Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 435 in window, 46607715 - 46607731, 17 bps 
B D                     Human  tggctgctttagtttg--c
B D                     Chimp  tggctgctttagtttg--c
B D                   Gorilla  tggctgctttagtttg--c
B D                 Orangutan  tggctgctttagtttg--c
B D                    Gibbon  tggctgctttagtttg--c
B D                    Rhesus  tggctgctttagtttg--c
B D       Crab-eating macaque  tggctgctttagtttg--c
B D                    Baboon  tggctgctttagtttg--c
B D              Green monkey  tggctgctttagtttg--c
B D                  Marmoset  ttgctgctttagtttg--c
B D           Squirrel monkey  ttgctgctttagtttg--t
B D                  Bushbaby  tggctgctttcttttg--c
           Chinese tree shrew  tggctgctgtagtttgatt
B D                  Squirrel  tggatgctttagttgg--c
       Lesser Egyptian jerboa  tgttt----tagtt----t
                 Prairie vole  tggttgatttagtt----t
B D           Chinese hamster  tgattgctgtagtttg--t
               Golden hamster  tgattgctgtagtttg--t
B D                     Mouse  tggttgctttagtttg--t
B D                       Rat  tggttgctttagtttg--t
B D            Naked mole-rat  tgactgctttagttca--c
B D                Guinea pig  tgactgctttagttta--c
                   Chinchilla  tgactgctttagttta--c
             Brush-tailed rat  tgactgctttagttta--c
B D                    Rabbit  tggctgctttagttca--c
B D                      Pika  tgacagctttcattca--c
B D                       Pig  gg-c--ctttagtttg--c
B D                    Alpaca  gg-c--ttttagtttg--c
               Bactrian camel  gg-c--ttttagtttg--c
B D                   Dolphin  gg-c--ctttagtttg--c
                 Killer whale  gg-c--ctttagtttg--c
             Tibetan antelope  gc-c--ctttagtttg--c
B D                       Cow  gc-c--ctttagtttg--c
B D                     Sheep  gc-c--ctttagtttg--c
                Domestic goat  gc-c--ctttagtttg--c
B D                     Horse  tg-ccactttagtttg--c
B D          White rhinoceros  tg-ccgctttagtttg--c
B D                       Cat  tg-ccgctttagtttg--c
B D                       Dog  tg-tcgctttagtttg--c
B D                   Ferret   gg-ccgcttcagtttg--c
B D                     Panda  tg-ccgctttagtttg--c
               Pacific walrus  tg-ccgctttagtttg--c
                 Weddell seal  tg-ctgctttagtttg--c
             Black flying-fox  tg-cag-------------
B D                   Megabat  tg-cag-------------
                Big brown bat  cg-ctgctttagtttg--c
         David's myotis (bat)  cg-ctgctttagtttg--c
B D                  Microbat  cg-ctgctttagtttg--c
B D                  Hedgehog  aa-tggctttaatttg--c
B D                     Shrew  tg-ttacttcagattg---
              Star-nosed mole  tg-tcactccagtcca--c
B D                  Elephant  cagccgctttagtttg--c
          Cape elephant shrew  taaccatttgggtttg--c
B D                   Manatee  cagccgcttgagtttg--c
             Cape golden mole  cagtcactttaattca--c
B D                    Tenrec  cagcagctttagttgg--c
                     Aardvark  cagctgctttagttca--c
B D                 Armadillo  tggctgctttagttta--c
B D                Coelacanth  ===================
B D             X. tropicalis  ===================
B D              Atlantic cod  ===================
                 Spotted gar  ===================
B D               Stickleback  ===================
          Southern platyfish  ===================
      Yellowbelly pufferfish  ===================
B D                      Fugu  ===================
B D                 Tetraodon  ===================
B D                    Turkey  ===================
B D                   Chicken  ===================
  D              Mallard duck  ===================
          Tibetan ground jay  ===================
B D               Zebra finch  ===================
  D    White-throated sparrow  ===================
B D           Tasmanian devil  ===================
    Mexican tetra (cavefish)  ===================
B D                 Zebrafish  ===================
B D                    Medaka  ===================
         Pundamilia nyererei  ===================
                 Zebra mbuna  ===================
       Burton's mouthbreeder  ===================
         Princess of Burundi  ===================
B D              Nile tilapia  ===================
  D            Painted turtle  ===================
  D           Green seaturtle  ===================
B D        American alligator  ===================
B D                Budgerigar  ===================
B D                   Opossum  -------------------
  D               Rock pigeon  ===================
  D       Collared flycatcher  ===================
B D       Medium ground finch  ===================
B D                    Lizard  ===================
  D          Peregrine falcon  ===================
  D              Saker falcon  ===================
B D                  Platypus  ===================
  D  Chinese softshell turtle  ===================

Inserts between block 1 and 2 in window
B D                 Bushbaby 2bp
B D                 Squirrel 2bp
      Lesser Egyptian jerboa 2bp
                Prairie vole 2bp
B D          Chinese hamster 2bp
              Golden hamster 2bp
B D                    Mouse 2bp
B D                      Rat 2bp
B D           Naked mole-rat 2bp
B D               Guinea pig 2bp
                  Chinchilla 121bp
            Brush-tailed rat 2bp
B D                   Rabbit 2bp
B D                     Pika 2bp
B D                      Pig 2bp
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 2bp
               Domestic goat 2bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                      Dog 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
               Big brown bat 2bp
        David's myotis (bat) 2bp
B D                 Microbat 2bp
B D                 Hedgehog 2bp
B D                    Shrew 2bp
             Star-nosed mole 2bp

Alignment block 2 of 435 in window, 46607732 - 46607805, 74 bps 
B D                     Human  --ctttta-ttttac----c-aa--------aaataacaacaataa-agtcttccctctgt---------
B D                     Chimp  --ctttta-ttttac----c-aa--------aaataacaacaataa-agtcttccctctgt---------
B D                   Gorilla  --ctttta-ttttac----c-aa--------aaataagaacaataa-agtcttccctctgt---------
B D                 Orangutan  --ctttta-ttttac----c-aa--------aaataacaacaataa-agtcttccctctgt---------
B D                    Gibbon  --ctttta-ttttac----c-aa--------aaataacaacaataa-agtcttccctctgt---------
B D                    Rhesus  --ctttta-ttttac----c-aa--------aaataacaacaataa-agtcttccctctgt---------
B D       Crab-eating macaque  --ctttta-ttttac----c-aa--------aaataacaacaataa-agtcttccctctgt---------
B D                    Baboon  --ctttta-ttttac----c-aa--------aaataacaacaataa-agtcttccctctgt---------
B D              Green monkey  --ctttta-ttttac----c-aa--------aaataacaacaataa-agtcttccctctgt---------
B D                  Marmoset  --ctttta-ttttat----g-aa--------aaataacaacaataa-agttttccctctgt---------
B D           Squirrel monkey  --ctttta-ttttac----g-aa--------aaataacaacaataa-agttttccctctgt---------
B D                  Bushbaby  --ctttta-ttttacaaaaa-aa--------aaaaaataacaataa-agtcttccctctgt---------
           Chinese tree shrew  --ccttta--tttac----c-aa--------aaataacaatgataa-agtcttccctctgt---------
B D                  Squirrel  --ctttta-ctttac----c-aa--------aaataacaacaataa-agtctcccttctat---------
       Lesser Egyptian jerboa  --ctttta-ttttac----c-aa--------aaatatc---aataa-agtcttccctatat---------
                 Prairie vole  --cttttatttttac----c-aa--------aaatagc------aa-aatcttccc--ttt---------
B D           Chinese hamster  --ctttta-ttttac----c-aa--------aaatagc------aa-aattttccc--tct---------
               Golden hamster  --ctttta-ttttac----c-aa--------aaatagc------aa-aatcttccc--tct---------
B D                     Mouse  --ctttta-ttttac----aaaa--------aaatagc------aa-aatctttc----tt---------
B D                       Rat  --ctttta-ttttac----caaa--------aaatagc------aa-aatctttcc--tct---------
B D            Naked mole-rat  --ctttta-ttttac----c-aa--------aaataacaacaataa-agtctttcctctgt---------
B D                Guinea pig  --ctttta-ttttac----c-aa--------aaataacaacaataa-agtctttcttcttt---------
                   Chinchilla  --ctttta-ttttac----c-aa--------aaataacaacaataa-agtcttttctctgt---------
             Brush-tailed rat  --ctttta-ttttac----c-aa--------aaataacaataataa-ggtctttcctctgt---------
B D                    Rabbit  --ctttta-ttttta----ccaa--------aaataacaacaataa-agtcttccctctgt---------
B D                      Pika  --ctttta-ttttac----caaa--------aaataacaacaataa-cgtctttcgcctgt---------
B D                       Pig  --ctttta-ttttac----c-aa--------aaataacaacaataa-agt-ttccctctgt---------
B D                    Alpaca  --ccttta-ttttac----c-aa--------aaataacaacaatat-aat-ttccctctgt---------
               Bactrian camel  --ccttta-ttttac----c-aa--------aaataacaacaataa-aat-ttccctctgt---------
B D                   Dolphin  --ccttta-ttttac----c-aa--------aaataacaacaataa-aat-ttccctctgt---------
                 Killer whale  --ccttta-ttttac----c-aa--------aaataacaacaataa-aat-ttccctctgt---------
             Tibetan antelope  --ccttta-ttttac----c-aa--------aaataacaaagataa-aat-ttccctctgt---------
B D                       Cow  --ccttta-ttttac----c-aa--------aaataacaaagataa-att-ttccctctgt---------
B D                     Sheep  --ccttta-ttttac----c-aa--------aaataacaaagataa-aat-ttccctctgt---------
                Domestic goat  --ccttta-ttttac----c-aa--------aaataacaaagataa-aat-ttccctctgt---------
B D                     Horse  --ccttta-ttttac----c-aa--------aaataacaacaataa-agtcttccctctgt---------
B D          White rhinoceros  --ccttta-ttttac----c-aa--------aaataacaataataa-agtcttccctctat---------
B D                       Cat  --ccttta-ttttac----c-aa--------aaataacaataataa-agtcttccctctgt---------
B D                       Dog  --ccttta-tttaac----c-aa--------aaataacaataataa-actcttccctctgt---------
B D                   Ferret   --ccttta-ttttac----c-aa--------aaataacaataataa-actcttccctctgt---------
B D                     Panda  --ccttta-ttttac----c-aa--------aaataacaataataa-acccttccctctgt---------
               Pacific walrus  --ccttta-ttttac----c-aa--------aaataacaataataa-actcttccctctgt---------
                 Weddell seal  --ccttta-ttttac----c-aa--------aaataacaataataa-actcttccctctgt---------
             Black flying-fox  ---cttta-ttttac----c-aa--------aaataacaacaataa-aatcttcc--ttgt---------
B D                   Megabat  ---cttta-ttttac----c-aa--------aaataacaacaataa-aatcttcc--ttgt---------
                Big brown bat  --ccttta-ttttac----c-aa--------aaataacaacaataa-agtcttccctctgt---------
         David's myotis (bat)  --tcttta-ttttac----c-aa--------aaataacaacaataa-agtcttccctctgtnnnnnnnnn
B D                  Microbat  --ccttta-ttttac----c-aa--------aaataacaacaataa-agtcttccctctgt---------
B D                  Hedgehog  --atttta-ttttat----a-aaaacaaaacaaacaaaaacaac---agttt----tcaga---------
B D                     Shrew  --ccttta-ttttac----c-aa--------aaataataacaa----agtcttcccttcat---------
              Star-nosed mole  --ccttta-ttttac----c-aa--------aaataacaataa----aatct----tttgt---------
B D                  Elephant  ctccttta-ttttac----c-aa--------a---aata-caataa-aatcttccctctgt---------
          Cape elephant shrew  ttccttta-ttttac----a-aa--------a---aatagcaataa-aatattccctttat---------
B D                   Manatee  ctccttta-ttttac----c-aa--------a---aataacaacaatagtcttccctctgt---------
             Cape golden mole  ttccttta-ttttac----a-aa------------aataacaataa-agtcttccctctgt---------
B D                    Tenrec  ctccttta-ttttac----c-aa--------aaataacaacaataa-agtcttccctctgt---------
                     Aardvark  ctctttta-ttttac----c-aa--------a---aataacaataa-agtattccctccgt---------
B D                 Armadillo  atccttta-ttttac----a-aa--------a---aataacaataa-agtcttccttctgt---------
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ----------------------------------------------------------------------
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Platypus  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  ---------------------------------------------------------ttcat-aaaaat-
                        Chimp  ---------------------------------------------------------ttcat-aaaaat-
                      Gorilla  ---------------------------------------------------------ttcat-aaaaat-
                    Orangutan  ---------------------------------------------------------ttcat-aaaaat-
                       Gibbon  ---------------------------------------------------------ttcat-aaaaat-
                       Rhesus  ---------------------------------------------------------ttcat-aaaaat-
          Crab-eating macaque  ---------------------------------------------------------ttcat-aaaaat-
                       Baboon  ---------------------------------------------------------ttcat-aaaaat-
                 Green monkey  ---------------------------------------------------------ttcat-aaaaat-
                     Marmoset  ---------------------------------------------------------ttcat-aaaaat-
              Squirrel monkey  ---------------------------------------------------------ttcat-aaaaat-
                     Bushbaby  ---------------------------------------------------------ttcat-aaaaat-
           Chinese tree shrew  ---------------------------------------------------------ttcac-aaaaat-
                     Squirrel  ---------------------------------------------------------ttcac-aaaaat-
       Lesser Egyptian jerboa  ---------------------------------------------------------ttcac-aaaaat-
                 Prairie vole  ---------------------------------------------------------ttcac-aaaaat-
              Chinese hamster  ---------------------------------------------------------ttcac-aaaaat-
               Golden hamster  ---------------------------------------------------------ttcac-aaaaat-
                        Mouse  ---------------------------------------------------------ttcac-aaaaat-
                          Rat  ---------------------------------------------------------ttcac-aaaaat-
               Naked mole-rat  ---------------------------------------------------------ttcacaaaaaat-
                   Guinea pig  ---------------------------------------------------------ttcac-aaaaat-
                   Chinchilla  ---------------------------------------------------------ttcac-aaaaat-
             Brush-tailed rat  ---------------------------------------------------------ttcac-agaaat-
                       Rabbit  ---------------------------------------------------------ttcac-aaaaat-
                         Pika  ---------------------------------------------------------ttcac-aaaaat-
                          Pig  ---------------------------------------------------------ttcac-aaaaat-
                       Alpaca  ---------------------------------------------------------ttcac-aaaaat-
               Bactrian camel  ---------------------------------------------------------ttcac-aaaaatc
                      Dolphin  ---------------------------------------------------------ttcac-aaaaaa-
                 Killer whale  ---------------------------------------------------------ttcac-aaaaaa-
             Tibetan antelope  ---------------------------------------------------------ttcac-aaaaaa-
                          Cow  ---------------------------------------------------------ttcac-aaaaaa-
                        Sheep  ---------------------------------------------------------ttcac-aaaaaa-
                Domestic goat  ---------------------------------------------------------ttcac-aaaaaa-
                        Horse  ---------------------------------------------------------ttcgc-aaaaat-
             White rhinoceros  ---------------------------------------------------------ttcac-aaaaat-
                          Cat  ---------------------------------------------------------ttcac-aaaaat-
                          Dog  ---------------------------------------------------------ttcac-aaaaat-
                      Ferret   ---------------------------------------------------------ttcac-aaaaat-
                        Panda  ---------------------------------------------------------ttcac-aaaaat-
               Pacific walrus  ---------------------------------------------------------ttcac-aaaaat-
                 Weddell seal  ---------------------------------------------------------ttcac-aaaaat-
             Black flying-fox  ---------------------------------------------------------ttcac-aaaaat-
                      Megabat  ---------------------------------------------------------ttcac-aaaaat-
                Big brown bat  ---------------------------------------------------------ttcac-aaaaat-
         David's myotis (bat)  nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn-------------
                     Microbat  ---------------------------------------------------------ttcac-aaaaat-
                     Hedgehog  ---------------------------------------------------------ttcac-aaaaat-
                        Shrew  ---------------------------------------------------------ttcac-aaaaat-
              Star-nosed mole  ---------------------------------------------------------ttcac-aaaatt-
                     Elephant  ---------------------------------------------------------ttcac-aaaaat-
          Cape elephant shrew  ---------------------------------------------------------gtcac-aaaaat-
                      Manatee  ---------------------------------------------------------ttcac-aaaaat-
             Cape golden mole  ---------------------------------------------------------ttcac-acaaat-
                       Tenrec  ---------------------------------------------------------ttcac-aaaaat-
                     Aardvark  ---------------------------------------------------------ttcac-aaaaat-
                    Armadillo  ---------------------------------------------------------ttcac-aaaaat-
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  --------------------------aaa--t-t---------ttcc--------------a------ac
                        Chimp  --------------------------aaa--t-t---------ttct--------------g------ac
                      Gorilla  --------------------------aaa--t-t---------ttcc--------------g------ac
                    Orangutan  --------------------------aaa--t-t---------ttcc--------------c------ac
                       Gibbon  --------------------------aaa--t-t---------ttcc--------------c------at
                       Rhesus  --------------------------aca--t-t---------ttcc--------------c------ac
          Crab-eating macaque  --------------------------aca--t-t---------ttcc--------------c------ac
                       Baboon  --------------------------aca--t-t---------ttcc--------------c------ac
                 Green monkey  --------------------------aca--t-t---------ttcc--------------c------ac
                     Marmoset  --------------------------aaa--t-t---------ttcc--------------c------ac
              Squirrel monkey  --------------------------aat--t-t---------ttcc--------------c------ac
                     Bushbaby  --------------------------aga--t-c---------cccc--------------c------cc
           Chinese tree shrew  --------------------------aga--t-t---------ttcc--------------c------ac
                     Squirrel  --------------------------aga--t-t---------tccc--------------tccccctgg
       Lesser Egyptian jerboa  --------------------------agt--t-t---------ttct--------------ttcccccaa
                 Prairie vole  --------------------------ata--t-t---------tccc--------------t--------
              Chinese hamster  --------------------------ata--t-t---------tccc--------------t--------
               Golden hamster  --------------------------ata--t-t---------tccc--------------t--------
                        Mouse  --------------------------aga--t-t---------tccc--------------tcct-----
                          Rat  --------------------------aga--t-t---------tccc--------------t--------
               Naked mole-rat  --------------------------aga--tcc---------cccc--------------c------aa
                   Guinea pig  --------------------------aga--t-t---------cccc--------------c------aa
                   Chinchilla  --------------------------aga----t---------cccc--------------c------aa
             Brush-tailed rat  --------------------------aga--t-t---------cccc--------------c------at
                       Rabbit  --------------------------aga--t-t---------tctc--------------c------tc
                         Pika  --------------------------aga--t-t---------tctc--------------c------tc
                          Pig  --------------------------aga--t-t-----------cc--------------c------ta
                       Alpaca  --------------------------aga--t-t---------cccc--------------c------ca
               Bactrian camel  ctctactgaaatacaaatcctcttccagattt-t---------ccca--------------c------ca
                      Dolphin  ---------------------------------------------at--------------a------ca
                 Killer whale  ---------------------------------------------at--------------a------ca
             Tibetan antelope  -------------------------taga--t-t---------gccc--------------c------ca
                          Cow  -------------------------taga--t-t---------gccc--------------c------ca
                        Sheep  -------------------------taga--t-t---------gccc--------------c------ca
                Domestic goat  -------------------------taga--t-t---------gccc--------------c------ca
                        Horse  --------------------------aga--t-t---------tacc--------------c------cc
             White rhinoceros  --------------------------aga--t-t---------tcgc--------------c------cc
                          Cat  --------------------------aga--t-t---------tccc--------------g------tc
                          Dog  --------------------------aga--t-t---------tccc--------------g------tc
                      Ferret   --------------------------aga--t-t---------tccc--------------g------tc
                        Panda  --------------------------aga--t-t---------tccc--------------g------tc
               Pacific walrus  --------------------------aga--t-t---------tcct--------------g------tc
                 Weddell seal  --------------------------aga--t-t---------tcca--------------g------tc
             Black flying-fox  --------------------------aga--t-t---------tccccac-----------c------cc
                      Megabat  --------------------------aga--t-t---------tccccac-----------c------cc
                Big brown bat  --------------------------aga--t-t---------tcctcccttccctccccaa------cc
         David's myotis (bat)  ----------------------------------------------------------------------
                     Microbat  --------------------------aga--t-t---------tccccacttccctccct-c------cc
                     Hedgehog  --------------------------aga--t-ctcccacccaccta--------------c------cc
                        Shrew  --------------------------ata--t-t---------cccc--------------t------cc
              Star-nosed mole  --------------------------aga--t-------------ca--------------t------ct
                     Elephant  --------------------------aga--t-t---------tccc--------------t------gc
          Cape elephant shrew  --------------------------aga--t-t---------tccc--------------c------tc
                      Manatee  --------------------------aga--t-t---------tccc--------------t------gc
             Cape golden mole  --------------------------aga--t-t---------tctc--------------c------tc
                       Tenrec  --------------------------aga--t-t---------tc-c--------------c------ta
                     Aardvark  --------------------------aga--t-t---------tctc--------------t------gc
                    Armadillo  --------------------------aga--t-t---------tcac--------------c------ac
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  cc----------------------------------------------------------t-cccc
                        Chimp  cc----------------------------------------------------------t-cccc
                      Gorilla  cc----------------------------------------------------------t-cccc
                    Orangutan  cc----------------------------------------------------------t-cccc
                       Gibbon  cc----------------------------------------------------------t-cccc
                       Rhesus  cc----------------------------------------------------------t-cccc
          Crab-eating macaque  cc----------------------------------------------------------t-cccc
                       Baboon  cc----------------------------------------------------------t-cccc
                 Green monkey  cc----------------------------------------------------------t-cccc
                     Marmoset  cc----------------------------------------------------------t-cccc
              Squirrel monkey  cc----------------------------------------------------------t--ccc
                     Bushbaby  cc----------------------------------------------------------c-c---
           Chinese tree shrew  tt----------------------------------------------------------c-ccc-
                     Squirrel  ------------------------------------------------------------c-cccc
       Lesser Egyptian jerboa  cc----------------------------------------------------------c-ctcc
                 Prairie vole  ------------------------------------------------------------c-ccca
              Chinese hamster  ------------------------------------------------------------------
               Golden hamster  ------------------------------------------------------------------
                        Mouse  cc----------------------------------------------------------c-ccct
                          Rat  ------------------------------------------------------------c-ccca
               Naked mole-rat  cc----------------------------------------------------------c-ttcc
                   Guinea pig  cc----------------------------------------------------------t-ttcc
                   Chinchilla  cc----------------------------------------------------------a-ttcc
             Brush-tailed rat  cc----------------------------------------------------------c-ttcc
                       Rabbit  cc----------------------------------------------------------c-ctcc
                         Pika  ct----------------------------------------------------------cgctcc
                          Pig  cc----------------------------------------------------------c-cc--
                       Alpaca  cc----------------------------------------------------------c-cc--
               Bactrian camel  ccctggacaggactctgcaaacttgttgtttcatagactataatggaagttataccaaaac-tc--
                      Dolphin  tc----------------------------------------------------------c-cc--
                 Killer whale  tc----------------------------------------------------------c-cc--
             Tibetan antelope  tt----------------------------------------------------------c-ca--
                          Cow  tt----------------------------------------------------------c-ca--
                        Sheep  tt----------------------------------------------------------c-ca--
                Domestic goat  tt----------------------------------------------------------c-ca--
                        Horse  tc----------------------------------------------------------c-cc--
             White rhinoceros  ta----------------------------------------------------------c-cc--
                          Cat  tc----------------------------------------------------------c-cc--
                          Dog  t-----------------------------------------------------------c-cc--
                      Ferret   tc----------------------------------------------------------c-cc--
                        Panda  tc----------------------------------------------------------c-cc--
               Pacific walrus  tc----------------------------------------------------------c-cc--
                 Weddell seal  tc----------------------------------------------------------c-cc--
             Black flying-fox  ct----------------------------------------------------------c-ct--
                      Megabat  ct----------------------------------------------------------c-ct--
                Big brown bat  ct----------------------------------------------------------c-cc--
         David's myotis (bat)  ------------------------------------------------------------------
                     Microbat  ct----------------------------------------------------------c-cc--
                     Hedgehog  ac----------------------------------------------------------c-cc--
                        Shrew  tc----------------------------------------------------------c-ca--
              Star-nosed mole  tc----------------------------------------------------------c-ct--
                     Elephant  cc----------------------------------------------------------c-----
          Cape elephant shrew  cc----------------------------------------------------------c-----
                      Manatee  cc----------------------------------------------------------c-----
             Cape golden mole  cc----------------------------------------------------------c-----
                       Tenrec  cc----------------------------------------------------------c-----
                     Aardvark  cc----------------------------------------------------------c-----
                    Armadillo  ct----------------------------------------------------------c-----
                   Coelacanth  ==================================================================
                X. tropicalis  ==================================================================
                 Atlantic cod  ==================================================================
                  Spotted gar  ==================================================================
                  Stickleback  ==================================================================
           Southern platyfish  ==================================================================
       Yellowbelly pufferfish  ==================================================================
                         Fugu  ==================================================================
                    Tetraodon  ==================================================================
                       Turkey  ==================================================================
                      Chicken  ==================================================================
                 Mallard duck  ==================================================================
           Tibetan ground jay  ==================================================================
                  Zebra finch  ==================================================================
       White-throated sparrow  ==================================================================
              Tasmanian devil  ==================================================================
     Mexican tetra (cavefish)  ==================================================================
                    Zebrafish  ==================================================================
                       Medaka  ==================================================================
          Pundamilia nyererei  ==================================================================
                  Zebra mbuna  ==================================================================
        Burton's mouthbreeder  ==================================================================
          Princess of Burundi  ==================================================================
                 Nile tilapia  ==================================================================
               Painted turtle  ==================================================================
              Green seaturtle  ==================================================================
           American alligator  ==================================================================
                   Budgerigar  ==================================================================
                      Opossum  ------------------------------------------------------------------
                  Rock pigeon  ==================================================================
          Collared flycatcher  ==================================================================
          Medium ground finch  ==================================================================
                       Lizard  ==================================================================
             Peregrine falcon  ==================================================================
                 Saker falcon  ==================================================================
                     Platypus  ==================================================================
     Chinese softshell turtle  ==================================================================

Inserts between block 2 and 3 in window
B D                      Pig 8bp
B D                   Alpaca 20bp
              Bactrian camel 136bp
B D                  Dolphin 11bp
                Killer whale 11bp
            Tibetan antelope 13bp
B D                      Cow 22bp
B D                    Sheep 13bp
               Domestic goat 13bp
B D                    Horse 10bp
B D         White rhinoceros 4bp
B D                      Cat 7bp
B D                      Dog 7bp
B D                  Ferret  7bp
B D                    Panda 7bp
              Pacific walrus 7bp
                Weddell seal 7bp
            Black flying-fox 18bp
B D                  Megabat 18bp
               Big brown bat 17bp
B D                 Microbat 17bp
B D                 Hedgehog 8bp
B D                    Shrew 8bp
             Star-nosed mole 8bp

Alignment block 3 of 435 in window, 46607806 - 46607814, 9 bps 
B D                     Human  ---ctatcccag--------
B D                     Chimp  ---ctatcccag--------
B D                   Gorilla  ---ctatcccag--------
B D                 Orangutan  ---ccatcccag--------
B D                    Gibbon  ---ccatcccag--------
B D                    Rhesus  ---ccaacccag--------
B D       Crab-eating macaque  ---ccaacccag--------
B D                    Baboon  ---ccaacccag--------
B D              Green monkey  ---tcatcccag--------
B D                  Marmoset  ---ccatcccag--------
B D           Squirrel monkey  ---ctatcccag--------
           Chinese tree shrew  ------tccccg--------
B D                  Squirrel  ---atgc-------------
       Lesser Egyptian jerboa  ---cttc-------------
                 Prairie vole  ---cccc-------------
B D           Chinese hamster  ---cccc-------------
               Golden hamster  ---cccc-------------
B D                     Mouse  ---cccc-------------
B D                       Rat  ---cccc-------------
B D            Naked mole-rat  ---ccac-------------
B D                Guinea pig  ---ccgc-------------
                   Chinchilla  ---ccac-------------
             Brush-tailed rat  ---ctac-------------
B D                    Rabbit  ---ccgc-------------
B D                      Pika  ---ccac-------------
B D                       Pig  ---ccac-------------
B D                    Alpaca  ---caat-------------
               Bactrian camel  ---caat-------------
B D                   Dolphin  ---gcat-------------
                 Killer whale  ---gcat-------------
             Tibetan antelope  ---tcat-------------
B D                       Cow  ---tcat-------------
B D                     Sheep  ---tcat-------------
                Domestic goat  ---tcat-------------
B D                     Horse  ---ctgc-------------
B D          White rhinoceros  ---ctgc-------------
B D                       Cat  ---ctgc-------------
B D                       Dog  ---cccc-------------
B D                   Ferret   ---ccgc-------------
B D                     Panda  ---ccgc-------------
               Pacific walrus  ---ccac-------------
                 Weddell seal  ---ccac-------------
             Black flying-fox  ---ctgc-------------
B D                   Megabat  ---ctgc-------------
                Big brown bat  ---cttc-------------
         David's myotis (bat)  ---cttc-------------
B D                  Microbat  ---cttc-------------
B D                  Hedgehog  ---ctgc-------------
B D                     Shrew  ---cc---------------
              Star-nosed mole  ---ccaa-------------
B D                  Elephant  cctcccc-----a-------
          Cape elephant shrew  ctttccc-----aa------
B D                   Manatee  cctcccc-----a-------
             Cape golden mole  tttcccc-----c-------
B D                    Tenrec  cttcccc-----a-------
                     Aardvark  tcctccc-----c-cca---
B D                 Armadillo  cctcccc-----c----cag
B D                Coelacanth  ====================
B D             X. tropicalis  ====================
B D              Atlantic cod  ====================
                 Spotted gar  ====================
B D               Stickleback  ====================
          Southern platyfish  ====================
      Yellowbelly pufferfish  ====================
B D                      Fugu  ====================
B D                 Tetraodon  ====================
B D                    Turkey  ====================
B D                   Chicken  ====================
  D              Mallard duck  ====================
          Tibetan ground jay  ====================
B D               Zebra finch  ====================
  D    White-throated sparrow  ====================
B D           Tasmanian devil  ====================
    Mexican tetra (cavefish)  ====================
B D                 Zebrafish  ====================
B D                    Medaka  ====================
         Pundamilia nyererei  ====================
                 Zebra mbuna  ====================
       Burton's mouthbreeder  ====================
         Princess of Burundi  ====================
B D              Nile tilapia  ====================
  D            Painted turtle  ====================
  D           Green seaturtle  ====================
B D        American alligator  ====================
B D                Budgerigar  ====================
B D                   Opossum  --------------------
  D               Rock pigeon  ====================
  D       Collared flycatcher  ====================
B D       Medium ground finch  ====================
B D                    Lizard  ====================
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
B D                  Platypus  ====================
B D                  Bushbaby  --------------------
  D  Chinese softshell turtle  ====================

Inserts between block 3 and 4 in window
         Cape elephant shrew 874bp

Alignment block 4 of 435 in window, 46607815 - 46607936, 122 bps 
B D                     Human  aaatcagccc-ttgccac------agcctaga----atccatcatgcaagtcac-ag--cactct-ggg-
B D                     Chimp  aaatcagccc-ttgccac------agcctaga----atccatcatgcaagtcac-ag--cactct-ggg-
B D                   Gorilla  aaatcagccc-ttgccac------agcctaga----atccatcatgcgagtcac-ag--cactct-ggg-
B D                 Orangutan  aagtcagccc-ttgccac------agcctaga----atccatcatgcaagtcac-ag--cactct-ggg-
B D                    Gibbon  aaattagccc-ttgccac------agcctaga----atccatcatgcaagtcac-ag--cactct-ggg-
B D                    Rhesus  aaatcagccc-ttgccgc------agcctaga----atccatcatgcaagtcac-ag--cactct-ggg-
B D       Crab-eating macaque  aaatcagccc-ttgccgc------agcctaga----atccatcatgcaagtcac-ag--cactct-ggg-
B D                    Baboon  aaatcagccc-ttgccgc------agcctaga----atccatcatgcaagtcac-ag--cactct-ggg-
B D              Green monkey  aaatcagccc-tcgccac------agcctaga----atccatcatgcaagtcac-ag--cactct-ggg-
B D                  Marmoset  aaatcagccc-ttgccat------agcctaga----attcatcttgcaagccac-ag--cactct-ggg-
B D           Squirrel monkey  aaatcagccc-ttgccat------agcctaga----attcatcttgtaagccac-ag--cactct-ggg-
B D                  Bushbaby  -aatcagtcc-ttgtcac------agtcta------------------------------cctcg-gag-
           Chinese tree shrew  taatcagccc-ttgccac------aacctaga----attggtcttgccagccac-agtttaccct-gga-
B D                  Squirrel  -catcagccc-ttgccat------agtctaga----atccaccgtgcaagctgc-agtccactct-ggg-
       Lesser Egyptian jerboa  -aaccagctc-ttaccac------aacctaga----atgcattgcataatgtgt-agtttactct-ggg-
                 Prairie vole  -catcatccc-tgttcac------agccgaga----tttcagaatatgtcctgt-agcccactat--cg-
B D           Chinese hamster  -catcatccc-ttttcac------agcctaga----tttcagagtatattctgcaagcccactgt--gg-
               Golden hamster  -catcatccc-ttttcac------agcctaga----ttccagagtatattctgcaaacccactgt--gg-
B D                     Mouse  -tgtggtccc-ttttcac------agcctaga----tttcagaatatattctgc-agcccaccgtgggg-
B D                       Rat  -tatggtccc-ttttcac------agcctaga----tttcagaatatattctgc-agcccatcgt-ggg-
B D            Naked mole-rat  -aatcaggcc-ttgccac------agcctaga----atccattgtgcaagctgc-agtctaccct-ggg-
B D                Guinea pig  -aatcagccc-ttgccac------agcctaga----atccatcgtgtaagccac-agccaatgct-gga-
                   Chinchilla  -aactagccc-ttgccac------agcctaga----atccatcatgcaagccgc-agtccatgct-ggg-
             Brush-tailed rat  -aatcagccc-ttgcca-------agcctaga----atccatcatgcaagcttc-agttcatgtt-gagg
B D                    Rabbit  -aatcagccc-tggccgc------agcctaga----atccatcttgccagccac-agtccactct--gc-
B D                      Pika  -aatcagccc-ttacggc------ggcctgga----attcctcttggaagccac-agtcctcccc--gg-
B D                       Pig  -aatcagcac-tggccat------agcctaga----ctccgtcttccaatcccc-agtcctgctc-ggg-
B D                    Alpaca  -ggtcaccac-tggccat------agcctaga----atccgttttccaatccgc-agtcctcctt-ggg-
               Bactrian camel  -ggtcggcac-tggccat------agtctaga----atccattttccaatccgc-agtcctcctt-ggg-
B D                   Dolphin  -aatcagtac-tggccat------agcctaga----ctccatcttccaatccac-agtcctcctt-ggc-
                 Killer whale  -aatcagtac-tggccat------agcctaga----ctccatcttccaatccac-agtcctcctt-ggc-
             Tibetan antelope  -aatcagcac-tggtagt------agcctaga----ctccaacgcccaatatac-aatcctcttt-ggg-
B D                       Cow  -aatcagcac-tggcagt------agcctaga----ctcaaactcccaatatac-aatcctcttt-ggg-
B D                     Sheep  -aatcagcac-tggtagt------agcctaga----ctccaacacccaatatac-aatcctcttt-ggg-
                Domestic goat  -aatcagcac-tggtagt------agcctaga----ctccaacacccaatatac-aatcctcttt-ggg-
B D                     Horse  -aatcagccattggccac------agcctaga----atccatctcccaatc--c-agtcctccct-ggg-
B D          White rhinoceros  -aatcagcaa-tggccac------agcctaga----attcatctcccagtg--c-agtcctccct-ggg-
B D                       Cat  -agtcagcac-tggccac------ggcctaga----acccatcttccagtcctc-agtcctccct-gag-
B D                       Dog  -agtgagcac-tggccgc------agcctaga----a-------------ccac-aggga-acct-gag-
B D                   Ferret   -agtcagcac-tggccac------agcctgga----acccatcttccaatccac-agtcctcccc-aag-
B D                     Panda  -agtcagcac-tggccac------agcctaga----acccatcttccaatccac-agacctccct-gag-
               Pacific walrus  -agccagcac-tggccac------agcctaga----acccatcttccaatccac-agtcctccct-gag-
                 Weddell seal  -agtcagcac-tggccac------agcctaga----acccatcttct-atccac-agtcctccct-gag-
             Black flying-fox  -aatcagcac-cagccac------aatctaga----atccatcttccaatccac-agtcctcttt-ggg-
B D                   Megabat  -aatcagcac-cagccac------aatctaga----atccatcttccaatccac-agtcctcttt-ggg-
                Big brown bat  -aatcagcac-cggccac------agcctaga----atctatgtttccacccac-tgtcc---ct-ggg-
         David's myotis (bat)  -aatcagcac-cggccacagccagggcctaga----atctatcttaccatccac-tgtcc---ct-ggg-
B D                  Microbat  -aatcagcac-cggccac------ggcctaga----atctatcttaccatccac-t--------------
B D                  Hedgehog  -aattagcac-tggccac------agtctaaagtctatctatcctccaatcagg-agtctactct-agg-
B D                     Shrew  -aattagcac-cgaccac------agcctag------------atccaacccag-agaccaccct-ggg-
              Star-nosed mole  -aattagcac-tga-cac------agcctaga----ctctgccatccaaacccc-agtccccact-gag-
B D                  Elephant  caatcagctc-tggccgt------agcctaga----atccatcttccaagccac-agac-agtct-ggg-
          Cape elephant shrew  aagtcagctc-tggccac------cgcttaga----atccgtcttccaagccac-agtc-caggt-tgg-
B D                   Manatee  caattggctc-tggccac------agcctaga----atccatcttccaagccac-agtctagtct-agg-
             Cape golden mole  aaatcagctc-tggccag------agcctaga----atccatcttctaagctat-agacaagtct-gggg
B D                    Tenrec  caatcagccc-tggccac------agcctaga----atccatcttccaagccac-agcccagcct-gagg
                     Aardvark  caatcagctc-tggccac------aggctaaa----atccatcttccaagccac-agtccagtct-ggg-
B D                 Armadillo  ----tcaccc-tggccac------agcctaga----ctccacattccaagccac-agttgaccct-ggg-
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ----------------------------------------------------------------------
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Platypus  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  ---aaaag---ctccta-c---------------taccctcgctccacagcctctggcaaa----gctgc
                        Chimp  ---gaaag---ctccta-c---------------taccctcgctccacagcctctggcaaa----gctgc
                      Gorilla  ---gaaag---ctccta-c---------------tcccctcgctccgcagcctctggcaaa----gctgc
                    Orangutan  ---gaaag---ctccta-c---------------taccctcgctctacagcctctggcaaa----gctgc
                       Gibbon  ---gaaag---ctcctg-c---------------taccctcgctccacagcctctggcaaa----gctgc
                       Rhesus  ---gaaag---ctccta-c---------------taccctcgctccacag-ctccggcaaa----gctgc
          Crab-eating macaque  ---gaaag---ctccta-c---------------taccctcgctccacag-ctccggcaaa----gctgc
                       Baboon  ---gaaag---ctccta-c---------------caccctcgctccacag-ctccggcaaa----gctgc
                 Green monkey  ---gaaag---ctccta-c---------------taccctcgctccacagcctccggcaaa----gctgc
                     Marmoset  ---gaaag---ctccga-c---------------taccctcactccacagcctctggcgaa----gctgc
              Squirrel monkey  ---gaaag---ctccta-c---------------taccctcgctccacagcctctggcgaa----gctgc
                     Bushbaby  ---gaaggaatctccaa-c---------------tctcctcgttccagagcctctggcaaa----gctcc
           Chinese tree shrew  ---gaaag---cactga-c---------------tcccctcactccggagcctctggcaaa----gctgc
                     Squirrel  ---ggaag---ctccta-c---------------taccctcactccagagccgcagacaaa----gctgc
       Lesser Egyptian jerboa  ---ggaat---ctccca-c---------------tctcctcagttcagaagtgctggcaaa----gctgc
                 Prairie vole  ---ggaat---taccca-c---------------tttccttacttccgaaccactgccaaa----gctg-
              Chinese hamster  ---gggaa---tttccc-a---------------cttcctcagttctgaaccacttccaaa----gctg-
               Golden hamster  ---ggaat---ttccta-c---------------cttcctcagttctgaaccactgccaaa----gcta-
                        Mouse  ---ggaat---ctccca-c---------------tgtcctcagttctgagacattgccaaa----gctg-
                          Rat  ---ggaat---ctccta-c---------------tgtcctcagttctgagacactgccaag----gctg-
               Naked mole-rat  ---ggaag---ctccta-c---------------tccccttactccggagctgctggtaaa----tccac
                   Guinea pig  ---ggaag---ctccta-c---------------tccctttactttggagctgctggtaaa----gttgc
                   Chinchilla  ---gaaaa---ctccta-c---------------tccccttactccggagctgctggtaaa----gctgc
             Brush-tailed rat  gaaggaag---ctccta-c---------------tccccttactccagagctgctggtaaa----gctgc
                       Rabbit  ---ggaag---ctccga-c---------------gtccctctctgcagagttgctggccca----gctt-
                         Pika  ---ggaag---ct---------------------------------------------------------
                          Pig  ---agaat---ttctga--------------ccaccgcctcaca-cagaggttctggcaaa----gctgc
                       Alpaca  ---ggaag---ctatga--------------cccccccttcatgtcagagcttctggcaaa----gctgc
               Bactrian camel  ---ggaag---ctatga---------------ccccccttcatgtcagagcttctggcaaa----gctgt
                      Dolphin  ---agaac---ctttga-caccaccccccaccacccccctcacaccagagcttctggcaaa----gctgc
                 Killer whale  ---agaac---ctttga-caccaccccccaccacccccctcacaccagagcttctggcaaa----gctgc
             Tibetan antelope  ---agact---c--tga-cttccccgcagacccccagccccacgccagaatttctggcgaa----gctgc
                          Cow  ---agact---ctttga-catccccccagacccccagccccacgccagaatttctggcgaa----gctgc
                        Sheep  ---agact---c--tga-cttccccacagacccccaaccccacgccagaatttctggtgaa----gctgc
                Domestic goat  ---agact---c--tga-cttccccacagacccccaaccccacgccagaatttctggcgaa----gctgc
                        Horse  ---ggaat---gtctga-c----cc----a--cccc--ctcattccagagtctctggcaaa----gctgc
             White rhinoceros  ---ggaat---ctctga-c----cc----a--cgcc--ctcacccgagagtctctggcaaa----gctgc
                          Cat  ---gcaat---ctctga-t----ccctgga--ccccaccccaacccagagcctccagcaaa----gctgc
                          Dog  ---ggaat---ctctga-c----ccctgga--ccccaccacaccccagagcctctggcaaa----gctgc
                      Ferret   ---ggaat---ctctga-t----ccctgga--ccccaccctaccccagagcctctggtgaa----gttgc
                        Panda  ---ggaat---ctctga-t---cccctgga--ccccagcccaccccagagcctctggcaaa----gctga
               Pacific walrus  ---ggaat---ctctga-t--ccccctgga--cctcaccccaccccagagcctctggcaaa----gctgc
                 Weddell seal  ---ggaat---ctctga-t--cccccggga--cctcaccccaccccagagcctctggcaaa----gctgc
             Black flying-fox  ---ggaat---ctttga-caacccccca-----cccgcctgccatgcaaacctctggcaaa----gctgc
                      Megabat  ---ggaat---ctttga-caacccccca-----cccgcctgccatgcaaacctctggcaaa----gctgc
                Big brown bat  ---agaat---ctttgaccacctccc---------cgcctccctcgagagcctttggcaaa----gctgc
         David's myotis (bat)  ---agaat---ctttga-cacctccctt-------cccctcactccagagcctttggcaaa----gctgc
                     Microbat  ------at---ctttga-catctccctt-----cccccctcactccagagcctttggcaaa----gcagc
                     Hedgehog  ---gggct----tctga-g---------------tctccacacttgaatgtttctggcaaa----gctgc
                        Shrew  ---gacct-----ctga-g----------------cacctcattccagagcctctggccaa----gctgc
              Star-nosed mole  ---attcc-----------------------------ccccactctagagcctttggcaaa----atgga
                     Elephant  ---ggaag---ctctga-c----------------cccctcactccagaggctctggcaaa----gctgc
          Cape elephant shrew  ---ggaag---ctctga-c----------------cccttcactccagagcctctggcaaa----gctgc
                      Manatee  ---gaaag---atctga-c----------------cccctcactccggagcctctggcaaa----gctgc
             Cape golden mole  ---ggaaa---cgctga-c----------------catctcacttcagaacctctggcaaacaaggcagg
                       Tenrec  acaggaag---ctctgg-c----------------cctctccc--cggagcctctggcaaa----gctgc
                     Aardvark  ---ggaag---ctctga-c----------------ctcctcactccagagcctctggtaaa----gctgc
                    Armadillo  ---ggaag---ctctga-c---------------tcctctcact-aagagcctc-ggcaaa----gctgc
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  caggcc-a----------------------ctctggaggcggcagag
                        Chimp  caggcc-a----------------------ctctggtggcggcagag
                      Gorilla  caggcc-a----------------------ctctggaggcggcagag
                    Orangutan  caggcc-a----------------------ctctggaggcggcagag
                       Gibbon  caggcc-a----------------------ctctgcaggcagcagag
                       Rhesus  tgggcc-a----------------------ctcgggaggcggcagag
          Crab-eating macaque  tgggcc-a----------------------ctcgggaggcggcagag
                       Baboon  cgggcc-a----------------------ctcgggaggcggcagag
                 Green monkey  caggcc-a----------------------ctctggaggcggtagag
                     Marmoset  caggcc-a----------------------ctctagaggtggcagag
              Squirrel monkey  caggcc-a----------------------ctctggaggtggcagag
                     Bushbaby  cagtccaa----------------------ttctggagacagcagag
           Chinese tree shrew  caggtc-agcg-tattttccttgggaatgtctctggaggcagcaga-
                     Squirrel  caggcc-agca-tgtttcccttgggaacttctctggaggcagcaaag
       Lesser Egyptian jerboa  caggcc-agca-ggtgtcccttgggatcctgtctggaggcagtaaaa
                 Prairie vole  taggac-agca-tactttctttggg-acttttctagagctggcagag
              Chinese hamster  cagggt-ggca-tgctcccctt--g-acttttctggagccagcagat
               Golden hamster  catggt-ggca-tgcccccctt--g-tcttttctggagccagcagag
                        Mouse  caggcc-agcc-tgtttcccttggggacttttctggagccagc----
                          Rat  caggcc-agca-tgtttcccttggg----------------------
               Naked mole-rat  ctggcc-agaa-tgcttctcttgggaaattctttggaatcagcagag
                   Guinea pig  catgcc-agaa-tatgtctcttgggaaattctttggagccggcagag
                   Chinchilla  tacacc-agaa-tgcatctctcaggaaattctttggagccagcagag
             Brush-tailed rat  cacggc-agaa-tgcatctctcgggaaagtttttggaaccagcagag
                       Rabbit  ccggcc-agca-tgtttccctcgggaacttctgtggcg---------
                         Pika  ----cc-agtg-ggtttcttttgggagcttctgtggtg---------
                          Pig  taggcc-a--g-tgtttccctcgagaacttctccggag---------
                       Alpaca  caggcc-a--g-cgtttcttctgggagcttctctggag---------
               Bactrian camel  caggcc-a--g-tgtttcttctgggagcttctctggag---------
                      Dolphin  tgggcc-a--g-tgcttccctcgggaacttctctggag---------
                 Killer whale  tgggcc-a--g-tgcttccctcgggaacttctctggag---------
             Tibetan antelope  tgagcc-a--g-tgtttcccttgggaatttctctggag---------
                          Cow  tgagcc-a--g-tgtttcccttgggaatttctctggag---------
                        Sheep  tgagcc-a--g-tgtttcccttgggaatttctctggag---------
                Domestic goat  tgagcc-a--g-tgtttcccttgggaatttctctggag---------
                        Horse  tgggtc-agtg-tgtttcccttgggaacttctccggag---------
             White rhinoceros  tgggcc-agtg-tgtttcca-gggaaacttctccagag---------
                          Cat  tgggtc-a--g-tgtttcccctgggaacttctccagag---------
                          Dog  tgggtc-a--g-tgtttcccttgggaacttctccagag---------
                      Ferret   tgggtc-a--g-tgtttgcctctggaacttctccagag---------
                        Panda  tgggtc-a--g-tgtttccctcgggaacttctccagag---------
               Pacific walrus  tgggtc-a--g-tgtttccctcgggaacttctccagag---------
                 Weddell seal  tgggtc-a--g-tgtttccttcgggaacttctccagag---------
             Black flying-fox  tggggc-agtg-tgtttctcttgggaacttctccagag---------
                      Megabat  tggggc-a--g-tgtttctcttgggaacttctccagag---------
                Big brown bat  agggcc-agggctgcttcccttgggaacttctctggag---------
         David's myotis (bat)  agggcc-agtgttgcttcccttgggaacttctctggag---------
                     Microbat  agggcc-agtgttgcttcccttgggaacttctctggag---------
                     Hedgehog  tgggct-gttg-tgtttccctcaggaacttgtctggag---------
                        Shrew  tgtgct-gttg-tgttcccctggggaacttgtcctcaa---------
              Star-nosed mole  tgggtc-agtg-tgtttct---ggaaagttctctggaa---------
                     Elephant  taggcc-agca-cagttcccttgggaacttctcgggag---------
          Cape elephant shrew  taaacc-agca-acattctcttgggaacttttcaggag---------
                      Manatee  taggcc-agca-gagttcccttgggaacttctcaggag---------
             Cape golden mole  aaggtc-aaca-cagttcccttgggagtttctcacgag---------
                       Tenrec  taggcc-agca-cagttcccttgggaatttctcaggag---------
                     Aardvark  cagacc-aaca-cagttcccttgagaacatttcaggag---------
                    Armadillo  tgggcc-agcc-tgttacctttgggaactgctctggag---------
                   Coelacanth  ===============================================
                X. tropicalis  ===============================================
                 Atlantic cod  ===============================================
                  Spotted gar  ===============================================
                  Stickleback  ===============================================
           Southern platyfish  ===============================================
       Yellowbelly pufferfish  ===============================================
                         Fugu  ===============================================
                    Tetraodon  ===============================================
                       Turkey  ===============================================
                      Chicken  ===============================================
                 Mallard duck  ===============================================
           Tibetan ground jay  ===============================================
                  Zebra finch  ===============================================
       White-throated sparrow  ===============================================
              Tasmanian devil  ===============================================
     Mexican tetra (cavefish)  ===============================================
                    Zebrafish  ===============================================
                       Medaka  ===============================================
          Pundamilia nyererei  ===============================================
                  Zebra mbuna  ===============================================
        Burton's mouthbreeder  ===============================================
          Princess of Burundi  ===============================================
                 Nile tilapia  ===============================================
               Painted turtle  ===============================================
              Green seaturtle  ===============================================
           American alligator  ===============================================
                   Budgerigar  ===============================================
                      Opossum  -----------------------------------------------
                  Rock pigeon  ===============================================
          Collared flycatcher  ===============================================
          Medium ground finch  ===============================================
                       Lizard  ===============================================
             Peregrine falcon  ===============================================
                 Saker falcon  ===============================================
                     Platypus  ===============================================
     Chinese softshell turtle  ===============================================

Alignment block 5 of 435 in window, 46607937 - 46608043, 107 bps 
B D                     Human  gca---------g-aag-----tcccaggcccagctgg----ctgggcccaag-agctccatctgtttcc
B D                     Chimp  gca---------g-aag-----tcccaggcccagctgg----ctgggcccaag-agctccatctgtttcc
B D                   Gorilla  gca---------g-aag-----tcccaggcccagctgg----ctgggcccaag-agctccatctgtttcc
B D                 Orangutan  gca---------g-aag-----tcccaggccaagctgg----ctgggcccaag-agctccatctgtttcc
B D                    Gibbon  gca---------g-aag-----tcccaggcccagctgg----ctgggcccaag-agctccatgtgtttcc
B D                    Rhesus  gca---------g-aag-----tcccaggcccagctgg----ctggccccaag-agctccatctgtttcc
B D       Crab-eating macaque  gca---------g-aag-----tcccaggcccagctgg----ctggccccaag-agctccatctgtttcc
B D                    Baboon  gca---------g-aag-----tcccaggcccagctgg----ctggccccaag-agctccatctgtttcc
B D              Green monkey  gca---------g-aag-----tcccaggcccagctgg----ctggccccaag-agctccatctgtttcc
B D                  Marmoset  gca---------g-aag-----ttccaggcccagctgg----ctggccccaag-agctccgtctgtttcc
B D           Squirrel monkey  gca---------g-aag-----tcccaggcccagctgg----ctggccccaag-agctctgtctgtttcc
B D                  Bushbaby  gta---------g-aag-----tcctaggcccacctgg----ctggccccaa--agccccatctgtttcc
           Chinese tree shrew  gca---------g-gag-----tcccaggcccagctgg----ccag----------------------cc
B D                  Squirrel  gca---------g-aaa-----tcccaggcccagatgg----ctggccccaag-agccccatctgttttc
       Lesser Egyptian jerboa  gca---------g-aag-----tcccgggtccagatgt----ctggtcccaag-agccccatctgtttcc
                 Prairie vole  aaa---------gaaag-----ttccaggtcctg--------ctgatctggag--agccctgctgtttct
B D           Chinese hamster  ata---------g-aaa-----ttccaggtcctg--------ctgctctagagtccccccagctgtttct
               Golden hamster  aca---------g-aag-----ttccaggtcctg--------ctagtctagag-ctccccagctgtttct
B D                     Mouse  --a---------g-aca-----tcccaggtcctg--------ctgccccggag-agcccca-ctgtttct
B D                       Rat  ------------g-aca-----ttccaggtcctg--------ttgccctagag-agccccagttgtctct
B D            Naked mole-rat  gca---------g-aag-----tcccaggcccagctgg----ctggccttgag-------ctccatttcc
B D                Guinea pig  gca---------g-aaa-----tcccaggctcggctgg----caagccttcag---------tggtttcc
                   Chinchilla  gca---------g-aag-----tcccaggcccagctgg----ctggccttgag-------ctctgtttcc
             Brush-tailed rat  gca---------g-aag-----tcccaggcccagctgg----ctggccttgag---------ctgtttcc
B D                    Rabbit  gta---------g-cag-----tccccagcccagctgg----ccagtcccagg-agctccatctgtttgc
B D                      Pika  gca---------g-cag-----accccggccccaccag----ctggtcct-gg-aactccgtgcgtttcc
B D                       Pig  gca---------g-ctg-----tcccgggtccagttgg----ccggccccagc-agctccatctgcttcc
B D                    Alpaca  gca---------g-ctg-----tcccaggtccagctgg----ctggccccagg-agccccatctgcttcc
               Bactrian camel  gca---------g-ctg-----tcccaggtccagctgg----ctggccccagg-agccccatctgcttcc
B D                   Dolphin  gca---------g-ctg-----tcccaggtccagctgg----ctggacccagg-agccccatctgcttcc
                 Killer whale  gca---------g-ctg-----tcccaggtccagctgg----ctggacccagg-agccccatctgcttcc
             Tibetan antelope  gca---------g-ctg-----tcccaggttcagctgg----ctggccccagg-agccccatctgttccc
B D                       Cow  gca---------g-ctg-----tcccaggtccagctgg----ctggccccagg-agccccatctgcttcc
B D                     Sheep  gca---------g-ctg-----tcccaggttcagctgg----ttggccccagg-agccccatctgtttcc
                Domestic goat  gca---------g-ctg-----tcccaggttcagctgg----ctggccccagg-agccccatctgtttcc
B D                     Horse  gca---------g-cag-----tcccaggtgcagctgg----ctggccccggg-agccccatctgcttcc
B D          White rhinoceros  gca---------g-cag-----tcccaggtgcagctgg----ctggccccagg-agccccatctgcttcc
B D                       Cat  aca---------g-ctg-----tctcaggtccagctgg----ctggcctcagg-agcctcatacacttcc
B D                       Dog  gca---------g-cgg-----tcccgggtccagctgg----caggccccagg-agccccatctgcttct
B D                   Ferret   gca---------g-cag-----tgtggggt-cagctgg-----cccgcccagg-agccccatctgcttcc
B D                     Panda  gca---------g-tgg-----tctggggtgcagctgg----ttggccccagg-agccccatctgcttcc
               Pacific walrus  gca---------a-tgg-----tctggggtccagatgg-----gggccccagg-agccccatttgctttc
                 Weddell seal  gca---------g-cgg-----tctggggtccagatgg-----gggccccagg-agccccatctgctttc
             Black flying-fox  aca---------g-ccg-----tcccaggaccagctgc----ctggccccaga-agcgccatctgcttcc
B D                   Megabat  aca---------g-ccg-----tcccaggtccagctgc----ctggccccaga-agcgccatctgcttcc
                Big brown bat  gca---------g-cag------cccgagtccagtggg----ctgactccagg-agccccgtctgcttcc
         David's myotis (bat)  gca---------g-cag------cccgagtccaatggg----ctgactccagg-agccccatctgcttcc
B D                  Microbat  gca---------g-cag------cccgagtccagtggg----ctgactccagg-agccccatctgcttcc
B D                  Hedgehog  gca---------g-cag-----gttgaggttcagctgg----ctggtactagg-gaccctgtctccttct
B D                     Shrew  gaa---------g-tca-----cctcaggtccagttggctccttaggac-------tcccatcagcttcc
              Star-nosed mole  gca---------g-cag-----tctcaagcccatcagaagccccaagaccagg-agccccatctgcttcc
B D                  Elephant  gcagcagaggcgg-cag-----gcccaggaccagcagg----ctggccccagg-agtcccatctgtttcc
          Cape elephant shrew  cca---------g-caa-----ttccaattccagccgg----ctgatcccagg-agtcccatatgttttc
B D                   Manatee  gcagaaaaggcgg-cag-----tcccaggaccagctgg----ctggcctcagg-agtcccatctgtttcc
             Cape golden mole  gca---------g-cag---------------aggtgg----cagttcctagg-ggtcctgtctgtttcc
B D                    Tenrec  gca---------a-cag-----tcacaggtccagctgg----ctgatcctagg-agttccatccgtttcc
                     Aardvark  gca---------g-cagagacggcccgagtccagctgg----ctggccccagg-agtcccatctgtttcc
B D                 Armadillo  ------------g-ctg-----------------------------ccctggg-agacccatctgtttcc
  D           Green seaturtle  gca---------g-cac-----tccagggcctaacact----ctgagttcaag-agccattactattaga
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ----------------------------------------------------------------------
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Platypus  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  ccaaagtac------------aggcagcttctaggccattgagt-gg---gg--------------catg
                        Chimp  ccaaagtgc------------aggcagcttctaggccattgagt-gg---gg--------------catg
                      Gorilla  ccaaagtgc------------aggcagcttctaggccattgagt-gg---gg--------------catg
                    Orangutan  ccaaagtac------------aggcagcttctaggccattgagt-gg---gg--------------catg
                       Gibbon  ccaaagtgc------------aggcagcttctaggccattgagt-gg---gg--------------catg
                       Rhesus  ccaaagtgc------------aggcagcttctaggccatttagt-gg---gg--------------catg
          Crab-eating macaque  ccaaagtgc------------aggcagcttctaggccatttagt-gg---gg--------------catg
                       Baboon  ccaaagtgc------------aggcagcttctaggccatttagt-gg---gg--------------catg
                 Green monkey  ccaaagtgc------------aggcagcttctaggccatttagt-gg---gg--------------catg
                     Marmoset  ccaaagtgc------------aggcagcttctaggccactgaga-gg---gg--------------catg
              Squirrel monkey  ccaaagtgc------------aggcagcttctaggccacagaga-gg---gg--------------catg
                     Bushbaby  ccagaggac------------agacagcttctgagccataaagc-tg---gg--------------cctg
           Chinese tree shrew  ccagagggc------------aggctgcttctaggtcatcaaga-ga---gg---------------atg
                     Squirrel  ccattgggc------------aggcagtt-ctaggctgtcaaga-ag---gg--------------cata
       Lesser Egyptian jerboa  tcagagggcaggcaggcaggcaggcagtttctaggccacac-----------------------------
                 Prairie vole  tcagagggc------------aggcagttcctagaccataacaa-ta---gg--------------ccta
              Chinese hamster  ctggagggc------------aggcagttcctaggccataaaga-tg---ga--------------cctg
               Golden hamster  ctggagggc------------aggcagttcctaggtcataaaaa-ca---ga--------------tctg
                        Mouse  ttggaaggc------------aggcagttcctcagccataagaa-gg---gg--------------cctg
                          Rat  ctggaaggca-----------aggcagttcctcagacataagaa-gg---gg--------------cctg
               Naked mole-rat  ccagaggac------------aggcagtttctaggccattaaaa-ag---aa--------------catg
                   Guinea pig  ccagaggac------------aggcagtttctaggccatg-aaa-gg---aa--------------catg
                   Chinchilla  ccagaggac------------aggcagtttctaggccatcaaaa-gg---aa--------------catg
             Brush-tailed rat  ccagaggac------------aggcagtttctgggccatc-aaa-gg---aa--------------catg
                       Rabbit  ccagagggc------------aggcagcttctaggccgttgaga-gg---gg--------------catg
                         Pika  ccagagggc------------aggtggctcctaagccattgag--gg---gg--------------cgtg
                          Pig  ccagagatc------------tggcagctgctgggccacggaga-gg---gg--------------cata
                       Alpaca  ccagagagc------------tggcagctgctgggccatggaga-gg---gg--------------catg
               Bactrian camel  ccagagagc------------tggcagctgctgggccatggaga-gg---gg--------------catg
                      Dolphin  ccagagatc------------tggcagctgcggggccatggaga-gg---gg--------------catg
                 Killer whale  ccagagatc------------tggcagctgcggggccatggaga-gg---gg--------------catg
             Tibetan antelope  ccagagatc------------tggcagctgcagggccatggaga-gg---gg--------------catg
                          Cow  ccagagatc------------tggcagctgcagggccatggaga-gg---gg--------------catg
                        Sheep  ccagagatc------------tggcagctgcagggccatggaga-gg---gg--------------catg
                Domestic goat  ccagagatc------------tggcagctgcagggccatggaga-gg---gg--------------catg
                        Horse  ctagagatc------------aggcagctgctgggccatggaga-gg---gg--------------catg
             White rhinoceros  ccagagatc------------aggcagctgctgggccacggaga-ca---gg--------------catg
                          Cat  ccagagatc------------aggcagcttctgggccactgaga-gg---gg--------------catg
                          Dog  tcagagatc------------agccagctgcagggccacggaga-gg---gg--------------cata
                      Ferret   tcagagatc------------aggcagctgctgggccacggaga-gg---gg--------------ggta
                        Panda  tcagagatc------------aggcagctgctgggccatggaga-gg---gg--------------cata
               Pacific walrus  tcagagatc------------aggcagctgctgggccacggaga-gg---gg--------------cata
                 Weddell seal  tcagagatc------------aggcagctgctgggccacggaga-gg---gg--------------cata
             Black flying-fox  ccagaaatc------------aggcagctgctgggccatggaga-gg---gt--------------catg
                      Megabat  ccagaaatc------------aggcagctgctggcccatggaga-gg---gt--------------catg
                Big brown bat  ccagagatc------------aggcagctgctgggtcatggagatgg---ga--------------catg
         David's myotis (bat)  ccagagatc------------aggcagctgctgggtcatggaga-gg---gg--------------catg
                     Microbat  ccagagatc------------gggcagctgctgggtcatggaga-gg---ga--------------catg
                     Hedgehog  caaaggatg------------aggcagctgctgggccatgaaga-ag---gg---------aatggcgtc
                        Shrew  acagagagc------------cagcagctactgggctagggaga-ggccaggttcagcagaaaccccatc
              Star-nosed mole  tcagag-tc------------aggcagctgctgggccacaaaga-gg---gg--------------catc
                     Elephant  ctagggggc------------aggcagcttctgggt---------------a--------------catg
          Cape elephant shrew  ttagagggc------------aggtagcttctcagtcctcaaga-ga---ga--------------catg
                      Manatee  ctagagggc------------aggcagcttctgggc---------------a--------------catg
             Cape golden mole  -tagggggc------------aggcagccgcagggc---------------a--------------catg
                       Tenrec  ttagtgggc------------aggcagctgtggggt---------------g---------------atg
                     Aardvark  ctagagggc------------aggcagcttctgggccctcaaga-gg---ca--------------catg
                    Armadillo  tcagagggc------------aagcaacttggagag----------g---ag--------------catg
              Green seaturtle  aaaagaaat------------ggggcattccaggcacacagagt-ga---aa--------------tacg
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  atattggat----gcttggct
                        Chimp  atattggat----gcttggct
                      Gorilla  atattggat----gcttggct
                    Orangutan  atattggat----gcttggct
                       Gibbon  atattggat----gcttggct
                       Rhesus  atattggat----gtttggct
          Crab-eating macaque  atattggat----gtttggct
                       Baboon  atattggat----gcttggct
                 Green monkey  atattggat----gcttggct
                     Marmoset  atattggat----gcttggct
              Squirrel monkey  atattggat----gcttggct
                     Bushbaby  attttggaa----gcttagct
           Chinese tree shrew  attttggat----gcttggct
                     Squirrel  attttggag----gcttggct
       Lesser Egyptian jerboa  -tttcagaggcttgcttgtct
                 Prairie vole  gttttggag----gtttgtct
              Chinese hamster  gttttggag----gcttgtct
               Golden hamster  gttttggac----gattgtct
                        Mouse  gttttggag----gtttgcct
                          Rat  gttttggag----gtttgcct
               Naked mole-rat  attttggag----gcttggct
                   Guinea pig  attttggag----ggttggct
                   Chinchilla  attttggag----gcttggct
             Brush-tailed rat  attttggag----gcttggct
                       Rabbit  acttcggag----gcttggct
                         Pika  actgtgaaa----gtgtggct
                          Pig  attttggag----gcttggct
                       Alpaca  attttggaa----gcttggct
               Bactrian camel  attttggaa----gcttggct
                      Dolphin  attttggag----ttttggct
                 Killer whale  attttggag----ttttggct
             Tibetan antelope  attttggag----gcttggct
                          Cow  attttggag----gcttggct
                        Sheep  attttggag----gcttggct
                Domestic goat  attttggag----gcttggct
                        Horse  attttggag----gcttggct
             White rhinoceros  attttggag----gtttggct
                          Cat  actttggag----gcttggct
                          Dog  attttggag----gcttggct
                      Ferret   attttggag----gcttggct
                        Panda  attttggag----gcttggct
               Pacific walrus  attttggag----gcttggct
                 Weddell seal  attttggag----gcttggct
             Black flying-fox  attttggag----gcttggct
                      Megabat  attttggag----gcttggct
                Big brown bat  agtgtggag----gtttggct
         David's myotis (bat)  agtttggag----gtttggct
                     Microbat  agtttggag----gtttggct
                     Hedgehog  agtggtgtg----gc------
                        Shrew  tgtgttgag----gg------
              Star-nosed mole  attttggag----gc------
                     Elephant  attttggag----atttggct
          Cape elephant shrew  attttggag----gcttggct
                      Manatee  gttttggag----gtttgtct
             Cape golden mole  gatttgggg----gcttggct
                       Tenrec  aatgtggag----gcttggct
                     Aardvark  attttggag----gcttgact
                    Armadillo  attttggag----atttggtt
              Green seaturtle  gtttgtggc----tctaggct
                   Coelacanth  =====================
                X. tropicalis  =====================
                 Atlantic cod  =====================
                  Spotted gar  =====================
                  Stickleback  =====================
           Southern platyfish  =====================
       Yellowbelly pufferfish  =====================
                         Fugu  =====================
                    Tetraodon  =====================
                       Turkey  =====================
                      Chicken  =====================
                 Mallard duck  =====================
           Tibetan ground jay  =====================
                  Zebra finch  =====================
       White-throated sparrow  =====================
              Tasmanian devil  =====================
     Mexican tetra (cavefish)  =====================
                    Zebrafish  =====================
                       Medaka  =====================
          Pundamilia nyererei  =====================
                  Zebra mbuna  =====================
        Burton's mouthbreeder  =====================
          Princess of Burundi  =====================
                 Nile tilapia  =====================
               Painted turtle  =====================
           American alligator  =====================
                   Budgerigar  =====================
                      Opossum  ---------------------
                  Rock pigeon  =====================
          Collared flycatcher  =====================
          Medium ground finch  =====================
                       Lizard  =====================
             Peregrine falcon  =====================
                 Saker falcon  =====================
                     Platypus  =====================
     Chinese softshell turtle  =====================

Alignment block 6 of 435 in window, 46608044 - 46608426, 383 bps 
B D                     Human  caggaaacaaccccagccaacc-caa---ggggcagtgggac---------------atgttggcc-tca
B D                     Chimp  caggaaacaaccccagccaacc-caa---ggagcagtgggac---------------attttggcc-tca
B D                   Gorilla  caggaaacaaccccagccaacc-caa---ggggcagtgggac---------------atgttggcc-tca
B D                 Orangutan  caggaaacaaccccagccaacc-caa---ggggcagtgggac---------------atgttggcc-tca
B D                    Gibbon  caggaaacaaccccagcccacc-caa---ggggcagtgggac---------------atgttggcc-tca
B D                    Rhesus  caggaaacaaccccagccaacc-caa---gg-gcagtggggc---------------atgttggca-tca
B D       Crab-eating macaque  caggaaacaaccccagccaacc-caa---gg-gcagtggggc---------------atgttggca-tca
B D                    Baboon  caggaaacaaccccagccaacc-caa---gg-gcagtggggc---------------atgttggca-tca
B D              Green monkey  caggaaacaaccccagccaacc-cat---gg-gcagtggggc---------------atgttggca-tca
B D                  Marmoset  caggaaacaaccccagccaacc-caa---ggggcagtggggc---------------atgttggcg-tca
B D           Squirrel monkey  caggaaacaaccccagccaacc-caa---ggggcagtggggc---------------atgttggca-tca
B D                  Bushbaby  caggagacaaccccagagaact-caa---caggcagtggggc---------------attctggca-tca
           Chinese tree shrew  cagcag---atcccagtcaacc-caa---agggcggtggggc---------------agtctggca-tca
B D                  Squirrel  cagcaggcaaccc-agccaacc-caa---ggggtggtggggc---------------tctct--------
       Lesser Egyptian jerboa  cagcagccaaccccaggcaact-caa---agggtgctggggc---------------tctttggca-tca
                 Prairie vole  cagtagccagtttgagccaacc-cag---gg-gtggtggggc---------------tctctggca-tca
B D           Chinese hamster  cagcagccaactcagcagcacc-cag---gg-gtggtggggc---------------tctctagca-tca
               Golden hamster  cagcagtcaactcgagccaacc-cag---gg-gtggt-gggc---------------tctctggca-tca
B D                     Mouse  cagcagccatctctagccaggc-cag---ggtgtggtagggc---------------tttgtggca-tca
B D                       Rat  cagcatccaactctagccaaacgcag---ggtgtggcagggc---------------ttcctggca-gca
B D            Naked mole-rat  cagcagccaaccccagccaacc-caa---ggggtggtggggt---------------tct-tggca-tct
B D                Guinea pig  tggcagacaaccccagccaatc-caa--gaaagtgttatagt---------------tct-tgcca-tct
                   Chinchilla  cagcagccaaccccagccaacc-caa---ggggaggtggggt---------------gct-tgcca-tct
             Brush-tailed rat  cagcagctaaccccagccaacc-caaggggggggggtagggt---------------tct-tgcca-tct
B D                    Rabbit  cagcagccaaccccagccagcc-cgg---gaggcagcggggt---------------t------------
B D                      Pika  cag-agccaaccctaggcagcc-tga---ggg--------------------------------------
B D                       Pig  cggcagacaaccccagcagacc-aga---ggggtagtagggc---------------actcgggca-tct
B D                    Alpaca  cagcagacaaccccagcagacc-tga---gggggtggtgggc---------------actctagca-tga
               Bactrian camel  cagcagacaaccccagcagacc-tga---gggggtggtgggc---------------actctggca-tga
B D                   Dolphin  cagcagacaaccccagcagacc-aca---ggggtggtggggt---------------actctggca-tca
                 Killer whale  cagcagacaaccccagcagacc-aca---ggggtggtggggt---------------actctggca-tca
             Tibetan antelope  cagcagacaaccccagcagacc-aca---gcagtggtggggt---------------actctggca-tca
B D                       Cow  cagcagacaaccccagcagacc-aca---ggggtggtggggt---------------actctggca-tca
B D                     Sheep  cagcagacaaccccagcagacc-aca---gcagtggtggggt---------------actctggca-tca
                Domestic goat  caggagacaaccccagcagacc-aca---gcagtggtggggt---------------actctggca-tca
B D                     Horse  cagcagacaacctcagcagacc-tga---ggggtggtagggc---------------gctctggca-tca
B D          White rhinoceros  cagctgacaacctcagcagacc-cga---gaggtagtagggc---------------actctggca-tca
B D                       Cat  cagcagacagccccagccaacc-tga---gaggcagtggggc---------------actctggcattca
B D                       Dog  cagcatacagctccagaagacc-caa---ggggctgcggggc---------------actgtggcattca
B D                   Ferret   cagcatacagccttagcagacc-cga---ggggcagtggggc---------------actctgaca-tca
B D                     Panda  cagcatacagccccagcagacc-tga---ggagcagtggggc---------------actctggcattca
               Pacific walrus  cagcatacagccccagcagacc-tgc---ggggcagt-gggc---------------actctggcattca
                 Weddell seal  cagcatacagccccagcagacc-tgc---gaggcagt-gggc---------------actctggcattca
             Black flying-fox  cagcagataatcccagcggatc-tgc---agggaggtggggc---------------actctggca-tca
B D                   Megabat  cagcagataatcccagcggatc-tgc---agggaggtggggc---------------actctggca-tca
                Big brown bat  cagcagatgaccctggcagacc-tga---gggaaagtggggc---------------------aca-tca
         David's myotis (bat)  cagcagacagccctggcaggcc-tga---gggaaggtggggc---------------actctgaca-tca
B D                  Microbat  cagcagatagccctggcaggcc-tga---gggaaggtggggc---------------actctgaca-tca
B D                  Hedgehog  --------aatcttgacaagtc--aa---gcagaggtcaagctgaggggtagtggagactcttatg-tca
B D                     Shrew  --------------------------------ggggtggagc---------------actctggt-----
              Star-nosed mole  --------------------------------aaggcttagc---------------acactggcc-tca
B D                  Elephant  cagtagacctccccaactgacc-tga---ggagtagtggggc---------------actctggta-tta
          Cape elephant shrew  -------ccagcccagggtaat-gga---agaataacagggc---------------actcttgca-cca
B D                   Manatee  cagcagacctccccagcctacc-tga---ggagtagtggggc---------------actctggca-tta
             Cape golden mole  cagcagactatcccagcagacc-tga---ggaatggtggggc---------------actctagca-tta
B D                    Tenrec  cagcagacaagcccag----cc-tga---ggaatggtgggac---------------actccggta-tca
                     Aardvark  cagcagacaactccagctgatc-tga---ggagcggtgggcc---------------actatggca-tca
B D                 Armadillo  cagcagaccaccccagcgtaac-tga---gggttggtgggac---------------actctcgta-ttg
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ----------------------------------------------------------------------
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Platypus  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  g-gttagaaattattgctcaaagc-agaaacagttgtgtccta---------------------gag---
                        Chimp  g-gttagaaattattgctcaaagc-agaaacagttgtgtccta---------------------gag---
                      Gorilla  g-gttagacattattgctcagagc-agaaacagttgtgtccta---------------------gag---
                    Orangutan  g-gttagaaattattgctcaaagc-a-aaacagttgtgtccta---------------------gag---
                       Gibbon  g-gttagaaattattgctcaaagc-agaaacagttgtgtccta---------------------gca---
                       Rhesus  g-gttagaaattattgctcaaagc-agaaacagttatgtccta---------------------gag---
          Crab-eating macaque  g-gttagaaattattgctcaaagc-agaaacagttatgtccta---------------------gag---
                       Baboon  g-gttagaaattattgctcaaagc-agaaacagttatgtccta---------------------gag---
                 Green monkey  g-gttagaaattattgctcaaagc-agaaacagttatgtccta---------------------gag---
                     Marmoset  g-gttagaaactgttgctcaaagc-aggaacagttgtgtcctg---------------------aag---
              Squirrel monkey  g-gttagaaattattgctcaaagc-aggaacagttgtgtcctg---------------------aag---
                     Bushbaby  g-gctagaaatccttgctcaaagc-aggaacaat--tgtcctg---------------------gag---
           Chinese tree shrew  g-actggaggtccttgctcaaagc-aggaacagttgtgtcctg---------------------gag---
                     Squirrel  g-gctagaaattcttgctcagagc-aggaacagctgtgtcctg---------------------aag---
       Lesser Egyptian jerboa  g-gcttgacatccttactcaaagc-aggaatagtc-cgtcctg---------------------gag---
                 Prairie vole  g-gctagaaatccttgttcaaaac-aggaacagttgtgtcctg---------------------gag---
              Chinese hamster  g-gctagaaatcactgctcaaagc-aggaacagctgtgtcctg---------------------cag---
               Golden hamster  g-gctagaaatcactgctcaaagc-aggagtagttgtgtcctg---------------------gag---
                        Mouse  g-gctagaaatccttactcaaagc-agaaacagttgtgtcctg---------------------gag---
                          Rat  g-gctagaaatcgttactcaaagc-agaaacagttgtgtcccg---------------------gag---
               Naked mole-rat  g-gctagaaatccttgcttagagc-ag-gacagttgcatcctg-------------------gagagaga
                   Guinea pig  g-gctagaaatctttgcttaaagc-ag-aacagtcgtgtcctg---------------------gag---
                   Chinchilla  g-gctagaaatctttgcttacagc-ag-aacagttgtgtcctg---------------------gagaga
             Brush-tailed rat  g-gctagaaatctttgcttaaagc-ag-aacagttgtatcctggtgagaaagagaagagagagagagaga
                       Rabbit  ------gacattcttgctcagagc-aggaacagtt-----ctg---------------------gag---
                         Pika  ---------------gctcaaagc-aggaacagct-----ctg---------------------gag---
                          Pig  g-gctagaaatccttggtcaaagc-agggacagttgtatcctg---------------------gag---
                       Alpaca  g-gctagaaatccttgctgaaagc-aggaacagctgtatcctg---------------------gag---
               Bactrian camel  a-gctagaaatccttgttgaaagc-aggaacagctgtatccgg---------------------gag---
                      Dolphin  g-actagaaatccttgctcaaagc-aggaacagttgtatcctg---------------------gag---
                 Killer whale  g-actagaaatccttgctcaaagc-aggaacagttgtatcctg---------------------gag---
             Tibetan antelope  g-gctagaaatccttcctcaaagcaaaaaacagctgtgttcta---------------------gag---
                          Cow  g-gctagaaatccttgcttaaagcaaaaaacagctgtgttctg---------------------gag---
                        Sheep  g-gctagaaatccttcctcaaagcaaaaaacagctgtgttctg---------------------gag---
                Domestic goat  g-gctagaaatccttcctcaaagcaaaaaacagctgtgttctg---------------------gag---
                        Horse  g-gctagacatccttgctcaaagc-aggaacagctgtgtcctg---------------------gag---
             White rhinoceros  g-actagacatccttgctcaaagc-aggaacagctgtgtcctg---------------------gag---
                          Cat  ---ctagaagtctttgctcaaagc-aggaacagttgtgcccta---------------------gag---
                          Dog  ---tgagaaatccttgctcaaggc-aggaacagttgtgcccta---------------------ggg---
                      Ferret   ---ctagaaatccttgctcaaagc-aggaacagttgtgctcta---------------------gag---
                        Panda  ---ctggaaatccttgctcgaagc-aggaacaagtgtgctcta---------------------gag---
               Pacific walrus  ---ctagaaatccttgcttaaagc-aggaacaattgtgctcta---------------------gag---
                 Weddell seal  ---ctagaaatccttgctcaaagc-aggaacaattatgctcta---------------------aag---
             Black flying-fox  g-gctagaaatccttgctcaaagc-aggaactgttgtgtcctg---------------------gag---
                      Megabat  g-gctagaaatccttgctcaaagc-aggaactgttgtgtcctg---------------------gag---
                Big brown bat  g-gctagaaatccttgctcaaagc-aggaacagttgtgtccca---------------------gag---
         David's myotis (bat)  g-gctagaaatccttgctcaaagc-aggaacagttgtgtcctg---------------------gag---
                     Microbat  g-gctagaaatccttgctcaaagc-aggaacagttgtgtcctg---------------------aag---
                     Hedgehog  agactaggtttctttgctctgagt-agcaacaactattt-ctg---------------------gag---
                        Shrew  ---------------gctccca-c-agaaacag-------ctg---------------------gaa---
              Star-nosed mole  g--------------gctctaagc-aggaacagctgtgtcctg---------------------gaa---
                     Elephant  g-gttagaaattcttgctcaaagc-aagaacagttgtgtcctg---------------------gag---
          Cape elephant shrew  g-gctagacatccttgctctaagc-aggaacagttgtgtctgg---------------------aaa---
                      Manatee  g-gctagaaatccttgctcaaagc-aggaacagttgtgtcctg---------------------gag---
             Cape golden mole  g-gcgagaaatctttgctcaaagc-aggaacagttgtgtcctg---------------------aaa---
                       Tenrec  g-gctagaaatctttgctcaaagc-aggaacagtag-gtcctg---------------------aaa---
                     Aardvark  g-gctagaaag------tcaaagc-agaagcagttgtgtcctg---------------------gag---
                    Armadillo  g-gctagaaacccttgctcaaagc-agaaatggttgtgtcctg---------------------gag---
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  -ag-ggtctgttaaaccctctttccatgtgtatct--------ctatgtagcaattgatgggccct----
                        Chimp  -ag-ggtctgttaaaccctctttccatgtgtatct--------ctatgtagcaattgatgggccct----
                      Gorilla  -ag-agtctgttaaaccctctttccatgtgtatct--------ctatgtagcaattgatgggccct----
                    Orangutan  -ag-ggtctgttaaaccctctttccatgtgtatct--------ctgtgtagcaattgatgggccct----
                       Gibbon  -ag-ggtctgttaaaccctctttccatgtgtatct--------ctgtgtagcaattgatgggccct----
                       Rhesus  -aa-ggtctgttaaaccctctttccatgtgcacct--------ctgtgtagcaatagatg----------
          Crab-eating macaque  -aa-ggtctgttaaaccctctttccatgtgcacct--------ctgtgtagcaatagatg----------
                       Baboon  -aa-ggtctgttaaaccctctttccatgtgcatct--------ctgtgtagcaatagatg----------
                 Green monkey  -aa-ggtctgttaaactctctttccatgtgcatct--------ctgtgtagcaatagatg----------
                     Marmoset  -ag-ggtctgttaaaccctctttccaggtgtatct--------ctgtgtagcaattgacgggtctt----
              Squirrel monkey  -ag-ggcctgataaaccctctttccaggtgtatct--------ctgtgtagcaattgatgggccct----
                     Bushbaby  --t-gtcctgtcaagccctctttccgtgtgcatct--------ctgtgtagcaatcagtggacccca-gg
           Chinese tree shrew  -ag-ggtctgccaagccccttctccatgtgcatct--------ctgtgcagcaactgctgggccttgttg
                     Squirrel  -ag-ggtttgtaaaaccctttttccatgtgcattt--------ctgtttaacaatca---ggtcctcatt
       Lesser Egyptian jerboa  -ag-ggtctgtcaaatcctctttccatgcgtatct--------ctgcatggcaatcaatgggttctaata
                 Prairie vole  -ag-tatttgacaaaccctatttccacaagcatct--------cggtgtcac-atcagcagaccctggag
              Chinese hamster  -ag-tatctgacaaaccccatttccacatgcatct--------cggtgtcacaatcagcagggcctagag
               Golden hamster  -ag-tggctgacaaaccccattttcacatgcatct--------cagtgtcacaatcagcaggccctagag
                        Mouse  -ag-tgtctgacagcctctatttgcacatgcatct--------tggtgttgcaatcagcaggccctagag
                          Rat  -ag-tgtctgacgacttctctttgcacgtgcatct--------tggtgtcacaatcagaaggcctgagag
               Naked mole-rat  gag-ggtctgccaagccctctttccacgtgtgtct--------ttgtgtagtaatgaatgggccctgggg
                   Guinea pig  ------------aaaacctctttccatatgcatct--------ctgtgtaataatcaatgagccctggga
                   Chinchilla  gag-gatctgccaaaacctcttcccatgtgtatct--------ctctgtagtaatcaatgggcccttggg
             Brush-tailed rat  aag-gatctgccaaaatct----ccatgtgcatct--------ctgtgtagtagtcagtgggccctggca
                       Rabbit  -ag-ggcctgccacacctt--------------ct--------ctccgtagcaaacaacgggccctgggg
                         Pika  -ag-agcccttctttccatg-----------gcat--------ctccctagcaatcctcagaccctgggg
                          Pig  -aa-aggctgtcaagccctctttctgcgttcatctcctc-gccctatgcagccatccgcaggc-ctgggg
                       Alpaca  -aa-gggcggtcaacccctctgtctacgtgcatctcatc-tccctgtgcagtaatccacaggc-tgcggg
               Bactrian camel  -aa-gggcagtcaacccctctgtccacgtgcctctcatc-tccctgtgcagtaatccacaggc-tgcggg
                      Dolphin  -ag-aagct------ccctcctttggagtgcatctcatc-tccctgtgtagcaatccacaggc-cagggg
                 Killer whale  -ag-aagct------ccctcctttggagtgcatctcatc-tccctgtgtagcaatccacaggc-cagggg
             Tibetan antelope  -ag--agttgtcaaacactcctttggagtgcctctcatc-tccctgtgtggcaatccacaggc-ctgggg
                          Cow  -ag--agctgtcaaacactcctttggagtgcctctcatc-tccctgtgtggcaatccacaggc-ctgggg
                        Sheep  -ag--agctgtcaaacactcctttggagtgcctctcatc-tccctgtgtggcaatccacaggc-ctgggg
                Domestic goat  -ag--agctgtcaaacactcctttggagtgcctctcatc-tccctgtgtggcaatccacaggc-ctgggg
                        Horse  -ag-ggcctgtcaaaccctctttccatgtgcatctcatc-tccctttgcagccatccacaggccctg-gg
             White rhinoceros  -ac-agcctgtcaaaccctctttccacgtgcatctcatc-ttcctatgtagcaatccacaggccctg-gg
                          Cat  -ag-gggctgtcagaccatctttccacatgcatctcacc-tccctatgtagcaatccacaggccctgagg
                          Dog  -ag-gggctgtcaaaccctttttccccatgcagctcata-tccctatgcagcaatccacatgctctgggg
                      Ferret   -ag-gggctgtcaaaccctctttccacatgcagttcatt-tccctgtgtagcaatctgcaagccccgggg
                        Panda  -ag-gggctgtcaaaccgtctttccacatgcagctcatc-tccctacgtagcaatccgcaggccctgggg
               Pacific walrus  -ag-gggctgtcaaaccctctttccacatgcaactcatc-tccctatgtagcaatccacaggccctgggg
                 Weddell seal  -ag-gggctgtcaaaccctctttccacatgcaactcatc-tccctatgtagcaatccacaggccttgggg
             Black flying-fox  -aa-gggttgtcaaaccctctttccatgtgctcctcatc-tccctatgtagcaatccataggctctgggg
                      Megabat  -aa-gggttgtcaaaccctctttccatgtactcctcatc-tccctatatagcaatccataggctctgggg
                Big brown bat  -ag-gggctgtcaaaccctcattccatgtgcttctcatc-tccctgtgtagcaatgcacaggccctgggg
         David's myotis (bat)  -ag-gggctggcaaaccctcattccatgt-----------------------------------------
                     Microbat  -ag-gggctggcaaaccctcattccatgt-----------------------------------------
                     Hedgehog  -ag-atgctgtcaagctcgcttttcatgtgtatctcatc-tccccaggtaacaatccataggttgtgggg
                        Shrew  -ag--------ttaaccctatctccacgtgtctttcatc--ccccatgtagcacctgactatccccagag
              Star-nosed mole  -gg-gggctgtcagaccctctttccatgtacatgtgatc-accccatgtagcatgctgcaggccttgggg
                     Elephant  -aa-gggctagaaaaccctctttccatgtgcatctaatg-ttcctattcagcaattgacaggtcctgggc
          Cape elephant shrew  -aa-ggactatgcaaccttctc--------------atg-tttccatttggcaataaacaggtcttgggc
                      Manatee  -aa-ggtctatcgaaccctctttccatgtgcatctaatg-ttcctattcagcaatcgacagaccctgggc
             Cape golden mole  -aa-gggctatcaaaccctcttt-catgtgtatcttata-ttcatatttagcaactgataggccct-ggt
                       Tenrec  -aataggttggcaaaccctctttgcacgtgcacctcatagttcctatttagcaattgacgagccct-ggc
                     Aardvark  -aa-cggctagcaaaccctcttcccatgtgcacctcatg-ttcctatttagcaatcaacaaatcctgggc
                    Armadillo  -ag-gggctgtcaaaccttctcttctcaggcatc------tccctattcagtaactgacaggccctgggc
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  -------gcggtcaggat---ccc-tg-------------------------------------------
                        Chimp  -------gcggtcaggat---ccc-tg-------------------------------------------
                      Gorilla  -------gcggtcaggat---ccc-tg-------------------------------------------
                    Orangutan  -------gtggtcaggat---ccc-tg-------------------------------------------
                       Gibbon  -------gcggtcaggat---ccc-tg-------------------------------------------
                       Rhesus  ---------ggtcaggat---ccc-tg-------------------------------------------
          Crab-eating macaque  ---------ggtcaggat---ccc-tg-------------------------------------------
                       Baboon  ---------ggtcaggat---ccc-tg-------------------------------------------
                 Green monkey  ---------ggtcaggat---ccc-tg-------------------------------------------
                     Marmoset  -------ggggtcaggat---ctc-tg-------------------------------------------
              Squirrel monkey  -------ggggtcaggat---ctc-tg-------------------------------------------
                     Bushbaby  tg-----gaagtcaggat---ctc-tg-------------------------------------------
           Chinese tree shrew  tggacaaggagttagggc---ccc-tg-------------------------------------------
                     Squirrel  tt-----ggaggcaaga----ccc-tg-------------------------------------------
       Lesser Egyptian jerboa  tg-----ggagtc-agac---cgg-tg-------------------------------------------
                 Prairie vole  ta-----gaagtcaagag---cct-tg-------------------------------------------
              Chinese hamster  aa-----gaagtcaagag---tct-tg-------------------------------------------
               Golden hamster  ga-----gaagtcaagag---cct-tg-------------------------------------------
                        Mouse  ta-----gaagtcaagag----ct-tt-------------------------------------------
                          Rat  ta-----gaagtcaagaagagcct-tg-------------------------------------------
               Naked mole-rat  tg-----ggagttaggac---ccc-tt-------------------------------------------
                   Guinea pig  tg-----ggagtcacaaa---cac-tt-------------------------------------------
                   Chinchilla  tg-----ggagtcaggac---tcc-tt-------------------------------------------
             Brush-tailed rat  tg-----ggagtcaggac---ccc-tt-------------------------------------------
                       Rabbit  tg-----ggagccaggac---cct-tg-------------------------------------------
                         Pika  tg-----gggatcaggat---tcc-ca-------------------------------------------
                          Pig  tg-----ggagtcagatg---ccc-tg-------------------------------------------
                       Alpaca  tg-----ggagtcaggac---cccttg-------------------------------------------
               Bactrian camel  tg-----ggagtcagaac---cccttg-------------------------------------------
                      Dolphin  tg-----ggagtcagaac---ccc-tg-------------------------------------------
                 Killer whale  tg-----ggagtcagaac---ccc-tg-------------------------------------------
             Tibetan antelope  tg-----aaagtcagaac---ccc-tg-------------------------------------------
                          Cow  tg-----aaagtcagaac---ccc-tg-------------------------------------------
                        Sheep  tg-----aaagtcagaac---ccc-tg-------------------------------------------
                Domestic goat  tg-----aaagtcagaac---ccc-tg-------------------------------------------
                        Horse  tg-----ggagta---------------------------------------------------------
             White rhinoceros  tg-----ggagtcaggac---ccc-tg-------------------------------------------
                          Cat  tg-----ggagtcaggac---ccc-tg-------------------------------------------
                          Dog  tg-----ggagtcaggac---tcc-tg-------------------------------------------
                      Ferret   tg-----ggagtcaggac---ctg-gg-------------------------------------------
                        Panda  tg-----ggagtcagga----ccc-tg-------------------------------------------
               Pacific walrus  tg-----ggagtcaggac---ccc-tg-------------------------------------------
                 Weddell seal  tg-----ggagtcaggac---ccc-tg-------------------------------------------
             Black flying-fox  tg-----gcagtcagggc---ccc-tg-------------------------------------------
                      Megabat  tg-----gcagtcagggc---ccc-tg-------------------------------------------
                Big brown bat  tg-----ggagtc--gga---cca-tg-------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                     Microbat  ----------------------------------------------------------------------
                     Hedgehog  ta-----agagtccagac---cc--tt-------------------------------------------
                        Shrew  tg-----ggaactgaggc---cc-----------------------------------------------
              Star-nosed mole  ta-----ggagtcaggat---ccc-tg-------------------------------------------
                     Elephant  tg-----ggagtcaggac---ccc-tg-------------------------------------------
          Cape elephant shrew  ta-----gaagttaggac---ccc-tgatttctggtagggctt----------caaactggtttaaaacc
                      Manatee  tg-----ggagtcaggac---cgc-tg-------------------------------------------
             Cape golden mole  tt-----ctagccagaag---ttt----------------------------------------------
                       Tenrec  cg-----agagtaaagag---tcc-tg-------------------------------------------
                     Aardvark  tg-----ggagtcaggac---atc-tggtttctagaagggctttgaaccagaataaactggtttgaagcc
                    Armadillo  cg-----ggagccgggac---ctg-ag-------------------------------------------
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  ---gttt---c---tccagctccatga--atg---------------cctccctgtg--aggccctggac
                        Chimp  ---gttt---c---tccagctccatga--atg---------------cctccctgtg--aggccctggac
                      Gorilla  ---gttt---c---tccagctccatgg--atg---------------cctccgtgtgacaggccctggac
                    Orangutan  ---gttt---c---tccagctccatga--acg---------------cctccctatg--aggccctggac
                       Gibbon  ---gttt---c---tccagctccatga--acg---------------cctccctgtg--aggccctggac
                       Rhesus  ---gttt---c---tccagctctgtga--acg---------------cctccctgtg--aggccttggac
          Crab-eating macaque  ---gttt---c---tccagctctgtga--acg---------------cctccctgtg--aggccttggac
                       Baboon  ---gttt---c---tccagctctgtga--aca---------------cctccctgtg--aggccttggac
                 Green monkey  ---gttt---c---tccagctctgtga--acg---------------cctccctgtg--aggtcttggac
                     Marmoset  ---gttt---c---tccagctccatga--acg----------------ctccctgta--aggccttggac
              Squirrel monkey  ---gttt---c---tccagctccatga--acg---------------cctccctgta--aggccttggac
                     Bushbaby  ---gtttctac---tccagcttcacta--aag---------------cctcactgtg--aaggcttggac
           Chinese tree shrew  ---gttt---ctagtccagttcca----------------------------cagcg--aggtcatggac
                     Squirrel  ---gtctttaa---tccaagtccatga--aagacagttttcccttcttctc-------------------
       Lesser Egyptian jerboa  ---gttttgac---tccaactccacca--aag---------------cctcatcctg--aggccttaggc
                 Prairie vole  ---gcttttat---accagctttaaaa--aag---------------cttc-------------------
              Chinese hamster  ---gcttttat---a-cagcttcacaa--aag---------------cctc-------------------
               Golden hamster  ---gcttttac---a-cagcttcacaa--aag---------------cctc-------------------
                        Mouse  ---gaattttt---a-------------------------------------------------------
                          Rat  ---gagtttta---a-------------------------------------------------------
               Naked mole-rat  ---gtttttat---tccagctccacaa--aaa---------------actcactctg--agg-cttgggc
                   Guinea pig  ---gattttac---tccagctccac----aag---------------actcatcctc--agg--atggac
                   Chinchilla  ---gattttac---tccagctccacaa--aag---------------attcaccctc--agg--gtggac
             Brush-tailed rat  ---gattttac---ttcagttccacaa--aag---------------actcaccttg--agg--gtggac
                       Rabbit  ---gcttctac---tccagccccatga--cag---------------cttcacttgg--cgc------gc
                         Pika  ---gtttctcc---ttcagtcccccaa--tag---------------cctccctttg--ag-------gc
                          Pig  ---atctctcc---tccggctctgcag--aag---------------ccttcctggg--aggcctgggac
                       Alpaca  ---gtttctac---tccacctccacaa--aag---------------ccttgctggg--aggtgctgaac
               Bactrian camel  ---gtttctac---tccacctccacaa--aag---------------ccttgctggg--aggcgctgaac
                      Dolphin  ---gtttccac---tccagctccacaa--aag---------------ctttgctggg--aggccttggac
                 Killer whale  ---gtttccac---tccagctccacaa--aag---------------ctttgctggg--aggccttggac
             Tibetan antelope  ---gtttctac---tccagctccacaa--aag---------------ctttgctggg--aggccttggac
                          Cow  ---gtttctac---tccagctccacaa--aag---------------ctttgctggg--aggccttggac
                        Sheep  ---gtttctac---tccagctccacaa--aag---------------ctttgctggg--aggccttggac
                Domestic goat  ---gtttctac---tccagctccacaa--aag---------------ctttgctgga--aggccttggac
                        Horse  ---------ac---tccagctccacaa--aag---------------ccttgctgtg--aggccttggac
             White rhinoceros  ---gtttctac---tccagctccacaa--aaa---------------ctttgctgtg--aggccttgtac
                          Cat  ---gtttctac---tccaactccataa--aag---------------ccttgctatg--aggccttggac
                          Dog  ---gtttctac---tccagctccacaa--aag---------------ccttgctgtg--tgagc------
                      Ferret   ---gtttctac---tccagctccataa--aag---------------ccttgcaggg--aggtcttggat
                        Panda  ---gtttctac---tccagctccacag--aag---------------cctctctgtg--aggccttggac
               Pacific walrus  ---gttgctag---tcttgctccacaa--aag---------------cctctctgtg--aggccttggac
                 Weddell seal  ---tttgctag---tctagctccacaa--aag---------------cctctctgtg--aggccttggac
             Black flying-fox  ---gtttctat---tccagctccacaa--cag---------------ccttgctgtg--aggccttggac
                      Megabat  ---gtttctat---tccagctccacaa--cag---------------ccttgctgtg--aggccttggac
                Big brown bat  ---gcttctcc---tccagctccacaa---ag---------------ccttgccatg--aggcctaggac
         David's myotis (bat)  ---gcttctcc---ttcagctccacaa---ag---------------ccttgccgtg--aggcc-aggac
                     Microbat  ---gctcctcc---tccagctccacga---ag---------------ccttgccgtg--aggcctaggac
                     Hedgehog  ---gtttctac---tacagatccacaa--aag---------------tcttgttttg--aggtcttggta
                        Shrew  ---------at---tctagccccacat--aag---------------ccttgtaggg--a-gtcttaga-
              Star-nosed mole  ---gtttctat---tccagttccacagaaaag---------------ctttgctgtg--aggtcttggac
                     Elephant  ---gtttctag---tccagttccatga--aag---------------cctcattacg--aggccttgggt
          Cape elephant shrew  ctagtttctag---tccagttccatga--aag---------------catcactgta--tggttttagat
                      Manatee  ---ctttctag---tccagttccatga--aag---------------cctcactatg--gggccttggac
             Cape golden mole  ----cttctag---tccagtttcatga--aag---------------tctcactgta--aggacttagac
                       Tenrec  ---gtttccag---gttaattccacga--agg---------------cctccctagg--aggtcttggac
                     Aardvark  ctggtttctaa---tccagttccatga--aag---------------cttcactgtg--agactctggaa
                    Armadillo  ---gtttccag---ttcagct-cacca--agg---------------cctcactgtg--aggctttcgac
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  agtttctccctcttcttctcctggcttcag---tttccccgtatgtacattgagaca-------gtaa--
                        Chimp  agtttctctctcttcttctcctggcttcag---tttccttgtatgtacattgagaca-------gtga--
                      Gorilla  agtttctccctcttcttctcctggcttcag---tttccttgtatgtacattgagaca-------gtga--
                    Orangutan  agtttctccctcttcttctcctggcttcag---tttcctcgtatgtacattgagaca-------gtaa--
                       Gibbon  agtttctccctcttcttctcctggcttcag---tttcctcgtatgtacattgagaca-------gtga--
                       Rhesus  agtttctccctcttcttctcctggcttcag---tttcctcgtatgtacattgagaca--------tga--
          Crab-eating macaque  agtttctccctcttcttctcctggcttcag---tttcctcgtatgtacattgagaca--------tga--
                       Baboon  agtttctccctcttcttctcctggcttcag---tttcctcgtatgtacattgagaca--------tga--
                 Green monkey  agtttctccctcttcttctcctggcttcag---tttccttgtatgtacattgagac-----------a--
                     Marmoset  agtttctgcctcctcttctcctggcttc---------ctcttgtgtacattgagact-------ctga--
              Squirrel monkey  agtttctccctcctcttatcctggcttcag---ttttctcctgtgtacattgagaca-------ctga--
                     Bushbaby  aaggttgccctcctctt---ctagcttcag---tttcctcctgtgtacattaagaga-------gtga--
           Chinese tree shrew  actttctccctcttct---cttggcttcca---tttcctcctatgtacagtgagaca-------gtga--
                     Squirrel  --------------------ccagctttag---tattctcctttgtacaatgagaga-------caga--
       Lesser Egyptian jerboa  agtct---cttcttcttcctccagctttag---tttcctccttcgcaacttgatata-------------
                 Prairie vole  --------------------cgggtttcag---tttcctcctttgtacactgagaga-------cag---
              Chinese hamster  --------------------cgggtttcag---tttcctcctctgcataccgagaaa-------caca--
               Golden hamster  --------------------c-agtttcag---tttcctcctctccataccgagaaa-------cac---
                        Mouse  --------------------ccggtttcaa---tttcctccaatgcatattgagaga-------caga--
                          Rat  --------------------cgggtttcag---tttcctctgatgcaagctgagaga-------cagt--
               Naked mole-rat  agtttc--ccccctctttgcctggcaccag---tatcctctgttgcacactgaaaga-------ctga--
                   Guinea pig  agttt---ttctccctttacctggcttcag---tttcctctgttgtatattgagaaa-------ctga--
                   Chinchilla  agttt---tcctctcttctcccggcttcag---tttcctctgttgcacactgagaga-------ctca--
             Brush-tailed rat  agttt---tcctttctcttcctggcttcag---ttttctcttttgcacactgaaagg-------ctga--
                       Rabbit  actgca--------------gagggctccc---tcctctcctgtgcatgctgagatg-------ctga--
                         Pika  atttt--------------------cctcc---tcttctcttatgaatgctgagctg-------ctga--
                          Pig  cgtctctccggcctcgcttcctggctt--g---tttccttctgcg------------------agtga--
                       Alpaca  agtctctcttccctctcctcctggcttcac---tttccttctaggcgcatgaatgattctgtgagtga--
               Bactrian camel  agtctctcttccctctcctcctagcttcac---tttccttctaggcacatgaatgattctgtgagtga--
                      Dolphin  agcttctcccgcctctcct-ctggcttcag---tttcctcccatgtacgtggatgattctg--agtga--
                 Killer whale  agcttctcccgcctctcct-ctggcttcag---tttcctcccatgtacgtggatgattctg--agtga--
             Tibetan antelope  aatttctcccacctctctt-ctggtttcag---ttttctcctgtgtccacggatgtttctgtaagtga--
                          Cow  aatttctcccacctctctt-ctggcttcag---tttcctcctgtgtccacagatgtttctgtaggcga--
                        Sheep  aatttctcccacctctctt-ctggtttcag---tttcctcctgtgtccacggatgtttctgtaagtga--
                Domestic goat  aatttctcccacctctctt-ctggtttcag---tttcctcctgtgtccacggatgttcctgtaagtga--
                        Horse  agtttctccctgccctcctcctggcctcag---tttcctcctttgtacgtggatgattct----gtga--
             White rhinoceros  agcttctccctcctttcctcctggcttcag---tttcctcctgtgtacgtggatgattctgtgagtga--
                          Cat  agtttctccctcctttcctcagggcttccg---tttcctcctaggtacacagatgattct----gtga--
                          Dog  -------------------------ttcgg---cttcctcctatgtacacagatttatct----ctaa--
                      Ferret   agtttctctctccctcctgct----ttcag---cttcctcctatgtaaagagatgattct----atga--
                        Panda  ag--tctctctcctttcttcctgg-ttcag---cttcctcctacgtacacagatgattct----gtga--
               Pacific walrus  agtttctctctcctttcttcctggcttcag---cttcctcctacgtacgtagctgattct----ggga--
                 Weddell seal  agtttctctctcctttcttcctggcttcag---cttcctcctacgtacgtagatgattct----ggga--
             Black flying-fox  agttgctccttcttctcttcccggcttcag---tctcctgctaggtacatggaggagtct----gtgagt
                      Megabat  agttgctc---cttctcttcccggcttcag---tctcctgctaggtacatggaggagtct----gtgagt
                Big brown bat  ag---------cttctcctcctggcttcag---tttcctcttatgtacgtggaggattct----gtga--
         David's myotis (bat)  ag---------cttctcctcctggcttcag---tttcctcttgtgtacgtggaggattct----gtga--
                     Microbat  ag---------cttctcctcctggcttcag---cttcctcttatgtacgtggaggattct--gagtga--
                     Hedgehog  agtttctt-----tctcctcctgattccag---tttccttcc--------------tcttgtgagtga--
                        Shrew  -ctttct------ccctcttctgatttcac---tttcctcttatgcatgtggatgagccttttgagta--
              Star-nosed mole  gctttctg-----ccttctcttggcttcag---tttcctcctctgtaggtggatgatcctgcgagtaa--
                     Elephant  ----------------------------------ttcctcctatgtacattgggaga-------gtgg--
          Cape elephant shrew  agtc-----------------------------cttccccctcttcttct------a-------ctgg--
                      Manatee  agtctctcc-ctgtctcctcctggcttcaacagtttcctcctatgtatattgaaaaa-------atga--
             Cape golden mole  tgtct-----tcctgtcctcctagaatcaacagcttcctcctatgtacattgagaga-------gtga-g
                       Tenrec  catctcttcgctctttcctccaggtatcaagagtttcttcc-agggacactgacacg-------gtga--
                     Aardvark  agtctctcccttctttcctctgggcttcaacagtttcctcttatgtacactgagaga-------c--a--
                    Armadillo  catcactccctcctcccctcctggcctcag----tccctcctgtg-----tgagagg-------gtga--
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  gact--ggat----------ga-ttctc-aggttc--cc------tctggctttc----c-attctggca
                        Chimp  gact--ggat----------ga-ttctc-aggttc--cc------tctggctttc----c-attctggca
                      Gorilla  gact--ggat----------ga-ttctc-aggttc--cc------tctggctttc----c-attctggca
                    Orangutan  gact--ggat----------ga-ttctc-aggttc--cc------tctggctttc----c-attctggcc
                       Gibbon  gact--ggat----------ga-ttctc-aggttc--cc------tctggctttc----c-attctggct
                       Rhesus  gact--ggat----------ga-tcctc-aggtcc--ct------tctggcttt-----c-attctggcc
          Crab-eating macaque  gact--ggat----------ga-tcctc-aggtcc--ct------tctggcttt-----c-attctggcc
                       Baboon  gact--ggat----------ga-ttctc-aggtcc--ct------tctggcttt-----c-attctggcc
                 Green monkey  gact--ggac----------ga-ttctc-aggtcc--ct------tctggctttc----c-attctggcc
                     Marmoset  gact--ggat----------ga-ttccc-aggtcc--ct------tctggctttc----c-attctagcc
              Squirrel monkey  gact--ggat----------ga-ttccc-aggtcc--ct------tctggctttc----c-attctggcc
                     Bushbaby  gacg--ggat----------aa-t-ctc-aggttc--ct------cttggctctc----c-atcctggac
           Chinese tree shrew  gact--ggat----------ga-ttctt-gggttc--ct------ttttgctctc----c-atcctggcc
                     Squirrel  --ct--ggat----------ta-ttctc-aggtc---cc------tctggtattc----c-atcctggcc
       Lesser Egyptian jerboa  ------gcat----------ga-tcctc-agatc---tt------tctggtcttt----t-atcctagcc
                 Prairie vole  ------acag----------ga-ttctt-gtgtta--ct------tcttgttctc----c-atcctggcc
              Chinese hamster  ---g--atgg----------ga-ttctt-atgtga--ct------tcttgttctc----c-atcctggcc
               Golden hamster  ------atgg----------ga-ttcttaatgtga--ct------tcttgttctc----c-gtcctggct
                        Mouse  ---g--acaa----------ta-ttctt-atgtga--ct------tcttg----c----c-ctcctggcc
                          Rat  ---g--acaa----------ta-ttctt-gtgtga--ct------tcttattc-c----c-atcctggcc
               Naked mole-rat  gact--ggag----------ga-ttctt-aggtcc--ct------tctgtttctc----c-atcct----
                   Guinea pig  gact--ggat----------ga-ttctc-agggcc--ct------tctggttctc----c-atcctagcc
                   Chinchilla  gact--ggtt----------ga-ttctc-aggacc--ct------tctgattctc----c-atcctagcc
             Brush-tailed rat  gact--acat----------ga-ttctc-aaggcc--ct------tctgattctc----c-atcctagcc
                       Rabbit  gact--ggac----------g--tcctc-gggtcc--ct------tccggctctc----c-atcctagcc
                         Pika  ggct--ggaa----------g--t-ctc-agctcc--ct------tctgactctc----c-atcctggcg
                          Pig  gact--ggat----------gattcccc-aggtcc--ct------tctggctctc----t-atcctggcc
                       Alpaca  gact--ggat----------ga-tcctc-aggtcc--ct------tctggctctc----c-atcctgacc
               Bactrian camel  gact--ggat----------ga-tcctc-aggtcc--ct------tctggctctc----c-atcctgatc
                      Dolphin  gact--ggat----------ga-tcctc-agattc--ct------tctggctctc----c-atcctggcc
                 Killer whale  gact--ggat----------ga-tcctc-agattc--ct------tctggctctc----c-atcctggcc
             Tibetan antelope  gact--ggat----------ga-tcctc-agattc--ct------tctggttctc----c-atcctggcc
                          Cow  gaat--ggat----------ga-tcctc-agattc--ct------tctggttctc----c-atcctgg-c
                        Sheep  gact--ggat----------ga-tcctc-agattc--ct------tctggttctc----c-atcctggcc
                Domestic goat  gact--ggat----------ga-tcctc-agattc--ct------tctggttctc----c-atcctggcc
                        Horse  gact--ggat----------ga-tgctc-aggtcc--tt------tctggctctc----c-atcctggcc
             White rhinoceros  gact--ggat----------ga-tcctc-aggtcc--tt------tctggctctc----c-at-ctggcc
                          Cat  gact--ggat----------aa-tcctc-aggccc--tt------cgtggctgtc----c-atcctggcc
                          Dog  gact--gaatcatcctcaggga-tcctc-aggccc--tt------tctggctctc----c-atcctggct
                      Ferret   gatt--ggat----------ga-tcccc-aggccc--tt------tctggctctc----c-atgctggcc
                        Panda  ggct--ggac----------ga-tcctt-gggccc--tt------tctggctctc----c-atactggcc
               Pacific walrus  gact--ggat----------ga-tcctc-aggccc--tt------tctggctctc----c-atcctggcc
                 Weddell seal  gact--ggat----------ga-tcctc-aggccc--tt------tctggctctc----c-atcctggcc
             Black flying-fox  gactcaggat----------ga-gcctc-aggtcc--ct------tctggctctc----c-atcctggcc
                      Megabat  gactcaggat----------ga-gcctc-aggtcc--ct------tctggctctc----c-atcctggcc
                Big brown bat  --ct--agat----------gc-tcctc-aggtct--tt------tctggctctc----c--ttctggcc
         David's myotis (bat)  ggat----------------------tc-aggtct--tt------tctggctctc----c--ttctggcc
                     Microbat  gact--agat----------gc-tcctc-aggtct--tt------tctggctctc----c--ttctggcc
                     Hedgehog  gacc--ggat----------ga-atctt-gggttc--tt------gccagctctt----c-atcctggcc
                        Shrew  gact--aggt----------gg-tcctc-a------------------ggcccc-------------gcc
              Star-nosed mole  gact--ggat----------ga-tcctc-a----c--tg------gatgattctc----c-actgtagcc
                     Elephant  gcct--ggat----------ga-ttctc-aggtcc--ct------tctagctctc----c-atcctggcc
          Cape elephant shrew  ctcc--aa-------------------c-agtttc--ctcttatgtatagatctc----aggtcctggac
                      Manatee  gcct--ga----------------tctc-aagtcc--ct------tctggctctc----c-atcctggcc
             Cape golden mole  gcct--ggat----------ga-ttctc-gggtccttct------tctggctctc----c-atcctggcc
                       Tenrec  gcct--ggat----------ga-ctctc-aggttc--ct------tctggctctctcttc-atcctggtc
                     Aardvark  gtct--agat----------ga-ttctc-aggtcc--ct------tctagttctctc--c-atcctggcc
                    Armadillo  gact--ggat----------ga-ttctc-agagtt--c-------tctggctctc----c-atcctagcc
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  tcccagagtgg-agg----ctc-t--gggagggcagaaccctgttcctgcctcagtttccccacctgtg-
                        Chimp  tcccagagtgg-agg----ctc-t--gggagggtagaaccctgttcctgcctcagtttccccacctgtg-
                      Gorilla  tcccagagtgg-agg----ctc-t--gggagggcagaaccctgttcctgcctcagtttccccacctgtg-
                    Orangutan  tcccagagtgg-agg----ctc-t--gggaaggcagaaccctgttcctgcctcagtttccccacctgtg-
                       Gibbon  tcccacagtgg-agg----ctc-t--gggagggcacacccctgttcctgcctcagtttccccacctgtg-
                       Rhesus  tcccagagtgg-agg----ctc-t--gggagggcagaacccggttcctgcctcagtttccccacctgtg-
          Crab-eating macaque  tcccagagtgg-agg----ctc-t--gggagggcagaacccggttcctgcctcagtttccccacctgtg-
                       Baboon  tcccagagtgg-agg----ctc-t--gggagggcagaacccggttcctgcctcagtttccccacctgtg-
                 Green monkey  tcccagagtgg-agg----ctc-t--gagagggcagaaccctgttcctgcctctgtttccccacctgtg-
                     Marmoset  tcccagagtgg-agg----ctc-t--gggagggcagaagcctgttcctgcctcagtttccccacctgtg-
              Squirrel monkey  tcccagagcgg-agg----ctc-t--gagagggcagaagcctgttcctgcctcagtttccccacctgtg-
                     Bushbaby  tctttgagtga-aag----ctc-t--cggaaggcaggaccctgcttctgcctcagtttcaccatatgtg-
           Chinese tree shrew  tccc--agtgg-agg----cct-t--aggaaggcaaaagcc-atttcttcctcagtttccccac------
                     Squirrel  tcccagtatag-agg----ctt-t--gggagggcagaatcctgttcctgccttagtttccccacctgtgt
       Lesser Egyptian jerboa  tctcagggtag-aag----ctc-t--gggagggtagaatccaatttctgcctcagttt-cctacc--ta-
                 Prairie vole  tctcaggatta-agg----ctc-t--ggaagg----------------atcacggtttccctac------
              Chinese hamster  tctcaagataa-agg----ctc-tgggggggggcagaaacctgtttctgccacggtttccctacctgtg-
               Golden hamster  tctcaggataa-aag----ctc-t--gggagggcagaagcctgtttctgccatggtttccctacctgtg-
                        Mouse  tctcaggataa-agg----ctc-t--ggaagggcagaaacctatttctgcc--ggtttccctgcctgtg-
                          Rat  tttggggatac-agg----ctc-t--gaaagggca-aaacctatttctgcc--agtccccctacctgtg-
               Naked mole-rat  ----agtgtag--gg----ctc-t--gggagggcagactcctattcttgccttagtttccacacctgtg-
                   Guinea pig  tctcagtgta---gg----ttc-c--aggagggtagaatcctcttcctgcttcagttcccacacacatg-
                   Chinchilla  tcccagtgtag--gg----ctc-t--gggagggcagaatcctattcctgcttgagttcccacacctgtg-
             Brush-tailed rat  ttccagtgtgg--gg----ctc-t--gggagggcagaatcctattcctacttgagttcccatacccatg-
                       Rabbit  tcccagtgtgg-agg----ctc-t--gggagggtggaaccccgttcctatt-ctgtggctccaccgaag-
                         Pika  tccctgtgt--------------t--gagatgaccagatcctgctcctgct-ctgctgccccactgacg-
                          Pig  tcccagcctgg-agg----ctc-t-------aggagggccctacccctgcctcagtttcccctcctgtg-
                       Alpaca  tcccagcatgg-agc----ctc-t---ggaggggagagccctgtccctgcctcagtttccccacctatg-
               Bactrian camel  tcccagcatgg-agc----ctc-t--gggaggggagagccctgtccctgcctcagtttccccacctatg-
                      Dolphin  ccccagcctgg-agt----ctc-c--aggagaggagggccttgtccctgcctcagtttccccacctgtg-
                 Killer whale  ccccagcctgg-agt----ctc-c--aggagaggagggccttgtccctgcctcagtttccccacctgtg-
             Tibetan antelope  ccccagcccac-cat----ctc-c--aggacaggagggccctgtccctgtct--gttttctcatt-----
                          Cow  ccccagcccac-cat----ctc-c--aggacaggagggccctgtccctgtctcagttttcttacttgtg-
                        Sheep  ccccagcccac-cat----ctc-c--aggacaggagggccctgtccctgtctcagttttctcact-----
                Domestic goat  ccccagcccac-cat----ctc-c--aggacaggagggccctgtccctgtctcaattttctcact-----
                        Horse  tcccagcgtgg-agg----ctc-t--gg------------ctgtccctgcctcagtttccccacccctg-
             White rhinoceros  tcccagtgtgg-agg----ctc-t--gggaggggagagccctgtctctgcctcagtttccccacctgtg-
                          Cat  tcccagtgtag-agg----ctctt--gg-aggggagggccccgcttctgcttcagtttccccacctgtg-
                          Dog  ctcca-------------------------------------tcccctgcctcagtttccccacctgtg-
                      Ferret   tcccagtgtagtaga----gtc-t--gg-tgggtcgggccc---------------------------a-
                        Panda  tcccagtgtag-cgg----ctc-t--gg-gagggagggtcccgtccttgtgtcagtttctccacctgtg-
               Pacific walrus  tcccagtgtag-agg----ctc-t--gg-gagggagggccctgtccctgcctcagtttccccaccggtg-
                 Weddell seal  tcccagtgtag-agg----ctc-t--gg-gagggagggccctgtccctgcctcagcttccccaccggtg-
             Black flying-fox  tcccagcatgg-aga----ctc-t--gggaggggagggccctgtccctgcctcagtttctccacctgtg-
                      Megabat  tcccagcatgg-aga----ctc-t--gggaggggagggccctgtccctgcctcagtttctccacctgtg-
                Big brown bat  tcccaatgtgg-agg----ctc-t--gggaagggagggccctgtccctgcctcaatttccccacctgtg-
         David's myotis (bat)  ttccagtgtgg-agg----ctc-t--gggaagggaggaccctgtccctgcctcaatttccacacctgtg-
                     Microbat  tcccggtgtgg-agg----ctc-t--gggaagggagggccctgtctctgcctcagtttccccacctgtg-
                     Hedgehog  tcctagtatgg-agg----ttc-t--ggaaaaggagggttctatccttgcctcaagttccccacctttg-
                        Shrew  tcccaacacag-aggttcattc-t--ggaacaggagggccctgtacctgcctccgattctccacctgtg-
              Star-nosed mole  acccatcatgg-ggg----ctc-t--ggaaatggagggtccaac-cctgcctcagtttcccc-catgtg-
                     Elephant  tcccagcatgg-agg----ttc-t--gggatggcaaggccatgttcctgccttggcttccccaccagtg-
          Cape elephant shrew  tccc--------aga----ctc-t--gggatggtaagaccatgttcttgccttggtttctctgctcatg-
                      Manatee  tcccggcatgg-agg----ctc-t--ggtacggcaaggccatgttcctgccttggtttccccaccaatg-
             Cape golden mole  tcccagcatgg-agg----ctc-t--ggtatggtaaggctatgctcctgccttggtttctctaccaatg-
                       Tenrec  ttccagcatgg-cca----ttt-g--ggtatggtaaagtcacattcttgccttgctttccc-----atg-
                     Aardvark  tcccagcaggg-agg----ctt-t--gggatagcaagg-catgtttctgccttggtattcccaccaatg-
                    Armadillo  tcctaacgagg-aag----ctc-t--gag----------cccgttcctgcctcagtttccccacccata-
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  ggtctgcgta-----------tag
                        Chimp  ggtctgcgta-----------tag
                      Gorilla  ggtctgcgta-----------tag
                    Orangutan  ggtctgcgta-----------tag
                       Gibbon  gatctgtgta-----------tag
                       Rhesus  ggtctgagca-----------tag
          Crab-eating macaque  ggtctgagca-----------tag
                       Baboon  ggtctgagca-----------tag
                 Green monkey  gggctgagca-----------tag
                     Marmoset  ggtctgaaca-----------tag
              Squirrel monkey  ggtctgaaca-----------tag
                     Bushbaby  ggtctgggta-----------tag
           Chinese tree shrew  ---------a-----------cgg
                     Squirrel  tgtgtgggca-----------cag
       Lesser Egyptian jerboa  actctatgca-----------tat
                 Prairie vole  ---ctgtgca-----------cag
              Chinese hamster  agtctgtgca-----------cag
               Golden hamster  agtctgtgca-----------cag
                        Mouse  agtctgtgca-----------gag
                          Rat  agtctgtgta-----------taa
               Naked mole-rat  ggtctgcgca-----------cag
                   Guinea pig  ggtctgggca-----------cag
                   Chinchilla  ggttggggca-----------cag
             Brush-tailed rat  ggtctgggca-----------cag
                       Rabbit  ------------------------
                         Pika  ------------------------
                          Pig  ggtctgggca-----------cag
                       Alpaca  ggtctgggca-----------cag
               Bactrian camel  ggtctgggca-----------cag
                      Dolphin  ggtctgggcg-----------cag
                 Killer whale  ggtctgggca-----------cag
             Tibetan antelope  --------tg-----------cag
                          Cow  ggtctgggtg-----------cag
                        Sheep  --------tg-----------cag
                Domestic goat  --------tg-----------cag
                        Horse  ggtctgggct-----------cag
             White rhinoceros  ggtctgggca-----------cag
                          Cat  gatctgggca-----------cag
                          Dog  ggtctgggca-----------cag
                      Ferret   gggctgggca-----------c--
                        Panda  ggtctgggca-----------c--
               Pacific walrus  ggtctgggca-----------cag
                 Weddell seal  ggtctgggca-----------cag
             Black flying-fox  ggtctgggca-----------cag
                      Megabat  ggtctgggca-----------cag
                Big brown bat  ggtctgcaca-----------aag
         David's myotis (bat)  ggtctgtgca-----------cag
                     Microbat  ggtctgcaca-----------cat
                     Hedgehog  ggtcaggaca-----------taa
                        Shrew  aatcagagca-----------aag
              Star-nosed mole  gctctggaca-----------ttg
                     Elephant  gctctgggca-----------tgg
          Cape elephant shrew  actctgggca-----------tgg
                      Manatee  gctctgggca-----------tgg
             Cape golden mole  gctctgggca-----------tgg
                       Tenrec  gctccaggca-----------tga
                     Aardvark  gctctgggca-----------tgg
                    Armadillo  ggtctggacacaggtagggtgtgg
                   Coelacanth  ========================
                X. tropicalis  ========================
                 Atlantic cod  ========================
                  Spotted gar  ========================
                  Stickleback  ========================
           Southern platyfish  ========================
       Yellowbelly pufferfish  ========================
                         Fugu  ========================
                    Tetraodon  ========================
                       Turkey  ========================
                      Chicken  ========================
                 Mallard duck  ========================
           Tibetan ground jay  ========================
                  Zebra finch  ========================
       White-throated sparrow  ========================
              Tasmanian devil  ========================
     Mexican tetra (cavefish)  ========================
                    Zebrafish  ========================
                       Medaka  ========================
          Pundamilia nyererei  ========================
                  Zebra mbuna  ========================
        Burton's mouthbreeder  ========================
          Princess of Burundi  ========================
                 Nile tilapia  ========================
               Painted turtle  ========================
              Green seaturtle  ========================
           American alligator  ========================
                   Budgerigar  ========================
                      Opossum  ------------------------
                  Rock pigeon  ========================
          Collared flycatcher  ========================
          Medium ground finch  ========================
                       Lizard  ========================
             Peregrine falcon  ========================
                 Saker falcon  ========================
                     Platypus  ========================
     Chinese softshell turtle  ========================

Alignment block 7 of 435 in window, 46608427 - 46608494, 68 bps 
B D                     Human  ggctgggtatggaggtactga-gtaa-----tggagtgctgcgtgaacat--------------c--cc-
B D                     Chimp  ggctgggtatggaggtactga-gtaa-----tggagtgctgcgtgaacat--------------c--cc-
B D                   Gorilla  ggctggttatggaggtactga-gtaa-----tggagtgctgtgtgaacat--------------c--cc-
B D                 Orangutan  ggctgggtatggaggtactga-gtaa-----tggagtgctgagtgaacat--------------c--cc-
B D                    Gibbon  ggctggctatggagatactga-gtaa-----tggagtgtcgaatgaacat--------------c--cc-
B D                    Rhesus  tgctgggtatggaggtactga-gtaa-----tgga-----gaatgaacat--------------c--cc-
B D       Crab-eating macaque  tgctgggtatggaggtactga-gtaa-----tgga-----gaatgaacat--------------c--cc-
B D                    Baboon  tgctgggtatggaggtactga-gtaa-----tggagtgctgaatgaacat--------------c--cc-
B D              Green monkey  -gctggatatggaggtactga-gtaa-----tggagtgctgaatgaacat--------------c--cc-
B D                  Marmoset  agttgtgtatggaggtaaggt-gtaa-----tggagtgctgaatgaacat--------------c--cc-
B D           Squirrel monkey  ggttgtgtatggatgaaaaga-gtaa-----tggagtgctgaatgaacat--------------c--cc-
B D                  Bushbaby  ggttgggcatggagttactga-gtaa-----tggagtactgaatgaacat-----------------cc-
           Chinese tree shrew  ggctgcacacggagatactga-gtag-----tggagtgcttaatgaacat--------------c--cc-
B D                  Squirrel  ggctgggcaagaagttattga-gcag-------------taaatgaacat--------------c--ct-
       Lesser Egyptian jerboa  ggctcagcatggaggtagtgaggtaaggaatg-ggctgctggctgaacat--------------c--cc-
                 Prairie vole  ggctcagcatggaggtactaa-gtaa-----t-ggctattgaaagagcat--------------c--cc-
B D           Chinese hamster  ggctcagcatggaggtattga-gtaa-----t-ggctaaagaaaaaacatcccagcctcaccccc--cc-
               Golden hamster  ggctcagcatggaataactga-gtaa-----t-ggctactgaaagagcat--------------c--cc-
B D                     Mouse  ggctcagcatggaggtattaa-gtaa-----t-ggctaatgaataagcat--------------c--ct-
B D                       Rat  ggctcagcatggagatactga-gtaa-----t-ggctactgagtgaggat--------------c--cc-
B D            Naked mole-rat  agctgggcatggaggtattga-gcaa-----tgggttgctgaatgaacat--------------c--cc-
B D                Guinea pig  ggctgggcatggaagtactga-gtaa-----tgggctgctgattgaacat--------------c--cc-
                   Chinchilla  ggctggacacggaggtactga-gcaa-----tgggttgctgattgaacat--------------c--cc-
             Brush-tailed rat  ggctgg-catagaggtactga-gaaa-----taggttgctgattgaacat--------------c--cc-
B D                    Rabbit  gtctgggcatggaggtactga-gtga-----tggggtactgaatgaacag--------------c--tc-
B D                      Pika  gtctgggcatggagatacgga-gcaa-----ggggttgctgaaagaacat--------------c--cc-
B D                       Pig  ggctgggcagggaagcactga-gaaa-----tggagggctgaacgaacac--------------c--cc-
B D                    Alpaca  ggctgggcatggaggcgctga-gtaa-----tggagcactgaatcaacat--------------c--cc-
               Bactrian camel  ggctgggcatgcaggcgctga-gtaa-----tggagccctgaatcaacat--------------t--cc-
B D                   Dolphin  ggctgggcatg-----------------------------------------------------g--cc-
                 Killer whale  ggctgggcatg-----------------------------------------------------g--cc-
             Tibetan antelope  ggctggacatggaggtgctga-gtca-----t-aagtgctgaatgaccat--------------g--cc-
B D                       Cow  ggctggacatggaggtgctga-gtaa-----t-aagtgctgaatgaccat--------------g--cc-
B D                     Sheep  ggctggacatggaggtgctga-gtca-----t-aagtgctgaatgaccat--------------g--cc-
                Domestic goat  ggctggacatggaggtgctga-gaca-----t-aagtgctgaacgaccat--------------g--cc-
B D                     Horse  ggctgggcatggg-gtgctga-gtaa-----tggagtgctgaatgaacat--------------c--cc-
B D          White rhinoceros  ggctgggcaggggcctgctga-gtaa-----tggagtgctgaatgaacac--------------c--cc-
B D                       Cat  ggctgggcatggcggtgctga-gtaa-----tggagtgtcaaatcaa---------------------c-
B D                       Dog  ggctggacgtggcagtgtggg-gtaa-----tgaagtgtcgaacgaacat--------------c--cc-
B D                   Ferret   ----------ggcggtatgga-gtaa-----tggagtgtcaaatgaacat--------------c--cc-
B D                     Panda  ----------gacggtgtgga-gtaa-----tggagtgtcgaatgaacat--------------c--cc-
               Pacific walrus  ggctaggcatggcggtactga-gtaa-----tggagtgtcgaatgaacat--------------c--cc-
                 Weddell seal  ggctaggcatggtggtacaga-gtaa-----tggagtgtcgaatgaacat--------------g--cc-
             Black flying-fox  ggttgggcatggg-gtgccga-gtga-----tagagtgctgaatggacat--------------c--cc-
B D                   Megabat  ggttgg----------gccga-gtga-----tagagtgctgaatggacat--------------c--cc-
                Big brown bat  ggctgggcatgggagtgctga-gaaa-----tggagtactgaatgaacat--------------c--cc-
         David's myotis (bat)  ggctgggcatgggagtgctga-gtaa-----tggagtactgaatgaacac--------------c--cc-
B D                  Microbat  ggctgggcatgggagtgctga-gtaa-----tggagtactgaatgaacat--------------c--cc-
B D                  Hedgehog  ggctgaacatgga-gtgctga-gt--------------------gaatat--------------c--ta-
B D                     Shrew  ggctggatatggg-gtgttga-at--------------------gaacat--------------c--cc-
              Star-nosed mole  ggctgggcctggg-gcactga-gtaa-----tggagtgcta---aagcat--------------cgtcc-
B D                  Elephant  gggtga-------------ga-gtaa-----tggagtgctgaatgaacat--------------c--cc-
          Cape elephant shrew  gaagta-------------ga-gcaa-----tgcagtattggatgaactt--------------c--tc-
B D                   Manatee  gggtga-------------ca-gtaa-----tggagtgctaaatgaacat--------------c--cc-
             Cape golden mole  caatga-------------ga-gtaa-----tggagtgctgaatgaacat--------------c--ct-
B D                    Tenrec  gggcaa-------------aa-gtaa-----tagagctctgaatgaacac--------------c--ca-
                     Aardvark  tggtga-------------ga-gcaa-----tgtagtgctgaatgaacat--------------c--cc-
B D                 Armadillo  gatgct-------------ga-gaaa-----cggagtgctaaatgaacat--------------c--cc-
  D            Painted turtle  ggctgggcacagagatggggg-atga-----ggtagagctgctttagcat--------------c--tct
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ----------------------------------------------------------------------
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Platypus  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  -agtctccc----tgtggatagctgt
                        Chimp  -agtctccc----tgtggatagctgt
                      Gorilla  -agtctccc----tgtggatagctgt
                    Orangutan  -agtctccc----tgtggatagctgt
                       Gibbon  -agtctccc----tgtggatacttgt
                       Rhesus  -agtctccc----tgtggatagctgt
          Crab-eating macaque  -agtctccc----tgtggatagctgt
                       Baboon  -agtctccc----tgtggatagctgt
                 Green monkey  -ggtctccc----tgtggatagctgt
                     Marmoset  -agtctccc----tgtgcatagctgt
              Squirrel monkey  -agtctccc----tgtgcaaagctgt
                     Bushbaby  -agtctctt----tggcgatagctgt
           Chinese tree shrew  -agtctac------atggagggctgt
                     Squirrel  -agtctctc----tgtggatggctgt
       Lesser Egyptian jerboa  -agcctcta------tgaatggggat
                 Prairie vole  -cgcctctc------tggatagccgt
              Chinese hamster  -agcctctc------tggatagctgt
               Golden hamster  -agcctctc------tggata-ctgt
                        Mouse  -agcctctc------tggatagctgt
                          Rat  -agcccctc-------agatagatgt
               Naked mole-rat  -agactctc----tgtaaatagctgt
                   Guinea pig  -agcctctc----tgtgaatagctgt
                   Chinchilla  -agcctctc----tgtgaatagctgt
             Brush-tailed rat  -agcctctc----tgtgaatagttgt
                       Rabbit  -gggctcct---------------gt
                         Pika  -agtctc------------------t
                          Pig  -agttgctc----tgtggatagctat
                       Alpaca  -agtttctc----tgcggatagatct
               Bactrian camel  -agtttctc----tgcggatagatct
                      Dolphin  -agtgtctc----tgtggacagctat
                 Killer whale  -agtgtctc----tgtggacagctat
             Tibetan antelope  -agtttctc----tgtggatagctat
                          Cow  -agtttctc----tgtggatagctat
                        Sheep  -agtttctc----tgtggatagctat
                Domestic goat  -agtttctc----tgtggatagctat
                        Horse  -aatttctc----tgtgggcagctac
             White rhinoceros  -agtttctc----tgtggacagctat
                          Cat  -agtttctc----tgtggatagct--
                          Dog  -aggttctc----tgtggacagct--
                      Ferret   -atgttctc----tgtggaaagct--
                        Panda  -agcttctc----tgtggacagct--
               Pacific walrus  -aggttctc----tgtggacagct--
                 Weddell seal  -aggttctc----tgtggatagct--
             Black flying-fox  -agtttctc----tgtggacagctat
                      Megabat  -agtttctc----tgtggacagctat
                Big brown bat  -agtttctc----tgtgaacagctgt
         David's myotis (bat)  -agtttctc----tgggaacagctgt
                     Microbat  -agtttctc----tgggaacagctgt
                     Hedgehog  -attttctc----tacagat---tag
                        Shrew  -agtgaccc----cacg---------
              Star-nosed mole  -atttctct----tggacat------
                     Elephant  -aatctctt----tgtggatggctgt
          Cape elephant shrew  -agtctctc----tgtggatggctgt
                      Manatee  -agtctctt----tgtggatggctgg
             Cape golden mole  -actctctc----tgtcaatatttgt
                       Tenrec  -gc-ctcttgcaatgtggatgtctgt
                     Aardvark  -agtctctc----tgtggatg-ctgt
                    Armadillo  -agtctctc----tgtggatagctgt
               Painted turtle  atgccctct----tttctgtagccgt
                   Coelacanth  ==========================
                X. tropicalis  ==========================
                 Atlantic cod  ==========================
                  Spotted gar  ==========================
                  Stickleback  ==========================
           Southern platyfish  ==========================
       Yellowbelly pufferfish  ==========================
                         Fugu  ==========================
                    Tetraodon  ==========================
                       Turkey  ==========================
                      Chicken  ==========================
                 Mallard duck  ==========================
           Tibetan ground jay  ==========================
                  Zebra finch  ==========================
       White-throated sparrow  ==========================
              Tasmanian devil  ==========================
     Mexican tetra (cavefish)  ==========================
                    Zebrafish  ==========================
                       Medaka  ==========================
          Pundamilia nyererei  ==========================
                  Zebra mbuna  ==========================
        Burton's mouthbreeder  ==========================
          Princess of Burundi  ==========================
                 Nile tilapia  ==========================
              Green seaturtle  ==========================
           American alligator  ==========================
                   Budgerigar  ==========================
                      Opossum  --------------------------
                  Rock pigeon  ==========================
          Collared flycatcher  ==========================
          Medium ground finch  ==========================
                       Lizard  ==========================
             Peregrine falcon  ==========================
                 Saker falcon  ==========================
                     Platypus  ==========================
     Chinese softshell turtle  ==========================

Alignment block 8 of 435 in window, 46608495 - 46608555, 61 bps 
B D                     Human  -gctgtgagatccaactggct-ggaatgtgtc-aggga-tgg---------ctggga-------aggagg
B D                     Chimp  -gctgtgagatccaactggct-ggaatgtgtc-aggga-tgg---------ctggga-------aggagg
B D                   Gorilla  -gctgtgagatccaactggct-ggaatgtgtc-aggga-tgg---------ctggga-------aggagg
B D                 Orangutan  -gccatgagatccaactggct-ggaatgcatc-aggga-tgg---------ctggga-------aggagg
B D                    Gibbon  -gctgtgagatccaactggct-gtgatgtgtc-c-gga-tgg---------ctggga-------aggaga
B D                    Rhesus  -gctctgagatccaactgtct-gggatgcctg-aggga-tgg---------ctggga-------aggagg
B D       Crab-eating macaque  -gctctgagatccaactgtct-gggatgcctg-aggga-tgg---------ctggga-------aggagg
B D                    Baboon  -gctctgagatccaactgtcc-agaatgcctg-aggga-tgg---------ctggga-------aggagg
B D              Green monkey  -gctctgagatccaactgtct-ggagtgcctg-cggga-tgg---------ctggga-------aggaga
B D                  Marmoset  -gctctgagatccagctggct-gaaatgcctc-aggga-tgg---------ctggga-------aggagg
B D           Squirrel monkey  -gctctgagatccagctggct-ggaatgcctc-aggga-tgg---------ctggga-------aggagg
B D                  Bushbaby  -gttctgagatccaaccatct-ggcttgtctc-aggga-tag---------gaggaa-------aggagg
           Chinese tree shrew  -gcactgagatccagttggct-ggaatgtcgc-agaga-tgg----------tggga-------aggagg
B D                  Squirrel  -gcttggagatccaatcattt-ggaatgtctc-aggaatagg---------tgggaa-------gg-agg
       Lesser Egyptian jerboa  -gct--gagatccaactagct-ggaatgtctt-aggga-tgg---------ttggga-------agaagg
                 Prairie vole  -gcttggggatccaagtagct-gggatgtctt-gaga--tgg---------ttgggt-------gg-agg
B D           Chinese hamster  -gcttggagatccaagtaggt-ggaatgtctc-tggg--tgg---------ttgggt-------gg-agg
               Golden hamster  -gctcagagatccaagtaggt-gggatgtctc-tggg--tgg---------ttggat-------gg-agg
B D                     Mouse  ggcttggaaatccaagaagcc-tgaatgtatc-agga---gg---------ctgggc-------cg-agg
B D                       Rat  -gcttgg-aattcaagaagccttgaatgtatc-agga---gg---------ttgggc-------tg-agg
B D            Naked mole-rat  -g--cagagctccaaccacct-ggaatgtctc-tgaga-tgc---------ttagga-------aggagg
B D                Guinea pig  -g--tggagat-cagccagct--gactgtctc-tgaga-tgg---------ttggga-------agaagg
                   Chinchilla  -g--tggagat-caaccagct-gggatgtctc-tgaga-tgg---------ttggga-------aggagg
             Brush-tailed rat  -g--tggaggt-caaccagct-ggaatgtttc-tgaga-tgg---------ttgcga-------aggagg
B D                    Rabbit  -g------------gacagct-ggaatgtctc-aggg--cgg---------ctggga-------aggagg
B D                      Pika  -g------------aatatct-ggaatgtctcaagga--tag---------ctggga-------ataagg
B D                       Pig  -gctctgagatccagccagct-ggaacgtctc-acgga-ttg---------ttggga-------aggagg
B D                    Alpaca  -tctctgagatccaaccagct-ggaatgtctt-aggga-tgg---------ttggga-------gggagg
               Bactrian camel  -tctctgagatccaaccagct-ggaatgtctt-aggga-tgg---------ttggga-------gggagg
B D                   Dolphin  -gctctgagatccaaccagct-ggaatatttc-aggga-tgg---------ttggga-------aggagg
                 Killer whale  -gctctgagatccaaccagct-ggaatatttc-aggga-tgg---------ttggga-------aggagg
             Tibetan antelope  -gctctgagatctaaccagct-ggaatgtctc-aggga-tgg---------ctgggaagggggaaggagg
B D                       Cow  -gctctgagatctaaccagct-ggaatgtctc-agaga-tgg---------ttggga-------------
B D                     Sheep  -gctctgagatctaaccagct-ggaatgtctc-aggga-tgg---------ttgggaaggaggaaggagg
                Domestic goat  -gctctgagatctaaccagct-ggaatgtctc-aggga-tgg---------ttgggaaggaggaaggagg
B D                     Horse  -gctctgagatccaaccagct-ggaatgtctc-aagaa-tgg---------ttggga-------aggagg
B D          White rhinoceros  -gctctgagatccaaccagct-ggaatgtctc-aagaa-tgg---------ttggga-------aggagg
B D                       Cat  ---------atccaaccagct-ggactgtctc-aggga-tgg---------ttggga-------aggagg
B D                       Dog  ---------atccaaccagct-ggaatgtctc-gggga-tgg---------ctgggc-------aggagg
B D                   Ferret   ---------gtccgaccagct-ggaatgtctc-gggga-tggggggatggctcgggg-------aggagg
B D                     Panda  ---------atccaaccagat-ggaatgtcta-gagga-tgg---------ctggac-------aggagg
               Pacific walrus  ---------atccaaccagct-ggaatgtctc-gcgga-tgg---------ctgggc-------aggagg
                 Weddell seal  ---------atccaaccagct-ggaatgtctc-acgga-tgg---------ctgggc-------aggagg
             Black flying-fox  -gctctgagagccaaccagct-ggaatgtctc-aggga-tag---------ttggga-------aagagg
B D                   Megabat  -gctctgagagccaaccagct-ggaatgtctc-aggga-tag---------ttggga-------aagagg
                Big brown bat  -gctctgagagccaaccagct-ggaatgtctc-a-gga-tgg---------ct-gaa-------aggaga
         David's myotis (bat)  -gctctgagaaccaaccagct-ggaatgtctc-a-gga-tgg---------tt-gaa-------aggagg
B D                  Microbat  -gctctgagagccaaccagct-ggaatgtctc-a-gga-tgg---------tt-gaa-------aggagg
B D                  Hedgehog  -gctctgatatccacccagct-ggaatggctc-aggga-agg---------tc-----------aagagg
B D                     Shrew  --ctctgagatcc-accagag-aaaatgtctc-aggga-tgg---------ctgaga-------aagtag
              Star-nosed mole  --ctctgatatccaaccagct-ggaatgtctc-aagga-tag---------ttggga-------aggagg
B D                  Elephant  -aatctaagctccaatcagct-ggaatgtctt-agaca-tgg---------ttggga-------agaagg
          Cape elephant shrew  -actctaagctctaattaggt-ggaatgtctg-agggg-tgg---------cttgga-------agaag-
B D                   Manatee  -gatctaagatccactcggct-ggaatgtctc-aggga-tga---------ctggga-------agaagg
             Cape golden mole  -gctctaaactccaatcagct-ggaatgtctc-aggat-tta---------ttggga-------agacag
B D                    Tenrec  -gctctaagctccaggcagct-ggaatgtctc-aggga-tgg---------ttagga-------agcagg
                     Aardvark  -gttctaggctccaatcagct-ggaatgtctc-aggga-cgg---------ctggga-------agaagg
B D                 Armadillo  -gctctgggctccagtcagct-ggaatgtctt-ggtga-tgg---------tt-gga-------aggagg
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ----------------------------------------------------------------------
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Platypus  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  caggtac-tttt
                        Chimp  caggtac-tttt
                      Gorilla  caggtac-tttt
                    Orangutan  caggtac-tttt
                       Gibbon  caggtacttttt
                       Rhesus  caggtag-tttt
          Crab-eating macaque  caggtag-tttt
                       Baboon  caggtag-tttt
                 Green monkey  caggtag-tttt
                     Marmoset  caggtac-tttt
              Squirrel monkey  caggtac-tttt
                     Bushbaby  caggtac-tttt
           Chinese tree shrew  caggtac-tgtt
                     Squirrel  caggtac-tttc
       Lesser Egyptian jerboa  cagatat-tttt
                 Prairie vole  caggtgt-tttc
              Chinese hamster  caggtat-tttt
               Golden hamster  caggtat-tttt
                        Mouse  caggtgt-tttt
                          Rat  caggtgt-tttt
               Naked mole-rat  caagtac-tttt
                   Guinea pig  caagtat-tttt
                   Chinchilla  caagtat-gttt
             Brush-tailed rat  caagaac-tttt
                       Rabbit  caggcac-ttcc
                         Pika  caggaac-t---
                          Pig  cagaact-ttgc
                       Alpaca  caggtag-ttgc
               Bactrian camel  caggtag-ttgc
                      Dolphin  caggcac-ttgc
                 Killer whale  caggcac-ttgc
             Tibetan antelope  caggtac-ttgc
                          Cow  -aggtac-ttgc
                        Sheep  caggtac-ttgc
                Domestic goat  caggtac-ttgc
                        Horse  caggtac-ttgc
             White rhinoceros  caggatc-ttgc
                          Cat  caggtcc-ttgc
                          Dog  caggtcc-ttgc
                      Ferret   caggtcc-ttgc
                        Panda  caggtcc-ttgc
               Pacific walrus  caggtcc-ttac
                 Weddell seal  caggtcc-ttgc
             Black flying-fox  caagtac-ttgc
                      Megabat  caagtac-ttgc
                Big brown bat  caagtac-ttga
         David's myotis (bat)  caagtgc-ttga
                     Microbat  caagtgc-ttga
                     Hedgehog  gagagat-ttgc
                        Shrew  caggcac-ttgc
              Star-nosed mole  gagctac-ttgt
                     Elephant  caggtac-ttgt
          Cape elephant shrew  ----------gt
                      Manatee  caggtac-ttgc
             Cape golden mole  cagatac-t---
                       Tenrec  cagctac-t---
                     Aardvark  taggtac-ttgc
                    Armadillo  caggtac-ttgc
                   Coelacanth  ============
                X. tropicalis  ============
                 Atlantic cod  ============
                  Spotted gar  ============
                  Stickleback  ============
           Southern platyfish  ============
       Yellowbelly pufferfish  ============
                         Fugu  ============
                    Tetraodon  ============
                       Turkey  ============
                      Chicken  ============
                 Mallard duck  ============
           Tibetan ground jay  ============
                  Zebra finch  ============
       White-throated sparrow  ============
              Tasmanian devil  ============
     Mexican tetra (cavefish)  ============
                    Zebrafish  ============
                       Medaka  ============
          Pundamilia nyererei  ============
                  Zebra mbuna  ============
        Burton's mouthbreeder  ============
          Princess of Burundi  ============
                 Nile tilapia  ============
               Painted turtle  ============
              Green seaturtle  ============
           American alligator  ============
                   Budgerigar  ============
                      Opossum  ------------
                  Rock pigeon  ============
          Collared flycatcher  ============
          Medium ground finch  ============
                       Lizard  ============
             Peregrine falcon  ============
                 Saker falcon  ============
                     Platypus  ============
     Chinese softshell turtle  ============

Inserts between block 8 and 9 in window
B D                 Bushbaby 195bp

Alignment block 9 of 435 in window, 46608556 - 46608811, 256 bps 
B D                     Human  aggat-gg---------------------------------------------agga-------------
B D                     Chimp  aggat-ga---------------------------------------------agga-------------
B D                   Gorilla  aggat-gg---------------------------------------------agga-------------
B D                 Orangutan  aggat-gg---------------------------------------------agga-------------
B D                    Gibbon  aggat-gg---------------------------------------------agga-------------
B D                    Rhesus  aggat-gg---------------------------------------------agga-------------
B D       Crab-eating macaque  aggat-gg---------------------------------------------agga-------------
B D                    Baboon  aggat-gg---------------------------------------------agga-------------
B D              Green monkey  aggat-gg---------------------------------------------agga-------------
B D                  Marmoset  aggat-gg---------------------------------------------agga-------------
B D           Squirrel monkey  aggat-gg---------------------------------------------agga-------------
B D                  Bushbaby  aggct-ggtcttaaactcctgagctcaagtctctcttagtctcccagagtgctaggattataggtgtgag
           Chinese tree shrew  aggat-tg---------------------------------------------gggc-------------
B D                  Squirrel  aggat-gg----------------------------------------------cgt-------------
       Lesser Egyptian jerboa  aggat-gg----------------------------------------------gaa-------------
                 Prairie vole  aggat-gg----------------------------------------------gaa-------------
B D           Chinese hamster  agggt-gg----------------------------------------------gaa-------------
               Golden hamster  aggat-gg----------------------------------------------gaa-------------
B D                     Mouse  aggat-gg----------------------------------------------gaa-------------
B D                       Rat  aggat-gg----------------------------------------------gaa-------------
B D            Naked mole-rat  aggat-ag----------------------------------------------ggg-------------
B D                Guinea pig  aggat-ag----------------------------------------------ggg-------------
                   Chinchilla  aggat-ag----------------------------------------------ggg-------------
             Brush-tailed rat  agaat-ag----------------------------------------------gga-------------
B D                    Rabbit  aggat-gg--------------------------------------------gggca-------------
B D                      Pika  ------------------------------------------------------gca-------------
B D                       Pig  aggct-gg---------------------------------------------gggc-------------
B D                    Alpaca  aggac-ag---------------------------------------------gggc-------------
               Bactrian camel  aggac-ag---------------------------------------------gggc-------------
B D                   Dolphin  aggat-gg---------------------------------------------gggc-------------
                 Killer whale  aggat-gg---------------------------------------------gggc-------------
             Tibetan antelope  aggat-gg---------------------------------------------gggc-------------
B D                       Cow  aggat-gg---------------------------------------------gggc-------------
B D                     Sheep  aggat-gg---------------------------------------------gggc-------------
                Domestic goat  aggat-gg---------------------------------------------gggc-------------
B D                     Horse  aggct-gg---------------------------------------------aggt-------------
B D          White rhinoceros  agaat-aa---------------------------------------------ggac-------------
B D                       Cat  agaat-gg---------------------------------------------gggc-------------
B D                       Dog  acaat-gg---------------------------------------------gggc-------------
B D                   Ferret   aagataag---------------------------------------------gggc-------------
B D                     Panda  aggat-gg---------------------------------------------gggc-------------
               Pacific walrus  aggat-gg---------------------------------------------gggc-------------
                 Weddell seal  aggat-gg---------------------------------------------gggc-------------
             Black flying-fox  aggat-gg---------------------------------------------gggc-------------
B D                   Megabat  aggat-gg---------------------------------------------gggc-------------
                Big brown bat  aggat-gg---------------------------------------------ggtt-------------
         David's myotis (bat)  aggat-gg---------------------------------------------ggtt-------------
B D                  Microbat  aggat-gg---------------------------------------------ggtt-------------
B D                  Hedgehog  aga-a-ga---------------------------------------------gggt-------------
B D                     Shrew  tggaa-aa---------------------------------------------gggg-------------
              Star-nosed mole  agatt-gg---------------------------------------------gggc-------------
B D                  Elephant  ggggt-at---------------------------------------------aggt-------------
          Cape elephant shrew  tggct-gc---------------------------------------------cagg-------------
B D                   Manatee  agggt-ac---------------------------------------------aggt-------------
             Cape golden mole  ----t-ac---------------------------------------------aggc-------------
B D                    Tenrec  ----t-gc---------------------------------------------agat-------------
                     Aardvark  aggct-gc---------------------------------------------aggt-------------
B D                 Armadillo  aggct-gt---------------------------------------------gggc-------------
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ----------------------------------------------------------------------
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Platypus  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  ----------------------------------------tctccatgcctggaagagt-ccattcacca
                        Chimp  ----------------------------------------tctccatgcctggaagagttccattcacca
                      Gorilla  ----------------------------------------tctccatgcctggaagagt-ccattcacca
                    Orangutan  ----------------------------------------tctccatgcctggaagagt-ccattcacca
                       Gibbon  ----------------------------------------tatccatgcatggaagagt-atattcacca
                       Rhesus  ----------------------------------------tctccatacctggaagagt-ccattcacca
          Crab-eating macaque  ----------------------------------------tctccatacctggaagagt-ccattcacca
                       Baboon  ----------------------------------------tctccatacctggaagagt-ccattcacca
                 Green monkey  ----------------------------------------tctccatacctggaagagt-ccattcacca
                     Marmoset  ----------------------------------------tctccatgcctggaagagt-ccattcacca
              Squirrel monkey  ----------------------------------------tctccctgcctggaagagt-ccattcacca
                     Bushbaby  ccactatgcctggccaaggcagttacttttaagtaagcactctgcaagcctagaagagt-ccattcacca
           Chinese tree shrew  ----------------------------------------tctccaagcctggaagaat-ctgtttatca
                     Squirrel  ------------------------------------------------------------ctctccatca
       Lesser Egyptian jerboa  ------------------------------------------------------------ctcttcatta
                 Prairie vole  ----------------------------------------------------------g-gtctccacca
              Chinese hamster  ----------------------------------------------------------g-ttctccacca
               Golden hamster  ----------------------------------------------------------g-gtctccacca
                        Mouse  ----------------------------------------------------------g-gtctccatca
                          Rat  ----------------------------------------------------------g-gtctccatca
               Naked mole-rat  ------------------------------------------------------------ctttcca-ca
                   Guinea pig  ------------------------------------------------------------ctctcca-ta
                   Chinchilla  ------------------------------------------------------------ctttccc-ca
             Brush-tailed rat  ------------------------------------------------------------ttctcca-tg
                       Rabbit  ----------------------------------------t-ttcacg-ctgcaacagt-tctttcacca
                         Pika  --------------------------------------------cac--ctgcaccagt-cctttcacca
                          Pig  ----------------------------------------tttccaaggctggaagagt-ccattca-ca
                       Alpaca  ----------------------------------------tctctaagcctggaagggt-ccattcagta
               Bactrian camel  ----------------------------------------tctctaagcctggaagagt-ccattcagta
                      Dolphin  ----------------------------------------tctccaagcctggaagagt-ccattca-ca
                 Killer whale  ----------------------------------------tctccaagcctggaagagt-ccattca-ca
             Tibetan antelope  ----------------------------------------tttccaagcctggaagagt-ctgttca-ca
                          Cow  ----------------------------------------tctccaagcctggaagagt-ctgttca-ca
                        Sheep  ----------------------------------------tctccaagcctggaagagt-ctgttca-ca
                Domestic goat  ----------------------------------------tctccaagcctggaagagt-ctgttca-ca
                        Horse  ----------------------------------------tctccaagcccggcagagt-ctactcacta
             White rhinoceros  ----------------------------------------tctccaagcctggaagagt-ccactcacta
                          Cat  ----------------------------------------tttccaagcctagaagggt-ccattcacta
                          Dog  ----------------------------------------tttccaagcttggaagagt-ccattcacta
                      Ferret   ----------------------------------------tttccaagcctggaagagt-ccattcgcta
                        Panda  ----------------------------------------tttccaagcctggaagagt-ccgttcacta
               Pacific walrus  ----------------------------------------tttccaagcctggaagagt-ccattcacta
                 Weddell seal  ----------------------------------------tttccaagcctggaagggt-ccattcacta
             Black flying-fox  ----------------------------------------tctccaagcttggaagggt-ccattcacta
                      Megabat  ----------------------------------------tctccaagcttggaagagt-ccattcacta
                Big brown bat  ----------------------------------------tctccaagcctggaagact-gcattcacta
         David's myotis (bat)  ----------------------------------------tctccaagcctggaagagt-gcattcacta
                     Microbat  ----------------------------------------tctccaagcctggaagagt-gcattcacta
                     Hedgehog  ----------------------------------------tctccaggccagagagagc-ccatccacta
                        Shrew  ----------------------------------------tctccatacccgcaagagt-ccagttacta
              Star-nosed mole  ----------------------------------------tctcca-acc-----------------cta
                     Elephant  ----------------------------------------tccccaggcctggaagaat-ccattcacca
          Cape elephant shrew  ----------------------------------------tccccaggcctggaataaa-ctattcactg
                      Manatee  ----------------------------------------tccctaggcctggaagaat-ccattcacca
             Cape golden mole  ----------------------------------------tccctaggcttggaagaac-tcatttacca
                       Tenrec  ----------------------------------------tccctgtgtctggaagaat-ccattcacca
                     Aardvark  ----------------------------------------tccccaggccttgaagaat-ccattcacca
                    Armadillo  ----------------------------------------tcc-------tggaagagt-ccatttactg
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  actac----atc-ctcaatgtgctggga---------tgg---gagacaag-actc-----caaa-gttc
                        Chimp  actac----atc-ctcaatgtgctggga---------tgg---gagacaag-actc-----caac-gttc
                      Gorilla  actac----atc-ctcaatgtgctggga---------tgg---gagacaag-actc-----caaa-gttc
                    Orangutan  actac----atc-ctcaatgtgctggga---------tgg---gagacaag-accc-----caaa-gttc
                       Gibbon  actac----atc-ttcaatgaggtggga---------tgg---gagacaat-g-tc-----caaa-gttc
                       Rhesus  actat----atc-ctcgatgtcctggga---------tgg---gagagaag-actc-----caaa-gttc
          Crab-eating macaque  actat----atc-ctcgatgtcctggga---------tgg---gagagaag-actc-----caaa-gttc
                       Baboon  actat----atc-ctcaatgtcctggga---------tgg---gagagaag-actc-----caaa-gttc
                 Green monkey  actat----atc-ctcaatgtcctggga---------tgg---gagagaag-actc-----caaa-gttc
                     Marmoset  cctac----atc-ttcagtgtcctggga---------tgg---aagacaag-actc-----caga-gttc
              Squirrel monkey  cctac----atc-ttcaatgtcctggga---------tgg---aagacaag-accc-----caga-gttc
                     Bushbaby  gctacg-tgatc-ctcaatgt-ctgaga---------tgg---gagacaag-actc-------aa-gctc
           Chinese tree shrew  gctgca-tgatc-ctcg--gtactgggaatcaggatttgg---gaattggg-aatc------aga-gttc
                     Squirrel  gctata-agatc-ctcagtgtcctggga---------tgg---gagagagg-actt-----caga-tttc
       Lesser Egyptian jerboa  actaca-tgatc-ttcagtggcccagga---------tag---gacataca-actc-----caga-tttc
                 Prairie vole  gctaca-tgctc-ctccgtgtcctgaga---------cag---tagaaaag-actc-----caga-tgcc
              Chinese hamster  gctaca-tgatc-ctcagtgtcctgaga---------ta----ggaaaaag-actc-----caga-tttc
               Golden hamster  gctaca-tgatc-ctcagtgtcctgaga---------tag---ggaaaaag-actc-----caga-ttcc
                        Mouse  gttgca-tgatc-ctcagtgtcctgaga---------tag---aagaaaa-----t-----tgga-ttct
                          Rat  gctaca-tgatc-ctcagt-tcctgaga---------tag---aagaaaag-actc-----tgga-ttct
               Naked mole-rat  gctaca-tgatc-cttagtgtcctggg----------cag---gagacaag-actcca---caga-cttc
                   Guinea pig  gctacg-tgatc-ctcagtgtcctggga---------tgg---gagacaag-attcca---cata-cttc
                   Chinchilla  gctaca-tggtc-ctcagtgtcctgggg---------tgg---gaggcaag-cttcca---caga-cttc
             Brush-tailed rat  gctaca-tgg----tcaatgtcctgggg---------tgg---gaaacaag-attcca---caga-cttc
                       Rabbit  gctgtg-tgg---------------------------------gagagaag-actg-----cag---tca
                         Pika  gctgcg-tggtc-ctcagggctctggca---------c-----gggagagg-actc-----caga-tttg
                          Pig  gctacg-tggtc-ctcagtgtccca-ga---------cag---gtgacaag-ggtc-----tggagtttc
                       Alpaca  gctatg-tggtc-ctcaatgcccca-ga---------tgg---gagacaag-gctc-----cagagtttc
               Bactrian camel  gctatg-tggtc-ctcaatgcccca-ga---------tgg---gagacaag-gctc-----cagagtttc
                      Dolphin  gctatg-tggtc-ctcaatgtccca-gg---------tgg---gagataag-gctc-----cggagcttc
                 Killer whale  gctatg-tggtc-ctcaatgtccca-gg---------tgg---gagataag-gctc-----cggagcttc
             Tibetan antelope  gctctg-tggtc-ctcaatatccca-ga---------tgg---gagataaa-gctc-----tggagtttc
                          Cow  gctatg-tggtc-ctcaatatccca-ga---------tgg---gagataag-gctc-----tggagtttc
                        Sheep  gctctg-tggtc-ctcaatatccca-ga---------tgg---gagataaa-gctc-----tggagtttc
                Domestic goat  gctctg-tggtc-ctcaatatccca-ga---------tgg---gagataaa-gctc-----tggagtttc
                        Horse  gctaca-tggtc-ctcaatgtcccagga---------tgg---gagacaag-tctc-----cagagtctc
             White rhinoceros  gctaca-cggtc-ctcgatgtcccacga---------tgg---gagacaag-tctc-----caga-tttc
                          Cat  gtaaca-c-atc-ttcagtgtcctggga---------tgg---gagaaaag-actc-----tggagttcc
                          Dog  gcaata-c-gtc-ttcactgccctggga---------tgg---gagacaat-tctc-----tggggtttc
                      Ferret   gcaata-c-atc-ttccctgtccgagga---------tgg---gatacaag-tctc-----cagggtttc
                        Panda  gcaaca-t-gtc-tttactgcccgggga---------tgg---gagacgag-tctc-----gcgtgttgc
               Pacific walrus  gcgata-c-gtc-tttgctggccgggga---------tgg---gagacgag-tctc-----cggggttac
                 Weddell seal  gcaata-c-gtc-ttcactggccgggga---------tgg---gaaacgag-tctc-----cggggtttc
             Black flying-fox  gtcacg-tggtc-ctcaatgtcccagga---------tgg---gagacaag-actc-----tggaatttc
                      Megabat  gtcacg-tggtc-ctcaatgtcccagga---------tgg---gagacaag-actc-----tggaatttc
                Big brown bat  acccca-gggtt-cttaatgtcctggga---------tgg---gagacaag-actc-----cagagtttc
         David's myotis (bat)  gccccg-tggtt-cttaatgtcctggga---------tttcccaattcaagttctc-----cagaatttc
                     Microbat  gccccg-tggtt-cttaatgtcctggga---------tgg---gagacaag--atc-----cagaatttc
                     Hedgehog  g------------ttcaatgtcctgggc---------tga---aagacatg-tctc-----tggagcttt
                        Shrew  ggaatc-tggtcttttaatatactggaa---------tgg---gagagaaa-actcgataatagagtttc
              Star-nosed mole  gctaca-tggtc-cttggcgtcctgaga---------ctg---gagacaag-ac-------tagcgtttc
                     Elephant  gcgatgttattc-ctcaatgccccagga---------tgg---atgacagg-actc-----tggagtttc
          Cape elephant shrew  gctaca-cagtc-ctcagtatcccaaga---------tgg---gaaacaag-a--c-----tggagcttt
                      Manatee  gctaca-gactc-ttcaatgccccagga---------tgg---gagagaag-actc-----tggagtttc
             Cape golden mole  gctatt-ttgtt-ctg----tctcaaga---------tgg---gagacaag-actc-----c--agtttc
                       Tenrec  gctact-atgtc-ctg---------gta---------tgg---gagacgag-actc-----tggagtttt
                     Aardvark  gctacg-tagtc-ctcagtatcccaggg---------agg---gagacaag-actc-----tggagtttc
                    Armadillo  gttatg-tagtc-ctcaatgtgctggaa---------tgg---gagacaag-actc-----cagagtttc
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  cca----attcaagttccacaagctc-cttggacggggagattatttt-gtgct-gggcttcagatccga
                        Chimp  cca----attcaagttccacaagctc-cttggactgggggattatttt-gtgct-gggcttcagatccta
                      Gorilla  cca----attcaagttccacaagctc-cttggactgggggattatttt-gtgct-gggcttcagatctga
                    Orangutan  cca----attcaagttccacaagctc-cttggactgggggattatttt-gtgct-gggcttcagatccaa
                       Gibbon  tca----aatcaagttctacaagctc-cttggactgggggattatttt-gtgct-gggcttcagatccga
                       Rhesus  cca----gctgaagttccacaagctc-cttggactgggggattattct-gtgct-gggcttcagatccga
          Crab-eating macaque  cca----gctgaagttccacaagctc-cttggactgggggattattct-gtgct-gggcttcagatccga
                       Baboon  cca----gctgaagttccacaagctc-cttggactgggggattattct-gtgct-gggcttcagatccga
                 Green monkey  cca----gttgaagttccacaagctc-cttggactgggggattatttt-gtgct-gggcttcagatccga
                     Marmoset  cca----attcaagttccacaagttc-cttggactagaggattaattt-cttct-gggcttcagatctga
              Squirrel monkey  cca----attcaagttccacaagttt-cttggactagaggattaattt-ctgct-gggcttcagatctga
                     Bushbaby  cta----g-tcaagttccagtaggtc-cttgagctgaaggattatttt-gtgct-gggcttcagattgga
           Chinese tree shrew  cca----attcaagttgcaccaactc-cttggactggaggatcatttt-gtggt-gggctttagattcta
                     Squirrel  tca----gttcaaa-tccactggatc-cttggactggaggattatttt-gtgct-ggatttcagatccta
       Lesser Egyptian jerboa  cca----gttcaatttctactggctg-tctgggctgaaccagtatttt-gtgct-gagctttaga-----
                 Prairie vole  cca----actcaggttccagtggctctgttt---tagagggctatgtt-gtgct-ggccttcag------
              Chinese hamster  cca----attcaagttccagtggctctcttggtctaaagggctatttt-gagcc-ggccttcag------
               Golden hamster  cca----attcaagttccagttgctctctttgtcaagagggctatttt-gtgcc-agccttcag------
                        Mouse  tcaattcattcaagttccagtggctc-cctggtctggagggctatttt-gtgct-ggccttcag------
                          Rat  cca----attcaagttccagtggctt-cctggtctggagggctatttt-gtgct-ggccttaag------
               Naked mole-rat  cca----agtcgagtctcactggctt-tttgggcaggaggattatttt-acgct-gggcttcagatccta
                   Guinea pig  cca----agtcgagtaccactggcgt-tttgggctgaaggtttatttt-gtgct-gggcttcagagccta
                   Chinchilla  cca----agtcgagttccactggctt-tttgggctggagggttactct-gtagt-gggcttcagatcctg
             Brush-tailed rat  cca----agttgagtcccactggctc-tttgggctggaacgttatttt-gtact-cggcttcagatccta
                       Rabbit  cca----gtccatgctgcaccggctc--tcgggctggcagattattct-gtgctggaacttcagatccta
                         Pika  cca----gttcg--------------------------agtttatgct-------gaccttcagagcctg
                          Pig  cca----gttcaagtt-cacgaactc-cgtgggttggaggattatctt-gcgct-gggcttcagatcctc
                       Alpaca  cca----attcaagtt-cactagctc-catgggttggaggattatctt-gtgct-gggcttcagattctc
               Bactrian camel  cca----atgcaagtt-cactagctc-catgggttggaggattatctt-gtgct-gggcttcagattctc
                      Dolphin  cca----attcaagct-cactagctt-tgtgggttggaggatgatctt-gtgct-gggcttcagatcctc
                 Killer whale  cca----attcaagct-cactagctt-tgtgggttggaggatgatctt-gtgct-gggcttcagatcctc
             Tibetan antelope  cca----gttcaagtt-cattagctc-tgtgagttggaggattatctt-ctact-gggtttcagatcctc
                          Cow  cca----gttcaagtt-cattagctc-tgtgagttggaggattatctt-ctact-gggtttcagatcctc
                        Sheep  cca----gttcaagtt-cattagctc-tgtgagttggaagattatctt-ctact-gggtttcagatcctc
                Domestic goat  cca----gttcaagtt-cattagctc-tgtgaattggaggattatctt-ctact-gggtttcagatcctc
                        Horse  cca----attcaagttccactagctc-ctcgggttggag--ctatctt-gtact-gggcttcagatcctg
             White rhinoceros  cca----gttcaagttccactagctc-cttgggttggaggattatctt-gtgct-gggcttcagatcctg
                          Cat  cca----attcaagttccactggctc-cttgggctggaggattatttt-gcgct-gggcttcagatcctg
                          Dog  tga----attcaagtt-cactagctc-cttgggttggaggattatctt-gtgct-gggcttcagatcctg
                      Ferret   cga----attcaagttcctctagctt-cttgggctaggggattatctt-gcact-gggcttcagatcctg
                        Panda  caa----attcaaggtgcactagctc-cttgggctggaggattatctt-gcgct-gggcttcagatccta
               Pacific walrus  cga----attcaagttccactagctc-cttgggttggaggattatctt-gcact-gggcttcagatcctg
                 Weddell seal  tga----attcaagttccactagctc-cttgggttggaggattatctt-gcact-gggcttcagatcctg
             Black flying-fox  cca----attcgagttccactagatc-cttgggttggaggatt-ttct-gtgct-ggacttca-------
                      Megabat  cca----attcgagttccactagatc-cttgggttggaggatt-ttct-gtgct-ggacttca-------
                Big brown bat  cca----attcaagttctactagacc-cttgggttggattattatcct-gtgct-gggcttcagatgctg
         David's myotis (bat)  cca----attcaagttctactagatc-cttgggttggattattatcct-gtgct-gggcttcagatgctg
                     Microbat  cca----attcaagttctactagatc-cttgggttggattattaccct-gtgct-gggcttcagatgctg
                     Hedgehog  cca----attcaacttccactagtcc-cttgggttgaaagattatcta-gtaca-gggcttcagatcctt
                        Shrew  cca----attcaagttccactagttt-cttgggatggagtttttttttggtgtt-gggtttcagatcctg
              Star-nosed mole  cta----attc-----tcactagctc-ctggggttggaagattatctt-atgct-gggcttcagatcctg
                     Elephant  cca----agtt----tccattggcaa-cttgggctggaggattatttt-gtgat---------tatcctg
          Cape elephant shrew  taa----gtctaaggtccactgacaa-cttgggctagatgattatttt-atgtt-gggctccagagcctg
                      Manatee  cca----atccaagttctggtggcaa-cttggggtggaagattatttt-gtgtt-gggcttcagatcctg
             Cape golden mole  cca----atttaagttttactggcat-gttgagctggaggat---ttt-gtgtt-gagtttcagatcctg
                       Tenrec  ctc----atccaagttccactggcaa-cttgggctggaggat--gttt-gtctt-gggcttcaaatcttg
                     Aardvark  cca----atccaacttccattggcag-cttgagctggaggattatttt-ctgtt-gggcttccactcttg
                    Armadillo  cca----acgctagttctagcagctc-cttgggctagaggattatttt-gtgtt-gggcttaagaccttg
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  ggagccaggtctgtagattctgggagctagagtggagta-tatg----attcccagatgaagggccaggg
                        Chimp  ggagccaggtctgtagattctgggagctagagtggagta-tatg----attcccagatgaagggccaggg
                      Gorilla  ggagccaggtctgtagattctgggagctagagtggagta-tatg----attcccagatgaagggccaggg
                    Orangutan  ggagccaggtctgtagattctgggagctagagtggagta-tatg----attcccagatgaagggccaggg
                       Gibbon  ggagccaggaatgtagattctgggagctagagtggagta-tatg----attcccagatgaaaggccaggg
                       Rhesus  ggagccaggtctgtagattctgggagctagactggagta-tatg----attcccagatgaagggccaggg
          Crab-eating macaque  ggagccaggtctgtagattctgggagctagactggagta-tatg----attcccagatgaagggccaggg
                       Baboon  ggagccaggtctgtagattctgggagctagactggagta-tatg----attcccagatgaagggccaggg
                 Green monkey  ggagccagatctgtagattctgggagctagactggagta-tatg----attcccagatgaagggccaggg
                     Marmoset  ggagccaagtctgtagattctgggagctagactagagta-tatg----attccccgctgaaggatcaggg
              Squirrel monkey  ggagccaggtctgtagattctgggagctagactggagta-catg----attcccagctgaaggatccagg
                     Bushbaby  ggagccaggtctgtagattctgagtgctagactga---g-tatg----attccaagtttaagggtcaggg
           Chinese tree shrew  ggagccaggtcttcagattctgggagtgagtctggagt--catg----attcccagtttaagggccaggg
                     Squirrel  agagtcagttttgtatattctgggagctagaatggagt-ccagg----attcctggtttaaaagccaggg
       Lesser Egyptian jerboa  ----tcatgtctgaagatt--gggagatagactagag-----tg----aatcccagttcaagagccaggg
                 Prairie vole  ----tcaggtcagtaggttctgggtatgagcctgaagtatctta----agtcccaattgaagatcca-gg
              Chinese hamster  ----tcaggtcagtaggttctgggtgtgagactgaagtatcttg----agttccagttcaagatccaggg
               Golden hamster  ----tcaggtcagtgggttcagggtgtgagactgaagtatcttg----ag--------------------
                        Mouse  ----tcatgtcagtagattctgggtttgagattgaagtatcttg----tgtccaagttcaagatccaggg
                          Rat  ----tcatgtcagtaggttctgggtttgagatcgaagtatcttg----tgtccaagtttaaaatccatgg
               Naked mole-rat  tgagtcaggtttatagatc-tgggagctagactggagta-catg----attcccagtttaggagccagga
                   Guinea pig  tgagtcaggcctgtagatt-tgggagctaaacaggagaa-catg----attcccagtttaagagacagga
                   Chinchilla  tgagtcaggcctatagatc-tgggagctaga---gagta-catg----attcacagtttaagagacagga
             Brush-tailed rat  tgaatcaggcctgtagatc-tgggagccagataggagta-catg----attcttagtttaagagacagca
                       Rabbit  ggagctgggtctgtagatctgggaagctagatcggcatc-tacc----atgcccagtgtaagcaccaggg
                         Pika  ggagtcaggttcctagatctgagaagctagactgg--------------tgtctagtgtaagggccaggg
                          Pig  acaaccacatctggagattcagggagttaggctggagtg-tgtg----attcctgaattaagga-ccagg
                       Alpaca  gcaactacatctggagattaagggagctggactggagta-tatg----attactgatttaagga-ctggg
               Bactrian camel  gcaactacatctggagattaagggagctagactggagta-tatg----attactgatttaagga-ctggg
                      Dolphin  acaaccacatctggagattcaggaagctagactggagtg-tatg----attcctgatttaagga-ctggg
                 Killer whale  acaaccacatctggaggttcaggaagctagactggagtg-tata----attcctgatttaagga-ctggg
             Tibetan antelope  acaatcacatctggagattcagggagctagattggagtg-tatg----attcctgatttaagga-cagag
                          Cow  acaaccacatctggagattcagggagctagattggagtg-tatg----attcctgatttaagga-cagag
                        Sheep  acaatcacatctggagattcagggagctagattggagtg-tatg----attcctgatttaagga-cagac
                Domestic goat  acaatcacatctggagattcagggagctagactggagtg-tatg----attcctgatttaagga-cagag
                        Horse  ggagccaagtcgatagattctaggagctagactggagcg-tgtg----attcccaatttaaggaccagga
             White rhinoceros  ggagccaagtctatagattctaggagctagactggagc---atg----attcccaatttaaggaccagga
                          Cat  agagccaagtctacagattctgggagctagattggagta-tatg----atttccagtttagggaccagag
                          Dog  agagccaagtctatagattctgggagctagactggagtg-tatg----attcccactttagggaccagag
                      Ferret   agagccaagtctacagattctgggagctagactggagtg-tatg----attcccaatttaaggaccagag
                        Panda  agagccaagtctatagactctgggatctagattggagtg-tatg----cttcccaatttaaggaccagag
               Pacific walrus  agagccaagtctatagattctgggagctagattggagtg-tatg----attcccaatttaaggaccagag
                 Weddell seal  agagccaagtctatagattctgggagctagattggagtg-tgtg----attcccaatttaaggaccagag
             Black flying-fox  ---------------gattctgggagctagactggatca-tgtg----attcccaatttaagaaccagtg
                      Megabat  ---------------gattctgggagctagactggatca-tgtg----attcccaatttaagagccagtg
                Big brown bat  ggagccaagtgtacggattctagaaggtagattggagta-tgtg----attcccaatttaagcaccagag
         David's myotis (bat)  ggagtcaagtgta--gattctagaagctagattggagta-tgtg----attcccaatttaagcaccagag
                     Microbat  ggagtcaagtgta--gattctagaagctagattggagta-tgtg----attcccaatttaagcaccagag
                     Hedgehog  ggagccaagtctatagattttgggagctagattggagc---atg----attcccaatcaaagaaccaggg
                        Shrew  ggagtcaaacctacagattttgggaggcagagtggagca-tatg----atttccaatttaaggactgcag
              Star-nosed mole  ggagtcaagtctatagattctgagagttagaaaggagca-catg----cttcccaattgaagggcca---
                     Elephant  ggagccagatctgtagattctgggagctatattggagtg-tatg----attcccaatttaaggaccaagg
          Cape elephant shrew  ggagcaaagtctatagattctgggaaa-acactcaagtg-tatatagtgatcccaatatagggatcaagg
                      Manatee  ggaggcaggtctgtagattctgggagctatactggagta-tatg----attcccaatttaaggaccgagg
             Cape golden mole  ggagccaggtctgtagattctgggaa-tatactagagtg-tatg----attctcaatttaaggaccaggg
                       Tenrec  gcagccaagtctcaagattctgggaactacattgaagta-tatg----atttccaatttaagggccaggg
                     Aardvark  ggagccaggtctgtagattctgcgaactgtaccggagta-tatg----attcccagtttaaggaccaatg
                    Armadillo  agaaccaggtctgttgg-cctgggaactagattggagtg-tatg----attcccaatttaaggaccaggc
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  gacctttgtgtacttgagggatca--------tctccaa-cccccaggag--g
                        Chimp  gacctttgtgtacttgagggatca--------tctccaa-cccccaggag--g
                      Gorilla  gacctttgtgtacttgagggatca--------tctccaa-cccccaggag--g
                    Orangutan  gacctttgcgtacttgagggatca--------tctccaa-cccccaggag--g
                       Gibbon  gaactttgtgtacttgagggatca--------tctccaa-cccccaggag--g
                       Rhesus  gacctttgtgtacttgagggatca--------tctccaa-ccccc---ag--g
          Crab-eating macaque  gacttttgtgtacttgagggatca--------tctccaa-ccccc---ag--g
                       Baboon  gacctttgtgtacttgagggatca--------tctccaa-ccccc---ag--g
                 Green monkey  gacctttgtgtacttgagggatca--------tctccaa-ccccc---ag--g
                     Marmoset  gacctttgtgtacttgagggatca--------tctccaa-cccccaagag--g
              Squirrel monkey  gacctttgtgtacttacgggatca--------tctccaa-cccccaagag--g
                     Bushbaby  gacctctgtggacatgagggatca--------ttcccaa-gccccaggag--g
           Chinese tree shrew  gaccttcatggacatgagggatca--------tccctaa--ctccaggag--g
                     Squirrel  gacctttgtgaacattagggatca--------ttcccaa-accccaggag--g
       Lesser Egyptian jerboa  aactt--agggacatgagggatca--------actctaa-cccaggag-----
                 Prairie vole  gacctttgtggacatgagggatca--------atctcaa-tcctcaagag--g
              Chinese hamster  gacctttgtggacatgagggatca--------atcccta-ccctcaagag--g
               Golden hamster  -----------------------------------------------------
                        Mouse  gaccc---------tgagggatca--------atcccaa-ccctcaagag--g
                          Rat  gaccc---------tgagggatca--------atcccaa-ccctcgagag--g
               Naked mole-rat  gacctttgtggacataaaggagc---------atctcag-tgctcagaag--g
                   Guinea pig  gatcttcatggacataaaggatc---------atcttga-agcttagaag--a
                   Chinchilla  gatctttgtgaacacaaaagatc---------atctgga-tgctcagaag--g
             Brush-tailed rat  gatcttcatggatataaaga------------atcttga-tgctcagaag--g
                       Rabbit  taccctggtgaacccgaaggatca--------tccccaa-ccctca-------
                         Pika  taccctggtagacccaaaggatca--------tccgcag-cccccatgag--g
                          Pig  aacctttgtggacatgagggatca--------cccccaa-ggcccaggag--g
                       Alpaca  gacctttgtggacatgagagatca--------cccccaa-cacccaggag--g
               Bactrian camel  gacctttgtggacatgagagatca--------cccccaa-tacccaggag--a
                      Dolphin  gatctttgtggacatgaagaatca--------cccctga-cgcccatgag--g
                 Killer whale  gatctttgtggacatgaagaatca--------cccctga-cgcccatgag--g
             Tibetan antelope  gacctttgtggacatgagggatca--------cccctga-tgcccaggag--g
                          Cow  gacctttgtggacatgagggatca--------cccctga-tgcctaggag--g
                        Sheep  gacctttgtggacttgagggatca--------cccctga-tgcctaggag--g
                Domestic goat  gacctttgtggacatgagggatca--------tccctga-tgcctaggag--g
                        Horse  gaccttcgtaaacatgagggatca--------cccccct-cctccaggaa--g
             White rhinoceros  gacctttgtaaacatgacagatca--------ctcccaa-tccccaggag--g
                          Cat  gacctttgtggatataagggatca--------actccag-ccctcaagag--g
                          Dog  gacctatgtggacataagggatag--------tccccag-cgctcaggag--g
                      Ferret   gacctatgtgggcatgagggatca--------tccccag-ccctctggag--g
                        Panda  gacttttgtggacatgagggattg--------cctctgg-ccctcaggag--g
               Pacific walrus  gacctttgtggacatgagggatcg--------ctcccag-ccctcaggag--g
                 Weddell seal  gacctttgtggacatgagggatcg--------ctcccag-ccctcaggag--g
             Black flying-fox  gaactttgtggacatgagggatca--------tccccaa-cccccaagag--g
                      Megabat  gaactttgtggacatgagggatca--------tccccaa-cccccaagag--g
                Big brown bat  gaccactgtggcca-gagggat-------------ctta-cccgcaggag--g
         David's myotis (bat)  gaccattgtggcca-gagggatca--------cccctta-cccccaggag--g
                     Microbat  gaccattgtggcca-gagggatga--------cccctca-cccccaggag--g
                     Hedgehog  gatctttgtggacatgagggacca--------ctcaaaa--acctctgag--g
                        Shrew  ta-ccctgtaggtaggagggactg--------cccccaa--gcccagggg--g
              Star-nosed mole  ---------ggaaatgagggacaa--------tcccaag--ccctaggag--g
                     Elephant  gacctttatggacccgagggatca--------tccccaa-cccccaggag--g
          Cape elephant shrew  tagccctgt-gatctgaagaatcg--------catcaaa-ctcctagaag--a
                      Manatee  gacctttgtggactcaagggatca--------tctccag-cccccaggag--g
             Cape golden mole  gacc-ttgtgggtctcagaaatca--------cccctaa-cccccagaagagt
                       Tenrec  gacctttgtgaaactgagagagca--------cccccag-tccccaggag---
                     Aardvark  gaactttgtggatctaagggatca--------ccttcaaccccccgggag--g
                    Armadillo  aacttttgtggacatgagggatcacctcctctcctcctg-tccccacagg---
                   Coelacanth  =====================================================
                X. tropicalis  =====================================================
                 Atlantic cod  =====================================================
                  Spotted gar  =====================================================
                  Stickleback  =====================================================
           Southern platyfish  =====================================================
       Yellowbelly pufferfish  =====================================================
                         Fugu  =====================================================
                    Tetraodon  =====================================================
                       Turkey  =====================================================
                      Chicken  =====================================================
                 Mallard duck  =====================================================
           Tibetan ground jay  =====================================================
                  Zebra finch  =====================================================
       White-throated sparrow  =====================================================
              Tasmanian devil  =====================================================
     Mexican tetra (cavefish)  =====================================================
                    Zebrafish  =====================================================
                       Medaka  =====================================================
          Pundamilia nyererei  =====================================================
                  Zebra mbuna  =====================================================
        Burton's mouthbreeder  =====================================================
          Princess of Burundi  =====================================================
                 Nile tilapia  =====================================================
               Painted turtle  =====================================================
              Green seaturtle  =====================================================
           American alligator  =====================================================
                   Budgerigar  =====================================================
                      Opossum  -----------------------------------------------------
                  Rock pigeon  =====================================================
          Collared flycatcher  =====================================================
          Medium ground finch  =====================================================
                       Lizard  =====================================================
             Peregrine falcon  =====================================================
                 Saker falcon  =====================================================
                     Platypus  =====================================================
     Chinese softshell turtle  =====================================================

Inserts between block 9 and 10 in window
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 3bp
                Prairie vole 189bp
B D          Chinese hamster 112bp
B D                    Mouse 7bp
B D                      Rat 169bp
B D           Naked mole-rat 1bp

Alignment block 10 of 435 in window, 46608812 - 46608812, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                      Pika  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  t
B D                     Shrew  g
              Star-nosed mole  c
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  t
                     Aardvark  c
B D                       Rat  =
                Prairie vole  =
              Golden hamster  -
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                Guinea pig  -
B D                    Rabbit  -
B D                Coelacanth  =
B D             X. tropicalis  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  -
B D            Naked mole-rat  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
            Brush-tailed rat  -
                  Chinchilla  -
B D                  Platypus  =
B D           Chinese hamster  =
B D                    Tenrec  -
  D  Chinese softshell turtle  =
B D                  Squirrel  =
B D                 Armadillo  -

Alignment block 11 of 435 in window, 46608813 - 46608817, 5 bps 
B D                     Human  cacgt
B D                     Chimp  cacct
B D                   Gorilla  cacct
B D                 Orangutan  cacct
B D                    Gibbon  cacct
B D                    Rhesus  tacct
B D       Crab-eating macaque  tacct
B D                    Baboon  tacct
B D              Green monkey  tacct
B D                  Marmoset  tacct
B D           Squirrel monkey  tacct
B D                  Bushbaby  tgtct
           Chinese tree shrew  tgtct
B D                  Squirrel  actct
       Lesser Egyptian jerboa  --cct
B D           Chinese hamster  --cat
B D                     Mouse  --tat
B D                       Rat  --gag
B D            Naked mole-rat  tccct
B D                Guinea pig  --ctt
                   Chinchilla  --cct
             Brush-tailed rat  --cct
B D                      Pika  --agt
B D                       Pig  tgtct
B D                    Alpaca  tgtct
               Bactrian camel  tgtct
B D                   Dolphin  tatct
                 Killer whale  tatct
             Tibetan antelope  tgtct
B D                       Cow  tgtct
B D                     Sheep  tgtct
                Domestic goat  tgtct
B D                     Horse  tgcct
B D          White rhinoceros  tgtct
B D                       Cat  tgtct
B D                       Dog  tgtct
B D                   Ferret   tgtct
B D                     Panda  tgtct
               Pacific walrus  tgtct
                 Weddell seal  tgtct
             Black flying-fox  tgtct
B D                   Megabat  tgtct
                Big brown bat  tgtct
         David's myotis (bat)  tgtct
B D                  Microbat  tggct
B D                  Hedgehog  taatt
B D                     Shrew  tct--
              Star-nosed mole  tctcc
B D                  Elephant  tgttt
          Cape elephant shrew  aattt
B D                   Manatee  tgctt
             Cape golden mole  tattt
B D                    Tenrec  ---tt
                     Aardvark  tgttt
B D                 Armadillo  tggtt
                Prairie vole  =====
              Golden hamster  -----
B D                    Rabbit  -----
B D                Coelacanth  =====
B D             X. tropicalis  =====
B D              Atlantic cod  =====
                 Spotted gar  =====
B D               Stickleback  =====
          Southern platyfish  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
B D                 Tetraodon  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
  D    White-throated sparrow  =====
B D           Tasmanian devil  =====
    Mexican tetra (cavefish)  =====
B D                 Zebrafish  =====
B D                    Medaka  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D              Nile tilapia  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D        American alligator  =====
B D                Budgerigar  =====
B D                   Opossum  -----
  D               Rock pigeon  =====
  D       Collared flycatcher  =====
B D       Medium ground finch  =====
B D                    Lizard  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
B D                  Platypus  =====
  D  Chinese softshell turtle  =====

Inserts between block 11 and 12 in window
B D          Chinese hamster 2bp
B D                    Mouse 198bp
B D                      Rat 5bp
B D                     Pika 2bp

Alignment block 12 of 435 in window, 46608818 - 46608823, 6 bps 
B D                     Human  ataata
B D                     Chimp  ataata
B D                   Gorilla  ataata
B D                 Orangutan  ataata
B D                    Gibbon  ataata
B D                    Rhesus  ataata
B D       Crab-eating macaque  ataata
B D                    Baboon  ataata
B D              Green monkey  ataata
B D                  Marmoset  agaata
B D           Squirrel monkey  agaatt
B D                  Bushbaby  ataat-
           Chinese tree shrew  agaat-
B D                  Squirrel  attat-
       Lesser Egyptian jerboa  atcata
B D           Chinese hamster  atgatg
B D                     Mouse  atgata
B D                       Rat  atgata
B D            Naked mole-rat  gttgcc
B D                Guinea pig  attata
                   Chinchilla  gttatg
             Brush-tailed rat  gtcaag
B D                    Rabbit  ----g-
B D                      Pika  agagt-
B D                       Pig  ctaat-
B D                    Alpaca  ttaac-
               Bactrian camel  ttaac-
B D                   Dolphin  ataat-
                 Killer whale  ataat-
             Tibetan antelope  ataac-
B D                       Cow  ataac-
B D                     Sheep  ataac-
                Domestic goat  ttaac-
B D                     Horse  ccaat-
B D          White rhinoceros  ataat-
B D                       Cat  ataat-
B D                       Dog  ataat-
B D                   Ferret   ataat-
B D                     Panda  ataat-
               Pacific walrus  ataat-
                 Weddell seal  ataat-
             Black flying-fox  ataat-
B D                   Megabat  ataat-
                Big brown bat  ataat-
         David's myotis (bat)  ataat-
B D                  Microbat  ataat-
B D                  Hedgehog  atcac-
              Star-nosed mole  ataat-
B D                  Elephant  ataat-
          Cape elephant shrew  gtaat-
B D                   Manatee  ataat-
             Cape golden mole  ataag-
B D                    Tenrec  ataat-
                     Aardvark  ataat-
B D                 Armadillo  aaaaa-
                Prairie vole  ======
              Golden hamster  ------
B D                     Shrew  ------
B D                Coelacanth  ======
B D             X. tropicalis  ======
B D              Atlantic cod  ======
                 Spotted gar  ======
B D               Stickleback  ======
          Southern platyfish  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
B D                 Tetraodon  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
  D    White-throated sparrow  ======
B D           Tasmanian devil  ======
    Mexican tetra (cavefish)  ======
B D                 Zebrafish  ======
B D                    Medaka  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D        American alligator  ======
B D                Budgerigar  ======
B D                   Opossum  ------
  D               Rock pigeon  ======
  D       Collared flycatcher  ======
B D       Medium ground finch  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
B D                  Platypus  ======
  D  Chinese softshell turtle  ======

Inserts between block 12 and 13 in window
B D          Chinese hamster 49bp
B D                    Mouse 1bp
B D                      Rat 1bp

Alignment block 13 of 435 in window, 46608824 - 46608868, 45 bps 
B D                     Human  caggccttcttggag-gcagagggatgagtaaaatgtcagctca-t-g
B D                     Chimp  caggccttcttggag-gcagagggatgagtaaaatgtcagctca-c-g
B D                   Gorilla  caggccttcttggag-gcagagggatgagtaaaatgtcagctca-t-g
B D                 Orangutan  caggccttcttggag-gcagagggatgagtaaaatgtcagctca-t-g
B D                    Gibbon  caggccttcttggag-gcagcgggatgagtaaaatgtcagctca-t-g
B D                    Rhesus  caggccttcttggag-gcagagggatgagtataatgtcagctta-t-g
B D       Crab-eating macaque  caggccttcttggag-gcagagggatgagtataatgtcagctta-t-g
B D                    Baboon  taggccttcttggag-gcagagggatgagtataatgtcagctca-t-g
B D              Green monkey  caggccttcttggag-gcagagggatgagtataatgtcagctca-t-a
B D                  Marmoset  caggccttcttggag-gcagagggaagagtaaaatggcagctcg-t-g
B D           Squirrel monkey  caggccttcttgggg-gcagagggatgagtaaaatggcagctcg-t-g
B D                  Bushbaby  caggtcctcctagag-acaaagagatgaatgaaatgacagctct-t-g
           Chinese tree shrew  ctggctctcctggag-gcagagggatgatggaaataacagctct-g-g
B D                  Squirrel  cagggctttctggaa-acatg---------------------------
       Lesser Egyptian jerboa  -aggcctgcctagag-gcagagagatgagtgaaatgacaagtca-t-g
                 Prairie vole  cagaccctcctggaa-gcagaaagatgagtgacataacaatttg-t-g
B D           Chinese hamster  caggccctcctggaa-gcagagagatgagtgaaataacaattca-t-g
               Golden hamster  ----------------------------------ttccagttca-a-g
B D                     Mouse  caggccctgctagag-gcag--agatgagtgaactaacaatcca-t-a
B D                       Rat  caggcccttctggag-gcag--agatgagtgaattgacaattca-t-a
B D            Naked mole-rat  -agggcctcctagat-acag--ggatgaatgaaatgacagctcg-t-t
B D                Guinea pig  -gggctcccctagag-acag--ggatgagtgaaatgacagattgtt-t
                   Chinchilla  -gggtgcttctagag-acaa--gcaggagtgaaatgacagcttg-t-t
             Brush-tailed rat  -gggccctcctagag----a--gaaggagtgaaatgacagcttg-t-t
B D                    Rabbit  ctggccctcctgaag-gcagagggatgaatgaaatgatagctca-g-g
B D                      Pika  cagccccttctgaaa-acatagggatgaatgaaaaaatggccca-g-g
B D                       Pig  cagaccttcctggag-gcagaggggtgagagaaatgacagctta-t-g
B D                    Alpaca  caggccttcctggag-gcagacggatgagtgaaatgacagttca-t-g
               Bactrian camel  caggccttcctggag-gcagacggatgagtgaaatgacagttca-t-g
B D                   Dolphin  caggcctt-ctggag-gcagagggatgggggaaatgacagctcc-t-g
                 Killer whale  caggcctt-ctggag-gcagagggatgggggaaatgacagctcc-t-g
             Tibetan antelope  caggccttcctggag-gcagagggatgagggaaatgacagcaca-t-g
B D                       Cow  caggccttcctggag-gcagagggatgagggaaatgatagcgca-a-g
B D                     Sheep  caggccttcctggag-gcagaggaatgagggagatgacagcgca-t-g
                Domestic goat  caggccttcctggag-gcagagggatgagggaaatgacagcgca-t-g
B D                     Horse  caggccttcctagag-gcagagggatgagtgaaatgacagctga-t-g
B D          White rhinoceros  caagccttcctacag-gcagagggatgagtgaaaggatagctga-t-g
B D                       Cat  caggctttcccggag-gcagagcgatgagtgaaatgatagttcc-t-g
B D                       Dog  caaactttcctggag-gcagaaggatgagtgaaatgacagctcc-t-g
B D                   Ferret   caggctttcctggag-gcaaaggggtgagtaaaataacagttcc-t-g
B D                     Panda  caggc-ttcctggag-gcagagggatgagtgaaatgacagctcc-t-g
               Pacific walrus  caggctttcctagag-gcagagggatgagtgaaatgacagttcc-t-g
                 Weddell seal  caggctttcctagag-gcagagggatgagtgaaatgacagttcc-t-g
             Black flying-fox  caggctttcctggag-gcagaggaacgagttaaatgacagcaaa-c-g
B D                   Megabat  caggctttcctggag-gcagaggaacgagttaaatgacagcaaa-c-g
                Big brown bat  caggcctttctggag-gcaaaggactgagtgaaatgacagctga-t-g
         David's myotis (bat)  caggcctttctggag-gcagagggctgagtgaaatgctagttgt-t-g
B D                  Microbat  caggcc-ttctggag-gcagagggctgagtgaaatgctagttgt-t-g
B D                  Hedgehog  caagccttccttgag-gcagaaggataagtggaatggcagctca-t-a
B D                     Shrew  ------ttcc---ac-ggagagagcagtgtgaaatgacagctct-t-g
              Star-nosed mole  caggccttcctggag-gcagaaggaggagtgaaatgacagctca-t-a
B D                  Elephant  caggacttcctggag-acagagggatgaataaaatgaaagctca-t-g
          Cape elephant shrew  caggccttcctgaggcaaagaaggatgagtgaaatgaaagctta-t-g
B D                   Manatee  ccggccttcctggag-gcagagggatgagtaaaatgaaagctca-t-g
             Cape golden mole  caggccttcccggag-gcagaggt---------atgaaagctca-t-g
B D                    Tenrec  caggagtccctagag-gcaaaaggatgggtgaaatgaaagcttg-t-g
                     Aardvark  caggtcttcctgaaa-gcagcaggctgagtgtaatgaaagttca-t-a
B D                 Armadillo  caggccttcaaggag-gcagaggaatgagtaaagtgacattttt-tgg
B D                Coelacanth  ================================================
B D             X. tropicalis  ================================================
B D              Atlantic cod  ================================================
                 Spotted gar  ================================================
B D               Stickleback  ================================================
          Southern platyfish  ================================================
      Yellowbelly pufferfish  ================================================
B D                      Fugu  ================================================
B D                 Tetraodon  ================================================
B D                    Turkey  ================================================
B D                   Chicken  ================================================
  D              Mallard duck  ================================================
          Tibetan ground jay  ================================================
B D               Zebra finch  ================================================
  D    White-throated sparrow  ================================================
B D           Tasmanian devil  ================================================
    Mexican tetra (cavefish)  ================================================
B D                 Zebrafish  ================================================
B D                    Medaka  ================================================
         Pundamilia nyererei  ================================================
                 Zebra mbuna  ================================================
       Burton's mouthbreeder  ================================================
         Princess of Burundi  ================================================
B D              Nile tilapia  ================================================
  D            Painted turtle  ================================================
  D           Green seaturtle  ================================================
B D        American alligator  ================================================
B D                Budgerigar  ================================================
B D                   Opossum  ------------------------------------------------
  D               Rock pigeon  ================================================
  D       Collared flycatcher  ================================================
B D       Medium ground finch  ================================================
B D                    Lizard  ================================================
  D          Peregrine falcon  ================================================
  D              Saker falcon  ================================================
B D                  Platypus  ================================================
  D  Chinese softshell turtle  ================================================

Alignment block 14 of 435 in window, 46608869 - 46608977, 109 bps 
B D                     Human  gg-catctctgggtaagagaat-------------------cag-agcctg-tg----------------
B D                     Chimp  gg-catctctgggtaagagaat-------------------cag-agcctg-tg----------------
B D                   Gorilla  gg-catctctgggtaagagaat-------------------cag-agcctg-tg----------------
B D                 Orangutan  gg-catctctgggtaagagaat-------------------cag-agcctg-tg----------------
B D                    Gibbon  gg-catctctgggtaagagaat-------------------cag-agcctg-tg----------------
B D                    Rhesus  gg-catctgtgggtaagagaat-------------------cag-agcctg-tg----------------
B D       Crab-eating macaque  gg-catctgtgggtaagagaat-------------------cag-agcctg-tg----------------
B D                    Baboon  gg-catctgtgggtaagagaat-------------------cag-agcctg-tg----------------
B D              Green monkey  gg-catctctgggtaagagaat-------------------cgg-agcctg-tg----------------
B D                  Marmoset  ggccatctttggatgagaaaat-------------------cag-agcctg-tg----------------
B D           Squirrel monkey  ggccatctctgggtgagaaaat-------------------cag-agcctg-tg----------------
B D                  Bushbaby  gg-catctctggctgagcaatt-------------------cag-aacctg-tg----------------
           Chinese tree shrew  gg-catctctggctgagcaaat-------------------cag-aatctg-tg----------------
B D                  Squirrel  gg-catccctgaccgagcaaat-------------------cag-aaccca-ca----------------
       Lesser Egyptian jerboa  ag-cattcttggctgagcaaat-------------------cagaacccca-ca----------------
                 Prairie vole  ga-catccttggctgagcaaat-------------------cag---ccca-ca----------------
B D           Chinese hamster  ga-catccttggctgagtaaat-------------------cag---ccca-ca----------------
B D                     Mouse  ga-catccttggctgggcaaat-------------------cag---ccca-ca----------------
B D                       Rat  ga-catccttggctgagcaaat-------------------cag----cca-ca----------------
B D            Naked mole-rat  gg-catccccggctgagcaaat-------------------cag-aactga-ca----------------
B D                Guinea pig  ag-catccttggctgaaaaaat-------------------cag-aaa----------------------
                   Chinchilla  gg-agtccctggctgagcaaat-------------------cag-aaatga-ca----------------
             Brush-tailed rat  gg-catctctggctcagcaaat-------------------cag-caacga-ca----------------
B D                    Rabbit  gg-catctctggctgaaccaat-------------------cag-aacctg-cg----------------
B D                      Pika  gg-cacctctggctgaacaaat-------------------cag-aacc---------------------
B D                       Pig  ag-catctctgactgagcaaat-------------------cag-aacctg-cg----------------
B D                    Alpaca  gg-catccctggctgagcaaat-------------------cag-aacctg-tg----------------
               Bactrian camel  gg-catctctggctgagcaaat-------------------cag-aacctg-tg----------------
B D                   Dolphin  gg-catctctagctgagcaaat-------------------cag-aac----------------------
                 Killer whale  gg-catctctagctgagcaaat-------------------cag-aac----------------------
             Tibetan antelope  ag-catccctggctgagcaaat-------------------ccg-aacctg-tg----------------
B D                       Cow  ag-cttctctggctgagcaaat-------------------ccg-aacctg-tg----------------
B D                     Sheep  ag-catctctggctgagcaaat-------------------ccg-aacctg-tg----------------
                Domestic goat  ag-catctctggctgagcaaat-------------------ccg-aacctg-tg----------------
B D                     Horse  gg-cacatctggctgagcgaat-------------------cag-aacctg-tgtgcaaatcagaacctg
B D          White rhinoceros  ag-catttccggctgagcaaat-------------------cag-aacctg-tg----------------
B D                       Cat  gg-tatctttggctgagcaagt-------------------cag-aacgtg-tg----------------
B D                       Dog  gg-catctccgggtgagcaaat-------------------cag-aatctc-tg----------------
B D                   Ferret   gg-catctctggctaagcagat-------------------cag-aacctc-tg----------------
B D                     Panda  gg-catctctggctgagcaaat-------------------cag-aacctg-tg----------------
               Pacific walrus  gg-catctctggctgagcagat-------------------cag-aacctg-tg----------------
                 Weddell seal  gg-catctctggctgagcagat-------------------cag-aacctg-tg----------------
             Black flying-fox  gg-catctctggctgagca-at-------------------cag-aacctg-tg----------------
B D                   Megabat  gg-catctctggctgagca-at-------------------cag-aacctg-tg----------------
                Big brown bat  gg-catctctggctgagca-at-------------------cag-aacctg-tg----------------
         David's myotis (bat)  gg-catccctggctgagca-at-------------------cag-aacctg-tg----------------
B D                  Microbat  gg-catccccggctgagca-at-------------------cag-aacctg-tg----------------
B D                  Hedgehog  gg-catctctggctgagcagag-------------------tgg-aagctg-tg----------------
B D                     Shrew  gg-cttttctgtctgagcacaacaa----------------tag-aacatg-ta----------------
              Star-nosed mole  cc-catctctggccgagcaaatcagaactggccgagcaaatcag-aacttg-tg----------------
B D                  Elephant  aa-catctctggttgagaaaat-------------------cag-aacctg-tg----------------
          Cape elephant shrew  aa-catttctgactgagacaat-------------------cag-aagctg-tg----------------
B D                   Manatee  aa-catctctggctgagaaaat-------------------cac-agcctg-tg----------------
             Cape golden mole  aa-catctctggctgagaaaat-------------------ctg-aatctgttg----------------
B D                    Tenrec  aa-cctctctggctgggaaaat-------------------cag-aacctg-tg----------------
                     Aardvark  aa-catctctgactgagaaaat-------------------cag-aacctg-tg----------------
B D                 Armadillo  gg-catctctggctgagcaaat-------------------cag-aacctg-tg----------------
              Golden hamster  ----------------------------------------------------------------------
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ----------------------------------------------------------------------
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Platypus  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  --t----ctgcagtgggtc--gg--tttaggaactcaaggcaaggct-cctc--ttc---ctacgt-t-c
                        Chimp  --t----ctgcagtgggtc--gg--tttaggaactcaaggcaaggct-cctc--ttc---ctacct-t-c
                      Gorilla  --t----ctgcagtgggtc--gg--tttaggaactcaaggcaaggct-cctc--ttc---ctacct-tcc
                    Orangutan  --t----ctgcagtgggtc--gg--tttaggaactcaaggcaaggct-cctc--ttc---ctacct-t-c
                       Gibbon  --t----ctggggtgggtc--gg--tttaggaactcaaggcaaggct-tctc--ttc---ctacct-t-c
                       Rhesus  --g----ctgtggtgggtcaggg--tttaggaactcaaggcaaggct-cctc--ttc---ctacct-t-c
          Crab-eating macaque  --g----ctgtggtgggtcaggg--tttaggaactcaaggcaaggct-cctc--ttc---ctacct-t-c
                       Baboon  --g----ctgtggtgggtcaggg--tttaggaactcaaggcaaggct-cctc--ttc---ctacct-t-c
                 Green monkey  --t----ctgcggtgggtcaggg--tttaggaactcaaggcaaggct-cctc--ttc---ctgcct-t-c
                     Marmoset  --t----ctgtggtgggtcaggg--tttaggaactcaaggcaaggct-ccac--ttc---ctacct-g--
              Squirrel monkey  --t----ctgcggtgggtcgggg--tttaagaactcaaggcaaggct-ccac--ttc---ctacct-g--
                     Bushbaby  --t----ctgc-----------------aggaagtcaggaaaaggttccccc--ctc---ccacct-c-c
           Chinese tree shrew  --t----ctgcagtggacagggc--tttagaaacttggggtggggct-cccc--gttaaactaccc-c--
                     Squirrel  --t----ctgtggtgggccaggggattaaggaactcaggctaagctt-cccc--ctt---ccaatc-t-c
       Lesser Egyptian jerboa  --t-----ag---tatgtcaggg--ttaaggaactcagggtcaggca-cccc--ctt---ccaatt-g-c
                 Prairie vole  --t-----ggtggtaggtcatgagtttaaggaattcagggcaaagct-gaac--ttt---ctagcc-t-c
              Chinese hamster  --t-----ggtgataggtcagggatttaaggaacttggggcaaagtt-gcac--ttt---ctaacc-t-c
                        Mouse  --t-----ggtgataggtcagaggtttaaggaactcagggcaaagct-gcac--tgt---ctaacc-t-c
                          Rat  --t-----ggtggtaggtcagagatctaatgaactcagggcaaagct-gcat--tgt---ctaacc-t-c
               Naked mole-rat  --g----ctgtggtgggccagggctttaaggaactcaggtaaaatct-cccc--ttt---ccaact-t-c
                   Guinea pig  --------tgtggttggcctgggctttaaggaactcaggtaaag-ct-cccc--ttt---ccaact-t-c
                   Chinchilla  --g----ctgtggtaggccagggctttaaggaactcaggtaaagtgt-cccc--ttt---acaact-t-c
             Brush-tailed rat  --g----ctgtgatgagccagggctttaaggaactcaggtaatatct-ctcc--ttt---tcaact-t-c
                       Rabbit  --t----ctgtggtag------------------tcaggcaagacgc-cctc--ttc---ttagct-t-c
                         Pika  --t----ctgtggtgg------------------tcagaacaggctc-cc-c--ctc---ttagct-t-g
                          Pig  --g----ctatggtgggccaggca-cctaggtcttcagggcaggggt-cccc--ttc---ctacct-c-c
                       Alpaca  --c----ctgagatgagccagggc-ttaaggtactcagggcagagtc-cccc--ttc---ctacct-c-c
               Bactrian camel  --c----ctgagatgggccagggc-ttaaggtactcagggcagagtc-cccc--ttc---ctacct-c-c
                      Dolphin  -------ctatggtgggccaggat-tttag----tcagggcagggtc-cccc--ttc---ctacctcc-c
                 Killer whale  -------ctatggtgggccaggat-tttag----tcagggcagggcc-cccc--ttc---ctacct-c-c
             Tibetan antelope  --t----ctatggtgggccaggat-tttaagtactcaggataggg-g-cccc--ttc---ctacct-c-c
                          Cow  --t----ctatggtgggccaggat-tttaaatactcaggatagggct-cccc--ttc---ctacct-c-c
                        Sheep  --t----ctatggtgggccaggat-tttaagtgctcaggatagggct-cccc--ttc---ctacct-c-c
                Domestic goat  --t----ctatggtgggccaggat-tttaagtactcaggatagggct-cccc--ttc---ctacct-c-c
                        Horse  tat----ctgtggtgggccagggg-tttaggtacccaaggcaaggct-cccc--ttc---ctgctt-g-c
             White rhinoceros  --a----ctgtggtgggccagggg-tttaggtacccagggcaaggct-cccc--ttc---ctacct-c-c
                          Cat  --t----ccgtggtgggccagggg-tgtaggtatccagggcaagacc--ccc--tcc---ttacct-c-c
                          Dog  --t----ctgtggggggccaagga-tttaggtgctcagggcaagact--ccc--ttc---ttatgt-t-c
                      Ferret   --t----ctgtagggggccaaggg-tttaggtactcagggcaggact--cct--ttc---ttacat-c-c
                        Panda  --t----ctgtggtgggccaaggg-tttaggtactcaaggcaagact--ccc--ttc---ttctgt-c-c
               Pacific walrus  --t----ctgtggtgggccaaggg-tttaggtactcagggcaagagt--ccc--ttc---ttaagt-c-c
                 Weddell seal  --t----ctgtggtgggccaaggg-tttaggtactcagggt--gact--ccc--ttc---ttaagt-c-c
             Black flying-fox  --t----ctgtggtggactatggc-tttaggtacctaggatgaggat-cctc--ttc---ctacct-c-t
                      Megabat  --t----ctgtggtggactatggc-tttaggtacctaggatgaggat-cctc--ttc---ctacct-c-t
                Big brown bat  --t----ctgtggtgggccaggga-tttaggtactcagggcaatggt-cctc--ttc---ctatct-c-c
         David's myotis (bat)  --t----ctgtggtgggccaggga-tttaggtacccagggcaatgct--cct--ttc---ttacct-c-c
                     Microbat  --t----ctgtggtgggccaggga-tttaggtacccagggcaatgct-cccc--ttc---ctacct-c-c
                     Hedgehog  --ttcacctatggtgggtcaagag-tttaagtactttgggaaaggct-cttc--ttc---ctacct-c-a
                        Shrew  --t----ctattgtgagccaaggg-gttaagtactta-ggcaatact-cccccatcc---caccct-c-a
              Star-nosed mole  --t----ctgc--tgggccagagg-tttaattactcatggcaaggct-ccccttttg---ctacct-c-a
                     Elephant  --t----ctgtagtgggccagagg-tttaggta-tcagggcaaggct-ccac--ttc---c------t--
          Cape elephant shrew  --t----ctacagtgagccaggga-cttaggtattcagaatcaggct-ccat--ttc---c------c--
                      Manatee  --t----ctgtagagggccagggg-tttaggtcctcagggcaaggct-ccac--ctt---t------c--
             Cape golden mole  --t----ctgtagtaggtcaaggg-tttaagtactcagtacaaaact-ccac--ctt---c------c-t
                       Tenrec  --t----tcacagt-ggccagcag-gttagacactcagggcaaggct-ctac--ctg---c------c--
                     Aardvark  --t----ctgtggtgggccagagg-tttaggtactcagggcaaggct-ctac--ctc---c------c--
                    Armadillo  --t----ctgcaaagggcc---------aggcactcag-gcaaggct-cc-c--ttc---c------t--
               Golden hamster  ----------------------------------------------------------------------
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  c------------------ccca------gct-ctccaggactcatgctg
                        Chimp  c------------------ccca------gct-ctccaggactcgtgctg
                      Gorilla  c------------------ccca------gct-ctccaggactcgtgctg
                    Orangutan  c------------------ccca------gct-ctccaggactcgtgctg
                       Gibbon  c------------------ccca------gct-ctccaggactcatgctg
                       Rhesus  c------------------ccca------gct-ctccaggactcatgctg
          Crab-eating macaque  c------------------ccca------gct-ctccaggactcatgctg
                       Baboon  c------------------ccta------gct-ctccaggactcatgctg
                 Green monkey  c------------------ccca------gct-ctccaggactcatgctg
                     Marmoset  c------------------tcca------gct-ctccaggactcatgctg
              Squirrel monkey  c------------------ccca------gct-ctccaggactcatgctg
                     Bushbaby  c------------------ccca------att-ccctaagactcacgctg
           Chinese tree shrew  c------------------ccca------gct-ccccgggacttatgctg
                     Squirrel  ca-----------------ccca------ggt-ccccaggattcatgcta
       Lesser Egyptian jerboa  ca-----------------ccca------gct-ccccaggacttatgctg
                 Prairie vole  ca-----------------ctca------act-gcatgggactcacgtag
              Chinese hamster  ca-----------------ctaa------act-gcctgggactcatgctg
                        Mouse  ca-----------------ctca------aat-gccagggactcatgttt
                          Rat  ca-----------------ctca------aat-gccagggactcatgttg
               Naked mole-rat  ca-----------------ccca------gttcccccaggactcatgcta
                   Guinea pig  ca-----------------ctta------gca-ccccaggattcatgctg
                   Chinchilla  ca-----------------ccca------gct-tcccaggactcatgctg
             Brush-tailed rat  ta-----------------ccca------gc--tcccaggactcatgctg
                       Rabbit  c------------------ctca------gtt--cccaggactcgtgcta
                         Pika  c------------------ccca---------------------------
                          Pig  c------------------caca------gct-ccccagaactcatactg
                       Alpaca  c------------------ccta-------ct-ccccagaactcatgctg
               Bactrian camel  c------------------ccta-------ct-ccccagaactcatgctg
                      Dolphin  c------------------cccatcagtggct-ccccagagctcatgctg
                 Killer whale  c------------------cccatcagtggct-ccccagagctcatgctg
             Tibetan antelope  c------------------acca------gct-ccccagaactcatgctg
                          Cow  t------------------acca------gct-ccccagaactcatgctg
                        Sheep  c------------------acca------gct-ccccagaactcatgctg
                Domestic goat  c------------------acca------gct-ccccagaactcatgctg
                        Horse  c------------------ccca------gct-cctcagaacttatgctt
             White rhinoceros  c------------------tgca------gct-ccccagaactcatgctt
                          Cat  c------------------tata------gct-ccccagaactcatgctt
                          Dog  c------------------ttt-------gct-ccccagaactcatgctt
                      Ferret   c------------------caca------gct-ccccagaactcatgctt
                        Panda  c------------------tccg------gct-cctcagaactcatgctt
               Pacific walrus  c------------------tacg------gct-ccccagaactcatgctt
                 Weddell seal  c------------------taag------gct-ccccagaactcatgctt
             Black flying-fox  t------------------caca------gct-cttcagaattcatgctg
                      Megabat  t------------------caca------gct-cttcagaattcatgctg
                Big brown bat  c------------------caca------gtt-tcccagaattcatgctg
         David's myotis (bat)  t--------------------ca------gtt-cctcagaattcatgctg
                     Microbat  c------------------caca------gtt-ccccagaattcatgctg
                     Hedgehog  c------------------ccct------gtt-ccccagaatacatgaca
                        Shrew  t------------------ct-------------ccctgtacttatgctg
              Star-nosed mole  c------------------agca------a----cccagaactcatgctg
                     Elephant  -------------------ccta------gct-ccctaggactcatgctg
          Cape elephant shrew  -------------------atca------gct-ccccacgactcatgctg
                      Manatee  -------------------ccca------gct-ccccaggactcatgctc
             Cape golden mole  cttcttcccctttccctggcccc------act-ccccagcactcatgctg
                       Tenrec  -------------------ccca------gct-ccccaaga--catgc--
                     Aardvark  -------------------ccaa------gct-ccccaggactcatgctg
                    Armadillo  -------------------acct------gc--cctcagca---------
               Golden hamster  --------------------------------------------------
                   Coelacanth  ==================================================
                X. tropicalis  ==================================================
                 Atlantic cod  ==================================================
                  Spotted gar  ==================================================
                  Stickleback  ==================================================
           Southern platyfish  ==================================================
       Yellowbelly pufferfish  ==================================================
                         Fugu  ==================================================
                    Tetraodon  ==================================================
                       Turkey  ==================================================
                      Chicken  ==================================================
                 Mallard duck  ==================================================
           Tibetan ground jay  ==================================================
                  Zebra finch  ==================================================
       White-throated sparrow  ==================================================
              Tasmanian devil  ==================================================
     Mexican tetra (cavefish)  ==================================================
                    Zebrafish  ==================================================
                       Medaka  ==================================================
          Pundamilia nyererei  ==================================================
                  Zebra mbuna  ==================================================
        Burton's mouthbreeder  ==================================================
          Princess of Burundi  ==================================================
                 Nile tilapia  ==================================================
               Painted turtle  ==================================================
              Green seaturtle  ==================================================
           American alligator  ==================================================
                   Budgerigar  ==================================================
                      Opossum  --------------------------------------------------
                  Rock pigeon  ==================================================
          Collared flycatcher  ==================================================
          Medium ground finch  ==================================================
                       Lizard  ==================================================
             Peregrine falcon  ==================================================
                 Saker falcon  ==================================================
                     Platypus  ==================================================
     Chinese softshell turtle  ==================================================

Alignment block 15 of 435 in window, 46608978 - 46609120, 143 bps 
B D                     Human  atggaagagtgt--agcctggaaggtttgaatgtagagcaac----atctacaaccacat-ttttgtgca
B D                     Chimp  atggaagagtgt--agcctggaaggtttgaatgtagagcaac----atctacaaccacat-ttt-gtgta
B D                   Gorilla  atggaagagtgt--agcccggaaggtttgaatgtagagcaac----atctacaaccacat-ttt-gtgca
B D                 Orangutan  acggaagagtgt--agcctggaaggtttgaatgtagaccaac----atctacaaccacat-ttt-gtgca
B D                    Gibbon  atggaagagtgt--agcctggaaggtgtgaatgtagagcaac----atctacaaccacat-ttt-gtgca
B D                    Rhesus  atggaagaatgt--agcctggaaggtttgaatgtagagcaac----atctacaaccacat-ttt-gggca
B D       Crab-eating macaque  atggaagaatgt--agcctggaaggtttgaatgtagagcaac----atctacaaccacat-ttt-gggca
B D                    Baboon  atggaagaatgt--agcctggaaggtttgaatgtagagcaac----atctacaaccacat-ttt-gggca
B D              Green monkey  atggaagaatgt--agcctggaaggtttgaatgtagagcaac----atctacaaccacat-gtt-gggca
B D                  Marmoset  atggaagagtgt--agcctggaaggtttgaatgtagagcaac----atccacaaccacat-ttt-gtgca
B D           Squirrel monkey  atggaagagtgt--agcctggaaggtctgaatgtagagcaac----atccacaaccacat-ttc-gtgca
B D                  Bushbaby  atggaacatggt--agcctggaaggttcacacatagagccgc----aagtacaatcacaa-tct-gtgta
           Chinese tree shrew  atggaggatggt--agcctggaatgttcaagtgccatgccac----atctac-accacat-ctt-gtgtt
B D                  Squirrel  atggaagatggt--agcctggaagcttccaccataaaagtac----atc-----------------taca
       Lesser Egyptian jerboa  atggaagatggttgagcttat--------------caactac----atctacaacaacat-ttt-ctgta
                 Prairie vole  atagaaaatggt--gttctagaagatccagaggtaccactcc----atctacatgcacat-tct-gtaca
B D           Chinese hamster  atagaaaatggt--agtctaggagattcagaggtacaattct----gtcttcaggcacat-tct-gtaca
               Golden hamster  atagaaaatggt--agtctagaagattcaaaggtacaattcc----atatacctgcacat-tct-gtaca
B D                     Mouse  atagaagatggt--agtctagaagattcagaggtacaattcc----atctatacacacacattt-gtaca
B D                       Rat  gtaggagatggc--agtctagaagattcagaggtataattcc----atccacacacacat-ttt-gtaca
B D            Naked mole-rat  atggaagacca---------------tcatctgtagaactac----atctacaactgcat-ttt-atgta
B D                Guinea pig  gtggaagatggt--tgtctgaaaggcttacctgtagaactac----ctctccaactgcat-ttt-atgta
                   Chinchilla  atggaagatggt--tgtctgagaaactcacctgt---cctac----atctacaaccgcat-ttt-atgaa
             Brush-tailed rat  atggaagatggc--tgcctgcaagtctcatctgt---actat----gtctacagctgca-----------
B D                    Rabbit  atggaagatggt--tgcctac-aggctcaaatgtagagctgc----atctgcaaccacat-tcc-aagct
B D                      Pika  ---------ggt--ta-ctac-aggttcaaatgtagagctgc----atctac-accatat-ctc-aggct
B D                       Pig  atggaagacgga--agcctggaaggttcaagcatggagctac----atctacaaccacat-cgc-gtgct
B D                    Alpaca  atggaagacggt--agcctggaaggttcaaacatggagctac----atctacaaccacat-tct-gtgca
               Bactrian camel  atggaagacggt--agcctggaaggttcaaacatggagctac----atctacaaccacat-tct-gtgca
B D                   Dolphin  atggaagatggt--agcctggaagattcaaacatggagccac----atctaccaccacag-ttc-gtgca
                 Killer whale  atggaagatggt--agcctggaagattcaaacatggagccac----atctaccaccacag-ttc-gtgca
             Tibetan antelope  atggaagatggt--ggcttggaaggttcaaatatggagctac----atctacaaccacag-tct-gtgca
B D                       Cow  atgtaagatggt--ggcttggaaggttcaaatatggagctac----atctataaccacag-ttt-gtgca
B D                     Sheep  atggaagatggt--ggcttggaaggttcaaatatggagctac----atctacaaccacag-ttt-gtgca
                Domestic goat  atggaagatggt--ggcttggaaggttcaaatatggagctac----atctacaaccacag-ttt-gtgca
B D                     Horse  gtggaagacggt--agcctggaaggttcaaacatagagctac----gtctacagcgacat-ttt-gtgca
B D          White rhinoceros  acggaagacagt--agcctggaaggttcaaacatagagctac----atctacagccacat-ttt-gtgta
B D                       Cat  atggaagacggt--agcct-aaaggttaaaatatagagctac----gtctacaatcacat-ttt-gtgca
B D                       Dog  atggaagatggt--agcct-gaaagttcaaatacagagctac----atctaca-tcatat-ttt-gtgca
B D                   Ferret   acggaagctggt--agcct-gaaggttcaaatagagagctac----atctacaatcatat-ttt-gtgca
B D                     Panda  atggaaactgat--agcct-gaaggttcaaacagagagctgc----atctataatcatag-ttt-gtgca
               Pacific walrus  atggaagctggt--agcct-gaaggttcaaataaagaactac----atatacagtcatat-ttt-gtgca
                 Weddell seal  atggaagctggt--agcct-gaaggttcaaataaagaactac----atctacagtcatat-ttt-gtgca
             Black flying-fox  atggaagaacgt--agcctagaagttt----cacagagctac----ctctacaaccacat-ttt-gtgca
B D                   Megabat  atggaagaacgt--agcctagaagttt----cacagagctac----ctctacaaccacat-ttt-gtgca
                Big brown bat  atggaaaaaggt--agcctagacgtttcaaacatagagctacacctacctacaaccacat-ttt-gt--a
         David's myotis (bat)  atggaaaaagat--agcctggaagtttcaaacatagagctacacccacctacaaccacat-att-gt--a
B D                  Microbat  atggaaaaaggt--agcctggaagtttcaaacatagagctacacccacctacaaccacat-att-gt--a
B D                  Hedgehog  acaaacaatggc--aacctggaagactgattcagagt--gac----aactacaaccacag-ctt-gtcca
B D                     Shrew  atggccagtga----------------------------tac----atctacaagcacat-ctt-gagca
              Star-nosed mole  acaggagatgaa--agcctggaaggttcaaacatagagctat----atctacaaggacat-ctt-gtgca
B D                  Elephant  atagaagacagt--agcctggaaagttcaaacatagagatac----ttctacaaccacat-ttg--tgta
          Cape elephant shrew  atgaaagacggt--agcctagaaggttaaaacataacaatat----acctataatcacat-ttt-ctgaa
B D                   Manatee  atggaagacagt--agcctggaaagttcagacatagagatac----ttctacaaccacat-ttg--tgaa
             Cape golden mole  atggaagacggt--agcctggaaagttcaaacatagagatat----gtccgcaaccacat-ttt-gttca
B D                    Tenrec  --------------agcccggaaaattcaaaggcagagatga----tcctagaaccacat-ttt-gagta
                     Aardvark  atggaagacagt--aggctggaaa-ttcaaacagagagatac----ttctacaaccatgt-ttt-gtgtg
B D                 Armadillo  -------------------ggaaggttcccacatagagatac----ttctgtaaccacat-ttt--gtca
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ----------------------------------------------------------------------
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Platypus  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  ctt-acacaca-tggtcagatac-actgagtgggg-acg---ctga----gc--tgtcatcactcctaca
                        Chimp  ctt-acacaca-tggtcagatac-actgagtgggg-acg---ctga----gc--tgtcatcactcctaca
                      Gorilla  ctt-acacaca-tggtcagatac-actgagtgggg-acg---ctga----gc--tgtcatcactcctaca
                    Orangutan  ctt-acacaca-tggtcagatac-actgagtgggg-acg---ctga----gc--tgtcatcactcctaca
                       Gibbon  ctt-acacaca-tggtcagatac-actgagtgggg-aca---ttga----gc--tgtcatcactcctaca
                       Rhesus  ctt-agtcaca-tggtcagatat-actgagtgggg-acg---ctga----gc--tgtcatcactcctaca
          Crab-eating macaque  ctt-agtcaca-tggtcagatat-actgagtgggg-acg---ctga----gc--tgtcatcactcctaca
                       Baboon  ctt-agtcaca-tggtcagatat-actgagtgggg-acg---ctga----gc--tgtcatcactcctaca
                 Green monkey  ctt-agtcaca-tggtcagatat-actgagtgggg-acg---ctga----gc--tgtcatcactcctaca
                     Marmoset  ctt-acacaca-tggtcagatac-actgagtgggg-aca---ctga----cc--tgtcaacacacctaca
              Squirrel monkey  ctt-acacaca-tggtcagatac-actgagagggg-aca---ctga----cc--tgtcatcactcctaca
                     Bushbaby  ctt-acacaca-tagtcatgtac-actgaatggtg-aca---ctga----cc--tgtcatccctcctaca
           Chinese tree shrew  ctc-acacaca-tggttagagac-actgaatgggg-aca---gtga----------------ctcctaca
                     Squirrel  ctt-gtacaca-tggtcagatac-cctgagagggg-ata---acaa----ct--tgtcaagac-cctaca
       Lesser Egyptian jerboa  ctt-acacaca-tggtcaata-c-cctgagggagg-gca---ctga----gc--tattactactcttaca
                 Prairie vole  ctt-gtacata-tggtcagag----ttgagctagg-gaa---caaa----gc--tgtcattactcctaaa
              Chinese hamster  ctt-gtactta-tggtgagag----ttgagttggg-gca---ctaa----gc--tgtcattactcctaga
               Golden hamster  ctt-gtaccta-tggtcagag----ttgagttgga-gca---ataa----gc--tgtcattactcctata
                        Mouse  ctt-gtacaca-tggtcagag----ttgggt------ca---ctaa----gc--tgtcattactcctaaa
                          Rat  ctt-gtacaca-cggtcaggg----ttgggt------ca---ctaa----gc--tgtcattactcctata
               Naked mole-rat  ctt-acacgcc-tggtcagttcc-cctgagtgggg-ata---ctgg----cc--tatcattattcctata
                   Guinea pig  ctt-acacatc-tggtcagatac-cctgagtgggg-ata---ctgg----cc--tgtcattattcctata
                   Chinchilla  ctc-acacacc-tggtcagatac-cctgagtgggg-ata---ctgg----cc--tatcgttattcctaca
             Brush-tailed rat  -----------------------------------------------------------ttattcctata
                       Rabbit  ctt-acata-a-ctgttagacac-actgagcaggg-gcactgctga----cc--tgtcatcac----acc
                         Pika  ctt-gcaca-a-ttatcatatac-actgagcagggagcactgctga----tc--tgtcattac----aca
                          Pig  ctt-acatgca-gggtcagacag-acccagtggag-aca---ggga----cg--tgtcatcactccta-c
                       Alpaca  ctt-atactca-tggtcagacac-accgaatgtgg-aca---ttga----ct--tgtcatcactcctaca
               Bactrian camel  ctt-acactca-tggtcagacac-accaaatgggg-aca---ctga----ct--tgtcatcactcctaca
                      Dolphin  ctt-acacaca-cagtcagacac-accaaatgggg-aga---ctga----ct--cgtcatcattccta-a
                 Killer whale  ctt-acacaca-cagtcagacac-accaaatgggg-aga---ctga----ct--cgtcatcattccta-a
             Tibetan antelope  cttaacacaca-aggtcaggcac-accgaatgggg-taa---ctga----ct--t---atcattccta-a
                          Cow  cttaacacaca-gggtcaggcac-accaaatgggg-taa---ctga----ct--tgtcatcattccta-g
                        Sheep  cttaacacaca-aggccaggcac-accaaatgggg-taa---ctga----ct--tgtcatcattccta-a
                Domestic goat  cttaacacaca-aggccaggcac-accaaatgggg-taa---ctga----ct--tgtcatcattccta-a
                        Horse  ctt-acacaca-tggtcagacac-actgagtggga-aca---ctga----cc--tgtcatca-tcctaca
             White rhinoceros  ctt-acacaca-tggtcagacac-actgagtgggg-aca---ctga----cc--tgtcatcactcctaca
                          Cat  ctt-ttacaca-tggtcagag---------tgggg-acg---ctca----cc--tgtcatcactcctaca
                          Dog  ctt-acacaag-tggtcagacac-actgagtgggg-aca---ctga----cc--tgtcgtcactcctaca
                      Ferret   ctc-acacaca-tggccagac----------------ca---ctga----cc--tgccatcccttgcaca
                        Panda  ctt-acacaca-tggtcaggc----------------ca---ctga----cc--tgtcatcactcccaca
               Pacific walrus  ctt-acacaca-cggttagac----------------ca---ctga----cc--tgtcatcactccccca
                 Weddell seal  ctt-acacaca-tggttagac----------------ca---ctga----cc--tgtcatcactccccca
             Black flying-fox  ctt-atacacatttgccagacat-gccaagtgggg-aca---gtga----cc--tgtcatcactctgaaa
                      Megabat  ctt-atacacatttgccagacat-gccaagtgggg-aca---gtga----cc--tgtcatcactccgaaa
                Big brown bat  ctt-acaca---tcatcagacac-atcaagtaggg-aca---gtga----at--tgtcatcacttctaca
         David's myotis (bat)  ctt-acaca---tcatcagacac-accgagagggg-aca---gtga----at--tgtcatcactcctact
                     Microbat  ctt-acaca---tcatcagacac-accgagagggg-aca---gtga----at--tgtcaccactcctaca
                     Hedgehog  ctc-acacaca---gtcagatac-actaagtagga-aca---ctgt----tctgtgtcaccacacctata
                        Shrew  ctt-acacaca-tggtgaaacaa-accag--cggg-aca---ctga----ca--tgccaccactcctgca
              Star-nosed mole  ctt-acacaca-tggtcacacac-cccaggcaggg-aca---ctga----cc--tgtcattactcccaca
                     Elephant  ctt-atacaca-tggtgagttac-accaagcaggg-ata---ctga----cc--taccatcacttctaca
          Cape elephant shrew  att-aaaaaca-caatgagatac-accaagcaggt-aca---ctga----cc--ggcgatcacatctata
                      Manatee  ctt-atacatg-tggtgagttac-accaagcaggg-ata---ctga----cc--taccatcactcctaca
             Cape golden mole  ctt-acaaaca-tggtgaggcct-accaagcaggg-tta---ctca----cc--tgccatcactcccaca
                       Tenrec  tgt-gctaacg-tggtgagctat-gtggagcaggg-cta---ctga----cc--caccat-gctgctgga
                     Aardvark  ctt-gcaaaca-tggtgagctac-atctagcaggg-ata---ctga----ct--tgccatcactc--ata
                    Armadillo  ctc-atgcaca-tggccagatacaaccaagcaggg-ata---cagatatgtc--tatcatcacgccttca
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  g--tggtcatggtctga---------------tggtc---------------------------------
                        Chimp  g--tggtcatggtctga---------------tggtc---------------------------------
                      Gorilla  g--tggtcatggtctga---------------tggtc---------------------------------
                    Orangutan  g--tggtcatggtctga---------------tggtc---------------------------------
                       Gibbon  g--tggtcatggtctga---------------tggtc---------------------------------
                       Rhesus  g--tggccgtggtctga---------------tggtc---------------------------------
          Crab-eating macaque  g--tggccgtggtctga---------------tggtc---------------------------------
                       Baboon  g--tggccgtggtctga---------------tggtc---------------------------------
                 Green monkey  g--tggccgtggtctga---------------tggtc---------------------------------
                     Marmoset  g--tggtcatggtctga---------------tggtt---------------------------------
              Squirrel monkey  g--tggtcatggtctga---------------tggtc---------------------------------
                     Bushbaby  g--tggtcaagctctga---------------tggtc---------------------------------
           Chinese tree shrew  g--tggtcacggtctga---------------tgatc---------------------------------
                     Squirrel  g--tggtcatggtctaa---------------tggtc---------------------------------
       Lesser Egyptian jerboa  g--tggtcatggtctca---------------tggtc---------------------------------
                 Prairie vole  a--gggtcatggacttagatcatcctgtctgtttgtcca------------------------cccatcc
              Chinese hamster  g--gggtcatggactta---------------tggtcag------------------------cccatcc
               Golden hamster  g--gggtcatggactta---------------cagtcag------------------------cccgcct
                        Mouse  a--tggtcatggactta---------------tagttaa------------------------cctctcc
                          Rat  a--tggtcatggactta---------------cagtcaa------------------------cctgtcc
               Naked mole-rat  g--tggtcacggtcaga---------------gagtc---------------------------------
                   Guinea pig  g--tggtcatggtcaaa---------------tagtc---------------------------------
                   Chinchilla  g--tggtcatggtcaaa---------------tagtc---------------------------------
             Brush-tailed rat  g--tggccatggtcaaa---------------aaatc---------------------------------
                       Rabbit  gacaggtcacggtctga---------------tggtcccaatc--------------------tctatcc
                         Pika  g--aggtcatggtctga---------------tggtcctaatccatccatccactcacctccatccttcc
                          Pig  g--tgggcatggtctga---------------tggcc---------------------------------
                       Alpaca  g--tggtcatgatctga---------------tggcc---------------------------------
               Bactrian camel  g--tggtcatgatctga---------------tggcc---------------------------------
                      Dolphin  g--tggtcatggtccga---------------tggcc---------------------------------
                 Killer whale  g--tggtcatggtccga---------------tggcc---------------------------------
             Tibetan antelope  g--tggtcatggcctga---------------aggcc---------------------------------
                          Cow  g--tggtcatggtctga---------------aagcc---------------------------------
                        Sheep  g--tggtcatggtctga---------------aggcc---------------------------------
                Domestic goat  g--tggtcatggtctga---------------aggcc---------------------------------
                        Horse  g--tggtcatggtctga---------------tggtc---------------------------------
             White rhinoceros  g--tggtcatggtctga---------------tggtc---------------------------------
                          Cat  g--tggtcatggtctgg---------------tggtc---------------------------------
                          Dog  g--tggtcatggtctgg---------------tggtc---------------------------------
                      Ferret   g--tggtcactgtctgg---------------tggtc---------------------------------
                        Panda  g--tggtcgtggtccgg---------------gggtc---------------------------------
               Pacific walrus  g--gggtcatggtctgg---------------tggtc---------------------------------
                 Weddell seal  g--gggtcatggtctgg---------------tggtc---------------------------------
             Black flying-fox  g--tggtcatagtctga---------------tggtc---------------------------------
                      Megabat  g--tggtcatagtctga---------------tggtc---------------------------------
                Big brown bat  g--tgatcatggtctga---------------tggtc---------------------------------
         David's myotis (bat)  g--tgatcatggtctga---------------tggtc---------------------------------
                     Microbat  g--tgatcaaggtctga---------------tggtc---------------------------------
                     Hedgehog  g--tcatcatggtctga---------------tggtc---------------------------------
                        Shrew  g--tgttcatggtctga---------------tggtc---------------------------------
              Star-nosed mole  g--tggccacagtctga---------------tgggt---------------------------------
                     Elephant  g--tggtcatggtttga---------------cgatt---------------------------------
          Cape elephant shrew  g--tgatca-----tga---------------tgatt---------------------------------
                      Manatee  g--tggtt------tga---------------tgatc---------------------------------
             Cape golden mole  g--tggtcatggtctga---------------tgatc---------------------------------
                       Tenrec  g--tggttttggtccga---------------tgacc---------------------------------
                     Aardvark  g--tggtcatggtctga---------------tgatt---------------------------------
                    Armadillo  g--tgttcatagtctga---------------tggta---------------------------------
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                 Green monkey  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  a---------------------------------------------------------------------
              Chinese hamster  a---------------------------------------------------------------------
               Golden hamster  a---------------------------------------------------------------------
                        Mouse  a---------------------------------------------------------------------
                          Rat  a---------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                       Rabbit  acctactcactc----------------------------------------------------------
                         Pika  atccactcacccattgtccattcaccagtccatccattcatctgtcccactcatccttccatctcaaaaa
                          Pig  ----------------------------------------------------------------------
                       Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
                      Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
                          Cow  ----------------------------------------------------------------------
                        Sheep  ----------------------------------------------------------------------
                Domestic goat  ----------------------------------------------------------------------
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                          Cat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
                        Panda  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                     Microbat  ----------------------------------------------------------------------
                     Hedgehog  ----------------------------------------------------------------------
                        Shrew  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
          Cape elephant shrew  ----------------------------------------------------------------------
                      Manatee  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
                       Tenrec  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
                    Armadillo  ----------------------------------------------------------------------
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  cca
                        Chimp  cca
                      Gorilla  cca
                    Orangutan  cca
                       Gibbon  cca
                       Rhesus  cca
          Crab-eating macaque  cca
                       Baboon  cca
                 Green monkey  cca
                     Marmoset  tca
              Squirrel monkey  tca
                     Bushbaby  cca
           Chinese tree shrew  cta
                     Squirrel  cca
       Lesser Egyptian jerboa  cca
                 Prairie vole  ccc
              Chinese hamster  tcc
               Golden hamster  tct
                        Mouse  tct
                          Rat  tcc
               Naked mole-rat  cca
                   Guinea pig  cca
                   Chinchilla  tca
             Brush-tailed rat  tca
                       Rabbit  tcc
                         Pika  tcc
                          Pig  cta
                       Alpaca  cta
               Bactrian camel  cta
                      Dolphin  cta
                 Killer whale  cta
             Tibetan antelope  cta
                          Cow  cta
                        Sheep  cta
                Domestic goat  cta
                        Horse  cta
             White rhinoceros  cca
                          Cat  cca
                          Dog  cca
                      Ferret   cta
                        Panda  cca
               Pacific walrus  cca
                 Weddell seal  cct
             Black flying-fox  cta
                      Megabat  cta
                Big brown bat  cca
         David's myotis (bat)  cca
                     Microbat  cca
                     Hedgehog  tca
                        Shrew  aca
              Star-nosed mole  cca
                     Elephant  cca
          Cape elephant shrew  cta
                      Manatee  cca
             Cape golden mole  cca
                       Tenrec  cca
                     Aardvark  cca
                    Armadillo  cct
                   Coelacanth  ===
                X. tropicalis  ===
                 Atlantic cod  ===
                  Spotted gar  ===
                  Stickleback  ===
           Southern platyfish  ===
       Yellowbelly pufferfish  ===
                         Fugu  ===
                    Tetraodon  ===
                       Turkey  ===
                      Chicken  ===
                 Mallard duck  ===
           Tibetan ground jay  ===
                  Zebra finch  ===
       White-throated sparrow  ===
              Tasmanian devil  ===
     Mexican tetra (cavefish)  ===
                    Zebrafish  ===
                       Medaka  ===
          Pundamilia nyererei  ===
                  Zebra mbuna  ===
        Burton's mouthbreeder  ===
          Princess of Burundi  ===
                 Nile tilapia  ===
               Painted turtle  ===
              Green seaturtle  ===
           American alligator  ===
                   Budgerigar  ===
                      Opossum  ---
                  Rock pigeon  ===
          Collared flycatcher  ===
          Medium ground finch  ===
                       Lizard  ===
             Peregrine falcon  ===
                 Saker falcon  ===
                     Platypus  ===
     Chinese softshell turtle  ===

Inserts between block 15 and 16 in window
B D                    Panda 25bp
            Black flying-fox 21bp
B D                  Megabat 21bp
               Big brown bat 21bp
        David's myotis (bat) 21bp
B D                 Microbat 21bp

Alignment block 16 of 435 in window, 46609121 - 46609137, 17 bps 
B D                     Human  tg-------gtctg------a------------------tggtcc--------------caa
B D                     Chimp  tg-------gtctg------a------------------tggtcc--------------caa
B D                   Gorilla  tg-------gt--------------------------------------------------a
B D                 Orangutan  -------------------------------------------------------------a
B D                    Gibbon  -------------------------------------------------------------a
B D                    Rhesus  tg-------gtctg------a------------------tggtcc--------------caa
B D       Crab-eating macaque  tg-------gtctg------a------------------tggtcc--------------caa
B D                    Baboon  tg-------gtctg------a------------------tggtcc--------------caa
B D              Green monkey  tg-------gtctg------a------------------tggtcc--------------caa
B D                  Marmoset  tg-------gtctg------a------------------tggtcc--------------caa
B D           Squirrel monkey  tg-------atctg------a------------------tggtcc--------------caa
B D                  Bushbaby  at-------ctctt------t------------------atctct--------------cca
           Chinese tree shrew  at-------ctctt------aatccatacacctacccatttatccatccatccatccatcca
B D                  Squirrel  ---------atctc------t------------------tcatcc----------------a
       Lesser Egyptian jerboa  ---------atctt------t------------------tcattc----------------a
                 Prairie vole  ---------atcca------t------------------ccatcc----------------a
B D           Chinese hamster  ---------atcca------t------------------ccatcc----------------a
               Golden hamster  ---------atcca-----------------------------cc----------------a
B D                     Mouse  ---------atcta------t------------------acatcc----------------a
B D                       Rat  ---------atcca------t------------------ccatcc----------------a
B D            Naked mole-rat  ---------gtctc------t------------------ttatac----------------a
B D                Guinea pig  ---------gtctt------t------------------ttatac----------------a
                   Chinchilla  ---------gtctc------t------------------ctatac----------------a
             Brush-tailed rat  ---------gtctc------t------------------ttgcac----------------a
B D                    Rabbit  ---------atcct------c------------------ccatcc----------------a
B D                      Pika  ---------atcca------t------------------ccatcc----------------a
B D                       Pig  ---------atccc------t------------------g----------------------
B D                    Alpaca  ---------atccc------t------------------a----------------------
               Bactrian camel  ---------atccc------t------------------a----------------------
B D                   Dolphin  ---------atccc------t------------------a----------------------
                 Killer whale  ---------atccc------t------------------a----------------------
             Tibetan antelope  ---------gtccc------c------------------a----------------------
B D                       Cow  ---------gtccc------t------------------a----------------------
B D                     Sheep  ---------gtccc------t------------------a----------------------
                Domestic goat  ---------gtccc------t------------------a----------------------
B D                     Horse  ---------aaccc------t------------------a----------------------
B D          White rhinoceros  ---------atccc------t------------------g----------------------
B D                       Cat  ---------atccc------t------------------a----------------------
B D                       Dog  ---------atccc------------------------------------------------
B D                   Ferret   ---------acccc------------------------------------------------
               Pacific walrus  ---------atccc------------------------------------------------
                 Weddell seal  ---------atccc------t------------------a----------------------
             Black flying-fox  -------tcattcc------t------------------t----------------------
B D                   Megabat  -------tcattcc------t------------------t----------------------
                Big brown bat  -------tcattcc------t------------------t----------------------
         David's myotis (bat)  -------tcgttcc------t------------------t----------------------
B D                  Microbat  -------tcgttcc------t------------------t----------------------
B D                  Hedgehog  -atccctccctccc------t------------------c----------------------
B D                     Shrew  -gcccacccccctc------c------------------c----------------------
              Star-nosed mole  -g--------tctc------t------------------c----------------------
B D                  Elephant  ---------gtcttcattaa------------------------------------------
          Cape elephant shrew  ---------gtctc------------------------------------------------
B D                   Manatee  ---------gtctc--ttca------------------------------------------
             Cape golden mole  ---------gttac------------------------------------------------
B D                    Tenrec  ---------gtatt------------------------------------------------
                     Aardvark  ---------gtctc------------------------------------------------
B D                 Armadillo  ---------gtctc------------------------------------------------
B D                Coelacanth  ==============================================================
B D             X. tropicalis  ==============================================================
B D              Atlantic cod  ==============================================================
                 Spotted gar  ==============================================================
B D               Stickleback  ==============================================================
          Southern platyfish  ==============================================================
      Yellowbelly pufferfish  ==============================================================
B D                      Fugu  ==============================================================
B D                 Tetraodon  ==============================================================
B D                    Turkey  ==============================================================
B D                   Chicken  ==============================================================
  D              Mallard duck  ==============================================================
          Tibetan ground jay  ==============================================================
B D               Zebra finch  ==============================================================
  D    White-throated sparrow  ==============================================================
B D           Tasmanian devil  ==============================================================
    Mexican tetra (cavefish)  ==============================================================
B D                 Zebrafish  ==============================================================
B D                    Medaka  ==============================================================
         Pundamilia nyererei  ==============================================================
                 Zebra mbuna  ==============================================================
       Burton's mouthbreeder  ==============================================================
         Princess of Burundi  ==============================================================
B D              Nile tilapia  ==============================================================
  D            Painted turtle  ==============================================================
  D           Green seaturtle  ==============================================================
B D        American alligator  ==============================================================
B D                Budgerigar  ==============================================================
B D                   Opossum  --------------------------------------------------------------
  D               Rock pigeon  ==============================================================
  D       Collared flycatcher  ==============================================================
B D       Medium ground finch  ==============================================================
B D                    Lizard  ==============================================================
  D          Peregrine falcon  ==============================================================
  D              Saker falcon  ==============================================================
B D                  Platypus  ==============================================================
  D  Chinese softshell turtle  ==============================================================
B D                     Panda  ==============================================================

Inserts between block 16 and 17 in window
B D                      Pig 30bp
B D                   Alpaca 8bp
              Bactrian camel 8bp
B D                  Dolphin 23bp
                Killer whale 23bp
            Tibetan antelope 14bp
B D                      Cow 14bp
B D                    Sheep 14bp
               Domestic goat 18bp
B D                    Horse 18bp
B D         White rhinoceros 18bp
B D                      Cat 29bp
B D                      Dog 12bp
B D                  Ferret  8bp
              Pacific walrus 16bp
                Weddell seal 18bp
            Black flying-fox 7bp
B D                  Megabat 7bp
               Big brown bat 7bp
        David's myotis (bat) 7bp
B D                 Microbat 7bp

Alignment block 17 of 435 in window, 46609138 - 46609224, 87 bps 
B D                     Human  tctat--------------------t-----------------------------tatccatccatcca-
B D                     Chimp  tctat--------------------t-----------------------------tatccatccatcca-
B D                   Gorilla  tctat--------------------t-----------------------------tatccatccatcca-
B D                 Orangutan  tctat--------------------t-----------------------------tatccatccatcca-
B D                    Gibbon  tctat--------------------t-----------------------------tatccatccatcca-
B D                    Rhesus  tctat--------------------t-----------------------------tatccatccatcca-
B D       Crab-eating macaque  tctat--------------------t-----------------------------tatccatccatcca-
B D                    Baboon  tctat--------------------t-----------------------------tatccatccatcca-
B D              Green monkey  tctat--------------------t-----------------------------tatccatccatcca-
B D                  Marmoset  tctat--------------------t-----------------------------tagccatccagcca-
B D           Squirrel monkey  tctat--------------------t-----------------------------tagccatccagcca-
B D                  Bushbaby  actgt--------------------c-----------------------------catctatctgccca-
           Chinese tree shrew  tccat--------------------c-----------------------------catccatccaccca-
B D                  Squirrel  tccat--------------------c-----------------------------catctctccattca-
       Lesser Egyptian jerboa  cccat--------------------t-----------------------------catccacacatcca-
                 Prairie vole  tccat--------------------c-----------------------------catccatccatcca-
B D           Chinese hamster  tccat--------------------c-----------------------------catccatccatcca-
               Golden hamster  tccat--------------------c-----------------------------catccatccatcca-
B D                     Mouse  t---------------------------------------------------------------------
B D                       Rat  tccat--------------------c-----------------------------catccatccatcca-
B D            Naked mole-rat  t-caa--------------------c-----------------------------cacccatccatcca-
B D                Guinea pig  tccaa--------------------t-----------------------------ggtccatccatcca-
                   Chinchilla  tccaa--------------------c-----------------------------catccatccatc---
             Brush-tailed rat  ttcaa--------------------c-----------------------------catccatccatccg-
B D                    Rabbit  ctcat--------------------c-----------------------------catccatccatcta-
B D                      Pika  tccat--------------------ccaaaaatctatctatgccactcacccactcatccatccatcca-
B D                       Pig  tccat--------------------c-----------------------------catccgtgtagctc-
B D                    Alpaca  --cat--------------------c-----------------------------tatcaacttaccta-
               Bactrian camel  --cat--------------------c-----------------------------tatcaacttaccta-
B D                   Dolphin  tccaa--------------------c-----------------------------catcaatttaccta-
                 Killer whale  tccat--------------------c-----------------------------catcaatttaccta-
             Tibetan antelope  tccat--------------------c-----------------------------catccatttaccta-
B D                       Cow  tccat--------------------c-----------------------------catccatttaccta-
B D                     Sheep  tccat--------------------c-----------------------------catccatttaccta-
                Domestic goat  tccat--------------------c-----------------------------catccatttaccta-
B D                     Horse  tcctt--------------------c-----------------------------catccatttacata-
B D          White rhinoceros  tcctt--------------------c-----------------------------cttccatgtaccta-
B D                       Cat  tccat--------------------t-----------------------------cacccatttaccta-
B D                       Dog  ttcat--------------------t-----------------------------caaccactgaccta-
B D                   Ferret   tccat--------------------t-----------------------------cttctacttacctc-
B D                     Panda  tccat--------------------t-----------------------------catccgtttaccta-
               Pacific walrus  tccgt--------------------t-----------------------------cattcatttaccta-
                 Weddell seal  tctgt--------------------t-----------------------------cattcatttaccta-
             Black flying-fox  tccat--------------------t-----------------------------catccatttatcta-
B D                   Megabat  tccat--------------------t-----------------------------catccatttatcta-
                Big brown bat  tccat--------------------c-----------------------------catccatttgccta-
         David's myotis (bat)  tccat--------------------c-----------------------------catccatctgccta-
B D                  Microbat  tccat--------------------c-----------------------------catccatctgccta-
B D                  Hedgehog  tccccctcttctccttaacattcata-----------------------------catttatttaccca-
B D                     Shrew  tcctt---------------tccaac-----------------------------catccagctaccta-
              Star-nosed mole  tcctt--------------------c-----------------------------catccacccactta-
B D                  Elephant  ttcat--------------------t-----------------------------cattcatacaacca-
          Cape elephant shrew  ttcat--------------------t-----------------------------cattcatacatcca-
B D                   Manatee  ttaat--------------------t-----------------------------cattcgtacattca-
             Cape golden mole  ttcat--------------------t-----------------------------cattcat--------
B D                    Tenrec  ttcat--------------------t-----------------------------cagtcat--------
                     Aardvark  ttcat--------------------t-----------------------------tattcat--------
B D                 Armadillo  ttcat--------------------t-----------------------------cattcattcattcat
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ----------------------------------------------------------------------
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Platypus  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  -------------------a------------------------------------catttatg--gaag
                        Chimp  -------------------a------------------------------------catttatg--gaag
                      Gorilla  -------------------a------------------------------------catttatg--gaag
                    Orangutan  -------------------a------------------------------------catttatg--gaag
                       Gibbon  -------------------a------------------------------------catttatg--gaag
                       Rhesus  -------------------a------------------------------------cgtttatg--gaag
          Crab-eating macaque  -------------------a------------------------------------cgtttatg--gaag
                       Baboon  -------------------a------------------------------------cgtttatg--gaag
                 Green monkey  -------------------a------------------------------------cgtttatg--gaag
                     Marmoset  -------------------a------------------------------------catttatg--gaag
              Squirrel monkey  -------------------a------------------------------------catttatg--gaag
                     Bushbaby  -------------------g------------------------------------tgtttatg--cagg
           Chinese tree shrew  -------------------a------------------------------------tgcttatg--gagg
                     Squirrel  -------------------cccaa--------------------------------catctatg--gaga
       Lesser Egyptian jerboa  -------------------cctgcccatc---------------------------cattcaacatgaag
                 Prairie vole  -------------------tccatctatccatccacccacccacccatc-------catccaacatgagg
              Chinese hamster  -------------------cccatccatccacccacctacccacccatg-------catccagc------
               Golden hamster  -------------------tccatccatc---------------------------catccaac------
                        Mouse  ---------------------catctatc---------------------------catccataatgaga
                          Rat  -------------------tccatccatc---------------------------catccatcatgagg
               Naked mole-rat  -------------------a------------------------------------catctgt---gaag
                   Guinea pig  -------------------a------------------------------------tatctgt---gaag
                   Chinchilla  --------------------------------------------------------catctg----gagg
             Brush-tailed rat  -------------------a------------------------------------catgtga---gaag
                       Rabbit  -------------------tccaccca-----------------------------tgtttatg--gagg
                         Pika  -------------------tccactcatccatccttctacccatccctccatccagtgcttatg--aggg
                          Pig  -------------------a------------------------------------cattcatg--gagg
                       Alpaca  -------------------a------------------------------------catttatg--gagg
               Bactrian camel  -------------------a------------------------------------tatttatg--gagg
                      Dolphin  -------------------a------------------------------------catttatg--gagg
                 Killer whale  -------------------a------------------------------------catttatg--gagg
             Tibetan antelope  -------------------a------------------------------------cacttatg--gagg
                          Cow  -------------------a------------------------------------catttatg--gatg
                        Sheep  -------------------a------------------------------------cacttatg--gagg
                Domestic goat  -------------------a------------------------------------cacttatg--gagg
                        Horse  -------------------a------------------------------------catttatg--gagg
             White rhinoceros  -------------------g------------------------------------tatttatg--gagg
                          Cat  -------------------a------------------------------------catttatg--gagg
                          Dog  -------------------a------------------------------------cacatagg--gagg
                      Ferret   -------------------a------------------------------------catttatg--gaag
                        Panda  -------------------g------------------------------------catgtatg--gagg
               Pacific walrus  -------------------g------------------------------------catttatg--gagg
                 Weddell seal  -------------------g------------------------------------catttatg--gagg
             Black flying-fox  -------------------a------------------------------------catttat---gagg
                      Megabat  -------------------a------------------------------------catttat---gagg
                Big brown bat  -------------------a------------------------------------catttat---gagg
         David's myotis (bat)  -------------------a------------------------------------catttat---gagg
                     Microbat  -------------------a------------------------------------catttat---gagg
                     Hedgehog  -------------------a------------------------------------tatttctg--ggaa
                        Shrew  -------------------a------------------------------------catgtatg--gaca
              Star-nosed mole  ----------------------------------------------------------------------
                     Elephant  -----------tttatctaa------------------------------------catttatg--gagg
          Cape elephant shrew  -----------cttatctaa------------------------------------cacttatg--gaag
                      Manatee  -----------tttatctaa------------------------------------catttatg--gagg
             Cape golden mole  -------------------t------------------------------------catttctg--gagg
                       Tenrec  -------------------t------------------------------------catttatg--gagg
                     Aardvark  -------------------t------------------------------------catttatg--gaga
                    Armadillo  tcattcatcattttatctaa------------------------------------tatttatg--gagg
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  g-cctac-t---atgt----gccaag-----g-----agggg-taaggcag------------------c
                        Chimp  g-cctac-t---atgt----gccaag-----g-----agggg-taaggcag------------------c
                      Gorilla  g-cctac-t---atgt----gccaag-----g-----agggg-taaggcag------------------c
                    Orangutan  g-cctac-t---atgt----gccaag-----g-----agggg-taaggcag------------------c
                       Gibbon  g-cctac-t---atgt----gccaag-----g-----agggg-taaggcag------------------c
                       Rhesus  g-cctat-t---atgt----gccaag-----g-----agggg-taaggcag------------------c
          Crab-eating macaque  g-cctat-t---atgt----gccaag-----g-----agggg-taaggcag------------------c
                       Baboon  g-cctat-t---atgt----gccaag-----g-----agggg-taaggcag------------------c
                 Green monkey  g-cctac-t---atgt----gccaag-----g-----agggg-taaggcag------------------c
                     Marmoset  g-cctac-t------t----gcaaag-----g-----agggg-taaggcag------------------c
              Squirrel monkey  g-cctac-t---atgt----gccaag-----g-----agggg-taaggcagct----------------c
                     Bushbaby  g-cctac-t---atgt----gccatg-----g-----agggtctaaggcag------------------c
           Chinese tree shrew  g-cctac-tactatgt----gccagg-----g-----agggtctaccatag------------------c
                     Squirrel  g-cctac-t---atgt----gccagg-----g-----agggc---------------------------c
       Lesser Egyptian jerboa  gtcctac-t---atgtacgcgccagg-----g-----atggt---------------------------c
                 Prairie vole  g-cctac-t---atgt----gccaga-----a-----aggac---------------------------c
              Chinese hamster  ------------atgt----gccagg-----a-----aggac---------------------------c
               Golden hamster  ------------atgt----gccagg-----a-----aggac---------------------------c
                        Mouse  g-cctac-t---atgt----gtctgg-----a-----aggac---------------------------c
                          Rat  g-cctac-t---atgt----gtctgg-----a-----aggac---------------------------t
               Naked mole-rat  g-cctacgt---acgt----gccagg-----a-----agggt---------------------------c
                   Guinea pig  g-cccattt---atgt----gccagg-----g-----agggt---------------------------c
                   Chinchilla  g-cctactt---atgt----gtcagg-----g-----agcgt---------------------------c
             Brush-tailed rat  g-cctaagt---atgt----gccagg-----g-----agggt---------------------------c
                       Rabbit  g-cctac-t---atgt----gccagg-----a------aggt---------------------------c
                         Pika  g-gccac-t---atgt----accagg-----g-----tgggt---------------------------c
                          Pig  g-cctac-t---atgt----gccagg-----a-----agggtttaaggcag------------------c
                       Alpaca  g-cctag-t---atgt----gccagg-----a-----agggtctaaggcag------------------c
               Bactrian camel  g-cctag-t---atgt----gccagg-----a-----agggtctaaggcag------------------c
                      Dolphin  g-cctac-t---atgt----gccagg-----a-----acagtctaaggcac------------------g
                 Killer whale  g-cctac-t---atgt----gccagg-----a-----acagtctaaggcac------------------g
             Tibetan antelope  g-c---c-c---atgt----gccagg-----a-----agggtctaaggcaa------------------c
                          Cow  g-c---c-c---atgt----gccagg-----a-----aggttctaaggcaa------------------c
                        Sheep  g-c---c-c---atgt----gccagg-----a-----agggtctaaggcaa------------------c
                Domestic goat  g-c---c-c---atgt----gccagg-----a-----agggtctaaggcaa------------------c
                        Horse  g-cctac-t---atgt----gccagg-----g-----aggt-ctaaggcag------------------c
             White rhinoceros  g-cctac-t---gtgt----gccagg-----g-----aggg-tcaagggag------------------c
                          Cat  g-cctac-t---atgt----gccagg-----g-----aggatctaaagcag------------------c
                          Dog  g-cctac-t---atgt----gccagg-----g-----aggg--tacagcag------------------c
                      Ferret   g-tctag-t---atgt----gccagg-----g-----agggtctaaagcag------------------c
                        Panda  g-cctac-t---atgt----gccagg-----g-----agggtctcagggag------------------c
               Pacific walrus  g-ccttc-t---atgt----gccaag-----g-----agggtctaaggcag------------------c
                 Weddell seal  g-tcttc-t---atgt----gccagg-----g-----agtgtctaaggcag------------------c
             Black flying-fox  g-cctct-t---atgt----gctatg-----g-----agggtctaaggcag------------------c
                      Megabat  g-cctct-t---atgt----gctatg-----g-----agggtctaaggcag------------------c
                Big brown bat  t-cccac-t---atgt----gtcagg-----gaaggtagggtctaaggtgg------------------c
         David's myotis (bat)  t-cccac-t---atgt----gccagg-----gagggtagggtcgaaggtgg------------------c
                     Microbat  t-cccac-t---atgt----gccagg-----gagggcagggtctaaggtgg------------------c
                     Hedgehog  g-tctaa-t---gtat----accagg-----g-----agggctcaagacag------------------c
                        Shrew  t-gc-----------t----accatgtactag-----aggggcgaaggccg------------------c
              Star-nosed mole  ---------------t----gccagg-----g-----agggcctaaggcat------------------c
                     Elephant  g-tgtat---------------------------------------------------------------
          Cape elephant shrew  a-tatgt-------------gtcagg-----c-----agggtctaaggcagacatacttcacagtcaaaa
                      Manatee  g-tgtat-t---atgt----gccagg-----t-----agggtctaaggca--------------------
             Cape golden mole  g-tgtac-a---gtgt----gccagg-----a-----tgggtctaaggca--------------------
                       Tenrec  g-tgtac-t---gtgt----gccagg------------------tgtgca--------------------
                     Aardvark  g-tgcat-t---atgt----gacagg-----c-----agggtct-aggca--------------------
                    Armadillo  t-catat-t---atat----gccagg-----c-----aggctttaaggcg-------------------c
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  tag-------ct-----ctcacagacac---acccca
                        Chimp  tag-------ct-----ctcacagacac---acccca
                      Gorilla  tag-------ct-----ctcacagacac---acccca
                    Orangutan  tag-------ct-----ctcacagacac---acccca
                       Gibbon  tag-------ct-----ctcacagacac---acccca
                       Rhesus  tag-------ct-----ctcacagacac---atccca
          Crab-eating macaque  tag-------ct-----ctcacagacac---atccca
                       Baboon  tag-------ct-----ctcacagacac---atccca
                 Green monkey  tag-------ct-----ctcacagacac---acccca
                     Marmoset  tag-------ct-----ctcacagacac---acccca
              Squirrel monkey  tag-------ct-----cttgcagacac---atccca
                     Bushbaby  ttg-------ct-----ctcacagacac---acccca
           Chinese tree shrew  cag-------ca-----ctcacacatat---a-ccca
                     Squirrel  tat-------ct-----ctcacagatag-gcatccta
       Lesser Egyptian jerboa  tag-------ct-----ctcacaaacaa---atctta
                 Prairie vole  tga-------at-----ctctcagacaa---atccca
              Chinese hamster  tgg-------at-----ctctcagacaa---atccca
               Golden hamster  tgg-------at-----ctctcagacaa---atccca
                        Mouse  tag-------at-----ctctcagacaa---atccca
                          Rat  tgg-------at-----ctctcagacaa---atccca
               Naked mole-rat  tgg-------tt-----ct--gaggcac---acccca
                   Guinea pig  tgg-------ct-----tt--caggcac---actcta
                   Chinchilla  tgg-------ct-----ct--gagacac---acccca
             Brush-tailed rat  tgg-------ct-----ctcagagacac---accccg
                       Rabbit  gaaagcagttac-----ctttcagacac---agccca
                         Pika  aaaagcagttac-----ctctcagac-------tcca
                          Pig  tag-------ca-----atcacagacac---actcct
                       Alpaca  tag-------ct-----ctcacagacac---acccca
               Bactrian camel  tag-------ct-----ctcacagacac---acccca
                      Dolphin  tag-------ct-----ctcacagacac---acccca
                 Killer whale  tag-------ct-----ctcacagacac---acccca
             Tibetan antelope  ttg-------ct-----ctcacagacac---acccca
                          Cow  ttg-------ct-----ctcacagacac---atccca
                        Sheep  ttg-------ct-----ctcacagacac---acccca
                Domestic goat  ttg-------ct-----ctcacagacac---acccca
                        Horse  tag-------ct-----ctcacaaacac---accccg
             White rhinoceros  tag-------ct-----gtcacagacat---acccca
                          Cat  tag-------tt-----cttattgacac---acccca
                          Dog  cag-------ct-----cttacacacac---acccca
                      Ferret   tgg-------ct-----cttacagccac---atccca
                        Panda  cag-------ct-----cttacagacac---acccca
               Pacific walrus  tag-------ct-----cttacagacac---acccca
                 Weddell seal  tag-------ct-----cttacagacac---acccca
             Black flying-fox  cag-------ct-----ctcacagacac---acccca
                      Megabat  cag-------ct-----ctcacagacac---acccca
                Big brown bat  tgg-------ct-----ctcccagacac---tctcca
         David's myotis (bat)  tgg-------ct-----ctcacagacgc---tctcca
                     Microbat  tgg-------ct-----ctcacagatgc---tctcca
                     Hedgehog  tgc-------ttacatgctcatagacac---acctca
                        Shrew  tgg-------ct-----ctcacagctaa---actcca
              Star-nosed mole  tga-------ct-----ttcacagctaacacacccca
                     Elephant  -----------------------tatgt---gaccca
          Cape elephant shrew  cca-------ca-----cacacatacac---acccca
                      Manatee  -----------------------gacat---acccaa
             Cape golden mole  -----------------------ggcac---atccca
                       Tenrec  -----------------------gacac---ctccca
                     Aardvark  -----------------------gacac---actcca
                    Armadillo  cta-------tt-----ctcacagacac---acccca
                   Coelacanth  =====================================
                X. tropicalis  =====================================
                 Atlantic cod  =====================================
                  Spotted gar  =====================================
                  Stickleback  =====================================
           Southern platyfish  =====================================
       Yellowbelly pufferfish  =====================================
                         Fugu  =====================================
                    Tetraodon  =====================================
                       Turkey  =====================================
                      Chicken  =====================================
                 Mallard duck  =====================================
           Tibetan ground jay  =====================================
                  Zebra finch  =====================================
       White-throated sparrow  =====================================
              Tasmanian devil  =====================================
     Mexican tetra (cavefish)  =====================================
                    Zebrafish  =====================================
                       Medaka  =====================================
          Pundamilia nyererei  =====================================
                  Zebra mbuna  =====================================
        Burton's mouthbreeder  =====================================
          Princess of Burundi  =====================================
                 Nile tilapia  =====================================
               Painted turtle  =====================================
              Green seaturtle  =====================================
           American alligator  =====================================
                   Budgerigar  =====================================
                      Opossum  -------------------------------------
                  Rock pigeon  =====================================
          Collared flycatcher  =====================================
          Medium ground finch  =====================================
                       Lizard  =====================================
             Peregrine falcon  =====================================
                 Saker falcon  =====================================
                     Platypus  =====================================
     Chinese softshell turtle  =====================================

Inserts between block 17 and 18 in window
B D                    Shrew 310bp
B D                 Elephant 1bp
         Cape elephant shrew 487bp

Alignment block 18 of 435 in window, 46609225 - 46609331, 107 bps 
B D                     Human  cagt-gaaaa------t------------------------------------------------c----
B D                     Chimp  cagt-gaaaa------t------------------------------------------------c----
B D                   Gorilla  cagt-gaaaa------t------------------------------------------------c----
B D                 Orangutan  cagt-gaaaa------t------------------------------------------------c----
B D                    Gibbon  cagt-gaaaa------t------------------------------------------------c----
B D                    Rhesus  cagt-gaaaa------t------------------------------------------------c----
B D       Crab-eating macaque  cagt-gaaaa------t------------------------------------------------c----
B D                    Baboon  cagt-gaaaa------t------------------------------------------------c----
B D              Green monkey  cagt-gaaaa------t------------------------------------------------c----
B D                  Marmoset  cagt-gaaaa------t------------------------------------------------c----
B D           Squirrel monkey  cagt-gaaaa------t------------------------------------------------c----
B D                  Bushbaby  cagt-caaaa------t------------------------------------------------c----
           Chinese tree shrew  cagt-caaaa------t--------------------------------catacacacaagcacac----
B D                  Squirrel  tagc-caaga------t------------------------------------------------c----
       Lesser Egyptian jerboa  cagc-taaaa------g------------------------------------------------t----
                 Prairie vole  caat-caa--------------------------------------------------------------
B D           Chinese hamster  caat-caac-------------------------------------------------------------
               Golden hamster  caat-caaca------a------------------------------------------------c----
B D                     Mouse  caat-ca---------------------------------------------------------------
B D                       Rat  caac-caatc------t------------------------------------------------ctctc
B D            Naked mole-rat  cagt-cagaa------c------------------------------------------------c----
B D                Guinea pig  aggt-caaaa------t------------------------------------------------c----
                   Chinchilla  cagt-caaaa------t------------------------------------------------c----
             Brush-tailed rat  cagt-caaaa------t------------------------------------------------c----
B D