Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 57 in window, 67864541 - 67864545, 5 bps 
B D                     Human  ccctt
B D                     Chimp  ccctt
B D                   Gorilla  ccctt
B D                 Orangutan  ccctt
B D                    Gibbon  ccctt
B D                    Rhesus  ccctt
B D       Crab-eating macaque  ccctt
B D                    Baboon  ccctt
B D              Green monkey  ccctt
B D                  Marmoset  ccgtt
B D           Squirrel monkey  ccctt
B D                  Bushbaby  cccct
B D                       Pig  ctttt
B D                    Alpaca  ctttt
               Bactrian camel  ctttt
B D                   Dolphin  ctttt
                 Killer whale  ctttt
             Tibetan antelope  cttta
B D                       Cow  cttta
B D                     Sheep  cttta
                Domestic goat  cttta
B D                     Horse  ctttt
B D          White rhinoceros  ctttt
B D                       Cat  ctttt
B D                       Dog  ctttt
B D                   Ferret   ctttt
B D                     Panda  ctttt
               Pacific walrus  ctttt
                 Weddell seal  ctttt
             Black flying-fox  ctctt
B D                   Megabat  ctctt
B D                     Shrew  tctac
              Star-nosed mole  ttttt
B D                   Manatee  ctttc
             Cape golden mole  ctttt
                     Aardvark  ttttt
B D                 Armadillo  ctttt
B D                     Mouse  =====
B D                       Rat  =====
      Lesser Egyptian jerboa  =====
B D                    Tenrec  =====
         Cape elephant shrew  =====
B D                  Hedgehog  =====
                Prairie vole  =====
              Golden hamster  =====
B D           Chinese hamster  =====
B D                      Pika  =====
B D                    Rabbit  -----
        David's myotis (bat)  =====
B D                  Microbat  =====
               Big brown bat  =====
B D                  Elephant  =====
B D                Guinea pig  =====
            Brush-tailed rat  =====
B D            Naked mole-rat  =====
                  Chinchilla  =====
          Chinese tree shrew  =====
B D                  Squirrel  =====
B D                    Turkey  =====
B D                   Chicken  =====
B D                Budgerigar  =====
          Tibetan ground jay  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D               Rock pigeon  =====
B D       Medium ground finch  =====
B D                Coelacanth  =====
  D              Mallard duck  =====
  D                    Parrot  =====
  D    White-throated sparrow  =====
  D    Spiny softshell turtle  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D           Tasmanian devil  =====
B D                   Opossum  =====
B D                    Lizard  =====
B D                  Platypus  =====
B D        American alligator  =====
B D               Zebra finch  =====
  D       Collared flycatcher  =====

Inserts between block 1 and 2 in window
            Cape golden mole 5599bp

Alignment block 2 of 57 in window, 67864546 - 67864562, 17 bps 
B D                     Human  aatg--------------------ggactagtgcaac
B D                     Chimp  aatg--------------------ggactagtgcaac
B D                   Gorilla  aatg--------------------ggactagtacaac
B D                 Orangutan  aatg--------------------ggactagtacaac
B D                    Gibbon  aatg--------------------ggactagtacaac
B D                    Rhesus  aatg--------------------ggactagtacaac
B D       Crab-eating macaque  aatg--------------------ggactagtacaac
B D                    Baboon  aatg--------------------ggactagtacaac
B D              Green monkey  aatg--------------------ggactagtacaac
B D                  Marmoset  aatg--------------------ggactagtacagt
B D           Squirrel monkey  aatg--------------------gtaccagtacagt
B D                  Bushbaby  aatg--------------------ggacaagtatgac
B D                       Pig  aaca--------------------gggctagtacaga
B D                    Alpaca  aatg--------------------g-actagtacaaa
               Bactrian camel  aatg--------------------g-actagtacaaa
B D                   Dolphin  agtgggactagtacaaatgtactagtactagtacaaa
                 Killer whale  agtgggactagtacaaatgtactagtactagtacaaa
             Tibetan antelope  agtg--------------------gtactaatataaa
B D                       Cow  aatg--------------------ggactaatttaaa
B D                     Sheep  agtg--------------------gtactaatataaa
                Domestic goat  agtg--------------------gtactaatataaa
B D                     Horse  aatg--------------------ggactgttacaaa
B D          White rhinoceros  aatg--------------------ggactattacaaa
B D                       Cat  tagg--------------------ggactagtacaaa
B D                       Dog  tagg--------------------ggactggtacaaa
B D                   Ferret   taag--------------------ggactagtacaaa
B D                     Panda  tagg--------------------ggactcatacaaa
               Pacific walrus  tagg--------------------ggactagtacaaa
                 Weddell seal  tagg--------------------ggactagtacaaa
             Black flying-fox  aaga--------------------agactagtacaaa
B D                   Megabat  aaga--------------------agactagtac-aa
B D                     Shrew  aata--------------------ggaccaatacaga
              Star-nosed mole  aatg--------------------gtactaacacaga
B D                   Manatee  agtg--------------------gaactagtacaga
                     Aardvark  aatg--------------------ggactagaacaaa
B D                 Armadillo  aatg--------------------taactagtgaaat
B D                     Mouse  =====================================
B D                       Rat  =====================================
      Lesser Egyptian jerboa  =====================================
B D                    Tenrec  =====================================
         Cape elephant shrew  =====================================
B D                  Hedgehog  =====================================
                Prairie vole  =====================================
              Golden hamster  =====================================
B D           Chinese hamster  =====================================
B D                      Pika  =====================================
B D                    Rabbit  -------------------------------------
        David's myotis (bat)  =====================================
B D                  Microbat  =====================================
               Big brown bat  =====================================
B D                  Elephant  =====================================
B D                Guinea pig  =====================================
            Brush-tailed rat  =====================================
B D            Naked mole-rat  =====================================
                  Chinchilla  =====================================
          Chinese tree shrew  =====================================
B D                  Squirrel  =====================================
B D                    Turkey  =====================================
B D                   Chicken  =====================================
B D                Budgerigar  =====================================
          Tibetan ground jay  =====================================
  D          Peregrine falcon  =====================================
  D              Saker falcon  =====================================
  D               Rock pigeon  =====================================
B D       Medium ground finch  =====================================
B D                Coelacanth  =====================================
  D              Mallard duck  =====================================
  D                    Parrot  =====================================
  D    White-throated sparrow  =====================================
            Cape golden mole  =====================================
  D    Spiny softshell turtle  =====================================
  D  Chinese softshell turtle  =====================================
  D            Painted turtle  =====================================
  D           Green seaturtle  =====================================
B D           Tasmanian devil  =====================================
B D                   Opossum  =====================================
B D                    Lizard  =====================================
B D                  Platypus  =====================================
B D        American alligator  =====================================
B D               Zebra finch  =====================================
  D       Collared flycatcher  =====================================

Inserts between block 2 and 3 in window
B D                Armadillo 12047bp

Alignment block 3 of 57 in window, 67864563 - 67864605, 43 bps 
B D                     Human  attgttt---tgaaatgctaatttttaacaaatgctcaaccattta
B D                     Chimp  attgttt---tgaaatgctaatttttaacaaatgctcaaccattta
B D                   Gorilla  attgttt---ttaaatgctaatttttaacaaatgctcaaccattta
B D                 Orangutan  attgttt---tgaaatgctaatttttaacaaatgctcaaccattta
B D                    Gibbon  attgttt---tgaagtgctaatttttaacaaatgctcaaccattta
B D                    Rhesus  attgttt---tgaaatgctaatttgtaacaaatgctcaaccattta
B D       Crab-eating macaque  attgttt---tgaaatgctaatttgtaacaaatgctcaaccattta
B D                    Baboon  attgttt---tgaaatgctaatttgtaacaaatgctcaaccattta
B D              Green monkey  attgttt---tgaaatgctaatttgtaacaaatgctcaaccattta
B D                  Marmoset  attgttt---tgaaatgccaatttgtaacaaatgctcaaccattta
B D           Squirrel monkey  tttgttt---tgaaatgccaatttgtaacaaatgctcaaccatttg
B D                  Bushbaby  attgttt---tgaaaggccaatttttaacaaatgccaaaccattta
B D                       Pig  attgttt---tgaaagaccaatttataacaaatgctaaacccatta
B D                    Alpaca  tttgttt---tgaaaggccaattcataacaaatgccaaaccaagtg
               Bactrian camel  tttgtct---tgaaaggccaattcataacaaatgccaaaccaagtg
B D                   Dolphin  attgttt---tgaaaggccaatttataaaaaatgctaaaccaatta
                 Killer whale  attgttt---tgaaaggccaatttataacaaatgctaaaccaatta
             Tibetan antelope  att-ctt---tgaaaggccaattcataacaaatgctaaaccaatta
B D                       Cow  attgttt---tgaaaggccaattcataacaaatgttaaaccaatta
B D                     Sheep  att-ttt---tgaaaggccaattcataacaaatgctaaaccaatta
                Domestic goat  attgttt---tgaaaggccaattcataacaaatgctaaaacaatta
B D                     Horse  attattc---tgaaaggccaattcataacaaatgctaaaccaatta
B D          White rhinoceros  attattc---tgaaagcccaattcataccaaatgctaaaccagtta
B D                       Cat  attgttc---taaaaggctaattcatgaggaatgctaaaccaaata
B D                       Dog  attgttcttttaaaaggccaattcataag-aatgctaaaccaatta
B D                   Ferret   attattc---taaaaggccaacatataagaaatgctaaaccaatta
B D                     Panda  attgttc---taaaaggccaattcataagaaatgctaaaccagtta
               Pacific walrus  attgttc---taaaaggccaattcataagaaatgctaatccaatta
                 Weddell seal  attgttc---taaaaag-caattcataagaaatgctaatccaatta
             Black flying-fox  attgttc---tgaaaggccaattcatagcaaatgctaaaccaatta
B D                   Megabat  attgttc---tg-aaggccaattcatagcaaatgctaaaccaatta
B D                     Shrew  attgttc---taaaaatct-atttatagtaaa---taaaccaatta
              Star-nosed mole  attgttt---tgaaaagccaatttgtatcaaaggctaacagaatta
B D                   Manatee  attgttt---tgagaggcc-acttgtaacaaaggctaaaacaatta
                     Aardvark  actgttt---tgagaggcc-actcatataaaaaactaaaccaatta
B D                 Armadillo  attgttt---tgagtggcc-aatttgtacaaaagctaaaccaatta
B D                     Mouse  ==============================================
B D                       Rat  ==============================================
      Lesser Egyptian jerboa  ==============================================
B D                    Tenrec  ==============================================
         Cape elephant shrew  ==============================================
B D                  Hedgehog  ==============================================
                Prairie vole  ==============================================
              Golden hamster  ==============================================
B D           Chinese hamster  ==============================================
B D                      Pika  ==============================================
B D                    Rabbit  ----------------------------------------------
        David's myotis (bat)  ==============================================
B D                  Microbat  ==============================================
               Big brown bat  ==============================================
B D                  Elephant  ==============================================
B D                Guinea pig  ==============================================
            Brush-tailed rat  ==============================================
B D            Naked mole-rat  ==============================================
                  Chinchilla  ==============================================
          Chinese tree shrew  ==============================================
B D                  Squirrel  ==============================================
B D                    Turkey  ==============================================
B D                   Chicken  ==============================================
B D                Budgerigar  ==============================================
          Tibetan ground jay  ==============================================
  D          Peregrine falcon  ==============================================
  D              Saker falcon  ==============================================
  D               Rock pigeon  ==============================================
B D       Medium ground finch  ==============================================
B D                Coelacanth  ==============================================
  D              Mallard duck  ==============================================
  D                    Parrot  ==============================================
  D    White-throated sparrow  ==============================================
            Cape golden mole  ==============================================
  D    Spiny softshell turtle  ==============================================
  D  Chinese softshell turtle  ==============================================
  D            Painted turtle  ==============================================
  D           Green seaturtle  ==============================================
B D           Tasmanian devil  ==============================================
B D                   Opossum  ==============================================
B D                    Lizard  ==============================================
B D                  Platypus  ==============================================
B D        American alligator  ==============================================
B D               Zebra finch  ==============================================
  D       Collared flycatcher  ==============================================

Inserts between block 3 and 4 in window
B D                  Manatee 300bp

Alignment block 4 of 57 in window, 67864606 - 67864613, 8 bps 
B D                     Human  ttaaagac
B D                     Chimp  ttaaagac
B D                   Gorilla  ttaaagac
B D                 Orangutan  ttaaagac
B D                    Gibbon  ttaaagac
B D                    Rhesus  ttaaagac
B D       Crab-eating macaque  ttaaagac
B D                    Baboon  ttaaagac
B D              Green monkey  ttaaagac
B D                  Marmoset  ttaaagac
B D           Squirrel monkey  ttaaagac
B D                  Bushbaby  ttaaagac
B D                       Pig  ttaaagc-
B D                    Alpaca  ttaaacca
               Bactrian camel  ttaaacca
B D                   Dolphin  ttaaagcc
                 Killer whale  ttaaagcc
             Tibetan antelope  ttaaagcc
B D                       Cow  ttaaagcc
B D                     Sheep  ttaaagcc
                Domestic goat  ttaaagcc
B D                     Horse  ataaa---
B D          White rhinoceros  ttaaa---
B D                       Cat  ttaaagcc
B D                       Dog  atagagcc
B D                   Ferret   -------c
B D                     Panda  ttaaagcc
               Pacific walrus  ttaaagcc
                 Weddell seal  ttaaagcc
             Black flying-fox  ttaaagcc
B D                   Megabat  tt-aagcc
B D                     Shrew  ttaaaa--
              Star-nosed mole  ttaaag--
                     Aardvark  ttaaagac
B D                 Armadillo  ttaaagac
B D                     Mouse  ========
B D                       Rat  ========
      Lesser Egyptian jerboa  ========
B D                    Tenrec  ========
         Cape elephant shrew  ========
B D                  Hedgehog  ========
                Prairie vole  ========
              Golden hamster  ========
B D           Chinese hamster  ========
B D                      Pika  ========
B D                    Rabbit  --------
        David's myotis (bat)  ========
B D                   Manatee  ========
B D                  Microbat  ========
               Big brown bat  ========
B D                  Elephant  ========
B D                Guinea pig  ========
            Brush-tailed rat  ========
B D            Naked mole-rat  ========
                  Chinchilla  ========
          Chinese tree shrew  ========
B D                  Squirrel  ========
B D                    Turkey  ========
B D                   Chicken  ========
B D                Budgerigar  ========
          Tibetan ground jay  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D               Rock pigeon  ========
B D       Medium ground finch  ========
B D                Coelacanth  ========
  D              Mallard duck  ========
  D                    Parrot  ========
  D    White-throated sparrow  ========
            Cape golden mole  ========
  D    Spiny softshell turtle  ========
  D  Chinese softshell turtle  ========
  D            Painted turtle  ========
  D           Green seaturtle  ========
B D           Tasmanian devil  ========
B D                   Opossum  ========
B D                    Lizard  ========
B D                  Platypus  ========
B D        American alligator  ========
B D               Zebra finch  ========
  D       Collared flycatcher  ========

Alignment block 5 of 57 in window, 67864614 - 67864617, 4 bps 
B D                     Human  tctt
B D                     Chimp  tctt
B D                   Gorilla  tctt
B D                 Orangutan  tctt
B D                    Gibbon  tctt
B D                    Rhesus  tctt
B D       Crab-eating macaque  tctt
B D                    Baboon  tctt
B D              Green monkey  tctt
B D                  Marmoset  tctt
B D           Squirrel monkey  tctt
B D                  Bushbaby  cttt
B D                       Pig  tctt
B D                    Alpaca  tctt
               Bactrian camel  tctt
B D                   Dolphin  tctt
                 Killer whale  tctt
             Tibetan antelope  tctt
B D                       Cow  tctt
B D                     Sheep  tctg
                Domestic goat  tctt
B D                     Horse  tcct
B D          White rhinoceros  tcct
B D                       Cat  tctt
B D                       Dog  tctt
B D                   Ferret   tctt
B D                     Panda  tctt
               Pacific walrus  tctt
                 Weddell seal  tctt
             Black flying-fox  tctt
B D                   Megabat  tctt
B D                  Hedgehog  tcta
B D                     Shrew  --ac
              Star-nosed mole  tctc
                     Aardvark  tctt
B D                 Armadillo  tctt
B D                     Mouse  ====
B D                       Rat  ====
      Lesser Egyptian jerboa  ====
B D                    Tenrec  ====
         Cape elephant shrew  ====
                Prairie vole  ====
              Golden hamster  ====
B D           Chinese hamster  ====
B D                      Pika  ====
B D                    Rabbit  ----
        David's myotis (bat)  ====
B D                   Manatee  ====
B D                  Microbat  ====
               Big brown bat  ====
B D                  Elephant  ====
B D                Guinea pig  ====
            Brush-tailed rat  ====
B D            Naked mole-rat  ====
                  Chinchilla  ====
          Chinese tree shrew  ====
B D                  Squirrel  ====
B D                    Turkey  ====
B D                   Chicken  ====
B D                Budgerigar  ====
          Tibetan ground jay  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D               Rock pigeon  ====
B D       Medium ground finch  ====
B D                Coelacanth  ====
  D              Mallard duck  ====
  D                    Parrot  ====
  D    White-throated sparrow  ====
            Cape golden mole  ====
  D    Spiny softshell turtle  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D           Tasmanian devil  ====
B D                   Opossum  ====
B D                    Lizard  ====
B D                  Platypus  ====
B D        American alligator  ====
B D               Zebra finch  ====
  D       Collared flycatcher  ====

Inserts between block 5 and 6 in window
                    Aardvark 1bp

Alignment block 6 of 57 in window, 67864618 - 67864626, 9 bps 
B D                     Human  aaata-tttt
B D                     Chimp  aaata-tttt
B D                   Gorilla  aaata-tttt
B D                 Orangutan  aaata-tttt
B D                    Gibbon  aaatattttt
B D                    Rhesus  aaatattttt
B D       Crab-eating macaque  aaatattttt
B D                    Baboon  aaatattttt
B D              Green monkey  aaatattttt
B D                  Marmoset  aaatattttc
B D           Squirrel monkey  aaatattttc
B D                  Bushbaby  aaata-----
B D                       Pig  aaatatttt-
B D                    Alpaca  aaatatttt-
               Bactrian camel  aaatatttt-
B D                   Dolphin  aaatatttt-
                 Killer whale  aaatatttt-
             Tibetan antelope  aaatatttt-
B D                       Cow  aaatatttt-
B D                     Sheep  aaatatttt-
                Domestic goat  aaatatttt-
B D                     Horse  aaatatttt-
B D          White rhinoceros  aaatatttt-
B D                       Cat  aaatatttt-
B D                       Dog  aaatgtttt-
B D                   Ferret   aaatatttt-
B D                     Panda  aaatatttt-
               Pacific walrus  aagtatttt-
                 Weddell seal  aaatatttt-
             Black flying-fox  aaatatttt-
B D                   Megabat  aaatatttt-
B D                  Hedgehog  aaatatttt-
B D                     Shrew  aaat-attt-
              Star-nosed mole  aaataattt-
B D                   Manatee  aaatatttt-
                     Aardvark  agtaatttc-
B D                 Armadillo  acatatttt-
B D                     Mouse  ==========
B D                       Rat  ==========
      Lesser Egyptian jerboa  ==========
B D                    Tenrec  ==========
         Cape elephant shrew  ==========
                Prairie vole  ==========
              Golden hamster  ==========
B D           Chinese hamster  ==========
B D                      Pika  ==========
B D                    Rabbit  ----------
        David's myotis (bat)  ==========
B D                  Microbat  ==========
               Big brown bat  ==========
B D                  Elephant  ==========
B D                Guinea pig  ==========
            Brush-tailed rat  ==========
B D            Naked mole-rat  ==========
                  Chinchilla  ==========
          Chinese tree shrew  ==========
B D                  Squirrel  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
B D                Budgerigar  ==========
          Tibetan ground jay  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
  D               Rock pigeon  ==========
B D       Medium ground finch  ==========
B D                Coelacanth  ==========
  D              Mallard duck  ==========
  D                    Parrot  ==========
  D    White-throated sparrow  ==========
            Cape golden mole  ==========
  D    Spiny softshell turtle  ==========
  D  Chinese softshell turtle  ==========
  D            Painted turtle  ==========
  D           Green seaturtle  ==========
B D           Tasmanian devil  ==========
B D                   Opossum  ==========
B D                    Lizard  ==========
B D                  Platypus  ==========
B D        American alligator  ==========
B D               Zebra finch  ==========
  D       Collared flycatcher  ==========

Inserts between block 6 and 7 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                 Hedgehog 1bp
B D                    Shrew 1bp
             Star-nosed mole 1bp

Alignment block 7 of 57 in window, 67864627 - 67864630, 4 bps 
B D                     Human  -aagg
B D                     Chimp  -aagg
B D                   Gorilla  -aagg
B D                 Orangutan  -aagg
B D                    Gibbon  -aagg
B D                    Rhesus  -aagg
B D       Crab-eating macaque  -aagg
B D                    Baboon  -aagg
B D              Green monkey  -aagg
B D                  Marmoset  -aaag
B D           Squirrel monkey  -aaag
B D                  Bushbaby  --agg
B D                       Pig  -aaga
B D                    Alpaca  -agga
               Bactrian camel  -agaa
B D                   Dolphin  -aaga
                 Killer whale  -aaga
             Tibetan antelope  --aga
B D                       Cow  --aga
B D                     Sheep  --aga
                Domestic goat  --aga
B D                     Horse  -aaga
B D          White rhinoceros  -aaga
B D                       Cat  -aatt
B D                       Dog  -aagt
B D                   Ferret   -aagt
B D                     Panda  -aagt
               Pacific walrus  -aagt
                 Weddell seal  -aagt
             Black flying-fox  -aaga
B D                  Hedgehog  -aaga
B D                     Shrew  -aaga
              Star-nosed mole  -aaaa
B D                   Manatee  aaagg
                     Aardvark  agagt
B D                 Armadillo  a-agg
B D                     Mouse  =====
B D                       Rat  =====
      Lesser Egyptian jerboa  =====
B D                    Tenrec  =====
         Cape elephant shrew  =====
                Prairie vole  =====
              Golden hamster  =====
B D           Chinese hamster  =====
B D                      Pika  =====
B D                    Rabbit  -----
        David's myotis (bat)  =====
B D                  Microbat  =====
               Big brown bat  =====
B D                  Elephant  =====
B D                Guinea pig  =====
            Brush-tailed rat  =====
B D            Naked mole-rat  =====
                  Chinchilla  =====
          Chinese tree shrew  =====
B D                  Squirrel  =====
B D                    Turkey  =====
B D                   Chicken  =====
B D                Budgerigar  =====
          Tibetan ground jay  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D               Rock pigeon  =====
B D       Medium ground finch  =====
B D                Coelacanth  =====
  D              Mallard duck  =====
  D                    Parrot  =====
  D    White-throated sparrow  =====
            Cape golden mole  =====
B D                   Megabat  NNNNN
  D    Spiny softshell turtle  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D           Tasmanian devil  =====
B D                   Opossum  =====
B D                    Lizard  =====
B D                  Platypus  =====
B D        American alligator  =====
B D               Zebra finch  =====
  D       Collared flycatcher  =====

Inserts between block 7 and 8 in window
B D                    Shrew 119bp
             Star-nosed mole 3bp

Alignment block 8 of 57 in window, 67864631 - 67864666, 36 bps 
B D                     Human  tcctattat--aaata-tcttcatgaggaaaaggtatag
B D                     Chimp  tcttattat--aaata-tcttcatgaggaaaaggtatag
B D                   Gorilla  tcctattat--aaata-tcttcatgaggaaaaggtatag
B D                 Orangutan  tcctattat--aaata-tcttcatgaggaaaaggtatag
B D                    Gibbon  tcctattat--aaata-tcttca-gaggaaaacgtatag
B D                    Rhesus  tcctagtat--aagta-tctttatgaggaaaaggtgtag
B D       Crab-eating macaque  tcctagtat--aagta-tctttatgaggaaaaggtgtag
B D                    Baboon  tcctagtat--aagta-tctttatgaggaaaagatgtag
B D              Green monkey  tcctagtat--aag-a-tctttatgaggaaaaggtgtag
B D                  Marmoset  tcctattat--aaata-tcttcatgaggaaaag-tatag
B D           Squirrel monkey  tcctatcat--aaata-tcgttgtgaggaaaagttacag
B D                  Bushbaby  ttctactgt--aaatg-tctcaatgaggaaaaggtatag
B D            Naked mole-rat  tcccattgtg-aaaaa-tgttcattggtattatttttgc
B D                    Rabbit  ttctattgtg-aaacattgcttattagtatgatatttac
B D                       Pig  tctttctat--aaata-tcttaatgaggaaaaggtatag
B D                    Alpaca  tctttctat--aaatg-tcttaatgaggagagggtatag
               Bactrian camel  tctttctat--aaatg-tcttaatgaggagagggtatag
B D                   Dolphin  tctttctat--aaatg-tcttaatgaggaaaaggtatag
                 Killer whale  tctttctat--aaatg-tcttaatgaggaaaaggtatag
             Tibetan antelope  gttttctat--aaatg-ttttattga-gaaaaaatatag
B D                       Cow  gctttctat--aaatg-tcttattga-gaaaaaatatag
B D                     Sheep  gctttctat--aaatg-ttttattga-gaaaaaatatag
                Domestic goat  gctttctat--aaatg-ttttattga-gaaaaaatatag
B D                     Horse  tccttttat--aagtg-tctt-atgaggaaaaggtatag
B D          White rhinoceros  tccttctat--aaatg-tcttaatgaggaaaaggtatag
B D                       Cat  tccttccat--aaatg-tcttaatgaggaaaagatatag
B D                       Dog  tccttctat--a---------aatgaggaaaagatatag
B D                   Ferret   tccttttat--aaatg-tcttaatgagaaaaagatacat
B D                     Panda  tccttctat--aaatg-tcttaatgaggaaaagatctgg
               Pacific walrus  tccttttat--aaatg-tcttaatgaggaaaagatacag
                 Weddell seal  tccttctct--aaatg-tcttaatgaggaaaagatatag
             Black flying-fox  tccttctat--aaatg-tcttaatgaggaaaaggtatag
B D                  Hedgehog  tcatatcata-agttg-tgttgataaagaaaaggtgtag
B D                     Shrew  tcctgctat--aaacg-ttttaataagaagaaggtatag
              Star-nosed mole  tactgttatacagatg-ccttaataaggaaaaggtatct
B D                   Manatee  tactactat--aaatg-tcttaatgaggaaaaggtataa
                     Aardvark  tacttgtgt--aaata-tcttaatgaggaaaaggtacaa
B D                 Armadillo  tcctattat--aaata-tcttaatgaggaaaagatatag
B D                     Mouse  =======================================
B D                       Rat  =======================================
      Lesser Egyptian jerboa  =======================================
B D                    Tenrec  =======================================
         Cape elephant shrew  =======================================
                Prairie vole  =======================================
              Golden hamster  =======================================
B D           Chinese hamster  =======================================
B D                      Pika  =======================================
        David's myotis (bat)  =======================================
B D                  Microbat  =======================================
               Big brown bat  =======================================
B D                  Elephant  =======================================
B D                Guinea pig  =======================================
            Brush-tailed rat  =======================================
                  Chinchilla  =======================================
          Chinese tree shrew  =======================================
B D                  Squirrel  =======================================
B D                    Turkey  =======================================
B D                   Chicken  =======================================
B D                Budgerigar  =======================================
          Tibetan ground jay  =======================================
  D          Peregrine falcon  =======================================
  D              Saker falcon  =======================================
  D               Rock pigeon  =======================================
B D       Medium ground finch  =======================================
B D                Coelacanth  =======================================
  D              Mallard duck  =======================================
  D                    Parrot  =======================================
  D    White-throated sparrow  =======================================
            Cape golden mole  =======================================
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D    Spiny softshell turtle  =======================================
  D  Chinese softshell turtle  =======================================
  D            Painted turtle  =======================================
  D           Green seaturtle  =======================================
B D           Tasmanian devil  =======================================
B D                   Opossum  =======================================
B D                    Lizard  =======================================
B D                  Platypus  =======================================
B D        American alligator  =======================================
B D               Zebra finch  =======================================
  D       Collared flycatcher  =======================================

Alignment block 9 of 57 in window, 67864667 - 67864679, 13 bps 
B D                     Human  aatg-ccaagt---tat
B D                     Chimp  aatg-ccaagt---tat
B D                   Gorilla  aatg-ccaagt---tat
B D                 Orangutan  aatg-ccaagt---tat
B D                    Gibbon  aatg-ccaagt---tgt
B D                    Rhesus  aatg-ccaagt---tat
B D       Crab-eating macaque  aatg-ccaagt---tat
B D                    Baboon  aatg-ccaagt---tat
B D              Green monkey  aatg-ccaagt---tat
B D                  Marmoset  aata-ccaagt---tat
B D           Squirrel monkey  aaca-ccaagt---tat
B D                  Bushbaby  aact-ccaagt---tgt
       Lesser Egyptian jerboa  aatg-ccagtg------
B D            Naked mole-rat  aatg-ccattg-tcaat
B D                    Rabbit  aatg-tcatttaacaat
B D                       Pig  -gcc-tcaagg---tgt
B D                    Alpaca  aact-gtaagt---tgt
               Bactrian camel  aact-gtaagt---tgt
B D                   Dolphin  aact-ccaagt---tgt
                 Killer whale  aact-ccaagt---tgt
             Tibetan antelope  aact-tcaagt---tgt
B D                       Cow  aact-tcaagt---tgt
B D                     Sheep  aact-tcaagt---tgt
                Domestic goat  aact-tcaagt---tgt
B D                     Horse  aactcccaagt---tgt
B D          White rhinoceros  aact-ccaagt---tgt
B D                       Cat  aact-cttggt---tct
B D                       Dog  aact-cccagt---tct
B D                   Ferret   aact-cccagt---tct
B D                     Panda  aact-cccagt---tct
               Pacific walrus  aact-cccagt---tct
                 Weddell seal  aact-cccagt---tct
             Black flying-fox  aact-ccaagt---tgt
B D                  Hedgehog  agct-tcaagt---tgg
B D                     Shrew  aact-ccaagt---tgt
              Star-nosed mole  aaca-ctaaat---tgt
B D                   Manatee  aact-ttaagg---tgt
                     Aardvark  aact-t--------tgt
B D                 Armadillo  aaat-------------
B D                     Mouse  =================
B D                       Rat  =================
B D                    Tenrec  =================
         Cape elephant shrew  =================
                Prairie vole  =================
              Golden hamster  =================
B D           Chinese hamster  =================
B D                      Pika  =================
        David's myotis (bat)  =================
B D                  Microbat  =================
               Big brown bat  =================
B D                  Elephant  =================
B D                Guinea pig  =================
            Brush-tailed rat  =================
                  Chinchilla  =================
          Chinese tree shrew  =================
B D                  Squirrel  =================
B D                    Turkey  =================
B D                   Chicken  =================
B D                Budgerigar  =================
          Tibetan ground jay  =================
  D          Peregrine falcon  =================
  D              Saker falcon  =================
  D               Rock pigeon  =================
B D       Medium ground finch  =================
B D                Coelacanth  =================
  D              Mallard duck  =================
  D                    Parrot  =================
  D    White-throated sparrow  =================
            Cape golden mole  =================
B D                   Megabat  NNNNNNNNNNNNNNNNN
  D    Spiny softshell turtle  =================
  D  Chinese softshell turtle  =================
  D            Painted turtle  =================
  D           Green seaturtle  =================
B D           Tasmanian devil  =================
B D                   Opossum  =================
B D                    Lizard  =================
B D                  Platypus  =================
B D        American alligator  =================
B D               Zebra finch  =================
  D       Collared flycatcher  =================

Inserts between block 9 and 10 in window
B D                  Ferret  214bp

Alignment block 10 of 57 in window, 67864680 - 67864685, 6 bps 
B D                     Human  gatggt
B D                     Chimp  gatggt
B D                   Gorilla  gatggt
B D                 Orangutan  gatggt
B D                    Gibbon  catggt
B D                    Rhesus  gatggt
B D       Crab-eating macaque  gatggt
B D                    Baboon  gatggt
B D              Green monkey  gatggt
B D                  Marmoset  gatggt
B D           Squirrel monkey  gatggt
B D                  Bushbaby  ggacgt
       Lesser Egyptian jerboa  ----at
B D            Naked mole-rat  gtgaat
B D                    Rabbit  gcagat
B D                       Pig  aa----
B D                    Alpaca  aa----
               Bactrian camel  aa----
B D                   Dolphin  ga----
                 Killer whale  ga----
             Tibetan antelope  ga----
B D                       Cow  ga----
B D                     Sheep  ga----
                Domestic goat  ga----
B D                     Horse  ga----
B D          White rhinoceros  ga----
B D                       Cat  ga----
B D                       Dog  ga----
B D                   Ferret   aa----
B D                     Panda  ga----
               Pacific walrus  ga----
                 Weddell seal  ga----
             Black flying-fox  ga----
B D                  Hedgehog  ga----
B D                     Shrew  ga----
              Star-nosed mole  ga----
B D                   Manatee  --gagt
                     Aardvark  --gagt
B D                     Mouse  ======
B D                       Rat  ======
B D                    Tenrec  ======
         Cape elephant shrew  ======
                Prairie vole  ======
              Golden hamster  ======
B D           Chinese hamster  ======
B D                      Pika  ======
        David's myotis (bat)  ======
B D                  Microbat  ======
               Big brown bat  ======
B D                 Armadillo  ------
B D                  Elephant  ======
B D                Guinea pig  ======
            Brush-tailed rat  ======
                  Chinchilla  ======
          Chinese tree shrew  ======
B D                  Squirrel  ======
B D                    Turkey  ======
B D                   Chicken  ======
B D                Budgerigar  ======
          Tibetan ground jay  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D               Rock pigeon  ======
B D       Medium ground finch  ======
B D                Coelacanth  ======
  D              Mallard duck  ======
  D                    Parrot  ======
  D    White-throated sparrow  ======
            Cape golden mole  ======
B D                   Megabat  NNNNNN
  D    Spiny softshell turtle  ======
  D  Chinese softshell turtle  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D           Tasmanian devil  ======
B D                   Opossum  ======
B D                    Lizard  ======
B D                  Platypus  ======
B D        American alligator  ======
B D               Zebra finch  ======
  D       Collared flycatcher  ======

Inserts between block 10 and 11 in window
      Lesser Egyptian jerboa 4bp
B D           Naked mole-rat 6bp
B D                   Rabbit 6bp

Alignment block 11 of 57 in window, 67864686 - 67864686, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  g
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
B D            Naked mole-rat  a
B D                Guinea pig  a
B D                    Rabbit  g
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                  Hedgehog  a
B D                     Shrew  c
              Star-nosed mole  a
B D                   Manatee  g
                     Aardvark  g
B D                     Mouse  =
B D                       Rat  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
         Cape elephant shrew  =
                Prairie vole  =
              Golden hamster  =
B D           Chinese hamster  =
B D                      Pika  =
        David's myotis (bat)  =
B D                  Microbat  =
               Big brown bat  =
B D                 Armadillo  -
B D                  Elephant  =
            Brush-tailed rat  =
                  Chinchilla  =
          Chinese tree shrew  =
B D                  Squirrel  =
B D                    Turkey  =
B D                   Chicken  =
B D                Budgerigar  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  =
B D                Coelacanth  =
  D              Mallard duck  =
  D                    Parrot  =
  D    White-throated sparrow  =
            Cape golden mole  =
B D                   Megabat  N
  D    Spiny softshell turtle  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D           Tasmanian devil  =
B D                   Opossum  =
B D                    Lizard  =
B D                  Platypus  =
B D        American alligator  =
B D               Zebra finch  =
  D       Collared flycatcher  =

Alignment block 12 of 57 in window, 67864687 - 67864688, 2 bps 
B D                     Human  ta
B D                     Chimp  ta
B D                   Gorilla  ta
B D                 Orangutan  ta
B D                    Gibbon  ta
B D                    Rhesus  ta
B D       Crab-eating macaque  ta
B D                    Baboon  ta
B D              Green monkey  ta
B D                  Marmoset  ta
B D           Squirrel monkey  ta
B D                  Bushbaby  ta
       Lesser Egyptian jerboa  tg
B D           Chinese hamster  tg
               Golden hamster  tg
B D            Naked mole-rat  tg
B D                Guinea pig  ta
B D                    Rabbit  ta
B D                       Pig  cg
B D                    Alpaca  tg
               Bactrian camel  tg
B D                   Dolphin  tt
                 Killer whale  tt
             Tibetan antelope  ta
B D                       Cow  tg
B D                     Sheep  ta
                Domestic goat  ta
B D                     Horse  tg
B D          White rhinoceros  tg
B D                       Cat  tg
B D                       Dog  tg
B D                   Ferret   tg
B D                     Panda  tg
               Pacific walrus  tg
                 Weddell seal  tg
             Black flying-fox  tg
B D                  Hedgehog  tg
B D                     Shrew  tg
              Star-nosed mole  tg
B D                   Manatee  ta
                     Aardvark  tg
B D                     Mouse  ==
B D                       Rat  ==
B D                    Tenrec  ==
         Cape elephant shrew  ==
                Prairie vole  ==
B D                      Pika  ==
        David's myotis (bat)  ==
B D                  Microbat  ==
               Big brown bat  ==
B D                 Armadillo  --
B D                  Elephant  ==
            Brush-tailed rat  ==
                  Chinchilla  ==
          Chinese tree shrew  ==
B D                  Squirrel  ==
B D                    Turkey  ==
B D                   Chicken  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
B D                Coelacanth  ==
  D              Mallard duck  ==
  D                    Parrot  ==
  D    White-throated sparrow  ==
            Cape golden mole  ==
B D                   Megabat  NN
  D    Spiny softshell turtle  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
B D                    Lizard  ==
B D                  Platypus  ==
B D        American alligator  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==

Inserts between block 12 and 13 in window
      Lesser Egyptian jerboa 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                 Hedgehog 1bp
B D                    Shrew 1bp
             Star-nosed mole 1bp

Alignment block 13 of 57 in window, 67864689 - 67864689, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  t
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
B D                    Rabbit  a
B D                   Manatee  a
                     Aardvark  a
B D                     Mouse  =
B D                       Rat  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
                Prairie vole  =
              Golden hamster  =
B D           Chinese hamster  =
             Star-nosed mole  =
B D                      Pika  =
B D                       Dog  =
B D                     Panda  =
B D                   Ferret   =
        David's myotis (bat)  =
B D                  Microbat  =
               Big brown bat  =
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
                Killer whale  =
B D                 Armadillo  -
B D                    Alpaca  =
              Bactrian camel  =
            Black flying-fox  =
B D                       Cat  =
B D                  Elephant  =
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
          Chinese tree shrew  =
              Pacific walrus  =
B D          White rhinoceros  =
B D                     Horse  =
B D                  Squirrel  =
B D                       Pig  =
                Weddell seal  =
B D                   Dolphin  =
B D                    Turkey  =
B D                   Chicken  =
B D                Budgerigar  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  =
B D                Coelacanth  =
  D              Mallard duck  =
  D                    Parrot  =
  D    White-throated sparrow  =
            Cape golden mole  =
B D                   Megabat  N
  D    Spiny softshell turtle  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D           Tasmanian devil  =
B D                   Opossum  =
B D                    Lizard  =
B D                  Platypus  =
B D        American alligator  =
B D               Zebra finch  =
  D       Collared flycatcher  =

Alignment block 14 of 57 in window, 67864690 - 67864701, 12 bps 
B D                     Human  at-gagtgaatgt
B D                     Chimp  at-gagtgaatgt
B D                   Gorilla  at-gagtgaatgt
B D                 Orangutan  at-gagtgaatgt
B D                    Gibbon  at-gagtgaatgt
B D                    Rhesus  at-aagtgaatgt
B D       Crab-eating macaque  at-aagtgaatgt
B D                    Baboon  at-aagtgaatgt
B D              Green monkey  at-aagtgaatgt
B D                  Marmoset  at-gagtgcatgt
B D           Squirrel monkey  at-gagtgaatgt
B D                  Bushbaby  gt-gaatgaatct
       Lesser Egyptian jerboa  at-gagtgactcc
B D           Chinese hamster  gc-gggtgcatct
               Golden hamster  gt-gggtgcatct
B D                     Mouse  gt-gactgacact
B D                       Rat  at-gggtgactct
B D            Naked mole-rat  at-cgatgaaact
B D                Guinea pig  at-tgatgaaact
B D                    Rabbit  at-taatgaatcc
B D                       Pig  at-aaatgaatgc
B D                    Alpaca  at-aaatgaatcc
               Bactrian camel  at-aaatgaatcc
B D                   Dolphin  at-aaatgaatcc
                 Killer whale  at-aaatgaatcc
             Tibetan antelope  at-caatgaatcc
B D                       Cow  at-caatgaatcc
B D                     Sheep  at-caatgaatcc
                Domestic goat  at-caatgaatcc
B D                     Horse  at-aaatgaatcc
B D          White rhinoceros  at-aaatgaatcc
B D                       Cat  at-aaatgtaccc
B D                       Dog  at-aaatgcaccc
B D                   Ferret   gt-atatgcaccc
B D                     Panda  at-aaatgcaccc
               Pacific walrus  at-aaatgccccc
                 Weddell seal  at-aaattcaccc
             Black flying-fox  ataaaataaatcc
B D                  Hedgehog  at-aaataaatcc
B D                     Shrew  at-aagtgaatcc
              Star-nosed mole  -t-aaatgaatcc
B D                   Manatee  ---aaatgaattc
                     Aardvark  ---aaatgaattc
B D                 Armadillo  ----accaaattc
B D                    Tenrec  =============
         Cape elephant shrew  =============
                Prairie vole  =============
B D                      Pika  =============
        David's myotis (bat)  =============
B D                  Microbat  =============
               Big brown bat  =============
B D                  Elephant  =============
            Brush-tailed rat  =============
                  Chinchilla  =============
          Chinese tree shrew  =============
B D                  Squirrel  =============
B D                    Turkey  =============
B D                   Chicken  =============
B D                Budgerigar  =============
          Tibetan ground jay  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
  D               Rock pigeon  =============
B D       Medium ground finch  =============
B D                Coelacanth  =============
  D              Mallard duck  =============
  D                    Parrot  =============
  D    White-throated sparrow  =============
            Cape golden mole  =============
B D                   Megabat  NNNNNNNNNNNNN
  D    Spiny softshell turtle  =============
  D  Chinese softshell turtle  =============
  D            Painted turtle  =============
  D           Green seaturtle  =============
B D           Tasmanian devil  =============
B D                   Opossum  =============
B D                    Lizard  =============
B D                  Platypus  =============
B D        American alligator  =============
B D               Zebra finch  =============
  D       Collared flycatcher  =============

Alignment block 15 of 57 in window, 67864702 - 67864706, 5 bps 
B D                     Human  ttcag
B D                     Chimp  ttcag
B D                   Gorilla  ttcag
B D                 Orangutan  ttcag
B D                    Gibbon  ttcat
B D                    Rhesus  ttcag
B D       Crab-eating macaque  ttcag
B D                    Baboon  ttcag
B D              Green monkey  ttcag
B D                  Marmoset  ttcag
B D           Squirrel monkey  ttcag
B D                  Bushbaby  tccag
       Lesser Egyptian jerboa  tgtag
                 Prairie vole  tctat
B D           Chinese hamster  tctag
               Golden hamster  tctag
B D                     Mouse  tctag
B D                       Rat  tccag
B D            Naked mole-rat  tctag
B D                Guinea pig  tccag
B D                    Rabbit  tccag
B D                       Pig  tccag
B D                    Alpaca  tccag
               Bactrian camel  tccag
B D                   Dolphin  tcaag
                 Killer whale  tcaag
             Tibetan antelope  tcaag
B D                       Cow  tcaag
B D                     Sheep  tcaag
                Domestic goat  tcaag
B D                     Horse  tccag
B D          White rhinoceros  tccag
B D                       Cat  tccag
B D                       Dog  tccag
B D                   Ferret   tctag
B D                     Panda  tccag
               Pacific walrus  tccag
                 Weddell seal  tccag
             Black flying-fox  tccag
B D                  Hedgehog  tctgt
B D                     Shrew  tttat
              Star-nosed mole  cttca
B D                   Manatee  tccag
                     Aardvark  tccag
B D                 Armadillo  t--ag
B D                    Tenrec  =====
         Cape elephant shrew  =====
B D                      Pika  =====
        David's myotis (bat)  =====
B D                  Microbat  =====
               Big brown bat  =====
B D                  Elephant  =====
            Brush-tailed rat  =====
                  Chinchilla  =====
          Chinese tree shrew  =====
B D                  Squirrel  =====
B D                    Turkey  =====
B D                   Chicken  =====
B D                Budgerigar  =====
          Tibetan ground jay  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D               Rock pigeon  =====
B D       Medium ground finch  =====
B D                Coelacanth  =====
  D              Mallard duck  =====
  D                    Parrot  =====
  D    White-throated sparrow  =====
            Cape golden mole  =====
B D                   Megabat  NNNNN
  D    Spiny softshell turtle  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D           Tasmanian devil  =====
B D                   Opossum  =====
B D                    Lizard  =====
B D                  Platypus  =====
B D        American alligator  =====
B D               Zebra finch  =====
  D       Collared flycatcher  =====

Alignment block 16 of 57 in window, 67864707 - 67864714, 8 bps 
B D                     Human  cctttctc
B D                     Chimp  cctttctc
B D                   Gorilla  cctttctc
B D                 Orangutan  cctttctc
B D                    Gibbon  cctttctc
B D                    Rhesus  cctttctc
B D       Crab-eating macaque  cctttctc
B D                    Baboon  cctttctc
B D              Green monkey  cctttctc
B D                  Marmoset  cctttctc
B D           Squirrel monkey  cctttctc
B D                  Bushbaby  cctttgtc
B D                  Squirrel  cctttctc
       Lesser Egyptian jerboa  ccctcctc
                 Prairie vole  cctttctc
B D           Chinese hamster  tctttctt
               Golden hamster  tctttctt
B D                     Mouse  cctttctc
B D                       Rat  tctttctc
B D            Naked mole-rat  catatttc
B D                Guinea pig  cctg-ttc
B D                    Rabbit  atgttttt
B D                       Pig  cccttctc
B D                    Alpaca  cctttctc
               Bactrian camel  cctttctc
B D                   Dolphin  gctttctc
                 Killer whale  gctttctc
             Tibetan antelope  cctttctc
B D                       Cow  cctttctc
B D                     Sheep  cctttctc
                Domestic goat  cctttctc
B D                     Horse  cttttctc
B D          White rhinoceros  cctttctc
B D                       Cat  catctctc
B D                       Dog  cctctctc
B D                   Ferret   cctctctt
B D                     Panda  cctctctc
               Pacific walrus  cctctctc
                 Weddell seal  cctctctc
             Black flying-fox  cctttctc
B D                  Hedgehog  ctttctt-
B D                     Shrew  ccctcttc
              Star-nosed mole  gctttctc
B D                   Manatee  tctttttc
                     Aardvark  ccgttttc
B D                 Armadillo  cctttttc
B D                    Tenrec  ========
         Cape elephant shrew  ========
B D                      Pika  ========
        David's myotis (bat)  ========
B D                  Microbat  ========
               Big brown bat  ========
B D                  Elephant  ========
            Brush-tailed rat  ========
                  Chinchilla  ========
          Chinese tree shrew  ========
B D                    Turkey  ========
B D                   Chicken  ========
B D                Budgerigar  ========
          Tibetan ground jay  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D               Rock pigeon  ========
B D       Medium ground finch  ========
B D                Coelacanth  ========
  D              Mallard duck  ========
  D                    Parrot  ========
  D    White-throated sparrow  ========
            Cape golden mole  ========
B D                   Megabat  NNNNNNNN
  D    Spiny softshell turtle  ========
  D  Chinese softshell turtle  ========
  D            Painted turtle  ========
  D           Green seaturtle  ========
B D           Tasmanian devil  ========
B D                   Opossum  ========
B D                    Lizard  ========
B D                  Platypus  ========
B D        American alligator  ========
B D               Zebra finch  ========
  D       Collared flycatcher  ========

Inserts between block 16 and 17 in window
B D                    Sheep 484bp

Alignment block 17 of 57 in window, 67864715 - 67864733, 19 bps 
B D                     Human  aactagaagtttctcatct
B D                     Chimp  aactaaaagtttctcatct
B D                   Gorilla  aactaaaaggttctcatct
B D                 Orangutan  aactgaaagtttctcatct
B D                    Gibbon  aactaaaagtttctcatct
B D                    Rhesus  aactaaaagtttctcatct
B D       Crab-eating macaque  aactaaaagtttctcatct
B D                    Baboon  aactaaaagtttctcatct
B D              Green monkey  aactaaaagtttctcatct
B D                  Marmoset  aactaaaagtttctcatct
B D           Squirrel monkey  aactaaaagttttccatct
B D                  Bushbaby  aacc-aaagtttctcatct
B D                  Squirrel  a-ttaaaa-ttttttatct
       Lesser Egyptian jerboa  atttgcaa-cttc---tgt
                 Prairie vole  aattttaa-cttcacgtct
B D           Chinese hamster  aattataa-cttcatacct
               Golden hamster  aattataa-cttcacatct
B D                     Mouse  aattataa-tttcacattt
B D                       Rat  aattatat-cttcacatct
B D            Naked mole-rat  aattaaaa-tttctcatct
B D                Guinea pig  agttaaaa-tttctcctct
B D                    Rabbit  gatcaaag-tttctcatct
B D                       Pig  aaccaaag-ttttttatct
B D                    Alpaca  aatcaaaa-tttttcatct
               Bactrian camel  aatcaaaa-tttttcatct
B D                   Dolphin  aacc--ag-tttttcatct
                 Killer whale  aacc--ag-tttttcatct
             Tibetan antelope  aaccaaag-tttttcatct
B D                       Cow  aaccaaag-tttttcatct
                Domestic goat  aaccaaag-tttttcatct
B D                     Horse  agccaaag-tttttcatgt
B D          White rhinoceros  aaccaaag-tttttcatct
B D                       Cat  aaccaaag-tttttcatct
B D                       Dog  aaccaaag-cttttcatct
B D                   Ferret   aaccaaag-cttttcattt
B D                     Panda  aaccaaag-cttttcattt
               Pacific walrus  aaccaaag-cttttcattt
                 Weddell seal  aaccaaag-cttttcattt
             Black flying-fox  aactaaag--ttttcatct
B D                  Hedgehog  -actgaat-ttttcccc-t
B D                     Shrew  aacctaat-tatttcatct
              Star-nosed mole  aactaaag-ttttttat-t
B D                   Manatee  aac-agag-tttcttattg
                     Aardvark  aac---ag-tttctcattt
B D                 Armadillo  aaccagca-ttcct-----
B D                    Tenrec  ===================
         Cape elephant shrew  ===================
B D                      Pika  ===================
        David's myotis (bat)  ===================
B D                  Microbat  ===================
               Big brown bat  ===================
B D                     Sheep  ===================
B D                  Elephant  ===================
            Brush-tailed rat  ===================
                  Chinchilla  ===================
          Chinese tree shrew  ===================
B D                    Turkey  ===================
B D                   Chicken  ===================
B D                Budgerigar  ===================
          Tibetan ground jay  ===================
  D          Peregrine falcon  ===================
  D              Saker falcon  ===================
  D               Rock pigeon  ===================
B D       Medium ground finch  ===================
B D                Coelacanth  ===================
  D              Mallard duck  ===================
  D                    Parrot  ===================
  D    White-throated sparrow  ===================
            Cape golden mole  ===================
B D                   Megabat  NNNNNNNNNNNNNNNNNNN
  D    Spiny softshell turtle  ===================
  D  Chinese softshell turtle  ===================
  D            Painted turtle  ===================
  D           Green seaturtle  ===================
B D           Tasmanian devil  ===================
B D                   Opossum  ===================
B D                    Lizard  ===================
B D                  Platypus  ===================
B D        American alligator  ===================
B D               Zebra finch  ===================
  D       Collared flycatcher  ===================

Alignment block 18 of 57 in window, 67864734 - 67864740, 7 bps 
B D                     Human  gaac--tac
B D                     Chimp  gaac--tac
B D                   Gorilla  gaac--tac
B D                 Orangutan  gaac--tac
B D                    Gibbon  gaac--tac
B D                    Rhesus  gaac--tac
B D       Crab-eating macaque  gaac--tac
B D                    Baboon  gaac--tac
B D              Green monkey  gaac--tac
B D                  Marmoset  gaac--tac
B D           Squirrel monkey  gaac--tac
B D                  Bushbaby  gaac--tac
B D                  Squirrel  gaac--tac
       Lesser Egyptian jerboa  gagt--aac
                 Prairie vole  g-gg--aac
B D           Chinese hamster  g-gt--aac
               Golden hamster  g-gt--aac
B D                     Mouse  g-gc--aac
B D                       Rat  g-gt--aac
B D            Naked mole-rat  gaac--tac
B D                Guinea pig  g-ac--tat
B D                    Rabbit  gaac--tat
B D                       Pig  gaac--tac
B D                    Alpaca  gaac--tac
               Bactrian camel  gaac--tac
B D                   Dolphin  gaac--tac
                 Killer whale  gaac--tac
             Tibetan antelope  gaactttgc
B D                       Cow  gaattttgc
                Domestic goat  gaactttgc
B D                     Horse  gaac--tac
B D          White rhinoceros  gaac--tac
B D                       Cat  gagt--tac
B D                       Dog  gaac--tgc
B D                   Ferret   gagc--tac
B D                     Panda  gaac--tac
               Pacific walrus  gaac--tac
                 Weddell seal  gaac--tac
             Black flying-fox  gaac--tac
B D                  Hedgehog  gaat--tat
B D                     Shrew  gaac--tac
              Star-nosed mole  aaac--tat
B D                   Manatee  gaac--tgt
                     Aardvark  gaac--tac
B D                 Armadillo  gaac--tat
           Tibetan ground jay  gaaa--taa
B D                    Tenrec  =========
         Cape elephant shrew  =========
B D                      Pika  =========
        David's myotis (bat)  =========
B D                  Microbat  =========
               Big brown bat  =========
B D                     Sheep  =========
B D                  Elephant  =========
            Brush-tailed rat  =========
                  Chinchilla  =========
          Chinese tree shrew  =========
B D                    Turkey  =========
B D                   Chicken  =========
B D                Budgerigar  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
  D               Rock pigeon  =========
B D       Medium ground finch  =========
B D                Coelacanth  =========
  D              Mallard duck  =========
  D                    Parrot  =========
  D    White-throated sparrow  =========
            Cape golden mole  =========
B D                   Megabat  NNNNNNNNN
  D    Spiny softshell turtle  =========
  D  Chinese softshell turtle  =========
  D            Painted turtle  =========
  D           Green seaturtle  =========
B D           Tasmanian devil  =========
B D                   Opossum  =========
B D                    Lizard  =========
B D                  Platypus  =========
B D        American alligator  =========
B D               Zebra finch  =========
  D       Collared flycatcher  =========

Inserts between block 18 and 19 in window
B D                    Shrew 1bp
             Star-nosed mole 413bp

Alignment block 19 of 57 in window, 67864741 - 67864744, 4 bps 
B D                     Human  aaaa
B D                     Chimp  aaaa
B D                   Gorilla  aaaa
B D                 Orangutan  aaaa
B D                    Gibbon  aaga
B D                    Rhesus  aaat
B D       Crab-eating macaque  aaat
B D                    Baboon  aaat
B D              Green monkey  aaat
B D                  Marmoset  aaaa
B D           Squirrel monkey  aaaa
B D                  Bushbaby  aaaa
B D                  Squirrel  aaaa
       Lesser Egyptian jerboa  ctga
                 Prairie vole  agag
B D           Chinese hamster  aaac
               Golden hamster  aaac
B D                     Mouse  aaag
B D                       Rat  aaag
B D            Naked mole-rat  aatt
B D                Guinea pig  agta
B D                    Rabbit  gaaa
B D                       Pig  agaa
B D                    Alpaca  agaa
               Bactrian camel  agaa
B D                   Dolphin  agaa
                 Killer whale  agaa
             Tibetan antelope  acaa
B D                       Cow  acaa
                Domestic goat  acaa
B D                     Horse  agaa
B D          White rhinoceros  agaa
B D                       Cat  agaa
B D                       Dog  agaa
B D                   Ferret   agaa
B D                     Panda  agaa
               Pacific walrus  agag
                 Weddell seal  agaa
             Black flying-fox  agaa
B D                  Hedgehog  ataa
B D                   Manatee  agaa
                     Aardvark  agaa
B D                 Armadillo  agaa
           Tibetan ground jay  agta
B D                    Tenrec  ====
         Cape elephant shrew  ====
B D                     Shrew  ====
             Star-nosed mole  ====
B D                      Pika  ====
        David's myotis (bat)  ====
B D                  Microbat  ====
               Big brown bat  ====
B D                     Sheep  ====
B D                  Elephant  ====
            Brush-tailed rat  ====
                  Chinchilla  ====
          Chinese tree shrew  ====
B D                    Turkey  ====
B D                   Chicken  ====
B D                Budgerigar  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D               Rock pigeon  ====
B D       Medium ground finch  ====
B D                Coelacanth  ====
  D              Mallard duck  ====
  D                    Parrot  ====
  D    White-throated sparrow  ====
            Cape golden mole  ====
B D                   Megabat  NNNN
  D    Spiny softshell turtle  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D           Tasmanian devil  ====
B D                   Opossum  ====
B D                    Lizard  ====
B D                  Platypus  ====
B D        American alligator  ====
B D               Zebra finch  ====
  D       Collared flycatcher  ====

Alignment block 20 of 57 in window, 67864745 - 67864751, 7 bps 
B D                     Human  tacagtg
B D                     Chimp  tacagtg
B D                   Gorilla  tacagtg
B D                 Orangutan  tacagtg
B D                    Gibbon  tacagtg
B D                    Rhesus  tacagtg
B D       Crab-eating macaque  tacagtg
B D                    Baboon  tacagtg
B D              Green monkey  tacagtg
B D                  Marmoset  tacagtg
B D           Squirrel monkey  tacagtg
B D                  Bushbaby  tacacag
           Chinese tree shrew  tacagaa
B D                  Squirrel  cacagag
       Lesser Egyptian jerboa  cacagag
                 Prairie vole  cacagac
B D           Chinese hamster  cacagaa
               Golden hamster  agcagaa
B D                     Mouse  cacagaa
B D                       Rat  gacagaa
B D            Naked mole-rat  cacagag
B D                Guinea pig  cacagag
B D                    Rabbit  caaagag
B D                       Pig  cagagag
B D                    Alpaca  cacagag
               Bactrian camel  cacagag
B D                   Dolphin  cacagag
                 Killer whale  cacagag
             Tibetan antelope  cacgg-g
B D                       Cow  cacag-g
                Domestic goat  cacag-g
B D                     Horse  cacagag
B D          White rhinoceros  cacagag
B D                       Cat  cacagaa
B D                       Dog  cacaaag
B D                   Ferret   cacagag
B D                     Panda  cacagag
               Pacific walrus  cacagag
                 Weddell seal  cacagag
             Black flying-fox  tacagag
B D                  Hedgehog  aaatg--
B D                   Manatee  --taaaa
                     Aardvark  --taaaa
B D                 Armadillo  --cagaa
           Tibetan ground jay  taaggat
B D                    Tenrec  =======
         Cape elephant shrew  =======
B D                     Shrew  =======
             Star-nosed mole  =======
B D                      Pika  =======
        David's myotis (bat)  =======
B D                  Microbat  =======
               Big brown bat  =======
B D                     Sheep  =======
B D                  Elephant  =======
            Brush-tailed rat  =======
                  Chinchilla  =======
B D                    Turkey  =======
B D                   Chicken  =======
B D                Budgerigar  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
B D       Medium ground finch  =======
B D                Coelacanth  =======
  D              Mallard duck  =======
  D                    Parrot  =======
  D    White-throated sparrow  =======
            Cape golden mole  =======
B D                   Megabat  NNNNNNN
  D    Spiny softshell turtle  =======
  D  Chinese softshell turtle  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D           Tasmanian devil  =======
B D                   Opossum  =======
B D                    Lizard  =======
B D                  Platypus  =======
B D        American alligator  =======
B D               Zebra finch  =======
  D       Collared flycatcher  =======

Alignment block 21 of 57 in window, 67864752 - 67864752, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
B D                    Rabbit  g
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  g
B D                   Megabat  g
B D                  Hedgehog  g
B D                   Manatee  g
                     Aardvark  g
B D                 Armadillo  g
           Tibetan ground jay  a
B D                    Tenrec  =
         Cape elephant shrew  =
B D                     Shrew  =
             Star-nosed mole  =
B D                      Pika  =
        David's myotis (bat)  =
B D                  Microbat  =
               Big brown bat  =
B D                     Sheep  =
B D                  Elephant  =
            Brush-tailed rat  =
                  Chinchilla  =
B D                    Turkey  =
B D                   Chicken  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  =
B D                Coelacanth  =
  D              Mallard duck  =
  D                    Parrot  =
  D    White-throated sparrow  =
            Cape golden mole  =
  D    Spiny softshell turtle  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D           Tasmanian devil  =
B D                   Opossum  =
B D                    Lizard  =
B D                  Platypus  =
B D        American alligator  =
B D               Zebra finch  =
  D       Collared flycatcher  =

Inserts between block 21 and 22 in window
B D                 Hedgehog 9bp

Alignment block 22 of 57 in window, 67864753 - 67864772, 20 bps 
B D                     Human  atgatt---tg-agtgac----t--a-tttt
B D                     Chimp  atgatt---tg-agtgac----t--a-tttt
B D                   Gorilla  atgatt---tg-agtgac----t--a-tttt
B D                 Orangutan  atgatt---tg-agtgac----t--a-tttt
B D                    Gibbon  atgctt---tg-agtggc----t--a-tttt
B D                    Rhesus  atgatt---tg-agtgac----t--a-tttt
B D       Crab-eating macaque  atgatt---tg-agtgac----t--a-tttt
B D                    Baboon  atgatt---tg-agtgac----t--a-tttt
B D              Green monkey  atgatt---tc-agtgac----t--a-tttt
B D                  Marmoset  atgatt---tg-agtgag----t--a-tttt
B D           Squirrel monkey  atgatt---cg-agtgac----t--g-tttt
B D                  Bushbaby  atgatt---tg-agaaac----t--a-tttc
           Chinese tree shrew  agaact---tg-agtgac----t--a-tttt
B D                  Squirrel  atgatt---tg-agtgac----c--a-tttt
       Lesser Egyptian jerboa  ctgatt--------tgag----g--------
                 Prairie vole  gtaactaactg-agtaag----c--a-ttct
B D           Chinese hamster  ataat---------ggag----c--a-tttt
               Golden hamster  ataat---------tgag----c--a-tttt
B D                     Mouse  gagattgactg-agtgac----cata-tttt
B D                       Rat  gtgactgactg-agtgac----c-----ttt
B D            Naked mole-rat  aggatt---tg-agtggc----t--a-tatt
B D                Guinea pig  aggatt---tg-agtgac----t--g-tatt
B D                    Rabbit  atgatt---tg-agtgaa----g--g-tttt
B D                       Pig  ctgatt---tg-ggtgac----t--g-tttt
B D                    Alpaca  gtgatt---tg-agggac----t--g-ttct
               Bactrian camel  gtgatt---tg-agggac----t--g-ttct
B D                   Dolphin  atggtc---tg-ggtgac----t--a-tttt
                 Killer whale  atggtc---tg-ggtgac----t--a-tttt
             Tibetan antelope  atgatt---tc-ggtgac----t--g-tttt
B D                       Cow  atgatt---tt-ggtgac----t--g-tttt
                Domestic goat  atgatt---tc-ggtgac----t--g-tttt
B D                     Horse  atgatt---tg-agtgac----t--attttt
B D          White rhinoceros  atgatt---tg-agtgac----t--a-tttt
B D                       Cat  atgatt---tgaagtgac----t--g-tttt
B D                       Dog  atggtt---tg-agtgac----c--a-tttt
B D                   Ferret   atgatt---ta-aatgac----t--a-tttt
B D                     Panda  gtgatt---ag-agtgac----t--a-tttt
               Pacific walrus  atgatt---tg-agtcac----t--a-ttct
                 Weddell seal  atgatt---tg-agtgac----t--a-ttct
             Black flying-fox  atgatt---tg-aatgac----t--a-tttt
B D                   Megabat  atga-t---tg-aatgac----t--a-tttt
B D                  Hedgehog  atgatt---tg-agtgacttttt--t-tttt
B D                     Shrew  --gatt---tg-agt------------tttt
              Star-nosed mole  acgatt---tg-agtgac----t--g-tttt
B D                   Manatee  ataatt---tg----gac----t--a-tttt
                     Aardvark  atgatt---tg-agtgac----t--g-tttt
B D                 Armadillo  atgatt---tg-agaaac----t--a-tt--
           Tibetan ground jay  atgctc---tg-tctgaa----a--a-gctt
B D                    Tenrec  ===============================
         Cape elephant shrew  ===============================
B D                      Pika  ===============================
        David's myotis (bat)  ===============================
B D                  Microbat  ===============================
               Big brown bat  ===============================
B D                     Sheep  ===============================
B D                  Elephant  ===============================
            Brush-tailed rat  ===============================
                  Chinchilla  ===============================
B D                    Turkey  ===============================
B D                   Chicken  ===============================
B D                Budgerigar  ===============================
  D          Peregrine falcon  ===============================
  D              Saker falcon  ===============================
  D               Rock pigeon  ===============================
B D       Medium ground finch  ===============================
B D                Coelacanth  ===============================
  D              Mallard duck  ===============================
  D                    Parrot  ===============================
  D    White-throated sparrow  ===============================
            Cape golden mole  ===============================
  D    Spiny softshell turtle  ===============================
  D  Chinese softshell turtle  ===============================
  D            Painted turtle  ===============================
  D           Green seaturtle  ===============================
B D           Tasmanian devil  ===============================
B D                   Opossum  ===============================
B D                    Lizard  ===============================
B D                  Platypus  ===============================
B D        American alligator  ===============================
B D               Zebra finch  ===============================
  D       Collared flycatcher  ===============================

Alignment block 23 of 57 in window, 67864773 - 67864774, 2 bps 
B D                     Human  ct
B D                     Chimp  ct
B D                   Gorilla  ct
B D                 Orangutan  ct
B D                    Gibbon  ct
B D                    Rhesus  ct
B D       Crab-eating macaque  ct
B D                    Baboon  ct
B D              Green monkey  ct
B D                  Marmoset  ct
B D           Squirrel monkey  ct
B D                  Bushbaby  at
           Chinese tree shrew  ct
B D                  Squirrel  ca
                 Prairie vole  cg
B D           Chinese hamster  cg
               Golden hamster  ca
B D                     Mouse  ca
B D                       Rat  ca
B D            Naked mole-rat  ct
B D                Guinea pig  tt
B D                    Rabbit  ct
B D                       Pig  tt
B D                   Dolphin  ct
                 Killer whale  ct
             Tibetan antelope  ct
B D                       Cow  ct
                Domestic goat  ct
B D                     Horse  tt
B D          White rhinoceros  ct
B D                       Cat  ct
B D                       Dog  ct
B D                   Ferret   ct
B D                     Panda  ct
               Pacific walrus  ct
                 Weddell seal  ct
             Black flying-fox  ct
B D                   Megabat  ct
B D                  Hedgehog  tc
B D                     Shrew  ct
              Star-nosed mole  ct
B D                   Manatee  cc
                     Aardvark  ct
B D           Tasmanian devil  ca
           Tibetan ground jay  tt
      Lesser Egyptian jerboa  --
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                      Pika  ==
        David's myotis (bat)  ==
B D                  Microbat  ==
               Big brown bat  ==
B D                     Sheep  ==
B D                 Armadillo  --
B D                    Alpaca  --
              Bactrian camel  --
B D                  Elephant  ==
            Brush-tailed rat  ==
                  Chinchilla  ==
B D                    Turkey  ==
B D                   Chicken  ==
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
B D                Coelacanth  ==
  D              Mallard duck  ==
  D                    Parrot  ==
  D    White-throated sparrow  ==
            Cape golden mole  ==
  D    Spiny softshell turtle  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                   Opossum  ==
B D                    Lizard  ==
B D                  Platypus  ==
B D        American alligator  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==

Inserts between block 23 and 24 in window
            Tibetan antelope 419bp

Alignment block 24 of 57 in window, 67864775 - 67864791, 17 bps 
B D                     Human  ca--attcctccaaggatg
B D                     Chimp  ca--attcctccaaggatg
B D                   Gorilla  ca--attcctccaaggatg
B D                 Orangutan  ca--attcctccaaagatg
B D                    Gibbon  ca--attcctccaaggata
B D                    Rhesus  ca--gttcctccaaggata
B D       Crab-eating macaque  ca--gttcctccaaggata
B D                    Baboon  ca--gttcctccaaggata
B D              Green monkey  ca--gttcctccaagtata
B D                  Marmoset  ca--atttttccaaggttg
B D           Squirrel monkey  ca--atttttctaaggata
B D                  Bushbaby  ca--gttcctctgaggcta
           Chinese tree shrew  ca--gttttcccatggatg
B D                  Squirrel  ca--gttcttccaaggatg
       Lesser Egyptian jerboa  ----tc-ctcccaaggata
                 Prairie vole  ----ttattcccaaggata
B D           Chinese hamster  tc--ttgctcccaaggatg
               Golden hamster  ca--ttgctcccaaggatg
B D                     Mouse  ----ttgctcccaaggata
B D                       Rat  ccattggctcccaaggata
B D            Naked mole-rat  ct--gttctcccaaggata
B D                Guinea pig  ct--gttctcccaaggaca
B D                    Rabbit  ca--acttccccaaaggta
B D                       Pig  ----catatcccaaggatg
B D                    Alpaca  cg--attctcccaagaatg
               Bactrian camel  ca--attctcccaagaatg
B D                   Dolphin  ca--cttctcccagggatg
                 Killer whale  ca--cttctcccagggatg
B D                       Cow  ca--tttctcccaaggatg
                Domestic goat  ca--tttcttccaaggatg
B D                     Horse  ca--tttctctcaaggatg
B D          White rhinoceros  ca--tttctcccaaggatg
B D                       Cat  ca--tttttcccaaggata
B D                       Dog  ca--tttttcccaaggatg
B D                   Ferret   ca--tttttccccaagatg
B D                     Panda  ca--tttttcccaaggttg
               Pacific walrus  ca--tttttcccggagatg
                 Weddell seal  ca--tttttcccaaagatg
             Black flying-fox  ta--tttctcccaaggatg
B D                   Megabat  ta--tttctccccaga--t
B D                  Hedgehog  ca--tgtctcctgcggctg
B D                     Shrew  cc--tttctcctgaggatg
              Star-nosed mole  ca--tttctctcaaggatg
B D                   Manatee  ca--attttccc-------
                     Aardvark  ca--attttcccgaggatg
B D                 Armadillo  -a--attctcccaaggatg
B D           Tasmanian devil  cg--attcctttagtgatg
           Tibetan ground jay  ta--attcttcaagggatg
B D                    Tenrec  ===================
         Cape elephant shrew  ===================
B D                      Pika  ===================
        David's myotis (bat)  ===================
B D                  Microbat  ===================
               Big brown bat  ===================
B D                     Sheep  ===================
            Tibetan antelope  ===================
B D                  Elephant  ===================
            Brush-tailed rat  ===================
                  Chinchilla  ===================
B D                    Turkey  ===================
B D                   Chicken  ===================
B D                Budgerigar  ===================
  D          Peregrine falcon  ===================
  D              Saker falcon  ===================
  D               Rock pigeon  ===================
B D       Medium ground finch  ===================
B D                Coelacanth  ===================
  D              Mallard duck  ===================
  D                    Parrot  ===================
  D    White-throated sparrow  ===================
            Cape golden mole  ===================
  D    Spiny softshell turtle  ===================
  D  Chinese softshell turtle  ===================
  D            Painted turtle  ===================
  D           Green seaturtle  ===================
B D                   Opossum  ===================
B D                    Lizard  ===================
B D                  Platypus  ===================
B D        American alligator  ===================
B D               Zebra finch  ===================
  D       Collared flycatcher  ===================

Inserts between block 24 and 25 in window
                    Aardvark 1348bp

Alignment block 25 of 57 in window, 67864792 - 67864793, 2 bps 
B D                     Human  gt
B D                     Chimp  gt
B D                   Gorilla  gt
B D                 Orangutan  gt
B D                    Gibbon  gt
B D                    Rhesus  gt
B D       Crab-eating macaque  gt
B D                    Baboon  gt
B D              Green monkey  gt
B D                  Marmoset  gt
B D           Squirrel monkey  gt
B D                  Bushbaby  ga
           Chinese tree shrew  at
B D                  Squirrel  -t
       Lesser Egyptian jerboa  gt
                 Prairie vole  -c
B D           Chinese hamster  -t
               Golden hamster  -t
B D                     Mouse  -t
B D                       Rat  -t
B D            Naked mole-rat  -c
B D                Guinea pig  -c
B D                    Rabbit  gt
B D                      Pika  gc
B D                       Pig  at
B D                    Alpaca  ac
               Bactrian camel  ac
B D                   Dolphin  gt
                 Killer whale  gt
B D                       Cow  gt
                Domestic goat  gt
B D                     Horse  gt
B D          White rhinoceros  gt
B D                       Cat  ct
B D                       Dog  gt
B D                   Ferret   gt
B D                     Panda  gt
               Pacific walrus  gt
                 Weddell seal  gt
             Black flying-fox  gt
B D                   Megabat  gt
B D                  Hedgehog  gt
B D                     Shrew  gt
              Star-nosed mole  gt
B D                 Armadillo  gt
B D           Tasmanian devil  -t
B D                    Tenrec  ==
         Cape elephant shrew  ==
        David's myotis (bat)  ==
B D                   Manatee  --
B D                  Microbat  ==
               Big brown bat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
B D                  Elephant  ==
            Brush-tailed rat  ==
                  Chinchilla  ==
B D                    Turkey  ==
B D                   Chicken  ==
B D                Budgerigar  ==
          Tibetan ground jay  --
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
B D                Coelacanth  ==
  D              Mallard duck  ==
  D                    Parrot  ==
  D    White-throated sparrow  ==
                    Aardvark  ==
            Cape golden mole  ==
  D    Spiny softshell turtle  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                   Opossum  ==
B D                    Lizard  ==
B D                  Platypus  ==
B D        American alligator  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==

Inserts between block 25 and 26 in window
B D               Guinea pig 1bp
B D                      Cow 392bp
               Domestic goat 11bp
B D          Tasmanian devil 1bp

Alignment block 26 of 57 in window, 67864794 - 67864795, 2 bps 
B D                     Human  ac
B D                     Chimp  ac
B D                   Gorilla  ac
B D                 Orangutan  ac
B D                    Gibbon  ac
B D                    Rhesus  ac
B D       Crab-eating macaque  ac
B D                    Baboon  ac
B D              Green monkey  ac
B D                  Marmoset  at
B D           Squirrel monkey  at
B D                  Bushbaby  ac
           Chinese tree shrew  ac
B D                  Squirrel  -t
       Lesser Egyptian jerboa  cc
                 Prairie vole  gc
B D           Chinese hamster  at
               Golden hamster  ac
B D                     Mouse  at
B D                       Rat  gc
B D            Naked mole-rat  ac
B D                Guinea pig  ac
B D                    Rabbit  ac
B D                      Pika  at
B D                       Pig  gc
B D                    Alpaca  ac
               Bactrian camel  ac
B D                   Dolphin  gc
                 Killer whale  gc
                Domestic goat  ac
B D                     Horse  ac
B D          White rhinoceros  ac
B D                       Cat  ac
B D                       Dog  at
B D                   Ferret   at
B D                     Panda  at
               Pacific walrus  at
                 Weddell seal  at
             Black flying-fox  ac
B D                   Megabat  ac
B D                  Hedgehog  at
B D                     Shrew  at
              Star-nosed mole  ac
B D                 Armadillo  at
B D           Tasmanian devil  ag
B D                    Tenrec  ==
         Cape elephant shrew  ==
        David's myotis (bat)  ==
B D                   Manatee  --
B D                  Microbat  ==
               Big brown bat  ==
B D                       Cow  ==
B D                     Sheep  ==
            Tibetan antelope  ==
B D                  Elephant  ==
            Brush-tailed rat  ==
                  Chinchilla  ==
B D                    Turkey  ==
B D                   Chicken  ==
B D                Budgerigar  ==
          Tibetan ground jay  --
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
B D                Coelacanth  ==
  D              Mallard duck  ==
  D                    Parrot  ==
  D    White-throated sparrow  ==
                    Aardvark  ==
            Cape golden mole  ==
  D    Spiny softshell turtle  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                   Opossum  ==
B D                    Lizard  ==
B D                  Platypus  ==
B D        American alligator  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==

Inserts between block 26 and 27 in window
               Domestic goat 382bp

Alignment block 27 of 57 in window, 67864796 - 67864801, 6 bps 
B D                     Human  ataact
B D                     Chimp  ataact
B D                   Gorilla  ataact
B D                 Orangutan  ataact
B D                    Gibbon  ataact
B D                    Rhesus  ataact
B D       Crab-eating macaque  ataact
B D                    Baboon  ataact
B D              Green monkey  ataact
B D                  Marmoset  ataact
B D           Squirrel monkey  ataact
B D                  Bushbaby  ataact
           Chinese tree shrew  ataact
B D                  Squirrel  acatag
       Lesser Egyptian jerboa  atgact
                 Prairie vole  atccca
B D           Chinese hamster  acccca
               Golden hamster  atccca
B D                     Mouse  atccta
B D                       Rat  gtccca
B D            Naked mole-rat  attact
B D                Guinea pig  attact
B D                    Rabbit  gttgct
B D                      Pika  accact
B D                       Pig  ataacc
B D                    Alpaca  ataact
               Bactrian camel  ataact
B D                   Dolphin  ataact
                 Killer whale  ataact
B D                     Horse  ataacc
B D          White rhinoceros  ataact
B D                       Cat  ataact
B D                       Dog  caaact
B D                   Ferret   ctaact
B D                     Panda  ctaact
               Pacific walrus  ctaact
                 Weddell seal  ctaact
             Black flying-fox  ataacc
B D                   Megabat  ataatc
B D                  Hedgehog  gta---
B D                     Shrew  aga---
              Star-nosed mole  ataact
B D                 Armadillo  gtaact
B D           Tasmanian devil  gt----
B D                    Tenrec  ======
         Cape elephant shrew  ======
        David's myotis (bat)  ======
B D                   Manatee  ------
B D                  Microbat  ======
               Big brown bat  ======
B D                       Cow  ======
               Domestic goat  ======
B D                     Sheep  ======
            Tibetan antelope  ======
B D                  Elephant  ======
            Brush-tailed rat  ======
                  Chinchilla  ======
B D                    Turkey  ======
B D                   Chicken  ======
B D                Budgerigar  ======
          Tibetan ground jay  ------
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D               Rock pigeon  ======
B D       Medium ground finch  ======
B D                Coelacanth  ======
  D              Mallard duck  ======
  D                    Parrot  ======
  D    White-throated sparrow  ======
                    Aardvark  ======
            Cape golden mole  ======
  D    Spiny softshell turtle  ======
  D  Chinese softshell turtle  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D                   Opossum  ======
B D                    Lizard  ======
B D                  Platypus  ======
B D        American alligator  ======
B D               Zebra finch  ======
  D       Collared flycatcher  ======

Inserts between block 27 and 28 in window
B D                    Shrew 4bp
             Star-nosed mole 14bp

Alignment block 28 of 57 in window, 67864802 - 67864806, 5 bps 
B D                     Human  agtgc
B D                     Chimp  agtgc
B D                   Gorilla  agtgc
B D                 Orangutan  agtgc
B D                    Gibbon  agtgc
B D                    Rhesus  agtgc
B D       Crab-eating macaque  agtgc
B D                    Baboon  agtgc
B D              Green monkey  agtgc
B D                  Marmoset  agtgc
B D           Squirrel monkey  agtgc
B D                  Bushbaby  aatac
           Chinese tree shrew  aatat
B D                  Squirrel  agtac
       Lesser Egyptian jerboa  agcac
                 Prairie vole  agcat
B D           Chinese hamster  aggat
               Golden hamster  aggat
B D                     Mouse  attat
B D                       Rat  agtat
B D            Naked mole-rat  agtat
B D                Guinea pig  agtat
B D                    Rabbit  agtat
B D                      Pika  gggat
B D                       Pig  agtac
B D                    Alpaca  agtac
               Bactrian camel  agtac
B D                   Dolphin  agtac
                 Killer whale  agtac
B D                     Horse  agtac
B D          White rhinoceros  agtac
B D                       Cat  agtac
B D                       Dog  agtac
B D                   Ferret   agtat
B D                     Panda  agtac
               Pacific walrus  agtac
                 Weddell seal  agtac
             Black flying-fox  agtac
B D                   Megabat  agtac
                Big brown bat  agaac
         David's myotis (bat)  agaac
B D                  Microbat  agaac
B D                     Shrew  agtac
              Star-nosed mole  ggtat
B D                 Armadillo  aataa
B D           Tasmanian devil  -gtgt
B D                    Tenrec  =====
         Cape elephant shrew  =====
B D                  Hedgehog  -----
B D                   Manatee  -----
B D                       Cow  =====
               Domestic goat  =====
B D                     Sheep  =====
            Tibetan antelope  =====
B D                  Elephant  =====
            Brush-tailed rat  =====
                  Chinchilla  =====
B D                    Turkey  =====
B D                   Chicken  =====
B D                Budgerigar  =====
          Tibetan ground jay  -----
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D               Rock pigeon  =====
B D       Medium ground finch  =====
B D                Coelacanth  =====
  D              Mallard duck  =====
  D                    Parrot  =====
  D    White-throated sparrow  =====
                    Aardvark  =====
            Cape golden mole  =====
  D    Spiny softshell turtle  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D                   Opossum  =====
B D                    Lizard  =====
B D                  Platypus  =====
B D        American alligator  =====
B D               Zebra finch  =====
  D       Collared flycatcher  =====

Inserts between block 28 and 29 in window
B D                 Squirrel 6bp
      Lesser Egyptian jerboa 5bp
                Prairie vole 5bp
B D          Chinese hamster 5bp
              Golden hamster 5bp
B D                    Mouse 5bp
B D                      Rat 5bp
B D          Tasmanian devil 3bp

Alignment block 29 of 57 in window, 67864807 - 67864842, 36 bps 
B D                     Human  caattc--agatgcagaggggag-----aagtta-att-cattcc
B D                     Chimp  caattc--agatgcagaggggag-----aagtta-att-cattcc
B D                   Gorilla  caattc--agatgcagaggggag-----aagtta-att-cattcc
B D                 Orangutan  caattc--agatgcagaggggag-----aagtta-att-cattcc
B D                    Gibbon  caattc--agatgcagaggggat-----aagtta-att-cattcc
B D                    Rhesus  caattc--agatgcagaggggag-----aagtta-att-cattac
B D       Crab-eating macaque  caattc--agatgcagaggggag-----aagtta-att-cattac
B D                    Baboon  caattc--agatgcagaagggag-----aagtta-att-cattac
B D              Green monkey  caattc--agatgcagaggggag-----aagtta-att-cattac
B D                  Marmoset  caatt--------cagaggagag-----aagtta-att-cattat
B D           Squirrel monkey  caatt--------cagaggagag-----aagtta-att-cattat
B D                  Bushbaby  caatct--gtatgcag--gggaa-----cagtta-att-cattgc
           Chinese tree shrew  caactc--acatgcacaggggag-----aggtta-ata-tattaa
B D                  Squirrel  g--------gatgcataggggag-----aagtta-att-cattat
       Lesser Egyptian jerboa  -------------acgatgcaga-----gggg-------------
                 Prairie vole  -------------cataagagga-----aagtta-g-t-tgttac
B D           Chinese hamster  -------------aaggagggga-----aagt-----t-tgtggc
               Golden hamster  -------------aatgagggga-----aagt-----t-tgttgc
B D                     Mouse  -------------tataagagaa-----aagtta-gca-tgctac
B D                       Rat  ------------aaataagggga-----acgtta-gct-tcttat
B D            Naked mole-rat  agctct--ggatgcatgggatgg-----aaatta-att-cattac
B D                Guinea pig  agtttt--ggatgcataagaaag-----aaatga-att-cattag
             Brush-tailed rat  gatttt--ag-----------gg-----aaatga-attatattat
B D                    Rabbit  caatcc--agatgtgcaggagag-----gagttc-atg-cagtac
B D                      Pika  cagtcc--agatgcacagggtgg-----gggtta-att-catgtt
B D                       Pig  caatcc--agatgaataagggag-----aag-ta-att-tattat
B D                    Alpaca  caatcc--aggtgcataggggag-----aagtta-att-tattgc
               Bactrian camel  caatcc--aggtgcataggggag-----aagtta-att-tattgc
B D                   Dolphin  caattc--agatggatagggggg-----aagtta-att-tattac
                 Killer whale  caattc--agatgcata-ggggg-----aagtta-att-tattac
B D                     Horse  caatcc--agatgcataggggag-----aagtta-att-cattat
B D          White rhinoceros  caatcc--agatacatgggggaa-----agatta-att-cattac
B D                       Cat  caatcc--agatacacaggggag-----aagtta-att-ccttac
B D                       Dog  caaccc--agacacataagggag-----aagtta-att-ccttac
B D                   Ferret   caatta--ggagatatagggaag-----gactta-att-cct---
B D                     Panda  caaccc--agac---taag--------------------------
               Pacific walrus  caaccc--agacacatagg---g-----gagtta-att-cct---
                 Weddell seal  taaccc--agacacatagggaag-----gagtta-att-cct---
             Black flying-fox  caatcc--agatgcatgggggtg-----aagtta-att-cattat
B D                   Megabat  caatcc--agatgcatgggggtg-----aagtta-att-cattat
                Big brown bat  caaccc--agatgcattggcgag-----aagtta-att-cattat
         David's myotis (bat)  caatcc--agatgcattggggag-----aagtta-att-cattat
B D                  Microbat  cagtcc--agatgcattggggag-----aagtta-att-cattat
B D                  Hedgehog  ----------------------------------------acaac
B D                     Shrew  cagtcc--acatacatagga--------------------atcac
              Star-nosed mole  gcatcccaagatgcataggggag-----aagttt-att-cattac
B D                   Manatee  -----------tgcatagagaag-----cagttacatt-caatgg
B D                 Armadillo  caatcc--agatgcatgtgcaag-----atgtta-agt-cattaa
B D           Tasmanian devil  ctattt--tgt--aatagaagta-----agattt-tct-tgttgc
           Tibetan ground jay  -aattt--gtatgcaaggtacagatccaagagta-act-------
B D                    Tenrec  =============================================
         Cape elephant shrew  =============================================
B D                       Cow  =============================================
               Domestic goat  =============================================
B D                     Sheep  =============================================
            Tibetan antelope  =============================================
B D                  Elephant  =============================================
                  Chinchilla  =============================================
B D                    Turkey  =============================================
B D                   Chicken  =============================================
B D                Budgerigar  =============================================
  D          Peregrine falcon  =============================================
  D              Saker falcon  =============================================
  D               Rock pigeon  =============================================
B D       Medium ground finch  =============================================
B D                Coelacanth  =============================================
  D              Mallard duck  =============================================
  D                    Parrot  =============================================
  D    White-throated sparrow  =============================================
                    Aardvark  =============================================
            Cape golden mole  =============================================
  D    Spiny softshell turtle  =============================================
  D  Chinese softshell turtle  =============================================
  D            Painted turtle  =============================================
  D           Green seaturtle  =============================================
B D                   Opossum  =============================================
B D                    Lizard  =============================================
B D                  Platypus  =============================================
B D        American alligator  =============================================
B D               Zebra finch  =============================================
  D       Collared flycatcher  =============================================

Inserts between block 29 and 30 in window
            Brush-tailed rat 7bp

Alignment block 30 of 57 in window, 67864843 - 67864856, 14 bps 
B D                     Human  atacaatggatgtc
B D                     Chimp  atacaatggctgtc
B D                   Gorilla  atacaatggatgtc
B D                 Orangutan  gtacaatggatgtc
B D                    Gibbon  atacaatggatgtc
B D                    Rhesus  atacgatggatgtc
B D       Crab-eating macaque  atacgatggatgtc
B D                    Baboon  atacgatggatgtc
B D              Green monkey  atacgatggatgtc
B D                  Marmoset  atacaatggatgtc
B D           Squirrel monkey  atacaatggatgtc
B D                  Bushbaby  ttatgatggatatc
           Chinese tree shrew  atacagtggattta
B D                  Squirrel  atataatggatgtt
       Lesser Egyptian jerboa  ----aatgaatgtt
                 Prairie vole  atacagtgggtgtc
B D           Chinese hamster  atacagtgggtgtc
               Golden hamster  atacagtgggtgtc
B D                     Mouse  ctgcagtgggggtc
B D                       Rat  gtgcagt-ggggtc
B D            Naked mole-rat  atgcaatggatgat
B D                Guinea pig  atgcaatgaatgtc
                   Chinchilla  atgcaatggctatc
             Brush-tailed rat  atgcaacggatgcc
B D                    Rabbit  acacaatggatatt
B D                      Pika  atgcaatggatgtc
B D                       Pig  atacaaagggtgta
B D                    Alpaca  acacaatgaatgta
               Bactrian camel  acacaatgaatgta
B D                   Dolphin  atacaaggggcgta
                 Killer whale  atacaaggggcgta
B D                     Horse  atacaatggatgtg
B D          White rhinoceros  atacgatggatgta
B D                       Cat  atacaatagatgta
B D                       Dog  atacaatagatgta
B D                   Ferret   -tacaatggatgta
B D                     Panda  ---------atgta
               Pacific walrus  -taaaacagatgta
                 Weddell seal  -tacaatagatgta
             Black flying-fox  agacaatgaatgta
B D                   Megabat  agacaatgaatgta
                Big brown bat  atacagtggaca--
         David's myotis (bat)  atacagtggaca--
B D                  Microbat  atacagtggaca--
B D                  Hedgehog  ttatggtgag----
B D                     Shrew  ttaatgtagg----
              Star-nosed mole  acaggatgggtt--
B D                   Manatee  atatcttggg-gta
B D                 Armadillo  atacagtggatgct
B D           Tasmanian devil  atatatttaaactc
           Tibetan ground jay  gcaagttggtcttt
B D                    Tenrec  ==============
         Cape elephant shrew  ==============
B D                       Cow  ==============
               Domestic goat  ==============
B D                     Sheep  ==============
            Tibetan antelope  ==============
B D                  Elephant  ==============
B D                    Turkey  ==============
B D                   Chicken  ==============
B D                Budgerigar  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
  D               Rock pigeon  ==============
B D       Medium ground finch  ==============
B D                Coelacanth  ==============
  D              Mallard duck  ==============
  D                    Parrot  ==============
  D    White-throated sparrow  ==============
                    Aardvark  ==============
            Cape golden mole  ==============
  D    Spiny softshell turtle  ==============
  D  Chinese softshell turtle  ==============
  D            Painted turtle  ==============
  D           Green seaturtle  ==============
B D                   Opossum  ==============
B D                    Lizard  ==============
B D                  Platypus  ==============
B D        American alligator  ==============
B D               Zebra finch  ==============
  D       Collared flycatcher  ==============

Inserts between block 30 and 31 in window
          Chinese tree shrew 2088bp

Alignment block 31 of 57 in window, 67864857 - 67864857, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
B D                  Squirrel  c
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  c
B D                      Pika  t
           Tibetan ground jay  c
B D                    Tenrec  =
         Cape elephant shrew  =
B D                  Hedgehog  -
B D                     Shrew  -
             Star-nosed mole  -
B D                       Dog  -
B D                     Panda  -
B D                   Ferret   -
        David's myotis (bat)  -
B D                   Manatee  -
B D                  Microbat  -
               Big brown bat  -
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
                Killer whale  -
B D                 Armadillo  -
B D                    Alpaca  -
              Bactrian camel  -
            Black flying-fox  -
B D                       Cat  -
B D                  Elephant  =
          Chinese tree shrew  =
              Pacific walrus  -
B D          White rhinoceros  -
B D                     Horse  -
B D                       Pig  -
                Weddell seal  -
B D                   Dolphin  -
B D                    Turkey  =
B D                   Chicken  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  =
B D                Coelacanth  =
  D              Mallard duck  =
  D                    Parrot  =
  D    White-throated sparrow  =
                    Aardvark  =
            Cape golden mole  =
B D                   Megabat  -
  D    Spiny softshell turtle  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D           Tasmanian devil  -
B D                   Opossum  =
B D                    Lizard  =
B D                  Platypus  =
B D        American alligator  =
B D               Zebra finch  =
  D       Collared flycatcher  =

Alignment block 32 of 57 in window, 67864858 - 67864861, 4 bps 
B D                     Human  t----------ggg
B D                     Chimp  t----------ggg
B D                   Gorilla  t----------ggg
B D                 Orangutan  t----------ggg
B D                    Gibbon  t----------ggg
B D                    Rhesus  t----------ggg
B D       Crab-eating macaque  t----------ggg
B D                    Baboon  t----------ggg
B D              Green monkey  t----------ggg
B D                  Marmoset  tggggtgtta-ggg
B D           Squirrel monkey  tggggtgttt-ggg
B D                  Bushbaby  t----------agg
           Chinese tree shrew  -------tat-gg-
B D                  Squirrel  tagggtatta-ggg
       Lesser Egyptian jerboa  tgggggagcagggg
                 Prairie vole  ttgggaagta-gag
B D           Chinese hamster  tagggaagca-ggg
               Golden hamster  tagggaagca-ggg
B D                     Mouse  ta---------ggg
B D                       Rat  tagggcagtg-ggg
B D            Naked mole-rat  tagaacagta----
B D                Guinea pig  tagggtagta-ggg
                   Chinchilla  tagggtagta-agg
             Brush-tailed rat  tagggtagta-agg
B D                    Rabbit  ta---------tgg
B D                      Pika  tc---------ggg
B D                       Pig  -------tta-ga-
B D                    Alpaca  -------tta-ga-
               Bactrian camel  -------tta-ga-
B D                   Dolphin  -------tta-ga-
                 Killer whale  -------tta-ga-
B D                     Horse  -------tca-ga-
B D          White rhinoceros  -------tta-ga-
B D                       Cat  -------tta-aa-
B D                       Dog  -------tta-ga-
B D                   Ferret   -------tta-ga-
B D                     Panda  -------tta-ga-
               Pacific walrus  -------tta-ga-
                 Weddell seal  -------tta-ga-
             Black flying-fox  -------tta-ga-
B D                   Megabat  -------tta-ga-
B D                     Shrew  -------ttg-aa-
              Star-nosed mole  -------ttg-ga-
B D                   Manatee  -------tta-gga
B D                 Armadillo  -------gta-ggg
B D           Tasmanian devil  -------tta-agg
           Tibetan ground jay  --------tg-gg-
  D                    Parrot  --------tg-gg-
  D             Scarlet macaw  --------tg-gg-
B D                    Tenrec  ==============
         Cape elephant shrew  ==============
B D                  Hedgehog  --------------
        David's myotis (bat)  --------------
B D                  Microbat  --------------
               Big brown bat  --------------
B D                       Cow  ==============
               Domestic goat  ==============
B D                     Sheep  ==============
            Tibetan antelope  ==============
B D                  Elephant  ==============
B D                    Turkey  ==============
B D                   Chicken  ==============
B D                Budgerigar  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
  D               Rock pigeon  ==============
B D       Medium ground finch  ==============
B D                Coelacanth  ==============
  D              Mallard duck  ==============
  D    White-throated sparrow  ==============
                    Aardvark  ==============
            Cape golden mole  ==============
  D    Spiny softshell turtle  ==============
  D  Chinese softshell turtle  ==============
  D            Painted turtle  ==============
  D           Green seaturtle  ==============
B D                   Opossum  ==============
B D                    Lizard  ==============
B D                  Platypus  ==============
B D        American alligator  ==============
B D               Zebra finch  ==============
  D       Collared flycatcher  ==============

Inserts between block 32 and 33 in window
B D                 Bushbaby 436bp
B D          Tasmanian devil 1bp

Alignment block 33 of 57 in window, 67864862 - 67864867, 6 bps 
B D                     Human  cttaat
B D                     Chimp  cttaat
B D                   Gorilla  cttaat
B D                 Orangutan  cttaat
B D                    Gibbon  cttaat
B D                    Rhesus  cttaat
B D       Crab-eating macaque  cttaat
B D                    Baboon  cttaat
B D              Green monkey  cttaat
B D                  Marmoset  cttaat
B D           Squirrel monkey  cttaat
           Chinese tree shrew  tttaat
B D                  Squirrel  gttaat
       Lesser Egyptian jerboa  gttgat
                 Prairie vole  ctcaat
B D           Chinese hamster  cttaat
               Golden hamster  cttaat
B D                     Mouse  cttaat
B D                       Rat  cttaat
B D                Guinea pig  tttaat
                   Chinchilla  cttaat
             Brush-tailed rat  cttaaa
B D                    Rabbit  tcaaat
B D                      Pika  tcagat
B D                       Pig  ----at
B D                    Alpaca  ----at
               Bactrian camel  ----at
B D                   Dolphin  ----at
                 Killer whale  ----at
B D                     Horse  ----at
B D          White rhinoceros  ----at
B D                       Cat  ----at
B D                       Dog  ----at
B D                   Ferret   ----at
B D                     Panda  ----at
               Pacific walrus  ----at
                 Weddell seal  ----at
             Black flying-fox  ----at
B D                   Megabat  ----at
B D                     Shrew  ----gc
              Star-nosed mole  ----gt
B D                   Manatee  cttaat
B D                 Armadillo  ctgaat
B D           Tasmanian devil  ----at
           Tibetan ground jay  ctgcgt
  D                    Parrot  ctgcat
  D             Scarlet macaw  ctgcat
B D                    Tenrec  ======
         Cape elephant shrew  ======
B D                  Hedgehog  ------
        David's myotis (bat)  ------
B D                  Microbat  ------
               Big brown bat  ------
B D                       Cow  ======
               Domestic goat  ======
B D                     Sheep  ======
            Tibetan antelope  ======
B D                  Bushbaby  ======
B D                  Elephant  ======
B D            Naked mole-rat  ------
B D                    Turkey  ======
B D                   Chicken  ======
B D                Budgerigar  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D               Rock pigeon  ======
B D       Medium ground finch  ======
B D                Coelacanth  ======
  D              Mallard duck  ======
  D    White-throated sparrow  ======
                    Aardvark  ======
            Cape golden mole  ======
  D    Spiny softshell turtle  ======
  D  Chinese softshell turtle  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D                   Opossum  ======
B D                    Lizard  ======
B D                  Platypus  ======
B D        American alligator  ======
B D               Zebra finch  ======
  D       Collared flycatcher  ======

Inserts between block 33 and 34 in window
B D                      Pig 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                      Dog 13bp
B D                  Ferret  13bp
B D                    Panda 2bp
              Pacific walrus 13bp
                Weddell seal 13bp
            Black flying-fox 2bp
B D                  Megabat 2bp
B D                    Shrew 9bp
             Star-nosed mole 6bp
B D                  Manatee 3bp
B D          Tasmanian devil 4bp
          Tibetan ground jay 4bp

Alignment block 34 of 57 in window, 67864868 - 67864870, 3 bps 
B D                     Human  tct
B D                     Chimp  tct
B D                   Gorilla  tct
B D                 Orangutan  tct
B D                    Gibbon  tct
B D                    Rhesus  tct
B D       Crab-eating macaque  tct
B D                    Baboon  tct
B D              Green monkey  tct
B D                  Marmoset  tct
B D           Squirrel monkey  tct
           Chinese tree shrew  tct
B D                  Squirrel  tct
       Lesser Egyptian jerboa  tct
                 Prairie vole  ttt
B D           Chinese hamster  tct
               Golden hamster  tct
B D                     Mouse  tct
B D                       Rat  tc-
B D                Guinea pig  tct
                   Chinchilla  tct
             Brush-tailed rat  ttc
B D                    Rabbit  tct
B D                      Pika  tct
B D                       Pig  tct
B D                    Alpaca  gtt
               Bactrian camel  gtt
B D                   Dolphin  --t
                 Killer whale  --t
B D                       Cow  -tt
B D                     Sheep  -tt
                Domestic goat  -tt
B D                     Horse  tct
B D          White rhinoceros  tct
B D                       Cat  tct
B D                       Dog  tct
B D                   Ferret   tct
B D                     Panda  tct
               Pacific walrus  tct
                 Weddell seal  tct
             Black flying-fox  tct
B D                   Megabat  tct
                Big brown bat  --t
         David's myotis (bat)  --t
B D                  Microbat  --t
B D                   Manatee  tct
             Cape golden mole  ttt
B D                 Armadillo  tct
B D           Tasmanian devil  ttt
           Tibetan ground jay  tct
  D                    Parrot  tct
  D             Scarlet macaw  tct
B D                    Tenrec  ===
         Cape elephant shrew  ===
B D                  Hedgehog  ---
B D                     Shrew  ===
             Star-nosed mole  ===
            Tibetan antelope  ===
B D                  Bushbaby  ===
B D                  Elephant  ===
B D            Naked mole-rat  ---
B D                    Turkey  ===
B D                   Chicken  ===
B D                Budgerigar  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D       Medium ground finch  ===
B D                Coelacanth  ===
  D              Mallard duck  ===
  D    White-throated sparrow  ===
                    Aardvark  ===
  D    Spiny softshell turtle  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D                   Opossum  ===
B D                    Lizard  ===
B D                  Platypus  ===
B D        American alligator  ===
B D               Zebra finch  ===
  D       Collared flycatcher  ===

Inserts between block 34 and 35 in window
B D                  Dolphin 2bp
                Killer whale 2bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                      Dog 26bp
B D                  Ferret  26bp
B D                    Panda 25bp
              Pacific walrus 26bp
                Weddell seal 26bp

Alignment block 35 of 57 in window, 67864871 - 67864891, 21 bps 
B D                     Human  -----------------c--------------tcctggg--aa-----ccc--------ag---gttagt
B D                     Chimp  -----------------c--------------tcctggg--aa-----ccc--------ag---gttagt
B D                   Gorilla  -----------------c--------------tcctggg--aa-----ccc--------ag---gttact
B D                 Orangutan  -----------------c--------------tcctggg--aa-----ccc--------ag---gttagt
B D                    Gibbon  -----------------c--------------tcctggg--aa-----ccc--------ag---gttagt
B D                    Rhesus  -----------------c--------------tcctggg--aa-----ccc--------ag---tttatt
B D       Crab-eating macaque  -----------------c--------------tcctggg--aa-----ccc--------ag---tttatt
B D                    Baboon  -----------------c--------------tcctggg--aa-----ccc--------ag---gttatt
B D              Green monkey  -----------------c--------------tcctggg--aa-----ccc--------ag---gttatt
B D                  Marmoset  -----------------c--------------tcttggg--ag-----ccc--------agagagatata
B D           Squirrel monkey  -----------------g--------------tctcggg--ag-----ccc--------agaggtatata
           Chinese tree shrew  -----------------g--------------tcctggg--aa-----ctc--------ag---g-tagt
B D                  Squirrel  -----------------g--------------tcct-ggttaactattccc--------ag---g-ttgt
       Lesser Egyptian jerboa  -----------------t--------------tcctagg--aa-----ccc--------ag---gttagc
                 Prairie vole  -----------------c--------------tcct-gg--aa-----ccc--------ag---gctcat
B D           Chinese hamster  -----------------t--------------tcct-ag--aa-----gcc--------ag---gctcat
               Golden hamster  -----------------t--------------tccc-ag--aa-----tcc--------ag---gctcat
B D                     Mouse  -----------------t--------------tctt-cc--aa-----cca--------ag---g-ttat
B D                       Rat  --------------------------------tctt-gg--aa-----cca--------at---g-ttat
B D            Naked mole-rat  -------------------------------------ag--ag---------------------------
B D                Guinea pig  -----------------t--------------tcct-ag--ag---------------------------
                   Chinchilla  -----------------t--------------tcct-ag--ga---------------------------
             Brush-tailed rat  -----------------t--------------tccc-gg--ag---------------------------
B D                    Rabbit  -----------------c--------------tctgggg--aa-----ccc--------ag---gttatt
B D                      Pika  -----------------c--------------tttggag--ag-----cac--------aa---gctagt
B D                       Pig  --------------------------------ctctggg--ga-----ccc--------ag---gttaat
B D                    Alpaca  --------------------------------ctctagg--aa-----ccc--------tg---gttagt
               Bactrian camel  --------------------------------ctctagg--aa-----ccc--------tg---gttagt
B D                   Dolphin  --------------------------------ctctggg--aa-----ccc--------ag---gttagt
                 Killer whale  --------------------------------ctctggg--aa-----ccc--------ag---gttagt
             Tibetan antelope  -------------------------------cttttggg--aa-----ccc--------ag---gttagt
B D                       Cow  -------------------------------cctttggg--aa-----ccc--------ag---gttagt
B D                     Sheep  -------------------------------cttttggg--aa-----ccc--------ag---gttagt
                Domestic goat  -------------------------------cttttggg--aa-----ccc--------ag---attagt
B D                     Horse  --------------------------------ctccagg--aa-----ctt--------gg---gttagt
B D          White rhinoceros  --------------------------------ttccagg--aa-----ctc--------ag---gttagt
B D                       Cat  --------------------------------ttatgag--aa-----ccc--------ag---gttagt
B D                       Dog  --------------------------------ctccagg--ag-----ccc--------ag---attagt
B D                   Ferret   --------------------------------ctccagg--aa-----ccc--------ag---gttagt
B D                     Panda  --------------------------------ctccagg--aa-----ccc--------ag---gttaat
               Pacific walrus  --------------------------------ctccagg--aa-----ccc--------aa---gttagt
                 Weddell seal  --------------------------------ctccagg--aa-----ccc--------aa---gttagt
             Black flying-fox  --------------------------------ccctggg--aa-----cccaggaacctag---gttagt
B D                   Megabat  --------------------------------ccctggg--aa-----cccaggaacctag---gttagt
                Big brown bat  --------------------------------ctctgga--aa-----ccc--------ag---attagt
         David's myotis (bat)  --------------------------------ctctggc--aa-----ccc--------ag---attagt
B D                  Microbat  --------------------------------ctctggc--aa-----tcc--------ag---attagt
B D                     Shrew  ------------------aagtggattaatttttctgga--aa-----cgc--------ag---gttcct
              Star-nosed mole  -----------------------gcttattttctctggg--aa-----cct--------ag---aaagat
B D                   Manatee  -------------------------------ctaggggg--at-----ctc--------tg---gttagc
             Cape golden mole  -------------------------------gttttggc--ag-----ccc--------ag---g--aaa
B D                 Armadillo  -------------------------------c------a--aa-----ccc--------tg---gttggt
B D           Tasmanian devil  -----------------------------------------------ttcc--------ag---gatatc
           Tibetan ground jay  tttcatgactgtcatctc--------------cttcggt--aa-----c---------------------
  D                    Parrot  ctttgtggctgtg---tc--------------ctttggt--ag-----c---------------------
  D             Scarlet macaw  ctttgtggctgtgtcctc--------------ctttggt--ag-----c---------------------
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ----------------------------------------------------------------------
B D                  Bushbaby  ======================================================================
B D                  Elephant  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                Coelacanth  ======================================================================
  D              Mallard duck  ======================================================================
  D    White-throated sparrow  ======================================================================
                    Aardvark  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================
B D                    Lizard  ======================================================================
B D                  Platypus  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================

Inserts between block 35 and 36 in window
B D          Tasmanian devil 3bp

Alignment block 36 of 57 in window, 67864892 - 67864894, 3 bps 
B D                     Human  tgg
B D                     Chimp  tgg
B D                   Gorilla  tgg
B D                 Orangutan  tgg
B D                    Gibbon  ttg
B D                    Rhesus  tgg
B D       Crab-eating macaque  tgg
B D                    Baboon  tgg
B D              Green monkey  tgg
B D                  Marmoset  tgc
B D           Squirrel monkey  tgc
           Chinese tree shrew  tgt
B D                  Squirrel  tgg
       Lesser Egyptian jerboa  tgg
                 Prairie vole  tgc
B D           Chinese hamster  tgg
               Golden hamster  tga
B D                     Mouse  ggg
B D                       Rat  ggg
B D            Naked mole-rat  tag
B D                Guinea pig  tag
                   Chinchilla  taa
             Brush-tailed rat  tac
B D                    Rabbit  tga
B D                      Pika  tga
B D                       Pig  tgg
B D                    Alpaca  tgg
               Bactrian camel  tgg
B D                   Dolphin  tgg
                 Killer whale  tgg
             Tibetan antelope  tga
B D                       Cow  tga
B D                     Sheep  tga
                Domestic goat  tga
B D                     Horse  tgg
B D          White rhinoceros  tcg
B D                       Cat  ggg
B D                       Dog  ggg
B D                   Ferret   ggg
B D                     Panda  ggg
               Pacific walrus  ggg
                 Weddell seal  ggg
             Black flying-fox  tgg
B D                   Megabat  tgg
                Big brown bat  tgt
         David's myotis (bat)  tgt
B D                  Microbat  tgt
B D                     Shrew  tgg
              Star-nosed mole  t--
B D                   Manatee  tgg
             Cape golden mole  cga
                     Aardvark  tgc
B D                 Armadillo  tgg
B D           Tasmanian devil  taa
           Tibetan ground jay  tgg
  D                    Parrot  tgg
  D             Scarlet macaw  tga
B D                    Tenrec  ===
         Cape elephant shrew  ===
B D                  Hedgehog  ---
B D                  Bushbaby  ===
B D                  Elephant  ===
B D                    Turkey  ===
B D                   Chicken  ===
B D                Budgerigar  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D       Medium ground finch  ===
B D                Coelacanth  ===
  D              Mallard duck  ===
  D    White-throated sparrow  ===
  D    Spiny softshell turtle  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D                   Opossum  ===
B D                    Lizard  ===
B D                  Platypus  ===
B D        American alligator  ===
B D               Zebra finch  ===
  D       Collared flycatcher  ===

Inserts between block 36 and 37 in window
            Cape golden mole 4bp
B D                Armadillo 4bp

Alignment block 37 of 57 in window, 67864895 - 67864896, 2 bps 
B D                     Human  ac
B D                     Chimp  ac
B D                   Gorilla  ac
B D                 Orangutan  ac
B D                    Gibbon  ac
B D                    Rhesus  ac
B D       Crab-eating macaque  ac
B D                    Baboon  ac
B D              Green monkey  ac
B D                  Marmoset  at
B D           Squirrel monkey  at
           Chinese tree shrew  at
B D                  Squirrel  at
       Lesser Egyptian jerboa  ac
                 Prairie vole  at
B D           Chinese hamster  at
               Golden hamster  at
B D                     Mouse  at
B D                       Rat  at
B D            Naked mole-rat  ac
B D                Guinea pig  at
                   Chinchilla  ac
             Brush-tailed rat  ac
B D                    Rabbit  ac
B D                      Pika  at
B D                       Pig  gc
B D                    Alpaca  ac
               Bactrian camel  ac
B D                   Dolphin  ac
                 Killer whale  ac
             Tibetan antelope  ac
B D                       Cow  ac
B D                     Sheep  ac
                Domestic goat  ac
B D                     Horse  ac
B D          White rhinoceros  ac
B D                       Cat  gc
B D                       Dog  ac
B D                   Ferret   ac
B D                     Panda  ac
               Pacific walrus  ac
                 Weddell seal  ac
             Black flying-fox  ac
B D                   Megabat  ac
                Big brown bat  ac
         David's myotis (bat)  ac
B D                  Microbat  ac
B D                  Hedgehog  at
B D                     Shrew  at
              Star-nosed mole  at
B D                  Elephant  at
          Cape elephant shrew  at
B D                   Manatee  at
             Cape golden mole  at
                     Aardvark  at
B D                 Armadillo  ac
B D                    Tenrec  ==
B D                  Bushbaby  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D             Scarlet macaw  --
B D                Budgerigar  ==
          Tibetan ground jay  --
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
B D                Coelacanth  ==
  D              Mallard duck  ==
  D                    Parrot  --
  D    White-throated sparrow  ==
  D    Spiny softshell turtle  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D           Tasmanian devil  --
B D                   Opossum  ==
B D                    Lizard  ==
B D                  Platypus  ==
B