Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 33 in window, 32589144 - 32589204, 61 bps 
B D                     Human  gag--ataa---tggg-g------------aggccactgg--------------gt-ccatcct--cac-
B D                     Chimp  gag--ttaa---tggg-g------------aggccactgg--------------gt-ccatcct--cac-
B D                   Gorilla  gag--atac---tagg-g------------aggccactgg--------------gt-ccatcct--cac-
B D                 Orangutan  gag--ataa---tggg-g------------aggccactgg--------------gt-ccatcct--cac-
B D                    Gibbon  gag--ataa---taga-g------------aggccactgg--------------gt-ccatcct--cac-
B D                    Rhesus  gag--ataa---tggg-g------------aggccactgg--------------gt-ccatcct--cac-
B D       Crab-eating macaque  gag--atga---tgag-g------------aggccact-g--------------gt-ccatcct--cac-
B D                    Baboon  gag--gtaa---tggg-g------------aggccactgg--------------gt-ctatcct--cac-
B D              Green monkey  gag--atca---tggg-a------------aggccgct-g--------------gt-ccatcct--cac-
B D                  Marmoset  gag--atac---tggg-g------------aggcccccag--------------gt-acatcct--cac-
B D           Squirrel monkey  gag--ataa---tcag-g------------aagcccctgg--------------gt-acatcct--cac-
           Chinese tree shrew  agg--ctaa---tgagca------------aggtctcttg--------------at-ccagcct--cac-
B D                  Squirrel  aag--acag---tgga-t-------g----acacatcctg--------------ga-gcatcct--cac-
                 Prairie vole  ga---gccc---tggg-c---------------------------------------tcagcct--ccca
B D           Chinese hamster  gat--gtca---tg---------------------------------------------atccc--ccc-
               Golden hamster  gat--gcca---tg---------------------------------------------atccc--ccc-
B D                     Mouse  aggaagccc---tggg-t---------------------------------------tacgcct--caca
B D                       Rat  aag------------------------------------------------------------c--caca
B D            Naked mole-rat  aag--gtga---caga-g-------g----tcgcctctcg--------------gg-atg----------
B D                Guinea pig  aag--ctga---caga-g-------g----acagttctgg--------------gt-acatctc--cac-
                   Chinchilla  gaa--gtga---tgga-g-------a----atgcctccca--------------gt-gcatcca--cac-
             Brush-tailed rat  -ag--atga---ggga-g-------g----agagcactga--------------ga-ggacctg--cac-
B D                    Rabbit  aac--atcc---agga-g-------t----ataaagctta-------------------aaccc--c---
B D                      Pika  cag--atag---agga-c-------tggtgatacagctcacacatagagaggaaca-ccaaccc--cac-
B D                       Pig  gat--ttaa---tggg-g------ag----cggccctgtg--------------at-acattct--cag-
B D                    Alpaca  tat--ttaa---tggg-g------ag----agcctctttg--------------at-acattct--cat-
               Bactrian camel  gat--ttaa---tggg-g------ag----agactctttg--------------at-acattct--cat-
                 Killer whale  aag--ataa---tagg-g-------g----agttcccttg--------------at-acatcct--cat-
             Tibetan antelope  ggc--ttaa---tagg-a------ag----agaccttttg--------------at-atgttct--tac-
B D                       Cow  ggc--ttaa---tggg-a------ac----agaccttttg--------------at-atattct--tac-
B D                     Sheep  agc--ttaa---tggg-g------ag----agaccttttg--------------at-atattct--tac-
                Domestic goat  agc--ttaa---tggg-g------ag----agaccttttg--------------at-atattct--tac-
B D                     Horse  gag--ataa---tgga-c-------g----agg-ctcttg--------------at-acatcct--cat-
B D                       Cat  gag--ataa---tggg-a-------g----agaacccttg--------------at-acagcct--cgc-
B D                       Dog  gag--atca---tggg-a-------g----aaacctcttg--------------at-acattct--cac-
B D                   Ferret   gag--ataa---tgga-a-------g----agacctcttg--------------at-acatcct--cac-
B D                     Panda  gag--ataa---tggt-a-------g----agacctcttg--------------at-acatcct--cac-
               Pacific walrus  gaa--ataa---tggg-a-------g----ggacctcttg--------------at-acatcct--cac-
                 Weddell seal  gag--ataa---tggg-a-------g----agacctcttg--------------at-acatcct--cac-
             Black flying-fox  gag--ataa---tgag-g-------g----aggccacttg--------------at-atatcct--cac-
B D                   Megabat  gag--ataa---tgag-g-------g----aggccacttg--------------at-atatcct--ctc-
         David's myotis (bat)  gag--atgg---tg-g-g-------a----aggccccttg--------------at-gctt-ct--cac-
B D                  Microbat  gag--atgg---tg-g-g-------g----aggcccctgg--------------at-acat-ct--cac-
B D                  Hedgehog  gag--acca---tagg-gtggtaata----aggcctcttg--------------at-acatctt--tcc-
B D                     Shrew  aat--aaca---tcga-g-------g----aggtctcttg--------------ga-atgtcaa--aac-
              Star-nosed mole  gag--ataa---tggg-g-------g----aggccccttg--------------at-atattgt--ggc-
B D                  Elephant  gtg--ataa---tgga-g-------g----aggcttcttg--------------atagcacacttatat-
B D                   Manatee  gtg--ttaa---tgga-g-------g----aggcttcttg--------------acagcacact--tac-
             Cape golden mole  gaa--agaa---tagg-a-------g----aggccccttg--------------attgtgtcct--cac-
                     Aardvark  gaa--gtcactgtggg-g-------g----gagactcttc--------------atggtattct--cac-
B D                 Armadillo  gag--ataa----ggg-g-------g----agtcctcttg--------------atcgcaccc---cac-
B D                   Dolphin  ======================================================================
                 Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ----------------------------------------------------------------------
B D             X. tropicalis  ----------------------------------------------------------------------
B D                    Lizard  ----------------------------------------------------------------------
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------------------
  D           Green seaturtle  ======================================================================
B D                    Turkey  ----------------------------------------------------------------------
B D                   Chicken  ----------------------------------------------------------------------
  D              Mallard duck  ----------------------------------------------------------------------
  D             Scarlet macaw  ----------------------------------------------------------------------
  D                    Parrot  ----------------------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------------------
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                  Platypus  ----------------------------------------------------------------------
B D                   Wallaby  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ----------------------------------------------------------------------
B D                  Bushbaby  ======================================================================
B D          White rhinoceros  ----------------------------------------------------------------------

                        Human  -----atatgaggacta-tggccaa---------------------------------------------
                        Chimp  -----atatgaggaagaggggccaa---------------------------------------------
                      Gorilla  -----atatgaggaagaggggccaa---------------------------------------------
                    Orangutan  -----atatgaggaagaggggccaa---------------------------------------------
                       Gibbon  -----agatgaggaagagggaccaa---------------------------------------------
                       Rhesus  -----atatgaggaagaggggccaa---------------------------------------------
          Crab-eating macaque  -----atatgaggaagaggggccaa---------------------------------------------
                       Baboon  -----ataggaggaagaggggccaa---------------------------------------------
                 Green monkey  -----atacgaggaagaggggccaa---------------------------------------------
                     Marmoset  -----atatgaggaagaggggtcaa---------------------------------------------
              Squirrel monkey  -----atatgaggaagaggggtcaa---------------------------------------------
           Chinese tree shrew  -----gtactggggagaggcaccat---------------------------------------------
                     Squirrel  ----cctttacagaggcagcagctt---------------------------------------------
                 Prairie vole  ggtgccca------ggcagtggcat---------------------------------------------
              Chinese hamster  -------------------tgacat---------------------------------------------
               Golden hamster  -------------------tggcat---------------------------------------------
                        Mouse  ggtagcaatg-tgtggcagtggcct---------------------------------------------
                          Rat  gatcccagtg-agga-------------------------------------------------------
               Naked mole-rat  ---------------acaggggcat---------------------------------------------
                   Guinea pig  -----------gcatacaggagcat---------------------------------------------
                   Chinchilla  -----------gagtacaagagcat---------------------------------------------
             Brush-tailed rat  -----------ccctgcgggaacat---------------------------------------------
                       Rabbit  ----------------------------------------------------------------------
                         Pika  ---------------------aaat---------------------------------------------
                          Pig  -----atacttgggagagacaccaa---------------------------------------------
                       Alpaca  -----gtattagggagagacaccaa---------------------------------------------
               Bactrian camel  -----gtattagggagagacaccaa---------------------------------------------
                 Killer whale  -----atattagggagaggtagcag---------------------------------------------
             Tibetan antelope  -----atatcaaggagagacag------------------------------------------------
                          Cow  -----atgctaaggagagacag------------------------------------------------
                        Sheep  -----atactaaggagagacag------------------------------------------------
                Domestic goat  -----atactaaggagagacag------------------------------------------------
                        Horse  -----atattaggaagcagcacgaa---------------------------------------------
                          Cat  -----atattacagagaggtaccaa---------------------------------------------
                          Dog  -----atattagaaagagacaccaa---------------------------------------------
                      Ferret   -----atattagggagaggcaccaa---------------------------------------------
                        Panda  -----atattagggagaggcaccat---------------------------------------------
               Pacific walrus  -----gtattaggaagaggcaccaa---------------------------------------------
                 Weddell seal  -----gtattaggaagaggcaccaa---------------------------------------------
             Black flying-fox  -----atattagggagtagcaccaa---------------------------------------------
                      Megabat  -----atattagggagtagcaccaa---------------------------------------------
         David's myotis (bat)  -----atggtagggagaggcaccaa---------------------------------------------
                     Microbat  -----atagtagggagaggcaccaa---------------------------------------------
                     Hedgehog  -----ttatttgggagaaaaagaca---------------------------------------------
                        Shrew  -----ata--------------------------------------------------------------
              Star-nosed mole  -----atat----gagagaaagttaccaatatctcagattctattgaaggtagaacacaggatcttctaa
                     Elephant  -----atattagcgagaggtaccaa---------------------------------------------
                      Manatee  -----atattaagtagaggtaccaa---------------------------------------------
             Cape golden mole  -----aaattag--agaggaagcaa---------------------------------------------
                     Aardvark  -----atattagggaaaggaatcag---------------------------------------------
                    Armadillo  -----atattagggagaggcaccaa---------------------------------------------
                      Dolphin  ======================================================================
                  Spotted gar  ----------------------------------------------------------------------
                   Coelacanth  ----------------------------------------------------------------------
                X. tropicalis  ----------------------------------------------------------------------
                       Lizard  ----------------------------------------------------------------------
       Spiny softshell turtle  ----------------------------------------------------------------------
     Chinese softshell turtle  ----------------------------------------------------------------------
               Painted turtle  ----------------------------------------------------------------------
              Green seaturtle  ======================================================================
                       Turkey  ----------------------------------------------------------------------
                      Chicken  ----------------------------------------------------------------------
                 Mallard duck  ----------------------------------------------------------------------
                Scarlet macaw  ----------------------------------------------------------------------
                       Parrot  ----------------------------------------------------------------------
                   Budgerigar  ----------------------------------------------------------------------
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ----------------------------------------------------------------------
                      Wallaby  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
                      Opossum  ----------------------------------------------------------------------
                     Bushbaby  ======================================================================
             White rhinoceros  ----------------------------------------------------------------------

                        Human  ---------------------caccaaag
                        Chimp  ---------------------caccaaag
                      Gorilla  ---------------------caccacag
                    Orangutan  ---------------------taccacag
                       Gibbon  ---------------------cactgaag
                       Rhesus  ---------------------caccacag
          Crab-eating macaque  ---------------------caccacag
                       Baboon  ---------------------caccacag
                 Green monkey  ---------------------caccacag
                     Marmoset  ---------------------caccaaag
              Squirrel monkey  ---------------------caccaaag
           Chinese tree shrew  ---------------------caccacag
                     Squirrel  ---------------------caca-ctt
                 Prairie vole  ---------------------catggcct
              Chinese hamster  ---------------------attagtca
               Golden hamster  ---------------------attagcca
                        Mouse  ---------------------cacagcct
                          Rat  ---------------------cacaaccc
               Naked mole-rat  ---------------------cagcatcg
                   Guinea pig  ---------------------cacctcgg
                   Chinchilla  ---------------------cacttatg
             Brush-tailed rat  ---------------------cgcttcca
                       Rabbit  -----------------------------
                         Pika  ---------------------cctgttga
                          Pig  ---------------------catcataa
                       Alpaca  ---------------------c-------
               Bactrian camel  ---------------------caaaataa
                 Killer whale  ---------------------catcacag
             Tibetan antelope  ------------------------catag
                          Cow  ------------------------catag
                        Sheep  ------------------------catag
                Domestic goat  ------------------------catag
                        Horse  ---------------------catcacag
                          Cat  ---------------------cgtaacta
                          Dog  ---------------------cataactg
                      Ferret   ---------------------cataactg
                        Panda  ---------------------catacctg
               Pacific walrus  ---------------------cataactg
                 Weddell seal  ---------------------cataactg
             Black flying-fox  ---------------------catcacag
                      Megabat  ---------------------catcacag
         David's myotis (bat)  ---------------------catcacag
                     Microbat  ---------------------catcacag
                     Hedgehog  ---------------------gtatatat
                        Shrew  ---------------------ttagatag
              Star-nosed mole  gagatttttcttttctttttttttaactg
                     Elephant  ---------------------catcacag
                      Manatee  ---------------------catcacg-
             Cape golden mole  ---------------------catcacag
                     Aardvark  ---------------------tattatgg
                    Armadillo  ---------------------tatca-ag
                      Dolphin  =============================
                  Spotted gar  -----------------------------
                   Coelacanth  -----------------------------
                X. tropicalis  -----------------------------
                       Lizard  -----------------------------
       Spiny softshell turtle  -----------------------------
     Chinese softshell turtle  -----------------------------
               Painted turtle  -----------------------------
              Green seaturtle  =============================
                       Turkey  -----------------------------
                      Chicken  -----------------------------
                 Mallard duck  -----------------------------
                Scarlet macaw  -----------------------------
                       Parrot  -----------------------------
                   Budgerigar  -----------------------------
           Tibetan ground jay  =============================
                  Zebra finch  =============================
          Medium ground finch  =============================
       White-throated sparrow  =============================
             Peregrine falcon  =============================
                 Saker falcon  =============================
                  Rock pigeon  =============================
                     Platypus  -----------------------------
                      Wallaby  -----------------------------
           American alligator  -----------------------------
              Tasmanian devil  =============================
                      Opossum  -----------------------------
                     Bushbaby  =============================
             White rhinoceros  -----------------------------

Inserts between block 1 and 2 in window
B D                 Hedgehog 2bp
B D                    Shrew 16bp
             Star-nosed mole 283bp

Alignment block 2 of 33 in window, 32589205 - 32589234, 30 bps 
B D                     Human  gtcctgtgggg-aacctaacactggatcgtc
B D                     Chimp  gtcctgtggag-aacctaacactggatcgtc
B D                   Gorilla  gtcctgtggag-gacataacccaggatcgtc
B D                 Orangutan  gtcctgtggag-gacataacactggatcatc
B D                    Gibbon  gtcctgtggag-gacataatacaggatcgtc
B D                    Rhesus  gtcctgtggag-gacataacccaggatcgtc
B D       Crab-eating macaque  gtcctgtggag-gacataacccaggatcatc
B D                    Baboon  gtcctgtggag-gatataacccaggatcgtc
B D              Green monkey  atcctgtggag-gacataacccaggatcgtc
B D                  Marmoset  gtcctgtggag-gatgtaacacaggatcatc
B D           Squirrel monkey  gtcctgtggag-gatgtaacacaggattatc
           Chinese tree shrew  agcttgttgag-gatataa--caggatcttc
B D                  Squirrel  cct---gtgag-gatat-acatcagattttc
                 Prairie vole  gca-----gag-gatgc-acagggatcctcc
B D           Chinese hamster  a-------atg-aacgc--cacagatcccag
               Golden hamster  gat---gtatg-aatgc--cacagaccccag
B D                     Mouse  gca-----gag-ggtgc-acaggaatctccc
B D                       Rat  -----------------------agtct-tc
B D            Naked mole-rat  acctcactgag-gaaggaacacgggatct-c
B D                Guinea pig  accctggtgag-cttgagacatggggtctac
                   Chinchilla  accctggtgag-cgtgagacacaggatcttc
             Brush-tailed rat  accccagggag-caggaaacccaggataagc
B D                    Rabbit  -------tgag-g-----------------c
B D                      Pika  gca--catgag-gccac-----------ttc
B D                       Pig  atc-tgttg-g-ggcataacacaggatcttc
B D                    Alpaca  ---------at-cacgtaaca--ggatcttc
               Bactrian camel  atcttattgat-gaaataaca--ggattttc
                 Killer whale  atcctgttgag-gacataacacaggaccttc
             Tibetan antelope  gtcctattgag-gacaaaacacaggttcatc
B D                       Cow  gtcctactgag-gacacaacacaggatcttc
B D                     Sheep  gtcctattgag-gacacaacacgggatcttc
                Domestic goat  gtcctattgag-gacacaacatcacatggac
B D                     Horse  atcctg-ttaaggatgtaacacaggatcttc
B D                       Cat  atcctg-tgaa-gacataacacagggtcttc
B D                       Dog  atccaa-tgaa-gacataaaacagggtcttc
B D                   Ferret   acccag-tgca-gacataacacagggtctac
B D                     Panda  gtccag-tgaa-gacataacacagggtcttc
               Pacific walrus  atccag-tgaa-gacataacacagggtcttc
                 Weddell seal  atccag-tgaa-gacataacacagggtcttc
             Black flying-fox  atcctgttgag-gccataacacaggatcttc
B D                   Megabat  atcctgttgag-gccataacacaggatcttc
         David's myotis (bat)  attctgctgag-gacagaacacaggatcctc
B D                  Microbat  attctgctgag-gacagaacacagggtcctc
B D                  Hedgehog  atcctgtcaag-aatacaacacaagttcat-
B D                     Shrew  atcctcctgaa-gataaaactctaattcttc
B D                  Elephant  atctcattgag-gacat---ataata-----
B D                   Manatee  --------gag-gacata--ataata-----
             Cape golden mole  atcctgttgaa-cccataacataagatc-ta
                     Aardvark  atctcatttaa-catacaacacaggatcttc
B D                 Armadillo  acaccattgaa-gatacatcacaggatcttc
             Star-nosed mole  ===============================
B D                   Dolphin  ===============================
                 Spotted gar  -------------------------------
B D                Coelacanth  -------------------------------
B D             X. tropicalis  -------------------------------
B D                    Lizard  -------------------------------
  D    Spiny softshell turtle  -------------------------------
  D  Chinese softshell turtle  -------------------------------
  D            Painted turtle  -------------------------------
  D           Green seaturtle  ===============================
B D                    Turkey  -------------------------------
B D                   Chicken  -------------------------------
  D              Mallard duck  -------------------------------
  D             Scarlet macaw  -------------------------------
  D                    Parrot  -------------------------------
B D                Budgerigar  -------------------------------
          Tibetan ground jay  ===============================
B D               Zebra finch  ===============================
B D       Medium ground finch  ===============================
  D    White-throated sparrow  ===============================
  D          Peregrine falcon  ===============================
  D              Saker falcon  ===============================
  D               Rock pigeon  ===============================
B D                  Platypus  -------------------------------
B D                   Wallaby  -------------------------------
B D        American alligator  -------------------------------
B D           Tasmanian devil  ===============================
B D                   Opossum  -------------------------------
B D                  Bushbaby  ===============================
B D          White rhinoceros  -------------------------------

Alignment block 3 of 33 in window, 32589235 - 32589235, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
           Chinese tree shrew  t
B D                  Squirrel  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                      Pika  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  c
             Black flying-fox  t
B D                   Megabat  t
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  t
B D                     Shrew  t
              Star-nosed mole  t
             Cape golden mole  a
                     Aardvark  t
B D                 Armadillo  c
B D                   Dolphin  =
                 Spotted gar  -
B D                Coelacanth  -
B D             X. tropicalis  -
B D                    Lizard  -
  D    Spiny softshell turtle  -
  D  Chinese softshell turtle  -
  D            Painted turtle  -
  D           Green seaturtle  =
B D                    Turkey  -
B D                   Chicken  -
  D              Mallard duck  -
  D             Scarlet macaw  -
  D                    Parrot  -
B D                Budgerigar  -
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                  Platypus  -
B D                   Wallaby  -
B D        American alligator  -
B D           Tasmanian devil  =
B D                   Opossum  -
B D                   Manatee  -
B D                  Elephant  -
B D                  Bushbaby  =
B D          White rhinoceros  -

Inserts between block 3 and 4 in window
               Domestic goat 496bp

Alignment block 4 of 33 in window, 32589236 - 32589254, 19 bps 
B D                     Human  a-gg--ag---------------------------agacccttt--------------------------
B D                     Chimp  a-gg--ag---------------------------agacccttt--------------------------
B D                   Gorilla  a-gg--ag---------------------------agacccttt--------------------------
B D                 Orangutan  a-gg--ag---------------------------agacccttt--------------------------
B D                    Gibbon  a-gg--ag---------------------------agacccttt--------------------------
B D                    Rhesus  a-gg--ag---------------------------agttccttt--------------------------
B D       Crab-eating macaque  a-gg--ag---------------------------agacccttt--------------------------
B D                    Baboon  a-gg--ag---------------------------agacccttt--------------------------
B D              Green monkey  a-gg--ag---------------------------agacacttt--------------------------
B D                  Marmoset  a-ga--ac---------------------------agacccctt--------------------------
B D           Squirrel monkey  a-gg--ac---------------------------agacccctt--------------------------
           Chinese tree shrew  a-gg--ag---------------------------aggcccttc--------------------------
B D                  Squirrel  g-gg--ag--a------------------------aacccttcc--------------------------
                 Prairie vole  g-gg--ac--acctgccctgttcccgtgactctgtaacacttcc--------------------------
B D           Chinese hamster  gagg--gc--ac-----------------------aacacatct----------------------tcta
               Golden hamster  gagg--gc--------------------------------------------------------------
B D                     Mouse  g-tg--at---------------------------gacctcact--------------------------
B D                       Rat  a-gg--ac---------------------------agcccccct--------------------------
B D            Naked mole-rat  g-gg--ga----------------------------aaccattcaaatttaggctccacgtaaaattttt
B D                Guinea pig  g-gg--aa---------------------------cagctattccaa-------------------ttta
                   Chinchilla  g-gg--ga---------------------------aaaccattt--------------------------
             Brush-tailed rat  g-gg--aa---------------------------aaattgttc--------------------------
B D                    Rabbit  g-gg--gt--------------------------------------------------------------
B D                      Pika  a-gg--ataa------------------------------------------------------------
B D                       Pig  a-gg--ca---------------------------agatctttc--------------------------
B D                    Alpaca  a-gg--ag---------------------------agatctttc--------------------------
               Bactrian camel  a-gg--ag---------------------------agatctttc--------------------------
                 Killer whale  a-gg--ag---------------------------agatcttcc--------------------------
             Tibetan antelope  a-gg--ag---------------------------agatctttc--------------------------
B D                       Cow  a-gg--ag---------------------------agatctttc--------------------------
B D                     Sheep  a-gg--ag---------------------------agatctttc--------------------------
B D                     Horse  a-gg--ag---------------------------agatatttc--------------------------
B D                       Cat  a-gg--ag---------------------------acacctttc--------------------------
B D                       Dog  c-ag--ag---------------------------agaactttc--------------------------
B D                   Ferret   a-gg--aa---------------------------agatcttac--------------------------
B D                     Panda  a-gg--ag---------------------------agatctttc--------------------------
               Pacific walrus  a-gg--ag---------------------------agacctttc--------------------------
                 Weddell seal  a-gg--ag---------------------------agacctttc--------------------------
             Black flying-fox  a-ga--ag---------------------------agacccttc--------------------------
B D                   Megabat  a-ga--ag---------------------------agacccttc--------------------------
         David's myotis (bat)  a-ag--ag---------------------------agaccc-tc--------------------------
B D                  Microbat  a-ag--ag---------------------------agaccc-tc--------------------------
B D                  Hedgehog  a-ag--gg---------------------------agatctttc--------------------------
B D                     Shrew  a-aa--ag---------------------------aagtatttc--------------------------
              Star-nosed mole  a-gg--ag---------------------------agatttttc--------------------------
B D                  Elephant  ----------------------------------------tttt--------------------------
B D                   Manatee  ----------------------------------------tttc--------------------------
             Cape golden mole  ---a--ag---------------------------agacttttc--------------------------
                     Aardvark  ---a--ag---------------------------agaggtctt--------------------------
B D                 Armadillo  ---agcag---------------------------aggcctttc--------------------------
               Domestic goat  ======================================================================
B D                   Dolphin  ======================================================================
                 Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ----------------------------------------------------------------------
B D             X. tropicalis  ----------------------------------------------------------------------
B D                    Lizard  ----------------------------------------------------------------------
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------------------
  D           Green seaturtle  ======================================================================
B D                    Turkey  ----------------------------------------------------------------------
B D                   Chicken  ----------------------------------------------------------------------
  D              Mallard duck  ----------------------------------------------------------------------
  D             Scarlet macaw  ----------------------------------------------------------------------
  D                    Parrot  ----------------------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------------------
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                  Platypus  ----------------------------------------------------------------------
B D                   Wallaby  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ----------------------------------------------------------------------
B D                  Bushbaby  ======================================================================
B D          White rhinoceros  ----------------------------------------------------------------------

                        Human  -------------gaa----------tt
                        Chimp  -------------gaa----------tt
                      Gorilla  -------------gaa----------tt
                    Orangutan  -------------gaa----------tt
                       Gibbon  -------------gaa----------tt
                       Rhesus  -------------gaa----------tt
          Crab-eating macaque  -------------gaa----------tt
                       Baboon  -------------gaa----------tt
                 Green monkey  -------------gaa----------tt
                     Marmoset  -------------gaa----------tt
              Squirrel monkey  -------------gaa----------tt
           Chinese tree shrew  -------------caattttttcttttt
                     Squirrel  -------------aat----------tc
                 Prairie vole  -----------agaga----------aa
              Chinese hamster  g----------acaga----------gg
               Golden hamster  -----------acaga----------gc
                        Mouse  --------------------------gc
                          Rat  --------------------------gc
               Naked mole-rat  ggagaaaccttttaaa----------gt
                   Guinea pig  gaatgcacc--aaaaa----------tt
                   Chinchilla  -------------aaa----------gt
             Brush-tailed rat  -------------aaa----------tt
                       Rabbit  ----------------------------
                         Pika  ----------------------------
                          Pig  -------------taa----------tt
                       Alpaca  -------------taa----------tt
               Bactrian camel  -------------taa----------gt
                 Killer whale  -------------taa----------tt
             Tibetan antelope  -------------taa----------tt
                          Cow  -------------taa----------tt
                        Sheep  -------------taa----------tt
                        Horse  -------------caa----------tt
                          Cat  -------------taa----------tt
                          Dog  -------------taa----------tt
                      Ferret   -------------taa----------tt
                        Panda  -------------taa----------tt
               Pacific walrus  -------------taa----------tt
                 Weddell seal  -------------taa----------tt
             Black flying-fox  -------------taa----------tt
                      Megabat  -------------taa----------tt
         David's myotis (bat)  -------------taa----------tt
                     Microbat  -------------taa----------tt
                     Hedgehog  -------------tac----------tg
                        Shrew  -------------tac----------tt
              Star-nosed mole  -------------taa----------tt
                     Elephant  -------------cta----------tt
                      Manatee  -------------cta----------tt
             Cape golden mole  -------------taa----------tt
                     Aardvark  -------------cta----------tt
                    Armadillo  -------------tat----------tg
                Domestic goat  ============================
                      Dolphin  ============================
                  Spotted gar  ----------------------------
                   Coelacanth  ----------------------------
                X. tropicalis  ----------------------------
                       Lizard  ----------------------------
       Spiny softshell turtle  ----------------------------
     Chinese softshell turtle  ----------------------------
               Painted turtle  ----------------------------
              Green seaturtle  ============================
                       Turkey  ----------------------------
                      Chicken  ----------------------------
                 Mallard duck  ----------------------------
                Scarlet macaw  ----------------------------
                       Parrot  ----------------------------
                   Budgerigar  ----------------------------
           Tibetan ground jay  ============================
                  Zebra finch  ============================
          Medium ground finch  ============================
       White-throated sparrow  ============================
             Peregrine falcon  ============================
                 Saker falcon  ============================
                  Rock pigeon  ============================
                     Platypus  ----------------------------
                      Wallaby  ----------------------------
           American alligator  ----------------------------
              Tasmanian devil  ============================
                      Opossum  ----------------------------
                     Bushbaby  ============================
             White rhinoceros  ----------------------------

Inserts between block 4 and 5 in window
B D           Naked mole-rat 8bp
B D               Guinea pig 31bp
                  Chinchilla 28bp
            Brush-tailed rat 1236bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
B D                    Horse 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 2bp
B D                  Megabat 2bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                 Hedgehog 1bp
B D                    Shrew 1bp
             Star-nosed mole 1bp

Alignment block 5 of 33 in window, 32589255 - 32589266, 12 bps 
B D                     Human  -cccttgact-c--------------------cc-
B D                     Chimp  -cccttgact-c--------------------cc-
B D                   Gorilla  -cccttgact-c--------------------cc-
B D                 Orangutan  -cccttgact-c--------------------cc-
B D                    Gibbon  -cccttgact-c--------------------cc-
B D                    Rhesus  -cccttgact-c--------------------cc-
B D       Crab-eating macaque  -cccttgact-c--------------------cc-
B D                    Baboon  -ccgttgact-c--------------------cc-
B D              Green monkey  -cccttgact-c--------------------cc-
B D                  Marmoset  -cccttgact-c--------------------cc-
B D           Squirrel monkey  -tccttgact-a--------------------cc-
           Chinese tree shrew  -ttttttactgt--------------------ct-
B D                  Squirrel  -cttttgact-c--------------------tt-
                 Prairie vole  -tctttgatt-a--------------------ct-
B D           Chinese hamster  -cctccagat-c--------------------ct-
               Golden hamster  -cccccaatt-c--------------------ct-
B D                     Mouse  -cccttgact-ctatgacacctccacagaaatct-
B D                       Rat  -tccccaatt-c--------------------cc-
B D            Naked mole-rat  ----ttacta-t--------------------ct-
B D                Guinea pig  -tgttttcca-c--------------------tt-
                   Chinchilla  -cttttaaca-c--------------------gt-
B D                      Pika  --ctttgact-t--------------------tc-
B D                       Pig  -cttttgatt-c--------------------cc-
B D                    Alpaca  -ctcttgagt-c--------------------cc-
               Bactrian camel  -ctcttgatt-c--------------------cc-
                 Killer whale  -atttagatt-c--------------------tc-
             Tibetan antelope  -cttttgaat-c--------------------ca-
B D                       Cow  -cttttgaat-c--------------------ca-
B D                     Sheep  -cttttgaat-c--------------------ca-
B D                     Horse  -cttttgcct-c--------------------tc-
B D                       Cat  -cttttgact-c--------------------tc-
B D                       Dog  -tttttcatt-c--------------------ac-
B D                   Ferret   -cttttgatt-c--------------------tc-
B D                     Panda  -cttttgatt-c--------------------tc-
               Pacific walrus  -cttttgatt-c--------------------tc-
                 Weddell seal  -cttttgatt-c--------------------tc-
             Black flying-fox  -tttttgact-c--------------------cc-
B D                   Megabat  -tttttgact-c--------------------cc-
         David's myotis (bat)  --ctttgact-c--------------------cc-
B D                  Microbat  --ctttgact-c--------------------cc-
B D                  Hedgehog  -atctc--------------------------ct-
B D                     Shrew  -ctacttcct-tttga----------------ct-
              Star-nosed mole  -cttttttgt-t--------------------cc-
B D                  Elephant  cccttccaca-t--------------------ccc
B D                   Manatee  cccttccaca-t--------------------ccc
             Cape golden mole  cccttacact-t--------------------gcc
                     Aardvark  ccctctt-ct-c--------------------ccc
B D                 Armadillo  tcctttcatt-c--------------------ccc
            Brush-tailed rat  ===================================
               Domestic goat  ===================================
B D                   Dolphin  ===================================
                 Spotted gar  -----------------------------------
B D                Coelacanth  -----------------------------------
B D             X. tropicalis  -----------------------------------
B D                    Lizard  -----------------------------------
  D    Spiny softshell turtle  -----------------------------------
  D  Chinese softshell turtle  -----------------------------------
  D            Painted turtle  -----------------------------------
  D           Green seaturtle  ===================================
B D                    Turkey  -----------------------------------
B D                   Chicken  -----------------------------------
  D              Mallard duck  -----------------------------------
  D             Scarlet macaw  -----------------------------------
  D                    Parrot  -----------------------------------
B D                Budgerigar  -----------------------------------
          Tibetan ground jay  ===================================
B D               Zebra finch  ===================================
B D       Medium ground finch  ===================================
  D    White-throated sparrow  ===================================
  D          Peregrine falcon  ===================================
  D              Saker falcon  ===================================
  D               Rock pigeon  ===================================
B D                  Platypus  -----------------------------------
B D                   Wallaby  -----------------------------------
B D        American alligator  -----------------------------------
B D           Tasmanian devil  ===================================
B D                   Opossum  -----------------------------------
B D                  Bushbaby  ===================================
B D                    Rabbit  -----------------------------------
B D          White rhinoceros  -----------------------------------

Inserts between block 5 and 6 in window
B D                 Squirrel 24bp
                Prairie vole 54bp
B D          Chinese hamster 55310bp
              Golden hamster 11bp
B D                    Mouse 2bp
B D                      Rat 2bp
B D           Naked mole-rat 16bp
B D               Guinea pig 47bp
                  Chinchilla 36bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                 Hedgehog 1bp
B D                    Shrew 1bp
             Star-nosed mole 1bp

Alignment block 6 of 33 in window, 32589267 - 32589267, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
           Chinese tree shrew  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
B D                     Horse  a
B D                       Cat  g
B D                       Dog  a
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  t
B D                   Manatee  t
             Cape golden mole  a
                     Aardvark  c
B D                 Armadillo  a
                Prairie vole  =
B D           Chinese hamster  =
B D                     Mouse  =
              Golden hamster  =
B D                       Rat  =
               Domestic goat  =
B D                  Squirrel  =
B D                   Dolphin  =
                 Spotted gar  -
B D                Coelacanth  -
B D             X. tropicalis  -
B D                    Lizard  -
  D    Spiny softshell turtle  -
  D  Chinese softshell turtle  -
  D            Painted turtle  -
  D           Green seaturtle  =
B D                    Turkey  -
B D                   Chicken  -
  D              Mallard duck  -
  D             Scarlet macaw  -
  D                    Parrot  -
B D                Budgerigar  -
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                  Platypus  -
B D                   Wallaby  -
B D        American alligator  -
B D           Tasmanian devil  =
B D                   Opossum  -
B D                  Bushbaby  =
B D                    Rabbit  -
B D          White rhinoceros  -

Inserts between block 6 and 7 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
B D                    Horse 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                 Hedgehog 1bp
B D                    Shrew 1bp
             Star-nosed mole 1bp

Alignment block 7 of 33 in window, 32589268 - 32589271, 4 bps 
B D                     Human  -caa-a
B D                     Chimp  -caa-a
B D                   Gorilla  -caa-a
B D                 Orangutan  -caa-c
B D                    Gibbon  -gaa-a
B D                    Rhesus  -caa-a
B D       Crab-eating macaque  -caa-a
B D                    Baboon  -caa-a
B D              Green monkey  -caa-a
B D                  Marmoset  -cag-a
B D           Squirrel monkey  -caa-a
           Chinese tree shrew  -taa-a
B D                  Squirrel  -taa--
                 Prairie vole  -caa--
B D                     Mouse  -tga--
B D                       Rat  -taa--
B D            Naked mole-rat  -cac--
B D                Guinea pig  -taa--
                   Chinchilla  -taa--
             Brush-tailed rat  -taa--
B D                      Pika  -tttg-
B D                       Pig  -aaa--
B D                    Alpaca  -aaa--
               Bactrian camel  -aaa--
                 Killer whale  -aaa--
             Tibetan antelope  -aaa--
B D                       Cow  -aaa--
B D                     Sheep  -aaa--
B D                     Horse  -aaa--
B D                       Cat  -cca--
B D                       Dog  -aaa--
B D                   Ferret   -aaa--
B D                     Panda  -aaa--
               Pacific walrus  -aaa--
                 Weddell seal  -aaa--
             Black flying-fox  -aaa--
B D                   Megabat  -aaa--
         David's myotis (bat)  -aaa--
B D                  Microbat  -aaa--
B D                  Hedgehog  -aac--
B D                     Shrew  -aaa--
              Star-nosed mole  -aaa--
B D                  Elephant  taaa--
B D                   Manatee  taaa--
             Cape golden mole  taaa--
                     Aardvark  caaa--
B D                 Armadillo  tgaa--
B D           Chinese hamster  ======
              Golden hamster  ======
               Domestic goat  ======
B D                   Dolphin  ======
                 Spotted gar  ------
B D                Coelacanth  ------
B D             X. tropicalis  ------
B D                    Lizard  ------
  D    Spiny softshell turtle  ------
  D  Chinese softshell turtle  ------
  D            Painted turtle  ------
  D           Green seaturtle  ======
B D                    Turkey  ------
B D                   Chicken  ------
  D              Mallard duck  ------
  D             Scarlet macaw  ------
  D                    Parrot  ------
B D                Budgerigar  ------
          Tibetan ground jay  ======
B D               Zebra finch  ======
B D       Medium ground finch  ======
  D    White-throated sparrow  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D               Rock pigeon  ======
B D                  Platypus  ------
B D                   Wallaby  ------
B D        American alligator  ------
B D           Tasmanian devil  ======
B D                   Opossum  ------
B D                  Bushbaby  ======
B D                    Rabbit  ------
B D          White rhinoceros  ------

Inserts between block 7 and 8 in window
B D                 Squirrel 26bp
                Prairie vole 1bp
B D                    Mouse 84bp
B D                      Rat 18480bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp

Alignment block 8 of 33 in window, 32589272 - 32589272, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
           Chinese tree shrew  a
B D                  Squirrel  a
                 Prairie vole  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  a
             Brush-tailed rat  a
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
B D                     Horse  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
B D                     Shrew  c
              Star-nosed mole  a
B D                  Elephant  a
B D                   Manatee  a
             Cape golden mole  a
                     Aardvark  a
B D                 Armadillo  a
B D           Chinese hamster  =
               Domestic goat  =
B D                   Dolphin  =
                 Spotted gar  -
B D                Coelacanth  -
B D             X. tropicalis  -
B D                    Lizard  -
  D    Spiny softshell turtle  -
  D  Chinese softshell turtle  -
  D            Painted turtle  -
  D           Green seaturtle  =
B D                    Turkey  -
B D                   Chicken  -
  D              Mallard duck  -
  D             Scarlet macaw  -
  D                    Parrot  -
B D                Budgerigar  -
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                  Platypus  -
B D                   Wallaby  -
B D        American alligator  -
B D           Tasmanian devil  =
B D                   Opossum  -
B D                  Bushbaby  =
B D                    Rabbit  -
B D          White rhinoceros  -

Inserts between block 8 and 9 in window
B D                 Squirrel 62bp
                Prairie vole 30bp
              Golden hamster 14bp
B D                    Mouse 1bp
B D                      Rat 1bp

Alignment block 9 of 33 in window, 32589273 - 32589303, 31 bps 
B D                     Human  -ttttc--------------------------------------------agtaaga-----------ac
B D                     Chimp  -ttttc--------------------------------------------agtaaga-----------ac
B D                   Gorilla  -ttttc--------------------------------------------agtaaaa-----------ac
B D                 Orangutan  -ttttc--------------------------------------------agaaaaa-----------gc
B D                    Gibbon  -ttttc--------------------------------------------aaaaaaa-----------ta
B D                    Rhesus  -ttttc--------------------------------------------agtaaga-----------ac
B D       Crab-eating macaque  -ttttc--------------------------------------------agtaaga-----------ac
B D                    Baboon  -ttttc--------------------------------------------aggaaaa-----------ac
B D              Green monkey  -ttttc--------------------------------------------agtaaaa-----------ac
B D                  Marmoset  -ttttca-------------------------------------------aaagaaa-----------cc
B D           Squirrel monkey  -ttataatg-----------------------------------------aaaaaaa-----------ac
           Chinese tree shrew  -ttgtc--------------------------------------------agataaa-----------ct
B D                  Squirrel  -tttta--------------------------------------------aaaaaaa-----------tc
                 Prairie vole  -tttta--------------------------------------------aagagaa-------------
B D           Chinese hamster  -tttta--------------------------------------------aagagaa-------------
               Golden hamster  -tttta--------------------------------------------aaaaaca-------------
B D                     Mouse  -tttta--------------------------------------------aagagaa-------------
B D                       Rat  -tttta--------------------------------------------aagagag-------------
B D            Naked mole-rat  -ttatatgcataaaatataatagaattatacatatagagttctctttttaaagagaaa----------tc
B D                Guinea pig  -ttatatgtgaagacccgaaaagg--------------------------gatgaaat----------tg
                   Chinchilla  -ttatgttcataagatagaatagaataatataaatgaagttctgtttttaaagagaag----------tc
             Brush-tailed rat  -ttgtg--------------------------------------------gggaaaaa----------tc
B D                    Rabbit  -tctct--------------------------------------------gataggag------------
B D                      Pika  -ttccc--------------------------------------------cacagaagtttcagacacac
B D                       Pig  -ttttg--------------------------------------------gctgaaa-----------tc
B D                    Alpaca  -ttttt--------------------------------------------ggc-aaa-----------tt
               Bactrian camel  -ttttt--------------------------------------------ggctaaa-----------ct
                 Killer whale  -tcttc--------------------------------------------agagaaa-----------ct
             Tibetan antelope  -ttttt--------------------------------------------ggcgaaa-----------ct
B D                       Cow  -ttttt--------------------------------------------ggtgaaa-----------ct
B D                     Sheep  -ttttt--------------------------------------------ggtgaaa-----------ct
B D                     Horse  -ttttc--------------------------------------------agagaaa-----------tt
B D                       Cat  -ttttc--------------------------------------------tgagaaa-----------ct
B D                       Dog  -ttttc--------------------------------------------agagaag-----------ct
B D                   Ferret   -ttttc--------------------------------------------agagaaa-----------at
B D                     Panda  -ttttc--------------------------------------------agagaaa-----------ct
               Pacific walrus  -ttttc--------------------------------------------agagaaa-----------ct
                 Weddell seal  -ttttc--------------------------------------------agaaaga-----------ct
             Black flying-fox  --tttc--------------------------------------------agagaaa-----------ct
B D                   Megabat  --tttc--------------------------------------------agagaaa-----------ct
         David's myotis (bat)  --tgcc--------------------------------------------agagaaa-----------ca
B D                  Microbat  --tgcc--------------------------------------------agagaaa-----------ct
B D                  Hedgehog  -atttc--------------------------------------------aag-gaa-----------tt
B D                     Shrew  -ttttc--------------------------------------------aga-aaa-----------gt
              Star-nosed mole  -ttttc--------------------------------------------agagaaa-----------ct
B D                  Elephant  aatttc--------------------------------------------acagaaa-----------cc
B D                   Manatee  caattc--------------------------------------------acagaaa-----------tc
             Cape golden mole  aa-tcc--------------------------------------------agagaaa-----------tg
                     Aardvark  aa-ttc--------------------------------------------agataaa-----------ta
B D                 Armadillo  atatc-------------------------------------------------aaa-----------ca
               Domestic goat  ======================================================================
B D                   Dolphin  ======================================================================
                 Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ----------------------------------------------------------------------
B D             X. tropicalis  ----------------------------------------------------------------------
B D                    Lizard  ----------------------------------------------------------------------
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------------------
  D           Green seaturtle  ======================================================================
B D                    Turkey  ----------------------------------------------------------------------
B D                   Chicken  ----------------------------------------------------------------------
  D              Mallard duck  ----------------------------------------------------------------------
  D             Scarlet macaw  ----------------------------------------------------------------------
  D                    Parrot  ----------------------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------------------
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                  Platypus  ----------------------------------------------------------------------
B D                   Wallaby  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ----------------------------------------------------------------------
B D                  Bushbaby  ======================================================================
B D          White rhinoceros  ----------------------------------------------------------------------

                        Human  c--tcct-tttgtct-------------------gac-at
                        Chimp  c--tcct-tttgtct-------------------gac-gt
                      Gorilla  c--tcct-tttgtct-------------------gac-at
                    Orangutan  c--tcct-tttgtct-------------------gac-at
                       Gibbon  ctgtcct-tttgtct-------------------gac-at
                       Rhesus  c--tcat-tttgtct-------------------gac-at
          Crab-eating macaque  c--tcat-tttgtct-------------------gac-at
                       Baboon  c--tcct-tttgtct-------------------gac-at
                 Green monkey  c--tcct-tttgtct-------------------gac-at
                     Marmoset  c--tcct-tttgtgc-------------------gac-at
              Squirrel monkey  c--tcct-tttgtgt-------------------gac-at
           Chinese tree shrew  t--tccc-ttttgtt-------------------agc-at
                     Squirrel  a--cctt-tttttct-------------------ggc-at
                 Prairie vole  a--cctc-tttgcct-------------------ggc-at
              Chinese hamster  a--cctc-tttgtcc-------------------aaa-at
               Golden hamster  t--catc-ttc---------------------------at
                        Mouse  a--ccac-tttgtct-------------------ggcttt
                          Rat  g--cctt-tttgtct-------------------ggc-at
               Naked mole-rat  t--tctc-ttttt-t-------------------gac-at
                   Guinea pig  t--ccct-tttt--t-------------------gtt-at
                   Chinchilla  t--cctc-tttttct-------------------gac-ag
             Brush-tailed rat  t--cccc-tttt--t-------------------gac-ag
                       Rabbit  ----------------------------------------
                         Pika  t--tccc-tttttct-------------------gga-ta
                          Pig  t--tccc---ttttt-------------------ggc-gt
                       Alpaca  t--tttc-ctttttt-------------------ggc-at
               Bactrian camel  t--cccc-ttttttt-------------------ggc-at
                 Killer whale  t--tccc-tttttct-------------------tgt-ac
             Tibetan antelope  t--tccc--tttttt-------------------ggc-at
                          Cow  t--tccc-ttttttt-------------------ggc-at
                        Sheep  t--cccctttttttt-------------------ggc-at
                        Horse  t--tccc-ttttcct-------------------ggc-at
                          Cat  t--tctt-attttct-------------------agc-at
                          Dog  t--tcct-actttct-------------------agc-at
                      Ferret   t--tcct-attttctatcttaacataagaaagggaac-at
                        Panda  t--tcct-attttcc-------------------agc-at
               Pacific walrus  t--tcct-attttct-------------------agc-at
                 Weddell seal  t--tcct-attttct-------------------agc-at
             Black flying-fox  t--tccc-ttttctt-------------------ggc-ac
                      Megabat  t--tccc-ttttctt-------------------ggc-ac
         David's myotis (bat)  t--tcct-tt---cg-------------------ggg-at
                     Microbat  t--ttct-tt----g-------------------ggg-at
                     Hedgehog  t--tttt-ttctt---------------------agt-ac
                        Shrew  t--ccct-ctttt-a-------------------agc-aa
              Star-nosed mole  t--tcag-ctctc-t-------------------ggc-at
                     Elephant  t--tg-c-tttatct-------------------agc--t
                      Manatee  t--ttcc-tttctct-------------------agc--t
             Cape golden mole  c--tctc-tttttct-------------------ctc-at
                     Aardvark  t--tccc-atttgtt-------------------ttt-at
                    Armadillo  t--tgtc-ttttttt-------------------taa-gc
                Domestic goat  ========================================
                      Dolphin  ========================================
                  Spotted gar  ----------------------------------------
                   Coelacanth  ----------------------------------------
                X. tropicalis  ----------------------------------------
                       Lizard  ----------------------------------------
       Spiny softshell turtle  ----------------------------------------
     Chinese softshell turtle  ----------------------------------------
               Painted turtle  ----------------------------------------
              Green seaturtle  ========================================
                       Turkey  ----------------------------------------
                      Chicken  ----------------------------------------
                 Mallard duck  ----------------------------------------
                Scarlet macaw  ----------------------------------------
                       Parrot  ----------------------------------------
                   Budgerigar  ----------------------------------------
           Tibetan ground jay  ========================================
                  Zebra finch  ========================================
          Medium ground finch  ========================================
       White-throated sparrow  ========================================
             Peregrine falcon  ========================================
                 Saker falcon  ========================================
                  Rock pigeon  ========================================
                     Platypus  ----------------------------------------
                      Wallaby  ----------------------------------------
           American alligator  ----------------------------------------
              Tasmanian devil  ========================================
                      Opossum  ----------------------------------------
                     Bushbaby  ========================================
             White rhinoceros  ----------------------------------------

Inserts between block 9 and 10 in window
            Tibetan antelope 459bp
B D                      Cow 7626bp
B D                    Sheep 1011bp

Alignment block 10 of 33 in window, 32589304 - 32589313, 10 bps 
B D                     Human  aagt--caacat
B D                     Chimp  aagt--caacat
B D                   Gorilla  aagt--caacat
B D                 Orangutan  aggt--caacat
B D                    Gibbon  aagt--caacat
B D                    Rhesus  aagt--taacat
B D       Crab-eating macaque  aagt--caacat
B D                    Baboon  aagt--catcat
B D              Green monkey  aagt--caacat
B D                  Marmoset  aagt--cagcat
B D           Squirrel monkey  aagt--caacat
           Chinese tree shrew  aact--cagtat
B D                  Squirrel  aata--acatat
                 Prairie vole  agct--caacac
B D           Chinese hamster  agct--caacac
               Golden hamster  attt--t-----
B D                     Mouse  atct--caacac
B D                       Rat  aact--caacac
B D            Naked mole-rat  aaca--caacat
B D                Guinea pig  aaac--caacat
                   Chinchilla  aaag--taacat
             Brush-tailed rat  aaag--caatgt
B D                      Pika  aact--cagtgt
B D                       Pig  aact--caacat
B D                    Alpaca  aa----caacat
               Bactrian camel  gatt--caacat
                 Killer whale  -att--caacat
B D                     Horse  agct--caacat
B D                       Cat  aact--caacat
B D                       Dog  aact--caacat
B D                   Ferret   atct--caacat
B D                     Panda  aact--caacat
               Pacific walrus  aact--c-acat
                 Weddell seal  aact--c-acat
             Black flying-fox  aact--caacat
B D                   Megabat  agct--caacat
         David's myotis (bat)  aact--caatac
B D                  Microbat  aact--caatac
B D                  Hedgehog  aact--cagcat
B D                     Shrew  aatt--ctacac
              Star-nosed mole  aact--caacat
B D                  Elephant  gctg--caacat
B D                   Manatee  actg--caatat
             Cape golden mole  actt--caacat
                     Aardvark  aaat--caacat
B D                 Armadillo  actgctcaacat
B D                       Cow  ============
               Domestic goat  ============
B D                     Sheep  ============
            Tibetan antelope  ============
B D                   Dolphin  ============
                 Spotted gar  ------------
B D                Coelacanth  ------------
B D             X. tropicalis  ------------
B D                    Lizard  ------------
  D    Spiny softshell turtle  ------------
  D  Chinese softshell turtle  ------------
  D            Painted turtle  ------------
  D           Green seaturtle  ============
B D                    Turkey  ------------
B D                   Chicken  ------------
  D              Mallard duck  ------------
  D             Scarlet macaw  ------------
  D                    Parrot  ------------
B D                Budgerigar  ------------
          Tibetan ground jay  ============
B D               Zebra finch  ============
B D       Medium ground finch  ============
  D    White-throated sparrow  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
  D               Rock pigeon  ============
B D                  Platypus  ------------
B D                   Wallaby  ------------
B D        American alligator  ------------
B D           Tasmanian devil  ============
B D                   Opossum  ------------
B D                  Bushbaby  ============
B D                    Rabbit  ------------
B D          White rhinoceros  ------------

Alignment block 11 of 33 in window, 32589314 - 32589401, 88 bps 
B D                     Human  aataaagggaagtgctgtatggggaat--ttattttagaatccttatttc-taaatcctcta----aaga
B D                     Chimp  aataaagggaagtgctgtatggggaat--ttactttagcatccttatttg-taaatcctcta----aaga
B D                   Gorilla  aataaagcgaagtgctgtatggggaat--ttattttagcatccttatatc-caaatcctcta----aaga
B D                 Orangutan  aataaagggaagtgctgtatggggaat--ttattttagcatccttatttc-caaatcctctg----aaga
B D                    Gibbon  aataaagggaagtgctgtatggggaat--ttattgtagcctcattatttc-taaatcctcta----aaga
B D                    Rhesus  aataaagggaagtgctgtatggggaat--ttattgtagcatctttatttc-taaatcctcta----agga
B D       Crab-eating macaque  aataaagggaagtgctgtatggggaat--ttattgtagcatctttatttc-taaatcctcta----agga
B D                    Baboon  aataaagggaagtgctgtatggggaat--ttattttatcatccttatttc-taaatcctcta----aaga
B D              Green monkey  aataaagggaagtgctgtatggggaat--ttattttagcatccttatttt-taaatcctcta----aaga
B D                  Marmoset  aataaagggcagtgctgtatggggaat--ttattttagcatccttatttc-tacatcctcta----aaga
B D           Squirrel monkey  aataaatggcagtgctctatggggaat--ttattttagcatccttatttc-taaatcctcta----aaga
           Chinese tree shrew  attaaaggaaagtgcttggtggggaa---ttactttagcatcattatttc-taaaccgtctc----caga
B D                  Squirrel  aaagggaaccg---ctgagtg-agaaa--tcagtttaacatta----ttt-ctaatccgtcc----aagg
                 Prairie vole  aatgaagacaagccctgtgca--gggg--ttgatttaacatcgtga-tta-tcagtcctctc----cagg
B D           Chinese hamster  aaggaggacaagccctgtgca-agggg--ctaatttaacatcatgattta-tggatcctctc----cagg
               Golden hamster  ----tggagaggttcttgaca-tctca--ctattgtaacaccctgatttc-ctcatcttttc----cagc
B D                     Mouse  agtgaagacagggcctgtccc-agaag--ttaatttaacatcatgattca-tcgatcttctc----aggg
B D                       Rat  aatgaagacagggcctgtccc-ggaag--ttaatttaacatcatgattta-tcgatcttccc----gggg
B D            Naked mole-rat  aatatagggaggtgctatatttggaaa--ttagtttaacgtccttattcc-taaatcctctc----aagg
B D                Guinea pig  gctatagagaactgcaatgtatagaaa--ttagtttaatgtcagta-ttc-taaatcccctc----aagg
                   Chinchilla  atcatagagaagtgctatatttggaaa--ttagtttaacatcatactttc-taaatcccata----aagt
             Brush-tailed rat  aacatacgaatatgctacgtttggaaa--ttagcttaacatcattatttt-taaatcccctc----cagg
B D                    Rabbit  -----------------------------------------------------------ctc----aaga
B D                      Pika  aatgaagtaaagcactatttg-gagac--ttttttcatcatcattatatt-taagcactcta----aaga
B D                       Pig  aataaaggaaattgctagaca-agaag--ttaatttgacatccttattta-taaatctactt----aaga
B D                    Alpaca  gataaaggaaactgctggatg-aggaa--ttatttagacattctcacatc-taaatcttctt----aaga
               Bactrian camel  aataaaggaaactga---------------cattttgacattctcattta-taaatcttctt----aaga
                 Killer whale  aataaagagatctgtta-atg-gagaa--ttattttaacatcattttttc-taaatcttttc----aaac
             Tibetan antelope  aataaaggaaactgctgtata-aggaa--ttattttgacattcttattta-taaatctt-------aaga
B D                       Cow  aataaaggaaactactgtatg-aggaa--ttattttgacattcttattta-taaatctt-------aaga
                Domestic goat  aataaaggaaactgctgtatg-aggaa--ttatttttacattcttattta-taaatctt-------aaga
B D                     Horse  gatgaag-gaaccactggatg-gggaa--ttatctggacatcgttatttc-taaatcttctc----aaga
B D                       Cat  tataaagggaaccactt-at--gggaa--ttaatttgaaatcattatttc-tgagtcttctc----aaga
B D                       Dog  aataaagggaactacttgat--gggaa--ttaatttggagtcattatttc-taagtcttctc----aaga
B D                   Ferret   aagaaagggaaccacttgat--aggaa--ttaatttgaaatcattattta-taagtcttctc----aaga
B D                     Panda  aataaagggaaccacttgat--gggaa--ttagtttgaaataattacttc-tgagtcttccc----aaga
               Pacific walrus  aataaagagaaccacttaat--gggaa--ttaatttgaaatcattatttc-taagtcttctc----aaga
                 Weddell seal  aattaagagaaccacttaat--gggaa--ttaatttgaaatcattatttc-taagtcttctc----aaga
             Black flying-fox  aataaatggaactgctggatg-gggaa--ttattttcacattataattta-aaaattttccc----cagc
B D                   Megabat  aataaatggaactgctggatg-gggaa--ttattttcacattataattta-aaaattttccc----cagc
         David's myotis (bat)  aataaatggagc-actgggt--gggaa--tcagtctgagatc---atttc-tcagtcctctc----aaga
B D                  Microbat  aataaatggagc-aatgtgt--gggaa--ttagcctgagatcattatttc-tcagtcctctc----taga
B D                  Hedgehog  aataaaactac----tagat--gatag--tcatgttgaaatcattatttt-------taacttcagaaga
B D                     Shrew  aataagaggaacaagaagat--ggtcc--ttattttagaataattatttg-aagtcattatttctaattc
              Star-nosed mole  aacaaaaagaa-gtctggat--gggaa--ttactttaatttcattatttc-taattgtaatg--aaatca
B D                  Elephant  aataaagggaacagttgaatg-gagaa--ttactttagcataattatttc-caaattctctc----caga
B D                   Manatee  aataaagggaacagttggatg-gagaa--ttattttagcaacattatttc-caagttctctc----aaga
             Cape golden mole  gataaagggaaagactagata-gggag--ttatttagacatcattatttc-taaatctgctc----aaga
                     Aardvark  aattaagggcacaactggata-aggaatttttttttaacaccattttttt-catatgctctc----aaga
B D                 Armadillo  aataatgggaacagctggatg-gcaaa--ttatcttaccaccattatttcttaagcccattc----aaga
B D                     Sheep  ======================================================================
B D                   Dolphin  ======================================================================
                 Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ----------------------------------------------------------------------
B D             X. tropicalis  ----------------------------------------------------------------------
B D                    Lizard  ----------------------------------------------------------------------
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------------------
  D           Green seaturtle  ======================================================================
B D                    Turkey  ----------------------------------------------------------------------
B D                   Chicken  ----------------------------------------------------------------------
  D              Mallard duck  ----------------------------------------------------------------------
  D             Scarlet macaw  ----------------------------------------------------------------------
  D                    Parrot  ----------------------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------------------
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                  Platypus  ----------------------------------------------------------------------
B D                   Wallaby  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ----------------------------------------------------------------------
B D                  Bushbaby  ======================================================================
B D          White rhinoceros  ----------------------------------------------------------------------

                        Human  ccctgaggacatgtgatgcaa--------aggt
                        Chimp  ccgtgaggacatgtgatgcaa--------aggt
                      Gorilla  ccctgaggacatgtgatgcaa--------aggt
                    Orangutan  ccctgaggacatgtgatgcaa--------aagt
                       Gibbon  ccctgaggaaatgtgatgcaa--------aggt
                       Rhesus  ccctgaggaaatgtgatgcaa--------aggt
          Crab-eating macaque  ccctgaggacatgtgatgcaa--------aagt
                       Baboon  ccctgacgacatgtgatacga--------aggt
                 Green monkey  ccctgaggacatgtgatgcaa--------aggt
                     Marmoset  ccttgaggaaatgtgatgcaa--------aggt
              Squirrel monkey  ccccgagaaaatgtgatgcaa--------aggt
           Chinese tree shrew  ccataaaggaatgtgctacaaagctggggaggt
                     Squirrel  ccctgagagaatatgatgtgagactgg--agac
                 Prairie vole  ccct-gaggactgtgaca-caggctgg--agat
              Chinese hamster  ccctgagggaatacgacataaggctgg--agat
               Golden hamster  ccct-aggaaatgtgatgtcaggctgg--aggg
                        Mouse  ccctaaaggaatatgacg-c-aggtgt--agat
                          Rat  ccctaagggaatatgaca-caaggcat--agat
               Naked mole-rat  ctctgagagaatgtgatttgagtctgg--agtt
                   Guinea pig  ctatgatagaaaatgatttgaggctga--aggt
                   Chinchilla  tcctcagagaatgtgatttaaggttag--agtt
             Brush-tailed rat  ccctgagagaacgtgatttgagggtga--agat
                       Rabbit  t--tggaaacaca--gtgcgtggctgg--aggg
                         Pika  c--tgaagacccatggtgtatgaatgg--aggg
                          Pig  ccccaagggaatgagatgcaaggctggaaagat
                       Alpaca  tcccaagggaatgggatgcaaagctggaaaatt
               Bactrian camel  ccccaaaggaatgggatgcaaagctggaatggt
                 Killer whale  acctgaagggatgggatgcaaggctggggaagg
             Tibetan antelope  ccctaagagaattgtatgcaaggctggataggt
                          Cow  ccctaagagaatcgaatgcaaggctggataggt
                Domestic goat  ccctaaaagaattgaatgcaaggctggataggt
                        Horse  tcttgagggaatgggatgcaaggctggagaggt
                          Cat  cactgagggaatgaaactcaaatctggaaagtt
                          Dog  ccctgatggaatgagatgcaagcctgaaaagct
                      Ferret   ccccgagggaatgagatacaaacctagagaact
                        Panda  ccctgagggaatgagatgcaagcctggagaact
               Pacific walrus  acctgagggaatgagatgcaagcctggagaact
                 Weddell seal  acctgagggaatgagatgcaagcctggagaact
             Black flying-fox  tcctgagtgaatgggatgcaaggctggagaggt
                      Megabat  tcctgagtgaatgggatgcaaggctggagaagt
         David's myotis (bat)  ccccagtgggaggggacatgaggctggggaggg
                     Microbat  ctctgatgaaaggtgacaggagactggggagat
                     Hedgehog  ccccaagggaataggatgtaagg-----gagtt
                        Shrew  ttct----caatacagcaaat-------gagct
              Star-nosed mole  ttctgggggaatagaatgaat--------agtt
                     Elephant  ccattagagaataggatataaggctggaaaggt
                      Manatee  ctgtgagagaacgggacataaaactggagaggt
             Cape golden mole  ccttgag-gaaagggatgcaagactggagaggt
                     Aardvark  ccctaaggaaatgggatgaaa-----gaaaggt
                    Armadillo  tcctgagggaataggatgcagagctggagaagt
                        Sheep  =================================
                      Dolphin  =================================
                  Spotted gar  ---------------------------------
                   Coelacanth  ---------------------------------
                X. tropicalis  ---------------------------------
                       Lizard  ---------------------------------
       Spiny softshell turtle  ---------------------------------
     Chinese softshell turtle  ---------------------------------
               Painted turtle  ---------------------------------
              Green seaturtle  =================================
                       Turkey  ---------------------------------
                      Chicken  ---------------------------------
                 Mallard duck  ---------------------------------
                Scarlet macaw  ---------------------------------
                       Parrot  ---------------------------------
                   Budgerigar  ---------------------------------
           Tibetan ground jay  =================================
                  Zebra finch  =================================
          Medium ground finch  =================================
       White-throated sparrow  =================================
             Peregrine falcon  =================================
                 Saker falcon  =================================
                  Rock pigeon  =================================
                     Platypus  ---------------------------------
                      Wallaby  ---------------------------------
           American alligator  ---------------------------------
              Tasmanian devil  =================================
                      Opossum  ---------------------------------
                     Bushbaby  =================================
             White rhinoceros  ---------------------------------

Alignment block 12 of 33 in window, 32589402 - 32589413, 12 bps 
B D                     Human  ttt--attggtgga
B D                     Chimp  ttt--attggtgga
B D                   Gorilla  ttt--attggtgga
B D                 Orangutan  ttt--attggtgga
B D                    Gibbon  ttt--attagtgga
B D                    Rhesus  ttt--attggtgga
B D       Crab-eating macaque  ttt--attggtgga
B D                    Baboon  ttt--attggtgga
B D              Green monkey  ttt--attggtgga
B D                  Marmoset  ttt--cctggtgga
B D           Squirrel monkey  ttt--cttggtgga
           Chinese tree shrew  gtt--actgaacta
B D                  Squirrel  ttt--actgaagac
                 Prairie vole  gct--ccaggaaga
B D           Chinese hamster  gtt--acctgagga
               Golden hamster  gtc--tcatgagga
B D                     Mouse  gtt--actgggaga
B D                       Rat  ttt--actggaaga
B D            Naked mole-rat  ttt--actggagaa
B D                Guinea pig  ttt--actggagca
                   Chinchilla  ctt--actgaagca
             Brush-tailed rat  ttt--actggtgtg
B D                    Rabbit  gttagactggagga
B D                      Pika  gtgagactggagga
B D                       Pig  ttt--attggagga
B D                    Alpaca  ttt--attggagga
               Bactrian camel  ttt--actggaaga
                 Killer whale  ttc--attgctgga
             Tibetan antelope  ttt--attggagga
B D                       Cow  ttt--actggagga
                Domestic goat  ttt--attggagga
B D                     Horse  ttt--attggaaga
B D                       Cat  ttg--actggggaa
B D                       Dog  ttt--attggagga
B D                   Ferret   ttc--actggagga
B D                     Panda  ttt--atcggagga
               Pacific walrus  ttt--attggagga
                 Weddell seal  ttt--attggagga
             Black flying-fox  ttt--actggaaga
B D                   Megabat  ttt--actggaaga
         David's myotis (bat)  ttt--attggaggc
B D                  Microbat  ttg--actggaggc
B D                  Hedgehog  ttt--actagagga
B D                     Shrew  -----------gga
              Star-nosed mole  -----------gaa
B D                  Elephant  ttt--attggagga
B D                   Manatee  ttt--attggagga
             Cape golden mole  ttt--attggagga
                     Aardvark  ttc--attggagga
B D                 Armadillo  ttt--ttgagaagc
B D           Tasmanian devil  ttc--attgaggag
B D                     Sheep  ==============
B D                   Dolphin  ==============
                 Spotted gar  --------------
B D                Coelacanth  --------------
B D             X. tropicalis  --------------
B D                    Lizard  --------------
  D    Spiny softshell turtle  --------------
  D  Chinese softshell turtle  --------------
  D            Painted turtle  --------------
  D           Green seaturtle  ==============
B D                    Turkey  --------------
B D                   Chicken  --------------
  D              Mallard duck  --------------
  D             Scarlet macaw  --------------
  D                    Parrot  --------------
B D                Budgerigar  --------------
          Tibetan ground jay  ==============
B D               Zebra finch  ==============
B D       Medium ground finch  ==============
  D    White-throated sparrow  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
  D               Rock pigeon  ==============
B D                  Platypus  --------------
B D                   Wallaby  --------------
B D        American alligator  --------------
B D                   Opossum  --------------
B D                  Bushbaby  ==============
B D          White rhinoceros  --------------

Inserts between block 12 and 13 in window
            Cape golden mole 141bp
B D                Armadillo 5bp

Alignment block 13 of 33 in window, 32589414 - 32589432, 19 bps 
B D                     Human  gattt--g-----aaaagaaatgatt
B D                     Chimp  gattt--g-----aaaagaaatgact
B D                   Gorilla  gattt--g-----agaagaaatgacc
B D                 Orangutan  gattt--g-----agaggaaatgacc
B D                    Gibbon  aattt--gaaaaaaaaaaaaatggcc
B D                    Rhesus  gattt--g-----agaagaaatgacc
B D       Crab-eating macaque  gatct--g-----agaagaaatgacc
B D                    Baboon  gattt--g-----agaagaagtgacc
B D              Green monkey  gattt--g----aaaaagaaatgatc
B D                  Marmoset  aattt--g-----agaagaaatggcc
B D           Squirrel monkey  aattt--g-----agaagaaatgacc
           Chinese tree shrew  gattt--g-----aggagaagtggcc
B D                  Squirrel  aactt--g-----aaaagaaatggtt
                 Prairie vole  aac-t--g-----gaaagcagtggct
B D           Chinese hamster  aac-t--g-----agaggcaatggct
               Golden hamster  aga-a--g------gaggacagaact
B D                     Mouse  aactt--g-----aaaagcaatggct
B D                       Rat  aactt--g-----aaaagcaatggca
B D            Naked mole-rat  gactt----------aagaaatggct
B D                Guinea pig  gactt--a-----aaaattaacacct
                   Chinchilla  gtctt--g-----aaaagaaatggtc
             Brush-tailed rat  gactt--a-----aaaagaaatagtt
B D                    Rabbit  gagtt--g-----ggaggaaatggtc
B D                      Pika  gaact--g-----ggaagaaatagcc
B D                       Pig  gagtt--g-----aaa--aaatggtt
B D                    Alpaca  gaggt--g-----aaaagaaatggct
               Bactrian camel  gagtt--g-----aaaataaatggtt
                 Killer whale  cactt--g-----agaagaaatagac
             Tibetan antelope  gagtt--g-----aaaagaaatggtt
B D                       Cow  gagtt--g-----aaaagaaatggtt
                Domestic goat  gagtt--g-----aaaagaaatggtt
B D                     Horse  gagtt--a-----cgaa-----ggct
B D                       Cat  gagtt--g-----agaagaaatggcc
B D                       Dog  gagtt--g-----agaagaaatggcc
B D                   Ferret   gagtt--g-----tgaataaatggcc
B D                     Panda  gagtt--a-----ggcataaatggcc
               Pacific walrus  gaggt--g-----agaataaatggcc
                 Weddell seal  gaggt--g-----agaataaatggcc
             Black flying-fox  gagtt--g-----agaagaaatggcc
B D                   Megabat  gagtt--g-----agaagaaatggcc
         David's myotis (bat)  gaggt--g-----agaagaaacagct
B D                  Microbat  gaggt--g-----agaagaaatggct
B D                  Hedgehog  tacct--g-----aaaataaatgttc
B D                     Shrew  agcaa--g-----actgagagattt-
              Star-nosed mole  gaccattg-----aatggaaactgtc
B D                  Elephant  gggtt--g-----agaggaagcatcc
B D                   Manatee  gggtt--a-----agaagaaacatcc
             Cape golden mole  acatg--g-----agaagaaatggcc
                     Aardvark  ggatt--g-----agaag---tggcc
B D                 Armadillo  gaagt--g-----agaagacaggtcc
B D           Tasmanian devil  ggtgt--c-----aagagagaaagtt
B D                     Sheep  ==========================
B D                   Dolphin  ==========================
                 Spotted gar  --------------------------
B D                Coelacanth  --------------------------
B D             X. tropicalis  --------------------------
B D                    Lizard  --------------------------
  D    Spiny softshell turtle  --------------------------
  D  Chinese softshell turtle  --------------------------
  D            Painted turtle  --------------------------
  D           Green seaturtle  ==========================
B D                    Turkey  --------------------------
B D                   Chicken  --------------------------
  D              Mallard duck  --------------------------
  D             Scarlet macaw  --------------------------
  D                    Parrot  --------------------------
B D                Budgerigar  --------------------------
          Tibetan ground jay  ==========================
B D               Zebra finch  ==========================
B D       Medium ground finch  ==========================
  D    White-throated sparrow  ==========================
  D          Peregrine falcon  ==========================
  D              Saker falcon  ==========================
  D               Rock pigeon  ==========================
B D                  Platypus  --------------------------
B D                   Wallaby  --------------------------
B D        American alligator  --------------------------
B D                   Opossum  --------------------------
B D                  Bushbaby  ==========================
B D          White rhinoceros  --------------------------

Inserts between block 13 and 14 in window
B D                      Pig 4bp
B D                   Alpaca 4bp
              Bactrian camel 4bp
                Killer whale 6bp
B D                    Horse 2bp
B D                      Cat 4bp
B D                      Dog 4bp
B D                  Ferret  4bp
B D                    Panda 4bp
              Pacific walrus 4bp
                Weddell seal 4bp
            Black flying-fox 2bp
B D                  Megabat 2bp
        David's myotis (bat) 4bp
B D                 Microbat 4bp
B D                 Hedgehog 2bp
             Star-nosed mole 2bp

Alignment block 14 of 33 in window, 32589433 - 32589436, 4 bps 
B D                     Human  tgtg
B D                     Chimp  tgtg
B D                   Gorilla  tgta
B D                 Orangutan  t-ta
B D                    Gibbon  tgta
B D                    Rhesus  tgta
B D       Crab-eating macaque  tgta
B D                    Baboon  tgta
B D              Green monkey  tgta
B D                  Marmoset  tgta
B D           Squirrel monkey  tgta
           Chinese tree shrew  tagg
B D                  Squirrel  taca
                 Prairie vole  gata
B D           Chinese hamster  gatg
               Golden hamster  catg
B D                     Mouse  gata
B D                       Rat  gata
B D            Naked mole-rat  tctg
B D                Guinea pig  tctg
                   Chinchilla  cctg
             Brush-tailed rat  tctg
B D                    Rabbit  tgga
B D                      Pika  tgga
B D                       Pig  tata
B D                    Alpaca  tatg
               Bactrian camel  tata
B D                   Dolphin  --ta
                 Killer whale  --ta
             Tibetan antelope  cata
B D                       Cow  cata
                Domestic goat  catg
B D                     Horse  tgtg
B D                       Cat  tatg
B D                       Dog  tata
B D                   Ferret   tata
B D                     Panda  tgta
               Pacific walrus  tata
                 Weddell seal  tata
             Black flying-fox  tatc
B D                   Megabat  tatg
         David's myotis (bat)  taca
B D                  Microbat  taca
B D                  Hedgehog  cata
B D                     Shrew  tatt
              Star-nosed mole  taaa
B D                  Elephant  catg
B D                   Manatee  ta-a
             Cape golden mole  cata
                     Aardvark  aata
B D                 Armadillo  ctta
B D           Tasmanian devil  ---g
B D                     Sheep  ====
                 Spotted gar  ----
B D                Coelacanth  ----
B D             X. tropicalis  ----
B D                    Lizard  ----
  D    Spiny softshell turtle  ----
  D  Chinese softshell turtle  ----
  D            Painted turtle  ----
  D           Green seaturtle  ====
B D                    Turkey  ----
B D                   Chicken  ----
  D              Mallard duck  ----
  D             Scarlet macaw  ----
  D                    Parrot  ----
B D                Budgerigar  ----
          Tibetan ground jay  ====
B D               Zebra finch  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D               Rock pigeon  ====
B D                  Platypus  ----
B D                   Wallaby  ----
B D        American alligator  ----
B D                   Opossum  ----
B D                  Bushbaby  ====
B D          White rhinoceros  ----

Inserts between block 14 and 15 in window
B D                  Dolphin 75bp
            Tibetan antelope 5bp
B D                      Cow 4bp
               Domestic goat 4bp

Alignment block 15 of 33 in window, 32589437 - 32589442, 6 bps 
B D                     Human  c--a--aagg
B D                     Chimp  c--a--aagg
B D                   Gorilla  t--g--gagg
B D                 Orangutan  t--g--gagg
B D                    Gibbon  t--g--gagg
B D                    Rhesus  c--a--gagg
B D       Crab-eating macaque  t--g--gagg
B D                    Baboon  t--g--gagg
B D              Green monkey  t--g--gagg
B D                  Marmoset  t--c--gtgg
B D           Squirrel monkey  t--t--gtgg
           Chinese tree shrew  t--g--ga-g
B D                  Squirrel  t--a--tgaa
                 Prairie vole  c-----gtgg
B D           Chinese hamster  t-----cagg
               Golden hamster  t-------gg
B D                     Mouse  c--c--cagc
B D                       Rat  c--a--caag
B D            Naked mole-rat  t--a--aaaa
B D                Guinea pig  t--a--taga
                   Chinchilla  c--a--caga
             Brush-tailed rat  t--a--caga
B D                    Rabbit  ccag--gagg
B D                      Pika  cc-g--caag
B D                       Pig  --tg--gagg
B D                    Alpaca  --tg--gagg
               Bactrian camel  --tg--gagg
                 Killer whale  --tg--gagg
             Tibetan antelope  --tg--gcgg
B D                       Cow  --tg--gtga
                Domestic goat  --cg--gcgg
B D                     Horse  --tg--gagg
B D                       Cat  --tg--gagg
B D                       Dog  --tga-aaga
B D                   Ferret   --tg--gagg
B D                     Panda  --tc--gagg
               Pacific walrus  --gg--gagg
                 Weddell seal  --tg--gagg
             Black flying-fox  --tg--gag-
B D                   Megabat  --tg--gag-
         David's myotis (bat)  --tg--gag-
B D                  Microbat  --ca--agg-
B D                  Hedgehog  --ta--gaga
B D                     Shrew  --gg--gaaa
              Star-nosed mole  --gg--gaag
B D                  Elephant  ----t-tagt
B D                   Manatee  ----t-tcgt
             Cape golden mole  ----tgtagg
                     Aardvark  ----tgttga
B D                 Armadillo  ----aggaat
B D           Tasmanian devil  ----aagaag
B D                     Sheep  ==========
B D                   Dolphin  ==========
                 Spotted gar  ----------
B D                Coelacanth  ----------
B D             X. tropicalis  ----------
B D                    Lizard  ----------
  D    Spiny softshell turtle  ----------
  D  Chinese softshell turtle  ----------
  D            Painted turtle  ----------
  D           Green seaturtle  ==========
B D                    Turkey  ----------
B D                   Chicken  ----------
  D              Mallard duck  ----------
  D             Scarlet macaw  ----------
  D                    Parrot  ----------
B D                Budgerigar  ----------
          Tibetan ground jay  ==========
B D               Zebra finch  ==========
B D       Medium ground finch  ==========
  D    White-throated sparrow  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
  D               Rock pigeon  ==========
B D                  Platypus  ----------
B D                   Wallaby  ----------
B D        American alligator  ----------
B D                   Opossum  ----------
B D                  Bushbaby  ==========
B D          White rhinoceros  ----------

Inserts between block 15 and 16 in window
B D                 Squirrel 2bp
                Prairie vole 2bp
B D          Chinese hamster 2bp
              Golden hamster 2bp
B D                    Mouse 2bp
B D                      Rat 2bp
B D           Naked mole-rat 1bp
B D               Guinea pig 2bp
                  Chinchilla 54187bp
            Brush-tailed rat 2bp

Alignment block 16 of 33 in window, 32589443 - 32589449, 7 bps 
B D                     Human  cccctta-
B D                     Chimp  cccctta-
B D                   Gorilla  cccctta-
B D                 Orangutan  cccctta-
B D                    Gibbon  cccctta-
B D                    Rhesus  cccctta-
B D       Crab-eating macaque  cccctta-
B D                    Baboon  cccctta-
B D              Green monkey  cccctta-
B D                  Marmoset  cccctta-
B D           Squirrel monkey  cccctta-
           Chinese tree shrew  cccctta-
B D                  Squirrel  cttttca-
                 Prairie vole  cctctca-
B D           Chinese hamster  cctctca-
               Golden hamster  ttccatt-
B D                     Mouse  cctctca-
B D                       Rat  cctctca-
B D            Naked mole-rat  tctctca-
B D                Guinea pig  cttctta-
                   Chinchilla  cttctta-
             Brush-tailed rat  cttttca-
B D                    Rabbit  cccctta-
B D                      Pika  tctctta-
B D                       Pig  caactta-
B D                    Alpaca  caactta-
               Bactrian camel  caactta-
                 Killer whale  ctacgta-
             Tibetan antelope  caactta-
B D                       Cow  caactta-
                Domestic goat  caactta-
B D                     Horse  cttctta-
B D                       Cat  cccctta-
B D                       Dog  cccctta-
B D                   Ferret   tccctta-
B D                     Panda  tccctta-
               Pacific walrus  tccctta-
                 Weddell seal  tccctta-
             Black flying-fox  tcccttg-
B D                   Megabat  tcccttg-
         David's myotis (bat)  ccccatg-
B D                  Microbat  ccccttg-
B D                  Hedgehog  ttcttta-
B D                     Shrew  t-------
              Star-nosed mole  tacttta-
B D                  Elephant  tccctta-
B D                   Manatee  cccctta-
             Cape golden mole  tcccttg-
                     Aardvark  tccctta-
B D                 Armadillo  ctcctta-
B D           Tasmanian devil  -tccttga
B D                     Sheep  ========
B D                   Dolphin  ========
                 Spotted gar  --------
B D                Coelacanth  --------
B D             X. tropicalis  --------
B D                    Lizard  --------
  D    Spiny softshell turtle  --------
  D  Chinese softshell turtle  --------
  D            Painted turtle  --------
  D           Green seaturtle  ========
B D                    Turkey  --------
B D                   Chicken  --------
  D              Mallard duck  --------
  D             Scarlet macaw  --------
  D                    Parrot  --------
B D                Budgerigar  --------
          Tibetan ground jay  ========
B D               Zebra finch  ========
B D       Medium ground finch  ========
  D    White-throated sparrow  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D               Rock pigeon  ========
B D                  Platypus  --------
B D                   Wallaby  --------
B D        American alligator  --------
B D                   Opossum  --------
B D                  Bushbaby  ========
B D          White rhinoceros  --------

Alignment block 17 of 33 in window, 32589450 - 32589452, 3 bps 
B D                     Human  cac-
B D                     Chimp  cac-
B D                   Gorilla  cac-
B D                 Orangutan  cac-
B D                    Gibbon  cac-
B D                    Rhesus  cac-
B D       Crab-eating macaque  cac-
B D                    Baboon  cac-
B D              Green monkey  cac-
B D                  Marmoset  cac-
B D           Squirrel monkey  cac-
B D                  Bushbaby  cac-
           Chinese tree shrew  cac-
B D                  Squirrel  aac-
                 Prairie vole  cac-
B D           Chinese hamster  cac-
               Golden hamster  cac-
B D                     Mouse  cac-
B D                       Rat  cac-
B D            Naked mole-rat  cat-
B D                Guinea pig  caa-
                   Chinchilla  tat-
             Brush-tailed rat  cac-
B D                    Rabbit  tgc-
B D                      Pika  gac-
B D                       Pig  tac-
B D                    Alpaca  tac-
               Bactrian camel  cac-
                 Killer whale  tgc-
             Tibetan antelope  tac-
B D                       Cow  tac-
                Domestic goat  tac-
B D                     Horse  tga-
B D                       Cat  cac-
B D                       Dog  agc-
B D                   Ferret   tgc-
B D                     Panda  tgc-
               Pacific walrus  tgt-
                 Weddell seal  tgc-
             Black flying-fox  tgc-
B D                   Megabat  tgc-
         David's myotis (bat)  cac-
B D                  Microbat  tat-
B D                  Hedgehog  cac-
B D                     Shrew  tac-
              Star-nosed mole  tac-
B D                  Elephant  agc-
B D                   Manatee  agc-
             Cape golden mole  atc-
                     Aardvark  agc-
B D                 Armadillo  agc-
B D           Tasmanian devil  -gtc
B D                     Sheep  ====
B D                   Dolphin  ====
                 Spotted gar  ----
B D                Coelacanth  ----
B D             X. tropicalis  ----
B D                    Lizard  ----
  D    Spiny softshell turtle  ----
  D  Chinese softshell turtle  ----
  D            Painted turtle  ----
  D           Green seaturtle  ====
B D                    Turkey  ----
B D                   Chicken  ----
  D              Mallard duck  ----
  D             Scarlet macaw  ----
  D                    Parrot  ----
B D                Budgerigar  ----
          Tibetan ground jay  ====
B D               Zebra finch  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D               Rock pigeon  ====
B D                  Platypus  ----
B D                   Wallaby  ----
B D        American alligator  ----
B D                   Opossum  ----
B D          White rhinoceros  ----

Inserts between block 17 and 18 in window
                Killer whale 1bp

Alignment block 18 of 33 in window, 32589453 - 32589453, 1 bps 
B D                     Human  a
B D                   Gorilla  a
B D                 Orangutan  g
B D                    Gibbon  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  g
B D                Guinea pig  c
                   Chinchilla  a
             Brush-tailed rat  c
B D                    Rabbit  a
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
             Tibetan antelope  a
B D                       Cow  a
                Domestic goat  a
B D                     Horse  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  a
B D                   Manatee  a
             Cape golden mole  a
                     Aardvark  a
B D                 Armadillo  a
                Killer whale  =
B D                     Sheep  =
B D                   Dolphin  =
                 Spotted gar  -
B D                Coelacanth  -
B D             X. tropicalis  -
B D                    Lizard  -
  D    Spiny softshell turtle  -
  D  Chinese softshell turtle  -
  D            Painted turtle  -
  D           Green seaturtle  =
B D                    Turkey  -
B D                   Chicken  -
  D              Mallard duck  -
  D             Scarlet macaw  -
  D                    Parrot  -
B D                Budgerigar  -
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                  Platypus  -
B D                   Wallaby  -
B D        American alligator  -
B D           Tasmanian devil  -
B D                   Opossum  -
B D                    Baboon  -
B D          White rhinoceros  -
B D              Green monkey  -
B D       Crab-eating macaque  -
B D                    Rhesus  -
B D                     Chimp  -

Alignment block 19 of 33 in window, 32589454 - 32589512, 59 bps 
B D                     Human  agt-ct--cat-gaagag---gg-----caagtaccca------------------------agctcctt
B D                     Chimp  agt-ct--cat-ggagag---gg-----caagtaccca------------------------agctcctt
B D                   Gorilla  agt-ct--cat-ggagag---gg-----caagtagcca------------------------agctcctt
B D                 Orangutan  aat-ct--cat-ggagag---gg-----caagtagcca------------------------agctcctt
B D                    Gibbon  agt-ct--cat-gcagag---gg-----caagtagcca------------------------ggctcctt
B D                    Rhesus  agt-ct--cat-ggagag---gg-----caagtagcca------------------------agctcctt
B D       Crab-eating macaque  agt-ct--cat-ggagag---gg-----caagtagcca------------------------agctcctt
B D                    Baboon  agt-ct--cat-ggagac---gg-----caagtagcca------------------------agctcctt
B D              Green monkey  agt-ct--cat-ggagac---ag-----caagtagcca------------------------aactcctt
B D                  Marmoset  agt-ct--cat-ggagac---gg-----caagtagcca------------------------agctcctt
B D           Squirrel monkey  agt-ct--cat-ggagag---gg-----ccagtagcca------------------------agctcctt
B D                  Bushbaby  cgt-ct--cat-aggaaa---gg-----caagtagcca------------------------ggctcctt
           Chinese tree shrew  ggt-ct--cataggagaa---gggctctcaag-ataca------------------------tgctcctg
B D                  Squirrel  ggt-ct--cat-ag-------aa-----aaggc-tctg------------------------gctctata
                 Prairie vole  gat-ct--gag-ag-------ca-----caggcatccc------------------------ggcttcca
B D           Chinese hamster  gat-tt--gaa-agga-----ca-----taaacatcca------------------------gac-tcaa
               Golden hamster  ggt-ct--taa-aggagcatcca-----agaaccttta------------------------aac-----
B D                     Mouse  gat-ct--gag-ag-------ca-----caaacatcca------------------------ggcttctg
B D                       Rat  ggt-ct--gag-ag-------ca-----caaacatccc------------------------gacttctg
B D            Naked mole-rat  ggt-ct--cac-aggaag---ga-----caagcatcca------------------------ggctccta
B D                Guinea pig  agctgg--cat-aggaag---ga-----tgcacacacacaca---------------------actccct
                   Chinchilla  agt-ct--cac-aggaaa---aa-----aactcacaca----------------------gaggctcctt
             Brush-tailed rat  agc-gt--cat-aggaag---ga-----aacacacacacacacacacacacacacacactcacacccttc
B D                    Rabbit  gat-ct--cac-aaagag---gg-----caaacatcca------------------------tgctcctt
B D                      Pika  gat-ctcacac-aaagag---ga-----caagcatcca------------------------ctctcctt
B D                       Pig  act-ct--cat-aaagaa---gg-----caagcactga------------------------gccttc-t
B D                    Alpaca  act-ct--cat-aaacag---tc-----caagccccca------------------------gcctcctt
               Bactrian camel  act-tt--cat-aaacag---tc-----caagcaccca------------------------ggctcc-c
                 Killer whale  aca-ct--cat-tgagag---ag-----caagtatcca------------------------ggcacc-t
             Tibetan antelope  act-ct--cat-taagtg---gg-----caagcaccca------------------------ggctcc-t
B D                       Cow  act-ct--cat-gaagtg---gg-----gaagcaccca------------------------ggctcc-t
                Domestic goat  act-ct--cat-taagtg---gg-----caagcactca------------------------ggctcc-t
B D                     Horse  act-ct--tat-agagag---gg-----ctagtatcca------------------------ggctcctt
B D                       Cat  gct-ct--tat-agagag---gg-----caagcattca------------------------gcctcctt
B D                       Dog  act-ct--tgt---agag---gg-----caagccggtg------------------------aactcctt
B D                   Ferret   gct-ct--ta---------------------------a------------------------ggatcctt
B D                     Panda  ggg-ct--tgt---agag---gg-----taagcatgca------------------------ggctcctt
               Pacific walrus  gct-ct--ttt---agag---ag-----caagcattca------------------------ggctcctt
                 Weddell seal  gct-ct--ttt---agag---ag-----caagcattca------------------------ggctcctt
             Black flying-fox  gct-ct--cac---agag---gg-----caaacagcca------------------------ggctcctt
B D                   Megabat  gct-ct--cac---agag---gg-----caaacagcca------------------------ggctcctt
         David's myotis (bat)  --t-ct--cat---ag-t---gg-----cgagca--cc------------------------agcccctt
B D                  Microbat  --t-ct--tgt---ag-t---ga-----cgaaca--cc------------------------agcccctt
B D                  Hedgehog  gtt-ct--cat-ccagag---ag-----gcaacatgaa------------------------gtttac-t
B D                     Shrew  aca-c-----------------------------------------------------------atct-t
              Star-nosed mole  ggt-ct--cgt-agagag---gg-----ccagaatcca------------------------ggatct-t
B D                  Elephant  act-ct--cat-aaggaa---ag-----caagcatcca------------------------tgctgctc
B D                   Manatee  act-tt--tat-aaggaa---gg-----aacgtatcca------------------------tgctgctc
             Cape golden mole  gtt-ct--cat---ggag---gg-----catgcattta------------------------ggatactt
                     Aardvark  gct-at--tgt-aaggtg---gg-----caagcatccg------------------------tgctcctt
B D                 Armadillo  gta-at--agt--gggag---ga-----caagaatcca------------------------agctctta
B D           Tasmanian devil  ----ct--gag-gaagag---gg-----aaaggatgta------------------------agaatc--
B D                     Sheep  ======================================================================
B D                   Dolphin  ======================================================================
                 Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ----------------------------------------------------------------------
B D             X. tropicalis  ----------------------------------------------------------------------
B D                    Lizard  ----------------------------------------------------------------------
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------------------
  D           Green seaturtle  ======================================================================
B D                    Turkey  ----------------------------------------------------------------------
B D                   Chicken  ----------------------------------------------------------------------
  D              Mallard duck  ----------------------------------------------------------------------
  D             Scarlet macaw  ----------------------------------------------------------------------
  D                    Parrot  ----------------------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------------------
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                  Platypus  ----------------------------------------------------------------------
B D                   Wallaby  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
B D                   Opossum  ----------------------------------------------------------------------
B D          White rhinoceros  ----------------------------------------------------------------------

                        Human  ttatggaggaaataatt-tgggatcc
                        Chimp  ttgtggaggaaataatt-tgggatcc
                      Gorilla  ttgtggaggaaataatt-tgcgatcc
                    Orangutan  ttgtggaggaagtaatt-tgggatcc
                       Gibbon  ttgtggtgtaaataatt-tgggatcc
                       Rhesus  ttgtggtggaaataatt-gggaatcc
          Crab-eating macaque  ttatggtggaaataatt-tgggatcc
                       Baboon  ttgtgaaggaaataatt-tgggatcc
                 Green monkey  tagtggtggaaataatt-tgggatcc
                     Marmoset  ctgtggtggaaataatt-tgggatcc
              Squirrel monkey  tggtggtggaaataatt-tgggatcc
                     Bushbaby  ttgttttggaaataact-tgggaacc
           Chinese tree shrew  ttgttatagaaataatt-tgggattc
                     Squirrel  ttttt--gaaagtagtt-tagaatcc
                 Prairie vole  tttga--ggaaacagtt-tggatttc
              Chinese hamster  ttctg--ggaaatagtt-tggatttc
               Golden hamster  -------ggaaacaact-tgagattc
                        Mouse  tttgg--ggacatagtt-tagagttc
                          Rat  tctgc--agacatagtt-tagagttc
               Naked mole-rat  ttgct--ggaaatagct-tagaatcc
                   Guinea pig  ctggta-ggaa--------agattca
                   Chinchilla  ctggt--ggaa--------agaatct
             Brush-tailed rat  ctggt--ggga--------agaatcc
                       Rabbit  tcaca--ggaaata-tt-gaacatct
                         Pika  tggt----gaaata-tt-taaaagcc
                          Pig  gaattgtggaaagaatt-gaggatcc
                       Alpaca  ttactgtggaaagaatt-gagcatcc
               Bactrian camel  ttattgtggaaagaatt-gagcatcc
                 Killer whale  tttgtggtagatagatt-ggagatcc
             Tibetan antelope  ttactgtggaaagaact-aaggatcc
                          Cow  ttactatggaaagaact-aaggatcc
                Domestic goat  ttactgtggaaagaact-aaggatcc
                        Horse  ttgttgtggaaagaatt-agggacac
                          Cat  ttgttttggatagaatt-ggggatct
                          Dog  ttgttctcaatagaatt-gggggtct
                      Ferret   ttgttctgggtagaattggggggtct
                        Panda  ttgttttggataaaatt-aggggtct
               Pacific walrus  ttgttttggatagaatt-gggggtct
                 Weddell seal  ttgttttggatagaatt-gggggtct
             Black flying-fox  ttgttctggaaagaaat-gaggatcc
                      Megabat  ttgttctggaaagaaac-gaggatcc
         David's myotis (bat)  ttgtagtggaaagaatt-g-ggatcc
                     Microbat  ttgtggtggaaagaatc-g-ggatcc
                     Hedgehog  ttgt-------ggaatt-tgggattc
                        Shrew  ttactgggaa-agaatt-taggatca
              Star-nosed mole  ttattgtgga-aggatt-tgagagcc
                     Elephant  ttgttgtggaaagaatt-tggggtcc
                      Manatee  ttgctgtggaaacagtt-tgggatcc
             Cape golden mole  tagtttaggaaaggaat-tgaatttt
                     Aardvark  ttgttgtggaaagaagt-tgggatcc
                    Armadillo  tagttatgaaaagaatt-tgggttcc
              Tasmanian devil  -aaaggaagaggtagtt-gggaggc-
                        Sheep  ==========================
                      Dolphin  ==========================
                  Spotted gar  --------------------------
                   Coelacanth  --------------------------
                X. tropicalis  --------------------------
                       Lizard  --------------------------
       Spiny softshell turtle  --------------------------
     Chinese softshell turtle  --------------------------
               Painted turtle  --------------------------
              Green seaturtle  ==========================
                       Turkey  --------------------------
                      Chicken  --------------------------
                 Mallard duck  --------------------------
                Scarlet macaw  --------------------------
                       Parrot  --------------------------
                   Budgerigar  --------------------------
           Tibetan ground jay  ==========================
                  Zebra finch  ==========================
          Medium ground finch  ==========================
       White-throated sparrow  ==========================
             Peregrine falcon  ==========================
                 Saker falcon  ==========================
                  Rock pigeon  ==========================
                     Platypus  --------------------------
                      Wallaby  --------------------------
           American alligator  --------------------------
                      Opossum  --------------------------
             White rhinoceros  --------------------------

Inserts between block 19 and 20 in window
B D                Orangutan 1bp
B D                 Bushbaby 1bp
          Chinese tree shrew 1bp
B D                 Squirrel 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 1bp
B D                     Pika 1bp
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                 Hedgehog 2bp

Alignment block 20 of 33 in window, 32589513 - 32589513, 1 bps 
B D                     Human  -a
B D                     Chimp  -t
B D                   Gorilla  -c
B D                 Orangutan  -t
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -c
B D                    Baboon  -c
B D              Green monkey  -a
B D                  Marmoset  -a
B D           Squirrel monkey  -a
B D                  Bushbaby  -t
           Chinese tree shrew  -c
B D                  Squirrel  -c
                 Prairie vole  -t
B D           Chinese hamster  -t
               Golden hamster  -t
B D                     Mouse  -t
B D                       Rat  -t
B D            Naked mole-rat  -t
B D                Guinea pig  -t
                   Chinchilla  -t
             Brush-tailed rat  -t
B D                    Rabbit  -c
B D                      Pika  -a
B D                       Pig  -a
B D                   Dolphin  -a
                 Killer whale  -a
             Tibetan antelope  -a
B D                       Cow  -a
                Domestic goat  -a
B D                     Horse  -a
B D                       Cat  -a
B D                       Dog  -a
B D                   Ferret   -a
B D                     Panda  -a
               Pacific walrus  -a
                 Weddell seal  -a
             Black flying-fox  -a
B D                   Megabat  -a
         David's myotis (bat)  -a
B D                  Microbat  -a
B D                     Shrew  -a
              Star-nosed mole  -t
B D                  Elephant  -a
B D                   Manatee  -a
             Cape golden mole  -a
                     Aardvark  -c
B D                 Armadillo  -a
B D           Tasmanian devil  g-
B D                  Hedgehog  ==
B D                     Sheep  ==
                 Spotted gar  --
B D                Coelacanth  --
B D             X. tropicalis  --
B D                    Lizard  --
  D    Spiny softshell turtle  --
  D  Chinese softshell turtle  --
  D            Painted turtle  --
  D           Green seaturtle  ==
B D                    Turkey  --
B D                   Chicken  --
  D              Mallard duck  --
  D             Scarlet macaw  --
  D                    Parrot  --
B D                Budgerigar  --
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                  Platypus  --
B D                   Wallaby  --
B D        American alligator  --
B D                   Opossum  --
              Bactrian camel  ==
B D          White rhinoceros  --
B D                    Alpaca  ==

Inserts between block 20 and 21 in window
B D                      Pig 1bp
B D                  Dolphin 719bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                    Shrew 2bp
             Star-nosed mole 2bp
B D                 Elephant 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 21 of 33 in window, 32589514 - 32589518, 5 bps 
B D                     Human  at------g-a--t--
B D                     Chimp  gt------g-a--t--
B D                   Gorilla  tt------g-a--t--
B D                 Orangutan  at------a-a--t--
B D                    Gibbon  at------g-a--t--
B D                    Rhesus  at------g-a--t--
B D       Crab-eating macaque  gt------g-a--t--
B D                    Baboon  gt------g-a--t--
B D              Green monkey  at------g-a--t--
B D                  Marmoset  at------g-a--t--
B D           Squirrel monkey  at------g-a--t--
B D                  Bushbaby  at------g-a--t--
           Chinese tree shrew  tt------g-a--t--
B D                  Squirrel  at------g-a--t--
                 Prairie vole  gt------g-a--g--
B D           Chinese hamster  gc------g-a--g--
               Golden hamster  ac------t-attg--
B D                     Mouse  gt------g-a--g--
B D                       Rat  gt------g-a--a--
B D            Naked mole-rat  at------a-a--t--
B D                Guinea pig  at------a-g--t--
                   Chinchilla  at------g-a--t--
             Brush-tailed rat  at------g-a--t--
B D                    Rabbit  ag------g-a--c--
B D                      Pika  aa------g-a--t--
B D                       Pig  at------gaa--t--
B D                    Alpaca  at------g-a--t--
               Bactrian camel  ac------a-a--t--
                 Killer whale  gt------g-a--t--
             Tibetan antelope  at------g-a--t--
B D                       Cow  at------g-a--t--
                Domestic goat  at------g-a--t--
B D                     Horse  at------g-a--t--
B D                       Cat  at------g-a--t--
B D                       Dog  atataataa-a--a--
B D                   Ferret   ac------c-a--c--
B D                     Panda  at------g-a--c--
               Pacific walrus  at------g-a--c--
                 Weddell seal  at------g-a--c--
             Black flying-fox  at------g-a--t--
B D                   Megabat  at------g-g--t--
         David's myotis (bat)  at------g-g--t--
B D                  Microbat  at------g-a--t--
B D                  Hedgehog  at------g-------
B D                     Shrew  ag------g-------
              Star-nosed mole  at------g-------
B D                  Elephant  ac------c-a--t--
B D                   Manatee  ac------g-a--t--
             Cape golden mole  at------t-a--t--
                     Aardvark  ac------a-a--t--
B D                 Armadillo  ac------a-a--t--
B D           Tasmanian devil  --------g-g--tct
B D                     Sheep  ================
B D                   Dolphin  ================
                 Spotted gar  ----------------
B D                Coelacanth  ----------------
B D             X. tropicalis  ----------------
B D                    Lizard  ----------------
  D    Spiny softshell turtle  ----------------
  D  Chinese softshell turtle  ----------------
  D            Painted turtle  ----------------
  D           Green seaturtle  ================
B D                    Turkey  ----------------
B D                   Chicken  ----------------
  D              Mallard duck  ----------------
  D             Scarlet macaw  ----------------
  D                    Parrot  ----------------
B D                Budgerigar  ----------------
          Tibetan ground jay  ================
B D               Zebra finch  ================
B D       Medium ground finch  ================
  D    White-throated sparrow  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
  D               Rock pigeon  ================
B D                  Platypus  ----------------
B D                   Wallaby  ----------------
B D        American alligator  ----------------
B D                   Opossum  ----------------
B D          White rhinoceros  ----------------

Inserts between block 21 and 22 in window
B D                 Hedgehog 334bp
B D                    Shrew 1bp
             Star-nosed mole 1bp

Alignment block 22 of 33 in window, 32589519 - 32589542, 24 bps 
B D                     Human  aa----agatgggcaa----tctc-t--------gaagaaa
B D                     Chimp  aa----agatgggcaa----tctc-t--------gaagaaa
B D                   Gorilla  aa----agatgagcaa----tctc-t--------gaagaaa
B D                 Orangutan  aa----agatgtgcaa----tccc-t--------gttgaaa
B D                    Gibbon  aa----agatgggcaa----tctc-t--------gaagaca
B D                    Rhesus  aa----agatggacaa----tctc-t--------gaaaaa-
B D       Crab-eating macaque  aa----agatgagcaa----tctc-t--------gaagaaa
B D                    Baboon  aa----agataggcaa----tctc-t--------gaagaga
B D              Green monkey  aa----agatggacaa----tctc-t--------gaaaaa-
B D                  Marmoset  aa----agatgggcag----tctc-t--------aaagaaa
B D           Squirrel monkey  aa----agatgggcaa----tctc-t--------gaagaaa
B D                  Bushbaby  aa----agataggtgg----tccc-t--------gaagaaa
           Chinese tree shrew  aa----atataggtga----tcac-t--------gaagaaa
B D                  Squirrel  gaaaacatgtggccag----tga-------------agaaa
                 Prairie vole  ga----ctgtgggtgg----tcac------------aaaaa
B D           Chinese hamster  ga-----tgtggttag----tcac------------agaga
               Golden hamster  aa-----agcagtc-t----tcaa------------agaaa
B D                     Mouse  ga----ctgtgcatgc----tcac------------agaag
B D                       Rat  ga----ctgtga--gg----tcac------------agaag
B D            Naked mole-rat  ga----aggtaattgt----tcac-c--------aaagcaa
B D                Guinea pig  ta----aggtagaaaa----tcac-t--------caagaaa
                   Chinchilla  ga----agataagaag----tcatgc--------aaaaaaa
             Brush-tailed rat  ga----acgtaggaaa----tcac-c--------caagaaa
B D                    Rabbit  aa----agatgggtgg----tcag-t--------gaagaaa
B D                      Pika  aa----agacaggtgg----tcac-c--------aaagaca
B D                       Pig  aa----agatcagtgg----tcac-t--------gaagaat
B D                    Alpaca  ga----agatagttgg----tcac-t--------gaaaaaa
               Bactrian camel  aa----agatagttgg----tcac-t--------gaagaaa
                 Killer whale  aa----agataggtgg----tcac-t---------aaaaac
             Tibetan antelope  aa----agataggtgg----tcaa-t---------aagaat
B D                       Cow  aa----agataggtgg----tcag-t---------aagaat
                Domestic goat  aa----agataggtgg----tcaa-t---------aagaat
B D                     Horse  aa----agagaggagg----tcac-t--------gaagaaa
B D                       Cat  aa--------aggtgggcaatcat-t--------aaagaaa
B D                       Dog  at--------tggtgg----ttat-t--------gaagaaa
B D                   Ferret   aa--------gggtgg----tcat-t--------gaagaaa
B D                     Panda  aa--------gcttgg----tcat-t--------gaagaaa
               Pacific walrus  aa--------gggtgg----tcat-t--------caagaaa
                 Weddell seal  aa--------gggtgg----tcat-t--------caagaaa
             Black flying-fox  aa----agataggtgg----tcat-t--------gaagaaa
B D                   Megabat  aa----agataggtgg----tcat-t--------gaagaaa
         David's myotis (bat)  aa----aggcaggtgg----tcac-t--------gaggaaa
B D                  Microbat  aa----aggcaggtgg----ccac-t--------gaggaaa
B D                     Shrew  gc----caaaaagtga----tcac-t--------gaaaaaa
              Star-nosed mole  ta----agatagatgg----tcac-t--------aaagaaa
B D                  Elephant  aa----agatagataa----tcac-t--------gaagaaa
B D                   Manatee  aa----agatagataa----tcac-t--------gaagaaa
             Cape golden mole  aa----aaataaatgg----tcac-t--------aaagaaa
                     Aardvark  aa----agatagatgg----tcac-t--------gaagaaa
B D                 Armadillo  aa----agaataattg----tccc-t--------aaagaaa
B D           Tasmanian devil  aa----aaaccagttt----cccc-tactcccctgagaacc
B D                  Hedgehog  =========================================
B D                     Sheep  =========================================
B D                   Dolphin  =========================================
                 Spotted gar  -----------------------------------------
B D                Coelacanth  -----------------------------------------
B D             X. tropicalis  -----------------------------------------
B D                    Lizard  -----------------------------------------
  D    Spiny softshell turtle  -----------------------------------------
  D  Chinese softshell turtle  -----------------------------------------
  D            Painted turtle  -----------------------------------------
  D           Green seaturtle  =========================================
B D                    Turkey  -----------------------------------------
B D                   Chicken  -----------------------------------------
  D              Mallard duck  -----------------------------------------
  D             Scarlet macaw  -----------------------------------------
  D                    Parrot  -----------------------------------------
B D                Budgerigar  -----------------------------------------
          Tibetan ground jay  =========================================
B D               Zebra finch  =========================================
B D       Medium ground finch  =========================================
  D    White-throated sparrow  =========================================
  D          Peregrine falcon  =========================================
  D              Saker falcon  =========================================
  D               Rock pigeon  =========================================
B D                  Platypus  -----------------------------------------
B D                   Wallaby  -----------------------------------------
B D        American alligator  -----------------------------------------
B D                   Opossum  -----------------------------------------
B D          White rhinoceros  -----------------------------------------

Alignment block 23 of 33 in window, 32589543 - 32589545, 3 bps 
B D                     Human  acg
B D                     Chimp  acc
B D                   Gorilla  acc
B D                 Orangutan  acg
B D                    Gibbon  acg
B D                    Rhesus  --g
B D       Crab-eating macaque  aca
B D                    Baboon  aca
B D              Green monkey  --a
B D                  Marmoset  aca
B D           Squirrel monkey  aca
B D                  Bushbaby  atg
           Chinese tree shrew  ata
B D                  Squirrel  atg
                 Prairie vole  ata
B D           Chinese hamster  ata
               Golden hamster  aaa
B D                     Mouse  ata
B D                       Rat  ata
B D            Naked mole-rat  atg
B D                Guinea pig  atg
                   Chinchilla  atg
             Brush-tailed rat  atg
B D                    Rabbit  atg
B D                      Pika  gtg
B D                       Pig  atg
B D                    Alpaca  atg
               Bactrian camel  atg
                 Killer whale  aaa
             Tibetan antelope  ata
B D                       Cow  ata
                Domestic goat  ata
B D                     Horse  atg
B D                       Cat  atg
B D                       Dog  ata
B D                   Ferret   ata
B D                     Panda  ata
               Pacific walrus  ata
                 Weddell seal  ata
             Black flying-fox  atg
B D                   Megabat  atg
         David's myotis (bat)  atg
B D                  Microbat  atg
B D                     Shrew  tta
              Star-nosed mole  atg
B D                  Elephant  atg
B D                   Manatee  atg
             Cape golden mole  ttg
                     Aardvark  atg
B D                 Armadillo  atg
B D           Tasmanian devil  atc
B D                  Platypus  atg
B D                  Hedgehog  ===
B D                     Sheep  ===
B D                   Dolphin  ===
                 Spotted gar  ---
B D                Coelacanth  ---
B D             X. tropicalis  ---
B D                    Lizard  ---
  D    Spiny softshell turtle  ---
  D  Chinese softshell turtle  ---
  D            Painted turtle  ---
  D           Green seaturtle  ===
B D                    Turkey  ---
B D                   Chicken  ---
  D              Mallard duck  ---
  D             Scarlet macaw  ---
  D                    Parrot  ---
B D                Budgerigar  ---
          Tibetan ground jay  ===
B D               Zebra finch  ===
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D                   Wallaby  ---
B D        American alligator  ---
B D                   Opossum  ---
B D          White rhinoceros  ---

Inserts between block 23 and 24 in window
                Killer whale 30bp
B D          Tasmanian devil 3bp

Alignment block 24 of 33 in window, 32589546 - 32589558, 13 bps 
B D                     Human  tcacaa--tttct-ta
B D                     Chimp  tcacaa--tttct-ta
B D                   Gorilla  tcacaa--tttct-ta
B D                 Orangutan  tcacaa--attct-ta
B D                    Gibbon  tcacaa--tttct-ta
B D                    Rhesus  tcacaa--tttca-ta
B D       Crab-eating macaque  tcacaa--tttct-ta
B D                    Baboon  tcacaa--tttct-ta
B D              Green monkey  tcacaa--tttcg-ta
B D                  Marmoset  tcacaa--attgt-ta
B D           Squirrel monkey  tcacaa--gttgt-ta
B D                  Bushbaby  tcacaa--ttttt-ta
           Chinese tree shrew  t---------------
B D                  Squirrel  tcacaa---gttt-tg
                 Prairie vole  taggta---gatt-ca
B D           Chinese hamster  tcagtg---gatt-ca
               Golden hamster  atgaca---attt-ta
B D                     Mouse  tcaata---gttc-cg
B D                       Rat  tcaata---gttt-ca
B D            Naked mole-rat  tctcaa---gttt-ta
B D                Guinea pig  tcctaa---gttt-tg
                   Chinchilla  tcacaa---gttt-ta
             Brush-tailed rat  tcacaa---gttt-tg
B D                    Rabbit  tcacag--ttttt-ta
B D                      Pika  tcacaa--tgtta-ta
B D                       Pig  tcacaa--tttttttc
B D                    Alpaca  tccagt--ttttt--a
               Bactrian camel  tccggt--ttttt--a
                 Killer whale  tcacaa--ctttt-aa
             Tibetan antelope  tcacag--ttttt--a
B D                       Cow  tcacaa--ttttt--a
                Domestic goat  tcacag--tttgt--a
B D                     Horse  acacaa--gtttt-ta
B D                       Cat  tcacaa--ttttc-ta
B D                       Dog  tcacaa--ttttc-ta
B D                   Ferret   ccacaa--tattc-ta
B D                     Panda  tcacaa--ttttc-ta
               Pacific walrus  ccacaa--ttttc-ta
                 Weddell seal  ccacaa--ttttc-ta
             Black flying-fox  tcatac--tttac-aa
B D                   Megabat  tcacag--tttac-aa
         David's myotis (bat)  ccacca--ttttc-ta
B D                  Microbat  ccacca--ttttc-ta
B D                  Hedgehog  tcacaa--ttctt--a
B D                     Shrew  tcag--------t--a
              Star-nosed mole  tcaa------------
B D                  Elephant  tcacaacttcttt-ta
B D                   Manatee  tcacag-tttttg-ta
             Cape golden mole  tcacttttttttt-ta
                     Aardvark  tcaca---tcttt-ta
B D                 Armadillo  tggcaa--ttttt-tg
B D           Tasmanian devil  tcccaa--gtctt-tc
B D                  Platypus  tagcca--atcct-cc
B D                     Sheep  ================
B D                   Dolphin  ================
                 Spotted gar  ----------------
B D                Coelacanth  ----------------
B D             X. tropicalis  ----------------
B D                    Lizard  ----------------
  D    Spiny softshell turtle  ----------------
  D  Chinese softshell turtle  ----------------
  D            Painted turtle  ----------------
  D           Green seaturtle  ================
B D                    Turkey  ----------------
B D                   Chicken  ----------------
  D              Mallard duck  ----------------
  D             Scarlet macaw  ----------------
  D                    Parrot  ----------------
B D                Budgerigar  ----------------
          Tibetan ground jay  ================
B D               Zebra finch  ================
B D       Medium ground finch  ================
  D    White-throated sparrow  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
  D               Rock pigeon  ================
B D                   Wallaby  ----------------
B D        American alligator  ----------------
B D                   Opossum  ----------------
B D          White rhinoceros  ----------------

Inserts between block 24 and 25 in window
B D          Tasmanian devil 58700bp

Alignment block 25 of 33 in window, 32589559 - 32589565, 7 bps 
B D                     Human  agggaca
B D                     Chimp  agggaca
B D                   Gorilla  agggaca
B D                 Orangutan  agggaca
B D                    Gibbon  agggaca
B D                    Rhesus  acagaca
B D       Crab-eating macaque  agggaca
B D                    Baboon  agggaca
B D              Green monkey  acagata
B D                  Marmoset  agggaca
B D           Squirrel monkey  agggaca
B D                  Bushbaby  aggaaca
           Chinese tree shrew  ---gcct
B D                  Squirrel  agggact
                 Prairie vole  aggggct
B D           Chinese hamster  agggact
               Golden hamster  aaagacc
B D                     Mouse  agggact
B D                       Rat  agggact
B D            Naked mole-rat  aggaagt
B D                Guinea pig  aggaact
                   Chinchilla  atgaact
             Brush-tailed rat  aggaact
B D                    Rabbit  aggaaca
B D                      Pika  aggtacc
B D                       Pig  agcgaca
B D                    Alpaca  agggaca
               Bactrian camel  agggaca
                 Killer whale  agaaggc
             Tibetan antelope  agggacc
B D                       Cow  agggacc
                Domestic goat  agaggtc
B D                     Horse  agggtca
B D                       Cat  aggcaca
B D                       Dog  agggaca
B D                   Ferret   agggaca
B D                     Panda  agggaca
               Pacific walrus  agggaca
                 Weddell seal  agggaca
             Black flying-fox  agggaca
B D                   Megabat  agggaca
         David's myotis (bat)  agggaca
B D                  Microbat  atgggca
B D                  Hedgehog  tgggtca
B D                     Shrew  gtggcca
              Star-nosed mole  -----aa
B D                  Elephant  aagaaca
B D                   Manatee  aagaaca
             Cape golden mole  agggaca
                     Aardvark  agaaaca
B D                 Armadillo  aaggaca
B D                  Platypus  caggatg
B D                     Sheep  =======
B D                   Dolphin  =======
                 Spotted gar  -------
B D                Coelacanth  -------
B D             X. tropicalis  -------
B D                    Lizard  -------
  D    Spiny softshell turtle  -------
  D  Chinese softshell turtle  -------
  D            Painted turtle  -------
  D           Green seaturtle  =======
B D                    Turkey  -------
B D                   Chicken  -------
  D              Mallard duck  -------
  D             Scarlet macaw  -------
  D                    Parrot  -------
B D                Budgerigar  -------
          Tibetan ground jay  =======
B D               Zebra finch  =======
B D       Medium ground finch  =======
  D    White-throated sparrow  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
B D                   Wallaby  -------
B D        American alligator  -------
B D           Tasmanian devil  =======
B D                   Opossum  -------
B D          White rhinoceros  -------

Inserts between block 25 and 26 in window
B D                 Elephant 10bp
B D                  Manatee 10bp
            Cape golden mole 10bp
                    Aardvark 10bp
B D                Armadillo 10bp

Alignment block 26 of 33 in window, 32589566 - 32589581, 16 bps 
B D                     Human  tggcctggg---cacaatg
B D                     Chimp  tggcctggg---cacaatg
B D                   Gorilla  tggcctggg---cacaatg
B D                 Orangutan  tggcctggg---cacagtg
B D                    Gibbon  tggcctgcg---cacgatg
B D                    Rhesus  tggtctggg---cacaatc
B D       Crab-eating macaque  tggcctggg---cacaatg
B D                    Baboon  tggcctggg---cacaatg
B D              Green monkey  tggtccggg---cacaatg
B D                  Marmoset  tggcctgga---cacaatg
B D           Squirrel monkey  tggcctggg---cataatg
B D                  Bushbaby  tgacctggg---cacagag
           Chinese tree shrew  ggacctagt---gaaaaag
B D                  Squirrel  tggcctgga---caaactg
                 Prairie vole  tgacctgga---cag--tg
B D           Chinese hamster  tgacctgga---tag--tg
               Golden hamster  tagtgttga---cca--aa
B D                     Mouse  tggcctgga---cag--tg
B D                       Rat  tggcccaga---cag--ta
B D            Naked mole-rat  tggcctgga---cacagta
B D                Guinea pig  tggcctgga---caacata
                   Chinchilla  cggcctgga---caaagca
             Brush-tailed rat  tggcctcgg---caagggg
B D                    Rabbit  aagtctgga---ctcagag
B D                      Pika  cagcct-ga---ctctgtg
B D                       Pig  tggcctaca---cagagtg
B D                    Alpaca  tggtctgga---cacagtg
               Bactrian camel  tggcctgga---cacagtg
                 Killer whale  tggtctgga---cacagag
             Tibetan antelope  tggcctgga---tataggg
B D                       Cow  tggcctgga---tatagtg
                Domestic goat  tggcctgga---tgtagtg
B D                     Horse  tggcctgga---cacagtg
B D                       Cat  tggcgtgga---cacagtg
B D                       Dog  tagcctgga---cacagtg
B D                   Ferret   tggcctaga---tacagtg
B D                     Panda  tggcctgga---c-cagtg
               Pacific walrus  tggcctgga---cacagtg
                 Weddell seal  tggcctgga---cacagtg
             Black flying-fox  tggcctaga---catagtg
B D                   Megabat  tggcctaga---catagtg
         David's myotis (bat)  tgg-ctgga---cacagtg
B D                  Microbat  tggcctggg---cacagtg
B D                  Hedgehog  gtgtctgagact-------
B D                     Shrew  tattctga-----------
              Star-nosed mole  tcttctaag----------
B D                  Elephant  tggcctgga---cacagtg
B D                   Manatee  tgacctaga---ctcagtg
             Cape golden mole  tgacttgga---tacagtg
                     Aardvark  tggtctaaa---tatagtg
B D                 Armadillo  tggcctaca----acagtg
B D           Tasmanian devil  tggtctggg---cttagag
B D                   Wallaby  tggtctggg---cccagag
B D                  Platypus  gggctggag---cggggca
B D                     Sheep  ===================
B D                   Dolphin  ===================
                 Spotted gar  -------------------
B D                Coelacanth  -------------------
B D             X. tropicalis  -------------------
B D                    Lizard  -------------------
  D    Spiny softshell turtle  -------------------
  D  Chinese softshell turtle  -------------------
  D            Painted turtle  -------------------
  D           Green seaturtle  ===================
B D                    Turkey  -------------------
B D                   Chicken  -------------------
  D              Mallard duck  -------------------
  D             Scarlet macaw  -------------------
  D                    Parrot  -------------------
B D                Budgerigar  -------------------
          Tibetan ground jay  ===================
B D               Zebra finch  ===================
B D       Medium ground finch  ===================
  D    White-throated sparrow  ===================
  D          Peregrine falcon  ===================
  D              Saker falcon  ===================
  D               Rock pigeon  ===================
B D        American alligator  -------------------
B D                   Opossum  -------------------
B D          White rhinoceros  -------------------

Inserts between block 26 and 27 in window
B D                      Pig 7bp
B D                   Alpaca 8bp
              Bactrian camel 8bp
                Killer whale 8bp
            Tibetan antelope 8bp
B D                      Cow 3bp
               Domestic goat 8bp
B D                    Horse 8bp
B D                      Cat 8bp
B D                      Dog 8bp
B D                  Ferret  8bp
B D                    Panda 8bp
              Pacific walrus 8bp
                Weddell seal 8bp
            Black flying-fox 8bp
B D                  Megabat 8bp
B D                 Microbat 8bp
B D                    Shrew 20bp
B D                 Elephant 3bp
B D                  Manatee 3bp
            Cape golden mole 3bp
                    Aardvark 3bp
B D                Armadillo 3bp

Alignment block 27 of 33 in window, 32589582 - 32589584, 3 bps 
B D                     Human  ---tta
B D                     Chimp  ---tta
B D                   Gorilla  ---tta
B D                 Orangutan  ---aca
B D                    Gibbon  ---tta
B D                    Rhesus  ---tta
B D       Crab-eating macaque  ---tta
B D                    Baboon  ---tta
B D              Green monkey  ---tta
B D                  Marmoset  ---tta
B D           Squirrel monkey  ---tta
B D                  Bushbaby  ---aca
           Chinese tree shrew  ---tta
B D                  Squirrel  ---aga
                 Prairie vole  ---aga
B D           Chinese hamster  ---agg
               Golden hamster  ---tga
B D                     Mouse  ---aga
B D                       Rat  ---agg
B D            Naked mole-rat  ---aga
B D                Guinea pig  ---aga
                   Chinchilla  ---aga
             Brush-tailed rat  ---aga
B D                    Rabbit  ---aca
B D                      Pika  ---aca
B D                  Hedgehog  ---tca
              Star-nosed mole  ----tt
B D           Tasmanian devil  ---aga
B D                   Wallaby  ---aga
B D                  Platypus  tcc---
B D                     Shrew  ======
            Black flying-fox  ======
                Weddell seal  ======
                Killer whale  ======
B D                     Panda  ======
B D                       Cow  ======
               Domestic goat  ======
B D                     Sheep  ======
            Tibetan antelope  ======
B D                  Microbat  ======
        David's myotis (bat)  ------
B D                 Armadillo  ======
B D                       Dog  ======
B D                   Ferret   ======
B D                       Cat  ======
              Pacific walrus  ======
B D                   Dolphin  ======
                 Spotted gar  ------
B D                Coelacanth  ------
B D             X. tropicalis  ------
B D                    Lizard  ------
  D    Spiny softshell turtle  ------
  D  Chinese softshell turtle  ------
  D            Painted turtle  ------
  D           Green seaturtle  ======
B D                    Turkey  ------
B D                   Chicken  ------
  D              Mallard duck  ------
  D             Scarlet macaw  ------
  D                    Parrot  ------
B D                Budgerigar  ------
          Tibetan ground jay  ======
B D               Zebra finch  ======
B D       Medium ground finch  ======
  D    White-throated sparrow  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D               Rock pigeon  ======
B D        American alligator  ------
B D                   Opossum  ------
B D                   Manatee  ======
B D                  Elephant  ======
              Bactrian camel  ======
B D                   Megabat  ======
                    Aardvark  ======
            Cape golden mole  ======
B D                       Pig  ======
B D          White rhinoceros  ------
B D                     Horse  ======
B D                    Alpaca  ======

Inserts between block 27 and 28 in window
B D                 Hedgehog 9bp
             Star-nosed mole 9bp
B D          Tasmanian devil 3bp
B D                  Wallaby 3bp

Alignment block 28 of 33 in window, 32589585 - 32589588, 4 bps 
B D                     Human  ---acaa
B D                     Chimp  ---acac
B D                   Gorilla  ---acac
B D                 Orangutan  ---a---
B D                    Gibbon  ---acaa
B D                    Rhesus  ---acaa
B D       Crab-eating macaque  ---acaa
B D                    Baboon  ---acaa
B D              Green monkey  ---acac
B D                  Marmoset  ---acaa
B D           Squirrel monkey  ---acaa
B D                  Bushbaby  ---a---
           Chinese tree shrew  ---ac--
B D                  Squirrel  ---aagt
                 Prairie vole  ---ag-t
B D           Chinese hamster  ---aagt
               Golden hamster  ---agct
B D                     Mouse  ---atgt
B D                       Rat  ---aagt
B D            Naked mole-rat  ---aaat
B D                Guinea pig  ---aagt
                   Chinchilla  ---aagt
             Brush-tailed rat  ---cagt
B D                    Rabbit  ---aatt
B D                      Pika  ---aagt
B D                       Pig  ---a---
B D                    Alpaca  ---a---
               Bactrian camel  ---a---
                 Killer whale  ---a---
             Tibetan antelope  ---a---
B D                       Cow  ---a---
                Domestic goat  ---a---
B D                     Horse  ---a---
B D                       Cat  ---g---
B D                       Dog  ---a---
B D                   Ferret   ---a---
B D                     Panda  ---a---
               Pacific walrus  ---a---
                 Weddell seal  ---a---
             Black flying-fox  ---a---
B D                   Megabat  ---a---
         David's myotis (bat)  ---g---
B D                  Microbat  ---a---
B D                  Hedgehog  ---a---
B D                     Shrew  ---a---
              Star-nosed mole  ---a---
B D                  Elephant  ---a---
B D                   Manatee  ---a---
             Cape golden mole  ---a---
                     Aardvark  ---a---
B D                 Armadillo  ---a---
B D           Tasmanian devil  ---a---
B D                   Wallaby  ---g---
B D                  Platypus  tccg---
B D                     Sheep  =======
B D                   Dolphin  =======
                 Spotted gar  -------
B D                Coelacanth  -------
B D             X. tropicalis  -------
B D                    Lizard  -------
  D    Spiny softshell turtle  -------
  D  Chinese softshell turtle  -------
  D            Painted turtle  -------
  D           Green seaturtle  =======
B D                    Turkey  -------
B D                   Chicken  -------
  D              Mallard duck  -------
  D             Scarlet macaw  -------
  D                    Parrot  -------
B D                Budgerigar  -------
          Tibetan ground jay  =======
B D               Zebra finch  =======
B D       Medium ground finch  =======
  D    White-throated sparrow  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
B D        American alligator  -------
B D                   Opossum  -------
B D          White rhinoceros  -------

Inserts between block 28 and 29 in window
B D                Orangutan 1263bp
B D                 Bushbaby 4bp
B D                 Elephant 4bp
B D                  Manatee 4bp
            Cape golden mole 4bp
                    Aardvark 4bp
B D                Armadillo 4bp

Alignment block 29 of 33 in window, 32589589 - 32589590, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D                    Baboon  aa
B D              Green monkey  aa
B D                  Marmoset  aa
B D           Squirrel monkey  aa
B D                  Bushbaby  aa
B D                  Squirrel  aa
                 Prairie vole  cg
B D           Chinese hamster  cg
               Golden hamster  ag
B D                     Mouse  ta
B D                       Rat  ta
B D            Naked mole-rat  ta
B D                Guinea pig  ca
                   Chinchilla  ta
             Brush-tailed rat  ta
B D                    Rabbit  aa
B D                      Pika  aa
B D                       Pig  ac
B D                    Alpaca  ac
               Bactrian camel  ac
                 Killer whale  ac
             Tibetan antelope  ac
B D                       Cow  ac
                Domestic goat  ac
B D                     Horse  gc
B D                       Cat  at
B D                       Dog  at
B D                   Ferret   at
B D                     Panda  at
               Pacific walrus  at
                 Weddell seal  at
             Black flying-fox  at
B D                   Megabat  at
         David's myotis (bat)  at
B D                  Microbat  at
B D                  Hedgehog  ac
B D                     Shrew  a-
              Star-nosed mole  a-
B D                  Elephant  aa
B D                   Manatee  aa
             Cape golden mole  aa
                     Aardvark  aa
B D                 Armadillo  ag
B D                  Platypus  -g
B D                     Sheep  ==
          Chinese tree shrew  --
B D                   Dolphin  ==
                 Spotted gar  --
B D                Coelacanth  --
B D             X. tropicalis  --
B D                    Lizard  --
  D    Spiny softshell turtle  --
  D  Chinese softshell turtle  --
  D            Painted turtle  --
  D           Green seaturtle  ==
B D                    Turkey  --
B D                   Chicken  --
  D              Mallard duck  --
  D             Scarlet macaw  --
  D                    Parrot  --
B D                Budgerigar  --
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                   Wallaby  --
B D        American alligator  --
B D           Tasmanian devil  --
B D                   Opossum  --
B D          White rhinoceros  --

Alignment block 30 of 33 in window, 32589591 - 32589623, 33 bps 
B D                     Human  ctccc-tat-t------t--t------cc---------ccac-------ccc-atagtagctca------
B D                     Chimp  ctcca-tat-t------t--t------cc---------ccac-------ccc-atagtagctca------
B D                   Gorilla  ctccc-tatat------t--c------cc---------ccac-------ccc-atagtagctca------
B D                 Orangutan  ctccc-tac-c------t--t------at---------ccac-------ctt-atagtagctca------
B D                    Gibbon  ctccc-tat-t------t--t------cc---------ccac-------ccc-ataggagctca------
B D                    Rhesus  ctccc-tat-t------t--t------cc---------ccac-------ccc-atagtagctca------
B D       Crab-eating macaque  ctccc-tat-t------t--t------cc---------cctc-------ccc-acagtagctca------
B D                    Baboon  ctccc-tat-t------t--t------cc---------ccac-------cgc-atagtagctca------
B D              Green monkey  ctccc-taa-t------t--t------cc---------ccac-------ccc-atagtagctca------
B D                  Marmoset  ctccc-tat-t------t--t------cc---------ccac-------ccc-atagtagctca------
B D           Squirrel monkey  ctccc-tat-t------t--t------cc---------ccac-------ccc-atagtaggtca------
B D                  Bushbaby  ctccc-ttt-c------t--t------cc---------ccaa-------ccc-ccaatagccca------
           Chinese tree shrew  ---tt-tct-t------t--t------cc---------ccac-------cccaaaaatagctca------
B D                  Squirrel  ttccc-ttc-c------t--t-------c---------ccca-------ccc-atggcctctcc------
                 Prairie vole  gcccc-ttc-c------t--c-------c---------cccg-------ccc-ccagcagctca------
B D           Chinese hamster  acccc-ttc-c------t--tcccacacc---------ccca-------acc-ccagcagctca------
               Golden hamster  ttctc-tgc-c------t--t-------c---------cccg-------ccc-acagcagct--------
B D                     Mouse  gctcc-ttc-c------t--t------cc---------ccga-------ccc-cgagcatccca------
B D                       Rat  gcgcc-ttc-t------t--c------cc---------ccca-------tcc-tcagcagccca------
B D            Naked mole-rat  actccattc-c------t--a------ct---------ccca-------gct-accacagctca------
B D                Guinea pig  acatcattc-c------t--g------ct---------ccca-------cct-actgtagctcc------
                   Chinchilla  actccattc-c------t--g------ct---------ccca-------cct-atcatagttta------
             Brush-tailed rat  actccgttc-c------t--a------ct---------ccca-------cct-tccacagctca------
B D                    Rabbit  ctccc-tt--c------t--t------cc---------ccac-------cca-ataatagccca------
B D                      Pika  ctccc-ttc-c------c--t------cc---------ccac-------cca-ataagaaccca------
B D                       Pig  tcccc-tcc-t---------t------cc---------ccac-------ccc-gtgatagatca------
B D                    Alpaca  tctcc-tcc-t------t--c------cc---------ccac-------ccc-ataagagctca------
               Bactrian camel  tcctt-tcc-t------t--t------cc---------ccac-------ccc-acaagagct--------
                 Killer whale  tccct-tcc-t------t--c------cc---------ccac-------ccc-acaatagctca------
             Tibetan antelope  tccgt-tcc-tctccagc--c------cc---------ctac-------ccc-atgattggtca------
B D                       Cow  tccgt-tcc-tccccacc--c------cc---------caac-------ccc-ctgataggtca------
                Domestic goat  tctgt-tct-tccccacc--c------cc---------ctac-------ccc-atggtaggtca------
B D                     Horse  atcct-tca-t------c--t------cc---------ccac-------ccc-accatgcctca------
B D                       Cat  ttctt-tct-t------t--c------cc--------cccac-------tcc-acaatagctca------
B D                       Dog  ttctt-tct-t------c--c------ct---------ccaa-------ccc-ataatatctta------
B D                   Ferret   ttctt-tcc-c------t--c------cc-----tcctctcc-------ccc-acaatagctta------
B D                     Panda  ttctt-tct-c------c--c------ct--cacccccctcc-------ccc-acaatagctta------
               Pacific walrus  ttctt-tct-c------c--c------ca-----cccccccc-------ccc-aagatagctta------
                 Weddell seal  ttctt-tct-c------c--c------ca---------cccc-------ccc-aaaatagctta------
             Black flying-fox  tccct-tcc-t------t--c------tc---------cctc----accccc-acaatagctaa------
B D                   Megabat  tccct-tcc-t------t--c------tc---------cctc----accccc-acaatagctaa------
         David's myotis (bat)  ttcct-ttc-t------t--c------ct---------ccg--------ccc-acaacagctca------
B D                  Microbat  ttcct-ttc-t------t--c------ct---------cc---------ccc-acaacagctca------
B D                  Hedgehog  accct-tta-t------c--c------cc---------aaac-------ccc-acaaaagctcacccacc
B D                     Shrew  ---tt-ccc-t------c--t------cc-----------tt-------tcc-ccagtacttca------
              Star-nosed mole  ---ct-ttt-t------c--c------tc-----------ac-------ccc-acaataactca------
B D                  Elephant  gtctt-tcc-c------t--a------tc----tcacaccac-------ccc-ataataact-a------
B D                   Manatee  ctctt-tcc-c------t--a------cc----tcaccccac-------ccc-ataataact-a------
             Cape golden mole  atttt-tac-c------t--a------cc---attctcccat-------ccc-ataatagct-a------
                     Aardvark  ctctt-tct-c------t--t------tctccctttctccac-------cac-ataattgct-a------
B D                 Armadillo  ctttt-tcc-c------t--t------ca-----tttcccac-------cgc-gtaagagct-c------
B D           Tasmanian devil  -tgct-ccc-t------t--g------gc---------ccca-------cct-gagatttctgg------
B D                   Wallaby  -tgct-ccc-c------tcgg------gc---------caca-------cct-gggctctctgg------
B D                  Platypus  atccc-ccc-t------c--t------tc---------ccacaaggacgtct-cggggtgctgg------
  D              Mallard duck  ccccc-cat-c------c--c------ac---------ctcc-------ccc-ccagcagccac------
B D                     Sheep  ======================================================================
B D                   Dolphin  ======================================================================
                 Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ----------------------------------------------------------------------
B D             X. tropicalis  ----------------------------------------------------------------------
B D                    Lizard  ----------------------------------------------------------------------
  D    Spiny softshell turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------------------
  D           Green seaturtle  ======================================================================
B D                    Turkey  ----------------------------------------------------------------------
B D                   Chicken  ----------------------------------------------------------------------
  D             Scarlet macaw  ----------------------------------------------------------------------
  D                    Parrot  ----------------------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------------------
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D        American alligator  ----------------------------------------------------------------------
B D                   Opossum  ----------------------------------------------------------------------
B D          White rhinoceros  ----------------------------------------------------------------------

                        Human  ---g-c
                        Chimp  ---g-c
                      Gorilla  ---g-c
                    Orangutan  ---g-c
                       Gibbon  ---g-c
                       Rhesus  ---g-t
          Crab-eating macaque  ---g-c
                       Baboon  ---g-c
                 Green monkey  ---g-c
                     Marmoset  ---g-c
              Squirrel monkey  ---g-c
                     Bushbaby  ---g-c
           Chinese tree shrew  ---g-c
                     Squirrel  ---a-t
                 Prairie vole  ---g-c
              Chinese hamster  ---g-c
               Golden hamster  -----a
                        Mouse  ---g-c
                          Rat  ---g-c
               Naked mole-rat  ---c-c
                   Guinea pig  ---c-c
                   Chinchilla  ---c-c
             Brush-tailed rat  ---c-c
                       Rabbit  ---g-t
                         Pika  ---g-c
                          Pig  ---a-c
                       Alpaca  ---c-c
               Bactrian camel  ------
                 Killer whale  ---c-c
             Tibetan antelope  ---c-c
                          Cow  ---c-c
                Domestic goat  ---c-c
                        Horse  ---t-c
                          Cat  ---c-c
                          Dog  ---c-c
                      Ferret   ---c-c
                        Panda  ---c-c
               Pacific walrus  ---c-c
                 Weddell seal  ---c-c
             Black flying-fox  ---c-c
                      Megabat  ---c-c
         David's myotis (bat)  ---c-c
                     Microbat  ---c-c
                     Hedgehog  ccac-c
                        Shrew  -----c
              Star-nosed mole  ---c-c
                     Elephant  ---c-c
                      Manatee  ---c-c
             Cape golden mole  ---c-c
                     Aardvark  ---c-c
                    Armadillo  ---ctc
              Tasmanian devil  ---g-t
                      Wallaby  ---g-g
                     Platypus  ---g-c
                 Mallard duck  ---a-c
                        Sheep  ======
                      Dolphin  ======
                  Spotted gar  ------
                   Coelacanth  ------
                X. tropicalis  ------
                       Lizard  ------
       Spiny softshell turtle  ------
     Chinese softshell turtle  ------
               Painted turtle  ------
              Green seaturtle  ======
                       Turkey  ------
                      Chicken  ------
                Scarlet macaw  ------
                       Parrot  ------
                   Budgerigar  ------
           Tibetan ground jay  ======
                  Zebra finch  ======
          Medium ground finch  ======
       White-throated sparrow  ======
             Peregrine falcon  ======
                 Saker falcon  ======
                  Rock pigeon  ======
           American alligator  ------
                      Opossum  ------
             White rhinoceros  ------

Inserts between block 30 and 31 in window
  D             Mallard duck 6bp

Alignment block 31 of 33 in window, 32589624 - 32589633, 10 bps 
B D                     Human  acccg-----------caatg
B D                     Chimp  accca-----------caatg
B D                   Gorilla  accca-----------caatg
B D                 Orangutan  atcca-----------caatg
B D                    Gibbon  accca-----------cagtg
B D                    Rhesus  acccg-----------caatg
B D       Crab-eating macaque  accag-----------caatg
B D                    Baboon  accca-----------caatg
B D              Green monkey  atcca-----------caatg
B D                  Marmoset  accca-----------caatg
B D           Squirrel monkey  accca-----------caatc
B D                  Bushbaby  atcca-----------aagtg
           Chinese tree shrew  accca-----------aggtg
B D                  Squirrel  gcctg-----------aagag
                 Prairie vole  acctg-----------aggtg
B D           Chinese hamster  ccctg-----------aggtt
               Golden hamster  ccctg-----------aggcg
B D                     Mouse  acctg-----------aggtg
B D                       Rat  acctg-----------gggta
B D            Naked mole-rat  atcta-----------agggc
B D                Guinea pig  agcta-----------aggtg
                   Chinchilla  agcta-----------agggc
             Brush-tailed rat  agcta-----------agctg
B D                    Rabbit  atcca-----------aagca
B D                      Pika  atctg-----------aagtg
B D                       Pig  tccca-----------agaga
B D                    Alpaca  atcca-----------agatg
               Bactrian camel  ---ca-----------aaata
                 Killer whale  cccca-----------aagtg
             Tibetan antelope  ctcca-----------aggta
B D                       Cow  atcca-----------aggta
                Domestic goat  atcca-----------aggta
B D                     Horse  actaa-----------agata
B D                       Cat  accca-----------aggag
B D                       Dog  accca-----------aagtg
B D                   Ferret   atgaa-----------aggta
B D                     Panda  accca-----------aggtg
               Pacific walrus  accca-----------cggtg
                 Weddell seal  accca-----------aggtg
             Black flying-fox  -cata-----------atgtg
B D                   Megabat  -cata-----------atgtg
         David's myotis (bat)  -ccca-----------a--gg
B D                  Microbat  -ccca-----------a--gg
B D                  Hedgehog  -ccca-----------aagta
B D                     Shrew  -cctc-----------aaata
              Star-nosed mole  -cctc-----------aggtg
B D                  Elephant  cccca-----------aggtg
B D                   Manatee  accca-----------aggtg
             Cape golden mole  cttca-----------agata
                     Aardvark  actca-----------aggtg
B D                 Armadillo  accca-----------aggtg
B D           Tasmanian devil  tgctg-----------ctgct
B D                   Wallaby  agcag-----------ctgct
B D                  Platypus  tctct-----------ggggg
  D              Mallard duck  tcctgccccacggcgtggggc
B D        American alligator  acctg-----------gggtc
B D                     Sheep  =====================
B D                   Dolphin  =====================
                 Spotted gar  ---------------------
B D                Coelacanth  ---------------------
B D             X. tropicalis  ---------------------
B D                    Lizard  ---------------------
  D    Spiny softshell turtle  ---------------------
  D  Chinese softshell turtle  ---------------------
  D            Painted turtle  ---------------------
  D           Green seaturtle  =====================
B D                    Turkey  ---------------------
B D                   Chicken  ---------------------
  D             Scarlet macaw  ---------------------
  D                    Parrot  ---------------------
B D                Budgerigar  ---------------------
          Tibetan ground jay  =====================
B D               Zebra finch  =====================
B D       Medium ground finch  =====================
  D    White-throated sparrow  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
  D               Rock pigeon  =====================
B D                   Opossum  ---------------------
B D          White rhinoceros  ---------------------

Inserts between block 31 and 32 in window
B D          Tasmanian devil 1bp
B D                  Wallaby 1bp
B D                 Platypus 8bp

Alignment block 32 of 33 in window, 32589634 - 32589637, 4 bps 
B D                     Human  tg--ca
B D                     Chimp  tg--ca
B D                   Gorilla  tg--ca
B D                 Orangutan  tg--ca
B D                    Gibbon  tg--ca
B D                    Rhesus  tg--ca
B D       Crab-eating macaque  tg--ca
B D                    Baboon  tg--ca
B D              Green monkey  tg--ca
B D                  Marmoset  tg--ca
B D           Squirrel monkey  tg--ca
B D                  Bushbaby  gg--ca
           Chinese tree shrew  tgcaca
B D                  Squirrel  tg--ca
                 Prairie vole  tg--ca
B D           Chinese hamster  tg--ca
               Golden hamster  tg--ca
B D                     Mouse  tg--ca
B D                       Rat  tg--ca
B D            Naked mole-rat  ----ca
B D                Guinea pig  tg--ca
                   Chinchilla  tg--ca
             Brush-tailed rat  cg--ca
B D                    Rabbit  tg--ca
B D                      Pika  tg--ca
B D                       Pig  gg--ta
B D                    Alpaca  tg--ca
               Bactrian camel  tg--ca
                 Killer whale  tt--ca
             Tibetan antelope  ta--ta
B D                       Cow  ta--ta
                Domestic goat  ta--aa
B D                     Horse  tc--ta
B D                       Cat  tg--ca
B D                       Dog  tg--ca
B D                   Ferret   tg--ta
B D                     Panda  tg--ca
               Pacific walrus  ca--ca
                 Weddell seal  ca--ca
             Black flying-fox  tg--ta
B D                   Megabat  tg--ta
         David's myotis (bat)  tg--ca
B D                  Microbat  tg--ca
B D                  Hedgehog  tg--ca
B D                     Shrew  tc--ca
              Star-nosed mole  ta--ca
B D                  Elephant  tg--ca
B D                   Manatee  tg--ca
             Cape golden mole  tg--ca
                     Aardvark  ac--ca
B D                 Armadillo  tg--ca
B D                   Opossum  tg--ca
B D           Tasmanian devil  tg--ta
B D                   Wallaby  tg--ta
B D                  Platypus  tg--ca
  D              Mallard duck  tg--ag
B D        American alligator  tc--tg
B D                     Sheep  ======
B D                   Dolphin  ======
                 Spotted gar  ------
B D                Coelacanth  ------
B D             X. tropicalis  ------
B D                    Lizard  ------
  D    Spiny softshell turtle  ------
  D  Chinese softshell turtle  ------
  D            Painted turtle  ------
  D           Green seaturtle  ======
B D                    Turkey  ------
B D                   Chicken  ------
  D             Scarlet macaw  ------
  D                    Parrot  ------
B D                Budgerigar  ------
          Tibetan ground jay  ======
B D               Zebra finch  ======
B D       Medium ground finch  ======
  D    White-throated sparrow  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D               Rock pigeon  ======
B D          White rhinoceros  ------

Alignment block 33 of 33 in window, 32589638 - 32589644, 7 bps 
B D                     Human  ctt-acgt
B D                     Chimp  ctt-acat
B D                   Gorilla  cttaacgt
B D                 Orangutan  ctt-acat
B D                    Gibbon  ctt-acgt
B D                    Rhesus  ctt-acgt
B D       Crab-eating macaque  ctt-acgt
B D                    Baboon  ctt-acgt
B D              Green monkey  ctt-acat
B D                  Marmoset  ctt-acgt
B D           Squirrel monkey  ctt-acat
B D                  Bushbaby  ctt-acgc
           Chinese tree shrew  ctt-aggt
B D                  Squirrel  ctt-acgt
                 Prairie vole  ctc-atgt
B D           Chinese hamster  ctt-acgt
               Golden hamster  ctt-acgt
B D                     Mouse  ctt-acgt
B D                       Rat  ctt-acgc
B D            Naked mole-rat  ctt-acgt
B D                Guinea pig  ctc-acgt
                   Chinchilla  ctt-acgt
             Brush-tailed rat  ctc-atgt
B D                    Rabbit  ctt-acat
B D                      Pika  ctt-acga
B D                       Pig  ctt-acgt
B D                    Alpaca  ctt-acgt
               Bactrian camel  ctt-acgt
                 Killer whale  ctt-acat
             Tibetan antelope  ctt-acgt
B D                       Cow  ctt-acgt
                Domestic goat  ctt-acgt
B D                     Horse  ctt-acgt
B D                       Cat  ctt-acgt
B D                       Dog  ctt-acgt
B D                   Ferret   ctt-acgt
B D                     Panda  ctt-acgt
               Pacific walrus  ctt-acgc
                 Weddell seal  ctt-acgc
             Black flying-fox  ctt-acgt
B D                   Megabat  ctt-acgt
         David's myotis (bat)  ctt-acgt
B D                  Microbat  ctt-acat
B D                  Hedgehog  ctt-acgt
B D                     Shrew  cat-atgt
              Star-nosed mole  ctt-acct
B D                  Elephant  ctt-atgt
B D                   Manatee  ctt-atgt
             Cape golden mole  ctt-acat
                     Aardvark  ctt-atgt
B D                 Armadillo  ctt-acct
B D                   Opossum  ctt-acct
B D           Tasmanian devil  ctt-acct
B D                   Wallaby  ctt-acct
B D                  Platypus  ctc-acct
  D              Mallard duck  ctc-accc
B D        American alligator  cac-acct
  D           Green seaturtle  ctc-acct
  D            Painted turtle  ctc-acct
B D                     Sheep  ========
B D                   Dolphin  ========
                 Spotted gar  --------
B D                Coelacanth  --------
B D             X. tropicalis  --------
B D                    Lizard  --------
  D    Spiny softshell turtle  --------
  D  Chinese softshell turtle  --------
B D                    Turkey  --------
B D                   Chicken  --------
  D             Scarlet macaw  --------
  D                    Parrot  --------
B D                Budgerigar  --------
          Tibetan ground jay  ========
B D               Zebra finch  ========
B D       Medium ground finch  ========
  D    White-throated sparrow  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D               Rock pigeon  ========
B D          White rhinoceros  --------

View table schema

Go to Conservation track controls

Data last updated: 2015-05-06

Downloads for data in this track are available:

Description

This track shows multiple alignments of 100 vertebrate species and measurements of evolutionary conservation using two methods (phastCons and phyloP) from the PHAST package, for all species. The multiple alignments were generated using multiz and other tools in the UCSC/Penn State Bioinformatics comparative genomics alignment pipeline. Conserved elements identified by phastCons are also displayed in this track. PHAST/Multiz are built from chains ("alignable") and nets ("syntenic"), see the documentation of the Chain/Net tracks for a description of the complete alignment process.

PhastCons is a hidden Markov model-based method that estimates the probability that each nucleotide belongs to a conserved element, based on the multiple alignment. It considers not just each individual alignment column, but also its flanking columns. By contrast, phyloP separately measures conservation at individual columns, ignoring the effects of their neighbors. As a consequence, the phyloP plots have a less smooth appearance than the phastCons plots, with more "texture" at individual sites. The two methods have different strengths and weaknesses. PhastCons is sensitive to "runs" of conserved sites, and is therefore effective for picking out conserved elements. PhyloP, on the other hand, is more appropriate for evaluating signatures of selection at particular nucleoti