Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 114 in window, 18202338 - 18202338, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
B D            Naked mole-rat  c
B D                Guinea pig  t
                   Chinchilla  t
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  c
B D          White rhinoceros  g
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
              Star-nosed mole  c
             Cape golden mole  -
B D              Nile tilapia  -
         Cape elephant shrew  =
              Golden hamster  =
                Prairie vole  =
B D                     Mouse  =
B D                       Rat  =
B D                   Lamprey  =
B D                    Medaka  =
    Mexican tetra (cavefish)  =
B D           Chinese hamster  =
B D                      Pika  =
B D                    Tenrec  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                 Zebrafish  =
B D             X. tropicalis  =
B D                    Lizard  =
  D              Mallard duck  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                   Wallaby  =
B D           Tasmanian devil  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
B D                   Opossum  =
  D    Spiny softshell turtle  =
  D    White-throated sparrow  =
B D                    Turkey  =
B D                   Chicken  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                Coelacanth  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D              Atlantic cod  =
B D               Stickleback  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
                 Spotted gar  =
B D        American alligator  =
          Tibetan ground jay  =
B D                  Platypus  =
            Brush-tailed rat  =
                    Aardvark  =
B D                 Armadillo  =
B D                   Manatee  =
B D                  Elephant  =

Alignment block 2 of 114 in window, 18202339 - 18202354, 16 bps 
B D                     Human  a----------------------------tgggagaacacaggt
B D                     Chimp  a----------------------------tgggagaacacaggt
B D                   Gorilla  a----------------------------tgggagaatacagat
B D                 Orangutan  a----------------------------tgggagaatgcaggt
B D                    Gibbon  a----------------------------tgggagaacacaggt
B D                    Rhesus  a----------------------------tgggagaacacagtt
B D       Crab-eating macaque  a----------------------------tgggagaacacagtt
B D                    Baboon  a----------------------------tgggagaacacagtt
B D              Green monkey  a----------------------------tgggagaacacagtt
B D                  Marmoset  a----------------------------tgggagaacacaggt
B D           Squirrel monkey  a----------------------------tgggagaacagaggt
B D                  Bushbaby  a----------------------------tgagggaacaggggt
           Chinese tree shrew  c----------------------------tgtgggaacagggct
B D                  Squirrel  a--------------------------------ggaacgggggt
       Lesser Egyptian jerboa  a----------------------------t---ggcacagagct
B D            Naked mole-rat  a----------------------------c---agctcccttgc
B D                Guinea pig  g----------------------------c---ctgaccctggt
                   Chinchilla  a----------------------------t---ggcacacccgg
B D                       Pig  a-------------------------------aagaaccgagat
B D                    Alpaca  a----------------------------ggggagaatgggggc
               Bactrian camel  a----------------------------ggggagaatgggggc
B D                   Dolphin  a----------------------------tggaagaacaggggc
                 Killer whale  a----------------------------tggaagaacaggggc
             Tibetan antelope  a----------------------------tgggaaaaacgggac
B D                       Cow  a----------------------------tgggagaaaggggac
B D                     Sheep  a----------------------------tgggagaaaccggac
                Domestic goat  a----------------------------tgggagaaacaggac
B D                     Horse  a----------------------------tgggagaacagcggc
B D          White rhinoceros  a----------------------------tgggagaacagatgc
B D                       Cat  a----------------------------tgggagaacaacagc
B D                       Dog  a----------------------------tggaaggaccc-agc
B D                   Ferret   a----------------------------tgggagaatag-ggc
B D                     Panda  a----------------------------tgggagaacag-ggc
               Pacific walrus  a----------------------------cgggagaacag-ggc
                 Weddell seal  a----------------------------cgggagaacag-ggc
             Black flying-fox  agccctggagaacactaaataggctccaatggaaaagcaggggt
                Big brown bat  agccctggagagcactatttaagctccaatggaagaggagggac
         David's myotis (bat)  ag---------------------------tggaagaggaggggc
B D                  Microbat  ag---------------------------tggaagaggaggggc
              Star-nosed mole  c----------------------------ttcctcactctgggg
B D                  Elephant  a----------------------------tgggggtgctggggt
B D                   Manatee  a----------------------------tgagggagctgaggt
             Cape golden mole  ------------------------------aaggga---ggggt
B D              Nile tilapia  ------------------------------gtgaaa--------
         Cape elephant shrew  ============================================
              Golden hamster  ============================================
                Prairie vole  ============================================
B D                     Mouse  ============================================
B D                       Rat  ============================================
B D                   Lamprey  ============================================
B D                    Medaka  ============================================
    Mexican tetra (cavefish)  ============================================
B D           Chinese hamster  ============================================
B D                      Pika  ============================================
B D                    Tenrec  ============================================
B D                  Hedgehog  ============================================
B D                     Shrew  ============================================
B D                 Zebrafish  ============================================
B D             X. tropicalis  ============================================
B D                    Lizard  ============================================
  D              Mallard duck  ============================================
      Yellowbelly pufferfish  ============================================
B D                      Fugu  ============================================
B D                   Wallaby  ============================================
B D           Tasmanian devil  ============================================
B D               Zebra finch  ============================================
B D       Medium ground finch  ============================================
  D       Collared flycatcher  ============================================
B D                   Opossum  ============================================
  D    Spiny softshell turtle  ============================================
  D    White-throated sparrow  ============================================
B D                    Turkey  ============================================
B D                   Chicken  ============================================
  D             Scarlet macaw  ============================================
  D                    Parrot  ============================================
B D                Budgerigar  ============================================
  D          Peregrine falcon  ============================================
  D              Saker falcon  ============================================
  D               Rock pigeon  ============================================
B D                Coelacanth  ============================================
  D  Chinese softshell turtle  ============================================
  D           Green seaturtle  ============================================
  D            Painted turtle  ============================================
B D                 Tetraodon  ============================================
B D              Atlantic cod  ============================================
B D               Stickleback  ============================================
          Southern platyfish  ============================================
         Pundamilia nyererei  ============================================
                 Zebra mbuna  ============================================
       Burton's mouthbreeder  ============================================
         Princess of Burundi  ============================================
                 Spotted gar  ============================================
B D        American alligator  ============================================
          Tibetan ground jay  ============================================
B D                  Platypus  ============================================
            Brush-tailed rat  ============================================
                    Aardvark  ============================================
B D                 Armadillo  ============================================

Alignment block 3 of 114 in window, 18202355 - 18202361, 7 bps 
B D                     Human  g----ct----------------------------------------------gt------tt
B D                     Chimp  g----ct----------------------------------------------gt------tt
B D                   Gorilla  g----ct----------------------------------------------gt------tt
B D                 Orangutan  g----ct----------------------------------------------gt------tt
B D                    Gibbon  a----ct----------------------------------------------gt------tt
B D                    Rhesus  gctgtct----------------------------------------------gt------tt
B D       Crab-eating macaque  gctgtct----------------------------------------------gt------tt
B D                    Baboon  gctgtct----------------------------------------------gt------tt
B D              Green monkey  gctgtct----------------------------------------------gt------tt
B D                  Marmoset  gccatct----------------------------------------------gt------tt
B D           Squirrel monkey  gctgtct----------------------------------------------gt------gt
B D                  Bushbaby  gctgcct----------------------------------------------gt----gctt
           Chinese tree shrew  attacct----------------------------------------------gt----accc
B D                  Squirrel  gctctat----------------------------------------------gat---cctc
       Lesser Egyptian jerboa  gggc--t----------------------------------------------gat---actc
B D            Naked mole-rat  tctc--c----------------------------------------------g-c---cccc
B D                Guinea pig  g-------------------------------------------------------------c
                   Chinchilla  t-------------------------------------------------------------c
B D                       Pig  accctct----------------------------------------------tctgtgcctc
B D                    Alpaca  actttcc----------------------------------------------tctgtgtctc
               Bactrian camel  actttcc----------------------------------------------tctgtgtctc
B D                   Dolphin  actctct----------------------------------------------tcagtgcctc
                 Killer whale  actctct----------------------------------------------tcagtgcctc
             Tibetan antelope  actctct----------------------------------------------tctgtgcctc
B D                       Cow  actctct----------------------------------------------tctgtgcctc
B D                     Sheep  actctct----------------------------------------------tctgtgcctc
                Domestic goat  actctct----------------------------------------------tctgtgcctg
B D                     Horse  actctct----------------------------------------------tctgcgcccc
B D          White rhinoceros  actctct----------------------------------------------tctatgtctc
B D                       Cat  actctat----------------------------------------------tctgggcctc
B D                       Dog  atttgctccttccccactcccagagagcagtgatgaggcacccatgggaggactctgggcctc
B D                   Ferret   actgtct----------------------------------------------tctgggcttc
B D                     Panda  actctcc----------------------------------------------tctgggcctt
               Pacific walrus  actctct----------------------------------------------tctgggcctc
                 Weddell seal  actctct----------------------------------------------tctgggcctc
             Black flying-fox  gctttct----------------------------------------------tctgtgcctc
                Big brown bat  tct--ct----------------------------------------------tctgtgcctt
         David's myotis (bat)  tctctct----------------------------------------------tctgtgcctt
B D                  Microbat  tctccct----------------------------------------------tctgtgcctt
              Star-nosed mole  agctctt----------------------------------------------actaagttcc
B D                  Elephant  gctctcc----------------------------------------------cctgtacgtc
B D                   Manatee  gctctct----------------------------------------------cctgtacctc
             Cape golden mole  gctctcc----------------------------------------------tctgtatctt
B D               Zebra finch  ----------------------------------------------------------gccgc
B D              Nile tilapia  --ccact----------------------------------------------t---------
         Cape elephant shrew  ===============================================================
              Golden hamster  ===============================================================
                Prairie vole  ===============================================================
B D                     Mouse  ===============================================================
B D                       Rat  ===============================================================
B D                   Lamprey  ===============================================================
B D                    Medaka  ===============================================================
    Mexican tetra (cavefish)  ===============================================================
B D           Chinese hamster  ===============================================================
B D                      Pika  ===============================================================
B D                    Tenrec  ===============================================================
B D                  Hedgehog  ===============================================================
B D                     Shrew  ===============================================================
B D                 Zebrafish  ===============================================================
B D             X. tropicalis  ===============================================================
B D                    Lizard  ===============================================================
  D              Mallard duck  ===============================================================
      Yellowbelly pufferfish  ===============================================================
B D                      Fugu  ===============================================================
B D                   Wallaby  ===============================================================
B D           Tasmanian devil  ===============================================================
B D       Medium ground finch  ===============================================================
  D       Collared flycatcher  ===============================================================
B D                   Opossum  ===============================================================
  D    Spiny softshell turtle  ===============================================================
  D    White-throated sparrow  ===============================================================
B D                    Turkey  ===============================================================
B D                   Chicken  ===============================================================
  D             Scarlet macaw  ===============================================================
  D                    Parrot  ===============================================================
B D                Budgerigar  ===============================================================
  D          Peregrine falcon  ===============================================================
  D              Saker falcon  ===============================================================
  D               Rock pigeon  ===============================================================
B D                Coelacanth  ===============================================================
  D  Chinese softshell turtle  ===============================================================
  D           Green seaturtle  ===============================================================
  D            Painted turtle  ===============================================================
B D                 Tetraodon  ===============================================================
B D              Atlantic cod  ===============================================================
B D               Stickleback  ===============================================================
          Southern platyfish  ===============================================================
         Pundamilia nyererei  ===============================================================
                 Zebra mbuna  ===============================================================
       Burton's mouthbreeder  ===============================================================
         Princess of Burundi  ===============================================================
                 Spotted gar  ===============================================================
B D        American alligator  ===============================================================
          Tibetan ground jay  ===============================================================
B D                  Platypus  ===============================================================
            Brush-tailed rat  ===============================================================
                    Aardvark  ===============================================================
B D                 Armadillo  ===============================================================

Inserts between block 3 and 4 in window
B D              Zebra finch 2bp

Alignment block 4 of 114 in window, 18202362 - 18202364, 3 bps 
B D                     Human  --ctg
B D                     Chimp  --ctg
B D                   Gorilla  --ctg
B D                 Orangutan  --ctg
B D                    Gibbon  --ctg
B D                    Rhesus  --ctg
B D       Crab-eating macaque  --ctg
B D                    Baboon  --ctg
B D              Green monkey  --ctg
B D                  Marmoset  --ctg
B D           Squirrel monkey  --ctg
B D                  Bushbaby  --ttg
           Chinese tree shrew  --ctg
B D                  Squirrel  --cac
       Lesser Egyptian jerboa  --cac
B D            Naked mole-rat  --cac
B D                Guinea pig  --caa
                   Chinchilla  --cag
B D                       Pig  --tat
B D                    Alpaca  --tag
               Bactrian camel  --tag
B D                   Dolphin  --tag
                 Killer whale  --tag
             Tibetan antelope  --tag
B D                       Cow  --tag
B D                     Sheep  --tag
                Domestic goat  --tag
B D                     Horse  --tag
B D          White rhinoceros  --tag
B D                       Cat  --tgg
B D                       Dog  --tag
B D                   Ferret   --tag
B D                     Panda  --tag
               Pacific walrus  --cag
                 Weddell seal  --cag
              Star-nosed mole  --cac
B D                  Elephant  --cat
B D                   Manatee  --caa
             Cape golden mole  --ctg
  D               Rock pigeon  --ccc
B D               Zebra finch  --ctg
B D              Nile tilapia  ctc--
         Cape elephant shrew  =====
              Golden hamster  =====
                Prairie vole  =====
B D                     Mouse  =====
B D                       Rat  =====
B D                   Lamprey  =====
B D                    Medaka  =====
    Mexican tetra (cavefish)  =====
B D           Chinese hamster  =====
B D                      Pika  =====
B D                    Tenrec  =====
B D                  Hedgehog  =====
               Big brown bat  -----
B D                     Shrew  =====
B D                 Zebrafish  =====
B D             X. tropicalis  =====
B D                    Lizard  =====
  D              Mallard duck  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
B D                   Wallaby  =====
B D           Tasmanian devil  =====
B D       Medium ground finch  =====
  D       Collared flycatcher  =====
B D                   Opossum  =====
  D    Spiny softshell turtle  =====
  D    White-throated sparrow  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D             Scarlet macaw  =====
  D                    Parrot  =====
B D                Budgerigar  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
B D                Coelacanth  =====
  D  Chinese softshell turtle  =====
  D           Green seaturtle  =====
  D            Painted turtle  =====
B D                 Tetraodon  =====
B D              Atlantic cod  =====
B D               Stickleback  =====
          Southern platyfish  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
                 Spotted gar  =====
B D        American alligator  =====
          Tibetan ground jay  =====
B D                  Platypus  =====
            Brush-tailed rat  =====
                    Aardvark  =====
B D                  Microbat  -----
        David's myotis (bat)  -----
            Black flying-fox  -----
B D                 Armadillo  =====

Inserts between block 4 and 5 in window
             Star-nosed mole 9bp

Alignment block 5 of 114 in window, 18202365 - 18202369, 5 bps 
B D                     Human  cc-c------------c-----------g
B D                     Chimp  cc-c------------c-t---------g
B D                   Gorilla  cc-c------------c-t---------g
B D                 Orangutan  cc-c------------c-t---------g
B D                    Gibbon  cc-c------------c-t---------g
B D                    Rhesus  cc-c------------c-t---------g
B D       Crab-eating macaque  cc-c------------c-t---------g
B D                    Baboon  cc-c------------c-t---------g
B D              Green monkey  cc-c------------c-t---------g
B D                  Marmoset  cc-c------------c-t---------g
B D           Squirrel monkey  cc-g------------c-t---------g
B D                  Bushbaby  ct-c------------t-t---------g
           Chinese tree shrew  cctt------------c-t---------g
B D                  Squirrel  cc-c------------c-a---------g
       Lesser Egyptian jerboa  cc-c------------c-t---------g
B D            Naked mole-rat  cc-c------------a-g---------g
B D                Guinea pig  gc-a------------a-g---------g
                   Chinchilla  gc-c------------a-g---------g
B D                       Pig  cc-t------------g-t---------g
B D                    Alpaca  cc-c------------c-tggtacacagg
               Bactrian camel  cc-c------------c-tggtacacagg
B D                   Dolphin  cc-c------------c-t---------t
                 Killer whale  cc-c------------c-t---------t
             Tibetan antelope  ac-c------------c-t---------g
B D                       Cow  cc-c------------c-t---------g
B D                     Sheep  cc-c------------c-t---------g
                Domestic goat  cc-c------------c-t---------g
B D                     Horse  cc-c------------a-t---------g
B D          White rhinoceros  cc-c------------g-t---------g
B D                       Cat  cc-c------------cag---------g
B D                       Dog  ct-c------------c-t---------a
B D                   Ferret   cc-c------------c-t---------g
B D                     Panda  cc-c------------c-t---------g
               Pacific walrus  cc-c------------c-t---------g
                 Weddell seal  cc-c------------c-t---------g
             Black flying-fox  ------------------t---------g
                Big brown bat  ------------------t---------g
         David's myotis (bat)  ------------------g---------g
B D                  Microbat  ------------------g---------g
              Star-nosed mole  ct-cacttctgtgcctc-t---------a
B D                  Elephant  cc-c------------c-t----------
B D                   Manatee  cc-c------------c-t----------
             Cape golden mole  cc-c------------t-t----------
                     Aardvark  -c-c------------c-t----------
  D               Rock pigeon  ----------------c-g---------g
B D               Zebra finch  ----------------c-c---------g
B D              Nile tilapia  ---c------------c-t---------a
         Cape elephant shrew  =============================
              Golden hamster  =============================
                Prairie vole  =============================
B D                     Mouse  =============================
B D                       Rat  =============================
B D                   Lamprey  =============================
B D                    Medaka  =============================
    Mexican tetra (cavefish)  =============================
B D           Chinese hamster  =============================
B D                      Pika  =============================
B D                    Tenrec  =============================
B D                  Hedgehog  =============================
B D                     Shrew  =============================
B D                 Zebrafish  =============================
B D             X. tropicalis  =============================
B D                    Lizard  =============================
  D              Mallard duck  =============================
      Yellowbelly pufferfish  =============================
B D                      Fugu  =============================
B D                   Wallaby  =============================
B D           Tasmanian devil  =============================
B D       Medium ground finch  =============================
  D       Collared flycatcher  =============================
B D                   Opossum  =============================
  D    Spiny softshell turtle  =============================
  D    White-throated sparrow  =============================
B D                    Turkey  =============================
B D                   Chicken  =============================
  D             Scarlet macaw  =============================
  D                    Parrot  =============================
B D                Budgerigar  =============================
  D          Peregrine falcon  =============================
  D              Saker falcon  =============================
B D                Coelacanth  =============================
  D  Chinese softshell turtle  =============================
  D           Green seaturtle  =============================
  D            Painted turtle  =============================
B D                 Tetraodon  =============================
B D              Atlantic cod  =============================
B D               Stickleback  =============================
          Southern platyfish  =============================
         Pundamilia nyererei  =============================
                 Zebra mbuna  =============================
       Burton's mouthbreeder  =============================
         Princess of Burundi  =============================
                 Spotted gar  =============================
B D        American alligator  =============================
          Tibetan ground jay  =============================
B D                  Platypus  =============================
            Brush-tailed rat  =============================
B D                 Armadillo  =============================

Inserts between block 5 and 6 in window
B D                 Elephant 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp
  D              Rock pigeon 2bp
B D              Zebra finch 2bp

Alignment block 6 of 114 in window, 18202370 - 18202436, 67 bps 
B D                     Human  gtacacag-tgggca--c----cttactg-ataa------------------------------------
B D                     Chimp  gtacacag-tgggca--c----ct----g-ataa------------------------------------
B D                   Gorilla  gtacacag-tgggca--c----ct----g-ataa------------------------------------
B D                 Orangutan  gtacacag-tgggca--c----ct----g-ataa------------------------------------
B D                    Gibbon  gtacacag-tgggca--c----ct----g-ataa------------------------------------
B D                    Rhesus  gtatatag-tgggca--c----ct----g-ataa------------------------------------
B D       Crab-eating macaque  gtatatag-tgggca--c----ct----g-ataa------------------------------------
B D                    Baboon  gtatatag-tgggca--c----ct----g-ataa------------------------------------
B D              Green monkey  gtatatag-tgggca--c----ct----g-ataa------------------------------------
B D                  Marmoset  gtacacag-cacgga--c----tt----g-ctaa------------------------------------
B D           Squirrel monkey  gcacatag-t----a--c----tt----g-ataa------------------------------------
B D                  Bushbaby  gtccacag-tatgca--c----ct----g-ataa------------------------------------
           Chinese tree shrew  ggaagaag-caagca--t----ct----g-caaa------------------------------------
B D                  Squirrel  gtatacag-taggca--t----ct----g-ataa------------------------------------
       Lesser Egyptian jerboa  ctgcgtaa-c--------------------ataa------------------------------------
B D            Naked mole-rat  gtgcca------------------------atga------------------------------------
B D                Guinea pig  ctgaga------------------------atggtgagagcgagagcgagagccagggttgggcaccagt
                   Chinchilla  gtggga------------------------atga------------------------------------
B D                       Pig  gtacacag-taaggg--c----ct----gaaaaa------------------------------------
B D                    Alpaca  gtacacag-taagca--c----ct----g-ataa------------------------------------
               Bactrian camel  gtacacag-taagca--c----ct----g-ataa------------------------------------
B D                   Dolphin  gtacacag-taagtg--c----tt----g-ataa------------------------------------
                 Killer whale  gtacacag-taagtg--c----tt----g-ataa------------------------------------
             Tibetan antelope  gtacacag-taagca--c----ct----c-ataa------------------------------------
B D                       Cow  gtacacag-taagcg--c----ct----c-ataa------------------------------------
B D                     Sheep  gtacacag-taagca--c----ct----c-ataa------------------------------------
                Domestic goat  gtacacag-taagca--c----ct----c-ataa------------------------------------
B D                     Horse  gtacacag-taagta--c----ct----a-ataa------------------------------------
B D          White rhinoceros  gtacacag-taagtg--c----ct----a-ataa------------------------------------
B D                       Cat  atacacag-gaggca--c----ct----g-ataa------------------------------------
B D                       Dog  atacacag-taggca--c----ct----g-ataa------------------------------------
B D                   Ferret   atacacag-taggca--c----cc----g-ataa------------------------------------
B D                     Panda  atacacag-taggca--c----ct----g-ataa------------------------------------
               Pacific walrus  atacacag-aaggca--c----ct----g-gtaa------------------------------------
                 Weddell seal  atacactg-aaggca--c----ct----g-ataa------------------------------------
             Black flying-fox  gtacacggataggta--c----at----g-ataa------------------------------------
                Big brown bat  gtaccccg-taggca--c----at----g-gtaa------------------------------------
         David's myotis (bat)  gtgcacag-taggca--c----at----g-gtaa------------------------------------
B D                  Microbat  atgcacag-taggca--c----tt----g-gtaa------------------------------------
              Star-nosed mole  gtccctag-aaggtg--c----ct----g-aaaa------------------------------------
B D                  Elephant  gtgcacag-cagacg--c----ct----g-ataa------------------------------------
          Cape elephant shrew  gtacaaag-tggaca--c----ct----g-atac------------------------------------
B D                   Manatee  gtacacaa-taggcg--c----ct----g-ataa------------------------------------
             Cape golden mole  gtgtacag-ttggca--c----ct----g-acac------------------------------------
                     Aardvark  ggacacag-cagtcg--c----ct----g-ataa------------------------------------
  D               Rock pigeon  acacaatg-tcaccc--ccggggt----g-atgg------------------------------------
B D               Zebra finch  gcgagctg-tgggca--cggcgcc----g-acgg------------------------------------
B D              Nile tilapia  --acagag-gggctggtt----ct----g-agga------------------------------------
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
B D                   Lamprey  ======================================================================
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D           Chinese hamster  ======================================================================
B D                      Pika  ======================================================================
B D                    Tenrec  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D              Mallard duck  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D       Medium ground finch  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Opossum  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                Coelacanth  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
                 Spotted gar  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D                  Platypus  ======================================================================
            Brush-tailed rat  ======================================================================
B D                 Armadillo  ======================================================================

                        Human  ---atgc--ccag----tgtgtaagtgaatgactccagtcagga----aagaga
                        Chimp  ---atgc--ccag----tgtgtaagtgaatgactccagtcagga----aagaga
                      Gorilla  ---atgc--ccag----tgtgtaagtgaatgactccagtcagga----aagaga
                    Orangutan  ---atgc--ccag----tgtgtaagtgaatgactccagtcggga----aagaga
                       Gibbon  ---atgc--ccag----tgtgtaagtgaatgactccagtcagga----aagaga
                       Rhesus  ---atgc--ccag----tgtgtaagtgaatgactccagtcagca----aagaga
          Crab-eating macaque  ---atgc--ccag----tgtgtaagtgaatgactccagtcagga----aagaga
                       Baboon  ---atgc--ccag----tgtgtaagtgaatgactccagtcagga----aagaga
                 Green monkey  ---atgc--ccag----tgtgtaagtgaatgactccagtcagga----aagaga
                     Marmoset  ---atgc--ccag----tgtgtaagtgagtgagtgcagccagga----aagaga
              Squirrel monkey  ---atgc--tcag----tgtgga----agtgactccagccagga----aacaga
                     Bushbaby  ---atgc--ccag----tgtgtaaattaatgactctagacaggg----aagaga
           Chinese tree shrew  ---acgc--acca----tgagtgaatgaatgaatcca-----------------
                     Squirrel  ---gtgc--ccca----ggtgtgaatgcacgaatctaaccaggaatgcatggaa
       Lesser Egyptian jerboa  ---atgc--acaa----ggaatgaagtcac----------------acgtgg--
               Naked mole-rat  ---atga--accg----g------------------------------aagggg
                   Guinea pig  ggtgtgc--acct----ggtcc-aggccagggtggcagtgagtg--acaaggga
                   Chinchilla  ---acgc--a--------------------------------------aagcaa
                          Pig  ---atgc--tcag----tgtgt-aatgaatgaatctagacagga----aagcaa
                       Alpaca  ---atgc--ccag----tgtgt-aatgaatgaatctagacagga----gagaga
               Bactrian camel  ---atgc--ccag----tgtgt-aatgaatgaatctagacagga----gagaga
                      Dolphin  ---atgc--ccag----tgtgt-aatgaatgaatctagacagga----aagaaa
                 Killer whale  ---atgc--ccag----tgtgt-aatgaatgaatctagacagga----aagaaa
             Tibetan antelope  ---atgc--ccag----tatgt-aatgagtgaatctagacagga----aagaaa
                          Cow  ---atgc--ccag----tgtgt-aatgagcgaatctagacagga----aagaaa
                        Sheep  ---atgc--ccag----tatgt-aatgagtgaatctagacagga----aagaaa
                Domestic goat  ---atgc--ccag----tatgt-aatgagtgaatctagacagga----aagaaa
                        Horse  ---atgc--ccag----tgtgtgagtgaataaatccagacagga----aagaga
             White rhinoceros  ---atgc--ctag----cacgtgcatggatgaatgcagacagca----aagaga
                          Cat  ---atgc--ccag----tgtgtgaatgaatgaatccagacaggg----aac---
                          Dog  ---acac--ccag----tgtg----tgagtgaatccaaacagga----aat---
                      Ferret   ---atgc--ccag----tgtgtgaatgaatgaatcaaggcagga----aag---
                        Panda  ---gtgc--ccag----tgtgtaaatgaacgaatccggacagga----aag---
               Pacific walrus  ---atgc--ccag----ggtgtggatgaatgaatccagacaaga----aag---
                 Weddell seal  ---atgc--ccag----ggtgtgaatgaacgaatccagacagga----aag---
             Black flying-fox  ---atgc--ccag----tgtatgaatgaatgaatctagacagga----aag---
                Big brown bat  ---atgc--ccagt---tgtgtgaatgaatga--------aaga----gat---
         David's myotis (bat)  ---atgc--ccagt---tgtgtgaatgaatga--------aaga----gat---
                     Microbat  ---atgc--ccagt---tgtgtgaatgaatga--------aaga----gat---
              Star-nosed mole  ---atgc--ccac----tgtgtgaatgaatgggtccagacagga----agg---
                     Elephant  ---atat--ctgg----ggtgtgaatgaatgaattcagccaagg----cagaga
          Cape elephant shrew  ---acat--tca----------gaatgaatgaactaagaaaggg----gagagc
                      Manatee  ---atgt--tgga----tgtgtgaatgaatgaactcagccaggg----gagaga
             Cape golden mole  ---atga--ccag----tgtgtgaatgaatccattcagctaag------aaaga
                     Aardvark  ---atgg--ccag----tgtgtgaatgaattaattcagcctgg-----------
                  Rock pigeon  ---atgcagccactccaggtggacagcaaggtc-----cccagg----gca---
                  Zebra finch  ---aaac--ccac----ggagcccagccggggctgcggcccggg----gca---
                 Nile tilapia  ---ctga--cacc----aatgcaggtgtccaa----agacacca----tag---
               Golden hamster  ======================================================
                 Prairie vole  ======================================================
                        Mouse  ======================================================
                          Rat  ======================================================
                      Lamprey  ======================================================
                       Medaka  ======================================================
     Mexican tetra (cavefish)  ======================================================
              Chinese hamster  ======================================================
                         Pika  ======================================================
                       Tenrec  ======================================================
                     Hedgehog  ======================================================
                        Shrew  ======================================================
                    Zebrafish  ======================================================
                X. tropicalis  ======================================================
                       Lizard  ======================================================
                 Mallard duck  ======================================================
       Yellowbelly pufferfish  ======================================================
                         Fugu  ======================================================
                      Wallaby  ======================================================
              Tasmanian devil  ======================================================
          Medium ground finch  ======================================================
          Collared flycatcher  ======================================================
                      Opossum  ======================================================
       Spiny softshell turtle  ======================================================
       White-throated sparrow  ======================================================
                       Turkey  ======================================================
                      Chicken  ======================================================
                Scarlet macaw  ======================================================
                       Parrot  ======================================================
                   Budgerigar  ======================================================
             Peregrine falcon  ======================================================
                 Saker falcon  ======================================================
                   Coelacanth  ======================================================
     Chinese softshell turtle  ======================================================
              Green seaturtle  ======================================================
               Painted turtle  ======================================================
                    Tetraodon  ======================================================
                 Atlantic cod  ======================================================
                  Stickleback  ======================================================
           Southern platyfish  ======================================================
          Pundamilia nyererei  ======================================================
                  Zebra mbuna  ======================================================
        Burton's mouthbreeder  ======================================================
          Princess of Burundi  ======================================================
                  Spotted gar  ======================================================
           American alligator  ======================================================
           Tibetan ground jay  ======================================================
                     Platypus  ======================================================
             Brush-tailed rat  ======================================================
                    Armadillo  ======================================================

Inserts between block 6 and 7 in window
B D              Zebra finch 1bp

Alignment block 7 of 114 in window, 18202437 - 18202438, 2 bps 
B D                     Human  ta
B D                     Chimp  ta
B D                   Gorilla  ta
B D                 Orangutan  ta
B D                    Gibbon  ta
B D                    Rhesus  ca
B D       Crab-eating macaque  ca
B D                    Baboon  ca
B D              Green monkey  ca
B D                  Marmoset  ca
B D           Squirrel monkey  ta
B D                  Bushbaby  ca
B D                  Squirrel  aa
B D            Naked mole-rat  at
B D                Guinea pig  ag
                   Chinchilla  ag
B D                       Pig  ta
B D                    Alpaca  ca
               Bactrian camel  ca
B D                   Dolphin  ta
                 Killer whale  ta
             Tibetan antelope  ta
B D                       Cow  ta
B D                     Sheep  ta
                Domestic goat  ta
B D                     Horse  ta
B D          White rhinoceros  ta
B D                       Cat  -a
B D                       Dog  -a
B D                   Ferret   -a
B D                     Panda  -a
               Pacific walrus  -t
                 Weddell seal  -t
             Black flying-fox  -a
                Big brown bat  -a
         David's myotis (bat)  -g
B D                  Microbat  -g
              Star-nosed mole  -a
B D                  Elephant  tg
          Cape elephant shrew  tg
B D                   Manatee  tg
             Cape golden mole  ca
B D              Nile tilapia  ca
              Golden hamster  ==
                Prairie vole  ==
B D                     Mouse  ==
B D                       Rat  ==
B D                   Lamprey  ==
B D                    Medaka  ==
    Mexican tetra (cavefish)  ==
B D           Chinese hamster  ==
      Lesser Egyptian jerboa  --
B D                      Pika  ==
B D                    Tenrec  ==
          Chinese tree shrew  --
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                 Zebrafish  ==
B D             X. tropicalis  ==
B D                    Lizard  ==
  D              Mallard duck  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                   Wallaby  ==
B D           Tasmanian devil  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D       Collared flycatcher  ==
B D                   Opossum  ==
  D    Spiny softshell turtle  ==
  D    White-throated sparrow  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  --
B D                Coelacanth  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D              Atlantic cod  ==
B D               Stickleback  ==
          Southern platyfish  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
                 Spotted gar  ==
B D        American alligator  ==
          Tibetan ground jay  ==
B D                  Platypus  ==
            Brush-tailed rat  ==
                    Aardvark  --
B D                 Armadillo  ==

Alignment block 8 of 114 in window, 18202439 - 18202441, 3 bps 
B D                     Human  gac
B D                     Chimp  gac
B D                   Gorilla  gac
B D                 Orangutan  gac
B D                    Gibbon  gac
B D                    Rhesus  gac
B D       Crab-eating macaque  gac
B D                    Baboon  gac
B D              Green monkey  gac
B D                  Marmoset  cat
B D           Squirrel monkey  gat
B D                  Bushbaby  gaa
B D                  Squirrel  gca
B D            Naked mole-rat  ggc
B D                Guinea pig  ggg
                   Chinchilla  ggg
B D                       Pig  ggg
B D                    Alpaca  ggc
               Bactrian camel  ggc
B D                   Dolphin  ggc
                 Killer whale  ggc
             Tibetan antelope  ggc
B D                       Cow  ggc
B D                     Sheep  ggc
                Domestic goat  ggc
B D                     Horse  ggc
B D          White rhinoceros  ggt
B D                       Cat  gac
B D                       Dog  ggc
B D                   Ferret   ggc
B D                     Panda  ggc
               Pacific walrus  ggc
                 Weddell seal  ggc
             Black flying-fox  ggc
                Big brown bat  ggc
         David's myotis (bat)  ggc
B D                  Microbat  ggc
              Star-nosed mole  gga
B D                  Elephant  gcc
B D                   Manatee  ggc
             Cape golden mole  ggc
  D               Rock pigeon  --c
B D              Nile tilapia  aac
        Burton's mouthbreeder  tag
         Cape elephant shrew  ---
              Golden hamster  ===
                Prairie vole  ===
B D                     Mouse  ===
B D                       Rat  ===
B D                   Lamprey  ===
B D                    Medaka  ===
    Mexican tetra (cavefish)  ===
B D           Chinese hamster  ===
      Lesser Egyptian jerboa  ---
B D                      Pika  ===
B D                    Tenrec  ===
          Chinese tree shrew  ---
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                 Zebrafish  ===
B D             X. tropicalis  ===
B D                    Lizard  ===
  D              Mallard duck  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                   Wallaby  ===
B D           Tasmanian devil  ===
B D               Zebra finch  ===
B D       Medium ground finch  ===
  D       Collared flycatcher  ===
B D                   Opossum  ===
  D    Spiny softshell turtle  ===
  D    White-throated sparrow  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D             Scarlet macaw  ===
  D                    Parrot  ===
B D                Budgerigar  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
B D                Coelacanth  ===
  D  Chinese softshell turtle  ===
  D           Green seaturtle  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D              Atlantic cod  ===
B D               Stickleback  ===
          Southern platyfish  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
         Princess of Burundi  ===
                 Spotted gar  ===
B D        American alligator  ===
          Tibetan ground jay  ===
B D                  Platypus  ===
            Brush-tailed rat  ===
                    Aardvark  ---
B D                 Armadillo  ===

Inserts between block 8 and 9 in window
             Star-nosed mole 4bp

Alignment block 9 of 114 in window, 18202442 - 18202447, 6 bps 
B D                     Human  gaggtt
B D                     Chimp  gaggtt
B D                   Gorilla  gaggtt
B D                 Orangutan  gaggtt
B D                    Gibbon  gaggtt
B D                    Rhesus  aaggct
B D       Crab-eating macaque  aaggct
B D                    Baboon  aaggct
B D              Green monkey  aaggct
B D                  Marmoset  gaggtt
B D           Squirrel monkey  gaggtt
B D                  Bushbaby  aacgtt
B D                  Squirrel  accaaa
       Lesser Egyptian jerboa  ----tg
B D            Naked mole-rat  a-----
B D                Guinea pig  accagg
                   Chinchilla  gcgagc
B D                       Pig  aaagct
B D                    Alpaca  aaagct
               Bactrian camel  aaagct
B D                   Dolphin  aaagct
                 Killer whale  aaagct
             Tibetan antelope  agagct
B D                       Cow  agagct
B D                     Sheep  agagct
                Domestic goat  agagct
B D                     Horse  aaagct
B D          White rhinoceros  caagct
B D                       Cat  aaagct
B D                       Dog  aaagct
B D                   Ferret   aaagta
B D                     Panda  aaagct
               Pacific walrus  taagct
                 Weddell seal  aaagct
             Black flying-fox  aaagct
                Big brown bat  aaagct
         David's myotis (bat)  aaagct
B D                  Microbat  aaagct
B D                  Hedgehog  gaggtt
              Star-nosed mole  gag---
B D                  Elephant  agaact
B D                   Manatee  agagct
             Cape golden mole  aatgct
                     Aardvark  agagct
  D               Rock pigeon  acgaca
B D        American alligator  --gaga
B D              Nile tilapia  caggtt
        Burton's mouthbreeder  agggtt
         Cape elephant shrew  ------
              Golden hamster  ======
                Prairie vole  ======
B D                     Mouse  ======
B D                       Rat  ======
B D                   Lamprey  ======
B D                    Medaka  ======
    Mexican tetra (cavefish)  ======
B D           Chinese hamster  ======
B D                      Pika  ======
B D                    Tenrec  ======
          Chinese tree shrew  ------
B D                     Shrew  ======
B D                 Zebrafish  ======
B D             X. tropicalis  ======
B D                    Lizard  ======
  D              Mallard duck  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
B D                   Wallaby  ======
B D           Tasmanian devil  ======
B D               Zebra finch  ======
B D       Medium ground finch  ======
  D       Collared flycatcher  ======
B D                   Opossum  ======
  D    Spiny softshell turtle  ======
  D    White-throated sparrow  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D             Scarlet macaw  ======
  D                    Parrot  ======
B D                Budgerigar  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
B D                Coelacanth  ======
  D  Chinese softshell turtle  ======
  D           Green seaturtle  ======
  D            Painted turtle  ======
B D                 Tetraodon  ======
B D              Atlantic cod  ======
B D               Stickleback  ======
          Southern platyfish  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
         Princess of Burundi  ======
                 Spotted gar  ======
          Tibetan ground jay  ======
B D                  Platypus  ======
            Brush-tailed rat  ======
B D                 Armadillo  ======

Inserts between block 9 and 10 in window
       Burton's mouthbreeder 5bp

Alignment block 10 of 114 in window, 18202448 - 18202454, 7 bps 
B D                     Human  ggggctg-
B D                     Chimp  ggggctg-
B D                   Gorilla  ggggctg-
B D                 Orangutan  ggggctg-
B D                    Gibbon  ggggctg-
B D                    Rhesus  ggggctg-
B D       Crab-eating macaque  ggggctg-
B D                    Baboon  ggggctg-
B D              Green monkey  ggggctg-
B D                  Marmoset  ggggctg-
B D           Squirrel monkey  agggctg-
B D                  Bushbaby  gcaactg-
           Chinese tree shrew  ------g-
B D                  Squirrel  cgggctg-
       Lesser Egyptian jerboa  tgagatg-
B D                Guinea pig  ccagctg-
                   Chinchilla  cagactg-
B D                       Pig  -gggctg-
B D                    Alpaca  ggggctg-
               Bactrian camel  ggggctg-
B D                   Dolphin  ggggctg-
                 Killer whale  ggggctg-
             Tibetan antelope  ggggctg-
B D                       Cow  ggggctg-
B D                     Sheep  ggggctg-
                Domestic goat  ggggctg-
B D                     Horse  ggagctg-
B D          White rhinoceros  ggggccg-
B D                       Cat  ggggctg-
B D                       Dog  ggggctg-
B D                   Ferret   ggggctg-
B D                     Panda  ggggctg-
               Pacific walrus  ggggctg-
                 Weddell seal  ggggctg-
             Black flying-fox  ggagctg-
                Big brown bat  ggggctg-
         David's myotis (bat)  ggggctg-
B D                  Microbat  ggggctc-
B D                  Hedgehog  ggggttt-
B D                  Elephant  ggggctg-
          Cape elephant shrew  gggacct-
B D                   Manatee  ggggc---
             Cape golden mole  gtactgt-
                     Aardvark  agggctg-
  D               Rock pigeon  tcagccc-
B D        American alligator  agggctg-
          Princess of Burundi  -gagtttt
        Burton's mouthbreeder  -ggttttt
              Golden hamster  ========
                Prairie vole  ========
B D                     Mouse  ========
B D                       Rat  ========
B D                   Lamprey  ========
B D                    Medaka  ========
    Mexican tetra (cavefish)  ========
B D           Chinese hamster  ========
B D                      Pika  ========
B D                    Tenrec  ========
B D                     Shrew  ========
B D                 Zebrafish  ========
B D             X. tropicalis  ========
B D                    Lizard  ========
  D              Mallard duck  ========
      Yellowbelly pufferfish  ========
B D                      Fugu  ========
B D                   Wallaby  ========
B D           Tasmanian devil  ========
B D               Zebra finch  ========
B D       Medium ground finch  ========
  D       Collared flycatcher  ========
B D                   Opossum  ========
  D    Spiny softshell turtle  ========
  D    White-throated sparrow  ========
B D                    Turkey  ========
B D                   Chicken  ========
  D             Scarlet macaw  ========
  D                    Parrot  ========
B D                Budgerigar  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
B D                Coelacanth  ========
  D  Chinese softshell turtle  ========
  D           Green seaturtle  ========
  D            Painted turtle  ========
B D                 Tetraodon  ========
B D              Atlantic cod  ========
B D               Stickleback  ========
          Southern platyfish  ========
         Pundamilia nyererei  ========
                 Zebra mbuna  ========
B D              Nile tilapia  --------
                 Spotted gar  ========
          Tibetan ground jay  ========
B D                  Platypus  ========
            Brush-tailed rat  ========
             Star-nosed mole  --------
B D            Naked mole-rat  --------
B D                 Armadillo  ========

Inserts between block 10 and 11 in window
  D              Rock pigeon 5bp
B D       American alligator 8bp

Alignment block 11 of 114 in window, 18202455 - 18202455, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
B D                Guinea pig  t
                   Chinchilla  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  c
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  g
                     Aardvark  t
  D               Rock pigeon  c
  D       Collared flycatcher  c
B D               Zebra finch  c
           Tibetan ground jay  c
B D        American alligator  c
          Princess of Burundi  c
        Burton's mouthbreeder  c
              Golden hamster  =
                Prairie vole  =
B D                     Mouse  =
B D                       Rat  =
B D                   Lamprey  =
B D                    Medaka  =
    Mexican tetra (cavefish)  =
B D           Chinese hamster  =
B D                      Pika  =
B D                    Tenrec  =
B D                     Shrew  =
B D                 Zebrafish  =
B D             X. tropicalis  =
B D                    Lizard  =
  D              Mallard duck  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                   Wallaby  =
B D           Tasmanian devil  =
B D       Medium ground finch  =
B D                   Opossum  =
  D    Spiny softshell turtle  =
  D    White-throated sparrow  =
B D                    Turkey  =
B D                   Chicken  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                Coelacanth  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D              Atlantic cod  =
B D               Stickleback  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
B D              Nile tilapia  -
                 Spotted gar  =
B D                  Platypus  =
            Brush-tailed rat  =
             Star-nosed mole  -
B D            Naked mole-rat  -
B D                 Armadillo  =

Alignment block 12 of 114 in window, 18202456 - 18202466, 11 bps 
B D                     Human  tt---------ttcc----aag--ta
B D                     Chimp  tt---------ttcc----aag--ta
B D                   Gorilla  tt---------ttcc----aag--ta
B D                 Orangutan  tt---------ttcc----aag--ga
B D                    Gibbon  tt---------ttcc----aag--ga
B D                    Rhesus  tt---------ttcc----aag--ga
B D       Crab-eating macaque  tt---------ttcc----aag--ga
B D                    Baboon  tt---------ttcc----aag--ga
B D              Green monkey  tt---------ttcc----aag--ga
B D                  Marmoset  tt---------ttcc----aaa--ga
B D           Squirrel monkey  tt---------ttcc----aaa--ga
B D                  Bushbaby  tt---------ttcc----aaa--ga
           Chinese tree shrew  tt---------tggc----aag--gc
B D                  Squirrel  tt---------ttcc----agc--aa
       Lesser Egyptian jerboa  tt---------ttc------------
B D                Guinea pig  ag---------tgca----ggg--gg
                   Chinchilla  tt---------ttc------------
B D                       Pig  tc---------tttg----ggacaga
B D                    Alpaca  ta---------ttct----gga--gt
               Bactrian camel  ta---------ttct----gga--ga
B D                   Dolphin  ta---------ttct----cgg--ga
                 Killer whale  ta---------ttct----cgg--ga
             Tibetan antelope  tg---------ttcc----tggc-gg
B D                       Cow  tg---------ttcc----tggttgg
B D                     Sheep  tg---------ttcc----tggtggg
                Domestic goat  tg---------ttcc----tggc-gg
B D                     Horse  tt---------ttcc----agg--ga
B D          White rhinoceros  tt---------ttcc----ggg--ga
B D                       Cat  tt---------ttct----ggg--aa
B D                       Dog  tt---------ttct----ggg--aa
B D                   Ferret   tt---------ttct----gga--aa
B D                     Panda  tt---------ttct----ggg--aa
               Pacific walrus  tt---------ttct----ggg--aa
                 Weddell seal  tt---------ttct----ggg--aa
             Black flying-fox  tg---------tttc----agg--aa
                Big brown bat  tt---------ttccgggaagg--ga
         David's myotis (bat)  tt---------ttctgggaagg--ga
B D                  Microbat  tt---------ttccgggaagg--ga
B D                  Hedgehog  ctggggcgcgg---------------
B D                  Elephant  gt---------ttca----ggg--ag
          Cape elephant shrew  tc---------ccca----agg--ag
B D                   Manatee  gt---------ttca----ggg--ag
             Cape golden mole  tt---------tcca----ggg--ag
                     Aardvark  gt---------tttg----ggg--cg
  D               Rock pigeon  aa---------cccc----aaa--a-
  D       Collared flycatcher  ct---------cccc----agc--a-
B D               Zebra finch  cc---------gctc----tgc--c-
           Tibetan ground jay  ct---------cccc----atc--a-
B D        American alligator  tc---------tccc----agt--g-
          Princess of Burundi  ta---------tcct----aag--ga
        Burton's mouthbreeder  ga---------tcct----aag--ga
                  Spotted gar  tt---------tact----gaa--ca
              Golden hamster  ==========================
                Prairie vole  ==========================
B D                     Mouse  ==========================
B D                       Rat  ==========================
B D                   Lamprey  ==========================
B D                    Medaka  ==========================
    Mexican tetra (cavefish)  ==========================
B D           Chinese hamster  ==========================
B D                      Pika  ==========================
B D                    Tenrec  ==========================
B D                     Shrew  ==========================
B D                 Zebrafish  ==========================
B D             X. tropicalis  ==========================
B D                    Lizard  ==========================
  D              Mallard duck  ==========================
      Yellowbelly pufferfish  ==========================
B D                      Fugu  ==========================
B D                   Wallaby  ==========================
B D           Tasmanian devil  ==========================
B D       Medium ground finch  ==========================
B D                   Opossum  ==========================
  D    Spiny softshell turtle  ==========================
  D    White-throated sparrow  ==========================
B D                    Turkey  ==========================
B D                   Chicken  ==========================
  D             Scarlet macaw  ==========================
  D                    Parrot  ==========================
B D                Budgerigar  ==========================
  D          Peregrine falcon  ==========================
  D              Saker falcon  ==========================
B D                Coelacanth  ==========================
  D  Chinese softshell turtle  ==========================
  D           Green seaturtle  ==========================
  D            Painted turtle  ==========================
B D                 Tetraodon  ==========================
B D              Atlantic cod  ==========================
B D               Stickleback  ==========================
          Southern platyfish  ==========================
         Pundamilia nyererei  ==========================
                 Zebra mbuna  ==========================
B D              Nile tilapia  --------------------------
B D                  Platypus  ==========================
            Brush-tailed rat  ==========================
             Star-nosed mole  --------------------------
B D            Naked mole-rat  --------------------------
B D                 Armadillo  ==========================

Inserts between block 12 and 13 in window
B D                 Hedgehog 16bp
  D              Rock pigeon 1bp
  D      Collared flycatcher 1bp
B D              Zebra finch 1bp
          Tibetan ground jay 1bp
B D       American alligator 1bp

Alignment block 13 of 114 in window, 18202467 - 18202469, 3 bps 
B D                     Human  -------cgg
B D                     Chimp  -------cgg
B D                   Gorilla  -------cgg
B D                 Orangutan  -------cag
B D                    Gibbon  -------cag
B D                    Rhesus  -------cag
B D       Crab-eating macaque  -------cag
B D                    Baboon  -------cag
B D              Green monkey  -------cag
B D                  Marmoset  -------cgg
B D           Squirrel monkey  -------tgg
B D                  Bushbaby  -------ggg
           Chinese tree shrew  -------gtg
B D                  Squirrel  -------g--
B D                Guinea pig  -------g--
B D                       Pig  -------ga-
B D                    Alpaca  -------gg-
               Bactrian camel  -------gg-
B D                   Dolphin  -------gg-
                 Killer whale  -------gg-
             Tibetan antelope  -------gg-
B D                       Cow  -------gg-
B D                     Sheep  -------gg-
                Domestic goat  -------gg-
B D                     Horse  -------cc-
B D          White rhinoceros  -------gc-
B D                       Cat  -------gg-
B D                       Dog  -------gg-
B D                   Ferret   -------gg-
B D                     Panda  -------gg-
               Pacific walrus  -------gg-
                 Weddell seal  -------gg-
             Black flying-fox  -------gg-
                Big brown bat  -------gg-
         David's myotis (bat)  -------gg-
B D                  Microbat  -------gg-
B D                  Elephant  -------tg-
          Cape elephant shrew  -------tg-
B D                   Manatee  -------tg-
             Cape golden mole  -------ta-
                     Aardvark  -------tg-
  D               Rock pigeon  -------at-
  D       Collared flycatcher  -------ag-
B D               Zebra finch  -------gg-
           Tibetan ground jay  -------cc-
B D        American alligator  -------ca-
  D  Chinese softshell turtle  -------gg-
B D              Nile tilapia  -------g--
          Princess of Burundi  cttcttaa--
        Burton's mouthbreeder  cttcttaa--
                  Spotted gar  c------g--
              Golden hamster  ==========
                Prairie vole  ==========
B D                     Mouse  ==========
B D                       Rat  ==========
B D                   Lamprey  ==========
B D                    Medaka  ==========
    Mexican tetra (cavefish)  ==========
B D           Chinese hamster  ==========
      Lesser Egyptian jerboa  ----------
B D                      Pika  ==========
B D                    Tenrec  ==========
B D                  Hedgehog  ==========
B D                     Shrew  ==========
B D                 Zebrafish  ==========
B D             X. tropicalis  ==========
B D                    Lizard  ==========
  D              Mallard duck  ==========
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
B D                   Wallaby  ==========
B D           Tasmanian devil  ==========
B D       Medium ground finch  ==========
B D                   Opossum  ==========
  D    Spiny softshell turtle  ==========
  D    White-throated sparrow  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
  D             Scarlet macaw  ==========
  D                    Parrot  ==========
B D                Budgerigar  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
B D                Coelacanth  ==========
  D           Green seaturtle  ==========
  D            Painted turtle  ==========
B D                 Tetraodon  ==========
B D              Atlantic cod  ==========
B D               Stickleback  ==========
          Southern platyfish  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
B D                  Platypus  ==========
            Brush-tailed rat  ==========
             Star-nosed mole  ----------
B D            Naked mole-rat  ----------
                  Chinchilla  ----------
B D                 Armadillo  ==========

Inserts between block 13 and 14 in window
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp

Alignment block 14 of 114 in window, 18202470 - 18202470, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  c
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  g
B D                       Dog  c
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
  D               Rock pigeon  c
  D       Collared flycatcher  g
B D               Zebra finch  g
           Tibetan ground jay  c
B D        American alligator  g
  D  Chinese softshell turtle  g
B D              Nile tilapia  a
          Princess of Burundi  a
        Burton's mouthbreeder  a
                  Spotted gar  a
         Cape elephant shrew  =
              Golden hamster  =
                Prairie vole  =
B D                     Mouse  =
B D                       Rat  =
B D                   Lamprey  =
B D                    Medaka  =
    Mexican tetra (cavefish)  =
B D           Chinese hamster  =
      Lesser Egyptian jerboa  -
B D                      Pika  =
B D                    Tenrec  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  -
B D                 Zebrafish  =
B D             X. tropicalis  =
B D                    Lizard  =
  D              Mallard duck  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                   Wallaby  =
B D           Tasmanian devil  =
B D       Medium ground finch  =
B D                   Opossum  =
  D    Spiny softshell turtle  =
  D    White-throated sparrow  =
B D                    Turkey  =
B D                   Chicken  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                Coelacanth  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D              Atlantic cod  =
B D               Stickleback  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
B D                  Platypus  =
            Cape golden mole  =
            Brush-tailed rat  =
             Star-nosed mole  -
B D            Naked mole-rat  -
                    Aardvark  =
                  Chinchilla  -
B D                 Armadillo  =
B D                   Manatee  =
B D                  Elephant  =
B D                  Squirrel  -

Inserts between block 14 and 15 in window
B D              Zebra finch 7bp

Alignment block 15 of 114 in window, 18202471 - 18202473, 3 bps 
B D                     Human  aat
B D                     Chimp  agt
B D                   Gorilla  aat
B D                 Orangutan  aat
B D                    Gibbon  aat
B D                    Rhesus  aat
B D       Crab-eating macaque  aat
B D                    Baboon  aat
B D              Green monkey  aat
B D                  Marmoset  agc
B D           Squirrel monkey  aac
B D                  Bushbaby  agc
           Chinese tree shrew  aca
B D                       Pig  gga
B D                    Alpaca  aga
               Bactrian camel  aga
B D                   Dolphin  aga
                 Killer whale  aga
             Tibetan antelope  aga
B D                       Cow  aga
B D                     Sheep  aga
                Domestic goat  aga
B D                     Horse  aga
B D          White rhinoceros  aga
B D                       Cat  aaa
B D                       Dog  aaa
B D                   Ferret   aaa
B D                     Panda  aaa
               Pacific walrus  aaa
                 Weddell seal  aaa
             Black flying-fox  aaa
                Big brown bat  aga
         David's myotis (bat)  aga
B D                  Microbat  aga
  D               Rock pigeon  aca
B D       Medium ground finch  agc
B D               Zebra finch  cgg
           Tibetan ground jay  agg
B D        American alligator  cag
  D  Chinese softshell turtle  ggc
B D              Nile tilapia  aca
          Princess of Burundi  aat
        Burton's mouthbreeder  aat
                  Spotted gar  gaa
         Cape elephant shrew  ===
              Golden hamster  ===
                Prairie vole  ===
B D                     Mouse  ===
B D                       Rat  ===
B D                   Lamprey  ===
B D                    Medaka  ===
    Mexican tetra (cavefish)  ===
B D           Chinese hamster  ===
      Lesser Egyptian jerboa  ---
B D                      Pika  ===
B D                    Tenrec  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                Guinea pig  ---
B D                 Zebrafish  ===
B D             X. tropicalis  ===
B D                    Lizard  ===
  D              Mallard duck  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                   Wallaby  ===
B D           Tasmanian devil  ===
  D       Collared flycatcher  ---
B D                   Opossum  ===
  D    Spiny softshell turtle  ===
  D    White-throated sparrow  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D             Scarlet macaw  ===
  D                    Parrot  ===
B D                Budgerigar  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
B D                Coelacanth  ===
  D           Green seaturtle  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D              Atlantic cod  ===
B D               Stickleback  ===
          Southern platyfish  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
B D                  Platypus  ===
            Cape golden mole  ===
            Brush-tailed rat  ===
             Star-nosed mole  ---
B D            Naked mole-rat  ---
                    Aardvark  ===
                  Chinchilla  ---
B D                 Armadillo  ===
B D                   Manatee  ===
B D                  Elephant  ===
B D                  Squirrel  ---

Alignment block 16 of 114 in window, 18202474 - 18202477, 4 bps 
B D                     Human  -ccaa
B D                     Chimp  -ccag
B D                   Gorilla  -ccaa
B D                 Orangutan  -ccaa
B D                    Gibbon  -ccaa
B D                    Rhesus  -caga
B D       Crab-eating macaque  -caga
B D                    Baboon  -caga
B D              Green monkey  -caga
B D                  Marmoset  -cc--
B D           Squirrel monkey  -ctga
B D                  Bushbaby  -t---
           Chinese tree shrew  -ccgc
B D                       Pig  -gtga
B D                    Alpaca  -gcta
               Bactrian camel  -gcta
B D                   Dolphin  -gtga
                 Killer whale  -gtga
             Tibetan antelope  -gtga
B D                       Cow  -gtga
B D                     Sheep  -gtga
                Domestic goat  -gtga
B D                     Horse  -atga
B D          White rhinoceros  -ctga
B D                       Cat  -gtg-
B D                       Dog  -gtga
B D                   Ferret   -ctgg
B D                     Panda  -ccga
               Pacific walrus  -ctga
                 Weddell seal  -ctga
             Black flying-fox  -gcga
                Big brown bat  -gtga
         David's myotis (bat)  -gtga
B D                  Microbat  -gtga
B D                  Elephant  ----a
          Cape elephant shrew  ----a
B D                   Manatee  ----a
             Cape golden mole  ----a
                     Aardvark  ----a
  D               Rock pigeon  -ccag
  D       Collared flycatcher  ---gc
B D       Medium ground finch  -ccag
B D               Zebra finch  -ccgt
           Tibetan ground jay  -ccag
B D        American alligator  -ccgc
  D  Chinese softshell turtle  -ccgc
B D              Nile tilapia  acta-
          Princess of Burundi  acta-
        Burton's mouthbreeder  acta-
                  Spotted gar  -ccc-
              Golden hamster  =====
                Prairie vole  =====
B D                     Mouse  =====
B D                       Rat  =====
B D                   Lamprey  =====
B D                    Medaka  =====
    Mexican tetra (cavefish)  =====
B D           Chinese hamster  =====
      Lesser Egyptian jerboa  -----
B D                      Pika  =====
B D                    Tenrec  =====
B D                  Hedgehog  =====
B D                     Shrew  =====
B D                Guinea pig  -----
B D                 Zebrafish  =====
B D             X. tropicalis  =====
B D                    Lizard  =====
  D              Mallard duck  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
B D                   Wallaby  =====
B D           Tasmanian devil  =====
B D                   Opossum  =====
  D    Spiny softshell turtle  =====
  D    White-throated sparrow  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D             Scarlet macaw  =====
  D                    Parrot  =====
B D                Budgerigar  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
B D                Coelacanth  =====
  D           Green seaturtle  =====
  D            Painted turtle  =====
B D                 Tetraodon  =====
B D              Atlantic cod  =====
B D               Stickleback  =====
          Southern platyfish  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
B D                  Platypus  =====
            Brush-tailed rat  =====
             Star-nosed mole  -----
B D            Naked mole-rat  -----
                  Chinchilla  -----
B D                 Armadillo  =====
B D                  Squirrel  -----

Inserts between block 16 and 17 in window
  D              Rock pigeon 1bp
B D       American alligator 1bp

Alignment block 17 of 114 in window, 18202478 - 18202479, 2 bps 
B D                     Human  -c-c
B D                     Chimp  -c-c
B D                   Gorilla  -c-c
B D                 Orangutan  -c-c
B D                    Gibbon  -c-c
B D                    Rhesus  -c-g
B D       Crab-eating macaque  -c-g
B D                    Baboon  -c-c
B D              Green monkey  -c-c
B D           Squirrel monkey  -g-c
           Chinese tree shrew  -c-c
B D                       Pig  -t-g
B D                    Alpaca  -t-g
               Bactrian camel  -t-g
B D                   Dolphin  -t-g
                 Killer whale  -t-g
             Tibetan antelope  -t-g
B D                       Cow  -t-g
B D                     Sheep  -t-g
                Domestic goat  -t-g
B D                     Horse  -t-g
B D          White rhinoceros  -c-g
B D                       Cat  ---a
B D                       Dog  -t-a
B D                   Ferret   -taa
B D                     Panda  -c-a
               Pacific walrus  -t-a
                 Weddell seal  -t-a
             Black flying-fox  -t-g
                Big brown bat  -t-g
         David's myotis (bat)  -t-g
B D                  Microbat  -t-g
B D                  Hedgehog  ---c
B D                     Shrew  ---g
B D                  Elephant  -c-a
          Cape elephant shrew  -c-a
B D                   Manatee  -c-a
             Cape golden mole  -c-a
                     Aardvark  -c-a
  D               Rock pigeon  -c--
  D                    Parrot  -c--
B D        American alligator  -c--
  D  Chinese softshell turtle  -c--
B D              Nile tilapia  ac--
          Princess of Burundi  ct--
        Burton's mouthbreeder  ct--
                  Spotted gar  cc--
              Golden hamster  ====
                Prairie vole  ====
B D                     Mouse  ====
B D                       Rat  ====
B D                   Lamprey  ====
B D                    Medaka  ====
    Mexican tetra (cavefish)  ====
B D           Chinese hamster  ====
      Lesser Egyptian jerboa  ----
B D                      Pika  ====
B D                    Tenrec  ====
B D                Guinea pig  ----
B D                 Zebrafish  ====
B D             X. tropicalis  ====
B D                    Lizard  ====
  D              Mallard duck  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D                   Wallaby  ====
B D           Tasmanian devil  ====
B D               Zebra finch  ----
B D       Medium ground finch  ----
  D       Collared flycatcher  ----
B D                   Opossum  ====
  D    Spiny softshell turtle  ====
  D    White-throated sparrow  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
B D                Coelacanth  ====
  D           Green seaturtle  ====
  D            Painted turtle  ====
B D                 Tetraodon  ====
B D              Atlantic cod  ====
B D               Stickleback  ====
          Southern platyfish  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
          Tibetan ground jay  ----
B D                  Platypus  ====
            Brush-tailed rat  ====
             Star-nosed mole  ----
B D            Naked mole-rat  ----
                  Chinchilla  ----
B D                 Armadillo  ====
B D                  Squirrel  ----
B D                  Bushbaby  ----
B D                  Marmoset  ----

Inserts between block 17 and 18 in window
  D              Rock pigeon 9bp
  D                   Parrot 4bp
B D       American alligator 15bp
  D Chinese softshell turtle 2bp

Alignment block 18 of 114 in window, 18202480 - 18202493, 14 bps 
B D                     Human  ------gagccgggc-gggag
B D                     Chimp  ------gagccgggc-gggag
B D                   Gorilla  ------gagccgggc-cggag
B D                 Orangutan  ------gagccgggc-gggag
B D                    Gibbon  ------gagccaggc-gggag
B D                    Rhesus  ------gagccgggc-gggag
B D       Crab-eating macaque  ------gagccgggc-gggag
B D                    Baboon  ------aagccaggt-gggag
B D              Green monkey  ------gaggcgggc-cggag
B D                  Marmoset  -------------ga-gagag
B D           Squirrel monkey  ------gagccggga-gggag
           Chinese tree shrew  ------caacc------gaaa
B D                  Squirrel  ------------agg-aggag
B D            Naked mole-rat  ------------gag-gggag
B D                Guinea pig  -----------gggg-atggg
                   Chinchilla  ------------ggg-gtgag
B D                       Pig  ------gagacagaa-t----
B D                    Alpaca  ------gagccagga-g----
               Bactrian camel  ------gagccagga-g----
B D                   Dolphin  ------aagccagaa-g----
                 Killer whale  ------aagccagaa-g----
             Tibetan antelope  ------gagccagaagg----
B D                       Cow  ------gagccagaagg----
B D                     Sheep  ------gagccagaagg----
                Domestic goat  ------gagccagaagg----
B D                     Horse  ------gagctggga-g----
B D          White rhinoceros  ------gagccagga-a----
B D                       Cat  ------gagacagga-g----
B D                       Dog  ------gggacggaa-g----
B D                   Ferret   ------gagacagga-g----
B D                     Panda  ------gagacagga-g----
               Pacific walrus  ------gagacagga-g----
                 Weddell seal  ------gagacagga-g----
             Black flying-fox  ------gagctagga-g----
                Big brown bat  ------gagctagga-g----
         David's myotis (bat)  ------gagttagga-g----
B D                  Microbat  ------gagttagga-g----
B D                  Hedgehog  ------ggccaggca-g----
B D                     Shrew  ------aagcacaca-g----
              Star-nosed mole  -------agccagga-g----
B D                  Elephant  ------gggatgaaa------
          Cape elephant shrew  ------ggggcaaag------
B D                   Manatee  ------gggaggaag------
             Cape golden mole  ------ggaatagag------
                     Aardvark  ------ggaacgcag------
  D               Rock pigeon  ------ccaccgggg-a----
  D              Saker falcon  ------cgtgcaggg-g----
  D          Peregrine falcon  ------cgtgcaggg-g----
  D       Collared flycatcher  --------tctgggg-g----
B D       Medium ground finch  --------cccaggg-g----
B D               Zebra finch  --------gccaggc-g----
           Tibetan ground jay  --------caggggg-g----
  D                    Parrot  ------caaccgcgc-a----
B D        American alligator  ------gctgcgggg-g----
  D  Chinese softshell turtle  ------cagcagagc-g----
B D              Nile tilapia  cacca-g--------------
          Princess of Burundi  cggca-gtgcagagg------
        Burton's mouthbreeder  cggca-gtgcagagg------
                  Spotted gar  cgccctgagcatgag------
              Golden hamster  =====================
                Prairie vole  =====================
B D                     Mouse  =====================
B D                       Rat  =====================
B D                   Lamprey  =====================
B D                    Medaka  =====================
    Mexican tetra (cavefish)  =====================
B D           Chinese hamster  =====================
      Lesser Egyptian jerboa  ---------------------
B D                      Pika  =====================
B D                    Tenrec  =====================
B D                 Zebrafish  =====================
B D             X. tropicalis  =====================
B D                    Lizard  =====================
  D              Mallard duck  =====================
      Yellowbelly pufferfish  =====================
B D                      Fugu  =====================
B D                   Wallaby  =====================
B D           Tasmanian devil  =====================
B D                   Opossum  =====================
  D    Spiny softshell turtle  =====================
  D    White-throated sparrow  =====================
B D                    Turkey  =====================
B D                   Chicken  =====================
  D             Scarlet macaw  =====================
B D                Budgerigar  =====================
B D                Coelacanth  =====================
  D           Green seaturtle  =====================
  D            Painted turtle  =====================
B D                 Tetraodon  =====================
B D              Atlantic cod  =====================
B D               Stickleback  =====================
          Southern platyfish  =====================
         Pundamilia nyererei  =====================
                 Zebra mbuna  =====================
B D                  Platypus  =====================
            Brush-tailed rat  =====================
B D                 Armadillo  =====================
B D                  Bushbaby  ---------------------

Inserts between block 18 and 19 in window
B D                 Elephant 8bp
         Cape elephant shrew 16bp
B D                  Manatee 8bp
  D      Collared flycatcher 12bp
B D      Medium ground finch 8bp
B D              Zebra finch 5bp
          Tibetan ground jay 8bp
  D                   Parrot 3bp
  D Chinese softshell turtle 6bp

Alignment block 19 of 114 in window, 18202494 - 18202494, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
           Chinese tree shrew  c
B D                  Squirrel  c
B D                     Mouse  c
B D                       Rat  c
B D                       Pig  t
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  t
                 Weddell seal  c
             Black flying-fox  t
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  g
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  c
          Cape elephant shrew  c
             Cape golden mole  c
                     Aardvark  c
B D                   Opossum  c
B D                   Wallaby  c
  D               Rock pigeon  c
B D                 Tetraodon  c
              Golden hamster  =
                Prairie vole  =
B D                   Lamprey  =
B D                    Medaka  =
    Mexican tetra (cavefish)  =
B D           Chinese hamster  =
      Lesser Egyptian jerboa  -
B D                      Pika  =
B D                    Tenrec  =
B D                Guinea pig  -
B D                 Zebrafish  =
B D             X. tropicalis  =
B D                    Lizard  =
  D              Mallard duck  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D           Tasmanian devil  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D    Spiny softshell turtle  =
  D    White-throated sparrow  =
B D                    Turkey  =
B D                   Chicken  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
  D          Peregrine falcon  -
  D              Saker falcon  -
B D                Coelacanth  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D              Atlantic cod  =
B D               Stickleback  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  -
         Princess of Burundi  -
B D              Nile tilapia  -
                 Spotted gar  -
B D        American alligator  -
          Tibetan ground jay  =
B D                  Platypus  =
            Brush-tailed rat  =
B D            Naked mole-rat  -
                  Chinchilla  -
B D                 Armadillo  =
B D                   Manatee  =
B D          White rhinoceros  -
B D                  Bushbaby  -

Inserts between block 19 and 20 in window
B D                  Wallaby 1bp

Alignment block 20 of 114 in window, 18202495 - 18202497, 3 bps 
B D                     Human  cct
B D                     Chimp  cct
B D                   Gorilla  cct
B D                 Orangutan  cct
B D                    Gibbon  cct
B D                    Rhesus  cct
B D       Crab-eating macaque  cct
B D                    Baboon  cct
B D              Green monkey  cct
B D                  Marmoset  cct
B D           Squirrel monkey  cct
           Chinese tree shrew  cct
B D                  Squirrel  cct
B D                     Mouse  cct
B D                       Rat  cct
B D            Naked mole-rat  gcg
B D                Guinea pig  agc
                   Chinchilla  gcc
B D                       Pig  ccc
B D                    Alpaca  ccc
               Bactrian camel  ccc
B D                   Dolphin  ccc
                 Killer whale  ccc
             Tibetan antelope  ccc
B D                       Cow  ccc
B D                     Sheep  ccc
                Domestic goat  ccc
B D                     Horse  ccc
B D          White rhinoceros  ccc
B D                       Cat  tcc
B D                       Dog  tcc
B D                   Ferret   tct
B D                     Panda  tcc
               Pacific walrus  tct
                 Weddell seal  tcc
             Black flying-fox  ccc
                Big brown bat  ccc
         David's myotis (bat)  ccc
B D                  Microbat  ccc
B D                  Hedgehog  gca
B D                     Shrew  ggc
              Star-nosed mole  ttt
B D                  Elephant  ccc
          Cape elephant shrew  ccc
B D                   Manatee  -cc
             Cape golden mole  acc
                     Aardvark  tgc
B D                   Opossum  ccc
B D           Tasmanian devil  ccc
B D                   Wallaby  ctc
  D               Rock pigeon  acg
  D              Saker falcon  -ca
  D          Peregrine falcon  -ca
  D       Collared flycatcher  -ct
B D       Medium ground finch  -ca
B D               Zebra finch  -cc
           Tibetan ground jay  -cc
  D  Chinese softshell turtle  -cg
  D    Spiny softshell turtle  -cg
B D                 Tetraodon  ctc
          Princess of Burundi  -ct
        Burton's mouthbreeder  -ct
                  Spotted gar  -cc
              Golden hamster  ===
                Prairie vole  ===
B D                   Lamprey  ===
B D                    Medaka  ===
    Mexican tetra (cavefish)  ===
B D           Chinese hamster  ===
      Lesser Egyptian jerboa  ---
B D                      Pika  ===
B D                    Tenrec  ===
B D                 Zebrafish  ===
B D             X. tropicalis  ===
B D                    Lizard  ===
  D              Mallard duck  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
  D    White-throated sparrow  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D             Scarlet macaw  ===
  D                    Parrot  ===
B D                Budgerigar  ===
B D                Coelacanth  ===
  D           Green seaturtle  ===
  D            Painted turtle  ===
B D              Atlantic cod  ===
B D               Stickleback  ===
          Southern platyfish  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
B D              Nile tilapia  ---
B D        American alligator  ---
B D                  Platypus  ===
            Brush-tailed rat  ===
B D                 Armadillo  ===
B D                  Bushbaby  ---

Alignment block 21 of 114 in window, 18202498 - 18202500, 3 bps 
B D                     Human  c-c-a
B D                     Chimp  c-c-a
B D                   Gorilla  c-c-a
B D                 Orangutan  c-c-a
B D                    Gibbon  c-c-a
B D                    Rhesus  c-c-a
B D       Crab-eating macaque  c-c-a
B D                    Baboon  c-c-a
B D              Green monkey  c-c-a
B D                  Marmoset  c-c-a
B D           Squirrel monkey  c-c-a
           Chinese tree shrew  g-c-a
B D                  Squirrel  c-c-a
       Lesser Egyptian jerboa  ----g
B D                     Mouse  c-c-a
B D                       Rat  c-c-a
B D            Naked mole-rat  c-c-c
B D                Guinea pig  c-c--
                   Chinchilla  c-c-c
B D                       Pig  c-c-a
B D                    Alpaca  cgc-a
               Bactrian camel  c-c-a
B D                   Dolphin  c-c-a
                 Killer whale  c-c-a
             Tibetan antelope  c-c-a
B D                       Cow  c-c-a
B D                     Sheep  c-c-a
                Domestic goat  c-c-a
B D                     Horse  c-c-a
B D          White rhinoceros  c-c-g
B D                       Cat  c-c-a
B D                       Dog  c-c-a
B D                   Ferret   c-c-a
B D                     Panda  c-c-a
               Pacific walrus  c-c-a
                 Weddell seal  g-c-a
             Black flying-fox  c-c-a
                Big brown bat  c-c-a
         David's myotis (bat)  c-ctg
B D                  Microbat  c-c-a
B D                  Hedgehog  g-g-g
B D                     Shrew  g-g-g
              Star-nosed mole  c-c-g
B D                  Elephant  c-g-a
          Cape elephant shrew  t-g-t
B D                   Manatee  c-g-a
             Cape golden mole  t-g-a
                     Aardvark  c-t-a
B D                   Opossum  a-c-c
B D           Tasmanian devil  c-c-a
B D                   Wallaby  a-t-a
B D                  Platypus  c-t-a
  D               Rock pigeon  c-c-g
  D              Saker falcon  c-c-g
  D          Peregrine falcon  c-c-g
  D       Collared flycatcher  c-c-c
B D       Medium ground finch  c-c-c
B D               Zebra finch  t-c-c
           Tibetan ground jay  c-c-c
B D                Budgerigar  c-c-g
  D                    Parrot  c-c-c
  D             Scarlet macaw  c-c-c
B D        American alligator  c-c-c
  D  Chinese softshell turtle  c-c-c
  D    Spiny softshell turtle  c-c-c
B D                    Lizard  c-c-c
B D                 Tetraodon  c-c-a
          Princess of Burundi  c-t-a
        Burton's mouthbreeder  c-t-a
                  Spotted gar  c-t-t
              Golden hamster  =====
                Prairie vole  =====
B D                   Lamprey  =====
B D                    Medaka  =====
    Mexican tetra (cavefish)  =====
B D           Chinese hamster  =====
B D                      Pika  =====
B D                    Tenrec  =====
B D                 Zebrafish  =====
B D             X. tropicalis  =====
  D              Mallard duck  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
  D    White-throated sparrow  =====
B D                    Turkey  =====
B D                   Chicken  =====
B D                Coelacanth  =====
  D           Green seaturtle  =====
  D            Painted turtle  =====
B D              Atlantic cod  =====
B D               Stickleback  =====
          Southern platyfish  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
B D              Nile tilapia  -----
            Brush-tailed rat  =====
B D                 Armadillo  =====
B D                  Bushbaby  -----

Inserts between block 21 and 22 in window
  D              Rock pigeon 8bp
  D             Saker falcon 7bp
  D         Peregrine falcon 7bp
  D      Collared flycatcher 2bp
B D      Medium ground finch 7bp
          Tibetan ground jay 8bp
B D               Budgerigar 5bp
  D                   Parrot 5bp
  D            Scarlet macaw 5bp
B D       American alligator 10bp
  D Chinese softshell turtle 7bp
  D   Spiny softshell turtle 4bp
B D                   Lizard 3bp

Alignment block 22 of 114 in window, 18202501 - 18202501, 1 bps 
B D                     Human  -g
B D                     Chimp  -g
B D                   Gorilla  -g
B D                 Orangutan  -c
B D                    Gibbon  -g
B D                    Rhesus  -g
B D       Crab-eating macaque  -g
B D                    Baboon  -g
B D              Green monkey  -g
B D                  Marmoset  -g
B D           Squirrel monkey  -g
           Chinese tree shrew  -g
B D                  Squirrel  -g
       Lesser Egyptian jerboa  -g
B D                     Mouse  -g
B D                       Rat  -g
B D            Naked mole-rat  -g
                   Chinchilla  -a
B D                       Pig  -g
B D                    Alpaca  -g
               Bactrian camel  -g
B D                   Dolphin  -g
                 Killer whale  -g
             Tibetan antelope  -g
B D                       Cow  -g
B D                     Sheep  -g
                Domestic goat  -g
B D                     Horse  -g
B D          White rhinoceros  -g
B D                       Cat  -g
B D                       Dog  -g
B D                   Ferret   -g
B D                     Panda  -g
               Pacific walrus  -g
                 Weddell seal  -g
             Black flying-fox  -g
                Big brown bat  -g
         David's myotis (bat)  -g
B D                  Microbat  -g
B D                  Hedgehog  -c
B D                     Shrew  -c
              Star-nosed mole  -c
B D                  Elephant  -a
          Cape elephant shrew  -g
B D                   Manatee  -g
             Cape golden mole  -g
                     Aardvark  -g
B D                   Opossum  -g
B D           Tasmanian devil  -g
B D                   Wallaby  -g
B D                  Platypus  -g
B D                    Lizard  -a
B D                 Tetraodon  g-
B D              Nile tilapia  c-
          Princess of Burundi  t-
        Burton's mouthbreeder  t-
              Golden hamster  ==
                Prairie vole  ==
B D                   Lamprey  ==
B D                    Medaka  ==
    Mexican tetra (cavefish)  ==
B D           Chinese hamster  ==
B D                      Pika  ==
B D                    Tenrec  ==
B D                Guinea pig  --
B D                 Zebrafish  ==
B D             X. tropicalis  ==
  D              Mallard duck  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D       Collared flycatcher  ==
  D    Spiny softshell turtle  ==
  D    White-throated sparrow  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                Coelacanth  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
  D            Painted turtle  ==
B D              Atlantic cod  ==
B D               Stickleback  ==
          Southern platyfish  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
                 Spotted gar  --
B D        American alligator  ==
          Tibetan ground jay  ==
            Brush-tailed rat  ==
B D                 Armadillo  ==
B D                  Bushbaby  --

Inserts between block 22 and 23 in window
B D                 Squirrel 4bp
B D                    Mouse 4bp
B D                      Rat 4bp
B D           Naked mole-rat 3bp
B D                 Elephant 6bp
         Cape elephant shrew 6bp
B D                  Manatee 6bp
            Cape golden mole 3bp
                    Aardvark 5bp
B D                  Opossum 1bp
B D          Tasmanian devil 1bp
B D                  Wallaby 1bp
B D                 Platypus 1bp

Alignment block 23 of 114 in window, 18202502 - 18202502, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
           Chinese tree shrew  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  g
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  t
                     Aardvark  c
B D                   Opossum  c
B D           Tasmanian devil  t
B D                   Wallaby  c
B D                  Platypus  c
  D               Rock pigeon  g
  D              Saker falcon  c
  D          Peregrine falcon  c
  D    White-throated sparrow  c
B D       Medium ground finch  t
B D               Zebra finch  c
           Tibetan ground jay  t
B D                Budgerigar  c
  D                    Parrot  c
  D             Scarlet macaw  c
  D              Mallard duck  c
B D                   Chicken  c
B D                    Turkey  c
B D        American alligator  c
  D  Chinese softshell turtle  c
  D    Spiny softshell turtle  c
B D                    Lizard  c
B D                 Tetraodon  c
B D              Nile tilapia  c
          Princess of Burundi  c
        Burton's mouthbreeder  c
B D              Atlantic cod  c
              Golden hamster  =
                Prairie vole  =
B D                     Mouse  =
B D                       Rat  =
B D                   Lamprey  =
B D                    Medaka  =
    Mexican tetra (cavefish)  =
B D           Chinese hamster  =
      Lesser Egyptian jerboa  -
B D                      Pika  =
B D                    Tenrec  =
B D                Guinea pig  -
B D                 Zebrafish  =
B D             X. tropicalis  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
  D       Collared flycatcher  =
B D                Coelacanth  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D               Stickleback  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
                 Spotted gar  -
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  -
B D                 Armadillo  =
B D                  Squirrel  =
B D                  Bushbaby  -

Alignment block 24 of 114 in window, 18202503 - 18202503, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
           Chinese tree shrew  c
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  c
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  g
B D                     Shrew  g
              Star-nosed mole  g
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  c
                     Aardvark  c
B D                   Opossum  c
B D           Tasmanian devil  c
B D                   Wallaby  c
B D                  Platypus  c
  D               Rock pigeon  g
  D              Saker falcon  a
  D          Peregrine falcon  a
  D    White-throated sparrow  t
B D       Medium ground finch  c
B D               Zebra finch  t
           Tibetan ground jay  c
B D                Budgerigar  g
  D                    Parrot  g
  D             Scarlet macaw  g
  D              Mallard duck  t
B D                   Chicken  t
B D                    Turkey  t
B D        American alligator  c
B D                    Lizard  t
B D                 Tetraodon  t
B D              Nile tilapia  t
          Princess of Burundi  t
        Burton's mouthbreeder  t
B D              Atlantic cod  t
B D                   Lamprey  t
              Golden hamster  =
                Prairie vole  =
B D                     Mouse  =
B D                       Rat  =
B D                    Medaka  =
    Mexican tetra (cavefish)  =
B D           Chinese hamster  =
      Lesser Egyptian jerboa  -
B D                      Pika  =
B D                    Tenrec  =
B D                Guinea pig  -
B D                 Zebrafish  =
B D             X. tropicalis  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
  D       Collared flycatcher  =
  D    Spiny softshell turtle  -
B D                Coelacanth  =
  D  Chinese softshell turtle  -
  D           Green seaturtle  =
  D            Painted turtle  =
B D               Stickleback  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
                 Spotted gar  -
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  -
B D                 Armadillo  =
B D                  Squirrel  =
B D                  Bushbaby  -

Inserts between block 24 and 25 in window
B D                    Shrew 7bp
B D                   Lizard 2bp
B D                Tetraodon 245bp

Alignment block 25 of 114 in window, 18202504 - 18202505, 2 bps 
B D                     Human  gg
B D                     Chimp  gg
B D                   Gorilla  gg
B D                 Orangutan  gg
B D                    Gibbon  gg
B D                    Rhesus  gg
B D       Crab-eating macaque  gg
B D                    Baboon  gg
B D              Green monkey  gg
B D                  Marmoset  gg
B D           Squirrel monkey  gg
B D                  Bushbaby  -g
           Chinese tree shrew  -g
B D                       Pig  gg
B D                    Alpaca  gg
               Bactrian camel  gg
B D                   Dolphin  gg
                 Killer whale  gg
             Tibetan antelope  gg
B D                       Cow  gg
B D                     Sheep  gg
                Domestic goat  gg
B D                     Horse  gg
B D          White rhinoceros  gg
B D                       Cat  gg
B D                       Dog  gg
B D                   Ferret   gg
B D                     Panda  gg
               Pacific walrus  gg
                 Weddell seal  gg
             Black flying-fox  gg
                Big brown bat  gg
         David's myotis (bat)  gg
B D                  Microbat  gg
B D                  Hedgehog  gg
B D                     Shrew  gg
              Star-nosed mole  gg
B D                  Elephant  ag
B D                   Manatee  ag
             Cape golden mole  ag
                     Aardvark  ag
B D                   Opossum  aa
B D           Tasmanian devil  at
B D                   Wallaby  ag
B D                  Platypus  at
  D               Rock pigeon  gg
  D              Saker falcon  gg
  D          Peregrine falcon  gg
  D    White-throated sparrow  gg
B D       Medium ground finch  tg
B D               Zebra finch  gg
           Tibetan ground jay  tc
B D                Budgerigar  gg
  D                    Parrot  gg
  D             Scarlet macaw  gg
  D              Mallard duck  gg
B D                   Chicken  gg
B D                    Turkey  gg
B D        American alligator  ac
  D            Painted turtle  gg
  D  Chinese softshell turtle  gg
  D    Spiny softshell turtle  gg
B D                    Lizard  aa
B D              Nile tilapia  -g
          Princess of Burundi  -c
        Burton's mouthbreeder  -c
B D                   Lamprey  ag
         Cape elephant shrew  --
              Golden hamster  ==
                Prairie vole  ==
B D                     Mouse  ==
B D                       Rat  ==
B D                    Medaka  ==
    Mexican tetra (cavefish)  ==
B D           Chinese hamster  ==
      Lesser Egyptian jerboa  --
B D                      Pika  ==
B D                    Tenrec  ==
B D                Guinea pig  --
B D                 Zebrafish  ==
B D             X. tropicalis  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
  D       Collared flycatcher  ==
B D                Coelacanth  ==
  D           Green seaturtle  ==
B D                 Tetraodon  ==
B D              Atlantic cod  --
B D               Stickleback  ==
          Southern platyfish  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
                 Spotted gar  --
            Brush-tailed rat  ==
B D            Naked mole-rat  ==
                  Chinchilla  --
B D                 Armadillo  ==
B D                  Squirrel  ==

Inserts between block 25 and 26 in window
  D              Rock pigeon 2bp
  D             Saker falcon 2bp
  D         Peregrine falcon 2bp
  D   White-throated sparrow 2bp
B D      Medium ground finch 2bp
B D              Zebra finch 2bp
          Tibetan ground jay 2bp
B D               Budgerigar 2bp
  D                   Parrot 2bp
  D            Scarlet macaw 2bp
  D             Mallard duck 2bp
B D                  Chicken 2bp
B D                   Turkey 2bp
B D       American alligator 2bp
  D           Painted turtle 2bp
  D Chinese softshell turtle 2bp
  D   Spiny softshell turtle 2bp
B D                   Lizard 6bp

Alignment block 26 of 114 in window, 18202506 - 18202506, 1 bps 
B D                     Human  -g
B D                     Chimp  -g
B D                   Gorilla  -g
B D                 Orangutan  -g
B D                    Gibbon  -g
B D                    Rhesus  -g
B D       Crab-eating macaque  -g
B D                    Baboon  -g
B D              Green monkey  -g
B D                  Marmoset  -g
B D           Squirrel monkey  -g
B D                  Bushbaby  -g
           Chinese tree shrew  -g
B D             X. tropicalis  -g
B D              Nile tilapia  -a
          Princess of Burundi  -a
        Burton's mouthbreeder  -a
B D              Atlantic cod  -g
B D                   Lamprey  c-
         Cape elephant shrew  --
              Golden hamster  ==
                Prairie vole  ==
B D                     Mouse  ==
B D                       Rat  ==
B D                    Medaka  ==
    Mexican tetra (cavefish)  ==
B D           Chinese hamster  ==
      Lesser Egyptian jerboa  --
B D                      Pika  ==
B D                    Tenrec  ==
B D                  Hedgehog  --
               Big brown bat  --
               Domestic goat  --
B D                     Sheep  --
B D                     Shrew  --
B D                       Cow  --
B D                Guinea pig  --
B D                 Zebrafish  ==
B D                    Lizard  ==
  D              Mallard duck  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                   Wallaby  --
B D           Tasmanian devil  --
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D       Collared flycatcher  ==
B D                   Opossum  --
  D    Spiny softshell turtle  ==
  D    White-throated sparrow  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                Coelacanth  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D               Stickleback  ==
          Southern platyfish  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
                 Spotted gar  --
B D        American alligator  ==
          Tibetan ground jay  ==
B D                  Platypus  --
            Cape golden mole  --
            Tibetan antelope  --
B D                   Dolphin  --
            Brush-tailed rat  ==
             Star-nosed mole  --
                Killer whale  --
B D            Naked mole-rat  ==
                    Aardvark  --
B D                       Pig  --
B D                  Microbat  --
        David's myotis (bat)  --
                Weddell seal  --
B D                     Panda  --
B D                   Ferret   --
              Pacific walrus  --
                  Chinchilla  --
            Black flying-fox  --
B D                       Dog  --
B D                       Cat  --
              Bactrian camel  --
B D                    Alpaca  --
B D                 Armadillo  ==
B D                   Manatee  --
B D                  Elephant  --
B D          White rhinoceros  --
B D                     Horse  --
B D                  Squirrel  ==

Inserts between block 26 and 27 in window
B D            X. tropicalis 1bp
B D             Atlantic cod 3bp

Alignment block 27 of 114 in window, 18202507 - 18202507, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
B D           Chinese hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
             Brush-tailed rat  a
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  g
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
                     Aardvark  a
B D                   Opossum  a
B D           Tasmanian devil  g
B D                   Wallaby  g
B D                   Lamprey  a
              Golden hamster  =
                Prairie vole  =
B D                    Medaka  =
    Mexican tetra (cavefish)  =
B D                    Tenrec  =
B D                 Zebrafish  =
B D             X. tropicalis  =
B D                    Lizard  =
  D              Mallard duck  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D    Spiny softshell turtle  =
  D    White-throated sparrow  =
B D                    Turkey  =
B D                   Chicken  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                Coelacanth  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D              Atlantic cod  =
B D               Stickleback  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
                 Spotted gar  -
B D        American alligator  =
          Tibetan ground jay  =
B D                  Platypus  -
                  Chinchilla  -
B D                 Armadillo  =

Alignment block 28 of 114 in window, 18202508 - 18202509, 2 bps 
B D                     Human  cc
B D                     Chimp  cc
B D                   Gorilla  cc
B D                 Orangutan  cc
B D                    Gibbon  cc
B D                    Rhesus  cc
B D       Crab-eating macaque  cc
B D                    Baboon  cc
B D              Green monkey  cc
B D                  Marmoset  cc
B D           Squirrel monkey  cc
B D                  Bushbaby  cc
           Chinese tree shrew  cc
B D                  Squirrel  cc
       Lesser Egyptian jerboa  cc
B D           Chinese hamster  ca
B D                     Mouse  ca
B D                       Rat  ca
B D            Naked mole-rat  cc
B D                Guinea pig  cc
                   Chinchilla  cc
             Brush-tailed rat  cc
B D                      Pika  cc
B D                       Pig  cc
B D                    Alpaca  cc
               Bactrian camel  cc
B D                   Dolphin  cc
                 Killer whale  cc
             Tibetan antelope  cc
B D                       Cow  cc
B D                     Sheep  cc
                Domestic goat  cc
B D                     Horse  cc
B D          White rhinoceros  cc
B D                       Cat  cc
B D                       Dog  cc
B D                   Ferret   cc
B D                     Panda  cc
               Pacific walrus  cc
                 Weddell seal  cc
             Black flying-fox  cc
                Big brown bat  cc
         David's myotis (bat)  cc
B D                  Microbat  cc
B D                  Hedgehog  tc
B D                     Shrew  cc
              Star-nosed mole  cc
B D                  Elephant  ct
          Cape elephant shrew  ct
B D                   Manatee  cc
             Cape golden mole  ct
                     Aardvark  cg
B D                   Opossum  ct
B D           Tasmanian devil  ct
B D                   Wallaby  ct
B D                  Platypus  tc
  D               Rock pigeon  ct
  D              Saker falcon  ct
  D          Peregrine falcon  ct
  D       Collared flycatcher  ct
  D    White-throated sparrow  ct
B D       Medium ground finch  ct
B D               Zebra finch  ct
           Tibetan ground jay  ct
B D                Budgerigar  ct
  D                    Parrot  ct
  D             Scarlet macaw  ct
  D              Mallard duck  ct
B D                   Chicken  ct
B D                    Turkey  ct
B D        American alligator  ct
  D           Green seaturtle  cc
  D            Painted turtle  cc
  D  Chinese softshell turtle  cc
  D    Spiny softshell turtle  ct
B D                    Lizard  ct
B D             X. tropicalis  ct
B D                Coelacanth  ct
B D                 Tetraodon  ct
B D                      Fugu  ct
       Yellowbelly pufferfish  ct
B D              Nile tilapia  ct
          Princess of Burundi  ct
        Burton's mouthbreeder  ct
                  Zebra mbuna  ct
          Pundamilia nyererei  ct
B D                    Medaka  ct
           Southern platyfish  ct
B D               Stickleback  ct
B D              Atlantic cod  ct
     Mexican tetra (cavefish)  ct
B D                   Lamprey  cg
              Golden hamster  ==
                Prairie vole  ==
B D                    Tenrec  ==
B D                 Zebrafish  ==
                 Spotted gar  --
B D                 Armadillo  ==

Inserts between block 28 and 29 in window
B D                 Hedgehog 13bp
B D                    Shrew 4bp
B D                 Platypus 1bp

Alignment block 29 of 114 in window, 18202510 - 18202510, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                      Pika  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  c
B D                     Shrew  c
              Star-nosed mole  c
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  c
                     Aardvark  c
B D                   Opossum  c
B D           Tasmanian devil  c
B D                   Wallaby  c
B D                  Platypus  c
  D               Rock pigeon  c
  D              Saker falcon  c
  D          Peregrine falcon  c
  D       Collared flycatcher  c
  D    White-throated sparrow  t
B D       Medium ground finch  c
B D               Zebra finch  t
           Tibetan ground jay  c
B D                Budgerigar  c
  D                    Parrot  c
  D             Scarlet macaw  c
  D              Mallard duck  t
B D                   Chicken  t
B D                    Turkey  t
B D        American alligator  c
  D           Green seaturtle  t
  D            Painted turtle  t
  D  Chinese softshell turtle  t
  D    Spiny softshell turtle  c
B D                    Lizard  t
B D             X. tropicalis  t
B D                Coelacanth  t
B D                 Tetraodon  c
B D                      Fugu  c
       Yellowbelly pufferfish  c
B D              Nile tilapia  c
          Princess of Burundi  c
        Burton's mouthbreeder  c
                  Zebra mbuna  c
          Pundamilia nyererei  c
B D                    Medaka  t
           Southern platyfish  c
B D               Stickleback  c
B D              Atlantic cod  c
     Mexican tetra (cavefish)  c
B D                   Lamprey  t
                Prairie vole  =
B D                    Tenrec  =
B D                 Zebrafish  =
                 Spotted gar  -
B D                 Armadillo  =

Alignment block 30 of 114 in window, 18202511 - 18202511, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
                     Aardvark  a
B D                   Opossum  a
B D           Tasmanian devil  a
B D                   Wallaby  a
B D                  Platypus  a
  D               Rock pigeon  a
  D              Saker falcon  a
  D          Peregrine falcon  a
  D       Collared flycatcher  a
  D    White-throated sparrow  a
B D       Medium ground finch  a
B D               Zebra finch  a
           Tibetan ground jay  a
B D                Budgerigar  a
  D                    Parrot  a
  D             Scarlet macaw  a
  D              Mallard duck  a
B D                   Chicken  a
B D                    Turkey  a
B D        American alligator  a
  D           Green seaturtle  a
  D            Painted turtle  a
  D  Chinese softshell turtle  a
  D    Spiny softshell turtle  a
B D                    Lizard  a
B D             X. tropicalis  a
B D                Coelacanth  a
B D                 Tetraodon  a
B D                      Fugu  a
       Yellowbelly pufferfish  a
B D              Nile tilapia  a
          Princess of Burundi  a
        Burton's mouthbreeder  a
                  Zebra mbuna  a
          Pundamilia nyererei  a
B D                    Medaka  a
           Southern platyfish  a
B D               Stickleback  a
B D              Atlantic cod  a
B D                 Zebrafish  a
     Mexican tetra (cavefish)  a
                  Spotted gar  a
B D                   Lamprey  a
B D                    Tenrec  =
B D                 Armadillo  =

Alignment block 31 of 114 in window, 18202512 - 18202608, 97 bps 
B D                     Human  cccagatctgcagcttgatcctcttgtcgttgcgatagatggtcttgaccttgaagtcgatgcccacggt
B D                     Chimp  cccagatctgcagcttgatcctcttgtcgttgcgatagatggtcttgaccttgaagtcgatgcccacggt
B D                   Gorilla  cccagatctgcagcttgatcctcttgtcgttgcgatagatggtcttgaccttgaagtcgatgcccacggt
B D                 Orangutan  cccagatctgcagcttgatcctcttgtcgttgcgatagatggtcttgaccttgaagtcgatacccacggt
B D                    Gibbon  cccagatctgcagcttgatcctcttgtcgttgcggtagatggtcttgaccttgaagtcgatgcccacggt
B D                    Rhesus  cccagatctgcagcttgatcctcttgtcgttgcgatagatggtcttgaccttgaagtcgatgcccacggt
B D       Crab-eating macaque  cccagatctgcagcttgatcctcttgtcgttgcgatagatggtcttgaccttgaagtcgatgcccacggt
B D                    Baboon  cccagatctgcagcttgatcctcttgtcgttgcgatagatggtcttgaccttgaagtcgatgcccacggt
B D              Green monkey  cccagatctgcagcttgatcctcttgtcgttgcgatagatggtcttgaccttgaagtcgatgcccacggt
B D                  Marmoset  cccagatctgcagcttgatcctcttgtcatttcgatagatggttttgaccttgaagtcgatgcccacggt
B D           Squirrel monkey  cccagatctgcagcttgatcctcttgtcatttcgatagatggttttgaccttgaagtcgatgcccacggt
B D                  Bushbaby  cccagatctgcagcttgatcctcttgtcgttgcggtagatggttttgaccttgaagtcgatgcccacagt
           Chinese tree shrew  cccagatctgcagcttgatcctcttgtcgttgcggtagatggtcttgaccttgaagtcgatgcccacggt
B D                  Squirrel  cccaaatctgcagcttgatcctcttgtcgttgcggtagatggtcttgaccttgaagtcgatgcccacagt
       Lesser Egyptian jerboa  cccaaatctgcagcttgatcctcttgtcattgcggtagatggtcttgaccttgaagtcgatgcccacggt
                 Prairie vole  cccagatctgcagtttgatccgcttgtcattgcggtagatggttttgaccttgaagtctatgccgactgt
B D           Chinese hamster  cccagatctgcagtttgatcctcttgtcattgcggtagatggttttgaccttgaagtctatgccaaccgt
               Golden hamster  cccagatctgcagtttgatcctcttgtcgttgcggtagatggttttgaccttgaagtctatgccaaccgt
B D                     Mouse  cccagatctgcagcttgatcctcttgtcgttgcggtagatggttttgaccttgaagtctatgccaacggt
B D                       Rat  cccagatctgcagcttgatcctcttgtcattgcggtagatggttttgaccttgaagtctatgcccacagt
B D            Naked mole-rat  cccagatctgtagcttgatcctcttgtcattgcggtaaatggtcttgaccttgaaatcaatgcccacggt
B D                Guinea pig  cccagatctgcagcttgatcctcttgtcattgcggtagatggtcttgaccttgaagtcgatgcccacggt
                   Chinchilla  cccagatctgcagcttgatcctcttgtcgttgcggtagatggtcttgaccttgaagtcgatgcccacggt
             Brush-tailed rat  cccagatctgcagcttgatcctcttgtcattgcggtagatggtcttgaccttgaagtcgatgcccacagt
B D                      Pika  cccagatctgcagtttgatcctcttgtcgttgcggtagatggtcttgactttgaagtcgatgcccacggt
B D                       Pig  cccagatctgcagcttgatcctcttatcattccggtagatggtcttgaccttgaagtcgattcctacagt
B D                    Alpaca  cccagatctgcagcttgatcctcttatcgttccggtagatggtcttgaccttgaagtctatgcctacagt
               Bactrian camel  cccagatctgcagcttgatcctcttatcgttccggtagatggtcttgaccttgaagtctatgcctacagt
B D                   Dolphin  cccagatttgcagcttgatcctcttatcgtttcggtagatggtcttgaccttgaagtcaatgcctacagt
                 Killer whale  cccagatttgcagcttgatcctcttatcgtttcggtagatggtcttgaccttgaagtcaatgcctacagt
             Tibetan antelope  cccagatctgcagcttgatcctcttatcgtttcggtagatggtcttgaccttgaagtcgatgcctacggt
B D                       Cow  cccagatctgcagcttgatcctcttatcatttcggtagatggtcttgaccttgaagtcgatgcctacagt
B D                     Sheep  cccagatctgcagcttgatcctcttatcgtttcggtagatggtcttgaccttgaagtcgatgcctacagt
                Domestic goat  cccagatctgcagcttgatcctcttatcgtttcggtagatggtcttgaccttgaagtcgatgcctacagt
B D                     Horse  cccagatctgcagcttgatcctcttgtcgttgcggtagatggtcttgaccttgaagtcgatgcccacagt
B D          White rhinoceros  cccagatctgcagcttgatcctcttgtcgttgcggtagatggtcttgaccttgaagtcgatgcccacggt
B D                       Cat  cccagatctgcagcttgatcctcttgtcgttgcggtagatggtcttgaccttgaagtctatgcccacagt
B D                       Dog  cccagatctgcagcttgatcctcttgtcgttgcggtagatggtcttgaccttgaagtcgatgcccacagt
B D                   Ferret   cccagatctgcagcttgatcctcttgtcgttgcggtagatggtcttgaccttgaagtcgatgcccacagt
B D                     Panda  cccagatctgcagcttgatcctcttgtcgttgcggtagatggtcttgaccttgaagtcgatgcccacagt
               Pacific walrus  cccagatctgcagcttgatcctcttgtcgttgcggtagatggtcttgaccttgaagtcaatgcccacagt
                 Weddell seal  cccagatctgcagcttgatcctcttgtcgttgcggtagatggtcttgaccttgaagtcaatgcccacagt
             Black flying-fox  cccagatctgcagcttgatcctcttgtcgttgcggtagatggtcttgaccttgaaatcgatgcccacagt
                Big brown bat  cccagatctgcagcttgatcctcttgtcattgcggtagatagtcttgaccttgaagtctatgcccacagt
         David's myotis (bat)  cccagatctgcagcttgatcctcttgtcattgcggtagatagtcttgaccttgaaatctatgcccacagt
B D                  Microbat  cccagatctgcagcttgatcctcttgtcattgcggtagatagtcttgaccttgaagtctatgcccacagt
B D                  Hedgehog  cccagatctgcagcttgatgcgcttgtcctgccggtacaccgtcttgaccttgaagtcgatgcccacggt
B D                     Shrew  cccagatctgcagcttgatcctcttctcgttgcggtagatggtcttgaccttgaagtcgatgcccacggt
              Star-nosed mole  cccagatctgcagcttgatcctcttgtcattgcggtagatggtcttgaccttgaagtctatgcccaccgt
B D                  Elephant  cccagatctgcagcttgatcctcttgtcgttgcggtagatggtcttgaccttgaagtcgatgcccacagt
          Cape elephant shrew  cccagatctgcagcttgatcctcttgtcgttgcggtaaatggtcttgaccttgaagtcgatgcccacagt
B D                   Manatee  cccagatctgcagcttgatccgcttgtcgttgcggtagatggtcttgaccttgaagtcgatgcccacggt
             Cape golden mole  cccagatctgcagcttgatcctcttgtcgttgcggtagatggtcttgaccttgaagtcaatgcccacggt
B D                    Tenrec  cccagatctgcagcttgatcctcttgtcattgcggtagatggtcttgaccttgaagtcgatgcccacggt
                     Aardvark  cccagatctgtagcttgatcctcttgtcgttgcggtagatggtcttgaccttgaagtcaatgcccacggt
B D                   Opossum  cccagatctgaagcttgatcctcttctcattgcgatagatggtcttcaccttgaagtctatgcccacagt
B D           Tasmanian devil  cccagatctgcagcttgattctcttctcattgcgatagatggtcttcaccttgaaatctatgcccacagt
B D                   Wallaby  cccagatctgcagtttgatcctcttctcatttcgatagatggtcttcaccttgaaatctatgcccacggt
B D                  Platypus  cccaaatctgcagcttgatcctcttgtcgttgcggtagatggtcttcaccttgaagtcgatgccaacggt
  D               Rock pigeon  cccaaatctgcagcttgatgcgcttgtcgttgcggtagatggtcttgaccttgaagtcgatgccgacggt
  D              Saker falcon  cccagatctgtagcttgatgcgcttgtcgttccggtagatggtcttgaccttgaagtcgatgccaacggt
  D          Peregrine falcon  cccagatctgtagcttgatgcgcttgtcgttccggtagatggtcttgaccttgaagtcgatgccaacggt
  D       Collared flycatcher  cccagatctgcagcttgatgcgtttgtcgttcctgtagatggtcttgaccttgaagtcgatgccgacggt
  D    White-throated sparrow  cccagatctgcagcttcaccctcttgtcattcctgtaaactgttttcaccttgaagtcgatccccaccgt
B D       Medium ground finch  cccagatctgcagcttgatgcgtttgtcgttcctgtagatggtcttgaccttgaagtcgatgccgacggt
B D               Zebra finch  cccaaatctgcagcttcacccttttgtcattcctgtaaactgttttcaccttgaagtcgattcccactgt
           Tibetan ground jay  cccagatctgcagcttgatgcgtttgtcgttccggtagatggtcttgaccttgaagtcgatgccgacagt
B D                Budgerigar  cccagatctgcagcttgatgcgcttgtcgttccggtagatggtcttgaccttgaagtcgatgcccacggt
  D                    Parrot  cccagatctgcagcttgatgcgcttgtcgttccggtagatggtcttgaccttgaagtcgatgccgacggt
  D             Scarlet macaw  cccagatctgcagcttgatgcgcttgtcgttccggtagatggtcttgaccttgaagtcgatgccgacggt
  D              Mallard duck  cccaaatctgcagcttcactcgtttgtcattcctataaactgttttcactttgaagtcaattcctactgt
B D                   Chicken  cccaaatctgcagtttcactcgcttgtcattcctataaactgttttcactttgaaatcaattcctactgt
B D                    Turkey  cccaaatctgcagtttcacccgtttatcattcctataaactgttttcactttgaagtcaattcctactgt
B D        American alligator  cccagatctgcagcttgatgcgcttgtcgttgcggtagatggtcttgaccttgaagtcgatgccgacggt
  D           Green seaturtle  cccagatctgcagcttgatgcgcttgtcgttcctgtagatggttttgactttgaagtcgatgcccacggt
  D            Painted turtle  cccagatctgcagcttgatgcgcttgtcattcctgtagatggttttgactttgaagtcgatgccgacggt
  D  Chinese softshell turtle  cccagatctgcagcttgatgcgcttgtcgttgcggtagatggttttgactttgaagtcgatgccgacggt
  D    Spiny softshell turtle  cccagatctgcagcttgaccctcttctcgttccgatagaccgtcttgaccttgaagtcgatgcccacggt
B D                    Lizard  cccaaatctgcagcttgactcttttctcattcctgtagactgtcttgaccttgaagtcgatgcccacagt
B D             X. tropicalis  cccagatctgcagcttgattcttttgtcattcctgtaaatagttttcactttgaagtcaattcccaccgt
B D                Coelacanth  cccagatctgtagtttgattcttttgtcgttcctgtagatggttttcactttgaagtctattcctactgt
B D                 Tetraodon  cccagatctgcagctttatcctcttgtcgttcctgtagatggtcttgaccttgaagtcgatgccgaccgt
B D                      Fugu  cccagatctgcagctttatccgcttgtcgcttctgtagatggtcttgaccttgaagtcgatgcccaccgt
       Yellowbelly pufferfish  cccagatctgcagctttatccgcttgtcgcttctgtagatggtcttgaccttgaagtcgatgcccaccgt
B D              Nile tilapia  cccatatctgcagctttatcctcttgtcattcctgtagatggtcttgaccttaaagtcgatgcccacagt
          Princess of Burundi  cccatatctgaagctttatcctcttgtcattcctgtagatggtcttgaccttaaagtcgatgcccacagt
        Burton's mouthbreeder  cccatatctgaagctttatcctcttgtcattcctgtagatggtcttgaccttaaagtcgatgcccacagt
                  Zebra mbuna  cccatatctgaagctttatcctcttgtcattcctgtagatggtcttgaccttaaagtcgatgcccacagt
          Pundamilia nyererei  cccatatctgaagctttatcctcttgtcattcctgtagatggtcttgaccttaaagtcgatgcccacagt
B D                    Medaka  cccagatctgcagctttattctcttgtcgttcctgtagatggtcttgaccttgaagtcgatgcccaccgt
           Southern platyfish  cccagatctgtagttttatccttttgtcgttcctatagatggtcttgaccttgaagtcgattcccaccgt
B D               Stickleback  cccatatctgcagctttatccttttgtcgttcctgtagatggtcttcaccttgaagtcgatgcccaccgt
B D              Atlantic cod  cccagatctgtagctttatcctcttgtcgttcctgtagatggtcttcaccttgaagtcgatgcccaccgt
B D                 Zebrafish  cccatatttggagctttatcctcttgtcgttcctatagatggtcttgactttgaagtctatgccgacagt
     Mexican tetra (cavefish)  cccagatctgcagcttgatcctcttgtcattcctgtagatggtcttcaccttgaagtcgatgcctactgt
                  Spotted gar  cccagatctgcagcttgatcctcttgtcattcctgtagatggtcttcaccttgaagtcgatgcccaccgt
B D                   Lamprey  cccagatctgtagcttgatgcgcttctcgttgcgatagacggtcttcactttgaagtcgatgcccaccgt
B D                 Armadillo  ======================================================================

                        Human  gctgacgaaggcaggcgtgaacgagtc
                        Chimp  gctgacgaaggcaggcgtgaacgagtc
                      Gorilla  gctgacgaaagcaggcgtgaacgagtc
                    Orangutan  gctgacgaaggcaggcgtgaacgagtc
                       Gibbon  gctgacgaaggcaggcgtgaacgagtc
                       Rhesus  gctgacgaaggcaggcgtgaacgagtc
          Crab-eating macaque  gctgacgaaggcaggcgtgaacgagtc
                       Baboon  gctgacgaaggcaggcgtgaacgagtc
                 Green monkey  gctgacgaaggcaggcgtgaacgagtc
                     Marmoset  gctgacgaaggcaggggtgaacgagtc
              Squirrel monkey  gctgacgaaggcaggggtgaacgagtc
                     Bushbaby  gctgacaaaggcaggtgtgaaggagtc
           Chinese tree shrew  gctgacgaaggcgggcgtgaaggagtc
                     Squirrel  gctgacgaaggcgggtgtgaaggagtc
       Lesser Egyptian jerboa  gctgacaaaggcaggtgtgaaggagtc
                 Prairie vole  gctgacaaaggctggcgtgaaggagtc
              Chinese hamster  gctgacgaaggccggtgtgaaggagtc
               Golden hamster  gctgacgaaggccggtgtgaaggagtc
                        Mouse  gctgacaaaggctggagtgaaggagtc
                          Rat  gctgacaaaggctggagtaaaagagtc
               Naked mole-rat  gctgacgaaggcgggcgtgaaggagtc
                   Guinea pig  gctgacaaaagccggtgtgaaggaatc
                   Chinchilla  gctgacgaaggcgggcgtgaaggagtc
             Brush-tailed rat  gctgacaaaggcgggtgtgaaggagtc
                         Pika  gctgacgaaggcgggggtgaaggagtc
                          Pig  gctgacaaaggcaggcgtgaaggagtc
                       Alpaca  gctgacaaaggcaggcgtgaaggagtc
               Bactrian camel  gctgacaaaggcaggcgtgaaggagtc
                      Dolphin  gctgacaaaggcaggcgtgaaggagtc
                 Killer whale  gctgacaaaggcaggcgtgaaggagtc
             Tibetan antelope  gctgacaaaggcaggcgtgaaggagtc
                          Cow  gctgacaaaggcaggcgtgaaggagtc
                        Sheep  gctgacaaaggcaggcgtgaaggagtc
                Domestic goat  gctgacaaaggcaggcgtgaaggagtc
                        Horse  gctgacgaaggcgggggtgaaggagtc
             White rhinoceros  gctgacgaaggcgggggtgaaggagtc
                          Cat  gctgacaaaagcaggcgtgaaggaatc
                          Dog  gctgacaaaagcaggcgtgaaggaatc
                      Ferret   gctgacgaaagcaggcgtgaaggagtc
                        Panda  gctgacgaaagcaggcgtgaaggagtc
               Pacific walrus  gctgacgaaggcaggcgtgaaggaatc
                 Weddell seal  gctgacgaaagcaggcgtgaaggaatc
             Black flying-fox  gctgacaaaggcaggtgtgaaggagtc
                Big brown bat  gctgacaaaggcgggtgtgaaggagtc
         David's myotis (bat)  gctgacaaaggcgggtgtgaaggagtc
                     Microbat  gctgacaaaggcgggtgtgaaggagtc
                     Hedgehog  gctgacgaaggcgggcgtgaacgagtc
                        Shrew  gctgacgaaggcgggcgtgaaggagtc
              Star-nosed mole  gctgacaaaggcaggcgtgaaagagtc
                     Elephant  gctgacaaaggcaggcgtgaaggagtc
          Cape elephant shrew  gctgacaaaggcaggcgtgaaggagtc
                      Manatee  gctgacgaaggcaggcgtgaaggagtc
             Cape golden mole  actgacaaaagcaggcgtgaaggagtc
                       Tenrec  gctgacgaaggcgggcgtgaaggagtc
                     Aardvark  gctgacaaaggcaggcgtgaaagagtc
                      Opossum  gctgacaaaggctggggtgaatgagtc
              Tasmanian devil  gctgacaaaggctggggtgaatgaatc
                      Wallaby  gctgacaaaagctggagtgaatgagtc
                     Platypus  actgacaaaagcgggcgtgaaggagtc
                  Rock pigeon  gctgacgaaggccggggtgaaggagtc
                 Saker falcon  gctgacgaaggcgggcgtgaaggaatc
             Peregrine falcon  gctgacgaaggcgggcgtgaaggaatc
          Collared flycatcher  gctgacgaaggcgggcgtgaaggagtc
       White-throated sparrow  gctcacaaaggctggggtgaaggtgtc
          Medium ground finch  gctgacgaaggcgggcgtgaaggagtc
                  Zebra finch  gctcacaaaggctggagtgaaggtgtc
           Tibetan ground jay  gctgacgaaggcgggcgtgaaggagtc
                   Budgerigar  gctgacgaaggcgggtgtgaaggagtc
                       Parrot  gctgacgaaggcgggtgtgaaggagtc
                Scarlet macaw  gctgacgaaggcgggtgtgaaggagtc
                 Mallard duck  gctaacgaaggctggtgtaaaagtgtc
                      Chicken  gctgacgaaggccgacgtaaaagtgtc
                       Turkey  gctgacaaaggctggcgtgaaagtgtc
           American alligator  gctgacaaaggcgggtgtgaaggagtc
              Green seaturtle  gctgacgaaggcgggagtgaaggagtc
               Painted turtle  gctgacgaaggcgggagtgaaggagtc
     Chinese softshell turtle  gctgacgaaggcgggggtgaaggagtc
       Spiny softshell turtle  gctgacgaaggccgaggtgaaggagtc
                       Lizard  gctaacaaaggctgatgtgaaggagtc
                X. tropicalis  gctgacaaatgctggggtaaatgagtc
                   Coelacanth  gctgacaaatgccggtgtgaaggaatc
                    Tetraodon  gctgacgaacgtcggtgtgaaggagtc
                         Fugu  gctgacaaacgttggtgtgaaggagtc
       Yellowbelly pufferfish  gctgacaaacgttggtgtgaaggagtc
                 Nile tilapia  gctgacaaaggccggcgtgaatgagtc
          Princess of Burundi  gctgacaaaggctggcgtgaatgagtc
        Burton's mouthbreeder  gctgacaaaggctggcgtgaatgagtc
                  Zebra mbuna  gctgacaaaggctggcgtgaatgagtc
          Pundamilia nyererei  gctgacaaaggctggcgtgaatgagtc
                       Medaka  gctaacaaaagctggagtgaaggagtc
           Southern platyfish  gctgacaaacgccggcgtgaacgagtc
                  Stickleback  gctgacgaaggctggcgtgaaggagtc
                 Atlantic cod  gctgacgaaggccggcgtgaaggagtc
                    Zebrafish  gctgacaaaagcaggtgtgaaggagtc
     Mexican tetra (cavefish)  gctaacgaaagctggagtgaaggagtc
                  Spotted gar  gctgacgaacgccggcgtgaaggagtc
                      Lamprey  gctcacgaaggccgaggtaaatgactc
                    Armadillo  ===========================

Alignment block 32 of 114 in window, 18202609 - 18202739, 131 bps 
B D                     Human  gtcagcatagcggaagaggaaggacgtcttgcccacgctgctgttgccgatgatgagaatcttgaacatg
B D                     Chimp  gtcagcatagcggaagaggaaggacgtcttgcccacgctgctgttgccgatgatgagaatcttgaacatg
B D                   Gorilla  gtcagcatagcggaagaggaatgacgtcttgcccacgctgctgttgccgatgatgagaatcttgaacatg
B D                 Orangutan  gtcagcatagcggaagaggaaggacgtcttgcccacgctgctgttgccgatgatgagaatcttgaacatg
B D                    Gibbon  gtcagcataacggaagaggaaggacgtcttgcccacgctgctgttgccgatgatgagaatcttgaacatg
B D                    Rhesus  atcagcatagcggaagaggaaggacgtcttgcccacgctgctgttgccgatgatgagaatcttgaacatg
B D       Crab-eating macaque  gtcagcatagcggaagaggaaggacgtcttgcccacgctgctgttgccgatgatgagaatcttgaacatg
B D                    Baboon  gtcagcatagcggaagaggaaggacgtcttgcccacgctgctgttgccgatgatgagaatcttgaacatg
B D              Green monkey  gtcagcatagcggaagaggaaggacgtcttgcccacgctgctgttgccgatgatgagaatcttgaacatg
B D                  Marmoset  gtcggcgtagcggaagaggaaggatgtcttgcccacgctgctgttgcctatgatgagaatcttgaacatg
B D           Squirrel monkey  gtcggcgtagcggaagaggaaggacgtcttgcccacgctgctgttgccgatgatgagaatcttgaacatg
B D                  Bushbaby  gtcggcgtagcggaagaggaaggatgtcttgcccacgctgctattgccaatgataaggatcttgaacatg
           Chinese tree shrew  gtcggcgtagcggaagaggaaggacgtcttgcccacgctgctgttaccaatgatgagaatcttgaacatg
B D                  Squirrel  atccgcgtagcggaagaggaaggacgtcttgcccacgctgctgttgccaatgatgaggatcttgaacatg
       Lesser Egyptian jerboa  atctgcatagcggaagaggaaggatgtcttgcccacactgctgttgccgatgatgaggattttgaacatg
                 Prairie vole  gtcagcatagcggaaaaggaaggaggttttgcccacgctgctgtttccaatgatcaggatcttgaacata
B D           Chinese hamster  atcagcatagcggaagaggaaggaggttttgcccacgctgctgttcccaatgatcaggatcttgaacata
               Golden hamster  gtcagcatagcggaagaggaaggaggttttgcccacgctgctgttcccgatgatcaggatcttgaacata
B D                     Mouse  atctgcgtagcggaagaggaacgaggttttgcccacgctgctgttcccaatgatcaggatcttgaacata
B D                       Rat  gtctgcgtagcggaaaaggaatgaggttttgcccacactgctgttaccaatgatcaggatcttgaacata
B D            Naked mole-rat  gtcagcatagcggaagagaaaggacgtcttccccacgctgctgttgccgatgatcaggatcttgaacatg
B D                Guinea pig  atcagcgtagcggaagaggaaggatgtcttccccacgctgctgttgccgatgatcaggattttgaacatg
                   Chinchilla  gtccgcgtagcggaagaggaaggacgtcttccccacgctgctgttgccgatgatcaggatcttgaacatg
             Brush-tailed rat  gtcggcatagcggaagaggaaggacgtcttccccacactgctgttgccgatgattaggatcttgaacatg
B D                      Pika  gtcggcgtagcggaagaggaaggaggtcttccccacgctgctgttgccaatgatgaggatcttgaacatg
B D                       Pig  gtctgcatagcggaagaggaaggatgtcttgcccacactgctgtttccaatgatgaggatcttaaacatg
B D                    Alpaca  gtctgcatagcggaagaggaaggacgtcttgcccacgctgctatttccgatgatgaggatcttgaacatg
               Bactrian camel  gtctgcatagcggaagaggaaggacgtcttgcccacgctgctatttccgatgatgaggatcttgaacatg
B D                   Dolphin  gtctgcgtagcggaagaggaaagacgtcttgcccacgctgctatttccgatgatgaggatcttgaacata
                 Killer whale  gtctgcgtagcggaagaggaaagacgtcttgcccacgctgctatttccgatgatgaggatcttgaacata
             Tibetan antelope  gtctgcatagcggaagaggaaagatgtcttgcccacgctgctgtttccgatgatgaggattttgaacatg