudopodoces humilisJan 2013PseHum1.0/pseHum1Net
TurkeyMeleagris gallopavoDec 2009TGC Turkey_2.01/melGal1Net
White-throated sparrowZonotrichia albicollisApr 2013ASM38545v1/zonAlb1Net
Zebra finchTaeniopygia guttataFeb 2013WashU taeGut324/taeGut2Net
Sarcopterygii subset
American alligatorAlligator mississippiensisAug 2012allMis0.2/allMis1Net
Chinese softshell turtlePelodiscus sinensisOct 2011PelSin_1.0/pelSin1Net
CoelacanthLatimeria chalumnaeAug 2011Broad/latCha1Net
Green seaturtleChelonia mydasMar 2013CheMyd_1.0/cheMyd1Net
LizardAnolis carolinensisMay 2010Broad AnoCar2.0/anoCar2Net
Painted turtleChrysemys picta belliiMar 2014v3.0.3/chrPic2Net
Spiny softshell turtleApalone spiniferaMay 2013ASM38561v1/apaSpi1Net
X. tropicalisXenopus tropicalisSep 2012JGI 7.0/xenTro7Net
Fish subset
Atlantic codGadus morhuaMay 2010Genofisk GadMor_May2010/gadMor1Net
Burton's mouthbreederHaplochromis burtoniOct 2011AstBur1.0/hapBur1Net
FuguTakifugu rubripesOct 2011FUGU5/fr3Net
LampreyPetromyzon marinusSep 2010WUGSC 7.0/petMar2Net
MedakaOryzias latipesOct 2005NIG/UT MEDAKA1/oryLat2Net
Mexican tetra (cavefish)Astyanax mexicanusApr 2013Astyanax_mexicanus-1.0.2/astMex1Net
Nile tilapiaOreochromis niloticusJan 2011Broad oreNil1.1/oreNil2Net
Princess of BurundiNeolamprologus brichardiMay 2011NeoBri1.0/neoBri1Net
Pundamilia nyerereiPundamilia nyerereiOct 2011PunNye1.0/punNye1Net
Southern platyfishXiphophorus maculatusJan 2012Xiphophorus_maculatus-4.4.2/xipMac1Net
Spotted garLepisosteus oculatusDec 2011LepOcu1/lepOcu1Net
SticklebackGasterosteus aculeatusFeb 2006Broad/gasAcu1Net
TetraodonTetraodon nigroviridisMar 2007Genoscope 8.0/tetNig2Net
Yellowbelly pufferfishTakifugu flavidusMay 2013version 1 of Takifugu flavidus genome/takFla1Net
Zebra mbunaMaylandia zebraMar 2012MetZeb1.1/mayZeb1Net
ZebrafishDanio rerioSep 2014GRCz10/danRer10Net

Table 1. Genome assemblies included in the 100-way Conservation track.

Display Conventions and Configuration

In full and pack display modes, conservation scores are displayed as a wiggle track (histogram) in which the height reflects the size of the score. The conservation wiggles can be configured in a variety of ways to highlight different aspects of the displayed information. Click the Graph configuration help link for an explanation of the configuration options.

Pairwise alignments of each species to the human genome are displayed below the conservation histogram as a grayscale density plot (in pack mode) or as a wiggle (in full mode) that indicates alignment quality. In dense display mode, conservation is shown in grayscale using darker values to indicate higher levels of overall conservation as scored by phastCons.

Checkboxes on the track configuration page allow selection of the species to include in the pairwise display. Note that excluding species from the pairwise display does not alter the the conservation score display.

To view detailed information about the alignments at a specific position, zoom the display in to 30,000 or fewer bases, then click on the alignment.

Gap Annotation

The Display chains between alignments configuration option enables display of gaps between alignment blocks in the pairwise alignments in a manner similar to the Chain track display. The following conventions are used:

  • Single line: No bases in the aligned species. Possibly due to a lineage-specific insertion between the aligned blocks in the human genome or a lineage-specific deletion between the aligned blocks in the aligning species.
  • Double line: Aligning species has one or more unalignable bases in the gap region. Possibly due to excessive evolutionary distance between species or independent indels in the region between the aligned blocks in both species.
  • Pale yellow coloring: Aligning species has Ns in the gap region. Reflects uncertainty in the relationship between the DNA of both species, due to lack of sequence in relevant portions of the aligning species.

Genomic Breaks

Discontinuities in the genomic context (chromosome, scaffold or region) of the aligned DNA in the aligning species are shown as follows:

  • Vertical blue bar: Represents a discontinuity that persists indefinitely on either side, e.g. a large region of DNA on either side of the bar comes from a different chromosome in the aligned species due to a large scale rearrangement.
  • Green square brackets: Enclose shorter alignments consisting of DNA from one genomic context in the aligned species nested inside a larger chain of alignments from a different genomic context. The alignment within the brackets may represent a short misalignment, a lineage-specific insertion of a transposon in the human genome that aligns to a paralogous copy somewhere else in the aligned species, or other similar occurrence.

Base Level

When zoomed-in to the base-level display, the track shows the base composition of each alignment. The numbers and symbols on the Gaps line indicate the lengths of gaps in the human sequence at those alignment positions relative to the longest non-human sequence. If there is sufficient space in the display, the size of the gap is shown. If the space is insufficient and the gap size is a multiple of 3, a "*" is displayed; other gap sizes are indicated by "+".

Codon translation is available in base-level display mode if the displayed region is identified as a coding segment. To display this annotation, select the species for translation from the pull-down menu in the Codon Translation configuration section at the top of the page. Then, select one of the following modes:

  • No codon translation: The gene annotation is not used; the bases are displayed without translation.
  • Use default species reading frames for translation: The annotations from the genome displayed in the Default species to establish reading frame pull-down menu are used to translate all the aligned species present in the alignment.
  • Use reading frames for species if available, otherwise no translation: Codon translation is performed only for those species where the region is annotated as protein coding.
  • Use reading frames for species if available, otherwise use default species: Codon translation is done on those species that are annotated as being protein coding over the aligned region using species-specific annotation; the remaining species are translated using the default species annotation.

Codon translation uses the following gene tracks as the basis for translation:

Gene TrackSpecies
UCSC GenesHuman, Mouse
RefSeq GenesCow, Frog (X. tropicalis)
Ensembl Genes v73Atlantic cod, Bushbaby, Cat, Chicken, Chimp, Coelacanth, Dog, Elephant, Ferret, Fugu, Gorilla, Horse, Lamprey, Lizard, Mallard duck, Marmoset, Medaka, Megabat, Microbat, Orangutan, Panda, Pig, Platypus, Rat, Soft-shell Turtle, Southern platyfish, Squirrel, Tasmanian devil, Tetraodo