Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 486 in window, 55035438 - 55035626, 189 bps 
B D                   Human  ggcaatccaggcagagggtacaatatcaacaaaatcagggaggtcttaagatgtttac-tgcatttcagg
B D                   Chimp  ggcaatccaggcagagggtacaatatcaacaaaatcagggaggtcttaagatgtttac-tgcatttcagg
B D                 Gorilla  ggcaatccaggcagagggtacaatatcaacaaaatcagggaggtcttaagatgtttac-tgcatttcagg
B D               Orangutan  tgcaatccaggcagagggtacaatatcaacaaaatcagggaggtcttaagatgtttac-tgcatttcagg
B D                  Gibbon  ggcaatccaggcagagggtacaatatcaacaaaatcagggaggtcttaagatgtttac-tgcatttcagg
B D                  Rhesus  ggcaatccaggcagagggtacaatatcaacaaaatcagggaggtcttaagatgtttac-tgcatttcagg
B D     Crab-eating macaque  ggcaatccaggcagagggtacaatatcaacaaaatcagggaggtcttaagatgtttac-tgcatttcagg
B D                  Baboon  ggcaatccaggcaaagggtacaatatcaacaaaatcagggaggtcttacgatgtttac-tgcatttcagg
B D            Green monkey  ggcaatccaggcagagggtacaatatcaacaaaatcagggaggtcttaagatgtttac-tgcatttcagg
B D                Marmoset  ggcaatccagacagagggtacaatatcaacaaaatcagggaggtcttaagatgtttac-tgcatttcagg
B D         Squirrel monkey  gacaatccagacagagggtacaatatcaacaaaatcagggaggtcttaagatgtttac-tgcatttcagg
             Golden hamster  aacaatccaggtagagtatgttatagcaatacgatc--agaggtatg----------------attcagg
B D                   Mouse  agcaatcctgat--agtgtgtaatatcaataaaatctaggtggtataaaagtagttac-tatcactcaga
B D          Naked mole-rat  ggcaatccaggcagaggatgcaatatcaata-aata--agagtttgagaagtatttac-tgtgtttcagg
                 Chinchilla  ggcaatccgg--aaaggacgcagtatcaaca-aaca--agagttttaaagctatttac-tgggtttcagg
B D                   Horse  ggcaatccaggcaaagggtacaatatcaacaaaatcagagaagttcaaaagtgtttac-tgcacttcagg
B D        White rhinoceros  ggcaatacaggcagagggtacaatatcaacaaaatcagagaagtttaaaattgtttacttgcacttcaga
           Black flying-fox  ggcaatccatgcagaaggagcaatatcaacaaaatcagagaggtttaaaattgtttac-tgtgcttcagg
B D                   Shrew  aggaatctaggcaga---------------------agagaaatttaaga-tgtttgc-tgtacttcagg
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                Microbat  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
              Prairie vole  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                Squirrel  ======================================================================
B D                     Pig  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                 Opossum  ======================================================================

                      Human  aacagtgagt--ttt------gtagatgtt--gagggaggaggaagagtctggaattacttgctccgtca
                      Chimp  aacagtgagt--ttt------gtagatgtt--gagggaggaggaagaggctggaattacttgctccgtca
                    Gorilla  aacagtgagt--ttt------gtagatgtt--gagggaggaggaagagtctggaattacttgctccgtca
                  Orangutan  aacagtcagt--ttt------gtagatgct--gagggaggaggaagagtctggaattacttgctcagtca
                     Gibbon  aacagtgagt--ttt------gtagatgtt--gagggaggaggaagagtctggaattacttgctcagtga
                     Rhesus  aacagtgagt--ttt------ctagatgtt--gagggagaaggaagagtctggaattacttgctcagtca
        Crab-eating macaque  aacagtgagt--ttt------ctagatgtt--gagggagaaggaagagtctggaattacttgctcagtca
                     Baboon  aacaatgagt--ttt------ctagatgtt--gagggagaa-gaagagtctggaattacttgctcagtca
               Green monkey  aacagtgagt--ttt------ctagatgtt--gagggagaaggaagagtctggaattacttgctcagtca
                   Marmoset  aacagtgagt--ttt------ctagatgtt--gagggagaaggaagagtctggaattacttgctcagtca
            Squirrel monkey  aacagtgagt--ttt------ctagatgtt--gagggagaaggaagagtctggaattacctgctcagtca
             Golden hamster  agccatgagt--tcc------ctagatact--gaagaaaaaagaagagtgtgcgatt-tctgctaattca
                      Mouse  agccatgact--tcc------ctagatgtt--gaaggagaatggaaagttcaaaattatctgccagttcc
             Naked mole-rat  aatagtgact--ttt------ctaaatgtt--aatggagaaagaagaatctggaatgtcctgctaagtta
                 Chinchilla  aacagtgagtagtcc------ctagatgtt--aatggacaaagaagaatgtgaaattacctggtaaatca
                      Horse  aacaatgagt--tcc------ctagatggtgagggagaacaaaaagagt-cggaattatttgctcagtta
           White rhinoceros  aacagtgagt--tcc------ctagatgttgagagagaacaagaagagt-tggaattacttgctcagtta
           Black flying-fox  aacagtaagt--tcc------ccagatatt-atagagaacaagaagagt-tggaattacttgttcagtta
                      Shrew  cacagtaaac--atcttaaatctagatgtt--gagagaacaa-aacagt-gagaattagttgcttagtca
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                        Pig  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================

                      Human  ctttatg------------gaagatgagatctcatc-ctggtacttggttcttctaaatgttactgcaag
                      Chimp  ctttatg------------gaagatgagatctcatc-ctggtacttggttcttctaaatgttactgcaag
                    Gorilla  ctttatg------------gaagatgagatctcatc-ctggtacttggttcttctaaatgttactgcaag
                  Orangutan  ctttatg------------gaagatgagatctcatc-ctggtacttggttcttctaaatgttactgcaag
                     Gibbon  ctttatg------------gaagatgagatctcatc-ctggtacttggttcttctaaatgtcactgcaag
                     Rhesus  ctatatg------------gaagaagagatctcatc-ctggtacttggttcttctaagtgttacctcaag
        Crab-eating macaque  ctatatg------------gaagaagagatctcatc-ctggtacttggttcttctaagtgttacctcaag
                     Baboon  ctatatg------------ga--gagagatctcatc-ctggtacttggttcttctaagtgttacctcaag
               Green monkey  ctatatg------------gaagaagagatctcatc-ctggtacttgg---ttctaagtgttacctcaag
                   Marmoset  ctttatg------------gaagatgagatctaatc-ctggtgcttggttcttctaagtattactgcaag
            Squirrel monkey  ctttatg------------gaagatgagatctaatc-ctggtacttggttcttctaagtattactgcaag
             Golden hamster  ctttctgatgagtgatctagtgggtgata--------tgggtccttagttcttctgcatgtaattat-ca
                      Mouse  ctttctg------------gtggatgaac--------tgggtccttagttcttctgcatgtcactgtcca
             Naked mole-rat  tttcttg------------gaatatgaaatctcaacttgggtacttggttcttttaagtgttactgtcag
                 Chinchilla  tttcttg------------gaatatgaaatctcagc-tgggtacttggttcttctaggtgttactgcctg
                      Horse  ctttctg------------gaggatgagatctcacc-ctggtgcttggttcttct--gggtcactgccag
           White rhinoceros  ctttctg------------gaggatgagatctcatc-ctggtgcttggttcttctaagagtcactgccag
           Black flying-fox  atttttg------------gaggatgagatcttatc-ttggtgcttggtttttctaagtttcactgccag
                      Shrew  ctttcta------------gaggataagacctcaac------------ttcttctaagtgtcattagcag
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                        Pig  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================

                      Human  aat
                      Chimp  aat
                    Gorilla  aat
                  Orangutan  aat
                     Gibbon  aat
                     Rhesus  aat
        Crab-eating macaque  aat
                     Baboon  aat
               Green monkey  aat
                   Marmoset  aat
            Squirrel monkey  aat
             Golden hamster  gat
                      Mouse  aat
             Naked mole-rat  act
                 Chinchilla  gat
                      Horse  aat
           White rhinoceros  aat
           Black flying-fox  aat
                      Shrew  aat
                       Pika  ===
                     Rabbit  ===
                   Microbat  ===
              Big brown bat  ===
       David's myotis (bat)  ===
               Prairie vole  ===
     Lesser Egyptian jerboa  ===
                   Squirrel  ===
                        Pig  ===
            Tasmanian devil  ===
                    Opossum  ===

Alignment block 2 of 486 in window, 55035627 - 55035645, 19 bps 
B D                   Human  gaacagtgattaagaa---cat
B D                   Chimp  gaacagtgattaagaa---cat
B D                 Gorilla  gaacagtgattaagaa---cat
B D               Orangutan  gaacagtgattaagaa---cat
B D                  Gibbon  gaacagtgattaagaa---cat
B D                  Rhesus  gaacagggattaagaa---cat
B D     Crab-eating macaque  gaacagggattaagaa---cat
B D                  Baboon  gaacagggattaagaa---cat
B D            Green monkey  gaacagggattaagaa---cat
B D                Marmoset  gaacagtgattaagaa---cat
B D         Squirrel monkey  gaacagtgattaagaa---cat
             Golden hamster  gaacacttgctaagaacgt---
B D                   Mouse  gaacaattgctaagaa------
B D          Naked mole-rat  gaatagtggttatgaa------
B D                   Horse  gaatagtggttaagaa---cat
B D        White rhinoceros  gaatagtggttaagaa---cat
           Black flying-fox  gaatagtgattaagaa---tat
B D                   Shrew  gaatagtggctacaaa---cat
B D                    Pika  ======================
B D                  Rabbit  ======================
B D                Microbat  ======================
             Big brown bat  ======================
      David's myotis (bat)  ======================
              Prairie vole  ======================
    Lesser Egyptian jerboa  ======================
B D                Squirrel  ======================
                Chinchilla  ======================
B D                     Pig  ======================
B D         Tasmanian devil  ======================
B D                 Opossum  ======================

Inserts between block 2 and 3 in window
            Golden hamster 3540bp

Alignment block 3 of 486 in window, 55035646 - 55035671, 26 bps 
B D                   Human  cagcc---ctcgagccagattaactgggt
B D                   Chimp  cagcc---ctcgagccagattaactgggt
B D                 Gorilla  cagcc---ctggagccagattaactgggt
B D               Orangutan  cagcc---ctcgagccagattaactgggt
B D                  Gibbon  cagcc---ctcgagccagattaactgggt
B D                  Rhesus  catcc---ctagagccagattaactggat
B D     Crab-eating macaque  catcc---ctagagccagattaactggat
B D                  Baboon  catcc---ctagagccagattaactggat
B D            Green monkey  catcc---ctagagccagattaactggat
B D                Marmoset  taa-----ttaacccaggattgcctgggt
B D         Squirrel monkey  cagcc---ctagagccagattgcctgggt
B D                   Mouse  ----c---ccgcagcccaactgtctgggt
B D          Naked mole-rat  --------------ccagatttcctggtt
B D                   Horse  gggct---ctggagccagactgcctgggt
B D        White rhinoceros  gggcc---ctggagccagactgcctgggt
           Black flying-fox  gagcc---ttggtgccagactgcttgtat
B D                   Shrew  tgatcacactagagtcattgtgcctggtg
B D                    Pika  =============================
B D                  Rabbit  =============================
B D                Microbat  =============================
             Big brown bat  =============================
      David's myotis (bat)  =============================
            Golden hamster  =============================
              Prairie vole  =============================
    Lesser Egyptian jerboa  =============================
B D                Squirrel  =============================
                Chinchilla  =============================
B D                     Pig  =============================
B D         Tasmanian devil  =============================
B D                 Opossum  =============================

Inserts between block 3 and 4 in window
B D                  Mouse 2653bp

Alignment block 4 of 486 in window, 55035672 - 55035802, 131 bps 
B D                   Human  tctgccatttattaactgtgtgaactttgggaggttatttcacctgtctgaatttcagtttccttgtctg
B D                   Chimp  tctgccatttattaactgtgtgaactttgggaggttatttcacctgtctgaatttcagtttccttgtctg
B D                 Gorilla  tctgccatttattaactgtgtgaactttgggaggttatttcacctgtctgaatttcagtttccttgtctg
B D               Orangutan  tctgccatttattaactgtgtgaactttgggaggttacttcacctgtctgaatttcagtttccttgtctg
B D                  Gibbon  tctgccatttattaactgtgtgaactttgggagattacttcacctgtctgaatttcagtttccttgtctg
B D                  Rhesus  tctgccatttattgactgtgtgaactttgggaggttacttcacctgtctgaatttcagtctccttctctg
B D     Crab-eating macaque  tctgccatttattgactgtgtgaactttgggaggttacttcacctgtctgaatttcagtctccttctctg
B D                  Baboon  tctgccatttattgactgtgtgaactttgggaggttacttcacctgtctgaatttcagtctccttctctg
B D            Green monkey  tctgccatttattgactgtgtgaactttgggaggttacttcacctgtctgaatttcggtctccttctctg
B D                Marmoset  tctgccatttattaactgtgtgaacttaaggaggttacttcacctgcctgaatttcagttcccttgtcta
B D         Squirrel monkey  tctgccatttattaactgtgtgaacttagggagcttacttcacctgtctgaatttcagttcccttgtcta
B D          Naked mole-rat  tctgcctttaattaattgtgcagagtttggtaggttatttaacttttatgaatttcagttttctta--ta
B D                   Horse  tccgccattcattaactgtgtgaacttgggtatattacttaacctctctgagcttcaatttccttgtcta
B D        White rhinoceros  tctgtcattctttaactgtgtgaacttgggtaggttacgtaaccattctgagcttcaatttccttgtcta
           Black flying-fox  tctgccattcattaactgtgtgaacttgggtaggttacttaacctctctgagcttcagtttccttgtcta
B D                   Shrew  tgtgccacttagtaacagtatgaaattttatgtattacttaatctcttttagcttttatttagctgtcga
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                Microbat  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
              Prairie vole  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                Squirrel  ======================================================================
                Chinchilla  ======================================================================
B D                     Pig  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                 Opossum  ======================================================================

                      Human  taatatgaagatactga-------taatatctactttatagtgtttttatgaagtgtaaaagagtgaa
                      Chimp  taatatgaagatactga-------taatatctacttcatagtgtttttatgaagtgtaaaagagtgaa
                    Gorilla  taatatgaagatactga-------taatatctactttatagtgtttttatgaagtgtaaaagagtgaa
                  Orangutan  taatatgaagatactga-------taatatctacttaatagtgtttttatgaagtgtaaaagagtgaa
                     Gibbon  taatatgaagatactga-------taatatctacttcatagtgtttttatgaagtgtaaaagagtgaa
                     Rhesus  taatatgaggatattga-------taatatctaattcatagtgtttttatgacgtgtaaaagagtgaa
        Crab-eating macaque  taatatgaggatattga-------taatatctaattcatagtgtttttatgacgtgtaaaagagtgaa
                     Baboon  taatatgaggatatgga-------taatatctaattcatagtgtttttatgacatgtaaaagagtgaa
               Green monkey  taatatgaggatattga-------taatatctaattcatagtgtttttatgacgtgtaaaagagtgaa
                   Marmoset  taatatgaggatactga-------tagtatctacttcatagtgtttttgtgagatgtagaag-gtgaa
            Squirrel monkey  taatatgaggatactga-------taatatctacttcatagtgtttttgtaagatgtagaagagtgaa
             Naked mole-rat  taagatgaagatactgataatatttaatatctacttgacaatg-ttttgtgatgtataaaagagtgaa
                      Horse  taatatggaaatactga-------tgctatctatttgatagtgtttttgtgaggtataaatgagtaaa
           White rhinoceros  taatatggaaatactga-------tagtatctatttgatactgtttttgtgaggtatgaaagagtgaa
           Black flying-fox  taatatggaaatactga-------tagtatctacttgatagaatttttatgaggtgtaaaagagtgaa
                      Shrew  taatatggaaatactga-------tgct----------tagtg-ttttatgatgtataaaagagtgaa
                       Pika  ====================================================================
                     Rabbit  ====================================================================
                   Microbat  ====================================================================
              Big brown bat  ====================================================================
       David's myotis (bat)  ====================================================================
             Golden hamster  ====================================================================
                      Mouse  ====================================================================
               Prairie vole  ====================================================================
     Lesser Egyptian jerboa  ====================================================================
                   Squirrel  ====================================================================
                 Chinchilla  ====================================================================
                        Pig  ====================================================================
            Tasmanian devil  ====================================================================
                    Opossum  ====================================================================

Alignment block 5 of 486 in window, 55035803 - 55035805, 3 bps 
B D                   Human  tct
B D                   Chimp  tct
B D                 Gorilla  tct
B D               Orangutan  tct
B D                  Gibbon  tct
B D                  Rhesus  tct
B D     Crab-eating macaque  tct
B D                  Baboon  tct
B D            Green monkey  tct
B D                Marmoset  tct
B D         Squirrel monkey  tct
B D          Naked mole-rat  tgt
B D                   Horse  tac
B D        White rhinoceros  tat
B D                   Shrew  tat
B D                    Pika  ===
B D                  Rabbit  ===
B D                Microbat  ===
             Big brown bat  ===
      David's myotis (bat)  ===
            Golden hamster  ===
B D                   Mouse  ===
              Prairie vole  ===
    Lesser Egyptian jerboa  ===
B D                Squirrel  ===
                Chinchilla  ===
B D                     Pig  ===
B D         Tasmanian devil  ===
B D                 Opossum  ===

Inserts between block 5 and 6 in window
B D                 Rhesus 28211bp
B D           Green monkey 20416bp
B D               Marmoset 18304bp
B D        Squirrel monkey 13530bp

Alignment block 6 of 486 in window, 55035806 - 55035811, 6 bps 
B D                   Human  gtttaa
B D                   Chimp  ctttaa
B D                 Gorilla  ctttaa
B D               Orangutan  ctttaa
B D                  Gibbon  ctttaa
B D     Crab-eating macaque  ctgcaa
B D                  Baboon  ctgcaa
B D          Naked mole-rat  atgcaa
B D                   Horse  atgcaa
B D        White rhinoceros  acataa
B D                   Shrew  atgtaa
B D                    Pika  ======
B D                  Rabbit  ======
B D                Microbat  ======
             Big brown bat  ======
      David's myotis (bat)  ======
            Golden hamster  ======
B D                   Mouse  ======
              Prairie vole  ======
    Lesser Egyptian jerboa  ======
B D                Squirrel  ======
                Chinchilla  ======
B D                Marmoset  ======
B D         Squirrel monkey  ======
B D            Green monkey  ======
B D                     Pig  ======
B D         Tasmanian devil  ======
B D                 Opossum  ======
B D                  Rhesus  ======

Alignment block 7 of 486 in window, 55035812 - 55035812, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D          Naked mole-rat  a
B D                   Horse  a
B D        White rhinoceros  a
B D                    Pika  =
B D                  Rabbit  =
B D                Microbat  =
             Big brown bat  =
      David's myotis (bat)  =
            Golden hamster  =
B D                   Mouse  =
              Prairie vole  =
    Lesser Egyptian jerboa  =
B D                Squirrel  =
                Chinchilla  =
B D                Marmoset  =
B D         Squirrel monkey  =
B D            Green monkey  =
B D                     Pig  =
B D         Tasmanian devil  =
B D                 Opossum  =
B D                  Rhesus  =

Inserts between block 7 and 8 in window
B D    Crab-eating macaque 29028bp
B D                 Baboon 29131bp
B D                  Horse 53392bp
B D       White rhinoceros 86651bp

Alignment block 8 of 486 in window, 55035813 - 55036859, 1047 bps 
B D                   Human  gtagttttttccaattctgtgaagaaagtcattggtagcttgatggggatggcattgaatctataaatta
B D                   Chimp  gtagttttttccaattctgtgaagaaagtcattggtagcttgatggggatggcattgaatctataaatta
B D                 Gorilla  gtagttttttccaattctgtgaagaaagtcattggtagcttgatggggatggcattgaatctataaatta
B D               Orangutan  gtagttttttccaattctgtgaagaaagtcattggtagcttgatggggatgggattgaatctataaatta
B D                  Gibbon  gtagttttttccaattcagtgaagaaagtcattggtagcttgatggggatggcattgaatctataaatta
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                Microbat  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
              Prairie vole  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                Squirrel  ======================================================================
                Chinchilla  ======================================================================
B D                   Horse  ======================================================================
B D                Marmoset  ======================================================================
B D        White rhinoceros  ======================================================================
B D         Squirrel monkey  ======================================================================
B D            Green monkey  ======================================================================
B D                     Pig  ======================================================================
B D     Crab-eating macaque  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                 Opossum  ======================================================================
B D                  Rhesus  ======================================================================
B D                  Baboon  ======================================================================

                      Human  ccttgggcagtatggccattttcacgatattgattcttcctacccattagcatggaatgttcttccattt
                      Chimp  ccttgggcagtatggccattttgacgatattgattcttcctacccatgagcatggaatgttcttccattt
                    Gorilla  ccttgggcagtatggacattttcacgatattgattcttcctacccatgagcatggaatgttcttccattt
                  Orangutan  ccttgggcagtatggccattttcacgatattgattcttcctacccatgagcatggaatgttcttccattt
                     Gibbon  ccttgggtggtatggccattttcacgatattgattcttcctacccatgagcatggaatgttcttccatct
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  gtttttatcctcttttatttccttgagcagtggtttgtagttctccttgaagaagtccttcacatccctt
                      Chimp  gtttttatcctcttttatttccttgagcagtggtttgtagttctccttgaagaagtccttcacatccctt
                    Gorilla  gtttttatcctcttttatttcattgagcagtggttggtagttctccttgaagaggtccttcacatccctt
                  Orangutan  gtttgtatcctcttttatttcattgagcagtggtttgtagttctccttgaagaggtccttcacatccctt
                     Gibbon  gtttgtatcctctttgatttcattgagcagtggtttgtagttctccttgaagaagtccttcacatccctt
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  gtaagctggattcctaggtattttattctctttgaagcaattgtgaatgggagttcactcatgatttggc
                      Chimp  gtaagctggattcctaggtattttattctctttgaagcaattgtgaatgggagttcactcatgatttggc
                    Gorilla  gtaagttggattcctaggtattttattctctttgaagcaattgtgaatgggagttcactcatgatttggc
                  Orangutan  gtaagctggattcctaggtattttattctctttgaagcaattgtgaatgggagttcattcatgatttggc
                     Gibbon  gtaagttggattcctaggtattttattctctttgaagcaattgtgaatgggagttcactcatgatttggc
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  tctctgtttgtctgttatttgtgtataagaatgcttgtgatttttacacattgcttttgtattctgagac
                      Chimp  tctctgtttgtctgttattggtgtataagaatgcttgtgatttttacacattgcttttgtatcctgagac
                    Gorilla  tctctgtttgtctgttatttgtgtataagaatgcttgtgatttttacacattgcttttgtattctgagac
                  Orangutan  tctctgtttgcctgttattggtgtataagaatgcttgtgatttttgcacattgattttgtatcctgagac
                     Gibbon  tctctgtttgtctgttattggtatatgagaatgcttgtgatttttgcacattgattttgtatgctgagac
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  tttgctgaagttgcctatcagcttaaggagattttgggctgagacaatggggttttctagatatacaatc
                      Chimp  tttgctgaagttgcctatcagcttaaggagattttgggctgagacaatggggttttctagatatacaatc
                    Gorilla  tttgctgaagttgcctatcagcttaaggagattttgggctgagacaatggggttttctagatatacaatc
                  Orangutan  --tgctgaagttgcctatcagcttaaggagattttgggctgagacaatggggttttctagatatacaatc
                     Gibbon  tttgctgaacttgcctatcagcttaaggagattttgggctgagacgatggggttttctacatatagaatc
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  atgtcatctgcaaacagggacaatttaacttcctcttttcctaattgaatgccctttatttccttctcct
                      Chimp  atatcatctgcaaacagggtcaatttgacttcctcttttcctaattgaatgccctttatttccttctcct
                    Gorilla  atgtcatctgcaaacagggacaatttaacttcctcttttcctaattgaatgccctttatttccttctcct
                  Orangutan  atgtcatctgcaaacagggacaatttgacttcctcttttcctaattgaatgccctttatttccttctcct
                     Gibbon  atgtcatctgcaaacaagaacaatttgacttcctcttttcctaattgaataccctttatttccttctcct
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  gcctgattgccctggccagaacttccaacactatgttgaataggagtggtgagagagggcatccctgtct
                      Chimp  tcctgattgccctggccagaacttccaacactatgttgaataggggtggtgagagagggcatccccgtct
                    Gorilla  gcctgattgccctggccagaacttccaacactatgttgaataggagtggtgagagagggaatccctgtct
                  Orangutan  gcctgattgtcctggccagaacttacaacactatgttgaataggagtggtgagagagggaatccctgtct
                     Gibbon  gccggattgccctggccagaacttcgaacactatgttgaataggagtggtgagaaagggcatccctgtct
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  tgtgccagttttcaaagggaatgcttccagtttttgtccattcagtatgatactggctgtgggtttgtca
                      Chimp  tgtgccagttttcaaagggaatgcttccagtttttgtccattcagtatgatactggctgtgggtttgtca
                    Gorilla  tgtgccagttttcaaagggaatgcttccagtttttgtccattcagtatgatactggctgtgggtttgtca
                  Orangutan  tgtgccagttttcaaaaggaatgcttccagtttttgcccattgagtatgatattggctgttggtttgtca
                     Gibbon  tgtgccagttttcaaagggaatgcttccagtttttgcccattcagtatgatattggctgtgggtttgtca
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  tagatagctcttattattttgagatacatcccatcaatacctaatttattgagagtttttagcatgaagg
                      Chimp  tagatagctcttattattttgagatacatcccatcaatacctaatttattgagagtttttagcatgaagg
                    Gorilla  tagagagctcttattattttgaaatacatcccatcaatacctaatttattgagagtttttagcatgaagg
                  Orangutan  tagatagctcttattattttgagatacatcccatcaatacctaatttattgagagtttttagcatgaagt
                     Gibbon  tagatagctcttattattttgagatacgtcccatcaatacctaatttattgagagtttttagcatgaagg
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  gttgttgaattttgtcaaaggccttttctgcatctattgagaaagttcatatggaaccaaaaaagagccc
                      Chimp  gttgttgaattttgtcaaaggccttttctgcatctattgagaaagttcatatggaaccaaaaaacagccc
                    Gorilla  gttgttgaattttgtcaaaggccttttctgcatctattgagaaagttcatatggagccaaaaaagagccc
                  Orangutan  gctgttgaattttgtcaaaggccttttctgcatctattgagaaagttcatatggaaccaaaaaagagccc
                     Gibbon  gctgctgaattttgtcaaaggccttttctgcatgtattgagaaagttcatatggaaccaaaaaagagccc
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  gcattgccaagtcaatcctaagccaaaagaacaaaactggaagcatcacgctacctgacttcaaactata
                      Chimp  gcattgccaagtcaatcctaagccaaaagaacaaaactggaagcatcacgctacctgacttcaaactata
                    Gorilla  gcattgccaagtcaatcctaagccaaaagaacaaaactggaagcatcacgctacctgacttcaaactata
                  Orangutan  gcattgccaagtcaatcctaagccaaaagaacaaagctggaagcatcacactacctgacttcaaactata
                     Gibbon  gcattgcccagtcaatcctaagccaaaagaacaaagctggaagcatcacactacctgagttcaaactata
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  ctacaaggctacagtaaccaaaacagcatggtactggtaccaaaacagagatatagatcaatggaacaga
                      Chimp  ctacaaggctacagtaaccaaaagagcatggtactggtaccaaaacagagatatagaccaatggaacaga
                    Gorilla  ctacaaggctacagtaaccaaaacagcatggtactggtaccaaaacagagatatagaccaatggaacaga
                  Orangutan  ctacaaggctacagtaaccaaaacagcatggtactggtaccaaagaagagatatagatcaatggaacaga
                     Gibbon  ctacaaggctacggtaaccaaaacagcatggtactggtaccaaaacagagatatagaccaatggaacaga
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  acagagccctcagaaataatgctgtatatctacaaccatctgatctttgacaaacctgacaaaaacaagc
                      Chimp  acagagccctcagaaataatgctgtatatctacaaccatctgatctttgacaaacctgacaaaaacaagc
                    Gorilla  acagagccctcagaaataatgctgtatatctacaaccatctgatctttgacaaacctgagaaaaacaagc
                  Orangutan  acagagccctcagaaataatgctgtatatctacaaccatctgatctttgacaaacctgagaaaaacaaga
                     Gibbon  acagagccctcagaaataatgccgcatatctacaaccatctgatctttgacaaacttaacaaaaacaaga
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  aatggggaaaggattccctatttaataaatggtgctgggaaaactggctagccatatgtagaaagct
                      Chimp  aatggggaaaggattccctatttaataagtggtgctgggaaaactggctagccatatgtagaaagct
                    Gorilla  aatggggaaaggattccctatttaataaatggtgctgggaaaactggctagccatatgtagaaagct
                  Orangutan  aatggggaaaggattccctatttaataaatggtgctgggaaaactggctagccatatgtagaaagct
                     Gibbon  aatggggaaatgattccctatttaataaatggtgctgggaaaactggctagccatatgtagaaagct
                       Pika  ===================================================================
                     Rabbit  ===================================================================
                   Microbat  ===================================================================
              Big brown bat  ===================================================================
       David's myotis (bat)  ===================================================================
             Golden hamster  ===================================================================
                      Mouse  ===================================================================
               Prairie vole  ===================================================================
     Lesser Egyptian jerboa  ===================================================================
                   Squirrel  ===================================================================
                 Chinchilla  ===================================================================
                      Horse  ===================================================================
                   Marmoset  ===================================================================
           White rhinoceros  ===================================================================
            Squirrel monkey  ===================================================================
               Green monkey  ===================================================================
                        Pig  ===================================================================
        Crab-eating macaque  ===================================================================
            Tasmanian devil  ===================================================================
                    Opossum  ===================================================================
                     Rhesus  ===================================================================
                     Baboon  ===================================================================

Alignment block 9 of 486 in window, 55036860 - 55037455, 596 bps 
B D                   Human  gaaactggatcccttccttacaccttatacaaaaattaattcaagatggattaaagacttacatgttaga
B D                   Chimp  gaaactagatcccttccttacaccttatacaaaaattaattcaagatggattaaagacttacatgttaga
B D                 Gorilla  gaaactggatcccttccttacaccttatacaaaaattaattcaagatggattaaagacttacatgttaga
B D               Orangutan  gaaactggatcccttccttacaccttacacaaaaattaattcaagatggatgaaagacttacatgttaga
B D                  Gibbon  gaaactggatctcttccttacaccttatacaaaaattaattcaagatggatgaaagacttaaatgttaga
B D         Tasmanian devil  gaaccaggctgtttcccaaacacagcagacaaagccaccccctacaaacacaaaagggcctctgttcaaa
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                Microbat  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
              Prairie vole  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                Squirrel  ======================================================================
                Chinchilla  ======================================================================
B D                   Horse  ======================================================================
B D                Marmoset  ======================================================================
B D        White rhinoceros  ======================================================================
B D         Squirrel monkey  ======================================================================
B D            Green monkey  ======================================================================
B D                     Pig  ======================================================================
B D     Crab-eating macaque  ======================================================================
B D                 Opossum  ======================================================================
B D                  Rhesus  ======================================================================
B D                  Baboon  ======================================================================

                      Human  cctaaaaccataaaaaccctagaagaaaacctagg-caataccattcaggacataggcatgggcaaggac
                      Chimp  cctaaaaccataaaaaccctagaagaaaacctagg-caataccattcaggacataggcttgggcaaggac
                    Gorilla  cctaaaaccataaaaaccctagaagaaaacctagg-caataccattcaggacataggcatgggcaaggac
                  Orangutan  cctaaaaccataaaaaccctagaagaaaacctaga-cattaccattcaggacacaggcatgggcaaggac
                     Gibbon  cctaaaaccataaaaaccctagaagaaaacctagg-caataccattcaggacataggcatgggcaaggac
            Tasmanian devil  gccaaggc--tcagagctgcatagggaagcttgggatagtgccacccttaccccaagagt------ggag
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  ttcatgtctaaaacaccaaaagcaatggcaacaaaagccaaaacagacaaatgggatctaattaaactaa
                      Chimp  ttcatgtctaaaacaccaaaagcaatggcaacaaaagccaaaacagacaaatgggatctaattaaactaa
                    Gorilla  ttcatgtctaaaacaccaaaagcaatggcaacaaaagccaaaacagacaaatgggatctaatgaaactaa
                  Orangutan  ttcatgtctaaaacaccaaaagcaatggcaacaaaagccaaaattgac-aatgggatctaattaaactca
                     Gibbon  ttcatgtctaaaacaccaaaagcaatggcaacaaaagccaaaattgacaaatgggatctaattaaactca
            Tasmanian devil  ttttaccctaaaagtaaaaaaaaaa----aaaaaaaacttaaacagcagaat-----------aaaccaa
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  agagcttctgcacagcaaaagaaactaccatcagggcgaacag----------------gcaacctacag
                      Chimp  agagcttctgcacagcaaaagaaactaccatcagggcgaacag----------------gcaacctacag
                    Gorilla  agagcttctgcacagcaaaagaaactaccatcagagcgaacag----------------gcaacctacaa
                  Orangutan  agagcttctgcacagcaaaagaaac-accatcagagtgaacag----------------gcaacctatgg
                     Gibbon  agagcttctgcacagcaaaagaaaccaccatcagagtgaacag----------------gcaacctacag
            Tasmanian devil  at------------gcaaaaaaaagagatacaaaggttaactgaataaaatcacacattgaaaacta--g
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  aatgggagaaaatttttgcaatctactcatctgacaaagggctaatatccagaat--ctacaatgaactc
                      Chimp  aatgggagaaaatttttgcaatctactcatctgacaaagggctaatatccagaat--ctacaatgaactc
                    Gorilla  aatgggagaaaatttttgcaatctactcatctgacaaagggctaatatccagaat--ctacaatgaactc
                  Orangutan  aatgggagaacatttttgcaatctactcatctgacaaagggctaatatccagaat--ctacaatgaactc
                     Gibbon  aatgggagaaaatttttgcaatctactcatctgacaaagggctaatatccagaat--ctacaatgaactc
            Tasmanian devil  aatagggcaaa-----tgtaagctaatgacattatga------aatagcaagaatcactcaaacaaactg
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  aaacaaattgacaagaaaaaaa----caaacaaccccatc-----aaaaagtgggcaaaggata------
                      Chimp  caacaaattgacaagaaaaaaa----caaacaaccccatc-----aaaaagtgggcaaaggaca------
                    Gorilla  caacaaatcaacaagaaaaaaa----caaacaaccccatc-----aaaaagtgggcaaaggaca------
                  Orangutan  aaacaaatttacaagaaaaaca----caaacaaccccatc-----aaaaagtgggcgaaggata------
                     Gibbon  aaacaaatttgcaagaaaaaaa----caaacaaccccatc-----aaaaagtgggcaaaggata------
            Tasmanian devil  aaaataatgaacaaaggaagaaaatgtaaaatacctcattggcaaaaaaagcagataaggaaaagagata
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  -tgaacagacacttctcaaaagaagacatttatgcagccaaaagacatatgaaaaaatgctcatcatcac
                      Chimp  -tgaacagacacttctcaaaagaagacatttatgcagccaaaagacacgtgaaaaaatgctcatcatcac
                    Gorilla  -tgaacagacacttctcaaaagaagacatttatgcagccaaaagacacatgaaaaaatgctcatcatcac
                  Orangutan  -tgagcagacacttctcaaaagaagacatttatgcagccaaaagacacatgaaaaaatgctcatcgtcac
                     Gibbon  -tgaacagacacttctcaaaagaagacatttatgcagccaaaagacacatgaaaaagtgctcatcatcac
            Tasmanian devil  ccgtaaagacaattt-----aaaaattattggcctacctgaaggacatgacaaaaaaaagcctggataac
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  tggccatcagagaaatgcaaatcaaaa--------ccacaatgggataccatctcacaccagttagaatg
                      Chimp  tgaccatcagagaaatgcaaatcaaaa--------ccacaatgagataccatctcacaccagttagaatg
                    Gorilla  tggccatcagagaaatgcaaatcaaaa--------ccacaatgagataccatctcacaccagttagaatg
                  Orangutan  tggccatcagagaaatgcaaattaaaa--------ccacaatgagataccatctcacaccagttagaatg
                     Gibbon  tagccatcagagaaatgcaaatcaaaa--------ccacaatgagatgccgtctcacaccagttagaatg
            Tasmanian devil  attctataaggtgggcacacaccgcccttcaccctcctcaacaaagtaacttcccatacc--taataata
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  gcaatcattaaaaagtcagg-aaacaacaggtgctggagaggatgtggagaaataggaacacttttacac
                      Chimp  gcgatcgttagaaagtcagg-aaacaacaggtgctggagaggatgtggagaaataggaacacttttacac
                    Gorilla  gcgatccttagaaagtcagg-aaacaacaggtgctggagaggatgtggagaaataggaacacttttacac
                  Orangutan  gcaatcattaaaaagtcagg-aaacaacaggtgctggagaggatgtggagaaataggaacacttttacac
                     Gibbon  gcaatcattaaaaagtcaggaaaacaacaggtgctggagaggatgtggaaaaataggaacacttttacac
            Tasmanian devil  gta--tgccaaaaagaggag-aaaagtcataacatggtaagtgtactggaaagt----gcacttgaatt-
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
                    Opossum  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  tgttggtggg
                      Chimp  cgttggtggg
                    Gorilla  tgttggtggg
                  Orangutan  tgttggtggg
                     Gibbon  tgttggtggg
            Tasmanian devil  ----------
                       Pika  ==========
                     Rabbit  ==========
                   Microbat  ==========
              Big brown bat  ==========
       David's myotis (bat)  ==========
             Golden hamster  ==========
                      Mouse  ==========
               Prairie vole  ==========
     Lesser Egyptian jerboa  ==========
                   Squirrel  ==========
                 Chinchilla  ==========
                      Horse  ==========
                   Marmoset  ==========
           White rhinoceros  ==========
            Squirrel monkey  ==========
               Green monkey  ==========
                        Pig  ==========
        Crab-eating macaque  ==========
                    Opossum  ==========
                     Rhesus  ==========
                     Baboon  ==========

Inserts between block 9 and 10 in window
B D                Gorilla 1424bp

Alignment block 10 of 486 in window, 55037456 - 55037564, 109 bps 
B D                   Human  actggaaactagttcaaccattgtggaagtcagtgtggcgattcctcagggatctagaactagaa-atac
B D                   Chimp  actgtaaactagttcaaccattgtggaagtcagtgtggcgattcctcagggatctagaactagaa-atac
B D               Orangutan  actgtaaactagttcaaccattgtggaagtcagtgtggcgactcctcagggatctagaactagaa-atac
B D                  Gibbon  actggaaactagttcaaccattgtggaagtcagtgtggcaattcctcagggatctagaactagaa-atac
B D         Tasmanian devil  accaaaatgtagttta---------------aataaagcgttt-------agtttacatctaaaagattt
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                Microbat  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
              Prairie vole  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                Squirrel  ======================================================================
                Chinchilla  ======================================================================
B D                   Horse  ======================================================================
B D                Marmoset  ======================================================================
B D        White rhinoceros  ======================================================================
B D         Squirrel monkey  ======================================================================
B D            Green monkey  ======================================================================
B D                 Gorilla  ======================================================================
B D                     Pig  ======================================================================
B D     Crab-eating macaque  ======================================================================
B D                 Opossum  ======================================================================
B D                  Rhesus  ======================================================================
B D                  Baboon  ======================================================================

                      Human  catttgacccagcaatcccattactgggtatatacccaaa-----
                      Chimp  catatgacccagcaatcccattactgggtatatacccaaa-----
                  Orangutan  catttgacccagccatcccattactgggtatatacccaaa-----
                     Gibbon  catttgacccagccatcccattactgggtatatacccaaa-----
            Tasmanian devil  cagctaaccctg----accatt-ttgagtg-aaacctaatcctac
                       Pika  =============================================
                     Rabbit  =============================================
                   Microbat  =============================================
              Big brown bat  =============================================
       David's myotis (bat)  =============================================
             Golden hamster  =============================================
                      Mouse  =============================================
               Prairie vole  =============================================
     Lesser Egyptian jerboa  =============================================
                   Squirrel  =============================================
                 Chinchilla  =============================================
                      Horse  =============================================
                   Marmoset  =============================================
           White rhinoceros  =============================================
            Squirrel monkey  =============================================
               Green monkey  =============================================
                    Gorilla  =============================================
                        Pig  =============================================
        Crab-eating macaque  =============================================
                    Opossum  =============================================
                     Rhesus  =============================================
                     Baboon  =============================================

Inserts between block 10 and 11 in window
B D                 Gibbon 1148bp

Alignment block 11 of 486 in window, 55037565 - 55037977, 413 bps 
B D                   Human  ggattataaatgatgctgctataaagacacatgcgcatgtatgtttattgcggcactattcacaatagca
B D                   Chimp  ggattataaatcatgctgctataaagacacatgcacacgtatgtt-----------tattcacaatagca
B D               Orangutan  ggattataaatcatgctgctataaagacacatgaacatgtacgtttattgcggcactattcacaatagca
B D         Tasmanian devil  ---atctaactaattaagctattta-ccacacacttcaaaacatt-----------tattcatcttagta
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                Microbat  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
              Prairie vole  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                Squirrel  ======================================================================
                Chinchilla  ======================================================================
B D                   Horse  ======================================================================
B D                Marmoset  ======================================================================
B D        White rhinoceros  ======================================================================
B D         Squirrel monkey  ======================================================================
B D            Green monkey  ======================================================================
B D                 Gorilla  ======================================================================
B D                     Pig  ======================================================================
B D     Crab-eating macaque  ======================================================================
B D                 Opossum  ======================================================================
B D                  Gibbon  ======================================================================
B D                  Rhesus  ======================================================================
B D                  Baboon  ======================================================================

                      Human  aagact-tgga----accaacccaaatgtccaacaatgatagactggatgaagaaaatgtggcacatata
                      Chimp  aagact-tgga----accaacccaaatgtccaacaatgatagactggattaagaaaatgtggcacatatg
                  Orangutan  aagact-tgga----accaagccaaatgtccaacaatgatagactggattaagaaaatgtggcacatatg
            Tasmanian devil  taggtgatggaatatatcaacccataggcatgataatgaaa----gtaccaagagg-------------g
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                    Gorilla  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
                    Opossum  ======================================================================
                     Gibbon  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  cactatggaatact-----atgc-agccataaaaaaggatgagt-----tcat-ttctttgtagggacat
                      Chimp  cactatggaatact-----atgc-agccataaaaaatgatgagt-----tcatgtcctttgtagggacat
                  Orangutan  cactatggaatact-----atgc-agccgtaaaaaatggtgagt-----tcatgtcctttgtagggacat
            Tasmanian devil  cactttgaaagattccatcgtgcaagtgacaaaaagcaaagattaaaccttataccttttgc--------
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                    Gorilla  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
                    Opossum  ======================================================================
                     Gibbon  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  ggatgaagctggaaaccatcattcttagcaaactatcacaaggacaaaaaaccaaacaccgcatgttctc
                      Chimp  ggatgaagctggaaaccatcattctcagcaaactatcgcaaggacaaaaatccaaacaccgcatgttccc
                  Orangutan  ggatgaagctggaaaccatcattctcagcaaactattgcaaggacaaaaaaccaaacaccacatgttctc
            Tasmanian devil  --ataaagatttagccagtcaaactggacaaa-------aagaattaaagcccatcttccccaaatt---
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                    Gorilla  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
                    Opossum  ======================================================================
                     Gibbon  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  actcataggtgggaattgaacaat--gagaacacatggacacaggaaggggaacatcacacactggggcc
                      Chimp  actcataggtgggaattgaacaat--gagaacacacggacacaggaaggggaacatcacacaatggggcc
                  Orangutan  actcataggtgggaattgaacaat--gagaacacatggacacaggaaggggaacatcacacaccggggcc
            Tasmanian devil  -------------aagtgagctattgtagaacaattgt--------------------cagaatgaacct
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                    Gorilla  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
                    Opossum  ======================================================================
                     Gibbon  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  tgttgtggggtggggggaggggggagggatagcattaggag---------atatacttaatgctaaatga
                      Chimp  tgttgtgggatggggggaggggggaggtgtagcattaggag---------atatacctaatgttaaatga
                  Orangutan  tgttgtggggtgggaggagtgggggggggtagcattagtag---------atatacctaatgttaaatgt
            Tasmanian devil  gactatgtggc-aaaatagtgaggtgattttacagtaggggtaaaaatctatgaatttaagttcaacttt
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                   Marmoset  ======================================================================
           White rhinoceros  ======================================================================
            Squirrel monkey  ======================================================================
               Green monkey  ======================================================================
                    Gorilla  ======================================================================
                        Pig  ======================================================================
        Crab-eating macaque  ======================================================================
                    Opossum  ======================================================================
                     Gibbon  ======================================================================
                     Rhesus  ======================================================================
                     Baboon  ======================================================================

                      Human  tgagttaatgggtgcagcaca
                      Chimp  cgagttaatgggtgcagcaca
                  Orangutan  cgagttactgggtgcagcaca
            Tasmanian devil  aaatttaactcaagtactaa-
                       Pika  =====================
                     Rabbit  =====================
                   Microbat  =====================
              Big brown bat  =====================
       David's myotis (bat)  =====================
             Golden hamster  =====================
                      Mouse  =====================
               Prairie vole  =====================
     Lesser Egyptian jerboa  =====================
                   Squirrel  =====================
                 Chinchilla  =====================
                      Horse  =====================
                   Marmoset  =====================
           White rhinoceros  =====================
            Squirrel monkey  =====================
               Green monkey  =====================
                    Gorilla  =====================
                        Pig  =====================
        Crab-eating macaque  =====================
                    Opossum  =====================
                     Gibbon  =====================
                     Rhesus  =====================
                     Baboon  =====================

Alignment block 12 of 486 in window, 55037978 - 55037998, 21 bps 
B D                   Human  ccaacatggcacatgtataca
B D                   Chimp  ccaacatggcacatgtataca
B D                 Gorilla  ccagcatggcacatgtataca
B D               Orangutan  ccaacatggcacatgtataca
B D         Tasmanian devil  caaatgtaacttaaatttaaa
B D                    Pika  =====================
B D                  Rabbit  =====================
B D                Microbat  =====================
             Big brown bat  =====================
      David's myotis (bat)  =====================
            Golden hamster  =====================
B D                   Mouse  =====================
              Prairie vole  =====================
    Lesser Egyptian jerboa  =====================
B D                Squirrel  =====================
                Chinchilla  =====================
B D                   Horse  =====================
B D                Marmoset  =====================
B D        White rhinoceros  =====================
B D         Squirrel monkey  =====================
B D            Green monkey  =====================
B D                     Pig  =====================
B D     Crab-eating macaque  =====================
B D                 Opossum  =====================
B D                  Gibbon  =====================
B D                  Rhesus  =====================
B D                  Baboon  =====================

Inserts between block 12 and 13 in window
B D        Tasmanian devil 1bp

Alignment block 13 of 486 in window, 55037999 - 55038049, 51 bps 
B D                   Human  tatgtaacaaacctgcacattgtgcacatgtaccctaaaacttaaagtata
B D                   Chimp  tatgtaacaaacctgcacgttgtgcacatgtaccctaaaacttaaagtata
B D                 Gorilla  tatgtaacatacctgcacgttgtgcacatgtaccctaaaacttaaagtata
B D               Orangutan  tatgtaactaacctgcacgttgtgcacatgtaccctaaaactgaaagtata
B D                 Opossum  tatataatacatgcttacatcat---cctattccatttaaatcaaattaaa
B D         Tasmanian devil  gctattaaaaaggggaacaac-t---cttttgacatgtaaa-caaacttcc
B D                    Pika  ===================================================
B D                  Rabbit  ===================================================
B D                Microbat  ===================================================
             Big brown bat  ===================================================
      David's myotis (bat)  ===================================================
            Golden hamster  ===================================================
B D                   Mouse  ===================================================
              Prairie vole  ===================================================
    Lesser Egyptian jerboa  ===================================================
B D                Squirrel  ===================================================
                Chinchilla  ===================================================
B D                   Horse  ===================================================
B D                Marmoset  ===================================================
B D        White rhinoceros  ===================================================
B D         Squirrel monkey  ===================================================
B D            Green monkey  ===================================================
B D                     Pig  ===================================================
B D     Crab-eating macaque  ===================================================
B D                  Gibbon  ===================================================
B D                  Rhesus  ===================================================
B D                  Baboon  ===================================================

Inserts between block 13 and 14 in window
B D                  Chimp 10058bp
B D              Orangutan 10282bp

Alignment block 14 of 486 in window, 55038050 - 55038076, 27 bps 
B D                   Human  ttaat--aaaaaat-aa---aaataaaaaaaag
B D                 Gorilla  ataat--aaaaaat-aa---aaataaaaaaaag
B D               Orangutan  ataattaaaaaaataaa---aaataaaacaaat
B D                 Opossum  -----ttaaat--t-aatgtaactgattgggga
B D         Tasmanian devil  -----ttagaggat-aatg-aaatatatacaaa
B D                    Pika  =================================
B D                  Rabbit  =================================
B D                Microbat  =================================
             Big brown bat  =================================
      David's myotis (bat)  =================================
            Golden hamster  =================================
B D                   Mouse  =================================
              Prairie vole  =================================
    Lesser Egyptian jerboa  =================================
B D                Squirrel  =================================
                Chinchilla  =================================
B D                   Horse  =================================
B D                Marmoset  =================================
B D        White rhinoceros  =================================
B D         Squirrel monkey  =================================
B D            Green monkey  =================================
B D                     Pig  =================================
B D                   Chimp  =================================
B D     Crab-eating macaque  =================================
B D                  Gibbon  =================================
B D                  Rhesus  =================================
B D                  Baboon  =================================

Alignment block 15 of 486 in window, 55038077 - 55038104, 28 bps 
B D                   Human  aaaaactgc--------aagatgaaaactgtcaac-a
B D                 Gorilla  aaaaactgc--------aagatgaaaactgtcacc-a
B D               Orangutan  aaaaactgc--------aagatgaaaactgtcacc-a
B D                  Rhesus  aaaaagtgc--------aagatgaaaactgtcacg-a
B D     Crab-eating macaque  aaaaagtgc--------aagatgaaaactgtcacg-a
B D                  Baboon  aaaaagtgc--------aagatgaaaactgccacg-a
B D            Green monkey  aaaaagtgc--------aagatgaaaactgtcaca-a
B D                Marmoset  aaaaactga--------aagatgaaaac-gtcatc-a
B D         Squirrel monkey  aaaaactga--------aagatgaaaactgtcatc-a
B D                   Horse  aaaagccat--------aagatgacccctatcccc-c
B D        White rhinoceros  aaaagccac--------gaaatgacaactatcctc-c
B D                 Megabat  aaaaaacac--------aagatgacaatgatcccctc
B D                 Opossum  -ggaattgt-----tataggaaggaaacattcagg-g
B D         Tasmanian devil  -aacattgtaagcctaaaagcagccaccaattaag-a
B D                    Pika  =====================================
B D                  Rabbit  =====================================
B D                Microbat  =====================================
             Big brown bat  =====================================
      David's myotis (bat)  =====================================
            Golden hamster  =====================================
B D                   Mouse  =====================================
              Prairie vole  =====================================
    Lesser Egyptian jerboa  =====================================
B D                Squirrel  =====================================
                Chinchilla  =====================================
B D                     Pig  =====================================
B D                   Chimp  =====================================
B D                  Gibbon  =====================================

Inserts between block 15 and 16 in window
B D                  Horse 2bp
B D       White rhinoceros 2bp
B D                Megabat 2bp

Alignment block 16 of 486 in window, 55038105 - 55038310, 206 bps 
B D                   Human  -----------aattccatccacatcctcccc-tatccccagcaaatccc--------tccctgccccac
B D                   Chimp  -----------aattccatccacatcctcccc-tatccccagcaaatccc--------tccctgccccac
B D                 Gorilla  -----------aattccatccacatcctcccc-tatccccagcaaatccc--------tccctgccccac
B D               Orangutan  -----------aattccatccacatcctcccc-tatccccagcaaatccc--------tccctgccccac
B D                  Rhesus  -----------aattccatccacatcctccct-tatccccagcaaatccc--------tccctgccccac
B D     Crab-eating macaque  -----------aattccatccacatcctccct-tatccccagcaaatccc--------tccctgccccac
B D                  Baboon  -----------aattccatccacatcctccct-tatcctcagcaaatccc--------tccctgccccac
B D            Green monkey  -----------aattccatccacatcctccct-tatccccagcaaatccc--------tccctgccccac
B D                Marmoset  -----------aattccatccacttcc-cccc-catcccaagcaaatccc--------tcccag-cccac
B D         Squirrel monkey  -----------aattccatccacttcctcccc-tatccccagcaaatccc--------tcctag-cccac
B D                   Horse  -----------aattccatccccttcctcttcctatccccagtagatgct--------tcccagcccaaa
B D        White rhinoceros  -----------aattaaatatcct---------tatccccagttgatgct--------tcccagaccaaa
B D                 Megabat  -----------aattccaccctcttcctccccctatccccagtagatgcc--------tctgagcccaaa
B D                 Opossum  cattttataaacattacattc-tttcttatat-tacacc---tatatccatattaattttataatttttg
B D         Tasmanian devil  aagtgt-taaagctcaaactcacctattattt-aatccc--agaaatcca--------tcaaaatcccta
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                Microbat  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
              Prairie vole  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                Squirrel  ======================================================================
                Chinchilla  ======================================================================
B D                     Pig  ======================================================================
B D                  Gibbon  ======================================================================

                      Human  cacccaagaaaacctggaaagaaaaaagcttatccaattctgctctctacccatataattcacatattca
                      Chimp  cacccaagaaaacctggaaagaaaaaagcttatccaattctgctctctacccatataattcacatattca
                    Gorilla  cacccaagaaaacctggaaagaaaaaagcttatccaattctgctctctacccatataattcacatattca
                  Orangutan  cacctaagaaaacctggaaagaaaaaagcttatccatttctgccctctacccatgtaattcacatattca
                     Rhesus  ccgtcaagaaaacctggaaagaaaaaagcttatccaattttgctctctacccatataattcacatattca
        Crab-eating macaque  ccgtcaagaaaacctggaaagaaaaaagcttatccaattttgctctctacccatataattcacatattca
                     Baboon  ccgtcaagaaaacctggaaagaaaaaagcttatccaattttgctctctacccatataattcacatattca
               Green monkey  ctgtcaagaaaacctggaaagaaaaaagcttatccaattttgctctctacccatataattcacatattca
                   Marmoset  ctg-caagaaaacctggaaagaaaaaagcttatccaattctgctctctatccatataatttacatattca
            Squirrel monkey  ctg-caagaaaacctggaaagcaaaaagcttatccaattctgctctctagccatataatttacatattca
                      Horse  ----gaagaaaatctggaaaggagaaatcttatccaactttgctctctactcatgcaatttacatatttg
           White rhinoceros  ----gaagaaaacctgggaaggagaaagcttatccaactttgctctctacccatacgatttacatattta
                    Megabat  ----ggagaaagcatgggaaggagaaagcttatccaactctgttctctacccatatgatttacatagtct
                    Opossum  -------------ctagtaatgggttattttccattcatt-----------ggtatagtatttata----
            Tasmanian devil  c----------acctaatactgaacaattctattaatattta------gaagatataatgctaatattag
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                        Pig  ======================================================================
                     Gibbon  ======================================================================

                      Human  taatatgtaaaaaaaa---ttttgcctttccccatttaataaatgatgcgtgatatttactttatgcct-
                      Chimp  taatatgtaaaaaaaa---ttttgcctttccccatttaataaatgatgcgtgatatttactttatgcct-
                    Gorilla  taatatgtaaaaaaaa----tttgcctttccccatttaataaatgatgcgtgatatttactttatgcct-
                  Orangutan  taatgtgtaaaaaaa-----tttgcctttccccatttaataaatgatgcatgatatttactttatgcct-
                     Rhesus  taatatgtaaaaaaaa---tattgcctttccccatttaataaatggtgcatgata-----tttatgcat-
        Crab-eating macaque  taatatgtaaaaaaaa---tattgcctttccccatttaataaatggtgcatgata-----tttatgcat-
                     Baboon  taatatgt-aaaaaaa---tattgcctttccccatttaataaatggtgcattata-----tttatgcat-
               Green monkey  taatatgtaaaaaaaa---tactgcctttccccatttaataaatggtgcatgata-----tttatgcat-
                   Marmoset  taatatgtaaagaaaac--ttttgcctttccttatttaataagtgatgcatggtatttactttatgtctt
            Squirrel monkey  taatacataaagaaaaa--ttttgcctttcccaatttaataagtgatgcatgatatttattttatgtctt
                      Horse  taatatataaagactaa--tttttcctttctccatttagtaggtggtgcatgatatttactttatgtct-
           White rhinoceros  taatatataaacactaa--ttattccttt----atttaataggtggtgcctgatatttactttatgtct-
                    Megabat  taatatataaggaccgattttttttctttatctgtttaatagatggtacaggatatttactttatgtct-
                    Opossum  tagcatgtaaaagagttcctcttacctattcacat-----------------------aaaacaaacca-
            Tasmanian devil  taacatg--agaagattctccttgcataaccata------------------------aactcagctca-
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                        Pig  ======================================================================
                     Gibbon  ======================================================================

                      Human  -aaa---aaag-catcatttgtcaa----------
                      Chimp  -aaa---aaag-catcatttgtcaa----------
                    Gorilla  aaaa---aaag-catcatttgtcaa----------
                  Orangutan  aaaa---aaag-catcatttgtcaa----------
                     Rhesus  -aaa---aaag-catcatttgtcaa----------
        Crab-eating macaque  -aaa---aaag-catcatttgtcaa----------
                     Baboon  -aaa---aaag-catcatttgtcaa----------
               Green monkey  --aa---aaag-catcatttgtcaa----------
                   Marmoset  taaa---aaag-cgtcatttgtcaa----------
            Squirrel monkey  taaa---aaca-cgtcatttgtcaa----------
                      Horse  -gaaaa-aaat-cttcatttctcca----------
           White rhinoceros  -aaaaacaaat-catcatttctcaa----------
                    Megabat  -aa----aaat-catcatttctcaa----------
                    Opossum  -aaa---gaacacaatgccatgtggagccttgcag
            Tasmanian devil  -gaa---caac-cactactacttaa------tcaa
                       Pika  ===================================
                     Rabbit  ===================================
                   Microbat  ===================================
              Big brown bat  ===================================
       David's myotis (bat)  ===================================
             Golden hamster  ===================================
                      Mouse  ===================================
               Prairie vole  ===================================
     Lesser Egyptian jerboa  ===================================
                   Squirrel  ===================================
                 Chinchilla  ===================================
                        Pig  ===================================
                     Gibbon  ===================================

Inserts between block 16 and 17 in window
B D                 Rhesus 5988bp
B D    Crab-eating macaque 6466bp
B D                 Baboon 6473bp
B D           Green monkey 3855bp

Alignment block 17 of 486 in window, 55038311 - 55038344, 34 bps 
B D                   Human  taaagaaatttttaaagc-------acccatcctatatga--------g
B D                   Chimp  taaagaaatttttaaagc-------acccatcctatatga--------g
B D                 Gorilla  taaagaaatttttaaagc-------acccatcctatatga--------g
B D               Orangutan  taaagaaattttttaagc-------acccatcctgtatga--------g
B D                  Rhesus  taaagaaatttttaaagc-------actcatcctgtgtga--------g
B D     Crab-eating macaque  taaagaaatttttaaagc-------actcatcctgtgtga--------g
B D                  Baboon  taaagaaatttttaaagc-------attcatcctgtgtga--------g
B D            Green monkey  taaagaaatttttaaagc-------actcatcctgtgtga--------g
B D                Marmoset  caaagaaatttttaaagc-------acccatcctgtatga--------g
B D         Squirrel monkey  caaagaaattttaaaagc-------acccatcttgtatga--------g
B D                   Horse  caaagaaatttttaaagt-------acccatcctgtatgg--------g
B D        White rhinoceros  caaacaaatttttcaact-------acccatcctgtatgg--------g
B D                 Megabat  caaagagaattttagagt-------acccatcttgtatgg--------g
B D                 Opossum  ---agaagaaattaaactcatcctaagtgggcctatgtta--------g
B D         Tasmanian devil  ---acaaatagtcatacccacac--actagcactctattacatatattg
B D                    Pika  =================================================
B D                  Rabbit  =================================================
B D                Microbat  =================================================
             Big brown bat  =================================================
      David's myotis (bat)  =================================================
            Golden hamster  =================================================
B D                   Mouse  =================================================
              Prairie vole  =================================================
    Lesser Egyptian jerboa  =================================================
B D                Squirrel  =================================================
                Chinchilla  =================================================
B D                     Pig  =================================================
B D                  Gibbon  =================================================

Alignment block 18 of 486 in window, 55038345 - 55038374, 30 bps 
B D                   Human  ttggcagctgattagg---ttaaactggctgga
B D                   Chimp  ttggcagctgattagg---ttaaactggctgga
B D                 Gorilla  ttggcagctgattagg---ttaaactggctgga
B D               Orangutan  ttggcagctgattagg---ttaaactggctgg-
B D                  Rhesus  ttggcagctgattagt---ttaaactggctgga
B D     Crab-eating macaque  ttggcagctgattagt---ttaaactggctgga
B D                  Baboon  ttggcagctgattagt---ttaaactggctgga
B D            Green monkey  ttggcagctgattagt---ttaaactggctgga
B D                Marmoset  ttgacagctgtttaca---ttaaactggctgga
B D         Squirrel monkey  ttgacagctgtttaca---ttaaactggctgga
B D                   Horse  ttggagactgatcagg---ttaaactggctggg
B D        White rhinoceros  ttggaaactgattagg---ttaaactggcttac
B D                 Megabat  ttagagattgattagg---ttaaactggctgga
B D                 Opossum  tttga--ataattagcaccttaaatacactgaa
B D         Tasmanian devil  ttaac--ctaactcagacatgtatttaaaggaa
B D             Zebra finch  tgggtagctgagccag---tcaggcctgtaagt
B D                    Pika  =================================
B D                  Rabbit  =================================
B D                Microbat  =================================
             Big brown bat  =================================
      David's myotis (bat)  =================================
            Golden hamster  =================================
B D                   Mouse  =================================
              Prairie vole  =================================
    Lesser Egyptian jerboa  =================================
B D                Squirrel  =================================
                Chinchilla  =================================
B D                     Pig  =================================
B D                  Gibbon  =================================

Inserts between block 18 and 19 in window
B D        Tasmanian devil 3bp

Alignment block 19 of 486 in window, 55038375 - 55038540, 166 bps 
B D                   Human  ----ttaaaaacatcactggactcaac--aagt-------tataaaatgtgaatatgttcgttatattta
B D                   Chimp  ----ttaaaaacatcactggactcaac--aagt-------tataaaatgtgaatatgttcgttatattta
B D                 Gorilla  ----ttaaaaacatcactggactcaac--aagt-------tataaaatgtgaatatgttcgttatattta
B D               Orangutan  ----ttaaaaacatcactggactcaac--aagt-------tataaaatatgaatatgttcgttatattta
B D                  Rhesus  ----ttaaaaacatcactggactcaac--aagt-------tataaaatatgaatatgttcactatattta
B D     Crab-eating macaque  ----ttaaaaacatcactggactcaac--aagt-------tataaaatatgaatatgttcactatattta
B D                  Baboon  ----ttaaaaacatcactggactcaac--aagt-------tataaaatatgaatatgttcactatattta
B D            Green monkey  ----ttaaaaacatcactggactcaac--aagt-------tataaaatatgaatatgttcactatattta
B D                Marmoset  ----ttaaaaacatcactggtctcaag--aagt-------tataaaacatgaatatgttcattatattta
B D         Squirrel monkey  ----ttaaaaacatcactggtctcaac--aagt-------tataaaatatgaatatgttcactatattta
B D                   Horse  ----ttggaaacatcaatgatctcatc--cagg-------tgtaaagcataaatatgctcttt-tattta
B D        White rhinoceros  ----ttggaaacatcgatggtctcatc--tagc-------tataaaacataagtatgttattt-tcttta
B D                 Megabat  ----ttagaaacatcagtgatctcttc--tagc-------tataaaacataaatatgctcttt-tgtttg
B D                 Opossum  ----ttaaaaaaa-ctcttatctgaac--aatt-------caaaaaccattattctattcgttatgctaa
B D         Tasmanian devil  ----ttaaaagga------ataaaagg--aacttggcaaacaaaaacc------------------ccac
B D             Zebra finch  aaggttaa----gtcatgaggaataacctaagt-------taaattcttttgctaagtt-gttatgttta
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                Microbat  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
              Prairie vole  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                Squirrel  ======================================================================
                Chinchilla  ======================================================================
B D                     Pig  ======================================================================
B D                  Gibbon  ======================================================================

                      Human  ctctcaa---------taaaatgataggctcaacactgttagacct---agcatatatttactgaga-ta
                      Chimp  ctctcaa---------taaaatgataggctcaacactgttagacct---agcatatatttactgaga-ta
                    Gorilla  ctctcaa---------taaaatgataggctcaacactgttagacct---agcatatatttactgaga-ta
                  Orangutan  ctctcaa---------taaaatgataggctcaacactgttagacct---agcatatatttactgaga-ta
                     Rhesus  ctctcaa---------taaaatgataggctcaacactgtcagacct---agcatatatttactgag----
        Crab-eating macaque  ctctcaa---------taaaatgataggctcaacactgtcagacct---agcatatatttactgag----
                     Baboon  ctctcaa---------taaaatgataggctcaacactgtcagacct---agcatatatttactgag----
               Green monkey  ctcttga---------taaaatgataggctcaacactgtcagacct---agcatatatttactgag----
                   Marmoset  ctctcaa---------taaaatgataggttcaacactgccagacct---agcatatatttactgagatta
            Squirrel monkey  ctctcaa---------taaaatgataggctcaacactgccagacct---agcatatatttactgagatta
                      Horse  ctctccc---------tgaagtcataggctaaccactgtcagatct---agcacacattcactgaga-ta
           White rhinoceros  ctctccc---------tggagtaataggttcaacactgtcagatct---agcacatattcactgaga-ta
                    Megabat  ctctccc---------tgaagtaataggctcatcattgtcaggtct---agcatatattcattgaaa-ta
                    Opossum  cttataaccctatacctaaactgttacattaac-----ttgataactaaaatccttatcctattcta-ta
            Tasmanian devil  ctatttaccaaaaacatcacctctagcatttaccagtattggaggc---actgcctgcctggtgagt-ta
                Zebra finch  atataag---------ttgaaagctaggttaaatactgttaaa--t---gctatttctctgtaaaaa-tg
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                        Pig  ======================================================================
                     Gibbon  ======================================================================

                      Human  ctatgtttttggaaataa------tcaaat--tgtcaacttacacttgtt-gataacttt-t
                      Chimp  ctatgtttttggaaataa------tcaaat--tgtcaacttacacttgtt-gataacttt-t
                    Gorilla  ctatgtttttggaaataa------tcaaat--tgtcaacttacacttgtt-gataatttt-t
                  Orangutan  ctatgtttttggaaataa------tcaaat--tgtcaacttacacttgat-gataacttt-t
                     Rhesus  -tatgtttttggaaataa------tcaaat--tgtcaacttgcacttgat-gataacttt-t
        Crab-eating macaque  -tatgtttttggaaataa------tcaaat--tgtcaacttgcacttgat-gataacttt-t
                     Baboon  -tatgtttttggaaataa------tcaaat--tgtcaacttgcacttgat-gataacttt-t
               Green monkey  -tatgtttttggaaataa------tcaaat--tgtcaacttgcacttgat-ggtaacttt-t
                   Marmoset  ctacgtttttggaaatta------tcaaat--tgtcaacttacacttgat-gataacttt-t
            Squirrel monkey  ctatgtttttggaaataa------tcaaac--tgtcaacttacacttgat-gataacttt-t
                      Horse  ctgtgttattggagataa------tcaaat--tgtcaacttacacttgat-gattacttt-t
           White rhinoceros  ctgtgttattggacataa------tcaaat--tgtcaacttacatttgat-gataacttt-t
                    Megabat  ctgtgttattgtacataa------gcaagt--tgtcaatttatgcttgat-gataacttt-t
                    Opossum  taatctttatccatatgc------tatata--cttaaaaataaatatgta-cataattaca-
            Tasmanian devil  caactttaatgggcacag------tat-----cctgaccttgcaaaggtagcataatcac--
                Zebra finch  tgaagtcataggttataagttaggttaaatactgttaagctctgtccttt-gct--------
                       Pika  ==============================================================
                     Rabbit  ==============================================================
                   Microbat  ==============================================================
              Big brown bat  ==============================================================
       David's myotis (bat)  ==============================================================
             Golden hamster  ==============================================================
                      Mouse  ==============================================================
               Prairie vole  ==============================================================
     Lesser Egyptian jerboa  ==============================================================
                   Squirrel  ==============================================================
                 Chinchilla  ==============================================================
                        Pig  ==============================================================
                     Gibbon  ==============================================================

Inserts between block 19 and 20 in window
B D                  Horse 1bp
B D       White rhinoceros 1bp

Alignment block 20 of 486 in window, 55038541 - 55038543, 3 bps 
B D                   Human  aaa
B D                   Chimp  aaa
B D                 Gorilla  aaa
B D               Orangutan  aaa
B D                  Rhesus  aaa
B D     Crab-eating macaque  aaa
B D                  Baboon  aaa
B D            Green monkey  aaa
B D                Marmoset  aaa
B D         Squirrel monkey  aaa
B D                   Horse  aa-
B D        White rhinoceros  aa-
B D                 Opossum  -a-
B D             Zebra finch  aaa
B D                    Pika  ===
B D                  Rabbit  ===
B D                Microbat  ===
             Big brown bat  ===
      David's myotis (bat)  ===
            Golden hamster  ===
B D                   Mouse  ===
              Prairie vole  ===
    Lesser Egyptian jerboa  ===
B D                Squirrel  ===
                Chinchilla  ===
B D                 Megabat  ---
B D                     Pig  ===
B D         Tasmanian devil  ---
B D                  Gibbon  ===

Alignment block 21 of 486 in window, 55038544 - 55038551, 8 bps 
B D                   Human  tggggaag
B D                   Chimp  tggggaag
B D                 Gorilla  tggggaag
B D               Orangutan  tcgggaag
B D                  Rhesus  tagggaag
B D     Crab-eating macaque  tagggaag
B D                  Baboon  tagggaag
B D            Green monkey  tagggaag
B D                Marmoset  tagggaca
B D         Squirrel monkey  tagggatg
B D                 Opossum  ----gaa-
B D             Zebra finch  tggtgaaa
B D                    Pika  ========
B D                  Rabbit  ========
B D                Microbat  ========
             Big brown bat  ========
      David's myotis (bat)  ========
            Golden hamster  ========
B D                   Mouse  ========
              Prairie vole  ========
    Lesser Egyptian jerboa  ========
B D                Squirrel  ========
                Chinchilla  ========
B D                   Horse  --------
B D                 Megabat  --------
B D        White rhinoceros  --------
B D                     Pig  ========
B D         Tasmanian devil  --------
B D                  Gibbon  ========

Alignment block 22 of 486 in window, 55038552 - 55038553, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Rhesus  tt
B D       Crab-eating macaque  tt
B D                    Baboon  tt
B D              Green monkey  tt
B D                  Marmoset  tt
B D           Squirrel monkey  tt
B D                   Dolphin  tc
             Cape golden mole  tt
                     Aardvark  tc
B D                   Opossum  tt
B D           Tasmanian devil  tt
B D               Zebra finch  tt
B D                Coelacanth  tt
B D                 Tetraodon  tt
B D              Nile tilapia  tt
B D               Stickleback  tt
B D              Atlantic cod  tt
B D                 Zebrafish  tt
     Mexican tetra (cavefish)  tt
B D                      Pika  ==
B D                    Rabbit  ==
B D                  Microbat  ==
               Big brown bat  ==
        David's myotis (bat)  ==
              Golden hamster  ==
B D                     Mouse  ==
                Prairie vole  ==
      Lesser Egyptian jerboa  ==
B D                  Squirrel  ==
                  Chinchilla  ==
B D                     Horse  --
B D                   Megabat  --
B D          White rhinoceros  --
B D                       Pig  ==
B D                    Gibbon  ==

Inserts between block 22 and 23 in window
B D          Tasmanian devil 6bp
B D              Zebra finch 1bp

Alignment block 23 of 486 in window, 55038554 - 55038630, 77 bps 
B D                     Human  taaatagggacttgtatgaat-ggcacatgagggtttagctgtctcttactttcaatcagtgaaattgac
B D                     Chimp  taaatagggacttgtatgaat-gccacatgagggtttagctgtctcttactttcaatccgtgaaattgac
B D                   Gorilla  taaatagggacttgtatgaat-gccacatgagggtttagctgtctcttactttcaatcagtgaaattgac
B D                 Orangutan  taaatagggacttgcatgaat-gccacatgagggtttaactgtctcttactttcaatcagtgaaattgac
B D                    Rhesus  taaatagggacttgtatgaat-gccacatgagggtttagctgtctcttactttcaatcagtgaaattgac
B D       Crab-eating macaque  taaatagggacttgtatgaat-gccacatgagggtttagctgtctcttactttcaatcagtgaaattgac
B D                    Baboon  taaatagggacttgtatgaat-gccacatgagggtttagctgtctcttactttcaatcagtgaaattgac
B D              Green monkey  taaatagggacttgtatgaat-gccacatgagggtttagctgtctcttactttcaatcagtgaaattgac
B D                  Marmoset  taaataggaatttgtatgaatggccacat-agggtttagctgtcacttactttccatcagtgaaattgac
B D           Squirrel monkey  taaataggaatttgtatgaatggccacat-agggtttagctgtctcttactttccatcagtaaaattgac
B D                   Dolphin  taaataaggacttgtatgaatggccacacaagggtttcactatctcttactttcaatcagtgaaactgac
B D                   Megabat  taaataaggacttgtatgaac-gccacatgagggttttgctgtctcttactttcagtcagtg-gactgac
             Cape golden mole  taattaaggacttgtatgaatggccacacgaggacttaactgtctcttatctccaatcagtgaaattgac
                     Aardvark  taaataagaacctatatgaatggccacatgaggatctaactgtctcttgctttgtatcagtgaaattgac
B D                   Opossum  taaatagagacttgtatgaatggcaaaacgagggtttaactgtctctttttctcaatcaatgaaattgac
B D           Tasmanian devil  taaatagggactagtatgaatggcataatgagggtttaactgtctcttatttccgatcagtgaaattgac
  D              Saker falcon  taaatagagacctgtatgaatggctaaatgaggtcttaactgtctcttacagataatcagtgaaattgat
B D               Zebra finch  aaggtagaagttaaggttaaggtataagtttagtcctgttaattta--------actctgttaagctttt
B D                Coelacanth  taaatgaagacctgtatgaatggcaccacgagggcttaactgtctcctctttccaatcagtaaaattgat
B D                 Tetraodon  taaatggggacctgtatgaatggcacgacgagggcttaactgtctcctttttcaagtcaatgaaattgat
B D              Nile tilapia  taaataaggactagtatgaatggcttgacgagggtttaactgtctcttacttttaatcagtgaaattgac
B D               Stickleback  taaatggagacctgtatgaatggcataacgagggcttagctgtctcctttttccagtcaatgaaattgat
B D              Atlantic cod  taaatgaagacctgtatgaatggcatcacgagggcttagctgtctcccatctccagtcaatgaaattgac
B D                 Zebrafish  taaatagggacctgtatgaatggccaaacgagggcttaactgtctcccccatcaagtcagtgaaattgat
     Mexican tetra (cavefish)  taaataaagacctgtatgaatggtgaaacgagggcttaactgtctcccttttctgatcagtgaaattgat
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
B D                  Microbat  ======================================================================
               Big brown bat  ======================================================================
        David's myotis (bat)  ======================================================================
              Golden hamster  ======================================================================
B D                     Mouse  ======================================================================
                Prairie vole  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                  Squirrel  ======================================================================
                  Chinchilla  ======================================================================
B D                     Horse  ----------------------------------------------------------------------
B D          White rhinoceros  ----------------------------------------------------------------------
B D                       Pig  ======================================================================
B D                    Gibbon  ======================================================================

                        Human  ctatcctt
                        Chimp  ctatcctt
                      Gorilla  ctatcctt
                    Orangutan  ctatccgt
                       Rhesus  ctatccat
          Crab-eating macaque  ctatccat
                       Baboon  ctatccgt
                 Green monkey  ctatccat
                     Marmoset  ctatctgt
              Squirrel monkey  ctatctgt
                      Dolphin  cttcccac
                      Megabat  ct---cgt
             Cape golden mole  cttcccgt
                     Aardvark  cttcccat
                      Opossum  ctacccgt
              Tasmanian devil  cttcccct
                 Saker falcon  cttcctgt
                  Zebra finch  atctcttt
                   Coelacanth  ctgtccgt
                    Tetraodon  ctttccgt
                 Nile tilapia  cttcccgt
                  Stickleback  ctccccgt
                 Atlantic cod  ctccccgt
                    Zebrafish  ctatccgt
     Mexican tetra (cavefish)  ctacccgt
                         Pika  ========
                       Rabbit  ========
                     Microbat  ========
                Big brown bat  ========
         David's myotis (bat)  ========
               Golden hamster  ========
                        Mouse  ========
                 Prairie vole  ========
       Lesser Egyptian jerboa  ========
                     Squirrel  ========
                   Chinchilla  ========
                        Horse  --------
             White rhinoceros  --------
                          Pig  ========
                       Gibbon  ========

Alignment block 24 of 486 in window, 55038631 - 55038641, 11 bps 
B D                     Human  gaagaggcagg
B D                     Chimp  gaagaggcagg
B D                   Gorilla  gaagaggcagg
B D                 Orangutan  gaagaggcagg
B D                    Rhesus  gaagaggtagg
B D       Crab-eating macaque  gaagaggtagg
B D                    Baboon  gaagaggtagg
B D              Green monkey  gaagaggtagg
B D                  Marmoset  gaagaggcagg
B D           Squirrel monkey  gaagaggcagg
B D                   Dolphin  gaagaggcagg
B D                   Megabat  gaagaggcggg
             Cape golden mole  gaagaggcagg
                     Aardvark  gaagaggtggg
B D                   Opossum  gcagaggcggg
B D           Tasmanian devil  gctgatata--
  D              Saker falcon  gcaaaagcagg
B D                Coelacanth  gcagaagcgga
B D                 Tetraodon  gcagaagcggg
B D              Nile tilapia  gaagaggcggg
B D               Stickleback  gcagaagcggg
B D              Atlantic cod  gcagaggcggg
B D                 Zebrafish  gcagaagcgga
     Mexican tetra (cavefish)  gcagaagcggg
B D                      Pika  ===========
B D                    Rabbit  ===========
B D                  Microbat  ===========
               Big brown bat  ===========
        David's myotis (bat)  ===========
              Golden hamster  ===========
B D                     Mouse  ===========
                Prairie vole  ===========
      Lesser Egyptian jerboa  ===========
B D                  Squirrel  ===========
                  Chinchilla  ===========
B D                     Horse  -----------
B D          White rhinoceros  -----------
B D                       Pig  ===========
B D                    Gibbon  ===========

Inserts between block 24 and 25 in window
B D               Coelacanth 2bp

Alignment block 25 of 486 in window, 55038642 - 55038645, 4 bps 
B D                     Human  tata
B D                     Chimp  tata
B D                   Gorilla  tata
B D                 Orangutan  tata
B D                    Rhesus  tata
B D       Crab-eating macaque  tata
B D                    Baboon  tata
B D              Green monkey  tata
B D                  Marmoset  tatc
B D           Squirrel monkey  tatc
B D                   Dolphin  aata
B D                   Megabat  tata
             Cape golden mole  aata
                     Aardvark  aata
B D                   Opossum  tata
B D           Tasmanian devil  -ata
  D              Saker falcon  aata
B D                Coelacanth  ta--
B D                 Tetraodon  aata
B D              Nile tilapia  aatt
B D               Stickleback  gatt
B D              Atlantic cod  gata
B D                 Zebrafish  tata
     Mexican tetra (cavefish)  tata
B D                      Pika  ====
B D                    Rabbit  ====
B D                  Microbat  ====
               Big brown bat  ====
        David's myotis (bat)  ====
              Golden hamster  ====
B D                     Mouse  ====
                Prairie vole  ====
      Lesser Egyptian jerboa  ====
B D                  Squirrel  ====
                  Chinchilla  ====
B D                     Horse  ----
B D          White rhinoceros  ----
B D                       Pig  ====
B D                    Gibbon  ====

Alignment block 26 of 486 in window, 55038646 - 55038658, 13 bps 
B D                     Human  aataaataagatg
B D                     Chimp  aataaataagatg
B D                   Gorilla  aataaataagatg
B D                 Orangutan  aataaataagatg
B D                    Rhesus  aataaataagatg
B D       Crab-eating macaque  aataaataagatg
B D                    Baboon  aataaataagatg
B D              Green monkey  aataaataagatg
B D                  Marmoset  aataaataagacg
B D           Squirrel monkey  aataaataagacg
B D                   Dolphin  acaaaatacgat-
B D                   Megabat  a------------
             Cape golden mole  aacatataagaca
B D                   Opossum  actttataagacg
B D           Tasmanian devil  cttatataaaatg
  D              Saker falcon  aacccataagatg
B D                Coelacanth  actacattagacg
B D                 Tetraodon  aaaacataagacg
B D              Nile tilapia  ttataataagacg
B D               Stickleback  actacataagacg
B D              Atlantic cod  attacataagacg
B D                 Zebrafish  ataatacaagacg
     Mexican tetra (cavefish)  agaatacaagacg
B D                      Pika  =============
B D                    Rabbit  =============
B D                  Microbat  =============
               Big brown bat  =============
        David's myotis (bat)  =============
              Golden hamster  =============
B D                     Mouse  =============
                Prairie vole  =============
      Lesser Egyptian jerboa  =============
B D                  Squirrel  =============
                  Chinchilla  =============
B D                     Horse  -------------
B D          White rhinoceros  -------------
B D                       Pig  =============
B D                    Gibbon  =============

Alignment block 27 of 486 in window, 55038659 - 55038659, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                     Horse  a
B D          White rhinoceros  a
             Cape golden mole  a
B D                   Opossum  a
B D           Tasmanian devil  a
  D              Saker falcon  a
B D                Coelacanth  a
B D                 Tetraodon  a
B D              Nile tilapia  a
B D               Stickleback  a
B D              Atlantic cod  a
B D                 Zebrafish  a
     Mexican tetra (cavefish)  a
B D                      Pika  =
B D                    Rabbit  =
B D                  Microbat  =
               Big brown bat  =
        David's myotis (bat)  =
              Golden hamster  =
B D                     Mouse  =
                Prairie vole  =
      Lesser Egyptian jerboa  =
B D                  Squirrel  =
                  Chinchilla  =
B D                   Megabat  -
B D                   Dolphin  -
B D                       Pig  =
B D                    Gibbon  =

Alignment block 28 of 486 in window, 55038660 - 55038683, 24 bps 
B D                   Human  tggagttgaattttctgaagtttt
B D                   Chimp  tggagtcgaattttctgaagtttt
B D                 Gorilla  tggagtcgaattttctgaagtttt
B D               Orangutan  tggagtcgaattttctgtagcttt
B D                  Rhesus  tagagtcgaa-aatctgaagtttt
B D     Crab-eating macaque  tagagtcgaa-aatctgaagtttt
B D                  Baboon  tagagtcgaattttctgaagtttt
B D            Green monkey  tggagtcgaattttctgaagtttt
B D                Marmoset  tggagtcaaattttctgaagcttc
B D         Squirrel monkey  tggagtcaaattttctgaagcttc
B D                 Dolphin  ---aggaaggccttctggagcttt
B D                   Horse  tggagtcaaattttctgaagtttt
B D        White rhinoceros  tggaatccaattttctgaagtttt
B D                 Megabat  -ggagtcaaattttttgaagtttt
B D                 Opossum  -gaag----accctgtggagct--
B D               Tetraodon  -gaag----accctatggagcttt
B D            Nile tilapia  -gaag----accctatggagcttt
B D                    Pika  ========================
B D                  Rabbit  ========================
B D                Microbat  ========================
             Big brown bat  ========================
      David's myotis (bat)  ========================
            Golden hamster  ========================
B D                   Mouse  ========================
              Prairie vole  ========================
    Lesser Egyptian jerboa  ========================
B D                Squirrel  ========================
                Chinchilla  ========================
B D                     Pig  ========================
B D         Tasmanian devil  ========================
B D                  Gibbon  ========================

Alignment block 29 of 486 in window, 55038684 - 55038692, 9 bps 
B D                   Human  -----tgtaatttc
B D                   Chimp  -----tgtaatttc
B D                 Gorilla  -----tgtaatttc
B D               Orangutan  -----tgtaatttc
B D                  Rhesus  -----tgtaatttc
B D     Crab-eating macaque  -----tgtaatttc
B D                  Baboon  -----tgtaatttc
B D            Green monkey  -----tgtaatttc
B D                Marmoset  -----tgtaatttc
B D         Squirrel monkey  -----tgtaacttc
B D                  Rabbit  -----tgtagtttc
B D                 Dolphin  -----attaacccc
B D                   Horse  -----tattattta
B D        White rhinoceros  -----tataatcta
B D                 Megabat  -----tataatttc
B D                 Opossum  -----taaaattac
B D               Tetraodon  agacataaa-----
B D            Nile tilapia  a---attta-----
B D                    Pika  ==============
B D                Microbat  ==============
             Big brown bat  ==============
      David's myotis (bat)  ==============
            Golden hamster  ==============
B D                   Mouse  ==============
              Prairie vole  ==============
    Lesser Egyptian jerboa  ==============
B D                Squirrel  ==============
                Chinchilla  ==============
B D                     Pig  ==============
B D         Tasmanian devil  ==============
B D                  Gibbon  ==============

Inserts between block 29 and 30 in window
B D                Opossum 3bp

Alignment block 30 of 486 in window, 55038693 - 55038718, 26 bps 
B D                   Human  ataatttactaggtatgatgcttcaa
B D                   Chimp  ataatttactaggtatgatgcttcaa
B D                 Gorilla  ataatttactaggtatgatgcttcaa
B D               Orangutan  ataatttactaggtatgatgcttcaa
B D                  Rhesus  ataatttactaggtatgatgcttcaa
B D     Crab-eating macaque  ataatttactaggtatgatgcttcaa
B D                  Baboon  ataatttgctaggtatgatgcttcaa
B D            Green monkey  ataatttactaggtatgatgcttcaa
B D                Marmoset  ataatttactaggtatgatgcttcaa
B D         Squirrel monkey  ataatttactaggtatgatgcttcaa
B D                  Rabbit  aaaattttctaagtatgatgctccaa
B D                   Horse  ataatttactaggtatgatgcttcaa
B D        White rhinoceros  ataatttactaggtatgatgcttcaa
B D                 Megabat  ataatttactaggtattattattcaa
B D                 Opossum  ttaaattaataaatactataccctaa
B D               Tetraodon  acagatca------------cgtcaa
B D            Nile tilapia  aca------------------gtctc
B D                    Pika  ==========================
B D                Microbat  ==========================
             Big brown bat  ==========================
      David's myotis (bat)  ==========================
            Golden hamster  ==========================
B D                   Mouse  ==========================
              Prairie vole  ==========================
    Lesser Egyptian jerboa  ==========================
B D                Squirrel  ==========================
                Chinchilla  ==========================
B D                     Pig  ==========================
B D         Tasmanian devil  ==========================
B D                  Gibbon  ==========================

Alignment block 31 of 486 in window, 55038719 - 55038720, 2 bps 
B D                   Human  at
B D                   Chimp  at
B D                 Gorilla  at
B D               Orangutan  at
B D                  Rhesus  at
B D     Crab-eating macaque  at
B D                  Baboon  at
B D            Green monkey  at
B D                Marmoset  gt
B D         Squirrel monkey  gt
B D                  Rabbit  at
B D                   Horse  at
B D        White rhinoceros  at
B D                 Megabat  at
B D               Tetraodon  ac
B D            Nile tilapia  ac
B D                    Pika  ==
B D                Microbat  ==
             Big brown bat  ==
      David's myotis (bat)  ==
            Golden hamster  ==
B D                   Mouse  ==
              Prairie vole  ==
    Lesser Egyptian jerboa  ==
B D                Squirrel  ==
                Chinchilla  ==
B D                     Pig  ==
B D         Tasmanian devil  ==
B D                 Opossum  ==
B D                  Gibbon  ==

Alignment block 32 of 486 in window, 55038721 - 55038741, 21 bps 
B D                   Human  gcatttagatccaatattaga
B D                   Chimp  gcatttagatccaatattaga
B D                 Gorilla  gcatttagatccaatattaga
B D               Orangutan  gcatttagatccaatattaga
B D                  Rhesus  gaatttagacccaatattaga
B D     Crab-eating macaque  gaatttagacccaatattaga
B D                  Baboon  gaatttagacccaatattaga
B D            Green monkey  gaatttagatccaatattaga
B D                Marmoset  gcagttagatccaatattaga
B D         Squirrel monkey  gcagttagatccaatattaga
B D                  Rabbit  gcatttagattcaatattaca
B D                   Horse  gtacttagatttaatagtaga
B D        White rhinoceros  gtatttagatttaatagtaga
B D                 Megabat  gccttgagattccatattaga
B D         Tasmanian devil  ---------------actgga
B D               Tetraodon  acccttagataaa-----aga
B D            Nile tilapia  agccttaattata-tcttagg
B D                    Pika  =====================
B D                Microbat  =====================
             Big brown bat  =====================
      David's myotis (bat)  =====================
            Golden hamster  =====================
B D                   Mouse  =====================
              Prairie vole  =====================
    Lesser Egyptian jerboa  =====================
B D                Squirrel  =====================
                Chinchilla  =====================
B D                     Pig  =====================
B D                 Opossum  =====================
B D                  Gibbon  =====================

Inserts between block 32 and 33 in window
B D           Nile tilapia 2bp

Alignment block 33 of 486 in window, 55038742 - 55038826, 85 bps 
B D                   Human  tatttaatattcttatatttagtattttaaa-attagatattttatggtta---gaagtttgttgtacta
B D                   Chimp  tatttaatattcttatatttagtattttaaa-attagatattttatggtta---gaagtttgttgtacta
B D                 Gorilla  tatttaatattcttatatttagtattttaaa-attagatattttatggtta---gaagtttgttgtacta
B D               Orangutan  tatttaatattcttatatttagtattttaca-atgagatattttatggtta---gaaatttgttgtacta
B D                  Rhesus  tatttaatattcttacagttagtattttaaa-attagatattttatggtta---taaatttgttgtagta
B D     Crab-eating macaque  tatttaatattcttacagttagtattttaaa-attagatattttatggtta---taaatttgttgtagta
B D                  Baboon  tatttcatattcttatagttagtattttaaa-attagatattttatggtta---taaatttgttgtagta
B D            Green monkey  tatttaatatccttatagttagtattttaaa-attagatattttatggtta---taaatttgttgtagta
B D                Marmoset  tatttaaaattcttatatttagcatttaaaa-attagatatttggtggtta--ggaaatttactgtagta
B D         Squirrel monkey  tatttaaaattcttatatttagcatctaaaa-attagatatttgatggtta--ggaaatttattgtagta
B D                  Rabbit  tatttggaattcatatattgcaaatgttaaa-aatagttattttatgatta--ggaaatttgttgtagaa
B D                   Horse  tattt-gaattcttatatttagtatctaaaaaattagttagcttatgatta--agaaatttgtttcagta
B D        White rhinoceros  catttggaattcttatatttagtatctaaaacattagttagcttattatta--ggaaatttgtttcagta
B D                 Megabat  tatttgaaattcttgcatgtaatacctaaaa-attag-cagtttataatta--gtaaacttgatgtagta
B D         Tasmanian devil  -----aaaacccgtata---agcccctgagt-tgtag----tctttggttggggtgaccttggagcataa
B D            Nile tilapia  ------------ttaaaactattgttcatag-actagaaattt--tggttggggtgacctcggagtacaa
B D                    Pika  ======================================================================
B D                Microbat  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
              Prairie vole  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                Squirrel  ======================================================================
                Chinchilla  ======================================================================
B D                     Pig  ======================================================================
B D                 Opossum  ======================================================================
B D                  Gibbon  ======================================================================

                      Human  gttcatgtgtgagttg---atg
                      Chimp  gttcatgtgtgagttg---atg
                    Gorilla  gttcatgtgtgagttg---atg
                  Orangutan  gttcatgtgtgagttg---atg
                     Rhesus  gttcatgtgtgagttt---atg
        Crab-eating macaque  gttcatgtgtgagttt---atg
                     Baboon  gttcatgtgtgagttt---atg
               Green monkey  gttcatgtgtgagttt---atg
                   Marmoset  gttcatgtgtgagtactggatg
            Squirrel monkey  gttcatgtgtgagttt---atg
                     Rabbit  gtttaagtatgaattg---atg
                      Horse  cttcatgtatgagcta---atg
           White rhinoceros  tttcatgtatgagtag---ata
                    Megabat  gttcatgtatgag---------
            Tasmanian devil  aataacctctgaatga---at-
               Nile tilapia  actaacctccgaat-g---ata
                       Pika  ======================
                   Microbat  ======================
              Big brown bat  ======================
       David's myotis (bat)  ======================
             Golden hamster  ======================
                      Mouse  ======================
               Prairie vole  ======================
     Lesser Egyptian jerboa  ======================
                   Squirrel  ======================
                 Chinchilla  ======================
                        Pig  ======================
                    Opossum  ======================
                     Gibbon  ======================

Alignment block 34 of 486 in window, 55038827 - 55038836, 10 bps 
B D                   Human  gtaacctgga
B D                   Chimp  gtaacctgga
B D                 Gorilla  gtaacctgga
B D               Orangutan  gtaacctgga
B D                  Rhesus  gtaacctgga
B D     Crab-eating macaque  gtaacctgga
B D                  Baboon  gtaacctgga
B D            Green monkey  gtaacctgga
B D                Marmoset  gtaacctgga
B D         Squirrel monkey  gtaacttgga
B D                  Rabbit  gaacagtgac
B D                   Horse  gtagcctcga
B D        White rhinoceros  attgcctgga
B D         Tasmanian devil  ataacccaga
B D            Nile tilapia  ataatctaga
B D                    Pika  ==========
B D                Microbat  ==========
             Big brown bat  ==========
      David's myotis (bat)  ==========
            Golden hamster  ==========
B D                   Mouse  ==========
              Prairie vole  ==========
    Lesser Egyptian jerboa  ==========
B D                Squirrel  ==========
                Chinchilla  ==========
B D                 Megabat  ----------
B D                     Pig  ==========
B D                 Opossum  ==========
B D                  Gibbon  ==========

Alignment block 35 of 486 in window, 55038837 - 55038848, 12 bps 
B D                   Human  ataagga-------ggtag
B D                   Chimp  ataagga-------ggtag
B D                 Gorilla  ataagga-------ggtag
B D               Orangutan  ataagga-------ggtag
B D                  Rhesus  ataagga-------ggcag
B D     Crab-eating macaque  ataagga-------ggcag
B D                  Baboon  ataagga-------ggcgg
B D            Green monkey  ataagga-------ggcag
B D                Marmoset  ataagga-------ggtag
B D         Squirrel monkey  ataagga-------ggtag
B D                  Rabbit  ataataa-------tgaag
B D                   Horse  ttaggga-------ggtag
B D        White rhinoceros  ttaggga-------ggcag
B D                 Megabat  ttaggga-------ggtag
B D                 Opossum  ---gtaaatgt---tgaaa
B D         Tasmanian devil  ttaatgaatctaagtgtaa
B D                    Pika  ===================
B D                Microbat  ===================
             Big brown bat  ===================
      David's myotis (bat)  ===================
            Golden hamster  ===================
B D                   Mouse  ===================
              Prairie vole  ===================
    Lesser Egyptian jerboa  ===================
B D                Squirrel  ===================
                Chinchilla  ===================
B D                     Pig  ===================
B D                  Gibbon  ===================

Inserts between block 35 and 36 in window
B D                 Rabbit 158bp

Alignment block 36 of 486 in window, 55038849 - 55038850, 2 bps 
B D                   Human  ca
B D                   Chimp  ca
B D                 Gorilla  ca
B D               Orangutan  ca
B D                  Rhesus  ca
B D     Crab-eating macaque  ca
B D                  Baboon  ca
B D            Green monkey  ca
B D                Marmoset  tg
B D         Squirrel monkey  tg
B D                   Horse  ca
B D        White rhinoceros  ca
B D                 Megabat  ta
B D                 Opossum  ca
B D         Tasmanian devil  ca
B D                    Pika  ==
B D                  Rabbit  ==
B D                Microbat  ==
             Big brown bat  ==
      David's myotis (bat)  ==
            Golden hamster  ==
B D                   Mouse  ==
              Prairie vole  ==
    Lesser Egyptian jerboa  ==
B D                Squirrel  ==
                Chinchilla  ==
B D                     Pig  ==
B D                  Gibbon  ==

Inserts between block 36 and 37 in window
B D                  Horse 689bp
B D                Megabat 14bp

Alignment block 37 of 486 in window, 55038851 - 55038854, 4 bps 
B D                   Human  ctga---
B D                   Chimp  ctga---
B D                 Gorilla  ctga---
B D               Orangutan  ctga---
B D                  Rhesus  ttga---
B D     Crab-eating macaque  ttga---
B D                  Baboon  ttga---
B D            Green monkey  ttga---
B D                Marmoset  ttga---
B D         Squirrel monkey  ttga---
B D        White rhinoceros  atga---
B D                 Megabat  gtaa---
B D                 Opossum  ---aaag
B D         Tasmanian devil  ---atac
B D                    Pika  =======
B D                  Rabbit  =======
B D                Microbat  =======
             Big brown bat  =======
      David's myotis (bat)  =======
            Golden hamster  =======
B D                   Mouse  =======
              Prairie vole  =======
    Lesser Egyptian jerboa  =======
B D                Squirrel  =======
                Chinchilla  =======
B D                   Horse  =======
B D                     Pig  =======
B D                  Gibbon  =======

Alignment block 38 of 486 in window, 55038855 - 55038866, 12 bps 
B D                   Human  cgtcaaataaaa
B D                   Chimp  cgtcaaataaaa
B D                 Gorilla  agtcaaataaaa
B D               Orangutan  agtcaaataaaa
B D                  Rhesus  agtcaaataaaa
B D     Crab-eating macaque  agtcaaataaaa
B D                  Baboon  agtcaaataaaa
B D            Green monkey  agtcaaataaaa
B D                Marmoset  agtc----aaaa
B D         Squirrel monkey  agtc----aaaa
B D        White rhinoceros  agatggacagaa
B D                 Opossum  agaagattttaa
B D         Tasmanian devil  cagtaattgacc
B D                    Pika  ============
B D                  Rabbit  ============
B D                Microbat  ============
             Big brown bat  ============
      David's myotis (bat)  ============
            Golden hamster  ============
B D                   Mouse  ============
              Prairie vole  ============
    Lesser Egyptian jerboa  ============
B D                Squirrel  ============
                Chinchilla  ============
B D                   Horse  ============
B D                 Megabat  ------------
B D                     Pig  ============
B D                  Gibbon  ============

Inserts between block 38 and 39 in window
B D       White rhinoceros 37bp
B D                Opossum 4bp
B D        Tasmanian devil 4bp

Alignment block 39 of 486 in window, 55038867 - 55038960, 94 bps 
B D                   Human  tatagagacaaatctctg---agattaaaacttttaatttgggaag--aaagaattgc--aatttg-gag
B D                   Chimp  tatagagacaaatctctg---agattaaaacttttaatttgggaag--aaagaattgc--aatttg-gag
B D                 Gorilla  tatagagacaaatctctg---agattaaaacttttaatttgggaag--aaagaattgc--aatttg-gag
B D               Orangutan  tatagagacaaatctctg---agattaaaacttttaatttgggaag--aaaaaattgc--aatttg-gag
B D                  Rhesus  tatagaaacaaatctctg---agattaaaacttttaacttgggaag--aaaaaattgc--aatttg-gag
B D     Crab-eating macaque  tatagaaacaaatctctg---agattaaaacttttaacttgggaag--aaaaaattgc--aatttg-gag
B D                  Baboon  tatagaaacaaatctctg---agattaaaacttttaacttgggaag--aaaaaattgc--aatttg-gag
B D            Green monkey  tatagaaacaaatctctg---agattaaaacttttaacttgggaag--aaaaaattgc--aatttg-gag
B D                Marmoset  tatagagacaaatctctg---agattaaaacgtttaatttgggaag---aaaaaatgc--aatttg-gag
B D         Squirrel monkey  tatagagacaaatctctg---agattaaaacgtttaatttgggagg--aaaaaaatgc--aatttg-gag
B D                 Opossum  tatttagaagaacttctgcccaaattattcattttagtcatggatattaattatttccaagatttgaaaa
B D         Tasmanian devil  tttt-----gatccacggaacaagttaccc--------cagggataacaacgcaatcc--tatttgagag
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                Microbat  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
              Prairie vole  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                Squirrel  ======================================================================
                Chinchilla  ======================================================================
B D                   Horse  ======================================================================
B D                 Megabat  ----------------------------------------------------------------------
B D        White rhinoceros  ======================================================================
B D                     Pig  ======================================================================
B D                  Gibbon  ======================================================================

                      Human  tatacaggcag--------accaggtgttcttcagtatgt
                      Chimp  tatacaggcag--------accaggtgttcttcagtatgt
                    Gorilla  tgtacaggcag--------accaggtgttcttcagtatgt
                  Orangutan  tatacatgcag--------accaggtgttcttcagtatgt
                     Rhesus  tatacatgcag--------accaggtattcttcagtatat
        Crab-eating macaque  tatacatgcag--------accaggtattcttcagtatat
                     Baboon  tacacatgcag--------accaggtattcttcagtatat
               Green monkey  tatacatgcag--------accaggtgttcttcagtatat
                   Marmoset  tatacatgcag--------accaggtgttcttcagtatgt
            Squirrel monkey  ggtacacgtag--------accaggtgttcttcagtatgt
                    Opossum  actgaatctaa--------tgcatgtattcttcattgtat
            Tasmanian devil  cccatatcgaaaattagggtttacgacctcgatgttggat
                       Pika  ========================================
                     Rabbit  ========================================
                   Microbat  ========================================
              Big brown bat  ========================================
       David's myotis (bat)  ========================================
             Golden hamster  ========================================
                      Mouse  ========================================
               Prairie vole  ========================================
     Lesser Egyptian jerboa  ========================================
                   Squirrel  ========================================
                 Chinchilla  ========================================
                      Horse  ========================================
                    Megabat  ----------------------------------------
           White rhinoceros  ========================================
                        Pig  ========================================
                     Gibbon  ========================================

Inserts between block 39 and 40 in window
B D        Tasmanian devil 8bp

Alignment block 40 of 486 in window, 55038961 - 55039011, 51 bps 
B D                   Human  ccaaagaacaaagagaaatttagaggt---tttatttaaaaatagaaatactac
B D                   Chimp  ccaaagaacaaagagaaatttagaggt---tttatttaaaaatagaaatattac
B D                 Gorilla  ccaaagaacaaagagaaatttagaggt---tttatttaaaaatagaaatattac
B D               Orangutan  ccaaagaacaaagagaaatttagagtt---tttatttaaaaatagaaatattac
B D                  Rhesus  ccaaagaacaaa-agaagtttagaggt---tttatttaaaaatagaaatattgc
B D     Crab-eating macaque  ccaaagaacaaa-agaagtttagaggt---tttatttaaaaatagaaatattgc
B D                  Baboon  ccaaagaacaaa-agaagtttagaggt---tttatttaaaaatagaaatattgc
B D            Green monkey  ccaaagaacaaa-agaagtttagaggt---tttatttaaaaatagaaatattgc
B D                Marmoset  ccaaagaacaaagagaagtttagaggt---tttatttaaaaacagaaatattac
B D         Squirrel monkey  ccaaagaacaaatagaagtttagaggt---tttatttaaaaacagaaatattac
B D         Tasmanian devil  ccaaatggtgcaactgatattaaaggttcatttgttcaacgattaaagtcctac
B D                    Pika  ======================================================
B D                  Rabbit  ======================================================
B D                Microbat  ======================================================
             Big brown bat  ======================================================
      David's myotis (bat)  ======================================================
            Golden hamster  ======================================================
B D                   Mouse  ======================================================
              Prairie vole  ======================================================
    Lesser Egyptian jerboa  ======================================================
B D                Squirrel  ======================================================
                Chinchilla  ======================================================
B D                   Horse  ======================================================
B D                 Megabat  ------------------------------------------------------
B D        White rhinoceros  ======================================================
B D                     Pig  ======================================================
B D                 Opossum  ======================================================
B D                  Gibbon  ======================================================

Alignment block 41 of 486 in window, 55039012 - 55039422, 411 bps 
B D                   Human  acattgctctttgagacagtacattggcactagtaagatttttggggaggtggcaagctcttattgttga
B D                   Chimp  acattgctctttgagacagtacattggcactagtaagatttttggggaggtggcaagctcttattgttga
B D                 Gorilla  acattgctctttaagacagtacattggcactagtaagatttttggggaggtggcaagctcttattgttga
B D               Orangutan  atattgctctttgagacagtacattggcactagtaagatttttggggaggtggcaagctcttattgttga
B D                  Rhesus  acatttctctttgagacagtacattggcactagtaaggtttttggggaggtgtcaagctctgattgttga
B D     Crab-eating macaque  acatttctctttgagacagtacattggcactagtaaggtttttggggaggtgtcaagctctgattgttga
B D                  Baboon  acatttctctttgagacagtacattggcactagtaaggtttttggggaggtgtcaagctctgattgttga
B D            Green monkey  acattgctctttgagacagtacattggcactagtaaggtttttgaggaggtgtcaagctctgattgttga
B D                Marmoset  atattgctctttgagaaagtacattggcactagtaatgtttttagggaggtggcaagctctgattggtga
B D         Squirrel monkey  atattgctctttgaggaagtacattggcactagtaatgtttttggggaggtggaaagttctgattggtga
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                Microbat  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
              Prairie vole  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                Squirrel  ======================================================================
                Chinchilla  ======================================================================
B D                   Horse  ======================================================================
B D                 Megabat  ----------------------------------------------------------------------
B D        White rhinoceros  ======================================================================
B D                     Pig  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                 Opossum  ======================================================================
B D                  Gibbon  ======================================================================

                      Human  gtggtcgtagtaggtaaa-----------agttgcagcaggc--tgtttcagtagccatgagataaaact
                      Chimp  gtggtcatagtaggtaaa-----------agttgcagcaggc--tgtttcagtagccatgagataaaact
                    Gorilla  gtggtcgtagtaggtaaa-----------agttgcagcaggc--tgtttcagtggccatgagataaaact
                  Orangutan  gtgatcgtggtgggtaaa-----------agttgcagcaggc--tgtttcagtagccatgagataaaact
                     Rhesus  gtggttgtggtgaataaa-----------agttacagcaggc--tagttcggtaggcatgagataaaact
        Crab-eating macaque  gtggttgtggtgaataaa-----------agttacagcaggc--tagttcggtaggcatgagataaaact
                     Baboon  gtggttgtggtgaataaa-----------agttacagcaggc--tagttcggtaggcatgagataaaact
               Green monkey  gtggttgtgatgaataaa-----------agttacagcaggc--tagttcagtaggcatgagataaaact
                   Marmoset  gtgttcatggtgggtaaaaatagtcttagagttgcagcaggctgtttttcagtggccatgaaataaaact
            Squirrel monkey  gtgttgatggtgggtaaaaatagtcttagagttgcagcaggc--tctttcagtggccatgagataaaact
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                    Megabat  ----------------------------------------------------------------------
           White rhinoceros  ======================================================================
                        Pig  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                     Gibbon  ======================================================================

                      Human  gctttcaggttacagcacgcagtttcagcagccaggcttgcagagaattatatttttggagcaatgttat
                      Chimp  gctttcaggttacagcaggcagtttcagcagccaggcttgcagagaattatatttttggagcaatgttat
                    Gorilla  gctttcagtttacagcaggcagtttcagcagccaggcttgcagagaattatatttttggagcaatgttat
                  Orangutan  gctttcaggttacagcaggcagtttcggcagtcaggcttgtagagaattatattttcggagcaatgttat
                     Rhesus  gctttcaggttacagcaggcagtttcagcagccaggtttgcagacaattttatttttggatcaatgttat
        Crab-eating macaque  gctttcaggttacagcaggcagtttcagcagccaggtttgcagacaattttatttttggatcaatgttat
                     Baboon  gctttcaggttacagcaggcagtttcagcagccaggtttgcagacaattttatttttggatcaatgttat
               Green monkey  gctttcaggttacagcaggcagtttcagcagccagatttgcagacaattttatttttggatcaatgttat
                   Marmoset  gctttcaagttacagcaggcagtttcagcagccaagcttgcagaaaattatatttttggagcaatgttat
            Squirrel monkey  gctttcaagttacagcagacagtttcagcagccaagcttgcagaaaattatatttttggagcaatgttat
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                    Megabat  ----------------------------------------------------------------------
           White rhinoceros  ======================================================================
                        Pig  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                     Gibbon  ======================================================================

                      Human  gtgccctgagtgattttccccc----------cctggcttcttgactctgttttagttgggtatgacaag
                      Chimp  gtgccctgagtgatttttcccc----------cctggcttcttgactctgttttagttgggtatgacaag
                    Gorilla  gtgccctgagtgattttccccc----------cttggcttcttgactctgttttagttgggtatgacgag
                  Orangutan  gtgccctgagtgatttcccccctccacccccgcccggcttcttgactctgttttagttgggtatgacaag
                     Rhesus  gtgtcctgagtgattttttccc----------cctggtttcttgactctgttttagttgggtatgacaag
        Crab-eating macaque  gtgtcctgagtgattttttccc----------cctggtttcttgactctgttttagttgggtatgacaag
                     Baboon  gtgtcctgagtgattttttccc----------cctggtttcttgactctgttttagttgggtatgacaag
               Green monkey  gtgtcctgagtgattttttccc----------cctggcttcttgactctgttttagttgggtatgacaag
                   Marmoset  gtgccatgagtgattttttgcc----------cctggcttcttaactctattttagttgggtatgataag
            Squirrel monkey  gtgccatgagtgattttttgcc----------cctggcttcttaactctatttttgttgggtatgctaag
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                    Megabat  ----------------------------------------------------------------------
           White rhinoceros  ======================================================================
                        Pig  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                     Gibbon  ======================================================================

                      Human  aatgacccaattcatataatcagctttcacagtagcgatgaagatggacagaagtgaatggaactgagat
                      Chimp  aatgacccaattcatataatcagctttcacagtagcgatgaagatggacagaagtgaatggaactgagat
                    Gorilla  aatgacccaattcatataatcagctttcacagtagcgatgaagatggacagaagtgaatggaactgagat
                  Orangutan  aatgacccaattcatataatcagctttcacagtagcgatgaagatggacagaagtgaatggaactgagat
                     Rhesus  aatgacccaatttacataatcagctttcacagtagtgatgaagatggacagaagtgaatggaaatgagat
        Crab-eating macaque  aatgacccaatttacataatcagctttcacagtagtgatgaagatggacagaagtgaatggaaatgagat
                     Baboon  aatgacccaatttacataatcagctttcacagtagtgatgaagatggacagaagtgaatggaactgagat
               Green monkey  aatgacccaatttacataatcagctttcacagtagtgatgaagatggacagaagtgaatggaactgagat
                   Marmoset  aatgacccaatttacataatcagctttcacagtagcaatgaagatggacagaagtgaacacaactgaaat
            Squirrel monkey  aatgacccaatttacataatcagctttcacagcagtaatgaagatggacagaagtgaacggaactgaaat
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                    Megabat  ----------------------------------------------------------------------
           White rhinoceros  ======================================================================
                        Pig  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                     Gibbon  ======================================================================

                      Human  atatttaaaagtaatgtctgcagcattagtcaaaatagccaaaaggtggaaacaacccaaatgtccattg
                      Chimp  atatttaaaagtaatgtctgcagcattagtcaaaatagccaaaaggtggaaacaacccaagtgtccattg
                    Gorilla  atatttaaaagtaatgtctgcagcattagtcaaaatagccaaaaggtggaaacaacccaagtgtccattg
                  Orangutan  atatttaaaagtaatgtctgcagcattagtcaaaatagccaaaaggtggaaacaacccaagggtccattg
                     Rhesus  atatttaaaagtaatgtctgtggcattcgtcaaaatagccaaac-gtggaaaaaatccaagtgtccattg
        Crab-eating macaque  atatttaaaagtaatgtctgtggcattagtcaaaatagccaaac-gtggaaaaaatccaagtgtccattg
                     Baboon  atatttaaaagtaatgtctgtggcattagtcaaaatagccaaac-gtggaaaaaatccaagtgtccattg
               Green monkey  atatttaaaagtaatgtctgtggcattagtcaaaatagccaaac-gtggaaacaatccaagtgtccattg
                   Marmoset  atatttaaaagtaatgtctgcagcattagtcaaaatagccgaaaggtggaaacaacccaagtgtccattg
            Squirrel monkey  atatttaaaagtaatgtctgcagcattagtcaaaatagccaaaaggtggaaaccacccaagtgtccattg
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                   Microbat  ======================================================================
              Big brown bat  ======================================================================
       David's myotis (bat)  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Squirrel  ======================================================================
                 Chinchilla  ======================================================================
                      Horse  ======================================================================
                    Megabat  ----------------------------------------------------------------------
           White rhinoceros  ======================================================================
                        Pig  ======================================================================
            Tasmanian devil  ======================================================================
                    Opossum  ======================================================================
                     Gibbon  ======================================================================

                      Human  aaggataaatggat
                      Chimp  aaggataaatggat
                    Gorilla  aaggataaatggat
                  Orangutan  aaggataaatggat
                     Rhesus  aaggataaacggat
        Crab-eating macaque  aaggataaacggat
                     Baboon  aaggataaacggat
               Green monkey  aaggataaatggat
                   Marmoset  aaggataaatggat
            Squirrel monkey  aagggtaaatggat
                       Pika  ==============
                     Rabbit  ==============
                   Microbat  ==============
              Big brown bat  ==============
       David's myotis (bat)  ==============
             Golden hamster  ==============
                      Mouse  ==============
               Prairie vole  ==============
     Lesser Egyptian jerboa  ==============
                   Squirrel  ==============
                 Chinchilla  ==============
                      Horse  ==============
                    Megabat  --------------
           White rhinoceros  ==============
                        Pig  ==============
            Tasmanian devil  ==============
                    Opossum  ==============
                     Gibbon  ==============

Alignment block 42 of 486 in window, 55039423 - 55039468, 46 bps 
B D                   Human  aaacaaaatgtggtatatacataccaaagaatactgttcagccttg
B D                   Chimp  aaacaaaatgtggtatatacataccaaagaatactgttcagccttg
B D                 Gorilla  aaacaaaatgtggtatatacataccaaagaatactgttcagccttg
B D               Orangutan  aaaccaaatgtggtatatacatacaaaagaacactgttcagccttg
B D                  Rhesus  aaacaaaatgtggtatatacatacaaaagaatactattcatccttg
B D     Crab-eating macaque  aaacaaaatgtggtatatacatacaaaagaatactattcatccttg
B D            Green monkey  aaacaaaatgtggtatatacatacaaaagaatactgttcatccttg
B D                Marmoset  aaacaaaatgtcgtatatacatacaaaagaatattgttcagccttg
B D         Squirrel monkey  aaacaaaatgtggtatacgcatacgaaagaatattgttcagccttg
B D                    Pika  ==============================================
B D                  Rabbit  ==============================================
B D                Microbat  ==============================================
             Big brown bat  ==============================================
      David's myotis (bat)  ==============================================
            Golden hamster  ==============================================
B D                   Mouse  ==============================================
              Prairie vole  ==============================================
    Lesser Egyptian jerboa  ==============================================
B D                Squirrel  ==============================================
                Chinchilla  ==============================================
B D                   Horse  ==============================================
B D                 Megabat  ----------------------------------------------
B D        White rhinoceros  ==============================================
B D                     Pig  ==============================================
B D         Tasmanian devil  ==============================================
B D                 Opossum  ==============================================
B D                  Gibbon  ==============================================
B D                  Baboon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 43 of 486 in window, 55039469 - 55039485, 17 bps 
B D                   Human  aaaaggaagaaaattc--t-
B D                   Chimp  aaaaggaagaaaattc-tt-
B D                 Gorilla  aaaaggaagaaaattcttt-
B D               Orangutan  aaaagaaagaaaattcttt-
B D                  Rhesus  aaaaggaagaaaatta----
B D     Crab-eating macaque  aaaaggaagaaaatta----
B D            Green monkey  aaaaggaagaaaattc----
B D                Marmoset  aaaaaaaagaaaattc---t
B D                    Pika  ====================
B D                  Rabbit  ====================
B D                Microbat  ====================
             Big brown bat  ====================
      David's myotis (bat)  ====================
            Golden hamster  ====================
B D                   Mouse  ====================
              Prairie vole  ====================
    Lesser Egyptian jerboa  ====================
B D                Squirrel  ====================
                Chinchilla  ====================
B D                   Horse  ====================
B D                 Megabat  --------------------
B D        White rhinoceros  ====================
B D         Squirrel monkey  --------------------
B D                     Pig  ====================
B D         Tasmanian devil  ====================
B D                 Opossum  ====================
B D                  Gibbon  ====================
B D                  Baboon  NNNNNNNNNNNNNNNNNNNN

Inserts between block 43 and 44 in window
B D               Marmoset 1094bp

Alignment block 44 of 486 in window, 55039486 - 55039532, 47 bps 
B D                   Human  tttttttttttttttaaaccacaggcctccagattgggccactaaaa
B D                   Chimp  tttttttttttttttaaaccacaggcctccagattgggccactaaaa
B D                 Gorilla  tttttttttttttttaaaccacaggcctccagattgggccactaaaa
B D               Orangutan  tttttttttttttttaaaccacaggcctccagattgggccactaaaa
B D                  Rhesus  -ttattttt-----ccccccacaggcctccagattgggccactaaaa
B D     Crab-eating macaque  -ttattttt-----ccccccacaggcctccagattgggccactaaaa
B D            Green monkey  -tttttttttttccccctccacaggcctccagattgggccactaaaa
B D                    Pika  ===============================================
B D                  Rabbit  ===============================================
B D                Microbat  ===============================================
             Big brown bat  ===============================================
      David's myotis (bat)  ===============================================
            Golden hamster  ===============================================
B D                   Mouse  ===============================================
              Prairie vole  ===============================================
    Lesser Egyptian jerboa  ===============================================
B D                Squirrel  ===============================================
                Chinchilla  ===============================================
B D                   Horse  ===============================================
B D                Marmoset  ===============================================
B D                 Megabat  -----------------------------------------------
B D        White rhinoceros  ===============================================
B D         Squirrel monkey  -----------------------------------------------
B D                     Pig  ===============================================
B D         Tasmanian devil  ===============================================
B D                 Opossum  ===============================================
B D                  Gibbon  ===============================================
B D                  Baboon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 45 of 486 in window, 55039533 - 55039627, 95 bps 
B D                   Human  ttactagtttatttagtgaagaaaccctaatggtattt----------ttttaaccctgaaaacaagcat
B D                   Chimp  ttactagtttatttagtgaagaaaccctaatggtattt----------ttttaaccctgaaaacaagcat
B D                 Gorilla  ttactagtttatttagtgaagaaaccctaatggtattt----------ttttaaccctgaaaacaagcat
B D               Orangutan  ttactagtttatttagtgaagaaaccctaatggtattt----------ttttaaccctgaaaacaagcat
B D                  Rhesus  ttactagtttatttagtgaagaaaccctaatggtattt----------ttttaaccctaaatacaagcat
B D     Crab-eating macaque  ttactagtttatttagtgaagaaaccctaatggtattt----------ttttaaccctaaatacaagcat
B D            Green monkey  ttactagtttatttagtgaagaaaccctaatggtattt----------ttttaaccctaaatacaagcat
B D                 Opossum  ttagtagcttattcaatgaagaaacctaagggaaatttgcaggacatattctgattt---------gcat
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                Microbat  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
              Prairie vole  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                Squirrel  ======================================================================
                Chinchilla  ======================================================================
B D                   Horse  ======================================================================
B D                Marmoset  ======================================================================
B D                 Megabat  ----------------------------------------------------------------------
B D        White rhinoceros  ======================================================================
B D         Squirrel monkey  ----------------------------------------------------------------------
B D                     Pig  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                  Gibbon  ======================================================================
B D                  Baboon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  ttccagttctttgctgatgccacatttttctgaga
                      Chimp  ttccagttctttgctgatgccacatttttctgaga
                    Gorilla  ttccagttctttgctgatgccacatttttctgaga
                  Orangutan  ttccagttctttgctgatgccacatttttctgaaa
                     Rhesus  ttccggttctttgctgacgccacatttttctgaga
        Crab-eating macaque  ttccggttctttgctgatgccacatttttctgaga
               Green monkey  ttccggttctttgctgatgccacattattctgaga
                    Opossum  taacatttc--tgataatgtaaaaagggtttagt-
                       Pika  ===================================
                     Rabbit  ===================================
                   Microbat  ===================================
              Big brown bat  ===================================
       David's myotis (bat)  ===================================
             Golden hamster  ===================================
                      Mouse  ===================================
               Prairie vole  ===================================
     Lesser Egyptian jerboa  ===================================
                   Squirrel  ===================================
                 Chinchilla  ===================================
                      Horse  ===================================
                   Marmoset  ===================================
                    Megabat  -----------------------------------
           White rhinoceros  ===================================
            Squirrel monkey  -----------------------------------
                        Pig  ===================================
            Tasmanian devil  ===================================
                     Gibbon  ===================================
                     Baboon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 46 of 486 in window, 55039628 - 55039633, 6 bps 
B D                   Human  tgaatg
B D                   Chimp  tgaatg
B D                 Gorilla  tgaatg
B D               Orangutan  tgaatg
B D                  Rhesus  tgaata
B D     Crab-eating macaque  tgaata
B D            Green monkey  tgaata
               Weddell seal  tg----
B D                 Opossum  tgatta
B D                    Pika  ======
B D                  Rabbit  ======
B D                Microbat  ======
             Big brown bat  ======
      David's myotis (bat)  ======
            Golden hamster  ======
B D                   Mouse  ======
              Prairie vole  ======
    Lesser Egyptian jerboa  ======
B D                Squirrel  ======
                Chinchilla  ======
B D                   Horse  ======
B D                Marmoset  ======
B D                 Megabat  ------
B D        White rhinoceros  ======
B D         Squirrel monkey  ------
B D                     Pig  ======
B D         Tasmanian devil  ======
B D                  Gibbon  ======
B D                  Baboon  NNNNNN

Inserts between block 46 and 47 in window
              Weddell seal 404bp

Alignment block 47 of 486 in window, 55039634 - 55039637, 4 bps 
B D                   Human  -ttat
B D                   Chimp  -ttat
B D                 Gorilla  -ttat
B D               Orangutan  -ttat
B D                  Rhesus  -ttat
B D     Crab-eating macaque  -ttat
B D            Green monkey  -ttat
B D                 Opossum  ttt--
B D                    Pika  =====
B D                  Rabbit  =====
B D                Microbat  =====
             Big brown bat  =====
      David's myotis (bat)  =====
            Golden hamster  =====
B D                   Mouse  =====
              Prairie vole  =====
    Lesser Egyptian jerboa  =====
B D                Squirrel  =====
                Chinchilla  =====
B D                   Horse  =====
B D                Marmoset  =====
B D                 Megabat  -----
B D        White rhinoceros  =====
B D         Squirrel monkey  -----
              Weddell seal  =====
B D                     Pig  =====
B D         Tasmanian devil  =====
B D                  Gibbon  =====
B D                  Baboon  NNNNN

Alignment block 48 of 486 in window, 55039638 - 55039641, 4 bps 
B D                   Human  tgtt-
B D                   Chimp  tgtt-
B D                 Gorilla  tgtt-
B D               Orangutan  tgtt-
B D                  Rhesus  tgtt-
B D     Crab-eating macaque  tgtt-
B D            Green monkey  tgtt-
B D                 Dolphin  tgtt-
B D                 Opossum  -gatc
B D                    Pika  =====
B D                  Rabbit  =====
B D                Microbat  =====
             Big brown bat  =====
      David's myotis (bat)  =====
            Golden hamster  =====
B D                   Mouse  =====
              Prairie vole  =====
    Lesser Egyptian jerboa  =====
B D                Squirrel  =====
                Chinchilla  =====
B D                   Horse  =====
B D                Marmoset  =====
B D                 Megabat  -----
B D        White rhinoceros  =====
B D         Squirrel monkey  -----
              Weddell seal  =====
B D                     Pig  =====
B D         Tasmanian devil  =====
B D                  Gibbon  =====
B D                  Baboon  NNNNN

Inserts between block 48 and 49 in window
B D                Dolphin 5bp

Alignment block 49 of 486 in window, 55039642 - 55039643, 2 bps 
B D                   Human  ac
B D                   Chimp  ac
B D                 Gorilla  ac
B D               Orangutan  ac
B D                  Rhesus  ac
B D     Crab-eating macaque  ac
B D            Green monkey  ac
B D                 Opossum  ag
B D                    Pika  ==
B D                  Rabbit  ==
B D                Microbat  ==
             Big brown bat  ==
      David's myotis (bat)  ==
            Golden hamster  ==
B D                   Mouse  ==
              Prairie vole  ==
    Lesser Egyptian jerboa  ==
B D                Squirrel  ==
                Chinchilla  ==
B D                   Horse  ==
B D                Marmoset  ==
B D                 Megabat  --
B D        White rhinoceros  ==
B D         Squirrel monkey  --
B D                 Dolphin  ==
              Weddell seal  ==
B D                     Pig  ==
B D         Tasmanian devil  ==
B D                  Gibbon  ==
B D                  Baboon  NN

Alignment block 50 of 486 in window, 55039644 - 55039644, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D            Green monkey  a
B D                 Megabat  g
B D                 Opossum  a
B D                    Pika  =
B D                  Rabbit  =
B D                Microbat  =
             Big brown bat  =
      David's myotis (bat)  =
            Golden hamster  =
B D                   Mouse  =
              Prairie vole  =
    Lesser Egyptian jerboa  =
B D                Squirrel  =
                Chinchilla  =
B D                   Horse  =
B D                Marmoset  =
B D        White rhinoceros  =
B D         Squirrel monkey  -
B D                 Dolphin  =
              Weddell seal  =
B D                     Pig  =
B D         Tasmanian devil  =
B D                  Gibbon  =
B D                  Baboon  N

Inserts between block 50 and 51 in window
B D                Megabat 382bp

Alignment block 51 of 486 in window, 55039645 - 55039646, 2 bps 
B D                   Human  tg-
B D                   Chimp  tg-
B D                 Gorilla  tg-
B D               Orangutan  tg-
B D                  Rhesus  ca-
B D     Crab-eating macaque  ca-
B D            Green monkey  ca-
B D                 Opossum  -ag
B D                    Pika  ===
B D                  Rabbit  ===
B D                Microbat  ===
             Big brown bat  ===
      David's myotis (bat)  ===
            Golden hamster  ===
B D                   Mouse  ===
              Prairie vole  ===
    Lesser Egyptian jerboa  ===
B D                Squirrel  ===
                Chinchilla  ===
B D                   Horse  ===
B D                Marmoset  ===
B D                 Megabat  ===
B D        White rhinoceros  ===
B D         Squirrel monkey  ---
B D                 Dolphin  ===
              Weddell seal  ===
B D                     Pig  ===
B D         Tasmanian devil  ===
B D                  Gibbon  ===
B D                  Baboon  NNN

Alignment block 52 of 486 in window, 55039647 - 55039648, 2 bps 
B D                   Human  ct
B D                   Chimp  ct
B D                 Gorilla  ct
B D               Orangutan  tt
B D                  Rhesus  tt
B D     Crab-eating macaque  tt
B D            Green monkey  tt
B D                 Dolphin  tt
B D                 Opossum  ct
B D                    Pika  ==
B D                  Rabbit  ==
B D                Microbat  ==
             Big brown bat  ==
      David's myotis (bat)  ==
            Golden hamster  ==
B D                   Mouse  ==
              Prairie vole  ==
    Lesser Egyptian jerboa  ==
B D                Squirrel  ==
                Chinchilla  ==
B D                   Horse  ==
B D                Marmoset  ==
B D                 Megabat  ==
B D        White rhinoceros  ==
B D         Squirrel monkey  --
              Weddell seal  ==
B D                     Pig  ==
B D         Tasmanian devil  ==
B D                  Gibbon  ==
B D                  Baboon  NN

Inserts between block 52 and 53 in window
B D                Dolphin 80bp

Alignment block 53 of 486 in window, 55039649 - 55039718, 70 bps 
B D                   Human  actgttactatttatggtgcccggagcagtgtggattc---------------------tttgcaaatat
B D                   Chimp  actgttactatttatggtgcccggagcagtgtggattc---------------------tttgcaaatat
B D                 Gorilla  actgttactacttatggtgcccggagcagtgtggattc---------------------tttgcaaatat
B D               Orangutan  accgttactatttatggtgcccggagcagtgtggattc---------------------tttgcaaatat
B D                  Rhesus  act-ttactatttatggtgcccggagcagtgtgagttc---------------------tttgcaaatat
B D     Crab-eating macaque  act-ttactatttatggtgcccggagcagtgtgagttc---------------------tttgcaaatat
B D            Green monkey  actgttactatttatggtgcccggagcagtgtgggttc---------------------tttgcaaatat
B D                 Opossum  ------actgcttttattccccgagtttacaaaaatcccacatcttccttctctgtctgcttggaaaaat
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                Microbat  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
              Prairie vole  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                Squirrel  ======================================================================
                Chinchilla  ======================================================================
B D                   Horse  ======================================================================
B D                Marmoset  ======================================================================
B D                 Megabat  ======================================================================
B D        White rhinoceros  ======================================================================
B D         Squirrel monkey  ----------------------------------------------------------------------
B D                 Dolphin  ======================================================================
              Weddell seal  ======================================================================
B D                     Pig  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                  Gibbon  ======================================================================
B D                  Baboon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  tattatcttgtcgatttctca
                      Chimp  tattatcttgtcgatttctca
                    Gorilla  tattatcttgtcgatttctca
                  Orangutan  tactatcttgtcgatttctca
                     Rhesus  ttttatcttgtcgatttctca
        Crab-eating macaque  tattatcttgtcgatttctca
               Green monkey  tattatcttgttgatttctca
                    Opossum  gcctagtctgtc---tcccc-
                       Pika  =====================
                     Rabbit  =====================
                   Microbat  =====================
              Big brown bat  =====================
       David's myotis (bat)  =====================
             Golden hamster  =====================
                      Mouse  =====================
               Prairie vole  =====================
     Lesser Egyptian jerboa  =====================
                   Squirrel  =====================
                 Chinchilla  =====================
                      Horse  =====================
                   Marmoset  =====================
                    Megabat  =====================
           White rhinoceros  =====================
            Squirrel monkey  ---------------------
                    Dolphin  =====================
               Weddell seal  =====================
                        Pig  =====================
            Tasmanian devil  =====================
                     Gibbon  =====================
                     Baboon  NNNNNNNNNNNNNNNNNNNNN

Inserts between block 53 and 54 in window
B D                Opossum 8bp

Alignment block 54 of 486 in window, 55039719 - 55039725, 7 bps 
B D                   Human  tgggatt
B D                   Chimp  tgggatt
B D                 Gorilla  tgggatt
B D               Orangutan  tgggatt
B D                  Rhesus  tgggatt
B D     Crab-eating macaque  tgggatt
B D            Green monkey  tgggatt
                   Aardvark  tgtgagt
B D                 Opossum  tggactt
B D                    Pika  =======
B D                  Rabbit  =======
B D                Microbat  =======
             Big brown bat  =======
      David's myotis (bat)  =======
            Golden hamster  =======
B D                   Mouse  =======
              Prairie vole  =======
    Lesser Egyptian jerboa  =======
B D                Squirrel  =======
                Chinchilla  =======
B D                   Horse  =======
B D                Marmoset  =======
B D                 Megabat  =======
B D        White rhinoceros  =======
B D         Squirrel monkey  -------
B D                 Dolphin  =======
              Weddell seal  =======
B D                     Pig  =======
B D         Tasmanian devil  =======
B D                  Gibbon  =======
B D                  Baboon  NNNNNNN

Alignment block 55 of 486 in window, 55039726 - 55039726, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D            Green monkey  t
B D                 Dolphin  c
                   Aardvark  t
B D                 Opossum  c
B D                    Pika  =
B D                  Rabbit  =
B D                Microbat  =
             Big brown bat  =
      David's myotis (bat)  =
            Golden hamster  =
B D                   Mouse  =
              Prairie vole  =
    Lesser Egyptian jerboa  =
B D                Squirrel  =
                Chinchilla  =
B D                   Horse  =
B D                Marmoset  =
B D                 Megabat  =
B D        White rhinoceros  =
B D         Squirrel monkey  -
              Weddell seal  =
B D                     Pig  =
B D         Tasmanian devil  =
B D                  Gibbon  =
B D                  Baboon  N

Inserts between block 55 and 56 in window
B D                Dolphin 30bp

Alignment block 56 of 486 in window, 55039727 - 55039730, 4 bps 
B D                   Human  tgca
B D                   Chimp  tgca
B D                 Gorilla  tgca
B D               Orangutan  tgca
B D                  Rhesus  tgca
B D     Crab-eating macaque  tgca
B D            Green monkey  tgca
                   Aardvark  ttta
B D                 Opossum  tgct
B D                    Pika  ====
B D                  Rabbit  ====
B D                Microbat  ====
             Big brown bat  ====
      David's myotis (bat)  ====
            Golden hamster  ====
B D                   Mouse  ====
              Prairie vole  ====
    Lesser Egyptian jerboa  ====
B D                Squirrel  ====
                Chinchilla  ====
B D                   Horse  ====
B D                Marmoset  ====
B D                 Megabat  ====
B D        White rhinoceros  ====
B D         Squirrel monkey  ----
B D                 Dolphin  ====
              Weddell seal  ====
B D                     Pig  ====
B D         Tasmanian devil  ====
B D                  Gibbon  ====
B D                  Baboon  NNNN

Inserts between block 56 and 57 in window
                  Aardvark 107bp

Alignment block 57 of 486 in window, 55039731 - 55039755, 25 bps 
B D                   Human  aatactgcttttccagaagaggaaa
B D                   Chimp  aatactgctttttcagaagaggaaa
B D                 Gorilla  aatactgcttttccagaagaggaaa
B D               Orangutan  aatactgcttttccagaagaggaaa
B D                  Rhesus  aatactgcttttccagaagaggaaa
B D     Crab-eating macaque  aatactgcttttccagaagaagaaa
B D            Green monkey  aatactgcttttccagaagaggaaa
B D                 Opossum  atggctgctgctgaggaaaaggtca
B D                    Pika  =========================
B D                  Rabbit  =========================
B D                Microbat  =========================
             Big brown bat  =========================
      David's myotis (bat)  =========================
            Golden hamster  =========================
B D                   Mouse  =========================
              Prairie vole  =========================
    Lesser Egyptian jerboa  =========================
B D                Squirrel  =========================
                Chinchilla  =========================
B D                   Horse  =========================
B D                Marmoset  =========================
B D                 Megabat  =========================
B D        White rhinoceros  =========================
B D         Squirrel monkey  -------------------------
B D                 Dolphin  =========================
              Weddell seal  =========================
B D                     Pig  =========================
                  Aardvark  =========================
B D         Tasmanian devil  =========================
B D                  Gibbon  =========================
B D                  Baboon  NNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 58 of 486 in window, 55039756 - 55039756, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D            Green monkey  c
B D                 Dolphin  t
B D                 Opossum  c
B D                    Pika  =
B D                  Rabbit  =
B D                Microbat  =
             Big brown bat  =
      David's myotis (bat)  =
            Golden hamster  =
B D                   Mouse  =
              Prairie vole  =
    Lesser Egyptian jerboa  =
B D                Squirrel  =
                Chinchilla  =
B D                   Horse  =
B D                Marmoset  =
B D                 Megabat  =
B D        White rhinoceros  =
B D         Squirrel monkey  -
              Weddell seal  =
B D                     Pig  =
                  Aardvark  =
B D         Tasmanian devil  =
B D                  Gibbon  =
B D                  Baboon  N

Inserts between block 58 and 59 in window
B D                Dolphin 71bp

Alignment block 59 of 486 in window, 55039757 - 55039798, 42 bps 
B D                   Human  ----------ctggtcttagagaactgagtcactgcctaaggtcacatagac------
B D                   Chimp  ----------ctggtcttagagaactgagtcactgcctaaggtcacatagac------
B D                 Gorilla  ----------ctggtcttagagaactgagtcactgcctaaggtcacatagac------
B D               Orangutan  ----------ctggtcttagagaactgagtcactgcctaaggtcacatagac------
B D                  Rhesus  ----------ctgttctcagagaactgagtcactgcctaaggtcacatagcc------
B D     Crab-eating macaque  ----------ctggtcttagagaactgagtcactgcctaaggtcacatagcc------
B D            Green monkey  ----------ctggtctcagagaactgagccactacctaaggtcacataacc------
B D                 Opossum  aacttaaatagtggtttttaa-----gagtca-tatccaggcacagacaggagcagtt
B D                    Pika  ==========================================================
B D                  Rabbit  ==========================================================
B D                Microbat  ==========================================================
             Big brown bat  ==========================================================
      David's myotis (bat)  ==========================================================
            Golden hamster  ==========================================================
B D                   Mouse  ==========================================================
              Prairie vole  ==========================================================
    Lesser Egyptian jerboa  ==========================================================
B D                Squirrel  ==========================================================
                Chinchilla  ==========================================================
B D                   Horse  ==========================================================
B D                Marmoset  ==========================================================
B D                 Megabat  ==========================================================
B D        White rhinoceros  ==========================================================
B D         Squirrel monkey  ----------------------------------------------------------
B D                 Dolphin  ==========================================================
              Weddell seal  ==========================================================
B D                     Pig  ==========================================================
                  Aardvark  ==========================================================
B D         Tasmanian devil  ==========================================================
B D                  Gibbon  ==========================================================
B D                  Baboon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 59 and 60 in window
B D                 Rhesus 1bp
B D    Crab-eating macaque 1bp
B D           Green monkey 4bp

Alignment block 60 of 486 in window, 55039799 - 55039799, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                 Opossum  a
B D                    Pika  =
B D                  Rabbit  =
B D                Microbat  =
             Big brown bat  =
      David's myotis (bat)  =
            Golden hamster  =
B D                   Mouse  =
              Prairie vole  =
    Lesser Egyptian jerboa  =
B D                Squirrel  =
                Chinchilla  =
B D                   Horse  =
B D                Marmoset  =
B D                 Megabat  =
B D        White rhinoceros  =
B D         Squirrel monkey  -
B D            Green monkey  =
B D                 Dolphin  =
              Weddell seal  =
B D                     Pig  =
B D     Crab-eating macaque  =
                  Aardvark  =
B D         Tasmanian devil  =
B D                  Gibbon  =
B D                  Rhesus  =
B D                  Baboon  N

Alignment block 61 of 486 in window, 55039800 - 55039818, 19 bps 
B D                   Human  gtgtgggccaggctgggat
B D                   Chimp  gtgtgggccaggctgggat
B D                 Gorilla  gtgtgggccaggctgggat
B D               Orangutan  gtgtgggccaggctgggat
B D                  Rhesus  gtgtgggccaggctgggat
B D     Crab-eating macaque  gtgtgggccaggctgggat
B D            Green monkey  gtgtgggctaggctgggat
B D                 Opossum  gtttcagctgggcaagggt
B D                    Pika  ===================
B D                  Rabbit  ===================
B D                Microbat  ===================
             Big brown bat  ===================
      David's myotis (bat)  ===================
            Golden hamster  ===================
B D                   Mouse  ===================
              Prairie vole  ===================
    Lesser Egyptian jerboa  ===================
B D                Squirrel  ===================
                Chinchilla  ===================
B D                   Horse  ===================
B D                Marmoset  ===================
B D                 Megabat  ===================
B D        White rhinoceros  ===================
B D         Squirrel monkey  -------------------
B D                 Dolphin  ===================
              Weddell seal  ===================
B D                     Pig  ===================
                  Aardvark  ===================
B D         Tasmanian devil  ===================
B D                  Gibbon  ===================
B D                  Baboon  NNNNNNNNNNNNNNNNNNN

Alignment block 62 of 486 in window, 55039819 - 55039822, 4 bps 
B D                   Human  tcag
B D                   Chimp  tcag
B D                 Gorilla  tcag
B D               Orangutan  tcag
B D                  Rhesus  tcag
B D     Crab-eating macaque  tcag
B D            Green monkey  tcag
B D                    Pika  ====
B D                  Rabbit  ====
B D                Microbat  ====
             Big brown bat  ====
      David's myotis (bat)  ====
            Golden hamster  ====
B D                   Mouse  ====
              Prairie vole  ====
    Lesser Egyptian jerboa  ====
B D                Squirrel  ====
                Chinchilla  ====
B D                   Horse  ====
B D                Marmoset  ====
B D                 Megabat  ====
B D        White rhinoceros  ====
B D         Squirrel monkey  ----
B D                 Dolphin  ====
              Weddell seal  ====
B D                     Pig  ====
                  Aardvark  ====
B D         Tasmanian devil  ====
B D                 Opossum  ====
B D                  Gibbon  ====
B D                  Baboon  NNNN

Alignment block 63 of 486 in window, 55039823 - 55039825, 3 bps 
B D                   Human  ccc
B D                   Chimp  ccc
B D                 Gorilla  ccc
B D               Orangutan  ccc
B D                  Rhesus  ccc
B D     Crab-eating macaque  ccc
B D            Green monkey  ccc
                   Aardvark  ccc
B D                    Pika  ===
B D                  Rabbit  ===
B D                Microbat  ===
             Big brown bat  ===
      David's myotis (bat)  ===
            Golden hamster  ===
B D                   Mouse  ===
              Prairie vole  ===
    Lesser Egyptian jerboa  ===
B D                Squirrel  ===
                Chinchilla  ===
B D                   Horse  ===
B D                Marmoset  ===
B D                 Megabat  ===
B D        White rhinoceros  ===
B D         Squirrel monkey  ---
B D                 Dolphin  ===
              Weddell seal  ===
B D                     Pig  ===
B D         Tasmanian devil  ===
B D                 Opossum  ===
B D                  Gibbon  ===
B D                  Baboon  NNN

Alignment block 64 of 486 in window, 55039826 - 55039832, 7 bps 
B D                   Human  ggggctg
B D                   Chimp  ggggctg
B D                 Gorilla  ggggctg
B D               Orangutan  ggggctg
B D                  Rhesus  ggggctg
B D     Crab-eating macaque  ggggctg
B D            Green monkey  aggactg
           Cape golden mole  cagactg
                   Aardvark  taggctg
B D                    Pika  =======
B D                  Rabbit  =======
B D                Microbat  =======
             Big brown bat  =======
      David's myotis (bat)  =======
            Golden hamster  =======
B D                   Mouse  =======
              Prairie vole  =======
    Lesser Egyptian jerboa  =======
B D                Squirrel  =======
                Chinchilla  =======
B D                   Horse  =======
B D                Marmoset  =======
B D                 Megabat  =======
B D        White rhinoceros  =======
B D         Squirrel monkey  -------
B D                 Dolphin  =======
              Weddell seal  =======
B D                     Pig  =======
B D         Tasmanian devil  =======
B D                 Opossum  =======
B D                  Gibbon  =======
B D                  Baboon  NNNNNNN

Alignment block 65 of 486 in window, 55039833 - 55039833, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  g
B D                  Rhesus  g
B D     Crab-eating macaque  g
B D            Green monkey  g
B D                 Dolphin  g
           Cape golden mole  a
                   Aardvark  g
B D                    Pika  =
B D                  Rabbit  =
B D                Microbat  =
             Big brown bat  =
      David's myotis (bat)  =
            Golden hamster  =
B D                   Mouse  =
              Prairie vole  =
    Lesser Egyptian jerboa  =
B D                Squirrel  =
                Chinchilla  =
B D                   Horse  =
B D                Marmoset  =
B D                 Megabat  =
B D        White rhinoceros  =
B D         Squirrel monkey  -
              Weddell seal  =
B D                     Pig  =
B D         Tasmanian devil  =
B D                 Opossum  =
B D                  Gibbon  =
B D                  Baboon  N

Inserts between block 65 and 66 in window
B D                Dolphin 165bp
          Cape golden mole 1bp

Alignment block 66 of 486 in window, 55039834 - 55039836, 3 bps 
B D                   Human  ccc
B D                   Chimp  ccc
B D                 Gorilla  ccc
B D               Orangutan  ccc
B D                  Rhesus  ccc
B D     Crab-eating macaque  ccc
B D            Green monkey  ccc
           Cape golden mole  ccc
B D                    Pika  ===
B D                  Rabbit  ===
B D                Microbat  ===
             Big brown bat  ===
      David's myotis (bat)  ===
            Golden hamster  ===
B D                   Mouse  ===
              Prairie vole  ===
    Lesser Egyptian jerboa  ===
B D                Squirrel  ===
                Chinchilla  ===
B D                   Horse  ===
B D                Marmoset  ===
B D                 Megabat  ===
B D        White rhinoceros  ===
B D         Squirrel monkey  ---
B D                 Dolphin  ===
              Weddell seal  ===
B D                     Pig  ===
B D         Tasmanian devil  ===
B D                 Opossum  ===
B D                  Gibbon  ===
B D                  Baboon  NNN

Alignment block 67 of 486 in window, 55039837 - 55039873, 37 bps 
B D                   Human  atgtccttgttcttttcaatagcttcttcactgtcac
B D                   Chimp  atgtccttgttcttttcaatagcttcttcactgtcac
B D                 Gorilla  atgtcctttttcttttcaatagcttcttcactgtcac
B D               Orangutan  atgtccttgttcttttcaatagcttcttcactgtcac
B D                  Rhesus  atgtccttgttcttttcaatagcttctttactgtcac
B D     Crab-eating macaque  atgtccttgttcttttcaatagcttctttactgtcac
B D            Green monkey  acatccttgttcttttcaataacttcttcactgtcac
B D                    Pika  =====================================
B D                  Rabbit  =====================================
B D                Microbat  =====================================
             Big brown bat  =====================================
      David's myotis (bat)  =====================================
            Golden hamster  =====================================
B D                   Mouse  =====================================
              Prairie vole  =====================================
    Lesser Egyptian jerboa  =====================================
B D                Squirrel  =====================================
                Chinchilla  =====================================
B D                   Horse  =====================================
B D                Marmoset  =====================================
B D                 Megabat  =====================================
B D        White rhinoceros  =====================================
B D         Squirrel monkey  -------------------------------------
B D                 Dolphin  =====================================
              Weddell seal  =====================================
B D                     Pig  =====================================
B D         Tasmanian devil  =====================================
B D                 Opossum  =====================================
B D                  Gibbon  =====================================
B D                  Baboon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 68 of 486 in window, 55039874 - 55039897, 24 bps 
B D                   Human  ttgcttattgctttccatttgcca
B D                   Chimp  ttgcttattgctttccatttgcca
B D                 Gorilla  ttgcttattgctttccatttgcca
B D               Orangutan  ttgcttattgctttccatttgcca
B D                  Rhesus  ttgcttattgctttccatttgcca
B D     Crab-eating macaque  ttgcttattgctttccatttgcca
B D                  Baboon  ttgcttattgctttccatttgcca
B D            Green monkey  ttgcttattgctttccatttgcca
B D                    Pika  ========================
B D                  Rabbit  ========================
B D                Microbat  ========================
             Big brown bat  ========================
      David's myotis (bat)  ========================
            Golden hamster  ========================
B D                   Mouse  ========================
              Prairie vole  ========================
    Lesser Egyptian jerboa  ========================
B D                Squirrel  ========================
                Chinchilla  ========================
B D                   Horse  ========================
B D                Marmoset  ========================
B D                 Megabat  ========================
B D        White rhinoceros  ========================
B D         Squirrel monkey  ------------------------
B D                 Dolphin  ========================
              Weddell seal  ========================
B D                     Pig  ========================
B D         Tasmanian devil  ========================
B D                 Opossum  ========================
B D                  Gibbon  ========================

Alignment block 69 of 486 in window, 55039898 - 55039968, 71 bps 
B D                   Human  atggaccatgctttatgacgtaggaatttgtgtttttgtttaaaagcatcaggaaaataat-aaaa--aa
B D                   Chimp  atggaccatgctttatgacgtaggaatttgtgtttttgtttaaaagcatcaggaaaataat-aaaa--aa
B D                 Gorilla  atggaccatgctttatgacataggaatttgtgtttttgtttaaaagcatcaggaaaataat-taaa--aa
B D               Orangutan  atggaccatgctttatgacataggaatttgtgtttttgtttaaaagcatcaggaaaataat-taaa--aa
B D                  Rhesus  atggaccatgctttatgacatagtaatttgtatttttgtttaaaagcatctggaaaataat-aaaaataa
B D     Crab-eating macaque  atggaccatggtttatgacataggaatttgtatttttgtttaaaaacatctggaaaataat-aaaaataa
B D                  Baboon  atggaccatggtttatgacataggaatttgtatttttgtttaaaaacatctggaaaataataaaaaataa
B D            Green monkey  atggaccatgctttatgacataggaatttgtatttttgtttaaaaacatctggaaaataat-aaaaataa
B D                 Opossum  atgaaacaaattccaatatgtagaact---ggcttttctttatgag-----------tcat-taaa--aa
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                Microbat  ======================================================================
             Big brown bat  ======================================================================
      David's myotis (bat)  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
              Prairie vole  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                Squirrel  ======================================================================
                Chinchilla  ======================================================================
B D                   Horse  ======================================================================
B D                Marmoset  ======================================================================
B D                 Megabat  ======================================================================
B D        White rhinoceros  ======================================================================
B D         Squirrel monkey  ----------------------------------------------------------------------
B D                 Dolphin  ======================================================================
              Weddell seal  ======================================================================
B D                     Pig  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                  Gibbon  ======================================================================

                      Human  attg
                      Chimp  attg
                    Gorilla  attg
                  Orangutan  gttg
                     Rhesus  tttg
        Crab-eating macaque  tttg
                     Baboon  tttg
               Green monkey  tttg
                    Opossum  attc
                       Pika  ====
                     Rabbit  ====
                   Microbat  ====
              Big brown bat  ====
       David's myotis (bat)  ====
             Golden hamster  ====
                      Mouse  ====
               Prairie vole  ====
     Lesser Egyptian jerboa  ====
                   Squirrel  ====
                 Chinchilla  ====
                      Horse  ====
                   Marmoset  ====
                    Megabat  ====
           White rhinoceros  ====
            Squirrel monkey  ----
                    Dolphin  ====
               Weddell seal  ====
                        Pig  ====
            Tasmanian devil  ====
                     Gibbon  ====

Alignment block 70 of 486 in window, 55039969 - 55039973, 5 bps 
B D                   Human  aaaat
B D                   Chimp  aaaat
B D                 Gorilla  aaaat
B D               Orangutan  aaaat
B D                  Rhesus  aaaat
B D     Crab-eating macaque  aaaat
B D                  Baboon  aaaat
B D            Green monkey  aaaat
B D                     Pig  aaaat
B D                 Opossum  aacat
B D                    Pika  =====
B D                  Rabbit  =====
B D                Microbat  =====
             Big brown bat  =====
      David's myotis (bat)  =====
            Golden hamster  =====
B D                   Mouse  =====
              Prairie vole  =====
    Lesser Egyptian jerboa  =====
B D                Squirrel  =====
                Chinchilla  =====
B D                   Horse  =====
B D                Marmoset  =====
B D                 Megabat  =====
B D        White rhinoceros  =====
B D         Squirrel monkey  -----
B D                 Dolphin  =====
              Weddell seal  =====
B D         Tasmanian devil  =====
B D                  Gibbon  =====

Inserts between block 70 and 71 in window
B D                Opossum 43bp

Alignment block 71 of 486 in window, 55039974 - 55039993, 20 bps 
B D                   Human  a-----------tagcttaa---------------gtatattacgt
B D                   Chimp  a-----------tagcttaa---------------gtatattatgt
B D                 Gorilla  a-----------tagcttaa---------------gtatattatgt
B D               Orangutan  a-----------tagcttaa---------------gtatattacgt
B D                  Rhesus  g-----------tagcttaa---------------gtatattgtgt
B D     Crab-eating macaque  g-----------tagcttaa---------------gtatattgtgt
B D                  Baboon  g-----------tagcttaa---------------gtatattgtgt
B D            Green monkey  a-----------tagcttaa---------------gtatattgtgt
B D                     Pig  aatctttacacttagcttaaaaatgcagtgcagatgtagattaaat
B D                    Pika  ==============================================
B D                  Rabbit  ==============================================
B D                Microbat  ==============================================
             Big brown bat  ==============================================
      David's myotis (bat)  ==============================================
            Golden hamster  ==============================================
B D                   Mouse  ==============================================
              Prairie vole  ==============================================
    Lesser Egyptian jerboa  ==============================================
B D                Squirrel  ==============================================
                Chinchilla  ==============================================
B D                   Horse  ==============================================
B D                Marmoset  ==============================================
B D                 Megabat  ==============================================
B D        White rhinoceros  ==============================================
B D         Squirrel monkey  ----------------------------------------------
B D                 Dolphin  ==============================================
              Weddell seal  ==============================================
B D         Tasmanian devil  ==============================================
B D                 Opossum  ==============================================
B D                  Gibbon  ==============================================

Alignment block 72 of 486 in window, 55039994 - 55039995, 2 bps 
B D                   Human  at
B D                   Chimp  at
B D                 Gorilla  at
B D               Orangutan  at
B D                  Rhesus  at
B D     Crab-eating macaque  at
B D                  Baboon  at
B D            Green monkey  at
B D                     Pig  ac
B D                 Dolphin  at
B D                    Pika  ==
B D                  Rabbit  ==
B D                Microbat  ==
             Big brown bat  ==
      David's myotis (bat)  ==
            Golden hamster  ==
B D                   Mouse  ==
              Prairie vole  ==
    Lesser Egyptian jerboa  ==
B D                Squirrel  ==
                Chinchilla  ==
B D                   Horse  ==
B D                Marmoset  ==
B D                 Megabat  ==
B D        White rhinoceros  ==
B D         Squirrel monkey  --
              Weddell seal  ==
B D         Tasmanian devil  ==
B D                 Opossum  ==
B D                  Gibbon  ==

Alignment block 73 of 486 in window, 55039996 - 55040007, 12 bps 
B D                   Human  --taaacaaaacac
B D                   Chimp  --taaacaaaacac
B D                 Gorilla  --taaacaaaacac
B D               Orangutan  --taaacagaacac
B D                  Rhesus  --taaacaaaacac
B D     Crab-eating macaque  --taaacaaaacac
B D                  Baboon  --taaacaaaacac