Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1099 in window, 883543 - 883546, 4 bps 
B D                     Human  tg-------------------tt
B D                     Chimp  tg-------------------tt
B D                   Gorilla  tg-------------------tt
B D                 Orangutan  tg-------------------tt
B D                    Gibbon  tg-------------------tt
B D                    Rhesus  tt-------------------ct
B D       Crab-eating macaque  tt-------------------ct
B D                    Baboon  tt-------------------ct
B D              Green monkey  tg-------------------ct
B D                  Marmoset  tg-------------------ct
B D           Squirrel monkey  tg-------------------ct
B D                  Bushbaby  tgttgcta-ccataagcctgttt
           Chinese tree shrew  tgtcattg-ccagaagtc---ca
B D                  Squirrel  tgcttctgatcat--------tt
B D                    Alpaca  tg-------------------t-
B D                     Horse  tg-------------------ct
B D          White rhinoceros  tg-------------------ct
B D                 Armadillo  ca-------------------ct
B D                   Opossum  t----------------------
  D              Saker falcon  tc-------------------tg
B D               Zebra finch  tc-------------------tg
B D        American alligator  tc-------------------tc
B D                      Pika  =======================
B D                  Hedgehog  =======================
         Cape elephant shrew  =======================
B D                     Panda  =======================
              Golden hamster  =======================
                Prairie vole  =======================
B D                       Rat  =======================
B D                     Mouse  =======================
B D           Chinese hamster  =======================
      Lesser Egyptian jerboa  =======================
               Domestic goat  =======================
B D                       Cow  =======================
B D                     Sheep  =======================
            Tibetan antelope  =======================
        David's myotis (bat)  =======================
               Big brown bat  =======================
                Killer whale  =======================
                 Zebra mbuna  =======================
       Burton's mouthbreeder  =======================
         Pundamilia nyererei  =======================
B D              Nile tilapia  =======================
          Southern platyfish  =======================
         Princess of Burundi  =======================
B D              Atlantic cod  =======================
B D                    Lizard  =======================
B D                      Fugu  =======================
B D                    Medaka  =======================
B D                 Tetraodon  =======================
                 Spotted gar  =======================
B D                   Lamprey  =======================
B D                 Zebrafish  =======================
B D               Stickleback  =======================
             Star-nosed mole  =======================
B D                   Ferret   =======================
            Black flying-fox  =======================
B D                       Cat  =======================
B D                   Manatee  =======================
B D                  Elephant  =======================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  =======================
          Tibetan ground jay  =======================
  D    White-throated sparrow  =======================
B D       Medium ground finch  =======================
B D                    Turkey  -----------------------
B D                   Chicken  =======================
  D             Scarlet macaw  =======================
  D          Peregrine falcon  =======================
  D               Rock pigeon  =======================
B D                Budgerigar  =======================
B D                  Platypus  =======================
  D       Collared flycatcher  =======================
            Cape golden mole  =======================
  D  Chinese softshell turtle  =======================
  D            Painted turtle  =======================
                    Aardvark  =======================
B D                   Wallaby  =======================
B D           Tasmanian devil  =======================
B D                Coelacanth  =======================
  D           Green seaturtle  =======================
B D                       Dog  =======================
              Pacific walrus  =======================
            Brush-tailed rat  =======================
                  Chinchilla  =======================
B D                       Pig  =======================
B D             X. tropicalis  NNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  =======================
                Weddell seal  =======================
B D                   Dolphin  =======================
B D                Guinea pig  =======================
B D            Naked mole-rat  =======================

Inserts between block 1 and 2 in window
B D                    Horse 10bp
B D         White rhinoceros 10bp
B D                Armadillo 1bp

Alignment block 2 of 1099 in window, 883547 - 883549, 3 bps 
B D                     Human  ttg
B D                     Chimp  ttg
B D                   Gorilla  ttg
B D                 Orangutan  ttg
B D                    Gibbon  ttg
B D                    Rhesus  ttg
B D       Crab-eating macaque  ttg
B D                    Baboon  ttg
B D              Green monkey  ttg
B D                  Marmoset  ttg
B D           Squirrel monkey  ttg
B D                  Bushbaby  ttg
           Chinese tree shrew  tta
B D                  Squirrel  ttg
B D                     Horse  ttg
B D          White rhinoceros  ttg
B D                     Panda  ttg
B D                 Armadillo  ct-
B D                   Opossum  gtg
  D              Saker falcon  cca
B D               Zebra finch  gga
B D        American alligator  cag
B D                      Pika  ===
B D                  Hedgehog  ===
         Cape elephant shrew  ===
              Golden hamster  ===
                Prairie vole  ===
B D                       Rat  ===
B D                     Mouse  ===
B D           Chinese hamster  ===
      Lesser Egyptian jerboa  ===
               Domestic goat  ===
B D                       Cow  ===
B D                     Sheep  ===
            Tibetan antelope  ===
        David's myotis (bat)  ===
               Big brown bat  ===
                Killer whale  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Pundamilia nyererei  ===
B D              Nile tilapia  ===
          Southern platyfish  ===
         Princess of Burundi  ===
B D              Atlantic cod  ===
B D                    Lizard  ===
B D                      Fugu  ===
B D                    Medaka  ===
B D                 Tetraodon  ===
                 Spotted gar  ===
B D                   Lamprey  ===
B D                 Zebrafish  ===
B D                    Alpaca  ---
B D               Stickleback  ===
             Star-nosed mole  ===
B D                   Ferret   ===
            Black flying-fox  ===
B D                       Cat  ===
B D                   Manatee  ===
B D                  Elephant  ===
              Bactrian camel  NNN
  D              Mallard duck  ===
          Tibetan ground jay  ===
  D    White-throated sparrow  ===
B D       Medium ground finch  ===
B D                    Turkey  ---
B D                   Chicken  ===
  D             Scarlet macaw  ===
  D          Peregrine falcon  ===
  D               Rock pigeon  ===
B D                Budgerigar  ===
B D                  Platypus  ===
  D       Collared flycatcher  ===
            Cape golden mole  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
                    Aardvark  ===
B D                   Wallaby  ===
B D           Tasmanian devil  ===
B D                Coelacanth  ===
  D           Green seaturtle  ===
B D                       Dog  ===
              Pacific walrus  ===
            Brush-tailed rat  ===
                  Chinchilla  ===
B D                       Pig  ===
B D             X. tropicalis  NNN
    Mexican tetra (cavefish)  ===
                Weddell seal  ===
B D                   Dolphin  ===
B D                Guinea pig  ===
B D            Naked mole-rat  ===

Inserts between block 2 and 3 in window
B D                  Opossum 13bp

Alignment block 3 of 1099 in window, 883550 - 883584, 35 bps 
B D                     Human  gccggcagagagcaccagcgctcactggctctca-g-
B D                     Chimp  gctggcagagagcaccagcgctcgctgactctca-g-
B D                   Gorilla  gccgacagagagcaccagcactcgctggctttca-g-
B D                 Orangutan  gccggcagagagcaccagcgctcgctggctctca-g-
B D                    Gibbon  gccggcagagagcaccagtgctcactggttctca-g-
B D                    Rhesus  accggcagagagcaccatcgctctctggctctca-g-
B D       Crab-eating macaque  accggcagagagcaccatcgctctctggctctca-g-
B D                    Baboon  accggcagagagcaccattgctctctggctctca-g-
B D              Green monkey  accggcagagagcaccatcgctccctggctctca-g-
B D                  Marmoset  gctggcagagagtaccaccgctcactggctctca-a-
B D           Squirrel monkey  gctggcagagagtgccaacgctcaccggctctca-a-
B D                  Bushbaby  actggc----agcaccaacacaaaccaactcgga-a-
           Chinese tree shrew  gctagtggacagccccag-atgtgccaactggga-a-
B D                  Squirrel  actgacagaatacaccaagatggaccagcttgga-g-
B D                    Alpaca  ----------ggaaccgccgggggcctgctgt---g-
B D                     Horse  gc-agcagacggcaccagcacgtgctggtccg---a-
B D          White rhinoceros  gtgggcagatagcaccggcacatgccagcctgga-a-
B D                   Ferret   gctggcagatgacaccagcatgtgtcccccag---g-
B D                     Panda  gctggcagatgatagcagcatgggcccaccag---g-
B D                 Armadillo  gctgtcatcacaagctgctggcagccccctctta-g-
B D                   Opossum  acctgcctcaagcagcagctggacgtgggccg-----
  D              Saker falcon  ggtaggg-----caccgcacagccctggcattggcag
B D               Zebra finch  tctctaa-----aaacacaaacgtctggctatcg-ag
B D        American alligator  gctcccagtgccccctgccccaccctggccctcc-ag
B D                      Pika  =====================================
B D                  Hedgehog  =====================================
         Cape elephant shrew  =====================================
              Golden hamster  =====================================
                Prairie vole  =====================================
B D                       Rat  =====================================
B D                     Mouse  =====================================
B D           Chinese hamster  =====================================
      Lesser Egyptian jerboa  =====================================
               Domestic goat  =====================================
B D                       Cow  =====================================
B D                     Sheep  =====================================
            Tibetan antelope  =====================================
        David's myotis (bat)  =====================================
               Big brown bat  =====================================
                Killer whale  =====================================
                 Zebra mbuna  =====================================
       Burton's mouthbreeder  =====================================
         Pundamilia nyererei  =====================================
B D              Nile tilapia  =====================================
          Southern platyfish  =====================================
         Princess of Burundi  =====================================
B D              Atlantic cod  =====================================
B D                    Lizard  =====================================
B D                      Fugu  =====================================
B D                    Medaka  =====================================
B D                 Tetraodon  =====================================
                 Spotted gar  =====================================
B D                   Lamprey  =====================================
B D                 Zebrafish  =====================================
B D               Stickleback  =====================================
             Star-nosed mole  =====================================
            Black flying-fox  =====================================
B D                       Cat  =====================================
B D                   Manatee  =====================================
B D                  Elephant  =====================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  =====================================
          Tibetan ground jay  =====================================
  D    White-throated sparrow  =====================================
B D       Medium ground finch  =====================================
B D                    Turkey  -------------------------------------
B D                   Chicken  =====================================
  D             Scarlet macaw  =====================================
  D          Peregrine falcon  =====================================
  D               Rock pigeon  =====================================
B D                Budgerigar  =====================================
B D                  Platypus  =====================================
  D       Collared flycatcher  =====================================
            Cape golden mole  =====================================
  D  Chinese softshell turtle  =====================================
  D            Painted turtle  =====================================
                    Aardvark  =====================================
B D                   Wallaby  =====================================
B D           Tasmanian devil  =====================================
B D                Coelacanth  =====================================
  D           Green seaturtle  =====================================
B D                       Dog  =====================================
              Pacific walrus  =====================================
            Brush-tailed rat  =====================================
                  Chinchilla  =====================================
B D                       Pig  =====================================
B D             X. tropicalis  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  =====================================
                Weddell seal  =====================================
B D                   Dolphin  =====================================
B D                Guinea pig  =====================================
B D            Naked mole-rat  =====================================

Alignment block 4 of 1099 in window, 883585 - 883591, 7 bps 
B D                     Human  cgc-----ctgt
B D                     Chimp  cgc-----ctgt
B D                   Gorilla  cgc-----ctgt
B D                 Orangutan  cgc-----ctgt
B D                    Gibbon  cgt-----ctgt
B D                    Rhesus  cgc---ctctgt
B D       Crab-eating macaque  cgc---ctctgt
B D                    Baboon  cgc---ctctgt
B D              Green monkey  cgc-----ctgt
B D                  Marmoset  agg---ctctgt
B D           Squirrel monkey  agg---ctctgt
B D                  Bushbaby  tat--ccttcat
           Chinese tree shrew  cgt--cttccat
B D                  Squirrel  tgt-----tcac
B D                    Alpaca  ggc---------
B D                     Horse  cgt-cctttcgt
B D          White rhinoceros  cga-ccttccat
B D                   Ferret   tgc---------
B D                     Panda  tgt---------
B D                 Armadillo  aatgcccttcgt
  D              Saker falcon  -----ggcctgg
B D               Zebra finch  -----ctgctgg
B D        American alligator  -----cccccat
  D            Painted turtle  -----ctcccag
B D                      Pika  ============
B D                  Hedgehog  ============
         Cape elephant shrew  ============
              Golden hamster  ============
                Prairie vole  ============
B D                       Rat  ============
B D                     Mouse  ============
B D           Chinese hamster  ============
      Lesser Egyptian jerboa  ============
               Domestic goat  ============
B D                       Cow  ============
B D                     Sheep  ============
            Tibetan antelope  ============
        David's myotis (bat)  ============
               Big brown bat  ============
                Killer whale  ============
                 Zebra mbuna  ============
       Burton's mouthbreeder  ============
         Pundamilia nyererei  ============
B D              Nile tilapia  ============
          Southern platyfish  ============
         Princess of Burundi  ============
B D              Atlantic cod  ============
B D                    Lizard  ============
B D                      Fugu  ============
B D                    Medaka  ============
B D                 Tetraodon  ============
                 Spotted gar  ============
B D                   Lamprey  ============
B D                 Zebrafish  ============
B D               Stickleback  ============
             Star-nosed mole  ============
            Black flying-fox  ============
B D                       Cat  ============
B D                   Manatee  ============
B D                  Elephant  ============
              Bactrian camel  NNNNNNNNNNNN
  D              Mallard duck  ============
          Tibetan ground jay  ============
  D    White-throated sparrow  ============
B D       Medium ground finch  ============
B D                    Turkey  ------------
B D                   Chicken  ============
  D             Scarlet macaw  ============
  D          Peregrine falcon  ============
  D               Rock pigeon  ============
B D                Budgerigar  ============
B D                  Platypus  ============
  D       Collared flycatcher  ============
            Cape golden mole  ============
  D  Chinese softshell turtle  ============
                    Aardvark  ============
B D                   Wallaby  ============
B D                   Opossum  ------------
B D           Tasmanian devil  ============
B D                Coelacanth  ============
  D           Green seaturtle  ============
B D                       Dog  ============
              Pacific walrus  ============
            Brush-tailed rat  ============
                  Chinchilla  ============
B D                       Pig  ============
B D             X. tropicalis  NNNNNNNNNNNN
    Mexican tetra (cavefish)  ============
                Weddell seal  ============
B D                   Dolphin  ============
B D                Guinea pig  ============
B D            Naked mole-rat  ============

Inserts between block 4 and 5 in window
B D                  Ferret  2bp
B D                    Panda 2bp

Alignment block 5 of 1099 in window, 883592 - 883597, 6 bps 
B D                     Human  ------cagc---ag
B D                     Chimp  ------cagc---ag
B D                   Gorilla  ------cagc---ag
B D                 Orangutan  ------cagc---ag
B D                    Gibbon  ------cagc---ag
B D                    Rhesus  ------cagt---ag
B D       Crab-eating macaque  ------cagt---ag
B D                    Baboon  ------cagc---ag
B D              Green monkey  ------cagc---ag
B D                  Marmoset  ------cagc---ag
B D           Squirrel monkey  ------cagc---ag
B D                  Bushbaby  ------ccac---ag
           Chinese tree shrew  ------cagtgaaag
B D                  Squirrel  ------caac---a-
B D                    Alpaca  --------------t
B D                     Horse  ------cagca--ac
B D          White rhinoceros  ------cgggg--ac
B D                 Armadillo  ------ctgt---gg
B D                  Platypus  ------caga---aa
  D              Saker falcon  catggg---------
B D               Zebra finch  ctgcag---------
B D        American alligator  t--------------
  D            Painted turtle  ctg------------
B D                      Pika  ===============
B D                  Hedgehog  ===============
         Cape elephant shrew  ===============
B D                     Panda  ===============
              Golden hamster  ===============
                Prairie vole  ===============
B D                       Rat  ===============
B D                     Mouse  ===============
B D           Chinese hamster  ===============
      Lesser Egyptian jerboa  ===============
               Domestic goat  ===============
B D                       Cow  ===============
B D                     Sheep  ===============
            Tibetan antelope  ===============
        David's myotis (bat)  ===============
               Big brown bat  ===============
                Killer whale  ===============
                 Zebra mbuna  ===============
       Burton's mouthbreeder  ===============
         Pundamilia nyererei  ===============
B D              Nile tilapia  ===============
          Southern platyfish  ===============
         Princess of Burundi  ===============
B D              Atlantic cod  ===============
B D                    Lizard  ===============
B D                      Fugu  ===============
B D                    Medaka  ===============
B D                 Tetraodon  ===============
                 Spotted gar  ===============
B D                   Lamprey  ===============
B D                 Zebrafish  ===============
B D               Stickleback  ===============
             Star-nosed mole  ===============
B D                   Ferret   ===============
            Black flying-fox  ===============
B D                       Cat  ===============
B D                   Manatee  ===============
B D                  Elephant  ===============
              Bactrian camel  NNNNNNNNNNNNNNN
  D              Mallard duck  ===============
          Tibetan ground jay  ===============
  D    White-throated sparrow  ===============
B D       Medium ground finch  ===============
B D                    Turkey  ---------------
B D                   Chicken  ===============
  D             Scarlet macaw  ===============
  D          Peregrine falcon  ===============
  D               Rock pigeon  ===============
B D                Budgerigar  ===============
  D       Collared flycatcher  ===============
            Cape golden mole  ===============
  D  Chinese softshell turtle  ===============
                    Aardvark  ===============
B D                   Wallaby  ===============
B D                   Opossum  ---------------
B D           Tasmanian devil  ===============
B D                Coelacanth  ===============
  D           Green seaturtle  ===============
B D                       Dog  ===============
              Pacific walrus  ===============
            Brush-tailed rat  ===============
                  Chinchilla  ===============
B D                       Pig  ===============
B D             X. tropicalis  NNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ===============
                Weddell seal  ===============
B D                   Dolphin  ===============
B D                Guinea pig  ===============
B D            Naked mole-rat  ===============

Inserts between block 5 and 6 in window
B D                 Squirrel 5bp
  D           Painted turtle 4bp

Alignment block 6 of 1099 in window, 883598 - 883601, 4 bps 
B D                     Human  gcag---
B D                     Chimp  gcag---
B D                   Gorilla  gcag---
B D                 Orangutan  gcag---
B D                    Gibbon  gcag---
B D                    Rhesus  gcag---
B D       Crab-eating macaque  gcag---
B D                    Baboon  gcag---
B D              Green monkey  gcag---
B D                  Marmoset  gcgg---
B D           Squirrel monkey  gtgg---
B D                  Bushbaby  ataa---
           Chinese tree shrew  acgg---
B D                    Alpaca  gggg---
B D                     Horse  gcgg---
B D          White rhinoceros  gcag---
B D                 Armadillo  acgc---
B D                  Platypus  gcga---
  D              Saker falcon  ---gctg
  D            Painted turtle  ---gcc-
B D                      Pika  =======
B D                  Hedgehog  =======
         Cape elephant shrew  =======
B D                     Panda  =======
              Golden hamster  =======
                Prairie vole  =======
B D                       Rat  =======
B D                     Mouse  =======
B D           Chinese hamster  =======
      Lesser Egyptian jerboa  =======
               Domestic goat  =======
B D                       Cow  =======
B D                     Sheep  =======
            Tibetan antelope  =======
        David's myotis (bat)  =======
               Big brown bat  =======
                Killer whale  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Pundamilia nyererei  =======
B D              Nile tilapia  =======
          Southern platyfish  =======
         Princess of Burundi  =======
B D              Atlantic cod  =======
B D                    Lizard  =======
B D                      Fugu  =======
B D                    Medaka  =======
B D                 Tetraodon  =======
                 Spotted gar  =======
B D                   Lamprey  =======
B D                 Zebrafish  =======
B D               Stickleback  =======
             Star-nosed mole  =======
B D                   Ferret   =======
B D                  Squirrel  =======
            Black flying-fox  =======
B D                       Cat  =======
B D                   Manatee  =======
B D                  Elephant  =======
              Bactrian camel  NNNNNNN
  D              Mallard duck  =======
          Tibetan ground jay  =======
B D               Zebra finch  -------
  D    White-throated sparrow  =======
B D       Medium ground finch  =======
B D        American alligator  -------
B D                    Turkey  -------
B D                   Chicken  =======
  D             Scarlet macaw  =======
  D          Peregrine falcon  =======
  D               Rock pigeon  =======
B D                Budgerigar  =======
  D       Collared flycatcher  =======
            Cape golden mole  =======
  D  Chinese softshell turtle  =======
                    Aardvark  =======
B D                   Wallaby  =======
B D                   Opossum  -------
B D           Tasmanian devil  =======
B D                Coelacanth  =======
  D           Green seaturtle  =======
B D                       Dog  =======
              Pacific walrus  =======
            Brush-tailed rat  =======
                  Chinchilla  =======
B D                       Pig  =======
B D             X. tropicalis  NNNNNNN
    Mexican tetra (cavefish)  =======
                Weddell seal  =======
B D                   Dolphin  =======
B D                Guinea pig  =======
B D            Naked mole-rat  =======

Inserts between block 6 and 7 in window
B D                   Alpaca 4bp
B D                    Horse 4bp
B D         White rhinoceros 4bp
B D                Armadillo 4bp
B D                 Platypus 1bp

Alignment block 7 of 1099 in window, 883602 - 883650, 49 bps 
B D                     Human  aag----------cc-------atttc--cct-------atct---gg--------------------aa
B D                     Chimp  aag----------cc-------gtttc--cct-------atct---gg--------------------aa
B D                   Gorilla  aag----------cc-------gtttc--cct-------atct---gg--------------------aa
B D                 Orangutan  aag----------cc-------gtttc--cct-------atct---gg--------------------aa
B D                    Gibbon  aag----------cc-------gtttc--cct-------atct---gg--------------------aa
B D                    Rhesus  aag----------cc-------gtttc--cct-------gtct---gg--------------------aa
B D       Crab-eating macaque  aag----------cc-------gtttc--cct-------gtct---gg--------------------aa
B D                    Baboon  aag----------cc-------gtttc--cct-------gtct---gg--------------------aa
B D              Green monkey  aag----------cc-------gtttc--cct-------gtct---gg--------------------aa
B D                  Marmoset  aag----------cc-------atttc--cct-------atat---gg--------------------ag
B D           Squirrel monkey  aag----------cc-------atttc--cct-------ctat---gg--------------------ag
B D                  Bushbaby  caacaaaaaagttct-------atttc--aat-------gtat---aa--------------------ag
           Chinese tree shrew  gaa----------ct-----cagtttc--agc-------gtct---gt--------------------aa
B D                  Squirrel  aag----------tc-------cac-c--tct-------agcg-tggg--------------------gt
       Lesser Egyptian jerboa  aag----------tc-------atctc--ccc-------agcc-taag--------------------aa
B D                    Alpaca  cca----------cc-------------------------------------------------------
B D                     Horse  cga----------cttg---cagtgtg--gac-------agtg---gt--------------------ca
B D          White rhinoceros  caa----------ct----------tc--gac-------ggtg---cg--------------------ca
B D                   Ferret   tga----------gc-------atgta--cac-------cttc---ca--------------------aa
B D                     Panda  cga----------cc-------aggta--cac-------tttc---ca--------------------aa
B D                 Armadillo  ----------------gacctgatttc--cat-------gtat---aa--------------------aa
B D                   Opossum  --g----------cc-------cttcccgcac-------acct---cc--------------------aa
B D                  Platypus  ggg----------cc-------accac--tag-------ccct---gg--------------------ag
  D              Saker falcon  ------ggggctgcc-------cctgc--cccttggcctagct---gggagccgcagtgcctgtcct-gc
B D        American alligator  -------------cc-------cctcc--cac-------agctgtagagaacccaggaatctgggctccc
  D            Painted turtle  -------------cc-------ccttt--ctc-------cgct---gg--------------------gt
B D                      Pika  ======================================================================
B D                  Hedgehog  ======================================================================
         Cape elephant shrew  ======================================================================
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
B D           Chinese hamster  ======================================================================
               Domestic goat  ======================================================================
B D                       Cow  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
                Killer whale  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Pundamilia nyererei  ======================================================================
B D              Nile tilapia  ======================================================================
          Southern platyfish  ======================================================================
         Princess of Burundi  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Lizard  ======================================================================
B D                      Fugu  ======================================================================
B D                    Medaka  ======================================================================
B D                 Tetraodon  ======================================================================
                 Spotted gar  ======================================================================
B D                   Lamprey  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
             Star-nosed mole  ======================================================================
            Black flying-fox  ======================================================================
B D                       Cat  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ----------------------------------------------------------------------
  D    White-throated sparrow  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ----------------------------------------------------------------------
B D                   Chicken  ======================================================================
  D             Scarlet macaw  ======================================================================
  D          Peregrine falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
  D       Collared flycatcher  ======================================================================
            Cape golden mole  ======================================================================
  D  Chinese softshell turtle  ======================================================================
                    Aardvark  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                Coelacanth  ======================================================================
  D           Green seaturtle  ======================================================================
B D                       Dog  ======================================================================
              Pacific walrus  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                       Pig  ======================================================================
B D             X. tropicalis  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ======================================================================
                Weddell seal  ======================================================================
B D                   Dolphin  ======================================================================
B D                Guinea pig  ======================================================================
B D            Naked mole-rat  ======================================================================

                        Human  --ggcacgtctg--ggtgtccacatggcacgg
                        Chimp  --ggcatgtctg--ggtgtccacacggcacgg
                      Gorilla  --ggcacgtctg--ggtgtccacacggcacgg
                    Orangutan  --ggcacgtctg--ggtgtcctcacagcacgg
                       Gibbon  --ggcacgtctg--ggtgtccacacagcacgg
                       Rhesus  --ggcatgtctg--ggtgtccacacagcacgg
          Crab-eating macaque  --ggcatgtctg--ggtgtccacacagcacgg
                       Baboon  --ggcatgtctg--ggtgtccacacagcacgg
                 Green monkey  --ggcatgtctg--ggtgtccacacagcacgg
                     Marmoset  --gatgcatctg--ggtgtccacactgcatgg
              Squirrel monkey  --gatgcatctg--ggtgtccacaccgcatgg
                     Bushbaby  --gttgatttgg--ggtgtttgtgtgaagtat
           Chinese tree shrew  atggtgcttttg------------------aa
                     Squirrel  --ggtgttcttg--gcattt------gtgtga
       Lesser Egyptian jerboa  --ggtgcttttg--ggtatt------atgcac
                       Alpaca  --------------tgagcgagcagagg----
                        Horse  --gctgtggaca--ggctgccacggagg----
             White rhinoceros  --ggtgtggacg--cgcagctgtagagg----
                      Ferret   --ggtgtgggca--tgggggtgcagaca----
                        Panda  --ggcatgtgcatgtgtgagtgcagaca----
                    Armadillo  --agtgtgttgg--cgtttttatgccgtgt--
                      Opossum  --gaccaccacg--gccgtctacatgttctat
                     Platypus  --gac----ctg--ggggcccccccgggg---
                 Saker falcon  --agctggc-----------------------
           American alligator  --agcgccc-----------------------
               Painted turtle  --ggcgccc-----------------------
                         Pika  ================================
                     Hedgehog  ================================
          Cape elephant shrew  ================================
               Golden hamster  ================================
                 Prairie vole  ================================
                          Rat  ================================
                        Mouse  ================================
              Chinese hamster  ================================
                Domestic goat  ================================
                          Cow  ================================
                        Sheep  ================================
             Tibetan antelope  ================================
         David's myotis (bat)  ================================
                Big brown bat  ================================
                 Killer whale  ================================
                  Zebra mbuna  ================================
        Burton's mouthbreeder  ================================
          Pundamilia nyererei  ================================
                 Nile tilapia  ================================
           Southern platyfish  ================================
          Princess of Burundi  ================================
                 Atlantic cod  ================================
                       Lizard  ================================
                         Fugu  ================================
                       Medaka  ================================
                    Tetraodon  ================================
                  Spotted gar  ================================
                      Lamprey  ================================
                    Zebrafish  ================================
                  Stickleback  ================================
              Star-nosed mole  ================================
             Black flying-fox  ================================
                          Cat  ================================
                      Manatee  ================================
                     Elephant  ================================
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                 Mallard duck  ================================
           Tibetan ground jay  ================================
                  Zebra finch  --------------------------------
       White-throated sparrow  ================================
          Medium ground finch  ================================
                       Turkey  --------------------------------
                      Chicken  ================================
                Scarlet macaw  ================================
             Peregrine falcon  ================================
                  Rock pigeon  ================================
                   Budgerigar  ================================
          Collared flycatcher  ================================
             Cape golden mole  ================================
     Chinese softshell turtle  ================================
                     Aardvark  ================================
                      Wallaby  ================================
              Tasmanian devil  ================================
                   Coelacanth  ================================
              Green seaturtle  ================================
                          Dog  ================================
               Pacific walrus  ================================
             Brush-tailed rat  ================================
                   Chinchilla  ================================
                          Pig  ================================
                X. tropicalis  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Mexican tetra (cavefish)  ================================
                 Weddell seal  ================================
                      Dolphin  ================================
                   Guinea pig  ================================
               Naked mole-rat  ================================

Inserts between block 7 and 8 in window
B D                 Squirrel 2bp
      Lesser Egyptian jerboa 3bp
B D                 Platypus 1bp

Alignment block 8 of 1099 in window, 883651 - 883673, 23 bps 
B D                     Human  ------------ccaata-gtgcgcagc----------------------atgc-----agag
B D                     Chimp  ------------ccaata-gtgcgcagc----------------------gtgc-----agag
B D                   Gorilla  ------------ccaata-gtgcgcagc----------------------gtgc-----agag
B D                 Orangutan  ------------ccaata-gtgtgcagc----------------------gtgc-----agag
B D                    Gibbon  ------------ccaata-gtgcgcagc----------------------atgc-----agag
B D                    Rhesus  ------------ccaaca-gtgcgcagc----------------------gtgc-----agag
B D       Crab-eating macaque  ------------ccaaca-gtgcgcagc----------------------gtgc-----agag
B D                    Baboon  ------------ccaaca-gtgcgcagc----------------------gtgc-----agag
B D              Green monkey  ------------ccaacg-gtgcgcagc----------------------gtgc-----agag
B D                  Marmoset  ------------ccaaca-gtgcacagc----------------------gtgc-----tgag
B D           Squirrel monkey  ------------ccaaca-gtgcacagc----------------------gtgc-----agag
B D                  Bushbaby  ------------tccgca-gcgtgcagc----------------------ctac-----agcc
           Chinese tree shrew  ------------caatca-gtgtactgt----------------------gcat-----aggt
B D                  Squirrel  ------------tcaaca-ttgctcagc----------------------gtgc---agaggg
       Lesser Egyptian jerboa  ------------ccggcg-ttgctcagt----------------------cttc---acgggg
B D            Naked mole-rat  ------------ccacta-tggctcagc----------------------acac---ggaggg
B D                    Alpaca  ---------------cca-gggctgc-------------------------------------
B D                     Horse  ---------------cca-gggccgcg-----------------------gggt-----ggcg
B D          White rhinoceros  ---------------cgaggggctgcgt----------------------gggt-----ggcg
B D                   Ferret   ---------------gca-gggctgcgt----------------------ggat-----ggtg
B D                     Panda  ---------------tca-gggctgcgt----------------------ggat-----ggtg
B D                 Armadillo  ------------ccaaaa-aggtgtgtc----------------------aggctgtggggaa
B D                   Opossum  -------------------ctgctgagc----------------------ctgc--tgcagcc
B D                  Platypus  ------------cgaggg-caccggagt----------------------cccc-----ggga
  D              Saker falcon  cctgtctgggtgacccca-acgtgctgcaacaggccaagggggccaaaagcccc-----aaca
B D        American alligator  cctgttt-----atcctg-ctgtccatc----------------------cccc-----agcg
  D            Painted turtle  cccttct--------tta-cagtccagc--caggctctg-----------gcca-----agtg
B D                      Pika  ===============================================================
B D                  Hedgehog  ===============================================================
         Cape elephant shrew  ===============================================================
              Golden hamster  ===============================================================
                Prairie vole  ===============================================================
B D                       Rat  ===============================================================
B D                     Mouse  ===============================================================
B D           Chinese hamster  ===============================================================
               Domestic goat  ===============================================================
B D                       Cow  ===============================================================
B D                     Sheep  ===============================================================
            Tibetan antelope  ===============================================================
        David's myotis (bat)  ===============================================================
               Big brown bat  ===============================================================
                Killer whale  ===============================================================
                 Zebra mbuna  ===============================================================
       Burton's mouthbreeder  ===============================================================
         Pundamilia nyererei  ===============================================================
B D              Nile tilapia  ===============================================================
          Southern platyfish  ===============================================================
         Princess of Burundi  ===============================================================
B D              Atlantic cod  ===============================================================
B D                    Lizard  ===============================================================
B D                      Fugu  ===============================================================
B D                    Medaka  ===============================================================
B D                 Tetraodon  ===============================================================
                 Spotted gar  ===============================================================
B D                   Lamprey  ===============================================================
B D                 Zebrafish  ===============================================================
B D               Stickleback  ===============================================================
             Star-nosed mole  ===============================================================
            Black flying-fox  ===============================================================
B D                       Cat  ===============================================================
B D                   Manatee  ===============================================================
B D                  Elephant  ===============================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ===============================================================
          Tibetan ground jay  ===============================================================
B D               Zebra finch  ---------------------------------------------------------------
  D    White-throated sparrow  ===============================================================
B D       Medium ground finch  ===============================================================
B D                    Turkey  ---------------------------------------------------------------
B D                   Chicken  ===============================================================
  D             Scarlet macaw  ===============================================================
  D          Peregrine falcon  ===============================================================
  D               Rock pigeon  ===============================================================
B D                Budgerigar  ===============================================================
  D       Collared flycatcher  ===============================================================
            Cape golden mole  ===============================================================
  D  Chinese softshell turtle  ===============================================================
                    Aardvark  ===============================================================
B D                   Wallaby  ===============================================================
B D           Tasmanian devil  ===============================================================
B D                Coelacanth  ===============================================================
  D           Green seaturtle  ===============================================================
B D                       Dog  ===============================================================
              Pacific walrus  ===============================================================
            Brush-tailed rat  ===============================================================
                  Chinchilla  ===============================================================
B D                       Pig  ===============================================================
B D             X. tropicalis  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ===============================================================
                Weddell seal  ===============================================================
B D                   Dolphin  ===============================================================
B D                Guinea pig  ===============================================================

Inserts between block 8 and 9 in window
B D                   Alpaca 9bp
  D             Saker falcon 13bp
B D       American alligator 5bp
  D           Painted turtle 12bp

Alignment block 9 of 1099 in window, 883674 - 883689, 16 bps 
B D                     Human  c-cg-ggc----------------------cg---gga-----gaagg
B D                     Chimp  c-ca-ggc----------------------cg---gga-----gaagg
B D                   Gorilla  c-cg-ggc----------------------cg---gga-----gaagg
B D                 Orangutan  c-cg-ggc----------------------cg---gga-----gaagg
B D                    Gibbon  c-cg-ggc----------------------cg---gga-----gaagg
B D                    Rhesus  c-ca-ggc----------------------cg---gga-----gaagg
B D       Crab-eating macaque  c-ca-ggc----------------------cg---gga-----gaagg
B D                    Baboon  c-ca-ggc----------------------cg---gga-----gaagg
B D              Green monkey  c-cg-ggc----------------------cg---gga-----gaagg
B D                  Marmoset  c-cg-agccaggagaatgg-----------cg---gga-----gaaag
B D           Squirrel monkey  c-cg-agcggggaggacag-----------cg---gga-----gaagg
B D                  Bushbaby  ctca-ggctctgtggatgggtt--------gg---ggg-----gtaga
           Chinese tree shrew  t-gg-ggc----------------------tgtgtgga-----caaga
B D                  Squirrel  c-ag-ggctgtgtggca------tgcatcctg---gga-------agg
       Lesser Egyptian jerboa  c-aa-agctgtgtg----------------tg---gga-----ctggg
B D            Naked mole-rat  c-a--ggctgtgtggagaggttttggtgtctg---ggg-------agg
B D                     Horse  c-cg-tgc----------------------c----gga-----aggct
B D          White rhinoceros  c-tg-cgc----------------------t----gga-----ggggt
B D                   Ferret   c-cg-ggc----------------------t----gga-----gggtt
B D                     Panda  c-tg-ggc----------------------tg---gga-----gggtt
B D                 Armadillo  c-ag-gac----------------------agtgtgga-----agagg
B D                   Opossum  c-aa-ggc----------------------gg---ggg-----gc---
B D                  Platypus  c-cgcagc----------------------cg---gga-----gcaag
  D              Saker falcon  -gca-gcc----------------------tg---ggggatg------
           Tibetan ground jay  -cca-ggc----------------------cg---ggctgtgc-----
B D        American alligator  -gaa-ggt----------------------gg---agg----------
  D            Painted turtle  -gcg-aac----------------------gg---ggg----------
B D                      Pika  ================================================
B D                  Hedgehog  ================================================
         Cape elephant shrew  ================================================
              Golden hamster  ================================================
                Prairie vole  ================================================
B D                       Rat  ================================================
B D                     Mouse  ================================================
B D           Chinese hamster  ================================================
               Domestic goat  ================================================
B D                       Cow  ================================================
B D                     Sheep  ================================================
            Tibetan antelope  ================================================
        David's myotis (bat)  ================================================
               Big brown bat  ================================================
                Killer whale  ================================================
                 Zebra mbuna  ================================================
       Burton's mouthbreeder  ================================================
         Pundamilia nyererei  ================================================
B D              Nile tilapia  ================================================
          Southern platyfish  ================================================
         Princess of Burundi  ================================================
B D              Atlantic cod  ================================================
B D                    Lizard  ================================================
B D                      Fugu  ================================================
B D                    Medaka  ================================================
B D                 Tetraodon  ================================================
                 Spotted gar  ================================================
B D                   Lamprey  ================================================
B D                 Zebrafish  ================================================
B D                    Alpaca  ================================================
B D               Stickleback  ================================================
             Star-nosed mole  ================================================
            Black flying-fox  ================================================
B D                       Cat  ================================================
B D                   Manatee  ================================================
B D                  Elephant  ================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ================================================
B D               Zebra finch  ------------------------------------------------
  D    White-throated sparrow  ================================================
B D       Medium ground finch  ================================================
B D                    Turkey  ------------------------------------------------
B D                   Chicken  ================================================
  D             Scarlet macaw  ================================================
  D          Peregrine falcon  ================================================
  D               Rock pigeon  ================================================
B D                Budgerigar  ================================================
  D       Collared flycatcher  ================================================
            Cape golden mole  ================================================
  D  Chinese softshell turtle  ================================================
                    Aardvark  ================================================
B D                   Wallaby  ================================================
B D           Tasmanian devil  ================================================
B D                Coelacanth  ================================================
  D           Green seaturtle  ================================================
B D                       Dog  ================================================
              Pacific walrus  ================================================
            Brush-tailed rat  ================================================
                  Chinchilla  ================================================
B D                       Pig  ================================================
B D             X. tropicalis  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ================================================
                Weddell seal  ================================================
B D                   Dolphin  ================================================
B D                Guinea pig  ================================================

Alignment block 10 of 1099 in window, 883690 - 883692, 3 bps 
B D                     Human  ccc
B D                     Chimp  ccc
B D                   Gorilla  ccc
B D                 Orangutan  ccc
B D                    Gibbon  ccc
B D                    Rhesus  ccc
B D       Crab-eating macaque  ccc
B D                    Baboon  ccc
B D              Green monkey  ccc
B D                  Marmoset  ccc
B D           Squirrel monkey  cct
B D                  Bushbaby  cct
           Chinese tree shrew  t--
B D                  Squirrel  cca
       Lesser Egyptian jerboa  cca
B D            Naked mole-rat  tcc
B D                     Horse  cct
B D          White rhinoceros  ctt
B D                   Ferret   cct
B D                     Panda  ctt
B D                 Armadillo  ctt
B D                  Platypus  ctc
B D               Zebra finch  ccc
           Tibetan ground jay  cgc
  D            Painted turtle  ctc
B D                      Pika  ===
B D                  Hedgehog  ===
         Cape elephant shrew  ===
              Golden hamster  ===
                Prairie vole  ===
B D                       Rat  ===
B D                     Mouse  ===
B D           Chinese hamster  ===
               Domestic goat  ===
B D                       Cow  ===
B D                     Sheep  ===
            Tibetan antelope  ===
        David's myotis (bat)  ===
               Big brown bat  ===
                Killer whale  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Pundamilia nyererei  ===
B D              Nile tilapia  ===
          Southern platyfish  ===
         Princess of Burundi  ===
B D              Atlantic cod  ===
B D                    Lizard  ===
B D                      Fugu  ===
B D                    Medaka  ===
B D                 Tetraodon  ===
                 Spotted gar  ===
B D                   Lamprey  ===
B D                 Zebrafish  ===
B D                    Alpaca  ===
B D               Stickleback  ===
             Star-nosed mole  ===
            Black flying-fox  ===
B D                       Cat  ===
B D                   Manatee  ===
B D                  Elephant  ===
              Bactrian camel  NNN
  D              Mallard duck  ===
  D    White-throated sparrow  ===
B D       Medium ground finch  ===
B D        American alligator  ---
B D                    Turkey  ---
B D                   Chicken  ===
  D             Scarlet macaw  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ---
  D               Rock pigeon  ===
B D                Budgerigar  ===
  D       Collared flycatcher  ===
            Cape golden mole  ===
  D  Chinese softshell turtle  ===
                    Aardvark  ===
B D                   Wallaby  ===
B D                   Opossum  ---
B D           Tasmanian devil  ===
B D                Coelacanth  ===
  D           Green seaturtle  ===
B D                       Dog  ===
              Pacific walrus  ===
            Brush-tailed rat  ===
                  Chinchilla  ===
B D                       Pig  ===
B D             X. tropicalis  NNN
    Mexican tetra (cavefish)  ===
                Weddell seal  ===
B D                   Dolphin  ===
B D                Guinea pig  ===

Inserts between block 10 and 11 in window
B D                 Bushbaby 1bp
B D                    Horse 5bp
B D         White rhinoceros 5bp
B D                  Ferret  5bp
B D                    Panda 5bp
B D                Armadillo 3bp

Alignment block 11 of 1099 in window, 883693 - 883732, 40 bps 
B D                     Human  ggccatgc-ccagc----tg----------------ccccccac---tc------tccc-cggc---ctc
B D                     Chimp  ggccatgc-ccagc----tg----------------ccccccac---tc------tccc-cagc---ctc
B D                   Gorilla  ggccatgc-ccagc----tg----------------ccccccac---tc------tccc-cggc---ctt
B D                 Orangutan  ggccatgc-ccagc----tt----------------ccccccat---tc------tccc-cagc---ctc
B D                    Gibbon  agccatgc-ccagc----tgccc-------------cccccccc---cc------tccc-tggc---ctc
B D                    Rhesus  agccttgc-ccagc----tg----------------ccccctac---tc------tccc-tggc---ctc
B D       Crab-eating macaque  agccttgc-ccagc----tg----------------ccccctac---tc------tccc-tggc---ctc
B D                    Baboon  agccttgc-ccagc----tg----------------ccccctac---tc------tccc-tggc---ctc
B D              Green monkey  agccttgc-ccagc----tg----------------ccccctac---tc------tccc-tggc---ctc
B D                  Marmoset  agctatgc-ccaac----tg----------------ccctccag---tc------tcct-cggc---ctt
B D           Squirrel monkey  ggctatgc-ctagc----tg----------------ccctccag---tc------ttcc-cagc---ctt
B D                  Bushbaby  ggttctgctccagc----ca----------------ctctcaag---tc------tccc-----------
           Chinese tree shrew  agtggtgg---agc----tg----------------acctgtat---tc------tcccatggc---ctt
B D                  Squirrel  -gctgctc-tcagc----aa----------------tct-------------------g-tggc---cta
       Lesser Egyptian jerboa  ---------tcagc----cg----------------tct------------------ct-tggc---ctt
B D            Naked mole-rat  -gttcctc-tcagc----tc----------------tcc------------------cg-tagc---t--
B D                    Alpaca  -----------ggc----tg----------------ctttgggc--gcc------accg-aggt---ctt
B D                     Horse  -----------ggc----ca----------------c-cccagc----c------cgct-ggga---ccc
B D          White rhinoceros  -----------ggc----tg----------------ctcccagc----c------cctg-aggc---ctt
B D                       Dog  -----------tcc----tg----------------ctctcagcccccc------tccc-aggc---ctt
B D                   Ferret   -----------ctc----tg----------------ctctcagc-aacc------tccc-aagc---ctt
B D                     Panda  -----------atc----tg----------------ctctcagc---cc------cccc-aggc---ttt
B D                 Armadillo  gggcactg-gctgc----tg----------------cttttctc---tc------cctc-taga---ccc
B D                   Opossum  tcccgggc-ccagc----cg----------------ccccccag---cc------tcag-gggc---ctc
B D                  Platypus  --------------------------------------ccccat---tcatggcacccc-cagc---ccc
  D              Saker falcon  -cctgtgc-ctggc----tg----------------gtagctga---ca------cctg-tctctgtccc
B D               Zebra finch  aacatcac-cctgc----tg----------------ccccccac---cc------ccca-cctc---ccc
           Tibetan ground jay  gtcagggc-ttt---------------------------tcctg---cc------cgcg-cctc---ctc
B D        American alligator  --cgctgc-ctgaccaagtg----------------gcctcaga---at------cacg-gaaccggatg
  D            Painted turtle  acccctgc-caggggcattgctctgtctgggccggtctctccag---cg------cccg-tc--------
B D                      Pika  ======================================================================
B D                  Hedgehog  ======================================================================
         Cape elephant shrew  ======================================================================
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
B D           Chinese hamster  ======================================================================
               Domestic goat  ======================================================================
B D                       Cow  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
                Killer whale  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Pundamilia nyererei  ======================================================================
B D              Nile tilapia  ======================================================================
          Southern platyfish  ======================================================================
         Princess of Burundi  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Lizard  ======================================================================
B D                      Fugu  ======================================================================
B D                    Medaka  ======================================================================
B D                 Tetraodon  ======================================================================
                 Spotted gar  ======================================================================
B D                   Lamprey  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
             Star-nosed mole  ======================================================================
            Black flying-fox  ======================================================================
B D                       Cat  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ======================================================================
  D    White-throated sparrow  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ----------------------------------------------------------------------
B D                   Chicken  ======================================================================
  D             Scarlet macaw  ======================================================================
  D          Peregrine falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
  D       Collared flycatcher  ======================================================================
            Cape golden mole  ======================================================================
  D  Chinese softshell turtle  ======================================================================
                    Aardvark  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                Coelacanth  ======================================================================
  D           Green seaturtle  ======================================================================
              Pacific walrus  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                       Pig  ======================================================================
B D             X. tropicalis  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ======================================================================
                Weddell seal  ======================================================================
B D                   Dolphin  ======================================================================
B D                Guinea pig  ======================================================================

                        Human  gggc
                        Chimp  gggc
                      Gorilla  gggc
                    Orangutan  gggc
                       Gibbon  gggc
                       Rhesus  gggc
          Crab-eating macaque  gggc
                       Baboon  gggc
                 Green monkey  gggc
                     Marmoset  aggc
              Squirrel monkey  aggc
                     Bushbaby  ----
           Chinese tree shrew  gggg
                     Squirrel  gggg
       Lesser Egyptian jerboa  gggg
               Naked mole-rat  -ggg
                       Alpaca  ggc-
                        Horse  cga-
             White rhinoceros  gga-
                          Dog  gg--
                      Ferret   gga-
                        Panda  ggg-
                    Armadillo  agac
                      Opossum  t---
                     Platypus  agga
                 Saker falcon  ca--
                  Zebra finch  cggc
           Tibetan ground jay  cggc
           American alligator  cggg
               Painted turtle  ----
                         Pika  ====
                     Hedgehog  ====
          Cape elephant shrew  ====
               Golden hamster  ====
                 Prairie vole  ====
                          Rat  ====
                        Mouse  ====
              Chinese hamster  ====
                Domestic goat  ====
                          Cow  ====
                        Sheep  ====
             Tibetan antelope  ====
         David's myotis (bat)  ====
                Big brown bat  ====
                 Killer whale  ====
                  Zebra mbuna  ====
        Burton's mouthbreeder  ====
          Pundamilia nyererei  ====
                 Nile tilapia  ====
           Southern platyfish  ====
          Princess of Burundi  ====
                 Atlantic cod  ====
                       Lizard  ====
                         Fugu  ====
                       Medaka  ====
                    Tetraodon  ====
                  Spotted gar  ====
                      Lamprey  ====
                    Zebrafish  ====
                  Stickleback  ====
              Star-nosed mole  ====
             Black flying-fox  ====
                          Cat  ====
                      Manatee  ====
                     Elephant  ====
               Bactrian camel  NNNN
                 Mallard duck  ====
       White-throated sparrow  ====
          Medium ground finch  ====
                       Turkey  ----
                      Chicken  ====
                Scarlet macaw  ====
             Peregrine falcon  ====
                  Rock pigeon  ====
                   Budgerigar  ====
          Collared flycatcher  ====
             Cape golden mole  ====
     Chinese softshell turtle  ====
                     Aardvark  ====
                      Wallaby  ====
              Tasmanian devil  ====
                   Coelacanth  ====
              Green seaturtle  ====
               Pacific walrus  ====
             Brush-tailed rat  ====
                   Chinchilla  ====
                          Pig  ====
                X. tropicalis  NNNN
     Mexican tetra (cavefish)  ====
                 Weddell seal  ====
                      Dolphin  ====
                   Guinea pig  ====

Inserts between block 11 and 12 in window
B D              Zebra finch 774bp
          Tibetan ground jay 12bp
B D       American alligator 1bp
  D           Painted turtle 1bp

Alignment block 12 of 1099 in window, 883733 - 883736, 4 bps 
B D                     Human  t-----------tga
B D                     Chimp  t-----------tga
B D                   Gorilla  t-----------tga
B D                 Orangutan  c-----------tga
B D                    Gibbon  c-----------tga
B D                    Rhesus  c-----------tga
B D       Crab-eating macaque  c-----------tga
B D                    Baboon  c-----------tga
B D              Green monkey  c-----------tga
B D                  Marmoset  c-----------tga
B D           Squirrel monkey  c-----------tga
           Chinese tree shrew  c-----------ctc
       Lesser Egyptian jerboa  c--------------
B D            Naked mole-rat  a--------------
B D                 Armadillo  c--------------
B D                  Platypus  cccccccgaggttga
           Tibetan ground jay  -----------ccgg
B D        American alligator  -----------acgg
  D            Painted turtle  -----------ccg-
B D                      Pika  ===============
B D                  Hedgehog  ===============
         Cape elephant shrew  ===============
B D          White rhinoceros  ---------------
B D                     Panda  ---------------
              Golden hamster  ===============
                Prairie vole  ===============
B D                       Rat  ===============
B D                     Mouse  ===============
B D           Chinese hamster  ===============
               Domestic goat  ===============
B D                       Cow  ===============
B D                     Sheep  ===============
            Tibetan antelope  ===============
        David's myotis (bat)  ===============
               Big brown bat  ===============
                Killer whale  ===============
                 Zebra mbuna  ===============
       Burton's mouthbreeder  ===============
         Pundamilia nyererei  ===============
B D              Nile tilapia  ===============
          Southern platyfish  ===============
         Princess of Burundi  ===============
B D              Atlantic cod  ===============
B D                    Lizard  ===============
B D                      Fugu  ===============
B D                    Medaka  ===============
B D                 Tetraodon  ===============
                 Spotted gar  ===============
B D                   Lamprey  ===============
B D                 Zebrafish  ===============
B D                    Alpaca  ---------------
B D               Stickleback  ===============
             Star-nosed mole  ===============
B D                   Ferret   ---------------
B D                     Horse  ---------------
B D                  Squirrel  ---------------
            Black flying-fox  ===============
B D                       Cat  ===============
B D                   Manatee  ===============
B D                  Elephant  ===============
              Bactrian camel  NNNNNNNNNNNNNNN
  D              Mallard duck  ===============
B D               Zebra finch  ===============
  D    White-throated sparrow  ===============
B D       Medium ground finch  ===============
B D                    Turkey  ---------------
B D                   Chicken  ===============
  D             Scarlet macaw  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ---------------
  D               Rock pigeon  ===============
B D                Budgerigar  ===============
  D       Collared flycatcher  ===============
            Cape golden mole  ===============
  D  Chinese softshell turtle  ===============
                    Aardvark  ===============
B D                   Wallaby  ===============
B D                   Opossum  ---------------
B D           Tasmanian devil  ===============
B D                Coelacanth  ===============
  D           Green seaturtle  ===============
B D                  Bushbaby  ---------------
B D                       Dog  ---------------
              Pacific walrus  ===============
            Brush-tailed rat  ===============
                  Chinchilla  ===============
B D                       Pig  ===============
B D             X. tropicalis  NNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ===============
                Weddell seal  ===============
B D                   Dolphin  ===============
B D                Guinea pig  ===============

Inserts between block 12 and 13 in window
B D       American alligator 1bp
  D           Painted turtle 1bp

Alignment block 13 of 1099 in window, 883737 - 883738, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Gibbon  gt
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  ga
B D                  Marmoset  ga
B D           Squirrel monkey  ga
           Chinese tree shrew  ag
B D                    Alpaca  -g
B D                     Horse  -g
B D          White rhinoceros  -g
B D                  Platypus  aa
           Tibetan ground jay  g-
B D                    Turkey  g-
B D        American alligator  a-
  D            Painted turtle  g-
B D                      Pika  ==
B D                  Hedgehog  ==
B D                 Armadillo  --
         Cape elephant shrew  ==
B D                     Panda  --
              Golden hamster  ==
                Prairie vole  ==
B D                       Rat  ==
B D                     Mouse  ==
B D           Chinese hamster  ==
      Lesser Egyptian jerboa  --
               Domestic goat  ==
B D                       Cow  ==
B D                     Sheep  ==
            Tibetan antelope  ==
        David's myotis (bat)  ==
               Big brown bat  ==
                Killer whale  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Pundamilia nyererei  ==
B D              Nile tilapia  ==
          Southern platyfish  ==
         Princess of Burundi  ==
B D              Atlantic cod  ==
B D                    Lizard  ==
B D                      Fugu  ==
B D                    Medaka  ==
B D                 Tetraodon  ==
                 Spotted gar  ==
B D                   Lamprey  ==
B D                 Zebrafish  ==
B D               Stickleback  ==
             Star-nosed mole  ==
B D                   Ferret   --
B D                  Squirrel  --
            Black flying-fox  ==
B D                       Cat  ==
B D                   Manatee  ==
B D                  Elephant  ==
              Bactrian camel  NN
  D              Mallard duck  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D       Medium ground finch  ==
B D                   Chicken  ==
  D             Scarlet macaw  ==
  D          Peregrine falcon  ==
  D              Saker falcon  --
  D               Rock pigeon  ==
B D                Budgerigar  ==
  D       Collared flycatcher  ==
            Cape golden mole  ==
  D  Chinese softshell turtle  ==
                    Aardvark  ==
B D                   Wallaby  ==
B D                   Opossum  --
B D           Tasmanian devil  ==
B D                Coelacanth  ==
  D           Green seaturtle  ==
B D                  Bushbaby  --
B D                       Dog  --
              Pacific walrus  ==
            Brush-tailed rat  ==
                  Chinchilla  ==
B D                       Pig  ==
B D             X. tropicalis  NN
    Mexican tetra (cavefish)  ==
                Weddell seal  ==
B D                   Dolphin  ==
B D                Guinea pig  ==
B D            Naked mole-rat  --

Inserts between block 13 and 14 in window
          Tibetan ground jay 1bp
B D                   Turkey 1bp

Alignment block 14 of 1099 in window, 883739 - 883755, 17 bps 
B D                     Human  gggtacctgtcctggct
B D                     Chimp  gggtacctgtcctggct
B D                   Gorilla  gggtacctgtcctggct
B D                 Orangutan  gggtacctgtcctggct
B D                    Gibbon  gggtacctgtcctgact
B D                    Rhesus  gggtacctgtcccggct
B D       Crab-eating macaque  gggtacctgtcccggct
B D                    Baboon  gggtacctgtcccggct
B D              Green monkey  gggtacccgtcccggct
B D                  Marmoset  gggcacccat-ccggct
B D           Squirrel monkey  gggcacccatcccggct
B D                  Bushbaby  -----------atggcc
           Chinese tree shrew  ggacaccagtttctgct
B D                  Squirrel  --gcccccaccctact-
       Lesser Egyptian jerboa  -accacccaacttgct-
B D            Naked mole-rat  -agacaccatcctgct-
B D                    Alpaca  ggcacctcttgcctgtt
B D                     Horse  ggcgcctcgtccc-gct
B D          White rhinoceros  ggcacctcacccctgct
B D                   Ferret   -----ctca--------
B D                     Panda  -----c-----------
B D                 Armadillo  aagccccacttttcact
B D                  Platypus  gagcatcccccgcc---
  D              Saker falcon  -----------cagggc
B D               Zebra finch  gtgcccctcacccgtcc
           Tibetan ground jay  gcgcgtccgtgccggcg
B D                    Turkey  ggccacgtgtgctgcac
  D            Painted turtle  --------------ggc
B D                      Pika  =================
B D                  Hedgehog  =================
         Cape elephant shrew  =================
              Golden hamster  =================
                Prairie vole  =================
B D                       Rat  =================
B D                     Mouse  =================
B D           Chinese hamster  =================
               Domestic goat  =================
B D                       Cow  =================
B D                     Sheep  =================
            Tibetan antelope  =================
        David's myotis (bat)  =================
               Big brown bat  =================
                Killer whale  =================
                 Zebra mbuna  =================
       Burton's mouthbreeder  =================
         Pundamilia nyererei  =================
B D              Nile tilapia  =================
          Southern platyfish  =================
         Princess of Burundi  =================
B D              Atlantic cod  =================
B D                    Lizard  =================
B D                      Fugu  =================
B D                    Medaka  =================
B D                 Tetraodon  =================
                 Spotted gar  =================
B D                   Lamprey  =================
B D                 Zebrafish  =================
B D               Stickleback  =================
             Star-nosed mole  =================
            Black flying-fox  =================
B D                       Cat  =================
B D                   Manatee  =================
B D                  Elephant  =================
              Bactrian camel  NNNNNNNNNNNNNNNNN
  D              Mallard duck  =================
  D    White-throated sparrow  =================
B D       Medium ground finch  =================
B D        American alligator  -----------------
B D                   Chicken  =================
  D             Scarlet macaw  =================
  D          Peregrine falcon  =================
  D               Rock pigeon  =================
B D                Budgerigar  =================
  D       Collared flycatcher  =================
            Cape golden mole  =================
  D  Chinese softshell turtle  =================
                    Aardvark  =================
B D                   Wallaby  =================
B D                   Opossum  -----------------
B D           Tasmanian devil  =================
B D                Coelacanth  =================
  D           Green seaturtle  =================
B D                       Dog  -----------------
              Pacific walrus  =================
            Brush-tailed rat  =================
                  Chinchilla  =================
B D                       Pig  =================
B D             X. tropicalis  NNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  =================
                Weddell seal  =================
B D                   Dolphin  =================
B D                Guinea pig  =================

Inserts between block 14 and 15 in window
B D                 Platypus 1bp

Alignment block 15 of 1099 in window, 883756 - 883760, 5 bps 
B D                     Human  tagtc-
B D                     Chimp  tagtc-
B D                   Gorilla  tagtc-
B D                 Orangutan  tagtc-
B D                    Gibbon  tagtc-
B D                    Rhesus  tagtc-
B D       Crab-eating macaque  tagtc-
B D                    Baboon  tggtc-
B D              Green monkey  tagtc-
B D                  Marmoset  tagtc-
B D           Squirrel monkey  tagtc-
B D                  Bushbaby  tagtc-
           Chinese tree shrew  tagtc-
B D                  Squirrel  cagtc-
       Lesser Egyptian jerboa  tcgtc-
B D            Naked mole-rat  taatc-
B D                Guinea pig  taatc-
B D                    Alpaca  tgggc-
B D                     Horse  gtcac-
B D          White rhinoceros  cagtc-
B D                 Armadillo  --ctc-
B D                   Opossum  --gtt-
B D                  Platypus  cagc--
  D              Saker falcon  ---tct
B D               Zebra finch  ---tcg
           Tibetan ground jay  ---tgg
B D                    Turkey  ---cct
B D        American alligator  ----gg
  D            Painted turtle  ---tct
B D                      Pika  ======
B D                  Hedgehog  ======
         Cape elephant shrew  ======
B D                     Panda  ------
              Golden hamster  ======
                Prairie vole  ======
B D                       Rat  ======
B D                     Mouse  ======
B D           Chinese hamster  ======
               Domestic goat  ======
B D                       Cow  ======
B D                     Sheep  ======
            Tibetan antelope  ======
        David's myotis (bat)  ======
               Big brown bat  ======
                Killer whale  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
         Pundamilia nyererei  ======
B D              Nile tilapia  ======
          Southern platyfish  ======
         Princess of Burundi  ======
B D              Atlantic cod  ======
B D                    Lizard  ======
B D                      Fugu  ======
B D                    Medaka  ======
B D                 Tetraodon  ======
                 Spotted gar  ======
B D                   Lamprey  ======
B D                 Zebrafish  ======
B D               Stickleback  ======
             Star-nosed mole  ======
B D                   Ferret   ------
            Black flying-fox  ======
B D                       Cat  ======
B D                   Manatee  ======
B D                  Elephant  ======
              Bactrian camel  NNNNNN
  D              Mallard duck  ======
  D    White-throated sparrow  ======
B D       Medium ground finch  ======
B D                   Chicken  ======
  D             Scarlet macaw  ======
  D          Peregrine falcon  ======
  D               Rock pigeon  ======
B D                Budgerigar  ======
  D       Collared flycatcher  ======
            Cape golden mole  ======
  D  Chinese softshell turtle  ======
                    Aardvark  ======
B D                   Wallaby  ======
B D           Tasmanian devil  ======
B D                Coelacanth  ======
  D           Green seaturtle  ======
B D                       Dog  ------
              Pacific walrus  ======
            Brush-tailed rat  ======
                  Chinchilla  ======
B D                       Pig  ======
B D             X. tropicalis  NNNNNN
    Mexican tetra (cavefish)  ======
                Weddell seal  ======
B D                   Dolphin  ======

Alignment block 16 of 1099 in window, 883761 - 883774, 14 bps 
B D                     Human  acctgg------aaacca-aa
B D                     Chimp  acctgg------aaacca-aa
B D                   Gorilla  acctgg------aaacca-aa
B D                 Orangutan  acctgg------aaacca-aa
B D                    Gibbon  acccgg------aatcca-aa
B D                    Rhesus  acccgg------aagcca-ga
B D       Crab-eating macaque  acccgg------aagcca-ga
B D                    Baboon  acccag------aagcca-ga
B D              Green monkey  accggg------aagcca-ga
B D                  Marmoset  accagg------aaacca-ga
B D           Squirrel monkey  acccag------aaacca-ga
B D                  Bushbaby  accaga------aa--ca-ga
           Chinese tree shrew  acgcag------aaatga-aa
B D                  Squirrel  acgcag------acacaa-aa
       Lesser Egyptian jerboa  actcag------aaaaga-aa
B D            Naked mole-rat  accccg------aattga-aa
B D                Guinea pig  acccag------aactga-ac
B D                    Alpaca  tctgag------aaacca-ag
B D                     Horse  ---cca------gcagtg-aa
B D          White rhinoceros  ---cct------tcaaca-ga
B D                       Dog  acccag------acacta-aa
B D                   Ferret   ----ga------caacta-aa
B D                     Panda  --ccag------acacta-aa
               Pacific walrus  acccag------aaactataa
B D                 Armadillo  acctag------agagtg-aa
B D                   Opossum  ccctgg------cggccg-cc
  D              Saker falcon  gccagg------aggccc-cc
B D               Zebra finch  ggccgg------gagctg-ag
           Tibetan ground jay  gccaga------gagccc-ag
B D                    Turkey  ggctgg------ctcccc-tg
B D        American alligator  acctgg------cgtcgc-t-
  D            Painted turtle  gcccggctcgctgagctc-tc
B D                      Pika  =====================
B D                  Hedgehog  =====================
         Cape elephant shrew  =====================
              Golden hamster  =====================
                Prairie vole  =====================
B D                       Rat  =====================
B D                     Mouse  =====================
B D           Chinese hamster  =====================
               Domestic goat  =====================
B D                       Cow  =====================
B D                     Sheep  =====================
            Tibetan antelope  =====================
        David's myotis (bat)  =====================
               Big brown bat  =====================
                Killer whale  =====================
                 Zebra mbuna  =====================
       Burton's mouthbreeder  =====================
         Pundamilia nyererei  =====================
B D              Nile tilapia  =====================
          Southern platyfish  =====================
         Princess of Burundi  =====================
B D              Atlantic cod  =====================
B D                    Lizard  =====================
B D                      Fugu  =====================
B D                    Medaka  =====================
B D                 Tetraodon  =====================
                 Spotted gar  =====================
B D                   Lamprey  =====================
B D                 Zebrafish  =====================
B D               Stickleback  =====================
             Star-nosed mole  =====================
            Black flying-fox  =====================
B D                       Cat  =====================
B D                   Manatee  =====================
B D                  Elephant  =====================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  =====================
  D    White-throated sparrow  =====================
B D       Medium ground finch  =====================
B D                   Chicken  =====================
  D             Scarlet macaw  =====================
  D          Peregrine falcon  =====================
  D               Rock pigeon  =====================
B D                Budgerigar  =====================
B D                  Platypus  ---------------------
  D       Collared flycatcher  =====================
            Cape golden mole  =====================
  D  Chinese softshell turtle  =====================
                    Aardvark  =====================
B D                   Wallaby  =====================
B D           Tasmanian devil  =====================
B D                Coelacanth  =====================
  D           Green seaturtle  =====================
            Brush-tailed rat  =====================
                  Chinchilla  =====================
B D                       Pig  =====================
B D             X. tropicalis  NNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  =====================
                Weddell seal  =====================
B D                   Dolphin  =====================

Inserts between block 16 and 17 in window
  D             Saker falcon 3bp
          Tibetan ground jay 78bp
B D                   Turkey 1bp
  D           Painted turtle 11bp

Alignment block 17 of 1099 in window, 883775 - 883812, 38 bps 
B D                     Human  atccttcgcagcttccag-----------a-attctccag---tacaggagga-----------------
B D                     Chimp  atccttcgcagcttccag-----------a-attctccag---tacaggagga-----------------
B D                   Gorilla  atcctttgcagcttccag-----------a-attctccag---tacaggagga-----------------
B D                 Orangutan  atccttcgcagctcccag-----------a-attctccag---tacaggagga-----------------
B D                    Gibbon  atccttcgcagcttccag-----------a-attctccag---tacaggagga-----------------
B D                    Rhesus  atccttcacagcttccgg-----------a-attctccag---tacaagag-------------------
B D       Crab-eating macaque  atccttcacagcttccgg-----------a-attctccag---tacaagag-------------------
B D                    Baboon  atccttcacagcttccgg-----------a-attctccag---tgcaagag-------------------
B D              Green monkey  atccttcacagcttctga-----------a-attctccag---tgcaagag-------------------
B D                  Marmoset  gtccttcacaccttctgg-----------a-attctccag---tgtcggag-------------------
B D           Squirrel monkey  gtccttcgcaccttctgg-----------a-attctcaag---tgtcggag-------------------
B D                  Bushbaby  gactctagc-----tctg-----------a-atcctc-ag---cggaaga--------------------
           Chinese tree shrew  atcccttccagctcctga-----------a-attggtcaa---tggaaaaa-------------------
B D                  Squirrel  atccctctcagttcccag-----------c-attctgcag---tggagaaaga-----------------
       Lesser Egyptian jerboa  atctctcccagctcccag-----------a-attgtatag---tgtgaaaaga-----------------
B D            Naked mole-rat  atccctcccagctcctag-----------a-actctgtga---tggga----------------------
B D                Guinea pig  atccttcccagctcctag-----------a-acactctaa---tggaa----------------------
B D                    Alpaca  ccccttcccg-ctcccag-----------c-gccgtgcggtgcagt------------------------
B D                     Horse  cctctcccc--tgcccgg-----------c-gttccgcgg---gga------------------------
B D          White rhinoceros  tcccttccca-cttgcga-----------a-gttctgcag---gaa------------------------
B D                       Dog  tcccttccca-taccctg-----------a-cttctgcag---aaa------------------------
B D                   Ferret   tcccttcctg-ttccccg-----------c-gttctgccg---aaa------------------------
B D                     Panda  tcccttccca-ttccctg-----------a-gttctgcag---aaa------------------------
               Pacific walrus  ttcctttcca-ttccctg-----------a-gttctgcag---aaa------------------------
B D                 Armadillo  tttccttccagctcccaa-----------c-attcttttt---tggaaaaagg-----------------
B D                   Opossum  ggcctctggcgccagcgg-----------atcctcttcga---cgaaga---------------------
B D                  Platypus  -tcctgcccgagttctggctcattatccag-gttctgcag---gaccgggt-------------------
  D              Saker falcon  -----------------------------------------------------ccccct-----------
B D               Zebra finch  ------------------------------------------------------ctcc------------
B D                    Turkey  ------------------------------------------------------cctctgcgcagggctg
  D            Painted turtle  ----------------------------------------------------gacccccagattccacca
B D                      Pika  ======================================================================
B D                  Hedgehog  ======================================================================
         Cape elephant shrew  ======================================================================
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
B D           Chinese hamster  ======================================================================
               Domestic goat  ======================================================================
B D                       Cow  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
                Killer whale  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Pundamilia nyererei  ======================================================================
B D              Nile tilapia  ======================================================================
          Southern platyfish  ======================================================================
         Princess of Burundi  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Lizard  ======================================================================
B D                      Fugu  ======================================================================
B D                    Medaka  ======================================================================
B D                 Tetraodon  ======================================================================
                 Spotted gar  ======================================================================
B D                   Lamprey  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
             Star-nosed mole  ======================================================================
            Black flying-fox  ======================================================================
B D                       Cat  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
  D    White-throated sparrow  ======================================================================
B D       Medium ground finch  ======================================================================
B D        American alligator  ----------------------------------------------------------------------
B D                   Chicken  ======================================================================
  D             Scarlet macaw  ======================================================================
  D          Peregrine falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
  D       Collared flycatcher  ======================================================================
            Cape golden mole  ======================================================================
  D  Chinese softshell turtle  ======================================================================
                    Aardvark  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                Coelacanth  ======================================================================
  D           Green seaturtle  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                       Pig  ======================================================================
B D             X. tropicalis  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ======================================================================
                Weddell seal  ======================================================================
B D                   Dolphin  ======================================================================

                        Human  --------
                        Chimp  --------
                      Gorilla  --------
                    Orangutan  --------
                       Gibbon  --------
                       Rhesus  --------
          Crab-eating macaque  --------
                       Baboon  --------
                 Green monkey  --------
                     Marmoset  --------
              Squirrel monkey  --------
                     Bushbaby  --------
           Chinese tree shrew  --------
                     Squirrel  --------
       Lesser Egyptian jerboa  --------
               Naked mole-rat  --------
                   Guinea pig  --------
                       Alpaca  --------
                        Horse  --------
             White rhinoceros  --------
                          Dog  --------
                      Ferret   --------
                        Panda  --------
               Pacific walrus  --------
                    Armadillo  --------
                      Opossum  --------
                     Platypus  --------
                 Saker falcon  gggggggt
                  Zebra finch  ----aggt
                       Turkey  ggggacga
               Painted turtle  cagaccgg
                         Pika  ========
                     Hedgehog  ========
          Cape elephant shrew  ========
               Golden hamster  ========
                 Prairie vole  ========
                          Rat  ========
                        Mouse  ========
              Chinese hamster  ========
                Domestic goat  ========
                          Cow  ========
                        Sheep  ========
             Tibetan antelope  ========
         David's myotis (bat)  ========
                Big brown bat  ========
                 Killer whale  ========
                  Zebra mbuna  ========
        Burton's mouthbreeder  ========
          Pundamilia nyererei  ========
                 Nile tilapia  ========
           Southern platyfish  ========
          Princess of Burundi  ========
                 Atlantic cod  ========
                       Lizard  ========
                         Fugu  ========
                       Medaka  ========
                    Tetraodon  ========
                  Spotted gar  ========
                      Lamprey  ========
                    Zebrafish  ========
                  Stickleback  ========
              Star-nosed mole  ========
             Black flying-fox  ========
                          Cat  ========
                      Manatee  ========
                     Elephant  ========
               Bactrian camel  NNNNNNNN
                 Mallard duck  ========
           Tibetan ground jay  ========
       White-throated sparrow  ========
          Medium ground finch  ========
           American alligator  --------
                      Chicken  ========
                Scarlet macaw  ========
             Peregrine falcon  ========
                  Rock pigeon  ========
                   Budgerigar  ========
          Collared flycatcher  ========
             Cape golden mole  ========
     Chinese softshell turtle  ========
                     Aardvark  ========
                      Wallaby  ========
              Tasmanian devil  ========
                   Coelacanth  ========
              Green seaturtle  ========
             Brush-tailed rat  ========
                   Chinchilla  ========
                          Pig  ========
                X. tropicalis  NNNNNNNN
     Mexican tetra (cavefish)  ========
                 Weddell seal  ========
                      Dolphin  ========

Inserts between block 17 and 18 in window
B D                 Squirrel 1009bp
      Lesser Egyptian jerboa 2905bp

Alignment block 18 of 1099 in window, 883813 - 883863, 51 bps 
B D                     Human  gaagc----cgtcca-cgttca--ga----gccgccttag-acgg-----tt-tg------------cc-
B D                     Chimp  gaagc----cgtcca-cgttca--ga----gccgccttag-acgg-----tt-tg------------cc-
B D                   Gorilla  gaagc----cgtcca-cgttca--ga----gccgccttag-acgg-----tt-tg------------cc-
B D                 Orangutan  gaagc----cgtcca-cgttcg--ga----gccgccttag-atgg-----tt-tg------------cc-
B D                    Gibbon  gaagt----tgtcca-cgttca--ga----gccgccttag-atgg-----tt-tg------------cc-
B D                    Rhesus  gaagc----catcca-tgttca--ga----gctgctttag-acgg-----tt-tg------------cc-
B D       Crab-eating macaque  gaagc----catcca-tgttca--ga----gctgctttag-acgg-----tt-tg------------cc-
B D                    Baboon  gaagc----catcca-tgttca--ga----gctgctttag-acgg-----tt-tg------------cc-
B D              Green monkey  gaagc----catcca-tgttca--ga----gctgctttag-acgg-----tt-tg------------cc-
B D                  Marmoset  gaagc----tgtcca-tgttca--ga----gccaccttag-atgg-----tt-tg------------cc-
B D           Squirrel monkey  gaagc----tgtccg-tgttca--ga----gctgccttag-acgg-----tt-tg------------cc-
B D                  Bushbaby  gaagc----ccattg-ttctca--ta----ttcaccttag-acta-----tt----------------c-
           Chinese tree shrew  gaagc---acacttg-ctttcacgga----gttgccttag-actgactgttt-tg------------tc-
B D            Naked mole-rat  aa--a----agttca-ttttct--tc----attacctgag--ctg-----ct-tg------------tc-
B D                Guinea pig  aaaga----agtttg-ttttct--tc----attgcctgag--cca-----ct-tg------------tc-
B D                    Alpaca  gaagg-----------tctctg--gt----gctgctctcc-gccg-----tc-tt---------------
B D                     Horse  gaagt---gcgttcgctttccg--cg----gtggccgt--------------------------------
B D          White rhinoceros  gaagc---acgttcatttttca--ta----gtggccgttc-tctg-----tc-ttcccagccccccccc-
B D                       Dog  gaagc---acgttcatttttca--gg----gttgcctttc-acta-----tt-tt------tttttttt-
B D                   Ferret   gaagg---atgctcatttctca--gc----gttgccttta-tccg-----cc-cc---------------
B D                     Panda  gaagc---gccttcatttctca--gg----gttgcctttc-actg-----tt-tt------------gt-
               Pacific walrus  gaagc---acgttcatttctca--gg----gttgcctttc-actg-----tt-tt---------------
B D                 Armadillo  --agc---acattcatttttca--ga----gttgcctttt-gtgt-----tt-tg------------ta-
B D                   Opossum  -----------------------cga----gctgcgcaggcacgg-----cc-tg----gaggcggccc-
B D                  Platypus  ggagctgtatgccca-cgcacg--gt----gaggagtcac-agga-----cg-gg------------gt-
  D              Saker falcon  -------------------gca--ga-------gtgccaa-ggga-----ct-ct------------tc-
B D               Zebra finch  -------------------cca--gc-cactctgcgctga-aggt-----ttccc------------tc-
B D                    Turkey  -------------------gca--gc--acgccg-gctgg-gtgg-----ct-gt------------cc-
B D        American alligator  ------------------------------gccg-gctga-gctc-----at-ca------------ac-
  D            Painted turtle  -------------------gca--gcccaggcag-agaga-gtga-----ct-ca------------ccg
B D                      Pika  ======================================================================
B D                  Hedgehog  ======================================================================
         Cape elephant shrew  ======================================================================
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
B D           Chinese hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
               Domestic goat  ======================================================================
B D                       Cow  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
                Killer whale  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Pundamilia nyererei  ======================================================================
B D              Nile tilapia  ======================================================================
          Southern platyfish  ======================================================================
         Princess of Burundi  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Lizard  ======================================================================
B D                      Fugu  ======================================================================
B D                    Medaka  ======================================================================
B D                 Tetraodon  ======================================================================
                 Spotted gar  ======================================================================
B D                   Lamprey  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
             Star-nosed mole  ======================================================================
B D                  Squirrel  ======================================================================
            Black flying-fox  ======================================================================
B D                       Cat  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
  D    White-throated sparrow  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Chicken  ======================================================================
  D             Scarlet macaw  ======================================================================
  D          Peregrine falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
  D       Collared flycatcher  ======================================================================
            Cape golden mole  ======================================================================
  D  Chinese softshell turtle  ======================================================================
                    Aardvark  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                Coelacanth  ======================================================================
  D           Green seaturtle  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                       Pig  ======================================================================
B D             X. tropicalis  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ======================================================================
                Weddell seal  ======================================================================
B D                   Dolphin  ======================================================================

                        Human  ------------tgtcaccggcat
                        Chimp  ------------tgtcaccggcat
                      Gorilla  ------------tgtcaccggcat
                    Orangutan  ------------cgtcactggcat
                       Gibbon  ------------cgtcaccggcat
                       Rhesus  ------------cgtcactggcat
          Crab-eating macaque  ------------cgtcactggcat
                       Baboon  ------------cgtcaccggcat
                 Green monkey  ------------cgtcaccggcat
                     Marmoset  ------------cgtcattggcat
              Squirrel monkey  ------------tgtcatcggcat
                     Bushbaby  ------------tcttacctgctg
           Chinese tree shrew  ------------ttttaccagatt
               Naked mole-rat  ------------ttttacaagctt
                   Guinea pig  ------------ttt---------
                       Alpaca  -----------------gtggttt
                        Horse  ----------------cccgggca
             White rhinoceros  ------------cccccccagctt
                          Dog  ------------tttttctgactt
                      Ferret   -------------ccccccagctt
                        Panda  ------------ttgttctggctt
               Pacific walrus  ------------------tggctt
                    Armadillo  ------------ttttactggc-t
                      Opossum  ------------acgtgtcggcct
                     Platypus  ------------tagtgagggca-
                 Saker falcon  ------------ctgtgcaggggc
                  Zebra finch  ------------ctgcccacgtcc
                       Turkey  ------------ctgtgctggctc
           American alligator  ------------cagattggtaac
               Painted turtle  atgggcacacagccaggccagagc
                         Pika  ========================
                     Hedgehog  ========================
          Cape elephant shrew  ========================
               Golden hamster  ========================
                 Prairie vole  ========================
                          Rat  ========================
                        Mouse  ========================
              Chinese hamster  ========================
       Lesser Egyptian jerboa  ========================
                Domestic goat  ========================
                          Cow  ========================
                        Sheep  ========================
             Tibetan antelope  ========================
         David's myotis (bat)  ========================
                Big brown bat  ========================
                 Killer whale  ========================
                  Zebra mbuna  ========================
        Burton's mouthbreeder  ========================
          Pundamilia nyererei  ========================
                 Nile tilapia  ========================
           Southern platyfish  ========================
          Princess of Burundi  ========================
                 Atlantic cod  ========================
                       Lizard  ========================
                         Fugu  ========================
                       Medaka  ========================
                    Tetraodon  ========================
                  Spotted gar  ========================
                      Lamprey  ========================
                    Zebrafish  ========================
                  Stickleback  ========================
              Star-nosed mole  ========================
                     Squirrel  ========================
             Black flying-fox  ========================
                          Cat  ========================
                      Manatee  ========================
                     Elephant  ========================
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNN
                 Mallard duck  ========================
           Tibetan ground jay  ========================
       White-throated sparrow  ========================
          Medium ground finch  ========================
                      Chicken  ========================
                Scarlet macaw  ========================
             Peregrine falcon  ========================
                  Rock pigeon  ========================
                   Budgerigar  ========================
          Collared flycatcher  ========================
             Cape golden mole  ========================
     Chinese softshell turtle  ========================
                     Aardvark  ========================
                      Wallaby  ========================
              Tasmanian devil  ========================
                   Coelacanth  ========================
              Green seaturtle  ========================
             Brush-tailed rat  ========================
                   Chinchilla  ========================
                          Pig  ========================
                X. tropicalis  NNNNNNNNNNNNNNNNNNNNNNNN
     Mexican tetra (cavefish)  ========================
                 Weddell seal  ========================
                      Dolphin  ========================

Inserts between block 18 and 19 in window
  D             Saker falcon 35bp
B D              Zebra finch 27bp
B D                   Turkey 45bp
B D       American alligator 16bp
  D           Painted turtle 19bp

Alignment block 19 of 1099 in window, 883864 - 883907, 44 bps 
B D                     Human  t------cctggacct----------------------ggaa--------acgggtgcccccagcc----
B D                     Chimp  t------cctggacct----------------------ggaa--------acgggtgcccccagcc----
B D                   Gorilla  t------cctggacct----------------------ggaa--------acgggtgcccccagcc----
B D                 Orangutan  t------cctggacct----------------------ggaa--------acgggtgcccccagcc----
B D                    Gibbon  t------cctggacct----------------------ggaa--------acgggcg-ccccagcc----
B D                    Rhesus  t------cctggacct----------------------ggaa--------acgggcacccccagcc----
B D       Crab-eating macaque  t------cctggacct----------------------ggaa--------acgggcacccccagcc----
B D                    Baboon  t------cctggacct----------------------ggaa--------acgggcacccccagcc----
B D              Green monkey  t------cctggacct----------------------ggaa--------acgggcacccccagcc----
B D                  Marmoset  t------cctggacct----------------------ggaa--------ttgggcagccccagcc----
B D           Squirrel monkey  t------cctggacct----------------------ggaa--------atgggcagctccagcc----
B D                  Bushbaby  t------cctggattg----------------------taac--------acaggcaattttcact----
           Chinese tree shrew  t----------gatgt----------------------agca--------acaggcagtttcagcg----
B D            Naked mole-rat  g------tcttgatct----------------------ggca--------acaggtgattgcgaca----
B D                Guinea pig  -------tcttgatct----------------------ggct--------ataggtgattctgatg----
B D                    Alpaca  tcagcacccttgatcc-----------------------gtg--------gccggcagtttcagct----
B D                     Horse  g------tcctgatct-----------------------gca--------g---gccactccagct----
B D          White rhinoceros  t------ccttgatct-----------------------gca--------gca-gcgactttgact----
B D                       Dog  t------cctcaaacc-----------------------gca--------acaggtgatttcacct----
B D                   Ferret   t------ccttgatct-----------------------gca--------acaggtgatcttatgt----
B D                     Panda  t------ccttgatct-----------------------gca--------acaggtgattg-acct----
               Pacific walrus  t------ccttgattt-----------------------gca--------acaggtgatttcacct----
B D                 Armadillo  t------ccttgatct----------------------ggca--------gtgggcagtttcagctctct
B D                   Opossum  t------cctcaacat-----------------------gaacgtcttccacaaagacatccagcg----
B D                  Platypus  -------cctgggaaa----------------------gatt--------aggggttatgtgggag----
  D              Saker falcon  --------------------------------------------------tggggggctgcgatgc----
B D               Zebra finch  -------gccgggagca---------------------gccc--------cccggagccccccacc----
           Tibetan ground jay  -------tctggggctaatga---------------acaccc--------cttggggctaatgaac----
B D                    Turkey  -------cgtgggggcagtggcacc-----------atgcag--------gtgggggaccctccgt----
B D        American alligator  -------tctacgatgagggggacccagccgagaagctggag--------cttgtcactggtatgt----
  D            Painted turtle  ----------------------------------------tg--------ctgtgggcgctgccct----
B D                      Pika  ======================================================================
B D                  Hedgehog  ======================================================================
         Cape elephant shrew  ======================================================================
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
B D           Chinese hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
               Domestic goat  ======================================================================
B D                       Cow  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
                Killer whale  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Pundamilia nyererei  ======================================================================
B D              Nile tilapia  ======================================================================
          Southern platyfish  ======================================================================
         Princess of Burundi  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Lizard  ======================================================================
B D                      Fugu  ======================================================================
B D                    Medaka  ======================================================================
B D                 Tetraodon  ======================================================================
                 Spotted gar  ======================================================================
B D                   Lamprey  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
             Star-nosed mole  ======================================================================
B D                  Squirrel  ======================================================================
            Black flying-fox  ======================================================================
B D                       Cat  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ======================================================================
  D    White-throated sparrow  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Chicken  ======================================================================
  D             Scarlet macaw  ======================================================================
  D          Peregrine falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
  D       Collared flycatcher  ======================================================================
            Cape golden mole  ======================================================================
  D  Chinese softshell turtle  ======================================================================
                    Aardvark  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                Coelacanth  ======================================================================
  D           Green seaturtle  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                       Pig  ======================================================================
B D             X. tropicalis  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ======================================================================
                Weddell seal  ======================================================================
B D                   Dolphin  ======================================================================

                        Human  ------aggcc--gggg--------accac
                        Chimp  ------aggcc--gggg--------accac
                      Gorilla  ------aggcc--gcgg--------accac
                    Orangutan  ------aggcc--gggg--------accac
                       Gibbon  ------aggcc--gggg--------accac
                       Rhesus  ------aggcc--gggg--------accac
          Crab-eating macaque  ------aggcc--gggg--------accac
                       Baboon  ------aggcc--gggg--------accac
                 Green monkey  ------aggcc--gggg--------accac
                     Marmoset  ------agggc--ggtg--------gctac
              Squirrel monkey  ------aggcc--cgtg--------gccac
                     Bushbaby  ------gggtg--tgg--------------
           Chinese tree shrew  ------aggtg--ggga--------atgac
               Naked mole-rat  ------aggt---aggg--------accag
                   Guinea pig  ------aagt---aaag--------accag
                       Alpaca  ------taggg--ga----------ctgtg
                        Horse  ------ggaag--ggga--------gtgag
             White rhinoceros  ------gggtg--ggga--------atgac
                          Dog  ------ggagg--gg----------acagg
                      Ferret   ------ggatg--gg----------acgag
                        Panda  ------ggatg--gg----------acgag
               Pacific walrus  ------ggatg--gg----------aagag
                    Armadillo  aaggaaaggtg--gtggaaagtgctaatac
                      Opossum  ------cgaga--gat---------actac
                     Platypus  ------gtgcg--gggg--------agtct
                 Saker falcon  ------gggca--gggg--------gaccc
                  Zebra finch  ------acgcc--gggg--------cccac
           Tibetan ground jay  ------accccttgggg--------ctaat
                       Turkey  ------gctccctggga--------tgcg-
           American alligator  ------gtgccctggcc--------ctag-
               Painted turtle  ------agggcaggagc--------ttggc
                         Pika  ==============================
                     Hedgehog  ==============================
          Cape elephant shrew  ==============================
               Golden hamster  ==============================
                 Prairie vole  ==============================
                          Rat  ==============================
                        Mouse  ==============================
              Chinese hamster  ==============================
       Lesser Egyptian jerboa  ==============================
                Domestic goat  ==============================
                          Cow  ==============================
                        Sheep  ==============================
             Tibetan antelope  ==============================
         David's myotis (bat)  ==============================
                Big brown bat  ==============================
                 Killer whale  ==============================
                  Zebra mbuna  ==============================
        Burton's mouthbreeder  ==============================
          Pundamilia nyererei  ==============================
                 Nile tilapia  ==============================
           Southern platyfish  ==============================
          Princess of Burundi  ==============================
                 Atlantic cod  ==============================
                       Lizard  ==============================
                         Fugu  ==============================
                       Medaka  ==============================
                    Tetraodon  ==============================
                  Spotted gar  ==============================
                      Lamprey  ==============================
                    Zebrafish  ==============================
                  Stickleback  ==============================
              Star-nosed mole  ==============================
                     Squirrel  ==============================
             Black flying-fox  ==============================
                          Cat  ==============================
                      Manatee  ==============================
                     Elephant  ==============================
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                 Mallard duck  ==============================
       White-throated sparrow  ==============================
          Medium ground finch  ==============================
                      Chicken  ==============================
                Scarlet macaw  ==============================
             Peregrine falcon  ==============================
                  Rock pigeon  ==============================
                   Budgerigar  ==============================
          Collared flycatcher  ==============================
             Cape golden mole  ==============================
     Chinese softshell turtle  ==============================
                     Aardvark  ==============================
                      Wallaby  ==============================
              Tasmanian devil  ==============================
                   Coelacanth  ==============================
              Green seaturtle  ==============================
             Brush-tailed rat  ==============================
                   Chinchilla  ==============================
                          Pig  ==============================
                X. tropicalis  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Mexican tetra (cavefish)  ==============================
                 Weddell seal  ==============================
                      Dolphin  ==============================

Alignment block 20 of 1099 in window, 883908 - 883913, 6 bps 
B D                     Human  tg-------------------tgtg--
B D                     Chimp  tg-------------------tgtg--
B D                   Gorilla  tg-------------------tgtg--
B D                 Orangutan  tg-------------------tatg--
B D                    Gibbon  tg-------------------tgcg--
B D                    Rhesus  tg-------------------tgtg--
B D       Crab-eating macaque  tg-------------------tgtg--
B D                    Baboon  tg-------------------tgtg--
B D              Green monkey  tg-------------------tgtg--
B D                  Marmoset  ca-------------------tgtg--
B D           Squirrel monkey  tg-------------------tgtg--
           Chinese tree shrew  tg--gttgaaaactctggtgttgtg--
B D            Naked mole-rat  ca-------------------tgtg--
B D                Guinea pig  ta-------------------tgtg--
B D                    Alpaca  gg-------------------------
B D                     Horse  cg-------------------------
B D          White rhinoceros  tg-------------------------
B D                       Dog  tg-------------------------
B D                   Ferret   tg-------------------------
B D                     Panda  gg-------------------------
               Pacific walrus  tg-------------------------
B D                 Armadillo  tg-------------------tgtc--
B D                   Opossum  ag-------------------cttc--
B D                  Platypus  ta-------------------cact--
  D              Saker falcon  ca-------------------------
B D               Zebra finch  catg-----------------------
           Tibetan ground jay  ta-------------------------
  D            Painted turtle  cg-------------------------
B D                   Lamprey  ---------------------tgtgtt
B D                      Pika  ===========================
B D                  Hedgehog  ===========================
         Cape elephant shrew  ===========================
              Golden hamster  ===========================
                Prairie vole  ===========================
B D                       Rat  ===========================
B D                     Mouse  ===========================
B D           Chinese hamster  ===========================
      Lesser Egyptian jerboa  ===========================
               Domestic goat  ===========================
B D                       Cow  ===========================
B D                     Sheep  ===========================
            Tibetan antelope  ===========================
        David's myotis (bat)  ===========================
               Big brown bat  ===========================
                Killer whale  ===========================
                 Zebra mbuna  ===========================
       Burton's mouthbreeder  ===========================
         Pundamilia nyererei  ===========================
B D              Nile tilapia  ===========================
          Southern platyfish  ===========================
         Princess of Burundi  ===========================
B D              Atlantic cod  ===========================
B D                    Lizard  ===========================
B D                      Fugu  ===========================
B D                    Medaka  ===========================
B D                 Tetraodon  ===========================
                 Spotted gar  ===========================
B D                 Zebrafish  ===========================
B D               Stickleback  ===========================
             Star-nosed mole  ===========================
B D                  Squirrel  ===========================
            Black flying-fox  ===========================
B D                       Cat  ===========================
B D                   Manatee  ===========================
B D                  Elephant  ===========================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ===========================
  D    White-throated sparrow  ===========================
B D       Medium ground finch  ===========================
B D        American alligator  ---------------------------
B D                    Turkey  ---------------------------
B D                   Chicken  ===========================
  D             Scarlet macaw  ===========================
  D          Peregrine falcon  ===========================
  D               Rock pigeon  ===========================
B D                Budgerigar  ===========================
  D       Collared flycatcher  ===========================
            Cape golden mole  ===========================
  D  Chinese softshell turtle  ===========================
                    Aardvark  ===========================
B D                   Wallaby  ===========================
B D           Tasmanian devil  ===========================
B D                Coelacanth  ===========================
  D           Green seaturtle  ===========================
B D                  Bushbaby  ---------------------------
            Brush-tailed rat  ===========================
                  Chinchilla  ===========================
B D                       Pig  ===========================
B D             X. tropicalis  NNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ===========================
                Weddell seal  ===========================
B D                   Dolphin  ===========================

Inserts between block 20 and 21 in window
B D               Guinea pig 894bp
B D                Armadillo 9bp
B D                  Opossum 3bp
B D                 Platypus 2bp

Alignment block 21 of 1099 in window, 883914 - 883960, 47 bps 
B D                     Human  cccagaattct---c--c--------------------------tcccgtc-ctttttccccttgc----
B D                     Chimp  cccagaattct---c--c--------------------------tcccgtc-ctttttccccttgc----
B D                   Gorilla  cccagaattct---c--c--------------------------tcccgtc-ctttttccccttgc----
B D                 Orangutan  cccagaattct---c--c--------------------------tcccatc-ctttttccccttgc----
B D                    Gibbon  cccagaattct---c--c--------------------------tcccgtc-ctttttccccttgc----
B D                    Rhesus  cccagaattct---c--c--------------------------tcccgtt-ctttttcccctcgc----
B D       Crab-eating macaque  cccagaattct---c--c--------------------------tcccatt-ctttttcccctcgc----
B D                    Baboon  cccagaattct---c--c--------------------------tcccgtt-ctttttcccctcgc----
B D              Green monkey  cccagaattct---c--t--------------------------tcccgtt-ctttttcccctcgc----
B D                  Marmoset  cccagaagtcc---c--c--------------------------ctcctgt-ccttccttcctcgc----
B D           Squirrel monkey  cccaggagtcc---c--c--------------------------cttctgt-ccgtccttcctcgc----
B D                  Bushbaby  ---------------------------------------------cccttc-cttctctcccctga----
           Chinese tree shrew  tgcatcagtca---c--c--------------------------gctgtttgcctcctcctctctc----
B D            Naked mole-rat  ----------------------------------------------------------------------
B D                    Alpaca  -c------------------------------------------catcccc-ctgccgccaacgc-----
B D                     Horse  -ctgggagtcc---c--a---------aggcccagtagacgggtca--------ccctccttgcg-----
B D          White rhinoceros  -gtgggaatcc---t--ggtggcatgtgtgctcagtagacgggtcaccacc-cccctcccctgtg-----
B D                       Dog  -ctggaaatgg---c--a--------------------------catcatc-ccatcccccttgg-----
B D                   Ferret   -ctggctgtgg---c--a--------------------------catcgcc-ccactcccccttg-----
B D                     Panda  -ctgcgcgtgg---c--g--------------------------c---------accgccccagg-----
               Pacific walrus  -ttggacgggg---t--g--------------------------ctttgcc-ctgcccccccttg-----
B D                 Armadillo  agtagaattttgggc--c--------------------------ccccatc-cctccctcccctccattg
B D                   Opossum  cacctgagctt---c--c--------------------------aggagtt-cttcgccgccatgt----
B D                  Platypus  cctgaaactct---c--c-----------------------aattcccctc-cgtgggacccctcc----
  D              Saker falcon  -----------------g--------------------------cccttct-ctgccccatgctgg----
B D               Zebra finch  ---------------gtg--------------------------ccgcttt-gcccct----ctcc----
           Tibetan ground jay  -----------------g--------------------------acgtgtt-tccctc----ctgc----
B D                    Turkey  -----------------g--------------------------ttgcgct-ctccttcctccccc----
B D        American alligator  -----------------t--------------------------tcgcgtc-ctgcccccctctgc----
  D            Painted turtle  -----------------a--------------------------gcgggca-gccctgccacctcc----
B D                   Lamprey  -cacaaattca---c--t--------------------------tcccgct-ctaccatctccagg----
B D                      Pika  ======================================================================
B D                  Hedgehog  ======================================================================
         Cape elephant shrew  ======================================================================
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
B D           Chinese hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
               Domestic goat  ======================================================================
B D                       Cow  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
                Killer whale  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Pundamilia nyererei  ======================================================================
B D              Nile tilapia  ======================================================================
          Southern platyfish  ======================================================================
         Princess of Burundi  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Lizard  ======================================================================
B D                      Fugu  ======================================================================
B D                    Medaka  ======================================================================
B D                 Tetraodon  ======================================================================
                 Spotted gar  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
             Star-nosed mole  ======================================================================
B D                  Squirrel  ======================================================================
            Black flying-fox  ======================================================================
B D                       Cat  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ======================================================================
  D    White-throated sparrow  ======================================================================
B D       Medium ground finch  ======================================================================
B D                   Chicken  ======================================================================
  D             Scarlet macaw  ======================================================================
  D          Peregrine falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
  D       Collared flycatcher  ======================================================================
            Cape golden mole  ======================================================================
  D  Chinese softshell turtle  ======================================================================
                    Aardvark  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                Coelacanth  ======================================================================
  D           Green seaturtle  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                       Pig  ======================================================================
B D             X. tropicalis  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ======================================================================
                Weddell seal  ======================================================================
B D                   Dolphin  ======================================================================
B D                Guinea pig  ======================================================================

                        Human  ccg---gctcccagc--t
                        Chimp  ccg---gctcccagc--t
                      Gorilla  ccg---gctcccagc--t
                    Orangutan  ccg---gctcacagc--t
                       Gibbon  ccg---gctcacagc--t
                       Rhesus  ctg---gctcacagc--t
          Crab-eating macaque  ctg---gctcacagc--t
                       Baboon  ctg---gctcacagc--t
                 Green monkey  ctg---gctcacagc--t
                     Marmoset  cta---gctcacagc--t
              Squirrel monkey  ctg---actcatggc--t
                     Bushbaby  atg--agcccactgc--t
           Chinese tree shrew  ctatgtgtgcccagc--t
               Naked mole-rat  ---------gaaggc--t
                       Alpaca  -ag---gcgcccg----t
                        Horse  -gg---gctcccg----t
             White rhinoceros  tgg---gctccca----t
                          Dog  ------gccccta-----
                      Ferret   ------gccccca-----
                        Panda  ------------------
               Pacific walrus  ------------------
                    Armadillo  tgg---ggactcagc--t
                      Opossum  tct---ac----------
                     Platypus  ctg---agacttggccat
                 Saker falcon  cag---ggcctgggc--a
                  Zebra finch  ccg---tgccctccc--t
           Tibetan ground jay  cgg---cagcttccc--t
                       Turkey  ccg---gctcagggc--t
           American alligator  ccc---tgcctcagt--t
               Painted turtle  cgg---cccaacggc--t
                      Lamprey  cca---actcccagc--t
                         Pika  ==================
                     Hedgehog  ==================
          Cape elephant shrew  ==================
               Golden hamster  ==================
                 Prairie vole  ==================
                          Rat  ==================
                        Mouse  ==================
              Chinese hamster  ==================
       Lesser Egyptian jerboa  ==================
                Domestic goat  ==================
                          Cow  ==================
                        Sheep  ==================
             Tibetan antelope  ==================
         David's myotis (bat)  ==================
                Big brown bat  ==================
                 Killer whale  ==================
                  Zebra mbuna  ==================
        Burton's mouthbreeder  ==================
          Pundamilia nyererei  ==================
                 Nile tilapia  ==================
           Southern platyfish  ==================
          Princess of Burundi  ==================
                 Atlantic cod  ==================
                       Lizard  ==================
                         Fugu  ==================
                       Medaka  ==================
                    Tetraodon  ==================
                  Spotted gar  ==================
                    Zebrafish  ==================
                  Stickleback  ==================
              Star-nosed mole  ==================
                     Squirrel  ==================
             Black flying-fox  ==================
                          Cat  ==================
                      Manatee  ==================
                     Elephant  ==================
               Bactrian camel  NNNNNNNNNNNNNNNNNN
                 Mallard duck  ==================
       White-throated sparrow  ==================
          Medium ground finch  ==================
                      Chicken  ==================
                Scarlet macaw  ==================
             Peregrine falcon  ==================
                  Rock pigeon  ==================
                   Budgerigar  ==================
          Collared flycatcher  ==================
             Cape golden mole  ==================
     Chinese softshell turtle  ==================
                     Aardvark  ==================
                      Wallaby  ==================
              Tasmanian devil  ==================
                   Coelacanth  ==================
              Green seaturtle  ==================
             Brush-tailed rat  ==================
                   Chinchilla  ==================
                          Pig  ==================
                X. tropicalis  NNNNNNNNNNNNNNNNNN
     Mexican tetra (cavefish)  ==================
                 Weddell seal  ==================
                      Dolphin  ==================
                   Guinea pig  ==================

Inserts between block 21 and 22 in window
  D             Saker falcon 2bp
B D              Zebra finch 2bp
          Tibetan ground jay 2bp
  D           Painted turtle 14bp

Alignment block 22 of 1099 in window, 883961 - 883969, 9 bps 
B D                     Human  gcccaggg-a
B D                     Chimp  gcccaggg-a
B D                   Gorilla  gcccaggg-a
B D                 Orangutan  gccccggg-a
B D                    Gibbon  gccccggg-a
B D                    Rhesus  gccctggg-a
B D       Crab-eating macaque  gccctggg-a
B D                    Baboon  gccctggg-a
B D              Green monkey  gccccggg-a
B D                  Marmoset  acccttgg-a
B D           Squirrel monkey  accctggg-a
B D                  Bushbaby  g-cctgga-c
           Chinese tree shrew  gtcctgag-a
B D            Naked mole-rat  gt-----g-a
B D                    Alpaca  gtccattg--
B D                     Horse  gcccgcag-c
B D          White rhinoceros  gccctgagac
B D                       Dog  gccccagg-a
B D                   Ferret   accccagg-a
B D                     Panda  -------t-a
B D                 Armadillo  gtctgggc-t
B D                   Opossum  gccctgga-g
B D                  Platypus  accctgcc-c
  D              Saker falcon  ggccacag-c
B D               Zebra finch  ttttatgg-c
           Tibetan ground jay  tcccaaag-c
B D        American alligator  -tccccat-c
  D            Painted turtle  tcccaggg-c
B D                   Lamprey  -ccgcggg-g
B D                      Pika  ==========
B D                  Hedgehog  ==========
         Cape elephant shrew  ==========
              Golden hamster  ==========
                Prairie vole  ==========
B D                       Rat  ==========
B D                     Mouse  ==========
B D           Chinese hamster  ==========
      Lesser Egyptian jerboa  ==========
               Domestic goat  ==========
B D                       Cow  ==========
B D                     Sheep  ==========
            Tibetan antelope  ==========
        David's myotis (bat)  ==========
               Big brown bat  ==========
                Killer whale  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
         Pundamilia nyererei  ==========
B D              Nile tilapia  ==========
          Southern platyfish  ==========
         Princess of Burundi  ==========
B D              Atlantic cod  ==========
B D                    Lizard  ==========
B D                      Fugu  ==========
B D                    Medaka  ==========
B D                 Tetraodon  ==========
                 Spotted gar  ==========
B D                 Zebrafish  ==========
B D               Stickleback  ==========
             Star-nosed mole  ==========
B D                  Squirrel  ==========
            Black flying-fox  ==========
B D                       Cat  ==========
B D                   Manatee  ==========
B D                  Elephant  ==========
              Bactrian camel  NNNNNNNNNN
  D              Mallard duck  ==========
  D    White-throated sparrow  ==========
B D       Medium ground finch  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
  D             Scarlet macaw  ==========
  D          Peregrine falcon  ==========
  D               Rock pigeon  ==========
B D                Budgerigar  ==========
  D       Collared flycatcher  ==========
            Cape golden mole  ==========
  D  Chinese softshell turtle  ==========
                    Aardvark  ==========
B D                   Wallaby  ==========
B D           Tasmanian devil  ==========
B D                Coelacanth  ==========
  D           Green seaturtle  ==========
              Pacific walrus  ----------
            Brush-tailed rat  ==========
                  Chinchilla  ==========
B D                       Pig  ==========
B D             X. tropicalis  NNNNNNNNNN
    Mexican tetra (cavefish)  ==========
                Weddell seal  ==========
B D                   Dolphin  ==========
B D                Guinea pig  ==========

Inserts between block 22 and 23 in window
  D             Saker falcon 7bp
B D              Zebra finch 302bp
B D       American alligator 5bp
  D           Painted turtle 13bp

Alignment block 23 of 1099 in window, 883970 - 883976, 7 bps 
B D                     Human  ----agaaggg
B D                     Chimp  ----agaaggg
B D                   Gorilla  ----agaaagg
B D                 Orangutan  ----agaaggg
B D                    Gibbon  ----agaaggg
B D                    Rhesus  ----agaaggg
B D       Crab-eating macaque  ----agaaggg
B D                    Baboon  ----agaaggg
B D              Green monkey  ----agaagag
B D                  Marmoset  ----tgaaggg
B D           Squirrel monkey  ----agaaggg
B D                  Bushbaby  ----ggaggct
           Chinese tree shrew  ----gggaag-
B D            Naked mole-rat  ----tgaagag
B D                    Alpaca  ----aggcagg
B D                     Horse  ----tggccgc
B D          White rhinoceros  ----gggccac
B D                       Dog  ----agggagt
B D                   Ferret   ----agggagg
B D                     Panda  ----aggaagg
               Pacific walrus  ---------gg
B D                 Armadillo  ----tggaggg
B D                   Opossum  ----ggggagc
B D                  Platypus  ----ataagcc
B D               Zebra finch  ------agcgg
           Tibetan ground jay  ------agagc
B D        American alligator  ------agggg
B D                   Lamprey  gtttggg----
B D                      Pika  ===========
B D                  Hedgehog  ===========
         Cape elephant shrew  ===========
              Golden hamster  ===========
                Prairie vole  ===========
B D                       Rat  ===========
B D                     Mouse  ===========
B D           Chinese hamster  ===========
      Lesser Egyptian jerboa  ===========
               Domestic goat  ===========
B D                       Cow  ===========
B D                     Sheep  ===========
            Tibetan antelope  ===========
        David's myotis (bat)  ===========
               Big brown bat  ===========
                Killer whale  ===========
                 Zebra mbuna  ===========
       Burton's mouthbreeder  ===========
         Pundamilia nyererei  ===========
B D              Nile tilapia  ===========
          Southern platyfish  ===========
         Princess of Burundi  ===========
B D              Atlantic cod  ===========
B D                    Lizard  ===========
B D                      Fugu  ===========
B D                    Medaka  ===========
B D                 Tetraodon  ===========
                 Spotted gar  ===========
B D                 Zebrafish  ===========
B D               Stickleback  ===========
             Star-nosed mole  ===========
B D                  Squirrel  ===========
            Black flying-fox  ===========
B D                       Cat  ===========
B D                   Manatee  ===========
B D                  Elephant  ===========
              Bactrian camel  NNNNNNNNNNN
  D              Mallard duck  ===========
  D    White-throated sparrow  ===========
B D       Medium ground finch  ===========
B D                    Turkey  ===========
B D                   Chicken  ===========
  D             Scarlet macaw  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
  D               Rock pigeon  ===========
B D                Budgerigar  ===========
  D       Collared flycatcher  ===========
            Cape golden mole  ===========
  D  Chinese softshell turtle  ===========
  D            Painted turtle  ===========
                    Aardvark  ===========
B D                   Wallaby  ===========
B D           Tasmanian devil  ===========
B D                Coelacanth  ===========
  D           Green seaturtle  ===========
            Brush-tailed rat  ===========
                  Chinchilla  ===========
B D                       Pig  ===========
B D             X. tropicalis  NNNNNNNNNNN
    Mexican tetra (cavefish)  ===========
                Weddell seal  ===========
B D                   Dolphin  ===========
B D                Guinea pig  ===========

Inserts between block 23 and 24 in window
B D                Armadillo 2222bp
B D                  Opossum 4bp
B D              Zebra finch 2bp
          Tibetan ground jay 2bp
B D       American alligator 8bp

Alignment block 24 of 1099 in window, 883977 - 883980, 4 bps 
B D                     Human  a------gcc
B D                     Chimp  a------gct
B D                   Gorilla  a------gcc
B D                 Orangutan  a------gcc
B D                    Gibbon  a------gcc
B D                    Rhesus  a------gcc
B D       Crab-eating macaque  a------gcc
B D                    Baboon  a------gcc
B D              Green monkey  a------gca
B D                  Marmoset  a------gcc
B D           Squirrel monkey  a------gcc
B D                  Bushbaby  g------gct
           Chinese tree shrew  -------gct
B D            Naked mole-rat  t------gct
B D                    Alpaca  agct---gcg
B D                     Horse  accc---gcc
B D          White rhinoceros  gatc---act
B D                       Dog  tacg---tcg
B D                   Ferret   cacc---gtg
B D                     Panda  cccc---gca
               Pacific walrus  cccccaggca
B D                  Platypus  -------acc
B D               Zebra finch  a---------
           Tibetan ground jay  a---------
B D        American alligator  a---------
  D            Painted turtle  g---------
B D                   Lamprey  ------agct
B D                      Pika  ==========
B D                  Hedgehog  ==========
B D                 Armadillo  ==========
         Cape elephant shrew  ==========
              Golden hamster  ==========
                Prairie vole  ==========
B D                       Rat  ==========
B D                     Mouse  ==========
B D           Chinese hamster  ==========
      Lesser Egyptian jerboa  ==========
               Domestic goat  ==========
B D                       Cow  ==========
B D                     Sheep  ==========
            Tibetan antelope  ==========
        David's myotis (bat)  ==========
               Big brown bat  ==========
                Killer whale  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
         Pundamilia nyererei  ==========
B D              Nile tilapia  ==========
          Southern platyfish  ==========
         Princess of Burundi  ==========
B D              Atlantic cod  ==========
B D                    Lizard  ==========
B D                      Fugu  ==========
B D                    Medaka  ==========
B D                 Tetraodon  ==========
                 Spotted gar  ==========
B D                 Zebrafish  ==========
B D               Stickleback  ==========
             Star-nosed mole  ==========
B D                  Squirrel  ==========
            Black flying-fox  ==========
B D                       Cat  ==========
B D                   Manatee  ==========
B D                  Elephant  ==========
              Bactrian camel  NNNNNNNNNN
  D              Mallard duck  ==========
  D    White-throated sparrow  ==========
B D       Medium ground finch  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
  D             Scarlet macaw  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
  D               Rock pigeon  ==========
B D                Budgerigar  ==========
  D       Collared flycatcher  ==========
            Cape golden mole  ==========
  D  Chinese softshell turtle  ==========
                    Aardvark  ==========
B D                   Wallaby  ==========
B D                   Opossum  ==========
B D           Tasmanian devil  ==========
B D                Coelacanth  ==========
  D           Green seaturtle  ==========
            Brush-tailed rat  ==========
                  Chinchilla  ==========
B D                       Pig  ==========
B D             X. tropicalis  NNNNNNNNNN
    Mexican tetra (cavefish)  ==========
                Weddell seal  ==========
B D                   Dolphin  ==========
B D                Guinea pig  ==========

Inserts between block 24 and 25 in window
B D                  Lamprey 7bp

Alignment block 25 of 1099 in window, 883981 - 884023, 43 bps 
B D                     Human  ggctgcaa------------------------ggcgcag-----t------------ccaaaccaggccg
B D                     Chimp  ggccgcaa------------------------ggcgcag-----t------------ccaaaccaggccg
B D                   Gorilla  ggccgcaa------------------------ggtgcag-----t------------ccaaaccaggcca
B D                 Orangutan  agccgcaa------------------------ggcgcag-----t------------ccaagccaggcca
B D                    Gibbon  ggccacaa------------------------ggcgcag-----c------------ccaagccaggccg
B D                    Rhesus  ggccgcaa------------------------ggcgcag-----t------------ccaagccgggccg
B D       Crab-eating macaque  ggccgcaa------------------------ggcgcag-----t------------ccaagccgggccg
B D                    Baboon  ggccgcaa------------------------ggcgcag-----t------------ccaacccgggccg
B D              Green monkey  ggccgcaa------------------------ggcgcag-----t------------ccaagctgggctg
B D                  Marmoset  ggccacaa------------------------ggtgcag-----t------------ccaggctgggccg
B D           Squirrel monkey  cgccacaa------------------------ggcgccg-----t------------ccaggccgggccg
B D                  Bushbaby  ggctactg------------------------gggcctggtggtt------------cccaggatggctg
           Chinese tree shrew  ggctgcaatactgcaggtgactgctgagcctgggagagg-----t------------ccatgc-aggctg
B D            Naked mole-rat  ggctgcaa------------------------gacagtg---------------------ggccaggctg
B D                    Alpaca  ggggcgtg--------------------------tgctg-----c------------agatgttgccccc
B D                     Horse  -cgtcccg------------------------agagcgg---------------------cgctgtccca
B D          White rhinoceros  gcctcctg------------------------aaagcag-----g------------ctccgtcatccca
B D                       Dog  ggtgcttg------------------------aaagcag-----g------------ccctgttatccca
B D                   Ferret   ggtgcttg------------------------aacaccg-----t------------gggtgttacccca
B D                     Panda  ggcgcctg------------------------agagcag-----g------------ccctgttacccca
               Pacific walrus  ggtgcttg------------------------aaagcag-----g------------ccctgttacccca
B D                   Opossum  ggcctctc------------------------cggccgg-----c------------ctcaccgggctcc
  D              Saker falcon  --------------------------------------------------------------------ag
B D               Zebra finch  -----cac------------------------ggcggtg-----t------------ccaaagggctggg
           Tibetan ground jay  -----tcc------------------------tgccggg---------------------atgagcagag
B D        American alligator  -----cag------------------------cacctag-----t------------tcaaggtgtgggg
  D            Painted turtle  -----tgc------------------------cacctgg-----t------------caggagagacctg
B D                   Lamprey  atctgctt------------------------gacccac-----cacccccgtgtcaccaaggcggcggg
B D                      Pika  ======================================================================
B D                  Hedgehog  ======================================================================
B D                 Armadillo  ======================================================================
         Cape elephant shrew  ======================================================================
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
B D           Chinese hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
               Domestic goat  ======================================================================
B D                       Cow  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
                Killer whale  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Pundamilia nyererei  ======================================================================
B D              Nile tilapia  ======================================================================
          Southern platyfish  ======================================================================
         Princess of Burundi  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Lizard  ======================================================================
B D                      Fugu  ======================================================================
B D                    Medaka  ======================================================================
B D                 Tetraodon  ======================================================================
                 Spotted gar  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
             Star-nosed mole  ======================================================================
B D                  Squirrel  ======================================================================
            Black flying-fox  ======================================================================
B D                       Cat  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ======================================================================
  D    White-throated sparrow  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D             Scarlet macaw  ======================================================================
  D          Peregrine falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
B D                  Platypus  ======================================================================
  D       Collared flycatcher  ======================================================================
            Cape golden mole  ======================================================================
  D  Chinese softshell turtle  ======================================================================
                    Aardvark  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                Coelacanth  ======================================================================
  D           Green seaturtle  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                       Pig  ======================================================================
B D             X. tropicalis  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ======================================================================
                Weddell seal  ======================================================================
B D                   Dolphin  ======================================================================
B D                Guinea pig  ======================================================================

                        Human  ggg---------gc-------------cgtgac------cat
                        Chimp  ggg---------gc-------------cgtgac------cat
                      Gorilla  ggg---------gc-------------cgtgac------cat
                    Orangutan  ggg---------gc-------------cgtgac------cat
                       Gibbon  ggg---------gc-------------cgtgac------cat
                       Rhesus  gag---------gc-------------cgagac------cat
          Crab-eating macaque  gag---------gc-------------cgagac------cat
                       Baboon  gag---------gc-------------cgagac------cat
                 Green monkey  ggg---------gc-------------cgagac------cat
                     Marmoset  gag---------gc-------------cgtgac------cat
              Squirrel monkey  gag---------gc-------------cgtgac------cat
                     Bushbaby  agg-gatatgttgc-------------cataat------tgt
           Chinese tree shrew  aagtggcttattgc-------------aatggt------cac
               Naked mole-rat  agg--acatgctgc-------------tgtgat------tcc
                       Alpaca  acg---------aa-------------ctaggt--------c
                        Horse  ggg---------g----------------------------c
             White rhinoceros  aga---------a-----------------------------
                          Dog  ggg---------at-------------ttg-----------c
                      Ferret   ggg---------at-------------ttg-----------c
                        Panda  ggg---------at-------------ttg------------
               Pacific walrus  gtg---------at-------------ttg-----------c
                      Opossum  tgg---------ac-------------cactacgccaagtgt
                 Saker falcon  ggg---------gctc----tggccac---------------
                  Zebra finch  ggt---------gctc----cagcagt---------------
           Tibetan ground jay  cgg---------gc----------------------------
           American alligator  gtg---------gggcatcatgatcat---------------
               Painted turtle  gag---------cc----------------------------
                      Lamprey  gag---------cc-------------actga----------
                         Pika  ==========================================
                     Hedgehog  ==========================================
                    Armadillo  ==========================================
          Cape elephant shrew  ==========================================
               Golden hamster  ==========================================
                 Prairie vole  ==========================================
                          Rat  ==========================================
                        Mouse  ==========================================
              Chinese hamster  ==========================================
       Lesser Egyptian jerboa  ==========================================
                Domestic goat  ==========================================
                          Cow  ==========================================
                        Sheep  ==========================================
             Tibetan antelope  ==========================================
         David's myotis (bat)  ==========================================
                Big brown bat  ==========================================
                 Killer whale  ==========================================
                  Zebra mbuna  ==========================================
        Burton's mouthbreeder  ==========================================
          Pundamilia nyererei  ==========================================
                 Nile tilapia  ==========================================
           Southern platyfish  ==========================================
          Princess of Burundi  ==========================================
                 Atlantic cod  ==========================================
                       Lizard  ==========================================
                         Fugu  ==========================================
                       Medaka  ==========================================
                    Tetraodon  ==========================================
                  Spotted gar  ==========================================
                    Zebrafish  ==========================================
                  Stickleback  ==========================================
              Star-nosed mole  ==========================================
                     Squirrel  ==========================================
             Black flying-fox  ==========================================
                          Cat  ==========================================
                      Manatee  ==========================================
                     Elephant  ==========================================
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                 Mallard duck  ==========================================
       White-throated sparrow  ==========================================
          Medium ground finch  ==========================================
                       Turkey  ==========================================
                      Chicken  ==========================================
                Scarlet macaw  ==========================================
             Peregrine falcon  ==========================================
                  Rock pigeon  ==========================================
                   Budgerigar  ==========================================
                     Platypus  ==========================================
          Collared flycatcher  ==========================================
             Cape golden mole  ==========================================
     Chinese softshell turtle  ==========================================
                     Aardvark  ==========================================
                      Wallaby  ==========================================
              Tasmanian devil  ==========================================
                   Coelacanth  ==========================================
              Green seaturtle  ==========================================
             Brush-tailed rat  ==========================================
                   Chinchilla  ==========================================
                          Pig  ==========================================
                X. tropicalis  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Mexican tetra (cavefish)  ==========================================
                 Weddell seal  ==========================================
                      Dolphin  ==========================================
                   Guinea pig  ==========================================

Inserts between block 25 and 26 in window
B D                    Panda 1bp
  D             Saker falcon 29bp
B D              Zebra finch 12bp
          Tibetan ground jay 9bp

Alignment block 26 of 1099 in window, 884024 - 884069, 46 bps 
B D                     Human  -cggcagtgcccccc--a----gagcaggctc----------------c--tcgtgcaggaatatgggtc
B D                     Chimp  -cggcagtgcccccc--a----gagcaggctc----------------c--tcgtgcaggaatatgggtc
B D                   Gorilla  -tggcagtgcccccc--a----gagcaggttt----------------c--tcatgcaggaatatgggtc
B D                 Orangutan  -tggcagtgcccccc--a----gaacaggctc----------------c--tcgtgcaggaatatgggtc
B D                    Gibbon  -cagcagtgcccccc--a----gagcaggctc----------------c--tcgtgcgggaatatgggtc
B D                    Rhesus  -cggcagtgcccccc--a----cagcaggctt----------------c--tcgtgcaggaatatgggtc
B D       Crab-eating macaque  -cggcagtgcccccc--a----cagcaggctt----------------c--tcgtgcaggaatatgggtc
B D                    Baboon  -cggcagtgcccccc--a----cagcaggctt----------------c--tcgtgcaggaatatgggtc
B D              Green monkey  -tggcagtgcccccc--a----cagcagggtt----------------c--tcgtgcaggaatatgggtc
B D                  Marmoset  -cggcaatgccccca--g----agccagggtc----------------c--ttgtgcaggaatgtgggtt
B D           Squirrel monkey  -caac-gtgccccca--g----agccagggtc----------------c--ttgtgcaggaatgtgggtc
B D                  Bushbaby  -cacctatacccctt-ga----aatcaggctc----------------ccttatcccaggaatttgggat
           Chinese tree shrew  -t-gcagtgccacttgga----aaataggttc----------------ctgtatccctagaatttggttt
B D            Naked mole-rat  -tggcaccaacctgg--g----aggctggttc----------------c-------cagcagattggttc
B D                    Alpaca  -tgt------------------------------------------------------------------
B D                     Horse  -cttcg----------------------------------------------------------------
B D          White rhinoceros  -tttta----------------------------------------------------------------
B D                       Dog  -tgtca----------------------------------------------------------------
B D                   Ferret   -tgtta----------------------------------------------------------------
               Pacific walrus  -tgtca----------------------------------------------------------------
B D                   Opossum  -gagaggagctcc---------------------------------------------------------
  D              Saker falcon  -ccccagtctccccc--a----ccacag-cac----------------c--cagca--------------
B D               Zebra finch  -tcccagccctgccc--tggaactgtggcagctcctcttgtgctttttc--tgggtttgggggaaatttt
           Tibetan ground jay  --cccaagcccgtcc--t----ctgcagacac----------------c--caggagggggacagagatc
  D            Painted turtle  ----cagctccctcc--t----ccccag---c----------------c--tggcacagcaggggatgat
B D                   Lamprey  gcgccactccccccc--a----cgtcccccgt-------------------tcacagcgaattgtaaacc
B D                      Pika  ======================================================================
B D                  Hedgehog  ======================================================================
B D                 Armadillo  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Panda  ======================================================================
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
B D           Chinese hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
               Domestic goat  ======================================================================
B D                       Cow  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
                Killer whale  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Pundamilia nyererei  ======================================================================
B D              Nile tilapia  ======================================================================
          Southern platyfish  ======================================================================
         Princess of Burundi  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Lizard  ======================================================================
B D                      Fugu  ======================================================================
B D                    Medaka  ======================================================================
B D                 Tetraodon  ======================================================================
                 Spotted gar  ======================================================================
B D                 Zebrafish  ======================================================================
B D               Stickleback  ======================================================================
             Star-nosed mole  ======================================================================
B D                  Squirrel  ======================================================================
            Black flying-fox  ======================================================================
B D                       Cat  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ======================================================================
  D    White-throated sparrow  ======================================================================
B D       Medium ground finch  ======================================================================
B D        American alligator  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D             Scarlet macaw  ======================================================================
  D          Peregrine falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
B D                  Platypus  ======================================================================
  D       Collared flycatcher  ======================================================================
            Cape golden mole  ======================================================================
  D  Chinese softshell turtle  ======================================================================
                    Aardvark  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                Coelacanth  ======================================================================
  D           Green seaturtle  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                       Pig  ======================================================================
B D             X. tropicalis  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ======================================================================
                Weddell seal  ======================================================================
B D                   Dolphin  ======================================================================
B D                Guinea pig  ======================================================================

                        Human  a
                        Chimp  a
                      Gorilla  a
                    Orangutan  a
                       Gibbon  a
                       Rhesus  a
          Crab-eating macaque  a
                       Baboon  a
                 Green monkey  a
                     Marmoset  a
              Squirrel monkey  a
                     Bushbaby  a
           Chinese tree shrew  a
               Naked mole-rat  a
                       Alpaca  -
                        Horse  -
             White rhinoceros  -
                          Dog  -
                      Ferret   -
               Pacific walrus  -
                      Opossum  -
                 Saker falcon  -
                  Zebra finch  g
           Tibetan ground jay  c
               Painted turtle  c
                      Lamprey  g
                         Pika  =
                     Hedgehog  =
                    Armadillo  =
          Cape elephant shrew  =
                        Panda  =
               Golden hamster  =
                 Prairie vole  =
                          Rat  =
                        Mouse  =
              Chinese hamster  =
       Lesser Egyptian jerboa  =
                Domestic goat  =
                          Cow  =
                        Sheep  =
             Tibetan antelope  =
         David's myotis (bat)  =
                Big brown bat  =
                 Killer whale  =
                  Zebra mbuna  =
        Burton's mouthbreeder  =
          Pundamilia nyererei  =
                 Nile tilapia  =
           Southern platyfish  =
          Princess of Burundi  =
                 Atlantic cod  =
                       Lizard  =
                         Fugu  =
                       Medaka  =
                    Tetraodon  =
                  Spotted gar  =
                    Zebrafish  =
                  Stickleback  =
              Star-nosed mole  =
                     Squirrel  =
             Black flying-fox  =
                          Cat  =
                      Manatee  =
                     Elephant  =
               Bactrian camel  N
                 Mallard duck  =
       White-throated sparrow  =
          Medium ground finch  =
           American alligator  =
                       Turkey  =
                      Chicken  =
                Scarlet macaw  =
             Peregrine falcon  =
                  Rock pigeon  =
                   Budgerigar  =
                     Platypus  =
          Collared flycatcher  =
             Cape golden mole  =
     Chinese softshell turtle  =
                     Aardvark  =
                      Wallaby  =
              Tasmanian devil  =
                   Coelacanth  =
              Green seaturtle  =
             Brush-tailed rat  =
                   Chinchilla  =
                          Pig  =
                X. tropicalis  N
     Mexican tetra (cavefish)  =
                 Weddell seal  =
                      Dolphin  =
                   Guinea pig  =

Inserts between block 26 and 27 in window
B D                 Bushbaby 1bp
B D           Naked mole-rat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
              Pacific walrus 1bp
B D                  Opossum 7bp
  D             Saker falcon 1bp
B D              Zebra finch 3bp
          Tibetan ground jay 3bp
  D           Painted turtle 3bp

Alignment block 27 of 1099 in window, 884070 - 884081, 12 bps 
B D                     Human  c-tgccttccagg
B D                     Chimp  c-tgccttccagg
B D                   Gorilla  c-tgccttccagg
B D                 Orangutan  c-tgccttccagg
B D                    Gibbon  c-tgccttccagg
B D                    Rhesus  c-tgccttccaag
B D       Crab-eating macaque  c-tgccttccaag
B D                    Baboon  c-tgccttccaag
B D              Green monkey  c-tgccttccaag
B D                  Marmoset  c-tgccttccagg
B D           Squirrel monkey  c-tgccttccagg
B D                  Bushbaby  c-tgcctttcaag
           Chinese tree shrew  tatgcccttcaaa
B D            Naked mole-rat  c-cgtctctcaag
B D                    Alpaca  c-tgccttctggg
B D                     Horse  c-tgcctcttgga
B D          White rhinoceros  c-tgcttttcagg
B D                       Dog  c-tgcttcttagc
B D                   Ferret   c-tgctccttggc
B D                     Panda  c-tgcttcttagc
               Pacific walrus  c-tgcttgttagc
             Black flying-fox  c-tgccttgcagg
B D                   Megabat  c-tgccttgcagg
B D                   Opossum  t-cgccgtgcg--
  D              Saker falcon  g-cccacccg---
B D               Zebra finch  c-tgcagcca---
           Tibetan ground jay  g-tcccctcc---
  D            Painted turtle  g-cccac------
B D                   Lamprey  -gtgatttactga
B D                      Pika  =============
B D                  Hedgehog  =============
B D                 Armadillo  =============
         Cape elephant shrew  =============
              Golden hamster  =============
                Prairie vole  =============
B D                       Rat  =============
B D                     Mouse  =============
B D           Chinese hamster  =============
      Lesser Egyptian jerboa  =============
               Domestic goat  =============
B D                       Cow  =============
B D                     Sheep  =============
            Tibetan antelope  =============
        David's myotis (bat)  =============
               Big brown bat  =============
                Killer whale  =============
                 Zebra mbuna  =============
       Burton's mouthbreeder  =============
         Pundamilia nyererei  =============
B D              Nile tilapia  =============
          Southern platyfish  =============
         Princess of Burundi  =============
B D              Atlantic cod  =============
B D                    Lizard  =============
B D                      Fugu  =============
B D                    Medaka  =============
B D                 Tetraodon  =============
                 Spotted gar  =============
B D                 Zebrafish  =============
B D               Stickleback  =============
             Star-nosed mole  =============
B D                  Squirrel  =============
B D                       Cat  =============
B D                   Manatee  =============
B D                  Elephant  =============
              Bactrian camel  NNNNNNNNNNNNN
  D              Mallard duck  =============
  D    White-throated sparrow  =============
B D       Medium ground finch  =============
B D        American alligator  =============
B D                    Turkey  =============
B D                   Chicken  =============
  D             Scarlet macaw  =============
  D          Peregrine falcon  =============
  D               Rock pigeon  =============
B D                Budgerigar  =============
B D                  Platypus  =============
  D       Collared flycatcher  =============
            Cape golden mole  =============
  D  Chinese softshell turtle  =============
                    Aardvark  =============
B D                   Wallaby  =============
B D           Tasmanian devil  =============
B D                Coelacanth  =============
  D           Green seaturtle  =============
            Brush-tailed rat  =============
                  Chinchilla  =============
B D                       Pig  =============
B D             X. tropicalis  NNNNNNNNNNNNN
    Mexican tetra (cavefish)  =============
                Weddell seal  =============
B D                   Dolphin  =============
B D                Guinea pig  =============

Inserts between block 27 and 28 in window
B D                    Horse 6bp
  D             Saker falcon 3bp
B D              Zebra finch 3bp
          Tibetan ground jay 3bp

Alignment block 28 of 1099 in window, 884082 - 884088, 7 bps 
B D                     Human  ga---g------------tcct
B D                     Chimp  ga---g------------tcct
B D                   Gorilla  ga---g------------tcct
B D                 Orangutan  ga---g------------tcct
B D                    Gibbon  ga---g------------tcct
B D                    Rhesus  ga---g------------tcct
B D       Crab-eating macaque  ga---g------------tcct
B D                    Baboon  ga---g------------tcct
B D              Green monkey  ga---g------------tcct
B D                  Marmoset  ga---g------------ttc-
B D           Squirrel monkey  gatttg------------ttc-
B D                  Bushbaby  -----t------------tctt
           Chinese tree shrew  ga---t------------tttt
B D            Naked mole-rat  aa---g------------caat
B D                    Alpaca  ga---t----tccc--------
B D          White rhinoceros  ga---c----------------
B D                       Dog  aa---t----------------
B D                   Ferret   ag---c----------------
B D                     Panda  at---gttct------------
               Pacific walrus  aa---c----------------
             Black flying-fox  ga---c----------------
B D                   Megabat  ga---c----------------
B D                  Platypus  ga---g------------gcct
  D              Saker falcon  ------------------gccc
B D               Zebra finch  ------------------cccc
           Tibetan ground jay  ------------------ccac
B D        American alligator  -----------agg----gttc
  D            Painted turtle  -----------atc----ccct
B D                   Lamprey  ----------gagcaaaatcct
B D                      Pika  ======================
B D                  Hedgehog  ======================
B D                 Armadillo  ======================
         Cape elephant shrew  ======================
              Golden hamster  ======================
                Prairie vole  ======================
B D                       Rat  ======================
B D                     Mouse  ======================
B D           Chinese hamster  ======================
      Lesser Egyptian jerboa  ======================
               Domestic goat  ======================
B D                       Cow  ======================
B D                     Sheep  ======================
            Tibetan antelope  ======================
        David's myotis (bat)  ======================
               Big brown bat  ======================
                Killer whale  ======================
                 Zebra mbuna  ======================
       Burton's mouthbreeder  ======================
         Pundamilia nyererei  ======================
B D              Nile tilapia  ======================
          Southern platyfish  ======================
         Princess of Burundi  ======================
B D              Atlantic cod  ======================
B D                    Lizard  ======================
B D                      Fugu  ======================
B D                    Medaka  ======================
B D                 Tetraodon  ======================
                 Spotted gar  ======================
B D                 Zebrafish  ======================
B D               Stickleback  ======================
             Star-nosed mole  ======================
B D                     Horse  ======================
B D                  Squirrel  ======================
B D                       Cat  ======================
B D                   Manatee  ======================
B D                  Elephant  ======================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNN
  D              Mallard duck  ======================
  D    White-throated sparrow  ======================
B D       Medium ground finch  ======================
B D                    Turkey  ======================
B D                   Chicken  ======================
  D             Scarlet macaw  ======================
  D          Peregrine falcon  ======================
  D               Rock pigeon  ======================
B D                Budgerigar  ======================
  D       Collared flycatcher  ======================
            Cape golden mole  ======================
  D  Chinese softshell turtle  ======================
                    Aardvark  ======================
B D                   Wallaby  ======================
B D                   Opossum  ----------------------
B D           Tasmanian devil  ======================
B D                Coelacanth  ======================
  D           Green seaturtle  ======================
            Brush-tailed rat  ======================
                  Chinchilla  ======================
B D                       Pig  ======================
B D             X. tropicalis  NNNNNNNNNNNNNNNNNNNNNN
    Mexican tetra (cavefish)  ======================
                Weddell seal  ======================
B D                   Dolphin  ======================
B D                Guinea pig  ======================

Inserts between block 28 and 29 in window
B D                   Alpaca 1bp
B D         White rhinoceros 7bp
            Black flying-fox 4bp
B D                  Megabat 4bp
B D                  Lamprey 4bp

Alignment block 29 of 1099 in window, 884089 - 884093, 5 bps 
B D                     Human  --tttt-t
B D                     Chimp  --tttt-t
B D                   Gorilla  --tttt-t
B D                 Orangutan  --tctt-t
B D                    Gibbon  --tttt-t
B D                    Rhesus  --ttttct
B D       Crab-eating macaque  --ttttct
B D                    Baboon  --ttttct
B D              Green monkey  --ttttct
B D                  Marmoset  -------t
B D           Squirrel monkey  -------t
B D                  Bushbaby  --tcttct
           Chinese tree shrew  --tttgtt
B D            Naked mole-rat  --ttttct
B D                    Alpaca  ---tatcc
B D                     Horse  ---tggct
B D          White rhinoceros  ---ttctt
B D                       Dog  ---tgctt
B D                   Ferret   ---ttcct
B D                     Panda  -------t
               Pacific walrus  ---ttctt
                 Weddell seal  ---ttctt
             Black flying-fox  ---ttcct
B D                   Megabat  ---ttcct
B D                   Opossum  ---cttcc
B D                  Platypus  ---ttccc
  D              Saker falcon  ---cccct
B D               Zebra finch  ---cccat
           Tibetan ground jay  ---cccat
B D        American alligator  ---acagt
  D            Painted turtle  ---cccct
B D                   Lamprey  gtgtt---
B D                      Pika  ========
B D                  Hedgehog  ========
B D                 Armadillo  ========
         Cape elephant shrew  ========
              Golden hamster  ========
                Prairie vole  ========
B D                       Rat  ========
B D                     Mouse  ========
B D           Chinese hamster  ========
      Lesser Egyptian jerboa  ========
               Domestic goat  ========
B D                       Cow  ========
B D                     Sheep  ========
            Tibetan antelope  ========
        David's myotis (bat)  ========
               Big brown bat  ========
                Killer whale  ========
                 Zebra mbuna  ========
       Burton's mouthbreeder  ========
         Pundamilia nyererei  ========
B D              Nile tilapia  ========
          Southern platyfish  ========
         Princess of Burundi  ========
B D              Atlantic cod  ========
B D                    Lizard  ========
B D                      Fugu  ========
B D                    Medaka  ========
B D                 Tetraodon  ========
                 Spotted gar  ========
B D                 Zebrafish  ========
B D               Stickleback  ========
             Star-nosed mole  ========
B D                  Squirrel  ========
B D                       Cat  ========
B D                   Manatee  ========
B D                  Elephant  ========
              Bactrian camel  NNNNNNNN
  D              Mallard duck  ========
  D    White-throated sparrow  ========
B D       Medium ground finch  ========
B D                    Turkey  ========
B D                   Chicken  ========
  D             Scarlet macaw  ========
  D          Peregrine falcon  ========
  D               Rock pigeon  ========
B D                Budgerigar  ========
  D       Collared flycatcher  ========
            Cape golden mole  ========
  D  Chinese softshell turtle  ========
                    Aardvark  ========
B D                   Wallaby  ========
B D           Tasmanian devil  ========
B D                Coelacanth  ========
  D           Green seaturtle  ========
            Brush-tailed rat  ========
                  Chinchilla  ========
B D                       Pig  ========
B D             X. tropicalis  NNNNNNNN
    Mexican tetra (cavefish)  ========
B D                   Dolphin  ========
B D                Guinea pig  ========

Inserts between block 29 and 30 in window
  D             Saker falcon 30bp
B D              Zebra finch 42bp
          Tibetan ground jay 7674bp

Alignment block 30 of 1099 in window, 884094 - 884111, 18 bps 
B D                     Human  tct------------------tctg-gt-t----------tctaa------------gtc
B D                     Chimp  tct------------------tctg-gt-t----------tctaa------------gtc
B D                   Gorilla  tct------------------tctg-gt-t----------tctaa------------gtg
B D                 Orangutan  tct------------------tctg-gt-a----------tctaa------------gtg
B D                    Gibbon  tct------------------tctg-gt-t----------tctaa------------gtg
B D                    Rhesus  tct------------------tctg-gt-t----------tttaa------------gct
B D       Crab-eating macaque  tct------------------tctg-gt-t----------tttaa------------gct
B D                    Baboon  tct------------------tctg-gt-t----------tttaa------------gct
B D              Green monkey  tct------------------tctg-gt-t----------tttaa------------gct
B D                  Marmoset  tca------------------tctg-gc-t----------tctaa------------cag
B D           Squirrel monkey  tca------------------tctg-gt-t----------tctaa------------cag
B D                  Bushbaby  tca------------------tttg-gt-tc---------tctaa------------agg
           Chinese tree shrew  tttgtttttgttttttctgtgtctg-gt-tt---------tctaa------------gag
B D            Naked mole-rat  ttg------------------tcagaaa-t----------tctga------------gat
B D                    Alpaca  tcc------------------tctg-ac-t----------tgtca------------gcc
B D                     Horse  tca------------------cctg-gtct----------cctga------------ga-
B D          White rhinoceros  tca------------------tctg-gttt----------tctaa------------gag
B D                       Dog  tca------------------tcag-gtgt----------tctga------------gag
B D                   Ferret   tct------------------tggg-gtgt----------tttga------------gag
B D                     Panda  tca------------------ccag-gtgt----------tcgga------------gac
               Pacific walrus  tta------------------tctg-gtgt----------tctga------------gag
                 Weddell seal  tta------------------tctg-gtgt----------tctga------------gag
             Black flying-fox  cca------------------tccg-gtgt----------tctga------------gaa
B D                   Megabat  cca------------------tccg-gtgt----------tctga------------gaa
B D                   Opossum  tct------------------tcgg-gc-t----------cctcaacgaggagacgcgcg
B D                  Platypus  tta------------------ttaa-cc-t----------cccac------------ctc
  D              Saker falcon  ------------------------------tctgc-----gctga------------ggc
B D               Zebra finch  ------------------------------cctgcctcttgctg-------------gcc
B D        American alligator  ------------------------------gctgt-----gccca------------gga
  D            Painted turtle  ------------------------------ccggcaggctgcagg------------ggc
B D                   Lamprey  tct------------------tatg-gg-g----------ttcga------------gcc
B D                      Pika  ============================================================
B D                  Hedgehog  ============================================================
B D                 Armadillo  ============================================================
         Cape elephant shrew  ============================================================
              Golden hamster  ============================================================
                Prairie vole  ============================================================
B D                       Rat  ============================================================
B D                     Mouse  ============================================================
B D           Chinese hamster  ============================================================
      Lesser Egyptian jerboa  ============================================================
               Domestic goat  ============================================================
B D                       Cow  ============================================================
B D                     Sheep  ============================================================
            Tibetan antelope  ============================================================
        David's myotis (bat)  ============================================================
               Big brown bat  ============================================================
                Killer whale  ============================================================
                 Zebra mbuna  ============================================================
       Burton's mouthbreeder  ============================================================
         Pundamilia nyererei  ============================================================
B D              Nile tilapia  ============================================================
          Southern platyfish  ============================================================
         Princess of Burundi  ============================================================
B D              Atlantic cod  ============================================================
B D                    Lizard  ============================================================
B D                      Fugu  ============================================================
B D                    Medaka  ============================================================
B D                 Tetraodon  ============================================================
                 Spotted gar  ============================================================
B D                 Zebrafish  ============================================================
B D               Stickleback  ======================================================