Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 48 in window, 16085256 - 16085268, 13 bps 
B D                     Human  cat-------ttttctataa
B D                     Chimp  tat-------ttttctataa
B D                   Gorilla  tat-------ttttcaataa
B D                 Orangutan  -at-------ttttcaataa
B D                    Gibbon  tat-------ttttcaataa
B D                    Rhesus  tat------atttttaataa
B D       Crab-eating macaque  tat------atttttaataa
B D                    Baboon  tat------atttttaataa
B D              Green monkey  tat-------tttttaataa
B D                  Marmoset  t-t-------ttttcgataa
B D           Squirrel monkey  t-t-------ttttcaataa
B D                  Bushbaby  ta--------tattcaatgc
           Chinese tree shrew  ta--------ttttcaatag
B D                  Squirrel  tgtg-t---ctttctaataa
       Lesser Egyptian jerboa  cata-t---atttccagtag
                 Prairie vole  taaa-t---atttccaggaa
B D           Chinese hamster  tata-t---atgtctaggaa
               Golden hamster  tgta-t---atgtctaggaa
B D                     Mouse  catg-c---atttctagtaa
B D                       Rat  tatg-c---atttctagtaa
B D                    Rabbit  -gtg-t---gttttctggaa
B D                      Pika  -acg-t---gtattctggaa
B D                       Pig  tcca-t---attttcagtg-
B D                    Alpaca  tata-t---atttgcagtaa
               Bactrian camel  tata-t---atttgcagtaa
B D                   Dolphin  tata-t---gttttcagcaa
                 Killer whale  tata-t---gttttcagcaa
             Tibetan antelope  tata-t---attttcagcaa
B D                       Cow  tata-t---attttcagcaa
B D                     Sheep  tata-t---attttcagcaa
                Domestic goat  tata-t---attttcagcaa
B D                     Horse  tatt-t---atttttcttaa
B D          White rhinoceros  tata-t---atttttcttaa
B D                       Cat  tata-t---attctccttaa
B D                       Dog  tcca-t---attttccttaa
B D                   Ferret   tatc-t---attttccc---
B D                     Panda  tata-t---atttgccctag
               Pacific walrus  tata-t---attttccctaa
                 Weddell seal  tata-t---attttccctaa
             Black flying-fox  tata-t---attttcattaa
B D                   Megabat  tata-t---attttcattaa
                Big brown bat  tata-t---ggtgcgattaa
         David's myotis (bat)  tata-t---agtgtgattaa
B D                  Microbat  tata-t---agtgtgattaa
B D                  Hedgehog  cgta-c---attttcatgaa
B D                     Shrew  tata-a---attttcattga
              Star-nosed mole  tccc-c---attttcattca
B D                  Elephant  taca-t---attttcaacaa
B D                   Manatee  tata-t---attttcaacaa
             Cape golden mole  t-cagt---gttttcaacaa
B D                    Tenrec  tatagtatggttttcaacaa
                     Aardvark  tata-t---attttcaaaaa
B D                 Armadillo  cata-t---atgctcaacaa
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
B D                Coelacanth  ====================
B D                Budgerigar  ====================
  D               Rock pigeon  ====================
  D              Mallard duck  ====================
  D  Chinese softshell turtle  ====================
B D                   Chicken  ====================
B D       Medium ground finch  ====================
B D                    Turkey  ====================
  D            Painted turtle  ====================
B D               Zebra finch  ====================
  D       Collared flycatcher  ====================
B D        American alligator  ====================
          Tibetan ground jay  ====================
B D                    Lizard  ====================
  D    White-throated sparrow  ====================
         Cape elephant shrew  ====================
B D                  Platypus  ====================
  D           Green seaturtle  ====================

Inserts between block 1 and 2 in window
B D                 Marmoset 310bp

Alignment block 2 of 48 in window, 16085269 - 16085302, 34 bps 
B D                     Human  tcatttctt-----gtttt-----------------tt--acagtgaagtgcaaaaaa
B D                     Chimp  tcatttctt-----gtttt-----------------tt--acagtgaagtgtaaaaaa
B D                   Gorilla  tcatttctt-----gtttt-----------------tt--acagtgaagtgcaaaaaa
B D                 Orangutan  tcatttctt-----gtttt-----------------tt--acagtgaagtgcaaaaaa
B D                    Gibbon  tcatttctt-----gtttt-----------------tt--acagtgaagtgcaaaaaa
B D                    Rhesus  tcatttctt-----gtttt-----------------tt--acagcgaagtgcaaaaaa
B D       Crab-eating macaque  tcatttctt-----gtttt-----------------tt--acagcgaagtgcaaaaaa
B D                    Baboon  tcatttctt-----gtttt-----------------tt--acagcgaagtgcaaaaaa
B D              Green monkey  tcatttctt-----gtttt-----------------tt--acagcgaagtgcaaaaaa
B D                  Marmoset  tcatgtctt-----gtttg-----------------tt--acagtgaagtgcaaaaaa
B D           Squirrel monkey  tcatgtctt-----gtttt-----------------tt--acagtaaagtccaaaaaa
B D                  Bushbaby  tcgtttctt-----gttct-----------------tt--atggtgaagtgtggaaaa
           Chinese tree shrew  ccatttctt-----gttct-----------------tt--atagcaaggtgt-gaaaa
B D                  Squirrel  tcgtctctt-----gttct-----------------tc--acggtgaagtttgggaaa
       Lesser Egyptian jerboa  tcatttctttttaaatttttatttatttatttgtaagc--aaagagaaatagaaaaga
                 Prairie vole  ttatttctt-----gccct-----------------gc--acagtgatggaggagaga
B D           Chinese hamster  tcctttctt-----gcctt-----------------ac--acagagaagtaggagaaa
               Golden hamster  --ccttctt-----gcctt-----------------gt--acagtgatgtaggggtga
B D                     Mouse  tcatttctt-----gtttt-----------------gc--acagtaaagtatgagaga
B D                       Rat  tcatttctt-----ggtct-----------------gc--acagtaaagtatgagaaa
B D                    Rabbit  tgatttctt-----gctct-----------------tt--gcagcaaagtatgagaa-
B D                      Pika  taagctctt-----gttct-----------------tt--ccagcaatgtatgaaaa-
B D                       Pig  -aatgtctt-----cttct-----------------tt--ccagtgaagtgtggaaaa
B D                    Alpaca  caatttctc-----attct-----------------tt--tcagtgaagtgtggaaaa
               Bactrian camel  caatttctc-----attct-----------------tt--acagtgaagtgtggaaaa
B D                   Dolphin  caatttctt-----cttct-----------------tt--acagta-agtgtggaaaa
                 Killer whale  caatttctt-----cttct-----------------tt--acagta-agtgtggaaaa
             Tibetan antelope  caatttctt-----cttct-----------------tt--acagcaaagcgtggaaaa
B D                       Cow  caatttctt-----cttct-----------------tt--acagtgaagcgtggaaga
B D                     Sheep  caat---tt-----cttct-----------------tt--acagcacagcatggaaaa
                Domestic goat  caat---tt-----cttct-----------------tt--acagcaaagcatggaaaa
B D                     Horse  caatttctg-----cctct-----------------tt--acagtgatgtgtggaaga
B D          White rhinoceros  caatttctg-----gttct-----------------tt--acagtgatgtgtggaaaa
B D                       Cat  taattt-----------------------------------cagcgaagtgtggataa
B D                       Dog  taatttctt-----gttct-----------------tt--acagtgaagtgtggaaaa
B D                   Ferret   taatttctt-----gttct-----------------tt---cagtgaagtatggaaaa
B D                     Panda  taatttctc-----gtcct-----------------tt--acagtgaagtgtggaaaa
               Pacific walrus  taatttctt-----gttct-----------------tt--acagtgaagtgtggaaaa
                 Weddell seal  taatttctt-----gttct-----------------tt--acagtgaagtgtggaaaa
             Black flying-fox  taatttcta-----gttcc-----------------tt--acagtgaagtgtggcaaa
B D                   Megabat  taatttcta-----gctcc-----------------tt--acagtgaagtgtggcaaa
                Big brown bat  tcatttctt-----gttcc-----------------tt--acagtgaagtgtggggaa
         David's myotis (bat)  tcatctctt-----gttcc-----------------tt--acagtgaagtgtgggaaa
B D                  Microbat  tcatttctt-----gttcc-----------------tt--acagtgaagtgtgggaaa
B D                  Hedgehog  gactttttg-----attgt-----------------tt--tccg----gtgcagagca
B D                     Shrew  tgatttctt-----gttca-----------------tg--acagtgaagtgtgggaaa
              Star-nosed mole  tcgtttctt-----gttct-----------------tt--gcag-gaagtgtggagga
B D                  Elephant  taattttgt-----gttct-----------------tt--agagttaagtttggaaaa
B D                   Manatee  taatttctt-----gttct-----------------tt--agagttcagtttggaaaa
             Cape golden mole  acagt---t-----gcctt-----------------tt--aaagtgaagcttgaaaaa
B D                    Tenrec  taatt---t-----atttt-----------------tttgagagtgaagtctggaaaa
                     Aardvark  taattcctt-----accct-----------------tt--agagttaagtttggaaaa
B D                 Armadillo  taatttctt-----gtcct-----------------gt--acagtgaaatgagaaaaa
  D          Peregrine falcon  ==========================================================
  D              Saker falcon  ==========================================================
B D                Coelacanth  ==========================================================
B D                Budgerigar  ==========================================================
  D               Rock pigeon  ==========================================================
  D              Mallard duck  ==========================================================
  D  Chinese softshell turtle  ==========================================================
B D                   Chicken  ==========================================================
B D       Medium ground finch  ==========================================================
B D                    Turkey  ==========================================================
  D            Painted turtle  ==========================================================
B D               Zebra finch  ==========================================================
  D       Collared flycatcher  ==========================================================
B D        American alligator  ==========================================================
          Tibetan ground jay  ==========================================================
B D                    Lizard  ==========================================================
  D    White-throated sparrow  ==========================================================
         Cape elephant shrew  ==========================================================
B D                  Platypus  ==========================================================
  D           Green seaturtle  ==========================================================

Inserts between block 2 and 3 in window
      Lesser Egyptian jerboa 392bp
B D                 Hedgehog 4bp
B D                 Elephant 1bp
                    Aardvark 1bp

Alignment block 3 of 48 in window, 16085303 - 16085425, 123 bps 
B D                     Human  tgaacaagga---ggcccaatgatgc--atctgcttaactt---------ttcagttgtc-aatgcaaat
B D                     Chimp  tgaacaagga---ggcccaatgatgc--atctgcttaactt---------ttcagttgtc-aatgcaaat
B D                   Gorilla  tgaacaagga---ggcccaatgatgc--atctgcttaacta---------ttcagttgtc-aatgcaaat
B D                 Orangutan  tgaacaagga---ggcccaatgatgc--atctgcttaactt---------ttcagttgtc-aacgcaaat
B D                    Gibbon  tgaacaaaga---ggcccgatgatgc--aactgcttaactt---------ttcagttgtc-aacgcacat
B D                    Rhesus  tgaacaaaga---ggcccgatgatgc--atctgctgaactt---------ttcagttgtcaaatgcaaat
B D       Crab-eating macaque  tgaacaaaga---ggcccgatgatgc--atctgctgaactt---------ttcagttgtcaaatgcaaat
B D                    Baboon  tgaacgaaga---ggcccaatgatgc--atctgctgaactt---------ttcagttgtcaaatgcaaat
B D              Green monkey  tgaacaaaga---ggcccgatgatgc--atctgcttaactt---------ttcagttgtcaaatgcaaat
B D                  Marmoset  tgaacagagg---ggcccgattatgc--atctgcttaactt---------ttcagttgtc-aacgcaaat
B D           Squirrel monkey  tgaacaaagg---ggcccgattatgc--atctgcttaac-t---------ttcagtcgtc-aacgcaaat
B D                  Bushbaby  tgaacaaag----ggcccaattgtgc--atctgcttcgctt---------tcccgttgtt-aaagcaaat
           Chinese tree shrew  cgaacaaagg--------------gc--atccgctcaac-t---------ttcagttgtc-caagcaaat
B D                  Squirrel  tgaacaaaa----ggcccggatgtcc--atctgcttaactt---------ccaggtggtc-aaaggaaat
                 Prairie vole  ggaacaaag----gctctgt-tgtgt--acctgcttaactc---------tgcagccgcc-gcagcaaac
B D           Chinese hamster  agaaaaaag----ggcccat-tgtat--atctgcttaactt---------tgcagtcacc-acagtaaac
               Golden hamster  agagcaaag----ggcctgt-tgtgt--atctgcttaactt---------tgcagtcctc-acagcaagc
B D                     Mouse  agaacaaag----ggtccat-tgtgt--atctgcttaactt---------tgcagtcgac-acagcaaaa
B D                       Rat  agaacaaag----ggcccat-tgtgt--atctgcttaaatt---------tgcagtcgcc-acagcaaaa
B D                    Rabbit  tgaacaaag----ggctcgactgtgc--gtctgctcaactt---------tgcagttgtc-aaaggaaat
B D                      Pika  tgaacaaagggctggctcaactgtgt--gtctgcttaactt---------tgcagttatc-aaaga----
B D                       Pig  ggaacaaag----ggcccagtggcc---acctgcccaactt---------tccagttgtc-aaagcaaat
B D                    Alpaca  tgaacaaga----ggcccagttgtg---acctgcctaactt---------tccagttgtc-aaaacaaat
               Bactrian camel  tgaacaaga----ggcccagttgtg---acctgcctaactt---------tccagttgtc-aaaacaaat
B D                   Dolphin  tgaacaaag----ggcccaattgtg---atctgcctcactt---------cccagttgtc-aaagcaaat
                 Killer whale  tgaacaaag----ggcccaattgtg---atctgcctcactt---------tccagttgtc-aaagcaaat
             Tibetan antelope  tgaatgaag----ggcccaactgtg---atctgcctacttt---------tccagttgtc-aaagcaaac
B D                       Cow  tgaatgaag----ggcccaactgtg---atctgcctacttt---------tccagttatc-aaagcaaac
B D                     Sheep  tgaatgaag----ggcccaactgtg---atctgcctacttt---------tccagttgtc-aaagcaaac
                Domestic goat  tgaatgaag----ggcccaactgtg---atctgcctacttt---------tccagttgtc-aaagcaaac
B D                     Horse  tgaacacac----gcctcagtc-tgt--gtctgccgaactt---------tccaggtgtc-taagcaaat
B D          White rhinoceros  tgaacacag----gcctcaattgcgt--acctgcctaactt---------tccagttgtc-atagcaaat
B D                       Cat  tgaacaaaa----ggcccgatggctc--atct----aactt---------tccagttgtc-aaagccaat
B D                       Dog  tgaacaaag----gggccgattgtgc--atct----cactt---------tccagttgtc-acagcaaat
B D                   Ferret   tgaacaaag----ggctctactgtgc--attt----aactt---------tccagttatc-aaagcaaat
B D                     Panda  tgaacaaag----gggccgactgtgc--atct----aactt---------cccagttgtc-agagcaaat
               Pacific walrus  tgaacaaag----gggccagctgtgc--atct----aactt---------ggcagttgtc-aaagcagat
                 Weddell seal  tgaacaaag----gagccgactgtgc--atct----aactt---------tccagtcgtc-aaagcaaat
             Black flying-fox  tgaacaaag----ggctcgattgtgc--atctgcctaattt---------tccatttgtc-aaagcaaat
B D                   Megabat  tgaacaaag----ggctcgattgtgc--atctgcctaattt---------tccatttgtc-aaagcaaat
                Big brown bat  tgaacaaag----ggcccaattgtgcatatctgcccaacgt---------cccatttgtc-aaggcaaat
         David's myotis (bat)  tgaacaaag----ggcccaattgtgcatatctgcccaacgt---------cccatttgtc-aaggcaaat
B D                  Microbat  tgaacaaag----ggcccaattgtgcatatctgcccaacgt---------cccatttgtc-aaggcaaat
B D                  Hedgehog  tgagcaaag----ggcccacagacac--atccacttgaggt---------cccagccgtc-aaaggaaac
B D                     Shrew  tgaacaaag----cacccagttgtat--ccctgctt-atctttctagcaaccactggatt-gaa---cac
              Star-nosed mole  tgaacaaga----ggcccagtcgtgc--atctgctt-acct---------ccccggggtc-aaagctccc
B D                  Elephant  taaacaaag----ggccccaaagtgt--atctgcttaactt---------tccagctgtc-aaagcaaat
B D                   Manatee  taaacaaag----ggccgaaaagcac--atctgcttaactt---------tccagttgtc-aaagcaaac
             Cape golden mole  cgaatcaag----ggtccaaaagcac--atctgcttaactt---------tccagttgtt-aaggcaaat
B D                    Tenrec  tgaacaaag----ggtcccaaagaac--acct---------------------agttgtt-ga-gtggat
                     Aardvark  tgaacaaag----ggccccaaagcac--atctgtttaactt---------ttcagttgtc-aaagcaaat
B D                 Armadillo  tgaac--ag----tgtccgcttgagc--atctgctgaactt---------tccagttgtc-aaagcagat
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                Coelacanth  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Lizard  ======================================================================
  D    White-throated sparrow  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
  D           Green seaturtle  ======================================================================
      Lesser Egyptian jerboa  ======================================================================

                        Human  t---------aagcacaaagaggacagagttgatgacatat--c-------------agg----------
                        Chimp  t---------aagcacaaagaggacagtgttgatgacatat--c-------------agg----------
                      Gorilla  t---------aagcacaaagaggacagagttgatgacatat--c-------------agg----------
                    Orangutan  t---------aagcacaaagaggacagagttgatgacgtat--c-------------agg----------
                       Gibbon  t---------aagcacaaagaggacagagttgatgacatac--c-------------agg----------
                       Rhesus  t---------gagcacaaagaggacagagttgatgacatat--c-------------agg----------
          Crab-eating macaque  t---------gagcacaaagaggacagagttgatgacatat--c-------------agg----------
                       Baboon  t---------aagcacaaagaggacagagttgatgacatat--c-------------agg----------
                 Green monkey  t---------gagcacaaagaggatagagttgatgacatat--c-------------agg----------
                     Marmoset  t---------gagcacaaacagaagagagttggtgacatat--c-------------agg----------
              Squirrel monkey  t---------gagcacaaacagaagagagttggtgacatat--c-------------agg----------
                     Bushbaby  t---------gagcacagagaggacagagtcgatgacatat--c-------------aga----------
           Chinese tree shrew  t---------gagcaccaagaggacagagttgatgacatat--g-------------aga----------
                     Squirrel  c---------gagtgcagagagaatagtgtccatgacacat--t-------------gtg----------
                 Prairie vole  c---------cag----cagaggatg--gtccattgtgccc--t-------------gga----------
              Chinese hamster  c---------cag----gagaggccg--gtcaattgttcat--t-------------gga----------
               Golden hamster  c---------cag----gagaggccg--gtcgatcgttcat--t-------------gga----------
                        Mouse  c---------tgg----cagaggacc--cccgatcgtacat--t-------------gga----------
                          Rat  c---------cgg----cagagaaca--cccgatcatacac--t-------------gaa----------
                       Rabbit  t---------gagcgctgtgaggacg--gcgggtgacacag--c-------------cga----------
                         Pika  -------------------gtggaca--gtcggtgatacac--a-------------caa----------
                          Pig  t---------gaattcagagagggcaagcttgacagta-----g-------------aga----------
                       Alpaca  t---------gaaggcagcgaaggc--aggtgacaacaca------------------------------
               Bactrian camel  t---------gaaggcagagaagac--aggtgacaacaca------------------------------
                      Dolphin  t---------gaactcagagaggacagagttgacaacacag--g-------------aaa----------
                 Killer whale  t---------gaactcagagaggacagagttgacaacgcag--g-------------aaa----------
             Tibetan antelope  t---------gggtgcaaagaggac--agttgacaacatat--g-------------aga----------
                          Cow  t---------ggatgcaaagaggac--agttgacaacatat--g-------------aga----------
                        Sheep  t---------ggatgcaaagaggac--agttgacaacatat--g-------------aga----------
                Domestic goat  t---------ggatgcaaagaggac--agttgacaacatat--g-------------aga----------
                        Horse  t---------gaacacagaggggacagaattgacgacacac--a-------------aga----------
             White rhinoceros  t---------gaacacagagagaacagagttgacgacaaac--g-------------aga----------
                          Cat  t---------ggatgcagagaggatggagttgatgacacac--g-------------aga----------
                          Dog  t---------gagcacagaggggatggagttgacgacacac--g-------------aga----------
                      Ferret   t---------gaacacgcagaggatagagttggcgacacat--g-------------aga----------
                        Panda  t---------gaacacggagaggatggagttgacgacatgt--g-------------aga----------
               Pacific walrus  t---------gaacacggagaggatggagttgatgacacatgag-------------aga----------
                 Weddell seal  t---------gaacacagagaggatggagtggacaacacac--g-------------aga----------
             Black flying-fox  t---------gaacacagagaggacagagttgatgacacat--g-------------aga----------
                      Megabat  t---------gaacacagagaggacagagttgatgacacat--g-------------aga----------
                Big brown bat  t---------gaacacagagaggatggagttgatgacacat--g-------------aga----------
         David's myotis (bat)  t---------gaacacagagaggatggagttgatgacacac--a-------------aga----------
                     Microbat  t---------gaacacagagaggatggagttgatgacacat--g-------------aga----------
                     Hedgehog  tgag------cagagtggcagggatagagttgaggacgcac--a-------------gaaggaccagaag
                        Shrew  ttagtagattgaagatggagaggataaagtggatgacaagt--g-------------gca----------
              Star-nosed mole  tgag------gcagagggcgcgggc--agccgaggacgcgt--g-------------agc----------
                     Elephant  t---------gagcac--agaggacaaagttgatgacacat--c-------------aaa----------
                      Manatee  t---------gagcac--agaggacaaagttgatgatacac--c-------------aaa----------
             Cape golden mole  t---------gagcat--agaggacagatttgatgacatat--c-------------aaa----------
                       Tenrec  g---------gagttc--agagggcagggccggggacaggt--ttgaaagctcagagcag----------
                     Aardvark  t---------gagtac--agaggacagagttgatgacacat--c-------------aaa----------
                    Armadillo  t---------gagcca--agaggacgggg-tgatgatgcat--c-------------aaa----------
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                   Coelacanth  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
                 Mallard duck  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
               Painted turtle  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================
           American alligator  ======================================================================
           Tibetan ground jay  ======================================================================
                       Lizard  ======================================================================
       White-throated sparrow  ======================================================================
          Cape elephant shrew  ======================================================================
                     Platypus  ======================================================================
              Green seaturtle  ======================================================================
       Lesser Egyptian jerboa  ======================================================================

                        Human  -aacattttttac--------ttc--c----ggag-------caggtctga----gtc
                        Chimp  -aatattttttac--------ttc--c----ggag-------caggtctga----gtc
                      Gorilla  -aacattttttac--------ttc--c----ggag-------caggtctga----gtc
                    Orangutan  -aacattttttac--------ttc--c----agag-------caggtctga----gtc
                       Gibbon  -aacattctttac--------ttc--c----agag-------cagatctga----gtg
                       Rhesus  -aacattttttat--------ttc--c----agag-------caggtctga----gtc
          Crab-eating macaque  -aacattttttat--------ttc--c----agag-------caggtctga----gtc
                       Baboon  -aacattttttat--------ttc--c----agag-------caggtctga----gtc
                 Green monkey  -aacattttttat--------ttc--c----agag-------caggtctga----gtc
                     Marmoset  -gacgtctcttac--------ttc--c----agag-------cagatcaga----gtc
              Squirrel monkey  -aacgtcttttac--------ttc--c----agag-------caggtctga----gtc
                     Bushbaby  -acaaattttcat--------ttc--c----aggg-------caggtctga----gtc
           Chinese tree shrew  -acaggtttacat--------ttc--a----ggag-------caatcctga----gtc
                     Squirrel  -acgggtttgcgt--------ttc--c----agag-------taggtctga----gtc
                 Prairie vole  -ac-agttggtac--------g----c----acag-------gaagtctga----gtc
              Chinese hamster  -ac-agtttgtag--------a-c--c----agag-------g-agtctga----gtc
               Golden hamster  -ac-agtttgtat--------g-c--c----acag-------gaaatcgga----gtc
                        Mouse  -ac-agtttgtat--------g-g--c----gcag-------g-agcctag----gtc
                          Rat  -ac-agtttgtat--------g-g--c----acag-------g-aatctgg----gtc
                       Rabbit  -gcaggtctgagt--------c-c--ctgctaca------------tcag--------
                         Pika  -gcaggttcgcgt--------t-g--ctggaacag-------g---tcaga----gtc
                          Pig  -acaggtttgcat--------ctc--a----agat-------gagatctaa----ggc
                       Alpaca  --caggtttttgt--------ctc--a----agag-------cagacctga----ggt
               Bactrian camel  --caggtttttgt--------ctc--a----aggg-------cagatctga----ggt
                      Dolphin  -acaagtttgcat--------ttc--a----agag-------cagatctga----ggc
                 Killer whale  -acaagtttgcat--------ttc--a----agag-------cagatctga----ggc
             Tibetan antelope  -gcaggtttgcat--------ttc--a----agag-------caggtctga----cgc
                          Cow  -gcaggtttacat--------ttc--a----agtg-------caggtctga----cgc
                        Sheep  -gcaggtttgcat--------ttc--a----agag-------caggtctga----cgc
                Domestic goat  -gcaggtttgcat--------ttc--a----agag-------caggtctga----tgc
                        Horse  -acaggtttgccc--------ttc--a----agag-------caggtctga----gcc
             White rhinoceros  -acaggtttgcat--------ttc--a----agag-------caggtctga----gtc
                          Cat  -acaggtttgcat--------ttc--a----agcg-------caggtctga----gtc
                          Dog  -acaggtttgtgt--------ttc--a----tgag-------caggtctga----gtc
                      Ferret   -acaggttttctt--------ttc--a----aggg-------caggtctga----gtc
                        Panda  -acaggtttgcgt--------ttcaag----agag-------caggtctga----gtc
               Pacific walrus  -acaggttc-----------------a----agag-------caggtctga----gtc
                 Weddell seal  -acaggttc-----------------a----agag-------caggtctga----gtc
             Black flying-fox  -acaggtttgcat--------ttc--a----agag-------caggtcgga----gtc
                      Megabat  -acaggtttgcat--------ttc--a----agag-------caggtcgga----gtc
                Big brown bat  -acaggtttacat--------ttc--a----agag-------cagacctga----gtc
         David's myotis (bat)  -acaggtttgcat--------ttc--a----agag-------cagacctga----gtc
                     Microbat  -acaggtttgcat--------ttc--a----agag-------cagacctga----gtc
                     Hedgehog  gaccagtctgcat--------ttc--t----ggag-------acggtctga----gtc
                        Shrew  -tcagctttgtgt--------ttc--a----agag-------caggtctgg----gtc
              Star-nosed mole  -acaggttt-------------------------g-------caggtctgg----gcc
                     Elephant  -acaggttagaat--------ttg--a----agag-------caggtctca----gtt
                      Manatee  -acaggtttgaat--------ttg--a----agag-------caagtctga----gcc
             Cape golden mole  -atcagtttgaat--------tag--a----agag-------caggtttga----gtc
                       Tenrec  -ataggtgtgagtcgcaggtgcag--a----atagacacgcccggtactgaatctgcc
                     Aardvark  -acaggtttgaat--------ttg--a----agag-------caggtctga----gtc
                    Armadillo  -acagggttccct--------ttt--g----agag-------ca-----------ggc
             Peregrine falcon  ==========================================================
                 Saker falcon  ==========================================================
                   Coelacanth  ==========================================================
                   Budgerigar  ==========================================================
                  Rock pigeon  ==========================================================
                 Mallard duck  ==========================================================
     Chinese softshell turtle  ==========================================================
                      Chicken  ==========================================================
          Medium ground finch  ==========================================================
                       Turkey  ==========================================================
               Painted turtle  ==========================================================
                  Zebra finch  ==========================================================
          Collared flycatcher  ==========================================================
           American alligator  ==========================================================
           Tibetan ground jay  ==========================================================
                       Lizard  ==========================================================
       White-throated sparrow  ==========================================================
          Cape elephant shrew  ==========================================================
                     Platypus  ==========================================================
              Green seaturtle  ==========================================================
       Lesser Egyptian jerboa  ==========================================================

Inserts between block 3 and 4 in window
             Star-nosed mole 120bp

Alignment block 4 of 48 in window, 16085426 - 16085435, 10 bps 
B D                     Human  ccagcggaag
B D                     Chimp  ccagcggaag
B D                   Gorilla  ccagcggaag
B D                 Orangutan  ccagcggaag
B D                    Gibbon  ccagcagaag
B D                    Rhesus  ccagcggaag
B D       Crab-eating macaque  ccagcggaag
B D                    Baboon  ccagcggaag
B D              Green monkey  ccagcggaag
B D                  Marmoset  ccagtggaag
B D           Squirrel monkey  ccagcggaag
B D                  Bushbaby  ccaggtggag
           Chinese tree shrew  ccagtcaaaa
B D                  Squirrel  ccagctgagg
                 Prairie vole  ccagataaag
B D           Chinese hamster  ccagataaag
               Golden hamster  ccagataaag
B D                     Mouse  tcagatgaag
B D                       Rat  ccagatgaag
B D                      Pika  gccactgggg
B D                       Pig  gcatcggaag
B D                    Alpaca  ccagccgaag
               Bactrian camel  ccagctgaag
B D                   Dolphin  ccagctgaag
                 Killer whale  ccagctgaag
             Tibetan antelope  ccagctgaag
B D                       Cow  ccagctgaag
B D                     Sheep  ccagctgaag
                Domestic goat  ccagctgaag
B D                     Horse  ccagctgcag
B D          White rhinoceros  ccagctgtgg
B D                       Cat  ctagctg-ag
B D                       Dog  ccagctg-ag
B D                   Ferret   ccacctg-ag
B D                     Panda  ccagctg-gg
               Pacific walrus  gcagctg-ag
                 Weddell seal  ccagctg-ag
             Black flying-fox  ccagctgaag
B D                   Megabat  ccagctgaag
                Big brown bat  cccgttgaag
         David's myotis (bat)  ccagttgaag
B D                  Microbat  ccagttgaag
B D                  Hedgehog  ccagctgagt
B D                     Shrew  cctgaaggaa
B D                  Elephant  gcagctgaag
B D                   Manatee  acagctgaag
             Cape golden mole  cca---gaaa
B D                    Tenrec  cta---ggag
                     Aardvark  ccagctgaag
B D                 Armadillo  ccagatgaag
             Star-nosed mole  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
B D                Coelacanth  ==========
B D                Budgerigar  ==========
  D               Rock pigeon  ==========
  D              Mallard duck  ==========
  D  Chinese softshell turtle  ==========
B D                   Chicken  ==========
B D       Medium ground finch  ==========
B D                    Turkey  ==========
  D            Painted turtle  ==========
B D               Zebra finch  ==========
  D       Collared flycatcher  ==========
B D        American alligator  ==========
          Tibetan ground jay  ==========
B D                    Lizard  ==========
  D    White-throated sparrow  ==========
         Cape elephant shrew  ==========
B D                  Platypus  ==========
  D           Green seaturtle  ==========
B D                    Rabbit  ----------
      Lesser Egyptian jerboa  ==========

Inserts between block 4 and 5 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 269bp
B D                      Cow 1bp
B D                    Sheep 268bp
               Domestic goat 269bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 2bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                 Hedgehog 3bp
B D                    Shrew 3bp

Alignment block 5 of 48 in window, 16085436 - 16085438, 3 bps 
B D                     Human  -a----------------------------------------c------t
B D                     Chimp  -a----------------------------------------c------t
B D                   Gorilla  -a----------------------------------------c------t
B D                 Orangutan  -a----------------------------------------c------t
B D                    Gibbon  -a----------------------------------------c-tgaggt
B D                    Rhesus  -a----------------------------------------c------t
B D       Crab-eating macaque  -a----------------------------------------c------t
B D                    Baboon  -a----------------------------------------c------t
B D              Green monkey  -a----------------------------------------c------t
B D                  Marmoset  -a----------------------------------------c------t
B D           Squirrel monkey  -a----------------------------------------c------t
B D                  Bushbaby  -a----------------------------------------c------t
           Chinese tree shrew  -t----------------------------------------g------c
B D                  Squirrel  -a----------------------------------------a------a
                 Prairie vole  -a----------------------------------------t------g
B D           Chinese hamster  -a----------------------------------------t------t
               Golden hamster  -a----------------------------------------t------t
B D                     Mouse  -a----------------------------------------t------t
B D                       Rat  -a----------------------------------------t------g
B D                      Pika  -a------------------------------------------------
B D                       Pig  -g----------------------------------------t-------
B D                    Alpaca  -g----------------------------------------t-------
               Bactrian camel  -g----------------------------------------t-------
B D                   Dolphin  -a----------------------------------------t-------
                 Killer whale  -a----------------------------------------t-------
B D                       Cow  -a----------------------------------------t-------
B D                     Horse  -a----------------------------------------t-------
B D          White rhinoceros  -a----------------------------------------c-------
B D                       Cat  -t----------------------------------------t-------
B D                       Dog  -a----------------------------------------c-------
B D                   Ferret   -a----------------------------------------c-------
B D                     Panda  -a----------------------------------------c-------
               Pacific walrus  -a----------------------------------------c-------
                 Weddell seal  -a----------------------------------------c-------
             Black flying-fox  -a----------------------------------------t-------
B D                   Megabat  -a----------------------------------------t-------
                Big brown bat  -a----------------------------------------t-------
         David's myotis (bat)  -a----------------------------------------t-------
B D                  Microbat  -a----------------------------------------t-------
B D                  Hedgehog  -a----------------------------------------ct------
B D                     Shrew  -a----------------------------------------ct------
B D                  Elephant  aa----------------------------------------t-------
B D                   Manatee  aa----------------------------------------t-------
             Cape golden mole  aa----------------------------------------t-------
B D                    Tenrec  aaagtaaaaactaaactcactggcagagtggaacggactctgt-------
                     Aardvark  aa----------------------------------------t-------
B D                 Armadillo  aa----------------------------------------g-------
             Star-nosed mole  ==================================================
  D          Peregrine falcon  ==================================================
  D              Saker falcon  ==================================================
B D                Coelacanth  ==================================================
B D                Budgerigar  ==================================================
  D               Rock pigeon  ==================================================
  D              Mallard duck  ==================================================
  D  Chinese softshell turtle  ==================================================
B D                   Chicken  ==================================================
B D       Medium ground finch  ==================================================
B D                    Turkey  ==================================================
  D            Painted turtle  ==================================================
B D               Zebra finch  ==================================================
  D       Collared flycatcher  ==================================================
B D        American alligator  ==================================================
          Tibetan ground jay  ==================================================
B D                    Lizard  ==================================================
  D    White-throated sparrow  ==================================================
         Cape elephant shrew  ==================================================
               Domestic goat  ==================================================
B D                     Sheep  ==================================================
B D                  Platypus  ==================================================
  D           Green seaturtle  ==================================================
            Tibetan antelope  ==================================================
B D                    Rabbit  --------------------------------------------------
      Lesser Egyptian jerboa  ==================================================

Inserts between block 5 and 6 in window
B D                      Cow 252bp

Alignment block 6 of 48 in window, 16085439 - 16085442, 4 bps 
B D                     Human  gagg----------
B D                     Chimp  gagg----------
B D                   Gorilla  gagg----------
B D                 Orangutan  gagg----------
B D                    Gibbon  gagg----------
B D                    Rhesus  gagg----------
B D       Crab-eating macaque  gagg----------
B D                    Baboon  gagg----------
B D              Green monkey  gagg----------
B D                  Marmoset  gagg----------
B D           Squirrel monkey  gagg----------
B D                  Bushbaby  gggg----------
           Chinese tree shrew  ggaa----------
B D                  Squirrel  g--g----------
                 Prairie vole  g--g----------
B D           Chinese hamster  g--g----------
               Golden hamster  g--g----------
B D                     Mouse  g--g----------
B D                       Rat  g--g----------
B D                    Rabbit  ---g----------
B D                      Pika  ---g----------
B D                       Pig  gggg----------
B D                    Alpaca  gagg----------
               Bactrian camel  gagg----------
B D                   Dolphin  gggg----------
                 Killer whale  gggg----------
B D                     Horse  gggg----------
B D          White rhinoceros  gggg----------
B D                       Cat  gggg----------
B D                       Dog  gtgg----------
B D                   Ferret   gggg----------
B D                     Panda  gggg----------
               Pacific walrus  gggg----------
                 Weddell seal  gggg----------
             Black flying-fox  gggg----------
B D                   Megabat  gggg----------
                Big brown bat  gggg----------
         David's myotis (bat)  ggag----------
B D                  Microbat  gggg----------
B D                  Hedgehog  gaag----------
B D                     Shrew  gagg----------
B D                  Elephant  --ga--------ga
B D                   Manatee  --gg--------ga
             Cape golden mole  --gggc------ga
B D                    Tenrec  --gggtttctgaga
                     Aardvark  --gg--------ga
B D                 Armadillo  --gg--------gt
             Star-nosed mole  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
B D                Coelacanth  ==============
B D                Budgerigar  ==============
  D               Rock pigeon  ==============
  D              Mallard duck  ==============
  D  Chinese softshell turtle  ==============
B D                   Chicken  ==============
B D       Medium ground finch  ==============
B D                    Turkey  ==============
  D            Painted turtle  ==============
B D               Zebra finch  ==============
  D       Collared flycatcher  ==============
B D        American alligator  ==============
          Tibetan ground jay  ==============
B D                    Lizard  ==============
  D    White-throated sparrow  ==============
         Cape elephant shrew  ==============
               Domestic goat  ==============
B D                     Sheep  ==============
B D                  Platypus  ==============
  D           Green seaturtle  ==============
B D                       Cow  ==============
            Tibetan antelope  ==============
      Lesser Egyptian jerboa  ==============

Inserts between block 6 and 7 in window
B D                 Hedgehog 3260bp

Alignment block 7 of 48 in window, 16085443 - 16085454, 12 bps 
B D                     Human  cc-gact-------ga-gc-----------------ca---------
B D                     Chimp  cc-gact-------ga-gc-----------------ca---------
B D                   Gorilla  cc-gact-------ga-gc-----------------ca---------
B D                 Orangutan  cc-aact-------ga-gc-----------------ca---------
B D                    Gibbon  cc-gact-------ga-gc-----------------ca---------
B D                    Rhesus  cc-gact-------ga-gc-----------------ca---------
B D       Crab-eating macaque  cc-gact-------ga-gc-----------------ca---------
B D                    Baboon  cc-gact-------ga-gccagaggtaccacttcaaca---------
B D              Green monkey  ct-gact-------ga-gc-----------------ca---------
B D                  Marmoset  ct-gact-------ga-gc-----------------ca---------
B D           Squirrel monkey  ct-gact-------ga-gc-----------------ca---------
B D                  Bushbaby  ct-gagt-------ca-gg-----------------ca---------
           Chinese tree shrew  ct-ggcc-------gaggt-----------------ca---------
B D                  Squirrel  gctgact-------ga-gg-----------------ca---------
                 Prairie vole  gc-aact-------ga-gg-----------------ca---------
B D           Chinese hamster  ac-aact-------ga-gg-----------------ca---------
               Golden hamster  ac-aact-------ga-gg-----------------ca---------
B D                     Mouse  ac-agct-------at-gg-----------------ca---------
B D                       Rat  ac-aact-------ct-gg-----------------ca---------
B D                    Rabbit  cc-gact-------gg-gg-----------------ca---------
B D                      Pika  cc-gacttac----tg-aa-----------------ca---------
B D                       Pig  ct-gct--------ga-gg-----------------ca---------
B D                    Alpaca  ct-gac--------ga-gg-----------------ca---------
               Bactrian camel  ct-ggc--------ga-gg-----------------ca---------
B D                   Dolphin  ct-gcc--------aa-gg-----------------ca---------
                 Killer whale  ct-gcc--------aa-gg-----------------ca---------
B D                     Horse  ct-gactgaggcc-ga-ag-----------------ca---------
B D          White rhinoceros  ct-gactgaggccggg-gg-----------------ca---------
B D                       Cat  ct-gact-------ga-gt-----------------ta---------
B D                       Dog  ct-g-cg-------gg-gg-----------------ca---------
B D                   Ferret   at-gacc-------aa-gg-----------------ca---------
B D                     Panda  ct-gacc-------ga-cg-----------------ca---------
               Pacific walrus  ct-gagg-------ga-gg-----------------cg---------
                 Weddell seal  ct-gagg-------ga-gg-----------------ca---------
             Black flying-fox  ct-ggct-------ga-gg-----------------ca---------
B D                   Megabat  ct-ggct-------ga-gg-----------------ca---------
                Big brown bat  ct-gact-------ga-gg-----------------ca---------
         David's myotis (bat)  ct-gacc-------ga-gg-----------------ca---------
B D                  Microbat  ct-gact-------ga-gg-----------------ca---------
B D                     Shrew  --------------ga-gg-----------------ag---------
B D                  Elephant  -----------------------------------ctatcttagtac
B D                   Manatee  -----------------------------------ctg---------
             Cape golden mole  -----------------------------------tcg---cagtac
B D                    Tenrec  -----------------------------------ccg---taactc
                     Aardvark  -----------------------------------ctaccctagtac
B D                 Armadillo  -----------------------------------ctgtcccggcag
             Star-nosed mole  ===============================================
B D                  Hedgehog  ===============================================
  D          Peregrine falcon  ===============================================
  D              Saker falcon  ===============================================
B D                Coelacanth  ===============================================
B D                Budgerigar  ===============================================
  D               Rock pigeon  ===============================================
  D              Mallard duck  ===============================================
  D  Chinese softshell turtle  ===============================================
B D                   Chicken  ===============================================
B D       Medium ground finch  ===============================================
B D                    Turkey  ===============================================
  D            Painted turtle  ===============================================
B D               Zebra finch  ===============================================
  D       Collared flycatcher  ===============================================
B D        American alligator  ===============================================
          Tibetan ground jay  ===============================================
B D                    Lizard  ===============================================
  D    White-throated sparrow  ===============================================
         Cape elephant shrew  ===============================================
               Domestic goat  ===============================================
B D                     Sheep  ===============================================
B D                  Platypus  ===============================================
  D           Green seaturtle  ===============================================
B D                       Cow  ===============================================
            Tibetan antelope  ===============================================
      Lesser Egyptian jerboa  ===============================================

Inserts between block 7 and 8 in window
B D                 Elephant 18bp
B D                  Manatee 16bp
            Cape golden mole 18bp
B D                   Tenrec 44bp
                    Aardvark 18bp
B D                Armadillo 17bp

Alignment block 8 of 48 in window, 16085455 - 16085496, 42 bps 
B D                     Human  g-aggcaccacttcaata-ggtcactggtct-----c-tgca-----------------------gggaa
B D                     Chimp  g-aggcaccacttcaata-ggtcactggtct-----c-tgca-----------------------gggaa
B D                   Gorilla  g-aggcaccacttcaata-ggtcactggtct-----c-tgca-----------------------gggaa
B D                 Orangutan  g-aggcaccacttcaata-ggtcactggtct-----c-tgca-----------------------gggga
B D                    Gibbon  g-aggcgccacttcaata-ggtcactggtct-----c-tgcg-----------------------gggga
B D                    Rhesus  g-aggtaccacttcaaca-ggtcactggtct-----c-tgca-----------------------gagga
B D       Crab-eating macaque  g-aggtaccacttcaaca-ggtcactggtct-----c-tgca-----------------------gagga
B D                    Baboon  g-aggtaccacttcaaca-ggtcactggtct-----c-tgca-----------------------gagga
B D              Green monkey  g-aggtaccacttcaaca-ggtcactggtct-----c-tgca-----------------------gagga
B D                  Marmoset  g-aggtaccacttcaaca-gcctgctggtct-----c-tgca-----------------------gggga
B D           Squirrel monkey  g-aggtaccacttcaaca-ggccactggtct-----c-tgcg-----------------------gggga
B D                  Bushbaby  gaaggcaccacttaaata-agcccctgggct-----c-tgca-----------------------gggga
           Chinese tree shrew  a-aggcacga-ggaaaca-agcaac-gggct-----c-tgtg-----------------------agtaa
B D                  Squirrel  gaaggtaccactt--gca-ga----aagctcttggtc-ttgc-----------------------tggaa
                 Prairie vole  ggagtcactgtttgaaca-gg----cgacct------------------------------------gaa
B D           Chinese hamster  gaagtcgc--ttttacta-gg----tgacct------------------------------------gaa
               Golden hamster  gaagtcactgttttaata-gg----tgacct------------------------------------gaa
B D                     Mouse  aaggacactattttaaca-gg----cagcct------------------------------------gaa
B D                       Rat  gagggcactgttttaaca-gg----aaactt------------------------------------gaa
B D                    Rabbit  gaaggcacccctgcaaca-agt---cagtct-----c-tggg-----------------------tggaa
B D                      Pika  gaaggcagcattgggaca-g-----cagttt-----c-tggg-----------------------tagaa
B D                       Pig  g-agacatcacttaa-----g---------g---------------------------------------
B D                    Alpaca  g-aaccatcacttaaata-ag---------c---------------------------------------
               Bactrian camel  g-aaccatcacttaaata-ag---------c---------------------------------------
B D                   Dolphin  g-aggcatcacttaaaca-gg---------c---------------------------------------
                 Killer whale  g-aggcatcacttaaaca-ag---------c---------------------------------------
B D                     Horse  g-aggcgtcatttagaga-tg---------c---------------------------------------
B D          White rhinoceros  g-aggcgtgactgaaaca-ag---------c---------------------------------------
B D                       Cat  g-aggcatcaccaaaacc-ag---------c---------------------------------------
B D                       Dog  g-aggcatcacggaaatc-aa---------c---------------------------------------
B D                   Ferret   g-cggcatccctacagcc-cg---------c---------------------------------------
B D                     Panda  g-gggcatccccacgacc-ag---------c---------------------------------------
               Pacific walrus  g-cagcatcactacaacc-ag---------c---------------------------------------
                 Weddell seal  g-caacatcgctaccacc-ag---------c---------------------------------------
             Black flying-fox  g-aggagtcgcttaaaca-ag---------c---------------------------------------
B D                   Megabat  g-aggagtcgcttaaaca-ag---------c---------------------------------------
                Big brown bat  a-aggcaggactgaacta-ag---------c---------------------------------------
         David's myotis (bat)  g-aggcaggactcagctg-ag---------c---------------------------------------
B D                  Microbat  a-aggcaggacgcagcta-ag---------c---------------------------------------
B D                     Shrew  g-tgacattgcttcaaca-ag---------g---------------------------------------
B D                  Elephant  -aagacaccacttaaaca--g-caccggtct-----cttgtg-----------------------gagaa
          Cape elephant shrew  -aaggtatcacttaaata-ct-catgggtct-----c-tgtg-----------------------gagga
B D                   Manatee  -aaggcaacacttaaaca--g-catt-gtct-----c-tggg-----------------------gagga
             Cape golden mole  -aaggcttcatttaaata-cc-tactgctct-----t-tgtgcagagtcccaatgtggcactgcaggata
B D                    Tenrec  -gagacagcccttcaaca-gc-cattggttc-----c-tgtg-----------------------ggcta
                     Aardvark  -aaggcatcacttaaaca-tg-cattgatct-----t-tgtg-----------------------gagaa
B D                 Armadillo  -gaggcggccctccaacaact-gactgttct-----c-tgtg-----------------------gggaa
             Star-nosed mole  ======================================================================
B D                  Hedgehog  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                Coelacanth  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Lizard  ======================================================================
  D    White-throated sparrow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                  Platypus  ======================================================================
  D           Green seaturtle  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
      Lesser Egyptian jerboa  ======================================================================

                        Human  agg
                        Chimp  agg
                      Gorilla  agg
                    Orangutan  att
                       Gibbon  agg
                       Rhesus  agg
          Crab-eating macaque  agg
                       Baboon  agg
                 Green monkey  agg
                     Marmoset  agg
              Squirrel monkey  agg
                     Bushbaby  agg
           Chinese tree shrew  agg
                     Squirrel  ggc
                 Prairie vole  gcc
              Chinese hamster  ggc
               Golden hamster  ggc
                        Mouse  ggc
                          Rat  gac
                       Rabbit  aga
                         Pika  tga
                          Pig  ---
                       Alpaca  ---
               Bactrian camel  ---
                      Dolphin  ---
                 Killer whale  ---
                        Horse  ---
             White rhinoceros  ---
                          Cat  ---
                          Dog  ---
                      Ferret   ---
                        Panda  ---
               Pacific walrus  ---
                 Weddell seal  ---
             Black flying-fox  ---
                      Megabat  ---
                Big brown bat  ---
         David's myotis (bat)  ---
                     Microbat  ---
                        Shrew  ---
                     Elephant  gga
          Cape elephant shrew  ggt
                      Manatee  aga
             Cape golden mole  aag
                       Tenrec  gag
                     Aardvark  agg
                    Armadillo  gga
              Star-nosed mole  ===
                     Hedgehog  ===
             Peregrine falcon  ===
                 Saker falcon  ===
                   Coelacanth  ===
                   Budgerigar  ===
                  Rock pigeon  ===
                 Mallard duck  ===
     Chinese softshell turtle  ===
                      Chicken  ===
          Medium ground finch  ===
                       Turkey  ===
               Painted turtle  ===
                  Zebra finch  ===
          Collared flycatcher  ===
           American alligator  ===
           Tibetan ground jay  ===
                       Lizard  ===
       White-throated sparrow  ===
                Domestic goat  ===
                        Sheep  ===
                     Platypus  ===
              Green seaturtle  ===
                          Cow  ===
             Tibetan antelope  ===
       Lesser Egyptian jerboa  ===

Inserts between block 8 and 9 in window
            Cape golden mole 185bp
                    Aardvark 1bp

Alignment block 9 of 48 in window, 16085497 - 16085531, 35 bps 
B D                     Human  a-aaaggt------------------------------------------------------g-------
B D                     Chimp  a-aaaggt------------------------------------------------------g-------
B D                   Gorilla  a-aaaggt------------------------------------------------------g-------
B D                 Orangutan  a-aaaggt------------------------------------------------------a-------
B D                    Gibbon  a-aaaggt------------------------------------------------------g-------
B D                    Rhesus  a-aaaggt------------------------------------------------------g-------
B D       Crab-eating macaque  a-aaaggt------------------------------------------------------g-------
B D                    Baboon  a-aaaggt------------------------------------------------------g-------
B D              Green monkey  a-aaaggt------------------------------------------------------g-------
B D                  Marmoset  a-agagga------------------------------------------------------g-------
B D           Squirrel monkey  a-agagga------------------------------------------------------g-------
B D                  Bushbaby  acagaggg------------------------------------------------------g-------
           Chinese tree shrew  acaaaggt------------------------------------------------------g-------
B D                  Squirrel  c-aaaggg------------------------------------------------------g-------
                 Prairie vole  c-aaaggg------------------------------------------------------t-------
B D           Chinese hamster  c-aaaggg------------------------------------------------------a-------
               Golden hamster  c-aaaggt------------------------------------------------------a-------
B D                     Mouse  c-agaggg------------------------------------------------------t-------
B D                       Rat  c-aaggca------------------------------------------------------t-------
B D                    Rabbit  c-acaggg------------------------------------------------------g-------
B D                      Pika  c-aaaggg------------------------------------------------------c-------
B D                       Pig  --gc------------------------------------------------------------------
B D                    Alpaca  --ta------------------------------------------------------------------
               Bactrian camel  --ta------------------------------------------------------------------
B D                   Dolphin  --ga------------------------------------------------------------------
                 Killer whale  --ga------------------------------------------------------------------
B D                     Horse  --aa------------------------------------------------------------------
B D          White rhinoceros  --ga------------------------------------------------------------------
B D                       Cat  --ca------------------------------------------------------------------
B D                       Dog  --ag------------------------------------------------------------------
B D                   Ferret   --ag------------------------------------------------------------------
B D                     Panda  --ag------------------------------------------------------------------
               Pacific walrus  --aa------------------------------------------------------------------
                 Weddell seal  --aa------------------------------------------------------------------
             Black flying-fox  --ga------------------------------------------------------------------
B D                   Megabat  --ga------------------------------------------------------------------
                Big brown bat  --ag------------------------------------------------------------------
         David's myotis (bat)  --ag------------------------------------------------------------------
B D                  Microbat  --ag------------------------------------------------------------------
B D                     Shrew  --aa------------------------------------------------------------------
B D                  Elephant  -gagaggg------------------------------------------------------g-------
          Cape elephant shrew  -caaaggg------------------------------------------------------gtttgttt
B D                   Manatee  -caaaggg------------------------------------------------------g-------
             Cape golden mole  --acaatgtgttggaaccgactcgatgtcattgaacaacaacaagctatctgtgagcttgggg-------
B D                    Tenrec  --------------------------------------------------------------g-------
                     Aardvark  -caaaggt------------------------------------------------------g-------
B D                 Armadillo  --------------------------------------------------------------------ca
             Star-nosed mole  ======================================================================
B D                  Hedgehog  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                Coelacanth  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Lizard  ======================================================================
  D    White-throated sparrow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                  Platypus  ======================================================================
  D           Green seaturtle  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
      Lesser Egyptian jerboa  ======================================================================

                        Human  --t---aagag--------------t--------------------tct---------c-cctgcataga
                        Chimp  --t---gagag--------------t--------------------tct---------c-cctgcataga
                      Gorilla  --t---aagag--------------t--------------------tct---------c-cctgcataga
                    Orangutan  --t---aagag--------------t--------------------tct---------c-cctgcataga
                       Gibbon  --t---aagag--------------t--------------------tct---------c-cctgcataga
                       Rhesus  --t---aagag--------------t--------------------tct---------c-cctgcataga
          Crab-eating macaque  --t---aagag--------------t--------------------tct---------c-cctgcataga
                       Baboon  --t---aagag--------------t--------------------tct---------c-cctgcataga
                 Green monkey  --t---aagag--------------t--------------------tct---------c-cctgcataga
                     Marmoset  --a---aagag--------------t--------------------tct---------c-tctacataga
              Squirrel monkey  --a---aagag--------------t--------------------tct---------c-cctacagaga
                     Bushbaby  --c---aggcg--------------t--------------------tct---------c-cctgcagaga
           Chinese tree shrew  --t---gaggg--------------t--------------------ccc---------ctcccgcacagg
                     Squirrel  --c---tggag--------------g--------------------tct------------ctgcctaga
                 Prairie vole  --t---cgggg--------------g--------------------tcc---------t-gctgtgtggt
              Chinese hamster  --t---aaggg--------------a--------------------tcc---------t-tatg------
               Golden hamster  --t---tgggg--------------a--------------------tcc---------t-tatgtgtgat
                        Mouse  --t---ccaga--------------a--------------------tcc---------t-gc--------
                          Rat  --t---ccaga--------------a--------------------tcc---------t-gc--------
                       Rabbit  --caggcaggg--------------c--------------------tcc---------t-cccgggagga
                         Pika  --tagataggg--------------t--------------------tcc---------t-cgtgcaaggg
                          Pig  ------ttggactcttcccccccccc--------------------ccc---------c-ccggcataga
                       Alpaca  ------ttggg--------------t--------------------ccc---------t-cctgcgtaaa
               Bactrian camel  ------ttggg--------------t--------------------ccc---------c-cctgtgtaaa
                      Dolphin  ------cgggg--------------t--------------------ccc---------c-cctgcataga
                 Killer whale  ------tgggg--------------t--------------------ccc---------c-cctgcataga
                        Horse  ------tcggg------------------------------------tc---------c-tctgcataga
             White rhinoceros  ------tcggg-----------------------------------ttc---------c-tctgcataga
                          Cat  ------ttggg--------------a--------------------tcc---------a-cctgcataaa
                          Dog  ------ttggg--------------a--------------------cccccc------c-cctgcagagg
                      Ferret   ------ctggg--------------a--------------------tccccatccccgc-cccacacaga
                        Panda  ------cgggg--------------a--------------------tcc---------c-cctgcgtaga
               Pacific walrus  ------ctggg--------------a--------------------tcc---------c-cctgcgtaga
                 Weddell seal  ------gtggg--------------g--------------------t-c---------c-cctgtgtaga
             Black flying-fox  ------tctgg--------------c--------------------ttc---------g-cctgcataga
                      Megabat  ------tctgg--------------c--------------------ttc---------c-cctgcgtaga
                Big brown bat  ------tccgg-----------------------------------ttc---------c-cctgcatagg
         David's myotis (bat)  ------tccgg-----------------------------------ttc---------c-cctgcatagg
                     Microbat  ------tccgg-----------------------------------ttc---------c-cctgcatagg
                        Shrew  ------ctggg--------------tgaggagaccagagtgacgggtcc---------t-cctgcagaga
                     Elephant  --t---agggg--------------c--------------------tcc---------c-atggtataga
          Cape elephant shrew  gct---tgggc--------------t--------------------ttc---------t-gt--------
                      Manatee  --t---agggg--------------c--------------------tcc---------c-cccacataga
             Cape golden mole  --a---tgggg--------------t--------------------ttc---------c-actgtataaa
                       Tenrec  --g---aggga--------------c--------------------ttg---------g-cctgcataga
                     Aardvark  --t---atggg--------------c--------------------aac---------c-cttatataga
                    Armadillo  aag---agggg--------------c--------------------ttt---------c-cccgcatagg
              Star-nosed mole  ======================================================================
                     Hedgehog  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                   Coelacanth  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
                 Mallard duck  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
               Painted turtle  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================
           American alligator  ======================================================================
           Tibetan ground jay  ======================================================================
                       Lizard  ======================================================================
       White-throated sparrow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                     Platypus  ======================================================================
              Green seaturtle  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
       Lesser Egyptian jerboa  ======================================================================

                        Human  t-------------------------------gctat
                        Chimp  t-------------------------------gctat
                      Gorilla  t-------------------------------gttat
                    Orangutan  t-------------------------------gctat
                       Gibbon  t-------------------------------gctat
                       Rhesus  t-------------------------------gctat
          Crab-eating macaque  t-------------------------------gctat
                       Baboon  t-------------------------------gctat
                 Green monkey  t-------------------------------gctat
                     Marmoset  t-------------------------------gctat
              Squirrel monkey  t-------------------------------gctat
                     Bushbaby  t-------------------------------ggcat
           Chinese tree shrew  t-------------------------------gctac
                     Squirrel  t-------------------------------gctat
                 Prairie vole  t-------------------------------gcca-
              Chinese hamster  -------------------------------------
               Golden hamster  t-------------------------------gccat
                        Mouse  -------------------------------------
                          Rat  -------------------------------------
                       Rabbit  t-------------------------------gccgc
                         Pika  c-------------------------------tccac
                          Pig  t-------------------------------gctac
                       Alpaca  c-------------------------------gctgt
               Bactrian camel  c-------------------------------gctgt
                      Dolphin  t-------------------------------gctgc
                 Killer whale  t-------------------------------gctgc
                        Horse  t-------------------------------gctat
             White rhinoceros  cactattgtatgtggacagagatgtctacacagatgt
                          Cat  t-------------------------------actat
                          Dog  t-------------------------------gctag
                      Ferret   t-------------------------------gctgg
                        Panda  g-------------------------------gctgg
               Pacific walrus  t-------------------------------gctgg
                 Weddell seal  t-------------------------------gctag
             Black flying-fox  c-------------------------------gctct
                      Megabat  c-------------------------------gctct
                Big brown bat  t-------------------------------gctct
         David's myotis (bat)  t-------------------------------gccct
                     Microbat  t-------------------------------gctct
                        Shrew  c-------------------------------accac
                     Elephant  t-------------------------------gatgt
          Cape elephant shrew  t-------------------------------gctat
                      Manatee  t-------------------------------gctat
             Cape golden mole  t-------------------------------gctat
                       Tenrec  t-------------------------------gctat
                     Aardvark  t-------------------------------gctat
                    Armadillo  t-------------------------------g-tgt
              Star-nosed mole  =====================================
                     Hedgehog  =====================================
             Peregrine falcon  =====================================
                 Saker falcon  =====================================
                   Coelacanth  =====================================
                   Budgerigar  =====================================
                  Rock pigeon  =====================================
                 Mallard duck  =====================================
     Chinese softshell turtle  =====================================
                      Chicken  =====================================
          Medium ground finch  =====================================
                       Turkey  =====================================
               Painted turtle  =====================================
                  Zebra finch  =====================================
          Collared flycatcher  =====================================
           American alligator  =====================================
           Tibetan ground jay  =====================================
                       Lizard  =====================================
       White-throated sparrow  =====================================
                Domestic goat  =====================================
                        Sheep  =====================================
                     Platypus  =====================================
              Green seaturtle  =====================================
                          Cow  =====================================
             Tibetan antelope  =====================================
       Lesser Egyptian jerboa  =====================================

Inserts between block 9 and 10 in window
B D                    Horse 47bp
B D         White rhinoceros 7bp
B D                      Cat 22bp
B D                      Dog 16bp
B D                  Ferret  15bp
B D                    Panda 16bp
              Pacific walrus 16bp
                Weddell seal 16bp
            Black flying-fox 251bp
B D                  Megabat 251bp
               Big brown bat 16bp
        David's myotis (bat) 16bp
B D                 Microbat 16bp

Alignment block 10 of 48 in window, 16085532 - 16085532, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  c
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  t
               Golden hamster  t
B D                    Rabbit  c
B D                      Pika  a
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  c
                 Killer whale  c
B D                     Shrew  t
B D                  Elephant  c
          Cape elephant shrew  t
B D                   Manatee  c
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
             Star-nosed mole  =
B D                  Hedgehog  =
B D                       Rat  -
B D                     Mouse  -
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                Coelacanth  =
B D                Budgerigar  =
  D               Rock pigeon  =
  D              Mallard duck  =
  D  Chinese softshell turtle  =
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Turkey  =
  D            Painted turtle  =
B D               Zebra finch  =
  D       Collared flycatcher  =
B D        American alligator  =
          Tibetan ground jay  =
B D                    Lizard  =
  D    White-throated sparrow  =
                Prairie vole  -
B D           Chinese hamster  -
B D                     Panda  =
               Domestic goat  =
B D                     Sheep  =
B D                  Platypus  =
  D           Green seaturtle  =
B D                       Cow  =
            Tibetan antelope  =
B D                  Microbat  =
        David's myotis (bat)  =
               Big brown bat  =
            Black flying-fox  =
B D                   Megabat  =
              Pacific walrus  =
B D                   Ferret   =
B D                       Dog  =
      Lesser Egyptian jerboa  =
B D                       Cat  =
B D                     Horse  =
                Weddell seal  =
B D          White rhinoceros  =

Inserts between block 10 and 11 in window
              Golden hamster 189bp
B D                   Rabbit 8bp
B D                     Pika 8bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
B D                    Shrew 5bp

Alignment block 11 of 48 in window, 16085533 - 16085539, 7 bps 
B D                     Human  t--gtgact
B D                     Chimp  t--gtgact
B D                   Gorilla  t--gtgact
B D                 Orangutan  t--gtgact
B D                    Gibbon  t--gtgact
B D                    Rhesus  t--gtgact
B D       Crab-eating macaque  t--gtgact
B D                    Baboon  t--gtgact
B D              Green monkey  t--gtgact
B D                  Marmoset  t--gtgact
B D           Squirrel monkey  t--gtgact
B D                  Bushbaby  t--ggggcc
           Chinese tree shrew  tg-gtgtct
B D                  Squirrel  --------t
B D           Chinese hamster  --------t
B D                     Mouse  --------t
B D                       Rat  --------t
B D                       Pig  ----tacat
B D                   Dolphin  ----tgtat
                 Killer whale  ----tgtat
B D          White rhinoceros  ----tgtag
B D                       Cat  ----tgtac
B D                       Dog  ----tgtgt
B D                   Ferret   ----tctct
B D                     Panda  ----tctct
               Pacific walrus  ----tctcc
                 Weddell seal  ----tctcg
                Big brown bat  ----tgtac
         David's myotis (bat)  ----tgtac
B D                  Microbat  ----tgtac
B D                     Shrew  ----tttac
B D                  Elephant  -tggtgact
          Cape elephant shrew  -tgatgact
B D                   Manatee  -tggtgact
             Cape golden mole  -tggtgact
B D                    Tenrec  -tggtggtt
                     Aardvark  -tggtgact
B D                 Armadillo  -tggggact
             Star-nosed mole  =========
              Golden hamster  =========
B D                  Hedgehog  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
B D                Coelacanth  =========
B D                Budgerigar  =========
  D               Rock pigeon  =========
  D              Mallard duck  =========
  D  Chinese softshell turtle  =========
B D                   Chicken  =========
B D       Medium ground finch  =========
B D                    Turkey  =========
  D            Painted turtle  =========
B D               Zebra finch  =========
  D       Collared flycatcher  =========
B D        American alligator  =========
          Tibetan ground jay  =========
B D                    Lizard  =========
  D    White-throated sparrow  =========
                Prairie vole  ---------
               Domestic goat  =========
B D                     Sheep  =========
B D                  Platypus  =========
  D           Green seaturtle  =========
B D                       Cow  =========
            Tibetan antelope  =========
            Black flying-fox  =========
B D                   Megabat  =========
B D                    Rabbit  =========
B D                      Pika  =========
              Bactrian camel  =========
B D                    Alpaca  =========
      Lesser Egyptian jerboa  =========
B D                     Horse  =========

Inserts between block 11 and 12 in window
B D                 Marmoset 341bp
B D          Squirrel monkey 314bp
B D                 Bushbaby 1bp
B D                 Squirrel 6bp
B D          Chinese hamster 3bp
B D                    Mouse 3bp
B D                      Rat 3bp
B D                      Pig 3bp
B D                  Dolphin 3bp
                Killer whale 3bp
B D         White rhinoceros 3bp
B D                      Cat 3bp
B D                      Dog 3bp
B D                  Ferret  3bp
B D                    Panda 3bp
              Pacific walrus 3bp
                Weddell seal 3bp
               Big brown bat 3bp
        David's myotis (bat) 3bp
B D                 Microbat 3bp
B D                    Shrew 3bp

Alignment block 12 of 48 in window, 16085540 - 16085552, 13 bps 
B D                     Human  tggat-gttttctt
B D                     Chimp  tggat-gttttctt
B D                   Gorilla  tggat-gttttctt
B D                 Orangutan  tggat-gttttctt
B D                    Gibbon  tggat-gttttctt
B D                    Rhesus  tggat-gttttctt
B D       Crab-eating macaque  tggat-gttttctt
B D                    Baboon  tggat-gttttctt
B D              Green monkey  tggat-gttttctt
B D                  Marmoset  tggat-gttttctt
B D           Squirrel monkey  tggat-gttttctt
B D                  Bushbaby  tggat-gttttcct
B D                  Squirrel  tggat-tccgtcac
                 Prairie vole  ----------ccat
B D           Chinese hamster  tggtt-gctattat
B D                     Mouse  tggaa-gcccccat
B D                       Rat  tggaa-gccctcat
B D                    Rabbit  tgcatgcgttttat
B D                      Pika  tggac-ccccttac
B D                       Pig  t-------------
B D                   Dolphin  tagat---------
                 Killer whale  tagat---------
B D          White rhinoceros  tag-----------
B D                       Cat  tcgat-gcttgcc-
B D                       Dog  ttgat-gcttgcct
B D                   Ferret   tggat-gcttgccc
B D                     Panda  tcgat-gctcgcct
               Pacific walrus  tcgac-gcttgcct
                 Weddell seal  cagat-gctcgcc-
                Big brown bat  cagat-gcttgcac
         David's myotis (bat)  cagat-gcttgcat
B D                  Microbat  cagat-gcttgcat
B D                     Shrew  tggag-gcttgtgt
B D                  Elephant  tagat-gttttcat
          Cape elephant shrew  tagat-gtttttat
B D                   Manatee  taaat-gttttctt
             Cape golden mole  tcggt-gtttccgt
B D                    Tenrec  cgggt-gttttcat
                     Aardvark  tagat-gttttcat
B D                 Armadillo  ggaat-gttttcat
             Star-nosed mole  ==============
              Golden hamster  ==============
B D                  Hedgehog  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
B D                Coelacanth  ==============
B D                Budgerigar  ==============
  D               Rock pigeon  ==============
  D              Mallard duck  ==============
  D  Chinese softshell turtle  ==============
B D                   Chicken  ==============
B D       Medium ground finch  ==============
B D                    Turkey  ==============
  D            Painted turtle  ==============
B D               Zebra finch  ==============
  D       Collared flycatcher  ==============
B D        American alligator  ==============
          Tibetan ground jay  ==============
B D                    Lizard  ==============
  D    White-throated sparrow  ==============
               Domestic goat  ==============
B D                     Sheep  ==============
B D                  Platypus  ==============
  D           Green seaturtle  ==============
B D                       Cow  ==============
            Tibetan antelope  ==============
            Black flying-fox  ==============
B D                   Megabat  ==============
          Chinese tree shrew  --------------
              Bactrian camel  ==============
B D                    Alpaca  ==============
      Lesser Egyptian jerboa  ==============
B D                     Horse  ==============

Inserts between block 12 and 13 in window
B D                      Cat 3bp
                Weddell seal 5bp
               Big brown bat 12bp
        David's myotis (bat) 12bp
B D                 Microbat 12bp

Alignment block 13 of 48 in window, 16085553 - 16085556, 4 bps 
B D                     Human  tcta
B D                     Chimp  tcta
B D                   Gorilla  tcta
B D                 Orangutan  tcta
B D                    Gibbon  tcta
B D                    Rhesus  tcta
B D       Crab-eating macaque  tcta
B D                    Baboon  tcta
B D              Green monkey  tcta
B D                  Marmoset  tcta
B D           Squirrel monkey  tcta
B D                  Bushbaby  tgca
B D                  Squirrel  tct-
                 Prairie vole  tct-
B D           Chinese hamster  tat-
B D                     Mouse  tct-
B D                       Rat  cct-
B D                    Rabbit  tcca
B D                      Pika  tcca
B D                    Alpaca  tcta
               Bactrian camel  tcta
B D                       Dog  -atg
B D                   Ferret   -acg
B D                     Panda  -ctg
               Pacific walrus  -atg
B D                     Shrew  -gtg
B D                  Elephant  tcta
          Cape elephant shrew  tcta
B D                   Manatee  tcta
             Cape golden mole  tcta
B D                    Tenrec  tct-
                     Aardvark  tgta
B D                 Armadillo  tcta
             Star-nosed mole  ====
              Golden hamster  ====
B D                  Hedgehog  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
B D                Coelacanth  ====
B D                Budgerigar  ====
  D               Rock pigeon  ====
  D              Mallard duck  ====
  D  Chinese softshell turtle  ====
B D                   Chicken  ====
B D       Medium ground finch  ====
B D                    Turkey  ====
  D            Painted turtle  ====
B D               Zebra finch  ====
  D       Collared flycatcher  ====
B D        American alligator  ====
          Tibetan ground jay  ====
B D                    Lizard  ====
  D    White-throated sparrow  ====
               Domestic goat  ====
B D                     Sheep  ====
B D                  Platypus  ====
  D           Green seaturtle  ====
B D                       Cow  ====
            Tibetan antelope  ====
B D                  Microbat  ====
        David's myotis (bat)  ====
               Big brown bat  ====
            Black flying-fox  ====
B D                   Megabat  ====
B D                       Pig  ----
          Chinese tree shrew  ----
      Lesser Egyptian jerboa  ====
B D                       Cat  ====
B D                     Horse  ====
                Weddell seal  ====
B D          White rhinoceros  ----
                Killer whale  ----
B D                   Dolphin  ----

Inserts between block 13 and 14 in window
B D                   Alpaca 5bp
B D                      Dog 9bp
B D                  Ferret  9bp
B D                    Panda 9bp
              Pacific walrus 9bp
B D                    Shrew 1bp

Alignment block 14 of 48 in window, 16085557 - 16085566, 10 bps 
B D                     Human  atacaaatgc
B D                     Chimp  atacaaatgc
B D                   Gorilla  atacaaatgc
B D                 Orangutan  atacaaatgc
B D                    Gibbon  atacaaatgc
B D                    Rhesus  atacaaatgc
B D       Crab-eating macaque  atacaaatgc
B D                    Baboon  atacaaatgc
B D              Green monkey  atacaaatgc
B D                  Marmoset  aagcaaatgt
B D           Squirrel monkey  aagcaaatgc
B D                  Bushbaby  atccagaggt
           Chinese tree shrew  -tggaaatgt
B D                  Squirrel  ---aagtaat
                 Prairie vole  ---caagcat
B D           Chinese hamster  ---taaatat
B D                     Mouse  ---caagcac
B D                       Rat  ---cgagcac
B D                    Rabbit  gcacaaacgc
B D                      Pika  gtgcaaaggt
B D                       Pig  acacaaatct
B D                    Alpaca  agacaagcgt
               Bactrian camel  ----aagtgt
B D                   Dolphin  atacaaatgc
                 Killer whale  atacaaacgc
B D                       Cow  aaacaacaac
B D                     Horse  gtacaaatgc
B D          White rhinoceros  gtacaaatgt
B D                       Cat  gtccaagcat
B D                       Dog  acacaagggt
B D                   Ferret   gcaagagcat
B D                     Panda  gcacgggggg
               Pacific walrus  acacaagtgt
                 Weddell seal  gcacaagtgt
                Big brown bat  gcacagatgt
         David's myotis (bat)  gcacaaatgt
B D                  Microbat  gcacaaatgt
B D                     Shrew  atgcatatgc
B D                  Elephant  atacaaatat
          Cape elephant shrew  atacaaatat
B D                   Manatee  atacaaatat
             Cape golden mole  atacaaatat
                     Aardvark  aaacaaatgt
B D                 Armadillo  acacaaatgt
             Star-nosed mole  ==========
              Golden hamster  ==========
B D                  Hedgehog  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
B D                Coelacanth  ==========
B D                Budgerigar  ==========
  D               Rock pigeon  ==========
  D              Mallard duck  ==========
  D  Chinese softshell turtle  ==========
B D                   Chicken  ==========
B D       Medium ground finch  ==========
B D                    Turkey  ==========
  D            Painted turtle  ==========
B D               Zebra finch  ==========
  D       Collared flycatcher  ==========
B D        American alligator  ==========
          Tibetan ground jay  ==========
B D                    Lizard  ==========
  D    White-throated sparrow  ==========
               Domestic goat  ==========
B D                     Sheep  ==========
B D                  Platypus  ==========
  D           Green seaturtle  ==========
            Tibetan antelope  ==========
            Black flying-fox  ==========
B D                   Megabat  ==========
      Lesser Egyptian jerboa  ==========
B D                    Tenrec  ----------

Inserts between block 14 and 15 in window
B D                      Cow 1bp
B D                    Shrew 8bp

Alignment block 15 of 48 in window, 16085567 - 16085567, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  g
B D                  Squirrel  g
                 Prairie vole  g
B D           Chinese hamster  g
B D                     Mouse  t
B D                       Rat  c
B D                    Rabbit  g
B D                      Pika  g
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                     Shrew  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  g
                     Aardvark  g
B D                 Armadillo  a
             Star-nosed mole  =
              Golden hamster  =
B D                  Hedgehog  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                Coelacanth  =
B D                Budgerigar  =
  D               Rock pigeon  =
  D              Mallard duck  =
  D  Chinese softshell turtle  =
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Turkey  =
  D            Painted turtle  =
B D               Zebra finch  =
  D       Collared flycatcher  =
B D        American alligator  =
          Tibetan ground jay  =
B D                    Lizard  =
  D    White-throated sparrow  =
B D                  Platypus  =
  D           Green seaturtle  =
            Black flying-fox  =
B D                   Megabat  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  -

Inserts between block 15 and 16 in window
B D                 Squirrel 8bp
                Prairie vole 3bp
B D          Chinese hamster 3bp
B D                    Mouse 3bp
B D                      Rat 3bp

Alignment block 16 of 48 in window, 16085568 - 16085571, 4 bps 
B D                     Human  tc-------aa
B D                     Chimp  tc-------aa
B D                   Gorilla  tc-------aa
B D                 Orangutan  tc-------aa
B D                    Gibbon  tc-------aa
B D                    Rhesus  tc-------aa
B D       Crab-eating macaque  tc-------aa
B D                    Baboon  tc-------aa
B D              Green monkey  tc-------aa
B D                  Marmoset  tc-------aa
B D           Squirrel monkey  tc-------at
B D                  Bushbaby  tc-------aa
           Chinese tree shrew  tc-------aa
B D                  Squirrel  gc-------aa
                 Prairie vole  tc-------aa
B D           Chinese hamster  tc-------at
               Golden hamster  tt-------aa
B D                     Mouse  cc-------aa
B D                       Rat  tc-------aa
B D                    Rabbit  -c------taa
B D                      Pika  -a-------aa
B D                       Pig  tc-------aa
B D                    Alpaca  cc-------aa
               Bactrian camel  cc-------aa
B D                   Dolphin  cc-------aa
                 Killer whale  cc-------aa
             Tibetan antelope  tc-------aa
B D                       Cow  tc-------aa
B D                     Sheep  tc-------aa
                Domestic goat  tc-------aa
B D                     Horse  tc-------aa
B D          White rhinoceros  cc-------ac
B D                       Cat  tc-------ca
B D                       Dog  tc-------aa
B D                   Ferret   tt-------ga
B D                     Panda  ac-------gg
               Pacific walrus  tc-------gg
                 Weddell seal  tt-------gg
                Big brown bat  cc-------ca
         David's myotis (bat)  cc-------aa
B D                  Microbat  cc-------aa
B D                     Shrew  ccagtgcataa
B D                  Elephant  tc-------aa
          Cape elephant shrew  tc-------aa
B D                   Manatee  cg-------aa
             Cape golden mole  tc-------a-
                     Aardvark  tc-------aa
B D                 Armadillo  tc-------aa
             Star-nosed mole  ===========
B D                  Hedgehog  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
B D                Coelacanth  ===========
B D                Budgerigar  ===========
  D               Rock pigeon  ===========
  D              Mallard duck  ===========
  D  Chinese softshell turtle  ===========
B D                   Chicken  ===========
B D       Medium ground finch  ===========
B D                    Turkey  ===========
  D            Painted turtle  ===========
B D               Zebra finch  ===========
  D       Collared flycatcher  ===========
B D        American alligator  ===========
          Tibetan ground jay  ===========
B D                    Lizard  ===========
  D    White-throated sparrow  ===========
B D                  Platypus  ===========
  D           Green seaturtle  ===========
            Black flying-fox  ===========
B D                   Megabat  ===========
      Lesser Egyptian jerboa  ===========
B D                    Tenrec  -----------

Inserts between block 16 and 17 in window
B D                 Elephant 640bp

Alignment block 17 of 48 in window, 16085572 - 16085585, 14 bps 
B D                     Human  agtgttcacaggaa
B D                     Chimp  agtgttcacaggaa
B D                   Gorilla  agtgttcacaggaa
B D                 Orangutan  actgttcataggaa
B D                    Gibbon  actgttcataggaa
B D                    Rhesus  agtgttcacaggaa
B D       Crab-eating macaque  agtgttcacaggaa
B D                    Baboon  agtgttcacaggaa
B D              Green monkey  agtgttcacaggaa
B D                  Marmoset  agtgttcacaggaa
B D           Squirrel monkey  agtgttcacaggaa
B D                  Bushbaby  ggtgttaat-gaga
           Chinese tree shrew  ggcgtaaagaggac
B D                  Squirrel  gttgtggacgggag
                 Prairie vole  agtgtgagctaaaa
B D           Chinese hamster  ggtatgagctgaaa
               Golden hamster  ggtatgaactgcaa
B D                     Mouse  ggtgtttgcaagaa
B D                       Rat  ggtgtttgcaagga
B D                    Rabbit  ggtgctaccaggaa
B D                      Pika  ggggttactacaca
B D                       Pig  ggtgttagcaggaa
B D                    Alpaca  ggtgttaacaggga
               Bactrian camel  ggtgttaacaggga
B D                   Dolphin  ggtgttaacaggaa
                 Killer whale  ggtgttaacaggaa
             Tibetan antelope  ggtgtcaacaggaa
B D                       Cow  ggtgttaacaggaa
B D                     Sheep  ggtgttattaggaa
                Domestic goat  ggtgttaacaggaa
B D                     Horse  ggtttgagcaggaa
B D          White rhinoceros  ggcgttcacaggaa
B D                       Cat  ggtgttagcaggaa
B D                       Dog  ggtgttcacgggaa
B D                   Ferret   agtgttagcctgag
B D                     Panda  ggtgtttaccggcg
               Pacific walrus  ggtgttaactggaa
                 Weddell seal  ggtgttaaccggaa
                Big brown bat  agtgttagcaggga
         David's myotis (bat)  agggttagcaggga
B D                  Microbat  agtgttagcaggga
B D                     Shrew  ggtgtcagcagcaa
          Cape elephant shrew  catgttatcatgaa
B D                   Manatee  gctgttaacaggaa
             Cape golden mole  agtgttaacagaag
B D                    Tenrec  ----ttaatgtcaa
                     Aardvark  ggtgtctacaggaa
B D                 Armadillo  gacgctaacagaaa
             Star-nosed mole  ==============
B D                  Hedgehog  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
B D                Coelacanth  ==============
B D                Budgerigar  ==============
  D               Rock pigeon  ==============
  D              Mallard duck  ==============
  D  Chinese softshell turtle  ==============
B D                   Chicken  ==============
B D       Medium ground finch  ==============
B D                    Turkey  ==============
  D            Painted turtle  ==============
B D               Zebra finch  ==============
  D       Collared flycatcher  ==============
B D        American alligator  ==============
          Tibetan ground jay  ==============
B D                    Lizard  ==============
  D    White-throated sparrow  ==============
B D                  Platypus  ==============
  D           Green seaturtle  ==============
            Black flying-fox  ==============
B D                   Megabat  ==============
      Lesser Egyptian jerboa  ==============
B D                  Elephant  ==============

Inserts between block 17 and 18 in window
B D                      Rat 4bp
         Cape elephant shrew 2bp
B D                  Manatee 637bp
            Cape golden mole 2bp
B D                   Tenrec 2bp
                    Aardvark 2bp
B D                Armadillo 2bp

Alignment block 18 of 48 in window, 16085586 - 16085593, 8 bps 
B D                     Human  tctagcta
B D                     Chimp  tctagcta
B D                   Gorilla  tctagcta
B D                 Orangutan  tctagcta
B D                    Gibbon  tctagcta
B D                    Rhesus  tctagcta
B D       Crab-eating macaque  tctagcta
B D                    Baboon  tctagcta
B D              Green monkey  tctagcta
B D                  Marmoset  tctagcta
B D           Squirrel monkey  tctagtta
B D                  Bushbaby  cctaagga
           Chinese tree shrew  gctcacga
B D                  Squirrel  tctaactc
                 Prairie vole  tggaactc
B D           Chinese hamster  tagaactt
               Golden hamster  tagaactt
B D                     Mouse  cgaaactc
B D                       Rat  ttcaactc
B D                    Rabbit  tctaaccg
B D                      Pika  cctgacta
B D                       Pig  tcca----
B D                    Alpaca  cctg----
               Bactrian camel  cctg----
B D                   Dolphin  tcta----
                 Killer whale  tcta----
             Tibetan antelope  tcta----
B D                       Cow  tcta----
B D                     Sheep  tcta----
                Domestic goat  tcta----
B D                     Horse  tctaacag
B D          White rhinoceros  tataac--
B D                       Cat  agtgacta
B D                       Dog  tcgaactt
B D                   Ferret   tctaactc
B D                     Panda  tctaatta
               Pacific walrus  tctcacta
                 Weddell seal  tctcacta
                Big brown bat  tctaactg
         David's myotis (bat)  tctaacta
B D                  Microbat  tctaacta
B D                     Shrew  tcgaactg
B D                  Elephant  tttaaata
          Cape elephant shrew  tttaactg
B D                   Manatee  tttaaatt
             Cape golden mole  gttaaata
B D                    Tenrec  tttaattt
                     Aardvark  tttaaata
B D                 Armadillo  ttcaaata
             Star-nosed mole  ========
B D                  Hedgehog  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
B D                Coelacanth  ========
B D                Budgerigar  ========
  D               Rock pigeon  ========
  D              Mallard duck  ========
  D  Chinese softshell turtle  ========
B D                   Chicken  ========
B D       Medium ground finch  ========
B D                    Turkey  ========
  D            Painted turtle  ========
B D               Zebra finch  ========
  D       Collared flycatcher  ========
B D        American alligator  ========
          Tibetan ground jay  ========
B D                    Lizard  ========
  D    White-throated sparrow  ========
B D                  Platypus  ========
  D           Green seaturtle  ========
            Black flying-fox  ========
B D                   Megabat  ========
      Lesser Egyptian jerboa  ========

Alignment block 19 of 48 in window, 16085594 - 16085598, 5 bps 
B D                     Human  tatgc
B D                     Chimp  catgc
B D                   Gorilla  tatgc
B D                 Orangutan  tatgt
B D                    Gibbon  tatgt
B D                    Rhesus  tatgc
B D       Crab-eating macaque  tatgc
B D                    Baboon  tatgc
B D              Green monkey  taagc
B D                  Marmoset  tatgc
B D           Squirrel monkey  tatgc
B D                  Bushbaby  tttgt
           Chinese tree shrew  ggtgg
B D                  Squirrel  tgtgt
                 Prairie vole  catga
B D           Chinese hamster  catga
               Golden hamster  catga
B D                     Mouse  catga
B D                       Rat  catga
B D                    Rabbit  tatgg
B D                      Pika  catgg
B D                     Horse  cacat
B D          White rhinoceros  tatgt
B D                       Cat  tatgt
B D                       Dog  tacgt
B D                   Ferret   tacgt
B D                     Panda  tgcgt
               Pacific walrus  tgcgt
                 Weddell seal  tgagt
                Big brown bat  tacgt
         David's myotis (bat)  cacgt
B D                  Microbat  tacgt
B D                     Shrew  tgggt
              Star-nosed mole  tgagg
B D                  Elephant  tatat
          Cape elephant shrew  tatgt
B D                   Manatee  tatat
             Cape golden mole  tatgt
B D                    Tenrec  taggt
                     Aardvark  tatgt
B D                 Armadillo  catat
B D                  Hedgehog  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
B D                Coelacanth  =====
B D                Budgerigar  =====
  D               Rock pigeon  =====
  D              Mallard duck  =====
  D  Chinese softshell turtle  =====
B D                   Chicken  =====
B D       Medium ground finch  =====
B D                    Turkey  =====
  D            Painted turtle  =====
B D               Zebra finch  =====
  D       Collared flycatcher  =====
B D        American alligator  =====
          Tibetan ground jay  =====
B D                    Lizard  =====
  D    White-throated sparrow  =====
               Domestic goat  -----
B D                     Sheep  -----
B D                  Platypus  =====
  D           Green seaturtle  =====
B D                       Cow  -----
            Tibetan antelope  -----
            Black flying-fox  =====
B D                   Megabat  =====
B D                       Pig  -----
              Bactrian camel  -----
B D                    Alpaca  -----
      Lesser Egyptian jerboa  =====
                Killer whale  -----
B D                   Dolphin  -----

Alignment block 20 of 48 in window, 16085599 - 16085744, 146 bps 
B D                     Human  aagaagtctggattatctgc---ctgagagaactggccagtatctcacccat-gagcaccagaaccca--
B D                     Chimp  aagaagtctggattatctgc---ctgagagaactggccagtatctcaaccat-gagcaccagaaccca--
B D                   Gorilla  aagaagtctggattatctgc---ctgagagaactggccagtatctcacccat-gagcaccagaaccca--
B D                 Orangutan  aagaagtctggattatctgc---ctgagagaactggccagtatctcacccat-gagcaccagaaccca--
B D                    Gibbon  aagaagtctggattatctgc---ctgagagaactggccagtatctcacccgt-gagcaccagaaccca--
B D                    Rhesus  aagaagtctggattttctgc---ctgagagaactggccagtatctcacccat-gggcaccagaaccca--
B D       Crab-eating macaque  aagaagtctggattttctgc---ctgagagaactggccagtatctcacccat-gggcaccagaaccca--
B D                    Baboon  aagaagtctggattttctgc---ctgagagaactggccagtatctcacccat-gggcaccagaaccca--
B D              Green monkey  aagaagtctgaattatctgc---ctgagagaactggccagtatctcacccat-gggccccagaaccca--
B D                  Marmoset  aagaagtctggattatctgc---ctgagagaatcggccagtatcccacccat-gagcatcagaactca--
B D           Squirrel monkey  aagaagtctggattatctgc---ctgagacaactggccagtatcccacccat-aagcatcagaactca--
B D                  Bushbaby  cagaagtctagactaccagg---ctgagggcacccgcctgtatctcaccagg-gactcgacgagacca--
           Chinese tree shrew  aagcagtctggattatcagg---cggagggagctggccagtctcccagtaat-gagcctcagagcaca--
B D                  Squirrel  tagaagcctagattgtctgc---ctgaga--------cagtaaaccaccaat-gatcttcagaaccca--
                 Prairie vole  gagaagccgtgattgcctac---ctgagagaagtggccaggaagcta----------ctcagagcctagg
B D           Chinese hamster  gagaagccatgattgtctgc---ttgagagagatggccagtcagccactcag-gagcctcagagcctaga
               Golden hamster  aagaaaccatgattatctgc---ttgagagaaatggccagtcagccactcag-gagcctcagagcctaga
B D                     Mouse  gagaggctgtgat----tgc---ctaagagaagtggccaggaagc------------ctcagaggcgaga
B D                       Rat  gagaagctgtgattatctgt---ctaagagaagtggccaggaaac------------ctcagc--ctaga
B D                    Rabbit  aagaagtctggactgcctgc---ctgagaggggtggcccgtaccccatgagg-ga--gtcagaatcca--
B D                      Pika  aaggagtttgaatgaactacttgctgggagaaatggccagtatgccac----------------------
B D                       Pig  ------------------gc---ctgagagacttggctcatatcccatcaaa-gagccc-ataactca--
B D                    Alpaca  ------------------gc---ctgagagagttggcccctattccacaagt-gagccc-agaaccca--
               Bactrian camel  ------------------gc---ctgagagagttggcccctattccacaaat-gagccc-agaa-cca--
B D                   Dolphin  ------------------gc---cagagagaggtggcctgtatcccataaat-gagccc-agaaccta--
                 Killer whale  ------------------gc---cagagagaggtggcctgtatcccataaat-gagccc-agaaccta--
             Tibetan antelope  ------------------gc---ctgagagagttggcccacattccataaaa-gagccc-aaaatgta--
B D                       Cow  ------------------gc---ctgagagagttggcccatattccataaat-gagccc-aaaacgtc--
B D                     Sheep  ------------------gc---ctgagagagttggcccatattccataaaa-gagccc-aaaatgta--
                Domestic goat  ------------------gc---ctgagagagttggcccatattccataaaa-gagccc-aaaatgta--
B D                     Horse  gagaagtctggattatctgc---ctgagagagttggcccatatctcacaaat-aagcttcaaaa-cca--
B D          White rhinoceros  gagaagtctggattatctgc---ctgagagagttggcccatatctcacaaat-aagtctcagaaccca--
B D                       Cat  aagaggtctaggttacctgc---ccgagaaagttggcgggtgtcccacaaatggggccccagagctca--
B D                       Dog  cggaagtccagatcagctgc---ctgagaaagttggctggtctcccacacat-gagccccagaactca--
B D                   Ferret   cagaagtccagatcaccggc---ctgcgaaacttggctactatcccacatac-aaggcccagaatgca--
B D                     Panda  ccgaagtctggatcacctgc---ctgagaaagttgactactaccccacaaac-gagccccagaactca--
               Pacific walrus  cagaagtctagatcacctgc---ctgagaaagttggctaccaccccacaaac-gagccccagagctgg--
                 Weddell seal  cagaagtctagatcaccggc---ctgagaaagttggctaccatctcacaaac-aagccccagaactca--
             Black flying-fox  aagaagtctgaattacctgc---ctgagagagttgg-------ctcatgaat-gaaccccagaaccca--
B D                   Megabat  aagaagtctgaattacctgc---ctgagagagttgg-------ctcatgaat-gaaccccagaaccca--
                Big brown bat  -agaggtccagattacctgc---ctgagagagctcg-------cccac--ag-cagcccgagaacgca--
         David's myotis (bat)  -agaagcccagattatctgc---ctgagagagttct-------cccac--ag-cagcctgagaatgca--
B D                  Microbat  -agaagtccagatgatccgc---ctgagagagttct-------cccac--ag-cagcctgagaacgca--
B D                     Shrew  atcaaatttagattatccac---ctaagagaactgtgccgcatctcacaagt-aagcttcagaatcct--
              Star-nosed mole  caggaatctggatgatctgc---ctgagag---------------------------ctctggccccg--
B D                  Elephant  aacaagcgcagattatatgc---cttagaaaattggcttttattccacaaat-gagtctcagaaccca--
          Cape elephant shrew  aacaagtgcaagttatttgt---cttagagtattggcctttatcccacaaaa-gagcctgagatctta--
B D                   Manatee  aacaagtgcagattatctgc---cttagataattggcctttatcccacaaat-gaatctctgaaccca--
             Cape golden mole  aataagtgtagattatctgc---ttgagagaattgatttttatcccacaaat-gagcctcagaaccca--
B D                    Tenrec  agccagtgcaggttgtctgc---cctagagaattagccttta------agat-gagcttcag-accca--
                     Aardvark  aacaaatgcagattatttgc---cttagaaaactggacttcatcctgcaaat-gaacctcagaaccca--
B D                 Armadillo  aacaggtgcagattatctgc---cagcgagaattggcctggagcccacaatc-aagcctccagattca--
B D                  Hedgehog  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                Coelacanth  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Lizard  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                  Platypus  ======================================================================
  D           Green seaturtle  ======================================================================
      Lesser Egyptian jerboa  ======================================================================

                        Human  ------------------------------------------tttctagattactaagaaa-ggagcaca
                        Chimp  ------------------------------------------tttctagattactaagaaa-tgagcaca
                      Gorilla  ------------------------------------------tttctagattactaagaaa-ggagcaca
                    Orangutan  ------------------------------------------tttctagattactaagaaa-tgagcaca
                       Gibbon  ------------------------------------------tttctagattactaagaaa-tgagcaca
                       Rhesus  ------------------------------------------tttctagattactaagaaa-tgagcaca
          Crab-eating macaque  ------------------------------------------tttctagattactaagaaa-tgagcaca
                       Baboon  ------------------------------------------tttctagattactaagaaa-tgagcaca
                 Green monkey  ------------------------------------------tttctagattactaagaaa-taagcaca
                     Marmoset  ------------------------------------------tttctagattgctaagaaa-tgagcaaa
              Squirrel monkey  ------------------------------------------tttctagattgctaagaaa-tgagcaca
                     Bushbaby  ------------------------------------------tttctagatcactgag-aa-tgagcaca
           Chinese tree shrew  ------------------------------------------tatctagattactgagaaa-tgagccca
                     Squirrel  ------------------------------------------tttctaggttattg-aaaa-tgggaa-c
                 Prairie vole  cttgacagggaag----ttgtgagcacattgtctttctgtccttctcagagtcctg-gaaa-tgcgca-c
              Chinese hamster  cttgataggaaag----gtgtgagcatattgtctttctgtcctcctcaaagttctg-gaaa-tgagca-c
               Golden hamster  cttgacagggaag----gtgtgagcatactgtctttctgtcctccttagagtcctg-gaaa-tgagca-c
                        Mouse  ctggacaggaaaggtgtgtgtgaacctattttctttctgtcctcctcagagtcctt-gaaa-caagca-c
                          Rat  ctgcacagggaag----gtgtgaatatatttcctt-------tcctcagcgtcctg-gaaa-tgagca--
                       Rabbit  -----------------------------------------ctgctacgtaactga-aaaa-cgaccacc
                         Pika  ----------------------------------------------------------aca-tgagcacc
                          Pig  ------------------------------------------cttgga--------gaagcctgatctca
                       Alpaca  ------------------------------------------cttcta-actcctgaaaaa-tgagcaca
               Bactrian camel  ------------------------------------------cttcta-actcctgaaaaa-tgagcaca
                      Dolphin  ------------------------------------------cttctagattcctgaaaaactgagcgcc
                 Killer whale  ------------------------------------------cttctagattcctgaaaaactgagcgcc
             Tibetan antelope  ------------------------------------------cttcaaggtttccgaaaaattgagcacc
                          Cow  ------------------------------------------cttcaaggtttccgaaaaattgagcacc
                        Sheep  ------------------------------------------cttcaaggtttctgaaaaattgagcacc
                Domestic goat  ------------------------------------------cttcagggtttctgaaaaattgagcacc
                        Horse  ------------------------------------------cttc-agactatggaaaaa-ggagcaca
             White rhinoceros  ------------------------------------------cttctagacggctgagaaa-tgagcaca
                          Cat  ------------------------------------------tttctagattaccgaaaaa-tgaacaca
                          Dog  ------------------------------------------tttctagattatggaaaaa-tgagcaca
                      Ferret   ------------------------------------------tttctggattacggaaaag-tgagccca
                        Panda  ------------------------------------------cttctagattacggacaag-tgagcgcg
               Pacific walrus  ------------------------------------------tttctagattacggaaaat-cgagcaca
                 Weddell seal  ------------------------------------------tttctagatttcggaaaag-tgaacaca
             Black flying-fox  ------------------------------------------cttctagatcaccggaaaa-taaacaca
                      Megabat  ------------------------------------------cttctagatcaccggaaaa-gaaacaca
                Big brown bat  ------------------------------------------cttctggcttgctgagaag-caagcaca
         David's myotis (bat)  ------------------------------------------cttgcagcttgctgaaaag-caagcac-
                     Microbat  ------------------------------------------cttctagcttgctggaaag-caagcaca
                        Shrew  ------------------------------------------atttc--tcgaagactgaa-aaaacaca
              Star-nosed mole  ------------------------------------------attct--ccaaaggaaata-cgagcgca
                     Elephant  ------------------------------------------tttctacattactgagaag-tgagcaca
          Cape elephant shrew  ------------------------------------------tttctagattactgagaaa-taagcatc
                      Manatee  -------------------------------------------ttctacatgactgagaaa-tgagcaca
             Cape golden mole  ------------------------------------------tttctagattac-tgaaaa-tgagagca
                       Tenrec  ------------------------------------------tttctaaatgac-gagacc-tgagccca
                     Aardvark  ------------------------------------------tttctagattaccgagaaa-tgggcaca
                    Armadillo  ------------------------------------------tttctagattactgaaaaa-cgagcaca
                     Hedgehog  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                   Coelacanth  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
                 Mallard duck  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
               Painted turtle  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================
           American alligator  ======================================================================
           Tibetan ground jay  ======================================================================
                       Lizard  ======================================================================
       White-throated sparrow  ======================================================================
                     Platypus  ======================================================================
              Green seaturtle  ======================================================================
       Lesser Egyptian jerboa  ======================================================================

                        Human  agaacactgtgtataag--------------gctctg---tgttcctagaactttc-taaattttactta
                        Chimp  aaaacactgtgtataag--------------gctctg---tgttcctagaactttc-taaatttcactta
                      Gorilla  agaacactgtgtatgag--------------gctctg---tgttcctagaactttc-taaattttactta
                    Orangutan  agaacactgtgtataag--------------gcactg---tgttcccagacctttc-taaattttactta
                       Gibbon  agaacactgtgtataag--------------gcactg---tgttcctagacctttc-tgaattttactta
                       Rhesus  agaatactgtgtataag--------------gcactg---tgttcctagacctttc-caaattttactta
          Crab-eating macaque  agaatactgtgtataag--------------gcactg---tgttcctagacctttc-caaattttactta
                       Baboon  agaatactgtgtataag--------------gcactg---tgttcctagacctttc-caaattttactta
                 Green monkey  agaatac-gtgtatacg--------------gcactg---tgttcctagacctatc-caaattttactta
                     Marmoset  tgaatact-tgcataa---------------gcagtg---tgtttctagacctttc-tgaatttcacttc
              Squirrel monkey  agaatact-tgcataa---------------gctcgg---tgtttctagacctttc-taaatttcacttc
                     Bushbaby  aggataatgtgtacggt--------------acgttg---tgtt-ctggacctctc-cacatttcacata
           Chinese tree shrew  agatgaatgtgtgtaag--------------gcactg---tgttcctggacttctc-caaatttcagtta
                     Squirrel  aagataatgt----aag--------------acctgg---tgttcctggacctctca----tttctctta
                 Prairie vole  agtataggatgcctacg--------------gccttg---tgttcttgggttctccacacatttctgtta
              Chinese hamster  aggatgatatgcacaag--------------gccttg---tgttcttggactctccacaggtttctatta
               Golden hamster  aggatgatatgcacaag--------------gtctta---cgttcttgagatcttcacaggtttctgtta
                        Mouse  agttcagtatgcagaag--------------gcctta---tattcttggattctccacccatttctgtta
                          Rat  ----caggatgcagaag--------------gccttg---tattcctggattctccacacttatctgtta
                       Rabbit  agggcgctgtgtggccggcactgtgtggccggcactg---tgttctggatctctccaca--ctgcactca
                         Pika  agggggctgtgtagaagat------------gtattg---tattcttgatttctccacg--ttcctttta
                          Pig  aggctaatgt-------------------------------gtccctggacctctc-ccaagttcccttc
                       Alpaca  aggaaaatgcgtctgag--------------gcactg---cgtttctggacccctt-ccaatttcactga
               Bactrian camel  aggataatgtgtatgag--------------gcactg---cgtttctggacccctt-ccaatttcactga
                      Dolphin  aggatgacgtgtataag--------------gcactg---tgttcctggacctctc-tcaatttctctta
                 Killer whale  aggatgacgtgtataag--------------gcattg---tgttcctggacctctc-tcaatttctctta
             Tibetan antelope  agaataatgtgcataaa--------------gcaccg---tgttctgggacctctc-tcaatttcactta
                          Cow  aggataatgtgcatagg--------------gcaccg---tgttcctggacctctc-tcaatttcactta
                        Sheep  aggataatgtgcataag--------------gcaccg---tgttccgggacctctc-tcaatttcactta
                Domestic goat  aggataatgtgcataag--------------gcaccg---tgttccgggacctctc-tcaatttcactta
                        Horse  a-gataatgtgggtaag--------------gtactg---tgttcctggacctctc-ccagttttgctgg
             White rhinoceros  a-gataatatgtataag--------------gcactg---tgttcctggacctctc-ccagtttcactta
                          Cat  aggataatgcgtgtaag--------------gcaatg---tgttcatggacctctc-tgcatttcattga
                          Dog  aggataatgtgtgtgag--------------gcactg---tgttcccggacctgtc-caaatttcattta
                      Ferret   aggataatgggagcaag--------------tcactg---tgttcctgaacctgtc-caaattttactta
                        Panda  aggataatgtgctcaag--------------gcaccc---tgttcctggggctgtc-caaaggttactta
               Pacific walrus  aggataatgtgtgcagg--------------gcaccg---tgttcctggaaccatc-caaattttactcg
                 Weddell seal  aggataatgtgtgcagg--------------gcacca---tgttcctggacccatc-caaattttactca
             Black flying-fox  aggataatatatataag--------------gcactg---tgctcctggacctttc-tcagtttcacttc
                      Megabat  aggataatatatataag--------------gcactg---tgctcctgggcctctc-tcagtatcacttc
                Big brown bat  aggataacgtgtgtaag--------------gccctg---tgttcctggacctctc-cccagtttacttc
         David's myotis (bat)  aggataacgtgtggaag--------------gcactg---tgttcctggacctctc-ccaagtttacttc
                     Microbat  aggataacgtgtggaag--------------gcactg---tgttcctggacctctc-ccaagtttacttc
                        Shrew  cagagcttggagataag--------------gcatta---tattcctgaacctctc-caaatttcacttg
              Star-nosed mole  cggctcatgcgcacaag----------------cgtg---tgctccccgacctctc--------cactgg
                     Elephant  aagataatttgtagagg--------------gcacta---tgtttctggacctctc-caaattctactta
          Cape elephant shrew  atgataatttgcatagt--------------tcactg---ggtttctgggcttctc-caaatcccactta
                      Manatee  aagacaatttgtagaag--------------gcactg---tgtttctggtcctctc-cagattccactta
             Cape golden mole  aagatcatttgtataag--------------gcactactgtgtttctggacttcac-caaatcccatgta
                       Tenrec  gagctcatctgcaccag--------------ccacca---tgcttctgggtctctc-caaagtcgattta
                     Aardvark  aagataatttgtaaaag--------------gcactg---cattttcgggcctttt-tgaatctcattta
                    Armadillo  aagatggggtgtctaag--------------gcactg---ggttccggggcctc----------------
                     Hedgehog  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                   Coelacanth  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
                 Mallard duck  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
               Painted turtle  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================
           American alligator  ======================================================================
           Tibetan ground jay  ======================================================================
                       Lizard  ======================================================================
       White-throated sparrow  ======================================================================
                     Platypus  ======================================================================
              Green seaturtle  ======================================================================
       Lesser Egyptian jerboa  ======================================================================

                        Human  at--------------------------------------g
                        Chimp  at--------------------------------------g
                      Gorilla  at--------------------------------------g
                    Orangutan  at--------------------------------------g
                       Gibbon  at--------------------------------------g
                       Rhesus  at--------------------------------------g
          Crab-eating macaque  at--------------------------------------g
                       Baboon  at--------------------------------------g
                 Green monkey  at--------------------------------------g
                     Marmoset  at--------------------------------------g
              Squirrel monkey  at--------------------------------------g
                     Bushbaby  tt--------------------------------------g
           Chinese tree shrew  ac--------------------------------------a
                     Squirrel  ac--------------------------------------g
                 Prairie vole  ac--------------------------------------t
              Chinese hamster  ac--------------------------------------c
               Golden hamster  ac--------------------------------------t
                        Mouse  at--------------------------------------a
                          Rat  at--------------------------------------g
                       Rabbit  at--------------------------------------a
                         Pika  tt--------------------------------------a
                          Pig  at--------------------------------------a
                       Alpaca  at--------------------------------------g
               Bactrian camel  at--------------------------------------g
                      Dolphin  at--------------------------------------g
                 Killer whale  at--------------------------------------g
             Tibetan antelope  at--------------------------------------g
                          Cow  at--------------------------------------g
                        Sheep  at--------------------------------------g
                Domestic goat  at--------------------------------------g
                        Horse  at--------------------------------------g
             White rhinoceros  at--------------------------------------g
                          Cat  gt--------------------------------------g
                          Dog  gc--------------------------------------g
                      Ferret   at--------------------------------------g
                        Panda  ac--------------------------------------g
               Pacific walrus  gt--------------------------------------g
                 Weddell seal  at--------------------------------------g
             Black flying-fox  cc--------------------------------------g
                      Megabat  cc--------------------------------------g
                Big brown bat  ct--------------------------------------g
         David's myotis (bat)  ct--------------------------------------g
                     Microbat  ct--------------------------------------g
                        Shrew  gt--------------------------------------g
              Star-nosed mole  at--------------------------------------g
                     Elephant  at--------------------------------------g
          Cape elephant shrew  at--------------------------------------g
                      Manatee  at--------------------------------------g
             Cape golden mole  at--------------------------------------a
                       Tenrec  atttgagcacacattaactctgcaccccaaacccactgcca
                     Aardvark  at--------------------------------------g
                    Armadillo  -----------------------------------------
                     Hedgehog  =========================================
             Peregrine falcon  =========================================
                 Saker falcon  =========================================
                   Coelacanth  =========================================
                   Budgerigar  =========================================
                  Rock pigeon  =========================================
                 Mallard duck  =========================================
     Chinese softshell turtle  =========================================
                      Chicken  =========================================
          Medium ground finch  =========================================
                       Turkey  =========================================
               Painted turtle  =========================================
                  Zebra finch  =========================================
          Collared flycatcher  =========================================
           American alligator  =========================================
           Tibetan ground jay  =========================================
                       Lizard  =========================================
       White-throated sparrow  =========================================
                     Platypus  =========================================
              Green seaturtle  =========================================
       Lesser Egyptian jerboa  =========================================

Alignment block 21 of 48 in window, 16085745 - 16085760, 16 bps 
B D                     Human  c-agg---ttaacttca----t---ca
B D                     Chimp  c-agg---ttaacttca----t---ca
B D                   Gorilla  c-agg---ttaacttca----t---ca
B D                 Orangutan  c-a-g---ttaacttca----t---ca
B D                    Gibbon  c-agg---ttgacttca----t---ca
B D                    Rhesus  c-aga---ttaacttca----t---ca
B D       Crab-eating macaque  c-aga---ttaacttca----t---ca
B D                    Baboon  c-aga---ttaacttca----t---ca
B D              Green monkey  c-aga---ttaacttca----t---ca
B D                  Marmoset  c-agg---ttaacttca----t---ca
B D           Squirrel monkey  t-agg---ttaacttca----t---ca
B D                  Bushbaby  c-agg---tgacctctg----g---ga
           Chinese tree shrew  c-agg---ttaactcta----c---aa
B D                  Squirrel  c-aggt--ttgactcta----t---aa
       Lesser Egyptian jerboa  ---------------ca--ggt---ca
                 Prairie vole  c-ag----ttaacttcaccagc---ca
B D           Chinese hamster  c-aggcaattaacttca----t---ca
               Golden hamster  c-aggcaattaacttca----t---ca
B D                     Mouse  a-attccattaa--tta----t---ca
B D                       Rat  a-attccattag--tca----t---ca
B D                    Rabbit  c-agg---ttaactcca----t---ca
B D                      Pika  c-agg---tcaactcta----t---cg
B D                       Pig  t-agg---ttaactttg----a---aa
B D                    Alpaca  t-agg---ttaacctta----a---ga
               Bactrian camel  t-agg---ttaacctta----a---ga
B D                   Dolphin  t-agg---ttgacttta----a---ca
                 Killer whale  t-agg---ttgacttta----a---ca
             Tibetan antelope  c-cgg---ttaacttgg----a---ga
B D                       Cow  t-cgg---ttaacttga----a---ga
B D                     Sheep  t-cgg---ttaacttgg----a---ga
                Domestic goat  t-cgg---ttaacttgg----a---ga
B D                     Horse  taggg----taactcta----a---ga
B D          White rhinoceros  ta-gg----taactcta----a---ga
B D                       Cat  t-aga---ctatcgcta----a---ca
B D                       Dog  gcatg---ttaactcta----a---ca
B D                   Ferret   gaagg---ttcactcta----a---cc
B D                     Panda  caagg---ttcactctc----a---ca
               Pacific walrus  gaagg---ttcactctg----a---ca
                 Weddell seal  gaagg----tcactctg----a---ca
             Black flying-fox  t-agg---ttaactcta----a---ga
B D                   Megabat  t-agg---ttaactcta----a---ga
                Big brown bat  c-agg---tgaactcta----a---gg
         David's myotis (bat)  c-agg---ttaactcta----a---gg
B D                  Microbat  c-agg---ttacctcta----a---gg
B D                     Shrew  t-aga---tttactatg----ctgaaa
              Star-nosed mole  c-ag----tcaactctg----c----a
B D                  Elephant  -aagg---ttaacccta----a---aa
          Cape elephant shrew  -aagg---ttaac--------------
B D                   Manatee  -aaag---ttaacccta----a---aa
             Cape golden mole  -aagg---ccaactcta----a---aa
B D                    Tenrec  -tgag---ttaattcca----a---ca
                     Aardvark  -taggt--ttgactcta----a---aa
B D                  Hedgehog  ===========================
  D          Peregrine falcon  ===========================
  D              Saker falcon  ===========================
B D                Coelacanth  ===========================
B D                Budgerigar  ===========================
  D               Rock pigeon  ===========================
  D              Mallard duck  ===========================
  D  Chinese softshell turtle  ===========================
B D                   Chicken  ===========================
B D       Medium ground finch  ===========================
B D                    Turkey  ===========================
  D            Painted turtle  ===========================
B D               Zebra finch  ===========================
  D       Collared flycatcher  ===========================
B D        American alligator  ===========================
          Tibetan ground jay  ===========================
B D                    Lizard  ===========================
  D    White-throated sparrow  ===========================
B D                  Platypus  ===========================
  D           Green seaturtle  ===========================
B D                 Armadillo  ---------------------------

Inserts between block 21 and 22 in window
            Black flying-fox 1bp
B D                  Megabat 1bp
B D                   Tenrec 156bp

Alignment block 22 of 48 in window, 16085761 - 16085817, 57 bps 
B D                     Human  accctg---gtgaaaatgccacc-tcctc----atgaggaag---ccttccccattt-gctctgtctca
B D                     Chimp  accctg---gtgaaaatgccacc-tcctc----gtgaggaag---gcttccccattt-gctctgtctca
B D                   Gorilla  accctg---gtgaaaatgccacc-tcctc----gtgaggaag---ccttccccattt-gctctgtctca
B D                 Orangutan  accctg---gtgaacatgccacc-tcctc------taggaag---ccttccccgttt-gccctgtctca
B D                    Gibbon  gccctg---gtgaaaatgccacc-tcctc------taggaag---ccttccccattt-gccctgtctca
B D                    Rhesus  accctg---gtgaaaatgccacc-tcctc------taggaag---ccttccccattt-gtcccgtctca
B D       Crab-eating macaque  accctg---gtgaaaatgccacc-tcctc------taggaag---ccttccccattt-gtcccgtctca
B D                    Baboon  accctc---gtgaaaatgccacc-tcctc------taggaag---ccttccccattt-gtcctgtctca
B D              Green monkey  accctg---gtgaaaatgccacc-ttctc------taggaag---ccttccccattt-ttcctgtctca
B D                  Marmoset  acctgg---gtggaaatgtcacc-tcttc------gaggaag---ccttctccattt-gccctgtctcg
B D           Squirrel monkey  acctgg---gtggaaatgtcacc-tcctc------gaggaag---gcttctccattt-gccctgtctcg
B D                  Bushbaby  atcctg---gtgaccgggccacc-ttgtc------tgggaag---cctttcctactt-gtcctacctca
           Chinese tree shrew  atcctg---gtgcaaatggcgcc-tcctc------tgggaag---acttccc--ttt-ctcct---tgg
B D                  Squirrel  acccct---gtgcaaatgtcacc-tcctc------taggaag---cctgctgggctt-tctctatctca
       Lesser Egyptian jerboa  gcttggcaagagtgaa-atc--c-tacctcaaaaacaaaaaa---acttcgccaaca-----------a
                 Prairie vole  acatag---gggtaaa-atcacc-tccct------caggaag---ccttccccaact-tctctgtggca
B D           Chinese hamster  acacag---gggcaaa-gtcacc-tcctt------caggaag---ccttccacaatt---tctgtctca
               Golden hamster  acac-g---gggcaaa-gtcatc-tcctt------caggaag---ccttccccgatt-tctctgtctcg
B D                     Mouse  acattg---gtgcgaa-gtcacc-tcctt------caggacg---gcttttctgact-tctctgcttca
B D                       Rat  acattg---gtgcaaa-gtcgcc-tcctt------caggaag---ccttttctgatc-tgtctgcctca
B D                    Rabbit  atcctg---gtgcaggtgccacc-tcctg------caggaca---ccttccctactt-gccctgactca
B D                      Pika  atcctg---ggggaagtaccatc-tcctc------caggagc---cggtcaccactt-gctctt-ctca
B D                       Pig  ttcctt---gtgcaaatgccacc-tcctc------tagaaag---ccctcccggctt-gccctgtgcca
B D                    Alpaca  acgctg---gtgcaaatgtcacc-tcctc------cagaaag---ccctccccgttt-gccctgtttca
               Bactrian camel  acgctg---gtgcaaatgtcacc-tcctc------cagaaag---ccctccccattt-gccctgtttca
B D                   Dolphin  accctg---gtgcaaatgccacc-tcctc------tagaaag---ccctccccatct-gccctgttcca
                 Killer whale  accctg---gtgcaaacgccacc-tcctc------tagaaag---ccctccccatct-gccctgttcca
             Tibetan antelope  a-cctg---gtgcaaatgcagcc-tcctc------tagaaag---ccat---------------ttcca
B D                       Cow  a-tctg---gtgcaaatgccgcc-tcctc------tagaaag---ccgt---------------ttccg
B D                     Sheep  a-cctg---gtgcaaatgccgcc-tcctc------tagaaag---ccgt---------------ttcca
                Domestic goat  a-cctg---gtgcaaatgccgcc-tcctc------tagaaag---ccgt---------------ttcca
B D                     Horse  gccctg---gtgcaaatgccagc-tcctc------tggaaag---cagcccccactt-gctctgtcccc
B D          White rhinoceros  accctg---gtgcaaatgcccca-tcctc------tggaaag---ctgaccccgctt-accctgtctca
B D                       Cat  acgtag---atgcaaatgccatc-tcacc------taggaag---ccctccccactt-gcctggtctca
B D                       Dog  accctg---gtg------------------------agaaag---ccctccctactt-gtgccatctca
B D                   Ferret   accctg---gtgaaaatgccatg-ttgcc------tagaaag---ccctcccaactc-aggctgtccta
B D                     Panda  accctg---gtaaaaatgccatg-tcctt------tagaaag---ccctccccactt-gcgctgtctca
               Pacific walrus  ac---------------gccatg-tcgcc------tagaaag---ccctccccactc-gcgctgtctca
                 Weddell seal  ac---------------gccatg-tcagc------tggaaag---ccctccccactt-gcgctgtctca
             Black flying-fox  gc-ctg---gg------gccacc-tcctc------caggaag---ccctccact------gctggctca
B D                   Megabat  gc-ctg---gg------gccacc-tcctc------caggaag---ccctcccct------gctggctca
                Big brown bat  ac-ctg---gtgcaaacgccaac-tcctc------caggaag---ccctcccca------gcgctatca
         David's myotis (bat)  ac-cta---gtgcaaacgccacc-tcctc------taggaag---ccctcccca------gcaccatca
B D                  Microbat  ac-cta---gtgcaaacgccacc-tcctc------taggaag---ccctcccca------gcgctatca
B D                     Shrew  tccctg---ctgcaaatgccaccttcctc------caggaag---tcctccttgctt-accc--tgtca
              Star-nosed mole  accctg---gagc--acggcctcctcttc------caggaag---cccccctaggca-ccgt--tctca
B D                  Elephant  actcta---gtgcaaatgccatc-tctcc------tagaaaaaagccctccccaattgtccctgtttca
          Cape elephant shrew  ----------tgtaatcactact-tcctc------taaaaag------cctccaatttcccctattcca
B D                   Manatee  acccta---gtgcaaatgccacc-tcctc------tagaaag------cct-------tccctgtttca
             Cape golden mole  acccta---gtgtagatgccacc-tccct------tggaaat---ccctctccaattgtccctgttttt
                     Aardvark  acctta---atgtaaatgctacc-tcctc------tagaaag---tcctctccaaatgtctttgtttca
B D                 Armadillo  -----------gcagctttcgtt-tgctt------ggcc------------------------------
B D                  Hedgehog  =====================================================================
  D          Peregrine falcon  =====================================================================
  D              Saker falcon  =====================================================================
B D                Coelacanth  =====================================================================
B D                Budgerigar  =====================================================================
  D               Rock pigeon  =====================================================================
  D              Mallard duck  =====================================================================
  D  Chinese softshell turtle  =====================================================================
B D                   Chicken  =====================================================================
B D       Medium ground finch  =====================================================================
B D                    Turkey  =====================================================================
  D            Painted turtle  =====================================================================
B D               Zebra finch  =====================================================================
  D       Collared flycatcher  =====================================================================
B D        American alligator  =====================================================================
          Tibetan ground jay  =====================================================================
B D                    Lizard  =====================================================================
  D    White-throated sparrow  =====================================================================
B D                  Platypus  =====================================================================
  D           Green seaturtle  =====================================================================
B D                    Tenrec  =====================================================================

Inserts between block 22 and 23 in window
B D                    Shrew 7bp
         Cape elephant shrew 5509bp
            Cape golden mole 1bp

Alignment block 23 of 48 in window, 16085818 - 16085825, 8 bps 
B D                     Human  gagacact
B D                     Chimp  gagacact
B D                   Gorilla  gagacact
B D                 Orangutan  gagacact
B D                    Gibbon  gagacact
B D                    Rhesus  gagacatt
B D       Crab-eating macaque  gagacatt
B D                    Baboon  gagacatt
B D              Green monkey  gagacatt
B D                  Marmoset  cagacact
B D           Squirrel monkey  cagacatt
B D                  Bushbaby  gtgacatt
           Chinese tree shrew  gggacatt
B D                  Squirrel  gagagagt
       Lesser Egyptian jerboa  aaaacctt
                 Prairie vole  atgacatt
B D           Chinese hamster  atgacatt
               Golden hamster  ataacatt
B D                     Mouse  gtggcatt
B D                       Rat  gttacttt
B D                    Rabbit  gcgaca--
B D                      Pika  ctaaca--
B D                       Pig  gtgacctt
B D                    Alpaca  gtgacc-g
               Bactrian camel  gtgacc-g
B D                   Dolphin  gtgacctt
                 Killer whale  gtgacctt
             Tibetan antelope  ttgccctg
B D                       Cow  ttgccctg
B D                     Sheep  ttgccctg
                Domestic goat  ttgccctg
B D                     Horse  atgacctt
B D          White rhinoceros  gtgacctt
B D                       Cat  gggaactt
B D                       Dog  gtgaactt
B D                   Ferret   gcaaaact
B D                     Panda  gtgaactt
               Pacific walrus  gtgaactt
                 Weddell seal  gtgaactt
             Black flying-fox  gtga-ctt
B D                   Megabat  gtga-ctt
                Big brown bat  gggacctt
         David's myotis (bat)  gtgacctt
B D                  Microbat  gtgacctt
B D                     Shrew  aagacctt
              Star-nosed mole  gcgagctt
B D                  Elephant  gtgtcctt
B D                   Manatee  gtgtcctt
             Cape golden mole  gtgtcatt
                     Aardvark  gtgtccct
B D                 Armadillo  ---accct
B D                  Hedgehog  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
B D                Coelacanth  ========
B D                Budgerigar  ========
  D               Rock pigeon  ========
  D              Mallard duck  ========
  D  Chinese softshell turtle  ========
B D                   Chicken  ========
B D       Medium ground finch  ========
B D                    Turkey  ========
  D            Painted turtle  ========
B D               Zebra finch  ========
  D       Collared flycatcher  ========
B D        American alligator  ========
          Tibetan ground jay  ========
B D                    Lizard  ========
  D    White-throated sparrow  ========
         Cape elephant shrew  ========
B D                  Platypus  ========
  D           Green seaturtle  ========
B D                    Tenrec  ========

Inserts between block 23 and 24 in window
                Prairie vole 3bp
B D          Chinese hamster 3bp
              Golden hamster 3bp
B D                    Mouse 308bp
B D                      Rat 31bp

Alignment block 24 of 48 in window, 16085826 - 16085830, 5 bps 
B D                     Human  tgact
B D                     Chimp  tgact
B D                   Gorilla  tgact
B D                 Orangutan  tgact
B D                    Gibbon  tgact
B D                    Rhesus  tgact
B D       Crab-eating macaque  tgact
B D                    Baboon  tgact
B D              Green monkey  tgact
B D                  Marmoset  tgact
B D           Squirrel monkey  tgact
B D                  Bushbaby  ttgtc
           Chinese tree shrew  tgagt
B D                  Squirrel  ---tt
       Lesser Egyptian jerboa  -cctc
                 Prairie vole  ---tt
B D           Chinese hamster  ---tt
               Golden hamster  ---tt
B D                       Rat  ---tt
B D                       Pig  tctct
B D                    Alpaca  tctct
               Bactrian camel  tctct
B D                   Dolphin  tctct
                 Killer whale  tctct
             Tibetan antelope  tccct
B D                       Cow  tccct
B D                     Sheep  tccct
                Domestic goat  tccct
B D                     Horse  tctct
B D          White rhinoceros  tctct
B D                       Cat  tctct
B D                       Dog  tctct
B D                   Ferret   tctct
B D                     Panda  tctct
               Pacific walrus  accct
                 Weddell seal  tcccg
             Black flying-fox  tctct
B D                   Megabat  tctct
                Big brown bat  tctct
         David's myotis (bat)  cctct
B D                  Microbat  tctct
B D                     Shrew  tcttc
              Star-nosed mole  tctct
B D                  Elephant  tttct
B D                   Manatee  tttct
             Cape golden mole  tttct
                     Aardvark  tttct
B D                 Armadillo  tctct
B D                  Hedgehog  =====
B D                     Mouse  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
B D                Coelacanth  =====
B D                Budgerigar  =====
  D               Rock pigeon  =====
  D              Mallard duck  =====
  D  Chinese softshell turtle  =====
B D                   Chicken  =====
B D       Medium ground finch  =====
B D                    Turkey  =====
  D            Painted turtle  =====
B D               Zebra finch  =====
  D       Collared flycatcher  =====
B D        American alligator  =====
          Tibetan ground jay  =====
B D                    Lizard  =====
  D    White-throated sparrow  =====
         Cape elephant shrew  =====
B D                  Platypus  =====
  D           Green seaturtle  =====
B D                    Rabbit  -----
B D                      Pika  -----
B D                    Tenrec  =====

Alignment block 25 of 48 in window, 16085831 - 16085832, 2 bps 
B D                     Human  cc
B D                     Chimp  cc
B D                   Gorilla  cc
B D                 Orangutan  cc
B D                    Gibbon  cc
B D                    Rhesus  cc
B D       Crab-eating macaque  cc
B D                    Baboon  cc
B D              Green monkey  cc
B D                  Marmoset  cc
B D           Squirrel monkey  cc
B D                  Bushbaby  cc
           Chinese tree shrew  cc
B D                  Squirrel  cc
       Lesser Egyptian jerboa  cc
                 Prairie vole  ac
B D           Chinese hamster  ac
               Golden hamster  at
B D                       Rat  gc
B D                       Pig  cc
B D                    Alpaca  cc
               Bactrian camel  cc
B D                   Dolphin  cc
                 Killer whale  cc
             Tibetan antelope  cc
B D                       Cow  cc
B D                     Sheep  cc
                Domestic goat  cc
B D                     Horse  cc
B D          White rhinoceros  cc
B D                       Cat  cc
B D                       Dog  cc
B D                   Ferret   cc
B D                     Panda  cc
               Pacific walrus  cc
                 Weddell seal  cc
             Black flying-fox  cc
B D                   Megabat  cc
                Big brown bat  cc
         David's myotis (bat)  cc
B D                  Microbat  cc
B D                     Shrew  ta
              Star-nosed mole  cc
B D                  Elephant  cc
B D                   Manatee  cc
             Cape golden mole  -c
B D                    Tenrec  cc
                     Aardvark  tt
B D                 Armadillo  cc
B D                  Hedgehog  ==
B D                     Mouse  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D                Coelacanth  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
  D              Mallard duck  ==
  D  Chinese softshell turtle  ==
B D                   Chicken  ==
B D       Medium ground finch  ==
B D                    Turkey  ==
  D            Painted turtle  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==
B D        American alligator  ==
          Tibetan ground jay  ==
B D                    Lizard  ==
  D    White-throated sparrow  ==
         Cape elephant shrew  ==
B D                  Platypus  ==
  D           Green seaturtle  ==
B D                    Rabbit  --
B D                      Pika  --

Inserts between block 25 and 26 in window
B D                 Squirrel 3bp
      Lesser Egyptian jerboa 1bp

Alignment block 26 of 48 in window, 16085833 - 16085858, 26 bps 
B D                     Human  atggac-t-tctct-----------------gcaattctgttctg
B D                     Chimp  atggac-t-tctct-----------------gcaattctcttctg
B D                   Gorilla  atggac-t-tctct-----------------gcaattctgttctg
B D                 Orangutan  atgggc-t-tctct-----------------gcaattctgttctg
B D                    Gibbon  atgggc-t-tctct-----------------gcagttctgttctg
B D                    Rhesus  atgggc-t-tctct-----------------gcagttttgttccg
B D       Crab-eating macaque  atgggc-t-tctct-----------------gcagttttgttccg
B D                    Baboon  ttgggc-t-tctct-----------------gcagttttgttgtg
B D              Green monkey  atgggc-t-tctct-----------------gcagttttgttctg
B D                  Marmoset  acgcgc-t-tctct-----------------gcaggtctgttctg
B D           Squirrel monkey  acgggc-t---tcc-----------------gcatgtctgttccg
B D                  Bushbaby  ggggat-t-ctcta-----------------gcta----------
           Chinese tree shrew  agggat-t-tctag-----------------gcagatttgctcta
B D                  Squirrel  atgggc-t-tctct-----------------atagagctaccctg
       Lesser Egyptian jerboa  atcaac-tacttct-----------------tcagcccagcaacg
                 Prairie vole  acgctc-t-tttcg-----------------cttgatctgttcca
B D           Chinese hamster  atgggc-t-tttcc-----------------ctagatctttcctg
               Golden hamster  atgggc-t-tttcc-----------------c-agctctgccctg
B D                     Mouse  atgagc-t-tgtcc-----------------ctagatcttacctg
B D                       Rat  ataggc-t-tggcc-----------------ttagatctgcccta
B D                    Rabbit  ---ggc-t-cctct-----------------ctgcacccgcccca
B D                      Pika  ---ggc-t-tctct-----------------gtagatctgccctg
B D                       Pig  -actgc-t-cccct-----------------gcagatgggctctt
B D                    Alpaca  -acgac-t-cctct-----------------gcagatgggctctg
               Bactrian camel  -acgac-t-cctct-----------------gcagatgggctctg
B D                   Dolphin  -gtggc-t-ccctt-----------------acagatgggctctg
                 Killer whale  -gtggc-t-ccctt-----------------acagatgggctctg
             Tibetan antelope  -acggc-t-cctct-----------------gcagac-ggctctg
B D                       Cow  -acggc-t-cctct-----------------gcagac-ggctctg
B D                     Sheep  -acggc-t-cctct-----------------gcagac-ggctctg
                Domestic goat  -acggc-t-cctct-----------------gcagat-ggctctg
B D                     Horse  -acggc-t-tccct-----------------gcagatcggctctc
B D          White rhinoceros  -a-ggc-t-ccttc-----------------acagatcggctcta
B D                       Cat  -atgac-t-cctct-----------------acagatgggctctg
B D                       Dog  -atggc-t-cctct-----------------gccgacaggcctcg
B D                   Ferret   -atgcc-t-tc-ct-----------------gttgacgggccccg
B D                     Panda  -atggc-c-cctct-----------------gccgacaggccccg
               Pacific walrus  -atgcc-t-ccttt-----------------gccgac-ggccccc
                 Weddell seal  -atgcc-t-ccttt-----------------gccgac-ggccccc
             Black flying-fox  -acagc-t-cctcc-----------------gcggatcggctctg
B D                   Megabat  -acagc-t-cctcc-----------------gcagatc-gctccg
                Big brown bat  -acggc-t-cctgc-----------------acagacccgttctg
         David's myotis (bat)  -atggc-t-cccgc-----------------acagacccgttctg
B D                  Microbat  -atgac-t-cccgc-----------------acagacccgttctg
B D                     Shrew  -gtttc-t-----c-----------------ccacagtggctctg
              Star-nosed mole  -atggc-t-gtagc-----------------gcacagggactgtg
B D                  Elephant  -acaag-t-cctcc-----------------tctgatcaaccctg
B D                   Manatee  -ccaag-t-cctct-----------------actgatcagccctg
             Cape golden mole  -acaaggt-ccccc-----------------actgatcaaccttg
B D                    Tenrec  -atgtgtt-tcccccccccccacagggctgtgctgatcactgccg
                     Aardvark  -acagg-t-cctcc-----------------actgatgagctttg
B D                 Armadillo  -acggc-t-tctct-----------------gacgactggccctg
B D                  Hedgehog  =============================================
  D          Peregrine falcon  =============================================
  D              Saker falcon  =============================================
B D                Coelacanth  =============================================
B D                Budgerigar  =============================================
  D               Rock pigeon  =============================================
  D              Mallard duck  =============================================
  D  Chinese softshell turtle  =============================================
B D                   Chicken  =============================================
B D       Medium ground finch  =============================================
B D                    Turkey  =============================================
  D            Painted turtle  =============================================
B D               Zebra finch  =============================================
  D       Collared flycatcher  =============================================
B D        American alligator  =============================================
          Tibetan ground jay  =============================================
B D                    Lizard  =============================================
  D    White-throated sparrow  =============================================
         Cape elephant shrew  =============================================
B D                  Platypus  =============================================
  D           Green seaturtle  =============================================

Inserts between block 26 and 27 in window
B D                 Marmoset 1020bp

Alignment block 27 of 48 in window, 16085859 - 16085867, 9 bps 
B D                     Human  tgtaggact
B D                     Chimp  tgtaggact
B D                   Gorilla  tgtaggact
B D                 Orangutan  tgta-gact
B D                    Gibbon  tgtacgact
B D                    Rhesus  tgtaggact
B D       Crab-eating macaque  tgtaggact
B D                    Baboon  tgtaggact
B D              Green monkey  tgtaggact
B D                  Marmoset  tgcaggact
B D           Squirrel monkey  tggaggact
B D                  Bushbaby  ---aggatt
           Chinese tree shrew  tactggact
B D                  Squirrel  tgtgggtct
       Lesser Egyptian jerboa  ggaaggcaa
                 Prairie vole  ggcaggact
B D           Chinese hamster  ggcaggact
               Golden hamster  ggcaggact
B D                     Mouse  ggcaggatt
B D                       Rat  ggt-ggatt
B D                    Rabbit  tgcagcacc
B D                      Pika  cgtgggact
B D                       Pig  tctaggact
B D                    Alpaca  tccaggact
               Bactrian camel  tccaggact
B D                   Dolphin  tctaagact
                 Killer whale  tctaagact
             Tibetan antelope  tctaggact
B D                       Cow  tct-ggact
B D                     Sheep  tctaggact
                Domestic goat  tctaggact
B D                     Horse  tggagaacc
B D          White rhinoceros  tgtaggacc
B D                       Cat  tctggggct
B D                       Dog  tgtagggct
B D                   Ferret   ctgagggct
B D                     Panda  tcgagggct
               Pacific walrus  tggagggct
                 Weddell seal  tggagggct
             Black flying-fox  tctcggact
B D                   Megabat  tctcggact
                Big brown bat  tctagga-t
         David's myotis (bat)  tcaagga-t
B D                  Microbat  tcaagga-t
B D                     Shrew  tgtaggaat
              Star-nosed mole  tgcagtacc
B D                  Elephant  tacagggct
B D                   Manatee  tacaggact
             Cape golden mole  tgcagtact
B D                    Tenrec  tgctggact
                     Aardvark  ttcaggatt
B D                 Armadillo  tgcaggact
B D                  Hedgehog  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
B D                Coelacanth  =========
B D                Budgerigar  =========
  D               Rock pigeon  =========
  D              Mallard duck  =========
  D  Chinese softshell turtle  =========
B D                   Chicken  =========
B D       Medium ground finch  =========
B D                    Turkey  =========
  D            Painted turtle  =========
B D               Zebra finch  =========
  D       Collared flycatcher  =========
B D        American alligator  =========
          Tibetan ground jay  =========
B D                    Lizard  =========
  D    White-throated sparrow  =========
         Cape elephant shrew  =========
B D                  Platypus  =========
  D           Green seaturtle  =========

Inserts between block 27 and 28 in window
            Cape golden mole 613bp

Alignment block 28 of 48 in window, 16085868 - 16085885, 18 bps 
B D                     Human  gcctagtgcctagcctt-c
B D                     Chimp  gcctagtgcctagcctt-c
B D                   Gorilla  gcctagtgcctagcctt-c
B D                 Orangutan  gcctagtgcctagcctt-c
B D                    Gibbon  gcctagtgcccagcctt-c
B D                    Rhesus  gcctagtgcctagcttt-c
B D       Crab-eating macaque  gcctagtgcctagcttt-c
B D                    Baboon  gcctagtgcctagcttt-c
B D              Green monkey  gcctagtgcctaacttt-c
B D                  Marmoset  gcctagtgcctcgcctt-c
B D           Squirrel monkey  gtctagtacctcgcctt-c
B D                  Bushbaby  gcctcatgtccagcctg-t
           Chinese tree shrew  gcctgctgcttctccct-t
B D                  Squirrel  gcctgg--cctggccac-a
       Lesser Egyptian jerboa  ttacagcacctggccga-t
                 Prairie vole  gtctggtgcccatccct-c
B D           Chinese hamster  gtctggtacccatccct-c
               Golden hamster  gtctggtgcccatcccc-c
B D                     Mouse  atctggtgtccatcatt-c
B D                       Rat  atctggtgcccatccct-c
B D                    Rabbit  atccgatgccgctcgcg-g
B D                      Pika  acgtggttcttgtgcct-g
B D                       Pig  gcttggtgctaatccct-c
B D                    Alpaca  tctcggtgcctgtcttt-c
               Bactrian camel  gcttgctgcctgtcttt-c
B D                   Dolphin  gcttggtgccagtccct-c
                 Killer whale  gcttggtgccagtccct-c
             Tibetan antelope  gctcagtgccagtccct-c
B D                       Cow  gcttagtgccagtccct-c
B D                     Sheep  gctcagtgcca-tccct-c
                Domestic goat  gctcagtgccagtccct-c
B D                     Horse  acctggggccggaccct-g
B D          White rhinoceros  gcctggggccaatccct-t
B D                       Cat  at-----------------
B D                       Dog  gcttgctgccagtccct-c
B D                   Ferret   gcttgctgccactgcct-t
B D                     Panda  gcttgctgccaggccct-c
               Pacific walrus  gcttgctccccacccct-c
                 Weddell seal  gcttgctgccggcccct-c
             Black flying-fox  gcttggtgccagtccct-c
B D                   Megabat  gcttggtgccagtccct-c
                Big brown bat  gctgggtgccaat-cct-c
         David's myotis (bat)  gctcggtgcccat-cct-c
B D                  Microbat  gctgggtgcccat-cct-c
B D                     Shrew  gcctggtgaccaacactat
              Star-nosed mole  gactggagcccagccct-c
B D                  Elephant  acctggtgacaattcct-c
B D                   Manatee  acctggtgacaattcct-c
B D                    Tenrec  -gctgttcccaatgcct-c
                     Aardvark  acctgacagcaattctt-c
B D                 Armadillo  -gcctgtgacggcccct-c
B D                  Hedgehog  ===================
  D          Peregrine falcon  ===================
  D              Saker falcon  ===================
B D                Coelacanth  ===================
B D                Budgerigar  ===================
  D               Rock pigeon  ===================
  D              Mallard duck  ===================
  D  Chinese softshell turtle  ===================
B D                   Chicken  ===================
B D       Medium ground finch  ===================
B D                    Turkey  ===================
  D            Painted turtle  ===================
B D               Zebra finch  ===================
  D       Collared flycatcher  ===================
B D        American alligator  ===================
          Tibetan ground jay  ===================
B D                    Lizard  ===================
  D    White-throated sparrow  ===================
         Cape elephant shrew  ===================
B D                  Platypus  ===================
  D           Green seaturtle  ===================
            Cape golden mole  ===================

Inserts between block 28 and 29 in window
B D                Orangutan 630bp
B D                 Bushbaby 24bp
          Chinese tree shrew 26bp
B D                 Squirrel 2bp
      Lesser Egyptian jerboa 2bp
                Prairie vole 2bp
B D          Chinese hamster 808bp
              Golden hamster 2bp
B D                    Mouse 2bp
B D                      Rat 2bp
B D                   Rabbit 21bp
B D                     Pika 21bp
B D                      Pig 21bp
B D                   Alpaca 21bp
              Bactrian camel 21bp
B D                  Dolphin 21bp
                Killer whale 21bp
            Tibetan antelope 21bp
B D                      Cow 21bp
B D                    Sheep 21bp
               Domestic goat 21bp
B D                    Horse 21bp
B D         White rhinoceros 21bp
B D                      Cat 15bp
B D                      Dog 21bp
B D                  Ferret  21bp
B D                    Panda 25bp
              Pacific walrus 21bp
                Weddell seal 21bp
            Black flying-fox 21bp
B D                  Megabat 21bp
               Big brown bat 20bp
        David's myotis (bat) 14bp
B D                 Microbat 20bp
B D                    Shrew 21bp
             Star-nosed mole 21bp

Alignment block 29 of 48 in window, 16085886 - 16085891, 6 bps 
B D                     Human  ttgtga
B D                     Chimp  ttgtga
B D                   Gorilla  ttgtga
B D                    Gibbon  ttgtga
B D                    Rhesus  ttgtgg
B D       Crab-eating macaque  ttgtgg
B D                    Baboon  ttgtgg
B D              Green monkey  ttgtgg
B D                  Marmoset  ttgtga
B D           Squirrel monkey  -tgcga
B D                  Bushbaby  tgggca
           Chinese tree shrew  tttttt
B D                  Squirrel  ctga--
       Lesser Egyptian jerboa  ttaa--
                 Prairie vole  ctga--
               Golden hamster  caga--
B D                     Mouse  ctga--
B D                       Rat  ttga--
B D                    Rabbit  tcca--
B D                      Pika  ttga--
B D                       Pig  ttgatc
B D                    Alpaca  ttgcta
               Bactrian camel  ttgata
B D                   Dolphin  tcgata
                 Killer whale  tcgata
             Tibetan antelope  ttgacg
B D                       Cow  ttgacg
B D                     Sheep  ttgacg
                Domestic goat  ttgacg
B D                     Horse  ttcatg
B D          White rhinoceros  tcgata
B D                       Cat  ttgata
B D                       Dog  ttgata
B D                   Ferret   ttcata
B D                     Panda  tgggta
               Pacific walrus  ttgata
                 Weddell seal  ttgata
             Black flying-fox  ttgata
B D                   Megabat  ttgata
                Big brown bat  tgggta
B D                  Microbat  tgggta
B D                     Shrew  ttcagt
B D                  Elephant  -tgccg
B D                   Manatee  -tgcta
B D                    Tenrec  -tgcta
                     Aardvark  -tgcta
B D                 Armadillo  -tcttc
             Star-nosed mole  ======
B D                  Hedgehog  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
B D                Coelacanth  ======
B D                Budgerigar  ======
  D               Rock pigeon  ======
  D              Mallard duck  ======
  D  Chinese softshell turtle  ======
B D                   Chicken  ======
B D       Medium ground finch  ======
B D                    Turkey  ======
  D            Painted turtle  ======
B D               Zebra finch  ======
  D       Collared flycatcher  ======
B D        American alligator  ======
          Tibetan ground jay  ======
B D                    Lizard  ======
  D    White-throated sparrow  ======
         Cape elephant shrew  ======
B D           Chinese hamster  ======
B D                  Platypus  ======
  D           Green seaturtle  ======
        David's myotis (bat)  ======
B D                 Orangutan  ======
            Cape golden mole  ======

Inserts between block 29 and 30 in window
      Lesser Egyptian jerboa 2bp
                Prairie vole 16bp
              Golden hamster 3bp
B D                    Mouse 19bp
B D                      Rat 16bp
B D                   Rabbit 2bp
B D                     Pika 2bp

Alignment block 30 of 48 in window, 16085892 - 16085920, 29 bps 
B D                     Human  -----------tgttcct------tg-----------cttatgtctt-----------------------
B D                     Chimp  -----------tgttcct------tg-----------cttatgtctt-----------------------
B D                   Gorilla  -----------tgttcct------tg-----------cttatgtctt-----------------------
B D                    Gibbon  -----------tgttcct------tg-----------cttatgtctt-----------------------
B D                    Rhesus  -----------tgttcct------tg-----------cttatgtctt-----------------------
B D       Crab-eating macaque  -----------tgttcct------tg-----------cttatgtctt-----------------------
B D                    Baboon  -----------tgttcct------tg-----------cttatgtctt-----------------------
B D              Green monkey  -----------tgttctt------tg-----------cttatgtctt-----------------------
B D                  Marmoset  -----------agtttct------tt-----------cttatgtctt-----------------------
B D           Squirrel monkey  -----------tgttcct------tg-----------cttgtgtctt-----------------------
B D                  Bushbaby  -----------tgtctct------tt-----------ctcacatctt-----------------------
           Chinese tree shrew  -----------tctttct------tt-----------ctttttctttttaataaaatgctcatttattta
B D                  Squirrel  -----------tgtctct------tg-----------ctcatgtctt-----------------------
       Lesser Egyptian jerboa  -----------tgcctct------tg-----------ctcatgcctt-----------------------
                 Prairie vole  -----------tgattct------cg-----------ctcatatctt-----------------------
B D           Chinese hamster  -----------tgattct------tg-----------ctcatgtctc-----------------------
               Golden hamster  -----------tctgcct------ag-----------ctcaagtctc-----------------------
B D                     Mouse  -----------tgattct------tg-----------ctcatgtctt-----------------------
B D                       Rat  -----------tgattct------tg-----------ttcgtgtctt-----------------------
B D                    Rabbit  -----------cgtctct------tg-----------cttgtgtcgt-----------------------
B D                      Pika  -----------catctct------tg-----------cgtgtgttca-----------------------
B D                       Pig  -----------agtctct------tg-----------ttcctgagtt-----------------------
B D                    Alpaca  -----------agtcctt------gg-----------cccatgtgtt-----------------------
               Bactrian camel  -----------agtcctt------gg-----------ctcacgtgtt-----------------------
B D                   Dolphin  -----------agtccct------tg-----------ctggtgtgtc-----------------------
                 Killer whale  -----------agtccct------tg-----------ctggtgtgtc-----------------------
             Tibetan antelope  -----------agtccct------tg-----------ctcttgtgtc-----------------------
B D                       Cow  -----------agtccct------tg-----------ctcttgtgtc-----------------------
B D                     Sheep  -----------agtccct------tg-----------ctcttgtgtc-----------------------
                Domestic goat  -----------agtccct------tg-----------ctcttgtgtc-----------------------
B D                     Horse  -----------agttcct------tg-----------ctcaggtctt-----------------------
B D          White rhinoceros  -----------agttgct------tg-----------ctcatgtctt-----------------------
B D                       Cat  -----------aact-ct------cg-----------ctcaagtctc-----------------------
B D                       Dog  -----------aact-ct------tg-----------ctcgtgcctc-----------------------
B D                   Ferret   -----------aact-ct------tt-----------ctcttgtccc-----------------------
B D                     Panda  -----------aact-ct------tg-----------ctcaagtctc-----------------------
               Pacific walrus  -----------agct-ct------tg-----------ctcgcgtctc-----------------------
                 Weddell seal  -----------agct-ct------tg-----------ctcgtgtctc-----------------------
             Black flying-fox  -----------agttccttgctcatg-----------ctcatgtctc-----------------------
B D                   Megabat  -----------aattccttgctcatg-----------ctcatgtctc-----------------------
                Big brown bat  -----------agtccct------tg-----------ttcatgtctt-----------------------
B D                  Microbat  -----------agtccct------tg-----------ttcatgtctt-----------------------
B D                     Shrew  -----------agacctt------tg-----------taacagatct-----------------------
              Star-nosed mole  -------------------------g-----------tgac---ttt-----------------------
B D                  Elephant  tggatctggctagttatt------ca-------------tatgtctt-----------------------
B D                   Manatee  tggatctggctagttatt------ga-------------tatgtcct-----------------------
B D                    Tenrec  tggatcccgccagttcct------gg-------------tatgtcag-----------------------
                     Aardvark  tggatctgtccaattctt------gt-------------tatgtctt-----------------------
B D                 Armadillo  tcagtctggacggttcta------gaaaggtccttggctcacgtctt-----------------------
B D                  Hedgehog  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                Coelacanth  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Lizard  ======================================================================
  D    White-throated sparrow  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
  D           Green seaturtle  ======================================================================
        David's myotis (bat)  ======================================================================
B D                 Orangutan  ======================================================================
            Cape golden mole  ======================================================================

                        Human  ------------------------------------------g-tct--------------------ccc
                        Chimp  ------------------------------------------g-tct--------------------ccc
                      Gorilla  ------------------------------------------g-tct--------------------ccc
                       Gibbon  ------------------------------------------g-tct--------------------ccc
                       Rhesus  ------------------------------------------g-tct--------------------ccc
          Crab-eating macaque  ------------------------------------------g-tct--------------------ccc
                       Baboon  ------------------------------------------g-tct--------------------ccc
                 Green monkey  ------------------------------------------g-tct--------------------tcc
                     Marmoset  ------------------------------------------g-tct--------------------ttt
              Squirrel monkey  ------------------------------------------a-tct--------------------ccc
                     Bushbaby  ------------------------------------------a-tct---------------------cc
           Chinese tree shrew  ttgggagaaagagagagagagagagctccaacaagcaacaggg-tcttcatgcagccatctatctagccc
                     Squirrel  ------------------------------------------a-cct--------------------tcc
       Lesser Egyptian jerboa  ------------------------------------------a-cct--------------------ccc
                 Prairie vole  ------------------------------------------aacct--------------------cct
              Chinese hamster  ------------------------------------------aacct--------------------cct
               Golden hamster  ------------------------------------------accct--------------------cct
                        Mouse  ------------------------------------------aacct--------------------ccc
                          Rat  ------------------------------------------aacct--------------------ccc
                       Rabbit  ------------------------------------------c-tct--------------------cgc
                         Pika  ------------------------------------------c--ct--------------------ccc
                          Pig  ------------------------------------------a-tct--------------------ccc
                       Alpaca  ------------------------------------------a-tct--------------------cct
               Bactrian camel  ------------------------------------------a-tct--------------------cct
                      Dolphin  ------------------------------------------a-tcg--------------------ctc
                 Killer whale  ------------------------------------------a-tcg--------------------ctc
             Tibetan antelope  ------------------------------------------a-tcg--------------------ccc
                          Cow  ------------------------------------------a-tca--------------------ccc
                        Sheep  ------------------------------------------a-tcg--------------------ccc
                Domestic goat  ------------------------------------------a-tcg--------------------ccc
                        Horse  ------------------------------------------g-tct--------------------tcc
             White rhinoceros  ------------------------------------------g-tct--------------------tcc
                          Cat  ------------------------------------------a-tct--------------------gcc
                          Dog  ------------------------------------------a-tct--------------------ctc
                      Ferret   ------------------------------------------a-tct--------------------ccc
                        Panda  ------------------------------------------a-tct--------------------tcc
               Pacific walrus  ------------------------------------------c-tct--------------------ccc
                 Weddell seal  ------------------------------------------a-tct--------------------ccc
             Black flying-fox  ------------------------------------------g-tct--------------------ccc
                      Megabat  ------------------------------------------g-tct--------------------ccc
                Big brown bat  ------------------------------------------a-tct--------------------cca
                     Microbat  ------------------------------------------a-tct--------------------cca
                        Shrew  ------------------------------------------t-act--------------------tcc
              Star-nosed mole  ------------------------------------------c-tct--------------------ctc
                     Elephant  ------------------------------------------a-tct--------------------ccc
                      Manatee  ------------------------------------------a-tct--------------------tcc
                       Tenrec  ------------------------------------------a-tcg--------------------ccc
                     Aardvark  ------------------------------------------a-cct--------------------tct
                    Armadillo  ------------------------------------------c-ttt--------------------ccc
                     Hedgehog  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                   Coelacanth  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
                 Mallard duck  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
               Painted turtle  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================
           American alligator  ======================================================================
           Tibetan ground jay  ======================================================================
                       Lizard  ======================================================================
       White-throated sparrow  ======================================================================
          Cape elephant shrew  ======================================================================
                     Platypus  ======================================================================
              Green seaturtle  ======================================================================
         David's myotis (bat)  ======================================================================
                    Orangutan  ======================================================================
             Cape golden mole  ======================================================================

                        Human  cat
                        Chimp  cat
                      Gorilla  cat
                       Gibbon  cat
                       Rhesus  cat
          Crab-eating macaque  cat
                       Baboon  cat
                 Green monkey  cag
                     Marmoset  cat
              Squirrel monkey  cat
                     Bushbaby  cgt
           Chinese tree shrew  cag
                     Squirrel  tat
       Lesser Egyptian jerboa  aat
                 Prairie vole  act
              Chinese hamster  gac
               Golden hamster  gac
                        Mouse  aag
                          Rat  aa-
                       Rabbit  cat
                         Pika  cat
                          Pig  cat
                       Alpaca  cg-
               Bactrian camel  cg-
                      Dolphin  cat
                 Killer whale  cat
             Tibetan antelope  cat
                          Cow  cat
                        Sheep  cat
                Domestic goat  cat
                        Horse  tgt
             White rhinoceros  tat
                          Cat  cat
                          Dog  cgc
                      Ferret   cac
                        Panda  cac
               Pacific walrus  cac
                 Weddell seal  cac
             Black flying-fox  tct
                      Megabat  tct
                Big brown bat  cgt
                     Microbat  cat
                        Shrew  tat
              Star-nosed mole  tgt
                     Elephant  cat
                      Manatee  cat
                       Tenrec  cat
                     Aardvark  caa
                    Armadillo  cag
                     Hedgehog  ===
             Peregrine falcon  ===
                 Saker falcon  ===
                   Coelacanth  ===
                   Budgerigar  ===
                  Rock pigeon  ===
                 Mallard duck  ===
     Chinese softshell turtle  ===
                      Chicken  ===
          Medium ground finch  ===
                       Turkey  ===
               Painted turtle  ===
                  Zebra finch  ===
          Collared flycatcher  ===
           American alligator  ===
           Tibetan ground jay  ===
                       Lizard  ===
       White-throated sparrow  ===
          Cape elephant shrew  ===
                     Platypus  ===
              Green seaturtle  ===
         David's myotis (bat)  ===
                    Orangutan  ===
             Cape golden mole  ===

Inserts between block 30 and 31 in window
B D                  Dolphin 2bp
                Killer whale 2bp

Alignment block 31 of 48 in window, 16085921 - 16085941, 21 bps 
B D                     Human  ttgatttggagg-gtcc----------------------tgggc
B D                     Chimp  ttgatttggagg-gtcc----------------------tgggc
B D                   Gorilla  ttgatttggagg-gtcc----------------------tgggc
B D                    Gibbon  ttgatttggagg-gtcc----------------------tgggc
B D                    Rhesus  ttgatttggagg-gtcc----------------------tggga
B D       Crab-eating macaque  ttgatttggagg-gtcc----------------------tggga
B D                    Baboon  ttgatttggagg-gtcc----------------------tggga
B D              Green monkey  ttgatttggagg-gtcc----------------------tggga
B D                  Marmoset  ttggtttggagg-ctcc----------------------tgggc
B D           Squirrel monkey  ttggtttggagg-ctcc----------------------tgggc
B D                  Bushbaby  tgggatgggagg-cacc----------------------tggcc
           Chinese tree shrew  tcagcccagatc-acac----------------------tgggc
B D                  Squirrel  ttggtttgtaga-cttc----------------------tgaga
       Lesser Egyptian jerboa  ctggtttggagg-ctcc----------------------tgggc
                 Prairie vole  ctggtgtggaag-ctcc----------------------tgggt
B D           Chinese hamster  atggtatggaag-cttt----------------------tgggc
               Golden hamster  atggtgtggaag-ctct----------------------tcggc
B D                     Mouse  gtggcatgatgg-tttc----------------------tgggc
B D                       Rat  -----------g-tttc----------------------tgggc
B D                    Rabbit  cgggttgggagg-ctct----------------------ttggc
B D                      Pika  ctagactggaag-ctct----------------------ttggc
B D                       Pig  ccaatttggaag-ctcc----------------------taacc
B D                    Alpaca  ---------------cc----------------------tagcc
               Bactrian camel  ---------------tc----------------------tagcc
             Tibetan antelope  caggtctggaag-cttc----------------------tggcc
B D                       Cow  caagtttggaag-cttc----------------------tggcc
B D                     Sheep  caagtttggaag-cttc----------------------tggcc
                Domestic goat  caagtttggaag-cttc----------------------tggcc
B D                     Horse  ctagtttggaag-ctca---------------------------
B D          White rhinoceros  caagtttggaag-ctct---------------------------
B D                       Cat  cgag------------c----------------------tggga
B D                       Dog  caagtttggaag-cttctgggcagtttcaagtttggaagtgggc
B D                   Ferret   cgagtttggaag-ctcc----------------------gggga
B D                     Panda  cgagtttggaag-ctcc----------------------cgggc
               Pacific walrus  cgagtttggaag-ctcc----------------------cgggc
                 Weddell seal  cgagtttggaag-ctcc----------------------tgggc
             Black flying-fox  ctagtttagaag-ctcc----------------------tgtgc
B D                   Megabat  ctagtttagaag-ctcc----------------------tgtgc
                Big brown bat  ctagttcggaa-------------------------------ga
B D                  Microbat  ctagttcggaa-------------------------------ga
B D                     Shrew  ctaccttggaag-tt-----------------------------
              Star-nosed mole  ctagtttgcgag-ttcc----------------------tt-cc
B D                  Elephant  ctgagttggaag-ctcc----------------------tgggc
B D                   Manatee  ctgggttggaag-ctcc----------------------tgggc
B D                    Tenrec  ctgaatgagaagacccc----------------------caggc
                     Aardvark  ctgggttggaaa-ctcc----------------------ttggc
B D                 Armadillo  ctgggttgggag-ctcc----------------------t-ggc
B D                  Hedgehog  ============================================
  D          Peregrine falcon  ============================================
  D              Saker falcon  ============================================
B D                Coelacanth  ============================================
B D                Budgerigar  ============================================
  D               Rock pigeon  ============================================
  D              Mallard duck  ============================================
  D  Chinese softshell turtle  ============================================
B D                   Chicken  ============================================
B D       Medium ground finch  ============================================
B D                    Turkey  ============================================
  D            Painted turtle  ============================================
B D               Zebra finch  ============================================
  D       Collared flycatcher  ============================================
B D        American alligator  ============================================
          Tibetan ground jay  ============================================
B D                    Lizard  ============================================
  D    White-throated sparrow  ============================================
         Cape elephant shrew  ============================================
B D                  Platypus  ============================================
  D           Green seaturtle  ============================================
        David's myotis (bat)  ============================================
                Killer whale  ============================================
B D                   Dolphin  ============================================
B D                 Orangutan  ============================================
            Cape golden mole  ============================================

Inserts between block 31 and 32 in window
          Chinese tree shrew 141bp
B D                 Squirrel 1bp

Alignment block 32 of 48 in window, 16085942 - 16085958, 17 bps 
B D                     Human  agggacc--actgg---gctgg----------------
B D                     Chimp  agggacc--actgg---gctgg----------------
B D                   Gorilla  agggacc--actgg---gctgg----------------
B D                    Gibbon  agggacc--actgg---gctgg----------------
B D                    Rhesus  agagacc--actgg---gctgg----------------
B D       Crab-eating macaque  agggacc--actgg---gctgg----------------
B D                    Baboon  agggacc--actgg---gctgg----------------
B D              Green monkey  agggacc--actgg---gctgg----------------
B D                  Marmoset  agggacc--actgg---gctga----------------
B D           Squirrel monkey  agggacc--actgg---gctga----------------
B D                  Bushbaby  agggccc--actgt---actgt----------------
           Chinese tree shrew  ggagacc--actgg---gctgg----------------
B D                  Squirrel  -gggacc--cctga---gctga----------------
       Lesser Egyptian jerboa  -aggacc--ctggg---gctgg----------------
                 Prairie vole  -agggtc--cttgg---gctgg----------------
B D           Chinese hamster  -aggtca--cctgg---gctgg----------------
               Golden hamster  -aggacc--cctgg---gctgg----------------
B D                     Mouse  -aggatc--cctgg---gccag----------------
B D                       Rat  -aggatc--tctgg---gccag----------------
B D                    Rabbit  -tgggcc--ccgg-------------------------
B D                      Pika  -tgtgatgacctg-------------------------
B D                       Pig  ggggacc--ac---------------------------
B D                    Alpaca  agggacc--cctgt---gt-------------------
               Bactrian camel  agggacc--cccgt---gt-------------------
             Tibetan antelope  agagatc--acggt---gccaa----------------
B D                       Cow  agagatc--acggt---gcaaa----------------
B D                     Sheep  agagatc--acggt---gcaaa----------------
                Domestic goat  agagatc--acggt---gcaaa----------------
B D                     Horse  ---gatg--gttgagggggc------------------
B D          White rhinoceros  ---gac----ttga---ggc------------------
B D                       Cat  agggatc--accgt---gttga----------------
B D                       Dog  agggacc--actgt---gctga----------------
B D                   Ferret   agggacc--accgt---ggtga----------------
B D                     Panda  agggacc--actgt---ggt------------------
               Pacific walrus  agggacc--gctgt---ggt------------------
                 Weddell seal  agggacc--actgt---ggt------------------
             Black flying-fox  aaggatc--atttt---gcaga----------------
B D                   Megabat  aaggatc--atttt---gcaga----------------
                Big brown bat  agggacc--actgt---gaaga----------------
B D                  Microbat  agggacc--actgt---gaaga----------------
B D                     Shrew  ------c--ccaag---gctgg----------------
              Star-nosed mole  aggggcc--cctgg---gctga----------------
B D                  Elephant  agggacc--actgt---gccaacctagagtcctgctgg
B D                   Manatee  agggacc--actgt---gccaacctagggccctgctga
B D                    Tenrec  agggacc--actgt---gccaagcgaaggctctgctgg
                     Aardvark  agggatc--actgt---gccaacctagagccctgctgg
B D                 Armadillo  agggtcc---ctgg---tcccatccggggccctga---
B D                  Hedgehog  ======================================
  D          Peregrine falcon  ======================================
  D              Saker falcon  ======================================
B D                Coelacanth  ======================================
B D                Budgerigar  ======================================
  D               Rock pigeon  ======================================
  D              Mallard duck  ======================================
  D  Chinese softshell turtle  ======================================
B D                   Chicken  ======================================
B D       Medium ground finch  ======================================
B D                    Turkey  ======================================
  D            Painted turtle  ======================================
B D               Zebra finch  ======================================
  D       Collared flycatcher  ======================================
B D        American alligator  ======================================
          Tibetan ground jay  ======================================
B D                    Lizard  ======================================
  D    White-throated sparrow  ======================================
         Cape elephant shrew  ======================================
B D                  Platypus  ======================================
  D           Green seaturtle  ======================================
        David's myotis (bat)  ======================================
                Killer whale  ======================================
B D                   Dolphin  ======================================
B D                 Orangutan  ======================================
            Cape golden mole  ======================================

Inserts between block 32 and 33 in window
B D                      Pig 19bp
B D                   Alpaca 19bp
              Bactrian camel 19bp
            Tibetan antelope 24bp
B D                      Cow 24bp
B D                    Sheep 24bp
               Domestic goat 24bp
B D                    Horse 8bp
B D         White rhinoceros 8bp
B D                      Cat 16bp
B D                      Dog 16bp
B D                  Ferret  16bp
B D                    Panda 1bp
              Pacific walrus 8bp
                Weddell seal 8bp
            Black flying-fox 15bp
B D                  Megabat 15bp
               Big brown bat 16bp
B D                 Microbat 16bp
B D                    Shrew 27bp
             Star-nosed mole 17bp

Alignment block 33 of 48 in window, 16085959 - 16085975, 17 bps 
B D                     Human  gct------ctagta----ggccccct
B D                     Chimp  gct------atagta----ggccccct
B D                   Gorilla  gct------atagta----ggccccct
B D                    Gibbon  gct------atagta----ggtcccct
B D                    Rhesus  gct------atagta----ggtcccct
B D       Crab-eating macaque  gct------atagca----ggtcccct
B D                    Baboon  gct------atagta----ggtcccct
B D              Green monkey  gct------atagta----ggtcccct
B D                  Marmoset  gct------acagta----ggtcccct
B D           Squirrel monkey  gct------acagta----agtcccct
B D                  Bushbaby  cct------atcata-----gtctcct
           Chinese tree shrew  act------atagta----ggtcttct
B D                  Squirrel  gct------gctgta----gaacattg
       Lesser Egyptian jerboa  tct------gcagta----ggtccttt
                 Prairie vole  act------caaaca----ggtctttg
B D           Chinese hamster  gct------aaaaca-----gtccata
               Golden hamster  gct------ggaaca-----gtccata
B D                     Mouse  gtt------aaagta----ggtccttt
B D                       Rat  gtt------aaagta----ggtctttt
B D                    Rabbit  -------------tt----ggccctct
B D                      Pika  -------------ct----gactcttg
B D                       Pig  gct------agaata----ggtcctcc
B D                    Alpaca  act------atagta----ggtcctct
               Bactrian camel  act------atagta----ggtcctct
             Tibetan antelope  gttacatcaatagta----ggtcctct
B D                       Cow  gttatatcaatagta----ggtcctct
B D                     Sheep  gttacatcaatagta----ggtcctct
                Domestic goat  gttacatcaatagta----ggtcctct
B D                     Horse  gct------accgta----ggtcctct
B D          White rhinoceros  gct------acagta----agtcctct
B D                       Cat  gcc------atgtta----ggtcccct
B D                       Dog  gct------atgtga----agtcccgc
B D                   Ferret   acc------aggtta----ggccccct
B D                     Panda  acc------atgtta----ggtcccct
               Pacific walrus  gcc------atgtga----ggtcccct
                 Weddell seal  gcc------ctgtta----ggtcccct
             Black flying-fox  act------ctagta----ggttctct
B D                   Megabat  act------ctagta----ggttctct
                Big brown bat  ggt------atagtg----ggttctct
B D                  Microbat  gct------atagcgcagcggttctca
B D                     Shrew  gct------tcagt-----ggcctgct
              Star-nosed mole  gac------ccggt-----ggccctct
B D                  Elephant  gct------atagta----ggttctct
B D                   Manatee  gct------atagca----ggttctct
B D                    Tenrec  gct------ttcata----ggttttct
                     Aardvark  acc------atagta----ggttttct
B D                  Hedgehog  ===========================
  D          Peregrine falcon  ===========================
  D              Saker falcon  ===========================
B D                Coelacanth  ===========================
B D                Budgerigar  ===========================
  D               Rock pigeon  ===========================
  D              Mallard duck  ===========================
  D  Chinese softshell turtle  ===========================
B D                   Chicken  ===========================
B D       Medium ground finch  ===========================
B D                    Turkey  ===========================
  D            Painted turtle  ===========================
B D               Zebra finch  ===========================
  D       Collared flycatcher  ===========================
B D        American alligator  ===========================
          Tibetan ground jay  ===========================
B D                    Lizard  ===========================
  D    White-throated sparrow  ===========================
         Cape elephant shrew  ===========================
B D                  Platypus  ===========================
  D           Green seaturtle  ===========================
        David's myotis (bat)  ===========================
B D                 Armadillo  ---------------------------
                Killer whale  ===========================
B D                   Dolphin  ===========================
B D                 Orangutan  ===========================
            Cape golden mole  ===========================

Inserts between block 33 and 34 in window
B D                 Microbat 157bp

Alignment block 34 of 48 in window, 16085976 - 16085976, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  t
B D                       Rat  c
B D                    Rabbit  g
B D                      Pika  c
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  a
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  t
             Black flying-fox  g
B D                   Megabat  g
B D                  Microbat  a
B D                     Shrew  a
              Star-nosed mole  g
B D                  Elephant  g
B D                   Manatee  g
B D                    Tenrec  g
                     Aardvark  g
B D                  Hedgehog  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                Coelacanth  =
B D                Budgerigar  =
  D               Rock pigeon  =
  D              Mallard duck  =
  D  Chinese softshell turtle  =
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Turkey  =
  D            Painted turtle  =
B D               Zebra finch  =
  D       Collared flycatcher  =
B D        American alligator  =
          Tibetan ground jay  =
B D                    Lizard  =
  D    White-throated sparrow  =
         Cape elephant shrew  =
B D                  Platypus  =
  D           Green seaturtle  =
        David's myotis (bat)  =
               Big brown bat  -
B D                 Armadillo  -
                Killer whale  =
B D                   Dolphin  =
B D                 Orangutan  =
            Cape golden mole  =

Alignment block 35 of 48 in window, 16085977 - 16085997, 21 bps 
B D                     Human  taaa-ga------c---ctgttga--g-ta----------------------------------------
B D                     Chimp  taaa-ga------c---ctgtcga--g-ta----------------------------------------
B D                   Gorilla  taaa-ga------c---ctgttga--g-ta----------------------------------------
B D                    Gibbon  taaa-ga------c---ctgttga--g-ta----------------------------------------
B D                    Rhesus  taaa-ga------c---ctgttga--g-ta----------------------------------------
B D       Crab-eating macaque  taaa-ga------c---ctgttga--g-ta----------------------------------------
B D                    Baboon  taaa-ga------c---ctgttga--g-ta----------------------------------------
B D              Green monkey  taaa-ga------c---ctgttga--g-ta----------------------------------------
B D                  Marmoset  caaa-ga------c---ctgttta--g-ta----------------------------------------
B D           Squirrel monkey  caaa-ga------c---ctgttga--g-ta----------------------------------------
B D                  Bushbaby  tgat-ga------c---ctgttga--t-ta----------------------------------------
           Chinese tree shrew  taaa-ga------t---gtgctga--t-ta----------------------------------------
B D                  Squirrel  taaa-ga------g---ctgttga--t-ta----------------------------------------
       Lesser Egyptian jerboa  ttatcaa------c---ctgttga--c-ta----------------------------------------
                 Prairie vole  taag-ac------c---ctattgg--c-ca----------------------------------------
B D           Chinese hamster  tgag-ta------c---ctattga--c-ca----------------------------------------
               Golden hamster  taag-aa------c---cttttga--c-ta----------------------------------------
B D                     Mouse  taag-aa------c---ctattga--c-ca----------------------------------------
B D                       Rat  taag-aa------t---ctattga--c-ca----------------------------------------
B D                    Rabbit  gaat-ga------c---ctcttga--cttc----------------------------------------
B D                      Pika  cagc-cc------c---agctgaa--tatc----------------------------------------
B D                       Pig  taaa-ga------c---ctattga--c-ta----------------------------------------
B D                    Alpaca  taaa-ga------a---ctgctga--g-tg----------------------------------------
               Bactrian camel  taaa-ga------a---ctgctga--g-tg----------------------------------------
             Tibetan antelope  tgaa-gg------acctctgttga--c-ta----------------------------------------
B D                       Cow  tgaa-gg------acctctgttga--c-ta----------------------------------------
B D                     Sheep  tgaa-gg------acctctgttga--c-ta----------------------------------------
                Domestic goat  tgaa-gg------acctctgttga--c-ta----------------------------------------
B D                     Horse  taaa-ga------c---ttgttgg--c-tt----------------------------------------
B D          White rhinoceros  tgaa-ga------c---cttttgg--c-ta----------------------------------------
B D                       Cat  tgaa-gc------c---ccatggg--c-ta----------------------------------------
B D                       Dog  cgaa-ac------c---ctgttgg--c-ta----------------------------------------
B D                   Ferret   tgaa-gc------c---ctgttgg--c-ta----------------------------------------
B D                     Panda  tgag-gc------c---ctgttgg--c-ta----------------------------------------
               Pacific walrus  cgaa-gc------c---ctgttgg--c-ta----------------------------------------
                 Weddell seal  cgaa-gc------c---ctattgg--c-ta----------------------------------------
             Black flying-fox  taaa-ga------c---ctggtga--t-ta----------------------------------------
B D                   Megabat  taaa-ga------c---ctggtga--t-ta----------------------------------------
                Big brown bat  ----------------------------------------------------------------------
B D                  Microbat  tgag-ga------a---ct-gtat--t-taaagggccagaaggttgaggaccactgctatagtgggttct
B D                     Shrew  taaa-at------c---ccgctga--t-ga----------------------------------------
              Star-nosed mole  gcag-ga------ctgactgctga--c-tg----------------------------------------
B D                  Elephant  taaa-gg------c---ctgttaa--c-tg----------------------------------------
B D                   Manatee  taaa-gg------c---ctgttaa--c-tg----------------------------------------
             Cape golden mole  taaa-ga------c---cttctga--c-tg----------------------------------------
B D                    Tenrec  tgaa-ga------c---ctgtcaa--c-tg----------------------------------------
                     Aardvark  taaa-ga------c---tttttga--c-tg----------------------------------------
B D                 Armadillo  taaa-gaccagatc---ctcttaaatc-tg----------------------------------------
B D                  Hedgehog  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                Coelacanth  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
  D            Painted turtle  ======================================================================