Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 28 in window, 112243028 - 112243847, 820 bps 
B D                     Human  caaggctgtggggaaaagggaacac--atatactgttggtgagaaaggagaatgtaaattagttcagcca
B D                     Chimp  caaggctgtggggaaaagggaacac--atatactgttggtgagaaaggagaatgtaaattagttcagcca
B D                   Gorilla  caaggctgtggggaaaagggaacac--atatactgttggtgagaaaggagaatgcaaattagttcagcca
B D                 Orangutan  caaggctgtggcaaaaggggaacac--atatactgttggtgagaaaggagaatgtaaattagttcagcca
B D                    Gibbon  caaggctgtggggaaaagggaacac--atatactgttggtgagaaaggagaatgtaaattagttcagcca
B D                    Rhesus  caaagctgtggagaaaagggaacacttatatactcctggtgagaaaggagaatataaattagttcagtca
B D       Crab-eating macaque  caaagctgtggagaaaagggaacacttatatactcctggtgagaaaggagaatataaattagttcagtca
B D                    Baboon  caaagctgtggggaaaagggaacacttatatactcctggtgagaaaggagaatataaattagttcagtca
B D              Green monkey  caaagctgtggggcaaagggaacacttatgtactcctggtgagaaaggagaatataaattagttcagtca
B D           Squirrel monkey  caaggttgtgaggaaaagagagcacttatatactgttgttgagaaaggagaatgtaaattagttcagcca
             Star-nosed mole  ======================================================================
B D                     Shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rabbit  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                   Megabat  ======================================================================
            Black flying-fox  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
                Prairie vole  ======================================================================
B D                    Tenrec  ======================================================================
               Domestic goat  ======================================================================
              Pacific walrus  ======================================================================
B D                 Armadillo  ======================================================================
         Cape elephant shrew  ======================================================================
                    Aardvark  ======================================================================
            Cape golden mole  ======================================================================
              Golden hamster  ======================================================================
B D                       Rat  ======================================================================
B D           Chinese hamster  ======================================================================
              Bactrian camel  ======================================================================
B D                     Horse  ======================================================================
B D                     Panda  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                     Mouse  ======================================================================
            Brush-tailed rat  ======================================================================
B D                Guinea pig  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                  Squirrel  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
          Chinese tree shrew  ======================================================================
                Weddell seal  ======================================================================
B D                       Cat  ======================================================================
B D                    Alpaca  ======================================================================
B D                       Cow  ======================================================================
                Killer whale  ======================================================================
B D                       Pig  ======================================================================
B D                   Ferret   ======================================================================
B D                       Dog  ======================================================================
B D          White rhinoceros  ======================================================================
B D                  Bushbaby  ======================================================================
B D                  Marmoset  ======================================================================

                        Human  ctgtggaaagcagtttggagatttctcaaataactataaacagaactaccattcaagctagccaccccaa
                        Chimp  ctgtggaaagcagtttggagatttctcaaataactataaacaaaactaccattcaagctagccaccccaa
                      Gorilla  ctgtggaaagcagtttggagatttctcaaataactataaacagaactaccattcaagctagccaccccaa
                    Orangutan  ctgtggaaagcagtttggagatttctcaaataactgtaaacagaactgccattcaagctagccaccccaa
                       Gibbon  ctgtggaaagcagtttggagatttctcaaataactataaacagaactaccattcaagctagccaccccaa
                       Rhesus  ttgtggaaagcagtttggagatttctcaaatagctataaacagaactaccattcaagctagccaccccaa
          Crab-eating macaque  ttgtggaaagcagtttggagatttctcaaatagctataaacagaactaccattcaagctagccaccccaa
                       Baboon  -tgtggaaagcagtttggagatttctcaaatagctataaacagaactaccattcaagctagccaccccaa
                 Green monkey  ttgtggaaagcagtttggagatttctcaaatagctataaacagaactaccattcaagctagccaccccaa
              Squirrel monkey  ctgtggaaagcagtttggagatttctcaaataactataaacagaactaccattcaagctagccaccccag
              Star-nosed mole  ======================================================================
                        Shrew  ======================================================================
                     Hedgehog  ======================================================================
                         Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rabbit  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                      Megabat  ======================================================================
             Black flying-fox  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
                Domestic goat  ======================================================================
               Pacific walrus  ======================================================================
                    Armadillo  ======================================================================
          Cape elephant shrew  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
               Golden hamster  ======================================================================
                          Rat  ======================================================================
              Chinese hamster  ======================================================================
               Bactrian camel  ======================================================================
                        Horse  ======================================================================
                        Panda  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
                   Guinea pig  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                     Squirrel  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
           Chinese tree shrew  ======================================================================
                 Weddell seal  ======================================================================
                          Cat  ======================================================================
                       Alpaca  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================
                          Pig  ======================================================================
                      Ferret   ======================================================================
                          Dog  ======================================================================
             White rhinoceros  ======================================================================
                     Bushbaby  ======================================================================
                     Marmoset  ======================================================================

                        Human  gatagccaaaggaaaatatatcattctacaaaaaagatacattcacttgtatgttcatcacagcattatt
                        Chimp  gatagccaaaggaaaatatatcattctacaaaaaagatacattcacttgtatgttcatcacagcattatt
                      Gorilla  gatagccaaaggaaaataaatcattctacaaaaaagatacattcacttgtatgttcatcacagcattatt
                    Orangutan  gatagccaaaggaaaataaatcattctacaaaaaagatacattcacttgtatgttcatcacagcattatt
                       Gibbon  gatagccaaaggaaaataaatcattctacaaaaaagatacattcacttgtatgttcatcacagcattatt
                       Rhesus  gatagccaaaggaaaataaatcattctacaaaaaagacccattcacttgtatgttcatcacagcactgtt
          Crab-eating macaque  gatagccaaaggaaaataaatcattctacaaaaaagacccattcacttgtatgttcatcacagcactgtt
                       Baboon  gatagccaaaggaaaataaatcattctacaaaaaagacccattcacttgtatgttcatcacagcactgtt
                 Green monkey  gatagccaaaggaaaataaatcattctacaaaaaagacccattcacttgtatgttcatcacagcactatt
              Squirrel monkey  tatagccaaaggaaaataaatcactctacaaaaaagacacattcacttgtatgttcatcacagcaccatt
              Star-nosed mole  ======================================================================
                        Shrew  ======================================================================
                     Hedgehog  ======================================================================
                         Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rabbit  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                      Megabat  ======================================================================
             Black flying-fox  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
                Domestic goat  ======================================================================
               Pacific walrus  ======================================================================
                    Armadillo  ======================================================================
          Cape elephant shrew  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
               Golden hamster  ======================================================================
                          Rat  ======================================================================
              Chinese hamster  ======================================================================
               Bactrian camel  ======================================================================
                        Horse  ======================================================================
                        Panda  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
                   Guinea pig  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                     Squirrel  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
           Chinese tree shrew  ======================================================================
                 Weddell seal  ======================================================================
                          Cat  ======================================================================
                       Alpaca  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================
                          Pig  ======================================================================
                      Ferret   ======================================================================
                          Dog  ======================================================================
             White rhinoceros  ======================================================================
                     Bushbaby  ======================================================================
                     Marmoset  ======================================================================

                        Human  cacaatagcaaagagatggaatcaacctaagtgtccatcaatggtggaatggataaagaaaatgtggtac
                        Chimp  cacaatagcaaagagatggaatcaacctaagtgtccatcagtggtggaatggataaagaaaatgtggtac
                      Gorilla  cacaatagcaaagagatggaatcaacctaagtgtccatcagtggtggaatggataaagaaaatgtggtac
                    Orangutan  cacaatagcaaagagatggaatcaacctaagtgtccatcaatggtggaatggataaagaaaatgtggtac
                       Gibbon  cacaatagcaaagagatggaatcaacctaagtgtccatcagtggtggaatggataaagaaaatgtgctat
                       Rhesus  cacaacagcaaagagatggaatcaacctaggtgtccatcattggtggaatggataaagaaaatgtggtac
          Crab-eating macaque  cacaacagcaaagagatggaatcaacctaggtgtccatcattggtggaatggataaagaaaatgtggtac
                       Baboon  cacaacagcaaagagatggaatcaacctaggtgtccatcactggtggaatggataaagaaaatgtggtac
                 Green monkey  cacaacagcaaagagatggaatcaacctaggtgtccatcattggtggaatggataaagaaaatgtggtac
              Squirrel monkey  cacaatagcaaagacatggaatcaacctaggtgtttatcagtggtggaatcgataaagaaaatgtggtac
              Star-nosed mole  ======================================================================
                        Shrew  ======================================================================
                     Hedgehog  ======================================================================
                         Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rabbit  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                      Megabat  ======================================================================
             Black flying-fox  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
                Domestic goat  ======================================================================
               Pacific walrus  ======================================================================
                    Armadillo  ======================================================================
          Cape elephant shrew  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
               Golden hamster  ======================================================================
                          Rat  ======================================================================
              Chinese hamster  ======================================================================
               Bactrian camel  ======================================================================
                        Horse  ======================================================================
                        Panda  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
                   Guinea pig  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                     Squirrel  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
           Chinese tree shrew  ======================================================================
                 Weddell seal  ======================================================================
                          Cat  ======================================================================
                       Alpaca  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================
                          Pig  ======================================================================
                      Ferret   ======================================================================
                          Dog  ======================================================================
             White rhinoceros  ======================================================================
                     Bushbaby  ======================================================================
                     Marmoset  ======================================================================

                        Human  agatacaccattgaatactatgcagccat-aaaaaagaacaagattatgccctttgccgcaacatggata
                        Chimp  agatacaccattgaatactatgcagccat-aaaaaagaacaagattatgccctttgctgcaacatggata
                      Gorilla  agatacaccattgaatactacgcagccat-aaaaaagaacaagattatgccctttgccgcaacatggata
                    Orangutan  agatacactattgaatactacgcagccat-aaaaaagaacaagattatgccctttgccgcaacatggata
                       Gibbon  agatacaccattgaatactacgcagccat-aaaaaagaacaagattatgccctttgccacaacatggata
                       Rhesus  agatacaccactgaatactacacagccat-aaaaaagaacaagattatgccctttgctgcaacatgaata
          Crab-eating macaque  agatacaccactgaatactacacagccat-aaaaaagaacaagattatgccctttgctgcaacatgaata
                       Baboon  agatacaccattgaatactacacagccat-aaaaaagaacaagattatgccctttgccacaacatggata
                 Green monkey  agatacaccactgaatactacacagccat-aaaaaagaacaagattatgccctttgccgcaacatgaata
              Squirrel monkey  agatacaccattgaatactacacagccataaaaaaagaaaaagattatgccctttgcaacaacatggatg
              Star-nosed mole  ======================================================================
                        Shrew  ======================================================================
                     Hedgehog  ======================================================================
                         Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rabbit  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                      Megabat  ======================================================================
             Black flying-fox  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
                Domestic goat  ======================================================================
               Pacific walrus  ======================================================================
                    Armadillo  ======================================================================
          Cape elephant shrew  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
               Golden hamster  ======================================================================
                          Rat  ======================================================================
              Chinese hamster  ======================================================================
               Bactrian camel  ======================================================================
                        Horse  ======================================================================
                        Panda  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
                   Guinea pig  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                     Squirrel  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
           Chinese tree shrew  ======================================================================
                 Weddell seal  ======================================================================
                          Cat  ======================================================================
                       Alpaca  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================
                          Pig  ======================================================================
                      Ferret   ======================================================================
                          Dog  ======================================================================
             White rhinoceros  ======================================================================
                     Bushbaby  ======================================================================
                     Marmoset  ======================================================================

                        Human  aagccagagaccactatcctaagtgaattaatgcaggagcagaaaatccaatatcttttgtgggaactaa
                        Chimp  aagccagaggccactatcctaagtgaattaatgcaggagcagaaaatccaatatcttttgtgggaactaa
                      Gorilla  aagccagaggccactatcctaagtgaattaatgcaggagcagaaaatccaatatcttttgtgggaactaa
                    Orangutan  aagccagaggccactatcttaagtgaattaatgcaggagcagaaaatccaataccttttgtgggaactaa
                       Gibbon  aagccagagtccactatcctaagtgaattaatgcaggagcagaaaatccaataccttttgtgggagctaa
                       Rhesus  aagccagaggccactatcctaagtgaattaatgcaggagcagaaaatccaataccttttgtgggaactaa
          Crab-eating macaque  aagccagaggccactatcctaagtgaattaatgcaggagcagaaaatccaataccttttgtgggaactaa
                       Baboon  aagccagaggccactatcctaagtgaattaatgcaggagcagaaaatccaataccttttgtgggaactaa
                 Green monkey  aagccagaggccactatcctaagtgaattaatgcaggagcagaaaatccaataccttttgtgggaactaa
              Squirrel monkey  gagccagaggccacaatcctaagtgaattaatgcaggagcaaacaatcaaataccttttgtgggagctaa
              Star-nosed mole  ======================================================================
                        Shrew  ======================================================================
                     Hedgehog  ======================================================================
                         Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rabbit  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                      Megabat  ======================================================================
             Black flying-fox  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
                Domestic goat  ======================================================================
               Pacific walrus  ======================================================================
                    Armadillo  ======================================================================
          Cape elephant shrew  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
               Golden hamster  ======================================================================
                          Rat  ======================================================================
              Chinese hamster  ======================================================================
               Bactrian camel  ======================================================================
                        Horse  ======================================================================
                        Panda  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
                   Guinea pig  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                     Squirrel  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
           Chinese tree shrew  ======================================================================
                 Weddell seal  ======================================================================
                          Cat  ======================================================================
                       Alpaca  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================
                          Pig  ======================================================================
                      Ferret   ======================================================================
                          Dog  ======================================================================
             White rhinoceros  ======================================================================
                     Bushbaby  ======================================================================
                     Marmoset  ======================================================================

                        Human  acattgagtacacatgaacatagagatgggaatagtggataccagggagtactagagtggggaaagagaa
                        Chimp  acattgagtacacatgaacatagagatgggaatagtggacaccagggagtactagagtggggaaagagaa
                      Gorilla  acattgagtacacatgaacatagagatgggaatagtggacaccagggagtactagagtggggaaagagaa
                    Orangutan  acattgagtacacatgaacatagagatgggaacagtggacaccagggagtactagagtggggaaagagaa
                       Gibbon  acattgagtacacatgaacatagagatgcgaacagtggacaccagggagtactagagtggggaaagagaa
                       Rhesus  acattgagtacacatgaacatagaaatgggaacagtggacaccagcgagtactagagtggggaaagagga
          Crab-eating macaque  acattgagtacacatgaacatagaaatgggaacagtggacaccagggagtactagagtggggaaagagaa
                       Baboon  acattgagtacacatgaacatagagatgggaacagtgcacaccagggagtactagagtggggaaagagaa
                 Green monkey  acattgagtacacatgaacatagagatgggaacagtggacaccagggagtactagagtggggaaagagaa
              Squirrel monkey  acattgaatacacatgaacatagagatgggaacagtggtcaccaagcagtactagagtggggaaagagaa
              Star-nosed mole  ======================================================================
                        Shrew  ======================================================================
                     Hedgehog  ======================================================================
                         Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rabbit  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                      Megabat  ======================================================================
             Black flying-fox  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
                Domestic goat  ======================================================================
               Pacific walrus  ======================================================================
                    Armadillo  ======================================================================
          Cape elephant shrew  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
               Golden hamster  ======================================================================
                          Rat  ======================================================================
              Chinese hamster  ======================================================================
               Bactrian camel  ======================================================================
                        Horse  ======================================================================
                        Panda  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
                   Guinea pig  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                     Squirrel  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
           Chinese tree shrew  ======================================================================
                 Weddell seal  ======================================================================
                          Cat  ======================================================================
                       Alpaca  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================
                          Pig  ======================================================================
                      Ferret   ======================================================================
                          Dog  ======================================================================
             White rhinoceros  ======================================================================
                     Bushbaby  ======================================================================
                     Marmoset  ======================================================================

                        Human  atgggatgtgagttgaaaagctaccttttgggtactgtggtcactaccttggtgatgagatctgtacctc
                        Chimp  atgggatgtgagttgaaaagctaccttttgggtactatggtcactaccttggtgatgagatctgtacctc
                      Gorilla  acgggatgtgagttgaaaagctaccttttgggtactgtggtcactaccttggtgatgagatctgtacctc
                    Orangutan  atgggatgtgagttgaaaagctacctttcgggtactgtggtcaccaccttggtgatgagatctgtacctc
                       Gibbon  atgggatgtgagttgcaaagctaccttttgggtactgtggtcactaccttggtgatgatatctgtacctc
                       Rhesus  atgggatgtgagttgaaaagctaccttttgggtactgtggtcactgccttggtgatgagatctgtatctc
          Crab-eating macaque  atgggatgtgagttgaaaagctaccttttgggtactgtggtcactgccttggtgatgagatctgtatctc
                       Baboon  atgggatgtgtgttgaaaagctaccttttgggtactgtggtcactgccttggtgatgagatctgtacctc
                 Green monkey  atgggatgtgagttgaaaagctaccttttgggtactgtggtcactgccttggtgatgagatctgtatctc
              Squirrel monkey  acagggtgtgagttgcaaagctacttttt--------cggtcactcacttggtgatgagatccatacctc
              Star-nosed mole  ======================================================================
                        Shrew  ======================================================================
                     Hedgehog  ======================================================================
                         Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rabbit  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                      Megabat  ======================================================================
             Black flying-fox  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
                Domestic goat  ======================================================================
               Pacific walrus  ======================================================================
                    Armadillo  ======================================================================
          Cape elephant shrew  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
               Golden hamster  ======================================================================
                          Rat  ======================================================================
              Chinese hamster  ======================================================================
               Bactrian camel  ======================================================================
                        Horse  ======================================================================
                        Panda  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
                   Guinea pig  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                     Squirrel  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
           Chinese tree shrew  ======================================================================
                 Weddell seal  ======================================================================
                          Cat  ======================================================================
                       Alpaca  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================
                          Pig  ======================================================================
                      Ferret   ======================================================================
                          Dog  ======================================================================
             White rhinoceros  ======================================================================
                     Bushbaby  ======================================================================
                     Marmoset  ======================================================================

                        Human  aaacctcagcatcacacaatatac------ccatgtaaccaacctgcacatg--------------tcaa
                        Chimp  aaacctcagcatcacacaatatac------ccatgtaaccaacctgcacatg--------------tcaa
                      Gorilla  aaacctcagcatcacaccatatac------ccatgtaacaaacctgcacatg--------------tcaa
                    Orangutan  aaacctcagcatcacacaatatac------ccatgtaacaaacctgcacatg--------------taaa
                       Gibbon  aaacctcagcatcacacagtatac------ccatgtaacaaacctgcacatg--------------taaa
                       Rhesus  aaacctcagcatcacacaatatacccatacccatgtaacaaacctgcatatg--------------taaa
          Crab-eating macaque  aaacctcagcatcacacaatatacccataaccatgtaacaaacctgcatatg--------------taaa
                       Baboon  aaacctcagcatcacacaatatacccatacccatgtaacaaacctgcatatg--------------taaa
                 Green monkey  aaacctcagcatcacacaatatacccatacccatgtaacaaacctgcatatg--------------taaa
              Squirrel monkey  aaacctcaacatcccacaatatac------ccatgtaacaaacttgcacatgtaattcccttaatctaaa
              Star-nosed mole  ======================================================================
                        Shrew  ======================================================================
                     Hedgehog  ======================================================================
                         Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rabbit  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                      Megabat  ======================================================================
             Black flying-fox  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
                Domestic goat  ======================================================================
               Pacific walrus  ======================================================================
                    Armadillo  ======================================================================
          Cape elephant shrew  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
               Golden hamster  ======================================================================
                          Rat  ======================================================================
              Chinese hamster  ======================================================================
               Bactrian camel  ======================================================================
                        Horse  ======================================================================
                        Panda  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
                   Guinea pig  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                     Squirrel  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
           Chinese tree shrew  ======================================================================
                 Weddell seal  ======================================================================
                          Cat  ======================================================================
                       Alpaca  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================
                          Pig  ======================================================================
                      Ferret   ======================================================================
                          Dog  ======================================================================
             White rhinoceros  ======================================================================
                     Bushbaby  ======================================================================
                     Marmoset  ======================================================================

                        Human  ataaaatttgaaaaaa-attaggcaccactgacttgtatttatataatttatatggat-------tcttt
                        Chimp  ataaaatttgaaaaaa-attaggcaccactgacttgtatgtatatcatttatatggat-------tcttt
                      Gorilla  ataaaatttgaaaaaa-attaggcaccactgacttgtatttatataatttatatggat-------tcttt
                    Orangutan  ataaaatttg-aaaaa-attaggcaccactgacttgtatttatataatttatatggat-------tcttt
                       Gibbon  ataaaatttgaaaaaa-attaggcaccactgacttgtatttatataatttatatggat-------tcttt
                       Rhesus  ataaaatttgaaaaaa-attaggcaccactgactcatagttatataatttatatatatatatatatattt
          Crab-eating macaque  ataaaatttgaaaaaa-attaggcaccactgactcatagttatataatttttatatatatatatatatat
                       Baboon  ataaaatttgaaaaaa-attaggcaccactgactcatatttatataatttatatatatatatatatatat
                 Green monkey  ataaaatttgaaaaaa-attaggcaccactgactcatatttatataatttatatg---------------
              Squirrel monkey  ataacatttgaaaaaatattaggcaacactgacttgtatttatataatttatatggac------------
              Star-nosed mole  ======================================================================
                        Shrew  ======================================================================
                     Hedgehog  ======================================================================
                         Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rabbit  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                      Megabat  ======================================================================
             Black flying-fox  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
                Domestic goat  ======================================================================
               Pacific walrus  ======================================================================
                    Armadillo  ======================================================================
          Cape elephant shrew  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
               Golden hamster  ======================================================================
                          Rat  ======================================================================
              Chinese hamster  ======================================================================
               Bactrian camel  ======================================================================
                        Horse  ======================================================================
                        Panda  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
                   Guinea pig  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                     Squirrel  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
           Chinese tree shrew  ======================================================================
                 Weddell seal  ======================================================================
                          Cat  ======================================================================
                       Alpaca  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================
                          Pig  ======================================================================
                      Ferret   ======================================================================
                          Dog  ======================================================================
             White rhinoceros  ======================================================================
                     Bushbaby  ======================================================================
                     Marmoset  ======================================================================

                        Human  tttttt----------------------------------------------------------------
                        Chimp  tttttt----------------------------------------------------------------
                      Gorilla  tttttt----------------------------------------------------------------
                    Orangutan  tttttt----------------------------------------------------------------
                       Gibbon  tttttt----------------------------------------------------------------
                       Rhesus  tttttt----------------------------------------------------------------
          Crab-eating macaque  atatatatatatatatatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                       Baboon  atatatatatatttt-------------------------------------------------------
                 Green monkey  gttttt----------------------------------------------------------------
              Squirrel monkey  ----ac----------------------------------------------------------------
              Star-nosed mole  ======================================================================
                        Shrew  ======================================================================
                     Hedgehog  ======================================================================
                         Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rabbit  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                      Megabat  ======================================================================
             Black flying-fox  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
                Domestic goat  ======================================================================
               Pacific walrus  ======================================================================
                    Armadillo  ======================================================================
          Cape elephant shrew  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
               Golden hamster  ======================================================================
                          Rat  ======================================================================
              Chinese hamster  ======================================================================
               Bactrian camel  ======================================================================
                        Horse  ======================================================================
                        Panda  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
                   Guinea pig  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                     Squirrel  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
           Chinese tree shrew  ======================================================================
                 Weddell seal  ======================================================================
                          Cat  ======================================================================
                       Alpaca  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================
                          Pig  ======================================================================
                      Ferret   ======================================================================
                          Dog  ======================================================================
             White rhinoceros  ======================================================================
                     Bushbaby  ======================================================================
                     Marmoset  ======================================================================

                        Human  --------------------------tttttt---gagacagggtcttgctctcttgcccagggtggagt
                        Chimp  --------------------------tttttt--tgagacagggtcttgctctcttgcccagggtggagt
                      Gorilla  --------------------------tttttttttgagacagggtcttgctctcttgcccagggtggagt
                    Orangutan  --------------------------tttttt--tgagacagggtcttgctctcttgcccagggtggagt
                       Gibbon  ----------------------------------tgagacagggtcttgctctcttgcccagggtggagt
                       Rhesus  --------------------------tttttt--tgagacagggtcttgctgtcttgcccatggtggagt
          Crab-eating macaque  nnnnnnnnnnnnnnnnnnnnnnnnnnnttttt--tgagacagggtcttgctgtcttgcccatggtggagt
                       Baboon  --------------------------tttttt--tgagacagggtcttgctgtcttgcccatggtggagt
                 Green monkey  --------------------------tttttt--tgagacagggtcttgctgtcttgcccagggtggagt
              Squirrel monkey  ----------------------------------tga------------ctttgttgcccagagtgaagt
              Star-nosed mole  ======================================================================
                        Shrew  ======================================================================
                     Hedgehog  ======================================================================
                         Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rabbit  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                      Megabat  ======================================================================
             Black flying-fox  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
                Domestic goat  ======================================================================
               Pacific walrus  ======================================================================
                    Armadillo  ======================================================================
          Cape elephant shrew  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
               Golden hamster  ======================================================================
                          Rat  ======================================================================
              Chinese hamster  ======================================================================
               Bactrian camel  ======================================================================
                        Horse  ======================================================================
                        Panda  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
                   Guinea pig  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                     Squirrel  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
           Chinese tree shrew  ======================================================================
                 Weddell seal  ======================================================================
                          Cat  ======================================================================
                       Alpaca  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================
                          Pig  ======================================================================
                      Ferret   ======================================================================
                          Dog  ======================================================================
             White rhinoceros  ======================================================================
                     Bushbaby  ======================================================================
                     Marmoset  ======================================================================

                        Human  gcagtggtgtgatcttgcctcactgcagcatcagcctcctgggttccagcgatcctccccaatcagcctt
                        Chimp  gcagtggtgtgatcttgcctcactgcagcatcagcctcctgggttccagcgatcctccccaatcagcctt
                      Gorilla  gcagtggtgtgatcttgcctcactgcagcatcagcctcctgggttccagcgatcctccccaatcagcctt
                    Orangutan  gcagtggtgtgatcttgcctcaatgcagcatcagcctcctgggttccagcgatcctccccaatcagcctt
                       Gibbon  gcagtggtgtgatcttgcctcactgcagcatcagcctcctgggttccagcgatcctccccaatcagcctt
                       Rhesus  gcagtggtgtgatcttggctcactgcagcatcagcctcctgggttccagcaatcttcccctatcagcctt
          Crab-eating macaque  gcagtggtgtgatcttggctcactgcagcatcagcctcctggtttccagcaatcttcccctatcagcctt
                       Baboon  gcagtggtgtgatcttggctcactgcagcatcagcctcctgggttccagcaatcctcccctatcagcctt
                 Green monkey  gcagtggtgtgatcttggctcactgcagcatcagcctcctgggttccagcaatcttcccctatcagcctt
              Squirrel monkey  gcagtggtgtgatcttggctcactgcagcatcaaactcctgggttccagagatccttccccaacagtctc
              Star-nosed mole  ======================================================================
                        Shrew  ======================================================================
                     Hedgehog  ======================================================================
                         Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rabbit  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                      Megabat  ======================================================================
             Black flying-fox  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
                Domestic goat  ======================================================================
               Pacific walrus  ======================================================================
                    Armadillo  ======================================================================
          Cape elephant shrew  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
               Golden hamster  ======================================================================
                          Rat  ======================================================================
              Chinese hamster  ======================================================================
               Bactrian camel  ======================================================================
                        Horse  ======================================================================
                        Panda  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
                   Guinea pig  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                     Squirrel  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
           Chinese tree shrew  ======================================================================
                 Weddell seal  ======================================================================
                          Cat  ======================================================================
                       Alpaca  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================
                          Pig  ======================================================================
                      Ferret   ======================================================================
                          Dog  ======================================================================
             White rhinoceros  ======================================================================
                     Bushbaby  ======================================================================
                     Marmoset  ======================================================================

                        Human  ccaaatagctaggacaacaggtgtgcactgccac
                        Chimp  cctaatagctaggacaacaggtgtgcactgccac
                      Gorilla  ccaaatagctaggacaacaggtgtgcactgccac
                    Orangutan  ccaaatagctaggacaacaggtgtgcactgctac
                       Gibbon  ccaaatagctaggacaacaggtgtgcaccgccac
                       Rhesus  ctgaatagctaggactatagatgtacaccaccac
          Crab-eating macaque  ctgaatagctaggactatagatgtacaccaccac
                       Baboon  ctgaatagctaggactatagatgtacaccaccac
                 Green monkey  ctgaatagctaggactatagatatacaccaccac
              Squirrel monkey  ccaaacagctaagactacaggtgtacaccaccac
              Star-nosed mole  ==================================
                        Shrew  ==================================
                     Hedgehog  ==================================
                         Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rabbit  ==================================
              Tasmanian devil  ==================================
                     Platypus  ==================================
                Big brown bat  ==================================
                     Microbat  ==================================
         David's myotis (bat)  ==================================
                      Megabat  ==================================
             Black flying-fox  ==================================
     Chinese softshell turtle  ==================================
              Green seaturtle  ==================================
           American alligator  ==================================
                      Opossum  ==================================
                 Prairie vole  ==================================
                       Tenrec  ==================================
                Domestic goat  ==================================
               Pacific walrus  ==================================
                    Armadillo  ==================================
          Cape elephant shrew  ==================================
                     Aardvark  ==================================
             Cape golden mole  ==================================
               Golden hamster  ==================================
                          Rat  ==================================
              Chinese hamster  ==================================
               Bactrian camel  ==================================
                        Horse  ==================================
                        Panda  ==================================
       Lesser Egyptian jerboa  ==================================
                        Mouse  ==================================
             Brush-tailed rat  ==================================
                   Guinea pig  ==================================
               Naked mole-rat  ==================================
                   Chinchilla  ==================================
                     Squirrel  ==================================
                      Manatee  ==================================
                     Elephant  ==================================
                        Sheep  ==================================
             Tibetan antelope  ==================================
           Chinese tree shrew  ==================================
                 Weddell seal  ==================================
                          Cat  ==================================
                       Alpaca  ==================================
                          Cow  ==================================
                 Killer whale  ==================================
                          Pig  ==================================
                      Ferret   ==================================
                          Dog  ==================================
             White rhinoceros  ==================================
                     Bushbaby  ==================================
                     Marmoset  ==================================

Alignment block 2 of 28 in window, 112243848 - 112243863, 16 bps 
B D                     Human  gcctggctaattttta
B D                     Chimp  gcctggctaattttta
B D                   Gorilla  gcctggctaattttta
B D                 Orangutan  ccctggctaattttta
B D                    Gibbon  acctggctaattttta
B D                    Rhesus  actgggctaattttca
B D       Crab-eating macaque  accgggctaattttca
B D                    Baboon  accgggctaattttca
B D              Green monkey  accgggctaattttca
B D           Squirrel monkey  acctggctaattttta
                 Prairie vole  gcctgaataatttata
B D           Chinese hamster  gcctgaataatttata
             Star-nosed mole  ================
B D                     Shrew  ================
B D                  Hedgehog  ================
B D                      Pika  NNNNNNNNNNNNNNNN
B D                    Rabbit  ================
B D           Tasmanian devil  ================
B D                  Platypus  ================
               Big brown bat  ================
B D                  Microbat  ================
        David's myotis (bat)  ================
B D                   Megabat  ================
            Black flying-fox  ================
  D  Chinese softshell turtle  ================
  D           Green seaturtle  ================
B D        American alligator  ================
B D                   Opossum  ================
B D                    Tenrec  ================
               Domestic goat  ================
              Pacific walrus  ================
B D                 Armadillo  ================
         Cape elephant shrew  ================
                    Aardvark  ================
            Cape golden mole  ================
              Golden hamster  ================
B D                       Rat  ================
              Bactrian camel  ================
B D                     Horse  ================
B D                     Panda  ================
      Lesser Egyptian jerboa  ================
B D                     Mouse  ================
            Brush-tailed rat  ================
B D                Guinea pig  ================
B D            Naked mole-rat  ================
                  Chinchilla  ================
B D                  Squirrel  ================
B D                   Manatee  ================
B D                  Elephant  ================
B D                     Sheep  ================
            Tibetan antelope  ================
          Chinese tree shrew  ================
                Weddell seal  ================
B D                       Cat  ================
B D                    Alpaca  ================
B D                       Cow  ================
                Killer whale  ================
B D                       Pig  ================
B D                   Ferret   ================
B D                       Dog  ================
B D          White rhinoceros  ================
B D                  Bushbaby  ================
B D                  Marmoset  ================

Alignment block 3 of 28 in window, 112243864 - 112243865, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  aa
B D              Green monkey  aa
B D           Squirrel monkey  aa
                 Prairie vole  ca
B D           Chinese hamster  aa
B D                       Pig  aa
             Star-nosed mole  ==
B D                     Shrew  ==
B D                  Hedgehog  ==
B D                      Pika  NN
B D                    Rabbit  ==
B D           Tasmanian devil  ==
B D                  Platypus  ==
               Big brown bat  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                   Megabat  ==
            Black flying-fox  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
B D                   Opossum  ==
B D                    Tenrec  ==
               Domestic goat  ==
              Pacific walrus  ==
B D                 Armadillo  ==
         Cape elephant shrew  ==
                    Aardvark  ==
            Cape golden mole  ==
              Golden hamster  ==
B D                       Rat  ==
              Bactrian camel  ==
B D                     Horse  ==
B D                     Panda  ==
      Lesser Egyptian jerboa  ==
B D                     Mouse  ==
            Brush-tailed rat  ==
B D                Guinea pig  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
B D                  Squirrel  ==
B D                   Manatee  ==
B D                  Elephant  ==
B D                     Sheep  ==
            Tibetan antelope  ==
          Chinese tree shrew  ==
                Weddell seal  ==
B D                       Cat  ==
B D                    Alpaca  ==
B D                       Cow  ==
                Killer whale  ==
B D                   Ferret   ==
B D                       Dog  ==
B D          White rhinoceros  ==
B D                  Bushbaby  ==
B D                  Marmoset  ==

Alignment block 4 of 28 in window, 112243866 - 112243884, 19 bps 
B D                     Human  ctttttgtagagacggggg
B D                     Chimp  ctttttgtagagacggggg
B D                   Gorilla  ctttttgtagagacggggg
B D                 Orangutan  --ttttgtagagatggggg
B D                    Gibbon  ctttttgtagagatggggg
B D                    Rhesus  ctttttgtagagatcggag
B D       Crab-eating macaque  ctttttgtagagatcggag
B D                    Baboon  ctttttgtagagatcggag
B D              Green monkey  ctttttgtagagatgggag
B D           Squirrel monkey  ctttttgtagagatggggg
                 Prairie vole  -tttttatacagt----ga
B D           Chinese hamster  --ttttatacagc----ag
B D                       Pig  cttcacatagagacgcagt
B D                  Elephant  ccttatttatagactactt
             Star-nosed mole  ===================
B D                     Shrew  ===================
B D                  Hedgehog  ===================
B D                      Pika  NNNNNNNNNNNNNNNNNNN
B D                    Rabbit  ===================
B D           Tasmanian devil  ===================
B D                  Platypus  ===================
               Big brown bat  ===================
B D                  Microbat  ===================
        David's myotis (bat)  ===================
B D                   Megabat  ===================
            Black flying-fox  ===================
  D  Chinese softshell turtle  ===================
  D           Green seaturtle  ===================
B D        American alligator  ===================
B D                   Opossum  ===================
B D                    Tenrec  ===================
               Domestic goat  ===================
              Pacific walrus  ===================
B D                 Armadillo  ===================
         Cape elephant shrew  ===================
                    Aardvark  ===================
            Cape golden mole  ===================
              Golden hamster  ===================
B D                       Rat  ===================
              Bactrian camel  ===================
B D                     Horse  ===================
B D                     Panda  ===================
      Lesser Egyptian jerboa  ===================
B D                     Mouse  ===================
            Brush-tailed rat  ===================
B D                Guinea pig  ===================
B D            Naked mole-rat  ===================
                  Chinchilla  ===================
B D                  Squirrel  ===================
B D                   Manatee  ===================
B D                     Sheep  ===================
            Tibetan antelope  ===================
          Chinese tree shrew  ===================
                Weddell seal  ===================
B D                       Cat  ===================
B D                    Alpaca  ===================
B D                       Cow  ===================
                Killer whale  ===================
B D                   Ferret   ===================
B D                       Dog  ===================
B D          White rhinoceros  ===================
B D                  Bushbaby  ===================
B D                  Marmoset  ===================

Inserts between block 4 and 5 in window
B D                 Elephant 4bp

Alignment block 5 of 28 in window, 112243885 - 112243892, 8 bps 
B D                     Human  tctcacta
B D                     Chimp  tctcacta
B D                   Gorilla  tctcacta
B D                 Orangutan  tctcacta
B D                    Gibbon  tctcacta
B D                    Rhesus  tctcacta
B D       Crab-eating macaque  tctcacta
B D                    Baboon  tctcacta
B D              Green monkey  tctcacta
B D           Squirrel monkey  tctgacta
                 Prairie vole  ttcaatta
B D           Chinese hamster  ttcaatta
B D                       Pig  ttccactt
B D                  Elephant  attaacta
                     Aardvark  tctaatta
B D                  Platypus  tttggctg
             Star-nosed mole  ========
B D                     Shrew  ========
B D                  Hedgehog  ========
B D                      Pika  NNNNNNNN
B D                    Rabbit  ========
B D           Tasmanian devil  ========
               Big brown bat  ========
B D                  Microbat  ========
        David's myotis (bat)  ========
B D                   Megabat  ========
            Black flying-fox  ========
  D  Chinese softshell turtle  ========
  D           Green seaturtle  ========
B D        American alligator  ========
B D                   Opossum  ========
B D                    Tenrec  ========
               Domestic goat  ========
              Pacific walrus  ========
B D                 Armadillo  ========
         Cape elephant shrew  ========
            Cape golden mole  ========
              Golden hamster  ========
B D                       Rat  ========
              Bactrian camel  ========
B D                     Horse  ========
B D                     Panda  ========
      Lesser Egyptian jerboa  ========
B D                     Mouse  ========
            Brush-tailed rat  ========
B D                Guinea pig  ========
B D            Naked mole-rat  ========
                  Chinchilla  ========
B D                  Squirrel  ========
B D                   Manatee  ========
B D                     Sheep  ========
            Tibetan antelope  ========
          Chinese tree shrew  ========
                Weddell seal  ========
B D                       Cat  ========
B D                    Alpaca  ========
B D                       Cow  ========
                Killer whale  ========
B D                   Ferret   ========
B D                       Dog  ========
B D          White rhinoceros  ========
B D                  Bushbaby  ========
B D                  Marmoset  ========

Inserts between block 5 and 6 in window
B D                 Elephant 1bp
                    Aardvark 1bp

Alignment block 6 of 28 in window, 112243893 - 112243893, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D           Squirrel monkey  t
                 Prairie vole  g
B D           Chinese hamster  g
B D                       Pig  c
                Big brown bat  t
B D                  Microbat  t
B D                  Platypus  t
             Star-nosed mole  =
B D                     Shrew  =
B D                  Hedgehog  =
B D                      Pika  N
B D                    Rabbit  =
B D           Tasmanian devil  =
        David's myotis (bat)  =
B D                   Megabat  =
            Black flying-fox  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                   Opossum  =
B D                    Tenrec  =
               Domestic goat  =
              Pacific walrus  =
B D                 Armadillo  =
         Cape elephant shrew  =
                    Aardvark  =
            Cape golden mole  =
              Golden hamster  =
B D                       Rat  =
              Bactrian camel  =
B D                     Horse  =
B D                     Panda  =
      Lesser Egyptian jerboa  =
B D                     Mouse  =
            Brush-tailed rat  =
B D                Guinea pig  =
B D            Naked mole-rat  =
                  Chinchilla  =
B D                  Squirrel  =
B D                   Manatee  =
B D                  Elephant  =
B D                     Sheep  =
            Tibetan antelope  =
          Chinese tree shrew  =
                Weddell seal  =
B D                       Cat  =
B D                    Alpaca  =
B D                       Cow  =
                Killer whale  =
B D                   Ferret   =
B D                       Dog  =
B D          White rhinoceros  =
B D                  Bushbaby  =
B D                  Marmoset  =

Inserts between block 6 and 7 in window
B D                      Pig 7bp

Alignment block 7 of 28 in window, 112243894 - 112243894, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D           Squirrel monkey  g
                 Prairie vole  a
B D           Chinese hamster  a
B D                       Pig  g
B D          White rhinoceros  g
                Big brown bat  g
B D                  Microbat  g
B D                  Elephant  g
                     Aardvark  g
B D                  Platypus  g
             Star-nosed mole  =
B D                     Shrew  =
B D                  Hedgehog  =
B D                      Pika  N
B D                    Rabbit  =
B D           Tasmanian devil  =
        David's myotis (bat)  =
B D                   Megabat  =
            Black flying-fox  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                   Opossum  =
B D                    Tenrec  =
               Domestic goat  =
              Pacific walrus  =
B D                 Armadillo  =
         Cape elephant shrew  =
            Cape golden mole  =
              Golden hamster  =
B D                       Rat  =
              Bactrian camel  =
B D                     Horse  =
B D                     Panda  =
      Lesser Egyptian jerboa  =
B D                     Mouse  =
            Brush-tailed rat  =
B D                Guinea pig  =
B D            Naked mole-rat  =
                  Chinchilla  =
B D                  Squirrel  =
B D                   Manatee  =
B D                     Sheep  =
            Tibetan antelope  =
          Chinese tree shrew  =
                Weddell seal  =
B D                       Cat  =
B D                    Alpaca  =
B D                       Cow  =
                Killer whale  =
B D                   Ferret   =
B D                       Dog  =
B D                  Bushbaby  =
B D                  Marmoset  =

Inserts between block 7 and 8 in window
                Prairie vole 6bp
B D          Chinese hamster 6bp

Alignment block 8 of 28 in window, 112243895 - 112243895, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D           Squirrel monkey  t
B D                       Pig  t
B D          White rhinoceros  t
                Big brown bat  t
B D                  Microbat  t
B D                  Elephant  c
                     Aardvark  c
B D                  Platypus  t
             Star-nosed mole  =
B D                     Shrew  =
B D                  Hedgehog  =
B D                      Pika  N
B D                    Rabbit  =
B D           Tasmanian devil  =
        David's myotis (bat)  =
B D                   Megabat  =
            Black flying-fox  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                   Opossum  =
                Prairie vole  =
B D                    Tenrec  =
               Domestic goat  =
              Pacific walrus  =
B D                 Armadillo  =
         Cape elephant shrew  =
            Cape golden mole  =
              Golden hamster  =
B D                       Rat  =
B D           Chinese hamster  =
              Bactrian camel  =
B D                     Horse  =
B D                     Panda  =
      Lesser Egyptian jerboa  =
B D                     Mouse  =
            Brush-tailed rat  =
B D                Guinea pig  =
B D            Naked mole-rat  =
                  Chinchilla  =
B D                  Squirrel  =
B D                   Manatee  =
B D                     Sheep  =
            Tibetan antelope  =
          Chinese tree shrew  =
                Weddell seal  =
B D                       Cat  =
B D                    Alpaca  =
B D                       Cow  =
                Killer whale  =
B D                   Ferret   =
B D                       Dog  =
B D                  Bushbaby  =
B D                  Marmoset  =

Inserts between block 8 and 9 in window
B D                      Pig 5bp
B D         White rhinoceros 5bp
               Big brown bat 5bp
B D                 Microbat 5bp
B D                 Elephant 5bp
                    Aardvark 5bp

Alignment block 9 of 28 in window, 112243896 - 112243904, 9 bps 
B D                     Human  -----tgcctaggc
B D                     Chimp  -----tgcctaggc
B D                   Gorilla  -----tgcctaggc
B D                 Orangutan  -----tgcctaggc
B D                    Gibbon  -----tgcctaggc
B D                    Rhesus  -----tgct-----
B D       Crab-eating macaque  -----tgct-----
B D                    Baboon  -----tgct-----
B D              Green monkey  -----tgcc-----
B D           Squirrel monkey  -----tgcctagga
B D                  Squirrel  -----tgat-----
       Lesser Egyptian jerboa  -----tgac-----
                 Prairie vole  -----tgac-----
B D           Chinese hamster  -----cgac-----
B D                       Pig  -----tgta-----
B D          White rhinoceros  -----tgta-----
                Big brown bat  -----tgca-----
B D                  Microbat  -----tgca-----
B D                  Elephant  -----tgac-----
                     Aardvark  -----tgac-----
B D                  Platypus  tgctctgtc-----
             Star-nosed mole  ==============
B D                     Shrew  ==============
B D                  Hedgehog  ==============
B D                      Pika  NNNNNNNNNNNNNN
B D                    Rabbit  ==============
B D           Tasmanian devil  ==============
        David's myotis (bat)  ==============
B D                   Megabat  ==============
            Black flying-fox  ==============
  D  Chinese softshell turtle  ==============
  D           Green seaturtle  ==============
B D        American alligator  ==============
B D                   Opossum  ==============
B D                    Tenrec  ==============
               Domestic goat  ==============
              Pacific walrus  ==============
B D                 Armadillo  ==============
         Cape elephant shrew  ==============
            Cape golden mole  ==============
              Golden hamster  ==============
B D                       Rat  ==============
              Bactrian camel  ==============
B D                     Horse  ==============
B D                     Panda  ==============
B D                     Mouse  ==============
            Brush-tailed rat  ==============
B D                Guinea pig  ==============
B D            Naked mole-rat  ==============
                  Chinchilla  ==============
B D                   Manatee  ==============
B D                     Sheep  ==============
            Tibetan antelope  ==============
          Chinese tree shrew  ==============
                Weddell seal  ==============
B D                       Cat  ==============
B D                    Alpaca  ==============
B D                       Cow  ==============
                Killer whale  ==============
B D                   Ferret   ==============
B D                       Dog  ==============
B D                  Bushbaby  ==============
B D                  Marmoset  ==============

Inserts between block 9 and 10 in window
B D                 Squirrel 6bp
      Lesser Egyptian jerboa 7bp
                Prairie vole 7bp
B D          Chinese hamster 7bp
B D                      Pig 1bp
B D         White rhinoceros 1bp
               Big brown bat 1bp
B D                 Microbat 1bp
B D                 Elephant 6bp
                    Aardvark 1bp

Alignment block 10 of 28 in window, 112243905 - 112243906, 2 bps 
B D                     Human  ---------tg
B D                     Chimp  ---------tg
B D                   Gorilla  ---------tg
B D                 Orangutan  ---------tg
B D                    Gibbon  ---------tg
B D           Squirrel monkey  ---------tg
B D                  Bushbaby  ---------tg
B D                  Squirrel  ---------t-
B D                       Pig  ---------t-
B D          White rhinoceros  ---------t-
                Big brown bat  ---------t-
B D                  Microbat  ---------t-
B D                  Elephant  ---------t-
             Cape golden mole  ---------t-
                     Aardvark  ---------t-
B D                  Platypus  ctcatttag--
             Star-nosed mole  ===========
B D                     Shrew  ===========
B D                  Hedgehog  ===========
B D                      Pika  NNNNNNNNNNN
B D                    Rabbit  ===========
B D           Tasmanian devil  ===========
        David's myotis (bat)  ===========
B D                   Megabat  ===========
            Black flying-fox  ===========
  D  Chinese softshell turtle  ===========
  D           Green seaturtle  ===========
B D        American alligator  ===========
B D                   Opossum  ===========
                Prairie vole  ===========
B D                    Tenrec  ===========
               Domestic goat  ===========
              Pacific walrus  ===========
B D                    Baboon  -----------
B D                 Armadillo  ===========
         Cape elephant shrew  ===========
              Golden hamster  ===========
B D                       Rat  ===========
B D           Chinese hamster  ===========
              Bactrian camel  ===========
B D                     Horse  ===========
B D                     Panda  ===========
      Lesser Egyptian jerboa  ===========
B D                     Mouse  ===========
            Brush-tailed rat  ===========
B D                Guinea pig  ===========
B D            Naked mole-rat  ===========
                  Chinchilla  ===========
B D                   Manatee  ===========
B D                     Sheep  ===========
            Tibetan antelope  ===========
          Chinese tree shrew  ===========
                Weddell seal  ===========
B D                       Cat  ===========
B D                    Alpaca  ===========
B D                       Cow  ===========
                Killer whale  ===========
B D                   Ferret   ===========
B D                       Dog  ===========
B D                  Marmoset  ===========
B D              Green monkey  -----------
B D       Crab-eating macaque  -----------
B D                    Rhesus  -----------

Inserts between block 10 and 11 in window
            Cape golden mole 1bp
                    Aardvark 5bp

Alignment block 11 of 28 in window, 112243907 - 112243908, 2 bps 
B D                     Human  ta
B D                     Chimp  ta
B D                   Gorilla  ta
B D                 Orangutan  ta
B D                    Gibbon  ta
B D           Squirrel monkey  ta
B D                  Bushbaby  ta
           Chinese tree shrew  ta
B D                       Pig  ta
               Bactrian camel  ta
                 Killer whale  ta
             Tibetan antelope  ta
B D                       Cow  ta
B D                     Sheep  ta
                Domestic goat  ta
B D          White rhinoceros  ta
B D                       Dog  ta
B D                   Ferret   ta
B D                     Panda  ta
               Pacific walrus  ta
                 Weddell seal  ta
                Big brown bat  ta
B D                  Microbat  ta
B D                  Elephant  ta
B D                   Manatee  ta
             Cape golden mole  ta
                     Aardvark  tg
B D                  Platypus  ca
             Star-nosed mole  ==
B D                     Shrew  ==
B D                  Hedgehog  ==
B D                      Pika  NN
B D                    Rabbit  ==
B D           Tasmanian devil  ==
        David's myotis (bat)  ==
B D                   Megabat  ==
            Black flying-fox  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
B D                   Opossum  ==
                Prairie vole  ==
B D                    Tenrec  ==
B D                    Baboon  --
B D                 Armadillo  ==
         Cape elephant shrew  ==
              Golden hamster  ==
B D                       Rat  ==
B D           Chinese hamster  ==
B D                     Horse  ==
      Lesser Egyptian jerboa  ==
B D                     Mouse  ==
            Brush-tailed rat  ==
B D                Guinea pig  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
B D                  Squirrel  --
B D                       Cat  ==
B D                    Alpaca  ==
B D                  Marmoset  ==
B D              Green monkey  --
B D       Crab-eating macaque  --
B D                    Rhesus  --

Alignment block 12 of 28 in window, 112243909 - 112243910, 2 bps 
B D                     Human  ta
B D                     Chimp  ta
B D                   Gorilla  ta
B D                 Orangutan  ta
B D                    Gibbon  ta
B D                    Rhesus  ta
B D       Crab-eating macaque  ta
B D                    Baboon  ta
B D              Green monkey  ta
B D           Squirrel monkey  ta
B D                  Bushbaby  ta
           Chinese tree shrew  ta
B D                  Squirrel  ta
       Lesser Egyptian jerboa  ta
                 Prairie vole  ta
B D           Chinese hamster  ta
               Golden hamster  ta
B D                     Mouse  ta
B D                       Rat  ta
B D                       Pig  ta
               Bactrian camel  ta
                 Killer whale  ta
             Tibetan antelope  ta
B D                       Cow  ta
B D                     Sheep  ta
                Domestic goat  ta
B D          White rhinoceros  ta
B D                       Dog  tg
B D                   Ferret   tg
B D                     Panda  tg
               Pacific walrus  tg
                 Weddell seal  tg
                Big brown bat  ta
B D                  Microbat  ta
              Star-nosed mole  ta
B D                  Elephant  ca
B D                   Manatee  ta
             Cape golden mole  ta
                     Aardvark  ta
B D                  Platypus  tg
B D                     Shrew  ==
B D                  Hedgehog  ==
B D                      Pika  NN
B D                    Rabbit  ==
B D           Tasmanian devil  ==
        David's myotis (bat)  ==
B D                   Megabat  ==
            Black flying-fox  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
B D                   Opossum  ==
B D                    Tenrec  ==
B D                 Armadillo  ==
         Cape elephant shrew  ==
B D                     Horse  ==
            Brush-tailed rat  ==
B D                Guinea pig  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
B D                       Cat  ==
B D                    Alpaca  ==
B D                  Marmoset  ==

Inserts between block 12 and 13 in window
B D                 Squirrel 2bp
      Lesser Egyptian jerboa 2bp
                Prairie vole 2bp
B D          Chinese hamster 2bp
              Golden hamster 2bp
B D                    Mouse 2bp
B D                      Rat 2bp

Alignment block 13 of 28 in window, 112243911 - 112243913, 3 bps 
B D                     Human  tgg
B D                     Chimp  tgg
B D                   Gorilla  tgg
B D                 Orangutan  tgg
B D                    Gibbon  tgg
B D                    Rhesus  tgg
B D       Crab-eating macaque  tgg
B D                    Baboon  tgg
B D              Green monkey  tgg
B D           Squirrel monkey  tgg
B D                  Bushbaby  tgg
           Chinese tree shrew  tgg
B D                  Squirrel  tgg
       Lesser Egyptian jerboa  tgg
                 Prairie vole  tgg
B D           Chinese hamster  tgg
               Golden hamster  tgg
B D                     Mouse  tgg
B D                       Rat  tgg
                   Chinchilla  taa
B D                       Pig  tgg
B D                    Alpaca  tgg
               Bactrian camel  tgg
                 Killer whale  tgg
             Tibetan antelope  tgg
B D                       Cow  tgg
B D                     Sheep  tgg
                Domestic goat  tgg
B D          White rhinoceros  tgg
B D                       Dog  cag
B D                   Ferret   tgg
B D                     Panda  tgg
               Pacific walrus  cgg
                 Weddell seal  cgg
                Big brown bat  tag
B D                  Microbat  tag
              Star-nosed mole  tga
B D                  Elephant  tgg
B D                   Manatee  tgg
             Cape golden mole  tgg
                     Aardvark  tgg
B D                  Platypus  tgt
B D                     Shrew  ===
B D                  Hedgehog  ===
B D                      Pika  NNN
B D                    Rabbit  ===
B D           Tasmanian devil  ===
        David's myotis (bat)  ===
B D                   Megabat  ===
            Black flying-fox  ===
  D  Chinese softshell turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
B D                   Opossum  ===
B D                    Tenrec  ===
B D                 Armadillo  ===
         Cape elephant shrew  ===
B D                     Horse  ===
            Brush-tailed rat  ===
B D                Guinea pig  ===
B D            Naked mole-rat  ===
B D                       Cat  ===
B D                  Marmoset  ===

Inserts between block 13 and 14 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D         White rhinoceros 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
               Big brown bat 1bp
B D                 Microbat 1bp
             Star-nosed mole 1bp
B D                 Elephant 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp

Alignment block 14 of 28 in window, 112243914 - 112243914, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                 Orangutan  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D           Squirrel monkey  -a
B D                  Bushbaby  -a
           Chinese tree shrew  -c
B D                  Squirrel  -a
       Lesser Egyptian jerboa  -g
                 Prairie vole  -a
B D           Chinese hamster  -a
               Golden hamster  -a
B D                     Mouse  -a
B D                       Rat  -a
B D            Naked mole-rat  -a
                   Chinchilla  -a
B D                 Armadillo  -a
B D                  Platypus  c-
             Star-nosed mole  ==
B D                     Shrew  ==
B D                  Hedgehog  ==
B D                      Pika  NN
B D                    Rabbit  ==
B D           Tasmanian devil  ==
               Big brown bat  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                   Megabat  ==
            Black flying-fox  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
B D                   Opossum  ==
B D                    Tenrec  ==
               Domestic goat  ==
              Pacific walrus  ==
         Cape elephant shrew  ==
                    Aardvark  ==
            Cape golden mole  ==
              Bactrian camel  ==
B D                     Horse  ==
B D                     Panda  ==
            Brush-tailed rat  ==
B D                Guinea pig  ==
B D                   Manatee  ==
B D                  Elephant  ==
B D                     Sheep  ==
            Tibetan antelope  ==
                Weddell seal  ==
B D                       Cat  ==
B D                    Alpaca  ==
B D                       Cow  ==
                Killer whale  ==
B D                       Pig  ==
B D                   Ferret   ==
B D                       Dog  ==
B D          White rhinoceros  ==
B D                  Marmoset  ==

Alignment block 15 of 28 in window, 112243915 - 112243915, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                   Gorilla  -t
B D                    Gibbon  -t
B D                    Rhesus  -t
B D       Crab-eating macaque  -t
B D                    Baboon  -t
B D              Green monkey  -t
B D           Squirrel monkey  -t
B D                  Bushbaby  -t
           Chinese tree shrew  -t
B D                  Squirrel  -c
       Lesser Egyptian jerboa  -t
                 Prairie vole  -t
B D           Chinese hamster  -t
               Golden hamster  -t
B D                     Mouse  -t
B D                       Rat  -t
B D            Naked mole-rat  -t
                   Chinchilla  -t
B D                    Rabbit  -t
B D                       Pig  -t
B D                    Alpaca  -t
               Bactrian camel  -t
                 Killer whale  -t
             Tibetan antelope  -t
B D                       Cow  -t
B D                     Sheep  -t
                Domestic goat  -t
B D                     Horse  -t
B D          White rhinoceros  -t
B D                       Dog  -t
B D                   Ferret   -t
B D                     Panda  -t
               Pacific walrus  -t
                 Weddell seal  -t
                Big brown bat  -t
B D                  Microbat  -t
              Star-nosed mole  -t
B D                 Armadillo  -t
B D                  Platypus  a-
B D                     Shrew  ==
B D                  Hedgehog  ==
B D                      Pika  NN
B D           Tasmanian devil  ==
        David's myotis (bat)  ==
B D                   Megabat  ==
            Black flying-fox  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
B D                   Opossum  ==
B D                    Tenrec  ==
         Cape elephant shrew  ==
                    Aardvark  ==
            Cape golden mole  ==
            Brush-tailed rat  ==
B D                Guinea pig  ==
B D                   Manatee  ==
B D                  Elephant  ==
B D                       Cat  ==
B D                  Marmoset  ==
B D                 Orangutan  --

Alignment block 16 of 28 in window, 112243916 - 112243917, 2 bps 
B D                     Human  tc
B D                     Chimp  tc
B D                   Gorilla  tc
B D                    Gibbon  tc
B D                    Rhesus  tc
B D       Crab-eating macaque  tc
B D                    Baboon  tc
B D              Green monkey  tc
B D           Squirrel monkey  tc
B D                  Bushbaby  tc
           Chinese tree shrew  tc
B D                  Squirrel  tt
       Lesser Egyptian jerboa  tc
                 Prairie vole  at
B D           Chinese hamster  at
               Golden hamster  at
B D                     Mouse  at
B D                       Rat  at
B D            Naked mole-rat  tt
                   Chinchilla  tt
B D                    Rabbit  tt
B D                       Pig  tc
B D                    Alpaca  tc
               Bactrian camel  tc
                 Killer whale  tc
             Tibetan antelope  tc
B D                       Cow  tc
B D                     Sheep  tc
                Domestic goat  tc
B D                     Horse  tc
B D          White rhinoceros  tc
B D                       Dog  gc
B D                   Ferret   tc
B D                     Panda  tc
               Pacific walrus  tc
                 Weddell seal  tc
                Big brown bat  tc
B D                  Microbat  tc
B D                  Hedgehog  tt
              Star-nosed mole  tc
B D                 Armadillo  -t
B D                  Platypus  tc
B D                     Shrew  ==
B D                      Pika  NN
B D           Tasmanian devil  ==
        David's myotis (bat)  ==
B D                   Megabat  ==
            Black flying-fox  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
B D                   Opossum  ==
B D                    Tenrec  ==
         Cape elephant shrew  ==
                    Aardvark  ==
            Cape golden mole  ==
            Brush-tailed rat  ==
B D                Guinea pig  ==
B D                   Manatee  ==
B D                  Elephant  ==
B D                       Cat  ==
B D                  Marmoset  ==
B D                 Orangutan  --

Inserts between block 16 and 17 in window
B D                Armadillo 2bp

Alignment block 17 of 28 in window, 112243918 - 112243919, 2 bps 
B D                     Human  tt-
B D                     Chimp  tt-
B D                   Gorilla  tt-
B D                 Orangutan  -t-
B D                    Gibbon  tt-
B D                    Rhesus  tt-
B D       Crab-eating macaque  tt-
B D                    Baboon  tt-
B D              Green monkey  tt-
B D           Squirrel monkey  tt-
B D                  Bushbaby  tt-
           Chinese tree shrew  tt-
B D                       Pig  tt-
B D                    Alpaca  tt-
               Bactrian camel  tt-
                 Killer whale  tg-
             Tibetan antelope  ct-
B D                       Cow  ct-
B D                     Sheep  ct-
                Domestic goat  ct-
B D                     Horse  tt-
B D          White rhinoceros  tt-
B D                       Dog  tt-
B D                   Ferret   tt-
B D                     Panda  tt-
               Pacific walrus  tt-
                 Weddell seal  tt-
                Big brown bat  tt-
B D                  Microbat  tt-
B D                  Hedgehog  tt-
B D                     Shrew  tt-
              Star-nosed mole  tt-
B D                  Elephant  t--
B D                   Manatee  t--
             Cape golden mole  t--
                     Aardvark  t--
B D                 Armadillo  t--
B D                  Platypus  -tg
B D                      Pika  NNN
B D                    Rabbit  ---
B D           Tasmanian devil  ===
        David's myotis (bat)  ===
B D                   Megabat  ===
            Black flying-fox  ===
  D  Chinese softshell turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
B D                   Opossum  ===
                Prairie vole  ---
B D                    Tenrec  ===
         Cape elephant shrew  ===
              Golden hamster  ---
B D                       Rat  ---
B D           Chinese hamster  ---
      Lesser Egyptian jerboa  ---
B D                     Mouse  ---
            Brush-tailed rat  ===
B D                Guinea pig  ===
B D            Naked mole-rat  ---
                  Chinchilla  ---
B D                  Squirrel  ---
B D                       Cat  ===
B D                  Marmoset  ===

Alignment block 18 of 28 in window, 112243920 - 112243924, 5 bps 
B D                     Human  tc----ttt
B D                     Chimp  tc----ttt
B D                   Gorilla  tc----ttt
B D                 Orangutan  tc----ttt
B D                    Gibbon  tc----ttt
B D                    Rhesus  tc----ttt
B D       Crab-eating macaque  tc----ttt
B D                    Baboon  tc----ttt
B D              Green monkey  tc----ttt
B D           Squirrel monkey  tc----ttt
B D                  Bushbaby  tc------c
           Chinese tree shrew  cc----ttc
B D                  Squirrel  ------ttt
       Lesser Egyptian jerboa  ------ttt
                 Prairie vole  ------ttt
B D           Chinese hamster  ------ttt
               Golden hamster  ------ttt
B D                     Mouse  ------ttt
B D                       Rat  ------ttt
B D            Naked mole-rat  -----cctc
B D                Guinea pig  tt--tctgt
                   Chinchilla  ----cctct
             Brush-tailed rat  tttcttttt
B D                    Rabbit  --ttttttt
B D                       Pig  tc----ttc
B D                    Alpaca  tc----ttc
               Bactrian camel  tc----ttc
                 Killer whale  tc----ttc
             Tibetan antelope  tc----ttc
B D                       Cow  tc----ttc
B D                     Sheep  tt----ttc
                Domestic goat  tt----ttc
B D                     Horse  tc----ttc
B D          White rhinoceros  ta----ttc
B D                       Dog  tc----ttc
B D                   Ferret   tc----ctc
B D                     Panda  tc----ctc
               Pacific walrus  tc----ctc
                 Weddell seal  tc----ctc
             Black flying-fox  tc----tta
B D                   Megabat  tc----tta
                Big brown bat  tt----ttc
B D                  Microbat  tc----ttc
B D                  Hedgehog  tc----ttt
B D                     Shrew  tc----ttc
              Star-nosed mole  tc----ttc
B D                  Elephant  tc----ttc
B D                   Manatee  tc----ttc
             Cape golden mole  tc----ttc
                     Aardvark  ta----ttc
B D                 Armadillo  tc----atc
B D                  Platypus  ----ggttc
B D                      Pika  NNNNNNNNN
B D           Tasmanian devil  =========
        David's myotis (bat)  =========
  D  Chinese softshell turtle  =========
  D           Green seaturtle  =========
B D        American alligator  =========
B D                   Opossum  =========
B D                    Tenrec  =========
         Cape elephant shrew  =========
B D                       Cat  =========
B D                  Marmoset  =========

Alignment block 19 of 28 in window, 112243925 - 112243929, 5 bps 
B D                     Human  attat
B D                     Chimp  attat
B D                   Gorilla  attat
B D                 Orangutan  attat
B D                    Gibbon  attat
B D                    Rhesus  attat
B D       Crab-eating macaque  attat
B D                    Baboon  attat
B D              Green monkey  attat
B D           Squirrel monkey  attaa
B D                  Bushbaby  attat
           Chinese tree shrew  attat
B D                  Squirrel  attgt
       Lesser Egyptian jerboa  catat
                 Prairie vole  cttat
B D           Chinese hamster  ctttt
               Golden hamster  ctttt
B D                     Mouse  cttat
B D                       Rat  cttat
B D            Naked mole-rat  tttat
B D                Guinea pig  ctaat
                   Chinchilla  tcaat
             Brush-tailed rat  taaat
B D                    Rabbit  tgtac
B D                       Pig  attat
B D                    Alpaca  attat
               Bactrian camel  attat
                 Killer whale  attat
             Tibetan antelope  attat
B D                       Cow  attat
B D                     Sheep  attat
                Domestic goat  attat
B D                     Horse  attat
B D          White rhinoceros  aatat
B D                       Dog  atcat
B D                   Ferret   attaa
B D                     Panda  attat
               Pacific walrus  attat
                 Weddell seal  cttat
             Black flying-fox  atttt
B D                   Megabat  atttt
                Big brown bat  atttt
         David's myotis (bat)  atttt
B D                  Microbat  atttt
B D                  Hedgehog  attgt
B D                     Shrew  atcgt
              Star-nosed mole  actgt
B D                  Elephant  attat
B D                   Manatee  attat
             Cape golden mole  attat
                     Aardvark  atcat
B D                 Armadillo  attat
B D                  Platypus  accgt
B D                      Pika  NNNNN
B D           Tasmanian devil  =====
  D  Chinese softshell turtle  =====
  D           Green seaturtle  =====
B D        American alligator  =====
B D                   Opossum  =====
B D                    Tenrec  =====
         Cape elephant shrew  =====
B D                       Cat  =====
B D                  Marmoset  =====

Alignment block 20 of 28 in window, 112243930 - 112243932, 3 bps 
B D                     Human  --tag
B D                     Chimp  --tag
B D                   Gorilla  --tag
B D                 Orangutan  --tag
B D                    Gibbon  --tag
B D                    Rhesus  --tat
B D       Crab-eating macaque  --tat
B D                    Baboon  --tat
B D              Green monkey  --tat
B D           Squirrel monkey  --tag
B D                  Bushbaby  --tat
           Chinese tree shrew  --tac
B D                  Squirrel  --tag
       Lesser Egyptian jerboa  --gag
                 Prairie vole  --tag
B D           Chinese hamster  --tag
               Golden hamster  --cag
B D                     Mouse  --cag
B D                       Rat  --cag
B D            Naked mole-rat  --taa
B D                Guinea pig  --taa
                   Chinchilla  --taa
             Brush-tailed rat  --taa
B D                    Rabbit  --tag
B D                       Pig  --tag
B D                    Alpaca  --tag
               Bactrian camel  --tag
                 Killer whale  --taa
             Tibetan antelope  --tag
B D                       Cow  --tag
B D                     Sheep  --tag
                Domestic goat  --tag
B D                     Horse  --tag
B D          White rhinoceros  --gag
B D                       Dog  --tag
B D                   Ferret   --tag
B D                     Panda  --tag
               Pacific walrus  --tag
                 Weddell seal  --tag
             Black flying-fox  --tag
B D                   Megabat  --tag
                Big brown bat  --tac
         David's myotis (bat)  --tac
B D                  Microbat  --tac
B D                  Hedgehog  --t-a
B D                     Shrew  --tga
              Star-nosed mole  --tag
B D                  Elephant  --ctg
B D                   Manatee  --tag
             Cape golden mole  --tag
                     Aardvark  --tag
B D                 Armadillo  --tag
B D                   Wallaby  --tac
B D                  Platypus  gat--
B D                      Pika  NNNNN
B D           Tasmanian devil  =====
  D  Chinese softshell turtle  =====
  D           Green seaturtle  =====
B D        American alligator  =====
B D                   Opossum  =====
B D                    Tenrec  =====
         Cape elephant shrew  =====
B D                       Cat  =====
B D                  Marmoset  =====

Inserts between block 20 and 21 in window
B D                  Wallaby 3bp

Alignment block 21 of 28 in window, 112243933 - 112243936, 4 bps 
B D                     Human  cact
B D                     Chimp  cact
B D                   Gorilla  cact
B D                 Orangutan  cact
B D                    Gibbon  cact
B D                    Rhesus  cact
B D       Crab-eating macaque  cact
B D                    Baboon  cact
B D              Green monkey  cact
B D           Squirrel monkey  cact
B D                  Bushbaby  tact
           Chinese tree shrew  cact
B D                  Squirrel  cata
       Lesser Egyptian jerboa  gaca
                 Prairie vole  cgc-
B D           Chinese hamster  tgc-
               Golden hamster  tgt-
B D                     Mouse  cgc-
B D                       Rat  tgc-
B D            Naked mole-rat  ta--
B D                Guinea pig  aa--
                   Chinchilla  aa--
             Brush-tailed rat  aa--
B D                    Rabbit  cact
B D                       Pig  caag
B D                    Alpaca  caat
               Bactrian camel  caat
                 Killer whale  caat
             Tibetan antelope  caat
B D                       Cow  caat
B D                     Sheep  caat
                Domestic goat  caat
B D                     Horse  caat
B D          White rhinoceros  caat
B D                       Dog  taat
B D                   Ferret   caat
B D                     Panda  caat
               Pacific walrus  caat
                 Weddell seal  caat
             Black flying-fox  caat
B D                   Megabat  caat
                Big brown bat  caat
         David's myotis (bat)  caat
B D                  Microbat  caat
B D                  Hedgehog  caac
B D                     Shrew  caaa
              Star-nosed mole  caat
B D                  Elephant  tgct
B D                   Manatee  tact
             Cape golden mole  tact
                     Aardvark  tatt
B D                 Armadillo  tatt
B D           Tasmanian devil  ctct
B D                   Wallaby  ccct
B D                  Platypus  cagt
B D                      Pika  NNNN
  D  Chinese softshell turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
B D                   Opossum  ====
B D                    Tenrec  ====
         Cape elephant shrew  ====
B D                       Cat  ====
B D                  Marmoset  ====

Inserts between block 21 and 22 in window
B D                 Squirrel 2bp
B D          Tasmanian devil 1bp
B D                  Wallaby 1bp

Alignment block 22 of 28 in window, 112243937 - 112243938, 2 bps 
B D                     Human  -tc
B D                     Chimp  -tc
B D                   Gorilla  -tc
B D                 Orangutan  -tc
B D                    Gibbon  -tc
B D                    Rhesus  -tt
B D       Crab-eating macaque  -tt
B D                    Baboon  -tt
B D              Green monkey  -tt
B D           Squirrel monkey  -tc
B D                  Bushbaby  -ac
           Chinese tree shrew  -tc
B D                  Squirrel  -tc
       Lesser Egyptian jerboa  -tt
                 Prairie vole  -tt
B D           Chinese hamster  -tt
               Golden hamster  -tt
B D                     Mouse  -tt
B D                       Rat  -tt
B D            Naked mole-rat  -cg
B D                Guinea pig  -cc
                   Chinchilla  -cc
             Brush-tailed rat  -tt
B D                    Rabbit  -tc
B D                       Pig  -tc
B D                    Alpaca  -tc
               Bactrian camel  -tc
                 Killer whale  -tc
             Tibetan antelope  -tc
B D                       Cow  -tc
B D                     Sheep  -tc
                Domestic goat  -tc
B D                     Horse  -tc
B D          White rhinoceros  -tc
B D                       Dog  -tc
B D                   Ferret   -tc
B D                     Panda  -tc
               Pacific walrus  -tc
                 Weddell seal  -tc
             Black flying-fox  -g-
B D                   Megabat  -g-
                Big brown bat  -tc
         David's myotis (bat)  -tc
B D                  Microbat  -tc
B D                  Hedgehog  -ta
B D                     Shrew  -gc
              Star-nosed mole  -tc
B D                  Elephant  -tc
B D                   Manatee  -tc
             Cape golden mole  -tc
                     Aardvark  -tc
B D                 Armadillo  -tc
B D                   Opossum  -t-
B D           Tasmanian devil  -t-
B D                   Wallaby  -t-
B D                  Platypus  ac-
B D                      Pika  NNN
  D  Chinese softshell turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
B D                    Tenrec  ===
         Cape elephant shrew  ===
B D                       Cat  ===
B D                  Marmoset  ===

Alignment block 23 of 28 in window, 112243939 - 112243945, 7 bps 
B D                     Human  tttacca
B D                     Chimp  tttacca
B D                   Gorilla  tttacca
B D                 Orangutan  tttacca
B D                    Gibbon  tttacca
B D                    Rhesus  ttgacca
B D       Crab-eating macaque  ttgacca
B D                    Baboon  ttgacca
B D              Green monkey  ttgacca
B D           Squirrel monkey  tttacca
B D                  Bushbaby  tttagca
           Chinese tree shrew  tatggca
B D                  Squirrel  attagca
       Lesser Egyptian jerboa  tttggca
                 Prairie vole  ctaatga
B D           Chinese hamster  cttagag
               Golden hamster  cctagag
B D                     Mouse  tttagag
B D                       Rat  cttagag
B D            Naked mole-rat  attgaca
B D                Guinea pig  actgaca
                   Chinchilla  attgata
             Brush-tailed rat  gttgata
B D                    Rabbit  attagca
B D                       Pig  tttagca
B D                    Alpaca  tttagca
               Bactrian camel  tttagca
                 Killer whale  tttagca
             Tibetan antelope  tttagta
B D                       Cow  tttagta
B D                     Sheep  tttagta
                Domestic goat  tttagta
B D                     Horse  tttagta
B D          White rhinoceros  tttagca
B D                       Dog  tttggca
B D                   Ferret   tttagca
B D                     Panda  tttagca
               Pacific walrus  tttagca
                 Weddell seal  tttagca
             Black flying-fox  tttagca
B D                   Megabat  tttagca
                Big brown bat  tttagca
         David's myotis (bat)  tttagca
B D                  Microbat  tttagca
B D                  Hedgehog  cttagca
B D                     Shrew  ttaaatt
              Star-nosed mole  ttcagca
B D                  Elephant  ttaagta
          Cape elephant shrew  tttagta
B D                   Manatee  ttaagca
             Cape golden mole  tttagtg
                     Aardvark  tttagca
B D                 Armadillo  tttagcc
B D                   Opossum  tcttata
B D           Tasmanian devil  tcttaga
B D                   Wallaby  tcttaga
B D                  Platypus  ttaggtt
B D                      Pika  NNNNNNN
  D  Chinese softshell turtle  =======
  D           Green seaturtle  =======
B D        American alligator  =======
B D                    Tenrec  =======
B D                       Cat  =======
B D                  Marmoset  =======

Alignment block 24 of 28 in window, 112243946 - 112243948, 3 bps 
B D                     Human  tac
B D                     Chimp  tac
B D                   Gorilla  tac
B D                 Orangutan  tac
B D                    Gibbon  tac
B D                    Rhesus  tat
B D       Crab-eating macaque  tat
B D                    Baboon  tat
B D              Green monkey  cat
B D           Squirrel monkey  tat
B D                  Bushbaby  cat
           Chinese tree shrew  tat
B D                  Squirrel  tat
       Lesser Egyptian jerboa  tat
                 Prairie vole  tat
B D           Chinese hamster  act
               Golden hamster  aat
B D                     Mouse  tat
B D                       Rat  tat
B D            Naked mole-rat  tat
B D                Guinea pig  tgt
                   Chinchilla  tat
             Brush-tailed rat  tat
B D                    Rabbit  aac
B D                       Pig  tag
B D                    Alpaca  tat
               Bactrian camel  tat
                 Killer whale  tgt
             Tibetan antelope  tat
B D                       Cow  tat
B D                     Sheep  tat
                Domestic goat  tat
B D                     Horse  tat
B D          White rhinoceros  tat
B D                       Dog  tat
B D                   Ferret   ttt
B D                     Panda  ttc
               Pacific walrus  ttt
                 Weddell seal  ttt
             Black flying-fox  tat
B D                   Megabat  tat
                Big brown bat  tat
         David's myotis (bat)  tat
B D                  Microbat  tat
B D                  Hedgehog  tat
B D                     Shrew  tat
              Star-nosed mole  tat
B D                  Elephant  tat
          Cape elephant shrew  aat
B D                   Manatee  tat
             Cape golden mole  tat
                     Aardvark  tat
B D                 Armadillo  tat
B D                   Opossum  ttt
B D           Tasmanian devil  ttc
B D                   Wallaby  ttc
B D                  Platypus  tat
B D        American alligator  tac
B D                      Pika  NNN
  D  Chinese softshell turtle  ===
  D           Green seaturtle  ===
B D                    Tenrec  ===
B D                       Cat  ===
B D                  Marmoset  ===

Alignment block 25 of 28 in window, 112243949 - 112243955, 7 bps 
B D                     Human  ttagaat
B D                     Chimp  ttagaat
B D                   Gorilla  ttagaat
B D                 Orangutan  ttagaat
B D                    Gibbon  ttagaat
B D                    Rhesus  ttagaat
B D       Crab-eating macaque  ttagaat
B D                    Baboon  ttagaat
B D              Green monkey  ttagaat
B D           Squirrel monkey  ttagaat
B D                  Bushbaby  ttagaat
           Chinese tree shrew  ttagaat
B D                  Squirrel  ttagaat
       Lesser Egyptian jerboa  ttggaa-
                 Prairie vole  ttggaat
B D           Chinese hamster  ttggaat
               Golden hamster  ttggaat
B D                     Mouse  ttggaat
B D                       Rat  ttggaat
B D            Naked mole-rat  atagaat
B D                Guinea pig  atagaat
                   Chinchilla  gtagaat
             Brush-tailed rat  atagaat
B D                    Rabbit  ttagaat
B D                       Pig  ttgggat
B D                    Alpaca  ttggaat
               Bactrian camel  ttggaat
                 Killer whale  ttggaat
             Tibetan antelope  ttggaat
B D                       Cow  ttggaat
B D                     Sheep  ttggaat
                Domestic goat  ttggaat
B D                     Horse  ttagaat
B D          White rhinoceros  ttagact
B D                       Cat  ttagaaa
B D                       Dog  ttagaat
B D                   Ferret   ttagaat
B D                     Panda  ttagaat
               Pacific walrus  ttagaac
                 Weddell seal  ttagaa-
             Black flying-fox  ttagaat
B D                   Megabat  ttagaat
                Big brown bat  ttagaat
         David's myotis (bat)  ttagaat
B D                  Microbat  ttagaat
B D                  Hedgehog  atgaaat
B D                     Shrew  tcaggtt
              Star-nosed mole  tgagaat
B D                  Elephant  ttagaat
          Cape elephant shrew  ttagaat
B D                   Manatee  ttagaat
             Cape golden mole  ttagaat
                     Aardvark  ctacaat
B D                 Armadillo  ttag-at
B D                   Opossum  tctgcat
B D           Tasmanian devil  tttgact
B D                   Wallaby  tctgcat
B D                  Platypus  tgcaaat
B D        American alligator  ttctaat
B D                      Pika  NNNNNNN
  D  Chinese softshell turtle  =======
  D           Green seaturtle  =======
B D                    Tenrec  =======
B D                  Marmoset  =======

Alignment block 26 of 28 in window, 112243956 - 112243969, 14 bps 
B D                     Human  gt-tttt--ct----ctccac---
B D                     Chimp  gt-tttt--ct----ctccac---
B D                   Gorilla  gt-tttt--ct----ctccac---
B D                 Orangutan  gt-tttt--ct----ctccac---
B D                    Gibbon  gt-tttt--ct----gtccac---
B D                    Rhesus  gt-tttt--ct----ctccac---
B D       Crab-eating macaque  gt-tttt--ct----ctccac---
B D                    Baboon  gt-tttt--ct----ctccac---
B D              Green monkey  gt-tttt--ct----ctccac---
B D           Squirrel monkey  gt-tttt--ct----ctacac---
B D                  Bushbaby  at-tttt--ct----cttcac---
           Chinese tree shrew  at-tctt--ct----cttcac---
B D                  Squirrel  at-tttt--ct----attcac---
       Lesser Egyptian jerboa  -----cc--tg----tttttc---
                 Prairie vole  aattttt--tt----cttttc---
B D           Chinese hamster  aa-tttt--tt----cttctg---
               Golden hamster  aa--ttt--tt----cttttg---
B D                     Mouse  aattatt---------ttctc---
B D                       Rat  aattttt--tt----cttctc---
B D            Naked mole-rat  at-tttt--ct----ctttac---
B D                Guinea pig  gt-tttt--ct----cttcac---
                   Chinchilla  at-tttt--ct----ctttac---
             Brush-tailed rat  at-tt-----------tttat---
B D                    Rabbit  tc--ttt--gt----attcac---
B D                       Pig  at-cttt--ct----ctttac---
B D                    Alpaca  at-tttt--ct----cttcac---
               Bactrian camel  at-tttc--ct----cttcac---
                 Killer whale  at-tttt--gt----cttcac---
             Tibetan antelope  at-tttt--ca----ttttac---
B D                       Cow  at-tttt--ct----ttttac---
B D                     Sheep  at-tttt--ct----ttttac---
                Domestic goat  at-tttt--ct----ttttac---
B D          White rhinoceros  at-tttt--ct----cttcac---
B D                       Cat  at-gttt--ct----cttcac---
B D                       Dog  gt-ctgt--tt----cttcac---
B D                   Ferret   gt-ttat--ct----cttcat---
B D                     Panda  gt--cgt--ct----cttcac---
               Pacific walrus  gt-ctgt--ct----cttcac---
                 Weddell seal  ----tgt--ct----cttcac---
             Black flying-fox  at-tttttcct----ctccaa---
B D                   Megabat  at-tttttcct----ctccaa---
                Big brown bat  at-ttct--ct----ctccac---
         David's myotis (bat)  ac-ttct--ct----cttcat---
B D                  Microbat  ac-ttct--ct----cttcat---
B D                  Hedgehog  cc-tttt--tt----cttcat---
B D                     Shrew  tt-tttt--at----cttcac---
              Star-nosed mole  gt-tttt--ct----ttttat---
B D                  Elephant  --agttt--ct----tttcac---
          Cape elephant shrew  --tgctt--ct----tttcac---
B D                   Manatee  --agttt--ct----cttcac---
             Cape golden mole  --tattt--ct----cttcat---
                     Aardvark  --agttt--cc----cttcat---
B D                 Armadillo  --acctt--cc----tgtcac---
B D                   Opossum  ac-ttat--gg----ccccat---
B D           Tasmanian devil  at-tttt--ttttacctacac---
B D                   Wallaby  at-tttt--tgt---ctctac---
B D                  Platypus  --attct--tc----cccaac---
B D        American alligator  --atttc--ct----ctcttcctt
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ========================
  D           Green seaturtle  ========================
B D                    Tenrec  ========================
B D                     Horse  NNNNNNNNNNNNNNNNNNNNNNNN
B D                  Marmoset  ========================

Inserts between block 26 and 27 in window
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 3bp
                    Aardvark 1bp
B D                Armadillo 1bp
B D                 Platypus 5bp

Alignment block 27 of 28 in window, 112243970 - 112244032, 63 bps 
B D                     Human  a---------gg-----------------------------------------------------aa-t-
B D                     Chimp  a---------gg-----------------------------------------------------aa-t-
B D                   Gorilla  a---------gg-----------------------------------------------------aa-t-
B D                 Orangutan  a---------gg-----------------------------------------------------aa-t-
B D                    Gibbon  a---------gg-----------------------------------------------------aa-t-
B D                    Rhesus  a---------gg-----------------------------------------------------aa-t-
B D       Crab-eating macaque  a---------gg-----------------------------------------------------aa-t-
B D                    Baboon  a---------gg-----------------------------------------------------aa-t-
B D              Green monkey  a---------gg-----------------------------------------------------aa-t-
B D           Squirrel monkey  t---------gg-----------------------------------------------------aa-t-
B D                  Bushbaby  t--------cag-----------------------------------------------------ag-t-
           Chinese tree shrew  t--------cag-----------------------------------------------------ca-t-
B D                  Squirrel  t--------aag-----------------------------------------------------aa-t-
       Lesser Egyptian jerboa  t--------caa-----------------------------------------------------gagt-
                 Prairie vole  t--------cac-----------------------------------------------------ca-t-
B D           Chinese hamster  t--------cat-----------------------------------------------------ca-t-
               Golden hamster  t--------cac-----------------------------------------------------ca-t-
B D                     Mouse  t--------cac-----------------------------------------------------ca-t-
B D                       Rat  t--------cac-----------------------------------------------------ca-t-
B D            Naked mole-rat  t--------cag-----------------------------------------------------ta-t-
B D                Guinea pig  t--------gag-----------------------------------------------------at-t-
                   Chinchilla  t--------gag-----------------------------------------------------aa-t-
             Brush-tailed rat  g--------gag-----------------------------------------------------aa-t-
B D                    Rabbit  t--------cag-----------------------------------------------------aa-t-
B D                       Pig  t--------cag-----------------------------------------------------aa-t-
B D                    Alpaca  t--------cag-----------------------------------------------------ag-t-
               Bactrian camel  t--------cag-----------------------------------------------------ag-t-
                 Killer whale  t--------cag-----------------------------------------------------aa-t-
             Tibetan antelope  t--------cag----------------------------------------------------------
B D                       Cow  t--------caa----------------------------------------------------------
B D                     Sheep  t--------cag----------------------------------------------------------
                Domestic goat  t--------cag----------------------------------------------------------
B D          White rhinoceros  t--------cag-----------------------------------------------------aa-t-
B D                       Cat  t--------cag-----------------------------------------------------aa-t-
B D                       Dog  t--------cag----------------------------------------t------------gt-t-
B D                   Ferret   t------------aatagtaattacaaggggttacttagttattagtagagtttacctagta---at-t-
B D                     Panda  t--------cagtaatagtaattactagggg---------------------taacctagta---at-t-
               Pacific walrus  t--------caggaatagtaattactagggg---------------------ttacctagtaagtag-t-
                 Weddell seal  t--------cgggaatagtaattactagggg---------------------ttacctagtaagtag-t-
             Black flying-fox  a--------gag-----------------------------------------------------aa-c-
B D                   Megabat  a--------gag-----------------------------------------------------aa-c-
                Big brown bat  t--------cag-----------------------------------------------------aa-ta
         David's myotis (bat)  t--------cag-----------------------------------------------------aa-t-
B D                  Microbat  t--------cag-----------------------------------------------------aa-t-
B D                  Hedgehog  ttagaatagtag-----------------------------------------------------aa-t-
B D                     Shrew  t--------tag-----------------------------------------------------aa-t-
              Star-nosed mole  t--------aag-----------------------------------------------------aa-t-
B D                  Elephant  ---------cac-----------------------------------------------------aa-t-
          Cape elephant shrew  ---------cac-----------------------------------------------------aa-t-
B D                   Manatee  ---------cac-----------------------------------------------------aa-t-
             Cape golden mole  ---------aaa-----------------------------------------------------aa-c-
B D                    Tenrec  ---------aga-----------------------------------------------------aa-t-
                     Aardvark  ---------cac-----------------------------------------------------aa-t-
B D                 Armadillo  ---------cac-----------------------------------------------------ta-t-
B D                   Opossum  ----------------------------------------------------------------------
B D           Tasmanian devil  ----------------------------------------------------------------------
B D                   Wallaby  ----------------------------------------------------------------------
B D                  Platypus  -----------------------------------------------------------------ag-t-
B D        American alligator  --------------------------------------------------------------aatac-t-
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                     Horse  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Marmoset  ======================================================================

                        Human  ---ag---------------------t--aa-ctg--ttagggcttacctagtatagtaactgccactgg
                        Chimp  ---ag---------------------t--aa-ctg--ttagggcttacctagtatagtaactgccactgg
                      Gorilla  ---ag---------------------t--aa-ctg--ttagggcttacctagtatagtaactgccactgg
                    Orangutan  ---ag---------------------t--aa-ttg--ttagggcttacctagtatagtaactgccattgg
                       Gibbon  ---gg---------------------t--aa-ttg--ttagggcttacctagtatagtaactgccaccgg
                       Rhesus  ---ag---------------------t--aa-ttg--ttagggcttacctagtatagtaactgctgttgg
          Crab-eating macaque  ---ag---------------------t--aa-ttg--ttagggcttacctagtatagtaactgctgttgg
                       Baboon  ---ag---------------------t--aa-ttg--ttagggcttacctagtatagtaactgctgttgg
                 Green monkey  ---ag---------------------t--aa-ttt--ttagggcttacctagtatagtaactgcagttgg
              Squirrel monkey  ---ag---------------------t--aa-tca--ttaggacttacctagtatagtaactgcctttgg
                     Bushbaby  ---gg---------------------ta-aa-tta--gtagggcttacctagtttagtaactgccattgg
           Chinese tree shrew  ---ag---------------------t--aa-tta--gtagaacttacctagtttaataactgccattgg
                     Squirrel  ---ag---------------------t--aa-ata--ggagtgcttacctagtttagtgactgccatcgg
       Lesser Egyptian jerboa  ---ag---------------------t--aa-gca--ggagggcttacctagtttggcaactgcagcagg
                 Prairie vole  ---ag---------------------t--aa-aca--gtagagcttacctagttttgtaactgccattgg
              Chinese hamster  ---ag---------------------t--aa-aca--gtagagcttacctagtttagtaactgccattgg
               Golden hamster  ---ag---------------------t--aa-aca--gtagagcttacctaatttagtaactgccattgg
                        Mouse  ---ag---------------------t--aa-aca--gtggggcttacctagtttagtaactgccattgg
                          Rat  ---ag---------------------t--aa-aca--gtagggcttacctagtttaattactgccattgg
               Naked mole-rat  ---ag---------------------t--ac-tta--atatgacttacctagtttagtaactgccattgg
                   Guinea pig  ---ag---------------------t--aa-tta--atatgacttacctagtttagtaactactattgg
                   Chinchilla  ---ag---------------------t--ag-tta--atatgacttacccagcttagaaactgccactgg
             Brush-tailed rat  ---ag---------------------t--aa-tta--atatgacttacctagtttagtaactgccatagg
                       Rabbit  ---ag---------------------t--aa-tta--ggagggcttacctagtttgttaactgccattgg
                          Pig  ---ag---------------------g--ac-gta--tcagggcttacctagtttactaactgctatggg
                       Alpaca  ---ag---------------------g--aa-tta--gcagggcttacctagttcactaactgccattgg
               Bactrian camel  ---ag---------------------g--aa-tta--gcagggcttacctagttcactaactgccattgg
                 Killer whale  ---at---------------------g--aa-ttt--gcagggcttaccgagtttagtaactgccattgg
             Tibetan antelope  --------------------------g--aa-tta--gcagggcttaccaagtttagtaactgccattgg
                          Cow  --------------------------g--aa-tta--gcagggcttaccaagtttagtaactgccattgg
                        Sheep  --------------------------g--aa-tta--gcagagcttaccaagtttagtaactgccattgg
                Domestic goat  --------------------------g--aa-tta--gcagggcttaccaagtttagtaactgccattgg
             White rhinoceros  ---ag---------------------t--ga-taa--gtagggcttacctagtttactaactgccattgg
                          Cat  ---ag---------------------t--aa-tta--gtagggcttacctagtttactaactgccattgg
                          Dog  ---ag---------------------t--aa-tta--gtagggcttacctaatttactaactgcaattgg
                      Ferret   ---ag---------------------t--aa-tta--ctagggcttacctagtttactgactgccattgg
                        Panda  ---agtagggcatatctagtaattagt--aa-ata--ctaggacttacctagtttactaactgccattgg
               Pacific walrus  ---ag---ggcttatctagtaattagt--aa-tta--ctagggcttacctagtttactaactgccgttgg
                 Weddell seal  ---ag---ggcttatctagtaattagt--aa-tta--ctagggcttacctagtttactaactgccattgg
             Black flying-fox  ---tg---------------------t--aa-tta--gtagggcttacctagtttactaactgccactgg
                      Megabat  ---tg---------------------t--aa-tta--gtagggcttacctagtttactaactgccactgg
                Big brown bat  ctaac---------------------t--aa-tta--gta-gacttacctagtttactaactaccatcgg
         David's myotis (bat)  ---ac---------------------t--aa-tta--gta-gacttacctagtttactgactaccattgg
                     Microbat  ---at---------------------t--aa-tta--gtg-gacttacctagtttactaactaccattgg
                     Hedgehog  ---ag---------------------t--aa-tta--gcagtgcttaccaaatttgttaactgccactgg
                        Shrew  ---aa---------------------t--aa-tta--tttg-gattacctagtctgttaactgccactgg
              Star-nosed mole  ---at---------------------t--aa-ttaaggtgg-gcttacctagtttatcaactgccattgg
                     Elephant  ---tt---------------------t--aa-tta--gtaggacttacctagtttagtaactgccagtgg
          Cape elephant shrew  ---ac---------------------t--aa-cta--gcagggcttacctagtttagaaacggctagcgg
                      Manatee  ---ac---------------------t--aattta--gtaggtcttacctagtttagtaactgccagtgg
             Cape golden mole  ---ggct-------------------t--aa-tt------gggcttacctagtttagtaacagccagtgg
                       Tenrec  ---aa---------------------t--aa-tta--tgagagcttacctagtttagcaactgccagtgg
                     Aardvark  ---ac---------------------a--aa-tta--gcagagcttacctagtttagcaactgccagtgg
                    Armadillo  ---ac---------------------t--aa-tta--gtaggacttacctagtttagtaactgccagtgg
                      Opossum  ---------------------------ggta-ttg--atatggcttacctaattggataactgcccgcgg
              Tasmanian devil  ---------------------------aata-tta--atatgacttacctaaatggataactgctcgagg
                      Wallaby  ---------------------------aata-tta--atatggcttacctaagtggataactgctcgagg
                     Platypus  ---at---------------------t--aa-tgg--atat-gtttacctaattgggtaacaacccaggg
           American alligator  ---at---------------------c--aa-ttg--atat-gtttacctaatgttctaaccagcttttt
                         Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
                        Horse  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Marmoset  ======================================================================

                        Human  caaaataaatctattg
                        Chimp  caaaataaatctattg
                      Gorilla  caaaataaatctattg
                    Orangutan  caaaataaatctattg
                       Gibbon  caaaataaatctattg
                       Rhesus  caaaacaaatctattg
          Crab-eating macaque  caaaacaaatctattg
                       Baboon  caaaacaaatctattg
                 Green monkey  caaaacgaatctattg
              Squirrel monkey  caaaataaatttattg
                     Bushbaby  caaaataaatttattg
           Chinese tree shrew  caaaataaatttattg
                     Squirrel  caaaataaatctattg
       Lesser Egyptian jerboa  caaaattagcctattg
                 Prairie vole  caaaatcaatctattg
              Chinese hamster  caaaataaatctattg
               Golden hamster  caaaataaatctattg
                        Mouse  caaaataaatctattg
                          Rat  caaaataaatctattg
               Naked mole-rat  caaaataaagttgttg
                   Guinea pig  caaaactaagttgttg
                   Chinchilla  taaaatgaaatggttg
             Brush-tailed rat  caaaatgatattgtta
                       Rabbit  caaaataaatctatta
                          Pig  caaaataaatctattg
                       Alpaca  caaaataaatctattg
               Bactrian camel  caaaataaatctattg
                 Killer whale  caaaataaatctattg
             Tibetan antelope  caaaataaatctattg
                          Cow  caaaataaatctatta
                        Sheep  caaaataaatctattg
                Domestic goat  caaaataaatctattg
             White rhinoceros  caaaacaaatctattg
                          Cat  caaaataaatctattg
                          Dog  caaaataaatctattg
                      Ferret   caaaataaatctattg
                        Panda  caaaataaatctattg
               Pacific walrus  caaaataaatctattg
                 Weddell seal  caaaataaatctattg
             Black flying-fox  caaaataactctgcta
                      Megabat  caaaataactctgcta
                Big brown bat  caaaataactctattg
         David's myotis (bat)  caaaataactctattg
                     Microbat  caaaataattctattg
                     Hedgehog  taaaataaatctacca
                        Shrew  caaaataaatctacta
              Star-nosed mole  caaaataaatctattg
                     Elephant  caaaataaatttattg
          Cape elephant shrew  caaaatgaatctattt
                      Manatee  caaaatgaatttattg
             Cape golden mole  caaaataaatttattg
                       Tenrec  caaaaaaaacttattg
                     Aardvark  caaaataaatttattg
                    Armadillo  caaaataaatctattg
                      Opossum  taatgtgattgaattg
              Tasmanian devil  taatgtcattgaattt
                      Wallaby  taatgtgattgaatta
                     Platypus  caaagtgaatgaattc
           American alligator  cactgtggtggagtta
                         Pika  NNNNNNNNNNNNNNNN
     Chinese softshell turtle  ================
              Green seaturtle  ================
                        Horse  NNNNNNNNNNNNNNNN
                     Marmoset  ================

Alignment block 28 of 28 in window, 112244033 - 112244042, 10 bps 
B D                     Human  acaacaaggg
B D                     Chimp  acaacaaggg
B D                   Gorilla  acaacaaggg
B D                 Orangutan  acaacaaggg
B D                    Gibbon  acaacaaggg
B D                    Rhesus  acaatgaggg
B D       Crab-eating macaque  acaatgaggg
B D                    Baboon  acaatgaggg
B D              Green monkey  acaatgaggg
B D           Squirrel monkey  acaacgaggg
B D                  Bushbaby  acaatcaggt
           Chinese tree shrew  ataataagtg
B D                  Squirrel  ataatcagat
       Lesser Egyptian jerboa  accatcaagg
                 Prairie vole  ataatcaggg
B D           Chinese hamster  ataatcaggg
               Golden hamster  acaatcaggg
B D                     Mouse  acaatcaggg
B D                       Rat  acaatcaggg
B D            Naked mole-rat  acaatcaagt
B D                Guinea pig  acaatcaagt
                   Chinchilla  acaatcatgc
             Brush-tailed rat  ataatcatgc
B D                    Rabbit  acaattaggg
B D                       Pig  acaatcaggc
B D                    Alpaca  ataatcatgc
               Bactrian camel  ataatcatgc
B D                   Dolphin  acaatcaggc
                 Killer whale  acaatcaggc
             Tibetan antelope  acaatcaagc
B D                       Cow  acaatcaagc
B D                     Sheep  acaatcaagc
                Domestic goat  acaatcaagc
B D          White rhinoceros  acaatcaggc
B D                       Cat  acaatcaagg
B D                       Dog  acaatcaacg
B D                   Ferret   acaatcaagg
B D                     Panda  acaatcaagg
               Pacific walrus  acaatcaagg
                 Weddell seal  acaatcaagg
             Black flying-fox  accatcaggg
B D                   Megabat  accatcaggg
                Big brown bat  acaatcaggg
         David's myotis (bat)  acaatcaggg
B D                  Microbat  acaatcaggg
B D                  Hedgehog  acaatcagat
B D                     Shrew  ataagcagat
              Star-nosed mole  ataatcaggt
B D                  Elephant  aaaatcaagg
          Cape elephant shrew  aaaatcaaag
B D                   Manatee  aaaatcaagg
             Cape golden mole  aaaatcaagg
B D                    Tenrec  gagatcaagg
                     Aardvark  caaatcaagg
B D                 Armadillo  aaaatcaggg
B D                   Opossum  atcatcaaag
B D           Tasmanian devil  atcaacaaag
B D                   Wallaby  atcaataaag
B D                  Platypus  acaatcaagg
B D        American alligator  atcaccaatg
B D                      Pika  NNNNNNNNNN
  D  Chinese softshell turtle  ==========
  D           Green seaturtle  ==========
B D                     Horse  NNNNNNNNNN
B D                  Marmoset  ==========

View table schema

Go to Conservation track controls

Data last updated: 2015-05-06

Downloads for data in this track are available:

Description

This track shows multiple alignments of 100 vertebrate species and measurements of evolutionary conservation using two methods (phastCons and phyloP) from the PHAST package, for all species. The multiple alignments were generated using multiz and other tools in the UCSC/Penn State Bioinformatics comparative genomics alignment pipeline. Conserved elements identified by phastCons are also displayed in this track. PHAST/Multiz are built from chains ("alignable") and nets ("syntenic"), see the documentation of the Chain/Net tracks for a description of the complete alignment process.

PhastCons is a hidden Markov model-based method that estimates the probability that each nucleotide belongs to a conserved element, based on the multiple alignment. It considers not just each individual alignment column, but also its flanking columns. By contrast, phyloP separately measures conservation at individual columns, ignoring the effects of their neighbors. As a consequence, the phyloP plots have a less smooth appearance than the phastCons plots, with more "texture" at individual sites. The two methods have different strengths and weaknesses. PhastCons is sensitive to "runs" of conserved sites, and is therefore effective for picking out conserved elements. PhyloP, on the other hand, is more appropriate for evaluating signatures of selection at particular nucleotides or classes of nucleotides (e.g., third codon positions, or first positions of miRNA target sites).

Another important difference is that phyloP can measure acceleration (faster evolution than expected under neutral drift) as well as conservation (slower than expected evolution). In the phyloP plots, sites predicted to be conserved are assigned positive scores (and shown in blue), while sites predicted to be fast-evolving are assigned negative scores (and shown in red). The absolute values of the scores represent -log p-values under a null hypothesis of neutral evolution. The phastCons scores, by contrast, represent probabilities of negative selection and range between 0 and 1.

Both phastCons and phyloP treat alignment gaps and unaligned nucleotides as missing data, and both were run with the same parameters.

See also: lastz parameters and other details and chain minimum score and gap parameters used in these alignments.

UCSC has repeatmasked and aligned all genome assemblies, and provides all the sequences for download. For genome assemblies not available in the genome browser, there are alternative assembly hub genome browsers. Missing sequence in any assembly is highlighted in the track display by regions of yellow when zoomed out and by Ns when displayed at base level (see Gap Annotation, below).

Primate subset
OrganismSpeciesRelease dateUCSC versionAlignment type
BaboonPapio hamadryasMar 2012Baylor Panu_2.0/papAnu2Reciprocal best net
BushbabyOtolemur garnettiiMar 2011Broad/otoGar3Syntenic net
ChimpPan troglodytesFeb 2011CSAC 2.1.4/panTro4Syntenic net
Crab-eating macaqueMacaca fascicularisJun 2013Macaca_fascicularis_5.0/macFas5Syntenic net
GibbonNomascus leucogenysOct 2012GGSC Nleu3.0/nomLeu3Syntenic net
GorillaGorilla gorilla gorillaMay 2011gorGor3.1/gorGor3Reciprocal best net
Green monkeyChlorocebus sabaeusMar 2014Chlorocebus_sabeus 1.1/chlSab2Syntenic net
HumanHomo sapiensDec 2013GRCh38/hg38reference species
MarmosetCallithrix jacchusMar 2009WUGSC 3.2/calJac3Syntenic net
OrangutanPongo pygmaeus abeliiJuly 2007WUGSC 2.0.2/ponAbe2Reciprocal best net
RhesusMacaca mulattaOct 2010BGI CR_1.0/rheMac3Syntenic net
Squirrel monkeySaimiri boliviensisOct 2011Broad/saiBol1Syntenic net
Euarchontoglires subset
Brush-tailed ratOctodon degusApr 2012OctDeg1.0/octDeg1Syntenic net
ChinchillaChinchilla lanigeraMay 2012 ChiLan1.0/chiLan1Syntenic net
Chinese hamsterCricetulus griseusJul 2013C_griseus_v1.0/criGri1Syntenic net
Chinese tree shrewTupaia chinensisJan 2013TupChi_1.0/tupChi1Syntenic net
Golden hamsterMesocricetus auratusMar 2013MesAur1.0/mesAur1Syntenic net
Guinea pigCavia porcellusFeb 2008Broad/cavPor3Syntenic net
Lesser Egyptian jerboaJaculus jaculusMay 2012JacJac1.0/jacJac1Syntenic net
MouseMus musculusDec 2011GRCm38/mm10Syntenic net
Naked mole-ratHeterocephalus glaberJan 2012Broad HetGla_female_1.0/hetGla2Syntenic net
PikaOchotona princepsMay 2012OchPri3.0/ochPri3Syntenic net
Prairie voleMicrotus ochrogasterOct 2012MicOch1.0/micOch1Syntenic net
RabbitOryctolagus cuniculusApr 2009Broad/oryCun2Syntenic net
RatRattus norvegicusJul 2014RGSC 6.0/rn6Syntenic net
SquirrelSpermophilus tridecemlineatusNov 2011Broad/speTri2Syntenic net
Laurasiatheria subset
AlpacaVicugna pacosMar 2013Vicugna_pacos-2.0.1/vicPac2Syntenic net
Bactrian camelCamelus ferusDec 2011CB1/camFer1Syntenic net
Big brown batEptesicus fuscusJul 2012EptFus1.0/eptFus1Syntenic net
Black flying-foxPteropus alectoAug 2012ASM32557v1/pteAle1Syntenic net
CatFelis catusNov 2014ICGSC Felis_catus 8.0/felCat8Syntenic net
CowBos taurusJun 2014Bos_taurus_UMD_3.1.1/bosTau8Syntenic net
David's myotis batMyotis davidiiAug 2012ASM32734v1/myoDav1Syntenic net
DogCanis lupus familiarisSep 2011Broad CanFam3.1/canFam3Syntenic net
DolphinTursiops truncatusOct 2011Baylor Ttru_1.4/turTru2Reciprocal best net
Domestic goatCapra hircusMay 2012CHIR_1.0/capHir1Syntenic net
Ferret Mustela putorius furoApr 2011MusPutFur1.0/musFur1Syntenic net
HedgehogErinaceus europaeusMay 2012EriEur2.0/eriEur2Syntenic net
HorseEquus caballusSep 2007EquCab3.0/equCab3Syntenic net
Killer whaleOrcinus orcaJan 2013Oorc_1.1/orcOrc1Syntenic net
MegabatPteropus vampyrusJul 2008Broad/pteVam1Reciprocal best net
MicrobatMyotis lucifugusJul 2010Broad Institute Myoluc2.0/myoLuc2Syntenic net
Pacific walrusOdobenus rosmarus divergensJan 2013Oros_1.0/odoRosDiv1Syntenic net
PandaAiluropoda melanoleucaDec 2009BGI-Shenzhen 1.0/ailMel1Syntenic net
PigSus scrofaAug 2011SGSC Sscrofa10.2/susScr3Syntenic net
SheepOvis ariesAug 2012ISGC Oar_v3.1/oviAri3Syntenic net
ShrewSorex araneusAug 2008Broad/sorAra2Syntenic net
Star-nosed moleCondylura cristataMar 2012ConCri1.0/conCri1Syntenic net
Tibetan antelopePantholops hodgsoniiMay 2013PHO1.0/panHod1Syntenic net
Weddell sealLeptonychotes weddelliiMar 2013LepWed1.0/lepWed1Reciprocal best net
White rhinocerosCeratotherium simumMay 2012CerSimSim1.0/cerSim1Syntenic net
Afrotheria subset
AardvarkOrycteropus afer aferMay 2012OryAfe1.0/oryAfe1Syntenic net
Cape elephant shrewElephantulus edwardiiAug 2012EleEdw1.0/eleEdw1Syntenic net
Cape golden moleChrysochloris asiaticaAug 2012ChrAsi1.0/chrAsi1Syntenic net
ElephantLoxodonta africanaJul 2009Broad/loxAfr3Syntenic net
ManateeTrichechus manatus latirostrisOct 2011Broad v1.0/triMan1Syntenic net
TenrecEchinops telfairiNov 2012Broad/echTel2Syntenic net
Mammal subset
ArmadilloDasypus novemcinctusDec 2011Baylor/dasNov3Syntenic net
OpossumMonodelphis domesticaOct 2006Broad/monDom5Net
PlatypusOrnithorhynchus anatinusMar 2007WUGSC 5.0.1/ornAna1Reciprocal best net
Tasmanian devilSarcophilus harrisiiFeb 2011WTSI Devil_ref v7.0/sarHar1Net
WallabyMacropus eugeniiSep 2009TWGS Meug_1.1/macEug2Reciprocal best net
Aves subset
BudgerigarMelopsittacus undulatusSep 2011WUSTL v6.3/melUnd1Net
ChickenGallus gallusNov 2011ICGSC Gallus_gallus-4.0/galGal4Net
Collared flycatcherFicedula albicollisJun 2013FicAlb1.5/ficAlb2Net
Mallard duckAnas platyrhynchosApr 2013BGI_duck_1.0/anaPla1Net
Medium ground finchGeospiza fortisApr 2012GeoFor_1.0/geoFor1Net
ParrotAmazona vittataJan 2013AV1/amaVit1Net
Peregrine falconFalco peregrinusFeb 2013F_peregrinus_v1.0/falPer1Net
Rock pigeonColumba liviaFeb 2013Cliv_1.0/colLiv1Net
Saker falconFalco cherrugFeb 2013F_cherrug_v1.0/falChe1Net
Scarlet macawAra macaoJun 2013SMACv1.1/araMac1Net
Tibetan ground jayPseudopodoces humilisJan 2013PseHum1.0/pseHum1Net
TurkeyMeleagris gallopavoDec 2009TGC Turkey_2.01/melGal1Net
White-throated sparrowZonotrichia albicollisApr 2013ASM38545v1/zonAlb1Net
Zebra finchTaeniopygia guttataFeb 2013WashU taeGut324/taeGut2Net
Sarcopterygii subset
American alligatorAlligator mississippiensisAug 2012allMis0.2/allMis1Net
Chinese softshell turtlePelodiscus sinensisOct 2011PelSin_1.0/pelSin1Net
CoelacanthLatimeria chalumnaeAug 2011Broad/latCha1Net
Green seaturtleChelonia mydasMar 2013CheMyd_1.0/cheMyd1Net
LizardAnolis carolinensisMay 2010Broad AnoCar2.0/anoCar2Net
Painted turtleChrysemys picta belliiMar 2014v3.0.3/chrPic2Net
Spiny softshell turtleApalone spiniferaMay 2013ASM38561v1/apaSpi1Net
X. tropicalisXenopus tropicalisSep 2012JGI 7.0/xenTro7Net
Fish subset
Atlantic codGadus morhuaMay 2010Genofisk GadMor_May2010/gadMor1Net
Burton's mouthbreederHaplochromis burtoniOct 2011AstBur1.0/hapBur1Net
FuguTakifugu rubripesOct 2011FUGU5/fr3Net
LampreyPetromyzon marinusSep 2010WUGSC 7.0/petMar2Net
MedakaOryzias latipesOct 2005NIG/UT MEDAKA1/oryLat2Net
Mexican tetra (cavefish)Astyanax mexicanusApr 2013Astyanax_mexicanus-1.0.2/astMex1Net
Nile tilapiaOreochromis niloticusJan 2011Broad oreNil1.1/oreNil2Net
Princess of BurundiNeolamprologus brichardiMay 2011NeoBri1.0/neoBri1Net
Pundamilia nyerereiPundamilia nyerereiOct 2011PunNye1.0/punNye1Net
Southern platyfishXiphophorus maculatusJan 2012Xiphophorus_maculatus-4.4.2/xipMac1Net
Spotted garLepisosteus oculatusDec 2011LepOcu1/lepOcu1Net
SticklebackGasterosteus aculeatusFeb 2006Broad/gasAcu1Net
TetraodonTetraodon nigroviridisMar 2007Genoscope 8.0/tetNig2Net
Yellowbelly pufferfishTakifugu flavidusMay 2013version 1 of Takifugu flavidus genome/takFla1Net
Zebra mbunaMaylandia zebraMar 2012MetZeb1.1/mayZeb1Net
ZebrafishDanio rerioSep 2014GRCz10/danRer10Net

Table 1. Genome assemblies included in the 100-way Conservation track.

Display Conventions and Configuration

In full and pack display modes, conservation scores are displayed as a wiggle track (histogram) in which the height reflects the size of the score. The conservation wiggles can be configured in a variety of ways to highlight different aspects of the displayed information. Click the Graph configuration help link for an explanation of the configuration options.

Pairwise alignments of each species to the human genome are displayed below the conservation histogram as a grayscale density plot (in pack mode) or as a wiggle (in full mode) that indicates alignment quality. In dense display mode, conservation is shown in grayscale using darker values to indicate higher levels of overall conservation as scored by phastCons.

Checkboxes on the track configuration page allow selection of the species to include in the pairwise display. Note that excluding species from the pairwise display does not alter the the conservation score display.

To view detailed information about the alignments at a specific position, zoom the display in to 30,000 or fewer bases, then click on the alignment.

Gap Annotation

The Display chains between alignments configuration option enables display of gaps between alignment blocks in the pairwise alignments in a manner similar to the Chain track display. The following conventions are used:

  • Single line: No bases in the aligned species. Possibly due to a lineage-specific insertion between the aligned blocks in the human genome or a lineage-specific deletion between the aligned blocks in the aligning species.
  • Double line: Aligning species has one or more unalignable bases in the gap region. Possibly due to excessive evolutionary distance between species or independent indels in the region between the aligned blocks in both species.
  • Pale yellow coloring: Aligning species has Ns in the gap region. Reflects uncertainty in the relationship between the DNA of both species, due to lack of sequence in relevant portions of the aligning species.

Genomic Breaks

Discontinuities in the genomic context (chromosome, scaffold or region) of the aligned DNA in the aligning species are shown as follows:

  • Vertical blue bar: Represents a discontinuity that persists indefinitely on either side, e.g. a large region of DNA on either side of the bar comes from a different chromosome in the aligned species due to a large scale rearrangement.
  • Green square brackets: Enclose shorter alignments consisting of DNA from one genomic context in the aligned species nested inside a larger chain of alignments from a different genomic context. The alignment within the brackets may represent a short misalignment, a lineage-specific insertion of a transposon in the human genome that aligns to a paralogous copy somewhere else in the aligned species, or other similar occurrence.

Base Level

When zoomed-in to the base-level display, the track shows the base composition of each alignment. The numbers and symbols on the Gaps line indicate the lengths of gaps in the human sequence at those alignment positions relative to the longest non-human sequence. If there is sufficient space in the display, the size of the gap is shown. If the space is insufficient and the gap size is a multiple of 3, a "*" is displayed; other gap sizes are indicated by "+".

Codon translation is available in base-level display mode if the displayed region is identified as a coding segment. To display this annotation, select the species for translation from the pull-down menu in the Codon Translation configuration section at the top of the page. Then, select one of the following modes:

  • No codon translation: The gene annotation is not used; the bases are displayed without translation.
  • Use default species reading frames for translation: The annotations from the genome displayed in the Default species to establish reading frame pull-down menu are used to translate all the aligned species present in the alignment.
  • Use reading frames for species if available, otherwise no translation: Codon translation is performed only for those species where the region is annotated as protein coding.
  • Use reading frames for species if available, otherwise use default species: Codon translation is done on those species that are annotated as being protein coding over the aligned region using species-specific annotation; the remaining species are translated using the default species annotation.

Codon translation uses the following gene tracks as the basis for translation:

Gene TrackSpecies
UCSC GenesHuman, Mouse
RefSeq GenesCow, Frog (X. tropicalis)
Ensembl Genes v73Atlantic cod, Bushbaby, Cat, Chicken, Chimp, Coelacanth, Dog, Elephant, Ferret, Fugu, Gorilla, Horse, Lamprey, Lizard, Mallard duck, Marmoset, Medaka, Megabat, Microbat, Orangutan, Panda, Pig, Platypus, Rat, Soft-shell Turtle, Southern platyfish, Squirrel, Tasmanian devil, Tetraodon, Zebrafish
no annotationAardvark, Alpaca, American alligator, Armadillo, Baboon, Bactrian camel, Big brown bat, Black flying-fox, Brush-tailed rat, Budgerigar, Burton's mouthbreeder, Cape elephant shrew, Cape golden mole, Chinchilla, Chinese hamster, Chinese tree shrew, Collared flycatcher, Crab-eating macaque, David's myotis (bat), Dolphin, Domestic goat, Gibbon, Golden hamster, Green monkey, Green seaturtle, Hedgehog, Killer whale, Lesser Egyptian jerboa, Manatee, Medium ground finch, Mexican tetra (cavefish), Naked mole-rat, Nile tilapia, Pacific walrus, Painted turtle, Parrot, Peregrine falcon, Pika, Prairie vole, Princess of Burundi, Pundamilia nyererei, Rhesus, Rock pigeon, Saker falcon, Scarlet Macaw, Sheep, Shrew, Spiny softshell turtle, Spotted gar, Squirrel monkey, Star-nosed mole, Tawny puffer fish, Tenrec, Tibetan antelope, Tibetan ground jay, Wallaby, Weddell seal, White rhinoceros, White-throated sparrow, Zebra Mbuna, Zebra finch
Table 2. Gene tracks used for codon translation.

Methods

Pairwise alignments with the human genome were generated for each species using lastz from repeat-masked genomic sequence. Lineage-specific repeats were removed prior to alignment, then reinserted. Pairwise alignments were then linked into chains using a dynamic programming algorithm that finds maximally scoring chains of gapless subsections of the alignments organized in a kd-tree. The scoring matrix and parameters for pairwise alignment and chaining were tuned for each species based on phylogenetic distance from the reference. High-scoring chains were then placed along the genome, with gaps filled by lower-scoring chains, to produce an alignment net. For more information about the chaining and netting process and parameters for each species, see the description pages for the Chain and Net tracks.

An additional filtering step was introduced in the generation of the 100-way conservation track to reduce the number of paralogs and pseudogenes from the high-quality assemblies and the suspect alignments from the low-quality assemblies: the pairwise alignments of high-quality mammalian sequences (placental and marsupial) were filtered based on synteny; those for 2X mammalian genomes were filtered to retain only alignments of best quality in both the target and query ("reciprocal best").

The resulting best-in-genome pairwise alignments were progressively aligned using multiz/autoMZ, following the tree topology diagrammed above, to produce multiple alignments. The multiple alignments were post-processed to add annotations indicating alignment gaps, genomic breaks, and base quality of the component sequences. The annotated multiple alignments, in MAF format, are available for bulk download. An alignment summary table containing an entry for each alignment block in each species was generated to improve track display performance at large scales. Framing tables were constructed to enable visualization of codons in the multiple alignment display.

Phylogenetic Tree Model

Both phastCons and phyloP are phylogenetic methods that rely on a tree model containing the tree topology, branch lengths representing evolutionary distance at neutrally evolving sites, the background distribution of nucleotides, and a substitution rate matrix. The all-species tree model for this track was generated using the phyloFit program from the PHAST package (REV model, EM algorithm, medium precision) using multiple alignments of 4-fold degenerate sites extracted from the 100-way alignment (msa_view). The 4d sites were derived from the RefSeq (Reviewed+Coding) gene set, filtered to select single-coverage long transcripts.

This same tree model was used in the phyloP calculations; however, the background frequencies were modified to maintain reversibility. The resulting tree model: all species.

PhastCons Conservation

The phastCons program computes conservation scores based on a phylo-HMM, a type of probabilistic model that describes both the process of DNA substitution at each site in a genome and the way this process changes from one site to the next (Felsenstein and Churchill 1996, Yang 1995, Siepel and Haussler 2005). PhastCons uses a two-state phylo-HMM, with a state for conserved regions and a state for non-conserved regions. The value plotted at each site is the posterior probability that the corresponding alignment column was "generated" by the conserved state of the phylo-HMM. These scores reflect the phylogeny (including branch lengths) of the species in question, a continuous-time Markov model of the nucleotide substitution process, and a tendency for conservation levels to be autocorrelated along the genome (i.e., to be similar at adjacent sites). The general reversible (REV) substitution model was used. Unlike many conservation-scoring programs, phastCons does not rely on a sliding window of fixed size; therefore, short highly-conserved regions and long moderately conserved regions can both obtain high scores. More information about phastCons can be found in Siepel et al. 2005.

The phastCons parameters used were: expected-length=45, target-coverage=0.3, rho=0.3.

PhyloP Conservation

The phyloP program supports several different methods for computing p-values of conservation or acceleration, for individual nucleotides or larger elements ( http://compgen.cshl.edu/phast/). Here it was used to produce separate scores at each base (--wig-scores option), considering all branches of the phylogeny rather than a particular subtree or lineage (i.e., the --subtree option was not used). The scores were computed by performing a likelihood ratio test at each alignment column (--method LRT), and scores for both conservation and acceleration were produced (--mode CONACC).

Conserved Elements

The conserved elements were predicted by running phastCons with the --viterbi option. The predicted elements are segments of the alignment that are likely to have been "generated" by the conserved state of the phylo-HMM. Each element is assigned a log-odds score equal to its log probability under the conserved model minus its log probability under the non-conserved model. The "score" field associated with this track contains transformed log-odds scores, taking values between 0 and 1000. (The scores are transformed using a monotonic function of the form a * log(x) + b.) The raw log odds scores are retained in the "name" field and can be seen on the details page or in the browser when the track's display mode is set to "pack" or "full".

Credits

This track was created using the following programs:

  • Alignment tools: lastz (formerly blastz) and multiz by Minmei Hou, Scott Schwartz and Webb Miller of the Penn State Bioinformatics Group
  • Chaining and Netting: axtChain, chainNet by Jim Kent at UCSC
  • Conservation scoring: phastCons, phyloP, phyloFit, tree_doctor, msa_view and other programs in PHAST by Adam Siepel at Cold Spring Harbor Laboratory (original development done at the Haussler lab at UCSC).
  • MAF Annotation tools: mafAddIRows by Brian Raney, UCSC; mafAddQRows by Richard Burhans, Penn State; genePredToMafFrames by Mark Diekhans, UCSC
  • Tree image generator: phyloPng by Galt Barber, UCSC
  • Conservation track display: Kate Rosenbloom, Hiram Clawson (wiggle display), and Brian Raney (gap annotation and codon framing) at UCSC

The phylogenetic tree is based on Murphy et al. (2001) and general consensus in the vertebrate phylogeny community. Thanks to Giacomo Bernardi for help with the fish relationships.

References

Phylo-HMMs, phastCons, and phyloP:

Felsenstein J, Churchill GA. A Hidden Markov Model approach to variation among sites in rate of evolution. Mol Biol Evol. 1996 Jan;13(1):93-104. PMID: 8583911

Pollard KS, Hubisz MJ, Rosenbloom KR, Siepel A. Detection of nonneutral substitution rates on mammalian phylogenies. Genome Res. 2010 Jan;20(1):110-21. PMID: 19858363; PMC: PMC2798823

Siepel A, Bejerano G, Pedersen JS, Hinrichs AS, Hou M, Rosenbloom K, Clawson H, Spieth J, Hillier LW, Richards S, et al. Evolutionarily conserved elements in vertebrate, insect, worm, and yeast genomes. Genome Res. 2005 Aug;15(8):1034-50. PMID: 16024819; PMC: PMC1182216

Siepel A, Haussler D. Phylogenetic Hidden Markov Models. In: Nielsen R, editor. Statistical Methods in Molecular Evolution. New York: Springer; 2005. pp. 325-351.

Yang Z. A space-time process model for the evolution of DNA sequences. Genetics. 1995 Feb;139(2):993-1005. PMID: 7713447; PMC: PMC1206396

Chain/Net:

Kent WJ, Baertsch R, Hinrichs A, Miller W, Haussler D. Evolution's cauldron: duplication, deletion, and rearrangement in the mouse and human genomes. Proc Natl Acad Sci U S A. 2003 Sep 30;100(20):11484-9. PMID: 14500911; PMC: PMC208784

Multiz:

Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, Green ED, et al. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res. 2004 Apr;14(4):708-15. PMID: 15060014; PMC: PMC383317

Lastz (formerly Blastz):

Chiaromonte F, Yap VB, Miller W. Scoring pairwise genomic sequence alignments. Pac Symp Biocomput. 2002:115-26. PMID: 11928468

Harris RS. Improved pairwise alignment of genomic DNA. Ph.D. Thesis. Pennsylvania State University, USA. 2007.

Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W. Human-mouse alignments with BLASTZ. Genome Res. 2003 Jan;13(1):103-7. PMID: 12529312; PMC: PMC430961

Phylogenetic Tree:

Murphy WJ, Eizirik E, O'Brien SJ, Madsen O, Scally M, Douady CJ, Teeling E, Ryder OA, Stanhope MJ, de Jong WW, Springer MS. Resolution of the early placental mammal radiation using Bayesian phylogenetics. Science. 2001 Dec 14;294(5550):2348-51. PMID: 11743200