Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 38 in window, 101543484 - 101543533, 50 bps 
B D                     Human  tc-----tca------ggagg--ggcatgaaactccctgcaggaagacaaggccctaagtcgg
B D                     Chimp  tc-----tca------ggagg--ggcatgaaactccctgcaggaagacaaggccctaagtcgg
B D                   Gorilla  tc-----tca------ggagg--ggcatgaaactccctgcaggaagacaaggccctaagtcgg
B D                 Orangutan  tc-----tcg------ggagg--ggcatgaaactccctgcaggaggacaaggccctaagtcgg
B D                    Gibbon  tc-----ttg------ggagg--ggcctgaaactccctgcaggaggacaaggctctaagtcgg
B D                    Rhesus  tc-----tcg------ggagg--ggcatgaaactccctgcagcaggacaaggccctatgtcag
B D       Crab-eating macaque  tc-----tcg------ggagg--ggcatgaaactccctgcagcaggacaaggccctatgtcag
B D                    Baboon  tc-----tcg------ggagg--ggcatgaaactccctgcagcaggacaaggccctgcgtcag
B D              Green monkey  tc-----tcg------ggagg--ggcatgaaactccctgcagcaggacaaggccctacgtcag
B D                  Marmoset  tc-----tcg------ggagg--gacacagaact-gctgcaggaggacaaggccctcggtcag
B D           Squirrel monkey  tc-----tcg------ggagg--gacacggagct-gctgcaggaggacaaggccttcagtcag
B D                  Bushbaby  tc-----ttg------gggga--agtatcagcctcccc-taggaaaatatagctctggtggga
B D                  Squirrel  tc-----ttg------ggaga--gagg----act-----aaggaggctggaggcctg------
B D                    Rabbit  tc-----ctg------ggagg--ggcg------t-----caggaggacacagccctga-----
B D                       Pig  tc-----tcg------ggaag--ag--------cacccagc------------cctgggaggt
B D                   Dolphin  tc-----tca------ggaag--gccac-gggccacccctaggacgac-----cccctggggt
                 Killer whale  tc-----tca------ggaag--gccac-gggccacccctaggacgac-----cccctggggt
             Tibetan antelope  gg---ctctgacaccgtgaag--at-----ggctactcagaaa-taaag----tatcgtgcgt
B D                       Cow  tc---cccca------ggacg--ac-----ccctagctgga----------------------
B D                     Sheep  tctgacaccg------tgaag--ac-----ggctactcagaaataaag-----tat----cgc
                Domestic goat  tctgacaccg------tgaag--ac-----ggctactcagaaataaag-----tatcgtgcgt
B D                     Horse  tc-----tc-------acaag--ggcgtcagcctccccacaagcggacacagccctgtggggt
B D          White rhinoceros  cc-----tcg------ggaag--ggcatcggcctccccacaagaggacacagccccgtggggt
B D                       Dog  tc-----tcg------ggcag--ggcatctgcctccccacgggaggacacagccgtgcaggga
B D                     Panda  tc-----tca------ggcgg--ggcattggcctccccacaggaggacacaaccccgcagggt
               Pacific walrus  tc-----gca------ggcag--ggcattggcctctccacgggaggacacagccctgcacagt
                 Weddell seal  tc-----tcg------ggcag--ggcattggcctgtccacgggaggacacagccctgcatggt
                Big brown bat  tc-----ggg------gggag--ggcatgggtctccccagaggaggacagaa-----------
         David's myotis (bat)  tc-----tgg------ggcag--ggcacgggtctccccacaggaggacagaa-----------
B D                  Microbat  tc-----tgg------ggcag--ggcacgggtctccccacaggaggacagaa-----------
B D                   Opossum  gc-----ttc------accgc--ggctctgaccg---tacaggaggcccgagccccactccgg
B D        American alligator  tc-----cag------gggagaaggggtggggcttagggaaagggggcagggcttcatactca
B D             X. tropicalis  ac-----tca------ggaat--agaaaggaacgggatggagagggtcaagaaccaggaatag
B D                     Mouse  ===============================================================
B D                       Rat  ===============================================================
      Lesser Egyptian jerboa  ===============================================================
B D                    Tenrec  ===============================================================
         Cape elephant shrew  ===============================================================
B D                  Hedgehog  ===============================================================
B D                     Shrew  ===============================================================
                Prairie vole  ===============================================================
              Golden hamster  ===============================================================
B D           Chinese hamster  ===============================================================
             Star-nosed mole  ===============================================================
B D                      Pika  ===============================================================
B D                   Ferret   ===============================================================
B D                   Manatee  ===============================================================
B D                 Armadillo  ===============================================================
B D                    Alpaca  ===============================================================
              Bactrian camel  ===============================================================
            Black flying-fox  ===============================================================
B D                       Cat  ===============================================================
B D                  Elephant  ===============================================================
B D                Guinea pig  ===============================================================
            Brush-tailed rat  ===============================================================
B D            Naked mole-rat  ===============================================================
                  Chinchilla  ===============================================================
          Chinese tree shrew  ===============================================================
B D                   Chicken  ===============================================================
B D                Budgerigar  ===============================================================
          Tibetan ground jay  ===============================================================
  D          Peregrine falcon  ===============================================================
  D              Saker falcon  ===============================================================
  D               Rock pigeon  ===============================================================
B D       Medium ground finch  ===============================================================
  D              Mallard duck  ===============================================================
B D                   Wallaby  ===============================================================
  D    White-throated sparrow  ===============================================================
                    Aardvark  ===============================================================
            Cape golden mole  ===============================================================
B D                   Megabat  ===============================================================
  D  Chinese softshell turtle  ===============================================================
  D            Painted turtle  ===============================================================
  D           Green seaturtle  ===============================================================
B D           Tasmanian devil  ===============================================================
B D                  Platypus  ===============================================================
B D               Zebra finch  ===============================================================
  D       Collared flycatcher  ===============================================================

Inserts between block 1 and 2 in window
B D                  Opossum 3655bp
B D       American alligator 5bp

Alignment block 2 of 38 in window, 101543534 - 101543566, 33 bps 
B D                     Human  gaa-------------caaaagaggctgg----------------gagtgtggattccctga
B D                     Chimp  gaa-------------caaaagaggctgg----------------gagtgtggattccctga
B D                   Gorilla  gaa-------------caaaagaggctgg----------------gagtgtggattccctga
B D                 Orangutan  gaa-------------caaaagaggctgg----------------gagtgtggattccctga
B D                    Gibbon  gaa-------------cataagaggctgg----------------gagtgtggattccctga
B D                    Rhesus  gaa-------------caaaagagactgg----------------gagtatggattcc--aa
B D       Crab-eating macaque  gaa-------------caaaagagactgg----------------gagtatggattcc--aa
B D                    Baboon  gaa-------------caaaagagactgg----------------gagtatggattcc--aa
B D              Green monkey  gaa-------------caaaagaggctgg----------------gagtatggattcc--aa
B D                  Marmoset  gaa-------------caaaagaggccag----------------gagtatggattccccaa
B D           Squirrel monkey  gaa-------------gaaaagaggccgg----------------gagta-----tccccaa
B D                  Bushbaby  gga-------------caaaagatactgg----------------aactctggactccacca
B D                  Squirrel  ------------------------------------------------------------ga
B D                    Rabbit  ------------------------------------------------------------gg
B D                       Pig  ggatg----------------------ga----------------ggc-ctggacgccccaa
B D                   Dolphin  gga-------------caggggagcctga----------------agg-ctggacttcccaa
                 Killer whale  gga-------------caggggagcctga----------------agg-ctggacttcccaa
             Tibetan antelope  gcgtgctcagacgcttcaattgtgtccgactcctagccactctacaga-ctactgcccgctg
B D                       Cow  ----------------cagaggagcctga----------------agg-ctgcactccccga
B D                     Sheep  gcatgctcagacgcttcag-tgtgtctgactccttgctactctacaga-ctgccgcccgctg
                Domestic goat  gcgtgctcagatgcttcagttgtgtctgactcctagccactctacaga-ctgccgcccgctg
B D                     Horse  gga-------------cagagggatctgg----------------aga-ctggactccccga
B D          White rhinoceros  gga-------------cagagaaggctga----------------aggcctggactccccga
B D                       Dog  gga-------------cggaggagcatgg----------------agaccagtactccctga
B D                     Panda  gga-------------gagaggagactgg----------------agacctgcaccccatga
               Pacific walrus  gga-------------cagaggagcctgg----------------acacctgcacgccctga
                 Weddell seal  gga-------------cagaggagcctgg----------------agacctgcacgccctga
                Big brown bat  ------------------------------------------------------------ga
         David's myotis (bat)  ------------------------------------------------------------ga
B D                  Microbat  ------------------------------------------------------------ga
B D        American alligator  ---------------------------------------------------gaacttctggc
B D             X. tropicalis  aaa-------------ggaacgggacaga----------------gagggtgaagaaccaga
B D                     Mouse  ==============================================================
B D                       Rat  ==============================================================
      Lesser Egyptian jerboa  ==============================================================
B D                    Tenrec  ==============================================================
         Cape elephant shrew  ==============================================================
B D                  Hedgehog  ==============================================================
B D                     Shrew  ==============================================================
                Prairie vole  ==============================================================
              Golden hamster  ==============================================================
B D           Chinese hamster  ==============================================================
             Star-nosed mole  ==============================================================
B D                      Pika  ==============================================================
B D                   Ferret   ==============================================================
B D                   Manatee  ==============================================================
B D                 Armadillo  ==============================================================
B D                    Alpaca  ==============================================================
              Bactrian camel  ==============================================================
            Black flying-fox  ==============================================================
B D                       Cat  ==============================================================
B D                  Elephant  ==============================================================
B D                Guinea pig  ==============================================================
            Brush-tailed rat  ==============================================================
B D            Naked mole-rat  ==============================================================
                  Chinchilla  ==============================================================
          Chinese tree shrew  ==============================================================
B D                   Chicken  ==============================================================
B D                Budgerigar  ==============================================================
          Tibetan ground jay  ==============================================================
  D          Peregrine falcon  ==============================================================
  D              Saker falcon  ==============================================================
  D               Rock pigeon  ==============================================================
B D       Medium ground finch  ==============================================================
  D              Mallard duck  ==============================================================
B D                   Wallaby  ==============================================================
  D    White-throated sparrow  ==============================================================
                    Aardvark  ==============================================================
            Cape golden mole  ==============================================================
B D                   Megabat  ==============================================================
  D  Chinese softshell turtle  ==============================================================
  D            Painted turtle  ==============================================================
  D           Green seaturtle  ==============================================================
B D           Tasmanian devil  ==============================================================
B D                   Opossum  ==============================================================
B D                  Platypus  ==============================================================
B D               Zebra finch  ==============================================================
  D       Collared flycatcher  ==============================================================

Alignment block 3 of 38 in window, 101543567 - 101543636, 70 bps 
B D                     Human  gcacacgcaccac----agacccacaga---gg---------------------c--ctccagaaaag-t
B D                     Chimp  gcacatgcaccac----agacccacaga---gg---------------------c--ctccagaaaag-t
B D                   Gorilla  gcacacgcaccac----agacccacaga---gg---------------------c--ctccagaaaag-t
B D                 Orangutan  gcacacgcaccac----aggcccacagg---ag---------------------c--ctccagaaaag-t
B D                    Gibbon  gcacatgcaccac----agacccacagc---ag---------------------c--ctccagaaaag-t
B D                    Rhesus  gcacacgcaccac----agatccacagg---ag---------------------c--ctccagaaaag-t
B D       Crab-eating macaque  gcacacgcaccac----agatccacagg---ag---------------------c--ctccagaaaag-t
B D                    Baboon  gcacacgcaccac----agatccacagg---ag---------------------c--ctccagaaaag-t
B D              Green monkey  gcacgcgcaccac----agatccacagg---ag---------------------c--ctccagaaaag-t
B D                  Marmoset  gcgcatgagccat----agacccacagg---ag---------------------c--ctccagaaagc-t
B D           Squirrel monkey  gcacaggcaccac----agacccacggg---ag---------------------c--ctccagaaagc-t
B D                  Bushbaby  gcatctgcactgt----aaacacacaag---ga---------------------a--cttt---gaag-t
B D                  Squirrel  cta-------------------cccagc---ag---------------------ctgccccagacagg-t
B D                    Rabbit  gca-------------------caaagg---ag---------------------c--ccccagcctgg-g
B D                       Pig  gggtccccacccc----agacccactaa--cag---------------------c--cttaagacctg-t
B D                   Dolphin  gggtccccaccct----agacccacaaa--cag---------------------c--cttgggaccag-c
                 Killer whale  gggtccccaccct----agacccacaaa--cag---------------------c--cttgggaccag-c
             Tibetan antelope  ggctcctctgtccatgggatcctccggg--caaggacactggagtgggttgatct--tctcgaccccg-g
B D                       Cow  aggtccccacccc----ggacccacaag--cag---------------------c--cttggaaccag-c
B D                     Sheep  ggctcctctgtccatggggtcctccagg--caaggacactggagtgggttgatct--tctcgacccag-g
                Domestic goat  ggctcctctgtccatggggccctccagg--caaggacactggagtgggttgatct--tctcgacccag-g
B D                     Horse  gtggccacacccc----g-acctgtgaa--cag---------------------c--cttgggacctg-t
B D          White rhinoceros  acctccacacccc----g-acccac-aa--cag---------------------c--cttgagacccg-t
B D                       Dog  gtgtcggcacccc----acacccacaag--cag---------------------c--cttcagaccgg-t
B D                     Panda  gtgtcagtacccc----acacccgcaag--cag---------------------c--ctaaagaccag-a
               Pacific walrus  gtgtcaggccccc----acacctgcaag--cag---------------------c--cttaagaccag-a
                 Weddell seal  gtgtcagcccccc----acagccgcaaa--cag---------------------c--cttaagaccagaa
                Big brown bat  gcatccacaccac----agacctacaca--cag---------------------c--ctagagaccag-t
         David's myotis (bat)  tcacccacaccac----agacccgcaga--cag---------------------c--ctagagaccag-t
B D                  Microbat  gcatccacaccac----agacctgcaga--cag---------------------c--ctagagaccag-t
B D        American alligator  gggggcg-gcacc----gtgcccacaacaccac---------------------g--ccccccactag-g
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
                Prairie vole  ======================================================================
              Golden hamster  ======================================================================
B D           Chinese hamster  ======================================================================
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
B D                   Ferret   ======================================================================
B D                   Manatee  ======================================================================
B D                 Armadillo  ======================================================================
B D                    Alpaca  ======================================================================
              Bactrian camel  ======================================================================
            Black flying-fox  ======================================================================
B D                       Cat  ======================================================================
B D                  Elephant  ======================================================================
B D                Guinea pig  ======================================================================
            Brush-tailed rat  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
          Chinese tree shrew  ======================================================================
B D                   Chicken  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
  D              Mallard duck  ======================================================================
B D                   Wallaby  ======================================================================
  D    White-throated sparrow  ======================================================================
                    Aardvark  ======================================================================
            Cape golden mole  ======================================================================
B D                   Megabat  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
B D                  Platypus  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================

                        Human  ccc--------t-----------------accc-tctctgggcctcaatttaccagc---
                        Chimp  ccc--------t-----------------accc-tctctgggcctcaatttaccagc---
                      Gorilla  ccc--------t-----------------accc-tctctgggcctcaatttaccagc---
                    Orangutan  ccc--------t-----------------accc-tctctgggcctcaatttaccagc---
                       Gibbon  ccc--------t-----------------gccc-tctctgggcctcaattgaccagc---
                       Rhesus  ccc--------t-----------------accc-tctctgggcctcagtttaccagc---
          Crab-eating macaque  ccc--------t-----------------accc-tctctgggcctcagtttaccagc---
                       Baboon  ccc--------t-----------------accc-tctctgggcctcagtttaccagc---
                 Green monkey  ccc--------t-----------------accc-tctctgggcctcagtttaccagc---
                     Marmoset  tcc--------t-----------------accc-tttctgggcctcagtttaccagc---
              Squirrel monkey  ccc--------c-----------------accc-tctctgggcctcagtttaccagc---
                     Bushbaby  tcc--------t-----------------tcct-tctctggatttca-ttcaccatc---
                     Squirrel  cct--------t------------------cct-gctgtgggtctcagctcact-tc---
                       Rabbit  ctc--------ctggaacacctgcagccagcct-gccgggcgcctc--------------
                          Pig  ccc-----------------------------t-cccctgcgtctcagccccacctc---
                      Dolphin  cgc-----------------------------c-accctgcgtctcagttcatcccc---
                 Killer whale  cgc-----------------------------c-accctgcgtctcagttcatcccc---
             Tibetan antelope  gct-----------------------------tgaacctgcgtctcttctgtccacc---
                          Cow  ccg-----------------------------c-agcctgcatctc-cctttacccc---
                        Sheep  gct-----------------------------cgaacctgtgtctcttctgtccacc---
                Domestic goat  gct-----------------------------cgaacctgcgtctcttctgtccacc---
                        Horse  -------------------------------------------ctccattcaccatc---
             White rhinoceros  ccc-------tt-----------------cccc-tctctggggctcagttcaccatc---
                          Dog  ccc--------t-----------------cccc-tcgccgggtctcagttcac---c---
                        Panda  ccc--------c-----------------cccc-accccggctcttggttcac---c---
               Pacific walrus  ccc--------------------------------ccccgtctctcagttcac---c---
                 Weddell seal  ccc--------------------------------ccctggctctcagttcac---c---
                Big brown bat  ccc--------------------------tccc-tctctggttcccggatcaa---c---
         David's myotis (bat)  ccc--------------------------tccc-tct-cgggcctcagatcca-------
                     Microbat  ccc--------------------------tccc-tctccgggcctcggatcca-------
           American alligator  gccagcaaggct-----------------actc-cccccatggcaccgcccaccgccagc
                        Mouse  ============================================================
                          Rat  ============================================================
       Lesser Egyptian jerboa  ============================================================
                       Tenrec  ============================================================
          Cape elephant shrew  ============================================================
                     Hedgehog  ============================================================
                        Shrew  ============================================================
                 Prairie vole  ============================================================
               Golden hamster  ============================================================
              Chinese hamster  ============================================================
              Star-nosed mole  ============================================================
                         Pika  ============================================================
                      Ferret   ============================================================
                      Manatee  ============================================================
                    Armadillo  ============================================================
                       Alpaca  ============================================================
               Bactrian camel  ============================================================
             Black flying-fox  ============================================================
                          Cat  ============================================================
                     Elephant  ============================================================
                   Guinea pig  ============================================================
             Brush-tailed rat  ============================================================
               Naked mole-rat  ============================================================
                   Chinchilla  ============================================================
           Chinese tree shrew  ============================================================
                      Chicken  ============================================================
                   Budgerigar  ============================================================
           Tibetan ground jay  ============================================================
             Peregrine falcon  ============================================================
                 Saker falcon  ============================================================
                  Rock pigeon  ============================================================
          Medium ground finch  ============================================================
                 Mallard duck  ============================================================
                      Wallaby  ============================================================
       White-throated sparrow  ============================================================
                     Aardvark  ============================================================
             Cape golden mole  ============================================================
                      Megabat  ============================================================
     Chinese softshell turtle  ============================================================
               Painted turtle  ============================================================
              Green seaturtle  ============================================================
              Tasmanian devil  ============================================================
                      Opossum  ============================================================
                     Platypus  ============================================================
                  Zebra finch  ============================================================
          Collared flycatcher  ============================================================

Alignment block 4 of 38 in window, 101543637 - 101543645, 9 bps 
B D                     Human  ---tgtgaaag-g
B D                     Chimp  ---tgtgaaag-g
B D                   Gorilla  ---tgtgaaag-g
B D                 Orangutan  ---tgtgaaag-g
B D                    Gibbon  ---tgttaaag-g
B D                    Rhesus  ---tgtgaaag-g
B D       Crab-eating macaque  ---tgtgaaag-g
B D                    Baboon  ---tgtgaaag-g
B D              Green monkey  ---tgtgaaag-g
B D                  Marmoset  ---tgtgaaag-g
B D           Squirrel monkey  ---tgtgaaag-g
B D                  Bushbaby  ---tgtaaaag-a
B D                  Squirrel  ---tgtaaccc-g
B D                    Rabbit  ----gagacca-g
B D                       Pig  ---cgtcccgt-g
B D                   Dolphin  ---tgtaagaa-g
                 Killer whale  ---tgtaagaa-g
             Tibetan antelope  ---tgccaggc-g
B D                       Cow  ---tgtaagaa-g
B D                     Sheep  ---tgccaggc-g
                Domestic goat  ---tgccaggc-g
B D                     Horse  ---tgtagaaa-g
B D          White rhinoceros  ---tgtaacaa-g
B D                       Dog  ---tctaaaaa-g
B D                     Panda  ---tcgaaaaa-g
               Pacific walrus  ---tctaaaaagg
                 Weddell seal  ---tctaaaaa-g
B D        American alligator  tgctgcccc----
B D                     Mouse  =============
B D                       Rat  =============
      Lesser Egyptian jerboa  =============
B D                    Tenrec  =============
         Cape elephant shrew  =============
B D                  Hedgehog  =============
B D                     Shrew  =============
                Prairie vole  =============
              Golden hamster  =============
B D           Chinese hamster  =============
             Star-nosed mole  =============
B D                      Pika  =============
B D                   Ferret   =============
        David's myotis (bat)  -------------
B D                   Manatee  =============
B D                  Microbat  -------------
               Big brown bat  -------------
B D                 Armadillo  =============
B D                    Alpaca  =============
              Bactrian camel  =============
            Black flying-fox  =============
B D                       Cat  =============
B D                  Elephant  =============
B D                Guinea pig  =============
            Brush-tailed rat  =============
B D            Naked mole-rat  =============
                  Chinchilla  =============
          Chinese tree shrew  =============
B D                   Chicken  =============
B D                Budgerigar  =============
          Tibetan ground jay  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
  D               Rock pigeon  =============
B D       Medium ground finch  =============
  D              Mallard duck  =============
B D                   Wallaby  =============
  D    White-throated sparrow  =============
                    Aardvark  =============
            Cape golden mole  =============
B D                   Megabat  =============
  D  Chinese softshell turtle  =============
  D            Painted turtle  =============
  D           Green seaturtle  =============
B D           Tasmanian devil  =============
B D                   Opossum  =============
B D                  Platypus  =============
B D               Zebra finch  =============
  D       Collared flycatcher  =============

Inserts between block 4 and 5 in window
B D                   Rhesus 10bp
B D      Crab-eating macaque 10bp
B D                   Baboon 10bp
B D             Green monkey 10bp
B D                 Marmoset 10bp
B D          Squirrel monkey 10bp
B D                 Bushbaby 10bp
B D                 Squirrel 9bp
B D                   Rabbit 3bp
B D                      Pig 6bp
            Tibetan antelope 5bp
B D                      Cow 266bp
B D                    Sheep 5bp
               Domestic goat 5bp
B D                    Horse 10bp
B D         White rhinoceros 10bp
B D                      Dog 10bp
B D                    Panda 10bp
              Pacific walrus 10bp
                Weddell seal 10bp

Alignment block 5 of 38 in window, 101543646 - 101543665, 20 bps 
B D                     Human  accacctcatatcct---------------------ccca-g
B D                     Chimp  accacctcatatcct---------------------ccca-g
B D                   Gorilla  accaactcatatcct---------------------ccca-g
B D                 Orangutan  accatctcatatcct---------------------ccca-g
B D                    Gibbon  accacctcatatcct---------------------ccca-g
B D                    Rhesus  accacctcatatcct---------------------ccca-g
B D       Crab-eating macaque  accacctcatatcct---------------------ccca-g
B D                    Baboon  accacctcatatcct---------------------ccca-g
B D              Green monkey  accacctcatatcct---------------------ccca-g
B D                  Marmoset  accacctcatatcct---------------------ccca-g
B D           Squirrel monkey  accgcctcatatcct---------------------ccca-g
B D                  Bushbaby  acactcacactcaca---------------------ctca-c
B D                  Squirrel  ---gcctcgtatcca---------------------ct----
B D                    Rabbit  -----cccccaccag---------------------cc----
B D                       Pig  -gccactctgacccccgcgaggatggtgattctgaaataa--
B D                   Dolphin  ggcggctctgaccct---------------------atgag-
                 Killer whale  ggcggctctgaccct---------------------atgag-
             Tibetan antelope  ttcgcccctagcacc---------------------acca--
B D                     Sheep  tttgcccctagcacc---------------------acca--
                Domestic goat  ttcgcccctagcacc---------------------acca--
B D                     Horse  agcacctcaccc-cc---------------------ttag-g
B D          White rhinoceros  agcacctcacacgca---------------------tgag-g
B D                       Dog  agcacctcacacccg---------------------ctga-g
B D                     Panda  agcgcctcacaccca---------------------ttaa-g
               Pacific walrus  agcacctcacaccca---------------------ttaa-g
                 Weddell seal  agcacctcacaccca---------------------ttga-g
                Big brown bat  --cacctcacacctg---------------------ttgg-a
         David's myotis (bat)  --catctcacgcctg---------------------ttag-a
B D                  Microbat  --catctcacacctg---------------------ttag-a
B D        American alligator  ccagccccaggtctc---------------------ccc---
B D                     Mouse  ==========================================
B D                       Rat  ==========================================
      Lesser Egyptian jerboa  ==========================================
B D                    Tenrec  ==========================================
         Cape elephant shrew  ==========================================
B D                  Hedgehog  ==========================================
B D                     Shrew  ==========================================
                Prairie vole  ==========================================
              Golden hamster  ==========================================
B D           Chinese hamster  ==========================================
             Star-nosed mole  ==========================================
B D                      Pika  ==========================================
B D                   Ferret   ==========================================
B D                   Manatee  ==========================================
B D                       Cow  ==========================================
B D                 Armadillo  ==========================================
B D                    Alpaca  ==========================================
              Bactrian camel  ==========================================
            Black flying-fox  ==========================================
B D                       Cat  ==========================================
B D                  Elephant  ==========================================
B D                Guinea pig  ==========================================
            Brush-tailed rat  ==========================================
B D            Naked mole-rat  ==========================================
                  Chinchilla  ==========================================
          Chinese tree shrew  ==========================================
B D                   Chicken  ==========================================
B D                Budgerigar  ==========================================
          Tibetan ground jay  ==========================================
  D          Peregrine falcon  ==========================================
  D              Saker falcon  ==========================================
  D               Rock pigeon  ==========================================
B D       Medium ground finch  ==========================================
  D              Mallard duck  ==========================================
B D                   Wallaby  ==========================================
  D    White-throated sparrow  ==========================================
                    Aardvark  ==========================================
            Cape golden mole  ==========================================
B D                   Megabat  ==========================================
  D  Chinese softshell turtle  ==========================================
  D            Painted turtle  ==========================================
  D           Green seaturtle  ==========================================
B D           Tasmanian devil  ==========================================
B D                   Opossum  ==========================================
B D                  Platypus  ==========================================
B D               Zebra finch  ==========================================
  D       Collared flycatcher  ==========================================

Inserts between block 5 and 6 in window
B D                      Pig 6bp
B D                  Dolphin 25bp
                Killer whale 25bp
            Tibetan antelope 6bp
B D                    Sheep 6bp
               Domestic goat 6bp
B D                    Horse 10bp
B D         White rhinoceros 10bp
B D                      Dog 10bp
B D                    Panda 10bp
              Pacific walrus 10bp
                Weddell seal 10bp
               Big brown bat 10bp
        David's myotis (bat) 10bp
B D                 Microbat 10bp

Alignment block 6 of 38 in window, 101543666 - 101543713, 48 bps 
B D                     Human  aa--------------aaagaaag----------------------------agga---ga-aaaga---
B D                     Chimp  aa--------------aaagaaag----------------------------agaa---ga-aaaga---
B D                   Gorilla  aa--------------aaaggaag----------------------------agaa---ga-aaaga---
B D                 Orangutan  aa--------------aaagaaag----------------------------agaa---ga-aaaga---
B D                    Gibbon  aa--------------aaagaaag----------------------------agaa---ga-aaaga---
B D                    Rhesus  aa--------------aaaggaag----------------------------cgaa---gg-aaaga---
B D       Crab-eating macaque  aa--------------aaaggaag----------------------------cgaa---gg-aaaga---
B D                    Baboon  aa--------------aaagaaag----------------------------cgaa---gg-aaaga---
B D              Green monkey  aa--------------aaagaaag----------------------------cgaa---gg-aaaga---
B D                  Marmoset  aa--------------aaggaaag----------------------------agga---ga-aaaga---
B D           Squirrel monkey  aa--------------aaggaaag----------------------------ggaa---ga-aaaga---
B D                  Bushbaby  tagggtggctactatcaagagagg----------------------------agaa---aa-aaaga---
           Chinese tree shrew  aa--------------ataggaag----------------------------aaaa---ga-aaggacct
B D                  Squirrel  -----------------aggacgt----------------------------gggg---ga-cagtg---
B D                    Rabbit  -------------------ggcgg----------------------------gggg---gg-cactg---
B D                       Pig  --------------------aaag----------------------------agaa---gc-aaaga---
B D                   Dolphin  --------------------aaag----------------------------aaaa---gg-aaaga---
                 Killer whale  --------------------aaag----------------------------aaaa---gg-aaaga---
             Tibetan antelope  --------------------aaag----------------------------agaa---ggaaaaga---
B D                       Cow  --------------------aaag----------------------------agaa---ggaaaaga---
B D                     Sheep  --------------------aaag----------------------------agaa---ggaaaaga---
                Domestic goat  --------------------caag----------------------------agaa---ggaaaaga---
B D                     Horse  --------------cgaaagaa------------------------------aaaa---gg-aaaga---
B D          White rhinoceros  --------------taaaataaaa------------------aat-------aaaa---gg-aaaga---
B D                       Dog  --------------taaaataaaa---------------taaaattcaaa--aaaacagga-aaaaa---
B D                     Panda  --------------taaaataaaa---------------taaaatctgaa--aaaa---aa-aaaaa---
               Pacific walrus  --------------taaaataaaataaaataaaataaagtaaaatttgaagaaaaa---aa-aaaaa---
                 Weddell seal  --------------taaaatataataaaataaaa-----taaaatttg----aaaa---aa-aaaaa---
                Big brown bat  --------------taaagtagaa---------------ttt----------aaga---ga-aaaga---
         David's myotis (bat)  --------------tgaagtaaca---------------tgt----------aaag---ga-aaaga---
B D                  Microbat  --------------taaagtaaaa---------------tgt----------aaag---ga-aaaga---
B D        American alligator  ---------------gagagccag----------------------------gggg---cc-agggc---
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
                Prairie vole  ======================================================================
              Golden hamster  ======================================================================
B D           Chinese hamster  ======================================================================
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
B D                   Ferret   ======================================================================
B D                   Manatee  ======================================================================
B D                 Armadillo  ======================================================================
B D                    Alpaca  ======================================================================
              Bactrian camel  ======================================================================
            Black flying-fox  ======================================================================
B D                       Cat  ======================================================================
B D                  Elephant  ======================================================================
B D                Guinea pig  ======================================================================
            Brush-tailed rat  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                   Chicken  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
  D              Mallard duck  ======================================================================
B D                   Wallaby  ======================================================================
  D    White-throated sparrow  ======================================================================
                    Aardvark  ======================================================================
            Cape golden mole  ======================================================================
B D                   Megabat  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
B D                  Platypus  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================

                        Human  -at----ga----tggtgaagat---gagagactggaac
                        Chimp  -at----ga----tggtgaagat---gagagactggaac
                      Gorilla  -at----ga----tggtgaagat---gagagactggaac
                    Orangutan  -at----ga----tggtgaagat---gagagactggaac
                       Gibbon  -at----ga----tggtgaagat---gagcaactggaac
                       Rhesus  -at----ca----tggtgaagat---gagaaactggaac
          Crab-eating macaque  -at----ca----tggtgaagat---gagaaactggaac
                       Baboon  -ac----ca----tggtgaagat---gagaaactggaac
                 Green monkey  -at----ca----tggtgaagat---gagaaactggaac
                     Marmoset  -ataaacga----tggcaaagag---gagaaactgaaac
              Squirrel monkey  -acaaacga----tggcaaagat---gagaaactgacac
                     Bushbaby  -ataagtga----cagcatagatatggagaaattggagc
           Chinese tree shrew  cat----gt----tgccaaagaggcagagaaattggagc
                     Squirrel  -gtgtgtgc----tggtgaagat---ggcc-ctgggagg
                       Rabbit  -acttcact----ccccttaggt---ggct--------g
                          Pig  -ac----aagtg-tgaggaggaggtggagaaataggggc
                      Dolphin  -ac----gagtg-tggtgagcatgcggagacatgggagc
                 Killer whale  -ac----gagtg-tggtgagcatgcggagacgtaggagc
             Tibetan antelope  -gc----aagtg-tgcggaggatgtgaagacacaggagc
                          Cow  -ac----aagtg-tg-ggaggacgtgaagacacaggagc
                        Sheep  -ag----aagtg-tgaggaggacatgaagacacaggagc
                Domestic goat  -ac----aagca-tgcggaggacgtggagacacaggagc
                        Horse  -ac----aagtg-tggcgaggatgtggagaaataggaag
             White rhinoceros  -ac----aagtg-tggcgaggctgtggagcaagaggaa-
                          Dog  -tc----aagtgttggtgaggatgtggagaaagaggaac
                        Panda  -gc----aagtgttggcgaggctatggggagacgggagc
               Pacific walrus  -gc----aagcgttggcgaggctgtggagaaacaggagc
                 Weddell seal  -gc----aagcgttggcgaggctgtggagaaacaggagc
                Big brown bat  -ac----aattg-tggtgaggac--------ataggaac
         David's myotis (bat)  -ac----aattg-tggtgaggatgtggagaaataggaac
                     Microbat  -ac----aa-tg-tagtgaggatgtggagaaataggaac
           American alligator  -ac----gg----tgctgcgaag---tgcaggctggggg
                        Mouse  =======================================
                          Rat  =======================================
       Lesser Egyptian jerboa  =======================================
                       Tenrec  =======================================
          Cape elephant shrew  =======================================
                     Hedgehog  =======================================
                        Shrew  =======================================
                 Prairie vole  =======================================
               Golden hamster  =======================================
              Chinese hamster  =======================================
              Star-nosed mole  =======================================
                         Pika  =======================================
                      Ferret   =======================================
                      Manatee  =======================================
                    Armadillo  =======================================
                       Alpaca  =======================================
               Bactrian camel  =======================================
             Black flying-fox  =======================================
                          Cat  =======================================
                     Elephant  =======================================
                   Guinea pig  =======================================
             Brush-tailed rat  =======================================
               Naked mole-rat  =======================================
                   Chinchilla  =======================================
                      Chicken  =======================================
                   Budgerigar  =======================================
           Tibetan ground jay  =======================================
             Peregrine falcon  =======================================
                 Saker falcon  =======================================
                  Rock pigeon  =======================================
          Medium ground finch  =======================================
                 Mallard duck  =======================================
                      Wallaby  =======================================
       White-throated sparrow  =======================================
                     Aardvark  =======================================
             Cape golden mole  =======================================
                      Megabat  =======================================
     Chinese softshell turtle  =======================================
               Painted turtle  =======================================
              Green seaturtle  =======================================
              Tasmanian devil  =======================================
                      Opossum  =======================================
                     Platypus  =======================================
                  Zebra finch  =======================================
          Collared flycatcher  =======================================

Inserts between block 6 and 7 in window
        David's myotis (bat) 300bp

Alignment block 7 of 38 in window, 101543714 - 101543788, 75 bps 
B D                     Human  -tcttg---tgcactaagttagtggggatgtgaaatgat---gtggcc-attacaggaaacagtgtggc-
B D                     Chimp  -tcttg---tacactacgttagtggggatgtgaaatgat---gtggcc-attacgggaaacagtgtggc-
B D                   Gorilla  -tcttg---tgcactaagttagtggggatgtgaaatgat---gtggcc-attacaggaaacagtgtggc-
B D                 Orangutan  -tctgg---tgcactaagttagtggggatgtgaaatgat---gtggcc-attacgggaaacagtgtggc-
B D                    Gibbon  -tcttg---tgcactaagttagtggggatgtgaaatgat---gtggcc-attgtgggaaacggtgtggc-
B D                    Rhesus  -ccttg---tgcactaagtcagtggggatgtgaaatgat---gtggcc-attatgggaaacagtgtggc-
B D       Crab-eating macaque  -ccttg---tgcactaagtcagtggggatgtgaaatgat---gtggcc-attatgggaaacagtgtggc-
B D                    Baboon  -ccttg---tgcactaagtcagtggggatgtgaaatgat---gtcgcc-attatgggaaacagtgtggc-
B D              Green monkey  -acttg---tgcactaagtcagtggggatgtgaaatgat---gtggcc-attatgggaaacagtgtggc-
B D                  Marmoset  -acttg---tgcat---gtcagcagggatgtaaaatggg---gcagcc-actgtggggaa--gggtggc-
B D           Squirrel monkey  -gctcg---tgcgt---gtccacgggaatgtaaaacaga---gcgacc--ccgtggggaa--gtgtggc-
B D                  Bushbaby  -tcttg---tgctcta---ctggggaaatataaaatgat---gtggcc-attatggaaaatagtatagt-
           Chinese tree shrew  -ccccg---tgcat---gctggggggacggccgcgtggc---atggcc-actgcagaggaaggtgcagc-
B D                  Squirrel  -cctcg---tgcactcgg--ggggggggcacaggacggt---gtggct-gt----ggggacag--cagc-
B D                    Rabbit  -cttca---gacaacaag--ggagaag-----aaagggt---gtgggc-gt----gggtggag-------
B D                       Pig  -cacccctgtgcacg--gtgggcacccgtgtccgttgca---gcagcc-gtgg----ggcgagtgcgga-
B D                   Dolphin  -ccctg---cgcatt--gttggtgcgaatgtcaaacggg---gcagag-gaggtagaggacagtacgga-
                 Killer whale  -ccctg---cgcatt--gttggtgcgaatgtcaaacggg---gcagag-gaggcagaggacagtacgga-
             Tibetan antelope  -ccccc--gtgtacc--gctggtgtgaatgccaagtggg---gcagcc-aagatggagaacaggatgga-
B D                       Cow  -ccccg---tgtacc--actggtgtgaatgccaagtggg---gcagcc-aaggtggagaacaggatgga-
B D                     Sheep  -ccccc--gtgtacc--accggtgtgaatgccaagtggg---gcagcc-aaggtggagaacaggatgga-
                Domestic goat  -ccccc---tgtacc--accggtgtgagtgccaagtggg---gcagcc-agggtggagaacaggacgga-
B D                     Horse  -ccctg---tgcgct--gttggtgggaatgtaaagtggt---gcagccgaagctgccgaccgggg-----
B D          White rhinoceros  -ccctg---tgcact--gttggtgggaatgtaaaatggc---gcagcccgaggtggagaacagtgtgga-
B D                       Dog  -ccccg---ggccct--gctggcgtg----------------acctcc-gaggtagagagcagcgtgga-
B D                     Panda  -gcc-----cgcgct--gtgggtgggcatgcaaaacggtgccgccgcc-gaggtaaagatcagtgtaga-
               Pacific walrus  -accca---cgcact--gttggtgggagtgcaaaacggt---gccacc-gaggtaaagaacagtgtgga-
                 Weddell seal  -accca---ctcact--gttggtgggagtgcaaaacggt---gccgcc-gaggtaaagaacagtgtgga-
                Big brown bat  --acta---cgcact--gttggtg-gaatgcaaaacggt---gcaagt----------------------
B D                  Microbat  --ccca---agcact--gctgatg-gaatgcaaaacagg---gcaagt----------------------
B D        American alligator  tcccga---ttccct-------tgtggctggaggcctct---gaagtt-gttgcggggagcaataagaaa
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
                Prairie vole  ======================================================================
              Golden hamster  ======================================================================
B D           Chinese hamster  ======================================================================
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
B D                   Ferret   ======================================================================
        David's myotis (bat)  ======================================================================
B D                   Manatee  ======================================================================
B D                 Armadillo  ======================================================================
B D                    Alpaca  ======================================================================
              Bactrian camel  ======================================================================
            Black flying-fox  ======================================================================
B D                       Cat  ======================================================================
B D                  Elephant  ======================================================================
B D                Guinea pig  ======================================================================
            Brush-tailed rat  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                   Chicken  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
  D              Mallard duck  ======================================================================
B D                   Wallaby  ======================================================================
  D    White-throated sparrow  ======================================================================
                    Aardvark  ======================================================================
            Cape golden mole  ======================================================================
B D                   Megabat  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
B D                  Platypus  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================

                        Human  -------------agctcctca---aaaaa
                        Chimp  -------------agctcctca---aaaaa
                      Gorilla  -------------agctcctca---aaaaa
                    Orangutan  -------------agctcctca---aaaaa
                       Gibbon  -------------agctcctca---aaaga
                       Rhesus  -------------agctcctca---aaaaa
          Crab-eating macaque  -------------agctcctca---aaaga
                       Baboon  -------------agctcctca---aaaaa
                 Green monkey  -------------agctcctca---aaaaa
                     Marmoset  -------------agctcctcc---aaata
              Squirrel monkey  -------------agctcctcc---aaaaa
                     Bushbaby  -------------ggttcctta---aaaaa
           Chinese tree shrew  -------------aggtcctca---aaacc
                     Squirrel  -------------catccctca---caac-
                       Rabbit  ------------------------------
                          Pig  -------------agggcttcg---aaaag
                      Dolphin  -------------cctgcctcaaagaaaaa
                 Killer whale  -------------cctgcctcaaagaaaaa
             Tibetan antelope  -------------acttcctca---aaaaa
                          Cow  -------------acttcctca---aaaaa
                        Sheep  -------------acttcctca---aaaaa
                Domestic goat  -------------acgtcctca---aaaaa
                        Horse  ----------------tcctca---aaaaa
             White rhinoceros  -------------ggctcctca---aaaaa
                          Dog  -------------gattcttcc---aacat
                        Panda  -------------cgttcttcc---caatg
               Pacific walrus  -------------gattcttcc---aaaag
                 Weddell seal  -------------gattcttcc---aaaag
                Big brown bat  ----------------tcctcc---aaaca
                     Microbat  ----------------tcctca---aaaca
           American alligator  tagggaaaagatgagagactgg---agaaa
                        Mouse  ==============================
                          Rat  ==============================
       Lesser Egyptian jerboa  ==============================
                       Tenrec  ==============================
          Cape elephant shrew  ==============================
                     Hedgehog  ==============================
                        Shrew  ==============================
                 Prairie vole  ==============================
               Golden hamster  ==============================
              Chinese hamster  ==============================
              Star-nosed mole  ==============================
                         Pika  ==============================
                      Ferret   ==============================
         David's myotis (bat)  ==============================
                      Manatee  ==============================
                    Armadillo  ==============================
                       Alpaca  ==============================
               Bactrian camel  ==============================
             Black flying-fox  ==============================
                          Cat  ==============================
                     Elephant  ==============================
                   Guinea pig  ==============================
             Brush-tailed rat  ==============================
               Naked mole-rat  ==============================
                   Chinchilla  ==============================
                      Chicken  ==============================
                   Budgerigar  ==============================
           Tibetan ground jay  ==============================
             Peregrine falcon  ==============================
                 Saker falcon  ==============================
                  Rock pigeon  ==============================
          Medium ground finch  ==============================
                 Mallard duck  ==============================
                      Wallaby  ==============================
       White-throated sparrow  ==============================
                     Aardvark  ==============================
             Cape golden mole  ==============================
                      Megabat  ==============================
     Chinese softshell turtle  ==============================
               Painted turtle  ==============================
              Green seaturtle  ==============================
              Tasmanian devil  ==============================
                      Opossum  ==============================
                     Platypus  ==============================
                  Zebra finch  ==============================
          Collared flycatcher  ==============================

Inserts between block 7 and 8 in window
B D          Squirrel monkey 48bp
               Big brown bat 2bp
B D                 Microbat 2bp

Alignment block 8 of 38 in window, 101543789 - 101543795, 7 bps 
B D                     Human  gtaaaaa
B D                     Chimp  ttaaaaa
B D                   Gorilla  ttaaaaa
B D                 Orangutan  ttaaaaa
B D                    Gibbon  ttaaaaa
B D                    Rhesus  ttaaaaa
B D       Crab-eating macaque  ttaaaaa
B D                    Baboon  ttaaaaa
B D              Green monkey  ttaaaaa
B D                  Marmoset  ttacaaa
B D                  Bushbaby  ttaaaaa
           Chinese tree shrew  tcaagca
B D                  Squirrel  tcacgca
B D                    Rabbit  ------a
B D                       Pig  -gaagcc
B D                   Dolphin  -cagtcg
                 Killer whale  -cagtcg
             Tibetan antelope  -taatcc
B D                       Cow  -taatcc
B D                     Sheep  -taatcc
                Domestic goat  -taatcc
B D                     Horse  ttaaaca
B D          White rhinoceros  ttaacca
B D                       Dog  -taagca
B D                     Panda  -taagca
               Pacific walrus  -taggca
                 Weddell seal  -taggca
                Big brown bat  ttaaac-
B D                  Microbat  ttaaac-
B D        American alligator  ataaaaa
B D                     Mouse  =======
B D                       Rat  =======
      Lesser Egyptian jerboa  =======
B D                    Tenrec  =======
         Cape elephant shrew  =======
B D                  Hedgehog  =======
B D                     Shrew  =======
                Prairie vole  =======
              Golden hamster  =======
B D           Chinese hamster  =======
             Star-nosed mole  =======
B D                      Pika  =======
B D                   Ferret   =======
B D           Squirrel monkey  =======
        David's myotis (bat)  =======
B D                   Manatee  =======
B D                 Armadillo  =======
B D                    Alpaca  =======
              Bactrian camel  =======
            Black flying-fox  =======
B D                       Cat  =======
B D                  Elephant  =======
B D                Guinea pig  =======
            Brush-tailed rat  =======
B D            Naked mole-rat  =======
                  Chinchilla  =======
B D                   Chicken  =======
B D                Budgerigar  =======
          Tibetan ground jay  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
B D       Medium ground finch  =======
  D              Mallard duck  =======
B D                   Wallaby  =======
  D    White-throated sparrow  =======
                    Aardvark  =======
            Cape golden mole  =======
B D                   Megabat  =======
  D  Chinese softshell turtle  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D           Tasmanian devil  =======
B D                   Opossum  =======
B D                  Platypus  =======
B D               Zebra finch  =======
  D       Collared flycatcher  =======

Inserts between block 8 and 9 in window
               Big brown bat 1bp
B D                 Microbat 1bp

Alignment block 9 of 38 in window, 101543796 - 101543804, 9 bps 
B D                     Human  tagaat--gag
B D                     Chimp  tagaat--gag
B D                   Gorilla  tagaat--gag
B D                 Orangutan  tagaat--gag
B D                    Gibbon  tagaat--gag
B D                    Rhesus  tagaat--gag
B D       Crab-eating macaque  tagaat--gag
B D                    Baboon  tagaat--gag
B D              Green monkey  tagaat--gag
B D                  Marmoset  tagaat--t--
B D                  Bushbaby  tagaac--cat
           Chinese tree shrew  ggaaat--gaa
B D                  Squirrel  cagaat--cac
B D                    Rabbit  cggggtggcag
B D                       Pig  cagcat--gat
B D                   Dolphin  caggat--tac
                 Killer whale  caggat--tac
             Tibetan antelope  ccgaac--tgc
B D                       Cow  ccaaac--tgc
B D                     Sheep  ccgaac--tgc
                Domestic goat  ccgaac--tgc
B D                     Horse  gagcac--tcc
B D          White rhinoceros  tagaat--tac
B D                       Dog  cagaat--tac
B D                     Panda  tggaat--tac
               Pacific walrus  tggaat--tac
                 Weddell seal  tggaat--tac
                Big brown bat  tagagt--tac
         David's myotis (bat)  tagagc--tac
B D                  Microbat  tagagc--tgc
B D        American alligator  -tgaat--gag
B D                     Mouse  ===========
B D                       Rat  ===========
      Lesser Egyptian jerboa  ===========
B D                    Tenrec  ===========
         Cape elephant shrew  ===========
B D                  Hedgehog  ===========
B D                     Shrew  ===========
                Prairie vole  ===========
              Golden hamster  ===========
B D           Chinese hamster  ===========
             Star-nosed mole  ===========
B D                      Pika  ===========
B D                   Ferret   ===========
B D           Squirrel monkey  ===========
B D                   Manatee  ===========
B D                 Armadillo  ===========
B D                    Alpaca  ===========
              Bactrian camel  ===========
            Black flying-fox  ===========
B D                       Cat  ===========
B D                  Elephant  ===========
B D                Guinea pig  ===========
            Brush-tailed rat  ===========
B D            Naked mole-rat  ===========
                  Chinchilla  ===========
B D                   Chicken  ===========
B D                Budgerigar  ===========
          Tibetan ground jay  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
  D               Rock pigeon  ===========
B D       Medium ground finch  ===========
  D              Mallard duck  ===========
B D                   Wallaby  ===========
  D    White-throated sparrow  ===========
                    Aardvark  ===========
            Cape golden mole  ===========
B D                   Megabat  ===========
  D  Chinese softshell turtle  ===========
  D            Painted turtle  ===========
  D           Green seaturtle  ===========
B D           Tasmanian devil  ===========
B D                   Opossum  ===========
B D                  Platypus  ===========
B D               Zebra finch  ===========
  D       Collared flycatcher  ===========

Inserts between block 9 and 10 in window
B D                 Marmoset 10bp
B D       American alligator 3316bp

Alignment block 10 of 38 in window, 101543805 - 101543805, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
B D                    Rabbit  c
B D                       Pig  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Dog  c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                     Mouse  =
B D                       Rat  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
                Prairie vole  =
              Golden hamster  =
B D           Chinese hamster  =
             Star-nosed mole  =
B D                      Pika  =
B D                   Ferret   =
B D           Squirrel monkey  =
B D                   Manatee  =
B D                 Armadillo  =
B D                    Alpaca  =
              Bactrian camel  =
            Black flying-fox  =
B D                  Marmoset  =
B D                       Cat  =
B D                  Elephant  =
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
B D                   Chicken  =
B D                Budgerigar  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  =
  D              Mallard duck  =
B D                   Wallaby  =
  D    White-throated sparrow  =
                    Aardvark  =
            Cape golden mole  =
B D                   Megabat  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D           Tasmanian devil  =
B D                   Opossum  =
B D                  Platypus  =
B D        American alligator  =
B D               Zebra finch  =
  D       Collared flycatcher  =

Alignment block 11 of 38 in window, 101543806 - 101543959, 154 bps 
B D                     Human  ctatgaccccgcgattccatctctaggtacat-gcccaaaggaatcgaaag-caggctctggaagaaata
B D                     Chimp  ctatgaccccgcgattccatctctaggtacat-gcccaaaggaatcgaaag-caggctctggaagaaata
B D                   Gorilla  ctatgaccccgcgattccatctctaggtacat-gcccaaaggaatcgaaag-caggctctggaagaaata
B D                 Orangutan  ctatgaccccgcgattccatctctgggtatac-gcccaaaggaatcgaaa--taggctctcaaagaaata
B D                    Gibbon  ccatgaccccacgattccatttctgggtatat-gcccaaaggaatcgaaag-caggctctggaagaaata
B D                    Rhesus  ctatgaccccgcgattccatttctgggtatat-gcccaaaggaatcgaaag-caggctctcgaagaaata
B D       Crab-eating macaque  ctatgaccccgcgattccatttctgggtatat-gcccaaaggaatcgaaag-caggctctcgaagaaata
B D                    Baboon  ctatgaccccgcgattccatttctgggtatat-gcccaaaggaatcgaaag-caggctctcgaagaaaga
B D              Green monkey  ctgtaaccccgcgattccatttctgggtatac-gcccaaaggaatcgaaag-caggctctcgaagaaata
B D                  Marmoset  caatgaccccacctttccattgctgggtacac-acccgaaggaatggaaag-caggttctggaagaaata
B D           Squirrel monkey  cagtgaccccacctttccattgctgggtacac-acccgaaggaatggaaag-caggttctggaagaaatg
B D                  Bushbaby  atatgacccagaaattcaatttgggggcatgt-attcgaaggaattgaaag-cagggtcttgaagaaata
           Chinese tree shrew  ttctgatccag-gaacccagttctgcacccac--cccgcaagaagggaggg-cagagtctggaaggaacg
B D                  Squirrel  ctgtgacccagtgactccccttctgagcatag-acccca--aacctgaaggccaggccttgaagagcatc
B D                    Rabbit  cgatgtcctcagacgtccccttctgcgtggat-gccccagggaactgacca-caggccctgggagaaaca
B D                       Pig  acgtgatgctgtgattcc---------------acc--gaagaactgag-------atgccaaagagaca
B D                   Dolphin  gtacgatgcagcaattcc---------------acccgaaagaactgaa-------atgtcgaagaggca
                 Killer whale  gtacgatgcagcaattcc---------------acccaaaggaaccgaa-------atgtcgaagagcca
             Tibetan antelope  atttgacgcagcaattgc---------------acccgaagaaactgag-------atacgaaggggaca
B D                       Cow  atttgacacagcaattgc---------------acccgaagaaactgaa-------atacgaaggagatg
B D                     Sheep  atttgacacagcaattgc---------------acccgaagaaactgag-------atacgaaggagatg
                Domestic goat  atttgacacaccaattgc---------------acccgaagaaactgag-------atacgaaggagaca
B D                     Horse  aaaagatgcagcaatcccacgtccgagtataa-accccaaagaaccaaaag-cagagtgtcagagagctc
B D          White rhinoceros  agatgagccagcaatcccactgctgggtataa-accccaaagaactgaaag-cagggtctcgaagagatc
B D                       Dog  acgtgac-cagcagttccactcctgggtgtgacacctagaagccctggagg-cagggactcggtgagacg
B D                     Panda  atgtgactcagcagttccacctccaaatgtcacacccgaaaggcctgaggg-cagggactcaatgagata
               Pacific walrus  atgtgacccagcagttccgcctctgggtgtccca-ccggaaggcctgag-g-cagggtctccatgagata
                 Weddell seal  atgtgacccagcaattctgcctctgggtgtcccacccgaaaggcctgagag-cagggtctccatgagata
                Big brown bat  acatgatccggcaattccattgctgggtatgt-cctcaaatgaattgaaag-caggatctcaaagagatg
         David's myotis (bat)  acatgatccagccattccattgctggggatgt-tctcaaaagaattgaagg-caggagctcaaagagatg
B D                  Microbat  acatgacccagccattccattgctgggtatgt-tctcaaaagaactgaagg-caggagctcaaagagatg
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
                Prairie vole  ======================================================================
              Golden hamster  ======================================================================
B D           Chinese hamster  ======================================================================
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
B D                   Ferret   ======================================================================
B D                   Manatee  ======================================================================
B D                 Armadillo  ======================================================================
B D                    Alpaca  ======================================================================
              Bactrian camel  ======================================================================
            Black flying-fox  ======================================================================
B D                       Cat  ======================================================================
B D                  Elephant  ======================================================================
B D                Guinea pig  ======================================================================
            Brush-tailed rat  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                   Chicken  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
  D              Mallard duck  ======================================================================
B D                   Wallaby  ======================================================================
  D    White-throated sparrow  ======================================================================
                    Aardvark  ======================================================================
            Cape golden mole  ======================================================================
B D                   Megabat  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
B D                  Platypus  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================

                        Human  ctt--gcgcactcatgttctcggcag-catcgttcacaacagccaaaaggt-ggaa-gcgacccgagtgt
                        Chimp  ctt--gcgcactcatgttctcggcag-catcgttcacaatagccaaaaggt-ggaa-gcgacccgagtgt
                      Gorilla  ctt--gcgcactcatgttctcggcag-catcgttcacaatagccaaaaggt-ggaa-gcgacccgagtgt
                    Orangutan  ctt--gcacactcatgttcacggcag-catcattcacaatagccaaaaggt-ggaa-gcgacccgagtgt
                       Gibbon  ctt--gtgcactcgtgttcacggcag-cattgttcacaatagccaaaaggt-ggaa-gcgacccaagtgt
                       Rhesus  ctt--gtgcactcatgttcgcagcag-catcgttcacaatagccaaaaggc-ggaa-gctacccgtgtgt
          Crab-eating macaque  ctt--gtgcactcatgttcgcagcag-catcgttcacaatagccaaaaggc-ggaa-gctacccgtgtgt
                       Baboon  ctt--gcgcactcatgttcacagcag-catcgttcacaatagccaaaaggt-ggaa-gcgacctgtgtgt
                 Green monkey  ctt--gcgcactcatgttcgcagcag-catcgttcacaacagccaagaggt-ggaa-gcaacccgtgtgt
                     Marmoset  cct--gcgtgctcatattctccgcag-caccgttcacaatggccaaaatgt-ggaa-gc-ccccgagtgt
              Squirrel monkey  cct--gcatgctcatgttcaccgcag-cactgttcacaatggccaagaggc-ggaa-gc-acccgagtgt
                     Bushbaby  ttc--ccatattcatgttcatagcac-aattgttcacaatagccagaaggt-ggaa-gcaacccaagtgt
           Chinese tree shrew  c-t--gtccac-cgtggtcacagc-t-catcgttcacaggggccaaaa--c-ggga-ccagccctggcgt
                     Squirrel  gt-----gcaccctcgt------------------------gggagaag----------tgcccagggat
                       Rabbit  g---------cccgagc------------------------ggcagaaggt-ggaa-gccacccaggcac
                          Pig  ttt--gcgcatccgtgttcacagcag-cgtgatttgccacggccaaaaggg-ggaacgtgacccc-gtcc
                      Dolphin  ttt--gtacacccatgttcgcggcag-catcgtccacaacagccaaaaggt-ggac-gccacccg-acgc
                 Killer whale  ttt--gtacatccatgttcgcggcag-cattgtccacgatagccaaaaggtaagac-gtcaccca-atgt
             Tibetan antelope  tttcagtgcatctgtgttcctagcaa-catcatccacagcagccaaagtgt-ggaa-gctgcctg-gcgc
                          Cow  tttcaatgcatccgtgttcctagcag-cagcatccacagcagccaaaaggt-ggaa-gctgccca-gcac
                        Sheep  tttcaatgcatctgtgttcctagcag-cagcatccacagcagccaaaatgt-ggaa-gctgcctg-gcga
                Domestic goat  tttcaatgcatctgtgttcctagcgg-cagcatccacagcagccaaaatgt-ggaa-gctgcctg-gcga
                        Horse  tgt--gcacacccatgtttacagtgg-cgtta-tcacagtagccgaaaggt-ggga-gccgaaag-gtg-
             White rhinoceros  tgt--gcacacccatgctcatagcag-cgttattcacagcagccaaaaggt-ggaa-gctacccg-gtgt
                          Dog  ttt--gcacacttgtgttcatggcag-cccta-----------tacatggt-agga-gcaccccaagtgc
                        Panda  gtg--gcaccc----------acgag-c-------------------------------agcccaagtgt
               Pacific walrus  ttt--gcacac----------ggcag-cactagtcccaacactcaaagggc-ggaa-gcaacccaagtgt
                 Weddell seal  ttt--gcacac----------ggcag-cactagtcccaacactcaaagggc-ggaa-ggaacccgagtgt
                Big brown bat  tct--gtccacccatgtccacagcag-cattattcacggaggccaaaaggt-ggag-gccgcccaggtgc
         David's myotis (bat)  tct--gtgcacccatgtccacagcagacgtcagtcacggaagcca----------------cccaggtgc
                     Microbat  tct--gtgcacccatgtccacagcagacgtcagtcacggaagcca----------------cccaggtgc
                        Mouse  ======================================================================
                          Rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                 Prairie vole  ======================================================================
               Golden hamster  ======================================================================
              Chinese hamster  ======================================================================
              Star-nosed mole  ======================================================================
                         Pika  ======================================================================
                      Ferret   ======================================================================
                      Manatee  ======================================================================
                    Armadillo  ======================================================================
                       Alpaca  ======================================================================
               Bactrian camel  ======================================================================
             Black flying-fox  ======================================================================
                          Cat  ======================================================================
                     Elephant  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                      Chicken  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                 Mallard duck  ======================================================================
                      Wallaby  ======================================================================
       White-throated sparrow  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
                      Megabat  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================

                        Human  -ccccaaca---ggtga-------acagatca
                        Chimp  -ccccgaca---ggtga-------acagatca
                      Gorilla  -ccccgaca---ggtga-------acagatca
                    Orangutan  cccccgaca---ggtga-------acagatca
                       Gibbon  ----gaaca---gatca-------acagatca
                       Rhesus  cccccgaca---ggtga-------acagatca
          Crab-eating macaque  cccccgaca---ggtga-------acagatca
                       Baboon  cccccgaca---ggtga-------acagatca
                 Green monkey  cccccgaca---ggtga-------acagatca
                     Marmoset  -ccccagca---ggtga-------tcagatca
              Squirrel monkey  --cccagca---ggtgg-------tcagatca
                     Bushbaby  ccatcagta---ggtga-------atgaataa
           Chinese tree shrew  --------------------------------
                     Squirrel  -ggacagag---atccg-------taaggtc-
                       Rabbit  -ccaccacg------------------gaca-
                          Pig  ccatcaatg---agtgatgggaac--------
                      Dolphin  ccatcaatg---g-------------------
                 Killer whale  ccatcaatg---g-------------------
             Tibetan antelope  ctgccgaca---gttga---------------
                          Cow  ctgccaatg---gccaa---------------
                        Sheep  ctgccgaca---gctga---------------
                Domestic goat  ctgccgaca---gctga---------------
                        Horse  ------------aaggc-------acag----
             White rhinoceros  ccatcagcggctgagg--------ataa----
                          Dog  ccgctgacg---gggta-------gtagataa
                        Panda  ccgtcgatg---gggg--------gtagatgg
               Pacific walrus  ccttggatg---gggga-------gtagatgg
                 Weddell seal  ctgtggatg---gggga-------gtagatgg
                Big brown bat  ccttcgaca---gacaa-------acggatac
         David's myotis (bat)  ccatcgaca---ggtaa-------acggatat
                     Microbat  ccatcgaca---ggtaa-------acggatcc
                        Mouse  ================================
                          Rat  ================================
       Lesser Egyptian jerboa  ================================
                       Tenrec  ================================
          Cape elephant shrew  ================================
                     Hedgehog  ================================
                        Shrew  ================================
                 Prairie vole  ================================
               Golden hamster  ================================
              Chinese hamster  ================================
              Star-nosed mole  ================================
                         Pika  ================================
                      Ferret   ================================
                      Manatee  ================================
                    Armadillo  ================================
                       Alpaca  ================================
               Bactrian camel  ================================
             Black flying-fox  ================================
                          Cat  ================================
                     Elephant  ================================
                   Guinea pig  ================================
             Brush-tailed rat  ================================
               Naked mole-rat  ================================
                   Chinchilla  ================================
                      Chicken  ================================
                   Budgerigar  ================================
           Tibetan ground jay  ================================
             Peregrine falcon  ================================
                 Saker falcon  ================================
                  Rock pigeon  ================================
          Medium ground finch  ================================
                 Mallard duck  ================================
                      Wallaby  ================================
       White-throated sparrow  ================================
                     Aardvark  ================================
             Cape golden mole  ================================
                      Megabat  ================================
     Chinese softshell turtle  ================================
               Painted turtle  ================================
              Green seaturtle  ================================
              Tasmanian devil  ================================
                      Opossum  ================================
                     Platypus  ================================
           American alligator  ================================
                  Zebra finch  ================================
          Collared flycatcher  ================================

Alignment block 12 of 38 in window, 101543960 - 101543972, 13 bps 
B D                     Human  acaaaatgtggta
B D                     Chimp  acaaaatgtggta
B D                   Gorilla  acaaaatgtggta
B D                 Orangutan  acaaaatgtggta
B D                    Gibbon  acaaaatgtggta
B D                    Rhesus  acaaaatgtggaa
B D       Crab-eating macaque  acaaaatgtggaa
B D                    Baboon  acaaaatgtggaa
B D              Green monkey  acaaaatgtggaa
B D                  Marmoset  acaaaatgtggca
B D           Squirrel monkey  gcaaaatgtggcc
B D                  Bushbaby  gtaaaatgtggtc
           Chinese tree shrew  ----cgtgtgaga
B D                       Pig  acaacaggtgctt
B D                   Dolphin  ---------ggta
                 Killer whale  ---------ggta
             Tibetan antelope  acaacaagtgata
B D                       Cow  atagcaagtggtg
B D                     Sheep  acaacaagtggta
                Domestic goat  acaacaagtggta
B D                     Horse  acaaaccgtggtc
B D          White rhinoceros  acaaactgtggtc
B D                       Cat  ataaaacgcggtc
B D                       Dog  ac----tgtgatc
B D                     Panda  acaaaacatggtc
               Pacific walrus  gc-aaacggggtc
                 Weddell seal  gc-aaatagggtc
                Big brown bat  accaagtgtggtc
         David's myotis (bat)  gcccaatgtggtc
B D                  Microbat  gccaaatgtggtc
B D                     Mouse  =============
B D                       Rat  =============
      Lesser Egyptian jerboa  =============
B D                    Tenrec  =============
         Cape elephant shrew  =============
B D                  Hedgehog  =============
B D                     Shrew  =============
                Prairie vole  =============
              Golden hamster  =============
B D           Chinese hamster  =============
             Star-nosed mole  =============
B D                      Pika  =============
B D                    Rabbit  -------------
B D                   Ferret   =============
B D                   Manatee  =============
B D                 Armadillo  =============
B D                    Alpaca  =============
              Bactrian camel  =============
            Black flying-fox  =============
B D                  Elephant  =============
B D                Guinea pig  =============
            Brush-tailed rat  =============
B D            Naked mole-rat  =============
                  Chinchilla  =============
B D                  Squirrel  -------------
B D                   Chicken  =============
B D                Budgerigar  =============
          Tibetan ground jay  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
  D               Rock pigeon  =============
B D       Medium ground finch  =============
  D              Mallard duck  =============
B D                   Wallaby  =============
  D    White-throated sparrow  =============
                    Aardvark  =============
            Cape golden mole  =============
B D                   Megabat  =============
  D  Chinese softshell turtle  =============
  D            Painted turtle  =============
  D           Green seaturtle  =============
B D           Tasmanian devil  =============
B D                   Opossum  =============
B D                  Platypus  =============
B D        American alligator  =============
B D               Zebra finch  =============
  D       Collared flycatcher  =============

Inserts between block 12 and 13 in window
B D                Orangutan 988bp

Alignment block 13 of 38 in window, 101543973 - 101544107, 135 bps 
B D                     Human  aatccataaaatggaatat----------tattcaggcct-gaaaag-gaaggacattctgagacatgct
B D                     Chimp  aatccataaaatggaatat----------tattcaggcct-gaaaag-gaaggacattctgagacatgct
B D                   Gorilla  aatccataaaatggaatat----------tattcaggcct-gaaaag-gaaggacattctgagacatgct
B D                    Gibbon  aatccataaaatggaatat----------tattcaggcct-aaaaag-gaaggacgttctgagacatgct
B D                    Rhesus  aatccgcagaatggaatag----------tactcaggcct-aaaaag-gaaggacattctgagacgtgct
B D       Crab-eating macaque  aatccgcagaatggaatag----------tactcaggcct-aaaaag-gaaggaccttctgagacgtgct
B D                    Baboon  aaaccgcagaatggaataa----------tactcaggcct-aaaaag-gaaggacattctgagacgtgct
B D              Green monkey  aatctatagaatggaatag----------tactcaggcct-aaaaag-gaaggacattctgagacatgct
B D                  Marmoset  aatccatagaatggaatat----------tatttaggcct-gaaaag-gaaggacattctgat-------
B D           Squirrel monkey  aatccatagaatggaatat----------tattcaggcct-aaaaag-gaagggcattctgatgcatgcc
B D                  Bushbaby  tatctgtacaatggaatat----------tattcggccatcaaaaag-gaatggaattctgatatgtgtc
           Chinese tree shrew  ------------------------------aatcagccct--cacag-agaggcaatgtgggcacgtgct
B D                  Squirrel  cacccacacggtggaacat----------ggatc-ggcct-g-acag-gacggagaccctgaggcctgct
B D                    Rabbit  catcggcaagctgg-gcgt----------tggtc-cccat-g--caa-ga-ggag-------gggctgcc
B D                       Pig  tttac-caccatggaccgt----------tcttctgcctc-aggaag-gaaggagatgctgaaacagg--
B D                   Dolphin  tttac-cagaatgaagcat----------tgttcagccgt-aagaag-gaagggaattctgacacaggct
                 Killer whale  tttac-tagaatgaagcat----------tgttcagccgt-aagaag-gaagggaattctgacacaggct
             Tibetan antelope  tttgc-tagaatgtggcatgattatattagattcggtctg-aagaag-gagggggcctctgacacaggcc
B D                       Cow  tttgc-tagaatgcggcgtgattatgttagatttggtctg-aagaag-gaaggagcctctgacacaggcc
B D                     Sheep  tttgc-tagaatgtggcatgattctattagattcggtctg-aagaag-gagggagcctctgacacaggcc
                Domestic goat  tttgc-tagaatgcggcatgattctattagattcggtctg-aagaag-gagggaacctctgacacaggcc
B D                     Horse  catccacacaatggaatgc----------tattccacctt-cgaaag-gaaggacagtctgatggatgct
B D          White rhinoceros  catccgtacaatggagtat----------tattctggctc-aaaaag-aaaggacgttctgacacaggct
B D                       Cat  tgtccgcgc-acggagcat----------cactc-acccg-cgagcgtgaagggggct--gacccccgct
B D                       Dog  cgtctacacaatggaggac----------cgttg-agcca-taaggg-gaaggagactctgacacctgct
B D                     Panda  tgtccgcacgatgggatac----------cattc-agcca-cagaag-ggaggagact--gacgccggct
               Pacific walrus  tgtccgcacggcgggatgc----------cattc-agcca-tagaag-ggcggagacttggcccctggct
                 Weddell seal  tgtccgcacggtgggatgc----------cattc-agcca-tagaag-ggaggagactcggccgccggct
                Big brown bat  catccatatagtggaaggt----------cactccgcctt-aagaag-gaaggaacctctg-cacttgct
         David's myotis (bat)  catccatagagaggaaggt----------cactccgccgt-aagaag-gcaggaacgtctgacacctgct
B D                  Microbat  catccatagagtggaaggt----------cactccgcctt-aagaag-gcaggaatgtctgacacctgct
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
                Prairie vole  ======================================================================
              Golden hamster  ======================================================================
B D           Chinese hamster  ======================================================================
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
B D                   Ferret   ======================================================================
B D                   Manatee  ======================================================================
B D                 Armadillo  ======================================================================
B D                    Alpaca  ======================================================================
              Bactrian camel  ======================================================================
            Black flying-fox  ======================================================================
B D                  Elephant  ======================================================================
B D                Guinea pig  ======================================================================
            Brush-tailed rat  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                   Chicken  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
  D              Mallard duck  ======================================================================
B D                   Wallaby  ======================================================================
  D    White-throated sparrow  ======================================================================
                    Aardvark  ======================================================================
            Cape golden mole  ======================================================================
B D                   Megabat  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
B D                  Platypus  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                 Orangutan  ======================================================================

                        Human  gcaacac---------ggttgaaccttgaggacatcaag-cgaagtgaaacaggcgagttactaaagga-
                        Chimp  gcaacac---------ggttgaaccttgaggacatcaag-cgaagtgaaacaggcgagttactaaagga-
                      Gorilla  gcaacac---------ggttgaaccttgaggacatcaag-cgaagtgaaacaggcgagttactaaagga-
                       Gibbon  gcaacac---------ggatgaaccttgaggacatcaag-cgaagtgaaacaggcgagttactaaaggg-
                       Rhesus  acaacat---------ggatgaaccttgaggacatcaag-caaagtgaaacaggcgagttactaaggga-
          Crab-eating macaque  acaacat---------ggatgaaccttgaggacatcaag-caaagtgaaacaggcgagttactaaggga-
                       Baboon  acaacat---------ggatgaaccttgaggacatcaag-caaagtgaaacgggcgagttactaaggga-
                 Green monkey  acaacat---------ggatgaaccttgaggacatcaag-caaagtgaaacaggtgagttactaaggga-
                     Marmoset  accacag---------aggggagccccgaggacatgtag-cgaggggaaac--------------agga-
              Squirrel monkey  accacag---------gggggagccctgaggacatgaag-cgagcggaaacaggccagtcactcaagga-
                     Bushbaby  ataacac---------agatgaactttgaggacattatg-ctcagtgaaataagccagacaaaaaagga-
           Chinese tree shrew  accacgg---------ggatgaaacc-gaggacctcgggtcgaggggtaac-------------ccgga-
                     Squirrel  gccacac---------ca--ggacccccaggacccc-tg-cggagccaatcaggccagtcacaaaaggac
                       Rabbit  gccgtgc---------c----ggcgtggaggacc------tgaagacgtgtgggttcatccccagagga-
                          Pig  accacat---------ggatgaagctggaggacagcatg-ctgagcgaaataagccag-cacaaaagga-
                      Dolphin  acaacag---------ggatgaatcttgaggacattatg-ctgagtgaaataaaccagtcacaaaagga-
                 Killer whale  acaacag---------ggatgaatcttgaggacattatg-ctgagtgaaataaaccagtcacaaaagga-
             Tibetan antelope  acgaggc-------------------------cgttacg-ctgagtgaagtaaagcagtcaccaaagga-
                          Cow  acgaggccattatgctggatgaatctcgaggacattacg-ctgagtgaaataaagcagtcaccaaagga-
                        Sheep  acgaggc-------------------------cattacg-ctgagtgaagtaaagcagtcaccaaagga-
                Domestic goat  acgaggc-------------------------cattacg-ctgagtgaagtaaagcagtcaccaaagga-
                        Horse  acaacat---------gggtgaaccttgaggacattgtg-ctaaatgaaataagccagtcccggaagga-
             White rhinoceros  acaacat---------ggatggaccttgaggacattatg-ttaaatgaaataagccagtcacaaaagga-
                          Cat  gcgacat---------gcatgcgccctgaggtccg------tgagtgacgtaagccagtcacggaaggg-
                          Dog  gcaacgc---------gcatgaacctcggggacgttatg-ctgagtgacctccgccagccacggaagga-
                        Panda  atcacac---------gtacagacctcaaggacgtgacg-ctgagcgacacaagcccgtcacagagaga-
               Pacific walrus  gccacac---------gcagggaccttgaggacattatg-ctgagtgacacaaacccgtcacagaagga-
                 Weddell seal  gccacac---------gcagggacctcgaggacattatg-ctgagtgacacaagcccatcacagaggga-
                Big brown bat  acaacgt---------ggatgaaccttgaggacattgtg-ttaaacgaaataagccagtcacggaagga-
         David's myotis (bat)  acagcgt---------ggacgaaccttgaggacactgtg-ttcaatgaaataagccagtcacagaagga-
                     Microbat  acaacgt---------ggatgaaccttgaggacactgtg-ttaaatgaaataagccagtcacagaagga-
                        Mouse  ======================================================================
                          Rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                 Prairie vole  ======================================================================
               Golden hamster  ======================================================================
              Chinese hamster  ======================================================================
              Star-nosed mole  ======================================================================
                         Pika  ======================================================================
                      Ferret   ======================================================================
                      Manatee  ======================================================================
                    Armadillo  ======================================================================
                       Alpaca  ======================================================================
               Bactrian camel  ======================================================================
             Black flying-fox  ======================================================================
                     Elephant  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                      Chicken  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                 Mallard duck  ======================================================================
                      Wallaby  ======================================================================
       White-throated sparrow  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
                      Megabat  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================
                    Orangutan  ======================================================================

                        Human  ccaatcct-gcaagatccc
                        Chimp  ccaatcct-gcaagatccc
                      Gorilla  cccatcct-gcaagatccc
                       Gibbon  caaatcct-gcaagatccc
                       Rhesus  caaatc-------------
          Crab-eating macaque  caaatc-------------
                       Baboon  caaatcct-gcaagattcc
                 Green monkey  caaatcct-gcaagatccc
                     Marmoset  caaaccct-g-aagaccca
              Squirrel monkey  caaaccct-gcaagatcca
                     Bushbaby  caaatcct-gtataagtcc
           Chinese tree shrew  c--------gtgtggctcc
                     Squirrel  ccactcac-aaaaggtccc
                       Rabbit  tgagtcct-gtaggaccc-
                          Pig  caaa--tt-cataggaccc
                      Dolphin  caaagactgttatgattcc
                 Killer whale  caaagactgttatgattcc
             Tibetan antelope  caaagact-ctctgcttcc
                          Cow  caaagact-ctctgcttct
                        Sheep  caaaggct-ctctgcttcc
                Domestic goat  caaagact-ctctgcttcc
                        Horse  cagatagt-gcacctttcc
             White rhinoceros  cagatact-gtatgattcc
                          Cat  caaacact-gtatgatccc
                          Dog  caaatacc-ata-gagtcc
                        Panda  cagagatc-gcctgattcc
               Pacific walrus  cagacact-gtctgattcc
                 Weddell seal  cagacact-gtctgattcc
                Big brown bat  caagtatt-ttatgattcc
         David's myotis (bat)  ccagtatt-ttatgattcc
                     Microbat  ccagtatc-ttatgattcc
                        Mouse  ===================
                          Rat  ===================
       Lesser Egyptian jerboa  ===================
                       Tenrec  ===================
          Cape elephant shrew  ===================
                     Hedgehog  ===================
                        Shrew  ===================
                 Prairie vole  ===================
               Golden hamster  ===================
              Chinese hamster  ===================
              Star-nosed mole  ===================
                         Pika  ===================
                      Ferret   ===================
                      Manatee  ===================
                    Armadillo  ===================
                       Alpaca  ===================
               Bactrian camel  ===================
             Black flying-fox  ===================
                     Elephant  ===================
                   Guinea pig  ===================
             Brush-tailed rat  ===================
               Naked mole-rat  ===================
                   Chinchilla  ===================
                      Chicken  ===================
                   Budgerigar  ===================
           Tibetan ground jay  ===================
             Peregrine falcon  ===================
                 Saker falcon  ===================
                  Rock pigeon  ===================
          Medium ground finch  ===================
                 Mallard duck  ===================
                      Wallaby  ===================
       White-throated sparrow  ===================
                     Aardvark  ===================
             Cape golden mole  ===================
                      Megabat  ===================
     Chinese softshell turtle  ===================
               Painted turtle  ===================
              Green seaturtle  ===================
              Tasmanian devil  ===================
                      Opossum  ===================
                     Platypus  ===================
           American alligator  ===================
                  Zebra finch  ===================
          Collared flycatcher  ===================
                    Orangutan  ===================

Inserts between block 13 and 14 in window
B D                 Squirrel 722bp

Alignment block 14 of 38 in window, 101544108 - 101544109, 2 bps 
B D                     Human  ac
B D                     Chimp  ac
B D                   Gorilla  ac
B D                    Gibbon  ac
B D                    Rhesus  -c
B D       Crab-eating macaque  -c
B D                    Baboon  ac
B D              Green monkey  ac
B D                  Marmoset  cc
B D           Squirrel monkey  cc
B D                  Bushbaby  ac
           Chinese tree shrew  at
B D                    Rabbit  ac
B D                       Pig  gc
B D                   Dolphin  ac
                 Killer whale  ac
             Tibetan antelope  ac
B D                       Cow  ac
B D                     Sheep  g-
                Domestic goat  ac
B D                     Horse  gc
B D          White rhinoceros  ac
B D                       Cat  ac
B D                       Dog  ac
B D                     Panda  ac
               Pacific walrus  ac
                 Weddell seal  ac
                Big brown bat  ac
         David's myotis (bat)  ac
B D                  Microbat  ac
B D                     Mouse  ==
B D                       Rat  ==
      Lesser Egyptian jerboa  ==
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
                Prairie vole  ==
              Golden hamster  ==
B D           Chinese hamster  ==
             Star-nosed mole  ==
B D                      Pika  ==
B D                   Ferret   ==
B D                   Manatee  ==
B D                 Armadillo  ==
B D                    Alpaca  ==
              Bactrian camel  ==
            Black flying-fox  ==
B D                  Elephant  ==
B D                Guinea pig  ==
            Brush-tailed rat  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
B D                  Squirrel  ==
B D                   Chicken  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
  D              Mallard duck  ==
B D                   Wallaby  ==
  D    White-throated sparrow  ==
                    Aardvark  ==
            Cape golden mole  ==
B D                   Megabat  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
B D                  Platypus  ==
B D        American alligator  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==
B D                 Orangutan  ==

Inserts between block 14 and 15 in window
B D                    Panda 323bp

Alignment block 15 of 38 in window, 101544110 - 101544216, 107 bps 
B D                     Human  tgatgagaagcacctgacgtagtcagactcatagagacaggaaacg-gaacg---gt----gctcgcc-g
B D                     Chimp  tgatgagaagcacctgacgtagtcagactcatagagacgggaaacg-gaacg---gt----gctcgcc-g
B D                   Gorilla  tgatgagaagcacctgacgtagtcagactcatagagacgggaaacg-gaacg---gt----gctcgcc-g
B D                    Gibbon  cgataagaagcacctgacgtagtcagactcatagagacgggaaatg-gaacg---gtgctcgctcgcc-g
B D                    Rhesus  caataagaagcacctgatgtagtcagactcatagagacgggaaatg-gaacg---gt----gctggcc-g
B D       Crab-eating macaque  caataagaagcacctgacgtagtcagactcatagagacgggaaatg-gaacg---gt----gctggcc-g
B D                    Baboon  caataagaagcacctgacgtagtcagactcatagagatgggaaatg-gaacg---gt----gctggcc-g
B D              Green monkey  cgataagaagcacctgacatagtcagactcatagagacgggaaatg-gaacg---gt----gctggcc-g
B D                  Marmoset  t----agaagcacct-acgtagtcggactcacagaggcgggaacta-gaacg---gt----tcttgcc-a
B D           Squirrel monkey  tag-aagaagcacctaacgcagtcgaactcacaaaggcgggaacca-gaacg---gt----gcttgccgg
B D                  Bushbaby  taatatgagggccctgaagcagtta-attcatagagacaaaaagta-gattg---gt----gggtgcc-a
           Chinese tree shrew  ttccacacagtccctagagcggcccg-ctcacaggacccagggccg-gggtg---gg----ggtggcc-g
B D                    Rabbit  ttccaggagggctcag-------cagagccacggacacgg-----------g---gc----g-------g
B D                       Pig  -----------------tcctgcgaggctccttgagacagaaggta-gcagg---g-----ggttgcc-t
B D                   Dolphin  -----------------ttctgtgaggttcatagagacagaaagca-gaagc---gt----cgtggcc-a
                 Killer whale  -----------------ttctgtgaggttcatagagacagaaagca-gaagc---gt----cgtggcc-a
             Tibetan antelope  ------------------cccatgaggttgataaagacagaaagta-caggg---gt----ggttgcc-a
B D                       Cow  ------------------tccgcgaggttcatagagacagaaagga-caggg---gt----ggttgcc-a
B D                     Sheep  ------------------cccgtgaggttgataaagacagaaagta-caggg---gt----ggttgcc-a
                Domestic goat  ------------------cccgtgaggttgataaagacagaaagta-caggg---gt----ggttgcc-a
B D                     Horse  ttctgtgagg-tcctagaatacgcggattcacagagagagcga----gaacg---gt----ggttgcc-a
B D          White rhinoceros  ttctgtgaggttcctggaatactgaaattcgtagagacagagagtg-gaggg---gt----ggttgcc-a
B D                       Cat  ttgccccaggtacgtagggtcttcagattcatagacgcagagagtg-gaaggtgagt----ggggggc-a
B D                       Dog  ttgcctgaggtacccagggtcttcaaattcaagggcacagtaagcagaagggtgagg----gggcgcc-a
               Pacific walrus  -----------------------------------------------atgggtgagt----gggagcc-g
                 Weddell seal  -----------------------------------------------aggggtgagt----gggcgct-g
                Big brown bat  ttgtctgaactccctagagcagtcagactcatagaaacaggacgt--acacg---gt----gggtgcc-a
         David's myotis (bat)  ttgtatgaactccctagagcagtcaggctcctagaaacagaaagt--acatg---gt----gggtgcc-a
B D                  Microbat  ttgtatgaactccctagagcagtcagactcctagaaacagaaagt--acatg---gt----ggg------
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
                Prairie vole  ======================================================================
              Golden hamster  ======================================================================
B D           Chinese hamster  ======================================================================
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
B D                     Panda  ======================================================================
B D                   Ferret   ======================================================================
B D                   Manatee  ======================================================================
B D                 Armadillo  ======================================================================
B D                    Alpaca  ======================================================================
              Bactrian camel  ======================================================================
            Black flying-fox  ======================================================================
B D                  Elephant  ======================================================================
B D                Guinea pig  ======================================================================
            Brush-tailed rat  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                  Squirrel  ======================================================================
B D                   Chicken  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
  D              Mallard duck  ======================================================================
B D                   Wallaby  ======================================================================
  D    White-throated sparrow  ======================================================================
                    Aardvark  ======================================================================
            Cape golden mole  ======================================================================
B D                   Megabat  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
B D                  Platypus  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                 Orangutan  ======================================================================

                        Human  gg---------ggct--ggggga--------------agggcagaagg--gaga----------------
                        Chimp  gg---------ggct--ggggga--------------agggcagaagg--gaga----------------
                      Gorilla  gg---------ggct--ggggga--------------agggcagaagg--gaca----------------
                       Gibbon  gg---------gcct--ggggga--------------aggtcagaagggagaga----------------
                       Rhesus  gg---------ggct--ggggga--------------agggcagaatg--gaga----------------
          Crab-eating macaque  gg---------ggct--gggggg--------------agggcagaatg--gaga----------------
                       Baboon  gg---------ggct--ggggga--------------agggcagaatg--gaga----------------
                 Green monkey  gg---------ggct--ggggga--------------agggcagaatg--gaga----------------
                     Marmoset  gg---------ggct--gtgggg--------------agggc-gagtg--gaga----------------
              Squirrel monkey  gg---------ggct--gtgcgg--------------agggcggaatg--gaga----------------
                     Bushbaby  gt---------ggcc--ag------------------------gaatc--atgt----------------
           Chinese tree shrew  gg---------gcgt----------------------------gcagg--gaga----------------
                       Rabbit  gg---------ggcg--ggggtg--------------agg----------agga----------------
                          Pig  gg---------ggcg--ggggag--------------gggga----------------------------
                      Dolphin  gg---------ggct--ggggga--------------ggggc----tg--ggggaggggctgggggaggg
                 Killer whale  gg---------ggct--gggggagggggctgggtgagggggc----tg--ggggaggggctgggggaggg
             Tibetan antelope  gg---------ggct--ggggga--------------ggggc----------------------------
                          Cow  gg---------ggct--ggggga--------------gggg-----------------------------
                        Sheep  gg---------ggct--ggggga--------------ggggc----------------------------
                Domestic goat  gg---------ggct--ggggga--------------ggggc----------------------------
                        Horse  gg---------ggct-gggggag--------------ggggc----gg--ggga----------------
             White rhinoceros  gg---------ggccggggggag--------------gggaa----tg--ggga----------------
                          Cat  gg---------ggct--ggggga--------------ggggg----gg--agg-----------------
                          Dog  gg---------gcct--ggggag--------------ggggc----tg--ggg-----------------
               Pacific walrus  ggg-gcgggggggct--gggaag--------------ggggc----tg--agg-----------------
                 Weddell seal  tg----gggggtact--gggaag--------------ggggc----tg--ggg-----------------
                Big brown bat  ggg--------gttg--ggggag--------------gggaa----gg--ggga----------------
         David's myotis (bat)  ggggctggggagggg--agggag--------------gagga----tg--ggga----------------
                     Microbat  gggggggaggggctg--ggggag--------------gagga----tg--ggga----------------
                        Mouse  ======================================================================
                          Rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                 Prairie vole  ======================================================================
               Golden hamster  ======================================================================
              Chinese hamster  ======================================================================
              Star-nosed mole  ======================================================================
                         Pika  ======================================================================
                        Panda  ======================================================================
                      Ferret   ======================================================================
                      Manatee  ======================================================================
                    Armadillo  ======================================================================
                       Alpaca  ======================================================================
               Bactrian camel  ======================================================================
             Black flying-fox  ======================================================================
                     Elephant  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                     Squirrel  ======================================================================
                      Chicken  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                 Mallard duck  ======================================================================
                      Wallaby  ======================================================================
       White-throated sparrow  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
                      Megabat  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================
                    Orangutan  ======================================================================

                        Human  --------gct---ggtgttcaatgtttca
                        Chimp  --------gct---ggtgttcaatgtttca
                      Gorilla  --------gct---ggtgttcaatgtttca
                       Gibbon  --------gct---ggtgtttaatgtttca
                       Rhesus  --------gct---ggtgcttaatgtttcg
          Crab-eating macaque  --------gct---ggtgcttaatgtttcg
                       Baboon  --------gct---ggtgcttagtgttttg
                 Green monkey  --------gct---ggtgcttagtgtttcg
                     Marmoset  --------gct---ggtggttcatgtttcc
              Squirrel monkey  --------gct---ggtggctcatgtttcc
                     Bushbaby  --------gttagaagtatttaatgtt---
           Chinese tree shrew  --------ggt-------------------
                       Rabbit  --------ggc---ggcgtccagcg-----
                          Pig  --------tct---cgcgttcaa-------
                      Dolphin  gaagggaagtt---agtgtctaa-------
                 Killer whale  gaagggaagtt---agtgtctaa-------
             Tibetan antelope  --------gcg---cgcgtttca-------
                          Cow  --------gcg---cgtgtctca-------
                        Sheep  --------gcg---cgtgtttca-------
                Domestic goat  --------gcg---cgtgtttca-------
                        Horse  --------gtc---gttgtttac-------
             White rhinoceros  --------gtt---gttgtttac-------
                          Cat  --------ctt---agtgtttcg-------
                          Dog  --------gtc---agcgtttaa-------
               Pacific walrus  --------gtc---agtgtttaa-------
                 Weddell seal  --------gtc---agtgtttca-------
                Big brown bat  --------gtt---ggtgttgaa-------
         David's myotis (bat)  --------gtt---agcgtttaa-------
                     Microbat  --------gtt---agcgtttaa-------
                        Mouse  ==============================
                          Rat  ==============================
       Lesser Egyptian jerboa  ==============================
                       Tenrec  ==============================
          Cape elephant shrew  ==============================
                     Hedgehog  ==============================
                        Shrew  ==============================
                 Prairie vole  ==============================
               Golden hamster  ==============================
              Chinese hamster  ==============================
              Star-nosed mole  ==============================
                         Pika  ==============================
                        Panda  ==============================
                      Ferret   ==============================
                      Manatee  ==============================
                    Armadillo  ==============================
                       Alpaca  ==============================
               Bactrian camel  ==============================
             Black flying-fox  ==============================
                     Elephant  ==============================
                   Guinea pig  ==============================
             Brush-tailed rat  ==============================
               Naked mole-rat  ==============================
                   Chinchilla  ==============================
                     Squirrel  ==============================
                      Chicken  ==============================
                   Budgerigar  ==============================
           Tibetan ground jay  ==============================
             Peregrine falcon  ==============================
                 Saker falcon  ==============================
                  Rock pigeon  ==============================
          Medium ground finch  ==============================
                 Mallard duck  ==============================
                      Wallaby  ==============================
       White-throated sparrow  ==============================
                     Aardvark  ==============================
             Cape golden mole  ==============================
                      Megabat  ==============================
     Chinese softshell turtle  ==============================
               Painted turtle  ==============================
              Green seaturtle  ==============================
              Tasmanian devil  ==============================
                      Opossum  ==============================
                     Platypus  ==============================
           American alligator  ==============================
                  Zebra finch  ==============================
          Collared flycatcher  ==============================
                    Orangutan  ==============================

Inserts between block 15 and 16 in window
B D                      Pig 7bp
B D                  Dolphin 8bp
                Killer whale 8bp
            Tibetan antelope 8bp
B D                      Cow 8bp
B D                    Sheep 8bp
               Domestic goat 8bp
B D                    Horse 8bp
B D         White rhinoceros 10bp
B D                      Cat 16bp
B D                      Dog 8bp
              Pacific walrus 8bp
                Weddell seal 63bp
               Big brown bat 2bp
        David's myotis (bat) 2bp
B D                 Microbat 2bp

Alignment block 16 of 38 in window, 101544217 - 101544257, 41 bps 
B D                     Human  gtccttcagttttgtacaatggaaa--gagttctggagattgg
B D                     Chimp  gtccttcagttttgtacaatggaaa--gagttctggagattgg
B D                   Gorilla  gtccttcagttttgtacaatggaaa--gacttctggagattgg
B D                    Gibbon  gtccttcagtattgtacaatggaaa--gagttctggagattgg
B D                    Rhesus  gtccttcagttttgtacaatggaaa--gagttctggaaattgg
B D       Crab-eating macaque  gtccttcagttttgtacaatggaaa--gagttctggaaattgg
B D                    Baboon  gtccttcagttttgtacaatggaaa--gagttctggaaattgg
B D              Green monkey  gtccttcagttttgcacaatggaaa--gagttctggaaattgg
B D                  Marmoset  gtccttcagttttgtacggtggaaa--gagttctggagattgg
B D           Squirrel monkey  atcctgcagttttgtacgatggaaa--gagttctggagattgc
B D                  Bushbaby  ----------------aaatgaaaa--gaattctggagattgg
           Chinese tree shrew  ------------------------------ttctggaggtcag
B D                    Rabbit  ------------gggacagcggtgg--cggcggtggtgatgg-
B D                       Pig  --gtttccgttttacag------------gttctggggatggg
B D                   Dolphin  --gtttcagttttacaagatgaaca---agttctggagatgga
                 Killer whale  --gtttcagttttacaagatgaaca---agttctggagatgga
             Tibetan antelope  --gtctcagttttacaagatggacg---cgtcgtggggacgga
B D                       Cow  --gtctcagttttacgagatggatg---tgtcgtggggatgga
B D                     Sheep  --gtctcagttttacaagatggacg---cgtcgcggggacgga
                Domestic goat  --gtcccagttttacaagatggacg---cgtcgcggggacgga
B D                     Horse  --gtttcagttttgcaagacgaaaa--gagttctgtggaggga
B D          White rhinoceros  --gtttcagttttgcaaaatgaaaa--gagttctggaga-tga
B D                       Cat  ---------ggtggggggagatgaacaccgttctggagatgga
B D                       Dog  gggtttcaggctggggagatgcgaa---agtcctggggac---
               Pacific walrus  gagtgtcaggctggggagatgagaa---agttctggagacgga
                Big brown bat  gagtttcagttttgcgagatgaaga--cagttctggagatgga
         David's myotis (bat)  gagttttagttttgcgagatgaaga--cagttctggagatggg
B D                  Microbat  gagttttcgttttgcgagatgaaga--cagttctggagatggg
B D                     Mouse  ===========================================
B D                       Rat  ===========================================
      Lesser Egyptian jerboa  ===========================================
B D                    Tenrec  ===========================================
         Cape elephant shrew  ===========================================
B D                  Hedgehog  ===========================================
B D                     Shrew  ===========================================
                Prairie vole  ===========================================
              Golden hamster  ===========================================
B D           Chinese hamster  ===========================================
             Star-nosed mole  ===========================================
B D                      Pika  ===========================================
B D                     Panda  ===========================================
B D                   Ferret   ===========================================
B D                   Manatee  ===========================================
B D                 Armadillo  ===========================================
B D                    Alpaca  ===========================================
              Bactrian camel  ===========================================
            Black flying-fox  ===========================================
B D                  Elephant  ===========================================
B D                Guinea pig  ===========================================
            Brush-tailed rat  ===========================================
B D            Naked mole-rat  ===========================================
                  Chinchilla  ===========================================
B D                  Squirrel  ===========================================
                Weddell seal  ===========================================
B D                   Chicken  ===========================================
B D                Budgerigar  ===========================================
          Tibetan ground jay  ===========================================
  D          Peregrine falcon  ===========================================
  D              Saker falcon  ===========================================
  D               Rock pigeon  ===========================================
B D       Medium ground finch  ===========================================
  D              Mallard duck  ===========================================
B D                   Wallaby  ===========================================
  D    White-throated sparrow  ===========================================
                    Aardvark  ===========================================
            Cape golden mole  ===========================================
B D                   Megabat  ===========================================
  D  Chinese softshell turtle  ===========================================
  D            Painted turtle  ===========================================
  D           Green seaturtle  ===========================================
B D           Tasmanian devil  ===========================================
B D                   Opossum  ===========================================
B D                  Platypus  ===========================================
B D        American alligator  ===========================================
B D               Zebra finch  ===========================================
  D       Collared flycatcher  ===========================================
B D                 Orangutan  ===========================================

Inserts between block 16 and 17 in window
B D                      Pig 223bp
B D                  Dolphin 12bp
                Killer whale 12bp
            Tibetan antelope 6bp
B D                      Cow 6bp
B D                    Sheep 6bp
               Domestic goat 6bp
B D                    Horse 12bp
B D         White rhinoceros 12bp
B D                      Cat 12bp
B D                      Dog 57bp
              Pacific walrus 13bp
               Big brown bat 12bp
        David's myotis (bat) 12bp
B D                 Microbat 12bp

Alignment block 17 of 38 in window, 101544258 - 101544286, 29 bps 
B D                     Human  ttatccaataatgtgaatacccttagcac
B D                     Chimp  ttatccaataatgtgaatacccttagcac
B D                   Gorilla  ttatccaataaagtgaatacccttagcac
B D                    Gibbon  ttttccaacaacgtgaatacccttagcac
B D                    Rhesus  ttatccaacaatgtgaatacccttagcac
B D       Crab-eating macaque  ttatccaacaatgtgaatacccttagcac
B D                    Baboon  ttatccaacaatgtgaatacccttagcac
B D              Green monkey  ttatccaaaaatgtgaacacgcttagcac
B D                  Marmoset  tta---gaccctgtgaa-----ttagcag
B D           Squirrel monkey  tta---gaccacgtgaa-----ttcgcag
B D                  Bushbaby  ctgcatgataatgtgaacatacttactgc
           Chinese tree shrew  ctgcacagcgacatggacgtgctcggctc
B D                    Rabbit  ---caccacggcgtgaatgcccttagcac
B D                   Dolphin  ttacacagccctgtgaacgccctcaaggc
                 Killer whale  ttatacagccctgtgaacgccctcaaggc
             Tibetan antelope  ---cctaaccctgcaaatgcactca----
B D                       Cow  ---cctaaccctgcgagtgtactcacggc
B D                     Sheep  ---cctaaccctacgaatgcactcacagc
                Domestic goat  ---cctaaccctgcgaatgcactcacggc
B D                     Horse  ttgtgcaacagtgtgagtgtgcttaatac
B D          White rhinoceros  ttgtgcaacagtgtgaatgtacttaatgc
B D                       Cat  gtgcaggacggtgtgaat-----------
               Pacific walrus  ctgcatgacggtgtgaatgtgcttcacgc
                Big brown bat  ttacacaacaacgtgaatgtacttggtgc
         David's myotis (bat)  ttacacaacaaagtgaatgtacttaatgc
B D                  Microbat  ttacacaacaacgtgaatgtacttaatgc
B D                     Mouse  =============================
B D                       Rat  =============================
      Lesser Egyptian jerboa  =============================
B D                    Tenrec  =============================
         Cape elephant shrew  =============================
B D                  Hedgehog  =============================
B D                     Shrew  =============================
                Prairie vole  =============================
              Golden hamster  =============================
B D           Chinese hamster  =============================
             Star-nosed mole  =============================
B D                      Pika  =============================
B D                       Dog  =============================
B D                     Panda  =============================
B D                   Ferret   =============================
B D                   Manatee  =============================
B D                 Armadillo  =============================
B D                    Alpaca  =============================
              Bactrian camel  =============================
            Black flying-fox  =============================
B D                  Elephant  =============================
B D                Guinea pig  =============================
            Brush-tailed rat  =============================
B D            Naked mole-rat  =============================
                  Chinchilla  =============================
B D                  Squirrel  =============================
B D                       Pig  =============================
                Weddell seal  =============================
B D                   Chicken  =============================
B D                Budgerigar  =============================
          Tibetan ground jay  =============================
  D          Peregrine falcon  =============================
  D              Saker falcon  =============================
  D               Rock pigeon  =============================
B D       Medium ground finch  =============================
  D              Mallard duck  =============================
B D                   Wallaby  =============================
  D    White-throated sparrow  =============================
                    Aardvark  =============================
            Cape golden mole  =============================
B D                   Megabat  =============================
  D  Chinese softshell turtle  =============================
  D            Painted turtle  =============================
  D           Green seaturtle  =============================
B D           Tasmanian devil  =============================
B D                   Opossum  =============================
B D                  Platypus  =============================
B D        American alligator  =============================
B D               Zebra finch  =============================
  D       Collared flycatcher  =============================
B D                 Orangutan  =============================

Alignment block 18 of 38 in window, 101544287 - 101544291, 5 bps 
B D                     Human  tactg
B D                     Chimp  tactg
B D                   Gorilla  tactg
B D                    Gibbon  tactg
B D                    Rhesus  tactg
B D       Crab-eating macaque  tactg
B D                    Baboon  tactg
B D              Green monkey  tactg
B D                  Marmoset  tatcg
B D           Squirrel monkey  tattg
B D                  Bushbaby  tactg
           Chinese tree shrew  tgctt
B D                    Rabbit  tgccc
B D                   Dolphin  cactg
                 Killer whale  cactg
B D                       Cow  tgcag
B D                     Sheep  cgcag
                Domestic goat  cgcag
B D                     Horse  tgctg
B D          White rhinoceros  cactg
               Pacific walrus  caatg
                Big brown bat  cacta
         David's myotis (bat)  cacta
B D                  Microbat  cacta
B D                     Mouse  =====
B D                       Rat  =====
      Lesser Egyptian jerboa  =====
B D                    Tenrec  =====
         Cape elephant shrew  =====
B D                  Hedgehog  =====
B D                     Shrew  =====
                Prairie vole  =====
              Golden hamster  =====
B D           Chinese hamster  =====
             Star-nosed mole  =====
B D                      Pika  =====
B D                       Dog  =====
B D                     Panda  =====
B D                   Ferret   =====
B D                   Manatee  =====
            Tibetan antelope  -----
B D                 Armadillo  =====
B D                    Alpaca  =====
              Bactrian camel  =====
            Black flying-fox  =====
B D                       Cat  -----
B D                  Elephant  =====
B D                Guinea pig  =====
            Brush-tailed rat  =====
B D            Naked mole-rat  =====
                  Chinchilla  =====
B D                  Squirrel  =====
B D                       Pig  =====
                Weddell seal  =====
B D                   Chicken  =====
B D                Budgerigar  =====
          Tibetan ground jay  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D               Rock pigeon  =====
B D       Medium ground finch  =====
  D              Mallard duck  =====
B D                   Wallaby  =====
  D    White-throated sparrow  =====
                    Aardvark  =====
            Cape golden mole  =====
B D                   Megabat  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D           Tasmanian devil  =====
B D                   Opossum  =====
B D                  Platypus  =====
B D        American alligator  =====
B D               Zebra finch  =====
  D       Collared flycatcher  =====
B D                 Orangutan  =====

Alignment block 19 of 38 in window, 101544292 - 101544292, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                    Rabbit  g
B D                   Dolphin  a
                 Killer whale  a
B D                       Cow  g
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                     Mouse  =
B D                       Rat  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
                Prairie vole  =
              Golden hamster  =
B D           Chinese hamster  =
             Star-nosed mole  =
B D                      Pika  =
B D                       Dog  =
B D                     Panda  =
B D                   Ferret   =
B D                   Manatee  =
            Tibetan antelope  -
B D                 Armadillo  =
B D                    Alpaca  =
              Bactrian camel  =
            Black flying-fox  =
B D                       Cat  -
B D                  Elephant  =
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
              Pacific walrus  -
B D                  Squirrel  =
B D                       Pig  =
                Weddell seal  =
B D                   Chicken  =
B D                Budgerigar  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  =
  D              Mallard duck  =
B D                   Wallaby  =
  D    White-throated sparrow  =
                    Aardvark  =
            Cape golden mole  =
B D                   Megabat  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D           Tasmanian devil  =
B D                   Opossum  =
B D                  Platypus  =
B D        American alligator  =
B D               Zebra finch  =
  D       Collared flycatcher  =
B D                 Orangutan  =

Alignment block 20 of 38 in window, 101544293 - 101544311, 19 bps 
B D                     Human  gctgc-tacttaaaaatggc
B D                     Chimp  gctgc-tacttaaaaatggc
B D                   Gorilla  gctgc-tacttaaaaatggc
B D                    Gibbon  gctgc-tacttaaaaatggc
B D                    Rhesus  gctgc-tacttaaaaatggc
B D       Crab-eating macaque  gctgc-tacttaaaaatggc
B D                    Baboon  gctgc-tacttaaagatggc
B D              Green monkey  gctgc-tacttaaaaatggc
B D                  Marmoset  actgc-tacttaaaaatggt
B D           Squirrel monkey  actgc-tacttaaaaatggt
B D                  Bushbaby  actg----------------
           Chinese tree shrew  gccgcatgctgacaaatggc
B D                    Rabbit  atgca-cgctcacagacggc
B D                   Dolphin  actgcacacttgaacatggt
                 Killer whale  actgcacacttgaacatggt
B D                       Cow  gctgcacacttgaaa-----
B D                     Sheep  actgcacgcttgaagacagt
                Domestic goat  actgcacgcttgaagacagt
B D          White rhinoceros  gctgtacacttaaaaatggt
B D                       Cat  -----ttactgaaaaatggt
                Big brown bat  gctgtattctaaaagatggt
         David's myotis (bat)  gctgtattctaaaag-tggt
B D                  Microbat  gctgtgttctaagagatggt
B D                     Mouse  ====================
B D                       Rat  ====================
      Lesser Egyptian jerboa  ====================
B D                    Tenrec  ====================
         Cape elephant shrew  ====================
B D                  Hedgehog  ====================
B D                     Shrew  ====================
                Prairie vole  ====================
              Golden hamster  ====================
B D           Chinese hamster  ====================
             Star-nosed mole  ====================
B D                      Pika  ====================
B D                       Dog  ====================
B D                     Panda  ====================
B D                   Ferret   ====================
B D                   Manatee  ====================
            Tibetan antelope  --------------------
B D                 Armadillo  ====================
B D                    Alpaca  ====================
              Bactrian camel  ====================
            Black flying-fox  ====================
B D                  Elephant  ====================
B D                Guinea pig  ====================
            Brush-tailed rat  ====================
B D            Naked mole-rat  ====================
                  Chinchilla  ====================
              Pacific walrus  --------------------
B D                     Horse  --------------------
B D                  Squirrel  ====================
B D                       Pig  ====================
                Weddell seal  ====================
B D                   Chicken  ====================
B D                Budgerigar  ====================
          Tibetan ground jay  ====================
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
  D               Rock pigeon  ====================
B D       Medium ground finch  ====================
  D              Mallard duck  ====================
B D                   Wallaby  ====================
  D    White-throated sparrow  ====================
                    Aardvark  ====================
            Cape golden mole  ====================
B D                   Megabat  ====================
  D  Chinese softshell turtle  ====================
  D            Painted turtle  ====================
  D           Green seaturtle  ====================
B D           Tasmanian devil  ====================
B D                   Opossum  ====================
B D                  Platypus  ====================
B D        American alligator  ====================
B D               Zebra finch  ====================
  D       Collared flycatcher  ====================
B D                 Orangutan  ====================

Alignment block 21 of 38 in window, 101544312 - 101544313, 2 bps 
B D                     Human  ta
B D                     Chimp  ta
B D                   Gorilla  ta
B D                    Gibbon  ta
B D                    Rhesus  ta
B D       Crab-eating macaque  ta
B D                    Baboon  ta
B D              Green monkey  ta
B D                  Marmoset  ta
B D           Squirrel monkey  ta
           Chinese tree shrew  ca
B D                    Rabbit  ca
                 Killer whale  ta
B D          White rhinoceros  ta
B D                       Cat  ga
                Big brown bat  ta
         David's myotis (bat)  ta
B D                  Microbat  tg
B D                     Mouse  ==
B D                       Rat  ==
      Lesser Egyptian jerboa  ==
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
                Prairie vole  ==
              Golden hamster  ==
B D           Chinese hamster  ==
             Star-nosed mole  ==
B D                      Pika  ==
B D                       Dog  ==
B D                     Panda  ==
B D                   Ferret   ==
B D                   Manatee  ==
B D                       Cow  --
               Domestic goat  --
B D                     Sheep  --
            Tibetan antelope  --
B D                 Armadillo  ==
B D                    Alpaca  ==
              Bactrian camel  ==
            Black flying-fox  ==
B D                  Bushbaby  --
B D                  Elephant  ==
B D                Guinea pig  ==
            Brush-tailed rat  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
              Pacific walrus  --
B D                     Horse  --
B D                  Squirrel  ==
B D                       Pig  ==
                Weddell seal  ==
B D                   Dolphin  --
B D                   Chicken  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
  D              Mallard duck  ==
B D                   Wallaby  ==
  D    White-throated sparrow  ==
                    Aardvark  ==
            Cape golden mole  ==
B D                   Megabat  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
B D                  Platypus  ==
B D        American alligator  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==
B D                 Orangutan  ==

Inserts between block 21 and 22 in window
          Chinese tree shrew 229bp

Alignment block 22 of 38 in window, 101544314 - 101544314, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                    Rabbit  a
                 Killer whale  a
B D          White rhinoceros  t
B D                       Cat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                     Mouse  =
B D                       Rat  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
                Prairie vole  =
              Golden hamster  =
B D           Chinese hamster  =
             Star-nosed mole  =
B D                      Pika  =
B D                       Dog  =
B D                     Panda  =
B D                   Ferret   =
B D                   Manatee  =
B D                       Cow  -
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
B D                 Armadillo  =
B D                    Alpaca  =
              Bactrian camel  =
            Black flying-fox  =
B D                  Bushbaby  -
B D                  Elephant  =
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
          Chinese tree shrew  =
              Pacific walrus  -
B D                     Horse  -
B D                  Squirrel  =
B D                       Pig  =
                Weddell seal  =
B D                   Dolphin  -
B D                   Chicken  =
B D                Budgerigar  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  =
  D              Mallard duck  =
B D                   Wallaby  =
  D    White-throated sparrow  =
                    Aardvark  =
            Cape golden mole  =
B D                   Megabat  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D           Tasmanian devil  =
B D                   Opossum  =
B D                  Platypus  =
B D        American alligator  =
B D               Zebra finch  =
  D       Collared flycatcher  =
B D                 Orangutan  =

Inserts between block 22 and 23 in window
               Big brown bat 574bp
        David's myotis (bat) 472bp
B D                 Microbat 460bp

Alignment block 23 of 38 in window, 101544315 - 101544317, 3 bps 
B D                     Human  gac
B D                     Chimp  gac
B D                   Gorilla  gac
B D                    Gibbon  gac
B D                    Rhesus  gac
B D       Crab-eating macaque  gac
B D                    Baboon  gac
B D              Green monkey  gac
B D                  Marmoset  gat
B D           Squirrel monkey  gat
B D                    Rabbit  gac
                 Killer whale  gat
B D          White rhinoceros  aat
B D                       Cat  gtt
B D                     Mouse  ===
B D                       Rat  ===
      Lesser Egyptian jerboa  ===
B D                    Tenrec  ===
         Cape elephant shrew  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
                Prairie vole  ===
              Golden hamster  ===
B D           Chinese hamster  ===
             Star-nosed mole  ===
B D                      Pika  ===
B D                       Dog  ===
B D                     Panda  ===
B D                   Ferret   ===
        David's myotis (bat)  ===
B D                   Manatee  ===
B D                  Microbat  ===
               Big brown bat  ===
B D                       Cow  ---
               Domestic goat  ---
B D                     Sheep  ---
            Tibetan antelope  ---
B D                 Armadillo  ===
B D                    Alpaca  ===
              Bactrian camel  ===
            Black flying-fox  ===
B D                  Bushbaby  ---
B D                  Elephant  ===
B D                Guinea pig  ===
            Brush-tailed rat  ===
B D            Naked mole-rat  ===
                  Chinchilla  ===
          Chinese tree shrew  ===
              Pacific walrus  ---
B D                     Horse  ---
B D                  Squirrel  ===
B D                       Pig  ===
                Weddell seal  ===
B D                   Dolphin  ---
B D                   Chicken  ===
B D                Budgerigar  ===
          Tibetan ground jay  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D       Medium ground finch  ===
  D              Mallard duck  ===
B D                   Wallaby  ===
  D    White-throated sparrow  ===
                    Aardvark  ===
            Cape golden mole  ===
B D                   Megabat  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D           Tasmanian devil  ===
B D                   Opossum  ===
B D                  Platypus  ===
B D        American alligator  ===
B D               Zebra finch  ===
  D       Collared flycatcher  ===
B D                 Orangutan  ===

Inserts between block 23 and 24 in window
B D                      Cat 6bp

Alignment block 24 of 38 in window, 101544318 - 101544321, 4 bps 
B D                     Human  agta
B D                     Chimp  agta
B D                   Gorilla  ggta
B D                    Gibbon  agta
B D                    Rhesus  ggta
B D       Crab-eating macaque  ggta
B D                    Baboon  ggta
B D              Green monkey  ggta
B D                  Marmoset  gctg
B D           Squirrel monkey  gctg
B D                    Rabbit  ggca
             Tibetan antelope  --ca
B D                       Cow  -gta
B D                     Mouse  ====
B D                       Rat  ====
      Lesser Egyptian jerboa  ====
B D                    Tenrec  ====
         Cape elephant shrew  ====
B D                  Hedgehog  ====
B D                     Shrew  ====
                Prairie vole  ====
              Golden hamster  ====
B D           Chinese hamster  ====
             Star-nosed mole  ====
B D                      Pika  ====
B D                       Dog  ====
B D                     Panda  ====
B D                   Ferret   ====
        David's myotis (bat)  ====
B D                   Manatee  ====
B D                  Microbat  ====
               Big brown bat  ====
               Domestic goat  ----
B D                     Sheep  ----
                Killer whale  ----
B D                 Armadillo  ====
B D                    Alpaca  ====
              Bactrian camel  ====
            Black flying-fox  ====
B D                       Cat  ====
B D                  Bushbaby  ----
B D                  Elephant  ====
B D                Guinea pig  ====
            Brush-tailed rat  ====
B D            Naked mole-rat  ====
                  Chinchilla  ====
          Chinese tree shrew  ====
              Pacific walrus  ----
B D          White rhinoceros  ----
B D                     Horse  ----
B D                  Squirrel  ====
B D                       Pig  ====
                Weddell seal  ====
B D                   Dolphin  ----
B D                   Chicken  ====
B D                Budgerigar  ====
          Tibetan ground jay  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D               Rock pigeon  ====
B D       Medium ground finch  ====
  D              Mallard duck  ====
B D                   Wallaby  ====
  D    White-throated sparrow  ====
                    Aardvark  ====
            Cape golden mole  ====
B D                   Megabat  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D           Tasmanian devil  ====
B D                   Opossum  ====
B D                  Platypus  ====
B D        American alligator  ====
B D               Zebra finch  ====
  D       Collared flycatcher  ====
B D                 Orangutan  ====

Inserts between block 24 and 25 in window
B D                   Rabbit 157bp

Alignment block 25 of 38 in window, 101544322 - 101544329, 8 bps 
B D                     Human  gccaggct
B D                     Chimp  gccaggct
B D                   Gorilla  gccaggct
B D                    Gibbon  gccaggct
B D                    Rhesus  gccaggct
B D       Crab-eating macaque  gccaggct
B D                    Baboon  gccaggct
B D              Green monkey  gccaggct
B D                  Marmoset  gccagact
B D           Squirrel monkey  gccagact
             Tibetan antelope  gcca----
B D                       Cow  gtcagggt
B D                       Cat  gcctgggg
B D                     Mouse  ========
B D                       Rat  ========
      Lesser Egyptian jerboa  ========
B D                    Tenrec  ========
         Cape elephant shrew  ========
B D                  Hedgehog  ========
B D                     Shrew  ========
                Prairie vole  ========
              Golden hamster  ========
B D           Chinese hamster  ========
             Star-nosed mole  ========
B D                      Pika  ========
B D                    Rabbit  ========
B D                       Dog  ========
B D                     Panda  ========
B D                   Ferret   ========
        David's myotis (bat)  ========
B D                   Manatee  ========
B D                  Microbat  ========
               Big brown bat  ========
               Domestic goat  --------
B D                     Sheep  --------
                Killer whale  --------
B D                 Armadillo  ========
B D                    Alpaca  ========
              Bactrian camel  ========
            Black flying-fox  ========
B D                  Bushbaby  --------
B D                  Elephant  ========
B D                Guinea pig  ========
            Brush-tailed rat  ========
B D            Naked mole-rat  ========
                  Chinchilla  ========
          Chinese tree shrew  ========
              Pacific walrus  --------
B D          White rhinoceros  --------
B D                     Horse  --------
B D                  Squirrel  ========
B D                       Pig  ========
                Weddell seal  ========
B D                   Dolphin  --------
B D                   Chicken  ========
B D                Budgerigar  ========
          Tibetan ground jay  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D               Rock pigeon  ========
B D       Medium ground finch  ========
  D              Mallard duck  ========
B D                   Wallaby  ========
  D    White-throated sparrow  ========
                    Aardvark  ========
            Cape golden mole  ========
B D                   Megabat  ========
  D  Chinese softshell turtle  ========
  D            Painted turtle  ========
  D           Green seaturtle  ========
B D           Tasmanian devil  ========
B D                   Opossum  ========
B D                  Platypus  ========
B D        American alligator  ========
B D               Zebra finch  ========
  D       Collared flycatcher  ========
B D                 Orangutan  ========

Inserts between block 25 and 26 in window
B D                      Cat 4bp

Alignment block 26 of 38 in window, 101544330 - 101544335, 6 bps 
B D                     Human  caatgc
B D                     Chimp  caatgc
B D                   Gorilla  caatgc
B D                    Gibbon  cagtgc
B D                    Rhesus  cagtgc
B D       Crab-eating macaque  cagtgc
B D                    Baboon  cagtgc
B D              Green monkey  cagtgc
B D                  Marmoset  cagtgc
B D           Squirrel monkey  cagtgc
B D                  Bushbaby  -aatgc
B D                       Cat  cagt--
B D                     Mouse  ======
B D                       Rat  ======
      Lesser Egyptian jerboa  ======
B D                    Tenrec  ======
         Cape elephant shrew  ======
B D                  Hedgehog  ======
B D                     Shrew  ======
                Prairie vole  ======
              Golden hamster  ======
B D           Chinese hamster  ======
             Star-nosed mole  ======
B D                      Pika  ======
B D                    Rabbit  ======
B D                       Dog  ======
B D                     Panda  ======
B D                   Ferret   ======
        David's myotis (bat)  ======
B D                   Manatee  ======
B D                  Microbat  ======
               Big brown bat  ======
B D                       Cow  ------
               Domestic goat  ------
B D                     Sheep  ------
            Tibetan antelope  ------
                Killer whale  ------
B D                 Armadillo  ======
B D                    Alpaca  ======
              Bactrian camel  ======
            Black flying-fox  ======
B D                  Elephant  ======
B D                Guinea pig  ======
            Brush-tailed rat  ======
B D            Naked mole-rat  ======
                  Chinchilla  ======
          Chinese tree shrew  ======
              Pacific walrus  ------
B D          White rhinoceros  ------
B D                     Horse  ------
B D                  Squirrel  ======
B D                       Pig  ======
                Weddell seal  ======
B D                   Dolphin  ------
B D                   Chicken  ======
B D                Budgerigar  ======
          Tibetan ground jay  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D               Rock pigeon  ======
B D       Medium ground finch  ======
  D              Mallard duck  ======
B D                   Wallaby  ======
  D    White-throated sparrow  ======
                    Aardvark  ======
            Cape golden mole  ======
B D                   Megabat  ======
  D  Chinese softshell turtle  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D           Tasmanian devil  ======
B D                   Opossum  ======
B D                  Platypus  ======
B D        American alligator  ======
B D               Zebra finch  ======
  D       Collared flycatcher  ======
B D                 Orangutan  ======

Alignment block 27 of 38 in window, 101544336 - 101544340, 5 bps 
B D                     Human  ataat
B D                     Chimp  acaat
B D                   Gorilla  acaat
B D                    Gibbon  acaat
B D                    Rhesus  acaat
B D       Crab-eating macaque  acaat
B D                    Baboon  acaat
B D              Green monkey  acaat
B D                  Marmoset  acagt
B D           Squirrel monkey  acaat
B D                     Mouse  =====
B D                       Rat  =====
      Lesser Egyptian jerboa  =====
B D                    Tenrec  =====
         Cape elephant shrew  =====
B D                  Hedgehog  =====
B D                     Shrew  =====
                Prairie vole  =====
              Golden hamster  =====
B D           Chinese hamster  =====
             Star-nosed mole  =====
B D                      Pika  =====
B D                    Rabbit  =====
B D                       Dog  =====
B D                     Panda  =====
B D                   Ferret   =====
        David's myotis (bat)  =====
B D                   Manatee  =====
B D                  Microbat  =====
               Big brown bat  =====
B D                       Cow  -----
               Domestic goat  -----
B D                     Sheep  -----
            Tibetan antelope  -----
                Killer whale  -----
B D                 Armadillo  =====
B D                    Alpaca  =====
              Bactrian camel  =====
            Black flying-fox  =====
B D                       Cat  -----
B D                  Bushbaby  -----
B D                  Elephant  =====
B D                Guinea pig  =====
            Brush-tailed rat  =====
B D            Naked mole-rat  =====
                  Chinchilla  =====
          Chinese tree shrew  =====
              Pacific walrus  -----
B D          White rhinoceros  -----
B D                     Horse  -----
B D                  Squirrel  =====
B D                       Pig  =====
                Weddell seal  =====
B D                   Dolphin  -----
B D                   Chicken  =====
B D                Budgerigar  =====
          Tibetan ground jay  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D               Rock pigeon  =====
B D       Medium ground finch  =====
  D              Mallard duck  =====
B D                   Wallaby  =====
  D    White-throated sparrow  =====
                    Aardvark  =====
            Cape golden mole  =====
B D                   Megabat  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D           Tasmanian devil  =====
B D                   Opossum  =====
B D                  Platypus  =====
B D        American alligator  =====
B D               Zebra finch  =====
  D       Collared flycatcher  =====
B D                 Orangutan  =====

Alignment block 28 of 38 in window, 101544341 - 101544371, 31 bps 
B D                     Human  ctggtcaccccagctactcaggaggctgagg------
B D                     Chimp  ctggtcaccccagctactcaggaggctgagg------
B D                   Gorilla  ctgatcaccccagctactcaggaggctgagg------
B D                    Gibbon  ccggtcaccccagctactcaggaggctgagg------
B D                    Rhesus  ccaggcaccccagctactcaggaggctgagg------
B D       Crab-eating macaque  ccaggcaccccagctactcaggaggctgagg------
B D                    Baboon  ccaggcaccccagctactcaggaggctgagg------
B D              Green monkey  ccagtcacaccagctactccggaggctgagg------
B D                  Marmoset  ctggtcaccccagcttctcagaaggctgagg------
B D           Squirrel monkey  ctggtcaccccagctattcggaaggctgagg------
B D                       Cat  -cggttaagcgcccgactctt--ggcttcggctcagg
B D                     Mouse  =====================================
B D                       Rat  =====================================
      Lesser Egyptian jerboa  =====================================
B D                    Tenrec  =====================================
         Cape elephant shrew  =====================================
B D                  Hedgehog  =====================================
B D                     Shrew  =====================================
                Prairie vole  =====================================
              Golden hamster  =====================================
B D           Chinese hamster  =====================================
             Star-nosed mole  =====================================
B D                      Pika  =====================================
B D                    Rabbit  =====================================
B D                       Dog  =====================================
B D                     Panda  =====================================
B D                   Ferret   =====================================
        David's myotis (bat)  =====================================
B D                   Manatee  =====================================
B D                  Microbat  =====================================
               Big brown bat  =====================================
B D                       Cow  -------------------------------------
               Domestic goat  -------------------------------------
B D                     Sheep  -------------------------------------
            Tibetan antelope  -------------------------------------
                Killer whale  -------------------------------------
B D                 Armadillo  =====================================
B D                    Alpaca  =====================================
              Bactrian camel  =====================================
            Black flying-fox  =====================================
B D                  Bushbaby  -------------------------------------
B D                  Elephant  =====================================
B D                Guinea pig  =====================================
            Brush-tailed rat  =====================================
B D            Naked mole-rat  =====================================
                  Chinchilla  =====================================
          Chinese tree shrew  =====================================
              Pacific walrus  -------------------------------------
B D          White rhinoceros  -------------------------------------
B D                     Horse  -------------------------------------
B D                  Squirrel  =====================================
B D                       Pig  =====================================
                Weddell seal  =====================================
B D                   Dolphin  -------------------------------------
B D                   Chicken  =====================================
B D                Budgerigar  =====================================
          Tibetan ground jay  =====================================
  D          Peregrine falcon  =====================================
  D              Saker falcon  =====================================
  D               Rock pigeon  =====================================
B D       Medium ground finch  =====================================
  D              Mallard duck  =====================================
B D                   Wallaby  =====================================
  D    White-throated sparrow  =====================================
                    Aardvark  =====================================
            Cape golden mole  =====================================
B D                   Megabat  =====================================
  D  Chinese softshell turtle  =====================================
  D            Painted turtle  =====================================
  D           Green seaturtle  =====================================
B D           Tasmanian devil  =====================================
B D                   Opossum  =====================================
B D                  Platypus  =====================================
B D        American alligator  =====================================
B D               Zebra finch  =====================================
  D       Collared flycatcher  =====================================
B D                 Orangutan  =====================================

Inserts between block 28 and 29 in window
B D                 Marmoset 288bp

Alignment block 29 of 38 in window, 101544372 - 101544377, 6 bps 
B D                     Human  cagaag
B D                     Chimp  cagaag
B D                   Gorilla  cagaag
B D                    Gibbon  caggag
B D                    Rhesus  caggag
B D       Crab-eating macaque  caggag
B D                    Baboon  caggag
B D              Green monkey  caggag
B D                  Marmoset  caggag
B D           Squirrel monkey  caggag
B D                       Cat  tggt--
B D                     Mouse  ======
B D                       Rat  ======
      Lesser Egyptian jerboa  ======
B D                    Tenrec  ======
         Cape elephant shrew  ======
B D                  Hedgehog  ======
B D                     Shrew  ======
                Prairie vole  ======
              Golden hamster  ======
B D           Chinese hamster  ======
             Star-nosed mole  ======
B D                      Pika  ======
B D                    Rabbit  ======
B D                       Dog  ======
B D                     Panda  ======
B D                   Ferret   ======
        David's myotis (bat)  ======
B D                   Manatee  ======
B D                  Microbat  ======
               Big brown bat  ======
B D                       Cow  ------
               Domestic goat  ------
B D                     Sheep  ------
            Tibetan antelope  ------
                Killer whale  ------
B D                 Armadillo  ======
B D                    Alpaca  ======
              Bactrian camel  ======
            Black flying-fox  ======
B D                  Bushbaby  ------
B D                  Elephant  ======
B D                Guinea pig  ======
            Brush-tailed rat  ======
B D            Naked mole-rat  ======
                  Chinchilla  ======
          Chinese tree shrew  ======
              Pacific walrus  ------
B D          White rhinoceros  ------
B D                     Horse  ------
B D                  Squirrel  ======
B D                       Pig  ======
                Weddell seal  ======
B D                   Dolphin  ------
B D                   Chicken  ======
B D                Budgerigar  ======
          Tibetan ground jay  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D               Rock pigeon  ======
B D       Medium ground finch  ======
  D              Mallard duck  ======
B D                   Wallaby  ======
  D    White-throated sparrow  ======
                    Aardvark  ======
            Cape golden mole  ======
B D                   Megabat  ======
  D  Chinese softshell turtle  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D           Tasmanian devil  ======
B D                   Opossum  ======
B D                  Platypus  ======
B D        American alligator  ======
B D               Zebra finch  ======
  D       Collared flycatcher  ======
B D                 Orangutan  ======

Inserts between block 29 and 30 in window
B D          Squirrel monkey 296bp

Alignment block 30 of 38 in window, 101544378 - 101544411, 34 bps 
B D                     Human  gatctttgagcccaggagttcaagcccagcctgg
B D                     Chimp  gatctttgagcccaggagttcaagcccagcctgg
B D                   Gorilla  gatctttgagcccaggagttcaagtccagccagg
B D                    Gibbon  gatctttgggcccaggaggtcaagtccagcctgg
B D                    Rhesus  gatctttgagcccaggagttcaagtccagcctgg
B D       Crab-eating macaque  gatctttgagcccaggagttcaagtccagcctgg
B D                    Baboon  gatctttgagcccaggagttcaagtccagcctgg
B D              Green monkey  gatctttgagcccaggagttcaagtccagcctgg
B D                  Marmoset  gatctttgggcccaggagttcaagtccaggctgg
B D           Squirrel monkey  gatctttgggcccaggagttcaagtccagcccgg
             Tibetan antelope  ------------cagaagtgcacgc---------
B D                       Cat  gatcttgtggttcgtgagttcgagccccacgtca
B D                     Mouse  ==================================
B D                       Rat  ==================================
      Lesser Egyptian jerboa  ==================================
B D                    Tenrec  ==================================
         Cape elephant shrew  ==================================
B D                  Hedgehog  ==================================
B D                     Shrew  ==================================
                Prairie vole  ==================================
              Golden hamster  ==================================
B D           Chinese hamster  ==================================
             Star-nosed mole  ==================================
B D                      Pika  ==================================
B D                    Rabbit  ==================================
B D                       Dog  ==================================
B D                     Panda  ==================================
B D                   Ferret   ==================================
        David's myotis (bat)  ==================================
B D                   Manatee  ==================================
B D                  Microbat  ==================================
               Big brown bat  ==================================
B D                       Cow  ----------------------------------
               Domestic goat  ----------------------------------
B D                     Sheep  ----------------------------------
                Killer whale  ----------------------------------
B D                 Armadillo  ==================================
B D                    Alpaca  ==================================
              Bactrian camel  ==================================
            Black flying-fox  ==================================
B D                  Bushbaby  ----------------------------------
B D                  Elephant  ==================================
B D                Guinea pig  ==================================
            Brush-tailed rat  ==================================
B D            Naked mole-rat  ==================================
                  Chinchilla  ==================================
          Chinese tree shrew  ==================================
              Pacific walrus  ----------------------------------
B D          White rhinoceros  ----------------------------------
B D                     Horse  ----------------------------------
B D                  Squirrel  ==================================
B D                       Pig  ==================================
                Weddell seal  ==================================
B D                   Dolphin  ----------------------------------
B D                   Chicken  ==================================
B D                Budgerigar  ==================================
          Tibetan ground jay  ==================================
  D          Peregrine falcon  ==================================
  D              Saker falcon  ==================================
  D               Rock pigeon  ==================================
B D       Medium ground finch  ==================================
  D              Mallard duck  ==================================
B D                   Wallaby  ==================================
  D    White-throated sparrow  ==================================
                    Aardvark  ==================================
            Cape golden mole  ==================================
B D                   Megabat  ==================================
  D  Chinese softshell turtle  ==================================
  D            Painted turtle  ==================================
  D           Green seaturtle  ==================================
B D           Tasmanian devil  ==================================
B D                   Opossum  ==================================
B D                  Platypus  ==================================
B D        American alligator  ==================================
B D               Zebra finch  ==================================
  D       Collared flycatcher  ==================================
B D                 Orangutan  ==================================

Inserts between block 30 and 31 in window
B D                      Cat 12bp

Alignment block 31 of 38 in window, 101544412 - 101544418, 7 bps 
B D                     Human  gcaacat
B D                     Chimp  gcaacat
B D                   Gorilla  gcaacat
B D                    Gibbon  gcaacat
B D                    Rhesus  gcaacat
B D       Crab-eating macaque  gcaacat
B D                    Baboon  gcaacat
B D              Green monkey  gcaacat
B D                  Marmoset  gcaacat
B D           Squirrel monkey  gcaacat
B D                       Cat  -----ac
                 Weddell seal  gcatgat
B D                     Mouse  =======
B D                       Rat  =======
      Lesser Egyptian jerboa  =======
B D                    Tenrec  =======
         Cape elephant shrew  =======
B D                  Hedgehog  =======
B D                     Shrew  =======
                Prairie vole  =======
              Golden hamster  =======
B D           Chinese hamster  =======
             Star-nosed mole  =======
B D                      Pika  =======
B D                    Rabbit  =======
B D                       Dog  =======
B D                     Panda  =======
B D                   Ferret   =======
        David's myotis (bat)  =======
B D                   Manatee  =======
B D                  Microbat  =======
               Big brown bat  =======
B D                       Cow  -------
               Domestic goat  -------
B D                     Sheep  -------
            Tibetan antelope  -------
                Killer whale  -------
B D                 Armadillo  =======
B D                    Alpaca  =======
              Bactrian camel  =======
            Black flying-fox  =======
B D                  Bushbaby  -------
B D                  Elephant  =======
B D                Guinea pig  =======
            Brush-tailed rat  =======
B D            Naked mole-rat  =======
                  Chinchilla  =======
          Chinese tree shrew  =======
              Pacific walrus  -------
B D          White rhinoceros  -------
B D                     Horse  -------
B D                  Squirrel  =======
B D                       Pig  =======
B D                   Dolphin  -------
B D                   Chicken  =======
B D                Budgerigar  =======
          Tibetan ground jay  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
B D       Medium ground finch  =======
  D              Mallard duck  =======
B D                   Wallaby  =======
  D    White-throated sparrow  =======
                    Aardvark  =======
            Cape golden mole  =======
B D                   Megabat  =======
  D  Chinese softshell turtle  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D           Tasmanian devil  =======
B D                   Opossum  =======
B D                  Platypus  =======
B D        American alligator  =======
B D               Zebra finch  =======
  D       Collared flycatcher  =======
B D                 Orangutan  =======

Alignment block 32 of 38 in window, 101544419 - 101544437, 19 bps 
B D                     Human  agtgctcattgtttttatc
B D                     Chimp  agtgctcattgtttttatc
B D                   Gorilla  agtgcttattgtttttatc
B D                    Gibbon  agtgctcattgtttttatc
B D                    Rhesus  agtgctcattgtttttctc
B D       Crab-eating macaque  agtgctcattgtttttctc
B D                    Baboon  agcgctcattgtttttctc
B D              Green monkey  agtgctcattgtttttctc
B D                  Marmoset  agcgctcactgtttttctc
B D           Squirrel monkey  ggcactcactgtttttctc
B D                     Horse  agtgtaca-----------
B D                       Cat  agtgcggagcctgcttggg
                 Weddell seal  ggtgtgaa-------tgtg
B D                     Mouse  ===================
B D                       Rat  ===================
      Lesser Egyptian jerboa  ===================
B D                    Tenrec  ===================
         Cape elephant shrew  ===================
B D                  Hedgehog  ===================
B D                     Shrew  ===================
                Prairie vole  ===================
              Golden hamster  ===================
B D           Chinese hamster  ===================
             Star-nosed mole  ===================
B D                      Pika  ===================
B D                    Rabbit  ===================
B D                       Dog  ===================
B D                     Panda  ===================
B D                   Ferret   ===================
        David's myotis (bat)  ===================
B D                   Manatee  ===================
B D                  Microbat  ===================
               Big brown bat  ===================
B D                       Cow  -------------------
               Domestic goat  -------------------
B D                     Sheep  -------------------
            Tibetan antelope  -------------------
                Killer whale  -------------------
B D                 Armadillo  ===================
B D                    Alpaca  ===================
              Bactrian camel  ===================
            Black flying-fox  ===================
B D                  Bushbaby  -------------------
B D                  Elephant  ===================
B D                Guinea pig  ===================
            Brush-tailed rat  ===================
B D            Naked mole-rat  ===================
                  Chinchilla  ===================
          Chinese tree shrew  ===================
              Pacific walrus  -------------------
B D          White rhinoceros  -------------------
B D                  Squirrel  ===================
B D                       Pig  ===================
B D                   Dolphin  -------------------
B D                   Chicken  ===================
B D                Budgerigar  ===================
          Tibetan ground jay  ===================
  D          Peregrine falcon  ===================
  D              Saker falcon  ===================
  D               Rock pigeon  ===================
B D       Medium ground finch  ===================
  D              Mallard duck  ===================
B D                   Wallaby  ===================
  D    White-throated sparrow  ===================
                    Aardvark  ===================
            Cape golden mole  ===================
B D                   Megabat  ===================
  D  Chinese softshell turtle  ===================
  D            Painted turtle  ===================
  D           Green seaturtle  ===================
B D           Tasmanian devil  ===================
B D                   Opossum  ===================
B D                  Platypus  ===================
B D        American alligator  ===================
B D               Zebra finch  ===================
  D       Collared flycatcher  ===================
B D                 Orangutan  ===================

Alignment block 33 of 38 in window, 101544438 - 101544439, 2 bps 
B D                     Human  -tt
B D                     Chimp  -tt
B D                   Gorilla  -tt
B D                    Gibbon  -tt
B D                    Rhesus  -tt
B D       Crab-eating macaque  -tt
B D                    Baboon  -tt
B D              Green monkey  -tt
B D                  Marmoset  -tt
B D           Squirrel monkey  -tt
B D                  Bushbaby  -tt
             Tibetan antelope  -t-
B D                     Horse  ct-
B D                       Cat  at-
                 Weddell seal  ct-
B D                     Mouse  ===
B D                       Rat  ===
      Lesser Egyptian jerboa  ===
B D                    Tenrec  ===
         Cape elephant shrew  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
                Prairie vole  ===
              Golden hamster  ===
B D           Chinese hamster  ===
             Star-nosed mole  ===
B D                      Pika  ===
B D                    Rabbit  ===
B D                       Dog  ===
B D                     Panda  ===
B D                   Ferret   ===
        David's myotis (bat)  ===
B D                   Manatee  ===
B D                  Microbat  ===
               Big brown bat  ===
B D                       Cow  ---
               Domestic goat  ---
B D                     Sheep  ---
                Killer whale  ---
B D                 Armadillo  ===
B D                    Alpaca  ===
              Bactrian camel  ===
            Black flying-fox  ===
B D                  Elephant  ===
B D                Guinea pig  ===
            Brush-tailed rat  ===
B D            Naked mole-rat  ===
                  Chinchilla  ===
          Chinese tree shrew  ===
              Pacific walrus  ---
B D          White rhinoceros  ---
B D                  Squirrel  ===
B D                       Pig  ===
B D                   Dolphin  ---
B D                   Chicken  ===
B D                Budgerigar  ===
          Tibetan ground jay  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D       Medium ground finch  ===
  D              Mallard duck  ===
B D                   Wallaby  ===
  D    White-throated sparrow  ===
                    Aardvark  ===
            Cape golden mole  ===
B D                   Megabat  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D           Tasmanian devil  ===
B D                   Opossum  ===
B D                  Platypus  ===
B D        American alligator  ===
B D               Zebra finch  ===
  D       Collared flycatcher  ===
B D                 Orangutan  ===

Inserts between block 33 and 34 in window
B D                   Rhesus 1bp
B D      Crab-eating macaque 1bp
B D                   Baboon 3bp
B D             Green monkey 2bp
B D          Squirrel monkey 2bp

Alignment block 34 of 38 in window, 101544440 - 101544440, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D                  Marmoset  -a
B D           Squirrel monkey  -a
B D                  Bushbaby  -a
           Chinese tree shrew  -g
             Tibetan antelope  t-
B D                     Horse  t-
B D                       Cat  t-
                 Weddell seal  t-
B D                     Mouse  ==
B D                       Rat  ==
      Lesser Egyptian jerboa  ==
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
                Prairie vole  ==
              Golden hamster  ==
B D           Chinese hamster  ==
             Star-nosed mole  ==
B D                      Pika  ==
B D                    Rabbit  ==
B D                       Dog  ==
B D                     Panda  ==
B D                   Ferret   ==
        David's myotis (bat)  ==
B D                   Manatee  ==
B D                  Microbat  ==
               Big brown bat  ==
B D                       Cow  --
               Domestic goat  --
B D                     Sheep  --
                Killer whale  --
B D                 Armadillo  ==
B D                    Alpaca  ==
              Bactrian camel  ==
            Black flying-fox  ==
B D                  Elephant  ==
B D                Guinea pig  ==
            Brush-tailed rat  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
              Pacific walrus  --
B D          White rhinoceros  --
B D                  Squirrel  ==
B D                       Pig  ==
B D                   Dolphin  --
B D                   Chicken  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
  D              Mallard duck  ==
B D                   Wallaby  ==
  D    White-throated sparrow  ==
                    Aardvark  ==
            Cape golden mole  ==
B D                   Megabat  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
B D                  Platypus  ==
B D        American alligator  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==
B D                 Orangutan  ==

Inserts between block 34 and 35 in window
B D                    Horse 1bp
B D                      Cat 49bp
                Weddell seal 8bp

Alignment block 35 of 38 in window, 101544441 - 101544442, 2 bps