Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 568 in window, 177389647 - 177389668, 22 bps 
B D                     Human  gga---agg---------------ga--------------gaga---aatcacacac
B D                     Chimp  gga---agg---------------ga--------------gaga---aatcacacac
B D                   Gorilla  gga---agg---------------ga--------------gaga---aatcacacac
B D                 Orangutan  gga---agg---------------ga--------------gaga---aatcgcacac
B D                    Gibbon  gga---agg---------------ga--------------gaga---aatcacacac
B D                    Rhesus  gga---agg---------------ga--------------gcaa---aatcacacac
B D       Crab-eating macaque  gga---agg---------------ga--------------gcga---aatcacacac
B D                    Baboon  gga---agg---------------ga--------------gcga---aatcacacac
B D              Green monkey  gga---agg---------------ga--------------gaga---aatcacacac
B D                  Marmoset  gga---agg---------------ga--------------gaga---aatcacacac
B D           Squirrel monkey  gga---agg---------------ga--------------gaga---aatcacacac
B D                  Bushbaby  gga---aga---------------ga--------------gaga---aattatacac
           Chinese tree shrew  -ga---aga---------------gc--------------taga---aatcacacgc
B D                  Squirrel  taaaggcga---------------aa--------------gagagagaatcacacct
       Lesser Egyptian jerboa  gga---aaa---------------ga--------------gaaa---aatcgcacac
                 Prairie vole  gggtagagg---------------aa--------------gaga---aatcacat--
B D           Chinese hamster  gggaggagg---------------aa--------------gaca---aatcacacac
               Golden hamster  gagtagagg---------------aa--------------gacg---aatcgaatac
B D                     Mouse  ggagagagg---------------ag--------------gaga---aatcacgtac
B D                       Rat  ggagagagg---------------aa--------------gaga---aagcacattc
B D            Naked mole-rat  aaatctgga--------------aga--------------gaga---ggtcacacac
B D                Guinea pig  aaagagagaagagagaaagaggaaga--------------gaga---gatcacacac
                   Chinchilla  aaagagaga--agagagagaggaaga--------------gaga---gattccacac
             Brush-tailed rat  aaagagaga----agagagaggaaga--------------gaga---gatcgcacac
B D                    Rabbit  gtaagggga---------------ga--------------gaga---aatcgctcgc
B D                    Alpaca  gaa---aga---------------ga--------------gcaa---agtcacacac
               Bactrian camel  gaa---aga---------------ga--------------gcaa---agtcacacac
B D                   Dolphin  gaa---aga---------------ga--------------ccaa---agtcacacac
                 Killer whale  gaa---aga---------------ga--------------ccaa---agtcacacac
             Tibetan antelope  gaa-----a---------------ga--------------ccag---agtcacacac
B D                       Cow  -------------------------------------------g---agtcacacac
B D                     Sheep  gaa-----a---------------ga--------------ccag---agtcacacac
                Domestic goat  gaa-----a---------------ga--------------ccag---agtcacacac
B D                     Horse  gga---aga---------------ga--------------gaga---aatcacacac
B D          White rhinoceros  gca---agt---------------ga--------------gaga---aattacacac
B D                       Cat  gga---cga---------------ca--------------gaga---aatcacacgg
B D                       Dog  gga---taa---------------ca--------------caga---aatcacaggg
B D                   Ferret   ggg---cga---------------ca--------------caga---catcacaccg
B D                     Panda  gga---gga---------------ca--------------caga---aatcgcaccg
               Pacific walrus  gga---cga---------------ca--------------caga---agtcacacca
                 Weddell seal  gga---cga---------------ca--------------caga---aatcacactg
             Black flying-fox  gga----gg---------------gg--------------gaga---aattgcacac
B D                   Megabat  gga----gg---------------gg--------------gaga---aattgcacac
                Big brown bat  gga----gg---------------ga--------------gagg---aatcacacac
         David's myotis (bat)  gg-----gg---------------ga--------------gagg---aatcacacac
B D                  Microbat  gg-----gg---------------ga--------------gagg---aatcacacac
B D                  Hedgehog  -tg---aga---------------aa--------------tgga---aatcattcac
              Star-nosed mole  gca---aga---------------ga--------------gaga---aatcacacac
B D                  Elephant  gaa---caa---------------aa-------------------------------
          Cape elephant shrew  gag---caa---------------ga-------------------------------
B D                   Manatee  gaa---cga---------------aa-------------------------------
             Cape golden mole  -aa---caa---------------ga-------------------------------
B D                    Tenrec  -------------------------g-------------------------------
                     Aardvark  gaa---taa---------------ga-------------------------------
B D                 Armadillo  gaa---aaa---------------gagagaaatcacacgc-----------------
B D                     Shrew  =========================================================
B D                      Pika  =========================================================
B D                      Fugu  =========================================================
    Mexican tetra (cavefish)  =========================================================
B D                   Lamprey  =========================================================
B D               Stickleback  =========================================================
      Yellowbelly pufferfish  =========================================================
B D                 Tetraodon  =========================================================
B D                Coelacanth  =========================================================
         Pundamilia nyererei  =========================================================
                 Zebra mbuna  =========================================================
       Burton's mouthbreeder  =========================================================
         Princess of Burundi  =========================================================
B D              Nile tilapia  =========================================================
  D             Scarlet macaw  =========================================================
  D                    Parrot  =========================================================
  D    White-throated sparrow  =========================================================
B D                    Medaka  =========================================================
          Southern platyfish  =========================================================
  D          Peregrine falcon  =========================================================
  D              Saker falcon  =========================================================
B D                   Wallaby  =========================================================
  D               Rock pigeon  =========================================================
B D                Budgerigar  =========================================================
B D                   Chicken  =========================================================
B D       Medium ground finch  =========================================================
                 Spotted gar  =========================================================
  D           Green seaturtle  =========================================================
B D                    Lizard  =========================================================
  D              Mallard duck  =========================================================
B D        American alligator  =========================================================
  D       Collared flycatcher  =========================================================
          Tibetan ground jay  =========================================================
B D                    Turkey  =========================================================
B D              Atlantic cod  =========================================================
B D                 Zebrafish  =========================================================
B D             X. tropicalis  =========================================================
B D               Zebra finch  =========================================================
B D                  Platypus  =========================================================
B D           Tasmanian devil  =========================================================
B D                   Opossum  =========================================================
  D            Painted turtle  =========================================================
B D                       Pig  =========================================================
  D  Chinese softshell turtle  =========================================================
  D    Spiny softshell turtle  =========================================================

Inserts between block 1 and 2 in window
              Golden hamster 170bp

Alignment block 2 of 568 in window, 177389669 - 177389681, 13 bps 
B D                     Human  ttt--gatct--------------------------------------------tcgca
B D                     Chimp  ttt--gatct--------------------------------------------tcgca
B D                   Gorilla  ttt--gatct--------------------------------------------tcgca
B D                 Orangutan  ttt--gatct--------------------------------------------tcgca
B D                    Gibbon  ttt--gatct--------------------------------------------tcgca
B D                    Rhesus  ttt--gatct--------------------------------------------tcaca
B D       Crab-eating macaque  ttt--gatct--------------------------------------------tcaca
B D                    Baboon  ttt--gatct--------------------------------------------tcaca
B D              Green monkey  ttt--gatct--------------------------------------------tcaca
B D                  Marmoset  ttt--gatct--------------------------------------------ttgca
B D           Squirrel monkey  tct--gatct--------------------------------------------tcgca
B D                  Bushbaby  -ct--gatct--------------------------------------------tcaca
           Chinese tree shrew  ttt---atct--------------------------------------------gcacg
B D                  Squirrel  ttt--gatct--------------------------------tcacacacacccacaaa
       Lesser Egyptian jerboa  --t--gatct--------------------------------------------acaca
                 Prairie vole  tct--gatc---------------------------------------------aaaaa
B D           Chinese hamster  --t--gatct-----------------------------------------aaaaaaaa
B D                     Mouse  --t--gatct-------------------------------------------------
B D                       Rat  --t--gatctaaaaaaaaaaaaaaaaagaaagaaaaaaaaagaaaaaaaaaagaaaaaa
B D            Naked mole-rat  --tccgattt--------------------------------------------tcaca
B D                Guinea pig  --t--gattt--------------------------------------------tcaca
                   Chinchilla  --t--gattt--------------------------------------------tcaca
             Brush-tailed rat  --t--gattt--------------------------------------------tcaca
B D                    Rabbit  ttt--catct--------------------------------------------tcacc
B D                    Alpaca  ttt--gagct--------------------------------------------tcaca
               Bactrian camel  ttt--gagct--------------------------------------------tcaca
B D                   Dolphin  ttt--gaact--------------------------------------------tcaca
                 Killer whale  ttt--gaact--------------------------------------------tcaca
             Tibetan antelope  ttt--ga-------------------------------------------------tca
B D                       Cow  ttt--ga-------------------------------------------------tca
B D                     Sheep  ttt--ga-------------------------------------------------tca
                Domestic goat  ttt--ga-------------------------------------------------tca
B D                     Horse  tgt--gatct--------------------------------------------gcagg
B D          White rhinoceros  ttt--gatct--------------------------------------------tcagg
B D                       Cat  ttt--gatct--------------------------------------------tcaca
B D                       Dog  ttt--ggtct--------------------------------------------tcaca
B D                   Ferret   ctg--gatct--------------------------------------------tcaca
B D                     Panda  ttt--gatct--------------------------------------------tcgca
               Pacific walrus  ctt--gatct--------------------------------------------ttaca
                 Weddell seal  ctt--gatct--------------------------------------------ttaca
             Black flying-fox  ttt--gatct--------------------------------------------tcaca
B D                   Megabat  ttt--gatct--------------------------------------------tcaca
                Big brown bat  ttt--gatct--------------------------------------------ttaca
         David's myotis (bat)  ttt--gatct--------------------------------------------ttaca
B D                  Microbat  ttt--gatct--------------------------------------------ttaca
B D                  Hedgehog  cct--g-aca--------------------------------------------ccaca
              Star-nosed mole  ttt--gcgct--------------------------------------------tcctg
B D                  Elephant  ttt--gccct--------------------------------------------tcata
          Cape elephant shrew  ttt--gatct--------------------------------------------tcaca
B D                   Manatee  ttt--gctct--------------------------------------------tcata
             Cape golden mole  ttt--gatct--------------------------------------------tcaca
B D                    Tenrec  ctt--gatct--------------------------------------------gcaga
                     Aardvark  ttt--gatct--------------------------------------------tcaca
B D                 Armadillo  ttt--gatgg--------------------------------------------tcat-
B D                     Shrew  ===========================================================
B D                      Pika  ===========================================================
              Golden hamster  ===========================================================
B D                      Fugu  ===========================================================
    Mexican tetra (cavefish)  ===========================================================
B D                   Lamprey  ===========================================================
B D               Stickleback  ===========================================================
      Yellowbelly pufferfish  ===========================================================
B D                 Tetraodon  ===========================================================
B D                Coelacanth  ===========================================================
         Pundamilia nyererei  ===========================================================
                 Zebra mbuna  ===========================================================
       Burton's mouthbreeder  ===========================================================
         Princess of Burundi  ===========================================================
B D              Nile tilapia  ===========================================================
  D             Scarlet macaw  ===========================================================
  D                    Parrot  ===========================================================
  D    White-throated sparrow  ===========================================================
B D                    Medaka  ===========================================================
          Southern platyfish  ===========================================================
  D          Peregrine falcon  ===========================================================
  D              Saker falcon  ===========================================================
B D                   Wallaby  ===========================================================
  D               Rock pigeon  ===========================================================
B D                Budgerigar  ===========================================================
B D                   Chicken  ===========================================================
B D       Medium ground finch  ===========================================================
                 Spotted gar  ===========================================================
  D           Green seaturtle  ===========================================================
B D                    Lizard  ===========================================================
  D              Mallard duck  ===========================================================
B D        American alligator  ===========================================================
  D       Collared flycatcher  ===========================================================
          Tibetan ground jay  ===========================================================
B D                    Turkey  ===========================================================
B D              Atlantic cod  ===========================================================
B D                 Zebrafish  ===========================================================
B D             X. tropicalis  ===========================================================
B D               Zebra finch  ===========================================================
B D                  Platypus  ===========================================================
B D           Tasmanian devil  ===========================================================
B D                   Opossum  ===========================================================
  D            Painted turtle  ===========================================================
B D                       Pig  ===========================================================
  D  Chinese softshell turtle  ===========================================================
  D    Spiny softshell turtle  ===========================================================

Inserts between block 2 and 3 in window
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 712bp
                Prairie vole 10bp
B D          Chinese hamster 10bp
B D                      Rat 10bp
B D           Naked mole-rat 5bp
B D               Guinea pig 5bp
                  Chinchilla 5bp
            Brush-tailed rat 5bp
            Cape golden mole 1bp
B D                   Tenrec 1bp

Alignment block 3 of 568 in window, 177389682 - 177389720, 39 bps 
B D                     Human  a-aaagc-aagcca-----------------tggaa-gacagctct------------g--------t--
B D                     Chimp  a-aaagc-aagcca-----------------tggaa-gacagctct------------g--------t--
B D                   Gorilla  a-aaagc-aagcca-----------------tggaa-gacagctct------------g--------t--
B D                 Orangutan  a-aaagc-aagcca-----------------tggaa-gacagctct------------g--------t--
B D                    Gibbon  a-aaagc-aagcca-----------------tggaa-gacagctct------------g--------t--
B D                    Rhesus  c-agagc-aagcca-----------------gggaa-accagctct------------g--------a--
B D       Crab-eating macaque  c-agagc-aagcca-----------------gggaa-accagctct------------g--------a--
B D                    Baboon  c-agagc-aagcca-----------------gggaa-accagctct------------g--------a--
B D              Green monkey  c-agagc-aagcca-----------------tggaa-accagctct------------g--------a--
B D                  Marmoset  a-aaagc-aagcca-----------------tggaa-gagagctct------------g--------t--
B D           Squirrel monkey  a-aaagc-aagcca-----------------tggaa-gagagctct------------g--------t--
B D                  Bushbaby  a-aaa-c-aagcca-----------------cgggataagagctcc------------g--------t--
           Chinese tree shrew  g-aaaac-acgcca-----------------taaaa-gagcgcccc------------c--------t--
B D                  Squirrel  a-aaaac-aagcca-----------------tggaa-aaga-----------------------------
                 Prairie vole  a-aaaaa-aagcca-----------------cctag-ag-------------------------------
B D           Chinese hamster  a-aaaaa-aggcca-----------------aggtg-ag-------------------------------
B D                     Mouse  ---aaaa-aagcct-----------------tggag-at-------------------------------
B D                       Rat  a-aaaaa-aagcct-----------------cagag-ag-------------------------------
B D            Naked mole-rat  a-a-gga-aagctt-----------------cttca-gt-------------------------------
B D                Guinea pig  a-aagaa-aagctg-----------------ctttt-ga-------------------------------
                   Chinchilla  a-aagga-aagctt-----------------ctttt-gc-------------------------------
             Brush-tailed rat  a-aggaa-aagctt-----------------ctctt-gc-------------------------------
B D                    Rabbit  g-aaaac-aagccg-----------------gggaa-gaga--cgc------------g--------g--
B D                    Alpaca  a-aaaac-aagctg-----------------gggaa-gggagctcctc--ggcgtggct--------g--
               Bactrian camel  a-aaaac-aagctg-----------------gggaa-gggagctcctc--ggtgtggct--------g--
B D                   Dolphin  g-aaagc-aagctg-----------------tggaa-gggagctcctc-agccgtggcg--------a--
                 Killer whale  g-aaagc-aagctg-----------------tggaa-gggaactcctc-agccgtggcg--------a--
             Tibetan antelope  a-aaagc-gagctg-----------------tggaa-aggagttcctc-ggccgtggtg--------a--
B D                       Cow  a-aaagc-gagctg-----------------tggaa-gggagttcctcggcccgtggtg--------a--
B D                     Sheep  a-aaagc-gagctg-----------------tggaa-aggagatcctc----------------------
                Domestic goat  a-aaagc-gagctg-----------------tggaa-aggagctcctc----------------------
B D                     Horse  a-aaaac-aagacc-----------------tggca-tggagctcctc-ggccacggcg--------gca
B D          White rhinoceros  a-aaaac-aagacc-----------------tggaa-gggagctgctc-ggccaagacg--------g--
B D                       Cat  c-aaaac-aaacca-----------------tgcaa-gggaggtcctg-agctgtggag--------t--
B D                       Dog  g-aaaac-cagcca-----------------cagga-gggagctcctc-agccgcggag--------t--
B D                   Ferret   g-gaaac-aagcca-----------------cagga-gggagctcctg-ggctgcggag--------t--
B D                     Panda  g-aagac-aagcca-----------------cggga-gggagctcctg-ggctgcggag--------t--
               Pacific walrus  g-gaaac-aagcca-----------------cggga-gggagctcctg-ggctgtggag--------t--
                 Weddell seal  g-aaaac-aagcca-----------------cggga-gggagctcctg-ggctgtggag--------t--
             Black flying-fox  a-aaaac-aaacca-----------------cagaa-g-----------------gacacggtgtttc--
B D                   Megabat  a-aaaac-aaacca-----------------cagaa-g-----------------gacacggtgtttc--
                Big brown bat  ataaaat-aagcc------------------------------------------ggca--------c--
         David's myotis (bat)  ataaaat-aagcc------------------------------------------ggca--------c--
B D                  Microbat  ataaaat-aagcc------------------------------------------ggca--------c--
B D                  Hedgehog  a-acaat-gag--a-----------------caggg-aagggtgccct-ggccttggca--------t--
              Star-nosed mole  a-aaaat-gagcca-----------------cagag-aggggag-ctt-ggatttggtg--------t--
B D                  Elephant  a-aaaac-aagcca-----------------tgaaa-gggagatcctc------agcca--------t--
          Cape elephant shrew  a-aaaac-aagcca-----------------tgaaa-gggagatcctc------tgcca--------t--
B D                   Manatee  a-aaaacaaagcca-----------------tgaaa-gggagatcctc------agccg--------t--
             Cape golden mole  a-cacacaaaggca-----------------tgaaa-gggaggttttc------agccc-------gt--
B D                    Tenrec  a-cacacacacacacacacacacacacgtcctgaaa-gggtgctcctg------ggccc--------t--
                     Aardvark  a-aaaac-aagcca-----------------tgaaa-gggagatcatc------agctg--------t--
B D                 Armadillo  g-gaaacgcagcca-----------------c-----gggggactctt------tgcag--------a--
      Lesser Egyptian jerboa  ======================================================================
B D                     Shrew  ======================================================================
B D                      Pika  ======================================================================
              Golden hamster  ======================================================================
B D                      Fugu  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                   Lamprey  ======================================================================
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                 Tetraodon  ======================================================================
B D                Coelacanth  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                    Medaka  ======================================================================
          Southern platyfish  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
                 Spotted gar  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Lizard  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
  D       Collared flycatcher  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Turkey  ======================================================================
B D              Atlantic cod  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D               Zebra finch  ======================================================================
B D                  Platypus  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D            Painted turtle  ======================================================================
B D                       Pig  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D    Spiny softshell turtle  ======================================================================

                        Human  -tcc---tcactgcc
                        Chimp  -tcc---tcactgcc
                      Gorilla  -tcc---tcactgcc
                    Orangutan  -tcc---tcactgcc
                       Gibbon  -tcc---tcgctgcc
                       Rhesus  -tcc---tcgctgcc
          Crab-eating macaque  -tcc---tcgctgcc
                       Baboon  -tcc---tcgctgcc
                 Green monkey  -tcc---tcgctgcc
                     Marmoset  -tcc---tcgctgcc
              Squirrel monkey  -tcc---tcgctgcc
                     Bushbaby  -tct---tcctttcc
           Chinese tree shrew  -ccc---cagtctcc
                     Squirrel  -gct---tcattcct
                 Prairie vole  ---------atttcc
              Chinese hamster  ---------atttcc
                        Mouse  ---------atttcc
                          Rat  ---------atttcc
               Naked mole-rat  -tcc---tcgctttc
                   Guinea pig  -gga----cactacc
                   Chinchilla  -tcc---ccacttcc
             Brush-tailed rat  -tcc---tcactgtc
                       Rabbit  -cac---ttgcttcc
                       Alpaca  -tcc---tcgcttcc
               Bactrian camel  -tcc---tcgcttcc
                      Dolphin  -tcc---ttgagtcc
                 Killer whale  -tcc---tcgagtcc
             Tibetan antelope  -tcc---tc--gctt
                          Cow  -tcc---tt--gctt
                        Sheep  -----------gctc
                Domestic goat  -----------gctc
                        Horse  ttcc---tcggctcc
             White rhinoceros  -tcc---tcgcctgc
                          Cat  -tcc---tctcttgc
                          Dog  -acc---gcccgcgc
                      Ferret   -ccc---tccct---
                        Panda  -ccc---tccctcgc
               Pacific walrus  -ccc---tccctc-g
                 Weddell seal  -ccc---tccctcgg
             Black flying-fox  -tcc---tcgct-gc
                      Megabat  -tcc---tcgct-gc
                Big brown bat  -tcc---tcgct-gc
         David's myotis (bat)  -tcc---tcgct-gc
                     Microbat  -tcc---tcgct-gc
                     Hedgehog  -tca---tc------
              Star-nosed mole  -tcc---tc------
                     Elephant  -gag---tcacgtcc
          Cape elephant shrew  -gag---tcacatcc
                      Manatee  -gag---tcacttcc
             Cape golden mole  -gag---ccaagtcc
                       Tenrec  -gag---tcacattc
                     Aardvark  -gag---tcacgtcc
                    Armadillo  -gtgaactcgcttcc
       Lesser Egyptian jerboa  ===============
                        Shrew  ===============
                         Pika  ===============
               Golden hamster  ===============
                         Fugu  ===============
     Mexican tetra (cavefish)  ===============
                      Lamprey  ===============
                  Stickleback  ===============
       Yellowbelly pufferfish  ===============
                    Tetraodon  ===============
                   Coelacanth  ===============
          Pundamilia nyererei  ===============
                  Zebra mbuna  ===============
        Burton's mouthbreeder  ===============
          Princess of Burundi  ===============
                 Nile tilapia  ===============
                Scarlet macaw  ===============
                       Parrot  ===============
       White-throated sparrow  ===============
                       Medaka  ===============
           Southern platyfish  ===============
             Peregrine falcon  ===============
                 Saker falcon  ===============
                      Wallaby  ===============
                  Rock pigeon  ===============
                   Budgerigar  ===============
                      Chicken  ===============
          Medium ground finch  ===============
                  Spotted gar  ===============
              Green seaturtle  ===============
                       Lizard  ===============
                 Mallard duck  ===============
           American alligator  ===============
          Collared flycatcher  ===============
           Tibetan ground jay  ===============
                       Turkey  ===============
                 Atlantic cod  ===============
                    Zebrafish  ===============
                X. tropicalis  ===============
                  Zebra finch  ===============
                     Platypus  ===============
              Tasmanian devil  ===============
                      Opossum  ===============
               Painted turtle  ===============
                          Pig  ===============
     Chinese softshell turtle  ===============
       Spiny softshell turtle  ===============

Alignment block 4 of 568 in window, 177389721 - 177389765, 45 bps 
B D                     Human  cctg---------------------------------------ag-ctccctgccggc-cacctact-gc
B D                     Chimp  cctg---------------------------------------ag-ctccctgccggc-cacctact-gc
B D                   Gorilla  cctg---------------------------------------ag-ctccctgccggc-cacctact-gc
B D                 Orangutan  tctg---------------------------------------ag-ctccctgccggc-cacctact-gc
B D                    Gibbon  tctg---------------------------------------ag-ctccctgccggc-cacctact-gc
B D                    Rhesus  tcgg---------------------------------------aa-ctccccgccggt-cacctgct-gc
B D       Crab-eating macaque  tcgg---------------------------------------ag-ctccccgccggt-cacctgct-gc
B D                    Baboon  tcgg---------------------------------------ag-ctccccgccggt-cacctgct-gc
B D              Green monkey  tcgg---------------------------------------ag-ctccccgccggt-cacctgct-gc
B D                  Marmoset  tctg---------------------------------------ag-ctccccgccggc-cacctgct-gc
B D           Squirrel monkey  tctg---------------------------------------ag-ctccgcgccggc-caccagct-gc
B D                  Bushbaby  tctg---------------------------------------ag-gtccccgctgtc-cacctgct-gc
           Chinese tree shrew  tctggaggctggctgtccaccgcctgggcgccagttgaatcacag-ctccatgccggt---cctgct-gc
B D                  Squirrel  -ctg---------------------------------------ag-aggcccactgtc-cacctgct-gc
                 Prairie vole  -----------------------------------------------ggtctgacggc-tg---acg-gc
B D           Chinese hamster  -----------------------------------------------ggcctgatgtc-t----------
B D                     Mouse  -----------------------------------------------gtcctgatgtc------------
B D                       Rat  -----------------------------------------------ggcctgaggtc------------
B D            Naked mole-rat  tctg---------------------------------------ag-ttgcccgttgtc-catctgct-gc
B D                Guinea pig  tctg---------------------------------------ag-ttgcccgctgcc-tacctgct-gc
                   Chinchilla  tctg---------------------------------------ag-ttgcccgctgtc-cacctgct-gc
             Brush-tailed rat  tctg---------------------------------------aa-ttgcccactgtc-cacctgct-gc
B D                    Rabbit  tctg---------------------------------------ag-caccccgccttc-cacctgct-gc
B D                    Alpaca  tctg---------------------------------------aa-atccccactgcc-cgcctgca-gc
               Bactrian camel  tctg---------------------------------------aa-atccccactgcc-cgcctgca-gc
B D                   Dolphin  tctg---------------------------------------aa-atccctgctgcc-tgcctgca-gc
                 Killer whale  tctg---------------------------------------aa-atccctgctgcc-tgcctgca-gc
             Tibetan antelope  actg---------------------------------------aa-atccccgccgcc-tgcctgca-gc
B D                       Cow  actg---------------------------------------aa-atccccgccacc-tgcctgca-gc
B D                     Sheep  actg---------------------------------------aa-atccctgccacc-cacctgca-gc
                Domestic goat  actg---------------------------------------aa-atccctgccacc-cgcctgca-gc
B D                     Horse  tctg---------------------------------------aa---ccccgctg-c-cacctgca-gc
B D          White rhinoceros  tctg---------------------------------------aa-atccccgctgcc-cacctgca-gc
B D                       Cat  tctg---------------------------------------aa-atccccgttgcc-cacctgca-gc
B D                       Dog  tccg---------------------------------------aa-agccccgcccccgcccccgcc-cc
B D                   Ferret   ----------------------------------------------------ggtgcc-tgcctgca-gc
B D                     Panda  tctg---------------------------------------aa-agtgccgctgcc-c-cctgcc-gc
               Pacific walrus  gcta---------------------------------------ac-agagctgctgcc-cacctgca-gc
                 Weddell seal  gctg---------------------------------------ac-agagctgctgcc-cacctgca-gc
             Black flying-fox  tctg---------------------------------------aa-ac--ccgctgcc-cacctgca---
B D                   Megabat  tctg---------------------------------------aa-ac--ccgctgcc-cacctgca---
                Big brown bat  tctg---------------------------------------aa-ac-------------cctgca---
         David's myotis (bat)  tctg---------------------------------------aa-ag-------------cctgcatgc
B D                  Microbat  tctg---------------------------------------aa-ac-------------cctgca---
B D                  Hedgehog  --tg---------------------------------------aa-at-tctgcaccc-t-tctgca-gc
              Star-nosed mole  --tg---------------------------------------aa-atccctgctccc-c-actgca-gc
B D                  Elephant  tctg---------------------------------------aaggtccctgcccct-gacctgca-gc
          Cape elephant shrew  tctg---------------------------------------aa-gttcctgcccct-cacctgca-gc
B D                   Manatee  tc----------------------------------------------------------acttgca-gc
             Cape golden mole  tctg---------------------------------------ag-gtgcctgcccct-cacctgct-gc
B D                    Tenrec  tctg---------------------------------------ag-gaccctgccact-cacctgca-gc
                     Aardvark  tctg---------------------------------------ag-gtccctgcccct-cacctgca-gc
B D                 Armadillo  tctg---------------------------------------ag-atgcccg---ct-caccggca-gc
B D        American alligator  ccca---------------------------------------gg-ctcccccccggc-cccttact-gc
      Lesser Egyptian jerboa  ======================================================================
B D                     Shrew  ======================================================================
B D                      Pika  ======================================================================
              Golden hamster  ======================================================================
B D                      Fugu  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                   Lamprey  ======================================================================
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                 Tetraodon  ======================================================================
B D                Coelacanth  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                    Medaka  ======================================================================
          Southern platyfish  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
                 Spotted gar  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Lizard  ======================================================================
  D              Mallard duck  ======================================================================
  D       Collared flycatcher  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Turkey  ======================================================================
B D              Atlantic cod  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D               Zebra finch  ======================================================================
B D                  Platypus  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D            Painted turtle  ======================================================================
B D                       Pig  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D    Spiny softshell turtle  ======================================================================

                        Human  a--------------g---------c-------------t------tcc---ggca------ga------
                        Chimp  a--------------g---------c-------------t------tcc---ggca------ga------
                      Gorilla  a--------------g---------c-------------t------tcc---ggca------ga------
                    Orangutan  a--------------g---------c-------------t------tcg---ggca------ga------
                       Gibbon  a--------------g---------c-------------t------tca---ggca------ga------
                       Rhesus  a--------------g---------c-------------t------tcg---ggca------gg------
          Crab-eating macaque  a--------------g---------c-------------t------tcg---ggca------gg------
                       Baboon  a--------------g---------c-------------t------tcg---ggca------gg------
                 Green monkey  a--------------g---------c-------------t------tcg---ggca------gg------
                     Marmoset  g--------------g---------c-------------t------tca---ggca------gc------
              Squirrel monkey  g--------------g---------c-------------t------tca---ggca------gc------
                     Bushbaby  a--------------g---------c-------------c------tca---ggca------gg------
           Chinese tree shrew  agcacacagcccctcg---------c-------------c------taa---tgca------ag------
                     Squirrel  a--------------g---------c-------------a------ttg---agcagtattgag------
                 Prairie vole  t--------------g---------a-------------c------ttg---ggca------ag------
              Chinese hamster  t--------------g---------g-------------c------ttg---ggca------ag------
                        Mouse  t--------------g---------t-------------c------ttg---ggca------ag------
                          Rat  t--------------g---------t-------------c------ttg---ggca------ag------
               Naked mole-rat  t--------------gctgctgcacc-------------a------gta---aaca------gg------
                   Guinea pig  a--------------g---------c-------------a------ata---agca------gg------
                   Chinchilla  g--------------g---------c-------------a------gta---agca------gg------
             Brush-tailed rat  a--------------g---------c-------------a------gta---cgca------gg------
                       Rabbit  t--------------a---------c-------------a------t---------------gg------
                       Alpaca  t--------------g---------c-------------a------ttc---aggc------gg------
               Bactrian camel  t--------------g---------c-------------a------ttc---aggc------ag------
                      Dolphin  t--------------g---------c-------------a------ttc---acct------gg------
                 Killer whale  t--------------g---------c-------------a------ttc---acct------gg------
             Tibetan antelope  t--------------g---------c-------------a------ttc---agcc------ag------
                          Cow  t--------------g---------c-------------a------ttc---ggcc------ag------
                        Sheep  c--------------g---------c-------------g------ttc---ggcc------ag------
                Domestic goat  c--------------g---------c-------------a------ctc---g-----------------
                        Horse  t--------------g--------------------------------c---ctca------gg------
             White rhinoceros  t--------------g---------c-------------a------ttc---cgca------gg------
                          Cat  t--------------g---------c-------------a------ttc---agca------gg------
                          Dog  a--------------g---------c-------------g------gccttgggca------gg------
                      Ferret   t--------------g---------t-------------g------ctc---agct------ggccttcc
                        Panda  c--------------c---------c-------------g------tcc---agca------gg------
               Pacific walrus  c--------------g---------c-------------g------ccc---agca------gg------
                 Weddell seal  c--------------g---------c-------------g------ccc---agca------gg------
             Black flying-fox  ----------------------------------------------tcc---agca------gg------
                      Megabat  ----------------------------------------------tcc---agcg------gg------
                Big brown bat  ----------------------------------------------tcc---agca------gg------
         David's myotis (bat)  a--------------g---------c-------------aggcccctgc---agca------cg------
                     Microbat  ----------------------------------------------tcc---agca------gg------
                     Hedgehog  t--------------g---------tggacagaagcctcc------tt----------------------
              Star-nosed mole  t--------------g---------t-------------c------tt----------------------
                     Elephant  t--------------g---------t-------------g------ttc---agca------gg------
          Cape elephant shrew  t--------------g---------t-------------g------ttc---tgca------gg------
                      Manatee  t--------------g---------c-------------g------ttc---agca------gg------
             Cape golden mole  t--------------g---------c-------------g------ttc---agca------gg------
                       Tenrec  t--------------g---------c-------------a------ttc---agcg------gg------
                     Aardvark  t--------------g---------t-------------g------ctc---agca------gg------
                    Armadillo  t--------------g---------c-------------c------tcc---cgcc------gg------
           American alligator  a--------------g---------t-------------t------------ggcg------gg------
       Lesser Egyptian jerboa  ======================================================================
                        Shrew  ======================================================================
                         Pika  ======================================================================
               Golden hamster  ======================================================================
                         Fugu  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                      Lamprey  ======================================================================
                  Stickleback  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                    Tetraodon  ======================================================================
                   Coelacanth  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                Scarlet macaw  ======================================================================
                       Parrot  ======================================================================
       White-throated sparrow  ======================================================================
                       Medaka  ======================================================================
           Southern platyfish  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                  Spotted gar  ======================================================================
              Green seaturtle  ======================================================================
                       Lizard  ======================================================================
                 Mallard duck  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                       Turkey  ======================================================================
                 Atlantic cod  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
                  Zebra finch  ======================================================================
                     Platypus  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
               Painted turtle  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
       Spiny softshell turtle  ======================================================================

                        Human  ----------------------------tctc----
                        Chimp  ----------------------------tctc----
                      Gorilla  ----------------------------tctc----
                    Orangutan  ----------------------------tctc----
                       Gibbon  ----------------------------tctc----
                       Rhesus  ----------------------------tctc----
          Crab-eating macaque  ----------------------------tctc----
                       Baboon  ----------------------------tctc----
                 Green monkey  ----------------------------tctc----
                     Marmoset  ----------------------------tctc----
              Squirrel monkey  ----------------------------tctc----
                     Bushbaby  ----------------------------tctc----
           Chinese tree shrew  ----------------------------ccac----
                     Squirrel  ----------------------------gtcc----
                 Prairie vole  ----------------------------actc----
              Chinese hamster  ----------------------------tccc----
                        Mouse  ----------------------------tctc----
                          Rat  ----------------------------tctc----
               Naked mole-rat  ----------------------------tttc----
                   Guinea pig  ----------------------------tttc----
                   Chinchilla  ----------------------------tttc----
             Brush-tailed rat  ----------------------------tttc----
                       Rabbit  ----------------------------tcat----
                       Alpaca  ----------------------------tgtc----
               Bactrian camel  ----------------------------tgtc----
                      Dolphin  ----------------------------tctc----
                 Killer whale  ----------------------------tctc----
             Tibetan antelope  ----------------------------tctc----
                          Cow  ----------------------------tctc----
                        Sheep  ----------------------------tctc----
                Domestic goat  ------------------------------------
                        Horse  ----------------------------tctc----
             White rhinoceros  ----------------------------tctc----
                          Cat  ----------------------------tctc----
                          Dog  ----------------------------tgtc----
                      Ferret   cccctgcaacaggtgcaccagacgctgcctgc----
                        Panda  ----------------------------cctc----
               Pacific walrus  ----------------------------tcgc----
                 Weddell seal  ----------------------------ctgc----
             Black flying-fox  ----------------------------tccc----
                      Megabat  ----------------------------tccc----
                Big brown bat  ----------------------------tccc----
         David's myotis (bat)  ----------------------------tccc----
                     Microbat  ----------------------------ccc-----
                     Hedgehog  ------------------------------------
              Star-nosed mole  ------------------------------------
                     Elephant  ----------------------------actc----
          Cape elephant shrew  ----------------------------actc----
                      Manatee  ----------------------------attc----
             Cape golden mole  ----------------------------actt----
                       Tenrec  ----------------------------tctc----
                     Aardvark  ----------------------------actc----
                    Armadillo  ----------------------------tctg----
           American alligator  ----------------------------ctcatcag
       Lesser Egyptian jerboa  ====================================
                        Shrew  ====================================
                         Pika  ====================================
               Golden hamster  ====================================
                         Fugu  ====================================
     Mexican tetra (cavefish)  ====================================
                      Lamprey  ====================================
                  Stickleback  ====================================
       Yellowbelly pufferfish  ====================================
                    Tetraodon  ====================================
                   Coelacanth  ====================================
          Pundamilia nyererei  ====================================
                  Zebra mbuna  ====================================
        Burton's mouthbreeder  ====================================
          Princess of Burundi  ====================================
                 Nile tilapia  ====================================
                Scarlet macaw  ====================================
                       Parrot  ====================================
       White-throated sparrow  ====================================
                       Medaka  ====================================
           Southern platyfish  ====================================
             Peregrine falcon  ====================================
                 Saker falcon  ====================================
                      Wallaby  ====================================
                  Rock pigeon  ====================================
                   Budgerigar  ====================================
                      Chicken  ====================================
          Medium ground finch  ====================================
                  Spotted gar  ====================================
              Green seaturtle  ====================================
                       Lizard  ====================================
                 Mallard duck  ====================================
          Collared flycatcher  ====================================
           Tibetan ground jay  ====================================
                       Turkey  ====================================
                 Atlantic cod  ====================================
                    Zebrafish  ====================================
                X. tropicalis  ====================================
                  Zebra finch  ====================================
                     Platypus  ====================================
              Tasmanian devil  ====================================
                      Opossum  ====================================
               Painted turtle  ====================================
                          Pig  ====================================
     Chinese softshell turtle  ====================================
       Spiny softshell turtle  ====================================

Inserts between block 4 and 5 in window
B D                      Cat 140bp
            Black flying-fox 108bp
B D                  Megabat 108bp
               Big brown bat 108bp
        David's myotis (bat) 92bp
B D                 Microbat 107bp
B D                 Elephant 12bp
         Cape elephant shrew 12bp
B D                  Manatee 12bp
            Cape golden mole 12bp
B D                   Tenrec 12bp
                    Aardvark 12bp
B D                Armadillo 12bp

Alignment block 5 of 568 in window, 177389766 - 177389787, 22 bps 
B D                     Human  aac---------------cagcagcctccac-----g--------------------tcctc-----
B D                     Chimp  aac---------------cagcagcctccac-----g--------------------tcctc-----
B D                   Gorilla  aac---------------cagcagcctccac-----g--------------------tcctc-----
B D                 Orangutan  aac---------------cagcagcctccac-----g--------------------tcctc-----
B D                    Gibbon  aac---------------ctgcagcctccac-----g--------------------tcctc-----
B D                    Rhesus  agc---------------ctgcagcctccac-----a--------------------tcctc-----
B D       Crab-eating macaque  agc---------------ctgcagcctccac-----a--------------------tcctc-----
B D                    Baboon  agc---------------ctgcagcctccac-----a--------------------tcctc-----
B D              Green monkey  agc---------------ctgcagcctccac-----a--------------------tcctc-----
B D                  Marmoset  aac---------------ctgcagcctccgt-----g--------------------tcctc-----
B D           Squirrel monkey  aac---------------ctgcggcctccgc-----g--------------------tccta-----
B D                  Bushbaby  agc---------------ttgcagcatacac-----c--------------------tccgc-----
           Chinese tree shrew  acaccacaccgggtcctgctgcagcacacag-----c--------------------ccctc-----
B D                  Squirrel  cgt---------------ttgcagggtgtgc-----c--------------------tcctc-----
                 Prairie vole  tac---------------ctgtgccctgaac-----t--------------------gcctc-----
B D           Chinese hamster  tac---------------ctgtgctctgaac-----c--------------------tcttc-----
B D                     Mouse  tac---------------ctgtgccctgaac-----c--------------------tcttc-----
B D                       Rat  tac---------------ctgtgccctgaac-----c--------------------tcctc-----
B D            Naked mole-rat  cac---------------ttgcaccatgtgc-----c--------------------atgcc-----
B D                Guinea pig  cac---------------ttgcaccacatgc-----c--------------------gtgtc-----
                   Chinchilla  cac---------------ttgcgtgatgtgt-----c--------------------atgtc-----
             Brush-tailed rat  cac---------------ttgcaccatgtgc-----c--------------------atgt------
B D                    Rabbit  tcc---------------c------------------------------------------------
B D                    Alpaca  ------------------------cccttgc-----aggacgcaccgccaaaggtagccgtc-----
               Bactrian camel  ------------------------cccttgc-----aggaggcaccgccaaaggtagccatc-----
B D                   Dolphin  ------------------------cccttga-----aggatgcaccggcaaatgtagctctc-----
                 Killer whale  ------------------------cccttga-----aggatgcaccggcaaatgtagctctc-----
             Tibetan antelope  ------------------------cctttgc-----aggat------gcaaacggggccctc-----
B D                       Cow  ------------------------cctttgc-----aggat------gcaaacggggccctc-----
B D                     Sheep  ------------------------cctttgc-----aggat------gcagacggggccctc-----
                Domestic goat  -----------------------------gc-----aggat------gcagacggggccctc-----
B D                     Horse  ---------------------------------------------------------ccctt-----
B D          White rhinoceros  ---------------------------------------------------------ccctc-----
B D                       Dog  ---------------------------------------------------------ccctc-----
B D                   Ferret   ---------------------------------------------------------ccctg-----
B D                     Panda  ---------------------------------------------------------ctctg-----
               Pacific walrus  ---------------------------------------------------------ccctg-----
                 Weddell seal  ---------------------------------------------------------ccct------
B D                  Hedgehog  -------------------------------------------------ggatggaagcccc-----
              Star-nosed mole  -------------------------------------------------aggcaaggccccc-----
B D                  Elephant  gac---------------tttcaacatgcac-----caactaactgagttcag----tcctt-----
          Cape elephant shrew  aac---------------tttgagcacatcc-----cagctcacctaatttag----tcctc-----
B D                   Manatee  gac---------------tttcagcatgtaccggctca-----cctaattcag----tcctc-----
             Cape golden mole  gac---------------ttacagcatgcac-----cagcttacctaactgag----tcctc-----
B D                    Tenrec  ggc---------------gatcagcagg--g-----caggctaacccactctg----gcctc-----
                     Aardvark  gac---------------tttcagcacgcac-----tggctcacctaattcag----tcctc-----
B D                 Armadillo  -ac---------------tttcagcatttgc-----cgtctcacctaatttac----tcctg-----
B D        American alligator  -------------------------------------------------------agccatcggcgc
      Lesser Egyptian jerboa  ===================================================================
B D                     Shrew  ===================================================================
B D                      Pika  ===================================================================
              Golden hamster  ===================================================================
            Black flying-fox  ===================================================================
B D                      Fugu  ===================================================================
B D                       Cat  ===================================================================
B D                  Microbat  ===================================================================
        David's myotis (bat)  ===================================================================
               Big brown bat  ===================================================================
    Mexican tetra (cavefish)  ===================================================================
B D                   Lamprey  ===================================================================
B D               Stickleback  ===================================================================
      Yellowbelly pufferfish  ===================================================================
B D                 Tetraodon  ===================================================================
B D                Coelacanth  ===================================================================
         Pundamilia nyererei  ===================================================================
                 Zebra mbuna  ===================================================================
       Burton's mouthbreeder  ===================================================================
         Princess of Burundi  ===================================================================
B D              Nile tilapia  ===================================================================
  D             Scarlet macaw  ===================================================================
  D                    Parrot  ===================================================================
  D    White-throated sparrow  ===================================================================
B D                    Medaka  ===================================================================
          Southern platyfish  ===================================================================
  D          Peregrine falcon  ===================================================================
  D              Saker falcon  ===================================================================
B D                   Wallaby  ===================================================================
  D               Rock pigeon  ===================================================================
B D                Budgerigar  ===================================================================
B D                   Chicken  ===================================================================
B D       Medium ground finch  ===================================================================
                 Spotted gar  ===================================================================
  D           Green seaturtle  ===================================================================
B D                    Lizard  ===================================================================
  D              Mallard duck  ===================================================================
  D       Collared flycatcher  ===================================================================
          Tibetan ground jay  ===================================================================
B D                    Turkey  ===================================================================
B D              Atlantic cod  ===================================================================
B D                 Zebrafish  ===================================================================
B D             X. tropicalis  ===================================================================
B D               Zebra finch  ===================================================================
B D                  Platypus  ===================================================================
B D           Tasmanian devil  ===================================================================
B D                   Megabat  ===================================================================
B D                   Opossum  ===================================================================
  D            Painted turtle  ===================================================================
B D                       Pig  ===================================================================
  D  Chinese softshell turtle  ===================================================================
  D    Spiny softshell turtle  ===================================================================

Inserts between block 5 and 6 in window
B D                   Alpaca 79bp
              Bactrian camel 79bp
B D                  Dolphin 42bp
                Killer whale 42bp
            Tibetan antelope 66bp
B D                      Cow 66bp
B D                    Sheep 66bp
               Domestic goat 66bp
B D                    Horse 113bp
B D         White rhinoceros 100bp
B D                      Dog 132bp
B D                  Ferret  101bp
B D                    Panda 142bp
              Pacific walrus 114bp
                Weddell seal 114bp
B D                 Hedgehog 8bp
             Star-nosed mole 2bp
B D                 Elephant 29bp
         Cape elephant shrew 29bp
B D                  Manatee 74bp
            Cape golden mole 29bp
B D                   Tenrec 47bp
                    Aardvark 29bp
B D                Armadillo 23bp

Alignment block 6 of 568 in window, 177389788 - 177389803, 16 bps 
B D                     Human  -------------acttgaagtca--t--cctc
B D                     Chimp  -------------acttgaagtca--t--cctc
B D                   Gorilla  -------------acttgaagtca--t--cctc
B D                 Orangutan  -------------acttgaagtca--t--cctc
B D                    Gibbon  -------------acttgtagtca--t--cctc
B D                    Rhesus  -------------acctgaagtcg--t--cctc
B D       Crab-eating macaque  -------------acctgaagtcg--t--cctc
B D                    Baboon  -------------acctgaagtcg--t--cctc
B D              Green monkey  -------------acctgaagtcg--t--cctc
B D                  Marmoset  -------------acctgaagtca--t--cctc
B D           Squirrel monkey  -------------acctgaagtca--t--cctc
B D                  Bushbaby  -------------acctaacagaa--t--cctc
           Chinese tree shrew  -------------gcctaacgcaa--g--ccac
B D                  Squirrel  -------------acccaggataa--t--cctc
                 Prairie vole  -------------acctactat-g--t--tctg
B D           Chinese hamster  -------------acctgctgc-----------
B D                     Mouse  -------------acccactgtag--t--catg
B D                       Rat  -------------acccactgtag--t--cctg
B D            Naked mole-rat  -------------atctaatgcaa--g--gctc
B D                Guinea pig  -------------atctaatgcaa--t--cctc
                   Chinchilla  -------------atctaatgcaa--t--cctc
             Brush-tailed rat  ----------------tagtgaga--tggacac
B D                    Alpaca  -------------acaggaagtaa--c--cc--
               Bactrian camel  -------------acaggaagtaa--c--cc--
B D                   Dolphin  -------------actggaagcaa--c--cc--
                 Killer whale  -------------actggaagcaa--c--cc--
             Tibetan antelope  -------------acc-taagcaa--g--ct--
B D                       Cow  -------------accagaagcaa--a--ct--
B D                     Sheep  -------------acc-taagcga--g--ct--
                Domestic goat  -------------acc-taagcga--g--ct--
B D                     Horse  ------------------------------c--
B D          White rhinoceros  ------------------------------c--
             Black flying-fox  -------------acatgaactaa--c--cc--
B D                   Megabat  -------------acatgaactaa--c--cc--
                Big brown bat  -------------gcctaaagcaa--c--ct--
         David's myotis (bat)  -------------gcctaaagcaa--c--ct--
B D                  Microbat  -------------gcctaaagcaa--c--ct--
B D                  Hedgehog  -------------atatggaggcagac--tt--
              Star-nosed mole  -------------atttggtggaatgc--tc--
B D                  Elephant  -------------tcct----------------
          Cape elephant shrew  -------------tcct----------------
B D                   Manatee  -------------acct----------------
             Cape golden mole  -------------acct----------------
B D                    Tenrec  -------------acct----------------
                     Aardvark  -------------tccc----------------
B D                 Armadillo  -------------cttt----------------
B D        American alligator  agtcgttgtcgcggtc-----------------
      Lesser Egyptian jerboa  =================================
B D                     Shrew  =================================
B D                      Pika  =================================
              Golden hamster  =================================
B D                   Ferret   =================================
B D                       Dog  =================================
              Pacific walrus  =================================
B D                     Panda  =================================
B D                      Fugu  =================================
B D                       Cat  =================================
    Mexican tetra (cavefish)  =================================
B D                   Lamprey  =================================
B D                    Rabbit  ---------------------------------
B D               Stickleback  =================================
      Yellowbelly pufferfish  =================================
B D                 Tetraodon  =================================
B D                Coelacanth  =================================
         Pundamilia nyererei  =================================
                 Zebra mbuna  =================================
       Burton's mouthbreeder  =================================
         Princess of Burundi  =================================
B D              Nile tilapia  =================================
  D             Scarlet macaw  =================================
  D                    Parrot  =================================
  D    White-throated sparrow  =================================
B D                    Medaka  =================================
          Southern platyfish  =================================
  D          Peregrine falcon  =================================
  D              Saker falcon  =================================
B D                   Wallaby  =================================
  D               Rock pigeon  =================================
B D                Budgerigar  =================================
B D                   Chicken  =================================
B D       Medium ground finch  =================================
                 Spotted gar  =================================
  D           Green seaturtle  =================================
B D                    Lizard  =================================
  D              Mallard duck  =================================
  D       Collared flycatcher  =================================
          Tibetan ground jay  =================================
B D                    Turkey  =================================
B D              Atlantic cod  =================================
B D                 Zebrafish  =================================
B D             X. tropicalis  =================================
B D               Zebra finch  =================================
B D                  Platypus  =================================
B D           Tasmanian devil  =================================
                Weddell seal  =================================
B D                   Opossum  =================================
  D            Painted turtle  =================================
B D                       Pig  =================================
  D  Chinese softshell turtle  =================================
  D    Spiny softshell turtle  =================================

Inserts between block 6 and 7 in window
B D                 Squirrel 97bp
                Prairie vole 66bp
B D          Chinese hamster 28bp
B D                    Mouse 23bp
B D                      Rat 20bp
B D           Naked mole-rat 77bp
B D               Guinea pig 71bp
                  Chinchilla 77bp
            Brush-tailed rat 53bp

Alignment block 7 of 568 in window, 177389804 - 177389807, 4 bps 
B D                     Human  ac---cc
B D                     Chimp  ac---cc
B D                   Gorilla  ac---cc
B D                 Orangutan  ac---cc
B D                    Gibbon  ac---cc
B D                    Rhesus  ac---cc
B D       Crab-eating macaque  ac---cc
B D                    Baboon  ac---cc
B D              Green monkey  ac---cc
B D                  Marmoset  ac---cc
B D           Squirrel monkey  ac---cc
B D                  Bushbaby  at---gc
           Chinese tree shrew  aca--cc
                 Prairie vole  tg---cc
B D           Chinese hamster  -----cc
               Golden hamster  tg---cc
B D                     Mouse  ag---cc
B D                       Rat  -g---tc
B D            Naked mole-rat  gc---cc
B D                Guinea pig  gc---cc
                   Chinchilla  tc---ct
             Brush-tailed rat  tc---cc
B D                    Alpaca  ac---cc
               Bactrian camel  gc---cc
B D                   Dolphin  ac---cc
                 Killer whale  ac---cc
             Tibetan antelope  gc---cc
B D                       Cow  gc---cc
B D                     Sheep  gc---cc
                Domestic goat  gc---cc
B D                     Horse  gc---cc
B D          White rhinoceros  gc---ct
             Black flying-fox  gc---cc
B D                   Megabat  gc---cc
                Big brown bat  gt---gc
         David's myotis (bat)  gt---gc
B D                  Microbat  gt---gc
B D                  Hedgehog  ga---gc
              Star-nosed mole  ac---ac
B D                  Elephant  --gtttc
          Cape elephant shrew  --g--tc
B D                   Manatee  --g--cc
             Cape golden mole  --g--cc
B D                    Tenrec  --g--cc
                     Aardvark  --a--tt
B D                 Armadillo  --a--gc
B D        American alligator  gc---ac
      Lesser Egyptian jerboa  =======
B D                     Shrew  =======
B D                      Pika  =======
B D                  Squirrel  =======
B D                   Ferret   =======
B D                       Dog  =======
              Pacific walrus  =======
B D                     Panda  =======
B D                      Fugu  =======
B D                       Cat  =======
    Mexican tetra (cavefish)  =======
B D                   Lamprey  =======
B D                    Rabbit  -------
B D               Stickleback  =======
      Yellowbelly pufferfish  =======
B D                 Tetraodon  =======
B D                Coelacanth  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D              Nile tilapia  =======
  D             Scarlet macaw  =======
  D                    Parrot  =======
  D    White-throated sparrow  =======
B D                    Medaka  =======
          Southern platyfish  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
B D                   Wallaby  =======
  D               Rock pigeon  =======
B D                Budgerigar  =======
B D                   Chicken  =======
B D       Medium ground finch  =======
                 Spotted gar  =======
  D           Green seaturtle  =======
B D                    Lizard  =======
  D              Mallard duck  =======
  D       Collared flycatcher  =======
          Tibetan ground jay  =======
B D                    Turkey  =======
B D              Atlantic cod  =======
B D                 Zebrafish  =======
B D             X. tropicalis  =======
B D               Zebra finch  =======
B D                  Platypus  =======
B D           Tasmanian devil  =======
                Weddell seal  =======
B D                   Opossum  =======
  D            Painted turtle  =======
B D                       Pig  =======
  D  Chinese softshell turtle  =======
  D    Spiny softshell turtle  =======

Inserts between block 7 and 8 in window
B D                   Alpaca 5bp
              Bactrian camel 5bp
B D                  Dolphin 5bp
                Killer whale 5bp
            Tibetan antelope 5bp
B D                      Cow 5bp
B D                    Sheep 5bp
               Domestic goat 5bp
B D                    Horse 8bp
B D         White rhinoceros 9bp
            Black flying-fox 10bp
B D                  Megabat 10bp
               Big brown bat 10bp
        David's myotis (bat) 10bp
B D                 Microbat 10bp
B D                 Hedgehog 12bp
             Star-nosed mole 32bp
B D                 Elephant 21bp
         Cape elephant shrew 9bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 46bp
B D                Armadillo 22bp

Alignment block 8 of 568 in window, 177389808 - 177389818, 11 bps 
B D                     Human  ag-------------------------------------------------gttcactct--
B D                     Chimp  ag-------------------------------------------------gttcactct--
B D                   Gorilla  ag-------------------------------------------------gttcactct--
B D                 Orangutan  ag-------------------------------------------------gttccctct--
B D                    Gibbon  ag-------------------------------------------------gttcattct--
B D                    Rhesus  ag-------------------------------------------------gttcactcc--
B D       Crab-eating macaque  ag-------------------------------------------------gttcactcc--
B D                    Baboon  ag-------------------------------------------------gttcactcc--
B D              Green monkey  ag-------------------------------------------------gttcactcc--
B D                  Marmoset  ag-------------------------------------------------gctcagtgt--
B D           Squirrel monkey  gg-------------------------------------------------gctcagtgt--
B D                  Bushbaby  agtgtgggcgaggcagacacaaggaccccattttacagaatcctgaagtttgtttaggta--
           Chinese tree shrew  at-------------------------------------------------gtgggc-----
B D                  Squirrel  gc-------------------------------------------------tatcctcag--
                 Prairie vole  ga-------------------------------------------------gctcccttg--
B D           Chinese hamster  gc-------------------------------------------------tctacacaa--
               Golden hamster  gt-------------------------------------------------gttccctcg--
B D                     Mouse  at-------------------------------------------------tttacacaa--
B D                       Rat  gt-------------------------------------------------tttacacag--
B D            Naked mole-rat  gc-------------------------------------------------cttcacctg--
B D                Guinea pig  ac-------------------------------------------------gttcacctg--
                   Chinchilla  gc-------------------------------------------------attcacctg--
             Brush-tailed rat  ac-------------------------------------------------attcacctg--
B D                    Alpaca  c-------------------------------------------------------------
               Bactrian camel  c-------------------------------------------------------------
B D                   Dolphin  c-------------------------------------------------------------
                 Killer whale  c-------------------------------------------------------------
             Tibetan antelope  c-------------------------------------------------------------
B D                       Cow  c-------------------------------------------------------------
B D                     Sheep  c-------------------------------------------------------------
                Domestic goat  c-------------------------------------------------------------
B D                     Horse  g-------------------------------------------------------------
B D          White rhinoceros  a-------------------------------------------------------------
B D                       Cat  g-------------------------------------------------------------
B D                       Dog  g-------------------------------------------------------------
B D                   Ferret   g-------------------------------------------------------------
B D                     Panda  g-------------------------------------------------------------
               Pacific walrus  g-------------------------------------------------------------
                 Weddell seal  g-------------------------------------------------------------
             Black flying-fox  g-------------------------------------------------------------
B D                   Megabat  g-------------------------------------------------------------
                Big brown bat  g-------------------------------------------------------------
         David's myotis (bat)  g-------------------------------------------------------------
B D                  Microbat  g-------------------------------------------------------------
B D                  Hedgehog  c-------------------------------------------------------------
B D                  Elephant  ----------------------------------------------------------ag--
          Cape elephant shrew  ----------------------------------------------------------gg--
B D                   Manatee  ----------------------------------------------------------ag--
             Cape golden mole  ----------------------------------------------------------ag--
B D                    Tenrec  ----------------------------------------------------------gg--
                     Aardvark  ----------------------------------------------------------ag--
B D                 Armadillo  ----------------------------------------------------------gg--
B D        American alligator  ---------------------------------------------------acccacacgcg
             Star-nosed mole  ==============================================================
      Lesser Egyptian jerboa  ==============================================================
B D                     Shrew  ==============================================================
B D                      Pika  ==============================================================
B D                      Fugu  ==============================================================
    Mexican tetra (cavefish)  ==============================================================
B D                   Lamprey  ==============================================================
B D                    Rabbit  --------------------------------------------------------------
B D               Stickleback  ==============================================================
      Yellowbelly pufferfish  ==============================================================
B D                 Tetraodon  ==============================================================
B D                Coelacanth  ==============================================================
         Pundamilia nyererei  ==============================================================
                 Zebra mbuna  ==============================================================
       Burton's mouthbreeder  ==============================================================
         Princess of Burundi  ==============================================================
B D              Nile tilapia  ==============================================================
  D             Scarlet macaw  ==============================================================
  D                    Parrot  ==============================================================
  D    White-throated sparrow  ==============================================================
B D                    Medaka  ==============================================================
          Southern platyfish  ==============================================================
  D          Peregrine falcon  ==============================================================
  D              Saker falcon  ==============================================================
B D                   Wallaby  ==============================================================
  D               Rock pigeon  ==============================================================
B D                Budgerigar  ==============================================================
B D                   Chicken  ==============================================================
B D       Medium ground finch  ==============================================================
                 Spotted gar  ==============================================================
  D           Green seaturtle  ==============================================================
B D                    Lizard  ==============================================================
  D              Mallard duck  ==============================================================
  D       Collared flycatcher  ==============================================================
          Tibetan ground jay  ==============================================================
B D                    Turkey  ==============================================================
B D              Atlantic cod  ==============================================================
B D                 Zebrafish  ==============================================================
B D             X. tropicalis  ==============================================================
B D               Zebra finch  ==============================================================
B D                  Platypus  ==============================================================
B D           Tasmanian devil  ==============================================================
B D                   Opossum  ==============================================================
  D            Painted turtle  ==============================================================
B D                       Pig  ==============================================================
  D  Chinese softshell turtle  ==============================================================
  D    Spiny softshell turtle  ==============================================================

Inserts between block 8 and 9 in window
B D                  Dolphin 5bp
                Killer whale 5bp
B D                  Ferret  1bp
B D                 Hedgehog 11bp
B D                 Elephant 7bp
         Cape elephant shrew 5bp
B D                  Manatee 7bp
            Cape golden mole 8bp
B D                   Tenrec 8bp
                    Aardvark 8bp
B D                Armadillo 17bp

Alignment block 9 of 568 in window, 177389819 - 177389835, 17 bps 
B D                     Human  gggg-----------ag------g---------------ccgcccttgg
B D                     Chimp  gggg-----------ag------g---------------ccgcccttgg
B D                   Gorilla  gtgg-----------ag------g---------------ccgtccttgg
B D                 Orangutan  gtgg-----------ag------g---------------ccgcccctgg
B D                    Gibbon  gtgg-----------ag------g---------------ccgcccttgg
B D                    Rhesus  gtgg-----------ag------g---------------ccgcccttgg
B D       Crab-eating macaque  gtgg-----------ag------g---------------ccgcccttgg
B D                    Baboon  gtgg-----------ag------g---------------ccgcccttgg
B D              Green monkey  gtgg-----------ag------g---------------ccgcccttgg
B D                  Marmoset  gcgg-----------aa------g---------------ccgccctcag
B D           Squirrel monkey  gcgg-----------ag------g---------------ctgccctcgg
B D                  Bushbaby  gaga-----------aa------c---------------ccacccaagt
           Chinese tree shrew  gagg-----------gg------c---------------tggggactgc
B D                  Squirrel  gttc-----------------------------------ttctcttccg
                 Prairie vole  gcggcgg--cggcgggg------c---------------ctgccttcca
B D           Chinese hamster  atgg-----------ag------a---------------ctga------
               Golden hamster  atgg------------g------c---------------ctgccttcc-
B D                     Mouse  acggaaactcagctggg------c---------------cagccttcag
B D                       Rat  atgg-----aaact-------------------------cagtgtcaag
B D            Naked mole-rat  gctg-----------gg------g---------------ctgccttcag
B D                Guinea pig  gctg-----------gg------g---------------ctgccttctg
                   Chinchilla  gctg-----------gg------g---------------ctgccttccg
             Brush-tailed rat  gct------------gg------g---------------ctgccctctg
B D                    Alpaca  cctg-----------gg------g---------------ctgtcctcac
               Bactrian camel  cctg-----------gg------g---------------ctgtcctcac
B D                   Dolphin  gctg-----------gg------g---------------ctgtcctcac
                 Killer whale  gctg-----------gg------g---------------ctgtcctcac
             Tibetan antelope  ---------------------------------------ctgtcttcac
B D                       Cow  ---------------------------------------ctgtcttcac
B D                     Sheep  ---------------------------------------ctgtcttcac
                Domestic goat  ---------------------------------------ctgtcttcac
B D                     Horse  gctg-----------gg------g---------------ctgtcctcac
B D          White rhinoceros  gcta-----------gg------g---------------ctgtcct---
B D                       Cat  gcgg-----------gg------g---------------ctggcctcac
B D                       Dog  gcgg-----------gg------g---------------ctgtcctcac
B D                   Ferret   ccag-----------ggc-----g---------------ctgtccccac
B D                     Panda  gtgg-----------ggg-----g---------------ctgtccttgc
               Pacific walrus  gcgg-----------ggg-----g---------------ctgtccccac
                 Weddell seal  gcgg-----------ggg-----g---------------ctgtccccac
             Black flying-fox  gctg-----------tg------a---------------ctgtcctcac
B D                   Megabat  gctg-----------tg------a---------------ctgtcctcac
                Big brown bat  gccg-----------gg------g---------------ctgtggtccc
         David's myotis (bat)  gct------------gg------g---------------ccgtggtcac
B D                  Microbat  gct------------gg------g---------------ccgtggtcac
B D                  Hedgehog  -----------------------g---------------gggtccccac
              Star-nosed mole  -----------------------g---------------aggaacccgc
B D                  Elephant  gctg-----------gg------g---------------ctgcccccac
          Cape elephant shrew  ---------------gg------g---------------tgacaccaac
B D                   Manatee  gagg-----------gg------c---------------tgccctcggc
             Cape golden mole  gcag-----------gg------g---------------ctgcccttgt
B D                    Tenrec  gc-------------------------------------ttgaccccg-
                     Aardvark  cctg-----------ga------g---------------ctgccctcac
B D                 Armadillo  cgga-----------gg------gcaagggcaagggcactggccctcac
B D        American alligator  -----------------cgggatg---------------cagcgcttgg
      Lesser Egyptian jerboa  =================================================
B D                     Shrew  =================================================
B D                      Pika  =================================================
B D                      Fugu  =================================================
    Mexican tetra (cavefish)  =================================================
B D                   Lamprey  =================================================
B D                    Rabbit  -------------------------------------------------
B D               Stickleback  =================================================
      Yellowbelly pufferfish  =================================================
B D                 Tetraodon  =================================================
B D                Coelacanth  =================================================
         Pundamilia nyererei  =================================================
                 Zebra mbuna  =================================================
       Burton's mouthbreeder  =================================================
         Princess of Burundi  =================================================
B D              Nile tilapia  =================================================
  D             Scarlet macaw  =================================================
  D                    Parrot  =================================================
  D    White-throated sparrow  =================================================
B D                    Medaka  =================================================
          Southern platyfish  =================================================
  D          Peregrine falcon  =================================================
  D              Saker falcon  =================================================
B D                   Wallaby  =================================================
  D               Rock pigeon  =================================================
B D                Budgerigar  =================================================
B D                   Chicken  =================================================
B D       Medium ground finch  =================================================
                 Spotted gar  =================================================
  D           Green seaturtle  =================================================
B D                    Lizard  =================================================
  D              Mallard duck  =================================================
  D       Collared flycatcher  =================================================
          Tibetan ground jay  =================================================
B D                    Turkey  =================================================
B D              Atlantic cod  =================================================
B D                 Zebrafish  =================================================
B D             X. tropicalis  =================================================
B D               Zebra finch  =================================================
B D                  Platypus  =================================================
B D           Tasmanian devil  =================================================
B D                   Opossum  =================================================
  D            Painted turtle  =================================================
B D                       Pig  =================================================
  D  Chinese softshell turtle  =================================================
  D    Spiny softshell turtle  =================================================

Inserts between block 9 and 10 in window
B D       American alligator 1514bp

Alignment block 10 of 568 in window, 177389836 - 177389928, 93 bps 
B D                     Human  --gc-ctttctctacg----gct-----gca-gct-------------------gacac-------ttg-
B D                     Chimp  --gc-ctttctctacg----gct-----gca-gct-------------------gccac-------ttg-
B D                   Gorilla  --gc-ctttctctacg----gct-----gca-gct-------------------gacac-------ttg-
B D                 Orangutan  --gc-ctttctctacg----gct-----gca-gct-------------------gccac-------ttg-
B D                    Gibbon  --gc-ctttctctacg----gct-----gca-gct-------------------gccac-------ttg-
B D                    Rhesus  --gc-ctttctctacg----gct-----gca-gct-------------------gccac-------ttg-
B D       Crab-eating macaque  --gc-ctttctctacg----gct-----gca-gct-------------------gccac-------ttg-
B D                    Baboon  --gc-ctttctctacg----gct-----gca-gct-------------------gccac-------ttg-
B D              Green monkey  --gc-ctttctctacg----gct-----gca-gct-------------------gccac-------ttg-
B D                  Marmoset  --gc-ctttctctatg----gct-----gaa-gct-------------------gacac-------ttg-
B D           Squirrel monkey  --gc-ggttctctacg----gct-----gaa-gct-------------------gccac-------ttg-
B D                  Bushbaby  --tcaccttttccatg----gct-----gca-act-------------------gccaa-------ttg-
           Chinese tree shrew  --gc-ctcacactcca----gcc-----gaa-gccctgtgaagtcaccgcccaggtcgc-------tggc
B D                  Squirrel  ------------ccccag--ctg-----tca-att---------------------------------g-
                 Prairie vole  ---------ggcttcccg--ctt-----cca-gct-------------------gcggc-------ttg-
B D           Chinese hamster  --------------------agc-----tca-gcg-------------------at--------------
               Golden hamster  ---------ggctccttgctgtc-----cca-gct-------------------gtcac-------ttg-
B D                     Mouse  --gc-tgtttgctgttcc--agc-----tgtcact--------------------------------tg-
B D                       Rat  taac-tgcagagttcctc--agc-----tgg-gcc--------------------------------tg-
B D            Naked mole-rat  --gc-tcttttctact----gcc-----cca-gtt-------------------gccac-------ttg-
B D                Guinea pig  --gc-tcgtctctact----gtt-----cca-gtt-------------------gccac-------ttg-
                   Chinchilla  --gc-tctttgctact----gct-----cca-gtt-------------------gccac-------ttg-
             Brush-tailed rat  --gc-tcttctctact----gtt-----ccc-gtt-------------------gccac-------ttg-
B D                    Rabbit  --gc-cccctaccccg----gcc-----tcg-gat-------------------gcaat------gctg-
B D                    Alpaca  --gt-gctcctccact----gtc-----cct-act-------------------gccac-------ctg-
               Bactrian camel  --gt-gctcctccact----gtc-----cct-gct-------------------gccac-------ctg-
B D                   Dolphin  --tg-gttcctccgct----gag-----cct-gct-------------------accac-------tcg-
                 Killer whale  --tg-gttcctccgct----gag-----cct-gct-------------------accac-------tcg-
             Tibetan antelope  --ac-gttcctccatg----gct-----ccc-gct-------------------accac-------tcg-
B D                       Cow  --at-gttcctccatg----gct-----cct-gct-------------------accac-------tcg-
B D                     Sheep  --ac-gttcctccacg----gct-----ccc-gct-------------------accac-------tcg-
                Domestic goat  --ac-gttcctccacg----gct-----ccc-gct-------------------accac-------tca-
B D                     Horse  ---------------g----gct-----cca-gcc-------------------gcccc-------tca-
B D          White rhinoceros  ---------------g----gct-----cca-gct-------------------gcccc-------tcc-
B D                       Cat  ---------------t----gct-----cct-gat-------------------gccac-------tgg-
B D                       Dog  ---------------t----gtc-----gca-gac-------------------gccgc-------ctg-
B D                   Ferret   ---------------t----gct-----ccc-tac-------------------atcac-------ttc-
B D                     Panda  ---------------t----gct-----cca-gac-------------------gccgc-------ttc-
               Pacific walrus  ---------------c----gtg-----ccc-tac-------------------gccac-------tag-
                 Weddell seal  ---------------t----gcg-----ccc-gac-------------------accgc-------tag-
             Black flying-fox  ---------------t----gct-----cca-gtt-------------------gccac-------ccg-
B D                   Megabat  ---------------t----gct-----cca-gtt-------------------gccac-------ctg-
                Big brown bat  ---------------t----gct-----tca-gct-------------------gccac-------ctg-
         David's myotis (bat)  ---------------t----gct-----cca-gcg-------------------gccac-------ctg-
B D                  Microbat  ---------------t----gct-----cca-gcg-------------------gccac-------ctg-
B D                  Hedgehog  ---------------t----gct-----cca-cct-------------------gccac-------ttg-
              Star-nosed mole  ---------------t----cctgttccctg-cct------------------ggcctt-------ttg-
B D                  Elephant  --a--gtttagccaag----gct-----tca-gcc-------------------gccac-------ttg-
          Cape elephant shrew  --------cagccggg----ggc-----t---gcc-------------------ctcacggtatcgtta-
B D                   Manatee  -------tttgccatg----gct-----cca-gct-------------------gccac-------ttg-
             Cape golden mole  --g--gttttgccaca----aat-----cc--ggc-------------------tccac-------ttg-
B D                    Tenrec  ----------gcccca----------------ggg-------------------gccac-------ttg-
                     Aardvark  --a--atgt-gtcacg----act-----aca-gct-------------------gccac-------ttg-
B D                 Armadillo  --gc-ttttttccgcg----gct-----cca-gct-------------------gctgc--------tg-
      Lesser Egyptian jerboa  ======================================================================
B D                     Shrew  ======================================================================
B D                      Pika  ======================================================================
B D                      Fugu  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                   Lamprey  ======================================================================
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                 Tetraodon  ======================================================================
B D                Coelacanth  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                    Medaka  ======================================================================
          Southern platyfish  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
                 Spotted gar  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Lizard  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
  D       Collared flycatcher  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Turkey  ======================================================================
B D              Atlantic cod  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D               Zebra finch  ======================================================================
B D                  Platypus  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D            Painted turtle  ======================================================================
B D                       Pig  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D    Spiny softshell turtle  ======================================================================

                        Human  -----------t----cca----gctggtttctcttc-------------ctca--ctctacc-----a-
                        Chimp  -----------t----cca----gctggtttctcttc-------------ctca--ctctacc-----a-
                      Gorilla  -----------t----cca----gctggtttctcttc-------------ctca--ctctacc-----a-
                    Orangutan  -----------t----cca----gctggtttctcttc-------------ctca--ctctacc-----g-
                       Gibbon  -----------t----cca----gctggtttctcttc-------------ctca--ctctacc-----a-
                       Rhesus  -----------t----cca----gctggtttctcttc-------------ctca--ctctgcc-----a-
          Crab-eating macaque  -----------t----cca----gctggtttctcttc-------------ctca--ctctgcc-----a-
                       Baboon  -----------t----cca----gctggtttctcttc-------------ctca--ctctgcc-----a-
                 Green monkey  -----------t----cca----gctggtttctcttc-------------ctca--ctctgcc-----a-
                     Marmoset  -----------t----cca----gctggtttctcttc-------------ctcg--ctctagc-----a-
              Squirrel monkey  -----------t----cca----gctgatttctcttc-------------ctcg--ctctagc-----a-
                     Bushbaby  -----------g----cta----agcaccagattatc-------------ctct--ctctact-----a-
           Chinese tree shrew  tctggcggggtt----gca----gcagaccttccttcactgcgccagcggccca--ctctccc-----a-
                     Squirrel  -----------c----caaagc-actggtttcatgtc-------------ccca--ctccatc-----a-
                 Prairie vole  -----------c----cagggc-accgg-ttcagtt--------------gcca--cactaac-----a-
              Chinese hamster  -----------a----cagagtaactgc-ct--ggt----------------------------------
               Golden hamster  -----------c----cagagt-actgt-ttcaggt----------------------------------
                        Mouse  -----------c----cagagc-actgg-ttcaggtc-------------cctg--aactagc-----a-
                          Rat  -----------c----c------------ttctgct----------------------------------
               Naked mole-rat  -----------c----cagagc-tctgatttcaaggg-------------ccca--ctctatt-----a-
                   Guinea pig  -----------c----tgaagc-tctagtttcatgtc-------------ctca--ttctatc-----a-
                   Chinchilla  -----------c----taaagc-tctggtttcatgtg-------------ctca--ctctatc-----a-
             Brush-tailed rat  -----------t----taaagc-tctggtttcatgtc-------------ctca--ctctgtg-----a-
                       Rabbit  -----------c----tgggat-gccacctgcagggt---------------------------------
                       Alpaca  -----------c----ctgagc-cctggtttctcgtc-------------ccag--ctctcct-------
               Bactrian camel  -----------c----ctgagc-cctggtttctcgtc-------------ccag--ctctcct-------
                      Dolphin  -----------c----ctgagc-actgttttctcgtc-------------ccag--ctctccc-------
                 Killer whale  -----------c----ctgagc-actgttttctcgtc-------------ccag--ctctccc-------
             Tibetan antelope  -----------c----ccgtgc-actggtttctcatc-------------ccag--ccctcct-----g-
                          Cow  -----------c----ccgtgc-actggtttctcaac-------------ccag--ccctcct-----g-
                        Sheep  -----------c----ccgtgc-actggtttctcatc-------------ccag--ccctcct-----g-
                Domestic goat  -----------c----ccgtgc-actggtttctcatc-------------ccag--ccctcct-----g-
                        Horse  -----------c----ctgagc-actgcttgctcgtc-------------ccat--cttcccc-----a-
             White rhinoceros  -----------c----ctgagc-actggtttctcgtc-------------ccac--ctcccc--------
                          Cat  -----------c----ctgagc-actggtttctcatc-------------ccag--atctccc-----a-
                          Dog  -----------c----ctgagt-agtggtctcgcgtc-------------ccag--ctctctg-----g-
                      Ferret   -----------c----ctgagt-gctggtctcgcag--------------ccgg--ctgtccc-----a-
                        Panda  -----------c----ttgagc-tctggtctcccagc-------------ccaa--ctctcct-----a-
               Pacific walrus  -----------c----ctgagc-actggccttgcagc-------------ccag--ttctccc-----g-
                 Weddell seal  -----------c----ttgagc-actggcctcgcagc-------------ccag--ttctccc-----g-
             Black flying-fox  -----------c----ctgaac-actggtttctcatc-------------ccag--ctgtccc-----g-
                      Megabat  -----------c----ctgaac-actggtttctcatc-------------ccag--ctgtccc-----g-
                Big brown bat  -----------c----ctaggc-actggtttctcagc-------------ccag--ct-tccc-----a-
         David's myotis (bat)  -----------c----ctgagc-actggtttctcagc-------------ccag--ctctgcc-----a-
                     Microbat  -----------c----ctgagc-actggtttctcagc-------------ccag--ctctgcc-----a-
                     Hedgehog  ------------------------------cccaagc-------------ccga--gtttttt-----at
              Star-nosed mole  -----------g----gggaga-agtagattccaggc-------------ccaa--ctctcct-------
                     Elephant  -----------c----ctgggc-accaccttctcaac-------------ccca--ctctacag----g-
          Cape elephant shrew  -----------cagttccagct-gccactttcctggc-------------agcagcttctaca-----a-
                      Manatee  -----------c----ctgggc-accagcttctcgac-------------ccca--ctcgaca-----g-
             Cape golden mole  -----------t----cagggc-accagcttctggtt-------------ccca--ctctatg-----g-
                       Tenrec  -----------c----cggggc-accagcctctcatg-------------cctg--ctcctca-----g-
                     Aardvark  -----------c----ctggcc-accagcttcttgtc-------------ccca--ctctatg-----g-
                    Armadillo  -----------c----tgaagt-gtccagttctcatc-------------gcca--ctctgtcatctca-
       Lesser Egyptian jerboa  ======================================================================
                        Shrew  ======================================================================
                         Pika  ======================================================================
                         Fugu  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                      Lamprey  ======================================================================
                  Stickleback  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                    Tetraodon  ======================================================================
                   Coelacanth  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                Scarlet macaw  ======================================================================
                       Parrot  ======================================================================
       White-throated sparrow  ======================================================================
                       Medaka  ======================================================================
           Southern platyfish  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                  Spotted gar  ======================================================================
              Green seaturtle  ======================================================================
                       Lizard  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                       Turkey  ======================================================================
                 Atlantic cod  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
                  Zebra finch  ======================================================================
                     Platypus  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
               Painted turtle  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
       Spiny softshell turtle  ======================================================================

                        Human  ----ggaaatgctttcctt----aaacgctt----------tctgc-a-g-gg-c
                        Chimp  ----ggaaatgctttcctt----aaacgctt----------tctgc-a-g-gg-c
                      Gorilla  ----ggaaatgctttcctt----aaacgctt----------tctgc-a-g-gg-c
                    Orangutan  ----ggaaatgctttcctt----aaacgctt----------tcagc-agg-gg-c
                       Gibbon  ----ggaaatgctttcctt----aaacgctt----------tctgc-a-g-gg-c
                       Rhesus  ----ggaaacgctttcctt----caacgctt----------tctgc-a-a-gg-c
          Crab-eating macaque  ----ggaaacgctttcctt----caacgctt----------tctgc-a-a-gg-c
                       Baboon  ----ggaaacgctttcctt----caacgctt----------tctgt-a-a-gg-c
                 Green monkey  ----ggaaacgctctcctt----caacgctt----------tctgc-a-a-gg-c
                     Marmoset  ----ggaaacactttcctt----aa-----------------tagc-a-g-gg-g
              Squirrel monkey  ----ggaaacactttcctt----aa-----------------tagc-a-g-gg-g
                     Bushbaby  ----ggaaac-----cttt----taa----------------tagc-a-gtgg-c
           Chinese tree shrew  ----ggaagccctttcccc----gc-----------------cagc-a-g-ggtc
                     Squirrel  ----ggaaacctatccctg----aagagcag----------gttgga--------
                 Prairie vole  ----gaaac-ctctctctgc---aacagcag----------gttgg---------
              Chinese hamster  -------------tccctg------------------------------------
               Golden hamster  -------------cccccga---ggtagcaa-------------gg---------
                        Mouse  ----ggaaacctttttctct---aacagcag----------gttgc---------
                          Rat  ----------ctttttcac-------------------------gt---------
               Naked mole-rat  ----ggaa--ctcttcctt----aacag---------------------------
                   Guinea pig  ----ggaaatcttctcctt----aatag---------------------------
                   Chinchilla  ----ggaaatcttttcctt----a-gag---------------------------
             Brush-tailed rat  ----ggaaatcttttcctt----actag---------------------------
                       Rabbit  -------------------------------------------------------
                       Alpaca  ----gggaaatctttcctc----agaagcagggtccagatc--------------
               Bactrian camel  ----gggaaatctttcctc----agaagcagggtccagatc--------------
                      Dolphin  ----gggaaaccttccctt----gagagcagggtccagact--------------
                 Killer whale  ----gggaaaccttccctt----gagagcagggtccagact--------------
             Tibetan antelope  ----gggaaacctttcctc----gacagcagggtccagata--------------
                          Cow  ----gggaaacctttcctt----gacagcagggtccagata--------------
                        Sheep  ----gggaaacctttcctc----ggcagcagggtccagata--------------
                Domestic goat  ----gggaaacctttcctc----ggcagcagggtccagata--------------
                        Horse  -----gagaccctgccttt----aagagtagtgtctggc----------------
             White rhinoceros  -----aagaccctttcttt----aagagtagtgtctggc----------------
                          Cat  ----ggagaacttttcttt----aagagcagtatccagatg--------------
                          Dog  ----gaagagcctctcctc----gagagcagtatccacttg--------------
                      Ferret   ----gaagaatgggtccgc----cgcaacagtatccatacg--------------
                        Panda  ----gaagaactggtcctg----cagagcagtagccagacg--------------
               Pacific walrus  ----gaagagcgggtcctc----cagagcagtatccagatg--------------
                 Weddell seal  ----gaagagcgggtcctc----cagagcagtatccagatg--------------
             Black flying-fox  ----ggagacccttcccttaaggatgaacag------------------------
                      Megabat  ----ggaaatccttcccttaaggatgaacag------------------------
                Big brown bat  ----ggagactcttt--------aagagcag------------------------
         David's myotis (bat)  ----ggagacccttt--------aagagcag------------------------
                     Microbat  ----ggagacccttt--------aagagcag------------------------
                     Hedgehog  attggggagccctttcatc----ccaagtgaagg-----tc--------------
              Star-nosed mole  ----tgaaggcctatcttt----aaaagcaatgggaatttc--------------
                     Elephant  ----gaaacc-ctttcctt----catgacagtgtccaggtc--------------
          Cape elephant shrew  ----gcaaactcttgactc----tatggcagtg----------------------
                      Manatee  ----gcaaac-cttttcgt----catggcagtgtccaggtc--------------
             Cape golden mole  ----gcaacctctctcctt----tagggcagtgttcaggtt--------------
                       Tenrec  ----agctccttcctccta----atggg----gaccaggtc--------------
                     Aardvark  ----gcaagccctttcctt----catggcagtgttcaggtc--------------
                    Armadillo  ----gcaaac----gcttt----tgtagcaatgccgaggtc--------------
       Lesser Egyptian jerboa  =======================================================
                        Shrew  =======================================================
                         Pika  =======================================================
                         Fugu  =======================================================
     Mexican tetra (cavefish)  =======================================================
                      Lamprey  =======================================================
                  Stickleback  =======================================================
       Yellowbelly pufferfish  =======================================================
                    Tetraodon  =======================================================
                   Coelacanth  =======================================================
          Pundamilia nyererei  =======================================================
                  Zebra mbuna  =======================================================
        Burton's mouthbreeder  =======================================================
          Princess of Burundi  =======================================================
                 Nile tilapia  =======================================================
                Scarlet macaw  =======================================================
                       Parrot  =======================================================
       White-throated sparrow  =======================================================
                       Medaka  =======================================================
           Southern platyfish  =======================================================
             Peregrine falcon  =======================================================
                 Saker falcon  =======================================================
                      Wallaby  =======================================================
                  Rock pigeon  =======================================================
                   Budgerigar  =======================================================
                      Chicken  =======================================================
          Medium ground finch  =======================================================
                  Spotted gar  =======================================================
              Green seaturtle  =======================================================
                       Lizard  =======================================================
                 Mallard duck  =======================================================
           American alligator  =======================================================
          Collared flycatcher  =======================================================
           Tibetan ground jay  =======================================================
                       Turkey  =======================================================
                 Atlantic cod  =======================================================
                    Zebrafish  =======================================================
                X. tropicalis  =======================================================
                  Zebra finch  =======================================================
                     Platypus  =======================================================
              Tasmanian devil  =======================================================
                      Opossum  =======================================================
               Painted turtle  =======================================================
                          Pig  =======================================================
     Chinese softshell turtle  =======================================================
       Spiny softshell turtle  =======================================================

Alignment block 11 of 568 in window, 177389929 - 177389937, 9 bps 
B D                     Human  agggtctca
B D                     Chimp  agggtctca
B D                   Gorilla  agggtctca
B D                 Orangutan  agggtctga
B D                    Gibbon  agggtctga
B D                    Rhesus  agggtctga
B D       Crab-eating macaque  agggtctga
B D                    Baboon  agggtctga
B D              Green monkey  agggtctga
B D                  Marmoset  aggggctga
B D           Squirrel monkey  aggggctga
B D                  Bushbaby  agagttgga
           Chinese tree shrew  aaggctgga
B D                    Alpaca  -gga-----
               Bactrian camel  -gga-----
B D                   Dolphin  -gga-----
                 Killer whale  -gga-----
             Tibetan antelope  -gaa-----
B D                       Cow  -gaa-----
B D                     Sheep  -gaa-----
                Domestic goat  -gaa-----
B D                     Horse  -aga-----
B D          White rhinoceros  -aga-----
B D                       Cat  -gga-----
B D                       Dog  -gga-----
B D                   Ferret   -gga-----
B D                     Panda  -gga-----
               Pacific walrus  -gga-----
                 Weddell seal  -gga-----
B D                  Hedgehog  -aga-----
              Star-nosed mole  -aga-----
B D                  Elephant  -gga-----
B D                   Manatee  -gga-----
             Cape golden mole  -gga-----
B D                    Tenrec  -agg-----
                     Aardvark  -aga-----
B D                 Armadillo  -aga-----
      Lesser Egyptian jerboa  =========
         Cape elephant shrew  ---------
B D                     Shrew  =========
B D                      Pika  =========
B D                  Squirrel  ---------
              Golden hamster  ---------
                Prairie vole  ---------
B D                       Rat  ---------
B D                     Mouse  ---------
B D           Chinese hamster  ---------
B D                Guinea pig  ---------
            Brush-tailed rat  ---------
            Black flying-fox  ---------
B D            Naked mole-rat  ---------
                  Chinchilla  ---------
B D                      Fugu  =========
B D                  Microbat  ---------
        David's myotis (bat)  ---------
               Big brown bat  ---------
    Mexican tetra (cavefish)  =========
B D                   Lamprey  =========
B D                    Rabbit  ---------
B D               Stickleback  =========
      Yellowbelly pufferfish  =========
B D                 Tetraodon  =========
B D                Coelacanth  =========
         Pundamilia nyererei  =========
                 Zebra mbuna  =========
       Burton's mouthbreeder  =========
         Princess of Burundi  =========
B D              Nile tilapia  =========
  D             Scarlet macaw  =========
  D                    Parrot  =========
  D    White-throated sparrow  =========
B D                    Medaka  =========
          Southern platyfish  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
B D                   Wallaby  =========
  D               Rock pigeon  =========
B D                Budgerigar  =========
B D                   Chicken  =========
B D       Medium ground finch  =========
                 Spotted gar  =========
  D           Green seaturtle  =========
B D                    Lizard  =========
  D              Mallard duck  =========
B D        American alligator  =========
  D       Collared flycatcher  =========
          Tibetan ground jay  =========
B D                    Turkey  =========
B D              Atlantic cod  =========
B D                 Zebrafish  =========
B D             X. tropicalis  =========
B D               Zebra finch  =========
B D                  Platypus  =========
B D           Tasmanian devil  =========
B D                   Megabat  ---------
B D                   Opossum  =========
  D            Painted turtle  =========
B D                       Pig  =========
  D  Chinese softshell turtle  =========
  D    Spiny softshell turtle  =========

Alignment block 12 of 568 in window, 177389938 - 177390012, 75 bps 
B D                     Human  tttc--ctcggcttggagagt------agctg-------gt-gg---------gtggga-----------
B D                     Chimp  tttc--ctcggcttggagagt------agctg-------gt-gg---------gtggga-----------
B D                   Gorilla  tttc--cttggcttggagagt------agctg-------gt-gg---------gtggga-----------
B D                 Orangutan  ttgc--ctcggctgggagagt------agctg-------ct-gg---------gtggga-----------
B D                    Gibbon  tttc--ctcggcttggagagt------agctg-------gt-gg---------gtggga-----------
B D                    Rhesus  tttc--ctcggctcggagagt------agctg-------gt-gg---------gtggga-----------
B D       Crab-eating macaque  tttc--ctcggctcggagagt------agctg-------gt-gg---------gtggga-----------
B D                    Baboon  tttc--ctcggctcggagagt------agctg-------gt-gg---------gtggga-----------
B D              Green monkey  tttc--ctcggctcggagagt------agctg-------gc-gg---------gtggga-----------
B D                  Marmoset  tttc--ctcggcttggagagt------aactg-------gt-gg---------gtggga-----------
B D           Squirrel monkey  tttc--ctcggcttggagagc------agctg-------gt-gg---------ggggga-----------
B D                  Bushbaby  tttt--tttgtcttgcaaagt------agccg-------tg-gg---------gtggga-----------
           Chinese tree shrew  tttc--ct--gctcagagact------agcag-------ag-ct---------ggagga-----------
B D                  Squirrel  tttt--cttggcttggaaagt------agctg-------ggggc---------ggggga-----------
       Lesser Egyptian jerboa  tttt--cttgtcttggaacgt------agct--------agggg---------attgga-----------
                 Prairie vole  attt--cttggcttgggacgt------a--------------aa---------gctgga-----------
B D           Chinese hamster  -----------------------------------------------------gccggg-----------
               Golden hamster  aaac--ctttctctgtaac------------------------a---------gctggt-----------
B D                     Mouse  attt--cttggcttggagtat------a--------------ag---------gctgga-----------
B D                       Rat  gtca--cttgcc--agagcac------c--------------ag---------tcc--------------
B D            Naked mole-rat  --------cagcttggaaact------agct-----------gg---------gaatgg-----------
B D                Guinea pig  --------cagcttggaagct------gggt-----------gg---------ggaggg-----------
                   Chinchilla  --------cagcttggaagct------aggt-----------gg---------ggatgg-----------
             Brush-tailed rat  --------cagcttggaagct------aggt-----------gg---------g---ag-----------
B D                    Alpaca  tttc--cttggcttggagagt------agct--------gg-gg---------gtggga-----------
               Bactrian camel  tttc--cttggcttggagagt------agct--------gg-gg---------gtggga-----------
B D                   Dolphin  tttc--cttggcttggagagt------agct--------gg-gg---------gtggga-----------
                 Killer whale  tttc--cttggcttggagagt------agct--------gg-gg---------gtggga-----------
             Tibetan antelope  tttc--cttggcctggagagt------ggcg--------gg-gg---------gtggga-----------
B D                       Cow  tttc--cttggcctggagagt------ggca--------ga-gg---------gtgtga-----------
B D                     Sheep  tttc--cttggcctggagagt------ggcg--------gg-gg---------gggggg-----------
                Domestic goat  tttc--cttggcctggagagt------ggct--------gg-gg---------agggggnnnnnnnnnnn
B D                     Horse  tttc--cttggcctggagagt------agctg-------gg-gg---------gtggga-----------
B D          White rhinoceros  tttt--cttggcttggagagt------agcta-------gg-tg---------gtggga-----------
B D                       Cat  tttc--cctggcttggagagt------agctg-------ag-gg---------gtggga-----------
B D                       Dog  tttc--cttggcttggacagt------agctgcgggggagg-gg---------gtggca-----------
B D                   Ferret   tttc--cctggcttgaagagt------agcag-------ac-ag---------gtggca-----------
B D                     Panda  tttc--cctggctcggagagg------agccg-------ag-gg---------gtggca-----------
               Pacific walrus  tttc--ccgggctt-gagagt------agctg-------ag-gg---------gtggca-----------
                 Weddell seal  tttc--ccgggctt-gagagt------agctg-------ag-gg---------gtggca-----------
             Black flying-fox  tctt--gtccacctggagagt------agcc--------at-gg---------gcggga-----------
B D                   Megabat  tctt--gtccacctggagagt------agcc--------at-gg---------gtggga-----------
                Big brown bat  tttc--cttggctgggagagt------aactg-------gc-gg---------gtggga-----------
         David's myotis (bat)  tttc--cttggcttggagagt------aactg-------gc-gg---------gtggga-----------
B D                  Microbat  tttc--cttggcttggagagt------aactg-------gc-gg---------gtggga-----------
B D                  Hedgehog  ttcc--ttggcc--agagggtaaccaggactg-------gg-gg---------acagtg-----------
              Star-nosed mole  tttcggtggggcttggagagt------ggctg-------gg-gg---------tttgcc-----------
B D                  Elephant  ttcc--cttggcatggagagt------ggctg-------gt-g----------ggggga-----------
          Cape elephant shrew  ---c--cctggca-------t------ggctg-------gt-a----------gggcac-----------
B D                   Manatee  tttc--cttggcatggaaagt------ggctc-------gt-gc---------acggat-----------
             Cape golden mole  tttc--cttggtgcagagagt------gactg-------gt-gtgtgtgacagggggga-----------
B D                    Tenrec  tttc--cttgctgtggagagg------ggctg-------gc-cggggt-----gggggg-----------
                     Aardvark  tttc--cttggtgtggagagt------ggctg-------gt-g----------ggggga-----------
B D                 Armadillo  gtcc--ctcagctcggagggt------gg------------------------gggtgg-----------
B D                     Shrew  ======================================================================
B D                      Pika  ======================================================================
B D                      Fugu  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                   Lamprey  ======================================================================
B D                    Rabbit  ----------------------------------------------------------------------
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                 Tetraodon  ======================================================================
B D                Coelacanth  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                    Medaka  ======================================================================
          Southern platyfish  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
                 Spotted gar  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Lizard  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
  D       Collared flycatcher  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Turkey  ======================================================================
B D              Atlantic cod  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D               Zebra finch  ======================================================================
B D                  Platypus  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D            Painted turtle  ======================================================================
B D                       Pig  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D    Spiny softshell turtle  ======================================================================

                        Human  -----cccaagctct---------c-actttcatcc-cc--tttctgg-----gacag------------
                        Chimp  -----cccaagctct---------c-actttcatcc-cc--tttctgg-----gacag------------
                      Gorilla  -----cccaagctct---------c-actttcatcc-tc--tttctgg-----gacag------------
                    Orangutan  -----cccaagctct---------c-actttcatcc-tc--tttctgg-----gaccg------------
                       Gibbon  -----cccaagctct---------c-actttcatcc-tc--tttctgg-----gaccg------------
                       Rhesus  -----cccaagctct---------c-acgttcaccc-tc--tttctgg-----gaccc------------
          Crab-eating macaque  -----cccaagctct---------c-acgttcaccc-tc--tttctgg-----gaccc------------
                       Baboon  -----cccaagctct---------c-acgttcaccc-tc--tttctgg-----gaccc------------
                 Green monkey  -----cccaagctct---------c-acgttcaccc-tc--tttctgg-----gaccc------------
                     Marmoset  -----cctgagctct---------c-actttcatcc-tc--ttcctgg-----gacga------------
              Squirrel monkey  -----cccgagctct---------c-actttcatcc-tc--ttcctgg-----gaccg------------
                     Bushbaby  -----tttgagctcc---------ctgctcccaccc-tt--tccctgg-----gactg------------
           Chinese tree shrew  -----cccaagtgcc---------c-cggttc-tac-tg--tctctgg-----gactg------------
                     Squirrel  -----tctgagatcc---------ctgctctcaccc-tc--cctctgg-----gactg------------
       Lesser Egyptian jerboa  -----gaggagtcct---------ttg---------------ctctgg-----gcttg------------
                 Prairie vole  -----tctgagcccc---------ctgctctctgcc-tc--cctctgg-----acctg------------
              Chinese hamster  -----cctgc-cttc---------cagctctttgcc-gc--tctctgg-----agctg------------
               Golden hamster  -----ggtg--tttc---------ttggtttggaat-gc--tctctgg-----acctg------------
                        Mouse  -----tctgaggacc---------ctgctctctgcc-tc---ctctgg-----acctg------------
                          Rat  ---------aggtcc---------ttgcgcta--------------------------------------
               Naked mole-rat  -----gatgagttcc---------ctgcactcaccc-tc--cttcggg-----gactt------------
                   Guinea pig  -----gat-agttcc---------ctgctctcgccc-tc--cctcgga-----gactt------------
                   Chinchilla  -----gacgagttcc---------ctgtgctcaccc-tc--cgtcagg-----gactt------------
             Brush-tailed rat  -----gatgagttcc---------ctgttctcaccc-tc--cctcggg-----gacgt------------
                       Alpaca  -----ggtgagctcc---------ctgttctcgccc-ccaatctctgg-----gacag------------
               Bactrian camel  -----ggtgagctcc---------ctgttctcgccc-ccaatctctgg-----gacag------------
                      Dolphin  -----tgtgagctcc---------ctgttctggccc-tc--tctctgg-----gacag------------
                 Killer whale  -----tgtgagctcc---------ctgttctggccc-tc--tctctgg-----gacag------------
             Tibetan antelope  -----tgtaagctcc---------tggtcccggccc-tc--tctctgg-----gacag------------
                          Cow  -----ggtaagctcc---------cggtcctggccc-tt--tctctgg-----gacag------------
                        Sheep  -----gggaaggtcc---------tgggccccgccc-cc--cccctgg-----ggcag------------
                Domestic goat  nnnnaggtaagctcc---------tggtcccggccc-tc--tctctgg-----gacag------------
                        Horse  -----tccgagctcc---------ctggcctc-ccc-tc--tctctgg-----g----------------
             White rhinoceros  -----tctgagctcc---------ctggtctc-ccc-tc--tctctgg-----g----------------
                          Cat  -----tccaagctcc---------ctgttctcaccc-tc--tctctag-----gtcag------------
                          Dog  -----tacaagctcc---------ctgttctcacccgcc--cctctag-----gtcag------------
                      Ferret   -----ttcgagctcc---------cttttctcatcc-tc--tcttgag-----gtcag------------
                        Panda  -----tccaagctcc---------ctgttctcaccc-tc--tctcgag-----gtcgg------------
               Pacific walrus  -----cccaggctcc---------ctgttctcaccc-tc--tctcaag-----gtcag------------
                 Weddell seal  -----tccaagctcc---------ctgttctcaccc-tc--tctcgag-----gtcgg------------
             Black flying-fox  -----tctgagctcc---------ctgttcttaccc-tc--tctg--g-----gacag------------
                      Megabat  -----tctgagctcc---------ctgttcttaccc-tc--tctg--g-----gacag------------
                Big brown bat  -----cttgagctcc---------ctgttcttactc-tc--tccc-------------------------
         David's myotis (bat)  -----ctcgagctcc---------ccgttctcactc-tc--tcct-------------------------
                     Microbat  -----ctcgagctcc---------ctgttcttactc-tc--tccc-------------------------
                     Hedgehog  -----cctt--ctccattggagag----------------------------------------------
              Star-nosed mole  -----cctcagctcc-------------------------------------------------------
                     Elephant  -----tcagagctcc---------ctgttctcacca-tt--cccctgg-----agcac------------
          Cape elephant shrew  -----gcaaagggcc---------ctgttctcac---tt--cacctgg-----ggcattgctctgcag--
                      Manatee  -----ccagagctcc---------ctgttctcgctt-tt--cctctgg-----ggcac------------
             Cape golden mole  -----tcagagctcc---------ttgctcccacca-tc--tccctgc----tgaaac----------tc
                       Tenrec  -----tcagagctgc---------ccgcactcatct-tc--tctctgg----cagtgc----------cc
                     Aardvark  -----tcagagcccc---------ctgttctcaccc-tc--tctttggg---ctgtgc----------cc
                    Armadillo  -----tcagagctag---------cagttctcacca-cg--ctctgggactttgattc------------
                        Shrew  ======================================================================
                         Pika  ======================================================================
                         Fugu  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                      Lamprey  ======================================================================
                       Rabbit  ----------------------------------------------------------------------
                  Stickleback  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                    Tetraodon  ======================================================================
                   Coelacanth  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                Scarlet macaw  ======================================================================
                       Parrot  ======================================================================
       White-throated sparrow  ======================================================================
                       Medaka  ======================================================================
           Southern platyfish  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                  Spotted gar  ======================================================================
              Green seaturtle  ======================================================================
                       Lizard  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                       Turkey  ======================================================================
                 Atlantic cod  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
                  Zebra finch  ======================================================================
                     Platypus  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
               Painted turtle  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
       Spiny softshell turtle  ======================================================================

                        Human  -cgcc--cc
                        Chimp  -cgcc--cc
                      Gorilla  -tgcc--cc
                    Orangutan  -cgcc--cc
                       Gibbon  -tgcc--tc
                       Rhesus  -cgc----c
          Crab-eating macaque  -cgc----c
                       Baboon  -cgc----c
                 Green monkey  -cgc----c
                     Marmoset  -tgcc--cc
              Squirrel monkey  -tgcc--ct
                     Bushbaby  -tcct--tc
           Chinese tree shrew  --gcc--ct
                     Squirrel  -t-cc--ct
       Lesser Egyptian jerboa  -t-tc--ac
                 Prairie vole  -tgcc--ct
              Chinese hamster  -c-cc--ct
               Golden hamster  -t-cc--cc
                        Mouse  -tccc--ct
                          Rat  ---------
               Naked mole-rat  -ttgc--cc
                   Guinea pig  -ttgc--tc
                   Chinchilla  -ttgc--cc
             Brush-tailed rat  -ttgt--cc
                       Alpaca  -tcccc---
               Bactrian camel  -tcccc---
                      Dolphin  -tcccc---
                 Killer whale  -tcccc---
             Tibetan antelope  -tcccct--
                          Cow  -tcccc---
                        Sheep  -tccccc--
                Domestic goat  -tcccct--
                        Horse  ---------
             White rhinoceros  ---------
                          Cat  -atcc----
                          Dog  -acca----
                      Ferret   -tcca----
                        Panda  -gtca----
               Pacific walrus  -gtca----
                 Weddell seal  -gtca----
             Black flying-fox  -tctc----
                      Megabat  -tctc----
                Big brown bat  ---------
         David's myotis (bat)  ---------
                     Microbat  ---------
                     Hedgehog  ---------
              Star-nosed mole  ---------
                     Elephant  ---------
          Cape elephant shrew  ---------
                      Manatee  ---------
             Cape golden mole  c--------
                       Tenrec  t--------
                     Aardvark  t--------
                    Armadillo  ---------
                        Shrew  =========
                         Pika  =========
                         Fugu  =========
     Mexican tetra (cavefish)  =========
                      Lamprey  =========
                       Rabbit  ---------
                  Stickleback  =========
       Yellowbelly pufferfish  =========
                    Tetraodon  =========
                   Coelacanth  =========
          Pundamilia nyererei  =========
                  Zebra mbuna  =========
        Burton's mouthbreeder  =========
          Princess of Burundi  =========
                 Nile tilapia  =========
                Scarlet macaw  =========
                       Parrot  =========
       White-throated sparrow  =========
                       Medaka  =========
           Southern platyfish  =========
             Peregrine falcon  =========
                 Saker falcon  =========
                      Wallaby  =========
                  Rock pigeon  =========
                   Budgerigar  =========
                      Chicken  =========
          Medium ground finch  =========
                  Spotted gar  =========
              Green seaturtle  =========
                       Lizard  =========
                 Mallard duck  =========
           American alligator  =========
          Collared flycatcher  =========
           Tibetan ground jay  =========
                       Turkey  =========
                 Atlantic cod  =========
                    Zebrafish  =========
                X. tropicalis  =========
                  Zebra finch  =========
                     Platypus  =========
              Tasmanian devil  =========
                      Opossum  =========
               Painted turtle  =========
                          Pig  =========
     Chinese softshell turtle  =========
       Spiny softshell turtle  =========

Inserts between block 12 and 13 in window
B D                    Sheep 111bp
B D                Armadillo 2bp

Alignment block 13 of 568 in window, 177390013 - 177390027, 15 bps 
B D                     Human  gaaggagtgt-ga--ctc
B D                     Chimp  gaaggagtgt-ga--ctc
B D                   Gorilla  gaaggagtgt-ga--ctc
B D                 Orangutan  gaaggagtgt-ga--ctc
B D                    Gibbon  gaaggagtgt-ga--ctc
B D                    Rhesus  gaaggagggt-ga--ctc
B D       Crab-eating macaque  gaaggagggt-ga--ctc
B D                    Baboon  gaaggagtgt-ga--ctc
B D              Green monkey  gaaggagtgt-ga--ctc
B D                  Marmoset  aaaggagtgt-gactctc
B D           Squirrel monkey  gaaggagtgt-ga--ctc
B D                  Bushbaby  atggggacat-ga--ctc
           Chinese tree shrew  gagggagcct-ga--ctc
B D                  Squirrel  atgagaatgg-ga--ctc
       Lesser Egyptian jerboa  caagggatga-aa--ctc
                 Prairie vole  gcaggaatgg-ga--ctc
B D           Chinese hamster  gcaggaatgt-ga--ctc
               Golden hamster  tcagggatgt-gg--ctc
B D                     Mouse  gcagggatgt-ga--ctt
B D                       Rat  gcaggaaacc-tc--ttt
B D            Naked mole-rat  ataggaatgt-ga--ttc
B D                Guinea pig  gtaggaatgt-ga--ttc
                   Chinchilla  ataggaacat-ga--ttc
             Brush-tailed rat  gtgggaactc-ct--ttc
B D                    Alpaca  tcgggaaggc-gg--ctc
               Bactrian camel  tcgggaaggt-gg--ctc
B D                   Dolphin  tttggaaagt-gg--ctc
                 Killer whale  tttggaaagt-gg--ctc
             Tibetan antelope  -caagaaagt-gg--ttc
B D                       Cow  tcaggaaagt-gg--ttc
                Domestic goat  -caagaaagt-gg--ttc
B D                     Horse  --------atggg--ccc
B D          White rhinoceros  --------at-gg--ccc
B D                       Cat  tgtggaacat-gg--ctc
B D                       Dog  cggggaacag-gg--ctc
B D                   Ferret   tgtggaacat-gg--ctc
B D                     Panda  tgtggaacgt-gg--ctc
               Pacific walrus  tgtggaacac-gg--ctc
                 Weddell seal  tgtggaacac-gg--ctc
             Black flying-fox  tgggaacgtg-gc--tca
B D                   Megabat  tgggaacgtg-gc--tca
B D                  Hedgehog  -----aa-----------
              Star-nosed mole  -----ca-----------
             Cape golden mole  ------------t--ctc
B D                    Tenrec  gtgggcatgt-gc--ctc
                     Aardvark  ctgggaactt-ga--ctc
         Cape elephant shrew  ------------------
B D                     Shrew  ==================
B D                      Pika  ==================
B D                     Sheep  ==================
B D                 Armadillo  ==================
B D                  Elephant  ------------------
B D                   Manatee  ------------------
B D                      Fugu  ==================
B D                  Microbat  ------------------
        David's myotis (bat)  ------------------
               Big brown bat  ------------------
    Mexican tetra (cavefish)  ==================
B D                   Lamprey  ==================
B D                    Rabbit  ------------------
B D               Stickleback  ==================
      Yellowbelly pufferfish  ==================
B D                 Tetraodon  ==================
B D                Coelacanth  ==================
         Pundamilia nyererei  ==================
                 Zebra mbuna  ==================
       Burton's mouthbreeder  ==================
         Princess of Burundi  ==================
B D              Nile tilapia  ==================
  D             Scarlet macaw  ==================
  D                    Parrot  ==================
  D    White-throated sparrow  ==================
B D                    Medaka  ==================
          Southern platyfish  ==================
  D          Peregrine falcon  ==================
  D              Saker falcon  ==================
B D                   Wallaby  ==================
  D               Rock pigeon  ==================
B D                Budgerigar  ==================
B D                   Chicken  ==================
B D       Medium ground finch  ==================
                 Spotted gar  ==================
  D           Green seaturtle  ==================
B D                    Lizard  ==================
  D              Mallard duck  ==================
B D        American alligator  ==================
  D       Collared flycatcher  ==================
          Tibetan ground jay  ==================
B D                    Turkey  ==================
B D              Atlantic cod  ==================
B D                 Zebrafish  ==================
B D             X. tropicalis  ==================
B D               Zebra finch  ==================
B D                  Platypus  ==================
B D           Tasmanian devil  ==================
B D                   Opossum  ==================
  D            Painted turtle  ==================
B D                       Pig  ==================
  D  Chinese softshell turtle  ==================
  D    Spiny softshell turtle  ==================

Inserts between block 13 and 14 in window
                Prairie vole 1bp
            Cape golden mole 12bp
B D                   Tenrec 119bp
                    Aardvark 5bp

Alignment block 14 of 568 in window, 177390028 - 177390030, 3 bps 
B D                     Human  --ac-a
B D                     Chimp  --ac-a
B D                   Gorilla  --ac-a
B D                 Orangutan  --ac-a
B D                    Gibbon  --ac-a
B D                    Rhesus  --ac-a
B D       Crab-eating macaque  --ac-a
B D                    Baboon  --ac-a
B D              Green monkey  --ac-a
B D                  Marmoset  --ac-g
B D           Squirrel monkey  --ac-g
B D                  Bushbaby  --at-g
           Chinese tree shrew  --ac-a
B D                  Squirrel  --at-g
       Lesser Egyptian jerboa  --ac-a
                 Prairie vole  --gc-a
B D           Chinese hamster  --tc-a
               Golden hamster  --gc-a
B D                     Mouse  --ac-a
B D                       Rat  --ct-g
B D            Naked mole-rat  --at-g
B D                Guinea pig  --at-g
                   Chinchilla  --at-g
             Brush-tailed rat  --at-g
B D                    Alpaca  --acg-
               Bactrian camel  --acg-
B D                   Dolphin  --act-
                 Killer whale  --act-
             Tibetan antelope  --aca-
B D                       Cow  --aca-
                Domestic goat  --aca-
B D                     Horse  --ca--
B D          White rhinoceros  --cg--
B D                       Cat  --cg--
B D                       Dog  --tg--
B D                   Ferret   --cg--
B D                     Panda  --cg--
               Pacific walrus  --cg--
                 Weddell seal  --cg--
             Black flying-fox  --tg--
B D                   Megabat  --tg--
B D                  Elephant  gca---
          Cape elephant shrew  gag---
B D                   Manatee  cca---
             Cape golden mole  gca---
                     Aardvark  gca---
B D                 Armadillo  gca---
B D                  Hedgehog  ------
             Star-nosed mole  ------
B D                     Shrew  ======
B D                      Pika  ======
B D                     Sheep  ======
B D                    Tenrec  ======
B D                      Fugu  ======
B D                  Microbat  ------
        David's myotis (bat)  ------
               Big brown bat  ------
    Mexican tetra (cavefish)  ======
B D                   Lamprey  ======
B D                    Rabbit  ------
B D               Stickleback  ======
      Yellowbelly pufferfish  ======
B D                 Tetraodon  ======
B D                Coelacanth  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
  D             Scarlet macaw  ======
  D                    Parrot  ======
  D    White-throated sparrow  ======
B D                    Medaka  ======
          Southern platyfish  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
B D                   Wallaby  ======
  D               Rock pigeon  ======
B D                Budgerigar  ======
B D                   Chicken  ======
B D       Medium ground finch  ======
                 Spotted gar  ======
  D           Green seaturtle  ======
B D                    Lizard  ======
  D              Mallard duck  ======
B D        American alligator  ======
  D       Collared flycatcher  ======
          Tibetan ground jay  ======
B D                    Turkey  ======
B D              Atlantic cod  ======
B D                 Zebrafish  ======
B D             X. tropicalis  ======
B D               Zebra finch  ======
B D                  Platypus  ======
B D           Tasmanian devil  ======
B D                   Opossum  ======
  D            Painted turtle  ======
B D                       Pig  ======
  D  Chinese softshell turtle  ======
  D    Spiny softshell turtle  ======

Inserts between block 14 and 15 in window
            Brush-tailed rat 1bp
               Domestic goat 31bp

Alignment block 15 of 568 in window, 177390031 - 177390037, 7 bps 
B D                     Human  cagcagt-----
B D                     Chimp  cagcagt-----
B D                   Gorilla  cagcagt-----
B D                 Orangutan  cagcagt-----
B D                    Gibbon  cagcaat-----
B D                    Rhesus  cagcaat-----
B D       Crab-eating macaque  cagcaat-----
B D                    Baboon  cagcaat-----
B D              Green monkey  cagcaat-----
B D                  Marmoset  cagcgat-----
B D           Squirrel monkey  cggcgat-----
B D                  Bushbaby  cagaaat-----
           Chinese tree shrew  cc----------
B D                  Squirrel  cagcatt-----
       Lesser Egyptian jerboa  cagctgc-----
                 Prairie vole  cagccac-----
B D           Chinese hamster  cagccgt-----
               Golden hamster  cagccac-----
B D                     Mouse  cagcagc-----
B D                       Rat  taacagt-----
B D            Naked mole-rat  cagca-------
B D                Guinea pig  ccctg-------
                   Chinchilla  cccca-------
             Brush-tailed rat  cccca-------
B D                    Alpaca  cagcc-------
               Bactrian camel  cagcc-------
B D                   Dolphin  cagcc-------
                 Killer whale  cagcc-------
             Tibetan antelope  --atc-------
B D                       Cow  --atc-------
B D                     Horse  cgggg-------
B D          White rhinoceros  tggga-------
B D                       Cat  cagcc-------
B D                       Dog  ctgcc-------
B D                   Ferret   cagcc-------
B D                     Panda  cagcc-------
               Pacific walrus  cagcc-------
                 Weddell seal  cagcc-------
             Black flying-fox  aagcc-------
B D                   Megabat  aagcc-------
B D                  Hedgehog  cagct-------
              Star-nosed mole  cagct-------
B D                  Elephant  -----ctgggg-
          Cape elephant shrew  -----ctggggt
B D                   Manatee  -----ctgggg-
             Cape golden mole  -----ctggg--
                     Aardvark  -----atgggct
B D                 Armadillo  -----gcgaagt
B D                     Shrew  ============
B D                      Pika  ============
               Domestic goat  ============
B D                     Sheep  ============
B D                    Tenrec  ============
B D                      Fugu  ============
B D                  Microbat  ------------
        David's myotis (bat)  ------------
               Big brown bat  ------------
    Mexican tetra (cavefish)  ============
B D                   Lamprey  ============
B D                    Rabbit  ------------
B D               Stickleback  ============
      Yellowbelly pufferfish  ============
B D                 Tetraodon  ============
B D                Coelacanth  ============
         Pundamilia nyererei  ============
                 Zebra mbuna  ============
       Burton's mouthbreeder  ============
         Princess of Burundi  ============
B D              Nile tilapia  ============
  D             Scarlet macaw  ============
  D                    Parrot  ============
  D    White-throated sparrow  ============
B D                    Medaka  ============
          Southern platyfish  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
B D                   Wallaby  ============
  D               Rock pigeon  ============
B D                Budgerigar  ============
B D                   Chicken  ============
B D       Medium ground finch  ============
                 Spotted gar  ============
  D           Green seaturtle  ============
B D                    Lizard  ============
  D              Mallard duck  ============
B D        American alligator  ============
  D       Collared flycatcher  ============
          Tibetan ground jay  ============
B D                    Turkey  ============
B D              Atlantic cod  ============
B D                 Zebrafish  ============
B D             X. tropicalis  ============
B D               Zebra finch  ============
B D                  Platypus  ============
B D           Tasmanian devil  ============
B D                   Opossum  ============
  D            Painted turtle  ============
B D                       Pig  ============
  D  Chinese softshell turtle  ============
  D    Spiny softshell turtle  ============

Inserts between block 15 and 16 in window
                Prairie vole 4bp
B D          Chinese hamster 4bp
              Golden hamster 4bp
B D                    Mouse 72bp

Alignment block 16 of 568 in window, 177390038 - 177390065, 28 bps 
B D                     Human  ggatgtgctt-----ggtcttgc------------------------------------------aaagt
B D                     Chimp  ggatgtgctt-----ggtcttgc------------------------------------------aaaat
B D                   Gorilla  ggatgtgctt-----ggtcttgc------------------------------------------aaagt
B D                 Orangutan  ggatgtgctt-----ggtcttgc------------------------------------------gaagt
B D                    Gibbon  ggatg---------------tgc------------------------------------------aaagt
B D                    Rhesus  ggatgtgctt-----ggtcttgc-------gaagtgtgaagtgcgaagtgtgaagtgtgaagtgcgaagt
B D       Crab-eating macaque  ggatgtgctt-----ggtcttgc-------gaagtgtgaagtgcgaagtgtgaagtgtgaagtgcgaagt
B D                    Baboon  ggatgtgctt-----ggtcttgcgaagtgtgaagtgtgaagtgcgaagtgtgaagtgtgaagtgcgaagt
B D              Green monkey  ggatgtgctt-----ggtcttgc---------------------gaagtgtgaagtgtgaagtgcgaagt
B D                  Marmoset  agatgcgctt-----gctcttgc------------------------------------------aaaat
B D           Squirrel monkey  agatgcgctt-----gctcttgc------------------------------------------aaagt
B D                  Bushbaby  ggatgtactg-----tgtcttga-----------------------------------------------
           Chinese tree shrew  -cgtgtgctc-----gctctgct------------------------------------------gaggt
B D                  Squirrel  --gtg--tgt-----gctcttgt------------------------------------------gataa
       Lesser Egyptian jerboa  --atc-acat-----gctcttgg------------------------------------------ggtgg
                 Prairie vole  -------cgc-----gcttctgg------------------------------------------cgtct
B D           Chinese hamster  -------ggc-----gctcttgg------------------------------------------c-tgt
               Golden hamster  -------gg------gttcttgg------------------------------------------catga
B D                       Rat  -------ag------gttctcgg------------------------------------------c-tta
B D            Naked mole-rat  ---------t-----gctcttat------------------------------------------gatgt
B D                Guinea pig  ---------t-----gctcttgt------------------------------------------gacgt
                   Chinchilla  ---------t-----gctcttat------------------------------------------gatgt
             Brush-tailed rat  ---------t-----gctcttgt------------------------------------------gatgt
B D                    Alpaca  --atgtgcgt-----gctcttgg------------------------------------------gaggt
               Bactrian camel  --atgtgcgt-----gctcttgg------------------------------------------gaggt
B D                   Dolphin  --acgtgcactggcagctcttgc-----------------------------------------actgaa
                 Killer whale  --acgtgcactggcagctcctgc-----------------------------------------actgaa
             Tibetan antelope  --atgagccatggcagctccttc-----------------------------------------------
B D                       Cow  --aggtgccctggcagctcctcc-----------------------------------------------
B D                     Horse  --acgtgct-------------------------------------------------------------
B D          White rhinoceros  --acgtgct-------------------------------------------------------------
B D                       Cat  --atgtgctt-----gctct-----------------------------------------------tgc
B D                       Dog  --ctgtgctt-----gctct-----------------------------------------------cgc
B D                   Ferret   --ccgtgcct-----gctct-----------------------------------------------ggc
B D                     Panda  --acgtgcct-----gctct-----------------------------------------------cgc
               Pacific walrus  --cactacct-----gctcc-----------------------------------------------ggc
                 Weddell seal  --gagtacct-----gctcc-----------------------------------------------ggc
             Black flying-fox  --atgtgctc-----attcttgg------------------------------------------gaggt
B D                   Megabat  --atgtgctc-----attcttgg------------------------------------------gaagt
                Big brown bat  ------ttat-----gctctcgg------------------------------------------gaggt
         David's myotis (bat)  -------gac-----gctctcgg------------------------------------------gaggt
B D                  Microbat  -------tcg-----ggaggagg------------------------------------------gagga
B D                  Hedgehog  --atgtactt-----ccttaca------------------------------------------------
              Star-nosed mole  --gtgcgctc-----tctcccac-----------------------------------------------
          Cape elephant shrew  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
B D                 Armadillo  ----------------------------------------------------------------------
B D                     Shrew  ======================================================================
B D                      Pika  ======================================================================
B D                     Mouse  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                    Tenrec  ======================================================================
B D                  Elephant  ----------------------------------------------------------------------
B D                   Manatee  ----------------------------------------------------------------------
B D                      Fugu  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                   Lamprey  ======================================================================
B D                    Rabbit  ----------------------------------------------------------------------
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                 Tetraodon  ======================================================================
B D                Coelacanth  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                    Medaka  ======================================================================
          Southern platyfish  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
                 Spotted gar  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Lizard  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
  D       Collared flycatcher  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Turkey  ======================================================================
B D              Atlantic cod  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D               Zebra finch  ======================================================================
B D                  Platypus  ======================================================================
B D           Tasmanian devil  ======================================================================
            Cape golden mole  ----------------------------------------------------------------------
B D                   Opossum  ======================================================================
  D            Painted turtle  ======================================================================
B D                       Pig  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D    Spiny softshell turtle  ======================================================================

                        Human  gtgaa------------------------
                        Chimp  gtgaa------------------------
                      Gorilla  gtgaa------------------------
                    Orangutan  gtgaa------------------------
                       Gibbon  gtgaa------------------------
                       Rhesus  gtgaa------------------------
          Crab-eating macaque  gtgaa------------------------
                       Baboon  gtgaa------------------------
                 Green monkey  gtgaa------------------------
                     Marmoset  gtgaa------------------------
              Squirrel monkey  gtgaa------------------------
                     Bushbaby  --gaa------------------------
           Chinese tree shrew  gcg-g------------------------
                     Squirrel  gct--------------------------
       Lesser Egyptian jerboa  aaa--------------------------
                 Prairie vole  gcg--------------------------
              Chinese hamster  gct--------------------------
               Golden hamster  gct--------------------------
                          Rat  gag--------------------------
               Naked mole-rat  gca--------------------------
                   Guinea pig  gaa--------------------------
                   Chinchilla  gca--------------------------
             Brush-tailed rat  gca--------------------------
                       Alpaca  g----------------------------
               Bactrian camel  g----------------------------
                      Dolphin  g----------------------------
                 Killer whale  g----------------------------
             Tibetan antelope  -----------------------------
                          Cow  -----------------------------
                        Horse  -----------------------------
             White rhinoceros  -----------------------------
                          Cat  t----------------------------
                          Dog  c----------------------------
                      Ferret   c----------------------------
                        Panda  c----------------------------
               Pacific walrus  c----------------------------
                 Weddell seal  c----------------------------
             Black flying-fox  g----------------------------
                      Megabat  g----------------------------
                Big brown bat  g----------------------------
         David's myotis (bat)  g----------------------------
                     Microbat  g----------------------------
                     Hedgehog  -----------------------------
              Star-nosed mole  -----------------------------
          Cape elephant shrew  ----------------ccaggatcaaaga
                     Aardvark  -------tgctcttcccctgtagcatgca
                    Armadillo  ----gtgtgctctttatctggaacacaca
                        Shrew  =============================
                         Pika  =============================
                        Mouse  =============================
                Domestic goat  =============================
                        Sheep  =============================
                       Tenrec  =============================
                     Elephant  -----------------------------
                      Manatee  -----------------------------
                         Fugu  =============================
     Mexican tetra (cavefish)  =============================
                      Lamprey  =============================
                       Rabbit  -----------------------------
                  Stickleback  =============================
       Yellowbelly pufferfish  =============================
                    Tetraodon  =============================
                   Coelacanth  =============================
          Pundamilia nyererei  =============================
                  Zebra mbuna  =============================
        Burton's mouthbreeder  =============================
          Princess of Burundi  =============================
                 Nile tilapia  =============================
                Scarlet macaw  =============================
                       Parrot  =============================
       White-throated sparrow  =============================
                       Medaka  =============================
           Southern platyfish  =============================
             Peregrine falcon  =============================
                 Saker falcon  =============================
                      Wallaby  =============================
                  Rock pigeon  =============================
                   Budgerigar  =============================
                      Chicken  =============================
          Medium ground finch  =============================
                  Spotted gar  =============================
              Green seaturtle  =============================
                       Lizard  =============================
                 Mallard duck  =============================
           American alligator  =============================
          Collared flycatcher  =============================
           Tibetan ground jay  =============================
                       Turkey  =============================
                 Atlantic cod  =============================
                    Zebrafish  =============================
                X. tropicalis  =============================
                  Zebra finch  =============================
                     Platypus  =============================
              Tasmanian devil  =============================
             Cape golden mole  -----------------------------
                      Opossum  =============================
               Painted turtle  =============================
                          Pig  =============================
     Chinese softshell turtle  =============================
       Spiny softshell turtle  =============================

Alignment block 17 of 568 in window, 177390066 - 177390077, 12 bps 
B D                     Human  gtgcgtcctg---gc
B D                     Chimp  gtgcgtcctg---gc
B D                   Gorilla  gtgcgtcctg---gc
B D                 Orangutan  gtgcgtcctg---gc
B D                    Gibbon  gtgagtcctg---gc
B D                    Rhesus  gtgcctcctg---gc
B D       Crab-eating macaque  gtgcctcctg---gc
B D                    Baboon  gtgcctcctg---gc
B D              Green monkey  gtgcctcctg---gc
B D                  Marmoset  gtgcgtcctg---gc
B D           Squirrel monkey  gtgcgtcctg---gc
B D                  Bushbaby  gtacatggtg---gg
           Chinese tree shrew  gtg------------
B D                  Squirrel  ----ttggtg---ac
       Lesser Egyptian jerboa  ----tcag-------
                 Prairie vole  ----tgggtg---gc
B D           Chinese hamster  ----ttggag---gg
               Golden hamster  ----ttggtg---ag
B D                       Rat  ----tgtaag---g-
B D            Naked mole-rat  ----ttcgtg---gc
B D                Guinea pig  ----ttggtg---gc
                   Chinchilla  ----tcagtg---gc
             Brush-tailed rat  ----ttggtg---ac
B D                    Alpaca  atgtacgttg---ac
               Bactrian camel  atgtacattg---ac
B D                   Dolphin  actcacgt-------
                 Killer whale  actcacgt-------
             Tibetan antelope  -tacacat-------
B D                       Cow  -tacacat-------
B D                       Cat  gtgtgtgctg---gt
B D                       Dog  acgtgtgctg---gt
B D                   Ferret   atgtgtgctg---gg
B D                     Panda  atgtgtgctg---gt
               Pacific walrus  atgtgtactc---gt
                 Weddell seal  atgtgtactt---gt
             Black flying-fox  acatgtgttg---gc
B D                   Megabat  acatgtgttg---gc
                Big brown bat  atgtgtgtta---gc
         David's myotis (bat)  atgtgtgtta---gc
B D                  Microbat  atgtgtgttc---gc
B D                  Hedgehog  --gtgtttca---gc
              Star-nosed mole  --atgcatca---gt
B D                  Elephant  -------------gc
          Cape elephant shrew  ----gctggctctgc
B D                   Manatee  -------------gc
             Cape golden mole  -------------gc
                     Aardvark  ----t--------gc
B D                 Armadillo  ----tcggcg---gc
B D                     Shrew  ===============
B D                      Pika  ===============
B D                     Mouse  ===============
               Domestic goat  ===============
B D                     Sheep  ===============
B D                    Tenrec  ===============
B D          White rhinoceros  ---------------
B D                     Horse  ---------------
B D                      Fugu  ===============
    Mexican tetra (cavefish)  ===============
B D                   Lamprey  ===============
B D                    Rabbit  ---------------
B D               Stickleback  ===============
      Yellowbelly pufferfish  ===============
B D                 Tetraodon  ===============
B D                Coelacanth  ===============
         Pundamilia nyererei  ===============
                 Zebra mbuna  ===============
       Burton's mouthbreeder  ===============
         Princess of Burundi  ===============
B D              Nile tilapia  ===============
  D             Scarlet macaw  ===============
  D                    Parrot  ===============
  D    White-throated sparrow  ===============
B D                    Medaka  ===============
          Southern platyfish  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
B D                   Wallaby  ===============
  D               Rock pigeon  ===============
B D                Budgerigar  ===============
B D                   Chicken  ===============
B D       Medium ground finch  ===============
                 Spotted gar  ===============
  D           Green seaturtle  ===============
B D                    Lizard  ===============
  D              Mallard duck  ===============
B D        American alligator  ===============
  D       Collared flycatcher  ===============
          Tibetan ground jay  ===============
B D                    Turkey  ===============
B D              Atlantic cod  ===============
B D                 Zebrafish  ===============
B D             X. tropicalis  ===============
B D               Zebra finch  ===============
B D                  Platypus  ===============
B D           Tasmanian devil  ===============
B D                   Opossum  ===============
  D            Painted turtle  ===============
B D                       Pig  ===============
  D  Chinese softshell turtle  ===============
  D    Spiny softshell turtle  ===============

Inserts between block 17 and 18 in window
B D                   Alpaca 6bp
              Bactrian camel 6bp
B D                      Cat 3bp
B D                      Dog 3bp
B D                  Ferret  3bp
B D                    Panda 3bp
              Pacific walrus 3bp
                Weddell seal 3bp
            Black flying-fox 3bp
B D                  Megabat 3bp
               Big brown bat 3bp
        David's myotis (bat) 3bp
B D                 Microbat 3bp
B D                 Hedgehog 3bp
             Star-nosed mole 2bp

Alignment block 18 of 568 in window, 177390078 - 177390092, 15 bps 
B D                     Human  tctt---------------------cct-gc--ccaaag
B D                     Chimp  tctt---------------------cct-gc--ccaaag
B D                   Gorilla  tcct---------------------cct-gc--ccaaag
B D                 Orangutan  tcct---------------------cct-gc--tcaaag
B D                    Gibbon  tcct---------------------cct-gc--ccaaag
B D                    Rhesus  tcct---------------------cct-gc--ccaaag
B D       Crab-eating macaque  tcct---------------------cct-gc--ctaaag
B D                    Baboon  tcct---------------------cct-gc--ccaaag
B D              Green monkey  tcct---------------------cct-gc--ccaaag
B D                  Marmoset  tcct---------------------cct-gc--ctgaag
B D           Squirrel monkey  tcct---------------------cct-gc--ctgaag
B D                  Bushbaby  tcct---------------------cct-gca-ctgaag
           Chinese tree shrew  ---------------------------------gtgagg
B D                  Squirrel  tcct---------------------cct-gta-ccaaag
       Lesser Egyptian jerboa  -ctt---------------------tct-gta-ccacag
                 Prairie vole  tctt---------------------cct-att-cca---
B D           Chinese hamster  tctt---------------------cct-tta-cta---
               Golden hamster  tctc---------------------cct-tta-tta---
B D            Naked mole-rat  tcct---------------------cct-gca-ccaaag
B D                Guinea pig  actc---------------------cct-gca-ccaaag
                   Chinchilla  tcct---------------------cct-gca-ccaaag
             Brush-tailed rat  tcct---------------------cca-gca-ccaaag
B D                    Alpaca  ttct---------------------gctc----------
               Bactrian camel  ttct---------------------gctc----------
B D                   Dolphin  tttt---------------------cct-----------
                 Killer whale  tttt---------------------cct-----------
             Tibetan antelope  tttt---------------------cct-----------
B D                       Cow  tttt---------------------cct-----------
                Domestic goat  tttt---------------------cct-----------
B D                     Horse  ------------------------------ca-tcaaa-
B D          White rhinoceros  ------------------------------ca-ctgaa-
B D                       Cat  ttct---------------------gct-gca-ccaaa-
B D                       Dog  tcct---------------------ccc-aca-cc--a-
B D                   Ferret   tctt---------------------cct-gca-cc--a-
B D                     Panda  ccct---------------------ccc-tca-cc--a-
               Pacific walrus  tcct---------------------cct-gca-cc--a-
                 Weddell seal  tcct---------------------cct-gca-cc--a-
             Black flying-fox  tcct---------------------cct-gca-ccaaa-
B D                   Megabat  tcct---------------------cct-gca-ccaaa-
                Big brown bat  tcct---------------------cct-gca-ccgaa-
         David's myotis (bat)  tcct---------------------cct-gca-ccgaa-
B D                  Microbat  tcct---------------------cct-gca-ccgaa-
B D                  Hedgehog  tccc---------------------cct-gaa-ccaaa-
              Star-nosed mole  tttt---------------------cct-ga--------
B D                  Elephant  ttct---------------------cct-gca-ctgaag
          Cape elephant shrew  ctctggcctacatgctggggacctgcct-aca-ccaaag
B D                   Manatee  tcct---------------------cct-gcc-ccaaag
             Cape golden mole  tcct---------------------cct-gcctccaaag
                     Aardvark  tcct---------------------tct-gtc-ctgaag
B D                 Armadillo  tcct---------------------cct-gca-ccagag
B D                     Shrew  =======================================
B D                      Pika  =======================================
B D                       Rat  ---------------------------------------
B D                     Mouse  =======================================
B D                     Sheep  =======================================
B D                    Tenrec  =======================================
B D                      Fugu  =======================================
    Mexican tetra (cavefish)  =======================================
B D                   Lamprey  =======================================
B D                    Rabbit  ---------------------------------------
B D               Stickleback  =======================================
      Yellowbelly pufferfish  =======================================
B D                 Tetraodon  =======================================
B D                Coelacanth  =======================================
         Pundamilia nyererei  =======================================
                 Zebra mbuna  =======================================
       Burton's mouthbreeder  =======================================
         Princess of Burundi  =======================================
B D              Nile tilapia  =======================================
  D             Scarlet macaw  =======================================
  D                    Parrot  =======================================
  D    White-throated sparrow  =======================================
B D                    Medaka  =======================================
          Southern platyfish  =======================================
  D          Peregrine falcon  =======================================
  D              Saker falcon  =======================================
B D                   Wallaby  =======================================
  D               Rock pigeon  =======================================
B D                Budgerigar  =======================================
B D                   Chicken  =======================================
B D       Medium ground finch  =======================================
                 Spotted gar  =======================================
  D           Green seaturtle  =======================================
B D                    Lizard  =======================================
  D              Mallard duck  =======================================
B D        American alligator  =======================================
  D       Collared flycatcher  =======================================
          Tibetan ground jay  =======================================
B D                    Turkey  =======================================
B D              Atlantic cod  =======================================
B D                 Zebrafish  =======================================
B D             X. tropicalis  =======================================
B D               Zebra finch  =======================================
B D                  Platypus  =======================================
B D           Tasmanian devil  =======================================
B D                   Opossum  =======================================
  D            Painted turtle  =======================================
B D                       Pig  =======================================
  D  Chinese softshell turtle  =======================================
  D    Spiny softshell turtle  =======================================

Inserts between block 18 and 19 in window
B D                    Horse 15bp
B D         White rhinoceros 15bp
B D                      Cat 15bp
B D                      Dog 15bp
B D                  Ferret  15bp
B D                    Panda 15bp
              Pacific walrus 15bp
                Weddell seal 15bp
            Black flying-fox 14bp
B D                  Megabat 14bp
               Big brown bat 14bp
        David's myotis (bat) 14bp
B D                 Microbat 14bp
B D                 Hedgehog 17bp

Alignment block 19 of 568 in window, 177390093 - 177390108, 16 bps 
B D                     Human  ac--------------------------------------------------------------------
B D                     Chimp  ac--------------------------------------------------------------------
B D                   Gorilla  ac--------------------------------------------------------------------
B D                 Orangutan  ac--------------------------------------------------------------------
B D                    Gibbon  act-------------------------------------------------------------------
B D                    Rhesus  act-------------------------------------------------------------------
B D       Crab-eating macaque  act-------------------------------------------------------------------
B D                    Baboon  act-------------------------------------------------------------------
B D              Green monkey  act-------------------------------------------------------------------
B D                  Marmoset  act-------------------------------------------------------------------
B D           Squirrel monkey  aca-------------------------------------------------------------------
B D                  Bushbaby  act-------------------------------------------------------------------
           Chinese tree shrew  act-------------------------------------------------------------------
B D                  Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  ----------------------------------------------------------------------
B D           Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
B D                       Rat  ----------------------------------------------------------------------
B D            Naked mole-rat  actgcact--------------------------------------------------------------
B D                Guinea pig  actgcact--------------------------------------------------------------
                   Chinchilla  actgtactgaagtctttcctttgattccttttcttttctttttttgtaccaggaatcgaactcaggacct
             Brush-tailed rat  actgca----------------------------------------------------------------
B D                    Rabbit  ----------------------------------------------------------------------
B D                    Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
B D                   Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
B D                       Cow  ----------------------------------------------------------------------
B D                     Sheep  ----------------------------------------------------------------------
                Domestic goat  ----------------------------------------------------------------------
B D                     Horse  ----------------------------------------------------------------------
B D          White rhinoceros  ----------------------------------------------------------------------
B D                       Cat  ----------------------------------------------------------------------
B D                       Dog  ----------------------------------------------------------------------
B D                   Ferret   ----------------------------------------------------------------------
B D                     Panda  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
B D                   Megabat  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
B D                  Microbat  ----------------------------------------------------------------------
B D                  Hedgehog  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
B D                  Elephant  ----------------------------------------------------------------------
          Cape elephant shrew  ----------------------------------------------------------------------
B D                   Manatee  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
B D                 Armadillo  ----------------------------------------------------------------------
B D                     Shrew  ======================================================================
B D                      Pika  ======================================================================
B D                     Mouse  ======================================================================
B D                    Tenrec  ======================================================================
B D                      Fugu  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                   Lamprey  ======================================================================
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                 Tetraodon  ======================================================================
B D                Coelacanth  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                    Medaka  ======================================================================
          Southern platyfish  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
                 Spotted gar  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Lizard  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
  D       Collared flycatcher  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Turkey  ======================================================================
B D              Atlantic cod  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D               Zebra finch  ======================================================================
B D                  Platypus  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D            Painted turtle  ======================================================================
B D                       Pig  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D    Spiny softshell turtle  ======================================================================

                        Human  -------------------------------------------------------------gggccacag
                        Chimp  -------------------------------------------------------------gggccacag
                      Gorilla  -------------------------------------------------------------gggccagag
                    Orangutan  -------------------------------------------------------------aggccacag
                       Gibbon  -------------tgggt-------------------------------ttgtcc----tttggccgcag
                       Rhesus  -------------tgggt-------------------------------ttgtcc----tttggctgcag
          Crab-eating macaque  -------------tgggt-------------------------------ttgtcc----tttggctgcag
                       Baboon  -------------tgggt-------------------------------ttgtcc----tttggccgcag
                 Green monkey  -------------tgggt-------------------------------ttgtcc----tttggccgcag
                     Marmoset  -------------tgggt-------------------------------ttgtcc----tttggccacag
              Squirrel monkey  -------------cgggt-------------------------------ttgtcc----tttggccac--
                     Bushbaby  -------------tgagt-------------------------------ctgccg----tttggccatgg
           Chinese tree shrew  -------------ccagt-------------------------------gt-ccc----tttggccacag
                     Squirrel  -------------a---------------------------------------------ctg---cacaa
       Lesser Egyptian jerboa  -------------gtttt-------------------------------ct--------tttggtcatag
                 Prairie vole  -------------ccccc-------------------------------acctgc-cggctgggctgcaa
              Chinese hamster  -------------gtctc-------------------------------ccccac----cacggcctcaa
               Golden hamster  -------------gcctc-------------------------------cctcac----ctcggcctcaa
                          Rat  -----------------------------------------------------------ttggatctgag
               Naked mole-rat  -------------gcagt-------------------------------ttttcc----tttgatggcaa
                   Guinea pig  -------------gaagc-------------------------------ttttcc----tttgattccaa
                   Chinchilla  tgctcttgccaggcaggcacttgtgccgctgagccatatccccggcccactttcc----tttgattccaa
             Brush-tailed rat  -------------caggt-------------------------------ttttcc----tttgattccaa
                       Rabbit  -------------------------------------------gcgtgttttcac----tctgaccacag
                       Alpaca  -------------------------------------------------------------------taa
               Bactrian camel  -------------------------------------------------------------------caa
                      Dolphin  ------------------------------------------------------------ctggccaccg
                 Killer whale  ------------------------------------------------------------ctggccaccg
             Tibetan antelope  ------------------------------------------------------------ttggccactg
                          Cow  ------------------------------------------------------------ttggccactg
                        Sheep  -----------------------------------------------------------tttggccactg
                Domestic goat  ------------------------------------------------------------ttggccactg
                        Horse  -----------------------------------------------------------tttagtccccg
             White rhinoceros  -----------------------------------------------------------tccagtatccg
                          Cat  -----------------------------------------------------------tttggccacca
                          Dog  -----------------------------------------------------------tttggccaccc
                      Ferret   -----------------------------------------------------------tgtgaccacca
                        Panda  -----------------------------------------------------------tgtggccaccg
               Pacific walrus  -----------------------------------------------------------tgtggccaccg
                 Weddell seal  -----------------------------------------------------------tgtggccaccg
             Black flying-fox  -----------------------------------------------------------tttggccacgg
                      Megabat  -----------------------------------------------------------tttggccacgg
                Big brown bat  -----------------------------------------------------------tttggccacgg
         David's myotis (bat)  -----------------------------------------------------------tttggccacgg
                     Microbat  -----------------------------------------------------------tttggccacgg
                     Hedgehog  -----------------------------------------------------------tttggctactc
              Star-nosed mole  --------------------------------------------------------------ggccactg
                     Elephant  ---------------------------------------------actcatatac-tccttgggccacgg
          Cape elephant shrew  ---------------------------------------------ac----acac-ctgttttgccatgg
                      Manatee  ---------------------------------------------acttacattcaccctttggccacgg
             Cape golden mole  ---------------------------------------------actcatgttc---------------
                     Aardvark  ---------------------------------------------actcaccttcgtcctttggccacag
                    Armadillo  ---------------------------------------------acgtgtattttccccttgactacgg
                        Shrew  ======================================================================
                         Pika  ======================================================================
                        Mouse  ======================================================================
                       Tenrec  ======================================================================
                         Fugu  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                      Lamprey  ======================================================================
                  Stickleback  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                    Tetraodon  ======================================================================
                   Coelacanth  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                Scarlet macaw  ======================================================================
                       Parrot  ======================================================================
       White-throated sparrow  ======================================================================
                       Medaka  ======================================================================
           Southern platyfish  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                  Spotted gar  ======================================================================
              Green seaturtle  ======================================================================
                       Lizard  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                       Turkey  ======================================================================
                 Atlantic cod  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
                  Zebra finch  ======================================================================
                     Platypus  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
               Painted turtle  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
       Spiny softshell turtle  ======================================================================

                        Human  agtct
                        Chimp  agtct
                      Gorilla  agtct
                    Orangutan  agtct
                       Gibbon  agtct
                       Rhesus  agtct
          Crab-eating macaque  agtct
                       Baboon  agtct
                 Green monkey  agtct
                     Marmoset  agtct
              Squirrel monkey  agtcc
                     Bushbaby  tgttt
           Chinese tree shrew  agtct
                     Squirrel  agttc
       Lesser Egyptian jerboa  aattt
                 Prairie vole  agttt
              Chinese hamster  agttt
               Golden hamster  agttt
                          Rat  ga---
               Naked mole-rat  agtct
                   Guinea pig  agcct
                   Chinchilla  agtcc
             Brush-tailed rat  agtct
                       Rabbit  agtcc
                       Alpaca  agtct
               Bactrian camel  agact
                      Dolphin  agtct
                 Killer whale  agtct
             Tibetan antelope  agtct
                          Cow  ggtct
                        Sheep  agtct
                Domestic goat  agtct
                        Horse  agttt
             White rhinoceros  agtct
                          Cat  agt--
                          Dog  agt--
                      Ferret   tgt--
                        Panda  aat--
               Pacific walrus  agt--
                 Weddell seal  agt--
             Black flying-fox  aatct
                      Megabat  aatct
                Big brown bat  agtct
         David's myotis (bat)  agtct
                     Microbat  agtct
                     Hedgehog  agtgt
              Star-nosed mole  agctt
                     Elephant  agtct
          Cape elephant shrew  agtct
                      Manatee  agtct
             Cape golden mole  accct
                     Aardvark  agtct
                    Armadillo  cgtct
                        Shrew  =====
                         Pika  =====
                        Mouse  =====
                       Tenrec  =====
                         Fugu  =====
     Mexican tetra (cavefish)  =====
                      Lamprey  =====
                  Stickleback  =====
       Yellowbelly pufferfish  =====
                    Tetraodon  =====
                   Coelacanth  =====
          Pundamilia nyererei  =====
                  Zebra mbuna  =====
        Burton's mouthbreeder  =====
          Princess of Burundi  =====
                 Nile tilapia  =====
                Scarlet macaw  =====
                       Parrot  =====
       White-throated sparrow  =====
                       Medaka  =====
           Southern platyfish  =====
             Peregrine falcon  =====
                 Saker falcon  =====
                      Wallaby  =====
                  Rock pigeon  =====
                   Budgerigar  =====
                      Chicken  =====
          Medium ground finch  =====
                  Spotted gar  =====
              Green seaturtle  =====
                       Lizard  =====
                 Mallard duck  =====
           American alligator  =====
          Collared flycatcher  =====
           Tibetan ground jay  =====
                       Turkey  =====
                 Atlantic cod  =====
                    Zebrafish  =====
                X. tropicalis  =====
                  Zebra finch  =====
                     Platypus  =====
              Tasmanian devil  =====
                      Opossum  =====
               Painted turtle  =====
                          Pig  =====
     Chinese softshell turtle  =====
       Spiny softshell turtle  =====

Inserts between block 19 and 20 in window
B D           Naked mole-rat 5bp
B D               Guinea pig 10bp
                  Chinchilla 10bp
            Brush-tailed rat 5bp
B D                   Rabbit 1bp

Alignment block 20 of 568 in window, 177390109 - 177390125, 17 bps 
B D                     Human  ccccgtgctcccttcc--------------a
B D                     Chimp  ccccgtgctcccttcc--------------a
B D                   Gorilla  ccctgtgctcccttcc--------------a
B D                 Orangutan  ccccgtgcgcccttcc--------------a
B D                    Gibbon  cactgtgctcccttcc--------------a
B D                    Rhesus  ccctgtgcttccttcc--------------a
B D       Crab-eating macaque  ccctgtgcttccttcc--------------a
B D                    Baboon  ccctgtgcttccttct--------------a
B D              Green monkey  ccctgtgtttccttcc--------------a
B D                  Marmoset  ctctgtgctcccttcc--------------a
B D           Squirrel monkey  ctctgtgctcccttcc--------------a
B D                  Bushbaby  ccctgtgcttccttcc--------------a
           Chinese tree shrew  ccctgtgtctgctgcc--------------c
B D                  Squirrel  ccctatacttccagcc--------------a
       Lesser Egyptian jerboa  --ctcctactgtctac--------------a
                 Prairie vole  -ttcttttcttttctttttttttcttttcca
B D           Chinese hamster  -ctggtttttttttttttttttttttttaaa
               Golden hamster  -ctcctcgtttttttc--------------a
B D                     Mouse  cctcatttttcttttc--------------a
B D                       Rat  --ccctgccctctgcc--------------g
B D            Naked mole-rat  tgctgtacttccttcc--------------a
B D                Guinea pig  ta-tgtacttccttcc--------------a
                   Chinchilla  tactgtacttccttcc--------------a
             Brush-tailed rat  tactatactccctccc--------------a
B D                    Rabbit  ccttgtgctgccttcc--------------a
B D                    Alpaca  -caagtttcccctttc--------------c
               Bactrian camel  -caagtttcccctttc--------------c
B D                   Dolphin  -cctgtggccccttcc--------------a
                 Killer whale  -cctgtggccccttcc--------------a
             Tibetan antelope  ccctgtggccccttct--------------g
B D                       Cow  ccctgtggccccttct--------------g
B D                     Sheep  ccctgtggcccctcct--------------g
                Domestic goat  ccctgtggccccttct--------------g
B D                     Horse  ctgtgtgctcccttcc--------------a
B D          White rhinoceros  ctgtgtgctcccttcc--------------a
B D                       Cat  -------ctcccttcc--------------a
B D                       Dog  -------ctcctttcc--------------a
B D                   Ferret   -------ctcccttcc--------------a
B D                     Panda  -------ctcccttcc--------------a
               Pacific walrus  -------ctcccttcc--------------a
                 Weddell seal  -------ctcccttcc--------------a
             Black flying-fox  ccttgtgctcccttcc--------------a
B D                   Megabat  ccttgtgctccctttc--------------a
                Big brown bat  ccctgtgctcccttcc--------------a
         David's myotis (bat)  ccctgtgctcccttcc--------------a
B D                  Microbat  ccctgtgctcccttcc---------------
B D                  Hedgehog  cctgctgcttccttcc--------------a
              Star-nosed mole  ccccatgcccccttcc--------------a
B D                  Elephant  ccctgtgcttccttcc--------------a
          Cape elephant shrew  --ctgttgttccttcc--------------a
B D                   Manatee  ctctgtatttccttcc--------------a
             Cape golden mole  ctctgtgtttccttcc--------------c
                     Aardvark  ctctttgttttattcc--------------t
B D                 Armadillo  cctggtgctgctttcc--------------g
B D                     Shrew  ===============================
B D                      Pika  ===============================
B D                    Tenrec  ===============================
B D                      Fugu  ===============================
    Mexican tetra (cavefish)  ===============================
B D                   Lamprey  ===============================
B D               Stickleback  ===============================
      Yellowbelly pufferfish  ===============================
B D                 Tetraodon  ===============================
B D                Coelacanth  ===============================
         Pundamilia nyererei  ===============================
                 Zebra mbuna  ===============================
       Burton's mouthbreeder  ===============================
         Princess of Burundi  ===============================
B D              Nile tilapia  ===============================
  D             Scarlet macaw  ===============================
  D                    Parrot  ===============================
  D    White-throated sparrow  ===============================
B D                    Medaka  ===============================
          Southern platyfish  ===============================
  D          Peregrine falcon  ===============================
  D              Saker falcon  ===============================
B D                   Wallaby  ===============================
  D               Rock pigeon  ===============================
B D                Budgerigar  ===============================
B D                   Chicken  ===============================
B D       Medium ground finch  ===============================
                 Spotted gar  ===============================
  D           Green seaturtle  ===============================
B D                    Lizard  ===============================
  D              Mallard duck  ===============================
B D        American alligator  ===============================
  D       Collared flycatcher  ===============================
          Tibetan ground jay  ===============================
B D                    Turkey  ===============================
B D              Atlantic cod  ===============================
B D                 Zebrafish  ===============================
B D             X. tropicalis  ===============================
B D               Zebra finch  ===============================
B D                  Platypus  ===============================
B D           Tasmanian devil  ===============================
B D                   Opossum  ===============================
  D            Painted turtle  ===============================
B D                       Pig  ===============================
  D  Chinese softshell turtle  ===============================
  D    Spiny softshell turtle  ===============================

Inserts between block 20 and 21 in window
                    Aardvark 230bp

Alignment block 21 of 568 in window, 177390126 - 177390156, 31 bps 
B D                     Human  acctgttcc-cattgacgccaactttca---ccat
B D                     Chimp  acctgttcc-cattgactccaactttca---ccat
B D                   Gorilla  acctgttcc-cattgactccaactttca---ccat
B D                 Orangutan  acctgttcc-cattgactccaactttca---ccac
B D                    Gibbon  acctgttcc-cattgactccaactttca---ccac
B D                    Rhesus  acctgttcc-cattgactccaacttcca---ccac
B D       Crab-eating macaque  acctgttcc-cattgactccaacttcca---ccac
B D                    Baboon  acctgttcc-cattgactccaacttcca---ccac
B D              Green monkey  acctgttcc-cattgactccaacttcca---ccac
B D                  Marmoset  acctgttcc-catcgactccagctttca---ccac
B D           Squirrel monkey  accttttcc-catcgactcccgctttca---ccac
B D                  Bushbaby  accagttct-cattgtctccagctttca---ccat
           Chinese tree shrew  a-cggttct-cat----tcctccttcca---ccat
B D                  Squirrel  c----ttct-cattgcctccagctttca---tcat
       Lesser Egyptian jerboa  a----ctct-tcttgcttccagctatca---ctg-
                 Prairie vole  a----cact-catgacctccagccttca---ccat
B D           Chinese hamster  a----cact-catggcttccagccttca---ccat
               Golden hamster  a----cact-----------------------cgt
B D                     Mouse  a----ctcttcatggcctccagccttca---ccac
B D                       Rat  c----ctcttcacagcctccagccttca---ccac
B D            Naked mole-rat  t----cttcttattgcctccagctttta---ccac
B D                Guinea pig  a----gttcttactgcccccagctttta---ccac
                   Chinchilla  a----cttctcattgcttccagctttta---ccac
             Brush-tailed rat  a----cttcttactgcttccagctttta---ccac
B D                    Rabbit  aactgctct-cagcgcccccagctgtca---ccac
B D                    Alpaca  acctgttct-cattgcctccagctttca---ccaa
               Bactrian camel  acctgttct-cattgcctccagctttca---ccaa
B D                   Dolphin  acctgttct-cattgcttccagctttca---ccaa
                 Killer whale  acctgttct-cattgcttccagctttca---ccaa
             Tibetan antelope  acctgttct-cactgcctccagctttca---gcaa
B D                       Cow  acctgttct-cactgcctccagcttgca---ccaa
B D                     Sheep  acctgttct-cactgcctccagctttca---ccaa
                Domestic goat  acctgttct-cactgcctccagctttca---ccaa
B D                     Horse  acct--------------------ttca---acaa
B D          White rhinoceros  acctgtcct-cgctgcatccagccttca---ccaa
B D                       Cat  acctgtcct-catggcctccagctttca---ccaa
B D                       Dog  acctgtcct-tgtggcctccaactttca---ccag
B D                   Ferret   acctgtcct-ggtggcctccattccccgcccccca
B D                     Panda  acctgtcct-tgtggtctccagcgttca---ccca
               Pacific walrus  acctgtcct-tgtggcctccagctttca---ccca
                 Weddell seal  acctgtcct-tgtggcctccagctttca---ccca
             Black flying-fox  acttgtccc-cattgcctccagttttca---ccaa
B D                   Megabat  acttgtccc-cattgcctccagttttca---ccaa
                Big brown bat  acctgtccc-agttgcctccagctttca---ccaa
         David's myotis (bat)  acctgtctc-agttgcctccagctttca---ccaa
B D                  Microbat  --------c-agttgcctccagctttca---ccaa
B D                  Hedgehog  gctttt-ct-ccttgcctccagatgcca---ctaa
              Star-nosed mole  gcctgt-cc-cagttgctccagttttga---ccaa
B D                  Elephant  gcctgattt-ccttgcctccagctttca---gcaa
          Cape elephant shrew  agtgtgttt-ccttgtctctgactttca---acaa
B D                   Manatee  acctgattt-ccttgcctccagctttca---gcaa
             Cape golden mole  acctgattt-ccttgcctctagctttca---tcaa
B D                 Armadillo  acttgcttt-cgttgcttccagcttgca---tcga
B D                     Shrew  ===================================
B D                      Pika  ===================================
B D                    Tenrec  ===================================
B D                      Fugu  ===================================
    Mexican tetra (cavefish)  ===================================
B D                   Lamprey  ===================================
B D               Stickleback  ===================================
      Yellowbelly pufferfish  ===================================
B D                 Tetraodon  ===================================
B D                Coelacanth  ===================================
         Pundamilia nyererei  ===================================
                 Zebra mbuna  ===================================
       Burton's mouthbreeder  ===================================
         Princess of Burundi  ===================================
B D              Nile tilapia  ===================================
  D             Scarlet macaw  ===================================
  D                    Parrot  ===================================
  D    White-throated sparrow  ===================================
B D                    Medaka  ===================================
          Southern platyfish  ===================================
  D          Peregrine falcon  ===================================
  D              Saker falcon  ===================================
B D                   Wallaby  ===================================
  D               Rock pigeon  ===================================
B D                Budgerigar  ===================================
B D                   Chicken  ===================================
B D       Medium ground finch  ===================================
                 Spotted gar  ===================================
  D           Green seaturtle  ===================================
B D                    Lizard  ===================================
  D              Mallard duck  ===================================
B D        American alligator  ===================================
  D       Collared flycatcher  ===================================
          Tibetan ground jay  ===================================
B D                    Turkey  ===================================
B D              Atlantic cod  ===================================
B D                 Zebrafish  ===================================
B D             X. tropicalis  ===================================
B D               Zebra finch  ===================================
B D                  Platypus  ===================================
B D           Tasmanian devil  ===================================
B D                   Opossum  ===================================
                    Aardvark  ===================================
  D            Painted turtle  ===================================
B D                       Pig  ===================================
  D  Chinese softshell turtle  ===================================
  D    Spiny softshell turtle  ===================================

Alignment block 22 of 568 in window, 177390157 - 177390203, 47 bps 
B D                     Human  gct--gg--a-cctga--------accagccc---gaaacagt--------------------ctcca-g
B D                     Chimp  gct--gg--a-cctga--------accagccc---gaaacagt--------------------ctcca-g
B D                   Gorilla  gct--gg--a-cctga--------accagccc---gaaacagt--------------------ctcca-g
B D                 Orangutan  gct--gg--a-cctga--------actagccc---gaaacagt--------------------ctcca-g
B D                    Gibbon  gct--gg--a-cccga--------cctagccc---gaaacagt--------------------ctcca-g
B D                    Rhesus  gct--ga--a-cctga--------act-------------agt--------------------cgcca-g
B D       Crab-eating macaque  gct--ga--a-cctga--------act-------------agt--------------------cgcca-g
B D                    Baboon  gct--ga--a-cctga--------act-------------agt--------------------cgcca-g
B D              Green monkey  gct--ga--a-cctga--------acg-------------agt--------------------cgcca-g
B D                  Marmoset  gct--gg--a-cccaa--------gctcgccc---aaaccagt--------------------ctcca-g
B D           Squirrel monkey  gct--gg--a-ctcaa--------gttcgccc---aaaccggt--------------------ctcca-g
B D                  Bushbaby  gct--ag--a-cctca--------cct-ctcc---agaccagc--------------------ttcca-g
           Chinese tree shrew  gcc--gc--a-cccga--------cctcgcc---------------------------------------
B D                  Squirrel  gtg--ag--a-cctga--------ccttaacc---aaaccatt--------------------ctcca-g
       Lesser Egyptian jerboa  -----ga--a-ctcga--------ccttgtcccaaaaaaatgt--------------------ctcca-g
                 Prairie vole  actgggg--a-gtgaa--------cgttgatc---aaaccagt--------------------ctcca-g
B D           Chinese hamster  actgggg--a-ctgaa--------tgttggtc---aaaccagt--------------------ctcca-g
               Golden hamster  actgggg--a-ctgaa--------tgctggtc---aaaccagt--------------------ctcca-g
B D                     Mouse  act--gg--a-cccaa--------cgttagcc---aaactggt--------------------ctcaata
B D                       Rat  gct--gg--a-cccaa--------cgttaagc---aaactggt--------------------ctcca-g
B D            Naked mole-rat  tct--gg--a-tccaa--------ctttgccc----agat-gt--------------------ctcca-g
B D                Guinea pig  tcg--ga--accccaa--------ccatgccc----acttggc--------------------ctcca-g
                   Chinchilla  tcg--gg--a-cctaa--------ccttgcct----ggccagt--------------------ctcca-g
             Brush-tailed rat  tcg--gg--a-cccaa--------ctttgcct----acctggt--------------------ctcca-g
B D                    Rabbit  gct--gg--a-cccga--------cccagccc---aaggcagt--------------------ctcca-g
B D                    Alpaca  gcc--gg--g-cccag--------ctttgcct---aaatcagt--------------------ctcca-a
               Bactrian camel  gcc--gg--g-cccag--------ctttgcct---gaatcagt--------------------ctcca-a
B D                   Dolphin  gct--ag--g-cccaa--------cctcgcct---aagccagc--------------------ctcca-g
                 Killer whale  gct--ag--g-cccaa--------cctcgcct---aagccagc--------------------ctcca-g
             Tibetan antelope  gcc--ag--g-cccaa--------cctcacct---gagccagc--------------------ctcca-g
B D                       Cow  gcc--ag--g-cccaa--------cattgcct---gagccagc--------------------ctcca-g
B D                     Sheep  gcc--ag--g-cccaa--------cctcgcct---gagccagc--------------------ctcca-g
                Domestic goat  gcc--ag--g-cccaa--------cctcgcct---gagccagc--------------------ctcca-g
B D                     Horse  gct--gg--c-cccga--------cctcaccc---aaaccagt--------------------ctcca-g
B D          White rhinoceros  gct--gg--a-cctga--------cctcacct---gaaccagt--------------------ctcca-g
B D                       Cat  act--gg--a-cccaa--------actcaccc---aaaacagt--------------------ctcca-a
B D                       Dog  act--gg--a-cccaa--------cctcacct---aaacca-----------------------------
B D                   Ferret   act--gg--a-cccaa--------cctcaccc---aagccagt--------------------ctcca-a
B D                     Panda  act--gg--a-cccaa--------ccttaccc---aa-ccagt--------------------ctcca-a
               Pacific walrus  act--ggaca-cccaa--------cctcgccc---aagccagt--------------------ctcca-a
                 Weddell seal  act--ggaca-cccaa--------cctcgccc---aaaccagt--------------------ctcca-a
             Black flying-fox  act--gg--a-cccaa--------cgtcactc---aaaacagt--------------------cttca-g
B D                   Megabat  act--gg--a-cccaa--------cgtcactc---aaaacagt--------------------cttca-g
                Big brown bat  gct--gg--a-cctga--------c-tcgccc---aaaccagt--------------------ctcca--
         David's myotis (bat)  gct--gg--a-cccga--------c-tcgccc---aaaccagt--------------------ctcca--
B D                  Microbat  gct--gg--a-ccc-a--------c-tcgccc---aaaccagt--------------------ctcca--
B D                  Hedgehog  gct--gg--a-cccaacctcccacccctaccc---caacctgt--------------------atcca-a
B D                     Shrew  gct--gg--a-tctga--------ccttgcct---aaagtatt--------------------ctcca-g
              Star-nosed mole  cct--gg--g-tctga---------cttgtct---aaaccagt--------------------ctcca-a
B D                  Elephant  acc--gg--a-cccaa--------ccttgccc---aaaacagt---------------------------
          Cape elephant shrew  act--ag--a-ctcaa--------cctcatcc---agagctgg---------------------------
B D                   Manatee  acc--ag--a-cccaa--------cctcaccc---agagcagt---------------------------
             Cape golden mole  act--gg--a-cccaa---------------------agtggt---------------------------
B D                 Armadillo  act--gg--a-caccc--------ccttgccc---aaactggtctccaggcaattaatgccac-------
B D                      Pika  ======================================================================
B D                    Tenrec  ======================================================================
B D                      Fugu  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                   Lamprey  ======================================================================
B D               Stickleback  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                 Tetraodon  ======================================================================
B D                Coelacanth  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                    Medaka  ======================================================================
          Southern platyfish  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
                 Spotted gar  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Lizard  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
  D       Collared flycatcher  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Turkey  ======================================================================
B D              Atlantic cod  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D               Zebra finch  ======================================================================
B D                  Platypus  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
                    Aardvark  ======================================================================
  D            Painted turtle  ======================================================================
B D                       Pig  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D    Spiny softshell turtle  ======================================================================

                        Human  g-----------------------------gaagct-atg-cacc
                        Chimp  g-----------------------------gaagct-atg-cacc
                      Gorilla  g-----------------------------gaagct-atg-cacc
                    Orangutan  g-----------------------------gaagct-atg-cacc
                       Gibbon  g-----------------------------gaagct-atg-cacc
                       Rhesus  g-----------------------------gaagct-acg-cacg
          Crab-eating macaque  g-----------------------------gaagct-acg-cacg
                       Baboon  g-----------------------------gaagct-acg-cacc
                 Green monkey  g-----------------------------gaagct-atg-cacc
                     Marmoset  g-----------------------------gaagcg-atg-cacc
              Squirrel monkey  g-----------------------------gaagtg-gtg-cacc
                     Bushbaby  a-----------------------------aaacct-atgccacc
           Chinese tree shrew  -----------------------------------------caca
                     Squirrel  g-----------------------------aaacct-atgtcacc
       Lesser Egyptian jerboa  g-----------------------------gaacct-gtatcatc
                 Prairie vole  gggccctagacaggacaggtca--------ggacct-atgccacc
              Chinese hamster  g-----------------------------ggaccc-atgccacc
               Golden hamster  g-----------------------------ggactt-gtgccacg
                        Mouse  g--------aaagggggaatca--------agtctt-ttg-----
                          Rat  g--------gtggagggagtccttctcgatggactt-ttg-----
               Naked mole-rat  g-----------------------------gaccct-gcgtcacc
                   Guinea pig  g-----------------------------gaccct-atgacacc
                   Chinchilla  g-----------------------------gaccct-gtgtcacc
             Brush-tailed rat  g-----------------------------gacccc-atgtcacc
                       Rabbit  g-----------------------------gagccc-actccacc
                       Alpaca  g-----------------------------gcatct---------
               Bactrian camel  g-----------------------------gcatct---------
                      Dolphin  g-----------------------------gcacct---------
                 Killer whale  g-----------------------------gcacct---------
             Tibetan antelope  g-----------------------------gcacct---------
                          Cow  g-----------------------------gcacct---------
                        Sheep  g-----------------------------gcacct---------
                Domestic goat  g-----------------------------gcacct---------
                        Horse  g-----------------------------gaacca-ggt-cacc
             White rhinoceros  g-----------------------------gaacca-tgt-cacc
                          Cat  g-----------------------------gaacga-agt-cacc
                          Dog  -------------------------------------agt-catc
                      Ferret   g-----------------------------aaaccc-agt-cacc
                        Panda  g-----------------------------gaaccc-agt-cacc
               Pacific walrus  g-----------------------------gaaccc-agt-cacc
                 Weddell seal  g-----------------------------gaaccc-agt-cacc
             Black flying-fox  g-----------------------------gaatca-tag-cacc
                      Megabat  g-----------------------------gaatca-tag-cacc
                Big brown bat  g-----------------------------gaaccg-tgg-cacc
         David's myotis (bat)  g-----------------------------gaaccg-tgt-cacc
                     Microbat  g-----------------------------gaaccg-tgt-cacc
                     Hedgehog  g-----------------------------aaccctctat-cccc
                        Shrew  a-----------------------------gaaccccagt-ctcc
              Star-nosed mole  g-----------------------------gaacctacat-cacc
                     Elephant  ---------------------------------------------
          Cape elephant shrew  ---------------------------------------------
                      Manatee  ---------------------------------------------
             Cape golden mole  ---------------------------------------------
                    Armadillo  ---------------------------------------------
                         Pika  =============================================
                       Tenrec  =============================================
                         Fugu  =============================================
     Mexican tetra (cavefish)  =============================================
                      Lamprey  =============================================
                  Stickleback  =============================================
       Yellowbelly pufferfish  =============================================
                    Tetraodon  =============================================
                   Coelacanth  =============================================
          Pundamilia nyererei  =============================================
                  Zebra mbuna  =============================================
        Burton's mouthbreeder  =============================================
          Princess of Burundi  =============================================
                 Nile tilapia  =============================================
                Scarlet macaw  =============================================
                       Parrot  =============================================
       White-throated sparrow  =============================================
                       Medaka  =============================================
           Southern platyfish  =============================================
             Peregrine falcon  =============================================
                 Saker falcon  =============================================
                      Wallaby  =============================================
                  Rock pigeon  =============================================
                   Budgerigar  =============================================
                      Chicken  =============================================
          Medium ground finch  =============================================
                  Spotted gar  =============================================
              Green seaturtle  =============================================
                       Lizard  =============================================
                 Mallard duck  =============================================
           American alligator  =============================================
          Collared flycatcher  =============================================
           Tibetan ground jay  =============================================
                       Turkey  =============================================
                 Atlantic cod  =============================================
                    Zebrafish  =============================================
                X. tropicalis  =============================================
                  Zebra finch  =============================================
                     Platypus  =============================================
              Tasmanian devil  =============================================
                      Opossum  =============================================
                     Aardvark  =============================================
               Painted turtle  =============================================
                          Pig  =============================================
     Chinese softshell turtle  =============================================
       Spiny softshell turtle  =============================================

Inserts between block 22 and 23 in window
B D                Armadillo 1bp

Alignment block 23 of 568 in window, 177390204 - 177390237, 34 bps 
B D                     Human  aggg-agagga-ggcaa-gtccaaggcctacca-----gatg
B D                     Chimp  aggg-agagga-ggcaa-gtccaaggccttcca-----gatg
B D                   Gorilla  aggg-agagga-ggcaa-gtccaaggccttcca-----gatg
B D                 Orangutan  aggg-agagga-ggcaa-gcccaaggccttcca-----gatg
B D                    Gibbon  aggg-agagga-ggcaa-gtccaaggccttcca-----gatg
B D                    Rhesus  cggg-agagga-ggcaa-gtccaaggccttcca-----gatg
B D       Crab-eating macaque  cggg-agagga-ggcaa-gtccaaggccttcca-----gatg
B D                    Baboon  cggg-agagga-ggcaa-gtccaaggccttcca-----gatg
B D              Green monkey  cggg-agagga-ggcaa-gtccaaggccttcca-----gatg
B D                  Marmoset  aggg-agagga-ggcga-gtccaaggccttcca-----gatg
B D           Squirrel monkey  aggg-agagga-ggtga-gtctgaggccttcca-----gatg
B D                  Bushbaby  aagg-aaagga-tgaga-ttctgaggctctaca-----gatg
           Chinese tree shrew  aggg--gagga-tgacg-gtcc-------------------g
B D                  Squirrel  aagg-aaagaa-tagga---------------g-----actg
       Lesser Egyptian jerboa  aagg-agacaa-tgaaa-actcgaggtgattca-----gatg
                 Prairie vole  cagg-acagga-cagga---tgagagttttcct-----gatg
B D           Chinese hamster  cagg-acagga-tggga-------------------------
               Golden hamster  cagg-acagga-tggga-------------------------
B D                     Mouse  -------agcg-tctga-------------------------
B D                       Rat  -------agtg-tttga-------------------------
B D            Naked mole-rat  aagg-aaagaa-tgagt---cataggctttcca-----ggtg
B D                Guinea pig  aagg-atggaa-tgagt---ctcaggcattcca-----gatg
                   Chinchilla  aagg-aaagaa-tgagt---cttaagcattcca-----gatg
             Brush-tailed rat  aaga-aaagaa-cgagt---cttaggcatccca-----agtg
B D                    Rabbit  gaac-agaggc-tgaga-gtctgaggctttgca-----gatg
B D                    Alpaca  -----acatgatgagga-gtc--aggttttcca-----gacg
               Bactrian camel  -----atgtgatgagga-gtc--aggttttcca-----gatg
B D                   Dolphin  -----atgtgactgaca-gtctggggttttcca-----gatg
                 Killer whale  -----atgtgactgaca-gtctggggttttcca-----gatg
             Tibetan antelope  -----atgtgattggca-gtctgggattttcca-----gatg
B D                       Cow  -----atgtgattggca-gtctgggattttcca-----gatg
B D                     Sheep  -----atgtgatcggca-gtctgggattttcca-----gatg
                Domestic goat  -----atgtgatctgca-gtctgggattttcca-----gatg
B D                     Horse  aagg-aaa-gactggga-ggctgaggttttcc-------tca
B D          White rhinoceros  aagg-aaaggactagga-gtctgaggttttcca-----gacg
B D                       Cat  aaag-acagcactggga-gtctga--------------gacg
B D                       Dog  aaag-acagtgttggga-atctgagggttttcg-----aata
B D                   Ferret   aaaa-tcagtattggga-atctgaaggtttcca-----gatg
B D                     Panda  aaag-acggcattggga-atctgagggtttcca-----gaca
               Pacific walrus  aaag-acggtattggga-atctgacggtttcca-----gatg
                 Weddell seal  aaag-gccgtattggga-atctgatggtttcca-----gatg
             Black flying-fox  atgg-agaggattggga-gtctgaggttgccca-----gatg
B D                   Megabat  atgg-agaggattggga-gtctgaggttgccca-----gatg
                Big brown bat  aagg-agagaattgaga-gtctgagcttgtcca-----gatg
         David's myotis (bat)  aagg-agagaatggaga-gcccgagcttgtcca-----gat-
B D                  Microbat  aagg-agagaacggaga-gtctgagcttgtcca-----gatg
B D                  Hedgehog  aagg-agagcactggga-gtctgaggctttcca-----gag-
B D                     Shrew  aaggggaag-actggga-atctcagattctcca-----gaag
              Star-nosed mole  aagatagagcactggga-ttctgagattttcca-----gatg
B D                  Elephant  -----ggaggactgggaggtttcaggctttcca-----gaaa
          Cape elephant shrew  -----agagggctaggatagccaaggcttccca-----gaaa
B D                   Manatee  -----agaggactgggaggtctgaggctttcca-----gaga
             Cape golden mole  -----agagggttgggaggtctgagacgttcca-----gaaa
                     Aardvark  -aggtggaggattgggaggtctgagctttgcca-----gaaa
B D                 Armadillo  aaggagagggactgggtggtctcagcgtttccagactggaaa
B D                      Pika  ==========================================
B D                    Tenrec  ==========================================
B D                      Fugu  ==========================================
    Mexican tetra (cavefish)  ==========================================
B D                   Lamprey  ==========================================
B D               Stickleback  ==========================================
      Yellowbelly pufferfish  ==========================================
B D                 Tetraodon  ==========================================
B D                Coelacanth  ==========================================
         Pundamilia nyererei  ==========================================
                 Zebra mbuna  ==========================================
       Burton's mouthbreeder  ==========================================
         Princess of Burundi  ==========================================
B D              Nile tilapia  ==========================================
  D             Scarlet macaw  ==========================================
  D                    Parrot  ==========================================
  D    White-throated sparrow  ==========================================
B D                    Medaka  ==========================================
          Southern platyfish  ==========================================
  D          Peregrine falcon  ==========================================
  D              Saker falcon  ==========================================
B D                   Wallaby  ==========================================
  D               Rock pigeon  ==========================================
B D                Budgerigar  ==========================================
B D                   Chicken  ==========================================
B D       Medium ground finch  ==========================================
                 Spotted gar  ==========================================
  D           Green seaturtle  ==========================================
B D                    Lizard  ==========================================
  D              Mallard duck  ==========================================
B D        American alligator  ==========================================
  D       Collared flycatcher  ==========================================
          Tibetan ground jay  ==========================================
B D                    Turkey  ==========================================
B D              Atlantic cod  ==========================================
B D                 Zebrafish  ==========================================
B D             X. tropicalis  ==========================================
B D               Zebra finch  ==========================================
B D                  Platypus  ==========================================
B D           Tasmanian devil  ==========================================
B D                   Opossum  ==========================================
  D            Painted turtle  ==========================================
B D                       Pig  ==========================================
  D  Chinese softshell turtle  ==========================================
  D    Spiny softshell turtle  ==========================================

Inserts between block 23 and 24 in window
B D                 Hedgehog 6bp
B D                    Shrew 1189bp
             Star-nosed mole 6bp

Alignment block 24 of 568 in window, 177390238 - 177390250, 13 bps 
B D                     Human  gggaaagcagc----------a-g
B D                     Chimp  gggaaagcagc----------a-g
B D                   Gorilla  gggaaagcagc----------a-g
B D                 Orangutan  gggaaagaagc----------a-g
B D                    Gibbon  gggaaagaagc----------a-g
B D                    Rhesus  gggaaggaaga----------a-g
B D       Crab-eating macaque  gggaaggaaga----------a-g
B D                    Baboon  gggaaggaaga----------a-g
B D              Green monkey  gggaaggaaga----------a-g
B D                  Marmoset  gggaaagaaga----------a-c
B D           Squirrel monkey  gggaaagaaga----------a-c
B D                  Bushbaby  gggaaagaaaa----------g-c
           Chinese tree shrew  gggaaaggaaa----------a-g
B D                  Squirrel  gagaaagaaaa----------a-a
       Lesser Egyptian jerboa  ggaagtggaaa----------a-t
                 Prairie vole  tggaaagggac----------a-a
B D            Naked mole-rat  ggaaaagaaaa----------a-a
B D                Guinea pig  gagaaagtaaa----------a-a
                   Chinchilla  ggaaaagtaaa----------a-a
             Brush-tailed rat  gagaaagtcaa----------a-a
B D                    Rabbit  gggaaagaaca----------a-g
B D                    Alpaca  gcaaaagaaaa----------g-c
               Bactrian camel  gcaaaagaaaa----------g-c
B D                   Dolphin  gtgaaagaaaa----------a-c
                 Killer whale  gtgaaagaaaa----------a-c
             Tibetan antelope  gtgaaagaaaa----------agc
B D                       Cow  gtgaaagaaaa----------agc
B D                     Sheep  gtgaaagaaaa----------agc
                Domestic goat  gtgaaagaaaa----------agc
B D                     Horse  gcaaaagaaaa----------a-c
B D          White rhinoceros  gtgaaagaaaa----------a-c
B D                       Cat  gtggaagaaaa----------c-c
B D                       Dog  gtggaagaaaa----------t-c
B D                   Ferret   gtggaagaaaa----------c-c
B D                     Panda  gcggaagaaaa----------c-c
               Pacific walrus  gtggaagaaaa----------c-c
                 Weddell seal  gtggaagaaaa----------c-c
             Black flying-fox  gcgaaagaaaa----------a-a
B D                   Megabat  gtgaaagaaaa----------a-a
                Big brown bat  gtggtggtggggg--------a-a
         David's myotis (bat)  gtgggggtggggggtggggg-a-a
B D                  Microbat  gtgggggtggagtgggggggca-a
B D                  Hedgehog  ------gaaga----------a-g
B D                     Shrew  ------ggaaa----------a-t
              Star-nosed mole  ------taaaa----------a-c
B D                  Elephant  -----aggaaa----------a-t
          Cape elephant shrew  -----agtaaa----------a-c
B D                   Manatee  -----aggaaa----------a-c
             Cape golden mole  -----aggaaa----------a-c
                     Aardvark  -----atgaaa----------a-c
B D                 Armadillo  -----agaaaa----------a-c
B D                      Pika  ========================
              Golden hamster  ------------------------
B D                       Rat  ------------------------
B D                     Mouse  ------------------------
B D           Chinese hamster  ------------------------
B D                    Tenrec  ========================
B D                      Fugu  ========================
    Mexican tetra (cavefish)  ========================
B D                   Lamprey  ========================
B D               Stickleback  ========================
      Yellowbelly pufferfish  ========================
B D                 Tetraodon  ========================
B D                Coelacanth  ========================
         Pundamilia nyererei  ========================
                 Zebra mbuna  ========================
       Burton's mouthbreeder  ========================
         Princess of Burundi  ========================
B D              Nile tilapia  ========================
  D             Scarlet macaw  ========================
  D                    Parrot  ========================
  D    White-throated sparrow  ========================
B D                    Medaka  ========================
          Southern platyfish  ========================
  D          Peregrine falcon  ========================
  D              Saker falcon  ========================
B D                   Wallaby  ========================
  D               Rock pigeon  ========================
B D                Budgerigar  ========================
B D                   Chicken  ========================
B D       Medium ground finch  ========================
                 Spotted gar  ========================
  D           Green seaturtle  ========================
B D                    Lizard  ========================
  D              Mallard duck  ========================
B D        American alligator  ========================
  D       Collared flycatcher  ========================
          Tibetan ground jay  ========================
B D                    Turkey  ========================
B D              Atlantic cod  ========================
B D                 Zebrafish  ========================
B D             X. tropicalis  ========================
B D               Zebra finch  ========================
B D                  Platypus  ========================
B D           Tasmanian devil  ========================
B D                   Opossum  ========================
  D            Painted turtle  ========================
B D                       Pig  ========================
  D  Chinese softshell turtle  ========================
  D    Spiny softshell turtle  ========================

Inserts between block 24 and 25 in window
B D                 Squirrel 9bp
      Lesser Egyptian jerboa 9bp
                Prairie vole 6bp
B D           Naked mole-rat 2bp
                  Chinchilla 169bp
            Brush-tailed rat 2bp

Alignment block 25 of 568 in window, 177390251 - 177390308, 58 bps 
B D                     Human  c------agcggca--------gt----tg----------------------------------------
B D                     Chimp  c------agcggca--------gt----tg----------------------------------------
B D                   Gorilla  c------agcggca--------gt----tg----------------------------------------
B D                 Orangutan  c------agcggca--------gt----tg----------------------------------------
B D                    Gibbon  c------agcggca--------gt----tg----------------------------------------
B D                    Rhesus  c------agtggca--------gt----tgt---------------------------------------
B D       Crab-eating macaque  c------agtggca--------gt----tgt---------------------------------------
B D                    Baboon  c------agtggca--------gt----tgt---------------------------------------
B D              Green monkey  c------agtggca--------gt----tgt---------------------------------------
B D                  Marmoset  c------agcggca--------gt----tgt---------------------------------------
B D           Squirrel monkey  c------agcagca--------gc----tgt---------------------------------------
B D                  Bushbaby  c------agaggca--------gt----tta---------------------------------------
           Chinese tree shrew  c------agggaca--------------------------------------------------------
B D                  Squirrel  a------aacagag--------gc----tg----------------------------------------
       Lesser Egyptian jerboa  a------att-------------c----cg----------------------------------------
                 Prairie vole  c------att-------------t----tg----------------------------------------
B D           Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
B D                     Mouse  ----------------------------------------------------------------------
B D                       Rat  ----------------------------------------------------------------------
B D            Naked mole-rat  g------acatact--------tt----tg----------------------------------------
B D                Guinea pig  c------acacact--------tt----tg----------------------------------------
             Brush-tailed rat  g------acacact--------tt----tg----------------------------------------
B D                    Rabbit  ----------------------------------------------------------------------
B D                    Alpaca  c------agaggca--------gc----gtc---------------------------------------
               Bactrian camel  c------agaggcg--------gt----gtc---------------------------------------
B D                   Dolphin  c------agaggca--------gtgtttgtt---------------------------------------
                 Killer whale  c------agaggca--------gtgtttgtt---------------------------------------
             Tibetan antelope  c------aga------------------gtt---------------------------------------
B