Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 61 in window, 2018477 - 2018484, 8 bps 
B D                     Human  ggg------------gg-----agg--------
B D                     Chimp  ggg------------gg-----tgg--------
B D                   Gorilla  ggg------------gg-----agg--------
B D                 Orangutan  ggg------------gg-----tgg--------
B D                    Gibbon  ggg------------gg-----agg--------
B D              Green monkey  ggg----------cagg-----agg--------
B D                  Marmoset  ggggcaggaggggctgg-----agg--------
B D           Squirrel monkey  ggggcaggaggtgccgg-----agg--------
       Lesser Egyptian jerboa  ---------------ag-----ggg--------
B D                     Mouse  ---------------ag-----agg--------
B D                       Rat  ---------------ag-----agg--------
B D            Naked mole-rat  ---------------ag-----agg--------
                   Chinchilla  ---------------ag-----cgg--------
             Brush-tailed rat  ---------------ag-----gag--------
B D                    Alpaca  ggg------------ag-----aga--------
               Bactrian camel  ggg------------ag-----aga--------
B D                   Dolphin  agg------------gg-----ata--------
                 Killer whale  agg------------gg-----ata--------
B D                     Horse  agg------------gg-----agg--------
B D          White rhinoceros  agg------------tt-----tgg--------
B D                       Cat  ggg------------gc-----agg--------
B D                       Dog  acg------------gc-----agg--------
B D                   Ferret   aca------------gc-----agg--------
               Pacific walrus  acg------------gc-----agg--------
                Big brown bat  agg------------gg-----agg--------
         David's myotis (bat)  agg------------ag-----agg--------
B D                  Elephant  ----------------a-----tgg--------
B D                   Manatee  ----------------c-----tgg--------
                     Aardvark  ----------------c-----ccg--------
B D                 Armadillo  ----------------c-----tgg--------
B D                   Opossum  --------------agg-----aag--------
B D           Tasmanian devil  --------------agg-----cag--------
B D                   Wallaby  --------------agg-----ggg--------
  D               Rock pigeon  --------------agg-----cca-----agg
  D              Saker falcon  --------------gggccctcggt-----cag
  D       Collared flycatcher  --------------aag-----cag-----gga
B D       Medium ground finch  --------------aag-----gag-----tga
B D               Zebra finch  --------------aag-----agg-----gga
           Tibetan ground jay  --------------ggg-----gac-----aga
B D                Budgerigar  --------------agg-----aga-----agc
  D           Green seaturtle  --------------agg-----gggcaaacagc
  D            Painted turtle  --------------ggg-----gag------gg
B D                      Pika  =================================
         Cape elephant shrew  =================================
                Prairie vole  ---------------------------------
B D           Chinese hamster  ---------------------------------
              Golden hamster  ---------------------------------
            Black flying-fox  =================================
B D                    Tenrec  =================================
B D                Guinea pig  =================================
B D                    Baboon  ---------------------------------
                Weddell seal  =================================
B D                     Panda  =================================
B D                       Cow  =================================
               Domestic goat  =================================
B D                     Sheep  =================================
            Tibetan antelope  =================================
B D                  Squirrel  =================================
          Chinese tree shrew  =================================
  D  Chinese softshell turtle  =================================
B D                   Chicken  =================================
  D          Peregrine falcon  =================================
B D        American alligator  =================================
            Cape golden mole  =================================
B D                  Bushbaby  =================================
B D       Crab-eating macaque  ---------------------------------
B D                    Rhesus  ---------------------------------

Inserts between block 1 and 2 in window
      Lesser Egyptian jerboa 3bp
B D                    Mouse 2bp
B D                      Rat 2bp
B D           Naked mole-rat 4bp
                  Chinchilla 4bp
            Brush-tailed rat 4bp
B D                 Elephant 11bp
B D                  Manatee 2bp
                    Aardvark 2bp
B D                Armadillo 3bp
B D                  Opossum 3bp
B D          Tasmanian devil 3bp

Alignment block 2 of 61 in window, 2018485 - 2018498, 14 bps 
B D                     Human  tg---------------------g----------------------------------------------
B D                     Chimp  tg---------------------g----------------------------------------------
B D                   Gorilla  tg---------------------g----------------------------------------------
B D                 Orangutan  tg---------------------g----------------------------------------------
B D                    Gibbon  tg---------------------g----------------------------------------------
B D              Green monkey  gg---------------------gaggc------------------------------------------
B D                  Marmoset  gg---------------------gaggaggaggagggggacaggaggggcaagaggagcaagagggggac
B D           Squirrel monkey  ggggaaggaggagggggacaggaggggc-------------------------------aagagggggac
           Chinese tree shrew  tg---------------------g----------------------------------------------
B D                  Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  ----------------------------------------------------------------------
B D           Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
B D                     Mouse  ----------------------------------------------------------------------
B D                       Rat  ----------------------------------------------------------------------
B D            Naked mole-rat  ----------------------------------------------------------------------
B D                Guinea pig  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
B D                    Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
B D                   Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
B D                  Elephant  ----------------------------------------------------------------------
B D                   Manatee  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
B D                 Armadillo  ----------------------------------------------------------------------
B D                   Opossum  ----------------------------------------------------------------------
B D           Tasmanian devil  ----------------------------------------------------------------------
B D                   Wallaby  ----------------------------------------------------------------------
  D               Rock pigeon  ----------------------------------------------------------------------
  D              Saker falcon  ----------------------------------------------------------------------
  D       Collared flycatcher  ----------------------------------------------------------------------
B D       Medium ground finch  ----------------------------------------------------------------------
B D               Zebra finch  ----------------------------------------------------------------------
           Tibetan ground jay  ----------------------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------------------
  D           Green seaturtle  ----------------------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------------------
B D                      Pika  ======================================================================
         Cape elephant shrew  ======================================================================
            Black flying-fox  ======================================================================
B D                    Tenrec  ======================================================================
B D                    Baboon  ----------------------------------------------------------------------
                Weddell seal  ======================================================================
B D                     Panda  ======================================================================
               Big brown bat  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ----------------------------------------------------------------------
B D          White rhinoceros  ----------------------------------------------------------------------
B D                     Horse  ----------------------------------------------------------------------
B D                       Dog  ----------------------------------------------------------------------
B D                   Ferret   ----------------------------------------------------------------------
B D                       Cat  ----------------------------------------------------------------------
              Pacific walrus  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================
B D        American alligator  ======================================================================
            Cape golden mole  ======================================================================
B D                  Bushbaby  ======================================================================
B D       Crab-eating macaque  ----------------------------------------------------------------------
B D                    Rhesus  ----------------------------------------------------------------------

                        Human  ---------------------------------------------gggaggagagg
                        Chimp  ---------------------------------------------gggaggagagg
                      Gorilla  ---------------------------------------------gggaggagagg
                    Orangutan  ---------------------------------------------gggaggagagg
                       Gibbon  ---------------------------------------------gggaggagagg
                 Green monkey  --------------------------------------------aggaaggcgagg
                     Marmoset  gagggacaggaggggaagttg-----------------------agggaggagagg
              Squirrel monkey  gaggggcaggaggggaaggtg-----------------------agtgaggagagg
           Chinese tree shrew  ---------------------------------------------ggcaggaagaa
                     Squirrel  -------------------gg-----------------------agggaggagact
       Lesser Egyptian jerboa  -------------------ag-----------------------ggagataaga--
                 Prairie vole  -----------------------------------------------aaggtga--
              Chinese hamster  -----------------------------------------------gaggtga--
               Golden hamster  -----------------------------------------------gagatga--
                        Mouse  -------------------aa-----------------------ggagaggtga--
                          Rat  -------------------aa-----------------------ggagaggtga--
               Naked mole-rat  -------------------ag-----------------------agagaggtaaat
                   Guinea pig  -------------------ag-----------------------aaggagataaat
                   Chinchilla  -------------------ag-----------------------agggaggtaaac
             Brush-tailed rat  -------------------ag-----------------------agggaggtaaat
                       Alpaca  ------------------tgc-----------------------agga----gtg-
               Bactrian camel  ------------------tgc-----------------------agga----gtg-
                      Dolphin  ------------------tgc-----------------------agggaggtgag-
                 Killer whale  ------------------tgc-----------------------agggaggtgag-
                     Elephant  ----------------tgggtcctcccc----------------aggctggagg--
                      Manatee  ----------------tgggggct--------------------aggctggggg--
                     Aardvark  ----------------tgggggct--------------------aggctggggg--
                    Armadillo  ----------------taggg-----------------------ag---ggggg--
                      Opossum  -------------------------ccg----------------agggaggtcggg
              Tasmanian devil  -------------------------tcacccaataaa-------aagggggagggg
                      Wallaby  --------------------------------------------aggaggggaggg
                  Rock pigeon  -----------------------------------tg-------ggggagcgggag
                 Saker falcon  -----------------------------------tg-------gggcaggcaggg
          Collared flycatcher  -----------------------------------gg-----ccgagggctgggag
          Medium ground finch  --------------------------------------------gagggaacgggg
                  Zebra finch  -----------------------------------tg-------gaggggatggag
           Tibetan ground jay  -----------------------------------tggaccctggaggaagtgggg
                   Budgerigar  -----------------------------------tg-------gagcaggcggag
              Green seaturtle  -----------------------------------tg-------aggccaggagaa
               Painted turtle  -----------------------------------tg-------gtgtgaggagag
                         Pika  ========================================================
          Cape elephant shrew  ========================================================
             Black flying-fox  ========================================================
                       Tenrec  ========================================================
                       Baboon  --------------------------------------------------------
                 Weddell seal  ========================================================
                        Panda  ========================================================
                Big brown bat  --------------------------------------------------------
                          Cow  ========================================================
                Domestic goat  ========================================================
                        Sheep  ========================================================
             Tibetan antelope  ========================================================
         David's myotis (bat)  --------------------------------------------------------
             White rhinoceros  --------------------------------------------------------
                        Horse  --------------------------------------------------------
                          Dog  --------------------------------------------------------
                      Ferret   --------------------------------------------------------
                          Cat  --------------------------------------------------------
               Pacific walrus  --------------------------------------------------------
     Chinese softshell turtle  ========================================================
                      Chicken  ========================================================
             Peregrine falcon  ========================================================
           American alligator  ========================================================
             Cape golden mole  ========================================================
                     Bushbaby  ========================================================
          Crab-eating macaque  --------------------------------------------------------
                       Rhesus  --------------------------------------------------------

Inserts between block 2 and 3 in window
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
  D              Rock pigeon 9bp
  D             Saker falcon 18bp
  D      Collared flycatcher 15bp
B D      Medium ground finch 8bp
B D              Zebra finch 5bp
          Tibetan ground jay 14bp
B D               Budgerigar 8bp
  D          Green seaturtle 1bp
  D           Painted turtle 6bp

Alignment block 3 of 61 in window, 2018499 - 2018503, 5 bps 
B D                     Human  c------gc--ag
B D                     Chimp  c------gc--ag
B D                   Gorilla  c------gc--aa
B D                 Orangutan  t------gc--ag
B D                    Gibbon  c------ac--ag
B D              Green monkey  c------gc--at
B D                  Marmoset  c------cc--ag
B D           Squirrel monkey  c------cc--ag
           Chinese tree shrew  c------ac--ag
B D                  Squirrel  c------at--gg
       Lesser Egyptian jerboa  t------gt--ag
                 Prairie vole  t------at--ag
B D           Chinese hamster  t------at--ag
               Golden hamster  t------at--ag
B D                     Mouse  c------at--ag
B D                       Rat  c------at--ag
B D            Naked mole-rat  t------tc--ag
B D                Guinea pig  t------gc--ag
                   Chinchilla  t------tc--ag
             Brush-tailed rat  t------tc--ag
B D                    Alpaca  c------ac--ag
               Bactrian camel  c------ac--ag
B D                   Dolphin  c------ac--ag
                 Killer whale  c------gc--ag
B D                     Horse  t------gc--a-
B D          White rhinoceros  t------gc--ag
B D                       Cat  t------gc--ag
B D                       Dog  cacaggtgc--ag
B D                   Ferret   tgtgtgtgc--aa
               Pacific walrus  t------------
             Black flying-fox  --------c--gg
B D                  Elephant  -------ct--gg
B D                   Manatee  -------gt--ca
                     Aardvark  -------cc----
B D                 Armadillo  -------ct--gg
B D                   Opossum  c------cc--cc
B D           Tasmanian devil  c------cc--gg
B D                   Wallaby  c------tg--gg
  D               Rock pigeon  g------gc--ag
  D              Saker falcon  t------gc--ag
  D       Collared flycatcher  c------ag--ag
B D       Medium ground finch  c------acctgg
B D               Zebra finch  c------ac--gt
           Tibetan ground jay  g------ac--gg
B D                Budgerigar  t------ac--ag
  D           Green seaturtle  -------gc--ag
  D            Painted turtle  t------gc--ag
B D                      Pika  =============
         Cape elephant shrew  =============
B D                    Tenrec  =============
B D                    Baboon  -------------
                Weddell seal  =============
B D                     Panda  =============
               Big brown bat  -------------
B D                       Cow  =============
               Domestic goat  =============
B D                     Sheep  =============
            Tibetan antelope  =============
        David's myotis (bat)  -------------
  D  Chinese softshell turtle  =============
B D                   Chicken  =============
  D          Peregrine falcon  =============
B D        American alligator  =============
            Cape golden mole  =============
B D                  Bushbaby  =============
B D       Crab-eating macaque  -------------
B D                    Rhesus  -------------

Inserts between block 3 and 4 in window
B D                      Cat 13bp
B D                      Dog 13bp
B D                  Ferret  5bp
            Black flying-fox 2bp
B D                 Elephant 1bp
B D                  Manatee 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 4 of 61 in window, 2018504 - 2018529, 26 bps 
B D                     Human  cggcgtg--ggggc------------aggcacccg-agaga-----------------------------
B D                     Chimp  cggcgtg--ggggc------------aggcacccg-agaga-----------------------------
B D                   Gorilla  cggtgtg--ggggc------------aggcacccg-agaga-----------------------------
B D                 Orangutan  cggcgta--ggggc------------aggcatccg-agtga-----------------------------
B D                    Gibbon  cggcgtg--ggggc------------aggcatccg-agaaa-----------------------------
B D              Green monkey  ctgcgtg--ggggc------------aggcatcca-agaga-----------------------------
B D                  Marmoset  gggcgt---ggggc------------aggtatccg-agaga-----------------------------
B D           Squirrel monkey  gggtgt---ggggc------------aggtatccg-agaga-----------------------------
           Chinese tree shrew  accatag--gaggc------------agg---ccg-aggga-----------------------------
B D                  Squirrel  tgacatg--gagga------------aggcatcca-agacc-----------------------------
       Lesser Egyptian jerboa  caatgtg--gggga------------cactgccga-agagg-----------------------------
                 Prairie vole  tgacatat-gaagc------------tggcatcca-acaga-----------------------------
B D           Chinese hamster  tgacat---gaagc------------tggcatcta-agaga-----------------------------
               Golden hamster  ggacacag-gaagc------------tggcatcta-agaga-----------------------------
B D                     Mouse  tgacatat-gaggc------------tgacatcca-agaaa-----------------------------
B D                       Rat  tgacacat-gaagc------------tgacatcca-agaga-----------------------------
B D            Naked mole-rat  caacatg--gggga------------agacatcca-agaga-----------------------------
B D                Guinea pig  cgacatg--g-gac------------agacatcca-agaga-----------------------------
                   Chinchilla  tgacatg--gaggc------------aggcatgca-aaaga-----------------------------
             Brush-tailed rat  tgacatg--gggac------------agatatcca-agaga-----------------------------
B D                     Horse  --------------------------ggaggtgag-acaca-----------------------------
B D          White rhinoceros  --------------------------ggaggtgag-acaca-----------------------------
B D                     Panda  -------------------------------cagg-gcagg-----------------------------
               Pacific walrus  ------------------------------------gtggg-----------------------------
             Black flying-fox  ------------------------------------tgggg-----------------------------
B D                  Elephant  -------ctggggg------------ggcaaaggg-agggg-----------------------------
B D                   Manatee  -------tgggggggatgct------ggcaagggg-tgggg-----------------------------
                     Aardvark  -------tgggaggcat---------cgtcaaggg-agaga-----------------------------
B D                 Armadillo  -------cagggga------------ggcagaggg-agggg-----------------------------
B D                   Opossum  -----------------ctttgctgcagccccccg-agatc-----------------------------
B D           Tasmanian devil  -----------------ggtc-----tggggtctg-gggtg-----------------------------
B D                   Wallaby  -----------------gatcaaagatggtgcttg-ggaag-----------------------------
  D               Rock pigeon  ------------------------------ccacg-ctcgggtc---gagccccat--gtccctgcaccc
  D              Saker falcon  ------------------------------tctcc-actgcagg---gcagct-----ccctaggg----
  D       Collared flycatcher  ------------------------------actgg-----------------------agttcagtgt--
B D       Medium ground finch  ------------------------------ccatg-actgaa----------------acatcagctg--
B D               Zebra finch  ------------------------------ccctg-tcccagc-----tcacctgctcacctcggtcgcc
           Tibetan ground jay  ------------------------------ccgcg-gccgcgcg---gtgacc-----gctccggt----
B D                Budgerigar  ------------------------------atgta-tgtatgc---------------gcaccggcaact
B D        American alligator  ---------------------------------------------------------tgcacctg-----
  D           Green seaturtle  ------------------------------cgggg---tgggcctgtggggcc-----tcagaaga----
  D            Painted turtle  ------------------------------cgggtgtctgggc----aggggt-----gcatgag-----
B D                      Pika  ======================================================================
         Cape elephant shrew  ======================================================================
B D                    Tenrec  ======================================================================
B D                    Baboon  ----------------------------------------------------------------------
B D                   Dolphin  ----------------------------------------------------------------------
                Weddell seal  ======================================================================
                Killer whale  ----------------------------------------------------------------------
               Big brown bat  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ----------------------------------------------------------------------
              Bactrian camel  ----------------------------------------------------------------------
B D                    Alpaca  ----------------------------------------------------------------------
B D                       Dog  ======================================================================
B D                   Ferret   ======================================================================
B D                       Cat  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================
            Cape golden mole  ======================================================================
B D                  Bushbaby  ======================================================================
B D       Crab-eating macaque  ----------------------------------------------------------------------
B D                    Rhesus  ----------------------------------------------------------------------

                        Human  ---------
                        Chimp  ---------
                      Gorilla  ---------
                    Orangutan  ---------
                       Gibbon  ---------
                 Green monkey  ---------
                     Marmoset  ---------
              Squirrel monkey  ---------
           Chinese tree shrew  ---------
                     Squirrel  ---------
       Lesser Egyptian jerboa  ---------
                 Prairie vole  ---------
              Chinese hamster  ---------
               Golden hamster  ---------
                        Mouse  ---------
                          Rat  ---------
               Naked mole-rat  ---------
                   Guinea pig  ---------
                   Chinchilla  ---------
             Brush-tailed rat  ---------
                        Horse  ---------
             White rhinoceros  ---------
                        Panda  ---------
               Pacific walrus  ---------
             Black flying-fox  ---------
                     Elephant  ---------
                      Manatee  ---------
                     Aardvark  ---------
                    Armadillo  ---------
                      Opossum  ---------
              Tasmanian devil  ---------
                      Wallaby  ---------
                  Rock pigeon  c------cc
                 Saker falcon  -------at
          Collared flycatcher  -------cc
          Medium ground finch  -------cc
                  Zebra finch  cttctctcc
           Tibetan ground jay  -------gc
                   Budgerigar  ctgc---cg
           American alligator  -------gg
              Green seaturtle  -------tc
               Painted turtle  ---------
                         Pika  =========
          Cape elephant shrew  =========
                       Tenrec  =========
                       Baboon  ---------
                      Dolphin  ---------
                 Weddell seal  =========
                 Killer whale  ---------
                Big brown bat  ---------
                          Cow  =========
                Domestic goat  =========
                        Sheep  =========
             Tibetan antelope  =========
         David's myotis (bat)  ---------
               Bactrian camel  ---------
                       Alpaca  ---------
                          Dog  =========
                      Ferret   =========
                          Cat  =========
     Chinese softshell turtle  =========
                      Chicken  =========
             Peregrine falcon  =========
             Cape golden mole  =========
                     Bushbaby  =========
          Crab-eating macaque  ---------
                       Rhesus  ---------

Inserts between block 4 and 5 in window
B D          Tasmanian devil 7bp
B D                  Wallaby 535bp

Alignment block 5 of 61 in window, 2018530 - 2018532, 3 bps 
B D                     Human  tgg
B D                     Chimp  tgg
B D                   Gorilla  tgg
B D                 Orangutan  tgg
B D                    Gibbon  tgg
B D              Green monkey  cgg
B D                  Marmoset  agg
B D           Squirrel monkey  ggg
           Chinese tree shrew  ctg
B D                  Squirrel  tgg
       Lesser Egyptian jerboa  agg
                 Prairie vole  tgg
B D           Chinese hamster  tgg
               Golden hamster  tgg
B D                     Mouse  tgg
B D                       Rat  tag
B D            Naked mole-rat  tga
B D                Guinea pig  tgg
                   Chinchilla  tgg
             Brush-tailed rat  tgg
B D                    Alpaca  -tg
               Bactrian camel  -tg
B D                   Dolphin  -tg
                 Killer whale  -tg
B D                     Horse  gca
B D          White rhinoceros  gtg
B D                       Cat  -gg
B D                     Panda  tgc
               Pacific walrus  tgc
             Black flying-fox  tgg
B D                  Elephant  tga
B D                   Manatee  tga
                     Aardvark  tga
B D                 Armadillo  aga
B D           Tasmanian devil  tgg
  D               Rock pigeon  tgg
  D              Saker falcon  ggg
  D       Collared flycatcher  tga
B D       Medium ground finch  tgg
B D               Zebra finch  tcg
           Tibetan ground jay  tgg
B D                Budgerigar  tgc
B D        American alligator  tgg
  D           Green seaturtle  tgg
  D            Painted turtle  tgg
B D                      Pika  ===
         Cape elephant shrew  ===
B D                    Tenrec  ===
B D                    Baboon  ---
                Weddell seal  ===
               Big brown bat  ---
B D                       Cow  ===
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
        David's myotis (bat)  ---
B D                       Dog  ===
B D                   Ferret   ===
  D  Chinese softshell turtle  ===
B D                   Chicken  ===
  D          Peregrine falcon  ===
B D                   Wallaby  ===
B D                   Opossum  ---
            Cape golden mole  ===
B D                  Bushbaby  ===
B D       Crab-eating macaque  ---
B D                    Rhesus  ---

Inserts between block 5 and 6 in window
B D                   Alpaca 5bp
              Bactrian camel 5bp
B D                  Dolphin 6bp
                Killer whale 6bp
B D                    Horse 6bp
B D         White rhinoceros 6bp
B D                      Cat 6bp
B D                    Panda 6bp
              Pacific walrus 6bp
            Black flying-fox 6bp
B D                 Elephant 2bp
B D                  Manatee 2bp
                    Aardvark 2bp
B D                Armadillo 2bp

Alignment block 6 of 61 in window, 2018533 - 2018536, 4 bps 
B D                     Human  cagg--
B D                     Chimp  cagg--
B D                   Gorilla  cagg--
B D                 Orangutan  cagg--
B D                    Gibbon  cagg--
B D       Crab-eating macaque  cagg--
B D                    Baboon  cagg--
B D              Green monkey  cagg--
B D                  Marmoset  cagg--
B D           Squirrel monkey  cagg--
           Chinese tree shrew  cagg--
B D                  Squirrel  cagg--
       Lesser Egyptian jerboa  caga--
                 Prairie vole  cagg--
B D           Chinese hamster  cagg--
               Golden hamster  cagg--
B D                     Mouse  aagg--
B D                       Rat  aagg--
B D            Naked mole-rat  taag--
B D                Guinea pig  tagg--
                   Chinchilla  tagg--
             Brush-tailed rat  tagg--
B D                    Alpaca  -ggg--
               Bactrian camel  -ggg--
B D                   Dolphin  -ggg--
                 Killer whale  -ggg--
B D                     Horse  -ggg--
B D          White rhinoceros  -ggg--
B D                       Cat  -ggg--
B D                       Dog  -tgg--
B D                   Ferret   --gc--
B D                     Panda  -ggg--
               Pacific walrus  -ggg--
             Black flying-fox  -ggg--
B D                  Elephant  tcgg--
B D                   Manatee  ctgg--
                     Aardvark  ctgg--
B D                 Armadillo  gtgg--
B D           Tasmanian devil  c-----
  D               Rock pigeon  --ggca
  D              Saker falcon  --ggca
  D       Collared flycatcher  --aggg
B D       Medium ground finch  --gcca
B D               Zebra finch  --gtca
           Tibetan ground jay  --gcag
B D                Budgerigar  --acgg
B D        American alligator  --gagg
  D           Green seaturtle  --ggga
  D            Painted turtle  --ggga
B D                      Pika  ======
         Cape elephant shrew  ======
B D                    Tenrec  ======
                Weddell seal  ======
               Big brown bat  ------
B D                       Cow  ======
               Domestic goat  ======
B D                     Sheep  ======
            Tibetan antelope  ======
        David's myotis (bat)  ------
  D  Chinese softshell turtle  ======
B D                   Chicken  ======
  D          Peregrine falcon  ======
B D                   Wallaby  ======
B D                   Opossum  ------
            Cape golden mole  ======
B D                  Bushbaby  ======
B D                    Rhesus  ------

Alignment block 7 of 61 in window, 2018537 - 2018554, 18 bps 
B D                     Human  --cc-----tggg------------------------------------------c------agcgtgg-
B D                     Chimp  --cc-----tggg------------------------------------------c------agcgtgg-
B D                   Gorilla  --cc-----tggg------------------------------------------a------agcgtgg-
B D                 Orangutan  --cc-----tggg------------------------------------------c------agcgtgg-
B D                    Gibbon  --cc-----tggg------------------------------------------c------agcgtgg-
B D                    Rhesus  --cc-----tggg------------------------------------------c------agcatgg-
B D       Crab-eating macaque  --cc-----tggg------------------------------------------c------agcatgg-
B D                    Baboon  --cc-----tggg------------------------------------------c------agcatgg-
B D              Green monkey  --cc-----tggg------------------------------------------c------agcatgg-
B D                  Marmoset  --cc-----tggg------------------------------------------c------agcatgg-
B D           Squirrel monkey  --cc-----tggg------------------------------------------c------agcgtgg-
           Chinese tree shrew  --ca-----tagg------------------------------------------c------agcacag-
B D                  Squirrel  --tc-----cagg------------------------------------------t------ggtatga-
       Lesser Egyptian jerboa  --tc-----cagg------------------------------------------c------agcaccg-
                 Prairie vole  --tc-----tgga------------------------------------------c------agcctag-
B D           Chinese hamster  --tc-----tgag------------------------------------------c------aacctag-
               Golden hamster  --tc-----tgtg------------------------------------------c------agcctag-
B D                     Mouse  --tc-----tgtg------------------------------------------c------agccca--
B D                       Rat  --tc-----tgtg------------------------------------------c------agcccag-
B D            Naked mole-rat  --cc-----cagg------------------------------------------c------agcatgg-
B D                Guinea pig  --ct-----cagg------------------------------------------c------agcacgg-
                   Chinchilla  --cc-----cagg------------------------------------------c------agcatgg-
             Brush-tailed rat  --cc-----cagg------------------------------------------c------agcatgg-
B D                    Alpaca  --cc-----cgtg------------------------------------------t------ggtacgg-
               Bactrian camel  --cc-----cgtg------------------------------------------t------ggtatgg-
B D                   Dolphin  --tc-----tggg------------------------------------------c------ggcatgg-
                 Killer whale  --tc-----tggg------------------------------------------c------ggcgtgg-
B D                     Horse  --gc-----ctgg------------------------------------------c------aacaggg-
B D          White rhinoceros  --gc-----ctgg------------------------------------------c------agca--g-
B D                       Cat  --cc-----tggg------------------------------------------c------agcacgg-
B D                       Dog  --tc-----tggg---------------------------------------------------------
B D                   Ferret   --cc-----tggg------------------------------------------c------tccac---
B D                     Panda  --cc-----tggg------------------------------------------c------agcacgga
               Pacific walrus  --cc-----tggg------------------------------------------c------agcaggg-
             Black flying-fox  --gt-----tcgg------------------------------------------caaaaggggcaggg-
                Big brown bat  --------------------------------------------------------------tgcaggg-
         David's myotis (bat)  --------------------------------------------------------------tgcaggg-
B D                  Elephant  --ct-----gggg------------------------------------------c------cttgctg-
B D                   Manatee  --cc-----gggg------------------------------------------c------cttgctg-
                     Aardvark  --cc-----tggg------------------------------------------c------cttgacg-
B D                 Armadillo  --ga-----ggag---------------------------------------ggtc------caccgag-
B D           Tasmanian devil  --cc-----tgggcagggcagcctgtgtctgcccgcgcgtgtgtggggtaca------------------
  D               Rock pigeon  gcacccc--tggc------------------------------------------c------cacagcc-
  D              Saker falcon  tctg-----gggg------------------------------------------g------tgccaga-
  D       Collared flycatcher  gccc-----atga------------------------------------------g------ctcaggg-
B D       Medium ground finch  gaag-----ggga------------------------------------------a------attgggg-
B D               Zebra finch  ccct-----gtga------------------------------------------a------gacacgg-
           Tibetan ground jay  gccccgctggggg------------------------------------------g------gtcagcc-
B D                Budgerigar  gcac-----tgaa------------------------------------------c------ctcgggg-
B D        American alligator  gcgc-----ctga------------------------------------------g------agcc----
  D           Green seaturtle  g--g-----ctag------------------------------------------g-------gtggga-
  D            Painted turtle  ggag-----ctgg------------------------------------------g------tgtctgg-
B D                      Pika  ======================================================================
         Cape elephant shrew  ======================================================================
B D                    Tenrec  ======================================================================
                Weddell seal  ======================================================================
B D                       Cow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Opossum  ----------------------------------------------------------------------
            Cape golden mole  ======================================================================
B D                  Bushbaby  ======================================================================

                        Human  ---aaca
                        Chimp  ---aaca
                      Gorilla  ---aaca
                    Orangutan  ---agca
                       Gibbon  ---agca
                       Rhesus  ---agca
          Crab-eating macaque  ---agca
                       Baboon  ---agca
                 Green monkey  ---agca
                     Marmoset  ---ggca
              Squirrel monkey  ---ggca
           Chinese tree shrew  ---gcca
                     Squirrel  ---gcca
       Lesser Egyptian jerboa  ---ccca
                 Prairie vole  ---accc
              Chinese hamster  ---acca
               Golden hamster  ---acca
                        Mouse  ---acca
                          Rat  ---acct
               Naked mole-rat  ---act-
                   Guinea pig  ---act-
                   Chinchilla  ---act-
             Brush-tailed rat  ---act-
                       Alpaca  ---acc-
               Bactrian camel  ---agc-
                      Dolphin  ---agc-
                 Killer whale  ---agc-
                        Horse  ---aga-
             White rhinoceros  ---agt-
                          Cat  ---agc-
                          Dog  ---ggc-
                      Ferret   ---agc-
                        Panda  gccagc-
               Pacific walrus  ---agc-
             Black flying-fox  ---ccg-
                Big brown bat  ---aga-
         David's myotis (bat)  ---aga-
                     Elephant  ---actc
                      Manatee  ---actc
                     Aardvark  ---actg
                    Armadillo  ---aggg
              Tasmanian devil  -------
                  Rock pigeon  ---ca--
                 Saker falcon  ---tg--
          Collared flycatcher  ---ag--
          Medium ground finch  ---ca--
                  Zebra finch  ---tg--
           Tibetan ground jay  ---cg--
                   Budgerigar  ---cg--
           American alligator  -------
              Green seaturtle  ---tg--
               Painted turtle  ---cc--
                         Pika  =======
          Cape elephant shrew  =======
                       Tenrec  =======
                 Weddell seal  =======
                          Cow  =======
                Domestic goat  =======
                        Sheep  =======
             Tibetan antelope  =======
     Chinese softshell turtle  =======
                      Chicken  =======
             Peregrine falcon  =======
                      Wallaby  =======
                      Opossum  -------
             Cape golden mole  =======
                     Bushbaby  =======

Inserts between block 7 and 8 in window
          Chinese tree shrew 1bp
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                 Elephant 1bp
B D                  Manatee 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 8 of 61 in window, 2018555 - 2018563, 9 bps 
B D                     Human  ttcatgt------------gc
B D                     Chimp  ttcatgt------------gc
B D                   Gorilla  ttcatgt------------gc
B D                 Orangutan  ttcacgt------------gc
B D                    Gibbon  ttcacgt------------gc
B D                    Rhesus  tccatgt------------gc
B D       Crab-eating macaque  tccatgt------------gc
B D                    Baboon  tccatgt------------gc
B D              Green monkey  tccgtgt------------gc
B D                  Marmoset  tccatgg------------gc
B D           Squirrel monkey  tccatgg------------gc
B D                  Bushbaby  tccttgt------------gc
           Chinese tree shrew  cctgtgt------------gt
B D                  Squirrel  cccatgg------------gc
       Lesser Egyptian jerboa  cacacag------------gc
                 Prairie vole  cccatgt------------gc
B D           Chinese hamster  cccatgt------------gc
               Golden hamster  cccatgt------------ac
B D                     Mouse  cctatgt------------gc
B D                       Rat  cccatga------------gc
B D            Naked mole-rat  cccacag------------ac
B D                Guinea pig  cccacag------------gt
                   Chinchilla  cccacag------------gc
             Brush-tailed rat  cccaaag------------a-
B D                    Alpaca  cccaagt------------gc
               Bactrian camel  cccacgt------------gc
B D                   Dolphin  cccatgt------------gc
                 Killer whale  cccatgt------------gc
B D                     Horse  cccatgt------------tc
B D          White rhinoceros  cctgtgt------------tc
B D                       Cat  cccgggt------------gc
B D                       Dog  tccatgc------------tc
B D                   Ferret   cgcgtgt------------gc
B D                     Panda  ctcatgt------------gc
               Pacific walrus  cccatgt------------gc
             Black flying-fox  ggcagcgtggagcccgcgtgc
                Big brown bat  cgcagtg------------gc
         David's myotis (bat)  ctcagtg------------gc
B D                  Elephant  cctgtgt------------gc
B D                   Manatee  -ctgtgt------------gc
                     Aardvark  cctatgc------------gt
B D                 Armadillo  cctgtgt------------gc
B D                   Opossum  --agggt------------tc
B D           Tasmanian devil  --tgagt------------gt
  D               Rock pigeon  ----tgg------------gg
  D              Saker falcon  ----ctg------------ac
B D       Medium ground finch  ----ggt------------gc
B D               Zebra finch  ----gtg------------gc
           Tibetan ground jay  ----ggg------------tc
B D                Budgerigar  ----ggg------------gg
  D           Green seaturtle  ----ggg------------gc
  D            Painted turtle  ----cgt------------gc
B D                      Pika  =====================
         Cape elephant shrew  =====================
B D                    Tenrec  =====================
                Weddell seal  =====================
B D                       Cow  =====================
               Domestic goat  =====================
B D                     Sheep  =====================
            Tibetan antelope  =====================
  D  Chinese softshell turtle  =====================
B D                   Chicken  =====================
  D       Collared flycatcher  ---------------------
  D          Peregrine falcon  =====================
B D                   Wallaby  =====================
B D        American alligator  ---------------------
            Cape golden mole  =====================

Inserts between block 8 and 9 in window
      Lesser Egyptian jerboa 1014bp
B D                  Opossum 2bp
B D          Tasmanian devil 2bp
B D      Medium ground finch 3bp
B D              Zebra finch 3bp
B D               Budgerigar 5bp

Alignment block 9 of 61 in window, 2018564 - 2018587, 24 bps 
B D                     Human  tgggaag-ggggcttgg-a-a-ga-ggg-g
B D                     Chimp  tgggaag-ggagcttgg-a-a-ga-ggg-g
B D                   Gorilla  tgggaag-ggggcttgg-a-a-ga-ggg-g
B D                 Orangutan  tgggaag-ggggcttgg-a-a-ga-ggg-g
B D                    Gibbon  tgggaag-ggagcttgg-a-a-ga-ggg-g
B D                    Rhesus  cgggaag-gaggcttgg-a-a-ga-gag-g
B D       Crab-eating macaque  cgggaag-gaggcttgg-a-a-ga-gag-g
B D                    Baboon  tgggaag-gaggcttgg-a-a-ga-gag-g
B D              Green monkey  cgggaag-gaggcttgg-a-a-ga-gag-g
B D                  Marmoset  tgggaag-agggctcag-a-a-ga-ggc-g
B D           Squirrel monkey  tgagaag-ggtgctcag-a-a-ga-ggg-g
B D                  Bushbaby  ttggaag-g-ggctcag-a-a-ga-cta-g
           Chinese tree shrew  tggggag-ggggctcag-a-a-ga-gggtg
B D                  Squirrel  ttagaca-agggctcgg-g-a-gt-ggg-a
       Lesser Egyptian jerboa  taaaaag-agggctccg-a-a-gg--gg-g
                 Prairie vole  tgaaaag-agagctcag-a-a-gc--gg-g
B D           Chinese hamster  ttaaaag-agagatcag-a-a-gt-agg-g
               Golden hamster  ttaaaag-agagatccg-a-a-gt-agg-g
B D                     Mouse  ttcaaag-aaagctcag-a-c-at-agg-g
B D                       Rat  ttaaaaa-agagctcag-a-a-at-aag-g
B D            Naked mole-rat  -ttggaa-gggtctcaa-a-a-gt-ggg-g
B D                Guinea pig  -ttggaa-ggatttcaa-a-a-gt-ggg-g
                   Chinchilla  -ttggaa-ggatctcag-a-a----ggg-a
             Brush-tailed rat  --tggaa-ggatctcaa-a-a-gtgggg-a
B D                    Alpaca  ttggaag-gaggtacag-a-atag-ggg-g
               Bactrian camel  ttggaag-gaggcacag-a-atag-ggg-g
B D                   Dolphin  ttggaag-gaggctcagaa-gagg-ggg-g
                 Killer whale  ttggagg-gaggctcag-a-gagg-ggg-g
B D                     Horse  ttggaag-ggagctcag-t-a-ga-ggg-g
B D          White rhinoceros  tcagaag-ggggctcgg-a-a-ga-ggg-g
B D                       Cat  tgggcag-gaggatcag-a-aagg-ggg-g
B D                       Dog  tgggaag-gaggatcag-a-a-gg-gag-g
B D                   Ferret   tgggaag-gaggatcaa-a-atgg-ggg-g
B D                     Panda  cgggacg-gagggtcgg-g-a-gg-ggg-g
               Pacific walrus  tggaa-g-gaggaccag-a-a-gg-ggg-g
             Black flying-fox  ttggg-a-ggggctcag-a-t-ga-ggg-g
                Big brown bat  atggg-a-gcggctcag-a-a-ga-ggg-g
         David's myotis (bat)  atggg-a-gcggctcag-a-a-ga-ggg-g
B D                  Elephant  --ttgaa-ggggctcag-a-a-ga-ggg-g
B D                   Manatee  --ttgaa-ggggcttgg-c-a-ga-ggg-g
                     Aardvark  --ctgaa-ggagcttgg-a-a-ga-ggg-a
B D                 Armadillo  --tggggtgggggctgg-g-g-ca-ggg-c
B D                   Opossum  ------g-cgggcttgg-gcc-gt-gga-g
B D           Tasmanian devil  ------g-cgggcgtga-g-c-gt-gaa-t
  D               Rock pigeon  cacagga--gcagctgg-g-g-cc-gca-g
  D              Saker falcon  agcgcag-tgtcccttg-c-a-gg-gaa-g
  D       Collared flycatcher  cccagaa-tagccctgg-c-c-tc-gcc-g
B D       Medium ground finch  cagaaag-tggccctaa-a-g-tc-aca-g
B D               Zebra finch  cacgggg-ctatccctg-a-g-cc-cct-a
           Tibetan ground jay  cccacga-tgttcctgc-g-g-cc-ac---
B D                Budgerigar  aagagag-ggggcctta-t-a-tg-gaa-a
B D        American alligator  tgcgggc-tgggtctga-a-c-aa-gcc-a
  D           Green seaturtle  tgtgggg-tgggctcaa-g-g-gg-cat-g
  D            Painted turtle  tgggggt-gggagctgg-g-t-gt-ctt-g
B D                      Pika  ==============================
         Cape elephant shrew  ==============================
B D                    Tenrec  ==============================
                Weddell seal  ==============================
B D                       Cow  ==============================
               Domestic goat  ==============================
B D                     Sheep  ==============================
            Tibetan antelope  ==============================
  D  Chinese softshell turtle  ==============================
B D                   Chicken  ==============================
  D          Peregrine falcon  ==============================
B D                   Wallaby  ==============================
            Cape golden mole  ==============================

Inserts between block 9 and 10 in window
  D             Saker falcon 2bp
B D               Budgerigar 2bp
  D          Green seaturtle 32bp
  D           Painted turtle 9824bp

Alignment block 10 of 61 in window, 2018588 - 2018600, 13 bps 
B D                     Human  a-cc--------------------------------c------------atcagggac
B D                     Chimp  a-cc--------------------------------c------------atcagggac
B D                   Gorilla  a-cc--------------------------------c------------atcagggac
B D                 Orangutan  a-cc--------------------------------c------------atcagggac
B D                    Gibbon  a-cc--------------------------------c------------atcaaggac
B D                    Rhesus  a-cc--------------------------------c------------gtcagggag
B D       Crab-eating macaque  a-cc--------------------------------c------------gtcagggag
B D                    Baboon  a-tc--------------------------------c------------gtcagggag
B D              Green monkey  a-cc--------------------------------c------------gtcagggag
B D                  Marmoset  a-ca--------------------------------c------------gtcagggag
B D           Squirrel monkey  a-cg--------------------------------t------------gtcggggag
B D                  Bushbaby  g-cc--------------------------------c------------cttatgg-t
           Chinese tree shrew  a-cc--------------------------------c------------ctcagggac
B D                  Squirrel  g-ac--------------------------------c------------cctcagggg
       Lesser Egyptian jerboa  a-gc--------------------------------c------------cttttaaac
                 Prairie vole  a-ag--------------------------------c------------cactgagac
B D           Chinese hamster  a-ca--------------------------------c------------ccccaggac
               Golden hamster  a-ca--------------------------------c------------accccagat
B D                     Mouse  a-cg--------------------------------c------------cctcaggac
B D                       Rat  a-tg--------------------------------t------------ccccaggac
B D            Naked mole-rat  a-cc--------------------------------c------------ctcaggggg
B D                Guinea pig  g-cc--------------------------------c------------ctc-agggg
                   Chinchilla  a-tc--------------------------------c------------ctcaaggag
             Brush-tailed rat  a-tc--------------------------------t------------ctcaaggag
B D                    Alpaca  t-cc--------------------------------c------------ctcgggggt
               Bactrian camel  t-cc--------------------------------c------------ctcgggggt
B D                   Dolphin  t-cc--------------------------------c------------ctcggggag
                 Killer whale  t-cc--------------------------------c------------ctcgggga-
B D                     Horse  t-cc--------------------------------c------------ctcggggac
B D          White rhinoceros  gacc--------------------------------c------------ctcggagac
B D                       Cat  a-ct--------------------------------c------------ctc-ggggc
B D                       Dog  a-ct--------------------------------c------------ctc----ac
B D                   Ferret   a-ct--------------------------------c------------cttggggac
B D                     Panda  a-cc--------------------------------c------------cttggggac
               Pacific walrus  a-ct--------------------------------c------------ctcggggac
             Black flying-fox  ------------------------------------t------------ctcgggggt
                Big brown bat  a-cc--------------------------------c------------ctttgggat
         David's myotis (bat)  g-cc--------------------------------c------------ctttgggag
B D                  Elephant  c-ac--------------------------------c------------ttcaggggc
B D                   Manatee  c-at--------------------------------c------------cttgggggc
                     Aardvark  c-ac--------------------------------c------------cctggatg-
B D                 Armadillo  g-ag--------------------------------c------------cctggaaa-
B D                   Opossum  g-cgcag-----------------------------c------------cccaggaag
B D           Tasmanian devil  g-cagagaggacaaatggcagcaaatgtgcccccccc------------cccaggcaa
  D               Rock pigeon  ---------------------------------ctaa------------ggctgggat
  D              Saker falcon  ---------------------------------cagc------------ggaggggac
  D       Collared flycatcher  ---------------------------------tggc------------agcagggcc
B D       Medium ground finch  ---------------------------------aatcatggaatggattaggagggac
B D               Zebra finch  ---------------------------------gacc---------------aggtcc
           Tibetan ground jay  ---------------------------------gtcc------------cgccgcgcc
B D                Budgerigar  ---------------------------------gtccatggggaggattgtcaggatc
B D        American alligator  ---------------------------------ggg-------------gtgggggtc
B D                      Pika  ==========================================================
         Cape elephant shrew  ==========================================================
B D                    Tenrec  ==========================================================
                Weddell seal  ==========================================================
B D                       Cow  ==========================================================
               Domestic goat  ==========================================================
B D                     Sheep  ==========================================================
            Tibetan antelope  ==========================================================
  D  Chinese softshell turtle  ==========================================================
  D            Painted turtle  ==========================================================
  D           Green seaturtle  ==========================================================
B D                   Chicken  ==========================================================
  D          Peregrine falcon  ==========================================================
B D                   Wallaby  ==========================================================
            Cape golden mole  ==========================================================

Alignment block 11 of 61 in window, 2018601 - 2018609, 9 bps 
B D                     Human  a-----------------------cag-cccag
B D                     Chimp  a-----------------------cag-cccag
B D                   Gorilla  a-----------------------cag-cccag
B D                 Orangutan  a-----------------------cag-cccag
B D                    Gibbon  a-----------------------cag-cccag
B D                    Rhesus  a-----------------------cag-cccag
B D       Crab-eating macaque  a-----------------------cag-ctcag
B D                    Baboon  a-----------------------cag-cccag
B D              Green monkey  a-----------------------cag-cccag
B D                  Marmoset  a-----------------------cag-tgcag
B D           Squirrel monkey  a-----------------------cag-ctcag
B D                  Bushbaby  a-----------------------cag-cccag
           Chinese tree shrew  a-----------------------cag-cccag
B D                  Squirrel  ta----------------------cag-tgcaa
       Lesser Egyptian jerboa  ta----------------------tggttttat
                 Prairie vole  aa----------------------cag-tatag
B D           Chinese hamster  aa----------------------cag-tgtag
               Golden hamster  aa----------------------tag-tgtag
B D                     Mouse  ag----------------------cag-tgtag
B D                       Rat  aa----------------------cgg-tgtag
B D            Naked mole-rat  ag----------------------cag-ctcaa
B D                Guinea pig  ag----------------------caa-gt-aa
                   Chinchilla  ag----------------------caa-gtcaa
             Brush-tailed rat  ag----------------------cag-gtcaa
B D                    Alpaca  a-----------------------aag-cccag
               Bactrian camel  a-----------------------aag-cccag
B D                   Dolphin  g-----------------------aag-cccgg
                 Killer whale  g-----------------------aag-cccgg
B D                     Horse  g-----------------------tag-cccag
B D          White rhinoceros  a-----------------------tag-cccaa
B D                       Cat  g-----------------------aaa-cccag
B D                       Dog  a-----------------------aag-ccctg
B D                   Ferret   a-----------------------acc-cccag
B D                     Panda  a-----------------------atg-cccag
               Pacific walrus  a-----------------------acg-accag
             Black flying-fox  g-----------------------gag-cccag
                Big brown bat  a-----------------------aag-gccac
         David's myotis (bat)  a-----------------------aag-gccac
B D                  Elephant  t-----------------------taa-ccaag
B D                   Manatee  t-----------------------taa-ccaag
                     Aardvark  -------------------------ag-ctgag
B D                 Armadillo  ------------------------tgg-caggt
B D                   Opossum  g-----------------------gca-cg---
B D           Tasmanian devil  t-----------------------gag-tg---
  D               Rock pigeon  -c----------------------ccc-cccag
  D              Saker falcon  -g----------------------cca-gcccg
  D       Collared flycatcher  -a----------------------cgg-cccag
B D       Medium ground finch  -c----ctaaagctcaccctgttccac-ccctg
B D               Zebra finch  -c----ccagacttcacctgg---cac-ctccg
           Tibetan ground jay  -cgtgaccacgcccccattggacacgc-cc---
B D                Budgerigar  -c----------------------cat-tcctg
B D        American alligator  -t----------------------gac-taccg
  D            Painted turtle  -----------------------gccg-cccgg
B D                      Pika  =================================
         Cape elephant shrew  =================================
B D                    Tenrec  =================================
                Weddell seal  =================================
B D                       Cow  =================================
               Domestic goat  =================================
B D                     Sheep  =================================
            Tibetan antelope  =================================
  D  Chinese softshell turtle  =================================
  D           Green seaturtle  =================================
B D                   Chicken  =================================
  D          Peregrine falcon  =================================
B D                   Wallaby  =================================
            Cape golden mole  =================================

Inserts between block 11 and 12 in window
  D              Rock pigeon 9bp
  D             Saker falcon 1bp
  D      Collared flycatcher 12bp
B D      Medium ground finch 16bp
B D              Zebra finch 13bp
          Tibetan ground jay 11bp
B D               Budgerigar 18bp
B D       American alligator 1bp

Alignment block 12 of 61 in window, 2018610 - 2018612, 3 bps 
B D                     Human  act
B D                     Chimp  act
B D                   Gorilla  act
B D                 Orangutan  act
B D                    Gibbon  act
B D                    Rhesus  act
B D       Crab-eating macaque  act
B D                    Baboon  act
B D              Green monkey  act
B D                  Marmoset  act
B D           Squirrel monkey  act
B D                  Bushbaby  act
           Chinese tree shrew  act
       Lesser Egyptian jerboa  act
                 Prairie vole  act
B D           Chinese hamster  act
               Golden hamster  act
B D                     Mouse  acc
B D                       Rat  acc
B D            Naked mole-rat  act
B D                Guinea pig  act
                   Chinchilla  act
             Brush-tailed rat  act
B D                    Alpaca  gcc
               Bactrian camel  gcc
B D                   Dolphin  act
                 Killer whale  act
B D                     Horse  act
B D          White rhinoceros  act
B D                       Cat  cct
B D                       Dog  act
B D                   Ferret   act
B D                     Panda  act
               Pacific walrus  act
             Black flying-fox  act
                Big brown bat  att
         David's myotis (bat)  act
B D                  Elephant  aca
B D                   Manatee  aca
                     Aardvark  gcc
B D                 Armadillo  aca
B D                   Opossum  acc
B D           Tasmanian devil  -ct
  D               Rock pigeon  cct
  D              Saker falcon  gcc
  D       Collared flycatcher  tgg
B D       Medium ground finch  tcc
B D               Zebra finch  tct
           Tibetan ground jay  ccg
B D                Budgerigar  agg
B D        American alligator  aat
  D           Green seaturtle  gct
  D            Painted turtle  -ct
B D                      Pika  ===
         Cape elephant shrew  ===
B D                    Tenrec  ===
                Weddell seal  ===
B D                       Cow  ===
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
B D                  Squirrel  ---
  D  Chinese softshell turtle  ===
B D                   Chicken  ===
  D          Peregrine falcon  ===
B D                   Wallaby  ===
            Cape golden mole  ===

Inserts between block 12 and 13 in window
  D          Green seaturtle 161bp
  D           Painted turtle 1bp

Alignment block 13 of 61 in window, 2018613 - 2018624, 12 bps 
B D                     Human  ca-ctg----tcccagc--
B D                     Chimp  ca-ctg----tcccagc--
B D                   Gorilla  ca-ctg----tcccagc--
B D                 Orangutan  ca-ctg----cctcagc--
B D                    Gibbon  ca-ctg----cctcagc--
B D                    Rhesus  ca-ctg----tcccagc--
B D       Crab-eating macaque  ca-ctg----tcccagc--
B D                    Baboon  ca-ctg----tcccagc--
B D              Green monkey  ca-ctg----tcccagc--
B D                  Marmoset  ca-ctg----ccccag---
B D           Squirrel monkey  ca-ctg----ccccgg---
B D                  Bushbaby  catcca----tcctggc--
           Chinese tree shrew  ca-----------------
       Lesser Egyptian jerboa  ca-tgg----gtctcaa--
                 Prairie vole  ca-tga----attccca--
B D           Chinese hamster  ca-tga----attccca--
               Golden hamster  ca-tga----attccca--
B D                     Mouse  ca-tga----atcccca--
B D                       Rat  ca-cga----atcccca--
B D            Naked mole-rat  ca-tag----gcctgga--
B D                Guinea pig  ca-tgg----gcctgga--
                   Chinchilla  ca-tgg----gcctgga--
             Brush-tailed rat  ca-tgg----acctgga--
B D                    Alpaca  ga-agg----gtctcag--
               Bactrian camel  ga-agg----gtctcgg--
B D                   Dolphin  ---cgg----gtccggc--
                 Killer whale  ca-cgg----gtccggc--
B D                     Horse  cacagg----ccctggc--
B D          White rhinoceros  ctcggg----ccccggc--
B D                       Cat  ct-ggg----tcccagt--
B D                       Dog  ct-ggg----tctcagc--
B D                   Ferret   ga-ggg----tctcagc--
B D                     Panda  gt-g---------------
               Pacific walrus  ct-ggg----tctcagc--
             Black flying-fox  ct-ggg----ttccgg---
                Big brown bat  gt--gg----tccaggc--
         David's myotis (bat)  gt---g----tccaggc--
B D                  Elephant  cc-tct----gtttggt--
B D                   Manatee  cc-tct----gcctggc--
                     Aardvark  cc-tcc----gcctgg---
B D                 Armadillo  ct-tgt-----cctggc--
B D                   Opossum  ag-ctg----cccctgc--
B D           Tasmanian devil  gt-gtg----cccggtc--
  D               Rock pigeon  ca-ctt----ccttgggcc
  D              Saker falcon  cc-cca----gccccggcc
  D       Collared flycatcher  ct-cca---cacctgggcg
B D       Medium ground finch  ca-ctg----tcccaggtg
B D               Zebra finch  ct-ccggacctcccggatt
           Tibetan ground jay  cc-ctc----tcacgggac
B D                Budgerigar  ct-gag----atgcaggga
B D        American alligator  cc-cag----tcccag--c
  D           Green seaturtle  ct-cca----tcccag--c
  D            Painted turtle  -----------cccag--c
B D                      Pika  ===================
         Cape elephant shrew  ===================
B D                    Tenrec  ===================
                Weddell seal  ===================
B D                       Cow  ===================
               Domestic goat  ===================
B D                     Sheep  ===================
            Tibetan antelope  ===================
B D                  Squirrel  -------------------
  D  Chinese softshell turtle  ===================
B D                   Chicken  ===================
  D          Peregrine falcon  ===================
B D                   Wallaby  ===================
            Cape golden mole  ===================

Inserts between block 13 and 14 in window
            Black flying-fox 8bp
B D          Tasmanian devil 5bp

Alignment block 14 of 61 in window, 2018625 - 2018633, 9 bps 
B D                     Human  cc-----ct-----caac----a
B D                     Chimp  cc-----ct-----caac----a
B D                   Gorilla  cc-----ct-----caac----a
B D                 Orangutan  cc-----ct-----caac----a
B D                    Gibbon  cc-----ct-----caac----a
B D                    Rhesus  cc-----ct-----cagc----a
B D       Crab-eating macaque  cc-----ct-----cagc----a
B D                    Baboon  cc-----ct-----cagc----a
B D              Green monkey  cc-----ct-----caac----a
B D                  Marmoset  cc-----ct-----caac----a
B D           Squirrel monkey  cc-----ct-----cagc----a
B D                  Bushbaby  tc-----tt-----cctc----g
       Lesser Egyptian jerboa  cc-----ct-----tta-----a
                 Prairie vole  cc-----ct-----tcac----g
B D           Chinese hamster  cc-----ct-----ccat----a
               Golden hamster  cc-----ct-----ccat----a
B D                     Mouse  cc-----ct-----ccat----a
B D                       Rat  cc-----ct-----ccac----a
B D            Naked mole-rat  -c-----ct-----cagt----a
B D                Guinea pig  -t-----ct-----cagc----a
                   Chinchilla  -c-----ct-----cagc----a
             Brush-tailed rat  -c-----ct-----cagc----a
B D                    Alpaca  ct-----cg--------------
               Bactrian camel  ct-----cg--------------
B D                   Dolphin  ct-----cg--------------
                 Killer whale  ct-----cg--------------
B D                     Horse  ct---------------------
B D          White rhinoceros  ct---------------------
B D                       Cat  ct-----ct--------------
B D                       Dog  ct-----ct--------------
B D                   Ferret   ct-----ct--------------
               Pacific walrus  ct---------------------
                Big brown bat  ct-----ct--------------
         David's myotis (bat)  ct-----ct--------------
B D                  Elephant  cc-----cc-----cggc----a
B D                   Manatee  cc-----ct-----cagc----a
                     Aardvark  cc-----ct-----ctac----a
B D                 Armadillo  cc-----ct-----ggga----a
B D                   Opossum  cc-----cc-----cca------
B D           Tasmanian devil  cc-----tc-----ccac----t
  D               Rock pigeon  ct-----tcggcagtggc----t
  D              Saker falcon  ct-----ac-----ttgc----a
  D       Collared flycatcher  ct-----gc-----taaa----t
B D       Medium ground finch  ct-----cc-----cagccctgt
B D               Zebra finch  cc-----cc-----cagctc--c
           Tibetan ground jay  cg-----cc-----catt----c
B D                Budgerigar  ct-----ga-----tgga----t
B D        American alligator  cc-----cc-----tagg----g
  D           Green seaturtle  cc-----ct-----cagc----a
  D            Painted turtle  ctccatgcc-----cagc----a
B D                      Pika  =======================
         Cape elephant shrew  =======================
            Black flying-fox  =======================
B D                    Tenrec  =======================
                Weddell seal  =======================
B D                     Panda  -----------------------
B D                       Cow  =======================
               Domestic goat  =======================
B D                     Sheep  =======================
            Tibetan antelope  =======================
B D                  Squirrel  -----------------------
          Chinese tree shrew  -----------------------
  D  Chinese softshell turtle  =======================
B D                   Chicken  =======================
  D          Peregrine falcon  =======================
B D                   Wallaby  =======================
            Cape golden mole  =======================

Inserts between block 14 and 15 in window
B D                    Horse 5bp
B D         White rhinoceros 5bp
              Pacific walrus 5bp
B D                  Opossum 2bp
B D          Tasmanian devil 4bp

Alignment block 15 of 61 in window, 2018634 - 2018635, 2 bps 
B D                     Human  cc
B D                     Chimp  cc
B D                   Gorilla  cc
B D                 Orangutan  cc
B D                    Gibbon  cc
B D                    Rhesus  cc
B D       Crab-eating macaque  cc
B D                    Baboon  cc
B D              Green monkey  cc
B D                  Bushbaby  tc
       Lesser Egyptian jerboa  ta
                 Prairie vole  tt
B D           Chinese hamster  tt
               Golden hamster  tt
B D                     Mouse  tt
B D                       Rat  tt
B D            Naked mole-rat  cc
B D                Guinea pig  cc
                   Chinchilla  ct
             Brush-tailed rat  cc
B D                   Opossum  gc
B D           Tasmanian devil  cc
  D               Rock pigeon  cc
  D              Saker falcon  ga
  D       Collared flycatcher  cc
B D       Medium ground finch  cc
B D               Zebra finch  cc
           Tibetan ground jay  ag
B D                Budgerigar  cc
B D        American alligator  cc
  D           Green seaturtle  cc
  D            Painted turtle  cc
B D                      Pika  ==
         Cape elephant shrew  ==
            Black flying-fox  ==
B D                    Tenrec  ==
B D                   Dolphin  --
                Weddell seal  ==
                Killer whale  --
B D                  Marmoset  --
B D           Squirrel monkey  --
B D                     Panda  --
               Big brown bat  --
B D                       Cow  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
        David's myotis (bat)  --
B D                 Armadillo  --
B D                   Manatee  --
B D                  Elephant  --
B D          White rhinoceros  ==
B D                     Horse  ==
              Bactrian camel  --
B D                    Alpaca  --
B D                  Squirrel  --
          Chinese tree shrew  --
B D                       Dog  --
B D                   Ferret   --
B D                       Cat  --
              Pacific walrus  ==
  D  Chinese softshell turtle  ==
B D                   Chicken  ==
  D          Peregrine falcon  ==
B D                   Wallaby  ==
            Cape golden mole  ==
                    Aardvark  --

Alignment block 16 of 61 in window, 2018636 - 2018639, 4 bps 
B D                     Human  -t----ccc
B D                     Chimp  -t----ccc
B D                   Gorilla  -t----ccc
B D                 Orangutan  -t----ccc
B D                    Gibbon  -t----ccc
B D                    Rhesus  -c----ccc
B D       Crab-eating macaque  -c----ccc
B D              Green monkey  -t----ccc
B D                  Marmoset  -g----ccg
B D           Squirrel monkey  -g----ccc
B D                  Bushbaby  -t----ttc
           Chinese tree shrew  ------cct
       Lesser Egyptian jerboa  -g----ccc
                 Prairie vole  -a----ccc
B D           Chinese hamster  -a----ccc
               Golden hamster  -a----cgc
B D                     Mouse  -a----ccc
B D                       Rat  -a----ccc
B D            Naked mole-rat  -t----cct
B D                Guinea pig  -t-----ct
                   Chinchilla  -t----ccc
             Brush-tailed rat  -t----ccc
B D                  Elephant  --------c
B D                   Manatee  --------c
                     Aardvark  --------t
B D                 Armadillo  ------gcc
B D                   Opossum  ------gcc
B D           Tasmanian devil  ------tcc
  D               Rock pigeon  ct----cc-
  D              Saker falcon  aa----gc-
  D       Collared flycatcher  ag----ag-
B D       Medium ground finch  ag----cc-
B D               Zebra finch  ag----cc-
           Tibetan ground jay  gg----cg-
B D                Budgerigar  tg----ct-
B D        American alligator  gg----cc-
  D           Green seaturtle  tt----cc-
  D            Painted turtle  atgcagtc-
B D                      Pika  =========
         Cape elephant shrew  =========
            Black flying-fox  =========
B D                    Tenrec  =========
B D                    Baboon  ---------
B D                   Dolphin  ---------
                Weddell seal  =========
                Killer whale  ---------
B D                     Panda  ---------
               Big brown bat  ---------
B D                       Cow  =========
               Domestic goat  =========
B D                     Sheep  =========
            Tibetan antelope  =========
        David's myotis (bat)  ---------
B D          White rhinoceros  =========
B D                     Horse  =========
              Bactrian camel  ---------
B D                    Alpaca  ---------
B D                  Squirrel  ---------
B D                       Dog  ---------
B D                   Ferret   ---------
B D                       Cat  ---------
              Pacific walrus  =========
  D  Chinese softshell turtle  =========
B D                   Chicken  =========
  D          Peregrine falcon  =========
B D                   Wallaby  =========
            Cape golden mole  =========

Inserts between block 16 and 17 in window
B D      Crab-eating macaque 3bp
B D                 Elephant 1bp
B D                  Manatee 1bp
B D                Armadillo 1bp
B D                  Opossum 5bp

Alignment block 17 of 61 in window, 2018640 - 2018642, 3 bps 
B D                     Human  cc--t--
B D                     Chimp  cc--t--
B D                   Gorilla  cc--t--
B D                 Orangutan  cc--t--
B D                    Gibbon  cc--t--
B D                    Rhesus  cc--t--
B D              Green monkey  tc--t--
B D                  Marmoset  cc--t--
B D           Squirrel monkey  tc--t--
B D                  Bushbaby  cc-----
           Chinese tree shrew  cc--t--
B D                  Squirrel  ----c--
       Lesser Egyptian jerboa  ccttt--
                 Prairie vole  ----t--
B D           Chinese hamster  ----t--
               Golden hamster  ----t--
B D                     Mouse  ----t--
B D                       Rat  ----t--
B D            Naked mole-rat  ----t--
B D                Guinea pig  ----t--
                   Chinchilla  ----t--
             Brush-tailed rat  ----t--
B D                  Elephant  cc--c--
B D                   Manatee  cc--c--
                     Aardvark  cc--c--
B D                 Armadillo  cc--t--
B D                   Opossum  --gat--
B D           Tasmanian devil  --cat--
  D               Rock pigeon  ----tgt
  D              Saker falcon  ----tgg
  D       Collared flycatcher  ----gga
B D       Medium ground finch  ----tgg
B D               Zebra finch  ----cgg
           Tibetan ground jay  ----tgg
B D                Budgerigar  ----tgg
B D        American alligator  ----acg
  D           Green seaturtle  ----cct
  D            Painted turtle  ----cgt
B D                      Pika  =======
         Cape elephant shrew  =======
            Black flying-fox  =======
B D                    Tenrec  =======
B D                    Baboon  -------
B D                   Dolphin  -------
                Weddell seal  =======
                Killer whale  -------
B D                     Panda  -------
               Big brown bat  -------
B D                       Cow  =======
               Domestic goat  =======
B D                     Sheep  =======
            Tibetan antelope  =======
        David's myotis (bat)  -------
B D          White rhinoceros  =======
B D                     Horse  =======
              Bactrian camel  -------
B D                    Alpaca  -------
B D                       Dog  -------
B D                   Ferret   -------
B D                       Cat  -------
              Pacific walrus  =======
  D  Chinese softshell turtle  =======
B D                   Chicken  =======
  D          Peregrine falcon  =======
B D                   Wallaby  =======
            Cape golden mole  =======
B D       Crab-eating macaque  =======

Alignment block 18 of 61 in window, 2018643 - 2018704, 62 bps 
B D                     Human  --t----accttg---------gct-------ccaga--aaacccaaggacatcggg---ctcttt----
B D                     Chimp  --t----acctcg---------gct-------ccaga--aaacccaaggacatcggg---cacttt----
B D                   Gorilla  --t----acctcg---------gct-------ccaga--aaacccaaggacatcggg---ctcttt----
B D                 Orangutan  --t----ccctct---------gct-------ccaga--aaacccatgcacatcggg---ctcttt----
B D                    Gibbon  --t----acctcg---------gct-------ccaga--aaacccaagcacatcggg---ctcttt----
B D                    Rhesus  --t----acctct---------gct-------ccaga--aaacccaagcacatcggg---ctcttt----
B D       Crab-eating macaque  --t----acctct---------gct-------ccaga--aaacccaagcacatcggg---ctcttt----
B D              Green monkey  --c----acctct---------gct-------ccaga--aaacccaagcacatcggg---ctcttt----
B D                  Marmoset  --t----acctct--------cgct-------ccaga--aaacctgagctcatgggg---c---------
B D           Squirrel monkey  --t----acctct---------gct-------ccgga--aaacccaagctcatagga---ctcttt----
B D                  Bushbaby  ---------ctct---------gat-------ccaga--gggcttgagcacatcagg---ctcctg----
           Chinese tree shrew  --t----acctct---------gtt-------ccagg--aagcccaagcacatcagg---ccctct----
B D                  Squirrel  --t----ccctgc---------tct-------caagg--cag------------ggg---ccttct----
       Lesser Egyptian jerboa  --t----acttct---------gct-------ccaca--aagcccaaacc--------------------
                 Prairie vole  --a----acc-cc---------gtt-------ccaca--aagccctgcgtgtt-ggg---ctctct----
B D           Chinese hamster  --t----ccctct---------gtt-------ccaca--aagccataagtgtt-ggg---ctctct----
               Golden hamster  --t----acttct---------gtt-------ccaca--aagccctaagtgtt-gga---ctatct----
B D                     Mouse  --t----ctctct---------gtt-------ctacg--aagccccaagtgtt-ggg---ctctct----
B D                       Rat  --t----ccctct---------gtt-------ccacg--gagccccaagtgtt-ggg---ct--------
B D            Naked mole-rat  --t----acggtt---------tct--------cagt--aagcctaatcacat-gag---ctttcc----
B D                Guinea pig  --t----gctgct---------tct-------cca---------------------------ttct----
                   Chinchilla  --t----gttgct---------tct-------ccggt--aagcttaaccacat-gaa---ctttct----
             Brush-tailed rat  --t----gttgct---------tct-------ccagt--aaacttaaccatat-gag---ctttct----
B D                    Alpaca  ----------------------gcg-------gcaga--cacctcacaagc----------tctct----
               Bactrian camel  ----------------------gcg-------gcagg--cacctcacaagc----------tctct----
B D                   Dolphin  ----------------------gcc-------ccagg--aagctcaagcacatggcgctctcctcc----
                 Killer whale  ----------------------gcc-------ccagg--aagctcaagcacacggcgctctcctcc----
B D                       Cat  ------------------------c-------ccgga--acactgaagcacgtgggg-------------
B D                       Dog  ----------------------gcc-------cccaa--aagctaaagcacatcggg-------------
B D                   Ferret   ----------------------gcc-------cccga--aagtgagagctcgtcggg-------------
B D                     Panda  ---------------------------------------------ggtctcagc----------------
                Big brown bat  ----------------------gcc-------ccaga--gagctcacgcccgatgg--------------
         David's myotis (bat)  ----------------------gcc-------ccaga--gagctca-gcccgatgga-------------
B D                  Elephant  --t----acctct---------gct-------ccaga--aagctcagacactt-cgc---ctctct----
B D                   Manatee  --t----acctct---------gct-------ccaga--aagctcaggtatgt-cac---ctctttg---
                     Aardvark  --t----aactgt---------gct-------ccag---aagttcaggcatgt-tac---ctccct----
B D                 Armadillo  --t----a------------------------ccaga--aagcaaactccgta-agg---ctctgtg---
B D                   Opossum  --t----tccctc---------ctt-------ccgagctgggctcaggag----agg---ccgccgggcc
B D           Tasmanian devil  --t----tccttg---------tct-------ctgag--gagacctgaag----ggg-------------
  D               Rock pigeon  ccc------ctct-------------------cctgc--agg------------gga---caacag----
  D              Saker falcon  taa----ggggtc-------------------ccagc-------------------t---caacag----
  D       Collared flycatcher  ttc----gccatccttcccggggccaggg---ccagg-----------------------tgggtg----
B D       Medium ground finch  cct--tgggcact---------gccagggat-ccagg---------------------------------
B D               Zebra finch  ccc----ggcacc----------ccaggaatgcctgg-------------------c---ttgcca----
           Tibetan ground jay  cct--atggctcc---------gccc------cttgg--aca------------cgc---ccattg----
B D                Budgerigar  gct-----gcgag---------gccagg----ccagc-------------------t---gcagtg----
B D        American alligator  gccgtatgccccc---------accgggt---cctgg---ag------------cac---tgcccg----
  D           Green seaturtle  cac----cacccc---------cac-------caagc-------------------c---actccc----
  D            Painted turtle  gtt----ccccct---------tcc-------ccagg-------------------a---tccccc----
B D                      Pika  ======================================================================
         Cape elephant shrew  ======================================================================
            Black flying-fox  ======================================================================
B D                    Tenrec  ======================================================================
B D                    Baboon  ----------------------------------------------------------------------
                Weddell seal  ======================================================================
B D                       Cow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
              Pacific walrus  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                   Wallaby  ======================================================================
            Cape golden mole  ======================================================================

                        Human  --ggggg----tcc-----------------------------tg----------g--------------
                        Chimp  --ggggc----tcc-----------------------------tg----------g--------------
                      Gorilla  --ggggc----tcc-----------------------------tg----------g--------------
                    Orangutan  --ggggc----tcc-----------------------------ta----------g--------------
                       Gibbon  --ggggc----tcc-----------------------------tg----------g--------------
                       Rhesus  --ggggc----ccc-----------------------------tg----------g--------------
          Crab-eating macaque  --ggggc----ccc-----------------------------tg----------g--------------
                 Green monkey  --ggggc----ccc-----------------------------tg----------g--------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  --gggag----ccc-----------------------------tg----------g--------------
                     Bushbaby  --a-------------------------------------------------------------------
           Chinese tree shrew  --ggtcc---------------------------------------------------------------
                     Squirrel  --gggtc----tcc-----------------------------tg----------g--------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  --ggagc----ccc-----------------------------tg----------g--------------
              Chinese hamster  --ggagc----ccc-----------------------------tg----------g--------------
               Golden hamster  --ggagc----ctc-----------------------------gg----------g--------------
                        Mouse  --ggaac----tcc-----------------------------tg----------g--------------
                          Rat  ----------------------------------------------------------------------
               Naked mole-rat  --aaggc----ctc-----------------------------tc--------tga--------------
                   Guinea pig  ----------------------------------------------------------------------
                   Chinchilla  --aaggc----ctc-----------------------------tc----------g--------------
             Brush-tailed rat  --caggc----ctc-----------------------------ta----------g--------------
                       Alpaca  --gaggg----ccc-----------------------------tt----------g--------------
               Bactrian camel  --gaggg----cccttgtccccnnnnnnnnnnnnnnnnnnnnntt----------g--------------
                      Dolphin  --ggggg----ccc-----------------------------tc----------g--------------
                 Killer whale  --ggggg----ccc-----------------------------tc----------g--------------
                          Cat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
                        Panda  ----------------------------------------------------------------------
                Big brown bat  ----ggg----ccc-----------------------------tt----------c--------------
         David's myotis (bat)  ----ggg----ccc-----------------------------tc----------c--------------
                     Elephant  --ggcac----ccc-----------------------------ta-------------------------
                      Manatee  --ggccc----ccc-----------------------------ta-------------------------
                     Aardvark  --gggac----ccc-----------------------------caccac---------------------
                    Armadillo  --gggac----ccc-----------------------------cttgtc---------------------
                      Opossum  acggggcttggcct-----------------------------tgcccccggggag--------------
              Tasmanian devil  --gaggcctggcct-----------------------------tg----------g--------------
                  Rock pigeon  --ggctc----tgc-----------------------------gg----------g--------------
                 Saker falcon  --ggtgg----caa-----------------------------tg----------g--------------
          Collared flycatcher  --ggggc----ctc-----------------------------tg----------gtga-----------
          Medium ground finch  --ggcag----ccc-----------------------------ca----------g--------------
                  Zebra finch  --ggctc----ccc-----------------------------tg----------g--------------
           Tibetan ground jay  --ggcgc----ggc-----------------------------cgtgac------g--------------
                   Budgerigar  --ggcaa----tgc-----------------------------tg----------g--------------
           American alligator  --agtgc----agc-----------------------------cg----------g--------------
              Green seaturtle  --agagc----cac-----------------------------ct----------gtctgcacagagacc
               Painted turtle  --agcgc----agc-----------------------------tc----------gtcatc---------
                         Pika  ======================================================================
          Cape elephant shrew  ======================================================================
             Black flying-fox  ======================================================================
                       Tenrec  ======================================================================
                       Baboon  ----------------------------------------------------------------------
                 Weddell seal  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
               Pacific walrus  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Chicken  ======================================================================
             Peregrine falcon  ======================================================================
                      Wallaby  ======================================================================
             Cape golden mole  ======================================================================

                        Human  ---tcatcctgcacc
                        Chimp  ---tcatcctgcacc
                      Gorilla  ---tcatcctgcacc
                    Orangutan  ---gcatcccgcacc
                       Gibbon  ---tcatcctgcact
                       Rhesus  ---tcatcctaaacc
          Crab-eating macaque  ---tcatcctaaacc
                 Green monkey  ---tcatcctgcacc
                     Marmoset  ---------------
              Squirrel monkey  ---tcatcctgcacc
                     Bushbaby  ---------------
           Chinese tree shrew  ---------------
                     Squirrel  ---tcaccctctact
       Lesser Egyptian jerboa  ---------------
                 Prairie vole  ---ttgccctctacc
              Chinese hamster  ---tggccctctacc
               Golden hamster  ---cggccctctacc
                        Mouse  ---ttgccctctagc
                          Rat  --------ctctacc
               Naked mole-rat  ---ttcccctct---
                   Guinea pig  ---------------
                   Chinchilla  ---tccccttct---
             Brush-tailed rat  ---tttc--------
                       Alpaca  ---tccccctccacc
               Bactrian camel  ---tccccctccacc
                      Dolphin  ---tgcccctctagc
                 Killer whale  ---tccccctctagc
                          Cat  ---------------
                          Dog  ---------------
                      Ferret   ---------------
                        Panda  ---------------
                Big brown bat  ---tcactctcc-cc
         David's myotis (bat)  ---tcactctcc-cc
                     Elephant  ---------------
                      Manatee  ---------------
                     Aardvark  ---------------
                    Armadillo  ---------------
                      Opossum  ---cctttccc----
              Tasmanian devil  ---tcagtttc----
                  Rock pigeon  ---------------
                 Saker falcon  ---ggacttg-----
          Collared flycatcher  ---ctgcccc-----
          Medium ground finch  ---ctgccct-----
                  Zebra finch  ---ctgccca-----
           Tibetan ground jay  ---cagcgct-----
                   Budgerigar  ---------------
           American alligator  ---gtcagcc-----
              Green seaturtle  ccactgccc------
               Painted turtle  ---ctgccca-----
                         Pika  ===============
          Cape elephant shrew  ===============
             Black flying-fox  ===============
                       Tenrec  ===============
                       Baboon  ---------------
                 Weddell seal  ===============
                          Cow  ===============
                Domestic goat  ===============
                        Sheep  ===============
             Tibetan antelope  ===============
             White rhinoceros  ===============
                        Horse  ===============
               Pacific walrus  ===============
     Chinese softshell turtle  ===============
                      Chicken  ===============
             Peregrine falcon  ===============
                      Wallaby  ===============
             Cape golden mole  ===============

Inserts between block 18 and 19 in window
                Prairie vole 137bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D                      Cat 2bp
B D                      Dog 2bp
B D                  Ferret  2bp
B D                    Panda 7bp

Alignment block 19 of 61 in window, 2018705 - 2018718, 14 bps 
B D                     Human  gagacccccagagg--------------------
B D                     Chimp  gagacccccagagg--------------------
B D                   Gorilla  gagacccccagagg--------------------
B D                 Orangutan  gagacccccagagg--------------------
B D                    Gibbon  gagacccccagagg--------------------
B D                    Rhesus  caggcctccagaga--------------------
B D       Crab-eating macaque  caggcctccagaga--------------------
B D                    Baboon  -----ctc--------------------------
B D              Green monkey  caggcctccagagg--------------------
B D           Squirrel monkey  caggctcccagagg--------------------
B D                  Squirrel  cagg------------------------------
       Lesser Egyptian jerboa  -aag-ctccagaga--------------------
B D                    Alpaca  --------cagg----------------------
               Bactrian camel  --------cagg----------------------
B D                   Dolphin  --------caggtg--------------------
                 Killer whale  --------cag-----------------------
                Big brown bat  --------caggtg--------------------
         David's myotis (bat)  --------aggtga--------------------
B D                  Elephant  -----ccccaagt---------------------
B D                   Manatee  ---ccccccacgt---------------------
                     Aardvark  ---ccccacgagt---------------------
B D                 Armadillo  ---acccccaggg---------------------
B D                   Opossum  -gggccccc-------------------------
B D           Tasmanian devil  -tggcccccaggct--------------------
  D               Rock pigeon  ----------------gggacatgtggtgaggca
  D              Saker falcon  -------------tg-gcactga-------gcca
  D       Collared flycatcher  -------------ca-gcccccc-------acaa
B D       Medium ground finch  -------------gg-gcaccctgt-----gcca
B D               Zebra finch  -------------ggcgggccct--------cgg
           Tibetan ground jay  -------------cgcgcgccca-----------
B D                Budgerigar  ----------------ggtccct-----------
B D        American alligator  -------------gc-cagcccc-------gcag
  D           Green seaturtle  -------------tg-gagacac-----------
  D            Painted turtle  -------------cg-gagccgt-----------
B D                      Pika  ==================================
         Cape elephant shrew  ==================================
B D                     Mouse  ==================================
                Prairie vole  ==================================
B D                       Rat  ==================================
B D           Chinese hamster  ==================================
              Golden hamster  ==================================
            Black flying-fox  ==================================
B D                    Tenrec  ==================================
            Brush-tailed rat  ----------------------------------
                  Chinchilla  ----------------------------------
B D                Guinea pig  ----------------------------------
                Weddell seal  ==================================
B D                  Marmoset  ----------------------------------
B D                     Panda  ==================================
B D                       Cow  ==================================
               Domestic goat  ==================================
B D                     Sheep  ==================================
            Tibetan antelope  ==================================
B D          White rhinoceros  ==================================
B D                     Horse  ==================================
          Chinese tree shrew  ----------------------------------
B D            Naked mole-rat  ----------------------------------
B D                       Dog  ==================================
B D                   Ferret   ==================================
B D                       Cat  ==================================
              Pacific walrus  ==================================
  D  Chinese softshell turtle  ==================================
B D                   Chicken  ==================================
  D          Peregrine falcon  ==================================
B D                   Wallaby  ==================================
            Cape golden mole  ==================================
B D                  Bushbaby  ----------------------------------

Inserts between block 19 and 20 in window
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 8bp
                Killer whale 6bp
               Big brown bat 8bp
        David's myotis (bat) 8bp
B D                  Opossum 14bp
B D          Tasmanian devil 18bp

Alignment block 20 of 61 in window, 2018719 - 2018727, 9 bps 
B D                     Human  gaccctgcc
B D                     Chimp  gaccctgcc
B D                   Gorilla  gaccctgcc
B D                 Orangutan  gaccctgcc
B D                    Gibbon  gaccctgcc
B D                    Rhesus  ggccctgcc
B D       Crab-eating macaque  ggccctgcc
B D           Squirrel monkey  ggccctgtc
B D                  Bushbaby  ggctctgcc
           Chinese tree shrew  --ccttgcc
       Lesser Egyptian jerboa  ------gca
B D                   Dolphin  gggcccagg
                Big brown bat  ggcggggcc
         David's myotis (bat)  gatggggcc
B D                  Elephant  atccaagtc
B D                   Manatee  gtccaagtc
                     Aardvark  gtccaagtc
B D                 Armadillo  ----aagtc
B D                   Opossum  ggctccccg
B D           Tasmanian devil  tgctcagca
  D               Rock pigeon  ggaccccca
  D              Saker falcon  ggccccagg
  D       Collared flycatcher  gagctgact
B D       Medium ground finch  gggcctgcc
B D               Zebra finch  gaccccgct
           Tibetan ground jay  ----ccgcc
B D                Budgerigar  ggtcctgcc
B D        American alligator  ggcccaggc
  D           Green seaturtle  cggcttcca
  D            Painted turtle  cagcccacg
B D                      Pika  =========
         Cape elephant shrew  =========
B D                     Mouse  =========
                Prairie vole  =========
B D                       Rat  =========
B D           Chinese hamster  =========
              Golden hamster  =========
            Black flying-fox  =========
B D                    Tenrec  =========
            Brush-tailed rat  ---------
                  Chinchilla  ---------
B D                Guinea pig  ---------
B D                    Baboon  ---------
                Weddell seal  =========
                Killer whale  =========
B D                  Marmoset  ---------
B D                     Panda  =========
B D                       Cow  =========
               Domestic goat  =========
B D                     Sheep  =========
            Tibetan antelope  =========
B D          White rhinoceros  =========
B D                     Horse  =========
              Bactrian camel  =========
B D                    Alpaca  =========
B D                  Squirrel  ---------
B D            Naked mole-rat  ---------
B D                       Dog  =========
B D                   Ferret   =========
B D                       Cat  =========
              Pacific walrus  =========
  D  Chinese softshell turtle  =========
B D                   Chicken  =========
  D          Peregrine falcon  =========
B D                   Wallaby  =========
            Cape golden mole  =========
B D              Green monkey  ---------

Inserts between block 20 and 21 in window
B D                  Dolphin 23bp
               Big brown bat 9bp
        David's myotis (bat) 1080bp
B D                  Opossum 1bp
B D          Tasmanian devil 1bp

Alignment block 21 of 61 in window, 2018728 - 2018728, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                 Orangutan  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D           Squirrel monkey  -a
B D                  Bushbaby  -c
           Chinese tree shrew  -a
B D                  Elephant  -a
B D                   Manatee  -a
                     Aardvark  -a
B D                 Armadillo  -c
  D               Rock pigeon  c-
  D              Saker falcon  c-
  D       Collared flycatcher  c-
B D       Medium ground finch  c-
B D               Zebra finch  c-
           Tibetan ground jay  c-
B D                Budgerigar  t-
B D        American alligator  a-
  D           Green seaturtle  t-
  D            Painted turtle  g-
B D                      Pika  ==
         Cape elephant shrew  ==
B D                     Mouse  ==
                Prairie vole  ==
B D                       Rat  ==
B D           Chinese hamster  ==
              Golden hamster  ==
            Black flying-fox  ==
      Lesser Egyptian jerboa  --
B D                    Tenrec  ==
            Brush-tailed rat  --
                  Chinchilla  --
B D                Guinea pig  --
B D                    Baboon  --
B D                   Dolphin  ==
                Weddell seal  ==
                Killer whale  ==
B D                  Marmoset  --
B D                     Panda  ==
               Big brown bat  ==
B D                       Cow  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
        David's myotis (bat)  ==
B D          White rhinoceros  ==
B D                     Horse  ==
              Bactrian camel  ==
B D                    Alpaca  ==
B D                  Squirrel  --
B D            Naked mole-rat  --
B D                       Dog  ==
B D                   Ferret   ==
B D                       Cat  ==
              Pacific walrus  ==
  D  Chinese softshell turtle  ==
B D                   Chicken  ==
  D          Peregrine falcon  ==
B D                   Wallaby  ==
B D                   Opossum  ==
B D           Tasmanian devil  ==
            Cape golden mole  ==
B D              Green monkey  --

Alignment block 22 of 61 in window, 2018729 - 2018729, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  t
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D           Squirrel monkey  c
B D                  Bushbaby  t
           Chinese tree shrew  c
       Lesser Egyptian jerboa  c
B D                  Elephant  c
B D                   Manatee  c
                     Aardvark  t
B D                 Armadillo  a
B D                   Opossum  c
B D           Tasmanian devil  c
  D               Rock pigeon  t
  D              Saker falcon  a
  D       Collared flycatcher  a
B D       Medium ground finch  a
B D               Zebra finch  a
           Tibetan ground jay  c
B D                Budgerigar  a
B D        American alligator  g
  D           Green seaturtle  c
  D            Painted turtle  c
B D                      Pika  =
         Cape elephant shrew  =
B D                     Mouse  =
                Prairie vole  =
B D                       Rat  =
B D           Chinese hamster  =
              Golden hamster  =
            Black flying-fox  =
B D                    Tenrec  =
            Brush-tailed rat  -
                  Chinchilla  -
B D                Guinea pig  -
B D                    Baboon  -
B D                   Dolphin  =
                Weddell seal  =
                Killer whale  =
B D                  Marmoset  -
B D                     Panda  =
               Big brown bat  =
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
        David's myotis (bat)  =
B D          White rhinoceros  =
B D                     Horse  =
              Bactrian camel  =
B D                    Alpaca  =
B D                  Squirrel  -
B D            Naked mole-rat  -
B D                       Dog  =
B D                   Ferret   =
B D                       Cat  =
              Pacific walrus  =
  D  Chinese softshell turtle  =
B D                   Chicken  =
  D          Peregrine falcon  =
B D                   Wallaby  =
            Cape golden mole  =
B D              Green monkey  -

Inserts between block 22 and 23 in window
B D                 Elephant 5bp
B D                  Manatee 8bp
                    Aardvark 2bp
B D                Armadillo 3bp

Alignment block 23 of 61 in window, 2018730 - 2018730, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Baboon  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
       Lesser Egyptian jerboa  c
                Big brown bat  t
B D                   Opossum  c
B D           Tasmanian devil  c
  D               Rock pigeon  c
  D              Saker falcon  t
  D       Collared flycatcher  c
B D       Medium ground finch  c
B D               Zebra finch  c
           Tibetan ground jay  c
B D                Budgerigar  g
B D        American alligator  c
  D           Green seaturtle  c
  D            Painted turtle  g
B D                      Pika  =
         Cape elephant shrew  =
B D                     Mouse  =
                Prairie vole  =
B D                       Rat  =
B D           Chinese hamster  =
              Golden hamster  =
            Black flying-fox  =
B D                    Tenrec  =
            Brush-tailed rat  -
                  Chinchilla  -
B D                Guinea pig  -
B D                   Dolphin  =
                Weddell seal  =
                Killer whale  =
B D                  Marmoset  -
B D                     Panda  =
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
        David's myotis (bat)  =
B D                 Armadillo  =
B D                   Manatee  =
B D                  Elephant  =
B D          White rhinoceros  =
B D                     Horse  =
              Bactrian camel  =
B D                    Alpaca  =
B D                  Squirrel  -
B D            Naked mole-rat  -
B D                       Dog  =
B D                   Ferret   =
B D                       Cat  =
              Pacific walrus  =
  D  Chinese softshell turtle  =
B D                   Chicken  =
  D          Peregrine falcon  =
B D                   Wallaby  =
            Cape golden mole  =
                    Aardvark  =
B D              Green monkey  -
B D       Crab-eating macaque  -
B D                    Rhesus  -

Inserts between block 23 and 24 in window
B D                  Opossum 2bp
B D          Tasmanian devil 2bp

Alignment block 24 of 61 in window, 2018731 - 2018731, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D           Squirrel monkey  t
B D                  Bushbaby  c
           Chinese tree shrew  c
       Lesser Egyptian jerboa  c
                Big brown bat  c
B D                   Opossum  c
B D           Tasmanian devil  t
  D               Rock pigeon  c
  D              Saker falcon  g
  D       Collared flycatcher  c
B D       Medium ground finch  c
B D               Zebra finch  c
           Tibetan ground jay  t
B D                Budgerigar  c
B D        American alligator  c
  D           Green seaturtle  c
  D            Painted turtle  c
B D                      Pika  =
         Cape elephant shrew  =
B D                     Mouse  =
                Prairie vole  =
B D                       Rat  =
B D           Chinese hamster  =
              Golden hamster  =
            Black flying-fox  =
B D                    Tenrec  =
            Brush-tailed rat  -
                  Chinchilla  -
B D                Guinea pig  -
B D                   Dolphin  =
                Weddell seal  =
                Killer whale  =
B D                  Marmoset  -
B D                     Panda  =
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
        David's myotis (bat)  =
B D                 Armadillo  =
B D                   Manatee  =
B D                  Elephant  =
B D          White rhinoceros  =
B D                     Horse  =
              Bactrian camel  =
B D                    Alpaca  =
B D                  Squirrel  -
B D            Naked mole-rat  -
B D                       Dog  =
B D                   Ferret   =
B D                       Cat  =
              Pacific walrus  =
  D  Chinese softshell turtle  =
B D                   Chicken  =
  D          Peregrine falcon  =
B D                   Wallaby  =
            Cape golden mole  =
                    Aardvark  =
B D              Green monkey  -
B D                    Rhesus  -

Inserts between block 24 and 25 in window
               Big brown bat 2bp
B D                  Opossum 2bp
B D          Tasmanian devil 2bp

Alignment block 25 of 61 in window, 2018732 - 2018735, 4 bps 
B D                     Human  ctca--
B D                     Chimp  ctca--
B D                   Gorilla  ctca--
B D                 Orangutan  ctca--
B D                    Gibbon  ctca--
B D       Crab-eating macaque  ctta--
B D                    Baboon  ctta--
B D              Green monkey  ctca--
B D           Squirrel monkey  ctta--
B D                  Bushbaby  --tt--
B D                    Alpaca  cg----
               Bactrian camel  cg----
B D                       Cow  ct----
                Domestic goat  ct----
B D                       Cat  ct----
B D                       Dog  ct----
B D                   Ferret   ct----
                Big brown bat  cc----
                     Aardvark  ---g--
B D                   Opossum  gt----
B D           Tasmanian devil  ct----
  D               Rock pigeon  --tt--
  D              Saker falcon  --cctg
  D       Collared flycatcher  --ctgg
B D       Medium ground finch  --tcca
B D               Zebra finch  --cacg
           Tibetan ground jay  --cccg
B D                Budgerigar  --tc--
B D        American alligator  --cccg
  D           Green seaturtle  --ccac
  D            Painted turtle  --cccg
B D                      Pika  ======
         Cape elephant shrew  ======
B D                     Mouse  ======
                Prairie vole  ======
B D                       Rat  ======
B D           Chinese hamster  ======
              Golden hamster  ======
            Black flying-fox  ======
      Lesser Egyptian jerboa  ------
B D                    Tenrec  ======
            Brush-tailed rat  ------
                  Chinchilla  ------
B D                Guinea pig  ------
B D                   Dolphin  ======
                Weddell seal  ======
                Killer whale  ======
B D                  Marmoset  ------
B D                     Panda  ======
B D                     Sheep  ======
            Tibetan antelope  ======
        David's myotis (bat)  ======
B D                 Armadillo  ======
B D                   Manatee  ======
B D                  Elephant  ======
B D          White rhinoceros  ======
B D                     Horse  ======
B D                  Squirrel  ------
          Chinese tree shrew  ------
B D            Naked mole-rat  ------
              Pacific walrus  ======
  D  Chinese softshell turtle  ======
B D                   Chicken  ======
  D          Peregrine falcon  ======
B D                   Wallaby  ======
            Cape golden mole  ======
B D                    Rhesus  ------

Inserts between block 25 and 26 in window
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                      Cow 1bp
               Domestic goat 1bp
B D                      Cat 20bp
B D                      Dog 20bp
B D                  Ferret  20bp
               Big brown bat 1146bp
                    Aardvark 3bp

Alignment block 26 of 61 in window, 2018736 - 2018739, 4 bps 
B D                     Human  --cctc
B D                     Chimp  --cctc
B D                   Gorilla  --cctc
B D                 Orangutan  --cctg
B D                    Gibbon  --cctc
B D       Crab-eating macaque  --cctc
B D                    Baboon  --cctc
B D              Green monkey  --cctc
B D           Squirrel monkey  --cctc
B D                  Bushbaby  --cccc
B D                    Alpaca  --gtc-
               Bactrian camel  --att-
B D                       Cow  --ctg-
                Domestic goat  --ctg-
B D                     Horse  --cta-
B D          White rhinoceros  --cca-
B D                       Cat  --cca-
B D                       Dog  --cca-
B D                   Ferret   --cca-
B D                     Panda  --cca-
               Pacific walrus  --ccg-
             Black flying-fox  --ctt-
B D                   Opossum  --cctt
B D           Tasmanian devil  --cctc
  D              Saker falcon  gccc--
  D       Collared flycatcher  ggtc--
B D       Medium ground finch  gagc--
B D               Zebra finch  gccc--
           Tibetan ground jay  cccc--
B D        American alligator  gagg--
  D           Green seaturtle  tcc---
  D            Painted turtle  cac---
B D                      Pika  ======
         Cape elephant shrew  ======
B D                     Mouse  ======
                Prairie vole  ======
B D                       Rat  ======
B D           Chinese hamster  ======
              Golden hamster  ======
      Lesser Egyptian jerboa  ------
B D                    Tenrec  ======
            Brush-tailed rat  ------
                  Chinchilla  ------
B D                Guinea pig  ------
B D                   Dolphin  ======
                Weddell seal  ======
                Killer whale  ======
B D                  Marmoset  ------
               Big brown bat  ======
B D                     Sheep  ======
            Tibetan antelope  ======
        David's myotis (bat)  ======
B D                 Armadillo  ======
B D                   Manatee  ======
B D                  Elephant  ======
B D                  Squirrel  ------
          Chinese tree shrew  ------
B D            Naked mole-rat  ------
  D  Chinese softshell turtle  ======
B D                   Chicken  ======
B D                Budgerigar  ------
  D          Peregrine falcon  ======
  D               Rock pigeon  ------
B D                   Wallaby  ======
            Cape golden mole  ======
                    Aardvark  ======
B D                    Rhesus  ------

Inserts between block 26 and 27 in window
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                      Cow 8bp
               Domestic goat 8bp
  D             Saker falcon 1bp
B D      Medium ground finch 42bp
B D              Zebra finch 17bp
          Tibetan ground jay 76bp
B D       American alligator 1bp

Alignment block 27 of 61 in window, 2018740 - 2018746, 7 bps 
B D                     Human  --tgcttta
B D                     Chimp  --tgcttta
B D                   Gorilla  --tgcttta
B D                 Orangutan  --tgcttta
B D                    Gibbon  --tgcttta
B D       Crab-eating macaque  --tgctcca
B D                    Baboon  --tgctcca
B D              Green monkey  --tgctcca
B D           Squirrel monkey  --tgctccg
B D                  Bushbaby  --cgagcct
           Chinese tree shrew  -----tcc-
       Lesser Egyptian jerboa  -----ttc-
B D                  Elephant  --------g
                     Aardvark  --------g
B D                   Opossum  --ttcacgg
B D           Tasmanian devil  --tcccccg
  D               Rock pigeon  tgggtca--
  D       Collared flycatcher  -tggcct--
B D       Medium ground finch  -tagttc--
B D               Zebra finch  -gggccg--
B D                Budgerigar  ---ccca--
  D           Green seaturtle  -ccacct--
  D            Painted turtle  -acgctg--
B D                      Pika  =========
         Cape elephant shrew  =========
B D                     Mouse  =========
                Prairie vole  =========
B D                       Rat  =========
B D           Chinese hamster  =========
              Golden hamster  =========
            Black flying-fox  ---------
B D                    Tenrec  =========
            Brush-tailed rat  ---------
                  Chinchilla  ---------
B D                Guinea pig  ---------
B D                   Dolphin  =========
                Weddell seal  =========
                Killer whale  =========
B D                  Marmoset  ---------
B D                     Panda  ---------
               Big brown bat  =========
B D                       Cow  =========
               Domestic goat  =========
B D                     Sheep  =========
            Tibetan antelope  =========
        David's myotis (bat)  =========
B D                 Armadillo  =========
B D                   Manatee  =========
B D          White rhinoceros  ---------
B D                     Horse  ---------
              Bactrian camel  =========
B D                    Alpaca  =========
B D                  Squirrel  ---------
B D            Naked mole-rat  ---------
B D                       Dog  ---------
B D                   Ferret   ---------
B D                       Cat  ---------
              Pacific walrus  ---------
  D  Chinese softshell turtle  =========
B D                   Chicken  =========
          Tibetan ground jay  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
B D                   Wallaby  =========
B D        American alligator  =========
            Cape golden mole  =========
B D                    Rhesus  ---------

Inserts between block 27 and 28 in window
B D                 Elephant 27bp
                    Aardvark 31bp
B D                  Opossum 33bp
B D          Tasmanian devil 40bp

Alignment block 28 of 61 in window, 2018747 - 2018747, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  c
B D                       Dog  t
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
             Black flying-fox  g
B D                  Elephant  a
B D                   Manatee  g
                     Aardvark  a
B D                 Armadillo  g
B D                   Opossum  g
B D           Tasmanian devil  c
  D               Rock pigeon  g
  D       Collared flycatcher  g
B D       Medium ground finch  a
B D               Zebra finch  g
B D                Budgerigar  a
  D           Green seaturtle  a
  D            Painted turtle  g
B D                      Pika  =
         Cape elephant shrew  =
B D                     Mouse  =
                Prairie vole  =
B D                       Rat  =
B D           Chinese hamster  =
              Golden hamster  =
      Lesser Egyptian jerboa  -
B D                    Tenrec  =
            Brush-tailed rat  -
                  Chinchilla  -
B D                Guinea pig  -
B D                   Dolphin  =
                Weddell seal  =
                Killer whale  =
B D                  Marmoset  -
               Big brown bat  =
        David's myotis (bat)  =
              Bactrian camel  =
B D                    Alpaca  =
B D                  Squirrel  -
          Chinese tree shrew  -
B D            Naked mole-rat  -
  D  Chinese softshell turtle  =
B D                   Chicken  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                   Wallaby  =
B D        American alligator  =
            Cape golden mole  =
B D                    Rhesus  -

Inserts between block 28 and 29 in window
  D          Green seaturtle 5181bp
  D           Painted turtle 8bp

Alignment block 29 of 61 in window, 2018748 - 2018776, 29 bps 
B D                     Human  aaaacccaagca-----c-------------------agcgggttc--------t--ttggg-a
B D                     Chimp  aaaacccaagca-----c-------------------agcgggttc--------t--ttggg-a
B D                   Gorilla  aaaacccaagca-----c-------------------agcgggttc--------t--ttggg-a
B D                 Orangutan  aaaacccaggca-----c-------------------agcgggttc--------t--ttggg-a
B D                    Gibbon  aaaacccaagca-----t-------------------agcgggctc--------t--ttggg-a
B D       Crab-eating macaque  aaaacccaagca-----c-------------------atcgggctc--------t--ttggg-g
B D                    Baboon  aaaacccaagca-----c-------------------atcgggctc--------t--ttggg-g
B D              Green monkey  aaaacccaagca-----c-------------------atcgggctc--------t--ttggg-g
B D                  Marmoset  --------------------------------------------tc--------t--ttggg-a
B D           Squirrel monkey  aaaacccaagct-----c-------------------ataggactc--------t--ttggg-a
B D                  Bushbaby  aaagca----------------------------------------------------------
           Chinese tree shrew  ---acccaggca-----c-------------------a----agtc--------c--ttggg-c
B D                  Squirrel  -----------cagagtc-------------------atggtggcc--------cagagggg-g
       Lesser Egyptian jerboa  ---ctctcagcaagagtc-------------------acaggggtc--------c--aagga-a
B D           Chinese hamster  -----------aagattc-------------------acaaagggc--------c--aagag-a
               Golden hamster  -----------aagattc-------------------acgagggtc--------c--aagag-a
B D                     Mouse  -----------atgactc-------------------atgagggtc--------c--aagag-a
B D                       Rat  -----------aagattc-------------------acaaaggtc--------c--aaggg-a
B D            Naked mole-rat  ---atccaggcacaagtc-------------------acaggggcc--------t--gaggg-g
B D                Guinea pig  ---atccaggcactagtc-------------------acaggggcc--------t--aagga-g
                   Chinchilla  ---atctaggcacgagtc-------------------ata--------------------gt-g
             Brush-tailed rat  ---atccaggcatgagtc-------------------ataggggct--------t--gaggt-g
B D                    Alpaca  ------------------------------------------------------------gg-g
               Bactrian camel  ------------------------------------------------------------gg-g
B D                   Dolphin  -------------------------------------atcgggtcc--------t--ccagg-a
                 Killer whale  ------------------------------------------------------t--caagg-g
             Tibetan antelope  aaagctcaggc--------------------------acagggcgc--------t--ctccg-g
B D                       Cow  aaagctcaagc--------------------------gcagggcac--------t--ctcgg-g
B D                     Sheep  aaagctcaggc--------------------------acagggtgc--------t--ccccg-g
                Domestic goat  aaagctcaggc--------------------------acagggtgc--------t--ctccg-g
B D                     Horse  aaagcttagacg-----c-------------------ggcgg------------g--cttttcg
B D          White rhinoceros  gaagctcagaca-----c-------------------atccggctc----ttcag--cccct--
B D                       Cat  gcaggt-------------------------------acaggcccc--------c--cctcc--
B D                       Dog  gtgggtacgtct-----ctgc----------------agctggcta--------c--cc-----
B D                   Ferret   caggttccggtc-----ccgaa---------------gctgggcta--------t--cccct--
B D                     Panda  aaagctagagca-----c-------------------atcgggctc--------t--cctct-g
               Pacific walrus  aaagctagagca-----c-------------------aacgagctg--------t--cctct-g
             Black flying-fox  gacgctcaagtg-----c-------------------ggtgcgccc--------c--ccgag-g
B D                  Elephant  ca--------------------------------------------------------------
B D                   Manatee  ca--------------------------------------------------------------
                     Aardvark  tc--------------------------------------------------------------
B D                 Armadillo  ga--------------------------------------------------------------
B D                   Opossum  cccgctgagc------------------------------------------------------
B D           Tasmanian devil  tccgtcccga------------------------------------------------------
  D               Rock pigeon  ---------------------gacccc---------------tctc--------c--tttgg--
  D              Saker falcon  -------------------------------------------tgc--------c--caaga--
  D       Collared flycatcher  ---------------------agccatccagcctgtgctgggctcc--------c--cctg---
B D       Medium ground finch  ---------------------aaccac---------------tccc--------c--cttgt--
B D               Zebra finch  ---------------------gggtac----------ctgggtctc--------c--cttg---
B D                Budgerigar  ---------------------agctaa-----tggcgatgagtgtc--------c--tgagc--
B D        American alligator  -------------------------------tggagactggagctc--------a--tctgc--
  D           Green seaturtle  ---------------------------------------aagcccc--------c--tctgt--
  D            Painted turtle  ---------------------------------------agctgccaggggagac--gctgc--
B D                      Pika  ================================================================
         Cape elephant shrew  ================================================================
                Prairie vole  ================================================================
B D                    Tenrec  ================================================================
                Weddell seal  ================================================================
               Big brown bat  ================================================================
        David's myotis (bat)  ================================================================
  D  Chinese softshell turtle  ================================================================
B D                   Chicken  ================================================================
          Tibetan ground jay  ================================================================
  D          Peregrine falcon  ================================================================
B D                   Wallaby  ================================================================
            Cape golden mole  ================================================================
B D                    Rhesus  ----------------------------------------------------------------

Inserts between block 29 and 30 in window
B D         White rhinoceros 28bp
B D                      Cat 20bp
B D                      Dog 16bp
B D                  Ferret  17bp

Alignment block 30 of 61 in window, 2018777 - 2018795, 19 bps 
B D                     Human  cccctggtcatcct--gcacc------------------------------
B D                     Chimp  cccctggtcatcct--gcacc------------------------------
B D                   Gorilla  cccctggtcatcct--gcacc------------------------------
B D                 Orangutan  cccctggtcatcct--gcacc------------------------------
B D                    Gibbon  cccttggtcatcct--gcacc------------------------------
B D                    Rhesus  cccctggtcatcct--aaacc------------------------------
B D       Crab-eating macaque  cccctggtcatcct--aaacc------------------------------
B D                    Baboon  cccctggtcatcct--gcacc------------------------------
B D              Green monkey  cccctggtcatcct--gcacc------------------------------
B D                  Marmoset  cccctggtcatcct--gca--------------------------------
B D           Squirrel monkey  gccctggtcatcct--gcacc------------------------------
B D                  Bushbaby  cccctg--------------c------------------------------
           Chinese tree shrew  -----------------cagc------------------------------
B D                  Squirrel  -tcctc----cccc--atctt------------------------------
       Lesser Egyptian jerboa  -ccctg----ctct--acctt------------------------------
B D           Chinese hamster  -ctctg----ccct--gactt------------------------------
               Golden hamster  -ccctg----ccct--gactt------------------------------
B D                     Mouse  -ccctt----ccct--gactt------------------------------
B D                       Rat  -ccctg----ccct--gactt------------------------------
B D            Naked mole-rat  -tcctg----ccct--gtcat------------------------------
B D                Guinea pig  -tcctg----cctt--gctat------------------------------
                   Chinchilla  -tcctg----ccct--accat------------------------------
             Brush-tailed rat  -ttctg----ccct--atgat------------------------------
B D                    Alpaca  ----------------ggccg------------------------------
               Bactrian camel  ----------------ggccg------------------------------
B D                   Dolphin  ----------------gc---------------------------------
                 Killer whale  ----------------gccca------------------------------
             Tibetan antelope  ----------------gccct------------------------------
B D                       Cow  ----------------gccct------------------------------
B D                     Sheep  ----------------gccct------------------------------
                Domestic goat  ----------------gcccc------------------------------
B D                     Horse  ----------------ggccc------------------------------
B D                     Panda  ----------------tccct------------------------------
               Pacific walrus  ----------------tgcct------------------------------
             Black flying-fox  ----------------gcctc------------------------------
B D                  Elephant  ---------cccccaggccca------------------------------
B D                   Manatee  ---------gccct--gccct------------------------------
                     Aardvark  ---------ctcca--ggcct------------------------------
B D                 Armadillo  ---------gcccc--ggccc------------------------------
B D                   Opossum  --------gccagg--ggctt------------------------------
B D           Tasmanian devil  --------gcccct--gtccc------------------------------
  D               Rock pigeon  ------------------ggctggt--------ccccccctcct-------
  D              Saker falcon  ------------------tgtgtgc--------ttggccccacagtgcccg
  D       Collared flycatcher  ---------------------------------ctcaccgtgcg-----cc
B D       Medium ground finch  ------------------cctggca--------ctccctgcccggtg--cc
B D               Zebra finch  ----------------------------------tcacctttgggt---cc
B D                Budgerigar  ------------------tgtgtca--------ctgatccccaagca--ct
B D        American alligator  ------------------cccttcc--------caggctggccgggg--ca
  D           Green seaturtle  ------------------cccgtctcggcagctgggatggttctgtg--ct
  D            Painted turtle  ------------------cccctgcgga-----gggtgggcccagcg--cc
B D                      Pika  ===================================================
         Cape elephant shrew  ===================================================
                Prairie vole  ===================================================
B D                    Tenrec  ===================================================
                Weddell seal  ===================================================
               Big brown bat  ===================================================
        David's myotis (bat)  ===================================================
B D          White rhinoceros  ===================================================
B D                       Dog  ===================================================
B D                   Ferret   ===================================================
B D                       Cat  ===================================================
  D  Chinese softshell turtle  ===================================================
B D                   Chicken  ===================================================
          Tibetan ground jay  ===================================================
  D          Peregrine falcon  ===================================================
B D                   Wallaby  ===================================================
            Cape golden mole  ===================================================

Inserts between block 30 and 31 in window
B D                   Alpaca 10bp
              Bactrian camel 10bp
B D                  Dolphin 8bp
                Killer whale 11bp
            Tibetan antelope 41bp
B D                      Cow 42bp
B D                    Sheep 41bp
               Domestic goat 41bp
B D                    Horse 28bp
B D                    Panda 22bp
              Pacific walrus 21bp
            Black flying-fox 85bp
B D                 Elephant 8bp
B D                  Manatee 5bp
                    Aardvark 8bp
B D                Armadillo 8bp
B D                  Opossum 12bp
B D          Tasmanian devil 8bp

Alignment block 31 of 61 in window, 2018796 - 2018805, 10 bps 
B D                     Human  caggcct----------cca
B D                     Chimp  caggcct----------cca
B D                   Gorilla  caggcct----------cca
B D                 Orangutan  caggcct----------cca
B D                    Gibbon  caggcct----------cca
B D                    Rhesus  caggcct----------cca
B D       Crab-eating macaque  caggcct----------cca
B D                    Baboon  caggcct----------cca
B D              Green monkey  caggcct----------cca
B D                  Marmoset  ------c----------cca
B D           Squirrel monkey  caggctc----------cca
B D                  Bushbaby  catgtct----------cga
           Chinese tree shrew  aggtcct-------------
B D                  Squirrel  gagg----------------
       Lesser Egyptian jerboa  gaggtcc-------------
B D           Chinese hamster  taaatcc-------------
               Golden hamster  gaagtcc-------------
B D                     Mouse  gaagtcc-------------
B D                       Rat  gaagtcc-------------
B D            Naked mole-rat  gaggttt-------------
B D                Guinea pig  gaggttt-------------
                   Chinchilla  gaggttt-------------
             Brush-tailed rat  gaagttt-------------
B D                    Alpaca  ----cct----------gcg
               Bactrian camel  ----cct----------gcg
                 Killer whale  ----cct----------gca
             Tibetan antelope  ctggcct----------gca
B D                       Cow  ctggcct----------gca
B D                     Sheep  ctggcct----------gcg
                Domestic goat  ctggcct----------gcg
B D                     Horse  ggggcct----------gcc
B D          White rhinoceros  ggggcct----------gca
B D                       Cat  agcgccc----------c--
B D                   Ferret   ga------------------
B D                     Panda  ggcccct----------gca
               Pacific walrus  ggtccct----------gcg
B D                  Elephant  ggggtgc-------------
B D                   Manatee  ggcgtcc-------------
                     Aardvark  gggg-cc-------------
B D                 Armadillo  cggaccc-------------
B D                   Opossum  cggccccacaaaagtgggca
B D           Tasmanian devil  cgtccct-------------
  D              Saker falcon  tgggccg----------aca
  D       Collared flycatcher  cagcccc----------ccg
B D       Medium ground finch  ttgatcc----------cca
B D               Zebra finch  tcgctcg----------cca
B D                Budgerigar  cagctcc----------aca
B D        American alligator  cggaccc----------cag
  D           Green seaturtle  gagcaca----------cgt
  D            Painted turtle  tggctcc----------ctg
B D                      Pika  ====================
         Cape elephant shrew  ====================
                Prairie vole  ====================
            Black flying-fox  ====================
B D                    Tenrec  ====================
B D                   Dolphin  ====================
                Weddell seal  ====================
               Big brown bat  ====================
        David's myotis (bat)  ====================
B D                       Dog  ====================
  D  Chinese softshell turtle  ====================
B D                   Chicken  ====================
          Tibetan ground jay  ====================
  D          Peregrine falcon  ====================
  D               Rock pigeon  --------------------
B D                   Wallaby  ====================
            Cape golden mole  ====================

Inserts between block 31 and 32 in window
  D             Saker falcon 16bp
  D      Collared flycatcher 38bp
B D      Medium ground finch 30bp
B D              Zebra finch 31bp
B D               Budgerigar 3515bp
  D          Green seaturtle 5bp
  D           Painted turtle 5bp

Alignment block 32 of 61 in window, 2018806 - 2018859, 54 bps 
B D                     Human  gaggggccccgccaca-------gt-------cc---------atc-cccttcg--ccca--------g-
B D                     Chimp  gaggggccctgccaca-------gt-------cc---------atc-cccttcg--cc------------
B D                   Gorilla  gaggggccccgccaca-------gt-------cc---------at--cccttct--ccca--------g-
B D                 Orangutan  gaggggccctgccaca-------gt-------cc---------atc-cccttcg--ccca--------g-
B D                    Gibbon  gaggggcccttccaca-------gt-------cc---------atc-ccctttg--ccca--------g-
B D                    Rhesus  gagaggccctgccaca-------gt-------cc---------atc-ccctgtg--ccca--------g-
B D       Crab-eating macaque  gagaggccctgccaca-------gt-------cc---------atc-ccctgtg--ccca--------g-
B D                    Baboon  gaggggccctgccaca-------gt-------cc---------atc-ccctgtg--ccca--------g-
B D              Green monkey  gaggggccctgccaca-------gt-------cc---------atc-ccctgtg--ccca--------g-
B D                  Marmoset  gagggaccctgtcacatctccatgt-------cc---------atc-acctgcc--ccca--------g-
B D           Squirrel monkey  gaggggccctgtcacatttccatgt-------cc---------atc-ccctgcc--ccca--------g-
B D                  Bushbaby  t----------------------gc-------cc---------act-ccctgcc--tcca--------g-
           Chinese tree shrew  -----gccctgacttg-------ac-------ac---------cca-ccctcac--tccc--------a-
B D                  Squirrel  ------------------------a-------tg---------gtc-ccctgcc--ctgg--------g-
       Lesser Egyptian jerboa  -----------------------ct-------ca---------gtc-ctctgac--ccta-------gg-
B D           Chinese hamster  -----------------------at-------cc---------atc-ccctgac--ccta--------g-
               Golden hamster  -----------------------at-------cc---------atc-ccctgac--ccta--------g-
B D                     Mouse  -----------------------at-------cc---------atg-ccctggc--ccta--------g-
B D                       Rat  -----------------------at-------cc---------atc-ccctgac--ccta--------g-
B D            Naked mole-rat  -----------------------gt-------gt---------cac-ccctg----------------g-
B D                Guinea pig  -----------------------gt-------gt---------cac-cccta----------------g-
                   Chinchilla  -----------------------gt-------gtc--------ccc-ccctg----------------g-
             Brush-tailed rat  -----------------------gt-------gt---------cac-acctg----------------g-
B D                    Alpaca  gctccaca---------------tc-------cca--------gtc-ccc------------------c-
               Bactrian camel  gctccaca---------------tc-------cca--------gcc-ccc------------------c-
                 Killer whale  gctcggct---------------gt-----------------------cc------------------t-
             Tibetan antelope  gctcagcc---------------gt-------ct---------gac-ccc------------------c-
B D                       Cow  gctcagcc---------------ag-------gc---------gac-ccc------------------c-
B D                     Sheep  gctcggcc---------------gt-------ct---------gac-ccc------------------c-
                Domestic goat  gctcagc-------------------------ct---------gac-ccc------------------c-
B D                     Horse  atcgggct---------------gt-------cgc--------ctgcccc------------------c-
B D          White rhinoceros  atggggct---------------gt-------ccc--------ctg-ccc------------------c-
B D                   Ferret   ----------------------------------------------------------------------
B D                     Panda  gcttggct---------------gc-------ccc--------ctg-ccc------------------c-
               Pacific walrus  gct----------------------------------------cag-ccc------------------c-
B D                  Elephant  -----------------------ga-------cc---------agg-gcc------------------a-
B D                   Manatee  -----------------------ac-------ccatcccccagagg-ccc------------------g-
                     Aardvark  -----------------------aa-------ctagggccccacag-cca------------------g-
B D                 Armadillo  -----------------------gg-------cccgagactgagcc-ccc------------------c-
B D                   Opossum  gggaagc----------------cg-------cc---------agc-ttctgcc--tttc--------g-
B D           Tasmanian devil  ----agc----------------cc-------cc---------gtc-cccaggc--ctcc--------gt
  D               Rock pigeon  ------------------------------------------------ttgggg--cagg--------g-
  D              Saker falcon  --------gtgcagca-------tt-------cc---------cgg-ctcaact--ctga--------g-
  D       Collared flycatcher  --------ctgggact-------ct-------cc---------agg-cccgagg--ccag--------g-
B D       Medium ground finch  --------ctggggtc-------ccct-cgtgcc---------ctc-cccgggggtcccc--------g-
B D               Zebra finch  --------ctgcgctg-------cc---agagcc---------agc-cctgagg--cggg--------g-
B D        American alligator  --------ccgggccc-------ccatcctcgcc---------agc-ccccagg--gtga--------c-
  D           Green seaturtle  --------ttacggac-------ct-------------------ga-cggcgct--ccct--------g-
  D            Painted turtle  --------gtttgtcc-------ct-------ct---------cgc-ccggatt--ccctcagcaaagg-
B D                      Pika  ======================================================================
         Cape elephant shrew  ======================================================================
                Prairie vole  ======================================================================
            Black flying-fox  ======================================================================
B D                    Tenrec  ======================================================================
B D                   Dolphin  ======================================================================
                Weddell seal  ======================================================================
               Big brown bat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                       Dog  ======================================================================
B D                       Cat  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                   Wallaby  ======================================================================
            Cape golden mole  ======================================================================

                        Human  ---------------------------------gt--------------------ccc------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ---------------------------------gt--------------------ccc------------
                    Orangutan  ---------------------------------gt--------------------ccc------------
                       Gibbon  ---------------------------------gt--------------------ccc------------
                       Rhesus  ---------------------------------gt--------------------ccc------------
          Crab-eating macaque  ---------------------------------gt--------------------ccc------------
                       Baboon  ---------------------------------gt--------------------ccc------------
                 Green monkey  ---------------------------------gt--------------------ccc------------
                     Marmoset  ---------------------------------gt--------------------ccc------------
              Squirrel monkey  ---------------------------------gt--------------------ccc------------
                     Bushbaby  ---------------------------------gg--------------------tct------------
           Chinese tree shrew  ---------------------------------at--------------------ccc------------
                     Squirrel  ---------------------------------gt--------------------tct------------
       Lesser Egyptian jerboa  ---------------------------------gc--------------------ccc------------
              Chinese hamster  ---------------------------------at--------------------ccc------------
               Golden hamster  ---------------------------------at--------------------ccc------------
                        Mouse  ---------------------------------at--------------------tcc------------
                          Rat  ---------------------------------at--------------------ccc------------
               Naked mole-rat  ---------------------------------gt--------------------ccc------------
                   Guinea pig  ---------------------------------tt--------------------ccc------------
                   Chinchilla  ---------------------------------gt--------------------tcc------------
             Brush-tailed rat  ---------------------------------gt--------------------ccc------------
                       Alpaca  ---------------------------------gt--------------------ccc------------
               Bactrian camel  ---------------------------------gt--------------------ccc------------
                 Killer whale  ---------------------------------gt--------------------cct------------
             Tibetan antelope  ---------------------------------gt--------------------ccc------------
                          Cow  ---------------------------------gt--------------------ccc------------
                        Sheep  ---------------------------------gt--------------------ccc------------
                Domestic goat  ---------------------------------gt--------------------ccc------------
                        Horse  ---------------------------------gc--------------------ccc------------
             White rhinoceros  ---------------------------------gt--------------------ccc------------
                      Ferret   ----------------------------------------------------------------------
                        Panda  ---------------------------------tt--------------------acc------------
               Pacific walrus  ---------------------------------tt--------------------ccc------------
                     Elephant  ---------------------------------gt--------------------gcc------------
                      Manatee  ---------------------------------gg--------------------gcc------------
                     Aardvark  ---------------------------------ga--------------------gcc------------
                    Armadillo  ---------------------------------gg--------------------ccc------------
                      Opossum  -----------------gggaccttcg------ct--------------------ctt------------
              Tasmanian devil  tcccagtcccccatccctgggcctccgttcccccc--------------------cct------------
                  Rock pigeon  ---------------------------------ct--------------------ccc------------
                 Saker falcon  ---------------------------------ca--------------------ctt------------
          Collared flycatcher  ---------------------------------gtggggggcaaagcccctaggagtg-------taggg
          Medium ground finch  ---------------------------------ct--------------------gtg------------
                  Zebra finch  ---------------------------------ct--------------------gtgagccctccccag
           American alligator  ---------------------------------ct--------------------gct------------
              Green seaturtle  ---------------------------------gc--------------------ctg------------
               Painted turtle  ---------------------------------gc--------------------ttg------------
                         Pika  ======================================================================
          Cape elephant shrew  ======================================================================
                 Prairie vole  ======================================================================
             Black flying-fox  ======================================================================
                       Tenrec  ======================================================================
                      Dolphin  ======================================================================
                 Weddell seal  ======================================================================
                Big brown bat  ======================================================================
         David's myotis (bat)  ======================================================================
                          Dog  ======================================================================
                          Cat  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
                      Chicken  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
             Peregrine falcon  ======================================================================
                      Wallaby  ======================================================================
             Cape golden mole  ======================================================================

                        Human  ---ctcgga------t----cagggcc-
                        Chimp  --------------------cagggcc-
                      Gorilla  ---ctcaga------t----cagggcc-
                    Orangutan  ---ctcgga------t----cagggcc-
                       Gibbon  ---ctcgga------t----cagggcc-
                       Rhesus  ---ctcgga------g----cagggcc-
          Crab-eating macaque  ---ctcgga------g----cagggcc-
                       Baboon  ---ctcgga------g----cagggcc-
                 Green monkey  ---gtcgga------g----cagggcc-
                     Marmoset  ---ctctga------g----cagggcc-
              Squirrel monkey  ---ctctaa------g----cagggcc-
                     Bushbaby  ---tcagga------g----cagggcc-
           Chinese tree shrew  ---ccagga------g----aggggcc-
                     Squirrel  -----ggga------g----caggcct-
       Lesser Egyptian jerboa  -----ggaa------g----caggtct-
              Chinese hamster  -----agga------g----caggtct-
               Golden hamster  -----agga------g----caggtct-
                        Mouse  -----agga------g----aagttct-
                          Rat  -----agga------g----caggtct-
               Naked mole-rat  -----agga------t----tgagtct-
                   Guinea pig  -----agga------t----tgggtct-
                   Chinchilla  -----agga------t----tggatcc-
             Brush-tailed rat  -----aaga------t----tggatct-
                       Alpaca  ---ctggga------a----cagggcc-
               Bactrian camel  ---ccggga------a----cagggcc-
                 Killer whale  ---ccagga------g----caggg---
             Tibetan antelope  ---tcaggt------t----caggg-c-
                          Cow  ---tcaggt------t----caagg-c-
                        Sheep  ---tcaggt------t----caagg-c-
                Domestic goat  ---tcaggt------t----caagg-c-
                        Horse  ---ccaggc------g----cagggcc-
             White rhinoceros  ---ccagga------g----cagggcc-
                      Ferret   ----------------------ggtcc-
                        Panda  ---ccggga------g----cggggcc-
               Pacific walrus  ---cgggga------g----ctgggcc-
                     Elephant  ---aggtga------a----ccaggcg-
                      Manatee  ---aggtga------a----ccaagcg-
                     Aardvark  ---aggtga------g----ccaggtg-
                    Armadillo  ---tggagg------c----ccctgcg-
                      Opossum  ---ccagaa------ggagctcgagcc-
              Tasmanian devil  ---cccgga------g--gccggggca-
                  Rock pigeon  ---ccctct------t----ttggggct
                 Saker falcon  ---cccacg------g----cccacgca
          Collared flycatcher  tgccccaga------g----ccagggc-
          Medium ground finch  ---cccagg------g----caggggca
                  Zebra finch  caccccagg------g----ctgaggcg
           American alligator  ---gccacgtcccatg----ccggggcg
              Green seaturtle  ---cccgcg-----------gcggtga-
               Painted turtle  ---tcaggg------a----ggggggc-
                         Pika  ============================
          Cape elephant shrew  ============================
                 Prairie vole  ============================
             Black flying-fox  ============================
                       Tenrec  ============================
                      Dolphin  ============================
                 Weddell seal  ============================
                Big brown bat  ============================
         David's myotis (bat)  ============================
                          Dog  ============================
                          Cat  ----------------------------
     Chinese softshell turtle  ============================
                      Chicken  ============================
                   Budgerigar  ============================
           Tibetan ground jay  ============================
             Peregrine falcon  ============================
                      Wallaby  ============================
             Cape golden mole  ============================

Inserts between block 32 and 33 in window
B D          Chinese hamster 40bp
B D                 Elephant 3bp
B D                  Manatee 3bp
                    Aardvark 3bp
B D                Armadillo 3bp

Alignment block 33 of 61 in window, 2018860 - 2018873, 14 bps 
B D                     Human  -------------------tgcc-agggtggtgt
B D                     Chimp  -------------------tgcc-agggtggtgt
B D                   Gorilla  -------------------tgcc-agggtggtgt
B D                 Orangutan  -------------------tacc-agggtggtgt
B D                    Gibbon  -------------------tacc-agggtggcgt
B D                    Rhesus  -------------------tacc-agggtcacgt
B D       Crab-eating macaque  -------------------tacc-agggtcacgt
B D                    Baboon  -------------------tacc-agggtcacgt
B D              Green monkey  -------------------tacc-agggtcacgt
B D                  Marmoset  -------------------tgcc-agagtggcat
B D           Squirrel monkey  -------------------tacc-agagtggcat
B D                  Bushbaby  --------------------------agtggcat
           Chinese tree shrew  --------------------aca-gtggtggcat
B D                  Squirrel  -------------------ggcc-aggagagcca
       Lesser Egyptian jerboa  -------------------ggct-ggggctgcct
               Golden hamster  -------------------gggt-gggactcctt
B D                     Mouse  -------------------gact-gggactgatt
B D                       Rat  -------------------gact-ggg-ctgttt
B D            Naked mole-rat  -------------------gcct-ggagtggcct
B D                Guinea pig  -------------------gatc-agagtgatct
                   Chinchilla  -------------------agcc-agggtggcct
             Brush-tailed rat  -------------------ggccaagagtggcct
B D                    Alpaca  ---------------------cg-aggtgaacat
               Bactrian camel  ---------------------cg-aggtgaacac
             Tibetan antelope  ---------------------cg-aggtgcatgg
B D                       Cow  ---------------------cg-aggtgcgtgg
B D                     Sheep  ---------------------cg-aggtgcatgg
                Domestic goat  ---------------------cg-aggtgcatgg
B D                     Horse  ---------------------cg-aggggcagac
B D          White rhinoceros  ---------------------cg-agaggaggat
B D                       Cat  ------------------------gggtgagcgc
B D                   Ferret   ---------------------cc-gggggaatgc
B D                     Panda  ---------------------cc-aggggagcac
               Pacific walrus  ---------------------cc-aggggaacac
B D                  Elephant  ---------------------------------t
B D                   Manatee  ---------------------------------t
                     Aardvark  ---------------------------------c
B D                 Armadillo  ---------------------------------t
B D                   Opossum  -------------------------gagcatcgt
B D           Tasmanian devil  -------------------------gactgaggt
  D               Rock pigeon  ggtcc--cccgctcttttgg--------------
  D              Saker falcon  tgaca--tcc--------gc--------------
  D       Collared flycatcher  ------------------at--------------
B D       Medium ground finch  c------ccc--------ac--------------
B D               Zebra finch  ------------------gc--------------
B D        American alligator  aggttggcac--------aa--------------
  D           Green seaturtle  ------------------tt--------------
  D            Painted turtle  ------------------ct--------------
B D                      Pika  ==================================
         Cape elephant shrew  ==================================
                Prairie vole  ==================================
B D           Chinese hamster  ==================================
            Black flying-fox  ==================================
B D                    Tenrec  ==================================
B D                   Dolphin  ==================================
                Weddell seal  ==================================
                Killer whale  ----------------------------------
               Big brown bat  ==================================
        David's myotis (bat)  ==================================
B D                       Dog  ==================================
  D  Chinese softshell turtle  ==================================
B D                   Chicken  ==================================
B D                Budgerigar  ==================================
          Tibetan ground jay  ==================================
  D          Peregrine falcon  ==================================
B D                   Wallaby  ==================================
            Cape golden mole  ==================================

Inserts between block 33 and 34 in window
B D                    Horse 3bp
B D         White rhinoceros 3bp
B D                      Cat 4bp
B D                  Ferret  4bp
B D                    Panda 4bp
              Pacific walrus 4bp
B D                 Elephant 13bp
B D                  Manatee 5bp
                    Aardvark 13bp
B D                  Opossum 19bp
B D          Tasmanian devil 15bp

Alignment block 34 of 61 in window, 2018874 - 2018908, 35 bps 
B D                     Human  ggcaaa---gg-ggcc-----------------------------------tg---------------ca
B D                     Chimp  ggcaaa---gg-ggcc-----------------------------------tg---------------ca
B D                   Gorilla  ggcaaa---gg-ggcc-----------------------------------tg---------------ca
B D                 Orangutan  ggcaaa---gg-ggcc-----------------------------------tg---------------ca
B D                    Gibbon  ggcaaa---gg-ggcc-----------------------------------tg---------------ca
B D                    Rhesus  ggcaaa---gg-ggcc-----------------------------------tg---------------ca
B D       Crab-eating macaque  ggcaaa---gg-ggcc-----------------------------------tg---------------ca
B D                    Baboon  ggcaaa---gg-ggcc-----------------------------------tg---------------ca
B D              Green monkey  ggcaaa---gg-ggcc-----------------------------------tg---------------ca
B D                  Marmoset  ggcaaa---gg-ggcc-----------------------------------ta---------------ca
B D           Squirrel monkey  ggcaaa---gg-ggtc-----------------------------------tg---------------ca
B D                  Bushbaby  tacgca---gg-ggca-----------------------------------ca---------------ca
           Chinese tree shrew  tgcaca---ag-acag-----------------------------------ca---------------ct
B D                  Squirrel  gcaaag---g--tgca-----------------------------------cg---------------ta
       Lesser Egyptian jerboa  ttcaga---ga-tgtg-----------------------------------ta---------------ca
               Golden hamster  ttgaag---gc-tatc------------------------------------a---------------ca
B D                     Mouse  ttgaag---acttatc-----------------------------------ta---------------ca
B D                       Rat  ttgaag---acttatc-----------------------------------tt---------------ca
B D            Naked mole-rat  caaaaa---g--tgat-----------------------------------tg---------------ta
B D                Guinea pig  taaaaa---g--caat-----------------------------------tg---------------ta
                   Chinchilla  tgaaaa---g--tgat-----------------------------------tg---------------ta
             Brush-tailed rat  tgaaaa---g--tgat-----------------------------------tg---------------ta
B D                    Alpaca  gcaggacacga-gtcc-----------------------------------gg---------------ga
               Bactrian camel  gcaggacacga-gtcc-----------------------------------gg---------------ga
B D                   Dolphin  -----a---gc-ggcc-----------------------------------ag---------------ga
                 Killer whale  -cccaa---gc-ggcc-----------------------------------ag---------------ga
             Tibetan antelope  accaaa---gc-ggct-----------------------------------gg---------------ga
B D                       Cow  accgaa---gc-ggct-----------------------------------gg---------------ga
B D                     Sheep  accgaa---gc-agct-----------------------------------gg---------------ga
                Domestic goat  accgaa---gt-ggct-----------------------------------gg---------------ga
B D                     Horse  actcca---gc-ccct-----------------------------------g------------------
B D          White rhinoceros  atgcca---gc-gtcc-----------------------------------a------------------
B D                       Cat  gaccct---gg-ggcc-----------------------------------ag-----------------
B D                       Dog  gaccca---ga-ggcc-----------------------------------gg-----------------
B D                   Ferret   gtgcca---ga-ggcc-----------------------------------tg-----------------
B D                     Panda  gaccca---ga-gacc-----------------------------------gg-----------------
               Pacific walrus  gaccca---gg-gacc-----------------------------------cg-----------------
         David's myotis (bat)  ggctga---ga-ggcc-----------------------------------tg---------------ct
B D                  Elephant  --ggca---gg-agac----------------------------tccagggcg---------------gg
B D                   Manatee  --ggca---gg-agct-----------gcgctcactccct--catcccaggcg---------------ga
                     Aardvark  --gcca---gg-agccaggtgacaggtgtgctcagagccggagaggcagggtg---------------ct
B D                 Armadillo  ------------cacc-----------------------------------tg---------------ca
B D                   Opossum  ccccag---gg-cgcc-----------------------------------tc---------------cg
B D           Tasmanian devil  ccccag---ga-ggcg-----------------------------------gc---------------cg
  D               Rock pigeon  ------------ggca-----------------------------------gg---------------ac
  D              Saker falcon  ------------aaca-----------------------------------t------------------
  D       Collared flycatcher  ------------ggca-----------------------------------ag---------------gg
B D       Medium ground finch  ------------agcc-----------------------------------tg---------------gc
B D               Zebra finch  ------------tgca-----------------------------------tg---------------ga
B D        American alligator  ------------ggca-----------------------------------cg---------------gc
  D           Green seaturtle  ------------gaca-----------------------------------gg---------------cc
  D            Painted turtle  ------------ggca-----------------------------------gggctgcgccgggtggccc
B D                      Pika  ======================================================================
         Cape elephant shrew  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
            Black flying-fox  ======================================================================
B D                    Tenrec  ======================================================================
                Weddell seal  ======================================================================
               Big brown bat  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                   Wallaby  ======================================================================
            Cape golden mole  ======================================================================

                        Human  tcgcgc--caacc------tctc----------g-cag
                        Chimp  tcgcgc--caccc------tctc----------a-cag
                      Gorilla  tcgcgc--cagcc------tctc----------g-ctg
                    Orangutan  tctcgc--cagcc------tctc----------g-ctg
                       Gibbon  tcgcgc--cagcc------tctt----------g-ctg
                       Rhesus  ccgagc--cagcc------tctc----------g-ctg
          Crab-eating macaque  ccgagc--cagcc------tctc----------g-ctg
                       Baboon  ccgagc--cagcc------tctc----------g-ctg
                 Green monkey  ccgagc--cagcc------tctc----------g-ctg
                     Marmoset  ccatgc--cagcc------cctc------------ctg
              Squirrel monkey  ccacgc--cagcc------cctc------------ctg
                     Bushbaby  ccacat--caccc------agag----------c-ctg
           Chinese tree shrew  tcatgc--cacct------taat----------gcctg
                     Squirrel  ccacct--cgct--------------------------
       Lesser Egyptian jerboa  ctgtcc--aggtt------ttc----------------
               Golden hamster  cagccc--tgggc------cttt---------------
                        Mouse  cagcct--tgggc------cttt---------------
                          Rat  cagcct--tgggc------cttt---------------
               Naked mole-rat  tcaccc--agcac------cttt---------------
                   Guinea pig  tcgcca--agcac------cttt---------------
                   Chinchilla  tcgccc--agcac------attt---------------
             Brush-tailed rat  ttgcct--ggcat------gttt---------------
                       Alpaca  ttcccg--cgggcgcctgtccgt----------g-ctg
               Bactrian camel  ttcccg--tgggcgcctgtccgt----------g-ctg
                      Dolphin  ctcccg--cgggcaccct-ccgt----------g-gag
                 Killer whale  ctcccg--cgggcaccct-cctt----------g-gag
             Tibetan antelope  ttctca--t-gacaccag-cctt----------g-ctg
                          Cow  ttctca--g-gacaccag-cctt----------g-ctg
                        Sheep  ttctca--c-gacaccag-cctt----------g-ctg
                Domestic goat  ttctca--c-aacaccag-cctt----------g-ctg
                        Horse  ------------c------cctc----------a-ccg
             White rhinoceros  -------------------tctc----------g-ctg
                          Cat  ---------gggg------tcgtgt--------g-gag
                          Dog  ---------ggac------tcgc----------g-cca
                      Ferret   ---------ggac------ctgcgcccccgcggg-cct
                        Panda  ---------ggac-------------------------
               Pacific walrus  ---------tgcc------t-------------g-cct
         David's myotis (bat)  tccagg--cggct------ccgtctc-------t-cag
                     Elephant  cgctcc--ccac--------------------------
                      Manatee  cgcctc--ccac--------------------------
                     Aardvark  tgttcc--caag--------------------------
                    Armadillo  cctgcc--gtgg--------------------------
                      Opossum  tcccccat------------------------------
              Tasmanian devil  gctccc--------------------------------
                  Rock pigeon  --------------------------------------
                 Saker falcon  --------------------------------------
          Collared flycatcher  --------------------------------------
          Medium ground finch  --------------------------------------
                  Zebra finch  --------------------------------------
           American alligator  --------------------------------------
              Green seaturtle  --------------------------------------
               Painted turtle  --------------------------------------
                         Pika  ======================================
          Cape elephant shrew  ======================================
                 Prairie vole  ======================================
              Chinese hamster  ======================================
             Black flying-fox  ======================================
                       Tenrec  ======================================
                 Weddell seal  ======================================
                Big brown bat  ======================================
     Chinese softshell turtle  ======================================
                      Chicken  ======================================
                   Budgerigar  ======================================
           Tibetan ground jay  ======================================
             Peregrine falcon  ======================================
                      Wallaby  ======================================
             Cape golden mole  ======================================

Alignment block 35 of 61 in window, 2018909 - 2018917, 9 bps 
B D                     Human  ----------------------ct--ctcc--agc
B D                     Chimp  ----------------------ct--ctcc--agc
B D                   Gorilla  ----------------------ct--ctcc--agc
B D                 Orangutan  ----------------------ct--ctcc--agc
B D                    Gibbon  ----------------------ct--ctcc--agc
B D                    Rhesus  ----------------------ct--ctcc--agt
B D       Crab-eating macaque  ----------------------ct--ctcc--agt
B D                    Baboon  ----------------------ct--ctcc--agc
B D              Green monkey  ----------------------ct--ctcc--ggt
B D                  Marmoset  ----------------------ct--cccc--agc
B D           Squirrel monkey  ----------------------ct--ctcc--agc
B D                  Bushbaby  ----------------------ctccctct--ggc
           Chinese tree shrew  ----------------------ctccctcc--agt
B D                  Squirrel  ----------------------ct--ctcc--agg
       Lesser Egyptian jerboa  ----------------------ct--ctcc--agc
B D           Chinese hamster  ----------------------tt--cttc--agc
               Golden hamster  ----------------------tt--cttc--agc
B D                     Mouse  ----------------------tt--ctcc--agc
B D                       Rat  ----------------------tt--ctcc--agc
B D            Naked mole-rat  ----------------------ct--ctcca-atc
B D                Guinea pig  ----------------------ct--ctcc--atc
                   Chinchilla  ----------------------ct--ctcc--agt
             Brush-tailed rat  ----------------------ct--ctct--agc
B D                    Alpaca  ---------------------------------gt
               Bactrian camel  ---------------------------------gt
B D                   Dolphin  ---------------------------------gg
                 Killer whale  ---------------------------------gg
             Tibetan antelope  ---------------------------------gc
B D                       Cow  ---------------------------------gt
B D                     Sheep  ---------------------------------gc
                Domestic goat  ---------------------------------gc
B D                     Horse  ---------------------------------gt
B D          White rhinoceros  ---------------------------------gc
B D                       Cat  ---------------------------------gg
B D                       Dog  ---------------------------------gt
B D                   Ferret   ---------------------------------gg
               Pacific walrus  ---------------------------------gt
         David's myotis (bat)  ---------------------------------gg
B D                  Elephant  ------------------------------caagg
B D                   Manatee  ------------------------------cgaag
                     Aardvark  ------------------------------caagg
B D                 Armadillo  ------------------------------ccagc
B D                   Opossum  --------------------------ctct-----
  D               Rock pigeon  c--------------ccccctcc------------
  D              Saker falcon  ---------------catccggc------------
  D       Collared flycatcher  a--------------gaccaggc------------
B D       Medium ground finch  c--------------ccccaggt------------
B D               Zebra finch  c--------------ccccagcc------------
B D        American alligator  tggatgctgatgccggctcatcc------------
  D           Green seaturtle  c--------------catcccac------------
  D            Painted turtle  c--------------ttccccac------------
B D                      Pika  ===================================
         Cape elephant shrew  ===================================
                Prairie vole  ===================================
            Black flying-fox  ===================================
B D                    Tenrec  ===================================
                Weddell seal  ===================================
B D                     Panda  -----------------------------------
               Big brown bat  ===================================
  D  Chinese softshell turtle  ===================================
B D                   Chicken  ===================================
B D                Budgerigar  ===================================
          Tibetan ground jay  ===================================
  D          Peregrine falcon  ===================================
B D                   Wallaby  ===================================
B D           Tasmanian devil  -----------------------------------
            Cape golden mole  ===================================

Inserts between block 35 and 36 in window
B D                 Bushbaby 2bp
          Chinese tree shrew 3bp
B D                 Squirrel 3bp
      Lesser Egyptian jerboa 3bp
B D          Chinese hamster 3bp
              Golden hamster 3bp
B D                    Mouse 3bp
B D                      Rat 3bp
B D           Naked mole-rat 2bp
B D               Guinea pig 2bp
                  Chinchilla 2bp
            Brush-tailed rat 2bp
B D                   Alpaca 3bp
              Bactrian camel 3bp
B D                  Dolphin 3bp
                Killer whale 3bp
            Tibetan antelope 3bp
B D                      Cow 3bp
B D                    Sheep 3bp
               Domestic goat 3bp
B D                    Horse 3bp
B D         White rhinoceros 3bp
B D                      Cat 3bp
B D                      Dog 3bp
B D                  Ferret  3bp
              Pacific walrus 3bp
        David's myotis (bat) 3bp

Alignment block 36 of 61 in window, 2018918 - 2018929, 12 bps 
B D                     Human  -----------------gggtgcagccag
B D                     Chimp  -----------------gggtgcagccag
B D                   Gorilla  -----------------gggtgcagccag
B D                 Orangutan  -----------------gggtgcagccag
B D                    Gibbon  -----------------gggtgcagccag
B D                    Rhesus  -----------------ggatgcagccag
B D       Crab-eating macaque  -----------------ggatgcagccag
B D                    Baboon  -----------------cgatgcagccag
B D              Green monkey  -----------------ggatgcagccag
B D                  Marmoset  -----------------gggtgcagcccg
B D           Squirrel monkey  -----------------gggtgcagcccg
B D                  Bushbaby  -----------------ggaggcagctgg
           Chinese tree shrew  -----------------ggaggcagctgg
B D                  Squirrel  -----------------agcagcagctgg
       Lesser Egyptian jerboa  -----------------ggcagcagctgg
                 Prairie vole  -----------------ggcagcagctgg
B D           Chinese hamster  -----------------ggcagcagctgg
               Golden hamster  -----------------ggcagcagctgg
B D                     Mouse  -----------------ggcagcagctgg
B D                       Rat  -----------------ggcagcagctgg
B D            Naked mole-rat  -----------------ggaagcagctgg
B D                Guinea pig  -----------------ggtagcagctgg
                   Chinchilla  -----------------ggtagctgctgg
             Brush-tailed rat  -----------------ggcagcagctgg
B D                    Alpaca  -----------------ggaggtaattgc
               Bactrian camel  -----------------ggaggtaactgc
B D                   Dolphin  -----------------ggaggcagctgc
                 Killer whale  -----------------ggaggcagccgc
             Tibetan antelope  -----------------g-----------
B D                       Cow  -----------------g-----------
B D                     Sheep  -----------------g-----------
                Domestic goat  -----------------g-----------
B D                     Horse  -----------------ggagacagctgc
B D          White rhinoceros  -----------------ggaggcagctgc
B D                       Cat  -----------------gggggcggccgc
B D                       Dog  -----------------ggaggtgactgc
B D                   Ferret   -----------------ggaggcggctgt
               Pacific walrus  -----------------ggaggcagctgc
         David's myotis (bat)  -----------------ggaggcagctgc
B D                  Elephant  -------------------aggca-----
B D                   Manatee  -------------------aggca-----
                     Aardvark  -------------------aggca-----
B D                 Armadillo  -------------------aggca-----
B D                   Opossum  -----------------gggagca-----
B D           Tasmanian devil  ------------------gaggca-----
  D               Rock pigeon  tttgggtcag-------gacccc------
  D              Saker falcon  a--gtgcc---------agccag------
  D       Collared flycatcher  a--gggccactggctccggctgc------
B D       Medium ground finch  g--tgccc---------agctgc------
B D               Zebra finch  a---gcccagaa-----agcagg------
B D        American alligator  c--gtccc---------gcctgc------
  D           Green seaturtle  g--gtcacaatgc----agctga------
  D            Painted turtle  g--ggctc----t----ggctgg------
B D                      Pika  =============================
         Cape elephant shrew  =============================
            Black flying-fox  =============================
B D                    Tenrec  =============================
                Weddell seal  =============================
B D                     Panda  -----------------------------
               Big brown bat  =============================
  D  Chinese softshell turtle  =============================
B D                   Chicken  =============================
B D                Budgerigar  =============================
          Tibetan ground jay  =============================
  D          Peregrine falcon  =============================
B D                   Wallaby  =============================
            Cape golden mole  =============================

Inserts between block 36 and 37 in window
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
              Pacific walrus 1bp
        David's myotis (bat) 1bp

Alignment block 37 of 61 in window, 2018930 - 2018930, 1 bps 
B D                     Human  -g
B D                     Chimp  -g
B D                   Gorilla  -g
B D                 Orangutan  -g
B D                    Gibbon  -g
B D                    Rhesus  -g
B D       Crab-eating macaque  -g
B D                    Baboon  -g
B D              Green monkey  -g
B D                  Marmoset  -g
B D           Squirrel monkey  -g
B D                  Bushbaby  -g
           Chinese tree shrew  -g
B D                  Squirrel  -g
       Lesser Egyptian jerboa  -g
                 Prairie vole  -g
B D           Chinese hamster  -g
               Golden hamster  -g
B D                     Mouse  -g
B D                       Rat  -g
B D            Naked mole-rat  -g
B D                Guinea pig  -g
                   Chinchilla  -g
             Brush-tailed rat  -g
B D                      Pika  -g
B D                    Alpaca  -g
               Bactrian camel  -g
B D                   Dolphin  -g
                 Killer whale  -g
B D                     Horse  -g
B D          White rhinoceros  -g
B D                       Cat  -a
B D                       Dog  -g
B D                   Ferret   -t
               Pacific walrus  -g
         David's myotis (bat)  -g
B D                  Elephant  -g
B D                   Manatee  -g
                     Aardvark  -g
B D                 Armadillo  -g
  D               Rock pigeon  c-
  D              Saker falcon  c-
  D       Collared flycatcher  a-
B D       Medium ground finch  g-
B D               Zebra finch  a-
B D        American alligator  a-
  D           Green seaturtle  c-
  D            Painted turtle  c-
         Cape elephant shrew  ==
            Black flying-fox  ==
B D                    Tenrec  ==
                Weddell seal  ==
B D                     Panda  --
               Big brown bat  ==
B D                       Cow  --
               Domestic goat  --
B D                     Sheep  --
            Tibetan antelope  --
  D  Chinese softshell turtle  ==
B D                   Chicken  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
  D          Peregrine falcon  ==
B D                   Wallaby  ==
B D                   Opossum  --
B D           Tasmanian devil  --
            Cape golden mole  ==

Inserts between block 37 and 38 in window
  D              Rock pigeon 30bp
  D             Saker falcon 32bp
  D      Collared flycatcher 26bp
B D      Medium ground finch 20bp
B D              Zebra finch 22bp
B D       American alligator 2003bp
  D          Green seaturtle 12bp
  D           Painted turtle 11bp

Alignment block 38 of 61 in window, 2018931 - 2018938, 8 bps 
B D                     Human  ctctggcc----
B D                     Chimp  ctctggcc----
B D                   Gorilla  ctctggcc----
B D                 Orangutan  ctctggcc----
B D                    Gibbon  ctctggcc----
B D                    Rhesus  ccctggcc----
B D       Crab-eating macaque  ccctggcc----
B D                    Baboon  ccctggcc----
B D              Green monkey  ccctggcc----
B D                  Marmoset  cgtggggc----
B D           Squirrel monkey  ccttgggc----
B D                  Bushbaby  ct-gagct----
           Chinese tree shrew  ctccagct----
B D                  Squirrel  ctccagcc----
       Lesser Egyptian jerboa  ctccagcc----
                 Prairie vole  ttccagcc----
B D           Chinese hamster  ctccagcc----
               Golden hamster  ctccagcc----
B D                     Mouse  ctccagct----
B D                       Rat  ctccagcc----
B D            Naked mole-rat  ctctggcc----
B D                Guinea pig  ctctgacc----
                   Chinchilla  ctctggcc----
             Brush-tailed rat  ctccggcc----
B D                      Pika  ccccgacc----
B D                    Alpaca  ctccagtt----
               Bactrian camel  ctccagtt----
B D                   Dolphin  ccccagtt----
                 Killer whale  ccccagtt----
             Tibetan antelope  -----gtt----
B D                       Cow  -----gtt----
B D                     Sheep  -----gtt----
                Domestic goat  -----gtt----
B D                     Horse  ctccagtt----
B D          White rhinoceros  ctccagtt----
B D                       Cat  ctc---tt----
B D                       Dog  ctacagtt----
B D                   Ferret   ctccggtt----
B D                     Panda  --ccggtt----
               Pacific walrus  ctctggtt----
         David's myotis (bat)  ctccg-------
B D                  Elephant  ctgcggct----
B D                   Manatee  ctgcggct----
                     Aardvark  ctgggccc----
B D                 Armadillo  ctgtgccc----
B D                   Opossum  ----gggc----
B D           Tasmanian devil  ----cgcg----
  D               Rock pigeon  ----ggcaggac
  D              Saker falcon  ----cccagccc
  D       Collared flycatcher  ----ggctgtga
B D       Medium ground finch  ----ggcagggg
B D               Zebra finch  ----cactgagc
B D        American alligator  ----gcaagtgc
  D           Green seaturtle  ----caccgcgc
  D            Painted turtle  ----ggccgcgg
         Cape elephant shrew  ============
            Black flying-fox  ============
B D                    Tenrec  ============
                Weddell seal  ============
               Big brown bat  ============
  D  Chinese softshell turtle  ============
B D                   Chicken  ============
B D                Budgerigar  ============
          Tibetan ground jay  ============
  D          Peregrine falcon  ============
B D                   Wallaby  ============
            Cape golden mole  ============

Inserts between block 38 and 39 in window
                    Aardvark 4bp
B D                Armadillo 5bp

Alignment block 39 of 61 in window, 2018939 - 2018948, 10 bps 
B D                     Human  ccc--acacg-ct--------
B D                     Chimp  ccc--acacg-ct--------
B D                   Gorilla  ccc--acacg-ct--------
B D                 Orangutan  ccc--acacg-ct--------
B D                    Gibbon  ccc--acacg-ct--------
B D                    Rhesus  ccc--acacg-ct--------
B D       Crab-eating macaque  ccc--acacg-ct--------
B D                    Baboon  ccc--acacg-ct--------
B D              Green monkey  ccc--acacg-ct--------
B D                  Marmoset  ccc--acaca-t---------
B D           Squirrel monkey  ccc--acacg-c---------
B D                  Bushbaby  cca--gcagg-ct--------
           Chinese tree shrew  cca--acaca-ct--------
B D                  Squirrel  cc---gcaca-cc--------
       Lesser Egyptian jerboa  cca--acacg-ct--------
                 Prairie vole  cca--acatg-ct--------
B D           Chinese hamster  cca--acatg-ct--------
               Golden hamster  cca--acatg-ct--------
B D                     Mouse  cca--acatg-ct--------
B D                       Rat  cca--acatg-ct--------
B D            Naked mole-rat  cca--acacg-ct--------
B D                Guinea pig  cca--acttg-ct--------
                   Chinchilla  cca--acatg-ct--------
             Brush-tailed rat  cca--aaatg-ct--------
B D                      Pika  cca--tccca-ct--------
B D                    Alpaca  cca--acgcggct--------
               Bactrian camel  cta--acgcggct--------
B D                   Dolphin  cca--aggcgccc--------
                 Killer whale  cca--aggcgccc--------
             Tibetan antelope  cca--tggcggtt--------
B D                       Cow  cca--ctgcggtt--------
B D                     Sheep  cca--cggcggtt--------
                Domestic goat  cca--tggcggtt--------
B D                     Horse  ccaacacacggct--------
B D          White rhinoceros  ccg--acacggct--------
B D                       Cat  ccc--acagagct--------
B D                       Dog  ccc--acagggct--------
B D                   Ferret   ccc--acagggct--------
B D                     Panda  ccc--acagggcc--------
               Pacific walrus  ccc--acagggct--------
         David's myotis (bat)  -----acagggag--------
B D                  Elephant  --g--acact-ct--------
B D                   Manatee  -ca--acact-ct--------
             Cape golden mole  ccc--acact-ct--------
                     Aardvark  cca--acact-ct--------
B D                 Armadillo  ccg--gcctt-t---------
B D                   Opossum  tcc--ccccg-ct--------
B D           Tasmanian devil  ccc--tcccg-ct--------
  D               Rock pigeon  -----------ccccctcctt
  D              Saker falcon  -----------ccagc-----
  D       Collared flycatcher  -----------cgcccggaca
B D       Medium ground finch  -----------ctgacagcct
B D               Zebra finch  -----------ccggc-----
B D        American alligator  -----------cct-------
  D           Green seaturtle  -----------cccctgcgcc
  D            Painted turtle  -----------ctgctgagct
         Cape elephant shrew  =====================
            Black flying-fox  =====================
B D                    Tenrec  =====================
                Weddell seal  =====================
               Big brown bat  =====================
  D  Chinese softshell turtle  =====================
B D                   Chicken  =====================
B D                Budgerigar  =====================
          Tibetan ground jay  =====================
  D          Peregrine falcon  =====================
B D                   Wallaby  =====================

Inserts between block 39 and 40 in window
  D              Rock pigeon 1bp
B D       American alligator 5bp

Alignment block 40 of 61 in window, 2018949 - 2018957, 9 bps 
B D                     Human  t----gggctttg
B D                     Chimp  t----gggctttg
B D                   Gorilla  t----gggctttg
B D                 Orangutan  g----gggctttg
B D                    Gibbon  g----gggcgttg
B D                    Rhesus  g----gggctttg
B D       Crab-eating macaque  g----gggctttg
B D                    Baboon  g----gggctttg
B D              Green monkey  g----gggctttg
B D                  Marmoset  g----gggctttg
B D           Squirrel monkey  g----gggctttg
B D                  Bushbaby  g----gagttttt
           Chinese tree shrew  g----ca--ctct
B D                  Squirrel  g----caggatct
       Lesser Egyptian jerboa  g----ccgcctct
                 Prairie vole  g----ccgtctct
B D           Chinese hamster  g----ccgtctct
               Golden hamster  g----ccgtcgct
B D                     Mouse  g----ccgtttct
B D                       Rat  g----ccgtctct
B D            Naked mole-rat  g----tcatttct
B D                Guinea pig  g----ccatttct
                   Chinchilla  g----tcattttt
             Brush-tailed rat  g----tcattttt
B D                      Pika  g------gtctcc
B D                    Alpaca  g----gaaccct-
               Bactrian camel  g----gaaccct-
B D                   Dolphin  g----gagcctt-
                 Killer whale  g----gagcctt-
             Tibetan antelope  g----gggcctt-
B D                       Cow  g----gagcctt-
B D                     Sheep  g----gagcctt-
                Domestic goat  g----gagcctt-
B D                     Horse  g----gagcctt-
B D          White rhinoceros  g----gagcctt-
B D                       Cat  g----cagcctt-
B D                       Dog  g----cggcctc-
B D                   Ferret   a----cggcctc-
B D                     Panda  a----cggcctc-
               Pacific walrus  g----tggactc-
         David's myotis (bat)  g----gagcccc-
B D                  Elephant  g----aagccc--
B D                   Manatee  g----aagcttt-
             Cape golden mole  g----aagcctc-
                     Aardvark  g----aagtctt-
B D                   Opossum  t----g-------
B D           Tasmanian devil  tggagg-------
  D               Rock pigeon  -----ggggctg-
  D              Saker falcon  -----tgagcca-
B D       Medium ground finch  -----ccgtttg-
B D               Zebra finch  --------tcca-
B D        American alligator  -----tgngctg-
  D           Green seaturtle  ----------tg-
  D            Painted turtle  ----------ga-
         Cape elephant shrew  =============
            Black flying-fox  =============
B D                    Tenrec  =============
                Weddell seal  =============
               Big brown bat  =============
B D                 Armadillo  -------------
  D  Chinese softshell turtle  =============
B D                   Chicken  =============
B D                Budgerigar  =============
          Tibetan ground jay  =============
  D          Peregrine falcon  =============
B D                   Wallaby  =============

Inserts between block 40 and 41 in window
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 2bp
               Domestic goat 2bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
        David's myotis (bat) 3bp

Alignment block 41 of 61 in window, 2018958 - 2018958, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  t
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                      Pika  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B