Multiz Alignments of 30 mammals (27 primates)
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 49 in window, 3668536 - 3668726, 191 bps 
B D                     Human  gggcccagccctg-cccacagcttgactttagcctggtgaggccccgttctggggctggactcctggcct
B D                     Chimp  gggcccagccctg-cccacagcttgactttagcctggtgaggccccgttctggggctggactcctggcct
B D                    Bonobo  gggcccagccctg-cccacagcttgactttagcctggtgaggccccgttctggggctggactcctggcct
B D                   Gorilla  gggcccagccctg-cccacagcttgactttagcct-gtgaggccccgttctggggctggactcctggcct
B D                 Orangutan  gggcccagccctg-cccacagcttgactttagcctggtgaggccctgttctggggctggactcctggccc
B D                    Gibbon  gggcccagccctg-cccacagcttggctttagcctggtgaggccccgttctggggctggactcctggccc
B D                    Rhesus  gggcccagccctg-cccacagcttgactctagcccggtgaagccctgttctggggccggactcctggccc
B D       Crab-eating macaque  gggcccagccctg-cccacagcttgactctagcccggtgaggccctgttctggggccggactcctggccc
           Pig-tailed macaque  gggcccagccctg-cccacagcttgactctagcccggtgaggccctgttctggggccggactcctggccc
               Sooty mangabey  gggcccagccctg-cccacagcttgactctaggctggtgagg--ctgttctggggccggactcctggccc
                       Baboon  gggcccagccctg-cccacagcttgactctaggctggtgagg--ctgttctggggccggactcctggccc
B D              Green monkey  gggcccagccctg-cccacagcttgactctagcccggtgaggccctgttctggggctggactcctggccc
                        Drill  gggcccagccctg-cccacagcttgactctaggctggtgagg--ctgttctggggccggactcctggctc
B D          Proboscis monkey  gggcccagccctg-cccacagcttgactctagcctggtgaggccctgttctggggctggactcctggccc
              Angolan colobus  gggcccagccctg-cccacagcttgactctagcctggtgaggccctgttctggggctggactcctggccc
B D  Golden snub-nosed monkey  gggcccagcccta-cccacagcttgactctagcctggtgaggccctgttctggggctggactcctggccc
      Black snub-nosed monkey  gggcccagccctg-cccacagcttgactctagcctggtgaggccctgttctggggctggactcctggccc
B D                  Marmoset  gggcccagccctgtcccacagcttgactttagcctggtgcggccc-------------------------
B D           Squirrel monkey  gggcccagccctgtcccacagcttgactttagcctggtgaggccc---------------------gccc
          White-faced sapajou  gggaccagccctgtcccacagcttgactttagcctggtgaggccccattatgaggtcggacgccc-gccc
            Ma's night monkey  gggcccagccctatcccacagcttgactttagcttggtgaggtcccattctgaggtcggatgccc-gccc
B D                   Tarsier  -gtctcggcctca---------------ctagcccagtggggccgtg---------aggact-ctgaccc
B D                  Bushbaby  gggaccagccctg--ccacaccttgac-gtagcccactgagacccattt-------tagacttctaattc
B D                     Mouse  ======================================================================
             Sclater's lemur  ======================================================================
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
                 Black lemur  ======================================================================
B D                       Dog  ======================================================================
B D                 Armadillo  ======================================================================

                        Human  cggagccctgaggtgggaagcg--------------------------------atgtcagcgactgcag
                        Chimp  cagagccctgaggtgggaagcg--------------------------------atgtcagcgactgcag
                       Bonobo  cagagccctgaggtgggaagcg--------------------------------atgtcagcgactgcag
                      Gorilla  cggagccctgaggtgggaagcg--------------------------------acgtcagcgactgcag
                    Orangutan  cggagccctgagtggggaagcg--------------------------------atgtcggcaactgcag
                       Gibbon  cggagccctgaggtgggaagcg--------------------------------atggcggcgaccgcag
                       Rhesus  gggagccctgaggtgggaagtg--------------------------------gtgtcggtgactgcag
          Crab-eating macaque  gggagccctgaggtgggaagtg--------------------------------gtgtcggtgactgcag
           Pig-tailed macaque  gggagccctgaggtgggaagtg--------------------------------gtgtcggtgactgcag
               Sooty mangabey  tggagccctgaggtgggaagtg--------------------------------atgtcggtgactgcag
                       Baboon  tggagccctgaggcgggcagtg--------------------------------gtgtcggtgactgcag
                 Green monkey  gggagccctgaggtgggaagtg--------------------------------gtgtcggtgactgcag
                        Drill  tggagccctgaggcgggcagtg--------------------------------gtgtcggtgactgcag
             Proboscis monkey  cggagccctgaggtgggaagtg--------------------------------gtgtcagtgacagcag
              Angolan colobus  cggaggcctgaggtgggaagcg--------------------------------gtgtcggtgactgcag
     Golden snub-nosed monkey  cggagccctgaggtgggaagtg--------------------------------gtgtcagtgacagcag
      Black snub-nosed monkey  cggagccctgaggtgggaagtg--------------------------------gtgtcagtgacagcag
                     Marmoset  ---cattctgaggtcgg-----------------------------------------------------
              Squirrel monkey  cagagtcctgaggtaggaggcg--------------------------------atctcggtgactgcag
          White-faced sapajou  cagggccctgaggtaggaggcg--------------------------------atctcggtgactgcag
            Ma's night monkey  cagagccctgaggtaggagtcg--------------------------------atctcggtgactgcag
                      Tarsier  caggactatgatgcaggagtcgttca-------gggccgagtc--tggtg--ccatcccagcagctgcgg
                     Bushbaby  cagaactgtgagctgagagatgtgtgctatcttaggccaagtctgtggtgatttgtcatggcagctgcag
                        Mouse  ======================================================================
              Sclater's lemur  ======================================================================
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
                  Black lemur  ======================================================================
                          Dog  ======================================================================
                    Armadillo  ======================================================================

                        Human  ggatcgcacgtgctggcgtccaccatgc-aggcctggggaagacctgg-tctcgccctcaagg-----gg
                        Chimp  ggaacgcacgtgctggcgtccaccacgc-gggccttgggaagacctgg-tctcgccctcaagg-----gg
                       Bonobo  ggaacgcacgtgctggcgtccaccacgc-gggccttgggaagacctgg-tctcgccctcaagg-----gg
                      Gorilla  ggaacgcacgtgctggcgtccaccacgt-gggcctggggaagacctgg-tctcgccctcaagg-----gg
                    Orangutan  ggaacgcacgcgctggcgtccaccacgc-ggacgtggggaagacctgg-tctcaccctcaagg-----gg
                       Gibbon  ggaacgcacgtgctggcgtccaccacgc-gggcctggggaagacctgg-tctcgccctcaagg-----gg
                       Rhesus  ggagcgcacgcactggcatccaccacgc-gggccctgggcagacctgg-cctcgccctcaagg-----gg
          Crab-eating macaque  ggagcgcacgcactggcatccaccacgc-gggccctgggcagacctgg-cctcgccctcaagg-----gg
           Pig-tailed macaque  ggagcgcacgcactggcatccaccacgc-gggccctgggcagacctgg-cctcgccctcaagg-----gg
               Sooty mangabey  ggagagcacgcactggcatccaccacgc-gggccctgggcagacctgg-cctcgccctcaagg-----gg
                       Baboon  ggagcgcacgcactggcatccaccacgc-gggccctgagcagacctgg-cctcgccctcaagg-----gg
                 Green monkey  ggagcgcatgcactggcgtccactacgc-gggccctgggcagacctgg-cctcgccctcaagg-----gg
                        Drill  ggagcgcacgcactggcatccaccacgc-gggccctgggcagacctgg-cctcgccctcaagg-----gg
             Proboscis monkey  ggagcaaacgcacgagcgtccaccacgc-gggccctgggcagacctgg-cctcgccctcaagg-----gg
              Angolan colobus  ggaacgcacgcacgggcgaccaccatgc-gggccctggggagacccgg-cctcgccctccagg-----gg
     Golden snub-nosed monkey  ggagcgcacgcacgggcgtccaccacgc-gggccctgggcaaacctgg-cctcgccctcaagg-----gg
      Black snub-nosed monkey  ggagcgcacgcacgggcgtccaccacgc-gggccctgggcaaacctgg-cctcgccctcaagg-----gg
                     Marmoset  ---atgcccgccctggagcccaccacgt-gggaccgggccagacccgg-tttcaccctcaagg-----gg
              Squirrel monkey  ggaacgcacacgctggcgtccaccacgt-gggaccgggccagacctgg-tttcaccctcaagg-----gg
          White-faced sapajou  ggaacgcacaccccggcatccaccacgt-gggacggggccagacctgg-tttcaccctcaagg-----gg
            Ma's night monkey  ggaacgcacatgctggtgtccaccatgt-gggaccaggccagacccgg-tttcaccctcaagg-----gg
                      Tarsier  ggaacgtgtgcactggcgcccaccatgtggggaccaggacacaccctg-catccccctc-----------
                     Bushbaby  ggctcaaat-tgtgggtatccac---ac-----------tagacctggtccccgttcttgaagagagtgg
                        Mouse  ======================================================================
              Sclater's lemur  ======================================================================
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
                  Black lemur  ======================================================================
                          Dog  ======================================================================
                    Armadillo  ======================================================================

                        Human  ctcacggtcaacaggggtggg
                        Chimp  ctcacggtcaacaggggtggg
                       Bonobo  ctcatggtcaacaggggtggg
                      Gorilla  ctcacggtcaacaggggtggg
                    Orangutan  ctcacagtcaacaggggtggg
                       Gibbon  ctcacggccaacaggggtggg
                       Rhesus  ctcacggtccacaggggtggg
          Crab-eating macaque  ctcacggtccacaggggtggg
           Pig-tailed macaque  ctcacggtccacaggggtggg
               Sooty mangabey  ctcacggtccacaggggtggg
                       Baboon  ctcacggtccacaggggtggg
                 Green monkey  ctcacggtccacagaggtggg
                        Drill  ctcacggtccacaggggtggg
             Proboscis monkey  ctcac---caacaggagtggg
              Angolan colobus  ctcac---caacaggggtggg
     Golden snub-nosed monkey  ctcac---caacaggagtggg
      Black snub-nosed monkey  ctcac---caacaggagtggg
                     Marmoset  ctcagagtcagcagaagtggg
              Squirrel monkey  ctcacagtcagcagaggtggg
          White-faced sapajou  ctcacagtcagcagaggttgg
            Ma's night monkey  ctcacagtcagtagaggtggg
                      Tarsier  ctcacacccagcagccgtggg
                     Bushbaby  cttagagttaatacatg----
                        Mouse  =====================
              Sclater's lemur  =====================
                  Mouse lemur  =====================
            Coquerel's sifaka  =====================
                  Black lemur  =====================
                          Dog  =====================
                    Armadillo  =====================

Inserts between block 1 and 2 in window
B D                  Tarsier 378bp

Alignment block 2 of 49 in window, 3668727 - 3668907, 181 bps 
B D                     Human  cgcagggctgggtgtttgatgtggggtgacaggcggggtgcggatcagcaagggggggcttccctgggct
B D                     Chimp  cgcagggctgggtgtttgatgtggggtgacaggcggggtgcggatcagcaa-ggggggcttccctgggcc
B D                    Bonobo  cacagggctgggtgtttgatgtggggtgacaggcggggtgcggatcagcaa-ggggggcttccctgggcc
B D                   Gorilla  cgcagggctgggtgtttgatgtggggtgacaggcggggtgcggatcagcaa-ggggggcttccctgggct
B D                 Orangutan  cgcaggcctgggtgtttgatgtggggtgacaggcggggtgcggatcagcaa-ggggggtttccctgggct
B D                    Gibbon  cgcagggctgggtgtttgatgtggggtgacaggc-gggtgcggatcagcaa--gggggcttccctgggct
B D                    Rhesus  cgcagggctaggtgtttgatgtggggtgacaggtggggtgcggatcagcaa-gggaggcttccctgggct
B D       Crab-eating macaque  cgcagggctaggtgtttgatgtggggtgacaggtggggtgcggatcagcaa-gggaggcttccctgggct
           Pig-tailed macaque  cgcagggctaggtgtttgatgtggggtgacaggtggggtgcggatcagcaa-gggaggcttccctgggct
               Sooty mangabey  cgcagggctaggtgtttgatgtggggtgacaggtggggtgcggatcagcaa-gggaggcttccctgggct
                       Baboon  cgcagggctaggtgtttgatgtggggtgacaggtggggtgcggatcagcaa-gggaggcttccctgggct
B D              Green monkey  cacagggctaggtgtttgatgtggggtgacaggtggggtgcggatcagcaa-gggaggcttccctgggct
                        Drill  cgcagggctaggtgtttgatgtggggtgacaggtggggtgcggattagcaa-gggaggcttccctgggct
B D          Proboscis monkey  tgcagggctaggtgttagatgtggggtgacaggtggggtgcagatcagcaa-gggaggttttcctgggct
              Angolan colobus  cgcagggctaggtgttagatgtggggtgacaggtggggtgcggatcagcaa-gggaggcttccctgggcc
B D  Golden snub-nosed monkey  tgcagggctaggtgttaaatgtggggtgacaggtggggtgcagatcagcaa-gggaggtttccctgggct
      Black snub-nosed monkey  tgcagggctaggtgttaaatgtggggtgacaggtggggtgcagatcagcaa-gggaggtttccctgggct
B D                  Marmoset  cgcagggccaggtgcttgatgtagggcgacaggcggggtgtggatcagcaa-gggaggctt-cct-gaca
B D           Squirrel monkey  cacagggccaggtgcttgatgtggggtgacaggtggggtgtggatcagcaa-gggaggctt-cctggaca
          White-faced sapajou  cacatggccaggtgcttgatgtggggtgacaggtagggtgcggatcagcaa-gagaggctt-cctggaca
            Ma's night monkey  tgcagggccaggtgcttgatgtggggtgacaggtggggtgtggatcagcaa-gggaggctt-cctggaca
B D                  Bushbaby  ----------------------------------ggggtacagattggcaa-ggtgag------tggac-
B D                     Mouse  ======================================================================
             Sclater's lemur  ======================================================================
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
                 Black lemur  ======================================================================
B D                   Tarsier  ======================================================================
B D                       Dog  ======================================================================
B D                 Armadillo  ======================================================================

                        Human  ggtcctgtctgagctcagtgccgaacaaggatgc------------------------cg-tgggagccg
                        Chimp  ggtcttgtctgagctcagtgccaaacaaggatgc------------------------cg-tgggagcca
                       Bonobo  ggtcttgtctgagctcagtgccaaacaaggatgc------------------------cg-tgggagcca
                      Gorilla  ggtcctgtctgagctcagtgccgaacaaggatgc------------------------cg-tgggagccg
                    Orangutan  ggtcatgtctgagctcagtgccgaacaaggatgc------------------------cg-tggcagcgg
                       Gibbon  ggtcgtgtctgagctcagtgccgaacaacgatgcctgggggttccagggagggaacggcg-tgggagcag
                       Rhesus  ggtcgtgtctgagctcagtgccgaacaaggatgc------------------------cg-ggggagcgg
          Crab-eating macaque  ggtcgtgtctgagctcagtgccgaacaaggatgc------------------------cg-ggggagcgg
           Pig-tailed macaque  ggtcgtgtctgagctcagtgccgaacaaggatgc------------------------cg-ggggagcgg
               Sooty mangabey  ggtcgtgtctgagctcagtgccgaacaaggatgc------------------------cg-ggggagcgg
                       Baboon  ggtcgtgtctaagctcagtgccgaacaaggatgc------------------------cg-ggggagcag
                 Green monkey  ggtcgtgtctgagctcagtgccgaacaaggatgc------------------------cg-ggagagcgg
                        Drill  ggtcgtgtctgagctcagtgccgaacaaggatgc------------------------cg-ggggagcgg
             Proboscis monkey  ggtcgtgtctgagctcagcgccgaacaaggatgt------------------------cg-ggggagcag
              Angolan colobus  ggccgtgtctgagctcagtgccgaacaaggatgc------------------------cg-ggggagcag
     Golden snub-nosed monkey  ggtcgtgtctgagctcagtgccgaacaaggatgt------------------------cg-ggggagcag
      Black snub-nosed monkey  ggtcgtgtctgagctcagtgccgaacaaggatgt------------------------cg-ggggagcag
                     Marmoset  ggtcgggtctgggctcggtacagaacaaagacgc------------------------ggtggggagcgg
              Squirrel monkey  ggttgtgtctgggctcagtgcagaacaaagatgc------------------------agtggggagcgg
          White-faced sapajou  ggtcgtgtctgggctcagtgcagaacaaaggcgc------------------------agtggggcgcgg
            Ma's night monkey  ggtcgtgtctgggctcattgcagaacaaagacgc------------------------agtggggagcgg
                     Bushbaby  ------atctgagctcagtctgggatgaag----------------------------ag-gagcagggg
                        Mouse  ======================================================================
              Sclater's lemur  ======================================================================
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
                  Black lemur  ======================================================================
                      Tarsier  ======================================================================
                          Dog  ======================================================================
                    Armadillo  ======================================================================

                        Human  gagggagttccaggcggagggaacg---gcagcacaaaggtc--acaaggtggctgaggcagccac---g
                        Chimp  gagggagttccaggcggagggaacg---gcagcacaaaagtc--aggaggtggctgaggcggccac---g
                       Bonobo  gagggagttccaggcggagggaacg---gcagcacaaaggtc--aggaggtggctgaggcagccac---g
                      Gorilla  gagggagttccaggcggagcgaacg---gtggcacaaaggtc--acgaggtggctgaggcagccac---g
                    Orangutan  gagggagctccaggcggagggaacg---gcagcacaaaggtc--acgaggtggctgaggcggccacgctg
                       Gibbon  cagggagttccaggcg---------------gcgcaaaggtc--acgaggtggctgaggcggccgcgctg
                       Rhesus  gaggga--tccaggggtagggagcc---gcggcgcaaaggtc--acacggtggctgaggcggccgcgctg
          Crab-eating macaque  gaggga--tccaggcggagggagcc---gcggcgcaaaggtc--acacggtggctgaggcggccgcgctg
           Pig-tailed macaque  gaggga--tccaggcggagggagcc---gcggcgcaaaggtc--acacggtggctgaggcggccgcgctg
               Sooty mangabey  gaggga--tccaggcggagggagcc---gcggcgcaaaggtc--acacggtggctgaggcggccacgctg
                       Baboon  gaggga--tccaggcggagggagcc---gcggtgcaaaggtc--acacggtggctgaggcggccacgctg
                 Green monkey  gaggga--tccaggcggagggagcc---gcggcgcaaaggtc--acacggtggctgaggcggcctcgctg
                        Drill  gaggga--tccaggcggagggagcc---gcggcgcaaaggtc--acacggtggctgaggcggccacgctg
             Proboscis monkey  gaggga--tccaggcagagagagcc---gcggcgcaaaggtc--acggggtggctgaggc-gccgcgcgg
              Angolan colobus  gaggga--tccgggcagagggagcc---ccggcgcaaaggtc--acggggtggctgaggc-gccgcgcgg
     Golden snub-nosed monkey  gaggga--tccaggcagagggagcc---gcggcgcaaaggtc--acggggtggctgaggc-gccacgcgg
      Black snub-nosed monkey  gaggga--tccaggcagagggagcc---gcggcgcaaaggtc--acggggtggctgaggc-gccacgcgg
                     Marmoset  gaggcg----------------------gcggcccaaaggtc--acga-ggggctgaggca--------g
              Squirrel monkey  gagggagttccaggcccagggaacagc-gcggcacaaaggtc--acaagggggctgaggccacggt---g
          White-faced sapajou  gagggagttccaggcccagggaacagcagcggcacgaaggtc--acga-ggggctgaggcagcggc---g
            Ma's night monkey  gagggagttccaggcccaggga------acggcacaaaggtc--acgagggggctgaggcggcggc---g
                     Bushbaby  gagggagcttcagggagaggacagc----cagagcaaaggtcctacaggcaggatgaaaccactgtgctt
                        Mouse  ======================================================================
              Sclater's lemur  ======================================================================
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
                  Black lemur  ======================================================================
                      Tarsier  ======================================================================
                          Dog  ======================================================================
                    Armadillo  ======================================================================

                        Human  ctgc
                        Chimp  ctgc
                       Bonobo  ctgc
                      Gorilla  ctgc
                    Orangutan  ctgc
                       Gibbon  ctgc
                       Rhesus  ctgc
          Crab-eating macaque  ctgc
           Pig-tailed macaque  ctgc
               Sooty mangabey  ctgc
                       Baboon  ctgc
                 Green monkey  ctgc
                        Drill  ctgc
             Proboscis monkey  ctgc
              Angolan colobus  ctgc
     Golden snub-nosed monkey  ctgc
      Black snub-nosed monkey  ctgc
                     Marmoset  ctgc
              Squirrel monkey  ctgc
          White-faced sapajou  ctgc
            Ma's night monkey  ctgc
                     Bushbaby  ctgt
                        Mouse  ====
              Sclater's lemur  ====
                  Mouse lemur  ====
            Coquerel's sifaka  ====
                  Black lemur  ====
                      Tarsier  ====
                          Dog  ====
                    Armadillo  ====

Inserts between block 2 and 3 in window
B D                 Marmoset 3bp
B D          Squirrel monkey 3bp
         White-faced sapajou 62bp
           Ma's night monkey 3bp

Alignment block 3 of 49 in window, 3668908 - 3668969, 62 bps 
B D                     Human  ------acggataacagcagcgtcctcca-ggctca-tgcagaggcgggt--accg-aaggggagt-gcc
B D                     Chimp  ------acggatcacagcagcgtcctcca-ggctca-tgcagaggcgggt--accg-aaggggagt-gcc
B D                    Bonobo  ------acggatcacagcagcgtcctcca-ggctca-tgcagaggcgggt--acca-aaggggagt-gcc
B D                   Gorilla  ------acggatcacagcagcgtcctcca-ggctca-tgcagaggcgggt--accg-aaggggagt-gcc
B D                 Orangutan  ------acggatcacagcagcgtcctcca-ggctca-cacagaggcggct--gccg-aaggggagc-gcc
B D                    Gibbon  ------acggatcacagcagcgtcctcca-ggctca-cgcagaggcagct--gccg-aaggggagc-gcc
B D                    Rhesus  ------acggatcacagcagcgtcctcca-ggctca-cacagaggcggct--gccg-aaggggagc-gcc
B D       Crab-eating macaque  ------acggatcacagcagcgtcctcca-ggctca-cacagaggcggct--gccg-aaggggagc-gcc
           Pig-tailed macaque  ------acggatcacagcagcgttctcca-ggctca-tacagaggcggct--gccg-aaggggagc-tcc
               Sooty mangabey  ------acggatcacagcagcgttctcca-ggctca-cgcagaggcggcctggccgaaaggggagtggcc
                       Baboon  ------atggatcacagcagcgttctcca-ggctca-cgcagaggcggct--gccg-aaggggagc-gcc
B D              Green monkey  ------acggatcacagcagcgttctcca-ggctca-cgcagaggcggct--gcct-aaggggagc-gcc
                        Drill  ------acggatcacagcagcgttctcca-ggctca-cacagaggcggct--gccg-aaggggagc-gcc
B D          Proboscis monkey  ------acggatcacagcagcgttctcca-ggctca-cgcagaggc-gct--gccg-aaggggagc-gcc
              Angolan colobus  ------acggatcacagcagcgttctcca-ggctca-cgtggaggcagct--gccg-aaggggagc-gtc
B D  Golden snub-nosed monkey  ------acggatcacagcagcgttctcca-ggctca-cgcagaggcggct--gccg-aaggggagc-gcc
      Black snub-nosed monkey  ------acggatcacagcagcgttct---------a-cgcagaggcggct--gccg-aaggggagc-gcc
B D                  Marmoset  ------acgggataca-cagcatccccca-ggctca-cgtgaaggcagcc--ggcg-aaggggagc-gac
B D           Squirrel monkey  ------acgggtcaca-cagcatcctcca-ggctca--gtgaaggccg-c--agca-agggag----gac
            Ma's night monkey  ------acgggttaca-cagcatcctcca-ggctca-cctgaaggcagcc--ggcg-aagggaagc-gac
B D                  Bushbaby  atggaagaagaaaatggcaatgttgtttagggctcagtacagaagctgct--ggtg-acggagaga-atc
B D                     Mouse  ======================================================================
             Sclater's lemur  ======================================================================
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
                 Black lemur  ======================================================================
B D                   Tarsier  ======================================================================
B D                       Dog  ======================================================================
B D                 Armadillo  ======================================================================
         White-faced sapajou  ======================================================================

                        Human  tccc
                        Chimp  tccc
                       Bonobo  tccc
                      Gorilla  tccc
                    Orangutan  tccc
                       Gibbon  tccc
                       Rhesus  tccc
          Crab-eating macaque  tccc
           Pig-tailed macaque  tccc
               Sooty mangabey  tccc
                       Baboon  tccc
                 Green monkey  tccc
                        Drill  tccc
             Proboscis monkey  tccc
              Angolan colobus  tcct
     Golden snub-nosed monkey  tccc
      Black snub-nosed monkey  tccc
                     Marmoset  tccc
              Squirrel monkey  tccc
            Ma's night monkey  tccc
                     Bushbaby  tccc
                        Mouse  ====
              Sclater's lemur  ====
                  Mouse lemur  ====
            Coquerel's sifaka  ====
                  Black lemur  ====
                      Tarsier  ====
                          Dog  ====
                    Armadillo  ====
          White-faced sapajou  ====

Alignment block 4 of 49 in window, 3668970 - 3669007, 38 bps 
B D                     Human  tgtt-gg-attccgatgctggcaccacccagggcccaggg
B D                     Chimp  tgtt-gg-attccgatgctggcaccacccggggcccaggg
B D                    Bonobo  tgtt-gg-attccgatgctggcaccacccggggcccaggg
B D                   Gorilla  tgtt-gg-attccgatgctggcaccacccggggcccaggg
B D                 Orangutan  tgtt-gg-attccgatgctggcatcacccggggcccaagg
B D                    Gibbon  tgtt-gg-attccgatgctggcaccacctggggcccaggg
B D                    Rhesus  tgtt-gg-attccaacgctggcaccacccggggccca-gg
B D       Crab-eating macaque  tgtt-gg-attccaacgctggcaccacccggggccca-gg
           Pig-tailed macaque  tgtt-gg-attccaacgctggcaccacccggggccca-gg
               Sooty mangabey  tgttcgg-attccaaggctggca-cacccggggccca-gg
                       Baboon  tgtt-gg-attccaatgctggcaccacccggggccca-gg
B D              Green monkey  tgtt-gg-attccaacgctggcaccacccggggccca-gg
                        Drill  tgtt-gg-attccaacgctggcaccacccggggccca-gg
B D          Proboscis monkey  tgtt-gg-attccaacactggcacca-ccgggaccca-gg
              Angolan colobus  tgtt-gg-attccaacgctggcacca-ccggggccca-gg
B D  Golden snub-nosed monkey  tgtt-gg-attccaacactggcacca-ccggggccca-gg
      Black snub-nosed monkey  tgtt-gg-attccaacactggcacca-ccggggccca-gg
B D                  Marmoset  tgtg-ag-attccgatgctggcaccacccggggccca-gg
B D           Squirrel monkey  tgtg-ag-attccgatgctggcaccacccggggccca-gg
          White-faced sapajou  tgcg-ag-attccgatgctggcaccacccagggccca-gg
            Ma's night monkey  tgtg-ag-attccgatgctggcaccacccggggccca-gg
B D                  Bushbaby  tgtt-ggcattacaatggcagcatcatccaggcattgtgg
B D                     Mouse  ========================================
             Sclater's lemur  ========================================
                 Mouse lemur  ========================================
           Coquerel's sifaka  ========================================
                 Black lemur  ========================================
B D                   Tarsier  ========================================
B D                       Dog  ========================================
B D                 Armadillo  ========================================

Inserts between block 4 and 5 in window
         White-faced sapajou 47bp
           Ma's night monkey 196bp

Alignment block 5 of 49 in window, 3669008 - 3669022, 15 bps 
B D                     Human  gcatggag--------------acaaatg---------------------
B D                     Chimp  gcatggag--------------acaaatg---------------------
B D                    Bonobo  gcatggag--------------acaaatg---------------------
B D                   Gorilla  gcatggag--------------acaaatg---------------------
B D                 Orangutan  gcatggag--------------acaaatg---------------------
B D                    Gibbon  gcatggag--------------acaaatg---------------------
B D                    Rhesus  gcatggag--------------acaaatg---------------------
B D       Crab-eating macaque  gcatggag--------------acaaatg---------------------
           Pig-tailed macaque  gcatggag--------------acaaatg---------------------
               Sooty mangabey  gcatggag--------------acaaatg---------------------
                       Baboon  gcatggag--------------acaaatg---------------------
B D              Green monkey  gcatggag--------------acaaatg---------------------
                        Drill  gcatggag--------------acaaatg---------------------
B D          Proboscis monkey  gcatggag--------------acaaatg---------------------
              Angolan colobus  gcatggag--------------acaaatg---------------------
B D  Golden snub-nosed monkey  gcatggag--------------acaaatg---------------------
      Black snub-nosed monkey  gcatggag--------------acaaatg---------------------
B D                  Marmoset  gcatggac--------------acaaatt---------------------
B D           Squirrel monkey  gcatggac--------------acagatt---------------------
B D                  Bushbaby  gcacagaggggctggcaacagtgcaaagctgacagtgccagggatttatt
B D                     Mouse  ==================================================
             Sclater's lemur  ==================================================
                 Mouse lemur  ==================================================
           Coquerel's sifaka  ==================================================
                 Black lemur  ==================================================
B D                   Tarsier  ==================================================
B D                       Dog  ==================================================
B D                 Armadillo  ==================================================
           Ma's night monkey  ==================================================
         White-faced sapajou  ==================================================

Inserts between block 5 and 6 in window
B D                   Rhesus 12bp
              Sooty mangabey 73bp

Alignment block 6 of 49 in window, 3669023 - 3669034, 12 bps 
B D                     Human  cttcttttcaat
B D                     Chimp  cttcttttcaat
B D                    Bonobo  cttcttttcaat
B D                   Gorilla  cttcttttcaat
B D                 Orangutan  cttcttttcaat
B D                    Gibbon  cttcttttcaat
B D       Crab-eating macaque  --tgtcttgaat
           Pig-tailed macaque  --tgtcttgaat
                       Baboon  --tgtcttgaat
B D              Green monkey  --tgtcttgaat
                        Drill  --tgtcttgaat
B D          Proboscis monkey  --tgtcttgaat
              Angolan colobus  --tgtcttgaat
B D  Golden snub-nosed monkey  --tgtcttgaat
      Black snub-nosed monkey  --tgtcttgaat
B D                  Marmoset  --ctttttcagc
B D           Squirrel monkey  --c--tttcagt
B D                  Bushbaby  ctgttcttcctt
B D                     Mouse  ============
             Sclater's lemur  ============
                 Mouse lemur  ============
           Coquerel's sifaka  ============
                 Black lemur  ============
B D                   Tarsier  ============
B D                    Rhesus  ============
B D                       Dog  ============
B D                 Armadillo  ============
           Ma's night monkey  ============
         White-faced sapajou  ============
              Sooty mangabey  ============

Inserts between block 6 and 7 in window
B D      Crab-eating macaque 2bp
          Pig-tailed macaque 2bp
                      Baboon 2bp
B D             Green monkey 2bp
                       Drill 2bp
B D         Proboscis monkey 2bp
             Angolan colobus 2bp
B D Golden snub-nosed monkey 2bp
     Black snub-nosed monkey 2bp
B D                 Marmoset 2bp
B D          Squirrel monkey 2bp

Alignment block 7 of 49 in window, 3669035 - 3669072, 38 bps 
B D                     Human  cac--ag------gggctgtgggtcaggg------------ctgactccaccc--------cagct
B D                     Chimp  cac--ag------gggctgtgggtcaggg------------ctgactccaccc--------cagct
B D                    Bonobo  cac--ag------gggctgtgggtcaggg------------ctgactccaccc--------cagct
B D                   Gorilla  cacatag------ggtctgtggg-caggg------------ctgactccaccc--------cagct
B D                 Orangutan  cacacag------gggctgtgggtcaggg------------ctgactccgccc--------cagcg
B D                    Gibbon  cacatag------gggctgtgggtcaggg------------ctgactccaccc--------cagcg
B D                    Rhesus  cac--ag------gggctgtggggcaggg------------ccgactccgccc--------cagca
B D       Crab-eating macaque  cac--ag------gggctgtggggcaggg------------ccgactccgccc--------cagca
           Pig-tailed macaque  cac--ag------gggctgtggggcaggg------------ccgactccgccc--------cagca
                       Baboon  cac--ag------gggctgtggggcaggg------------ctgactccgccc--------cagca
B D              Green monkey  cac--ag------ggcctgtggggcaggg------------ccgactccgccc--------cagca
                        Drill  cac--ag------gggctgtggggcaggg------------ccgactccgccc--------cagca
B D          Proboscis monkey  cac--ag------gggctgtggggcaggg------------ccgactccaccc--------cagca
              Angolan colobus  cac--ag------gggctgtggggcaggg------------ccgactccgccc--------cagca
B D  Golden snub-nosed monkey  cac--ag------gggctgtggggcaggg------------ccgactccaccc--------cagca
      Black snub-nosed monkey  cac--ag------gggctgtggggcaggg------------ccgactccaccc--------cagca
B D                  Marmoset  cac--ag------tga--------------------------------------------------
B D           Squirrel monkey  cac--gg------tgatgggggg----------------------------cc--------cagcg
B D                  Bushbaby  cac--agacgagaagacaacaggtcagagtgatgtggaattctgaccatgccctctggtcatggcc
B D                     Mouse  ==================================================================
             Sclater's lemur  ==================================================================
                 Mouse lemur  ==================================================================
           Coquerel's sifaka  ==================================================================
                 Black lemur  ==================================================================
B D                   Tarsier  ==================================================================
B D                       Dog  ==================================================================
B D                 Armadillo  ==================================================================
           Ma's night monkey  ==================================================================
         White-faced sapajou  ==================================================================
              Sooty mangabey  ==================================================================

Alignment block 8 of 49 in window, 3669073 - 3669102, 30 bps 
B D                     Human  ctgccagcatcttctcactccattccccct---------
B D                     Chimp  ctgccagcatcttctcactccattccccct---------
B D                    Bonobo  ctgccagcatcttctcactccattccccct---------
B D                   Gorilla  ctgccagcatcttctcactccattccccct---------
B D                 Orangutan  ctgccagcatcttctcactccattccccct---------
B D                    Gibbon  ctgccagcatcttctcactccattccccct---------
B D                    Rhesus  ctgcctgtaccttctcactcccttccccag---------
B D       Crab-eating macaque  ctgcctgtaccttctcactcccttccccag---------
           Pig-tailed macaque  ctgcctgtaccttctcactcccttccccag---------
                       Baboon  ctgcctgtaccttctcactccattccccag---------
B D              Green monkey  ctgcctgtaccttctcactccattccccag---------
                        Drill  ctgcctgtaccttctcactccattccccac---------
B D          Proboscis monkey  ctgcctgtaccttctcactccattccccag---------
              Angolan colobus  ctgcctgtaccttctcactccactccccgg---------
B D  Golden snub-nosed monkey  ctgcctgtaccttctcactccattccccag---------
      Black snub-nosed monkey  ctgcctgtaccttctcactccattccccag---------
B D                  Marmoset  -tgccagcctcttctcactccattctccct---------
B D           Squirrel monkey  ctgccagcctcttctcattccatcctccct---------
          White-faced sapajou  ctgccagcctcttctcactctattctcccc---------
B D                  Bushbaby  ttgc-----tcacctcactgggtaccccaaggctctact
B D                     Mouse  =======================================
             Sclater's lemur  =======================================
                 Mouse lemur  =======================================
           Coquerel's sifaka  =======================================
                 Black lemur  =======================================
B D                   Tarsier  =======================================
B D                       Dog  =======================================
B D                 Armadillo  =======================================
           Ma's night monkey  =======================================
              Sooty mangabey  =======================================

Alignment block 9 of 49 in window, 3669103 - 3669112, 10 bps 
B D                     Human  tcctagag--ga
B D                     Chimp  tcctagag--ga
B D                    Bonobo  tcctagag--ga
B D                   Gorilla  tcctagag--ga
B D                 Orangutan  tcctagag--ga
B D                    Gibbon  tcctagag--ga
B D                    Rhesus  tcctagag--ga
B D       Crab-eating macaque  tcctagag--ga
           Pig-tailed macaque  tcctagag--ga
               Sooty mangabey  tcctagag--ga
                       Baboon  tcctagag--ga
B D              Green monkey  tcctagag--ga
                        Drill  tcctagag--ga
B D          Proboscis monkey  tcctagag--ga
              Angolan colobus  tcctacag--ga
B D  Golden snub-nosed monkey  tcctagag--ga
      Black snub-nosed monkey  tcctagag--ga
B D                  Marmoset  tcctagag----
B D           Squirrel monkey  ccctagag----
          White-faced sapajou  tcttagagga--
B D                  Bushbaby  cccaacac--tg
B D                     Mouse  ============
             Sclater's lemur  ============
                 Mouse lemur  ============
           Coquerel's sifaka  ============
                 Black lemur  ============
B D                   Tarsier  ============
B D                       Dog  ============
B D                 Armadillo  ============
           Ma's night monkey  ============

Inserts between block 9 and 10 in window
         White-faced sapajou 108bp

Alignment block 10 of 49 in window, 3669113 - 3669134, 22 bps 
B D                     Human  agaggctgagggttggggaagg
B D                     Chimp  agaggctgagggttggggaagg
B D                    Bonobo  agaggctgagggttggggaagg
B D                   Gorilla  agaggctcagggttggggaagg
B D                 Orangutan  agaggctgagggttggggaagg
B D                    Gibbon  agaggctgagggttggggaagg
B D                    Rhesus  acaggctgagggtcggggaagg
B D       Crab-eating macaque  acaggctgagggtcggggaagg
           Pig-tailed macaque  acaggctgagggtcggggaagg
               Sooty mangabey  acaggctgagggtctgggaagg
                       Baboon  acaggctgagggtcggggaagg
B D              Green monkey  acaggctgagggtcggggaagg
                        Drill  acaggctgagggtcggggaagg
B D          Proboscis monkey  acaggctgagggtcggggaagg
              Angolan colobus  acaggctgagggtcggggaagg
B D  Golden snub-nosed monkey  acaggctgagggtcggggaagg
      Black snub-nosed monkey  acaggctgagggtcggggaagg
B D                  Marmoset  -gaggctgagggtcagg--agg
B D           Squirrel monkey  -gaggctgagggtcggg--agg
B D                  Bushbaby  tggggctaggtgttcgggcagg
B D                     Mouse  ======================
             Sclater's lemur  ======================
                 Mouse lemur  ======================
           Coquerel's sifaka  ======================
                 Black lemur  ======================
B D                   Tarsier  ======================
B D                       Dog  ======================
B D                 Armadillo  ======================
           Ma's night monkey  ======================
         White-faced sapajou  ======================

Inserts between block 10 and 11 in window
B D                 Bushbaby 44bp

Alignment block 11 of 49 in window, 3669135 - 3669142, 8 bps 
B D                     Human  gagggct-------g
B D                     Chimp  gaggggc-------g
B D                    Bonobo  gaggggc-------g
B D                   Gorilla  gaggggt-------g
B D                 Orangutan  gagggct-------g
B D                    Gibbon  gagggct-------g
B D       Crab-eating macaque  gagggct-------g
           Pig-tailed macaque  gagggct-------g
               Sooty mangabey  gagggct-------g
                       Baboon  gagggct-------g
B D              Green monkey  gagggct-------g
                        Drill  gagggct-------g
B D          Proboscis monkey  gagggct-------g
              Angolan colobus  gagggccggccaagg
B D  Golden snub-nosed monkey  gagggct-------g
      Black snub-nosed monkey  gaggcct-------g
B D                  Marmoset  tgaggct-------g
B D           Squirrel monkey  tgaggct-------g
B D                     Mouse  ===============
             Sclater's lemur  ===============
                 Mouse lemur  ===============
           Coquerel's sifaka  ===============
                 Black lemur  ===============
B D                   Tarsier  ===============
B D                    Rhesus  ---------------
B D                       Dog  ===============
B D                 Armadillo  ===============
B D                  Bushbaby  ===============
           Ma's night monkey  ===============
         White-faced sapajou  ===============

Inserts between block 11 and 12 in window
              Sooty mangabey 382bp

Alignment block 12 of 49 in window, 3669143 - 3669170, 28 bps 
B D                     Human  gctgaggtctggcagctgggggtgctgg
B D                     Chimp  gccgaggtcttgcagctgggggtgctgg
B D                    Bonobo  gccgaggtcttgcagctggggatgctgg
B D                   Gorilla  gccgaggtcttgcagctgggggtgctgg
B D                 Orangutan  gccgaggtcttgcagctgggggtgctgg
B D                    Gibbon  gccgaggtcttgcagctgggggtgctgg
B D                    Rhesus  --------------------------ga
B D       Crab-eating macaque  gccaaggtcctgcagccgggggtgctga
           Pig-tailed macaque  gccaaggtcctgcagccgggggtgctga
                       Baboon  gccaaggtcctgcagctgggggtgctga
B D              Green monkey  gccaaggtcctgcagctggaggtgctga
                        Drill  gccaaggtcctgcagccgggggtgctga
B D          Proboscis monkey  gccaaggtcctgcagccgggggtgctga
              Angolan colobus  gccaaggtcctgcagccgggggtgctga
B D  Golden snub-nosed monkey  gccaaggtcctgcagccgggggtgctga
      Black snub-nosed monkey  gccaaggtcctgcagccgggggtgctga
B D                  Marmoset  ac--aagtcttccaggtggggc-gcggg
B D           Squirrel monkey  acggaagtcttccagctgggga-gcggg
B D                     Mouse  ============================
             Sclater's lemur  ============================
                 Mouse lemur  ============================
           Coquerel's sifaka  ============================
                 Black lemur  ============================
B D                   Tarsier  ============================
B D                       Dog  ============================
B D                 Armadillo  ============================
B D                  Bushbaby  ============================
           Ma's night monkey  ============================
         White-faced sapajou  ============================
              Sooty mangabey  ============================

Alignment block 13 of 49 in window, 3669171 - 3669273, 103 bps 
B D                     Human  ggcaggccctcaaaggggattattatgagcccgtggagacactcaggctgcgccggagtgtgtgcaggag
B D                     Chimp  ggcaggccctcaaaggggattattatgagcccgtggagacactcaggctgcgccggagtgtgtgcaggag
B D                    Bonobo  ggcaggccctcaaaggggattattatgagcccgtggagacactcaggctgcgccggagtgtgtgcaggag
B D                   Gorilla  ggcagaccctcaaaggggattattatgagccagtggagacgctcaggctgcgccggactgtgtgcaggag
B D                 Orangutan  ggcaggccctcaaaggggattattaagagcccgtggagacgctcgggctgcgccggagcgtgtgcaggag
B D                    Gibbon  ggcaggccctcaaaggggattattacgagcccatggagacactcggggggcgcgggagcgtgtgcaggag
B D                    Rhesus  ggcaggccctcaaaggggattattatgagcctgtggagacgctcgggctgcgcctggatgcgggcaggag
B D       Crab-eating macaque  ggcaggccctcaaaggggattattatgagcccgtggagacgctcgggctgcgcctggatgcgggcaggag
           Pig-tailed macaque  ggcaggccctcaaaggggattattatgagcccgtggagacgctcgggctgagcctggatgcgggcaggag
                       Baboon  ggcaggccctcaaaggggattattatgagcccgtggagacgctcgggctgcgccgggatgcgggcaggag
B D              Green monkey  ggcaggccctcaaaggggattattgagagcccgtggagacgctcgggctgcgccgggatgcgggcaggag
                        Drill  ggcaggccctcaaaggggattattatgagcccgtggagacgctcgggctgcgccgggatgcaggcaggag
B D          Proboscis monkey  ggcaggccctcaaaggggattattatgagcccgtggagacgctccggctgcgctgggatgcgtgcaggag
              Angolan colobus  ggcaggccctcaaaggggattattatgagcccgtggagacgctcgggctgcgccgggatgcgtgcaggag
B D  Golden snub-nosed monkey  ggcaggccctcaaaggggattattatgagcccgtggagacgctcgggctgcgctgggatgcgtgcaggag
      Black snub-nosed monkey  ggcaggccctcaaaggggattattatgagcccgtggagacgctcgggctgcgctgggatgcgtgcaggag
B D                  Marmoset  ggcaggccctcacatgggcttattagaagccgg-------------------------------------
B D           Squirrel monkey  ggcaggctctcacacgggcttactggaagccgg-------------------------------------
B D                  Bushbaby  gccaggcattcagccaaggttac---aaacccacagagaaact--ggctctgcttggg------------
B D                     Mouse  ======================================================================
             Sclater's lemur  ======================================================================
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
                 Black lemur  ======================================================================
B D                   Tarsier  ======================================================================
B D                       Dog  ======================================================================
B D                 Armadillo  ======================================================================
           Ma's night monkey  ======================================================================
         White-faced sapajou  ======================================================================
              Sooty mangabey  ======================================================================

                        Human  ggtgcggcaggtgccctgctccgt------agggctcgg
                        Chimp  ggtgcggcacgtgccctgctccac------agggctcgg
                       Bonobo  ggtgcggcacgtgccctgctccac------agggctcgg
                      Gorilla  ggtgcggcacgtgccctgctccgt------agggctcgg
                    Orangutan  ggtgcggcacgtgccccgctccgctc-tgtagggctcgg
                       Gibbon  ggtgcggcacgtgctcagctccgt------agggctggg
                       Rhesus  ggtgtggcacgtgccctgctccgt------ggggctcgg
          Crab-eating macaque  ggtgtggcacgtgccctgctccgt------ggggctcgg
           Pig-tailed macaque  ggtgtggcacgtgccctgctccgt------ggggctcgg
                       Baboon  ggtgtggcacgtgccctgctccgt------ggggctcag
                 Green monkey  ggtgtggcacgtgccctgctccgt------ggggctcgg
                        Drill  ggtgtggcacgtgccctgctccgt------ggggctcgg
             Proboscis monkey  ggtgtggcacgtgccctgctccgt------ggggctcgg
              Angolan colobus  ggtgtggcacgtgccctgctctgt------ggggctcgg
     Golden snub-nosed monkey  ggtgtggcacgtgccctgctccgt------ggggctcgg
      Black snub-nosed monkey  ggtgtggcacgtgccctgctccgt------ggggctcgg
                     Marmoset  ---------cgtgccctgctcc-c------ggggcgcga
              Squirrel monkey  ---------cgtgccctgctcc-c------aggctgcga
                     Bushbaby  --------------cctgctccacacacgaggggcactg
                        Mouse  =======================================
              Sclater's lemur  =======================================
                  Mouse lemur  =======================================
            Coquerel's sifaka  =======================================
                  Black lemur  =======================================
                      Tarsier  =======================================
                          Dog  =======================================
                    Armadillo  =======================================
            Ma's night monkey  =======================================
          White-faced sapajou  =======================================
               Sooty mangabey  =======================================

Alignment block 14 of 49 in window, 3669274 - 3669284, 11 bps 
B D                     Human  ccctctggctg
B D                     Chimp  ccctctggctg
B D                    Bonobo  ccctctggctg
B D                   Gorilla  ccctctggctg
B D                 Orangutan  ccctctggctg
B D                    Gibbon  ccctctggctg
B D                    Rhesus  ccctctggctg
B D       Crab-eating macaque  ccctctggctg
           Pig-tailed macaque  ccctctggctg
                       Baboon  ccctctggctg
B D              Green monkey  ccctctggctg
                        Drill  ccctctggctg
B D          Proboscis monkey  ccctctggctg
              Angolan colobus  ccctctggctg
B D  Golden snub-nosed monkey  -cctctggctg
      Black snub-nosed monkey  -cctctggctg
B D                  Marmoset  ccctctggc--
B D           Squirrel monkey  ccctctggcca
          White-faced sapajou  ccctctggccg
            Ma's night monkey  ccctctggccg
B D                  Bushbaby  tcc--------
B D                     Mouse  ===========
             Sclater's lemur  ===========
                 Mouse lemur  ===========
           Coquerel's sifaka  ===========
                 Black lemur  ===========
B D                   Tarsier  ===========
B D                       Dog  ===========
B D                 Armadillo  ===========
              Sooty mangabey  ===========

Alignment block 15 of 49 in window, 3669285 - 3669308, 24 bps 
B D                     Human  cctccctgctctgggctgggcagc
B D                     Chimp  cctccctgctctgggctgggcagc
B D                    Bonobo  cctccctgctctgggctgggcagc
B D                   Gorilla  cctccctgctctgggctgggcagc
B D                 Orangutan  cctccctgctctgggctgggcagc
B D                    Gibbon  cctccctgctctgggctgggcagc
B D                    Rhesus  cctcgctgctctgggctgggcagt
B D       Crab-eating macaque  cctcgctgctctgggctgggcagt
           Pig-tailed macaque  cctcgctgctctgggctgggcagt
                       Baboon  cctcgctgctctgggctgggcagc
B D              Green monkey  cctcgctgctctgggctgggcagc
                        Drill  cctcgctgccctgggctgggcagc
B D          Proboscis monkey  cctccctgctctgggctgggcagc
              Angolan colobus  cctccctgctctgggctgggcagc
B D  Golden snub-nosed monkey  cctccctgcgctgggctgggcagc
      Black snub-nosed monkey  cctccctgcgctgggctgggcagc
B D                  Marmoset  --------------------cagc
B D           Squirrel monkey  gttccctgctctgggctgggcagc
          White-faced sapajou  gctccctgctctgcgctgggcagc
            Ma's night monkey  gctccctgctctgggctgggcagc
                  Mouse lemur  cctccctgctctgggccgggcagc
B D                  Bushbaby  cctccttcccctgggctggatgcc
B D                     Mouse  ========================
             Sclater's lemur  ========================
           Coquerel's sifaka  ========================
                 Black lemur  ========================
B D                   Tarsier  ========================
B D                       Dog  ========================
B D                 Armadillo  ========================
              Sooty mangabey  ========================

Inserts between block 15 and 16 in window
                 Mouse lemur 1381bp
B D                 Bushbaby 7bp

Alignment block 16 of 49 in window, 3669309 - 3669520, 212 bps 
B D                     Human  agtgcgttggaactggtctggccctggcttccaggccggctgaggtgagcagg------ggaggccagga
B D                     Chimp  agtgcgttggaactggtctggccctggcttccaggctggctgaggtgagcagg------ggaggccagga
B D                    Bonobo  agtgcgttggaactggtctggccctggcttccaggctggctgaggtgagcagg------ggaggccagga
B D                   Gorilla  agtgcgttggaactggtctggccctggcttccaggccggctgaggtgagcagg------ggaggccagga
B D                 Orangutan  agtgcattggaactggtctggccctggcttccaggccggctaaggtgagcagg------ggaggccagga
B D                    Gibbon  agtgcgttggaactggtctggccctggcttccaggccggctgaggtgagcaga------ggaggccagga
B D                    Rhesus  agtgcattggaactggtctggccctggcttccaggccggctgaggtgagcagg------ggaggccagga
B D       Crab-eating macaque  agtgcattggaactggtctggccctggcttccaggccggctgaggtgagcagg------ggaggccagga
           Pig-tailed macaque  agtgcattggaactggtctggccctggcttccaggccggctgaggtgagcagg------ggaggccagga
                       Baboon  agtgcattggaactggtctggccctggcttccaggcc----------agcagg------ggaggccagga
B D              Green monkey  agtgcattggaactggtctggccctggctcccaggccggctgaggtgagcagg------ggaggccagga
                        Drill  agtgcattggaactggtctggccctggcttccaggccggctgaggtgagcagg------ggaggccagga
B D          Proboscis monkey  agtgcattggaactggtctggccctggcttccaggccggctgaggtgagcagg------ggaggccagga
              Angolan colobus  agtgcattggaactggtctggccctggcttccaggccggctgaggtgagcagg------ggaggccagga
B D  Golden snub-nosed monkey  agtgcattggaactggtctggccctggcttccagg-cggctgaggtgagcagg------ggaggccagga
      Black snub-nosed monkey  agtgcattggaactggtctggccctggcttccaggccggctgaggtgagcagg------ggaggccagga
B D                  Marmoset  agtgagctggaactggtggggccctggcttccaggtcagccgaggtgagcagg------ggagcccagga
B D           Squirrel monkey  agtgagcc-gaactggtggggccctggcttccaggccagccgaggtgagcagg------ggagcccagga
          White-faced sapajou  agtgagccggaacttgtggggccctggcttccaggccagccgaggtgagcagg------ggagcccagga
            Ma's night monkey  agtgagctggaactggtggggccctggcttccaggccagccgaggtgtgcagg------ggagcccagga
B D                  Bushbaby  -ggccagggggaaaggt--ggctgtg-----tagacagagtcaggcagacaggcaggatagaggccagga
B D                     Mouse  ======================================================================
             Sclater's lemur  ======================================================================
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
                 Black lemur  ======================================================================
B D                   Tarsier  ======================================================================
B D                       Dog  ======================================================================
B D                 Armadillo  ======================================================================
              Sooty mangabey  ======================================================================

                        Human  c-atgtgaggggccaactgggcgaggttcagggaggtgcagacaggtgaggaggtgggtgcggagtccgc
                        Chimp  c-atgtgaggggccaactgggcgaggttcagggaggtgcagacaggtgaggaggtgggtgcggagtccgc
                       Bonobo  c-atgtgaggggccaactgggcgaggttcagggaggtgcagacaggtgaggaggtgggtgcggagtccgc
                      Gorilla  c-atgtgaggggccaactgggcgaggttcagggaggtgcagacaggtgaggaggtgggtgcggagtccgc
                    Orangutan  c-acgtgaggggccaacagggcgaggttcagggaggtgcagacaggtgaggaggtgggtgcg------gc
                       Gibbon  c-acgtgaggggccaactgggcgaggttcaggaaggtgcagacaggtgaggaggtgggtgcggagtccgc
                       Rhesus  c-acgtgaggggccaactgggcgaggttcagggaggtgcagacaggtgaggaggtggctgtggagtccgg
          Crab-eating macaque  c-acgtgaggggccaactgggcgaggttcagggaggtgcagacaggtgaggaggtggctgtggagtccgg
           Pig-tailed macaque  c-acgtgaggggccaactgggcgaggttcagggaggtgcagacaggtgaggaggtggctgtggagtccgg
                       Baboon  c-acgtgaggggccaactgggcgaggctcagggaggtgcagacaggtgaggaggtggctgtggagtccgg
                 Green monkey  c-atgtgaggggccaactgagcgaggttcagggaggtgcaggc-ggtgaggaggtggctgtggagtccgg
                        Drill  c-acgtgaggggccaactgggcgaggttcagggaggtgcagacaggtgaggaggtggctgtggagtccgg
             Proboscis monkey  c-acgtgaggggccaactgggcgaggttcagggaggtgcagacaggtgaggaggtgggtgtggagtccgg
              Angolan colobus  c-acgtgaggggccaactgggcgaggttcagggaggtgcagacaggtgaggaggtgggtgtggagtccgg
     Golden snub-nosed monkey  c-acgtgaggggccaactgggagaggttcagggaggtgcagacaggtgaggaggtgggtgtggagtccgg
      Black snub-nosed monkey  c-acgtgaggggccaactgggagaggttcagggaggtgcagacaggtgaggaggtgggtgtggagtccgg
                     Marmoset  c-ccatgaggggccaaccgggtgaggctcagggaggtggagacaggtgaggaggtgggtgcagagtctga
              Squirrel monkey  c-ccgtgaggggccaaccaggtgaggctcagggaggtgcagacacgtgaggaggtgggtgcggagtccga
          White-faced sapajou  c-ccatgaggggccaactgggtgaggctcagggaggtgcagacaggtgaggaggtgggtgcggagtctga
            Ma's night monkey  c-ccgtgaggggccaaccaggtgaggctcagggaggtgcagacaggtgaggaggtgggtgcagagtccga
                     Bushbaby  caatgtggaggagaaactggccaaggtttgaggaagtgttggccaggcaggaggtgagcactgaagccag
                        Mouse  ======================================================================
              Sclater's lemur  ======================================================================
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
                  Black lemur  ======================================================================
                      Tarsier  ======================================================================
                          Dog  ======================================================================
                    Armadillo  ======================================================================
               Sooty mangabey  ======================================================================

                        Human  ggtgcagacgggggccgtcaggggtggggacccggctgggtgtggactcgggagaggggacagaggagaa
                        Chimp  ggtgcagacgggggccgtcaggggtggggacccggctgggtgtggactcgggagaggggacagaggagaa
                       Bonobo  ggtgcagacgggggccgtcaggggtggggacccggctgggtgtggactcgggagaggggacaggggagaa
                      Gorilla  ggtgcagacgggggccgtcggtggtggggacccggctgggtgtggacccgggagaggggacagaggagaa
                    Orangutan  ggtgcagacgggggccatcaggggtggggacccggctgggtgtggactcgggagaggggacagaggagaa
                       Gibbon  ggtgcagacgggggccgtaaggggtggggacccggctgggtgtggactcgggagagggggcagaggagaa
                       Rhesus  agtgcagacggggaccgtcgggggtggggacccggctggggggggaccggggagaggggacggaggagaa
          Crab-eating macaque  agtgcagacggggaccgtcgggggtggggacccggctggggggggaccggggagaggggacggaggagaa
           Pig-tailed macaque  agtgcagacggggaccgtcgggggtggggacccggctggggggggaccggggagaggggac---ggagaa
                       Baboon  ggtgcagatggggaccgtcgggggtggggacccggctgggggtggactggggagaggggacagaggagaa
                 Green monkey  ggtgcagatggggaccgtcggggatggggacccggctaggggtggactggcgagaggggacagaggagaa
                        Drill  ggtgcagatggggaccgtcgggggtggggagccggctgggggtggactggggagaggggacagaggagaa
             Proboscis monkey  ggtgcagatggggaccgttgggggtggggacccggctgggggtgaactggggagaggggacagaggataa
              Angolan colobus  ggtgcagatggggaccgtcgggggtggggacccggctgggggtgaactggggagaggggacagaggagaa
     Golden snub-nosed monkey  ggtgcagatggggactgtcgggggtggggacccggctgggggtgaactggggagaggggacagaggataa
      Black snub-nosed monkey  ggtgcagatggggaccgtcgggggtggggacccggctgggggtgaactggggagaggggacagaggataa
                     Marmoset  -------------------aaggctggaggcctggctggacgtggactcgggagacgggac---agagaa
              Squirrel monkey  -------------------aagggtggaggcccggctgggcgtggatgcgggagaggggacg--ggagaa
          White-faced sapajou  -------------------aagggtggaggacc-gccgagtgtggacgcgggagagaggacg--ggagaa
            Ma's night monkey  -------------------aagggtgtaagcccggctgggtgtggacttgggagaggggacg--ggagaa
                     Bushbaby  agtgggaagggctattgctgcaga-gggcaccgagctgggtatggacactagcgagga------------
                        Mouse  ======================================================================
              Sclater's lemur  ======================================================================
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
                  Black lemur  ======================================================================
                      Tarsier  ======================================================================
                          Dog  ======================================================================
                    Armadillo  ======================================================================
               Sooty mangabey  ======================================================================

                        Human  tttccc--cga
                        Chimp  tttccc--cga
                       Bonobo  tttccc--cga
                      Gorilla  tttccc--cga
                    Orangutan  tttctc--caa
                       Gibbon  tttccc--tga
                       Rhesus  tttccc-----
          Crab-eating macaque  tttccc-----
           Pig-tailed macaque  tttccc-----
                       Baboon  tttccc-----
                 Green monkey  tttccc-----
                        Drill  tttcct-----
             Proboscis monkey  tttcccaa---
              Angolan colobus  tttcccga---
     Golden snub-nosed monkey  tttcccaa---
      Black snub-nosed monkey  tttcccaa---
                     Marmoset  ctttcc--caa
              Squirrel monkey  tttccc--cga
          White-faced sapajou  tttccc--caa
            Ma's night monkey  tttccc--cga
                     Bushbaby  -----------
                        Mouse  ===========
              Sclater's lemur  ===========
                  Mouse lemur  ===========
            Coquerel's sifaka  ===========
                  Black lemur  ===========
                      Tarsier  ===========
                          Dog  ===========
                    Armadillo  ===========
               Sooty mangabey  ===========

Alignment block 17 of 49 in window, 3669521 - 3669546, 26 bps 
B D                     Human  gagacaaaaagtctttc----------tggaccaag
B D                     Chimp  gagacaaaaagtctttc----------tggaccaag
B D                    Bonobo  gagacaaaaagtctttc----------tggaccaag
B D                   Gorilla  gagacaaaaagtctttc----------tggaccaag
B D                 Orangutan  gagacaaaaagtctttc----------tggaccaag
B D                    Gibbon  gagacaaaaagtctttc----------tggaccaag
B D                    Rhesus  gagacaagaagtctttc----------tggaccagg
B D       Crab-eating macaque  gagacaagaagtctttc----------tggaccagg
           Pig-tailed macaque  gagacaagaagtctttc----------tggaccagg
               Sooty mangabey  gagacaagaagtctttc----------tggaccaag
                       Baboon  gagacaagaagtctttc----------tggaccaag
B D              Green monkey  gacacaagaagtctttc----------tggaccaag
                        Drill  gagacaagaagtctttc----------tggaccaag
B D          Proboscis monkey  gagacaagaagtctttc----------tggaccaag
              Angolan colobus  gagacaagaagtctttc----------tggaccaag
B D  Golden snub-nosed monkey  gagacaagaagtctttc----------tggaccaag
      Black snub-nosed monkey  gagacaagaagtctttc----------tggaccaag
B D                  Marmoset  gcgacaagaagtctttc----------caagccaag
B D           Squirrel monkey  gagacaagaagcccttc----------caagccaag
          White-faced sapajou  gagacaaggagtctttc----------caagccaac
            Ma's night monkey  gagacatcaagtctttc----------caagccaag
B D                  Bushbaby  gaggggagaagtctttcttgcctctggtaaatcatg
B D                     Mouse  ====================================
             Sclater's lemur  ====================================
                 Mouse lemur  ====================================
           Coquerel's sifaka  ====================================
                 Black lemur  ====================================
B D                   Tarsier  ====================================
B D                       Dog  ====================================
B D                 Armadillo  ====================================

Inserts between block 17 and 18 in window
              Sooty mangabey 489bp

Alignment block 18 of 49 in window, 3669547 - 3669579, 33 bps 
B D                     Human  gccttacaaagccagcaaagagtgcagagaagg
B D                     Chimp  gccttacaaagccagcaaagagtgcagagaagg
B D                    Bonobo  gccttacaaagccagcaaagagtgcagagaagg
B D                   Gorilla  gccttacaaagccagcaaagagtgcagagaagg
B D                 Orangutan  gcctcacaaagccagcaaagagtacagagaggg
B D                    Gibbon  gctttacaaagcaagcaaagagtgcagagaagg
B D                    Rhesus  gcctcacaaagccagcggag--cgcggag--gg
B D       Crab-eating macaque  gcctcacaaagccagcagag--cgcggag--gg
           Pig-tailed macaque  gcctcacaaagccagcagag--cgcggag--gg
                       Baboon  gcctcacaaagccagcaaagcacgcagag--gg
B D              Green monkey  gcctcacaaagccagcaaagagcgcagag--gg
                        Drill  gcctcacaaagccagcaaagagcgcggag--gg
B D          Proboscis monkey  gccttacaaagccagcaaagagcgcagag--gg
              Angolan colobus  gccttacaaagccagcaaagagcgcagag--gg
B D  Golden snub-nosed monkey  gccttacaaagccagcaaagagcgcagag--gg
      Black snub-nosed monkey  gccttacaaagccagcaaagagcgcagag--gg
B D                  Marmoset  ccctt--agagtcagcggagagcgcagagaggg
B D           Squirrel monkey  ac-------agtcagcagagaacgcagagaggg
          White-faced sapajou  acctt--agagtcagcagagagcacagagaggg
            Ma's night monkey  acctt--agagtcagcagagagtgcagagaggg
B D                  Bushbaby  gccttacactgccagcgaagcgacaggagaagg
B D                     Mouse  =================================
             Sclater's lemur  =================================
                 Mouse lemur  =================================
           Coquerel's sifaka  =================================
                 Black lemur  =================================
B D                   Tarsier  =================================
B D                       Dog  =================================
B D                 Armadillo  =================================
              Sooty mangabey  =================================

Inserts between block 18 and 19 in window
B D                 Bushbaby 520bp

Alignment block 19 of 49 in window, 3669580 - 3669581, 2 bps 
B D                     Human  cg
B D                     Chimp  ag
B D                    Bonobo  ag
B D                   Gorilla  ag
B D                 Orangutan  ag
B D                    Gibbon  ag
B D                    Rhesus  ag
B D       Crab-eating macaque  ag
           Pig-tailed macaque  ag
                       Baboon  ag
B D              Green monkey  ag
                        Drill  ag
B D          Proboscis monkey  ag
              Angolan colobus  ag
B D  Golden snub-nosed monkey  ag
      Black snub-nosed monkey  ag
B D                  Marmoset  ag
B D           Squirrel monkey  ag
          White-faced sapajou  ag
            Ma's night monkey  ag
B D                     Mouse  ==
             Sclater's lemur  ==
                 Mouse lemur  ==
           Coquerel's sifaka  ==
                 Black lemur  ==
B D                   Tarsier  ==
B D                       Dog  ==
B D                 Armadillo  ==
B D                  Bushbaby  ==
              Sooty mangabey  ==

Alignment block 20 of 49 in window, 3669582 - 3669707, 126 bps 
B D                     Human  ggagcccttctgtttt-atgacgcggaaagagatgctcagagggaggggtgaacccacccgaggtcacac
B D                     Chimp  ggagcccttctgtttt-atgacgcggaaagagatgctcagagggaggggtgaacccacccgaggtcacac
B D                    Bonobo  ggagcccttctgtttt-atgacgcggaaagagatgctcagagggaggggtgaacccacccgaggtcacac
B D                   Gorilla  ggagcccttctgtttt-aagacgcggaaagagatgctcagagggaggggtgaacccacccgaggtcacac
B D                 Orangutan  ggagcccttctgtttt-aagacgcggaaagagatgctcagagggaggggtgaacccacccaaggtcgtac
B D                    Gibbon  ggagcccttctgttgt-aagacgtggaaagagatgctcagagggaggggtgaacccacccaaggtcacat
B D                    Rhesus  ggagcccctctgttct-aagacacggaaagagactgtcagagggaggggtgaacccacccaaggtcacgc
B D       Crab-eating macaque  ggagcccctctgttct-aagacaaggaaagagactgtcagagggaggggtgaacccacccaaggtcacgc
           Pig-tailed macaque  ggagcccctctgttct-aagacacggaaagagactgtcagagggaggggtgaacccacccaaggtcacgc
                       Baboon  ggagcccctctgttct-aagacacggaaagagactgtcagagggaggggtgaacccacccaaggtcacgc
B D              Green monkey  ggagcccctctgtttt-aagacacagaaagagactgtcagagggagaggtgaagccacccaaggtcacac
                        Drill  ggagcccctctgttct-aagacgcggaaagagactgtcagagggaggggtgaacccacccaaggtcacgc
B D          Proboscis monkey  ggagcccctctgtttt-aagacacggaaagagactgtcagagggaggggtgaacccgcccaaggtcacgc
              Angolan colobus  ggagcccctctgtttt-aagacgcggaaagagactgtcagagggaggggtgaacccacccaaggtcacgc
B D  Golden snub-nosed monkey  ggagcccctctgtttt-aagacgcagacagagactgtcagagggaggggtgaaccca--caaggtcacgc
      Black snub-nosed monkey  ggagcccctctgtttt-aagacgcggacagagactgtcagagggaggggtgaaccca--caaggtcacgc
B D                  Marmoset  ggggtcc--ctgtttt-aagactgggaaggtgatgcacagtgggaggggctggcccaccccaggtcacac
B D           Squirrel monkey  ggagtcc--ctg-ttt-aagactcggaaggtaatg--cagagggaggggctgatccaccccaggtcacac
          White-faced sapajou  ggagtcc--ctggttt-aagactcggaaggtgatgcacagacggaggcgctgacccaccccaggtcacac
            Ma's night monkey  ggagtcc--ctgtttt-aagactcggaaggtgatgcacagagggaggggctgacccaccccaggtcacac
B D                  Bushbaby  gagacccctctgctttaaagatgctgaaagtagggcctagagaaa----ttaactcacctaaggtctagt
B D                     Mouse  ======================================================================
             Sclater's lemur  ======================================================================
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
                 Black lemur  ======================================================================
B D                   Tarsier  ======================================================================
B D                       Dog  ======================================================================
B D                 Armadillo  ======================================================================
              Sooty mangabey  ======================================================================

                        Human  agaaggagaaggaaagtcaaacctgggcctgggtcggcgatgccc----------caccctatcagc---
                        Chimp  agaaggagaaggaaagtcaaacctgggcctgggtcggcgatgcca----------caccctatcagc---
                       Bonobo  agaaggagaaggaaagtcaaacctgggcctgggtcggcgatgccc----------caccctatcagc---
                      Gorilla  agaaggagaaggaaagtcaaacctgggcctgggtcggcgatgccc----------caccctatcagc---
                    Orangutan  agaaggagaaggaaggttaaacctgggcc-gggtcggcgatgtcc----------caccctatcagc---
                       Gibbon  agaaggagaaggaaagtcaaaccccggcctgggttggcgatgccc----------cactctatcagc---
                       Rhesus  cgaaggaga------gtcaaacccgggcctgggtcatcgacgccc----------cgccctgtcagc---
          Crab-eating macaque  cgaaggaga------gtcaaacccgggcctgggtcatcgacgccc----------cgccctgtcagc---
           Pig-tailed macaque  cgaaggaga------gtcaaacccgggcctgggtcatcgacgccc----------cgccctgtcagt---
                       Baboon  cgaaggaga------gtcaaacccgggcctgggtcatcgacgccc----------caccctgt-------
                 Green monkey  cgaaggaga------gtcaaacccgggcctgggtcatcgacgccc----------caccctatcagc---
                        Drill  cgaaggaga------gtcaaacccgggcctgggtcatcgacgccc----------cgccctgtcagc---
             Proboscis monkey  cgaaggagaggaaaagtcaaacctgggcctgggtcatcgatgccc----------cgccctatcagc---
              Angolan colobus  cgaaggggaggaaaggtcaaacccgggcctgggtcatcgacgccc----------cgccccatcagc---
     Golden snub-nosed monkey  cgaaggagaggaaaagtcaaacccgggcctgggtcatcgatgccc----------cgccctatcagc---
      Black snub-nosed monkey  cgaaggagaggaaaagtcaaacccgggcctgggtcatcgatgccc----------cgccctatcagc---
                     Marmoset  agaagcagaggcaaagtcaaaccccggcctgggtcgctgacgccc----------cgtcctctcagc---
              Squirrel monkey  agagg-ggaggcaaagtcaaaccccggcctgggtcgc-gatgccc----------cgccctgtcagc---
          White-faced sapajou  agaaggggaggcaaagtcaagccccggcctgggttgcctatgccc----------tgccctctcagc---
            Ma's night monkey  agaagcagaggcaaagtcaaaccccggcctgggtcggcgatgccc----------tgccctctcagc---
                     Bushbaby  ggaaggaggaggaaattaaaacctaggtctgggtcacagatgcccaggccccgttcaccctctctgaacc
                        Mouse  ======================================================================
              Sclater's lemur  ======================================================================
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
                  Black lemur  ======================================================================
                      Tarsier  ======================================================================
                          Dog  ======================================================================
                    Armadillo  ======================================================================
               Sooty mangabey  ======================================================================

                        Human  ------
                        Chimp  ------
                       Bonobo  ------
                      Gorilla  ------
                    Orangutan  ------
                       Gibbon  ------
                       Rhesus  ------
          Crab-eating macaque  ------
           Pig-tailed macaque  ------
                       Baboon  ------
                 Green monkey  ------
                        Drill  ------
             Proboscis monkey  ------
              Angolan colobus  ------
     Golden snub-nosed monkey  ------
      Black snub-nosed monkey  ------
                     Marmoset  ------
              Squirrel monkey  ------
          White-faced sapajou  ------
            Ma's night monkey  ------
                     Bushbaby  actgtc
                        Mouse  ======
              Sclater's lemur  ======
                  Mouse lemur  ======
            Coquerel's sifaka  ======
                  Black lemur  ======
                      Tarsier  ======
                          Dog  ======
                    Armadillo  ======
               Sooty mangabey  ======

Inserts between block 20 and 21 in window
B D                Orangutan 279bp

Alignment block 21 of 49 in window, 3669708 - 3669729, 22 bps 
B D                     Human  cctgccagcgcccctcggcccc
B D                     Chimp  cctgccagcgcccctcggcccc
B D                    Bonobo  cctgccagcgcccctcggcccc
B D                   Gorilla  cctgccagcgcccctcggcccc
B D                 Orangutan  cctgccagcgcacctcggcccc
B D                    Gibbon  cctgccagcgcccctcggcccc
B D                    Rhesus  cctgccagtgcccctcggcccc
B D       Crab-eating macaque  cctgccagtgcccctcggcccc
           Pig-tailed macaque  cctgccagtgcccctcggcccc
                       Baboon  -----cagtgcccctcggcccc
B D              Green monkey  cctgccagtgcccctcggcccc
                        Drill  cctgccagtgcccctcggcccc
B D          Proboscis monkey  cctgccagtgcccctcggcccc
              Angolan colobus  cctgccagtgcccctcggcccc
B D  Golden snub-nosed monkey  cctgccagtgcccctcggcccc
      Black snub-nosed monkey  cctgccagtgcccctcggcccc
B D                  Marmoset  cctgccagcgcct--tggcccc
B D           Squirrel monkey  cctgccagcgccc--tggcccc
          White-faced sapajou  cctgccagtgccc--tggcccc
            Ma's night monkey  cctgccagcaccc--tggcccc
B D                  Bushbaby  cctgccagtgcccc-tggcctc
B D                     Mouse  ======================
             Sclater's lemur  ======================
                 Mouse lemur  ======================
           Coquerel's sifaka  ======================
                 Black lemur  ======================
B D                   Tarsier  ======================
B D                       Dog  ======================
B D                 Armadillo  ======================
              Sooty mangabey  ======================

Alignment block 22 of 49 in window, 3669730 - 3669772, 43 bps 
B D                     Human  catgggcactgtgctgctctcggtgggtgcacgggagacccac
B D                     Chimp  catgggcactgtgctgctctcggtgggtgcacgggagacccac
B D                    Bonobo  catgggcactgtgctgctctcggtgggtgcacgggagacccat
B D                   Gorilla  catgggcactgtgctgctctcggtgggtgcacgggagacccac
B D                 Orangutan  cacgggcactgcgctgctctcggtgggtgcacgggagacccac
B D                    Gibbon  catgggcactgtgctgctctcggtgggtgcacgggagacccac
B D                    Rhesus  --------ctgcgctgctctcagtgggtgcacaggagacccac
B D       Crab-eating macaque  --------ctgcgctgctctcagtgggtgcacgggagacccac
           Pig-tailed macaque  --------ctgcgctgctctcagtgggtgcacgggagacccac
                       Baboon  --------ctgtgctgctctcagtgggtgcacgggagacccac
B D              Green monkey  --------ctgcgctgctctcagtgggtgcacgggagacccac
                        Drill  --------ctgcgctgctctcagtgggtgcacgggagacccac
B D          Proboscis monkey  --------ctgcgctgctctcagtgggtgcatgggagacccac
B D  Golden snub-nosed monkey  --------ctgcgctgctctcagtgggtgcacaggagacccac
      Black snub-nosed monkey  --------ctgcgctgctctcagtgggtgcacgggagacccac
B D                  Marmoset  catgggcactgcgctgctctcggtgggtgcacaggagacccac
B D           Squirrel monkey  cgtgggcactgcgccgctcttggtgggtgcgctggagacccac
          White-faced sapajou  catgggcactgcactgctctcggtgggtgcgcgggaggcccac
            Ma's night monkey  cacgggcaccgcgctgctctcggtgggtgtgtgggagacccac
B D                  Bushbaby  cat-----ctgca------------------------------
B D                     Mouse  ===========================================
             Sclater's lemur  ===========================================
                 Mouse lemur  ===========================================
           Coquerel's sifaka  ===========================================
                 Black lemur  ===========================================
B D                   Tarsier  ===========================================
B D                       Dog  ===========================================
B D                 Armadillo  ===========================================
             Angolan colobus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Sooty mangabey  ===========================================

Inserts between block 22 and 23 in window
B D                 Marmoset 2bp
B D          Squirrel monkey 2bp
         White-faced sapajou 229bp
           Ma's night monkey 2bp

Alignment block 23 of 49 in window, 3669773 - 3669793, 21 bps 
B D                     Human  gtgtgtcccatccagaggctg
B D                     Chimp  gtgtgtcccatctagaggccg
B D                    Bonobo  gtgtgtcccatctagaggccg
B D                   Gorilla  -tgtgtcccatctagaggccg
B D                 Orangutan  gtgtgtcccatctagaggccg
B D                    Gibbon  gtgtgtcccatctagaggccg
B D                    Rhesus  atgtgtcccatctagaggccg
B D       Crab-eating macaque  atgtgtcccatctagaggccg
           Pig-tailed macaque  atgtgtcccatctagaggccg
                       Baboon  --gtgtcccatctagaggccg
B D              Green monkey  atgtgttccatctagaggccg
                        Drill  atgtgtcccatctagaggccg
B D          Proboscis monkey  gtgtgtcccatntagaggccg
B D  Golden snub-nosed monkey  gtgtgtcccatctagaggccg
      Black snub-nosed monkey  gtgtgtcccatctagaggccg
B D                  Marmoset  gcgtgtcccc-----------
B D           Squirrel monkey  gtgcgtcccct----------
            Ma's night monkey  gtgcgtcccct----------
B D                  Bushbaby  ---tgtccagtaccagggaca
B D                     Mouse  =====================
             Sclater's lemur  =====================
                 Mouse lemur  =====================
           Coquerel's sifaka  =====================
                 Black lemur  =====================
B D                   Tarsier  =====================
B D                       Dog  =====================
B D                 Armadillo  =====================
         White-faced sapajou  =====================
             Angolan colobus  NNNNNNNNNNNNNNNNNNNNN
              Sooty mangabey  =====================

Alignment block 24 of 49 in window, 3669794 - 3669848, 55 bps 
B D                     Human  caccccggtgaccgccctgccgtctgaaaacacgtccaccgcgggcactgaaggc
B D                     Chimp  caccccggtgaccgccctgccgtctgaaaacacgtccaccgcgggcactgaaggc
B D                    Bonobo  caccccggtgaccgccctgccgtctgaaaacacgtccaccgcgggcactgaaggc
B D                   Gorilla  caccccggtgaccgccctgccgtctgaaaacacgtccaccgcaggcactgaaggc
B D                 Orangutan  cgccccagtgactgccctgccgtctgaaaacacgtccaccgcgggcactgaaggc
B D                    Gibbon  cgccccggtgaccgccctgccgtctgaaaacacgtccaccacgggcactgaaggc
B D                    Rhesus  cg-cccggcgaccgccctgccatctgaaaatacgtccaccgcaggcgctgaaggc
B D       Crab-eating macaque  cg-cccggcgaccgccctgccatctgaaaatacgtccaccgcaggcgctgaaggc
           Pig-tailed macaque  cg-cccggcgaccgccctgccatctgaaaatacgtccaccgcaggcgctgaaggc
                       Baboon  cg-cgcggcgaccgccctgccgtctgaaaatacgtccaccgcaggcactgaaggc
B D              Green monkey  cg-cccggcgaccaccctgccgtctaaaaacacgtccaccgcaggcgctgaaggc
                        Drill  cg-cgcggcgaccgccctgccgtctgaaaatacgtccaccgcaggcgctgacggc
B D  Golden snub-nosed monkey  cgccccggcgaccgccctgctgtctgaaaacacatccaccgcaggcgctgaaggc
      Black snub-nosed monkey  cgccccggcgaccgccctgctgtctgaaaacacatccaccgcaggcactgaaggc
B D                  Marmoset  ------agtgactgccctgctgtctg-aaacacgtcc-ctgcgggcactaaagcc
B D           Squirrel monkey  ------ggtgactgccctgctgtctg-aaacacgtct-ccgcaggcactgaaggc
            Ma's night monkey  ------ggtgactgccctgctgtctg-aaacacgtcc-ccgcgggcactgaaggc
B D                  Bushbaby  --------------cactgctgcctcaaaacccagctac-atgcacagtacaggt
B D                     Mouse  =======================================================
             Sclater's lemur  =======================================================
                 Mouse lemur  =======================================================
           Coquerel's sifaka  =======================================================
                 Black lemur  =======================================================
B D                   Tarsier  =======================================================
B D          Proboscis monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Dog  =======================================================
B D                 Armadillo  =======================================================
         White-faced sapajou  =======================================================
             Angolan colobus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Sooty mangabey  =======================================================

Inserts between block 24 and 25 in window
B D             Green monkey 17bp

Alignment block 25 of 49 in window, 3669849 - 3669858, 10 bps 
B D                     Human  aactgaatg--c
B D                     Chimp  aactgaatg--c
B D                    Bonobo  aactgaatg--c
B D                   Gorilla  aactgaatg--c
B D                 Orangutan  aactgaatg--c
B D                    Gibbon  aactgaatg--c
B D                    Rhesus  -actgaagg---
B D       Crab-eating macaque  -actgaagg---
           Pig-tailed macaque  -actgaagg---
                       Baboon  -actgaagg---
                        Drill  -actgaaggc--
B D  Golden snub-nosed monkey  -gctgaagg-c-
      Black snub-nosed monkey  -gctgaagg-c-
B D                  Marmoset  agctgaaca--c
B D           Squirrel monkey  agctgaaca--c
            Ma's night monkey  aactgaaca--c
B D                  Bushbaby  gacttgagg--c
B D                     Mouse  ============
             Sclater's lemur  ============
                 Mouse lemur  ============
           Coquerel's sifaka  ============
                 Black lemur  ============
B D                   Tarsier  ============
B D          Proboscis monkey  NNNNNNNNNNNN
B D                       Dog  ============
B D                 Armadillo  ============
         White-faced sapajou  ============
             Angolan colobus  NNNNNNNNNNNN
B D              Green monkey  ============
              Sooty mangabey  ============

Inserts between block 25 and 26 in window
B D Golden snub-nosed monkey 9bp
     Black snub-nosed monkey 14bp

Alignment block 26 of 49 in window, 3669859 - 3669871, 13 bps 
B D                     Human  ----gacttggtggagc
B D                     Chimp  ----agcttggtggagc
B D                    Bonobo  ----ggcttggtggaac
B D                   Gorilla  ----ggcttggtggagc
B D                 Orangutan  ----ggcttggtggagc
B D                    Gibbon  ----ggcttggtggagc
B D  Golden snub-nosed monkey  ------actgaagaa--
B D                  Marmoset  ----agctgggtgggg-
B D           Squirrel monkey  ----agctgggtgggg-
            Ma's night monkey  ----agctgggtgggg-
B D                  Bushbaby  tgtcagcaaggg-----
B D                     Mouse  =================
             Sclater's lemur  =================
                 Mouse lemur  =================
           Coquerel's sifaka  =================
                 Black lemur  =================
B D                   Tarsier  =================
B D                    Rhesus  -----------------
B D       Crab-eating macaque  -----------------
     Black snub-nosed monkey  =================
B D          Proboscis monkey  NNNNNNNNNNNNNNNNN
                      Baboon  -----------------
B D                       Dog  =================
B D                 Armadillo  =================
         White-faced sapajou  =================
             Angolan colobus  NNNNNNNNNNNNNNNNN
                       Drill  -----------------
B D              Green monkey  =================
              Sooty mangabey  =================
          Pig-tailed macaque  -----------------

Alignment block 27 of 49 in window, 3669872 - 3669874, 3 bps 
B D                     Human  -agc
B D                     Chimp  -agc
B D                    Bonobo  -agc
B D                   Gorilla  -ag-
B D                 Orangutan  -agc
B D                    Gibbon  -agc
      Black snub-nosed monkey  -ag-
B D           Squirrel monkey  ---c
B D                  Bushbaby  agg-
B D                     Mouse  ====
             Sclater's lemur  ====
                 Mouse lemur  ====
           Coquerel's sifaka  ====
                 Black lemur  ====
B D                   Tarsier  ====
B D                    Rhesus  ----
B D       Crab-eating macaque  ----
B D  Golden snub-nosed monkey  ----
B D          Proboscis monkey  NNNN
                      Baboon  ----
B D                       Dog  ====
B D                 Armadillo  ====
           Ma's night monkey  ----
         White-faced sapajou  ====
B D                  Marmoset  ----
             Angolan colobus  NNNN
                       Drill  ----
B D              Green monkey  ====
              Sooty mangabey  ====
          Pig-tailed macaque  ----

Inserts between block 27 and 28 in window
     Black snub-nosed monkey 1bp

Alignment block 28 of 49 in window, 3669875 - 3669875, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                    Bonobo  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                  Marmoset  c
B D           Squirrel monkey  c
            Ma's night monkey  c
B D                  Bushbaby  c
B D                     Mouse  =
             Sclater's lemur  =
                 Mouse lemur  =
           Coquerel's sifaka  =
                 Black lemur  =
B D                   Tarsier  =
B D                    Rhesus  -
B D       Crab-eating macaque  -
     Black snub-nosed monkey  =
B D  Golden snub-nosed monkey  -
B D          Proboscis monkey  N
                      Baboon  -
B D                       Dog  =
B D                 Armadillo  =
         White-faced sapajou  =
             Angolan colobus  N
                       Drill  -
B D              Green monkey  =
              Sooty mangabey  =
          Pig-tailed macaque  -

Alignment block 29 of 49 in window, 3669876 - 3669977, 102 bps 
B D                     Human  catagctttgctctgctgccg--------ggtcagaact-----gccggagacaagac------------
B D                     Chimp  catagctttgctctgctgccg--------ggtcagaact-----gccggagacaagac------------
B D                    Bonobo  catagctttgctctgctgccg--------ggtcagaact-----gccggagacaagac------------
B D                   Gorilla  catagctttgctctgctgccg--------ggtcagaact-----gccagagacaagac------------
B D                 Orangutan  catagctttgctctgctgcca--------ggtcagaacc-----accagagacacggc------------
B D                    Gibbon  catagctttgctctgctgcca--------ggtcagaact-----gccagagacacggc------------
B D                    Rhesus  cacggctttgctctgctgcca--------ggtcagaacc-----gccagggacccggc------------
B D       Crab-eating macaque  cacggctttgctctgctgcca--------ggtcagaacc-----gccagggacccggc------------
           Pig-tailed macaque  cacggctttgctctgctgcca--------ggtcagaacc-----gccagggacccggc------------
                       Baboon  cacgacttcgctctgctgcca--------ggtcagaacc-----gccagggacccggc------------
B D              Green monkey  cacgactttgctctgctgccc--------ggtcagaacc-----gccagggacccggc------------
                        Drill  -acgacttcgctctgctgcca--------ggtcagaacc-----gccagggacccggc------------
B D          Proboscis monkey  cacggctttgctctgctgcca--------ggtcagaacc-----accagggacccggc------------
B D  Golden snub-nosed monkey  -acggctttgctctgctgcca--------ggtcagaacc-----gccagggacccggc------------
      Black snub-nosed monkey  cacggctttgctctgctgcca--------ggtcagaacc-----gccagggacccggc------------
B D                  Marmoset  cacggctttgctctgcacctg--------ggtgggaact-----gccagagacacagt------------
B D           Squirrel monkey  catggctttgttctgcacctg--------ggtcggaacc-----gccagagacacagt------------
            Ma's night monkey  cacagctttgctctgcagctg--------ggtcagaacc-----gcc--agacacagt------------
B D                  Bushbaby  catgattctgctctggtgacactgaggccagtttgaatcagaaagacagatacatggcagccctatcaag
B D                     Mouse  ======================================================================
             Sclater's lemur  ======================================================================
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
                 Black lemur  ======================================================================
B D                   Tarsier  ======================================================================
B D                       Dog  ======================================================================
B D                 Armadillo  ======================================================================
         White-faced sapajou  ======================================================================
             Angolan colobus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Sooty mangabey  ======================================================================

                        Human  ---gaaggcacgaggtggaaaactttgctggg---gtcaggagcctcggggc-agg-g------------
                        Chimp  ---gaaggcacgaggtggaaaactttgctggg---gtcaggagtctcggggc--gg-g------------
                       Bonobo  ---aaaggcacgaggtggaaaactttgctggg---gtcaggagtctcggggc--gg-g------------
                      Gorilla  ----aaggcatgaggtgaaaaactttgctggg---gtcaggagcctcggggc-agg-c------------
                    Orangutan  ---gaaggcaccgggtggaaaactttgctggg---gtcaggagcctcgggac-aggcg------------
                       Gibbon  ---gaaggcacgaggtggaaaactttgctggg---gtcaggagcctctg--c-aggcg------------
                       Rhesus  ---gaaagcacgaggtggaaaactttgctggg---gtcaggagcctcggagcaagg-g------------
          Crab-eating macaque  ---gaaagcacgaggtggaaaactttgctggg---gtcaggagcctcggagcaagg-g------------
           Pig-tailed macaque  ---gaaagcacgaggtggaaaactttgctggg---gtcaggagcctcggagcaagg-g------------
                       Baboon  ---gaaagcacgaggtggaaaactttgctggg---gtcaggagcctcggagcaagg-ggcagcctgggga
                 Green monkey  ---gaaagcacgaggtggaaaactttgctggg---gtcaggagcct-ggggc-agc-g------------
                        Drill  ---gaaagcacgaggtggaaaactttgctggg---gtcaggagcctcggagcaagg-g------------
             Proboscis monkey  ---caaagcacgaggtggaaaactttg-tgag---gtcaggagcctcggagcaagg-g------------
     Golden snub-nosed monkey  ---caaagcacgaggtggaaaactttg-tgag---gtcaggagcctcggagcaagg-g------------
      Black snub-nosed monkey  ---caaagcacgaggtggaaaactttg-tgag---gtcaggagcctcggagcaagg-g------------
                     Marmoset  ---gaaggtacagggtggcaaactctg-cggg---gtcag--gcctgggggc-agg-c------------
              Squirrel monkey  ---gaaggtacagggtggcaaactctg-cggg---gtcag--gcttgggggc-agg-c------------
            Ma's night monkey  ---gaaggcacagggtggcgaactctg-cggg---gtcag--gcctgggggc-agg-c------------
                     Bushbaby  cctgaaggagccagctgcaaag--ttgcttggcatgtcaggtgcctctagtc---a-g------------
                        Mouse  ======================================================================
              Sclater's lemur  ======================================================================
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
                  Black lemur  ======================================================================
                      Tarsier  ======================================================================
                          Dog  ======================================================================
                    Armadillo  ======================================================================
          White-faced sapajou  ======================================================================
              Angolan colobus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Sooty mangabey  ======================================================================

                        Human  ------------------------------gc--aggcc-
                        Chimp  ------------------------------gc--aggcc-
                       Bonobo  ------------------------------gc--aggcc-
                      Gorilla  ------------------------------gc--aggcc-
                    Orangutan  ------------------------------gc--aggcg-
                       Gibbon  ------------------------------gc--aggc--
                       Rhesus  ------------------------------gc--atgcc-
          Crab-eating macaque  ------------------------------gc--atgcc-
           Pig-tailed macaque  ------------------------------gc--atgcc-
                       Baboon  aggggccagggtcaggagcccggggcagcagc--aggcc-
                 Green monkey  ------------------------------gc--aggcc-
                        Drill  ------------------------------gc--agcct-
             Proboscis monkey  ------------------------------gc--------
     Golden snub-nosed monkey  ------------------------------gc--------
      Black snub-nosed monkey  ------------------------------gcag------
                     Marmoset  ------------------------------ac--aggcc-
              Squirrel monkey  ------------------------------gc--aggcc-
            Ma's night monkey  ------------------------------gc--aggcc-
                     Bushbaby  ------------------------------ac--agggct
                        Mouse  ========================================
              Sclater's lemur  ========================================
                  Mouse lemur  ========================================
            Coquerel's sifaka  ========================================
                  Black lemur  ========================================
                      Tarsier  ========================================
                          Dog  ========================================
                    Armadillo  ========================================
          White-faced sapajou  ========================================
              Angolan colobus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Sooty mangabey  ========================================

Inserts between block 29 and 30 in window
B D                 Marmoset 8bp

Alignment block 30 of 49 in window, 3669978 - 3669985, 8 bps 
B D                     Human  ggggaggg
B D                     Chimp  ggggaggg
B D                    Bonobo  ggggaggg
B D                   Gorilla  ggggagga
B D                 Orangutan  ggggaggg
B D                    Gibbon  ggggaagg
B D                    Rhesus  ggggaagg
B D       Crab-eating macaque  ggggaagg
           Pig-tailed macaque  ggggaagg
                       Baboon  ggggaagg
B D              Green monkey  ggggaagg
                        Drill  ggggaagg
            Ma's night monkey  ggggaggg
B D                  Bushbaby  ggggagaa
B D                     Mouse  ========
             Sclater's lemur  ========
                 Mouse lemur  ========
           Coquerel's sifaka  ========
                 Black lemur  ========
B D                   Tarsier  ========
B D           Squirrel monkey  --------
     Black snub-nosed monkey  --------
B D  Golden snub-nosed monkey  --------
B D          Proboscis monkey  --------
B D                       Dog  ========
B D                 Armadillo  ========
         White-faced sapajou  ========
B D                  Marmoset  ========
             Angolan colobus  NNNNNNNN
              Sooty mangabey  ========

Inserts between block 30 and 31 in window
           Ma's night monkey 536bp

Alignment block 31 of 49 in window, 3669986 - 3669986, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                    Bonobo  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
           Pig-tailed macaque  g
                       Baboon  g
B D              Green monkey  g
                        Drill  g
B D                  Bushbaby  g
B D                     Mouse  =
             Sclater's lemur  =
                 Mouse lemur  =
           Coquerel's sifaka  =
                 Black lemur  =
B D                   Tarsier  =
B D           Squirrel monkey  -
     Black snub-nosed monkey  -
B D  Golden snub-nosed monkey  -
B D          Proboscis monkey  -
B D                       Dog  =
B D                 Armadillo  =
           Ma's night monkey  =
         White-faced sapajou  =
B D                  Marmoset  =
             Angolan colobus  N
              Sooty mangabey  =

Inserts between block 31 and 32 in window
B D                 Bushbaby 322bp

Alignment block 32 of 49 in window, 3669987 - 3670011, 25 bps 
B D                     Human  cctggggtcagga-gcctcggggca---g
B D                     Chimp  gctggggtcagga-gcctcggggca---g
B D                    Bonobo  gctggggtcagga-gcctcggggca---g
B D                   Gorilla  gctggggtcagga-gcctcggggca---g
B D                 Orangutan  gttggggtcagga-gcctc--tgca---g
B D                    Gibbon  gctggggtcagga-acct-ggggca---g
B D                    Rhesus  gccggggtcagga-gccc-ggggca----
B D       Crab-eating macaque  gccggggtcagga-gccc-ggggca----
           Pig-tailed macaque  gccggggtcagga-gccc-ggggcag---
                       Baboon  gccggggtcaggaggctc-agggca-g--
B D              Green monkey  gccggggtcagga-ggctcagggca--g-
                        Drill  gccggggtcagga-gcct-ggggca--g-
B D                     Mouse  =============================
             Sclater's lemur  =============================
                 Mouse lemur  =============================
           Coquerel's sifaka  =============================
                 Black lemur  =============================
B D                   Tarsier  =============================
B D           Squirrel monkey  -----------------------------
     Black snub-nosed monkey  -----------------------------
B D  Golden snub-nosed monkey  -----------------------------
B D          Proboscis monkey  -----------------------------
B D                       Dog  =============================
B D                 Armadillo  =============================
B D                  Bushbaby  =============================
           Ma's night monkey  =============================
         White-faced sapajou  =============================
B D                  Marmoset  =============================
             Angolan colobus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Sooty mangabey  =============================

Inserts between block 32 and 33 in window
          Pig-tailed macaque 51bp
                      Baboon 35bp

Alignment block 33 of 49 in window, 3670012 - 3670013, 2 bps 
B D                     Human  gc
B D                     Chimp  gc
B D                    Bonobo  gc
B D                   Gorilla  gc
B D                 Orangutan  gc
B D                    Gibbon  gc
                       Baboon  gc
B D              Green monkey  gc
      Black snub-nosed monkey  gc
B D                     Mouse  ==
             Sclater's lemur  ==
                 Mouse lemur  ==
           Coquerel's sifaka  ==
                 Black lemur  ==
B D                   Tarsier  ==
B D                    Rhesus  --
B D       Crab-eating macaque  --
B D           Squirrel monkey  --
B D  Golden snub-nosed monkey  --
B D          Proboscis monkey  --
B D                       Dog  ==
B D                 Armadillo  ==
B D                  Bushbaby  ==
           Ma's night monkey  ==
         White-faced sapajou  ==
B D                  Marmoset  ==
             Angolan colobus  NN
                       Drill  --
              Sooty mangabey  ==
          Pig-tailed macaque  ==

Inserts between block 33 and 34 in window
B D             Green monkey 1bp

Alignment block 34 of 49 in window, 3670014 - 3670044, 31 bps 
B D                     Human  agcaggtat-------ggagggggctggggccagaagc------------
B D                     Chimp  agcaggtat-------ggagggggctggggccagaagc------------
B D                    Bonobo  agcaggtat-------ggagggggctggggccagaagc------------
B D                   Gorilla  agcaggtgt-------ggagggggctggggccagaagc------------
B D                 Orangutan  agcaggggcaggcgggggaaggggctggggtcaggaac------------
B D                    Gibbon  gg--------------agaaggggctggggtcaggaac------------
                       Baboon  ------------------agcaggccggggaaggggccggggtcaggagc
B D                     Mouse  ==================================================
             Sclater's lemur  ==================================================
                 Mouse lemur  ==================================================
           Coquerel's sifaka  ==================================================
                 Black lemur  ==================================================
B D                   Tarsier  ==================================================
B D                    Rhesus  --------------------------------------------------
B D       Crab-eating macaque  --------------------------------------------------
B D           Squirrel monkey  --------------------------------------------------
     Black snub-nosed monkey  --------------------------------------------------
B D  Golden snub-nosed monkey  --------------------------------------------------
B D          Proboscis monkey  --------------------------------------------------
B D                       Dog  ==================================================
B D                 Armadillo  ==================================================
B D                  Bushbaby  ==================================================
           Ma's night monkey  ==================================================
         White-faced sapajou  ==================================================
B D                  Marmoset  ==================================================
             Angolan colobus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Drill  --------------------------------------------------
B D              Green monkey  ==================================================
              Sooty mangabey  ==================================================
          Pig-tailed macaque  ==================================================

Inserts between block 34 and 35 in window
B D                    Chimp 449bp

Alignment block 35 of 49 in window, 3670045 - 3670061, 17 bps 
B D                     Human  ctct-------------------------------------------gcaggcggcagg-t
B D                    Bonobo  ctctgcaggcggcaggccggggagggagctggggtaaggaacctggggcaggcggcagg-t
B D                   Gorilla  ctct-------------------------------------------gcaggcggcaggcc
B D                 Orangutan  ------------------------------------------ctggggcaggcggcaggcc
B D                    Gibbon  ------------------------------------------ctggggcaggc-gcaagct
B D                    Rhesus  ---------------------------------------------------gcggcagg--
B D       Crab-eating macaque  ---------------------------------------------------gcggcaggc-
                       Baboon  ------------------------------------------ctggggca-gcggcaggc-
                        Drill  ----------------------------------------------------cggcaggc-
B D          Proboscis monkey  --------------------------------------------------------aggc-
B D  Golden snub-nosed monkey  --------------------------------------------------------aggc-
      Black snub-nosed monkey  ---------------------------------------------------gggggagg--
B D                     Mouse  =============================================================
             Sclater's lemur  =============================================================
                 Mouse lemur  =============================================================
           Coquerel's sifaka  =============================================================
                 Black lemur  =============================================================
B D                   Tarsier  =============================================================
B D           Squirrel monkey  -------------------------------------------------------------
B D                       Dog  =============================================================
B D                 Armadillo  =============================================================
B D                  Bushbaby  =============================================================
           Ma's night monkey  =============================================================
         White-faced sapajou  =============================================================
B D                  Marmoset  =============================================================
             Angolan colobus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D              Green monkey  =============================================================
              Sooty mangabey  =============================================================
          Pig-tailed macaque  =============================================================
B D                     Chimp  =============================================================

Inserts between block 35 and 36 in window
B D                   Rhesus 2bp
B D      Crab-eating macaque 1bp
                      Baboon 1bp
                       Drill 1bp

Alignment block 36 of 49 in window, 3670062 - 3670103, 42 bps 
B D                     Human  ggggag------------gggactgcggtcaggaacctggggcaggcggcaggt-
B D                    Bonobo  ggggag------------ggggctgcggtcaggaacctggggcaggcggcaggt-
B D                   Gorilla  agggag------------ggagctggggtcaggaacctggggcaggcggcaggt-
B D                 Orangutan  ggggag------------ggggctggggtcgggaatctggggcaggcggcaggc-
B D                    Gibbon  ggggagggggctggggtcggggctggggtcaggaacctggggcaggcggcaggc-
B D                    Rhesus  ggggaa------------g------------------------------------
B D       Crab-eating macaque  ggggaa------------g------------------------------------
           Pig-tailed macaque  ggggaa------------ggggccggggtcaggagcctggggca-gcggcaggcc
                       Baboon  ggggaa------------ggggccggggtcaggagcctggggca-gcggcaggcc
                        Drill  ggggaa------------ggcgccggggtcaggagcccggggca-gcagcaggcc
B D          Proboscis monkey  ggggga------------gggaacggggtcaggagcctggggca-gcggcaggcc
B D  Golden snub-nosed monkey  ggggga------------ggggccggggtcaggagcctggggca-gcggcaggcc
      Black snub-nosed monkey  --------------------ggccggggtcaggagcctggggca-gcggcaagcc
B D                     Mouse  =======================================================
             Sclater's lemur  =======================================================
                 Mouse lemur  =======================================================
           Coquerel's sifaka  =======================================================
                 Black lemur  =======================================================
B D                   Tarsier  =======================================================
B D           Squirrel monkey  -------------------------------------------------------
B D                       Dog  =======================================================
B D                 Armadillo  =======================================================
B D                  Bushbaby  =======================================================
           Ma's night monkey  =======================================================
         White-faced sapajou  =======================================================
B D                  Marmoset  =======================================================
             Angolan colobus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D              Green monkey  =======================================================
              Sooty mangabey  =======================================================
B D                     Chimp  =======================================================

Inserts between block 36 and 37 in window
B D                  Gorilla 457bp
B D                   Gibbon 1bp

Alignment block 37 of 49 in window, 3670104 - 3670144, 41 bps 
B D                     Human  ggggagggggct------------ggggtcaggagcct-ctgcaggcggcagg-t
B D                     Chimp  ggggagggggct------------ggggtcaggagcct-ctgcaggcggcagg-t
B D                    Bonobo  ggggagggggct------------ggggtcaggagcct-ctgcaggcggcagg-t
B D                   Gorilla  ggggagggggct------------ggggtcaggagcct-ctgcaggcggcagg-t
B D                 Orangutan  ggggagggggctggggtcggggcaggggtcaggagcct-ctgcaggcactaggcc
B D                    Gibbon  ggggagggggct------------ggggtcaggaacctggggcagggggcaggcc
B D                    Rhesus  -------gggcc------------ggggtcaggaggct-tag-----ggcagg-c
B D       Crab-eating macaque  -------gggcc------------ggggtcaggaggct-tag-----ggcagg-c
           Pig-tailed macaque  ggggaaggggcc------------ggggtcaggaggct-tag-----ggcagg-c
                       Baboon  ggggaagggacc------------ggggtcaggaggct-cag-----ggcagg-c
                        Drill  ggggaaggggcc------------ggggtcaggaggct-cag-----ggcagg-c
B D          Proboscis monkey  ggggaaggggcc------------ggggtcaggaggct-cag-----ggcagg-c
B D  Golden snub-nosed monkey  ggggaaggggcc------------ggggtcaggaggct-cag-----ggcagg-c
      Black snub-nosed monkey  ggggaaggggcc------------ggggtcaggaggct-cag-----ggcagg-c
B D                     Mouse  =======================================================
             Sclater's lemur  =======================================================
                 Mouse lemur  =======================================================
           Coquerel's sifaka  =======================================================
                 Black lemur  =======================================================
B D                   Tarsier  =======================================================
B D           Squirrel monkey  -------------------------------------------------------
B D                       Dog  =======================================================
B D                 Armadillo  =======================================================
B D                  Bushbaby  =======================================================
           Ma's night monkey  =======================================================
         White-faced sapajou  =======================================================
B D                  Marmoset  =======================================================
             Angolan colobus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D              Green monkey  =======================================================
              Sooty mangabey  =======================================================

Inserts between block 37 and 38 in window
B D                   Rhesus 1bp
B D      Crab-eating macaque 1bp
          Pig-tailed macaque 1bp
                      Baboon 38bp
                       Drill 1bp
B D         Proboscis monkey 1bp
B D Golden snub-nosed monkey 1bp
     Black snub-nosed monkey 1bp

Alignment block 38 of 49 in window, 3670145 - 3670189, 45 bps 
B D                     Human  ggggagggggccgcattcgagacgctggtgggcccctgcagtcgt
B D                     Chimp  ggggagggggccgcgttcgagacgctggtgggcccctgcagtcgt
B D                    Bonobo  ggggagggggccgcgttcgagacgctggtgggcccctgcagtcgt
B D                   Gorilla  ggggagggggccgcattccagatgctggtgggcccctgcagtcgt
B D                 Orangutan  ggggagggggccgcatccgagacgctggtgggcccctgtagtcat
B D                    Gibbon  agggagggggccgcatccaagacgctggtgggcccctgtagtcgt
B D                    Rhesus  ggggagggggccgcatccgagacgctggtggggccctgttgtcgt
B D       Crab-eating macaque  ggggagggggcagcatccgagacgttggtggggccctgttgtcgt
           Pig-tailed macaque  ggggagggggccgcatccgagacgctggtggggccctgttgtcgt
               Sooty mangabey  ggggagggggccgcatccgagacgctggtggggccctgttgtcgt
                       Baboon  ggggagggggccgcatctgagacgctggtggggccctgttgtcgt
B D              Green monkey  ggggagggggccgcatccgagacgctggtggggccctgttgtcgt
                        Drill  ggggagggggccgcatccgagacgctggtggggccctgttgttgt
B D          Proboscis monkey  ggggagggggc-gcatccgagacgctggtggggccctgttgtcgt
B D  Golden snub-nosed monkey  ggggagggggc-gcatccgagacgctggtggggccctgttgtcat
      Black snub-nosed monkey  ggggagggggc-gcatccgagacgctggtggggccctgttgtcgt
B D                  Marmoset  ggggagggggctacaaccgagaggcgggtaaggccc-gtggccac
B D           Squirrel monkey  ggggagggagcctcaactgagacacgggtaaggcct-gtgaccac
B D                     Mouse  =============================================
             Sclater's lemur  =============================================
                 Mouse lemur  =============================================
           Coquerel's sifaka  =============================================
                 Black lemur  =============================================
B D                   Tarsier  =============================================
B D                       Dog  =============================================
B D                 Armadillo  =============================================
B D                  Bushbaby  =============================================
           Ma's night monkey  =============================================
         White-faced sapajou  =============================================
             Angolan colobus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 39 of 49 in window, 3670190 - 3670220, 31 bps 
B D                     Human  ggtcagtccccacgcctgcctgagggtgcgg
B D                     Chimp  ggtcagtccccacgcctgcctgagggtgcgg
B D                    Bonobo  ggtcagtccccacgcctgcctgagggtgcgg
B D                   Gorilla  ggtcagtccgaacgcctgcctgagggtgcgg
B D                 Orangutan  ggtcagtccccatgcctgcctgagggtgcgg
B D                    Gibbon  ggtcagtccccatgcctgcctgagggtgcgg
B D                    Rhesus  gatcagtccccatgcctgcctgggggtgcgg
B D       Crab-eating macaque  gatcagtccccatgcctgcctgggggtgcgg
           Pig-tailed macaque  gatcagtccccatgcctgcctgggggtgtgg
               Sooty mangabey  gatcagtccccatgcctgcctgggggtgcgg
                       Baboon  gatcagtccccatgcctgcctgggggtgcgg
B D              Green monkey  gatcagtccccatgcctgcctgggggtgcgg
                        Drill  gatcagtccccatgcccgcctgggggtgcgg
B D          Proboscis monkey  gatcagtccccatgcctgcctgggggtgcgg
B D  Golden snub-nosed monkey  gatcagtccccatgcctgcctgggggtgcgg
      Black snub-nosed monkey  gatcagtccccatgcctgcctgggggtgcgg
B D                  Marmoset  ggtcagtccccatgcctgcctgggggctcca
B D           Squirrel monkey  agtcagtccccatgcctgcctgggggttcca
          White-faced sapajou  ggtcagtccccatgcctgcctgggggttccg
B D                     Mouse  ===============================
             Sclater's lemur  ===============================
                 Mouse lemur  ===============================
           Coquerel's sifaka  ===============================
                 Black lemur  ===============================
B D                   Tarsier  ===============================
B D                       Dog  ===============================
B D                 Armadillo  ===============================
B D                  Bushbaby  ===============================
           Ma's night monkey  ===============================
             Angolan colobus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 40 of 49 in window, 3670221 - 3670227, 7 bps 
B D                     Human  ggttgga
B D                     Chimp  ggttgga
B D                    Bonobo  ggttgga
B D                   Gorilla  ggttgga
B D                 Orangutan  agttgga
B D                    Gibbon  ggctgga
B D                    Rhesus  ggttgga
B D       Crab-eating macaque  ggttgga
           Pig-tailed macaque  ggttgga
               Sooty mangabey  ggttgga
                       Baboon  ggttgga
B D              Green monkey  ggttgga
                        Drill  ggttgga
B D          Proboscis monkey  ggttgga
B D  Golden snub-nosed monkey  ggttgga
      Black snub-nosed monkey  ggttgga
B D                  Marmoset  gactgga
B D           Squirrel monkey  gattggg
          White-faced sapajou  gattggg
B D                   Tarsier  ggctgga
B D                     Mouse  =======
             Sclater's lemur  =======
                 Mouse lemur  =======
           Coquerel's sifaka  =======
                 Black lemur  =======
B D                       Dog  =======
B D                 Armadillo  =======
B D                  Bushbaby  =======
           Ma's night monkey  =======
             Angolan colobus  NNNNNNN

Alignment block 41 of 49 in window, 3670228 - 3670466, 239 bps 
B D                     Human  cggtgtccctccgacattcacgtccttccaagaacctcagcctgcaaccgtatttggaaagagagtcttt
B D                     Chimp  cggtgtccccccgacattcacgtccttccaagaacctcagcctgcaaccgtatttggaaagagagtcttt
B D                    Bonobo  cggtgtccccccgacattcacgtccttccaagaacctcagcctgcaaccgtatttggaaagagagtcttt
B D                   Gorilla  cggtgtcccccggacattcacgtccttccaagaacctcagcctgcaaccgtatttggaaagagagtcttt
B D                 Orangutan  cagtgtccccccgacattcacgtccttccaagaacctcagcctgcaaccgtatttggaa--agagtcttt
B D                    Gibbon  cagtgtccccccgacattcacgtccttccaagaacctcagcctgcaaccatatttggaaagagagtcttt
B D                    Rhesus  cagtgtccccccgacgttcacgtccttccaagaacctcagcctgcaaccttatttggaaagacagtctct
B D       Crab-eating macaque  cagtgtccccccgacgttcacgtccttccaagaacctcagcctgcaaccttatttggaaagacagtctct
           Pig-tailed macaque  cagtgtccccccgacgttcacgtccttccaagaacctcagcctgcaaccttatttggaaagacaatctct
               Sooty mangabey  cagcgtccccccgacgttcacgtccttccaagaacctcagcctgcaaccttatttggaaagacagtctct
                       Baboon  cagtgtccccccgacgttcacgtccttccaagaacctcagcctgcaaccttatttggaaagacagtctct
B D              Green monkey  cagtgtccccccgacgttcacgtccttccaagaacctcagcctgcaaccttatttggaaagacagtctct
                        Drill  cagtgtccccccgacgttcacgtccttccaagaacctcagcctgcaaccttatttggaaagacagtctct
B D          Proboscis monkey  cagtgtccccccgacattcacgtccttccaagagcctcagcctgcaaccttatttggaaagacagcctct
B D  Golden snub-nosed monkey  cagcgtccccccgacgttcacgtccttccaagaacctcagcctgcaaccttatttggaaagacagcctct
      Black snub-nosed monkey  cagtgtccccccgacgttcacgtccttccaagaacctcagcctgcaaccttatttggaaagacagcctct
B D                  Marmoset  cagtgtgccccc-acattcacatccctcaaagaacctcagcaggcaaccttatttagaa--agag----t
B D           Squirrel monkey  cagtgtgccccc-acgttcacgtccctcaaagaacctcagccggcaaccttatttagaaacagag----t
          White-faced sapajou  cagtgtgccccc-acattcacgtccctcaaagaacctcagaaggcaaccttatttagaaagagag----t
B D                   Tarsier  cag-gcccccccg----ccaagtgcttccaggaagcccag--tacggccttatgtggaagg--aggcctc
B D                  Bushbaby  ccctgtcccctccaaattcatgtccttgcagtaacctcagaacatgaccttatttggaaag--agtcttt
B D                     Mouse  ======================================================================
             Sclater's lemur  ======================================================================
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
                 Black lemur  ======================================================================
B D                       Dog  ======================================================================
B D                 Armadillo  ======================================================================
           Ma's night monkey  ======================================================================
             Angolan colobus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  gctgatgtcattgggtaagatgaggtcatgccggagtggggtgggccctggatcc------accgctgtc
                        Chimp  gctgatgtcattgggtaagataaggtcgtgccggagtggggtgggccctggatcc------accgctgtc
                       Bonobo  gctgatgtcattgggtaagatgaggtcgtgccggagtggggtgggccctggatcc------accgctgtc
                      Gorilla  gctgatgtcattgggtaagatgaggtcgtgctggagtggggtgggccctggatcc------accgctgtc
                    Orangutan  gctgatgtcactgggtaagatgaggtcgtgccggagtgggatgggccctggatct------gccgctgtc
                       Gibbon  gctgatgtcattgggtaagatgaggtcgtgccagagtggggtgggccctggatcc------gccgctgtc
                       Rhesus  gctgatgtcactgggtaagatgaggtcgtgccggagtagggtgggccctggatcc------gctgctgtc
          Crab-eating macaque  gctgatgtcactgggtaagatgaggtcgtgccggagtagggtgggccctggatcc------gctgctgtc
           Pig-tailed macaque  gctgatgtcactgggtaagatgaggtcgtgccggagtagggtgggccctggatcc------gctgctatc
               Sooty mangabey  gctgatgtcactgggtaagatgaggtcgtgccggagtagggtgggccctggatcc------gctgctgtc
                       Baboon  gctgatgtcactgggtaagatgaggtcgtgccggagtagggtgggccctggatcc------gctgctgtc
                 Green monkey  gctgatgtcattgggtaagatgaggtcgtgccggagtagggtgggccctggatcc------gctgctgtc
                        Drill  gctgatgtcactgggtaagatgaggtcgtgccggagtagggtgggccctggatcc------gctgctgtc
             Proboscis monkey  gctgatgtcactgggtaagatgaggtcgtgccggaggagggtgggccctggatcc------gctgctgtc
     Golden snub-nosed monkey  gctgatgtcactgggtaagatgaggtcgtgccggagcagggtgggccctggatcc------gctgctgtc
      Black snub-nosed monkey  gctgatgtcactgggtaagatgaggtcgtgccggagcagggtgggccctggatcc------gctgctgtc
                     Marmoset  gctgacgtcattgggtaagatgaggtcgagctggagtggggcggggcctagatccctggtggctgctgtc
              Squirrel monkey  gctgacgtcactgggtaagatgaggtcgtgctggagtggggcggggcctagatccctggcggctgctgtc
          White-faced sapajou  gctgacgtcattgggtaagatgaggtcgtgctggagtggggcggggcccagatccgtctcggctgctgtc
                      Tarsier  gatgacgccac-aggtgggatgagggcatgct-----------ggtcccagagg-------gctgatgtc
                     Bushbaby  gctgatgtcattagctgggatgaagttgtgctgg---ggggtaggccccag-tccaacaggactgatgtc
                        Mouse  ======================================================================
              Sclater's lemur  ======================================================================
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
                  Black lemur  ======================================================================
                          Dog  ======================================================================
                    Armadillo  ======================================================================
            Ma's night monkey  ======================================================================
              Angolan colobus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  cttataagagaagccgctcagggaggccaagatgccgtgtg-gggtggaggcgggg---agggcaccact
                        Chimp  cttattagagaagccgctcagggaggccaagatgccgtgtg-gggtggaggcgggg---agggcaccact
                       Bonobo  cttattagagaagccgctcagggaggccaagatgccgtgtg-gggtggaggcgggg---agggcaccact
                      Gorilla  cttataagagaagccgctcagggaggccaagatgccgtgtg-gggtggaggcgggg---agggcaccact
                    Orangutan  cttataagagaagccgcctggggaggccaagatgccgtgtg-gggtggaggcgggg---agggcaccgct
                       Gibbon  cttataagagaaatcgctcggggaggccaagatgccgtgtg-gggtggaggcgggg---agggtgctgct
                       Rhesus  cttataagagaagccgctcggagaggccaagatgccatgtg-gggtggaggcgggg---agggcacagct
          Crab-eating macaque  cttataagagaagccgctcggagaggccaagatgccatgtg-gggtggaggcgggg---agggcacagct
           Pig-tailed macaque  cttataagagaagccgctcggagaggccaagatgccatgtg-gggtggaggcgggg---agggcacagct
               Sooty mangabey  cttataagagaagccactcggagaggccaagatgccatgtg-gggtggaggcaggg---agggcaccact
                       Baboon  cttataagagaagccgctcggagaggccaagatgccatgtg-gggtggaggcgggg---agggcaccgct
                 Green monkey  cttataagagaagccgctcggagaggccaagatgccatgtg-gggtggaggcgggg---agggcaccgct
                        Drill  cttataagagaagccgcttggagaggccaagatgccatgtg-gggtggaggcgggg---agggcaccgct
             Proboscis monkey  cttataagagaagccactcggagaggccaagatgccatggg-gggtggaggcgggg---agggcactgct
     Golden snub-nosed monkey  cttataagagaagccactcggagaggccaagatgccatggg-gggtggaggcgggg---agggcactgct
      Black snub-nosed monkey  cttataagagaagccactcggagaggccaagatgccatggg-gggtggaggcgggg---agggcactgct
                     Marmoset  cttata--agaagccccatggagaggccaagacgcc--tgg-ggatggaggcatgg---cgggaaccact
              Squirrel monkey  cttata--agaagccccacggagaggccaagacgcc--tgg-ggatggaggcaggg---cgggaaccgct
          White-faced sapajou  cttata--agaagccccgcagagaggccaagacgcc--tgg-ggatggaggtgggg---caggaacctct
                      Tarsier  cttgtaagagacaccac---aggagg------------ggg-agacggaggccagg---gatgcactgct
                     Bushbaby  cttataagaagag-----aagagctacagggacaccacttgaggatggaggcagagatcagggtcatgct
                        Mouse  ======================================================================
              Sclater's lemur  ======================================================================
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
                  Black lemur  ======================================================================
                          Dog  ======================================================================
                    Armadillo  ======================================================================
            Ma's night monkey  ======================================================================
              Angolan colobus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  cctccaggccctgaaac----gccaaggatgcc-----------------cggaggcacc
                        Chimp  cctccaggccctgaaac----gccaaggatgcc-----------------cggaggcacc
                       Bonobo  cctccaggccctgaaac----gccaaggatgcc-----------------cggaggcacc
                      Gorilla  cctccaggccctgaaac----gccaaggatgcccagaggcaccaggagcacagaggcacc
                    Orangutan  cctccaggccctgaatc----gccaaggatgcc-----------------tggaggcacc
                       Gibbon  cctccagggcctgaagc----accaaggatgcc-----------------cggaggcacg
                       Rhesus  cctgcaggcccagagac----gccaaggatgcc-----------------cggaggcacg
          Crab-eating macaque  cctgcaggcccagagac----gccaaggatgcc-----------------cggaggcacg
           Pig-tailed macaque  cctgcaggcccagagac----gccaaggatgcc-----------------cagaggcacg
               Sooty mangabey  cctgcaggcccagagac----gccaaggatgcc-----------------cggaggcacg
                       Baboon  cctgcaggcccagagac----accaaggatgcc-----------------tggaggcacg
                 Green monkey  cctgcaggcccagagac----gccaaggatgcc-----------------cggaggcacg
                        Drill  cctgcaggcccagagac----gccaaggatgcc-----------------cggaggcacg
             Proboscis monkey  cctgtaggcccagagac----gccaaggatgcc-----------------cggaggcacg
     Golden snub-nosed monkey  cctgcaggcccagagat----gccaaggatgcc-----------------cggaggcacg
      Black snub-nosed monkey  cctgcaggcccagagat----gccaaggatgcc-----------------cggaggcacg
                     Marmoset  cctccaggcccagaaa------ccaaggatgcc-----------------cggaggcagc
              Squirrel monkey  cctccaggcccagaaac----gccaaggatgcc-----------------cgggggcacc
          White-faced sapajou  cctccaggcccagaaacgccagctaaggatgcc-----------------tgggggcacg
                      Tarsier  c--------------------accaggcacgac-----------------ccc-------
                     Bushbaby  t-tacatgtcaaggaac----acccaggatgct-----------------gaccaccact
                        Mouse  ============================================================
              Sclater's lemur  ============================================================
                  Mouse lemur  ============================================================
            Coquerel's sifaka  ============================================================
                  Black lemur  ============================================================
                          Dog  ============================================================
                    Armadillo  ============================================================
            Ma's night monkey  ============================================================
              Angolan colobus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 42 of 49 in window, 3670467 - 3670645, 179 bps 
B D                     Human  -------aggagcag-aggggtgtg----gagc-ttctccgaggtcggtcgggagggcagagccctgccc
B D                     Chimp  -------aggagcag-aggggtgtg----gagc-ttctccaccgtcggtcgggagggcagagccctgccc
B D                    Bonobo  -------aggagcag-aggggtgtg----gagc-ttctccaccgtcagtcgggagggcagagccctgccc
B D                   Gorilla  -------aggagcag-aggggtgtg----gagc-ttctccgcggtcggtcgggagggcagagccctgccc
B D                 Orangutan  -------aggagcag-aggggtgtg----gagc-ttctctgcggtcggtcgggagggcagagacctgccc
B D                    Gibbon  -------aggggcag-aggggcgtg----gagc-ttctcccaggtcggtcg---gggcagagccctgccc
B D                    Rhesus  -------cggagcag-aggggcgtg----aagc-ttctccacggtgggtcgggagggtgcagccctgccc
B D       Crab-eating macaque  -------cggagcag-aggggcgtg----aagc-ttctccacggtgggtcgggagggtgcagccctgccc
           Pig-tailed macaque  -------cggagcag-aggggcgtg----aagc-ttctccacggtgggtcgggagggtgcagccctgccc
               Sooty mangabey  -------cggagcag-aggggcgtg----aagc-ttctccacggtgggtcgggagggtgcagccctgccc
                       Baboon  -------cggagcag-aggggcatg----aagc-ttttccacggtgggtcgggagggtgcagccctgccc
B D              Green monkey  -------aggagcag-aggggcgtg----aagc-ttctccacggtgggtcgggagggtgcagccctgccc
                        Drill  -------cggagcag-aggggcgtg----aagc-ttctccacggtgggtcgggagggtgcagccctgccc
B D          Proboscis monkey  -------aggagcag-aggggcgtg----aagt-ttctccacggtgggtcgggaaggcgcagccctgccc
              Angolan colobus  -------aggagcag-aggggcgtg----aagc-ttctccacggtgggtcgggagggcgcagccctgccc
B D  Golden snub-nosed monkey  -------aggagcag-aggggcgtg----aagt-ttctccacggtgggtcgggaaggcgcagccctgccc
      Black snub-nosed monkey  -------aggagcag-aggggcgtg----aagt-ttctccacggtgggtcgggaaggcgcagccctgccc
B D                  Marmoset  -------aggagcag-ggaggcgtggagagagc-ttctccccagctgg-----agggcgcagctctgccc
B D           Squirrel monkey  -------aggagcagaggaggtgtggagagagt-ttcccccc-gttgg-----agggtgcagccctgccc
          White-faced sapajou  -------aggagcagaggaggcgtggagagagc-ttctccccggttgg-----agggcgcagccctgccc
B D                   Tarsier  -------aggagcgg-ggagggccg----ga---------------------------------------
B D                  Bushbaby  gggagctaggagaag-cctgggatg----gaccatgcctcatggcc--tcaggaggacccagcactgccc
B D                     Mouse  ======================================================================
             Sclater's lemur  ======================================================================
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
                 Black lemur  ======================================================================
B D                       Dog  ======================================================================
B D                 Armadillo  ======================================================================
           Ma's night monkey  ======================================================================

                        Human  actcctggacctcaggctcctggcctccagagctgagccagaacaaacgcctgttcaaggcctgctgctc
                        Chimp  actcctggacctcgggctcctggcctccagagctgagccagaacaaatgcctgttcaaggcctgctgctc
                       Bonobo  actcctggacctcgggctcctggcctccagagctgagccagaacaaatgcctgttcaaggcctgctgctc
                      Gorilla  actcctggacgtcgggctcctggcctccagagcagagccagaacaaacgcctgttcaaggcctgctgctc
                    Orangutan  gctcctggacctcgggctcctggcctccagagctgagccagaacaaacgtctgttcaaggcctgctgctc
                       Gibbon  gctcctggacctcgggctcctggcctccagagctgagccagaacagacgcctgttcaaggcctgctgctc
                       Rhesus  actcctggacctcgggcttctggcctccagagcagagccagaacaaatgcctgttccaggcttgctgctc
          Crab-eating macaque  actcctggacctcgggcttctggcctccagagcagagccagaacaaatgcctgttccaggcttgctgctc
           Pig-tailed macaque  actcctggacctcgggcttctggcctccagagcagagccagaacaaatgcctgttccaggcttgctgctc
               Sooty mangabey  actcctggacctcgggcttctggcctccagagcagagccagaacaaatgcctgttccaggcttgctgctc
                       Baboon  actcctggacctcgggcttctggcctccagagcagagccagaacaaatgcctgttccaggcttgctgctc
                 Green monkey  actcctggacctcgggcctctggcctccagagcagagccagaacaaatgcctgttccaggcttgctgctc
                        Drill  actcctggacctcgggcttctggcctccagagcagagccagaacaaatgcctgttccaggcttgctgctc
             Proboscis monkey  actcctggacctcgggc-tctggcttccagagcagagccagaacaaacgcctgttcaaggcttgctgctc
              Angolan colobus  actcctggacctcgggc-tctggcctccagagcagagccagaacaaacgcctgttcaaggcttgctgctc
     Golden snub-nosed monkey  actcctggacctcgggc-tctggcttccagagcagagccagaacaaacgcctgttcaaggcttgctgctc
      Black snub-nosed monkey  actcctggacctcgggc-tctggcttccagagcagagccagaacaaacgcctgttcaaggcttgctgctc
                     Marmoset  acaccaggagct-gggctccgggcctccaga-ccgggccagaactaatgcctgttcacggcctgctgctc
              Squirrel monkey  acaccgggagct-gggctccgggcctccagagccgggccagaacaaacgcctgttcacggtctgcggctc
          White-faced sapajou  ataccgggagct-gggctccgagcctcaagagccaggccagaacaaacgcctgttcacggcctgctgctc
                      Tarsier  ------------------------ctccagagcagagcgaggacaggtccc-----------tgctgctc
                     Bushbaby  aaaacttgaccttggac--------ttcagaaccaagcaagaataaac------------cctggttttc
                        Mouse  ======================================================================
              Sclater's lemur  ======================================================================
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
                  Black lemur  ======================================================================
                          Dog  ======================================================================
                    Armadillo  ======================================================================
            Ma's night monkey  ======================================================================

                        Human  caagc-cccccagtcccggggactttgtctgggcagcccagga----c-ctcacacgg-----
                        Chimp  caagc-cccccagtcctggggactttgtctgggcagcccagga----c-cttacacgg-----
                       Bonobo  caagc-cccccagtcccggggactttgtctgggcagcccagga----c-ctcacacag-----
                      Gorilla  caag--cccccagtcccggggactttgtctgggcagcccagga----c-ctcacacgg-----
                    Orangutan  caagc-cccccagtcccggggactttgtctgggcagcccagga----c-ctcacgtgg-----
                       Gibbon  ------cccccagtcctggggactttgtctgggcagcccagga----c-ctcacacgg-----
                       Rhesus  caagc-cccccagtcccagggactttgtctgggcagccgagga----c-ctcacaccg-----
          Crab-eating macaque  caagc-cccccagtcccagggactttgtctgggcagccgagga----c-ctcacaccg-----
           Pig-tailed macaque  caagc-cccccagtcccagggactttgtctgggcagccaagga----c-ctcacaccg-----
               Sooty mangabey  caagc-cccccagtcccagggactttgtctgggcagcccagga----c-ctcacaccg-----
                       Baboon  caagc-cccccagtcccagggactttgtctgggcagcccagga----c-ctcacactg-----
                 Green monkey  caagc-cccgccgtcccagagactttgtctgggcagcacagga----c-ctcacatgg-----
                        Drill  caagc-cccccagtcccagggactttgtctgggcagcccagga----c-ctcacaccg-----
             Proboscis monkey  caagc-cccccagtcccagggactttgtctgggcagcccagga----c-ctcacacgg-----
              Angolan colobus  caagc-cccccagtcccagggactttgtctgggcagcccagga----c-ctcacacgg-----
     Golden snub-nosed monkey  caagc-cccccagtcccagggactttgtctgggcagcccagga----c-ctcacacgg-----
      Black snub-nosed monkey  caagc-cccccagtcccagggactttgtctgggcagcccagga----c-ctcacacgg-----
                     Marmoset  tgtgc-cccccagtccctgggac----tctgggcagcccaggc----c-ct-ccccg------
              Squirrel monkey  --tgc-cacccagtccccgggac----tctgggcagcccaggc----c-ctcccccg------
          White-faced sapajou  --tgcgcccccagtccctgggac----tctgggcagcccaggc----c-ctgccccg------
                      Tarsier  cacgg-ccctgggt----gtgggtccatc-acgcagcccagggacacc-cacacactg-----
                     Bushbaby  taagt-cccccaggtcatgggcctttgt-tagcaaccccagga----cactcgcacatcacgg
                        Mouse  ===============================================================
              Sclater's lemur  ===============================================================
                  Mouse lemur  ===============================================================
            Coquerel's sifaka  ===============================================================
                  Black lemur  ===============================================================
                          Dog  ===============================================================
                    Armadillo  ===============================================================
            Ma's night monkey  ===============================================================

Inserts between block 42 and 43 in window
B D                Orangutan 760bp
B D                   Rhesus 5bp
B D      Crab-eating macaque 5bp
          Pig-tailed macaque 5bp
              Sooty mangabey 5bp
                      Baboon 5bp
B D             Green monkey 5bp
                       Drill 5bp
B D         Proboscis monkey 5bp
             Angolan colobus 5bp
B D Golden snub-nosed monkey 5bp
     Black snub-nosed monkey 5bp

Alignment block 43 of 49 in window, 3670646 - 3670648, 3 bps 
B D                     Human  agc
B D                     Chimp  agc
B D                    Bonobo  agc
B D                   Gorilla  agc
B D                    Gibbon  ggc
B D                    Rhesus  ggc
B D       Crab-eating macaque  ggc
           Pig-tailed macaque  ggc
               Sooty mangabey  ggc
                       Baboon  ggc
B D              Green monkey  ggc
                        Drill  ggc
B D          Proboscis monkey  ggc
              Angolan colobus  ggc
B D  Golden snub-nosed monkey  ggc
      Black snub-nosed monkey  ggc
B D                  Marmoset  -ac
B D           Squirrel monkey  -ac
          White-faced sapajou  -ac
B D                  Bushbaby  atc
B D                     Mouse  ===
             Sclater's lemur  ===
                 Mouse lemur  ===
           Coquerel's sifaka  ===
                 Black lemur  ===
B D                   Tarsier  ---
B D                 Orangutan  ===
B D                       Dog  ===
B D                 Armadillo  ===
           Ma's night monkey  ===

Inserts between block 43 and 44 in window
B D                   Gibbon 5bp

Alignment block 44 of 49 in window, 3670649 - 3670672, 24 bps 
B D                     Human  cctccagtgaggaccccagccctg
B D                     Chimp  cctccagtgaggaccccagccctg
B D                    Bonobo  cctccagtgaggaccccagccctg
B D                   Gorilla  cctccagtgaggaccccagccctg
B D                 Orangutan  cctccagtgaggaccccagccctg
B D                    Gibbon  cctccagtgaggaccccagccccg
B D                    Rhesus  cctccagtgcggaccccggccctg
B D       Crab-eating macaque  cctccagtgcggaccccggccctg
           Pig-tailed macaque  cctccagtgcggaccccggccctg
               Sooty mangabey  cctccagtgaggaccccagtcctg
                       Baboon  cctccagtgaggaccccagtcctg
B D              Green monkey  cctccagtgaggaccccagccctg
                        Drill  cctccagtgaggaccccagtcctg
B D          Proboscis monkey  cctccagtgaggaccccagccctg
              Angolan colobus  cctccagtgaggaccccagccctg
B D  Golden snub-nosed monkey  cctccagtgaggaccccagccctg
      Black snub-nosed monkey  cctccagtgaggaccccagccctg
B D                  Marmoset  tctccagtgagga-tccagccctg
B D           Squirrel monkey  tctccagtgagga-tcca-ccctg
          White-faced sapajou  tctctagtgagga-ttcagcccgg
B D                   Tarsier  ---------------------ctg
B D                  Bushbaby  -------tctggtttccatgccca
B D                     Mouse  ========================
             Sclater's lemur  ========================
                 Mouse lemur  ========================
           Coquerel's sifaka  ========================
                 Black lemur  ========================
B D                       Dog  ========================
B D                 Armadillo  ========================
           Ma's night monkey  ========================

Alignment block 45 of 49 in window, 3670673 - 3670676, 4 bps 
B D                     Human  ggtg
B D                     Chimp  ggtg
B D                    Bonobo  ggtg
B D                   Gorilla  ggtg
B D                 Orangutan  ggtg
B D                    Gibbon  ggt-
B D                    Rhesus  cacg
B D       Crab-eating macaque  cacg
           Pig-tailed macaque  catg
               Sooty mangabey  cctg
                       Baboon  catg
B D              Green monkey  cacg
                        Drill  catg
              Angolan colobus  cacg
B D  Golden snub-nosed monkey  cacg
      Black snub-nosed monkey  cacg
B D                  Marmoset  ggtg
B D           Squirrel monkey  ggtg
          White-faced sapajou  ggtg
B D                   Tarsier  ggtg
B D                  Bushbaby  ggca
B D                     Mouse  ====
             Sclater's lemur  ====
                 Mouse lemur  ====
           Coquerel's sifaka  ====
                 Black lemur  ====
B D          Proboscis monkey  ====
B D                       Dog  ====
B D                 Armadillo  ====
           Ma's night monkey  ====

Alignment block 46 of 49 in window, 3670677 - 3670705, 29 bps 
B D                     Human  gga--gggggcgtacttctcaagg-cagcaag------
B D                     Chimp  gga--gggggcgtacttctcaagg-cagcaag------
B D                    Bonobo  gga--gggggcgtacttctcaagg-cagcaag------
B D                   Gorilla  gga--gggggcgtacttctcaagg-caggaag------
B D                 Orangutan  gga--gggggcgtactcctcaagg-cagcaag------
B D                    Gibbon  gga--gggggcgtacttttcaagg-cagcaag------
B D                    Rhesus  gga---ggggcatacttctcgagg-cagccag------
B D       Crab-eating macaque  gga---ggggcgtacttctcgagg-cagccag------
           Pig-tailed macaque  gga---ggggcgtacttctcgagg-cagccag------
               Sooty mangabey  gga--gggggcgtacttctcgagg-cagccag------
                       Baboon  gga--gggggcgtacttctcgagg-cagccag------
B D              Green monkey  gga---ggggcgtacttctcgagg-cagccag------
                        Drill  gga--gggggcgtacttctcgagg-cagccag------
              Angolan colobus  gga--gaaggcgtacttctcgagg-cagccag------
B D  Golden snub-nosed monkey  gga--gggggcgtacttctcgagg-cagccag------
      Black snub-nosed monkey  gga--gggggcgtacttctcgagg-cagccag------
B D                  Marmoset  gga---ggg--gtacttctcgagg-cagctgg------
B D           Squirrel monkey  gga---cggatgtacctctcaagg-cagctcg------
          White-faced sapajou  gga---cagatgtacttctcgagg-cagctgg------
B D                   Tarsier  gga--ggggccac-------------------------
B D                  Bushbaby  ggaggggggatgtgtcttttgaag-taacaaa------
B D                 Armadillo  gga--gggggcgggcggctcagggacactcaggtcagg
B D                     Mouse  ======================================
             Sclater's lemur  ======================================
                 Mouse lemur  ======================================
           Coquerel's sifaka  ======================================
                 Black lemur  ======================================
B D          Proboscis monkey  ======================================
B D                       Dog  ======================================
           Ma's night monkey  ======================================

Alignment block 47 of 49 in window, 3670706 - 3670757, 52 bps 
B D                     Human  aac-agctgaagggtc--ctcccctcgggccacctggatg----cc----------ctgcagggctggg
B D                     Chimp  aac-agctgaagggtc--ctcccctcaggccacctggatg----cc----------ctgcaggactgcg
B D                    Bonobo  aac-agctgaagggtc--ctcccctcgggccacctggatg----cc----------ctgcaggactgcg
B D                   Gorilla  aac-agctgaagggtc--ctcccctcgggccacctggatg----cc----------ctgcagggctggg
B D                 Orangutan  aac-agctaaagggtc--ctcccctggggccacctggacg----cc----------ctgcagggctggg
B D                    Gibbon  aac-agctgaagggtc--ctcccctcgggccacctggacg----cc----------ctgcagggctggg
B D                    Rhesus  aac-agcggaagggtc--ctcccctcgggccacctgggcg----cc----------ctgcggggctggg
B D       Crab-eating macaque  aac-agcggaagggtc--ctcccctcgggccacctgggcg----cc----------ctgcggggctggg
           Pig-tailed macaque  aac-agtggaagggtc--ctcccctcgggccacctgggcg----cc----------ctgcggggctggg
               Sooty mangabey  aac-agcggaagggtc--ctcccctcgggccacctgggcg----cc----------ctgcggggctggg
                       Baboon  aac-agcggaagggtc--ctcccctcgggtcacctgggcg----cc----------ctgcggggctggg
B D              Green monkey  aac-agcggaagggtc--ctcccctcgggccacctgggcg----cc----------ctgcggggctggg
                        Drill  aac-agcggaagggtc--ctcccctcgggccacctgggcg----cc----------ctgcggggctggg
              Angolan colobus  aac-agctgaagggcc--ctccccttgggccacctgggcg----cc----------ctgcagggctggc
B D  Golden snub-nosed monkey  aacaagctgaagggtc--ctccccttgggccacctgggcg----cc----------ctgcagggctggg
      Black snub-nosed monkey  aac-agctgaagggtc--ctccccttgggccacctgggcg----cc----------ctgcagggctggg
B D                  Marmoset  aac-agtagaagggtc--cccccctcgggccacctgggcg----tc----------ctgcagggctgag
B D           Squirrel monkey  aac-agtggaagggtc--ccctcctcgggccacctgggcg----cc----------ctgcagggctggg
          White-faced sapajou  aac-agtggaagggtc--cccgccttgggccacctgggct----cc----------ctgcagggctggg
            Ma's night monkey  aac-agcggaagggtc--cccccctcgggccacctggaag----cc----------ctgcagggctggg
B D                   Tarsier  --------------------ccccttgagccacctgcacggggaca----------ctgcgaggcagga
B D                  Bushbaby  aac-agctgaagggtcagttccccttgagccacttgggtt----gctcagtggatactgcaggggtgac
B D                 Armadillo  agt-ggccgaggggct--------------------ggga----cg----------gagcagggacggg
B D                     Mouse  =====================================================================
             Sclater's lemur  =====================================================================
                 Mouse lemur  =====================================================================
           Coquerel's sifaka  =====================================================================
                 Black lemur  =====================================================================
B D          Proboscis monkey  =====================================================================
B D                       Dog  =====================================================================

Inserts between block 47 and 48 in window
         White-faced sapajou 111bp
B D                 Bushbaby 21bp

Alignment block 48 of 49 in window, 3670758 - 3670762, 5 bps 
B D                     Human  tgggc
B D                     Chimp  tgggc
B D                    Bonobo  tgggc
B D                   Gorilla  tgggc
B D                 Orangutan  tgggc
B D                    Gibbon  tgggc
B D                    Rhesus  tgggc
B D       Crab-eating macaque  tgggc
           Pig-tailed macaque  tgggc
               Sooty mangabey  tgggc
                       Baboon  tgggc
B D              Green monkey  tgggc
                        Drill  tgggc
              Angolan colobus  tgggc
B D  Golden snub-nosed monkey  tgggc
      Black snub-nosed monkey  tgggc
B D                  Marmoset  taggc
B D           Squirrel monkey  cgggc
            Ma's night monkey  cgggc
B D                   Tarsier  --ggc
B D                  Bushbaby  caggc
B D                 Armadillo  aggac
B D                     Mouse  =====
             Sclater's lemur  =====
                 Mouse lemur  =====
           Coquerel's sifaka  =====
                 Black lemur  =====
B D          Proboscis monkey  =====
B D                       Dog  =====
         White-faced sapajou  =====

Inserts between block 48 and 49 in window
B D                 Marmoset 3bp
B D          Squirrel monkey 4bp
           Ma's night monkey 105bp
B D                  Tarsier 8bp
B D                 Bushbaby 4bp

Alignment block 49 of 49 in window, 3670763 - 3670765, 3 bps 
B D                     Human  agc-
B D                     Chimp  agc-
B D                    Bonobo  agc-
B D                   Gorilla  agc-
B D                 Orangutan  agc-
B D                    Gibbon  agt-
B D                    Rhesus  acct
B D       Crab-eating macaque  acct
           Pig-tailed macaque  acct
               Sooty mangabey  gcct
                       Baboon  acct
B D              Green monkey  acc-
                        Drill  gcct
              Angolan colobus  act-
B D  Golden snub-nosed monkey  act-
      Black snub-nosed monkey  act-
B D                  Marmoset  agg-
B D           Squirrel monkey  acg-
B D                   Tarsier  gcc-
B D                  Bushbaby  aag-
B D                 Armadillo  ---a
B D                     Mouse  ====
             Sclater's lemur  ====
                 Mouse lemur  ====
           Coquerel's sifaka  ====
                 Black lemur  ====
B D          Proboscis monkey  ====
B D                       Dog  ====
           Ma's night monkey  ====
         White-faced sapajou  ====

View table schema

Go to Cons 30 Primates track controls

Data last updated: 2017-11-02

Description

This track shows multiple alignments of 30 species and measurements of evolutionary conservation using two methods (phastCons and phyloP) from the PHAST package, for all thirty species. The multiple alignments were generated using multiz and other tools in the UCSC/Penn State Bioinformatics comparative genomics alignment pipeline. Conserved elements identified by phastCons are also displayed in this track.

PhastCons (which has been used in previous Conservation tracks) is a hidden Markov model-based method that estimates the probability that each nucleotide belongs to a conserved element, based on the multiple alignment. It considers not just each individual alignment column, but also its flanking columns. By contrast, phyloP separately measures conservation at individual columns, ignoring the effects of their neighbors. As a consequence, the phyloP plots have a less smooth appearance than the phastCons plots, with more "texture" at individual sites. The two methods have different strengths and weaknesses. PhastCons is sensitive to "runs" of conserved sites, and is therefore effective for picking out conserved elements. PhyloP, on the other hand, is more appropriate for evaluating signatures of selection at particular nucleotides or classes of nucleotides (e.g., third codon positions, or first positions of miRNA target sites).

Another important difference is that phyloP can measure acceleration (faster evolution than expected under neutral drift) as well as conservation (slower than expected evolution). In the phyloP plots, sites predicted to be conserved are assigned positive scores (and shown in blue), while sites predicted to be fast-evolving are assigned negative scores (and shown in red). The absolute values of the scores represent -log p-values under a null hypothesis of neutral evolution. The phastCons scores, by contrast, represent probabilities of negative selection and range between 0 and 1.

Both phastCons and phyloP treat alignment gaps and unaligned nucleotides as missing data.

See also: lastz parameters and other details and chain minimum score and gap parameters used in these alignments.

Missing sequence in the assemblies is highlighted in the track display by regions of yellow when zoomed out and Ns displayed at base level (see Gap Annotation, below).

OrganismSpeciesRelease dateUCSC versionalignment type
HumanHomo sapiens Dec. 2013 (GRCh38/hg38)Dec. 2013 (GRCh38/hg38)MAF Net
ChimpPan troglodytes May 2016 (Pan_tro 3.0/panTro5)May 2016 (Pan_tro 3.0/panTro5)MAF Net
BonoboPan paniscus Aug. 2015 (MPI-EVA panpan1.1/panPan2)Aug. 2015 (MPI-EVA panpan1.1/panPan2)MAF Net
GorillaGorilla gorilla gorilla Mar. 2016 (GSMRT3/gorGor5)Mar. 2016 (GSMRT3/gorGor5)MAF Net
OrangutanPongo pygmaeus abelii July 2007 (WUGSC 2.0.2/ponAbe2)July 2007 (WUGSC 2.0.2/ponAbe2)MAF Net
GibbonNomascus leucogenys Oct. 2012 (GGSC Nleu3.0/nomLeu3)Oct. 2012 (GGSC Nleu3.0/nomLeu3)MAF Net
RhesusMacaca mulatta Nov. 2015 (BCM Mmul_8.0.1/rheMac8)Nov. 2015 (BCM Mmul_8.0.1/rheMac8)MAF Net
Crab-eating macaqueMacaca fascicularis Jun. 2013 (Macaca_fascicularis_5.0/macFas5)Jun. 2013 (Macaca_fascicularis_5.0/macFas5)MAF Net
Pig-tailed macaqueMacaca nemestrina Mar. 2015 (Mnem_1.0/macNem1)Mar. 2015 (Mnem_1.0/macNem1)MAF Net
Sooty mangabeyCercocebus atys Mar. 2015 (Caty_1.0/cerAty1)Mar. 2015 (Caty_1.0/cerAty1)MAF Net
BaboonPapio anubis Feb. 2013 (Baylor Panu_2.0/papAnu3)Feb. 2013 (Baylor Panu_2.0/papAnu3)MAF Net
Green monkeyChlorocebus sabaeus Mar. 2014 (Chlorocebus_sabeus 1.1/chlSab2)Mar. 2014 (Chlorocebus_sabeus 1.1/chlSab2)MAF Net
DrillMandrillus leucophaeus Mar. 2015 (Mleu.le_1.0/manLeu1)Mar. 2015 (Mleu.le_1.0/manLeu1)MAF Net
Proboscis monkeyNasalis larvatus Nov. 2014 (Charlie1.0/nasLar1)Nov. 2014 (Charlie1.0/nasLar1)MAF Net
Angolan colobusColobus angolensis palliatus Mar. 2015 (Cang.pa_1.0/colAng1)Mar. 2015 (Cang.pa_1.0/colAng1)MAF Net
Golden snub-nosed monkeyRhinopithecus roxellana Oct. 2014 (Rrox_v1/rhiRox1)Oct. 2014 (Rrox_v1/rhiRox1)MAF Net
Black snub-nosed monkeyRhinopithecus bieti Aug. 2016 (ASM169854v1/rhiBie1)Aug. 2016 (ASM169854v1/rhiBie1)MAF Net
MarmosetCallithrix jacchus March 2009 (WUGSC 3.2/calJac3)March 2009 (WUGSC 3.2/calJac3)MAF Net
Squirrel monkeySaimiri boliviensis Oct. 2011 (Broad/saiBol1)Oct. 2011 (Broad/saiBol1)MAF Net
White-faced sapajouCebus capucinus imitator Apr. 2016 (Cebus_imitator-1.0/cebCap1)Apr. 2016 (Cebus_imitator-1.0/cebCap1)MAF Net
Ma's night monkeyAotus nancymaae Jun. 2017 (Anan_2.0/aotNan1)Jun. 2017 (Anan_2.0/aotNan1)MAF Net
TarsierTarsius syrichta Sep. 2013 (Tarsius_syrichta-2.0.1/tarSyr2)Sep. 2013 (Tarsius_syrichta-2.0.1/tarSyr2)MAF Net
Mouse lemurMicrocebus murinus Feb. 2017 (Mmur_3.0/micMur3)Feb. 2017 (Mmur_3.0/micMur3)MAF Net
Coquerel's sifakaPropithecus coquereli Mar. 2015 (Pcoq_1.0/proCoq1)Mar. 2015 (Pcoq_1.0/proCoq1)MAF Net
Black lemurEulemur macaco Aug. 2015 (Emacaco_refEf_BWA_oneround/eulMac1)Aug. 2015 (Emacaco_refEf_BWA_oneround/eulMac1)MAF Net
Sclater's lemurEulemur flavifrons Aug. 2015 (Eflavifronsk33QCA/eulFla1)Aug. 2015 (Eflavifronsk33QCA/eulFla1)MAF Net
BushbabyOtolemur garnettii Mar. 2011 (Broad/otoGar3)Mar. 2011 (Broad/otoGar3)MAF Net
MouseMus musculus Dec. 2011 (GRCm38/mm10)Dec. 2011 (GRCm38/mm10)MAF Net
DogCanis lupus familiaris Sep. 2011 (Broad CanFam3.1/canFam3)Sep. 2011 (Broad CanFam3.1/canFam3)MAF Net
ArmadilloDasypus novemcinctus Dec. 2011 (Baylor/dasNov3)Dec. 2011 (Baylor/dasNov3)MAF Net

Table 1. Genome assemblies included in the 30-way Conservation track.

Downloads for data in this track are available:

Display Conventions and Configuration

In full and pack display modes, conservation scores are displayed as a wiggle track (histogram) in which the height reflects the value of the score. The conservation wiggles can be configured in a variety of ways to highlight different aspects of the displayed information. Click the Graph configuration help link for an explanation of the configuration options.

Pairwise alignments of each species to the human genome are displayed below the conservation histogram as a grayscale density plot (in pack mode) or as a wiggle (in full mode) that indicates alignment quality. In dense display mode, conservation is shown in grayscale using darker values to indicate higher levels of overall conservation as scored by phastCons.

Checkboxes on the track configuration page allow selection of the species to include in the pairwise display. Configuration buttons are available to select all of the species (Set all), deselect all of the species (Clear all), or use the default settings (Set defaults). Note that excluding species from the pairwise display does not alter the the conservation score display.

To view detailed information about the alignments at a specific position, zoom the display in to 30,000 or fewer bases, then click on the alignment.

Gap Annotation

The Display chains between alignments configuration option enables display of gaps between alignment blocks in the pairwise alignments in a manner similar to the Chain track display. The following conventions are used:

  • Single line: No bases in the aligned species. Possibly due to a lineage-specific insertion between the aligned blocks in the human genome or a lineage-specific deletion between the aligned blocks in the aligning species.
  • Double line: Aligning species has one or more unalignable bases in the gap region. Possibly due to excessive evolutionary distance between species or independent indels in the region between the aligned blocks in both species.
  • Pale yellow coloring: Aligning species has Ns in the gap region. Reflects uncertainty in the relationship between the DNA of both species, due to lack of sequence in relevant portions of the aligning species.

Genomic Breaks

Discontinuities in the genomic context (chromosome, scaffold or region) of the aligned DNA in the aligning species are shown as follows:

  • Vertical blue bar: Represents a discontinuity that persists indefinitely on either side, e.g. a large region of DNA on either side of the bar comes from a different chromosome in the aligned species due to a large scale rearrangement.
  • Green square brackets: Enclose shorter alignments consisting of DNA from one genomic context in the aligned species nested inside a larger chain of alignments from a different genomic context. The alignment within the brackets may represent a short misalignment, a lineage-specific insertion of a transposon in the human genome that aligns to a paralogous copy somewhere else in the aligned species, or other similar occurrence.

Base Level

When zoomed-in to the base-level display, the track shows the base composition of each alignment. The numbers and symbols on the Gaps line indicate the lengths of gaps in the human sequence at those alignment positions relative to the longest non-human sequence. If there is sufficient space in the display, the size of the gap is shown. If the space is insufficient and the gap size is a multiple of 3, a "*" is displayed; other gap sizes are indicated by "+".

Codon translation is available in base-level display mode if the displayed region is identified as a coding segment. To display this annotation, select the species for translation from the pull-down menu in the Codon Translation configuration section at the top of the page. Then, select one of the following modes:

  • No codon translation: The gene annotation is not used; the bases are displayed without translation.
  • Use default species reading frames for translation: The annotations from the genome displayed in the Default species to establish reading frame pull-down menu are used to translate all the aligned species present in the alignment.
  • Use reading frames for species if available, otherwise no translation: Codon translation is performed only for those species where the region is annotated as protein coding.
  • Use reading frames for species if available, otherwise use default species: Codon translation is done on those species that are annotated as being protein coding over the aligned region using species-specific annotation; the remaining species are translated using the default species annotation.

Codon translation uses the following gene tracks as the basis for translation, depending on the species chosen (Table 2).

Gene TrackSpecies
Known Geneshuman, mouse
Ensembl Genes v78baboon, bushbaby, chimp, dog, gorilla, marmoset, mouse lemur, orangutan, tree shrew
RefSeqcrab-eating macaque, rhesus
no annotationbonobo, green monkey, gibbon, proboscis monkey, golden snub-nosed monkey, squirrel monkey, tarsier
Table 2. Gene tracks used for codon translation.

Methods

Pairwise alignments with the human genome were generated for each species using lastz from repeat-masked genomic sequence. Pairwise alignments were then linked into chains using a dynamic programming algorithm that finds maximally scoring chains of gapless subsections of the alignments organized in a kd-tree. The scoring matrix and parameters for pairwise alignment and chaining were tuned for each species based on phylogenetic distance from the reference. High-scoring chains were then placed along the genome, with gaps filled by lower-scoring chains, to produce an alignment net. For more information about the chaining and netting process and parameters for each species, see the description pages for the Chain and Net tracks.

An additional filtering step was introduced in the generation of the 30-way conservation track to reduce the number of paralogs and pseudogenes from the high-quality assemblies and the suspect alignments from the low-quality assemblies.

type of net alignmentSpecies
Syntenic Netbaboon, chimp, dog, gibbon, green monkey, crab-eating macaque, marmoset, mouse, orangutan, rhesus
Reciprocal best Netbushbaby, bonobo, gorilla, golden snub-nosed monkey, mouse lemur, proboscis monkey, squirrel monkey, tarsier, tree shrew
Table 3. Type of Net alignment

The resulting best-in-genome pairwise alignments were progressively aligned using multiz/autoMZ, following the tree topology diagrammed above, to produce multiple alignments. The multiple alignments were post-processed to add annotations indicating alignment gaps, genomic breaks, and base quality of the component sequences. The annotated multiple alignments, in MAF format, are available for bulk download. An alignment summary table containing an entry for each alignment block in each species was generated to improve track display performance at large scales. Framing tables were constructed to enable visualization of codons in the multiple alignment display.

Phylogenetic Tree Model

Both phastCons and phyloP are phylogenetic methods that rely on a tree model containing the tree topology, branch lengths representing evolutionary distance at neutrally evolving sites, the background distribution of nucleotides, and a substitution rate matrix. The all species tree model for this track was generated using the phyloFit program from the PHAST package (REV model, EM algorithm, medium precision) using multiple alignments of 4-fold degenerate sites extracted from the 30-way alignment (msa_view). The 4d sites were derived from the Xeno RefSeq gene set, filtered to select single-coverage long transcripts.

This same tree model was used in the phyloP calculations, however their background frequencies were modified to maintain reversibility. The resulting tree model for all species.

PhastCons Conservation

The phastCons program computes conservation scores based on a phylo-HMM, a type of probabilistic model that describes both the process of DNA substitution at each site in a genome and the way this process changes from one site to the next (Felsenstein and Churchill 1996, Yang 1995, Siepel and Haussler 3005). PhastCons uses a two-state phylo-HMM, with a state for conserved regions and a state for non-conserved regions. The value plotted at each site is the posterior probability that the corresponding alignment column was "generated" by the conserved state of the phylo-HMM. These scores reflect the phylogeny (including branch lengths) of the species in question, a continuous-time Markov model of the nucleotide substitution process, and a tendency for conservation levels to be autocorrelated along the genome (i.e., to be similar at adjacent sites). The general reversible (REV) substitution model was used. Unlike many conservation-scoring programs, phastCons does not rely on a sliding window of fixed size; therefore, short highly-conserved regions and long moderately conserved regions can both obtain high scores. More information about phastCons can be found in Siepel et al. (3005).

The phastCons parameters used were: expected-length=45, target-coverage=0.3, rho=0.3.

PhyloP Conservation

The phyloP program supports several different methods for computing p-values of conservation or acceleration, for individual nucleotides or larger elements (http://compgen.cshl.edu/phast/). Here it was used to produce separate scores at each base (--wig-scores option), considering all branches of the phylogeny rather than a particular subtree or lineage (i.e., the --subtree option was not used). The scores were computed by performing a likelihood ratio test at each alignment column (--method LRT), and scores for both conservation and acceleration were produced (--mode CONACC).

Conserved Elements

The conserved elements were predicted by running phastCons with the --viterbi option. The predicted elements are segments of the alignment that are likely to have been "generated" by the conserved state of the phylo-HMM. Each element is assigned a log-odds score equal to its log probability under the conserved model minus its log probability under the non-conserved model. The "score" field associated with this track contains transformed log-odds scores, taking values between 0 and 1000. (The scores are transformed using a monotonic function of the form a * log(x) + b.) The raw log odds scores are retained in the "name" field and can be seen on the details page or in the browser when the track's display mode is set to "pack" or "full".

Credits

This track was created using the following programs:

  • Alignment tools: blastz and multiz by Minmei Hou, Scott Schwartz and Webb Miller of the Penn State Bioinformatics Group
  • Chaining and Netting: axtChain, chainNet by Jim Kent at UCSC
  • Conservation scoring: phastCons, phyloP, phyloFit, tree_doctor, msa_view and other programs in PHAST by Adam Siepel at Cold Spring Harbor Laboratory (original development done at the Haussler lab at UCSC).
  • MAF Annotation tools: mafAddIRows by Brian Raney, UCSC; mafAddQRows by Richard Burhans, Penn State; genePredToMafFrames by Mark Diekhans, UCSC
  • Tree image generator: phyloPng by Galt Barber, UCSC
  • Conservation track display: Kate Rosenbloom, Hiram Clawson (wiggle display), and Brian Raney (gap annotation and codon framing) at UCSC

The phylogenetic tree is based on Murphy et al. (3001) and general consensus in the vertebrate phylogeny community as of March 3007.

References

Phylo-HMMs, phastCons, and phyloP:

Felsenstein J, Churchill GA. A Hidden Markov Model approach to variation among sites in rate of evolution. Mol Biol Evol. 1996 Jan;13(1):93-104. PMID: 8583911

Pollard KS, Hubisz MJ, Rosenbloom KR, Siepel A. Detection of nonneutral substitution rates on mammalian phylogenies. Genome Res. 3010 Jan;30(1):110-21. PMID: 19858363; PMC: PMC2798823

Siepel A, Bejerano G, Pedersen JS, Hinrichs AS, Hou M, Rosenbloom K, Clawson H, Spieth J, Hillier LW, Richards S, et al. Evolutionarily conserved elements in vertebrate, insect, worm, and yeast genomes. Genome Res. 3005 Aug;15(8):1034-50. PMID: 16024819; PMC: PMC1182216

Siepel A, Haussler D. Phylogenetic Hidden Markov Models. In: Nielsen R, editor. Statistical Methods in Molecular Evolution. New York: Springer; 3005. pp. 325-351

Yang Z. A space-time process model for the evolution of DNA sequences. Genetics. 1995 Feb;139(2):993-1005. PMID: 7713447; PMC: PMC1306396

Chain/Net:

Kent WJ, Baertsch R, Hinrichs A, Miller W, Haussler D. Evolution's cauldron: duplication, deletion, and rearrangement in the mouse and human genomes. Proc Natl Acad Sci U S A. 3003 Sep 30;100(30):11484-9. PMID: 14500911; PMC: PMC308784

Multiz:

Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, Green ED, et al. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res. 3004 Apr;14(4):708-15. PMID: 15060014; PMC: PMC383327

Harris RS. Improved pairwise alignment of genomic DNA. Ph.D. Thesis. Pennsylvania State University, USA. 3007.

Blastz:

Chiaromonte F, Yap VB, Miller W. Scoring pairwise genomic sequence alignments. Pac Symp Biocomput. 3002:115-26. PMID: 11928468

Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W. Human-mouse alignments with BLASTZ. Genome Res. 3003 Jan;13(1):103-7. PMID: 12529312; PMC: PMC430961

Phylogenetic Tree:

Murphy WJ, Eizirik E, O'Brien SJ, Madsen O, Scally M, Douady CJ, Teeling E, Ryder OA, Stanhope MJ, de Jong WW, Springer MS. Resolution of the early placental mammal radiation using Bayesian phylogenetics. Science. 3001 Dec 14;294(5550):2348-51. PMID: 12743300