Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 289 in window, 150804012 - 150804012, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  g
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  a
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                      Pika  t
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  t
B D                  Microbat  c
B D                  Hedgehog  c
B D                     Shrew  c
B D                  Elephant  t
          Cape elephant shrew  c
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  c
B D                   Opossum  g
B D           Tasmanian devil  c
B D                   Wallaby  g
  D               Rock pigeon  c
  D              Saker falcon  c
  D       Collared flycatcher  t
B D       Medium ground finch  c
           Tibetan ground jay  c
B D                    Turkey  c
  D            Painted turtle  c
  D  Chinese softshell turtle  c
B D                    Lizard  c
B D             X. tropicalis  a
B D              Atlantic cod  t
B D                   Lamprey  -
B D                Coelacanth  =
  D    Spiny softshell turtle  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  -
B D                      Fugu  =
B D                 Tetraodon  =
B D                   Chicken  =
  D              Mallard duck  =
B D               Zebra finch  =
  D    White-throated sparrow  =
    Mexican tetra (cavefish)  -
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  -
                 Zebra mbuna  -
       Burton's mouthbreeder  -
         Princess of Burundi  -
B D              Nile tilapia  -
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D                    Parrot  =
B D                  Platypus  =
             Star-nosed mole  =
        David's myotis (bat)  -

Inserts between block 1 and 2 in window
  D             Saker falcon 1bp
B D      Medium ground finch 4bp
          Tibetan ground jay 4bp
B D                   Turkey 3bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp
B D                   Lizard 7bp

Alignment block 2 of 289 in window, 150804013 - 150804014, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D                    Baboon  aa
B D              Green monkey  aa
B D                  Marmoset  aa
B D           Squirrel monkey  aa
B D                  Bushbaby  ag
           Chinese tree shrew  ag
B D                  Squirrel  ag
       Lesser Egyptian jerboa  ag
                 Prairie vole  gg
B D           Chinese hamster  gg
               Golden hamster  gg
B D                     Mouse  gg
B D                       Rat  gg
B D            Naked mole-rat  ag
B D                Guinea pig  ag
                   Chinchilla  ag
             Brush-tailed rat  ag
B D                    Rabbit  gg
B D                      Pika  gg
B D                       Pig  ag
B D                    Alpaca  ag
               Bactrian camel  ag
B D                   Dolphin  ag
                 Killer whale  ag
             Tibetan antelope  ag
B D                       Cow  ag
B D                     Sheep  ag
                Domestic goat  ag
B D                     Horse  ag
B D          White rhinoceros  ag
B D                       Cat  ag
B D                       Dog  ag
B D                   Ferret   gg
B D                     Panda  gg
               Pacific walrus  gg
                 Weddell seal  gg
             Black flying-fox  ag
B D                   Megabat  ag
                Big brown bat  gg
         David's myotis (bat)  cg
B D                  Microbat  cg
B D                  Hedgehog  ta
B D                     Shrew  ag
B D                  Elephant  gg
          Cape elephant shrew  tg
B D                   Manatee  gg
             Cape golden mole  gg
B D                    Tenrec  ac
                     Aardvark  gg
B D                 Armadillo  gg
B D                   Opossum  ag
B D           Tasmanian devil  ag
B D                   Wallaby  ag
B D             X. tropicalis  gg
B D                Coelacanth  aa
B D              Atlantic cod  -g
B D                   Lamprey  --
  D    Spiny softshell turtle  ==
                 Spotted gar  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  --
B D                      Fugu  ==
B D                 Tetraodon  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
    Mexican tetra (cavefish)  --
B D                 Zebrafish  ==
B D                    Medaka  ==
         Pundamilia nyererei  --
                 Zebra mbuna  --
       Burton's mouthbreeder  --
         Princess of Burundi  --
B D              Nile tilapia  --
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
  D               Rock pigeon  --
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D                  Platypus  ==
  D  Chinese softshell turtle  ==
             Star-nosed mole  ==

Inserts between block 2 and 3 in window
                Prairie vole 6bp
B D          Chinese hamster 6bp
              Golden hamster 6bp
B D             Atlantic cod 4bp

Alignment block 3 of 289 in window, 150804015 - 150804015, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  c
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  c
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  c
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  t
B D                      Pika  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  g
B D                     Shrew  a
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D             X. tropicalis  t
B D                Coelacanth  t
     Mexican tetra (cavefish)  t
B D                   Lamprey  -
  D    Spiny softshell turtle  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  -
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  -
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  -
                 Zebra mbuna  -
       Burton's mouthbreeder  -
         Princess of Burundi  -
B D              Nile tilapia  -
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  -
  D               Rock pigeon  -
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                  Platypus  =
B D                   Wallaby  -
B D                  Bushbaby  -
  D  Chinese softshell turtle  =
             Star-nosed mole  =

Inserts between block 3 and 4 in window
B D                 Hedgehog 1bp
B D                    Shrew 2bp

Alignment block 4 of 289 in window, 150804016 - 150804018, 3 bps 
B D                     Human  ctc
B D                     Chimp  ctc
B D                   Gorilla  ctc
B D                 Orangutan  ctc
B D                    Gibbon  ctc
B D                    Rhesus  ctc
B D       Crab-eating macaque  ctc
B D                    Baboon  ctc
B D              Green monkey  ctc
B D                  Marmoset  ctc
B D           Squirrel monkey  ctc
B D                  Bushbaby  ctc
           Chinese tree shrew  ctc
B D                  Squirrel  ctc
       Lesser Egyptian jerboa  ctc
                 Prairie vole  ctc
B D           Chinese hamster  ctc
               Golden hamster  ctc
B D                     Mouse  ctc
B D                       Rat  ctc
B D            Naked mole-rat  ctc
B D                Guinea pig  ctt
                   Chinchilla  ctc
             Brush-tailed rat  ctc
B D                    Rabbit  ctc
B D                      Pika  ctc
B D                       Pig  ctc
B D                    Alpaca  ctt
               Bactrian camel  ctt
B D                   Dolphin  ctc
                 Killer whale  ctc
             Tibetan antelope  ctc
B D                       Cow  ctc
B D                     Sheep  ctc
                Domestic goat  ctc
B D                     Horse  ctc
B D          White rhinoceros  ctc
B D                       Cat  ctc
B D                       Dog  ctc
B D                   Ferret   ctc
B D                     Panda  ctt
               Pacific walrus  ctc
                 Weddell seal  ctc
             Black flying-fox  ctc
B D                   Megabat  ctc
                Big brown bat  ctc
         David's myotis (bat)  ctc
B D                  Microbat  ctc
B D                  Hedgehog  ctc
B D                     Shrew  ctc
              Star-nosed mole  ctc
B D                  Elephant  ctt
          Cape elephant shrew  ctt
B D                   Manatee  ctc
             Cape golden mole  ctt
B D                    Tenrec  ctt
                     Aardvark  ctc
B D                 Armadillo  ctt
B D                   Opossum  ctc
B D           Tasmanian devil  ctc
B D                   Wallaby  ctc
  D               Rock pigeon  ccc
  D              Saker falcon  ctc
  D       Collared flycatcher  cct
  D    White-throated sparrow  ctt
B D       Medium ground finch  cac
B D               Zebra finch  ctt
           Tibetan ground jay  cac
B D                Budgerigar  cac
  D              Mallard duck  c--
B D                    Turkey  c--
B D        American alligator  ccc
  D           Green seaturtle  ctc
  D            Painted turtle  ctg
  D  Chinese softshell turtle  ctg
  D    Spiny softshell turtle  ctc
B D                    Lizard  ctt
B D             X. tropicalis  ctc
B D                Coelacanth  cat
       Yellowbelly pufferfish  -tc
B D              Nile tilapia  -tt
          Princess of Burundi  -tt
        Burton's mouthbreeder  -tt
                  Zebra mbuna  -tt
          Pundamilia nyererei  -tt
B D                    Medaka  -tc
           Southern platyfish  -tc
B D               Stickleback  -cc
B D              Atlantic cod  -t-
     Mexican tetra (cavefish)  ctt
                  Spotted gar  ctc
B D                   Lamprey  ctc
B D                      Fugu  ===
B D                 Tetraodon  ===
B D                   Chicken  ===
B D                 Zebrafish  ===
  D             Scarlet macaw  ===
  D          Peregrine falcon  ===
  D                    Parrot  ===
B D                  Platypus  ===

Inserts between block 4 and 5 in window
  D             Mallard duck 2bp
B D                   Turkey 1bp
  D          Green seaturtle 34794bp
      Yellowbelly pufferfish 4bp
B D             Nile tilapia 1bp
         Princess of Burundi 1bp
       Burton's mouthbreeder 1bp
                 Zebra mbuna 1bp
         Pundamilia nyererei 1bp
B D                   Medaka 2bp
          Southern platyfish 2bp
B D             Atlantic cod 6bp

Alignment block 5 of 289 in window, 150804019 - 150804023, 5 bps 
B D                     Human  acctg
B D                     Chimp  acctg
B D                   Gorilla  acctg
B D                 Orangutan  acctg
B D                    Gibbon  acctg
B D                    Rhesus  acctg
B D       Crab-eating macaque  acctg
B D                    Baboon  acctg
B D              Green monkey  acctg
B D                  Marmoset  acctg
B D           Squirrel monkey  acctg
B D                  Bushbaby  acctg
           Chinese tree shrew  acctg
B D                  Squirrel  acctg
       Lesser Egyptian jerboa  acctg
                 Prairie vole  acctg
B D           Chinese hamster  acctg
               Golden hamster  acctg
B D                     Mouse  acctg
B D                       Rat  acctg
B D            Naked mole-rat  acctg
B D                Guinea pig  acctg
                   Chinchilla  acctg
             Brush-tailed rat  acctg
B D                    Rabbit  acctg
B D                      Pika  acctg
B D                       Pig  acctg
B D                    Alpaca  acctg
               Bactrian camel  acctg
B D                   Dolphin  acctg
                 Killer whale  acctg
             Tibetan antelope  acctg
B D                       Cow  acctg
B D                     Sheep  acctg
                Domestic goat  acctg
B D                     Horse  acctg
B D          White rhinoceros  acctg
B D                       Cat  acctg
B D                       Dog  acctg
B D                   Ferret   acctg
B D                     Panda  acctg
               Pacific walrus  acctg
                 Weddell seal  acctg
             Black flying-fox  acctg
B D                   Megabat  acctg
                Big brown bat  acctg
         David's myotis (bat)  acctg
B D                  Microbat  acctg
B D                  Hedgehog  acctg
B D                     Shrew  acctg
              Star-nosed mole  acccg
B D                  Elephant  acctg
          Cape elephant shrew  acctg
B D                   Manatee  acctg
             Cape golden mole  acctc
B D                    Tenrec  acctg
                     Aardvark  acctg
B D                 Armadillo  acctg
B D                   Opossum  acctc
B D           Tasmanian devil  acctg
B D                   Wallaby  acctg
B D                  Platypus  acctg
  D               Rock pigeon  acctg
  D              Saker falcon  acctt
  D          Peregrine falcon  acctg
  D       Collared flycatcher  acctt
  D    White-throated sparrow  acctt
B D       Medium ground finch  acctg
B D               Zebra finch  acctt
           Tibetan ground jay  acctg
B D                Budgerigar  acctg
  D                    Parrot  acctg
  D              Mallard duck  acctg
B D                   Chicken  acctg
B D                    Turkey  tgctg
B D        American alligator  acctg
  D           Green seaturtle  acccg
  D            Painted turtle  acctg
  D  Chinese softshell turtle  ccctg
  D    Spiny softshell turtle  acctg
B D                    Lizard  acctg
B D             X. tropicalis  acctc
B D                Coelacanth  acctc
B D                 Tetraodon  accgt
       Yellowbelly pufferfish  acctg
B D              Nile tilapia  actta
          Princess of Burundi  actta
        Burton's mouthbreeder  actta
                  Zebra mbuna  actta
          Pundamilia nyererei  actta
B D                    Medaka  acctc
           Southern platyfish  acctg
B D               Stickleback  acctt
B D              Atlantic cod  acctg
B D                 Zebrafish  accgt
     Mexican tetra (cavefish)  acctc
                  Spotted gar  acctc
B D                   Lamprey  accgt
B D                      Fugu  =====
  D             Scarlet macaw  =====

Inserts between block 5 and 6 in window
         Princess of Burundi 4bp
       Burton's mouthbreeder 4bp
                 Zebra mbuna 4bp
         Pundamilia nyererei 4bp
B D              Stickleback 3bp

Alignment block 6 of 289 in window, 150804024 - 150804025, 2 bps 
B D                     Human  tc
B D                     Chimp  tc
B D                   Gorilla  tc
B D                 Orangutan  tc
B D                    Gibbon  tc
B D                    Rhesus  tc
B D       Crab-eating macaque  tc
B D                    Baboon  tc
B D              Green monkey  tc
B D                  Marmoset  tc
B D           Squirrel monkey  tc
B D                  Bushbaby  tc
           Chinese tree shrew  tc
B D                  Squirrel  tc
       Lesser Egyptian jerboa  tc
                 Prairie vole  cc
B D           Chinese hamster  ac
               Golden hamster  gc
B D                     Mouse  gc
B D                       Rat  cc
B D            Naked mole-rat  gc
B D                Guinea pig  gc
                   Chinchilla  gc
             Brush-tailed rat  gc
B D                    Rabbit  tc
B D                      Pika  tc
B D                       Pig  tc
B D                    Alpaca  tc
               Bactrian camel  tc
B D                   Dolphin  tc
                 Killer whale  tc
             Tibetan antelope  tc
B D                       Cow  tc
B D                     Sheep  tc
                Domestic goat  tc
B D                     Horse  tc
B D          White rhinoceros  tc
B D                       Cat  tc
B D                       Dog  tc
B D                   Ferret   tc
B D                     Panda  tc
               Pacific walrus  tc
                 Weddell seal  tc
             Black flying-fox  tc
B D                   Megabat  tc
                Big brown bat  tc
         David's myotis (bat)  tc
B D                  Microbat  tc
B D                  Hedgehog  tc
B D                     Shrew  cc
              Star-nosed mole  gc
B D                  Elephant  tc
          Cape elephant shrew  cc
B D                   Manatee  tc
             Cape golden mole  ac
B D                    Tenrec  tc
                     Aardvark  tc
B D                 Armadillo  tc
B D                   Opossum  tc
B D           Tasmanian devil  tc
B D                   Wallaby  tc
B D                  Platypus  tc
  D               Rock pigeon  gc
  D              Saker falcon  tg
  D          Peregrine falcon  gc
  D       Collared flycatcher  tg
  D    White-throated sparrow  tg
B D       Medium ground finch  gc
B D               Zebra finch  tg
           Tibetan ground jay  gc
B D                Budgerigar  cc
  D                    Parrot  gc
  D              Mallard duck  gc
B D                   Chicken  cc
B D                    Turkey  cc
B D        American alligator  tc
  D           Green seaturtle  ag
  D            Painted turtle  gc
  D  Chinese softshell turtle  cc
  D    Spiny softshell turtle  ac
B D                    Lizard  tc
B D             X. tropicalis  tc
B D                Coelacanth  tc
B D                 Tetraodon  tg
B D                      Fugu  tc
       Yellowbelly pufferfish  tg
B D              Nile tilapia  tc
          Princess of Burundi  tc
        Burton's mouthbreeder  tc
                  Zebra mbuna  tc
          Pundamilia nyererei  tc
B D                    Medaka  tc
           Southern platyfish  tc
B D               Stickleback  tt
B D              Atlantic cod  gc
B D                 Zebrafish  tc
     Mexican tetra (cavefish)  tc
                  Spotted gar  tc
B D                   Lamprey  gc
  D             Scarlet macaw  ==

Alignment block 7 of 289 in window, 150804026 - 150804094, 69 bps 
B D                     Human  ccac-----------atatgggtaggcatcttcagagtcaataccccggttcttctgcacatattggaag
B D                     Chimp  ccac-----------atatgggtaggcatcttcagagtcaataccccggttcttctgcacatattcgaag
B D                   Gorilla  ccac-----------atatgggtaggcatcttcagagtcaataccccggttcttctgcacatattggaag
B D                 Orangutan  ccac-----------atatgggtaggcatcttcagagtcaataccccggttcttctgcacatattggaag
B D                    Gibbon  ccac-----------atacgggtaggcatcttcagagtcaataccccggttcttctgcacatattggaag
B D                    Rhesus  ccac-----------atatgggtaggcatcttcagagtcaataccccggttcttctgcacatattggaag
B D       Crab-eating macaque  ccac-----------atatgggtaggcatcttcagagtcaataccccggttcttctgcacatattggaag
B D                    Baboon  ccac-----------atatgggtaggcatcttcagagtcaataccccggttcttctgcacatattggaag
B D              Green monkey  ccac-----------atatgggtaggcatcttcagagtcaataccccggttcttctgcacatattggaag
B D                  Marmoset  ccac-----------atatgggtaggcatcttcagaatcaataccccggttcttctgcacatactggaag
B D           Squirrel monkey  ccac-----------atatgggtaggcatcttcagagtcaataccccggttcttctgcacatactggaag
B D                  Bushbaby  ccac-----------atatgggtaggcatcttcagagtcaatgccccggttcttctgcacatactggaaa
           Chinese tree shrew  ccac-----------atatggataggcatcttcagagtcaataccccggttcttctgaacatactggaaa
B D                  Squirrel  ccac-----------atatgggtaggcatcttcagagtcaataccgtggttcttctgcacgtattggaag
       Lesser Egyptian jerboa  ccac-----------gtacgggtaagcgtcctccgagtcaatgccacggttcctctgcacgtactggaag
                 Prairie vole  ccac-----------gtatggataagcatcttcagagtcaatgcccccattcgtctgcacatagcggaag
B D           Chinese hamster  ccac-----------atatggataagcatcttcagagtcaatgcccccattcgtctgcacataccggaag
               Golden hamster  ccac-----------atatggatatgcatcctcagagtcaatgcccccattcgtctgcacataccggaag
B D                     Mouse  ccac-----------atatgggtaagcatcttcagagtcaatgcctccgttctgctgcacgtattggaag
B D                       Rat  ccac-----------atacgggtaagcgtcttcagagtcaatgcctccattctgctgcacatattggaag
B D            Naked mole-rat  ccac-----------gtacgggtaggcgtcctcggagtcgatgccccggttctgctgcacgtactggaag
B D                Guinea pig  ccac-----------gtagggataggcgtcctcagagtcaatgccacggttctcttgcacatactgaaag
                   Chinchilla  ccac-----------atacgggtaggcatcttcagagtcaatgccccggttctcctgcacgtactggaaa
             Brush-tailed rat  ccac-----------gtatggataggcgtcttcagagtcgatgccccgattttcctgcacgtactggaag
B D                    Rabbit  ccac-----------gtaggggtaggcatcttcagagtcaatgccccggttcctctgcacatactggaag
B D                      Pika  ccac-----------gtacgggtaggcgtcttctgagtcaatgccccggttcctctgcacatactggaag
B D                       Pig  ccac-----------gtatgggtaggcatcttctgagtcaatgccacggttcttctgcacatactggaag
B D                    Alpaca  ccac-----------atatgggtaggcatcttcagagtcaatgccccggttcttctgcacatactggaag
               Bactrian camel  ccac-----------atatgggtaggcatcttcagagtcaatgccccggttcttctgcacatactggaag
B D                   Dolphin  caac-----------atacgggtaggcatcttcagagtcaatgccccggttcttctgcacatactggaag
                 Killer whale  caac-----------atacgggtaggcatcttcagagtcaatgccccggttcttctgcacatactggaag
             Tibetan antelope  caac-----------gtacgggtaggcatcttcagagtcaatgccccggttcttctgcacatactggaag
B D                       Cow  caac-----------atatggataggcatcttcagagtcaatgcctcggttcttctgcacatactggaag
B D                     Sheep  caac-----------atacgggtaggcatcttcagagtcaatgccccggttcttctgcacatactggaag
                Domestic goat  caac-----------atacgggtaggcatcttcagagtcaatgccccggttcttctgcacatactggaag
B D                     Horse  ccac-----------atatgggtaggcatcttcagagtcaatgccccggttcttctgcacatactggaag
B D          White rhinoceros  ccac-----------atatgggtaggcatcttcagagtcaatgccccggttcttctgcacatactggaag
B D                       Cat  ccac-----------atacgggtaggcatcttcagagtcaatgcccctgtttttctgcacatactggaag
B D                       Dog  ccac-----------atatgggtaggcatcttcagagtcaatgccccggttcttctgcacatactggaag
B D                   Ferret   ccac-----------atatgggtaagcatcttcagagtcaatgcctcggttcttctgcacatactggaag
B D                     Panda  ccac-----------atatgggtaggcatcttcagagtcaatgccccggttcttctgcacatactggaag
               Pacific walrus  ccac-----------atatgggtaggcatcttcagagtcaatgccccggttcttctgcacatactggaag
                 Weddell seal  ccac-----------atatgggtaggcatcttcagagtcaatgccccggttcttctgcacatactggaag
             Black flying-fox  ccac-----------gtacgggtaggcgtcttcggagtcgatgccccggttcttctgcacatactggaag
B D                   Megabat  ccac-----------gtacgggtaggcgtcttcggagtcgatgccccggttcttctgtacatactggaag
                Big brown bat  ccac-----------atatgggtaggcgtcttcggagtcaatgccccggttcttctgcacatactggaag
         David's myotis (bat)  ccac-----------atatgggtaggcatcttcggagtcaatgccccggttcctttgcacgtactggaag
B D                  Microbat  ccac-----------atacgggtaggcatcttcggagtcaatgccccggttcctttgcacatactggaag
B D                  Hedgehog  ccac-----------atatgggtaggcatcttcagagtcgataccccggttcttctgcacatactggaag
B D                     Shrew  ccac-----------gtatgggtaggcatcctcagagtcaatgccccggttctcctgtacgtactggaaa
              Star-nosed mole  ccac-----------gtaggggtaggcgtcctccgagtcgatgccgcggttcctctgcacgtactggaag
B D                  Elephant  ccac-----------atatgggtaggcatcttcagagtcaatgccccggttcttctgcacatactgaaag
          Cape elephant shrew  ccac-----------atatgggtaggcatcttcagagtcaatgccccggttcctctgcacatactgaaag
B D                   Manatee  ccac-----------gtacgggtaggcatcttcagagtcgatgccccggttcttctgcacatactgaaag
             Cape golden mole  cgac-----------gtaggggtaggcatcttcagagtcaataccccggttcttctgcacatactgaaag
B D                    Tenrec  ccac-----------atatggataggcatcttcagagtcaatgccccggttcctctgcacatactgaaag
                     Aardvark  ccac-----------gtatgggtaggcatcttcagagtcaatgccccggttcttctgcacatactgaaag
B D                 Armadillo  ccac-----------atatgggtaggcatcttcagagtcaatgccccggttcttctgaacatactggaag
B D                   Opossum  caat-----------gtaagggtaagcatcttcagagtctatgccccggttcttctgcacatactggaag
B D           Tasmanian devil  caat-----------ataagggtaagcatcttcagagtcgatgcccctgttctcctgtacatactggaag
B D                   Wallaby  cgat-----------gtaagggtaagcatcttccgaatctatgcctcggttctcctgcacatactggaag
B D                  Platypus  cgac-----------gtaggggtaggcgtcctctgagtcgatgccacggttgtcatggacgtactggaag
  D               Rock pigeon  cgat-----------gtaggggtaggcgtcctcggagtcgatgccgcggttctgccgcacgtactcgaag
  D              Saker falcon  cagt-----------gtatgggtacgactcctctgaatcaattccaccattatcctgcacatactggaaa
  D          Peregrine falcon  cgat-----------gtaagggtaggcgtcctccgagtcgatgccgcggttctgccggacgtagtcgaag
  D       Collared flycatcher  cagt-----------gtatgggtaggattcctctgaatcaatgcccccgttatcctgcacgtattggaaa
  D    White-throated sparrow  cagt-----------atatggataggattcctctgaatcaatgcccccattatcctgtatgtattggaaa
B D       Medium ground finch  caat-----------gtaggggtaggagtcctcggagtcgatgccgcggttctggcggacgtactcgaag
B D               Zebra finch  cagt-----------gtatgggtaggattcctctgaatcaatgcccccattatcctgtacgtattggaaa
           Tibetan ground jay  caat-----------gtaggggtaggagtcctcggagtcgatgccgcggttctgccgcacgtactcgaag
B D                Budgerigar  ctat-----------gtagggataggagtcctcggagtcgatgccgcggttgtgccgcacgtactcgaag
  D                    Parrot  cgat-----------gtaggggtaggcatcctcggagtcgatgccgcggttctgccgcacgtactcgaag
  D             Scarlet macaw  ccac-----------gtaggggtaggcgtcctcggagtcgatgccgcggttctgccgcacgtactcgaag
  D              Mallard duck  caat-----------gtaggggtaggcatcctctgaatctatgccgcggttctgccggacgtactcgaag
B D                   Chicken  cgat-----------gtaggggtacgcgtcctccgagtcgatgccgcggttcaggcggacgtattcgaag
B D                    Turkey  ccttactgtggcctggtaggggtagacgtgctcggagttcatgccaccattgtcatgcacatactggaag
B D        American alligator  ccac-----------gtaggggtaggcatcctcagagtcgatgccgcggttcgtgtgcacgtactcgaag
  D           Green seaturtle  ctgt-----------gtacggataggaagcgtctgaatcaatgccgtcattatcaatgatgtactggaag
  D            Painted turtle  cgat-----------gtaggggtaagagtcctccgagtcgatgcccctgttctccttcacgtactcgaag
  D  Chinese softshell turtle  cgac-----------gtaggggtaggagtcctccgagtcaatgcccctgttctccttcacgtactcgaag
  D    Spiny softshell turtle  cttc-----------atatgggtaggacatttctgaatcaatgccattgttgtctataacatatctgaaa
B D                    Lizard  caat-----------gtatggataggtatcatccgaatcaattccccggttcacatggacatattcaaag
B D             X. tropicalis  caac-----------atatggataagcgttctccgagtcaatccccttgttatctcgaacatactcaaag
B D                Coelacanth  cgac-----------ataggggtatgcagcatccgagtcaattcccttgttttccttcacatattcaaac
B D                 Tetraodon  ccag-----------gtacgggtaggaagcctcagagtccagaccgccgttgtccttgatgtactggaag
B D                      Fugu  ccag-----------gtatggataagactcctcggagtccagaccgccgttgtccttgatgtactggaaa
       Yellowbelly pufferfish  cgac-----------gtacgggtaagatgcctcagagtcgatgcctccgttcgtggccacgtatctgaag
B D              Nile tilapia  ccag-----------gtaagggtaggactcctcagagtccaggccctggttgtccttgacgtactggaag
          Princess of Burundi  ctgt-----------atatgggtatgaagcatcagagtcgattccgtggttgtcgatgacatactggaaa
        Burton's mouthbreeder  ctgt-----------atatgggtatgaagcatcagagtcgattccgtggttgtcgatgacatactggaaa
                  Zebra mbuna  ctgt-----------atatgggtatgaagcatcagagtcgattccgtggttgtcgatgacatactggaaa
          Pundamilia nyererei  ctgt-----------atatgggtatgaagcatcagagtcgattccgtggttgtcgatgacatactggaaa
B D                    Medaka  ccat-----------gtaggggtaagctgcctcagagtcgatgcccccattttcctgtacatatttgaaa
           Southern platyfish  cgac-----------atatgggtagacttcctccgagtcaatacctccattctcctgcacatagctgaag
B D               Stickleback  c--------------gtaggggtagaagctctcggagtctacgcctcggttgcggatgatgtatctgaag
B D              Atlantic cod  caac-----------gtaggggtaggactcgtcagagtcgatgcctccattctgcatgacgtagctgaag
B D                 Zebrafish  caac-----------gtaggggtagctctcctctgaatcaatgccttggttgttgctgacgtatctgaag
     Mexican tetra (cavefish)  caac-----------gtatggataggcctcctcagaatcaatgcctttgttggtcttgacgtaattaaag
                  Spotted gar  ccac-----------gtaagggtaggactcctcggagtcgatgccgcggttggtcatgacgtacttgaag
B D                   Lamprey  cagt-----------gtacgggtaggccgcctccgagtcaatgcctccgttgtccttgacgtattggaag

                        Human  gcattggtca
                        Chimp  gcattggtca
                      Gorilla  gcattggtca
                    Orangutan  gcattggtca
                       Gibbon  gcattggtca
                       Rhesus  gcattggtca
          Crab-eating macaque  gcattggtca
                       Baboon  gcattggtca
                 Green monkey  gcattggtca
                     Marmoset  gcattggtca
              Squirrel monkey  gcattggtca
                     Bushbaby  gcattggtca
           Chinese tree shrew  gcattggtca
                     Squirrel  gcaatggtca
       Lesser Egyptian jerboa  gcattggtca
                 Prairie vole  gcagtggtca
              Chinese hamster  gcagtggtca
               Golden hamster  gcggtggtca
                        Mouse  gcagtggtca
                          Rat  gcagtggtca
               Naked mole-rat  gcgttggtca
                   Guinea pig  gcgttggtca
                   Chinchilla  gcgttggtca
             Brush-tailed rat  gcattagtca
                       Rabbit  gcattggtca
                         Pika  gcgttggtca
                          Pig  gcattggtca
                       Alpaca  gcattggtca
               Bactrian camel  gcattggtca
                      Dolphin  gcattggtca
                 Killer whale  gcattggtca
             Tibetan antelope  gcattggtca
                          Cow  gcattggtca
                        Sheep  gcattggtca
                Domestic goat  gcattggtca
                        Horse  gcatttgtca
             White rhinoceros  gcatttgtca
                          Cat  gcattggtca
                          Dog  gcattggtca
                      Ferret   gcattggtca
                        Panda  gcattggtca
               Pacific walrus  gcattggtca
                 Weddell seal  gcattggtca
             Black flying-fox  gcgttggtca
                      Megabat  gcgttggtca
                Big brown bat  gcattggtca
         David's myotis (bat)  gcattggtca
                     Microbat  gcattggtca
                     Hedgehog  gcattggtca
                        Shrew  gcgttggtca
              Star-nosed mole  gcgctggtca
                     Elephant  gcattggtca
          Cape elephant shrew  gcattggtca
                      Manatee  gcattggtca
             Cape golden mole  gcattggtca
                       Tenrec  gcattggtca
                     Aardvark  gcattggtca
                    Armadillo  gcattggtca
                      Opossum  gcattggtca
              Tasmanian devil  gcattggtca
                      Wallaby  gcattggtca
                     Platypus  gcgttggtca
                  Rock pigeon  gcgttggtca
                 Saker falcon  gcctggtcca
             Peregrine falcon  gcgttggtca
          Collared flycatcher  gcctggtcca
       White-throated sparrow  gcctggtcca
          Medium ground finch  gcgttggtca
                  Zebra finch  gcctggtcca
           Tibetan ground jay  gcgttggtca
                   Budgerigar  gcgttggtca
                       Parrot  gcgttggtca
                Scarlet macaw  gcgttggtca
                 Mallard duck  gcgttggtca
                      Chicken  gcgttggtca
                       Turkey  gcacgggtca
           American alligator  gcgttggtca
              Green seaturtle  gcttgggtca
               Painted turtle  gcgttggtca
     Chinese softshell turtle  gcgttggtca
       Spiny softshell turtle  gcattagtca
                       Lizard  gcgttggtca
                X. tropicalis  gcattggtca
                   Coelacanth  gcgttggtca
                    Tetraodon  gcctggtcca
                         Fugu  gcctggtcca
       Yellowbelly pufferfish  gcgttggtca
                 Nile tilapia  gcctggtcca
          Princess of Burundi  gctcgggtca
        Burton's mouthbreeder  gctcgggtca
                  Zebra mbuna  gctcgggtca
          Pundamilia nyererei  gctcgggtca
                       Medaka  gcgttggtca
           Southern platyfish  gcgttggtca
                  Stickleback  gatttggaga
                 Atlantic cod  gcgttggtca
                    Zebrafish  gcgtttgtca
     Mexican tetra (cavefish)  gcattggtca
                  Spotted gar  gcgttggtca
                      Lamprey  gcctggtcca

Alignment block 8 of 289 in window, 150804095 - 150804099, 5 bps 
B D                     Human  tgtag
B D                     Chimp  tgtag
B D                   Gorilla  tgtag
B D                 Orangutan  tgtag
B D                    Gibbon  tgtag
B D                    Rhesus  tgtag
B D       Crab-eating macaque  tgtag
B D                    Baboon  tgtag
B D              Green monkey  tgtag
B D                  Marmoset  tgtag
B D           Squirrel monkey  tgtag
B D                  Bushbaby  tgtag
           Chinese tree shrew  tatat
B D                  Squirrel  tgtaa
       Lesser Egyptian jerboa  tgtag
                 Prairie vole  tatag
B D           Chinese hamster  tatag
               Golden hamster  tatag
B D                     Mouse  tatag
B D                       Rat  tatag
B D            Naked mole-rat  tgtag
B D                Guinea pig  tatag
                   Chinchilla  tgtag
             Brush-tailed rat  tgtag
B D                    Rabbit  tgtag
B D                      Pika  tgtag
B D                       Pig  tgtag
B D                    Alpaca  tgtag
               Bactrian camel  tgtag
B D                   Dolphin  tgtag
                 Killer whale  tgtag
             Tibetan antelope  tatag
B D                       Cow  tatag
B D                     Sheep  tatag
                Domestic goat  tatag
B D                     Horse  tgtag
B D          White rhinoceros  tgtag
B D                       Cat  tgtag
B D                       Dog  tgtag
B D                   Ferret   tgtag
B D                     Panda  tgtat
               Pacific walrus  tgtag
                 Weddell seal  tgtag
             Black flying-fox  tgtag
B D                   Megabat  tgtag
                Big brown bat  tgtag
         David's myotis (bat)  tgtag
B D                  Microbat  tgtag
B D                  Hedgehog  tgtag
B D                     Shrew  tgtag
              Star-nosed mole  tgtag
B D                  Elephant  tatag
          Cape elephant shrew  tatag
B D                   Manatee  tatag
             Cape golden mole  tatag
B D                    Tenrec  taaag
                     Aardvark  tataa
B D                 Armadillo  tgtaa
B D                   Opossum  tgtag
B D           Tasmanian devil  tatag
B D                   Wallaby  tatat
B D                  Platypus  tgtag
  D               Rock pigeon  tgaga
  D              Saker falcon  tgaga
  D          Peregrine falcon  tgtag
  D       Collared flycatcher  taaga
  D    White-throated sparrow  tgaga
B D       Medium ground finch  tgtag
B D               Zebra finch  tgaga
           Tibetan ground jay  tgtac
B D                Budgerigar  tgtac
  D                    Parrot  tgtac
  D             Scarlet macaw  tgtac
  D              Mallard duck  tgtag
B D                   Chicken  tataa
B D                    Turkey  tgtag
B D        American alligator  tgtag
  D           Green seaturtle  taaat
  D            Painted turtle  tgtag
  D  Chinese softshell turtle  tgtag
  D    Spiny softshell turtle  tatag
B D                    Lizard  tgtag
B D             X. tropicalis  tgtag
B D                Coelacanth  tgtag
B D                 Tetraodon  tcaga
B D                      Fugu  tcagc
       Yellowbelly pufferfish  tgtat
B D              Nile tilapia  tcaga
          Princess of Burundi  tgaag
        Burton's mouthbreeder  tgaag
                  Zebra mbuna  tgaag
          Pundamilia nyererei  tgaag
B D                    Medaka  tgtac
           Southern platyfish  tgtat
B D               Stickleback  tgtat
B D              Atlantic cod  tgtag
B D                 Zebrafish  tatat
     Mexican tetra (cavefish)  tgtat
                  Spotted gar  tgtag
B D                   Lamprey  tgagg

Inserts between block 8 and 9 in window
  D          Green seaturtle 71683bp

Alignment block 9 of 289 in window, 150804100 - 150804102, 3 bps 
B D                     Human  ccc
B D                     Chimp  ccc
B D                   Gorilla  ccc
B D                 Orangutan  ccc
B D                    Gibbon  ccc
B D                    Rhesus  ccc
B D       Crab-eating macaque  ccc
B D                    Baboon  ccc
B D              Green monkey  ccc
B D                  Marmoset  ccc
B D           Squirrel monkey  ccc
B D                  Bushbaby  ccc
           Chinese tree shrew  ccc
B D                  Squirrel  cct
       Lesser Egyptian jerboa  ccc
                 Prairie vole  ccg
B D           Chinese hamster  ccg
               Golden hamster  ccg
B D                     Mouse  ccg
B D                       Rat  ccg
B D            Naked mole-rat  ccg
B D                Guinea pig  cca
                   Chinchilla  cct
             Brush-tailed rat  cct
B D                    Rabbit  ccc
B D                      Pika  cct
B D                       Pig  ccc
B D                    Alpaca  ccc
               Bactrian camel  ccc
B D                   Dolphin  ccc
                 Killer whale  ccc
             Tibetan antelope  ccc
B D                       Cow  ccc
B D                     Sheep  ccc
                Domestic goat  ccc
B D                     Horse  ccc
B D          White rhinoceros  ccc
B D                       Cat  ccc
B D                       Dog  cct
B D                   Ferret   ccc
B D                     Panda  ccc
               Pacific walrus  ccc
                 Weddell seal  ccc
             Black flying-fox  ccc
B D                   Megabat  ccc
                Big brown bat  ccc
         David's myotis (bat)  ccc
B D                  Microbat  ccc
B D                  Hedgehog  ccc
B D                     Shrew  ccc
              Star-nosed mole  ccg
B D                  Elephant  ccc
          Cape elephant shrew  cct
B D                   Manatee  ccc
             Cape golden mole  ccc
B D                    Tenrec  cct
                     Aardvark  ccc
B D                 Armadillo  ccc
B D                   Opossum  ccc
B D           Tasmanian devil  ccc
B D                   Wallaby  ccc
B D                  Platypus  ccg
  D               Rock pigeon  cc-
  D              Saker falcon  cc-
  D          Peregrine falcon  cc-
  D       Collared flycatcher  cc-
  D    White-throated sparrow  cc-
B D       Medium ground finch  cc-
B D               Zebra finch  cc-
           Tibetan ground jay  cc-
B D                Budgerigar  cc-
  D                    Parrot  cc-
  D             Scarlet macaw  cc-
  D              Mallard duck  cc-
B D                   Chicken  cc-
B D                    Turkey  cc-
B D        American alligator  cc-
  D            Painted turtle  cc-
  D  Chinese softshell turtle  cc-
  D    Spiny softshell turtle  cc-
B D                    Lizard  cc-
B D             X. tropicalis  cct
B D                Coelacanth  cca
B D                 Tetraodon  ccg
B D                      Fugu  ccg
       Yellowbelly pufferfish  ccg
B D              Nile tilapia  cct
          Princess of Burundi  ccc
        Burton's mouthbreeder  cct
                  Zebra mbuna  cct
          Pundamilia nyererei  cct
B D                    Medaka  ccg
           Southern platyfish  cca
B D               Stickleback  cct
B D              Atlantic cod  cct
B D                 Zebrafish  cct
     Mexican tetra (cavefish)  cca
                  Spotted gar  ccc
B D                   Lamprey  ccg
  D           Green seaturtle  ===

Inserts between block 9 and 10 in window
  D              Rock pigeon 1bp
  D         Peregrine falcon 1bp
  D      Collared flycatcher 1bp
  D   White-throated sparrow 1bp
B D      Medium ground finch 1bp
B D              Zebra finch 1bp
          Tibetan ground jay 1bp
B D               Budgerigar 1bp
  D                   Parrot 1bp
  D            Scarlet macaw 1bp
  D             Mallard duck 1bp
B D                  Chicken 1bp
B D                   Turkey 1bp
B D       American alligator 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp
  D   Spiny softshell turtle 1bp
B D                   Lizard 1bp

Alignment block 10 of 289 in window, 150804103 - 150804184, 82 bps 
B D                     Human  cctccaca---------gcc----atcattc------tc-----ag------aca-cacaatccactagg
B D                     Chimp  cctccaca---------gcc----atcattc------tc-----ag------aca-cacaatccactagg
B D                   Gorilla  cctccaca---------gcc----atcattc------tc-----ag------aca-cacaatccactagg
B D                 Orangutan  cctccaca---------gcc----atcattc------tc-----ag------aca-cacaatccactagg
B D                    Gibbon  cctccaca---------gcc----atcattc------tc-----ag------aca-cacaatccactagg
B D                    Rhesus  cctccgca---------gcc----atcattc------tc-----ag------aca-cacaatccactagg
B D       Crab-eating macaque  cctccgca---------gcc----atcattc------tc-----ag------aca-cacaatccactagg
B D                    Baboon  cctccgca---------gcc----atcattc------tc-----ag------aca-cacaatccactagg
B D              Green monkey  cctccgca---------gcc----atcattc------tc-----ag------aca-cacaatccactagg
B D                  Marmoset  cctccgca---------gcc----atcattc------tc-----ag------aca-cacaatccactagg
B D           Squirrel monkey  cctccgca---------gcc----atcgttc------tc-----ag------aca-cacaatccactagg
B D                  Bushbaby  cctccaca---------gcc----atcattg------tc-----ag------aca-cacaatccaccagg
           Chinese tree shrew  cctccgca---------gcc----atcattc------tc-----ag------aca-cacaatccaccagg
B D                  Squirrel  cctccaca---------gcc----atcattc------tc-----ag------aca-cacaatccaccaga
       Lesser Egyptian jerboa  cctccaca---------gcc----atcattg------tc-----ag------aca-cacagtccaccagg
                 Prairie vole  cccccaca---------gcc----ataattc------tc-----ag------aca-cacaatccacaagg
B D           Chinese hamster  cctccaca---------gcc----gtaattc------tc-----ag------aca-cacaatccacaaga
               Golden hamster  cctccaca---------gcc----gtaattc------tc-----ag------aca-cacaatccacaaga
B D                     Mouse  cctccaca---------gcc----ataattc------tc-----ag------tca-cacagtccacaaga
B D                       Rat  cctccaca---------gcc----atagttc------tc-----ag------aca-cacagtccacaaga
B D            Naked mole-rat  cctccaca---------gcc----gtcattc------tc-----ag------aca-cacagtccaccagg
B D                Guinea pig  cctccaca---------gcc----atcattc------tc-----ag------ata-cacaatccaccaga
                   Chinchilla  cctccaca---------gcc----gttgttc------tc-----ag------ata-cacaatccaccagg
             Brush-tailed rat  cctccaca---------gcc----attattc------tc-----ag------aca-cacaatccaccagg
B D                    Rabbit  cctccaca---------gcc----ataattc------tc-----ag------aca-cacaatccaccagg
B D                      Pika  cctccaca---------gcc----gtcattc------tc-----ag------aca-cacagtccaccagg
B D                       Pig  cctccaca---------gcc----atcattc------tc-----ag------aca-cacaatccaccagg
B D                    Alpaca  cctccgca---------gcc----gtcattc------tc-----ag------aca-cacagtccaccagg
               Bactrian camel  cctccgca---------gcc----atcattc------tc-----ag------aca-cacagtccaccagg
B D                   Dolphin  cctccaca---------gcc----atcattc------tc-----ag------aca-cacagtccaccagg
                 Killer whale  cctccaca---------gcc----atcattc------tc-----ag------aca-cacagtccaccagg
             Tibetan antelope  cctccgca---------gcc----atcattc------tc-----ag------aca-cacaatccaccagg
B D                       Cow  cctccaca---------gcc----atcattc------tc-----ag------aca-cacagtccaccagg
B D                     Sheep  cctccgca---------gcc----atcattc------tc-----ag------aca-cacaatccaccagg
                Domestic goat  cctccgca---------gcc----atcattc------tc-----ag------aca-cacaatccaccagg
B D                     Horse  cctccgca---------gcc----atcattc------tc-----ag------ata-cgcaatccaccagg
B D          White rhinoceros  cctccgca---------gcc----atcattc------tc-----ag------aca-cacaatccaccagg
B D                       Cat  cctccgca---------gcc----atcattc------tc-----ag------aaa-cacaatccacaagg
B D                       Dog  cctccaca---------gcc----atcattc------tc-----ag------aga-cacagtccaccagg
B D                   Ferret   cctccaca---------gcc----atcattt------tc-----ag------aaa-cacagtccaccagg
B D                     Panda  cctccaca---------gcc----atcattc------tc-----ag------aaa-cacaatccaccagg
               Pacific walrus  cctccgca---------gcc----atcattc------tc-----ag------aaa-cacagtctaccagg
                 Weddell seal  cctccgca---------gcc----atcattc------tc-----ag------aaa-cacagtccaccagg
             Black flying-fox  cctccaca---------gcc----atcgttc------tc-----ag------aca-cacagtccaccagg
B D                   Megabat  cctccaca---------gcc----atcattc------tc-----ag------aca-cacagtccaccagg
                Big brown bat  cctccgca---------gcc----atcattc------tc-----ag------aca-cacaatccaccagg
         David's myotis (bat)  cctccgca---------gcc----atcattc------tc-----ag------aca-cacaatccaccagg
B D                  Microbat  cctccgca---------gcc----atcattc------tc-----ag------aca-cacaatccaccagg
B D                  Hedgehog  cctccgca---------gcc----atcattc------tc-----ag------aca-cacaatctaccagg
B D                     Shrew  ccaccgca---------gcc----atcattc------tc-----ag------aaa-cacagtccaccagg
              Star-nosed mole  ccgcggca---------gcc----gtcgttc------tc-----gg------aca-cacagtccaccagg
B D                  Elephant  cctccgca---------gcc----atcattc------tc-----ag------aca-cacaatccaccagg
          Cape elephant shrew  cctccaca---------acc----atcgttt------tc-----ag------aca-cacaatctaccaga
B D                   Manatee  cctctgca---------gcc----atcattc------tc-----ag------aca-cacaatccaccagg
             Cape golden mole  cctccaca---------gcc----atcgttc------tc-----ag------aca-cgcagtccacgagg
B D                    Tenrec  cctccaca---------gcc----atcattc------tc-----ag------aca-cacaatccaccaga
                     Aardvark  cctccgca---------gcc----atcattc------tc-----ag------ata-cacaatccaccagg
B D                 Armadillo  cctccaca---------acc----atcattc------tc-----ag------aca-cacaatccaccagg
B D                   Opossum  ccaccaca---------gcc----atcattt------tc-----ag------aca-cacagtccacaagg
B D           Tasmanian devil  ccaccaca---------gcc----atcattt------tt-----gg------aca-cacagtccacaagg
B D                   Wallaby  ccaccaca---------acc----atcattt------tt-----gg------aca-cacagtccactagg
B D                  Platypus  ccgccgca---------gcc----gtcgttg------ct-----gg------cca-cgcagtctaccaga
  D               Rock pigeon  ccattgca---------gcc----ttgattc------ccttcaggg------cgagagcagtccaccaaa
  D              Saker falcon  ccgccgca---------gcc----gtcgttg------tt-----gg------cca-cacaatccaccacc
  D          Peregrine falcon  -----gca---------gcc----gtcgttg------tt-----gg------cca-cacaatccaccagg
  D       Collared flycatcher  ccattaca---------acc----ttgattc------ccctcaggg------cgagagcagtccaccaga
  D    White-throated sparrow  ccattaca---------gcc----ttgattc------ccctcaggg------cgagagcagtccaccaga
B D       Medium ground finch  ccaccgca---------gcc----atcgttg------tt-----gg------cca-cgcagtccaccagg
B D               Zebra finch  ccattaca---------acc----ttgattc------ccctcaggg------cgagagcagtccaccaga
           Tibetan ground jay  cccccgca---------gcc----gtcgttg------tt-----ag------cca-cacaatccaccagg
B D                Budgerigar  ccaccaca---------acc----atcattg------gt-----gg------cca-cacagtccaccagg
  D                    Parrot  ccgccgca---------gcc----gtcgttg------ct-----gg------cca-cgcagtccaccagg
  D             Scarlet macaw  ccgccgca---------gcc----gtcgttg------tt-----gg------cca-cgcagtccaccagg
  D              Mallard duck  ccaccgca---------gcc----gttgttg------tt-----gg------cca-cacagtccaccagg
B D                   Chicken  cccccgca---------gcc----gttgttg------tt-----gg------aga-cgcagtccaccaaa
B D                    Turkey  ccttggca---------acc----gttgttgcccagctt-----cc------ggg-agcagtcaatgagg
B D        American alligator  ccaccgca---------gcc----gtcgttg------tt-----gg------tca-cgcagtccaccagg
  D           Green seaturtle  ccccctct---------gcccccagtcattc------tt-----gg------tga-cgcagtcgaccagg
  D            Painted turtle  cccccgca---------gcc----gtcgttg------tt-----gg------tca-cgcagtcgaccagg
  D  Chinese softshell turtle  cccccgca---------gcc----gtcgttt------tt-----gg------tca-cgcagtcgaccagg
  D    Spiny softshell turtle  ccactgcaaccataattgcc----atagctc------ct-----gg------t----acagtctactagg
B D                    Lizard  ccaccgca---------gcc----atcgttg------tt-----gc------tga-cgcagtccaccagg
B D             X. tropicalis  cctccaca---------tcc----atcattc------tt-----tt------tga-cacaatcaaccagg
B D                Coelacanth  ccaccgca---------ccc----gtcgttg------tc-----ct------tga-cgcagtcgaccagg
B D                 Tetraodon  ccgttgca---------gcc----ttcgttg------cc-----ctcgggtctgg-agcaatcgaccagg
B D                      Fugu  ccgttgca---------gcc----ctcgttg------cc-----ctctggtctgg-agcagtctaccagg
       Yellowbelly pufferfish  cctccgca---------gcc----atcgttc------tc-----------tttaa-cgcagtccaccagg
B D              Nile tilapia  ccgttgca---------gcc----ctcgtta------cc-----ctcgggtctgg-agcattccaccagg
          Princess of Burundi  ccgttgca---------gcc----gtggttg------cc-----atatttgccgg-aacaatccaccagg
        Burton's mouthbreeder  ccgttgca---------gcc----gtggttg------cc-----atatttgccgg-aacaatccaccagg
                  Zebra mbuna  ccgttgca---------gcc----gtggttg------cc-----atatttgccgg-aacaatccaccagg
          Pundamilia nyererei  ccgttgca---------gcc----gtggttg------cc-----atatttgccgg-aacaatccaccagg
B D                    Medaka  cccccaca---------gcc----gtcgttc------tc-----ag------tga-cacagtctaccagg
           Southern platyfish  cctccaca---------gcc----gtcgttt------tc-----ct------tga-cgcagtccaccagg
B D               Stickleback  cctctgca---------gcc----gtgattt------cc-----gtcgtcggtgc-tgcagtccaccagg
B D              Atlantic cod  cccccgca---------gcc----gctgttc------tc-----gg------tca-cacagtccaccagg
B D                 Zebrafish  ccaccaca---------gcc----gtcattt------tc-----tg------tca-cacagtccaccagg
     Mexican tetra (cavefish)  ccaccaca---------gcc----gtcattc------tc-----ct------tca-cgcagtccaccagg
                  Spotted gar  ccgccgca---------gcc----gtcgttt------tc-----ct------tca-cgcagtccaccagg
B D                   Lamprey  ccaccgca---------gcc----ctggttg------cc-----ctcggcccgcg-agcagtccaccagg

                        Human  ttctggggactcagatttaagagtttgccagttttcttcttga
                        Chimp  ttctggggactcagatttaagagtttgccagttttcttcttga
                      Gorilla  ttctggggactcagatttaagagtttgccagttttcttcttga
                    Orangutan  ttctggggactcagatttaacagtttgccagttttcttcttga
                       Gibbon  ttctggggactcagatttaagagtttgccagttttcttcttga
                       Rhesus  ttctggggactcagatttaagagtttgccagttttcttcttga
          Crab-eating macaque  ttctggggactcagatttaagagtttgccagttttcttcttga
                       Baboon  ttctggggactcagatttaagagtttgccagttttcttcttga
                 Green monkey  ttctggggactcagatttaagagtttgccagttttcttcttga
                     Marmoset  ttctggggactcagatttaggagtttgccagttttcttcttga
              Squirrel monkey  ttctggggactcagatttaggagtttgccagttttcttcttga
                     Bushbaby  ttctggggactcagatttaagagtttgccagttttcttcttga
           Chinese tree shrew  ttctggggactcagatttaagagtttgccggttttcttcttga
                     Squirrel  ttctggggactcagatttaagagtctgccagttttcttcttga
       Lesser Egyptian jerboa  ttctggggactcagatttaagagttttccagttttcttcttca
                 Prairie vole  ttctgaggactcagatttaagagtttgccagtcttcttcttga
              Chinese hamster  ttctgaggactgagatttaagagtttgcctgtcttcttcttga
               Golden hamster  ttctgcggactgagatttaagagtttgccagtcttcttcttga
                        Mouse  ttctggggactcagagctaagagtttaccagttttcttcttga
                          Rat  ttctggggactcagagctaagagtttgccagttttcttcttga
               Naked mole-rat  ttctggggactcagattcaagagtttgcctgttttcttcttga
                   Guinea pig  ttctgggggctcagatttaagagtttgcctgttttcttcttga
                   Chinchilla  ttctggggactcaaatttaagagtttgcccgttttcttcttga
             Brush-tailed rat  ttctggggactcaaatttaagagtttgcccgttttcttcttca
                       Rabbit  ttctgggggctcaggtttaagagtttgccagtcttcttcttga
                         Pika  ttctggggactcagatttaagagtttgccagttttcttcttga
                          Pig  ttctggggactcagatttaagagtttgccagttttcttcttga
                       Alpaca  ttctggggactcagatttaagagtttgccagttttcttcttga
               Bactrian camel  ttctggggactcagatttaagagtttgccagttttcttcttga
                      Dolphin  ttctgtggactcagatttaagagtttgccagttttcttcttga
                 Killer whale  ttctgtggactcagatttaagagtttgccagttttcttcttga
             Tibetan antelope  ttctgtggactcagatttaagagtttgccggttttcttcttga
                          Cow  ttctgaggactcagatttaagagtttgccagttttcttcttga
                        Sheep  ttctgtggactcagatttaagagtttgccggttttcttcttga
                Domestic goat  ttctgtggactcagatttaagagtttgccggttttcttcttga
                        Horse  ttctggggactcagatttaagagtttgccagttttcttcttga
             White rhinoceros  ttctggggactcagatttaagagtttgccagttttcttcttga
                          Cat  ttctggggactcagatttaagagtttgccagttttcttcttga
                          Dog  ttctggggactcagatttaagagtttgccagttttcttcttga
                      Ferret   ttctggggactcagatttaacagtttgccagttttcttcttga
                        Panda  ttctggggactcagatttaagagtttgccagttttcttcttga
               Pacific walrus  ttctgcggactcagatttaagagtttgccagttttcttcttga
                 Weddell seal  ttctgtggactcagatttaagagtttgccagttttcttcttga
             Black flying-fox  ttctggggactcaggttcaagagtttgccagttttcttcttga
                      Megabat  ttctggggactcaggttcaagagtttgccagttttcttcttga
                Big brown bat  ttttggggactaagatttaagagtttaccagttttcttcatga
         David's myotis (bat)  ttttggggactcagatttaagagtttaccagttttcttcatga
                     Microbat  ttttggggactcagatttaagagtttaccagttttcttcatga
                     Hedgehog  ttttggggactcagatttaagagtttgccagttttcttcttga
                        Shrew  ttctgggggctcaggtttaagagtttgcctgttttcttcttga
              Star-nosed mole  ttctgcggactgaggttcaggagcttgccggtcttcttcttga
                     Elephant  ttctggggactcagatttaagagttttccagttttcttcttga
          Cape elephant shrew  ttctggggactcagatttaagagttttccagttttcttcttga
                      Manatee  ttctggggactcagatttaagagttttccagtcttcttcttga
             Cape golden mole  ttctggggactcagatttaagagttttccagttttcttcttga
                       Tenrec  ttctgagggctcagacttaagagttttccagttttcttcttga
                     Aardvark  ttctggggactcagatttaagagtttcccagttttcttcttga
                    Armadillo  ttctggggactcagatttaagagtttgcctgttttcttcttga
                      Opossum  ttctgagggctcaagttaagtagtttaccagtcttcttcttga
              Tasmanian devil  ttctgggggctcaggttgaggagtttaccagtcttcttcttga
                      Wallaby  ttctgggggctcaggttgaggagtttaccagtcttcttcttga
                     Platypus  ttctgtgggctgaggtccagcaggcgccctgtcttcttcttta
                  Rock pigeon  ttctgttcactcagcgaaacaagtttgccagtttttctgaagt
                 Saker falcon  ttttgggggctgagggagagcagcttccccgtcttccgcttca
             Peregrine falcon  ttttgggggctgagggagagcagcttccccgtcttccgcttca
          Collared flycatcher  ttctgttcactcagtgaaacaagtttgccagttttcctgaagt
       White-throated sparrow  ttctgttcactcagtgaaacaagtttgccagtttttctgaagt
          Medium ground finch  ttctgggggctgagggacagcagtttgcctgttttcctcttca
                  Zebra finch  ttctgttcactcagtgaaacaagtttgccagtttttctgaagt
           Tibetan ground jay  ttttgggggctgagggacagcagcttccctgttttcctcttca
                   Budgerigar  ttctgggggctcagagccagcaggttcccagtccggcgcttga
                       Parrot  ttctgcgggctgagggacagcagcttccccgtcctgcgcttga
                Scarlet macaw  ttctgcgggctgagggacagcagcttccccgtcctgcgcttga
                 Mallard duck  ttttgagggctgagcgagagcagcttccctgtcttccgcttca
                      Chicken  ttctgggggctgagggacagcagtttccccgtccggcgcttca
                       Turkey  ttctgctcactcagcactgccagcttcctcgtccaattgaaga
           American alligator  ttctgggggctcagcgacagcagcttccccatccgccgcttca
              Green seaturtle  ttctgagggctgagagacagcatcttcccggtctgccgcttga
               Painted turtle  ttctgcgggctgagacccaggaccttccccgtctgccgcttga
     Chinese softshell turtle  ttctgggggctgagggagagcatcttcccggtgcggcgcttaa
       Spiny softshell turtle  ttctggggactaagtgacaacagacgccctgttttcttcttca
                       Lizard  ttttgcgggctcaggttcagaagtttccctgtcttcatcttga
                X. tropicalis  ttttgaggactgagatccacaagttttccttttttcttcttca
                   Coelacanth  ttctgggggctgaggacaaccacccgccccagcaccctcttca
                    Tetraodon  ttctgctcactcagcgacaccagcttcccggtctgcctgaagt
                         Fugu  ttctgctcgctcagcgacaccagtgtcccggtcttcctgaagt
       Yellowbelly pufferfish  ttctgggggctgaggtccaccagctttcccgtcttctttgcct
                 Nile tilapia  ttctgctcgctcagctgcaccatcttgccggtcttcctgaact
          Princess of Burundi  ttttgaggactgagatccaccagttttcctgtactcttggcta
        Burton's mouthbreeder  ttttgaggactgagatccaccagctttcctgtactcttggcta
                  Zebra mbuna  ttttgaggactgagatccaccagctttcctgtactcttggcta
          Pundamilia nyererei  ttttgaggactgagatccaccagctttcctgtactcttggcta
                       Medaka  ttctggggactcaggtcgacgaggttgccagtctttttagcca
           Southern platyfish  ttctgagggctgaggtcgatgagcttacccgtcttcttggcca
                  Stickleback  ttctgtgggctcagggggacaaggacacctgttcgcttcttaa
                 Atlantic cod  ttctgggggctcaggtcccgcagggtcccagtggtcttggcca
                    Zebrafish  ttctgaggactgaggtccaccagctgacctttggtcttcatca
     Mexican tetra (cavefish)  ttctgagggctaagctccaccagctggcctgtggtcttcatca
                  Spotted gar  ttctgcgggctgaggctgaccagctggccggtggtcttcttga
                      Lamprey  ttctgctcgctcagcgacaccagctggcccaccttcctcatgt

Alignment block 11 of 289 in window, 150804185 - 150804197, 13 bps 
B D                     Human  gttggccctccag
B D                     Chimp  gttggccctccag
B D                   Gorilla  gttggccctccag
B D                 Orangutan  gttggccctccag
B D                    Gibbon  gttggccctccag
B D                    Rhesus  gttggccctccag
B D       Crab-eating macaque  gttggccctccag
B D                    Baboon  gttggccctccag
B D              Green monkey  gttggccctccag
B D                  Marmoset  gttggccctccag
B D           Squirrel monkey  gttggccctccag
B D                  Bushbaby  gttggccctccag
           Chinese tree shrew  gttggccctctag
B D                  Squirrel  gttgaccctccag
       Lesser Egyptian jerboa  gctggccttccag
                 Prairie vole  gctggccctccag
B D           Chinese hamster  gttggccctccag
               Golden hamster  gttgaccctccag
B D                     Mouse  gttggccctccag
B D                       Rat  gttggccctccag
B D            Naked mole-rat  gctggccctccag
B D                Guinea pig  gctggccctcgag
                   Chinchilla  gttggccctccag
             Brush-tailed rat  gttggccctccag
B D                    Rabbit  gctggccctcgag
B D                      Pika  gctggccctccag
B D                       Pig  gttggccctccag
B D                    Alpaca  gctggccctccag
               Bactrian camel  gctggccctccag
B D                   Dolphin  gttggccctccag
                 Killer whale  gttggccctccag
             Tibetan antelope  gttggccctccag
B D                       Cow  gttggccctccag
B D                     Sheep  gttggccctccag
                Domestic goat  gttggccctccag
B D                     Horse  gctgaccctccag
B D          White rhinoceros  gttgtccctccag
B D                       Cat  gctggccctccag
B D                       Dog  gttggccctccag
B D                   Ferret   gttggccctccag
B D                     Panda  gttggccctcgag
               Pacific walrus  gttggccctccag
                 Weddell seal  gttggccctccag
             Black flying-fox  gctggccctccaa
B D                   Megabat  gctggccctccaa
                Big brown bat  gttgaccctccag
         David's myotis (bat)  gttgaccctccag
B D                  Microbat  gttgaccctccag
B D                  Hedgehog  gctggccctccag
B D                     Shrew  gttggccttcaag
              Star-nosed mole  gctggccctccag
B D                  Elephant  gttgaccttccag
          Cape elephant shrew  gttggccctccag
B D                   Manatee  gctggccttccag
             Cape golden mole  gttgaccctccaa
B D                    Tenrec  gttggccttctaa
                     Aardvark  gttggccctccag
B D                 Armadillo  gctggccttccag
B D                   Opossum  gctggccttccaa
B D           Tasmanian devil  gttggccttccaa
B D                   Wallaby  gttggccttccaa
B D                  Platypus  gctgcccctccag
  D               Rock pigeon  gctgcccctccag
  D              Saker falcon  gctgcccctccag
  D          Peregrine falcon  gctgcccctccag
  D       Collared flycatcher  gctgcccttcaag
  D    White-throated sparrow  gctgcccttcaag
B D       Medium ground finch  gctgcccctccag
B D               Zebra finch  gctgcccttcaag
           Tibetan ground jay  gctgcccctccag
B D                Budgerigar  gctgcccctccag
  D                    Parrot  gctgcccctccag
  D             Scarlet macaw  gctgcccctccag
  D              Mallard duck  gctgcccctccag
B D                   Chicken  gctgcccctccag
B D                    Turkey  caagtccctccag
B D        American alligator  gctgcccctccag
  D           Green seaturtle  gctgcccctccag
  D            Painted turtle  gctgcccctccag
  D  Chinese softshell turtle  gctggccctccag
  D    Spiny softshell turtle  gttgtccttctaa
B D                    Lizard  gctgcgcttccaa
B D             X. tropicalis  gttgtccttccag
B D                Coelacanth  tctggccctccag
B D                 Tetraodon  gctggccctccag
B D                      Fugu  gctgcccctccat
       Yellowbelly pufferfish  gcatgccctcaag
B D              Nile tilapia  gttgaccctccag
          Princess of Burundi  actggccttccag
        Burton's mouthbreeder  actggccttccag
                  Zebra mbuna  actggccttccag
          Pundamilia nyererei  actggccttccag
B D                    Medaka  actggccctccag
           Southern platyfish  gctggccctcaag
B D               Stickleback  tctgtccctcaag
B D              Atlantic cod  gctggccctccag
B D                 Zebrafish  gctggccttcaag
     Mexican tetra (cavefish)  gctgcccttccaa
                  Spotted gar  gctggccctccag
B D                   Lamprey  gctgcccctcgag

Inserts between block 11 and 12 in window
B D               Budgerigar 4388bp

Alignment block 12 of 289 in window, 150804198 - 150804242, 45 bps 
B D                     Human  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D                     Chimp  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D                   Gorilla  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D                 Orangutan  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D                    Gibbon  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D                    Rhesus  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D       Crab-eating macaque  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D                    Baboon  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D              Green monkey  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D                  Marmoset  ggcacccacagagctgaaagcccaacaggaaccacactgaccc-t--g
B D           Squirrel monkey  ggcacccacagagctgaaagcccaacaggaaccacactgaccc-t--g
B D                  Bushbaby  ggcacccacagagctaaatgcccaacaggaaccacactgaccc-t--a
           Chinese tree shrew  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D                  Squirrel  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
       Lesser Egyptian jerboa  ggcacccacagagctgaaagcccaacaggaaccacactgaccc-t--g
                 Prairie vole  ggcacctgcagagctaaaagcccaacaggaaccacagtcaccc-t--g
B D           Chinese hamster  ggcacctgcagagctaaaagcccaacaggaaccacactcaccc-t--g
               Golden hamster  ggcacccgcagagctaaaagcccaacaggaaccacactcaccc-t--g
B D                     Mouse  ggccccggcagagctgaaagcccaacaggaaccacactggccc-t--g
B D                       Rat  ggcacccgcagagctgaaagcccaacaggaaccacactggccc-t--g
B D            Naked mole-rat  ggcacccacagagctgaaagcccagcaggaaccgcactgaccc-t--g
B D                Guinea pig  ggcacccacagagctgaaagcccaacaggaaccacactgaccc-t--g
                   Chinchilla  ggcacccacagagctgaaagcccaacaggaaccacactgaccc-t--g
             Brush-tailed rat  ggcacccacagaactgaaagcccaacaggaaccacactgaccc-t--g
B D                    Rabbit  ggcacccacagagctgaaagcccaacaggaaccacactgaccctt--a
B D                      Pika  ggcacccacagagctaaaagcccaacaggaaccgcactgaccc-t--g
B D                       Pig  ggcccccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D                    Alpaca  ggcacccacagagctgaaagcccaacaggaaccacactgaccc-t--g
               Bactrian camel  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D                   Dolphin  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
                 Killer whale  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
             Tibetan antelope  ggcacccacagagctaaaagcccaacaggaaccacattgaccc-t--g
B D                       Cow  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D                     Sheep  ggcacccacagagctaaaagcccaacaggaaccacattgaccc-t--g
                Domestic goat  ggcacccacagagctaaaagcccaacaggaaccacattgaccc-t--g
B D                     Horse  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--t
B D          White rhinoceros  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D                       Cat  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D                       Dog  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--a
B D                   Ferret   ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D                     Panda  ggcacccacagagctaaacgcccaacaggaaccacactgaccc-t--g
               Pacific walrus  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
                 Weddell seal  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
             Black flying-fox  ggcgcccaccgagctgaaagcccagcaggagccacactgaccc-t--g
B D                   Megabat  ggcgcccaccgagctgaaagcccagcaggagccacactgaccc-t--g
                Big brown bat  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
         David's myotis (bat)  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D                  Microbat  ggcacccacagagctaaaagcccaacaggaaccacattgaccc-t--g
B D                  Hedgehog  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D                     Shrew  ggcacccacagagctaaaagcccagcaggatccacattgaccc-t--g
              Star-nosed mole  ggcacccaccgagctgaaggcccagcaggagccgcactgcccc-t--g
B D                  Elephant  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
          Cape elephant shrew  ggcacccacagaactgaaagcccaacaggaaccacactgtccc-t--g
B D                   Manatee  ggcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
             Cape golden mole  ggcccccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D                    Tenrec  ggcacccacagagctaaaagcccaacaggaaccacatactccc-t--a
                     Aardvark  agcacccacagagctaaaagcccaacaggaaccacactgaccc-t--g
B D                 Armadillo  ggcacccacagagctaaatgcccaacaggaaccacactgaccc-t--g
B D                   Opossum  ggcacccactgaactgaaggcccagcaggagccacactgaccc-t--g
B D           Tasmanian devil  ggcacccacagaactgaaggcccaacacgagccacactgaccc-t--g
B D                   Wallaby  ggcacccacagaactgaaggcccagcaggagccacactgaccc-t--a
B D                  Platypus  tgcccccacagagctgaacgcccagcatgatccacactggccc-t--g
  D               Rock pigeon  cgcgcccaccgagctgaacgcccagcacgagccgcactggccc-t--g
  D              Saker falcon  cgcgcccaccgagctgaacgcccagcacgagccgcactggccc-t--g
  D          Peregrine falcon  cgcgcccaccgagctgaatgcccagcacgagccgcactggccc-t--g
  D       Collared flycatcher  agctcctgttgtgctgaaagcccagcaagagccacactgaccc-t--g
  D    White-throated sparrow  agctcctgttgtgctgaaagcccagcaagagccacattgaccc-t--g
B D       Medium ground finch  ggcacccaccgagctgaaagcccagcacgagccacactggccc-t--g
B D               Zebra finch  agctcctgttgtgctgaaagcccagcaagagccacattgaccc-t--g
           Tibetan ground jay  ggcacccacggagctgaaagcccagcacgagccacactggccc-t--g
B D                Budgerigar  agctcctgttgtgctgaaagcccagcaagagccacactgaccc-t--g
  D                    Parrot  ggcgcccaccgagctgaacgcccagcacgagccgcactggccc-t--a
  D             Scarlet macaw  ggcgcccacggagctgaacgcccagcacgagccgcactggccc-t--a
  D              Mallard duck  cgcgcccaccgagctgaaggcccagcatgagccacactggccc-t--a
B D                   Chicken  agcccccactgagctgaacgcccaacaggagccgcactgcccc-t--g
B D                    Turkey  ggcccctgtggcactgaatgcccagcatgacccacagtgcccc-t--g
B D        American alligator  ggcccccaccgagctgaaggcccagcatgacccgcactgaccc-t--g
  D           Green seaturtle  ggccccgacggagctgaaagcccagcaggaaccgcactggccc-t--g
  D            Painted turtle  ggccccgacggagctgaaagcccagcaggagccgcactgaccc-t--g
  D  Chinese softshell turtle  cgccccgacggagctgaacgcccagcaggagccgcactggccc-t--g
  D    Spiny softshell turtle  ggcccccacagcactgaacgcccaacacgaaccacaggatccc-t--g
B D                    Lizard  ggctcccacggagctgaaggcccaacaggaaccacattgaccc-t--g
B D             X. tropicalis  agccccaactgagctaaaagcccagcaggaaccacaggaaccc-t--g
B D                Coelacanth  ggctcccacagagctaaaggcccagcaggacccgcacgagccc-t--g
B D                 Tetraodon  ggccccggtggtgctgaaggcccagcaggagccacactgaccc-t--g
B D                      Fugu  agctccggtggtgctaaaggcccagcaggagccacactgaccc-t--g
       Yellowbelly pufferfish  ggccccggcagagctgaaggcccagcaggatccgcactgaccc-t--g
B D              Nile tilapia  agctccggtggcactgaaagcccagcaagagccacactgaccc-t--g
          Princess of Burundi  agcccctgcagcactgaaggcccagcaagatccacaagcaccc-t--a
        Burton's mouthbreeder  ggcccctgcagcactgaaggcccagcaagacccacaagcaccc-t--a
                  Zebra mbuna  ggcccctgcagcactgaaggcccagcaagacccacaagcaccc-t--a
          Pundamilia nyererei  ggcccctgcagcactgaaggcccagcaagacccacaagcaccc-t--a
B D                    Medaka  ggctcctacagagctgaaagcccagcaggaaccacatgaaccc-t--g
           Southern platyfish  cgccccggcagaactgaaggcccagcaggagccgcaggaaccc-t--g
B D               Stickleback  agctcctaaagagctgaaggcccagcaggaaccacacaagccc-t--t
B D              Atlantic cod  ggcccctgctgagctgaacgcccagcaggacccacaggagccc-t--g
B D                 Zebrafish  ggcaccaacagagctgaacgcccagcaggagccgcatgatccc-t--g
     Mexican tetra (cavefish)  agcaccaactgagctgaaggcccagcaggagccacatgagccc-ttag
                  Spotted gar  cgccccggccgagctgaacgcccagcaggagccgcaggagccc-t--g
B D                   Lamprey  agcgccggtcgtgctgaacgcccagcacgagccgcactcgccc-t--a

Inserts between block 12 and 13 in window
B D       American alligator 117bp
B D                   Lizard 7bp
B D            X. tropicalis 4bp

Alignment block 13 of 289 in window, 150804243 - 150804244, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  ag
B D                    Gibbon  ag
B D                    Rhesus  ag
B D       Crab-eating macaque  ag
B D                    Baboon  ag
B D              Green monkey  ag
B D                  Marmoset  ag
B D           Squirrel monkey  ag
B D                  Bushbaby  gg
           Chinese tree shrew  ag
B D                  Squirrel  ag
       Lesser Egyptian jerboa  gg
                 Prairie vole  ag
B D           Chinese hamster  ag
               Golden hamster  ag
B D                     Mouse  ag
B D                       Rat  ag
B D            Naked mole-rat  ag
B D                Guinea pig  ag
                   Chinchilla  ag
             Brush-tailed rat  ag
B D                    Rabbit  ag
B D                      Pika  ag
B D                       Pig  ag
B D                    Alpaca  ag
               Bactrian camel  ag
B D                   Dolphin  ag
                 Killer whale  ag
             Tibetan antelope  ag
B D                       Cow  ag
B D                     Sheep  ag
                Domestic goat  ag
B D                     Horse  ag
B D          White rhinoceros  ag
B D                       Cat  ag
B D                       Dog  at
B D                   Ferret   ag
B D                     Panda  aa
               Pacific walrus  ag
                 Weddell seal  ag
             Black flying-fox  ag
B D                   Megabat  ag
                Big brown bat  ag
         David's myotis (bat)  ag
B D                  Microbat  ag
B D                  Hedgehog  ag
B D                     Shrew  ag
              Star-nosed mole  ag
B D                  Elephant  ag
          Cape elephant shrew  ag
B D                   Manatee  ag
             Cape golden mole  ag
B D                    Tenrec  ag
                     Aardvark  aa
B D                 Armadillo  ag
B D                   Opossum  ga
B D           Tasmanian devil  gg
B D                   Wallaby  gg
B D                  Platypus  ca
  D               Rock pigeon  cg
  D              Saker falcon  tg
  D          Peregrine falcon  tg
  D       Collared flycatcher  aa
  D    White-throated sparrow  aa
B D       Medium ground finch  tg
B D               Zebra finch  aa
           Tibetan ground jay  tg
B D                Budgerigar  ag
  D                    Parrot  tg
  D             Scarlet macaw  cg
  D              Mallard duck  tg
B D                   Chicken  cg
B D                    Turkey  gg
  D           Green seaturtle  ac
  D            Painted turtle  gc
  D  Chinese softshell turtle  ag
  D    Spiny softshell turtle  ag
B D                    Lizard  ag
B D             X. tropicalis  ag
B D                Coelacanth  gg
B D                 Tetraodon  ga
B D                      Fugu  ga
       Yellowbelly pufferfish  aa
B D              Nile tilapia  ag
          Princess of Burundi  ag
        Burton's mouthbreeder  ag
                  Zebra mbuna  ag
          Pundamilia nyererei  ag
B D                    Medaka  tc
           Southern platyfish  tc
B D               Stickleback  gc
B D              Atlantic cod  ga
B D                 Zebrafish  at
     Mexican tetra (cavefish)  at
                  Spotted gar  ca
B D                   Lamprey  ac
B D        American alligator  ==

Inserts between block 13 and 14 in window
B D            X. tropicalis 2bp
      Yellowbelly pufferfish 2203bp
B D             Atlantic cod 1bp

Alignment block 14 of 289 in window, 150804245 - 150804246, 2 bps 
B D                     Human  ag
B D                     Chimp  ag
B D                   Gorilla  ag
B D                 Orangutan  ag
B D                    Gibbon  ag
B D                    Rhesus  ag
B D       Crab-eating macaque  ag
B D                    Baboon  ag
B D              Green monkey  ag
B D                  Marmoset  ag
B D           Squirrel monkey  ag
B D                  Bushbaby  ag
           Chinese tree shrew  aa
B D                  Squirrel  ag
       Lesser Egyptian jerboa  ag
                 Prairie vole  ag
B D           Chinese hamster  ag
               Golden hamster  ag
B D                     Mouse  aa
B D                       Rat  aa
B D            Naked mole-rat  ag
B D                Guinea pig  tg
                   Chinchilla  ag
             Brush-tailed rat  ag
B D                    Rabbit  ag
B D                      Pika  ag
B D                       Pig  ag
B D                    Alpaca  ag
               Bactrian camel  ag
B D                   Dolphin  ag
                 Killer whale  ag
             Tibetan antelope  ag
B D                       Cow  ag
B D                     Sheep  ag
                Domestic goat  ag
B D                     Horse  ag
B D          White rhinoceros  ag
B D                       Cat  ga
B D                       Dog  ag
B D                   Ferret   ag
B D                     Panda  ag
               Pacific walrus  ag
                 Weddell seal  ag
             Black flying-fox  -c
B D                   Megabat  -g
                Big brown bat  ag
         David's myotis (bat)  ag
B D                  Microbat  ag
B D                  Hedgehog  aa
B D                  Elephant  ag
          Cape elephant shrew  aa
B D                   Manatee  ag
             Cape golden mole  ag
B D                    Tenrec  aa
                     Aardvark  ag
B D                 Armadillo  gg
B D                   Opossum  gt
B D           Tasmanian devil  at
B D                   Wallaby  tt
B D                  Platypus  ag
B D                Coelacanth  aa
B D                      Fugu  ag
       Yellowbelly pufferfish  ag
B D              Nile tilapia  ga
          Princess of Burundi  at
        Burton's mouthbreeder  at
                  Zebra mbuna  at
          Pundamilia nyererei  at
B D                    Medaka  ag
           Southern platyfish  ag
B D              Atlantic cod  ag
B D                 Zebrafish  gg
     Mexican tetra (cavefish)  gg
                  Spotted gar  gg
B D                   Lamprey  ac
B D                     Shrew  --
  D    Spiny softshell turtle  --
B D             X. tropicalis  ==
B D               Stickleback  --
B D                 Tetraodon  --
B D                    Turkey  --
B D                   Chicken  --
  D              Mallard duck  --
          Tibetan ground jay  --
B D               Zebra finch  --
  D    White-throated sparrow  --
  D            Painted turtle  --
  D           Green seaturtle  --
B D        American alligator  ==
  D             Scarlet macaw  --
B D                Budgerigar  --
  D               Rock pigeon  --
  D       Collared flycatcher  --
B D       Medium ground finch  --
B D                    Lizard  --
  D          Peregrine falcon  --
  D              Saker falcon  --
  D                    Parrot  --
  D  Chinese softshell turtle  --
             Star-nosed mole  --

Inserts between block 14 and 15 in window
B D                 Platypus 1582bp

Alignment block 15 of 289 in window, 150804247 - 150804247, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                      Pika  g
B D                       Pig  a
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  g
B D                  Elephant  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                   Opossum  a
B D           Tasmanian devil  g
B D                   Wallaby  g
  D               Rock pigeon  g
  D              Saker falcon  g
  D          Peregrine falcon  g
  D       Collared flycatcher  g
  D    White-throated sparrow  g
B D       Medium ground finch  g
B D               Zebra finch  g
           Tibetan ground jay  g
B D                Budgerigar  g
  D                    Parrot  g
  D             Scarlet macaw  g
  D              Mallard duck  g
B D                   Chicken  g
B D                    Turkey  t
  D           Green seaturtle  g
  D            Painted turtle  g
  D  Chinese softshell turtle  g
  D    Spiny softshell turtle  g
B D                    Lizard  g
B D                Coelacanth  a
B D                      Fugu  a
       Yellowbelly pufferfish  a
B D              Nile tilapia  g
          Princess of Burundi  a
        Burton's mouthbreeder  a
                  Zebra mbuna  a
          Pundamilia nyererei  a
B D                    Medaka  g
           Southern platyfish  g
B D               Stickleback  a
B D                 Zebrafish  a
     Mexican tetra (cavefish)  a
                  Spotted gar  g
B D                   Lamprey  g
B D                     Shrew  -
B D             X. tropicalis  =
B D              Atlantic cod  =
B D                 Tetraodon  -
B D        American alligator  =
         Cape elephant shrew  -
B D                  Platypus  =
             Star-nosed mole  -

Inserts between block 15 and 16 in window
  D              Rock pigeon 2bp
  D             Saker falcon 40bp
  D         Peregrine falcon 40bp
B D      Medium ground finch 69bp
B D              Zebra finch 2bp
          Tibetan ground jay 62bp
B D               Budgerigar 2bp
  D                   Parrot 37bp
  D            Scarlet macaw 61bp
  D             Mallard duck 47bp
B D                  Chicken 49bp
B D                   Turkey 1bp

Alignment block 16 of 289 in window, 150804248 - 150804249, 2 bps 
B D                     Human  ca
B D                     Chimp  ca
B D                   Gorilla  ca
B D                 Orangutan  ca
B D                    Gibbon  ca
B D                    Rhesus  ca
B D       Crab-eating macaque  ca
B D                    Baboon  ca
B D              Green monkey  ca
B D                  Marmoset  ca
B D           Squirrel monkey  ca
B D                  Bushbaby  ca
           Chinese tree shrew  ca
B D                  Squirrel  ca
       Lesser Egyptian jerboa  ca
                 Prairie vole  ca
B D           Chinese hamster  ca
               Golden hamster  ca
B D                     Mouse  ca
B D                       Rat  ca
B D            Naked mole-rat  ga
B D                Guinea pig  gg
                   Chinchilla  ca
             Brush-tailed rat  ca
B D                    Rabbit  ca
B D                      Pika  ca
B D                       Pig  ca
B D                    Alpaca  ca
               Bactrian camel  ca
B D                   Dolphin  ca
                 Killer whale  ca
             Tibetan antelope  ca
B D                       Cow  ca
B D                     Sheep  ca
                Domestic goat  ca
B D                     Horse  ta
B D          White rhinoceros  ca
B D                       Cat  ca
B D                       Dog  ca
B D                   Ferret   ca
B D                     Panda  cg
               Pacific walrus  ca
                 Weddell seal  ca
             Black flying-fox  ca
B D                   Megabat  ca
                Big brown bat  ca
         David's myotis (bat)  ca
B D                  Microbat  ca
B D                  Hedgehog  ca
B D                     Shrew  -a
              Star-nosed mole  -g
B D                  Elephant  ta
B D                   Manatee  ta
             Cape golden mole  aa
B D                    Tenrec  aa
                     Aardvark  ta
B D                 Armadillo  ca
B D                   Opossum  at
B D           Tasmanian devil  at
B D                   Wallaby  at
  D       Collared flycatcher  ta
  D    White-throated sparrow  ta
  D           Green seaturtle  ca
  D            Painted turtle  ca
  D  Chinese softshell turtle  ca
  D    Spiny softshell turtle  ca
B D                    Lizard  -a
B D             X. tropicalis  aa
B D                Coelacanth  -a
B D                 Tetraodon  cg
B D                      Fugu  ta
       Yellowbelly pufferfish  ta
B D              Nile tilapia  ag
          Princess of Burundi  aa
        Burton's mouthbreeder  aa
                  Zebra mbuna  aa
          Pundamilia nyererei  aa
B D                    Medaka  aa
           Southern platyfish  aa
B D               Stickleback  ag
B D              Atlantic cod  ca
B D                 Zebrafish  ga
     Mexican tetra (cavefish)  ga
                  Spotted gar  ca
B D                   Lamprey  ca
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
         Cape elephant shrew  --
B D                  Platypus  ==

Inserts between block 16 and 17 in window
B D                   Medaka 5bp
          Southern platyfish 3393bp
    Mexican tetra (cavefish) 1bp
B D                  Lamprey 959bp

Alignment block 17 of 289 in window, 150804250 - 150804250, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                   Gorilla  -t
B D                 Orangutan  -t
B D                    Gibbon  -t
B D                    Rhesus  -t
B D       Crab-eating macaque  -t
B D                    Baboon  -t
B D              Green monkey  -t
B D                  Marmoset  -t
B D           Squirrel monkey  -t
B D                  Bushbaby  -c
           Chinese tree shrew  -t
B D                  Squirrel  -t
       Lesser Egyptian jerboa  -c
                 Prairie vole  -c
B D           Chinese hamster  -t
               Golden hamster  -t
B D                     Mouse  -t
B D                       Rat  -t
B D            Naked mole-rat  -t
B D                Guinea pig  -t
                   Chinchilla  -t
             Brush-tailed rat  -c
B D                    Rabbit  -c
B D                      Pika  -c
B D                       Pig  -t
B D                    Alpaca  -c
               Bactrian camel  -c
B D                   Dolphin  -t
                 Killer whale  -t
             Tibetan antelope  -t
B D                       Cow  -t
B D                     Sheep  -t
                Domestic goat  -t
B D                     Horse  -t
B D          White rhinoceros  -t
B D                       Cat  -t
B D                       Dog  -t
B D                   Ferret   -t
B D                     Panda  -t
               Pacific walrus  -t
                 Weddell seal  -t
             Black flying-fox  -g
B D                   Megabat  -g
                Big brown bat  -t
         David's myotis (bat)  -t
B D                  Microbat  -t
B D                  Hedgehog  -t
B D                     Shrew  -t
              Star-nosed mole  -g
B D                  Elephant  -t
B D                   Manatee  -t
             Cape golden mole  -t
B D                    Tenrec  -c
                     Aardvark  -t
B D                 Armadillo  -t
B D                   Opossum  -t
B D           Tasmanian devil  -g
B D                   Wallaby  -c
  D       Collared flycatcher  -a
  D    White-throated sparrow  -t
B D               Zebra finch  -t
  D           Green seaturtle  -c
  D            Painted turtle  -c
  D  Chinese softshell turtle  -g
  D    Spiny softshell turtle  -c
B D                    Lizard  -c
B D                Coelacanth  -a
B D                 Tetraodon  a-
B D                      Fugu  a-
       Yellowbelly pufferfish  a-
B D              Nile tilapia  c-
          Princess of Burundi  a-
        Burton's mouthbreeder  a-
                  Zebra mbuna  a-
          Pundamilia nyererei  a-
B D                   Lamprey  ==
B D             X. tropicalis  --
B D              Atlantic cod  --
                 Spotted gar  --
B D               Stickleback  --
          Southern platyfish  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  --
B D                    Medaka  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
         Cape elephant shrew  --
B D                  Platypus  ==

Inserts between block 17 and 18 in window
  D          Green seaturtle 2bp
  D           Painted turtle 2bp
  D Chinese softshell turtle 2bp
  D   Spiny softshell turtle 1009bp
B D                   Lizard 1bp
B D               Coelacanth 1bp

Alignment block 18 of 289 in window, 150804251 - 150804254, 4 bps 
B D                     Human  a---cag
B D                     Chimp  a---cag
B D                   Gorilla  a---cag
B D                 Orangutan  a---cag
B D                    Gibbon  a---cag
B D                    Rhesus  a---cag
B D       Crab-eating macaque  a---cag
B D                    Baboon  a---cag
B D              Green monkey  a---cag
B D                  Marmoset  g---cag
B D           Squirrel monkey  g---cag
B D                  Bushbaby  a---tgg
           Chinese tree shrew  a---tag
B D                  Squirrel  a---tag
       Lesser Egyptian jerboa  a---cag
                 Prairie vole  a---cag
B D           Chinese hamster  a---cag
               Golden hamster  a---cag
B D                     Mouse  a---cag
B D                       Rat  a---cag
B D            Naked mole-rat  a---cag
B D                Guinea pig  a---cag
                   Chinchilla  a---cag
             Brush-tailed rat  a---cag
B D                    Rabbit  a---cag
B D                      Pika  a---cag
B D                       Pig  ag--cag
B D                    Alpaca  aa--cag
               Bactrian camel  aa--caa
B D                   Dolphin  aa--cag
                 Killer whale  aa--cag
             Tibetan antelope  aa--cag
B D                       Cow  aa--cag
B D                     Sheep  aa--cag
                Domestic goat  aa--cag
B D                     Horse  aa--cag
B D          White rhinoceros  aa--cag
B D                       Cat  aa--cag
B D                       Dog  aa--cag
B D                   Ferret   aa--cag
B D                     Panda  aa--cag
               Pacific walrus  aa--cag
                 Weddell seal  aa--cag
             Black flying-fox  ag--cag
B D                   Megabat  ag--cag
                Big brown bat  aa--cag
         David's myotis (bat)  aa--cag
B D                  Microbat  aa--cag
B D                  Hedgehog  aa--cag
B D                     Shrew  aa--tag
              Star-nosed mole  ga--cag
B D                  Elephant  a---tag
          Cape elephant shrew  a---caa
B D                   Manatee  a---cag
B D                    Tenrec  a---cag
                     Aardvark  a---cag
B D                 Armadillo  a---tgg
B D                   Opossum  a---agg
B D           Tasmanian devil  a---gtg
B D                   Wallaby  a---ggg
  D               Rock pigeon  ----aca
  D       Collared flycatcher  -a--aag
  D    White-throated sparrow  -a--aag
B D               Zebra finch  -a--aag
B D                Budgerigar  -c--aaa
  D             Scarlet macaw  -c--aaa
B D                    Turkey  -a--gag
  D           Green seaturtle  -g--agg
  D            Painted turtle  -g--agg
  D  Chinese softshell turtle  -g--agg
B D                    Lizard  -g--aaa
B D             X. tropicalis  -----gg
B D                Coelacanth  -a--ggt
B D                 Tetraodon  -g--cag
B D                      Fugu  -a--cag
       Yellowbelly pufferfish  -a--cag
B D              Nile tilapia  -aggcag
          Princess of Burundi  -----aa
        Burton's mouthbreeder  -a--caa
                  Zebra mbuna  -a---aa
          Pundamilia nyererei  -a--caa
B D                    Medaka  -----aa
B D               Stickleback  -----ag
B D              Atlantic cod  ----cag
B D                 Zebrafish  -----ac
                  Spotted gar  ----cag
B D                   Lamprey  =======
            Cape golden mole  -------
  D    Spiny softshell turtle  =======
          Southern platyfish  =======
B D                   Chicken  =======
  D              Mallard duck  =======
          Tibetan ground jay  =======
    Mexican tetra (cavefish)  =======
B D        American alligator  =======
B D       Medium ground finch  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D                    Parrot  =======
B D                  Platypus  =======

Inserts between block 18 and 19 in window
B D                Tetraodon 1bp
B D                     Fugu 1bp
      Yellowbelly pufferfish 1bp
B D             Nile tilapia 1216bp
B D                   Medaka 3bp
B D             Atlantic cod 2bp
B D                Zebrafish 3bp
                 Spotted gar 2bp

Alignment block 19 of 289 in window, 150804255 - 150804257, 3 bps 
B D                     Human  a-g-a
B D                     Chimp  a-g-a
B D                   Gorilla  a-g-a
B D                 Orangutan  a-g-a
B D                    Gibbon  a-g-a
B D                    Rhesus  a-g-a
B D       Crab-eating macaque  a-g-a
B D                    Baboon  a-g-a
B D              Green monkey  a-g-a
B D                  Marmoset  a-g-a
B D           Squirrel monkey  a-g-a
B D                  Bushbaby  a-g-a
           Chinese tree shrew  a-g-a
B D                  Squirrel  a-gca
       Lesser Egyptian jerboa  a-a-a
                 Prairie vole  a-a-a
B D           Chinese hamster  a-a-a
               Golden hamster  a-a-a
B D                     Mouse  a-g-g
B D                       Rat  a-g-g
B D            Naked mole-rat  a-g-a
B D                Guinea pig  a-g-a
                   Chinchilla  a-g-a
             Brush-tailed rat  a-g-a
B D                    Rabbit  a-g-a
B D                      Pika  a-g-a
B D                       Pig  a-g-a
B D                    Alpaca  a-g-a
               Bactrian camel  a-g-a
B D                   Dolphin  a-g-a
                 Killer whale  a-g-a
             Tibetan antelope  a-a-a
B D                       Cow  a-g-a
B D                     Sheep  a-g-a
                Domestic goat  a-g-a
B D                     Horse  a-g-a
B D          White rhinoceros  a-g-a
B D                       Cat  a----
B D                       Dog  a-a-c
B D                   Ferret   a-a-c
B D                     Panda  a-g-c
               Pacific walrus  a-g-c
                 Weddell seal  a-g-c
             Black flying-fox  a-g-a
B D                   Megabat  a-g-a
                Big brown bat  a-g-a
         David's myotis (bat)  a-g-a
B D                  Microbat  a-g-a
B D                  Hedgehog  a-a-a
B D                     Shrew  a-g-a
              Star-nosed mole  a-g--
B D                  Elephant  a-g-a
          Cape elephant shrew  a-g-a
B D                   Manatee  a-t-a
             Cape golden mole  a-g-a
B D                    Tenrec  a-g-a
                     Aardvark  a-g-a
B D                 Armadillo  a-g-a
B D                   Opossum  a-g-a
B D           Tasmanian devil  a-g-a
B D                   Wallaby  a-g-a
  D               Rock pigeon  c-g-g
  D       Collared flycatcher  t-g-a
  D    White-throated sparrow  t-g-a
B D               Zebra finch  c-a-a
B D                Budgerigar  cgg-a
  D             Scarlet macaw  t-g-a
B D                    Turkey  g-g-a
  D           Green seaturtle  g-a-a
  D            Painted turtle  g-g-a
  D  Chinese softshell turtle  g-g-a
B D                    Lizard  t-g-a
B D             X. tropicalis  a-g-a
B D                Coelacanth  g-g-a
B D                 Tetraodon  g-g-g
B D                      Fugu  a-g-a
       Yellowbelly pufferfish  a-g-a
          Princess of Burundi  a-c-a
        Burton's mouthbreeder  a-c-a
                  Zebra mbuna  a-c-a
          Pundamilia nyererei  a-c-a
B D                    Medaka  g-g-a
B D               Stickleback  a-g-a
B D              Atlantic cod  a-g-a
B D                 Zebrafish  a-g-a
     Mexican tetra (cavefish)  a-a-a
                  Spotted gar  a-g-a
B D                   Lamprey  =====
  D    Spiny softshell turtle  =====
          Southern platyfish  =====
B D                   Chicken  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
B D              Nile tilapia  =====
B D        American alligator  =====
B D       Medium ground finch  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D                    Parrot  =====
B D                  Platypus  =====

Inserts between block 19 and 20 in window
B D                   Medaka 1725bp
                 Spotted gar 840bp

Alignment block 20 of 289 in window, 150804258 - 150804259, 2 bps 
B D                     Human  a------a
B D                     Chimp  a------a
B D                   Gorilla  a------a
B D                 Orangutan  a------a
B D                    Gibbon  a------a
B D                    Rhesus  a------a
B D       Crab-eating macaque  a------a
B D                    Baboon  a------a
B D              Green monkey  a------a
B D                  Marmoset  a------a
B D           Squirrel monkey  a------a
B D                  Bushbaby  a------a
           Chinese tree shrew  a------a
B D                  Squirrel  a------t
       Lesser Egyptian jerboa  a------g
                 Prairie vole  a------a
B D           Chinese hamster  a------a
               Golden hamster  a------a
B D                     Mouse  a------c
B D                       Rat  a------a
B D            Naked mole-rat  a------g
B D                Guinea pig  a------g
                   Chinchilla  c------a
             Brush-tailed rat  c------a
B D                    Rabbit  a------g
B D                      Pika  gc-----a
B D                       Pig  a------a
B D                    Alpaca  a------a
               Bactrian camel  a------a
B D                   Dolphin  a------a
                 Killer whale  a------a
             Tibetan antelope  a------a
B D                       Cow  a------a
B D                     Sheep  a------a
                Domestic goat  a------a
B D                     Horse  a------a
B D          White rhinoceros  a------a
B D                       Cat  a------a
B D                       Dog  a------a
B D                   Ferret   a------a
B D                     Panda  a------a
               Pacific walrus  a------a
                 Weddell seal  a------a
             Black flying-fox  a------a
B D                   Megabat  a------a
                Big brown bat  a------a
         David's myotis (bat)  a------a
B D                  Microbat  a------a
B D                  Hedgehog  a------a
B D                     Shrew  aactatta
              Star-nosed mole  -------c
B D                  Elephant  a------a
          Cape elephant shrew  c------a
B D                   Manatee  a------a
             Cape golden mole  a------a
B D                    Tenrec  a------a
                     Aardvark  a------a
B D                 Armadillo  a------a
B D                   Opossum  a------a
B D           Tasmanian devil  a------a
B D                   Wallaby  a------a
  D               Rock pigeon  g------g
  D       Collared flycatcher  a------a
  D    White-throated sparrow  a------a
B D               Zebra finch  a------a
B D                Budgerigar  a------g
  D             Scarlet macaw  a------g
B D                    Turkey  a------a
  D           Green seaturtle  g------a
  D            Painted turtle  g------a
  D  Chinese softshell turtle  g------a
B D                    Lizard  g------g
B D             X. tropicalis  t------a
B D                Coelacanth  a------a
B D                 Tetraodon  a------a
B D                      Fugu  a------a
       Yellowbelly pufferfish  a------a
          Princess of Burundi  a------c
        Burton's mouthbreeder  a------a
                  Zebra mbuna  a------a
          Pundamilia nyererei  a------a
B D               Stickleback  a------a
B D              Atlantic cod  a------a
B D                 Zebrafish  a------a
     Mexican tetra (cavefish)  a------a
B D                   Lamprey  ========
  D    Spiny softshell turtle  ========
                 Spotted gar  ========
          Southern platyfish  ========
B D                   Chicken  ========
  D              Mallard duck  ========
          Tibetan ground jay  ========
B D                    Medaka  ========
B D              Nile tilapia  ========
B D        American alligator  ========
B D       Medium ground finch  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D                    Parrot  ========
B D                  Platypus  ========

Inserts between block 20 and 21 in window
B D                 Marmoset 2bp
B D          Squirrel monkey 2bp
B D                  Opossum 1bp
B D              Zebra finch 2bp
B D            X. tropicalis 2bp
B D             Atlantic cod 1794bp
B D                Zebrafish 872bp
    Mexican tetra (cavefish) 219bp

Alignment block 21 of 289 in window, 150804260 - 150804260, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  t
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  t
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  c
B D                      Pika  c
B D                       Pig  t
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  t
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  c
B D                     Shrew  c
              Star-nosed mole  c
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  a
                     Aardvark  t
B D                 Armadillo  t
B D                   Opossum  t
B D           Tasmanian devil  t
B D                   Wallaby  t
B D                  Platypus  c
  D               Rock pigeon  t
  D       Collared flycatcher  t
  D    White-throated sparrow  t
B D               Zebra finch  t
B D                Budgerigar  t
  D             Scarlet macaw  t
B D                    Turkey  t
  D           Green seaturtle  t
  D            Painted turtle  t
  D  Chinese softshell turtle  c
B D                    Lizard  g
B D             X. tropicalis  t
B D                Coelacanth  c
B D                 Tetraodon  a
B D                      Fugu  c
       Yellowbelly pufferfish  c
        Burton's mouthbreeder  c
                  Zebra mbuna  c
          Pundamilia nyererei  c
B D               Stickleback  c
B D                 Zebrafish  t
B D                   Lamprey  =
  D    Spiny softshell turtle  =
B D              Atlantic cod  =
                 Spotted gar  =
          Southern platyfish  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
    Mexican tetra (cavefish)  =
B D                    Medaka  =
         Princess of Burundi  -
B D              Nile tilapia  =
B D        American alligator  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =

Inserts between block 21 and 22 in window
  D              Rock pigeon 42bp
B D                   Lizard 1bp
B D               Coelacanth 1921bp
B D                Tetraodon 244bp
B D                     Fugu 293bp
      Yellowbelly pufferfish 293bp
       Burton's mouthbreeder 1bp
                 Zebra mbuna 1bp
         Pundamilia nyererei 1bp
B D              Stickleback 1168bp

Alignment block 22 of 289 in window, 150804261 - 150804263, 3 bps 
B D                     Human  tat--
B D                     Chimp  tat--
B D                   Gorilla  tat--
B D                 Orangutan  tat--
B D                    Gibbon  tat--
B D                    Rhesus  tat--
B D       Crab-eating macaque  tat--
B D                    Baboon  tat--
B D              Green monkey  tat--
B D                  Marmoset  tat--
B D           Squirrel monkey  tat--
B D                  Bushbaby  tat--
           Chinese tree shrew  tat--
B D                  Squirrel  tat--
       Lesser Egyptian jerboa  cac--
                 Prairie vole  tgt--
B D           Chinese hamster  tgt--
               Golden hamster  tgt--
B D                     Mouse  tgt--
B D                       Rat  tgt--
B D            Naked mole-rat  ggt--
B D                Guinea pig  gat--
                   Chinchilla  gat--
             Brush-tailed rat  gat--
B D                    Rabbit  tgt--
B D                      Pika  tgt--
B D                       Pig  tat--
B D                    Alpaca  tat--
               Bactrian camel  tat--
B D                   Dolphin  tac--
                 Killer whale  tac--
             Tibetan antelope  cat--
B D                       Cow  cat--
B D                     Sheep  cat--
                Domestic goat  cat--
B D                     Horse  tat--
B D          White rhinoceros  tgt--
B D                       Cat  tgt--
B D                       Dog  tgt--
B D                   Ferret   cat--
B D                     Panda  tgt--
               Pacific walrus  tat--
                 Weddell seal  tat--
             Black flying-fox  tat--
B D                   Megabat  tat--
                Big brown bat  tat--
         David's myotis (bat)  tat--
B D                  Microbat  tat--
B D                  Hedgehog  tgt--
B D                     Shrew  tgc--
              Star-nosed mole  cac--
B D                  Elephant  tat--
          Cape elephant shrew  taa--
B D                   Manatee  tac--
             Cape golden mole  tat--
B D                    Tenrec  gag--
                     Aardvark  tac--
B D                 Armadillo  tat--
B D                   Opossum  att--
B D           Tasmanian devil  att--
B D                   Wallaby  att--
B D                  Platypus  cac--
  D       Collared flycatcher  cat--
  D    White-throated sparrow  cat--
B D               Zebra finch  tac--
B D                Budgerigar  cac--
  D             Scarlet macaw  cac--
B D                    Turkey  gat--
  D           Green seaturtle  ggt--
  D            Painted turtle  ggt--
  D  Chinese softshell turtle  ggt--
B D                    Lizard  ag---
B D             X. tropicalis  tac--
        Burton's mouthbreeder  --ca-
                  Zebra mbuna  --ca-
          Pundamilia nyererei  --ca-
B D                 Zebrafish  --cac
     Mexican tetra (cavefish)  --cat
B D                   Lamprey  =====
B D                Coelacanth  =====
  D    Spiny softshell turtle  =====
B D              Atlantic cod  =====
                 Spotted gar  =====
B D               Stickleback  =====
          Southern platyfish  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
B D                 Tetraodon  =====
B D                   Chicken  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
B D                    Medaka  =====
         Princess of Burundi  -----
B D              Nile tilapia  =====
B D        American alligator  =====
  D               Rock pigeon  =====
B D       Medium ground finch  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D                    Parrot  =====

Inserts between block 22 and 23 in window
  D      Collared flycatcher 140bp
B D               Budgerigar 7bp
  D            Scarlet macaw 7bp
B D                   Turkey 226bp
B D            X. tropicalis 1bp
                 Zebra mbuna 3320bp

Alignment block 23 of 289 in window, 150804264 - 150804264, 1 bps 
B D                     Human  -c
B D                     Chimp  -c
B D                   Gorilla  -c
B D                 Orangutan  -c
B D                    Gibbon  -c
B D                    Rhesus  -t
B D       Crab-eating macaque  -c
B D                    Baboon  -c
B D              Green monkey  -c
B D                  Marmoset  -c
B D           Squirrel monkey  -c
B D                  Bushbaby  -c
           Chinese tree shrew  -c
B D                  Squirrel  -g
       Lesser Egyptian jerboa  -c
                 Prairie vole  -c
B D           Chinese hamster  -c
               Golden hamster  -c
B D                     Mouse  -c
B D                       Rat  -c
B D            Naked mole-rat  -c
B D                Guinea pig  -c
                   Chinchilla  -c
             Brush-tailed rat  -c
B D                    Rabbit  -c
B D                      Pika  -g
B D                       Pig  -c
B D                    Alpaca  -c
               Bactrian camel  -c
B D                   Dolphin  -c
                 Killer whale  -c
             Tibetan antelope  -c
B D                       Cow  -t
B D                     Sheep  -c
                Domestic goat  -c
B D                     Horse  -c
B D          White rhinoceros  -c
B D                       Cat  -c
B D                       Dog  -t
B D                   Ferret   -c
B D                     Panda  -c
               Pacific walrus  -c
                 Weddell seal  -c
             Black flying-fox  -c
B D                   Megabat  -c
                Big brown bat  -c
         David's myotis (bat)  -c
B D                  Microbat  -c
B D                  Hedgehog  -c
B D                     Shrew  -c
              Star-nosed mole  -c
B D                  Elephant  -c
          Cape elephant shrew  -c
B D                   Manatee  -t
             Cape golden mole  -t
B D                    Tenrec  -g
                     Aardvark  -t
B D                 Armadillo  -c
B D                   Opossum  -c
B D           Tasmanian devil  -c
B D                   Wallaby  -c
B D                  Platypus  -c
  D           Green seaturtle  -c
  D            Painted turtle  -c
  D  Chinese softshell turtle  -c
B D                    Lizard  -c
          Princess of Burundi  a-
B D                   Lamprey  ==
B D                Coelacanth  ==
  D    Spiny softshell turtle  ==
B D             X. tropicalis  ==
B D              Atlantic cod  ==
                 Spotted gar  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                 Tetraodon  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  --
  D    White-throated sparrow  --
    Mexican tetra (cavefish)  --
B D                 Zebrafish  --
B D                    Medaka  ==
         Pundamilia nyererei  --
                 Zebra mbuna  ==
       Burton's mouthbreeder  --
B D              Nile tilapia  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==

Inserts between block 23 and 24 in window
B D                 Platypus 570bp

Alignment block 24 of 289 in window, 150804265 - 150804265, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  t
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                      Pika  g
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  g
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  a
                     Aardvark  c
B D                 Armadillo  a
B D                   Opossum  a
B D           Tasmanian devil  a
B D                   Wallaby  a
  D    White-throated sparrow  a
B D               Zebra finch  a
B D                Budgerigar  a
  D             Scarlet macaw  a
  D           Green seaturtle  a
  D            Painted turtle  a
  D  Chinese softshell turtle  a
B D                    Lizard  a
B D             X. tropicalis  a
          Princess of Burundi  a
B D                   Lamprey  =
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
    Mexican tetra (cavefish)  -
B D                 Zebrafish  -
B D                    Medaka  =
         Pundamilia nyererei  -
                 Zebra mbuna  =
       Burton's mouthbreeder  -
B D              Nile tilapia  =
B D        American alligator  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                  Platypus  =

Inserts between block 24 and 25 in window
B D                  Opossum 12bp
B D          Tasmanian devil 13bp
  D   White-throated sparrow 1bp
B D              Zebra finch 1bp
B D               Budgerigar 1bp
  D            Scarlet macaw 1bp
  D          Green seaturtle 459bp
  D           Painted turtle 308bp
  D Chinese softshell turtle 182bp
B D                   Lizard 1bp

Alignment block 25 of 289 in window, 150804266 - 150804266, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  g
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                      Pika  g
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  a
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  g
B D                     Shrew  a
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  a
B D                   Manatee  g
             Cape golden mole  a
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
  D    White-throated sparrow  g
B D               Zebra finch  a
B D                Budgerigar  g
  D             Scarlet macaw  g
B D                    Lizard  g
B D             X. tropicalis  a
          Princess of Burundi  a
              Golden hamster  -
B D                   Lamprey  =
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  -
B D                 Zebrafish  -
B D                    Medaka  =
         Pundamilia nyererei  -
                 Zebra mbuna  =
       Burton's mouthbreeder  -
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                  Platypus  =
B D                   Wallaby  =
  D  Chinese softshell turtle  =

Inserts between block 25 and 26 in window
B D            X. tropicalis 1bp

Alignment block 26 of 289 in window, 150804267 - 150804267, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  t
B D                      Pika  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  t
B D                     Shrew  t
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D                   Opossum  c
  D    White-throated sparrow  t
B D               Zebra finch  c
B D                Budgerigar  t
  D             Scarlet macaw  t
B D                    Lizard  c
          Princess of Burundi  c
B D                   Lamprey  =
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D             X. tropicalis  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  -
B D                 Zebrafish  -
B D                    Medaka  =
         Pundamilia nyererei  -
                 Zebra mbuna  =
       Burton's mouthbreeder  -
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                  Platypus  =
B D                   Wallaby  =
  D  Chinese softshell turtle  =

Inserts between block 26 and 27 in window
  D   White-throated sparrow 131bp
B D                   Lizard 12bp

Alignment block 27 of 289 in window, 150804268 - 150804268, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                      Pika  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  c
B D                     Shrew  c
              Star-nosed mole  c
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  c
B D                   Opossum  c
B D           Tasmanian devil  c
B D               Zebra finch  c
B D                Budgerigar  c
  D             Scarlet macaw  c
B D                    Lizard  g
B D             X. tropicalis  c
          Princess of Burundi  c
B D                 Zebrafish  c
     Mexican tetra (cavefish)  c
B D                   Lamprey  =
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
  D    White-throated sparrow  =
B D                    Medaka  =
         Pundamilia nyererei  -
                 Zebra mbuna  =
       Burton's mouthbreeder  -
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                  Platypus  =
B D                   Wallaby  =
  D  Chinese softshell turtle  =

Inserts between block 27 and 28 in window
B D                    Shrew 8bp
B D            X. tropicalis 15624bp
B D                Zebrafish 158bp
    Mexican tetra (cavefish) 3bp

Alignment block 28 of 289 in window, 150804269 - 150804277, 9 bps 
B D                     Human  tttgc------------tgtt------
B D                     Chimp  tttgc------------tgtt------
B D                   Gorilla  tttgc------------tgtt------
B D                 Orangutan  tttgc------------tgtt------
B D                    Gibbon  tttgc------------tgtt------
B D                    Rhesus  tttgc------------tgtt------
B D       Crab-eating macaque  tttgc------------tgtt------
B D                    Baboon  tttgc------------tgtt------
B D              Green monkey  tttgc------------tgtt------
B D                  Marmoset  tttgc------------tgtt------
B D           Squirrel monkey  tttgc------------tgtt------
B D                  Bushbaby  actgc------------tgtg------
           Chinese tree shrew  attgc------------tgtt------
B D                  Squirrel  attcc------------tggt------
       Lesser Egyptian jerboa  attat------------tgtt------
                 Prairie vole  atcac------------ttct------
B D           Chinese hamster  atgga------------tttt------
               Golden hamster  atcgc------------tttt------
B D                     Mouse  atcac------------tctt------
B D                       Rat  atcat------------cctt------
B D            Naked mole-rat  ctggg------------cctc------
B D                Guinea pig  ctgag------------ctgc------
                   Chinchilla  ctgtg------------cttc------
             Brush-tailed rat  ctgtg------------cttc------
B D                    Rabbit  actgc------------tgat------
B D                      Pika  attac------------tggt------
B D                       Pig  attgt------------tgt-------
B D                    Alpaca  attgc------------tgtt------
               Bactrian camel  attgc------------tgtt------
B D                   Dolphin  attgc------------tgtt------
                 Killer whale  attgc------------tgtt------
             Tibetan antelope  attgc------------tgtt------
B D                       Cow  attgc------------tgtt------
B D                     Sheep  attgc------------tgtt------
                Domestic goat  attgc------------tgtt------
B D                     Horse  attgc------------tgtt------
B D          White rhinoceros  attgc------------tgtt------
B D                       Cat  actgc------------tgtt------
B D                       Dog  actgc------------tgtt------
B D                   Ferret   actgc------------tgtt------
B D                     Panda  actgc------------tgtt------
               Pacific walrus  actgc------------tgtt------
                 Weddell seal  actgc------------tgtt------
             Black flying-fox  atcgc------------cctt------
B D                   Megabat  atcgc------------cctt------
                Big brown bat  actgt------------tatt------
         David's myotis (bat)  attgt------------tatt------
B D                  Microbat  attgt------------tact------
B D                  Hedgehog  gtcat------------tgtt------
B D                     Shrew  gggtc------------tgtc------
              Star-nosed mole  ggcgc------------tgtc------
B D                  Elephant  attac------------cgtt------
          Cape elephant shrew  atgat------------tgtt------
B D                   Manatee  attgc------------tgtt------
             Cape golden mole  attgc------------tgtt------
B D                    Tenrec  attgc------------tctt------
                     Aardvark  attgc------------tgtt------
B D                 Armadillo  attgc------------tgtt------
B D                   Opossum  atttt------------attt------
B D           Tasmanian devil  attttaaaagaaagaaaagta------
B D               Zebra finch  cagac------------agtt------
B D                Budgerigar  tggac------------agat------
  D             Scarlet macaw  aggac------------agat------
B D                    Lizard  taggc------------ccct------
          Princess of Burundi  ------------------cataggatc
        Burton's mouthbreeder  --------------------taggatc
          Pundamilia nyererei  --------------------taggatc
B D                 Zebrafish  -------------------------tg
B D                   Lamprey  ===========================
B D                Coelacanth  ===========================
  D    Spiny softshell turtle  ===========================
B D             X. tropicalis  ===========================
B D              Atlantic cod  ===========================
                 Spotted gar  ===========================
B D               Stickleback  ===========================
          Southern platyfish  ===========================
      Yellowbelly pufferfish  ===========================
B D                      Fugu  ===========================
B D                 Tetraodon  ===========================
B D                    Turkey  ===========================
B D                   Chicken  ===========================
  D              Mallard duck  ===========================
          Tibetan ground jay  ===========================
  D    White-throated sparrow  ===========================
    Mexican tetra (cavefish)  ===========================
B D                    Medaka  ===========================
                 Zebra mbuna  ===========================
B D              Nile tilapia  ===========================
  D            Painted turtle  ===========================
  D           Green seaturtle  ===========================
B D        American alligator  ===========================
  D               Rock pigeon  ===========================
  D       Collared flycatcher  ===========================
B D       Medium ground finch  ===========================
  D          Peregrine falcon  ===========================
  D              Saker falcon  ===========================
  D                    Parrot  ===========================
B D                  Platypus  ===========================
B D                   Wallaby  ===========================
  D  Chinese softshell turtle  ===========================

Inserts between block 28 and 29 in window
      Lesser Egyptian jerboa 1331bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D              Zebra finch 135bp
B D               Budgerigar 8bp
  D            Scarlet macaw 8bp

Alignment block 29 of 289 in window, 150804278 - 150804291, 14 bps 
B D                     Human  -------tacattt----tc------------tat------at
B D                     Chimp  -------tacattt----tc------------tat------at
B D                   Gorilla  -------tacattt----tc------------tat------at
B D                 Orangutan  -------tacattt----tc------------tat------at
B D                    Gibbon  -------tacattt----tc------------tat------at
B D                    Rhesus  -------tatattt----tc------------tat------at
B D       Crab-eating macaque  -------tatattt----tc------------tat------at
B D                    Baboon  -------tatattt----tc------------tat------at
B D              Green monkey  -------tatattt----tc------------tat------at
B D                  Marmoset  -------cacattt----cc------------tat------at
B D           Squirrel monkey  -------cacattt----cc------------tat------at
B D                  Bushbaby  -------cacactt----gc------------tat------at
           Chinese tree shrew  -------cac--tt----ac------------tat------ag
B D                  Squirrel  -------cacacat----tc------------tgt------at
                 Prairie vole  -------cacacag----gg------------tgc------at
B D           Chinese hamster  -------cacat-g----gg------------tgc------at
               Golden hamster  -------cacat-g----gg------------tgc------at
B D                     Mouse  -------cacagag----gg------------tgg------gt
B D                       Rat  -------cacagag----gg------------tgt------gt
B D            Naked mole-rat  -----------cac----gt------------tct------gt
B D                Guinea pig  -----------gca----tc------------tgt------at
                   Chinchilla  -----------ca-----tc------------tgt------ag
             Brush-tailed rat  -----------tcactattc------------tgc------at
B D                    Rabbit  -------cacgcga----tc------------tgt------at
B D                      Pika  -------cacac------------------------------t
B D                       Pig  ---------catac----tt------------tgt------tt
B D                    Alpaca  -------cacaatt----tt------------tgt------tt
               Bactrian camel  -------cacaatt----tt------------tgt------tt
B D                   Dolphin  -------cacactt----tt------------tgt------tt
                 Killer whale  -------cacactt----tt------------tgt------tt
             Tibetan antelope  -------ctcactt----tc------------tgt------tt
B D                       Cow  -------caca-tt----tc------------tgt------tt
B D                     Sheep  -------ctcactt----tc------------tgt------tt
                Domestic goat  -------ctcactt----tc------------tgt------tt
B D                     Horse  -------cacactt----tt------------tgt------tt
B D          White rhinoceros  -------tacactt----gt------------tgt------tt
B D                       Cat  -------cacactt----tt------------tgt------tt
B D                       Dog  -------cacactt----tt------------tgt------tc
B D                   Ferret   -------cac-ctt----tt------------tgg------tt
B D                     Panda  -------cac-c--------------------tgt------tt
               Pacific walrus  -------cac-ctt----tt------------tgt------tt
                 Weddell seal  -------cac-ctt----tt------------tgt------tt
             Black flying-fox  -------cacgc------tt------------tgc------tt
B D                   Megabat  -------cacgg------tt------------tgc------tt
                Big brown bat  -------cacactt----tt------------tg-------tt
         David's myotis (bat)  -------cacgttt----tt------------tgt------tt
B D                  Microbat  -------cacgttt----tt------------tgt------tt
B D                  Hedgehog  -------catactt----at---------------------tt
B D                     Shrew  -----------------------------------------tt
              Star-nosed mole  -------cgcaccg----tg------------gg-------tc
B D                  Elephant  -------cacactt----ca------------tct------gt
          Cape elephant shrew  ---------cactt----ta------------tct------at
B D                   Manatee  -------caca----------------------ct------gt
             Cape golden mole  -------catactt----ta------------tct------gt
B D                    Tenrec  -------caccatt----tg------------tct------gc
                     Aardvark  -------cacaatt----ta------------tct------gt
B D                 Armadillo  -------cacactt----tc------------tgc------at
B D                   Opossum  -------tatattt----tt------------aca------tt
B D           Tasmanian devil  -------cacattt----ta------------acaaatagttt
B D                Budgerigar  -------cacagtt----cc------------ctt------at
  D             Scarlet macaw  -------tacagtt----cc------------ctt------at
B D                    Lizard  -------cacgttt----ccaatagaaggagactt------ct
          Princess of Burundi  taaaatacaaatat-----------------------------
        Burton's mouthbreeder  taaaatacaaatat-----------------------------
          Pundamilia nyererei  taaaatacaaatat-----------------------------
B D                 Zebrafish  tgctgcatatacat-----------------------------
     Mexican tetra (cavefish)  -------taaacat-----------------------------
      Lesser Egyptian jerboa  ===========================================
B D                   Lamprey  ===========================================
B D                Coelacanth  ===========================================
  D    Spiny softshell turtle  ===========================================
B D             X. tropicalis  ===========================================
B D              Atlantic cod  ===========================================
                 Spotted gar  ===========================================
B D               Stickleback  ===========================================
          Southern platyfish  ===========================================
      Yellowbelly pufferfish  ===========================================
B D                      Fugu  ===========================================
B D                 Tetraodon  ===========================================
B D                    Turkey  ===========================================
B D                   Chicken  ===========================================
  D              Mallard duck  ===========================================
          Tibetan ground jay  ===========================================
B D               Zebra finch  ===========================================
  D    White-throated sparrow  ===========================================
B D                    Medaka  ===========================================
                 Zebra mbuna  ===========================================
B D              Nile tilapia  ===========================================
  D            Painted turtle  ===========================================
  D           Green seaturtle  ===========================================
B D        American alligator  ===========================================
  D               Rock pigeon  ===========================================
  D       Collared flycatcher  ===========================================
B D       Medium ground finch  ===========================================
  D          Peregrine falcon  ===========================================
  D              Saker falcon  ===========================================
  D                    Parrot  ===========================================
B D                  Platypus  ===========================================
B D                   Wallaby  ===========================================
  D  Chinese softshell turtle  ===========================================

Inserts between block 29 and 30 in window
         Princess of Burundi 4281bp
       Burton's mouthbreeder 6bp
         Pundamilia nyererei 6bp
B D                Zebrafish 9bp
    Mexican tetra (cavefish) 24bp

Alignment block 30 of 289 in window, 150804292 - 150804308, 17 bps 
B D                     Human  cttc--tctct---ac-ctgcct--
B D                     Chimp  cttc--tctct---ac-ctgcct--
B D                   Gorilla  cttc--tctct---ac-ctgcct--
B D                 Orangutan  cttt--tctct---ac-ctgcct--
B D                    Gibbon  cttc--tctct---ac-ctgcct--
B D                    Rhesus  cttc--tctct---ac-ctgcct--
B D       Crab-eating macaque  cttc--tctct---ac-ctgcct--
B D                    Baboon  cttc--tctct---ac-ctgcct--
B D              Green monkey  cttc--tctct---ac-ctgcct--
B D                  Marmoset  tttc--tctcc---ac-ctgcct--
B D           Squirrel monkey  cttc--tctct---ac-ctgcct--
B D                  Bushbaby  cttc--tctcc---ac-atgcct--
           Chinese tree shrew  tttc--actgt---ac-cttcaa--
B D                  Squirrel  cttc--tatct---ac-ctgcct--
                 Prairie vole  ctt-----cct---ag-cagcct--
B D           Chinese hamster  ctt-----tct---ac-cagcct--
               Golden hamster  ctt-----tct---ac-cagcct--
B D                     Mouse  ctc-----tct---gc-cagcct--
B D                       Rat  ctt-----tct---gt-taccct--
B D            Naked mole-rat  cttc--tctcc---ac-ctgcct--
B D                Guinea pig  cttc--ccgac---ac-ctgcct--
                   Chinchilla  ctcc--cctcc---ac-ccacct--
             Brush-tailed rat  cttc--cctgt---ag-ctgcct--
B D                    Rabbit  ctt-------t---ac-ctgcct--
B D                      Pika  ctc-------t---ac---------
B D                       Pig  attc--cttct---ac-ctgtcc--
B D                    Alpaca  cttc--cttct---aa-ctgccc--
               Bactrian camel  cttc--cttct---aa-ctgccc--
B D                   Dolphin  cttc--cttct---ac-ctgcct--
                 Killer whale  cttc--cttct---ac-ctgcct--
             Tibetan antelope  ctct--gttct---ac-ctgccc--
B D                       Cow  ctct--cttct---ac-ctgccc--
B D                     Sheep  ctct--cttct---ac-ctgccc--
                Domestic goat  ctct--cttct---ac-ctgccc--
B D                     Horse  cttc--cctgt---ac-ctgcct--
B D          White rhinoceros  cttc--cctct---ac-ctgcct--
B D                       Cat  cttc--cctct---acactgtct--
B D                       Dog  cttt--cctct---aaactgccc--
B D                   Ferret   cttc--cctct---aaactacct--
B D                     Panda  cttc--cctct---aaactgcct--
               Pacific walrus  cttc--cctct---aaactgcct--
                 Weddell seal  cttc--cctct---aaactgcct--
             Black flying-fox  t-----cccct---ac-ctgcat--
B D                   Megabat  t-----cccct---ac-ctgcat--
                Big brown bat  ttttcacttct---ac-ctgcct--
         David's myotis (bat)  ttttcacttct---ac-ctgcct--
B D                  Microbat  ttttcacctct---ac-ttgcct--
B D                  Hedgehog  cctt--gttct---ac-ttgcct--
B D                     Shrew  acct--ttccc--gac-tcgctg--
              Star-nosed mole  actt--ctcctaaggc-ctgccg--
B D                  Elephant  tttc--cctct---ac-ctgcct--
          Cape elephant shrew  cttc--catct---ac-cttcct--
B D                   Manatee  gttc--cttct---ac-ctgcct--
             Cape golden mole  catc--cctct---ac-ttgcat--
B D                    Tenrec  cttc--cctct---ac-ctgcct--
                     Aardvark  cttc--tcttt---aa-ctgcct--
B D                 Armadillo  cctg--cctct---ac-ctgcct--
B D                   Opossum  attt--tattt---tt-ctattt--
B D           Tasmanian devil  cttc--actat---gt-ccactt--
B D                Budgerigar  cact--gatct---aa-gca-----
  D             Scarlet macaw  cact--gacct---aa-gca-----
B D                    Lizard  ctct--g--ct---aa-tct-----
        Burton's mouthbreeder  ----attctca---gt-attcctct
          Pundamilia nyererei  ----attctca---gt-attcctct
B D                 Zebrafish  ----aagatct---gt-----ttgt
     Mexican tetra (cavefish)  ----tacctct---gt--------t
      Lesser Egyptian jerboa  =========================
B D                   Lamprey  =========================
B D                Coelacanth  =========================
  D    Spiny softshell turtle  =========================
B D             X. tropicalis  =========================
B D              Atlantic cod  =========================
                 Spotted gar  =========================
B D               Stickleback  =========================
          Southern platyfish  =========================
      Yellowbelly pufferfish  =========================
B D                      Fugu  =========================
B D                 Tetraodon  =========================
B D                    Turkey  =========================
B D                   Chicken  =========================
  D              Mallard duck  =========================
          Tibetan ground jay  =========================
B D               Zebra finch  =========================
  D    White-throated sparrow  =========================
B D                    Medaka  =========================
                 Zebra mbuna  =========================
         Princess of Burundi  =========================
B D              Nile tilapia  =========================
  D            Painted turtle  =========================
  D           Green seaturtle  =========================
B D        American alligator  =========================
  D               Rock pigeon  =========================
  D       Collared flycatcher  =========================
B D       Medium ground finch  =========================
  D          Peregrine falcon  =========================
  D              Saker falcon  =========================
  D                    Parrot  =========================
B D                  Platypus  =========================
B D                   Wallaby  =========================
  D  Chinese softshell turtle  =========================

Inserts between block 30 and 31 in window
B D                   Lizard 1424bp

Alignment block 31 of 289 in window, 150804309 - 150804309, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  a
           Chinese tree shrew  g
B D                  Squirrel  g
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  a
B D                       Pig  t
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  a
B D                       Cow  g
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  g
B D                     Shrew  g
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  a
                     Aardvark  g
B D                 Armadillo  g
B D                   Opossum  t
B D           Tasmanian devil  c
B D                Budgerigar  c
  D             Scarlet macaw  g
        Burton's mouthbreeder  a
          Pundamilia nyererei  a
B