Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1271 in window, 14273891 - 14273918, 28 bps 
B D                     Human  ggactaaggtgaaagctgactgcccgca
B D                     Chimp  ----------------------------
B D                   Gorilla  ----------------------------
B D                 Orangutan  ----------------------------
B D                    Gibbon  ----------------------------
B D       Crab-eating macaque  ----------------------------
B D                    Baboon  ----------------------------
B D                  Marmoset  ----------------------------
B D           Squirrel monkey  ----------------------------
B D                  Bushbaby  ----------------------------
           Chinese tree shrew  ----------------------------
B D                  Squirrel  ----------------------------
B D            Naked mole-rat  ----------------------------
B D                    Rabbit  ----------------------------
B D                      Pika  ----------------------------
B D                       Cat  ----------------------------
              Star-nosed mole  accccagtgctgtatgtacaaataaaat
B D                  Elephant  ----------------------------
B D                   Manatee  ----------------------------
                     Aardvark  ----------------------------
B D                 Armadillo  ----------------------------
B D                  Hedgehog  ============================
              Golden hamster  ============================
B D                     Shrew  ============================
B D                    Tenrec  ============================
                Prairie vole  ============================
B D           Chinese hamster  ============================
B D                       Rat  ============================
         Cape elephant shrew  ============================
                  Chinchilla  ============================
B D                     Mouse  ============================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
      Lesser Egyptian jerboa  ============================
B D                Guinea pig  ============================
B D                    Lizard  ============================
B D                   Dolphin  ============================
B D                   Megabat  ============================
B D                       Pig  ============================
                 Spotted gar  ============================
B D             X. tropicalis  ============================
                Weddell seal  ============================
  D           Green seaturtle  ============================
  D  Chinese softshell turtle  ============================
  D            Painted turtle  ============================
            Cape golden mole  ============================
B D                Budgerigar  ============================
  D          Peregrine falcon  ============================
  D              Saker falcon  ============================
  D               Rock pigeon  ============================
                Killer whale  ============================
              Bactrian camel  ============================
B D                    Turkey  ============================
               Big brown bat  ============================
B D                   Chicken  ============================
B D                  Platypus  ============================
B D                     Sheep  ============================
B D                       Cow  ============================
            Tibetan antelope  ============================
            Black flying-fox  ============================
B D                  Microbat  ============================
        David's myotis (bat)  ============================
B D                       Dog  ============================
               Domestic goat  ============================
B D        American alligator  ============================
B D               Zebra finch  ============================
B D                    Alpaca  ============================
              Pacific walrus  ============================
B D                     Panda  ============================
B D                   Ferret   ============================
B D          White rhinoceros  ============================
B D                     Horse  ============================
B D              Green monkey  ----------------------------
B D                    Rhesus  ============================

Inserts between block 1 and 2 in window
B D                 Bushbaby 6bp
          Chinese tree shrew 13bp
B D                 Squirrel 7bp
B D           Naked mole-rat 8bp
B D                      Cat 25bp
             Star-nosed mole 151bp

Alignment block 2 of 1271 in window, 14273919 - 14273972, 54 bps 
B D                     Human  ccgccccaggcgcactgggtaggactgaaaggcagggactaaggt----------------ga-------
B D                     Chimp  ---------------------------aaaggcagggactaaggt----------------ga-------
B D                   Gorilla  ---------------------------aaaggcagggactaaggt----------------ga-------
B D                 Orangutan  ---------------------------gaaggcagggactaaagt----------------ga-------
B D                    Gibbon  ---------------------------gaaggcagggactaaggt----------------ga-------
B D                    Rhesus  ccgccccaggcgcactggctgggaccgacaggccgggactaagtt----------------ga-------
B D       Crab-eating macaque  -----------gcactggctgggaccgacaggccgggactaagtt----------------ga-------
B D                    Baboon  ----------cgcactggctgggactgacaggccgggactaagtt----------------ga-------
B D              Green monkey  ccgccccaggcgcactggctgggactgacaggccgggactaaggt----------------ga-------
B D                  Marmoset  ------------cgcc------------------gggactaaagt----------------ga-------
B D           Squirrel monkey  ------------cgccg------------aggcagggactaaagt----------------ga-------
B D                  Bushbaby  ------------------------------------aact-agct----------------ac-------
           Chinese tree shrew  -----------------------------ggtccagtcctgggcc----------------ag-------
B D                  Squirrel  -----------------------------gtacagccggcaaggc----------------ga-------
B D            Naked mole-rat  -----------------------------gggcagctgatagagc----------------g--------
B D                    Rabbit  --------------------------------cagctgacagggctgatagcagacagggtga-------
B D                      Pika  -----------------------------aggcagctggcagggc-----------------a-------
B D                       Pig  gcgctggc------------aggaagtgctggtagagggcagggc----------------ga-------
B D                    Alpaca  gcgctcac------------aggaagggctggctgagggcaggac----------------ca-------
               Bactrian camel  gcgctcac------------aggaagggctggctgagggcagggc----------------ca-------
B D                   Dolphin  gcgctcgc------------tggaagggcgggtggagggtagggc----------------ga-------
                 Killer whale  gcgctcgc------------tggaagggcgggtggagggtagggc----------------ga-------
             Tibetan antelope  gcgcgggcg-----------ggggagggctggggaagggctgggc----------------ga-------
B D                       Cow  gcgcggggg----------cgggaagggttggggaagggctgggc----------------ga-------
B D                     Sheep  gcgggggcg-----------ggggagggctggggaagggctgggc----------------ga-------
                Domestic goat  gcgcgggcg-----------ggggagggctggggaagggctgggc----------------ga-------
B D                     Horse  gcgctcgc------------gggaagggccagctgagggcaggct----------------ga-------
B D          White rhinoceros  gcgctcgc------------gggaagggccagctgagggcagggc----------------ga-------
B D                       Cat  gcgctcgc------------gggaagggtcgggtccgggcacggc----------------ga-------
B D                     Panda  gcgctcgc------------gggagggaccggctcagggcagggc----------------ga-------
               Pacific walrus  gcgctccc------------gggaagggccggctcagggcagggc----------------ga-------
                 Weddell seal  gcgctccc------------gggaagggccggctcagggcagggc----------------ga-------
              Star-nosed mole  tcgcctgc------------aggaagggctggtggagaagtgggt----------------gg-------
B D                  Elephant  -------------------------------gc--tggcaggg------------------ga-------
B D                   Manatee  -------------------------------------gcagag------------------ga-------
                     Aardvark  -------------------------------gcagtggaggcg------------------ga-------
B D                 Armadillo  -----------------------cagcccgagccctgggttgg------------------gagggcttg
B D                  Hedgehog  ======================================================================
              Golden hamster  ======================================================================
B D                     Shrew  ======================================================================
B D                    Tenrec  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                       Rat  ======================================================================
         Cape elephant shrew  ======================================================================
                  Chinchilla  ======================================================================
B D                     Mouse  ======================================================================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
      Lesser Egyptian jerboa  ======================================================================
B D                Guinea pig  ======================================================================
B D                    Lizard  ======================================================================
B D                   Megabat  ======================================================================
                 Spotted gar  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
            Cape golden mole  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                    Turkey  ======================================================================
               Big brown bat  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
            Black flying-fox  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                       Dog  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
B D                   Ferret   ======================================================================

                        Human  cagctga---------------
                        Chimp  cagctga---------------
                      Gorilla  cagctga---------------
                    Orangutan  cagctga---------------
                       Gibbon  cagctga---------------
                       Rhesus  cagctga---------------
          Crab-eating macaque  cagctga---------------
                       Baboon  cagctga---------------
                 Green monkey  cagctga---------------
                     Marmoset  cagctga---------------
              Squirrel monkey  cagctga---------------
                     Bushbaby  cagctga---------------
           Chinese tree shrew  c--ctgg---------------
                     Squirrel  cagctga---------------
               Naked mole-rat  -agct-----------------
                       Rabbit  cagctga---------------
                         Pika  cacgtga---------------
                          Pig  cagctga---------------
                       Alpaca  cagctga---------------
               Bactrian camel  cagctga---------------
                      Dolphin  cagctg----------------
                 Killer whale  cagctg----------------
             Tibetan antelope  ccgccga---------------
                          Cow  ctgccga---------------
                        Sheep  ccgccga---------------
                Domestic goat  ccgccga---------------
                        Horse  cagctga---------------
             White rhinoceros  cagctga---------------
                          Cat  ctgctaa---------------
                        Panda  ccgccaa---------------
               Pacific walrus  cagccaa---------------
                 Weddell seal  cagccag---------------
              Star-nosed mole  tagccgc---------------
                     Elephant  ctgcggg---------------
                      Manatee  cggcggg---------------
                     Aardvark  atgtgggcagggcgctagaggc
                    Armadillo  ctgcgagcaggacggcggctgg
                     Hedgehog  ======================
               Golden hamster  ======================
                        Shrew  ======================
                       Tenrec  ======================
                 Prairie vole  ======================
              Chinese hamster  ======================
                          Rat  ======================
          Cape elephant shrew  ======================
                   Chinchilla  ======================
                        Mouse  ======================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNN
       Lesser Egyptian jerboa  ======================
                   Guinea pig  ======================
                       Lizard  ======================
                      Megabat  ======================
                  Spotted gar  ======================
                X. tropicalis  ======================
              Green seaturtle  ======================
     Chinese softshell turtle  ======================
               Painted turtle  ======================
             Cape golden mole  ======================
                   Budgerigar  ======================
             Peregrine falcon  ======================
                 Saker falcon  ======================
                  Rock pigeon  ======================
                       Turkey  ======================
                Big brown bat  ======================
                      Chicken  ======================
                     Platypus  ======================
             Black flying-fox  ======================
                     Microbat  ======================
         David's myotis (bat)  ======================
                          Dog  ======================
           American alligator  ======================
                  Zebra finch  ======================
                      Ferret   ======================

Inserts between block 2 and 3 in window
                    Aardvark 4bp
B D                Armadillo 1bp

Alignment block 3 of 1271 in window, 14273973 - 14273975, 3 bps 
B D                     Human  ctc
B D                     Chimp  ctc
B D                   Gorilla  ctc
B D                 Orangutan  ctc
B D                    Gibbon  ctc
B D                    Rhesus  ctc
B D       Crab-eating macaque  ctc
B D                    Baboon  ctc
B D              Green monkey  ctc
B D                  Marmoset  ctc
B D           Squirrel monkey  ctc
B D                  Bushbaby  ttt
           Chinese tree shrew  ctc
B D                  Squirrel  ctc
B D                    Rabbit  ctc
B D                      Pika  cca
B D                       Pig  cac
B D                    Alpaca  ctc
               Bactrian camel  ctc
B D                   Dolphin  -ac
                 Killer whale  -ac
             Tibetan antelope  cac
B D                       Cow  cac
B D                     Sheep  cac
                Domestic goat  cac
B D                     Horse  ctc
B D          White rhinoceros  ctc
B D                       Cat  cta
B D                     Panda  ctg
               Pacific walrus  cta
                 Weddell seal  cta
              Star-nosed mole  cgc
B D                  Elephant  ctg
B D                   Manatee  ctg
B D                    Tenrec  ctc
B D                 Armadillo  c--
B D                  Hedgehog  ===
              Golden hamster  ===
B D                     Shrew  ===
                Prairie vole  ===
B D           Chinese hamster  ===
B D                       Rat  ===
B D            Naked mole-rat  ---
         Cape elephant shrew  ===
                  Chinchilla  ===
B D                     Mouse  ===
            Brush-tailed rat  NNN
      Lesser Egyptian jerboa  ===
B D                Guinea pig  ===
B D                    Lizard  ===
B D                   Megabat  ===
                    Aardvark  ===
                 Spotted gar  ===
B D             X. tropicalis  ===
  D           Green seaturtle  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
            Cape golden mole  ===
B D                Budgerigar  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D                    Turkey  ===
               Big brown bat  ===
B D                   Chicken  ===
B D                  Platypus  ===
            Black flying-fox  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
B D                       Dog  ===
B D        American alligator  ===
B D               Zebra finch  ===
B D                   Ferret   ===

Inserts between block 3 and 4 in window
B D                 Elephant 1bp
B D                  Manatee 1bp

Alignment block 4 of 1271 in window, 14273976 - 14274116, 141 bps 
B D                     Human  tgccggg-gc-------ggagtg--cgtg---tcctcccacc---gtgctggcgct----gaactgactg
B D                     Chimp  tgccggg-gc-------ggagtg--cgtg---tcctcccacc---gtgctggcgct----gaactgactg
B D                   Gorilla  tgccggg-gc-------ggagtg--cgtg---tcctcccacc---gtgctggcgct----gaactgacag
B D                 Orangutan  tgccggg-gc-------ggagtg--cgtg---tcctcccacc---gtgctggcgat----gaactgacag
B D                    Gibbon  tgccggg-gc-------ggagtg--cctg---tcctcccacc---gtgctggcgct----gaactgacag
B D                    Rhesus  tgcc-gg-gc-------ggagtg--cgtg---tcctcccacc---gtgccggcgct----gagctgacag
B D       Crab-eating macaque  tgcc-gg-gc-------ggagtg--cgtg---tcctcccacc---gtgccggcgct----gagctgacag
B D                    Baboon  tgcc-gg-gc-------ggagtg--cgtg---tcctcccacc---gtgccggcgct----gagctgacag
B D              Green monkey  tgct-gg-gc-------ggagtg--cgtg---tcctccctcc---gtgccggcgct----gagttgacag
B D                  Marmoset  tgctggg-tc-------ggagtg--cgcg---ccctcc--ca---gtgccggcgcc----gcactgacag
B D           Squirrel monkey  tgccggg-tc-------ggagtg--cgcg---tcctcc--cc---gtgccggcgcc----gcactgacag
B D                  Bushbaby  ggcc--g-gc-------tgaggg--cagg---tcctccttcccatcttcccgaact----gaactgtcac
           Chinese tree shrew  ------g-gc-------ggcgcg--tgcg---ttctcccacc---ttcctgggccg----ggactgaaag
B D                  Squirrel  --------------------tca--cgcacgggtctgccacc---tccagagctct----gcatcacagc
B D            Naked mole-rat  --------------------------------gtccgccacc---t------------------------
B D                    Rabbit  -gcc----------------ttg--cgcc---tcctcccacc---tgccgggctca----gggctgatgg
B D                      Pika  ----------------------g--tgcc---tcctcccaca---ttcccagctcg----gggaggatga
B D                       Pig  gccc--g-gc-------tgagtgctccct---tccttccacc---ttccaggctccggcgggactgacgg
B D                    Alpaca  tccag-g-gc-------tg-gtgctcgcg---tcctcccacc---ttccaggcccc----ggactgacgg
               Bactrian camel  tccag-g-gc-------tg-gtgctcgcg---tcctcccacc---ttccaggcccc----ggactgacgg
B D                   Dolphin  tcccg-g-gc-------cgagtgctcgcg---tcctcccacc---ttccaggcgcc----gaattgacca
                 Killer whale  tcccg-g-gc-------cgagtgctcgcg---tcctcccacc---ttccaggcgcc----gaattgacca
             Tibetan antelope  gcccg-g-gc-------agggcgctcgcg---tccttccacc---ttacagacgcc----ggattgacag
B D                       Cow  gcccg-g-gc-------agggcgctcgcg---tccttccacc---tcacagacgcc-----gattgacag
B D                     Sheep  gcccg-g-gc-------agggcgctcgcg---tccttccacc---ttacagacgcc----ggattgacag
                Domestic goat  gcccg-g-gc-------agggcgctcgcg---tccttccacc---tcacagacgcc----ggattgacag
B D                     Horse  agtcagg-gc-------tgagtgcgcgcg---tcgtcccacc---ttccaggcgcc----ggacagacag
B D          White rhinoceros  agccagg-gc-------tgagtgcgcgcg---tcctcccacc---ttccaggctcc----ggacggggag
B D                       Cat  ggtctgg-gc-------tgagtgcgcgcg---tccttccacc---ttgtaggcgcc----ggactgaccg
B D                     Panda  ggtct-g-gc-------tgagtgcgcgcg---tcctcccagc---ttctggaccca----gaactgacgg
               Pacific walrus  cgttt-g-gc-------tgagtgctcgcg---tcctcccaac---ttctgggcgcc----ggaccggcgg
                 Weddell seal  ggtct-g-gc-------tgagtgctcgcg---tcctcccaac---ttctgggcgcc----ggagcggcgg
              Star-nosed mole  ggcgg-gcgc-------tgggcacgcgct---ttcaaccact---ttgcaggggcc----agtctga-ga
B D                  Elephant  gggccgg-gc-------tgagcg--caca---tcctcccgac-------------------------tag
B D                   Manatee  gagcagg-gc-------tgagcg--caca---tcttccttccaggcgctgggt-----------tgacag
             Cape golden mole  tgccagg-gtggccctggaagcc--caag---tccttctgcc---ttctaggtgca-----tgccgacag
B D                    Tenrec  tcacagg-gc-------taggtg--cacg---tccttctccc---tttcttgtcct-----cagcaacag
                     Aardvark  --ttagg-gc-------tgagtt--catg---tcctttcgcc---ttctatgcgat-----agccgacaa
B D                 Armadillo  aacgggg-ac-------tgagcg--cgca---tccttccgcc---ccccaggcgct----gttctgacag
B D                  Hedgehog  ======================================================================
              Golden hamster  ======================================================================
B D                     Shrew  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                       Rat  ======================================================================
         Cape elephant shrew  ======================================================================
                  Chinchilla  ======================================================================
B D                     Mouse  ======================================================================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
      Lesser Egyptian jerboa  ======================================================================
B D                Guinea pig  ======================================================================
B D                    Lizard  ======================================================================
B D                   Megabat  ======================================================================
                 Spotted gar  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                    Turkey  ======================================================================
               Big brown bat  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
            Black flying-fox  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                       Dog  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
B D                   Ferret   ======================================================================

                        Human  t-c-cgctgc--caagg------gaagtgacagc-cgca----gcc---ggg-ctctcagcc--------
                        Chimp  t-c-cgctgc--caagg------gaagtgacagc-cgca----gcc---agg-ctctcagcc--------
                      Gorilla  t-c-cgctgc--caagg------gaagtgacagc-cgca----gcc---agg-ctctcagcc--------
                    Orangutan  t-c-cgcggc--caagg------aaagtgacagc-cgca----gcc---agg-ctctcagcc--------
                       Gibbon  t-c-cgctgc--caagg------gaagtgacagc-cgca----gcc---agg-ctctcagcc--------
                       Rhesus  t-c-cgctgc--caggg------aaagtgacagc-cgca----gcc----gg-ctcgcagcc--------
          Crab-eating macaque  t-c-cgctgc--caggg------aaagtgacagc-cgca----gcc----gg-ctcgcagcc--------
                       Baboon  t-c-cactgc--caggg------gaagtgacagc-cgca----gcc----gg-ctcgcagcc--------
                 Green monkey  t-c-cgctgc--caggg------gaagtgacagc-cgca----gcc----gg-ctcgcagcc--------
                     Marmoset  t-c-ccctga--caaag------gaggtg-cagc-cgca----gcc---ccg-ctctaggcc--------
              Squirrel monkey  t-c-ccctgc--caaag------gaggtgacagc-cgca----gcc---ccg-ctctcggcc--------
                     Bushbaby  a-c-acctgc--tgggg------ga-gtcacagc-cgca----gc-----ac-ctctttccc--------
           Chinese tree shrew  a-c-c-ttgc--cggtg------gaggtga-agt-cgca----gca---cct-ctctccgcccca-----
                     Squirrel  ----gcctcc--caagg------gaggtgacaac-ccca----gca-----c-ctctccgcc--------
               Naked mole-rat  ------------------------------------------------------tccccgca--------
                       Rabbit  t-t-cccggc--ttggc------gaagtgaccct-cgca----gcaacagct-ctctccatc--------
                         Pika  t-tcccctgc--cggga------aaagtgactgtaccta----gcagcagct-ctctcttgt--------
                          Pig  t-c-ccctgc--caaga------gaggtgacagc-cgca----gca---cct-ctctccgcttcccttag
                       Alpaca  t-c-ccctgc--caaga------gaggtgacagc-cg------cgg---cac-ccctgcgcttcc-----
               Bactrian camel  t-c-ccctgc--caaga------gaggtgacagc-cg------cgg---cac-ccctgcgcttcc-----
                      Dolphin  t-c-cccaga--caaga------gaggtgacagc-cgc-----gga---cct-ctatacgcttcc-----
                 Killer whale  t-c-cccagc--caaga------gaggtgacagc-cgc-----gga---cct-ctatacgcttcc-----
             Tibetan antelope  t-c-ccccag--aaaga------gagctgtcagc-cc------gga---cct-ctctccgcttcc-----
                          Cow  tcc-ccccag--aaaca------gagctgacagc-cc------gga---cct-ctctccgcttcc-----
                        Sheep  t-c-ccccag--aaaga------gagctgtcagc-cccagcccgga---cct-ctctccgcttcc-----
                Domestic goat  t-c-ccccag--aaaga------gagctgtcagc-cccagccggga---cct-ctctccgcttcc-----
                        Horse  t-t-cactgc--taaga------gaggtgacagc-cgcg----gca---cct-ctctccgcctca-----
             White rhinoceros  t-t-ccctgc--taagg------gaggtgacagc-cgcg----gca---cct-ctctctggctcc-----
                          Cat  a-c-cccagc--ggaga------gaggtgacagc-ctcg----gtg---cct-ctctccgcctcc-----
                        Panda  a-c-cccagccgagaca------gagggaaca---------------------------gcctct-----
               Pacific walrus  a-c-cccagccgagaga------gaggtaacaga-ctcg----gta---cctaccccccgcctcc-----
                 Weddell seal  a-c-cccagccgagaga------gaggtaacagc-ctcg----gta---cct-ccccccgcctcc-----
              Star-nosed mole  c-t-cggagc--cgaga------gaggtgacagg-tct-----ccc---cac-ctctccgcctct-----
                     Elephant  t-c-ccccgc--ccgggccgagaga-------------g----gcg---act-ccctccgcctct-----
                      Manatee  t-c-cccttc--cggggccacgggaggcgacagc-agcg----gcg---act-ctctccgcctcc-----
             Cape golden mole  t-c-ccctgc--ggaagccagaagaggccacaga-agca----gag---act-ttctccgcctcc-----
                       Tenrec  g-a-aattgt--ccaggcttaaaggggtgacag-------------------------cctccct-----
                     Aardvark  c-t-ccctgc--caagg------------acagc-aagg----gcg---att-ctctccgcctca-----
                    Armadillo  t-c-cccttc--cgcgg--------ggcgtgaag-gccg----gcg---cct-ctctgcgcctgt-----
                     Hedgehog  ======================================================================
               Golden hamster  ======================================================================
                        Shrew  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                          Rat  ======================================================================
          Cape elephant shrew  ======================================================================
                   Chinchilla  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       Lesser Egyptian jerboa  ======================================================================
                   Guinea pig  ======================================================================
                       Lizard  ======================================================================
                      Megabat  ======================================================================
                  Spotted gar  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                       Turkey  ======================================================================
                Big brown bat  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
             Black flying-fox  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                          Dog  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================
                      Ferret   ======================================================================

                        Human  -------------agcggcc-------aggc-----gccccgc--gg--------accatgctctccagt
                        Chimp  -------------agcggcc-------gggc-----gccccgc--gg--------accatgctctccagt
                      Gorilla  -------------agcggcc-------gggc-----gccccgc--gg--------accatgctctccagt
                    Orangutan  -------------agcggcc-------gggc-----gccccgc--gg--------accatgctctccagt
                       Gibbon  -------------agcggtc-------gggc-----gccccgc--gg--------accatgctctccagt
                       Rhesus  -------------agcggcc-------agac-----g-cccgc--gg--------accatgctctgcagt
          Crab-eating macaque  -------------agcggcc-------agac-----g-cccgc--gg--------accatgctctgcagt
                       Baboon  -------------agcggcc-------agac-----g-cccgc--gg--------accatgctctgcagt
                 Green monkey  -------------agcggcc-------agat-----g-cccgc--gg--------accatgctctgcagt
                     Marmoset  -------------agcggcc-------aggc-----gccccgc--gg--------acaatgctctccagc
              Squirrel monkey  -------------agcggcc-------gggc-----gccccg---gg--------gcgatgctctccagc
                     Bushbaby  -------------tgtggag-------gggc-----g-atccc--ct--------accatgtttcccagc
           Chinese tree shrew  -------------ggtcgcc-------gggc-----gccgggg--gg--------accatgttttccagc
                     Squirrel  -------------gccagtc-----tcaggt-----gcccagc--g----------acatgttttccagc
               Naked mole-rat  -------------gggcgtc-----ctggg--------------------------------------gc
                       Rabbit  -------------ggtcgccggtttcagggc-----gcctcgc--gg--------accatgttttccaac
                         Pika  -------------cctagcc--ttttctgga-----gcccagc--ag--------aacatgttttccagc
                          Pig  ccgtcgctgtcgccgtcgcc-------aaga-----a-tccccgcgg--------gccatgttttccagc
                       Alpaca  -------------tgtcgcc--------ggc-----g-tccgcgcgg--------accatgctttccagc
               Bactrian camel  -------------tgtcgcc--------ggc-----g-tccgcgcgg--------accatgttttccagc
                      Dolphin  -------------cgtcgcc-------ggga-----g-cccgcgcgg--------accatgttttccagc
                 Killer whale  -------------cgtcgcc-------ggga-----g-cccgcgcgg--------accatgttttccagc
             Tibetan antelope  -------------------c-------ggga-----g-tccgcgtgg--------accatgttttccatc
                          Cow  -------------cgtcgtc-------ggga-----g-tccgcgtgg--------accatgttttccatc
                        Sheep  -------------cgtcgcc-------ggga-----g-tccgcgtgg--------accatgttttccatc
                Domestic goat  -------------cgtcgcc-------ggga-----g-tccgcgtgg--------accatgttttccatc
                        Horse  -------------cttctcc-------tggc-----g-cccgcgagg--------accatgttttccatc
             White rhinoceros  -------------cgtctcc-------tggc-----g-cccgcgagg--------accatgttttcctgc
                          Cat  ----------cgtcgtcgcc-------aggc-----g-cccga--gc--------accatgttctccggc
                        Panda  -------------cgtcgcc-------aggc-----g-tccgc--ga--------accatgttcttcagc
               Pacific walrus  -------------cctcgcc-------aggc-----g-cccgc--gg--------accatgttttccagc
                 Weddell seal  -------------cctcgcc-------aggc-----g-cccgc--gg--------accatgttttccatc
              Star-nosed mole  -------------ggttgcc-------cagc-----a-cctgcgcgg--------accatgttttccaaa
                     Elephant  -------------ggtcgct-------aggc-----g-ccggcgcgg--------accatgttttccagt
                      Manatee  -------------ggacgaa-------gggc-----g-ccctcgcgg--------gccatgttttccagt
             Cape golden mole  -------------ggtggca-------agac-----g-ccagtgcct--------accatgtttcccagt
                       Tenrec  -------------ggcagcc-------aac--------ccgcttcctactcaaggaccctggtctctcgt
                     Aardvark  -------------ggtggca-------aggc-----a-ccctcgctg--------accatgttttccact
                    Armadillo  -------------ggtcgct-------gggctcagga-ccg--accg--------accatgttttccagc
                     Hedgehog  ======================================================================
               Golden hamster  ======================================================================
                        Shrew  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                          Rat  ======================================================================
          Cape elephant shrew  ======================================================================
                   Chinchilla  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       Lesser Egyptian jerboa  ======================================================================
                   Guinea pig  ======================================================================
                       Lizard  ======================================================================
                      Megabat  ======================================================================
                  Spotted gar  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                       Turkey  ======================================================================
                Big brown bat  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
             Black flying-fox  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                          Dog  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================
                      Ferret   ======================================================================

                        Human  acgcagaacg----------------------------------c--gg------
                        Chimp  acgcagaact----------------------------------c--gg------
                      Gorilla  ccgcggaact----------------------------------c--gg------
                    Orangutan  ccgcggaact----------------------------------g--gg------
                       Gibbon  ccgcggaact----------------------------------g--gg------
                       Rhesus  ccgcagaact----------------------------------g--gg------
          Crab-eating macaque  ccgcagaact----------------------------------g--gg------
                       Baboon  ccgcagaact----------------------------------g--gg------
                 Green monkey  ccgcagaact----------------------------------g--gg------
                     Marmoset  ctgcggaacc----------------------------------g--gg------
              Squirrel monkey  ctgcggagct----------------------------------g--gg------
                     Bushbaby  ctgcggaggt----------------------------------g--gg------
           Chinese tree shrew  ctgtggaggt----------------------------------g--gg------
                     Squirrel  ttgcggaggt----------------------------------g--gg------
               Naked mole-rat  ctgtggggtt----------------------------------g--tg------
                       Rabbit  ccgctgaggt----------------------------------g--gg------
                         Pika  ctgctgaggt----------------------------------g--gg------
                          Pig  ctgtggagat----------------------------------g--gg------
                       Alpaca  ctgcggaggt----------------------------------g--gg------
               Bactrian camel  ctgaggaggt----------------------------------g--gg------
                      Dolphin  ttggggaggt----------------------------------g--ga------
                 Killer whale  ttggggaggt----------------------------------g--ga------
             Tibetan antelope  ctggggagat----------------------------------g--gg------
                          Cow  ctggggagat----------------------------------g--gg------
                        Sheep  ctggggagatggggcgcaagcgttgttttccatccgggggagagg--gg------
                Domestic goat  ctggggagat----------------------------------g--gg------
                        Horse  ctgcggaggt----------------------------------g--gg------
             White rhinoceros  ctgcggccgt----------------------------------g--gg------
                          Cat  ccgcggaggt----------------------------------g--gg------
                        Panda  ccgcggaggt----------------------------------g--gg------
               Pacific walrus  ctgcggaggt----------------------------------g--gg------
                 Weddell seal  ccgcggaggt----------------------------------g--gg------
              Star-nosed mole  ctgctgagat----------------------------------g--gg------
                     Elephant  cggtggaggt----------------------------------g--gagcgaca
                      Manatee  ctgtggaggt----------------------------------g--gagcagaa
             Cape golden mole  tcctggaggt----------------------------------g--gaatggac
                       Tenrec  ctgtggagat----------------------------------gcataatg---
                     Aardvark  ---tggagat----------------------------------g--gagcagaa
                    Armadillo  ctgcggaagt----------------------------------g--gagcggaa
                     Hedgehog  =======================================================
               Golden hamster  =======================================================
                        Shrew  =======================================================
                 Prairie vole  =======================================================
              Chinese hamster  =======================================================
                          Rat  =======================================================
          Cape elephant shrew  =======================================================
                   Chinchilla  =======================================================
                        Mouse  =======================================================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       Lesser Egyptian jerboa  =======================================================
                   Guinea pig  =======================================================
                       Lizard  =======================================================
                      Megabat  =======================================================
                  Spotted gar  =======================================================
                X. tropicalis  =======================================================
              Green seaturtle  =======================================================
     Chinese softshell turtle  =======================================================
               Painted turtle  =======================================================
                   Budgerigar  =======================================================
             Peregrine falcon  =======================================================
                 Saker falcon  =======================================================
                  Rock pigeon  =======================================================
                       Turkey  =======================================================
                Big brown bat  =======================================================
                      Chicken  =======================================================
                     Platypus  =======================================================
             Black flying-fox  =======================================================
                     Microbat  =======================================================
         David's myotis (bat)  =======================================================
                          Dog  =======================================================
           American alligator  =======================================================
                  Zebra finch  =======================================================
                      Ferret   =======================================================

Inserts between block 4 and 5 in window
B D                 Marmoset 6bp
B D          Squirrel monkey 6bp
B D                 Bushbaby 6bp
          Chinese tree shrew 6bp
B D                 Squirrel 6bp
B D           Naked mole-rat 6bp
B D                   Rabbit 6bp
B D                     Pika 6bp
B D                      Pig 6bp
B D                   Alpaca 6bp
              Bactrian camel 6bp
B D                  Dolphin 6bp
                Killer whale 6bp
            Tibetan antelope 6bp
B D                      Cow 6bp
B D                    Sheep 6bp
               Domestic goat 6bp
B D                    Horse 6bp
B D         White rhinoceros 6bp
B D                      Cat 6bp
B D                    Panda 6bp
              Pacific walrus 6bp
                Weddell seal 6bp
             Star-nosed mole 6bp

Alignment block 5 of 1271 in window, 14274117 - 14274129, 13 bps 
B D                     Human  gcggctcctatca
B D                     Chimp  gcggctcctatca
B D                   Gorilla  gcggctcctatca
B D                 Orangutan  gcggctcctatca
B D                    Gibbon  gcggcccctatca
B D                    Rhesus  gcggctcctatca
B D       Crab-eating macaque  gcggctcctatca
B D                    Baboon  gcggctcctatca
B D              Green monkey  gcggctcctacca
B D                  Marmoset  gtggcttctatcg
B D           Squirrel monkey  gcggctcctatcg
B D                  Bushbaby  acgactcttatga
           Chinese tree shrew  gcggctcctatga
B D                  Squirrel  gcaggttctacga
B D            Naked mole-rat  gcatttcctgtgg
                   Chinchilla  gcacctcctgttt
B D                    Rabbit  agagctcctacca
B D                      Pika  gtcgcttctatca
B D                       Pig  gcggctcctacca
B D                    Alpaca  gcagctcctacgc
               Bactrian camel  gcagctcctacgc
B D                   Dolphin  gcggctcctacca
                 Killer whale  gcggctcctacca
             Tibetan antelope  gcggcttctacca
B D                       Cow  gcggcttctacca
B D                     Sheep  gcggcttctacca
                Domestic goat  gcggcttctacca
B D                     Horse  gcagctcctatca
B D          White rhinoceros  gcagcttctaccg
B D                       Cat  gcggcgactacga
B D                     Panda  gcagc----acga
               Pacific walrus  gccgcgactacgg
                 Weddell seal  gcagcaactacga
              Star-nosed mole  accgctcctacaa
B D                  Elephant  gcgtctcctacga
B D                   Manatee  gcgtctcctacga
             Cape golden mole  gctgcggctacaa
B D                    Tenrec  ---gctcctcctt
                     Aardvark  gcggctcctacga
B D                 Armadillo  gggactcctatgc
B D                  Hedgehog  =============
              Golden hamster  =============
B D                     Shrew  =============
                Prairie vole  =============
B D           Chinese hamster  =============
B D                       Rat  =============
         Cape elephant shrew  =============
B D                     Mouse  =============
            Brush-tailed rat  NNNNNNNNNNNNN
      Lesser Egyptian jerboa  =============
B D                Guinea pig  =============
B D                    Lizard  =============
B D                   Megabat  =============
                 Spotted gar  =============
B D             X. tropicalis  =============
  D           Green seaturtle  =============
  D  Chinese softshell turtle  =============
  D            Painted turtle  =============
B D                Budgerigar  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
  D               Rock pigeon  =============
B D                    Turkey  =============
               Big brown bat  =============
B D                   Chicken  =============
B D                  Platypus  =============
            Black flying-fox  =============
B D                  Microbat  =============
        David's myotis (bat)  =============
B D                       Dog  =============
B D        American alligator  =============
B D               Zebra finch  =============
B D                   Ferret   =============

Alignment block 6 of 1271 in window, 14274130 - 14274240, 111 bps 
B D                     Human  gcgggtccgcggggcg-cttgatacacaggtaaagttctc---tggt------c-------ct-t-----
B D                     Chimp  gcgggtccgcgggggggcttgatgcacaggtaaagttctc---tggt------t-------ct-t-----
B D                   Gorilla  gcgggtccgcgggggg-cttgatgcacaggtgaagttctc---tggt------t-------ct-t-----
B D                 Orangutan  gcgggtccgcggggac-cttgatgcacaggtaaagttctc---tggt------c-------ct-t-----
B D                    Gibbon  gcgggtccgcgggggg-cttgacgcacaggcaaagttctc---cggt------c-------ct-t-----
B D                    Rhesus  gcgggtccgcgggggg-cttgatgcgcaggtaaagttctc---tggt------t-------ct-t-----
B D       Crab-eating macaque  gcgggtccgcgggggg-cttgatgcgcaggtaaagttctc---tggt------t-------ct-t-----
B D                    Baboon  gcgggtccgcgggggg-cttgatgcgcaggtaaagttctc---tggt------t-------ct-t-----
B D              Green monkey  gcgggtccgcgggggg-cttgatgcgcaggtaaagttctc---tggt------t-------ct-t-----
B D                  Marmoset  gcccgtccgcggggag-ctggatgagcaggtaaagttcgc---tggt------c-------ct-t-----
B D           Squirrel monkey  gcgcgtccgtggggag-ctgaaagcgcaggtaaagttcgc---cgga------c-------ct-t-----
B D                  Bushbaby  gcaggtcccggggagg-ctggatgcgcaggtaaagctccc---tggt------c-------ct-g-----
           Chinese tree shrew  gcggatccccggaggg-atcaatgctcaggtaaagctcat---tggt------c-------ct-g-----
B D                  Squirrel  gccgatcccagggggg-ctggatacgcaggtaaagcccac---tggt------c-------ct-------
       Lesser Egyptian jerboa  gcgggt--gggggaag-caagatgtgcaggtacgtgcagt---tggt---------------t-------
B D            Naked mole-rat  gccggtcccttgggga-ctc-aagggcagggaaagttcct---aggt------c-------ct-------
                   Chinchilla  acaggttctgtgggga-ccctaagaacggataaaggtcgt---tggt------c-------ct-------
B D                    Rabbit  gcaggtggccggagga-ctggatgcgcaggtaaaactcct---tcgc------tattcctgct-------
B D                      Pika  gcgggtgccggtggga-ctgaatactcaggtaaaactcct---tcgc------tattcctgct-------
B D                       Pig  gcgggtcccccaaggc-tcctggacgcaggtaaagctcg----gggt------g-------ga-g-----
B D                    Alpaca  gcggctcccccggggc-ccccaggcgcaggtaaaactgct---cggtccggagc-------gg-g-----
               Bactrian camel  gcggctcccctgggg----------------------------cgat-----------------------
B D                   Dolphin  gcggctcccccgaggc-cccgaggcgcaggtaaagattcc---cggt------g-------ga-g-----
                 Killer whale  gcggctcccccgaggc-cccgaggcgcaggtaaagattcc---cggt------g-------ga-g-----
             Tibetan antelope  gcgg---------gtc-accgaggcgcaggtaaagctctt---tggt------g-------gc-g-----
B D                       Cow  gcgg---------gtc-accgaggcgcaggtaaagctctt---tggt------g-------ga-g-----
B D                     Sheep  gcgg---------gtc-accgaggcgcaggtaaagctctt---cggt------g-------ga-g-----
                Domestic goat  gcgg---------gtc-accgaggcgcaggtaaagctctt---tggt------g-------ga-g-----
B D                     Horse  gcgggtccccgggggg-cccgaggcgcaggtaaagctcat---tggt------c-------ct-g-----
B D          White rhinoceros  gcgggtccccgggggg-cccgaggcgcaggtaaagctcat---tggt------c-------cc-g-----
B D                       Cat  gcgggtccccgagggg-cctgaggcgcaggtaatgcttat---tggt------c-------ct-g-----
B D                     Panda  gcgggtccccgagggg-cctggggcgcaggtaatgctcct---tggt------c-------ct-g-----
               Pacific walrus  gcgggtccccgagggg-cctgaggcgcaggtaatgctcat---tggt------c-------ctgggggac
                 Weddell seal  gcgggtccccgagggg-cctgaggcgcaggtactgctcat---tggt------c-------ct-ggggac
              Star-nosed mole  gcgcgtcccggagggg-cccgaggcgcaggtaaagctcat---tggt------c-------ct-g-----
B D                  Elephant  gagggtctccggggga-ctcgaggagcaggtaacgctcat---tggt------c-------ct-g-----
B D                   Manatee  gcgggtctctggggga-ctcaaggcgcaggtaaagctctt---tggc------t-------ct-g-----
             Cape golden mole  gccggtctctggggga-cgaaagacgcaggtaaagctcat---tggt------c-------ct-g-----
B D                    Tenrec  gaggatctct-gggca-caaagacaacagataaag-gcat---aggt------t-------ct-g-----
                     Aardvark  gcgggtccccggcgga-ctccaggcgcaggtaaagcgcattggtggt------c-------ct-g-----
B D                 Armadillo  gcgggtccccgaggcc-cttgaggcgcaggtaaaactctt---tggt------c-------cc-t-----
B D                  Hedgehog  ======================================================================
              Golden hamster  ======================================================================
B D                     Shrew  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                       Rat  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Mouse  ======================================================================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Guinea pig  ======================================================================
B D                    Lizard  ======================================================================
B D                   Megabat  ======================================================================
                 Spotted gar  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                    Turkey  ======================================================================
               Big brown bat  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
            Black flying-fox  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                       Dog  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
B D                   Ferret   ======================================================================

                        Human  --ag-ggg-----agagga---ga---ggcg-----gg-tcgtggggaccact----gtggg--------
                        Chimp  --ag-ggg-----agagga---ga---ggcg-----gg-tcgtggggaccact----gtggg--------
                      Gorilla  --ag-ggg-----agagga---ga---ggcg-----gg-tcgtggggaccact----gtggg--------
                    Orangutan  --ag-ggg-----agacga---ga---ggcg-----gg-tcgtggggactact----gtggg--------
                       Gibbon  --ag-ggg-----agagga---ga---ggcg-----gg-tcgtgggaaccact----gcggg--------
                       Rhesus  --ag-ggg-----agagga---ga---ggcg-----gg-tcgtgggg-ccact----gtggg--------
          Crab-eating macaque  --ag-ggg-----agagga---ga---ggcg-----gg-tcgtgggg-ccact----gtggg--------
                       Baboon  --ag-ggg-----agagga---ga---ggcg-----gg-tcgtgggg-ccact----gtggg--------
                 Green monkey  --ag-ggg-----agagga---ga---ggcg-----gg-tcgtgggg-ccact----gtggg--------
                     Marmoset  --ag-ggg-----agaggagagga---ggct-----gg-tcgtgggg-ccact----gtggg--------
              Squirrel monkey  --ag-ggg-----agaggagagga---ggct-----gg-ccgtgggg-ccact----gtggg--------
                     Bushbaby  --gg-ggg----aagaggc---gt---ggca-----ag-tctttggg-ccact----ctggg--------
           Chinese tree shrew  --gg-ggg-----cgaggc---gc---ggca-----gg-cgttaggg-tcact----ttggggc------
                     Squirrel  --gg-ggc-----cgagga---ag---agca-----ag-ttttggc---------ggctccg--------
       Lesser Egyptian jerboa  --gg-gg-------gaaga---ag-acagta-----gg-cgtcttc---------tactgtt--------
               Naked mole-rat  --ag-gtg-----agagga---ggcggagca-----ag-tctccta---ccctcgggctggg--------
                   Chinchilla  --gg-gtg-----agagaa---ggtggagga-----ag-tcttctg--cccctcgggttggg--------
                       Rabbit  --gg-ggg-----agaggc---ag---ggca-----ag-tctccag--ccact----ctgcg--------
                         Pika  ---g-ggg-----agaggc---gg---ggca-----aa-tttcccg--cccct----ctggg--------
                          Pig  --ca-gggtgggaaaaagc---gg---ggcg-----gt-tttctgg--ctggt----ctgag--------
                       Alpaca  --ag-ggg-----agaggc---gg---gggg-----atttttctgg--ccaat----tgggg--------
               Bactrian camel  ---------------------------------------tttctgg--ccaat----tgggg--------
                      Dolphin  --gt-gcg-----ggaggc---gg---gacg-----gt-tttctgg--ccaat----ctgg---------
                 Killer whale  --gt-gcg-----ggaggc---gg---gacg-----gt-tttctgg--ccaat----ctgg---------
             Tibetan antelope  --gt-ggg-----agaggc---gg---ggcg-----gt-tttccgg--ccaat----ctgg---------
                          Cow  --gt-ggg-----agaggc---gg---ggcg-----gt-tttccgg--ccaat----ctgg---------
                        Sheep  --gt-ggg-----agaggc---gg---ggcg-----gt-tttccgg--ccaat----ctgg---------
                Domestic goat  --gg-ggg-----agaggg---gg---ggcg-----gg-tttcccg--ccaat----ctgg---------
                        Horse  --gg-ggg-----agaggc---gg---ggcg-----gt-cttctcg--cggct----ctggg--------
             White rhinoceros  --gg-agg-----agaggc---gg---ggcg-----gt-cttctgg--ccgct----ctggg--------
                          Cat  --cg-ggg-----agaggc----g---ggcg-----gt-ctcccgg--ccact----ctcga--------
                        Panda  --cg-ggg-----agaggc----a---ggtg-----gt-cttc--g--cccct----gtggg--------
               Pacific walrus  cctg-ggg-----ggaggc----g---ggcg-----gt-cttc--g--ccact----ctggg--------
                 Weddell seal  cctg-ggg-----ggaggc----g---ggcg-----gt-cttc--g--ccgct----ctggg--------
              Star-nosed mole  --gg-ggc-----agaggc---gg---ggct-----gt-tttgggg--ccact----ctggg--------
                     Elephant  --ga-ggg-----agaggc---gg---ggct-----gg-tcttctgctcccag----ggcgg--------
                      Manatee  --ga-ggg-----agagaa---gg---ggct-----gg-ttttctggcccctg----gtcgg--------
             Cape golden mole  --ggtggg-----agaggc---gg---gacgggactgg-tcttctggcttctg----ggtggc-------
                       Tenrec  --g--ggg-----agagtt---gg---ggcg-----gc-ttttcctgtccagg----gggagcagtcagg
                     Aardvark  --ga-ggg-----agaggc---gg---agct-----gg-tcttttggcacaag----ggcgg--------
                    Armadillo  --ggcggg-----agaggc---gg----gca-----ga-tcttctactccttt----gaaga--------
                     Hedgehog  ======================================================================
               Golden hamster  ======================================================================
                        Shrew  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                          Rat  ======================================================================
          Cape elephant shrew  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Guinea pig  ======================================================================
                       Lizard  ======================================================================
                      Megabat  ======================================================================
                  Spotted gar  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                       Turkey  ======================================================================
                Big brown bat  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
             Black flying-fox  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                          Dog  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================
                      Ferret   ======================================================================

                        Human  -----t-------------------gcaggagtgg-a----agt-----ggggagaggtg
                        Chimp  -----t-------------------gcaggagtgg-a----agt-----ggggagaggtg
                      Gorilla  -----t-------------------gcaggagtgg-a----agt-----gaggagaggtg
                    Orangutan  -----t-------------------gcaggagtgg-a----agt-----ggggagaggtg
                       Gibbon  -----t-------------------gcaggagtgg-a----agt-----ggggagaggtg
                       Rhesus  -----t-------------------gcgggagtgg-a----agt-----ggggagaggtg
          Crab-eating macaque  -----t-------------------gcgggagtgg-a----agt-----ggggagaggtg
                       Baboon  -----t-------------------gcgggagtga-a----agt-----ggggagaggtg
                 Green monkey  -----t-------------------gcgggagtgg-a----agt-----ggggagaggtc
                     Marmoset  -----t-------------------gggggagtgg-a----agt-----ggagagaggtg
              Squirrel monkey  -----t-------------------gggggagtgg-a----agc-----ggggagaggtg
                     Bushbaby  -----t-------------------ggggaagtgg-t----agt-----ggggagagctg
           Chinese tree shrew  -----t-------------------gaggatgtgg-a----agc-----caggagagcgg
                     Squirrel  -----g-------------------tgggggcggg-a----gtg-----gaaaagggggg
       Lesser Egyptian jerboa  -----g-------------------aggggagggg-a----agc-----caggagagctg
               Naked mole-rat  --------------------------tgggagcgg-g----ggc-----agggagagcgg
                   Chinchilla  -----g-------------------tggggagcag-a----agc-----gaggagagcag
                       Rabbit  -----t-------------------ggggcagtgt-a----agc-----caggaacg---
                         Pika  -----t-------------------cagggagtgg-a----atc-----tggaaacctgg
                          Pig  -------------------------ggaaaaagga-a----agt-----ggggagagcta
                       Alpaca  -----ttgctggggggtggggggacggggaaaggg-a----agt-----aggaagaactg
               Bactrian camel  -----ttgctgtggggtggggggacggcgaaaggg-a----agt-----aggaagaactg
                      Dolphin  -------------------------cggcgagggg-a----agc-----ggggagagctg
                 Killer whale  -------------------------cggcgagggg-a----agc-----ggggagagctg
             Tibetan antelope  -------------------------ggaccaaggg-a----agt-----ggggagagttg
                          Cow  -------------------------ggacgaaggg-a----agt-----ggggagagctg
                        Sheep  -------------------------ggaccaaggg-t----agt-----ggggagagttg
                Domestic goat  -------------------------gg--------------------------------g
                        Horse  -----t-------------------ggggaaaggg-a----agc-----ggggagagctg
             White rhinoceros  -----t-------------------ggggaaaggg-a----agc-----gggcagagccg
                          Cat  -----t-------------------ggcgaaaggg-a----gttgcggagggtagagcct
                        Panda  -----t---------------------ggagaggg-a----ggt-----ggggagagccg
               Pacific walrus  -----t-------------------ggggagaggg-atcccggtg----ggggagagccg
                 Weddell seal  -----t-------------------ggggagaggg-a----ggtg----ggggagagccg
              Star-nosed mole  -----a-------------------ggagaaaaggcg----agc-----agagaaaactg
                     Elephant  -----g-------------------ggagacaggg-a----cag-----aggtgtttctg
                      Manatee  -----g-------------------ggagacaggg-g----cgg-----gg--gtctctg
             Cape golden mole  -----t-------------------gga---ctga-g----aaa-----ctgtggtgcga
                       Tenrec  tgaggt-------------------ggggtcctgg-a----aag-----tggcgtttctg
                     Aardvark  -----g-------------------gg-----tag-g----gag-----gggtgtctctg
                    Armadillo  -----a-------------------gg-----------------------ggcagctctg
                     Hedgehog  ============================================================
               Golden hamster  ============================================================
                        Shrew  ============================================================
                 Prairie vole  ============================================================
              Chinese hamster  ============================================================
                          Rat  ============================================================
          Cape elephant shrew  ============================================================
                        Mouse  ============================================================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Guinea pig  ============================================================
                       Lizard  ============================================================
                      Megabat  ============================================================
                  Spotted gar  ============================================================
                X. tropicalis  ============================================================
              Green seaturtle  ============================================================
     Chinese softshell turtle  ============================================================
               Painted turtle  ============================================================
                   Budgerigar  ============================================================
             Peregrine falcon  ============================================================
                 Saker falcon  ============================================================
                  Rock pigeon  ============================================================
                       Turkey  ============================================================
                Big brown bat  ============================================================
                      Chicken  ============================================================
                     Platypus  ============================================================
             Black flying-fox  ============================================================
                     Microbat  ============================================================
         David's myotis (bat)  ============================================================
                          Dog  ============================================================
           American alligator  ============================================================
                  Zebra finch  ============================================================
                      Ferret   ============================================================

Inserts between block 6 and 7 in window
B D                     Pika 134bp
               Domestic goat 48bp

Alignment block 7 of 1271 in window, 14274241 - 14274250, 10 bps 
B D                     Human  a--------gt----cctcgaa
B D                     Chimp  a--------gt----cctcgaa
B D                   Gorilla  a--------gt----cctcgaa
B D                 Orangutan  a--------gt----cctcgaa
B D                    Gibbon  a--------gt----cctcgaa
B D                    Rhesus  a--------gt----cctcgaa
B D       Crab-eating macaque  a--------gt----cctcgaa
B D                    Baboon  a--------gt----cctcgaa
B D              Green monkey  a--------gt----cctcgaa
B D                  Marmoset  a--------gt----cctcgga
B D           Squirrel monkey  a--------gt----cctcgga
B D                  Bushbaby  a--------gt----cctggga
           Chinese tree shrew  a--------tc----gcttgg-
B D                  Squirrel  actggttggct----cctggga
       Lesser Egyptian jerboa  actctacagtt----cctgaga
B D            Naked mole-rat  a--------tt----cccgcga
                   Chinchilla  a--------tt----cctgcgg
B D                    Rabbit  --tgggcatat----cctgatg
B D                       Pig  a--------ct----gttgaga
B D                    Alpaca  g--------ct----gtccaga
               Bactrian camel  g--------ct----gtccaga
B D                   Dolphin  a--------tt----gtccaga
                 Killer whale  a--------tt----gtccaga
             Tibetan antelope  a--------ct----gtgcaaa
B D                       Cow  a--------ct----gtgcaga
B D                     Sheep  a--------ct----gtgcaga
                Domestic goat  n--------nn----gtggaga
B D                     Horse  a--------ctgttcgttcaga
B D          White rhinoceros  a--------ct----gttcaga
B D                       Cat  c--------ct----gttaaga
B D                     Panda  c--------tt----gttcgga
               Pacific walrus  c--------gg----gttcgga
                 Weddell seal  c--------cg----gttcgga
              Star-nosed mole  a--------ct------tcaga
B D                  Elephant  g--------ct----ctgcaga
B D                   Manatee  a--------ct----cttcaga
             Cape golden mole  a--------ct----cttctga
B D                    Tenrec  a--------cc----cctcaga
                     Aardvark  a--------tt----cttcaga
B D                 Armadillo  g---------g----ccgcaga
B D                  Hedgehog  ======================
              Golden hamster  ======================
B D                      Pika  ======================
B D                     Shrew  ======================
                Prairie vole  ======================
B D           Chinese hamster  ======================
B D                       Rat  ======================
         Cape elephant shrew  ======================
B D                     Mouse  ======================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNN
B D                Guinea pig  ======================
B D                    Lizard  ======================
B D                   Megabat  ======================
                 Spotted gar  ======================
B D             X. tropicalis  ======================
  D           Green seaturtle  ======================
  D  Chinese softshell turtle  ======================
  D            Painted turtle  ======================
B D                Budgerigar  ======================
  D          Peregrine falcon  ======================
  D              Saker falcon  ======================
  D               Rock pigeon  ======================
B D                    Turkey  ======================
               Big brown bat  ======================
B D                   Chicken  ======================
B D                  Platypus  ======================
            Black flying-fox  ======================
B D                  Microbat  ======================
        David's myotis (bat)  ======================
B D                       Dog  ======================
B D        American alligator  ======================
B D               Zebra finch  ======================
B D                   Ferret   ======================

Alignment block 8 of 1271 in window, 14274251 - 14274373, 123 bps 
B D                     Human  ccctgaa-cgtggacg-ga-----c-gagc-ccttgttt---cagtagccaa-----------cacac--
B D                     Chimp  ccctgaa-tgtggact-ga-----c-gagc-ccttgttt---cagtagccat-----------cacac--
B D                   Gorilla  cgctgaa-tgtggact-ga-----c-gagc-ccttgttt---cagtagccag-----------cacac--
B D                 Orangutan  ccctgaa-tgtggact-ga-----c-gagc-ccttgttt---cagtagccat-----------cacac--
B D                    Gibbon  ccctgaa-tgtggact-ga-----c-gagc-ccttgttt---cagtagccat-----------cacac--
B D                    Rhesus  ccctgga-tgtggact-ga-----c-aagc-ccttgttt---gagtagccat-----------cacac--
B D       Crab-eating macaque  ccctgga-tgtggact-ga-----c-aagc-ccttgttt---gagtagccat-----------cacac--
B D                    Baboon  ccctgga-tgtggact-ga-----c-gacc-ccttgttt---gagtagccat-----------cacac--
B D              Green monkey  ccctgga-tgtggact-ga-----c-aagc-ccttgttt---gagtagccat-----------cacac--
B D                  Marmoset  ccctgaa-tgtggact-ta-----t-gagc-ccttgttt---cagttgtcat-----------cacac--
B D           Squirrel monkey  ccccgaa-tgtggact-ga-----t-gagc-ccttgttt---cagtcgtcat-----------cacac--
B D                  Bushbaby  ccctgca-cgtaggct-gatgtctc-agaa-ctttgtt-----agtaggaat-----------cacct--
           Chinese tree shrew  ctctgaa-cgtgggct-ggtgactt-ggag-ccttgtct---tagcagcaat-----------cacac--
B D                  Squirrel  ccgtgga-c-taggca-gatgtctt-a---------ttt---tagtggt---------------------
       Lesser Egyptian jerboa  --------------------gtcac-t---------ttc---ctgaagt---------------------
B D            Naked mole-rat  cct--gg-c-cagaac-ccgggcgc-agag-cgct-ttc---cagcaggcat-----------cactc--
                   Chinchilla  ccctgag-c-cagaat-gctgtcac-agag-cactgttt---ccgcagtcaa-----------cattc--
B D                    Rabbit  acttag------------------------------ttt---tagtagaaat-----------cacac--
B D                       Pig  tctggaaacgtgaatt-gatgtctt-agat-ctttgttt---tcctagtaa-------------------
B D                    Alpaca  ccctgaaatgtcaact-gatgtctt-aca---cctgctt---tcgtagtaat-----------cacccac
               Bactrian camel  ccctgaaatgtcaact-gatgtctt-aca---cctgctt---tcgtagtaat-----------cacccac
B D                   Dolphin  ccctgaaacgcgaact-ggtgtctt-agat-ccctgttt---ttgtcgtaat-----------cacacag
                 Killer whale  ccctgaaacgcgaact-ggtgtctt-agat-ccctgttt---ttgtcgtaat-----------cacacag
             Tibetan antelope  ccctgaaacgtgaatt-gatgtctt-agat-ccctgtat---gcgtagtagt-----------caaac--
B D                       Cow  ccctgaaacatgaact-gatgtctt-agac-ccctgtat---gcgtagtagt-----------caaac--
B D                     Sheep  ccctgaaacgtgaatt-gatgtctt-agat-ccctgtat---gcgtagtagt-----------caaac--
                Domestic goat  ctcagacgcgagtagt-ggtgtct---gat-acctgtgt---gtgtggtagt-----------ctcac--
B D                     Horse  ccctgaaccttgaact-gatgtctt-aga--tccttgtt---taatagtaat-----------catac--
B D          White rhinoceros  ccttgaactgtgaact-gatgtc-----a--ccgtgctt---taatagcagt-----------cacac--
B D                       Cat  cgctgaaacgcaaagt-gatggttt-agag-tcttgttt---tagccgtaatcacacacgacacacac--
B D                   Ferret   -----cccggggcacg-gatggctt-cgag-ccgcgtgttcgcagcagtcgc-----------caccc--
B D                     Panda  cgctggcctgtgacct-ggtgtttt-agag-ccccgttt---tagtagtcat-----------cccac--
               Pacific walrus  cgctggcctgtgagct-gatgtttt-agagcccccgttttagtagtagtaat-----------cacac--
                 Weddell seal  cgctggcctgtgaact-gatgtttt-agagcccccgttt---tagtagtaat-----------cacac--
              Star-nosed mole  ccctgaagtg-aaact-gatgtctt-------------t---tggtagtaat-----------cgcgcaa
B D                  Elephant  ccctgaaaagtggacc-tttgtcgt-agag-ccttgttt---tcatagtaac-----------aaaac--
B D                   Manatee  cccggaaaggcggacc-tttgtcttaaggg-gcttgttt---tcgtagtaac-----------aacac--
             Cape golden mole  ccctgaaaagtggacc-----tctt-aaag-gcttgttt---taaaagtaac-----------agca---
B D                    Tenrec  tgctgagaagtggcct--ttgtttt-aaat-tctagttt---tcatagtaat-----------cacac--
                     Aardvark  ccctgaaacttgggacagttgcctt-agag-gcttgttt---taatagtaac-----------aactc--
B D                 Armadillo  ccctgaagtgtgagtg-gctgtctt-agat-acctgttg---tgagagtcat-----------cccac--
B D                  Hedgehog  ======================================================================
              Golden hamster  ======================================================================
B D                      Pika  ======================================================================
B D                     Shrew  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                       Rat  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Mouse  ======================================================================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Guinea pig  ======================================================================
B D                    Lizard  ======================================================================
B D                   Megabat  ======================================================================
                 Spotted gar  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                    Turkey  ======================================================================
               Big brown bat  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
            Black flying-fox  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                       Dog  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================

                        Human  ----------------------------acg-gg-a------ca--gacaga----------ccggcgta
                        Chimp  ----------------------------acg-gg-a------ca--gacaga----------cccgcgta
                      Gorilla  ----------------------------acg-gg-a------ca--gacaga----------cccgcgta
                    Orangutan  ----------------------------acg-gg-a------ca--gacaga----------cgcgcgta
                       Gibbon  ----------------------------acg-gg-a------ca--gacaga----------cccgcgta
                       Rhesus  ----------------------------acg-gg-a------ca--gaccga----------cccgcata
          Crab-eating macaque  ----------------------------acg-gg-a------ca--gaccga----------tccgcata
                       Baboon  ----------------------------acg-gg-a------ca--cacaga----------cccgcata
                 Green monkey  ----------------------------acg-gg-a------ca--gacaga----------cgcgcata
                     Marmoset  ----------------------------gcg-gg-a------ta--aacaga----------cctgcatt
              Squirrel monkey  ----------------------------acg-gg-a------ta--gacaga----------gctgcaga
                     Bushbaby  ----------------------------cca-gg------------gacaga----------------tg
           Chinese tree shrew  ----------------------------acgtag-a------ca--gacggg----------ctcgc---
                     Squirrel  ----------------------------gca-g----------a--gacaga----------cacatgca
       Lesser Egyptian jerboa  ----------------------------act-g-----------------ga----------tacacacg
               Naked mole-rat  ----------------------------act-g----------a--gcggga----------cacg----
                   Chinchilla  ----------------------------tct-g----------a--gcaaga----------gacacac-
                       Rabbit  ----------------------------aca-c----------a--cacaca----------cacacaca
                          Pig  ----------------------------------------------atcaga----------cacacaca
                       Alpaca  agacc-ggacggac--------ggacggacg-taca------ca--cacaca----------cacacaga
               Bactrian camel  agaca-gcacggac----------acggaca-caca------ca--cacaca----------cacacaca
                      Dolphin  ggaca-gcacagat----------tcagacg-cgca------cgcacacaca----------cacagaca
                 Killer whale  ggaca-gcacagat----------tcagacg-cgca------cg--cacaca----------cacagaca
             Tibetan antelope  ----------------------------aca-caca------ga--cacaca----------cacaaaca
                          Cow  ----------------------------ata-caca------ca--cacaca----------cacacaca
                        Sheep  ----------------------------aca-caca------ca--cacaca----------cacacaca
                Domestic goat  ----------------------------aca-caca------ca--cacaca----------cacacaca
                        Horse  ----------------------------acg-cactcgcgcgcg--cgcgcg----------tgcacac-
             White rhinoceros  ----------------------------a-------------cg--cgcgca----------cacacac-
                          Cat  ----------------------------aca-caca------ca--cacaca----------cacacaca
                      Ferret   ----------------------------aca-gaga------cg--gacgga----------cgc-----
                        Panda  ----------------------------aca-gaga------ca--gacgga----------cacgcac-
               Pacific walrus  ----------------------------aca-caga------cg--gacaga----------cacacaca
                 Weddell seal  ----------------------------aca-caga------cg--gacgga----------cacgcaca
              Star-nosed mole  gcgcgcgcacatacacttacaggcacacaca-cgct------cg--cgcaaa----------cacacaca
                     Elephant  ----------------------------aca-----------ca--gagcag----------cgcacaga
                      Manatee  ----------------------------aca-----------ca--ttg--------------gcacaca
             Cape golden mole  ----------------------------------------------------------------------
                       Tenrec  ----------------------------aca-----------ta--gtggcc----------ttcagaca
                     Aardvark  ----------------------------ccg-----------cc--cccccccccccccccacacagaca
                    Armadillo  ----------------------------aca-----------ga--cgcaca----------ttcagata
                     Hedgehog  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                        Shrew  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                          Rat  ======================================================================
          Cape elephant shrew  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Guinea pig  ======================================================================
                       Lizard  ======================================================================
                      Megabat  ======================================================================
                  Spotted gar  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                       Turkey  ======================================================================
                Big brown bat  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
             Black flying-fox  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                          Dog  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================

                        Human  ----c---acact------------------------------------c--------------------
                        Chimp  ----c---acact------------------------------------c--------------------
                      Gorilla  ----c---acact------------------------------------c--------------------
                    Orangutan  ----c---acact------------------------------------c--------------------
                       Gibbon  ----c---acact------------------------------------c--------------------
                       Rhesus  ----c---acact------------------------------------c--------------------
          Crab-eating macaque  ----c---acact------------------------------------c--------------------
                       Baboon  ----c---acact------------------------------------c--------------------
                 Green monkey  ----c---acact------------------------------------c--------------------
                     Marmoset  ----c---acact------------------------------------c--------------------
              Squirrel monkey  ----c---acgct------------------------------------c--------------------
                     Bushbaby  ----c---acact------------------------------------c--------------------
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  ----c---acact-----------------------------------cc--------------------
       Lesser Egyptian jerboa  ----g---tcacc-----------------------------------ag--------------------
               Naked mole-rat  --------ggagc-----------------------------------gc--------------------
                   Chinchilla  --------gaagg-----------------------------------gc--------------------
                       Rabbit  ----c---acact-----------------------------------ca--------------------
                          Pig  ----c---gctca------------------------------------g--------------------
                       Alpaca  ----c---acaca------------------------------------c--------------------
               Bactrian camel  ----c---acaca------------------------------------c--------------------
                      Dolphin  ----c---acaca------------------------------------c--------------------
                 Killer whale  ----c---acaca------------------------------------c--------------------
             Tibetan antelope  ----c---acaca---------------------------------------------------------
                          Cow  ----c---acaca------------------------------------c--------------------
                        Sheep  ----c---acaca------------------------------------cacacacacacacacacacac
                Domestic goat  ----c---acaca------------------------------------c--------------------
                        Horse  --------acact------------------------------------a--------------------
             White rhinoceros  --------tcacg------------------------------------a--------------------
                          Cat  ----c---acaca------------------------------------c--------------------
                      Ferret   --------gcgcg------------------------------------c--------------------
                        Panda  --------gcgcg------------------------------------c--------------------
               Pacific walrus  ----atgcgcgcg------------------------------------c--------------------
                 Weddell seal  ----a---gcgcg------------------------------------c--------------------
              Star-nosed mole  ----c---gcacg------------------------------------c--------------------
                     Elephant  ----c---acacg------------------------------------c--------------------
                      Manatee  ----g---acacg------------------------------------c--------------------
             Cape golden mole  ----c---acatt------------------------------------c--------------------
                       Tenrec  gtctc---acatt------------------------------------c--------------------
                     Aardvark  ----c---aaatt------------------------------------c--------------------
                    Armadillo  ----c---acgctccccacctctccccttttccccctctttccctgtccc--------------------
                     Hedgehog  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                        Shrew  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                          Rat  ======================================================================
          Cape elephant shrew  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Guinea pig  ======================================================================
                       Lizard  ======================================================================
                      Megabat  ======================================================================
                  Spotted gar  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                       Turkey  ======================================================================
                Big brown bat  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
             Black flying-fox  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                          Dog  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================

                        Human  ----------a-atcctcagagcagagatcagag------------------------------------
                        Chimp  ----------a-atcctgagagcagagatgagag------------------------------------
                      Gorilla  ----------a-atcctgagagcagagatcagag------------------------------------
                    Orangutan  ----------a-atcctgagagcagagagcagac------------------------------------
                       Gibbon  ----------a-ctcctgagagcagagatcagag------------------------------------
                       Rhesus  ----------a-atcctggaagcagagatcagag------------------------------------
          Crab-eating macaque  ----------a-atcctggaagcagagatcagag------------------------------------
                       Baboon  ----------a-atcctggaagcagagatcagag------------------------------------
                 Green monkey  ----------a-atcctggaagcagagatcagag------------------------------------
                     Marmoset  ----------a-atcctgagagcagagagcagag------------------------------------
              Squirrel monkey  ----------a-atcctgagagcagagcgcagcg------------------------------------
                     Bushbaby  ----------a-atcttgagagtc-agatcaatc------------------------------------
           Chinese tree shrew  -------------tccggagagcagaggtcagtt------------------------------------
                     Squirrel  ----------a-atcctgagagctgagatcagtc------------------------------------
       Lesser Egyptian jerboa  ----------a-gtcctgatgg---------gtc------------------------------------
               Naked mole-rat  ----------a-atccggagagcggaagtcagta------------------------------------
                   Chinchilla  ----------a-gtccg-----------------------------------------------------
                       Rabbit  ----------c-acacacaccacgcaga---gtc------------------------------------
                          Pig  ---------ga-----------------------------------------------------------
                       Alpaca  ------acaca-gtagggagagctgagaacactc------------------------------------
               Bactrian camel  ------acacacacacacacacacacacacacacannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                      Dolphin  ----------a-gtcgggagagctgagatcagac------------------------------------
                 Killer whale  ----------a-gtcgggagagctgagatcagac------------------------------------
             Tibetan antelope  ---------ga-gtctgaagagctaagatctgtc------------------------------------
                          Cow  ----acgcaca-gtcttaagagctaagatctgtc------------------------------------
                        Sheep  acacacacaga-gtctgaagagctaagatctgtc------------------------------------
                Domestic goat  ---------ga-gtctgaagagctaagatctgtc------------------------------------
                        Horse  ----------g-atcgtgagagctgagattagtc------------------------------------
             White rhinoceros  ----------g-atcgtgagagctgacatcagtc------------------------------------
                          Cat  ----------a-cacacgaggg-------cagtc------------------------------------
                      Ferret   ----------a-gtcgggggagctgacgccggtc------------------------------------
                        Panda  ----------c-atcgtgagagctgacgccagtc------------------------------------
               Pacific walrus  ----------a-gtcgtgagagctgacaccagtc------------------------------------
                 Weddell seal  ----------a-gtcgtgagagctgacaccagtc------------------------------------
              Star-nosed mole  ------gcgcg-cgtgagacagcagagagctgtc------------------------------------
                     Elephant  ----------a---cgtgagagctaagata-ttc------------------------------------
                      Manatee  ----------a---cacgagagctaagata-gtc------------------------------------
             Cape golden mole  ----------a-atcgtgagagttaaatta-gtt------------------------------------
                       Tenrec  ----------a-gtcttgcgtctttggaca-gcc------------------------------------
                     Aardvark  ----------a-atcgtgagagctaagaga-gtc------------------------------------
                    Armadillo  ----------a-ttcttgagagctgagatctgga------------------------------------
                     Hedgehog  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                        Shrew  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                          Rat  ======================================================================
          Cape elephant shrew  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Guinea pig  ======================================================================
                       Lizard  ======================================================================
                      Megabat  ======================================================================
                  Spotted gar  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                       Turkey  ======================================================================
                Big brown bat  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
             Black flying-fox  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                          Dog  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================

                        Human  ---atc--agggtag-gtgcaacttgaaccag-
                        Chimp  ---atc--ggggtgg-gtgcaacttgaaccag-
                      Gorilla  ---atc--ggggtgg-gtgcaacttgaaccag-
                    Orangutan  ---atc--agggcgg-gtgcaacttgaaccag-
                       Gibbon  ---atc--agggtgg-gtgcaacttgaaccag-
                       Rhesus  ---atc--agggtg----------tgaaccac-
          Crab-eating macaque  ---atc--agggtg----------tgaaccac-
                       Baboon  ---atc--agggtg----------tgaaccac-
                 Green monkey  ---atc--agggtgg-gtgcaacttgaaccac-
                     Marmoset  ---atc--agggtgg-gtgcagcttgaaccag-
              Squirrel monkey  ---gtc--agggtgg-gcgcagcttgaaccag-
                     Bushbaby  ---tcc--aggatggtgtgaaatctgagccag-
           Chinese tree shrew  ---tcc--aggagggtgggaaacctgagccat-
                     Squirrel  ---ccc--aggacggtgggaaacctgagccat-
       Lesser Egyptian jerboa  ---cac--aggacagagtgaagcttgagccct-
               Naked mole-rat  ---c-a--aggatggagtgaggcctgagtctt-
                   Chinchilla  -----c--agggtggtgtgaaaactgagtctt-
                       Rabbit  ---tcc--aggatggtgtgaaacctgagctgt-
                          Pig  ---------ggatggtgtgaaacttaaacctt-
                       Alpaca  ---ccc--aggatggtgtgaaacttgagccat-
               Bactrian camel  nnnccc--aggatggtgtgaaacttgagccat-
                      Dolphin  ---ccc--aggatggtgtgaaacttcagccag-
                 Killer whale  ---ccc--aggatggtgtgaaacttcagccag-
             Tibetan antelope  ---cat--gggatggtgtgaaacttcaccgag-
                          Cow  ---cat--gggatggtgtgaaacttcaccgag-
                        Sheep  ---cat--gggatggtgtgaaacttcacagag-
                Domestic goat  ---cat--gggatggtgtgaaacttcaccgag-
                        Horse  ---ccc--aggatggtgtgaaacctacgccat-
             White rhinoceros  ---ccc--aggatggtgtgaaacctaggccat-
                          Cat  ---ttg--agagcgg------------------
                      Ferret   ---ccc--gggactctgggagatcggagccgt-
                        Panda  ---ctc--aggatgatgtgaaatctgaaccat-
               Pacific walrus  ---ctc--aggatgatgtgaaatctgaaccat-
                 Weddell seal  ---ctc--gggatgatgtgaactctgaaccat-
              Star-nosed mole  ---tcc--agca--gtgtgaaacctgggccat-
                     Elephant  ---acc--tgggtgatgtgaaacctcagccacc
                      Manatee  ---cct--tgtatggtgtgaaacctgagccgcc
             Cape golden mole  ---ccc--agggtggtgtga-aaatgagccatc
                       Tenrec  ---gcc--agagtagtgtggcagctgagtcagc
                     Aardvark  ---ccccagggatgatgtgaaacctaagc---a
                    Armadillo  ---ccc--gcgatggtttgaaacctgagctgtc
                     Hedgehog  =================================
               Golden hamster  =================================
                         Pika  =================================
                        Shrew  =================================
                 Prairie vole  =================================
              Chinese hamster  =================================
                          Rat  =================================
          Cape elephant shrew  =================================
                        Mouse  =================================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Guinea pig  =================================
                       Lizard  =================================
                      Megabat  =================================
                  Spotted gar  =================================
                X. tropicalis  =================================
              Green seaturtle  =================================
     Chinese softshell turtle  =================================
               Painted turtle  =================================
                   Budgerigar  =================================
             Peregrine falcon  =================================
                 Saker falcon  =================================
                  Rock pigeon  =================================
                       Turkey  =================================
                Big brown bat  =================================
                      Chicken  =================================
                     Platypus  =================================
             Black flying-fox  =================================
                     Microbat  =================================
         David's myotis (bat)  =================================
                          Dog  =================================
           American alligator  =================================
                  Zebra finch  =================================

Inserts between block 8 and 9 in window
B D                   Baboon 1175bp
B D                 Marmoset 1bp
B D          Squirrel monkey 1bp
B D                 Bushbaby 1bp
          Chinese tree shrew 1bp
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 1bp
B D           Naked mole-rat 1bp
                  Chinchilla 1bp
B D                   Rabbit 1bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
             Star-nosed mole 1bp

Alignment block 9 of 1271 in window, 14274374 - 14274392, 19 bps 
B D                     Human  agg-------agctcagtct-tggt---ag
B D                     Chimp  agg-------agctcagtct-tggt---ag
B D                   Gorilla  agg-------agctcagtct-tggt---ag
B D                 Orangutan  agg-------agctcagtct-tggt---ag
B D                    Gibbon  aga-------agctcagtct-tggt---ag
B D                    Rhesus  agg-------agctcagtct-tggt---ag
B D       Crab-eating macaque  agg-------agctcagtct-tggt---ag
B D                    Baboon  agg-------agctcagtct-tggt---ag
B D              Green monkey  agg-------agctcagtct-tggt---ag
B D                  Marmoset  ggg-------agctcagtct-tggt---gg
B D           Squirrel monkey  ggc-------agctcagcct-tggt---gg
B D                  Bushbaby  gcg-------atctcagtct-tggt---gg
           Chinese tree shrew  agg-------atcttgggcg-aggt---gg
B D                  Squirrel  gtg-------atctacgcct----------
       Lesser Egyptian jerboa  att-------acatgcatccatgga-----
B D            Naked mole-rat  gtg-------atctgtgtct-tact-----
                   Chinchilla  cag-------atctgtgtct-tgtt-----
B D                    Rabbit  gga-------tcttagttct-tggtgct--
B D                       Pig  act-------atctcagtgg-aggt---gg
B D                    Alpaca  aag-------acctcagtcg-gggt---gg
               Bactrian camel  aag-------acctcagtcg-cggt---gg
B D                   Dolphin  gcg-------atctcagtca-aggt---gg
                 Killer whale  gcg-------atctcagtca-aggt---gg
             Tibetan antelope  aag-------atctcagtca-aggt---gg
B D                       Cow  aag-------atctcagtca-aggt---gg
B D                     Sheep  aag-------atcacagtca-aggt---gg
                Domestic goat  aag-------atctcagtca-aggt---gg
B D                     Horse  actcatcgctgtctcagtca-aggt---gg
B D          White rhinoceros  actcatcaccatctcagtca-aggt---gg
B D                       Cat  --------------cagtcg-agga---gg
B D                   Ferret   cag-------atctccgtcc-aggt---gg
B D                     Panda  aag-------atctcagtcc-aggt---gg
               Pacific walrus  aag-------atctcagtca-aggt---gg
                 Weddell seal  aag-------atctcagtca-aggt---gg
              Star-nosed mole  acg-------atcc---tca-ggtt---gt
B D                  Elephant  acc-------atctcagcct-tgct---gg
B D                   Manatee  acc-------atctcagtct-tggt---gg
             Cape golden mole  acc-------atctcttcct-gggt---gg
B D                    Tenrec  acc-------tcc-----------------
                     Aardvark  acc-------atctcagtct-cggt---gg
B D                 Armadillo  acg-------atcacg------ggt---gg
B D                  Hedgehog  ==============================
              Golden hamster  ==============================
B D                      Pika  ==============================
B D                     Shrew  ==============================
                Prairie vole  ==============================
B D           Chinese hamster  ==============================
B D                       Rat  ==============================
         Cape elephant shrew  ==============================
B D                     Mouse  ==============================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Guinea pig  ==============================
B D                    Lizard  ==============================
B D                   Megabat  ==============================
                 Spotted gar  ==============================
B D             X. tropicalis  ==============================
  D           Green seaturtle  ==============================
  D  Chinese softshell turtle  ==============================
  D            Painted turtle  ==============================
B D                Budgerigar  ==============================
  D          Peregrine falcon  ==============================
  D              Saker falcon  ==============================
  D               Rock pigeon  ==============================
B D                    Turkey  ==============================
               Big brown bat  ==============================
B D                   Chicken  ==============================
B D                  Platypus  ==============================
            Black flying-fox  ==============================
B D                  Microbat  ==============================
        David's myotis (bat)  ==============================
B D                       Dog  ==============================
B D        American alligator  ==============================
B D               Zebra finch  ==============================

Inserts between block 9 and 10 in window
          Chinese tree shrew 1bp
B D                      Pig 2bp
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 2bp
               Domestic goat 2bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
             Star-nosed mole 2bp
B D                 Elephant 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 10 of 1271 in window, 14274393 - 14274393, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  t
           Chinese tree shrew  a
       Lesser Egyptian jerboa  a
B D            Naked mole-rat  g
                   Chinchilla  g
B D                    Rabbit  g
B D                      Pika  g
B D                  Elephant  a
B D                   Manatee  a
             Cape golden mole  a
                     Aardvark  a
B D                 Armadillo  g
B D                  Hedgehog  =
              Golden hamster  =
             Star-nosed mole  =
B D                     Shrew  =
B D                    Tenrec  -
                Prairie vole  =
B D           Chinese hamster  =
B D                       Rat  =
         Cape elephant shrew  =
B D                     Mouse  =
            Brush-tailed rat  N
B D                Guinea pig  =
B D                    Lizard  =
B D                   Dolphin  =
B D                   Megabat  =
B D                       Pig  =
                 Spotted gar  =
B D             X. tropicalis  =
                Weddell seal  =
  D           Green seaturtle  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
                Killer whale  =
              Bactrian camel  =
B D                    Turkey  =
               Big brown bat  =
B D                   Chicken  =
B D                  Platypus  =
B D                     Sheep  =
B D                       Cow  =
            Tibetan antelope  =
            Black flying-fox  =
B D                  Squirrel  -
B D                  Microbat  =
        David's myotis (bat)  =
B D                       Dog  =
               Domestic goat  =
B D        American alligator  =
B D               Zebra finch  =
B D                    Alpaca  =
              Pacific walrus  =
B D                     Panda  =
B D                   Ferret   =
B D                       Cat  =
B D          White rhinoceros  =
B D                     Horse  =

Alignment block 11 of 1271 in window, 14274394 - 14274415, 22 bps 
B D                     Human  gctggaggagaggaagaggcat
B D                     Chimp  gctggaggagaggaagaggcat
B D                   Gorilla  gctggaggagaggaagaggcat
B D                 Orangutan  gctggaggagaggaagaggcat
B D                    Gibbon  gctggaggagaggaagaggcat
B D                    Rhesus  gctggaggagaggaggaggcat
B D       Crab-eating macaque  gctggaggagaggaggaggcat
B D                    Baboon  gctgaaggagaggaggaggcat
B D              Green monkey  gctggaggagaggaggaggcat
B D                  Marmoset  gctggatgagaggaagaggaat
B D           Squirrel monkey  gctggaggagaggaagaggaat
B D                  Bushbaby  gccggagcaga-gaaggggcat
           Chinese tree shrew  gctggaggagcttaagatgcac
B D                  Squirrel  --tggtgaag------------
       Lesser Egyptian jerboa  gatggggaaggaaatggg----
B D            Naked mole-rat  gctggaggag----------ag
                   Chinchilla  gctggaggag----------ag
B D                    Rabbit  gttggagctgacaaggaggcat
B D                      Pika  gctggatgtgagaatacatcat
B D                       Pig  gcctaa----gcaaagaggcat
B D                    Alpaca  gctgga----ggaaagaggcat
               Bactrian camel  gctgga----ggaaagaggcat
B D                   Dolphin  gctgga--agagaaagcagcat
                 Killer whale  gctgga--agagaaagcagcat
             Tibetan antelope  gctggaggagggcaagaggca-
B D                       Cow  gctggaggagagaaagaggcat
B D                     Sheep  gctggaggagggaaagaggcat
                Domestic goat  gctggaggagggaaagaggcat
B D                     Horse  cctggagcagagaaagaggctt
B D          White rhinoceros  gctggagcagagaaagaggcat
B D                       Cat  gctggaggagagaaagaggcat
B D                   Ferret   gcgggag--gagaaaggggcct
B D                     Panda  gctggaggagagaaagaggcat
               Pacific walrus  gctggaggagagaaagaggctt
                 Weddell seal  gctggaggagagaaagaggctt
B D                  Hedgehog  gctaga----ggaaagagtgac
              Star-nosed mole  gctgga----ggaaggaggtgt
B D                  Elephant  g-cagaggagagaaggaggcat
B D                   Manatee  g-cagagaagacaaggaggcat
             Cape golden mole  gccagagtagaaaaaaaggcgt
                     Aardvark  gtcagaggagaaaaagcagcat
B D                 Armadillo  gccaaaggagagaaagaggcat
              Golden hamster  ======================
B D                     Shrew  ======================
B D                    Tenrec  ----------------------
                Prairie vole  ======================
B D           Chinese hamster  ======================
B D                       Rat  ======================
         Cape elephant shrew  ======================
B D                     Mouse  ======================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNN
B D                Guinea pig  ======================
B D                    Lizard  ======================
B D                   Megabat  ======================
                 Spotted gar  ======================
B D             X. tropicalis  ======================
  D           Green seaturtle  ======================
  D  Chinese softshell turtle  ======================
  D            Painted turtle  ======================
B D                Budgerigar  ======================
  D          Peregrine falcon  ======================
  D              Saker falcon  ======================
  D               Rock pigeon  ======================
B D                    Turkey  ======================
               Big brown bat  ======================
B D                   Chicken  ======================
B D                  Platypus  ======================
            Black flying-fox  ======================
B D                  Microbat  ======================
        David's myotis (bat)  ======================
B D                       Dog  ======================
B D        American alligator  ======================
B D               Zebra finch  ======================

Inserts between block 11 and 12 in window
B D           Naked mole-rat 33bp
                  Chinchilla 27bp
B D                Armadillo 20bp

Alignment block 12 of 1271 in window, 14274416 - 14274618, 203 bps 
B D                     Human  ctttg----ttt---gaag-aga-taagtaa-----ctcccc----c----ataagcagaa---------
B D                     Chimp  ctttg----ttt---gaag-aga-taagtaa-----ctcccc----c----ataagcagaa---------
B D                   Gorilla  ctttg----ttt---gaag-aga-taagtaa-----ctcccc----c----ataagcagaa---------
B D                 Orangutan  ctttg----ttt---gaag-aga-taagtaa-----ctccct----c----ataagcagaa---------
B D                    Gibbon  ctttg----ttc---gaag-aga-taagtaa-----ctcccc----c----ataagcagaa---------
B D                    Rhesus  atttg----ttt---gaag-aga-taagtaa-----ctcccc----c----ataaacagaa---------
B D       Crab-eating macaque  atttg----ttt---gaag-aga-taagtaa-----ctcccc----c----ataaacagaa---------
B D                    Baboon  cttcg----ttt---gaag-aga-taagtaa-----ctcccc----c----ataaacagaa---------
B D              Green monkey  ctttg----ttt---gaag-aga-taagtaa-----ctcccc----c----ataaacagaa---------
B D                  Marmoset  c--------ttt---gaag-aga-taagtaa-----ctcccc----c----ataaacagag---------
B D           Squirrel monkey  ct--g----tgt---gaag-aga-taagtaa-----ctcccc----c----ataaacagaa---------
B D                  Bushbaby  ctttg----ttg---aaag-aga-tcagtaa-----ttccac----t----gtaaccagaaa-tgcgccc
           Chinese tree shrew  c--------------gacg-aga-aaagcaa-----catccc----a----ggaagcagaa-------ac
B D                  Squirrel  ---------------------aa-taagtga-----ctcgtg----c----ataaggaaaaa-caagcgt
       Lesser Egyptian jerboa  --ttc----tat---ggag-aga-gaagtaa-----ttctgg----c----atcagcagaaa-caaacat
B D            Naked mole-rat  gtttt----tca---gaaaaaga-taagtaa-----ctccac----c----ataaagagaag-caggcat
B D                Guinea pig  ctttc----ttt---ggagaaca-----taa-----ctgcac----t----ataaacagaaa-caagcat
                   Chinchilla  ccttt----tgt---gaagaaga-----taa-----gtccac----c----ctaaaaagaaa-caagcat
B D                    Rabbit  ----c----ttt---gaag-aca-taactca-----ttccca---------ggagctagaaa-caagcgt
B D                      Pika  ----c----ttt---caag-ata-taactca-----ttccag---------gtaacaagaaa-taagaaa
B D                       Pig  ----t----ttt---gaag-ggattaggtga-----ctcccc----t----gttaccagaaa-cacacat
B D                    Alpaca  ----c----ttt---gaag-gga-taattga-----ctcccc----c----ataaatagaaa-caaacat
               Bactrian camel  ----c----ttt---gaag-gga-taattga-----ctcccc----c----ataaatagaaa-caaacat
B D                   Dolphin  ----c----ttt---gaag-gtc-taagtga-----ctccactgttt----gcaaacagaag-caaatat
                 Killer whale  ----c----ttt---gaag-gtc-taagtga-----ctccactgttt----gcaaacagaag-caaatat
             Tibetan antelope  ----c----ttt---gaag-gga-taagtgcccccccccccc---ct----gtaaacagaaa-cgagcat
B D                       Cow  ----c----ttt---gcag-gga-taagtgg-----cccccc---ct----gtaaacagaaa-caagcat
B D                     Sheep  ----c----ttt---gaag-gga-taagtgg-----cccccc---ct----gtaaacagaaa-cgagcat
                Domestic goat  ----c----ttt---gaag-gga-taagtgg----ccccccc---ct----gtaaacagaaa-cgagcat
B D                     Horse  ----ttttgttt---gaag-gga-taagtaa-----ctcccc----c----gtaaacagaaa-caaacat
B D          White rhinoceros  ----gtttgttt---gaag-gga-taagtaa-----ctcctc----c----ataaacagaaa-taagcat
B D                       Cat  ----ctttgttt---gaag-gga-tgaataa-----ctcccc----cg-tagtaaacagaaa-caagcat
B D                   Ferret   ----c----ttt---gaag-agg--ggacaa-----ctgccc----g----gtcaccagaaa-cgagcgc
B D                     Panda  ----c----ttt---gaag-ggg-tgaataa-----ctcccc----c----gtcaacagaaa-caagcat
               Pacific walrus  ----c----ttt---gaag-ggg-tgaaaca-----ctcccc----c----atcaacagaaa-caagcat
                 Weddell seal  ----c----ttt---gaag-ggg-tgaaaca-----ctcccc----c----gtcaacagaaa-caagcgt
B D                  Hedgehog  ----c----ttg---actt-gac-cgggtaa-----gtgact---------ctaaatagaaa-caaatat
              Star-nosed mole  ----t----ttgtttacag-gga-tgggtta-----atccca---------gtaaagagaac-cagacat
B D                  Elephant  -----------------------------------------------ctcggtgaacag----attctgt
B D                   Manatee  -----------------------------------------------cctggtaaacagaagcattcctt
             Cape golden mole  ---------------------------------------------------------------act---t
B D                    Tenrec  ----------------------------------------------------------------------
                     Aardvark  ------------------------------------------------ttggtaaatagcaa-attcatt
B D                 Armadillo  -----------------------------------------------tcttgtaaacaggaagcgtgctt
              Golden hamster  ======================================================================
B D                     Shrew  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                       Rat  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Mouse  ======================================================================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Lizard  ======================================================================
B D                   Megabat  ======================================================================
                 Spotted gar  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                    Turkey  ======================================================================
               Big brown bat  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
            Black flying-fox  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                       Dog  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================

                        Human  --------agcgtggatgggcctg---tcatc-gctgaagg--aacacag-gttggag-cagaattctac
                        Chimp  --------agcgtggatgggcctg---tcatc-gctgaagg--aacacag-gttggag-cggaattctac
                      Gorilla  --------agcgtggatgggcctg---taatc-gctgaagg--aacacag-gttggac-cggaattctac
                    Orangutan  --------agcgtgggtgggcctg---tcatc-gctgaagg--aacccag-gttggag-cggaattctac
                       Gibbon  --------ggcgtgggtgggcctg---tcatc-gctgaagg--aacacgg-gttggag-c-gaattctac
                       Rhesus  --------aggatgggtggacctg---tcatc-gctgaagg--gacacag-gttggag-gggaattctac
          Crab-eating macaque  --------aggatgggtggacctg---tcatc-gctgaagg--gacacag-gttggag-gggaattctac
                       Baboon  --------aggatgggtggacctg---tcatc-gctgaagg--gacacag-gttggag-gggaattctac
                 Green monkey  --------aggatgggtggacctg---tcatc-gctgaagg--gacacag-gttggag-gggaattctac
                     Marmoset  --------agcgtgcgcggacctg---ttatc-gctgaagg--aacacag-gttggag-tggaattctgc
              Squirrel monkey  --------agcatgcgcggacctg---tcatc-gctgaagg--aacacag-gttgggg-tggaattctgc
                     Bushbaby  tggag---agactgaggggggctgtcttcatc-actgaagg--ggtacaa-ggtgggg-cgcaattctac
           Chinese tree shrew  tgaag---aggatgaatgagcctg---tcctg-gctcgagg--g-tagac-gttgggg-tggatttctcc
                     Squirrel  ttgag---agcatgaatgggcttg---tcctt-gctgaagg--ggtggaagcccgtgg-ggaaattctac
       Lesser Egyptian jerboa  gtagg---agactggatggg--tg---gcttt-gctggggt--gct------------------ttcgac
               Naked mole-rat  ttaa-------atgaacggaagtg---caatt-gctgaagg---------------ga-tggaattctac
                   Guinea pig  ttaa-------atgaacgaactt----tcatt-gctgaaggtcagtag----tgggag-tgaagttctat
                   Chinchilla  ttaa-------aaggagggacttg---ccatt-gctgaagg--agtggtc-tttgggg-tggagttccat
                       Rabbit  ttgag---agaacgaatgcatctg---tcatc-cctgaagg--ggtagag-ggtggag-tggaattctac
                         Pika  ttaaa---caagagaa-----ctg---tcatc-gctgaaga--ggtgaag-gttggag-gagaattctgc
                          Pig  ttgagaaaagaatgaatggatttg---actttgactgaagg--agtagag-gtcagaa-tggaaatttac
                       Alpaca  ttgagaaaagaatgaatggacctg---acatc-accaaagg--agtagaa-gttggga-tgaaattccac
               Bactrian camel  ctgagaaaagaatgaatggacctg---acatc-accaaagg--agtagaa-gttggaa-tgaaattccac
                      Dolphin  ttgagaaaggaatgaatggacctg---acttctgctgaagg--agtagag-gttggga-tgggactctaa
                 Killer whale  ttgagaaaggaatgaatggacctg---acttctgctgaagg--agtagag-gttggga-tgggactctaa
             Tibetan antelope  ttgagaaaagaatgaagggacctg---acttccgctccagg--agtagag-ggtagga-tggaattctac
                          Cow  ttgagaaaagaatgaatggacttg---gcttccgctgcagg--agtagag-ggtggga-tggaattctac
                        Sheep  ttgagaaaagaatgaagggacttg---acttccgctgcagg--agtagag-ggtggga-tggaattctac
                Domestic goat  ttgagaaaagaatgaagggacctg---acttccgctgcagg--agtagag-ggtggga-tggaattctac
                        Horse  ttgagaaaagaatgaatggacctg---acaac-c------------------------------------
             White rhinoceros  ttgcgaagaaaatgaacagtcctg---acaac-c------------------------------------
                          Cat  ttgagaaaagaacgagtggacctg---gcatc-gctgaagg--agtagag-gttggaattagaattctgc
                      Ferret   gtgagaagagcgtgcatggccctg---gcgtc-accgaagg--cggagag-gctgggg-tggcgctccac
                        Panda  ttgagaaaagcatgaatggacctg---gcatc-actggagg--aggagag-gcgggga-tggaatcccac
               Pacific walrus  ttgagaaaagaatgaatggacctg---gcatc-cgtggagg--aggagag-gttggga-tggaattccac
                 Weddell seal  ttgagaaaagaatgaatggacctg---gcatc-agtgaagg--aggagag-gctggga-tggaattccac
                     Hedgehog  ttgagaagaaattgatg------------atc-actgaagg--gacagaa-gttggga-agaaattctgc
              Star-nosed mole  ttgagaggaga------------------atc-agtggagg--ggcagag-gttggga-agaaattccac
                     Elephant  cctggaggagagtgaatcaactag---acctc-tccaaagg--ggtagaa-gctgggg-tggaactctac
                      Manatee  cctggaggagaatgaatcaacctg---acatc-gccgaagg--ggtagaa-tttagcg-tagaattatac
             Cape golden mole  cctagaggaggataaattaacttg---gcatt-gctaaagg--tgtaaac-attgggg-tacaattctac
                       Tenrec  catggagggaaatgcatctgcccc---acatc-tccgaagg--tgtagaa-gttggtg-tataattcttc
                     Aardvark  cctagagaagaatgaatcaatctg---accgc-tccacagg--gttagaa-gttgggg-tgcaattctac
                    Armadillo  ttgagaggagagtgaat-gacctg---gcgtc-gctaaagg--ggcagaa-atgcagg-tggaattccac
               Golden hamster  ======================================================================
                        Shrew  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                          Rat  ======================================================================
          Cape elephant shrew  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Lizard  ======================================================================
                      Megabat  ======================================================================
                  Spotted gar  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                       Turkey  ======================================================================
                Big brown bat  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
             Black flying-fox  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                          Dog  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================

                        Human  ta--ccatt----gagtgatccc--attaaaaccgca---g-a-gc---------------------a-t
                        Chimp  aa--ccagt----gaatgatccc--attaaaaccgca---g-a-gc---------------------a-c
                      Gorilla  aa--ccagt----gaatgatccc--attaaaaccgca---g-a-gc---------------------a-c
                    Orangutan  aa--ccagt----gagtgatccc--attaaaaccgca---g-a-gc---------------------a-t
                       Gibbon  aa--ccagt----gagtgaaccc--attaaaaccgca---g-a-gc---------------------a-c
                       Rhesus  aa--ccact----gagtgatccc--attaaaaccgca---g-a-gc---------------------a-c
          Crab-eating macaque  aa--ccact----gagtgatccc--attaaaaccgca---g-a-gc---------------------a-c
                       Baboon  aa--ccagt----gagtgatccc--attaaaaccgca---g-a-gc---------------------a-c
                 Green monkey  aa--ccagt----gagtgacccc--attaaaaccgca---g-a-cc---------------------a-t
                     Marmoset  aa--ccagt----gggtggtccc--attaaacccgga---g-a-gc---------------------a-t
              Squirrel monkey  aa--ccagt----gggtggtccc--attaaacccaca---g-a-gc---------------------a-t
                     Bushbaby  aa--ccagt----gggtgatccc---------ccgca---g-gtgc---------------------gtc
           Chinese tree shrew  aa--ctagt----gagcgatccc--attaaaaccgca--gg-a-gc--------------------ga-a
                     Squirrel  aa--ccagg----ggctcatccc--acgaaaaccgcg--gg-a-gc--------------------ca-t
       Lesser Egyptian jerboa  at--ccagaccttgatttctccc--actaaagcttca--gg-a-gc--------------------ag-c
               Naked mole-rat  aa--ccact----gggtgatctc--gctaaatatcct--ag-g-gc---------------------g-t
                   Guinea pig  aa--cctct----gggcaacccc---ctaaatactca--ag-g-gt---------------------g-t
                   Chinchilla  ga--cccct----gggagacgcc---ctaaatactct--gg-g-gt---------------------g-t
                       Rabbit  aa--cctgt----gtgagatcct--gttatcacttca--tg-a-gctactcggatcaaaaacggggtg-t
                         Pika  aa-----gt----gttagatctg--gttgaaatttcc--tg-a-gtgattcatattaaaatgactgtg-t
                          Pig  ca--tcag-------tagagccc--attaaaacccca--gg-a-ga--------------------ga-t
                       Alpaca  aa--gcagt----gatagagccc--ataaaaaccaca--gg-a-ga--------------------ga-t
               Bactrian camel  aa--gcagt----gatagagccc--ataaaaaccaca--gg-a-ga--------------------ga-t
                      Dolphin  aa--ccagt----gatagagcct--gttaaaaccaca--gg-a-ga--------------------ga-t
                 Killer whale  aa--ccagt----gatagagcct--gttaaaaccaca--gg-a-ga--------------------ga-t
             Tibetan antelope  aa--ccagt----ggtagagccc--aataaaaccaca--ggaa-ga--------------------ga-c
                          Cow  aa--ccagt----ggtagagccc--aataaaacccca--ggaa-ga--------------------ga-c
                        Sheep  ag--ccagt----ggtagagccc--aataaaaccaca--ggaa-ga--------------------ga-c
                Domestic goat  ag--ccagt----ggtagacccc--aataaaaccaca--ggaa-ga--------------------ga-c
                        Horse  ------agt----gcttgagccc--cttaaaaccgca--gg-a-ga--------------------ga-t
             White rhinoceros  -------gt----gctcgagccc--gttaaaaccgca--gg-a-ga--------------------ct-t
                          Cat  aa--gcggt----ggcagacccc--attgaagccgca--gg-a-ga--------------------ga-c
                      Ferret   gg--gcggt----ggcagaaccc--gccggcaccgcg--gg-g-gc--------------------ga-t
                        Panda  ca--gcagt----ggcagaagcc--acggaaaccgca--gg-g-ga--------------------ga-t
               Pacific walrus  aa--gcagt----ggcagaaccc--accgaaactgcagggg-g-ga--------------------ga-t
                 Weddell seal  aa--gcagc----ggcagaaccc--accgaaactgca--gg-g-ga--------------------ga-t
                     Hedgehog  aaccgcaa-----ggtccagactagttaagaaccaca--gg-a-aa--------------------ga-t
              Star-nosed mole  aa--gcagt----ggtccagacc--tctaaagccata--gg-a-ga--------------------cc-c
                     Elephant  aa--gcagt----gggtgagc-t--actagagccgca--gg-t-gc--------------------ca-t
                      Manatee  aa--ccagc----gggtgagc-c--attagaaccgca--gg-t-gc--------------------cg-t
             Cape golden mole  aa--ccaat----aggtaagt-a--ttagaacccaca--ag-a-gc--------------------ta-t
                       Tenrec  ta--ccagt----gggtgatc-c--actagttcctcc--ag-t-gc--------------------ca-t
                     Aardvark  aa-------------gtgagt-c--atttgaaccgcg--ag-t-ga--------------------cc-t
                    Armadillo  ta--cctgt----ggatgagctc--attaacatcgcg--gg-t-gc--------------------ga-t
               Golden hamster  ======================================================================
                        Shrew  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                          Rat  ======================================================================
          Cape elephant shrew  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Lizard  ======================================================================
                      Megabat  ======================================================================
                  Spotted gar  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                       Turkey  ======================================================================
                Big brown bat  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
             Black flying-fox  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                          Dog  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================

                        Human  tggggat-taataacac--------t---cagt--g----------t-----------------------
                        Chimp  tggggat-tcataacac--------t---cagt--g----------t-----------------------
                      Gorilla  tggggat-taataacac--------t---cagt--g----------t-----------------------
                    Orangutan  tggggat-taataacac--------t---cagt--g----------t-----------------------
                       Gibbon  tggggat-taatagcac--------t---cagt--g----------t-----------------------
                       Rhesus  tggggat-taataatac--------t---ccgt--a----------t-----------------------
          Crab-eating macaque  tggggat-taataatac--------t---cagt--a----------t-----------------------
                       Baboon  tggggat-taataatac--------t---cagt--a----------t-----------------------
                 Green monkey  tggggat-taagaatac--------t---cagt--a----------t-----------------------
                     Marmoset  tggggat-taataatac--------t---cagt--g----------t-----------------------
              Squirrel monkey  tggggat-taataatac--------t---cagt--g----------t-----------------------
                     Bushbaby  tcaggat-aaagggtac--------c---cagt--gcgttaaccgcc-----------------------
           Chinese tree shrew  tcggaat-aaagaatac--------a---tagt--g----------t-----------------------
                     Squirrel  tagagat-aaatactcaagagaaccc---tgac--t----------t-----------------------
       Lesser Egyptian jerboa  tagagac-aaatagtgctga-----c---tagc--c----------t-----------------------
               Naked mole-rat  taa----------------------c---ccac--a----------t-----------------------
                   Guinea pig  taa----------------------c---tgac--a----------t-----------------------
                   Chinchilla  taa----------------------t---tgac--a----------t-----------------------
                       Rabbit  taa----------------------c---taac--a----------c-----------------------
                         Pika  caa----------------------c---ggac--a----------t-----------------------
                          Pig  tcgggat-aaataa-ac--------t---gtgt--g----------tcaactgaca--------------
                       Alpaca  tcgggat-aagtaacac--------ttctgtgt--g----------ctaactgaca--------------
               Bactrian camel  tcgggat-aagtaacac--------ttctgtgt--g----------ctaactgac---------------
                      Dolphin  ctgggat-aactaa-ac--------tc-tgtgt--g----------tcaactgaca--------------
                 Killer whale  ctgggat-aactaa-ac--------tc-tgtgt--g----------tcaactgaca--------------
             Tibetan antelope  ccgggat-aaataa-ac--------t---------g----------tcgactgaca--------------
                          Cow  ccgggat-aaataa-ac--------tc-----c--g----------tcaactgaca--------------
                        Sheep  ccgggat-aaataa-ac--------t---------g----------tcaactgaca--------------
                Domestic goat  ccgggat-aaataa-ac--------t---------g----------tcaactgaca--------------
                        Horse  gcaggat-aaataatac--------t-----ct--g----------ttaactgacg--------------
             White rhinoceros  gtgggat-aaataatac--------t-----ctgcg----------ttatctgaca--------------
                          Cat  tcggaat-aaataatgc--------t-----gt--g----------ttaaccgaccgtt-----------
                      Ferret   gcgggat-cagtaaccc--------c-----ga--g------------gaccgacaggtgttaacc-ccg
                        Panda  tcggaat-aaataacac--------g-----gt--g----------ttagcggacaggtgttaagtgagg
               Pacific walrus  tcggcat-aaatatcac--------g-----gg--g----------ttaactgacaggtgttaactgacc
                 Weddell seal  tcgggat-aaataccac--------g-----gg--g----------ttaactggcaggtgttgactgacc
                     Hedgehog  gcgctactaagtcacat--------t-----gt--g----------tcaagtgaca--------------
              Star-nosed mole  tcaggatgaag----aa--------t-----gc--g----------ttatagaatt--------------
                     Elephant  tatgaat-aaataatat--------t-ctggct--g----------tgaacagaca--------------
                      Manatee  tctgaat-aaataatat--------t-ctgggt--g----------tgaactgaca--------------
             Cape golden mole  tctgaat-aaaaaatat--------t-ctgggc--a----------tgaactgact--------------
                       Tenrec  tctga----------at--------t-catggc--a----------taa---------------------
                     Aardvark  gacga-----acggtat--------t-ctgggt--g----------tgagctgaca--------------
                    Armadillo  tctctgt-aaataatac--------t-ctgggt--a----------ttagttgact--------------
               Golden hamster  ======================================================================
                        Shrew  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                          Rat  ======================================================================
          Cape elephant shrew  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Lizard  ======================================================================
                      Megabat  ======================================================================
                  Spotted gar  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                       Turkey  ======================================================================
                Big brown bat  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
             Black flying-fox  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                          Dog  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================

                        Human  gga-tt-----------------------------t-tggga--ccc--aggtctggggcaaatccagaa
                        Chimp  gaa-tt-----------------------------t-tggga--ccc--aggtctggggcaaatccagaa
                      Gorilla  gaa-tt-----------------------------t-tggga--ccc--aggtctggggcaaatccagaa
                    Orangutan  gga-tt-----------------------------t-tggga--ccc--aggtctgcggcaaatgcagaa
                       Gibbon  gga-tt-----------------------------t-tggga--ccc--aggtctggggcaaatctagaa
                       Rhesus  gga-tt-----------------------------t-tggga--ccc--aggtctggggtaaatccagaa
          Crab-eating macaque  gga-tt-----------------------------t-tggga--ccc--aggtctggggtaaatccagaa
                       Baboon  gga-tt-----------------------------t-tggga--ccc--aggtctggggcaaatccagaa
                 Green monkey  gga-tt-----------------------------t-tggga--ccc--aggtctggggcaaatccagaa
                     Marmoset  gga-tt-----------------------------t-tgata--ccc--aggtctggggcaaattcagaa
              Squirrel monkey  gga-tt-----------------------------t-tggga--ccc--aggtctggggcaaatccagaa
                     Bushbaby  ggg-tt-----------------------------t-ggggaagttg--cggtctgaggcaaactccgaa
           Chinese tree shrew  gtt-aa-----------------------------c-tgg----cat--gggtgtgg----aaaactgca
                     Squirrel  gag-ta-----------------------------t-gggga--cactagggtctgggacaaatccagaa
       Lesser Egyptian jerboa  gag-tg-----------------------------c-ttggt--cactgaggcctgggtcaaacccagca
               Naked mole-rat  gat-g------------------------------t-tggga--aagggagatctgggacaaatccagaa
                   Guinea pig  gag-a------------------------------t-tggga--aacggaggtctggaacaaatccagac
                   Chinchilla  gag-aagtgggaagtgaagaaaagtgagaagagatg-tggga--agtgaatgtctgggacaaatccagaa
                       Rabbit  gtt-tc-----------------------------a-tggga--cagtgaggtctggggc-aatctaaga
                         Pika  gga-tt-----------------------------t-tggga--ccgtgagatctggggc-aattcaaga
                          Pig  gag-ta-----------------------------c-aggga--cactgaggcctccggaaaatccagaa
                       Alpaca  tgg-ta-------------------------------tggga--caccgagg-tgggggcaaatccagaa
               Bactrian camel  -gg-ta-------------------------------tggga--caccgagg-tgggggcaaatccagaa
                      Dolphin  tgg-tg-----------------------------t-tggga--cactgaggcctggggcaaatccaaaa
                 Killer whale  tgg-tg-----------------------------t-tggga--cactgaggcctggggcaaatccaaaa
             Tibetan antelope  tga-ta-----------------------------t-tgcga--acccgaggcctggggcaaatccagaa
                          Cow  tga-ta-----------------------------t-tgaga--acccgaggcctggagcaaacccagaa
                        Sheep  cga-ta-----------------------------t-tgcga--acccgaggcctggggcaaatctagaa
                Domestic goat  tga-ta-----------------------------t-tgcga--acccgaggcctggggcaaatccagaa
                        Horse  tgg-ga-----------------------------t-tggga--caccgaagtctggggcaaatccaaaa
             White rhinoceros  tgg-ta-----------------------------t-tggga--cactgaggtctggggcaaatccagag
                          Cat  -----------------------------------t-tggga--gactgaggt-tggggc-aacccagaa
                      Ferret   ggg-tg-----------------------------t-tggga--gac--gaga-cggggc-agtccagaa
                        Panda  ggg-tg-----------------------------t-tggga--gactgaggt-tggggc-aatctagaa
               Pacific walrus  ggg-ta-----------------------------t-tggga--aactgcggt-tggggc-aatccagaa
                 Weddell seal  ggg-ta-----------------------------t-tggga--gactgcggt-tggggc-aatccagaa
                     Hedgehog  ggg-tg-----------------------------t-tggga---actgagatcagagtgaaatccagga
              Star-nosed mole  ggg-cc-----------------------------tgtaagg---actga-------------------a
                     Elephant  ggc-tg-----------------------------c-tggga--tactgaggtctgaggcagagccagaa
                      Manatee  cgg-tg-----------------------------c-tggga--tactgaggtctggggcagattgagaa
             Cape golden mole  tgg-tg-----------------------------c-tggga--tactgaggtctggtgcagaatcagaa
                       Tenrec  -------------------------------------tggga--tgctgacatctgggccatagccagaa
                     Aardvark  tgg-tg-----------------------------c-tggga--tactgaggtctggggcagatccagaa
                    Armadillo  tggcta-----------------------------t-tggga--cac--agatctgggactaatccagaa
               Golden hamster  ======================================================================
                        Shrew  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                          Rat  ======================================================================
          Cape elephant shrew  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Lizard  ======================================================================
                      Megabat  ======================================================================
                  Spotted gar  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                       Turkey  ======================================================================
                Big brown bat  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
             Black flying-fox  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                          Dog  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================

                        Human  actt--cagac-acttaatt
                        Chimp  actt--cagac-acttaatt
                      Gorilla  actt--cagac-acttaatt
                    Orangutan  actt--cagac-acttaatt
                       Gibbon  actt--cagac-agttaatt
                       Rhesus  actt--cagac-acttaacc
          Crab-eating macaque  actt--cagac-acttaact
                       Baboon  actt--cagac-acttaact
                 Green monkey  actt--cagac-acttaact
                     Marmoset  attt--cagac-acttgatt
              Squirrel monkey  actt--cagac-tctagatt
                     Bushbaby  actg--cggag-acttaa--
           Chinese tree shrew  gtca--cagct-gcggaact
                     Squirrel  actg--tagac-acttaatg
       Lesser Egyptian jerboa  atgg--tgaac-acttcatt
               Naked mole-rat  ac------------------
                   Guinea pig  actt--caggt-atttagtt
                   Chinchilla  actg--caggg-atttagtt
                       Rabbit  actg--tagac-at------
                         Pika  actg--aagacaat------
                          Pig  actg--cagac--cttatct
                       Alpaca  actg--cggac-tcttaact
               Bactrian camel  actg--cggac-tcataact
                      Dolphin  actg--cagac-atttgact
                 Killer whale  actg--cagac-atttgact
             Tibetan antelope  actg--cggac-atttgact
                          Cow  actg--cggac-atttgact
                        Sheep  actg--cggac-atttgact
                Domestic goat  actg--cggac-atttgact
                        Horse  actg--cagac-acttaacc
             White rhinoceros  actg--cagac-acttaacc
                          Cat  actg--cggac-actgaact
                      Ferret   actg--cgggc-ccttgacg
                        Panda  actg--cagac-acttaact
               Pacific walrus  actg--cagac-acttaact
                 Weddell seal  actg--cagac-acttaact
                     Hedgehog  actg--tgggc-acttggct
              Star-nosed mole  tttt--caggc-atttaacc
                     Elephant  actg--cgcac-actccact
                      Manatee  actg--cgcac-actccacc
             Cape golden mole  actg----cac-acgccaca
                       Tenrec  attgggcacac-cctccact
                     Aardvark  actg--cacac-actccact
                    Armadillo  actg--cagac-acttaa--
               Golden hamster  ====================
                        Shrew  ====================
                 Prairie vole  ====================
              Chinese hamster  ====================
                          Rat  ====================
          Cape elephant shrew  ====================
                        Mouse  ====================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNN
                       Lizard  ====================
                      Megabat  ====================
                  Spotted gar  ====================
                X. tropicalis  ====================
              Green seaturtle  ====================
     Chinese softshell turtle  ====================
               Painted turtle  ====================
                   Budgerigar  ====================
             Peregrine falcon  ====================
                 Saker falcon  ====================
                  Rock pigeon  ====================
                       Turkey  ====================
                Big brown bat  ====================
                      Chicken  ====================
                     Platypus  ====================
             Black flying-fox  ====================
                     Microbat  ====================
         David's myotis (bat)  ====================
                          Dog  ====================
           American alligator  ====================
                  Zebra finch  ====================

Alignment block 13 of 1271 in window, 14274619 - 14274621, 3 bps 
B D                     Human  gtg
B D                     Chimp  gtg
B D                   Gorilla  gtg
B D                 Orangutan  gtg
B D                    Gibbon  gtg
B D                    Rhesus  gtg
B D       Crab-eating macaque  gtg
B D                    Baboon  gtg
B D              Green monkey  gtg
B D                  Marmoset  gtg
B D           Squirrel monkey  gtg
           Chinese tree shrew  ttg
B D                  Squirrel  gtg
       Lesser Egyptian jerboa  gcc
B D                     Mouse  gcg
B D                Guinea pig  atg
                   Chinchilla  gtg
B D                    Rabbit  -tg
B D                      Pika  -cg
B D                       Pig  gta
B D                    Alpaca  gtg
               Bactrian camel  gtg
B D                   Dolphin  gtg
                 Killer whale  gtg
             Tibetan antelope  gtg
B D                       Cow  gtg
B D                     Sheep  gtg
                Domestic goat  gcg
B D                     Horse  gcg
B D          White rhinoceros  tcg
B D                       Cat  gtg
B D                   Ferret   gtg
B D                     Panda  gtg
               Pacific walrus  gtg
                 Weddell seal  gtg
B D                  Hedgehog  gtg
              Star-nosed mole  -tg
B D                  Elephant  gtg
B D                   Manatee  gtg
             Cape golden mole  gtg
B D                    Tenrec  gtg
                     Aardvark  gtg
              Golden hamster  ===
B D                     Shrew  ===
                Prairie vole  ===
B D           Chinese hamster  ===
B D                       Rat  ===
B D            Naked mole-rat  ---
B D                 Armadillo  ---
         Cape elephant shrew  ===
            Brush-tailed rat  NNN
B D                    Lizard  ===
B D                   Megabat  ===
                 Spotted gar  ===
B D             X. tropicalis  ===
  D           Green seaturtle  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
B D                Budgerigar  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D                    Turkey  ===
               Big brown bat  ===
B D                   Chicken  ===
B D                  Platypus  ===
            Black flying-fox  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
B D                       Dog  ===
B D        American alligator  ===
B D               Zebra finch  ===
B D                  Bushbaby  ---

Inserts between block 13 and 14 in window
B D                      Pig 11bp
B D                   Alpaca 3bp
B D                  Dolphin 3bp
                Killer whale 3bp
            Tibetan antelope 3bp
B D                      Cow 3bp
B D                    Sheep 3bp
               Domestic goat 3bp

Alignment block 14 of 1271 in window, 14274622 - 14274639, 18 bps 
B D                     Human  ctctcctc-----tggc------------gcacta
B D                     Chimp  ctctcctc-----tggc------------gcacta
B D                   Gorilla  ctctcctc-----tggc------------acacta
B D                 Orangutan  ctctcctc-----tgac------------gcactg
B D                    Gibbon  ctctcctc-----tggt------------gcactc
B D                    Rhesus  ctctgctc-----tggc------------gcacta
B D       Crab-eating macaque  ctctgctc-----tggc------------gcacta
B D                    Baboon  ctctgctc-----tggc------------acacta
B D              Green monkey  ctctgctc-----tggc------------acacta
B D                  Marmoset  ctttgctc-----tggc------------acagga
B D           Squirrel monkey  ctttgctc-----tggc------------acagga
B D                  Bushbaby  -----ctc-----tgcc------------ccttga
           Chinese tree shrew  ctttgccc-----ggg-------------------
B D                  Squirrel  ctttgctc-----tacc------------ccataa
       Lesser Egyptian jerboa  ttttgctc-----tgcc------------tcacaa
B D                     Mouse  ctttgctc-----tgtg------------ccac-a
B D            Naked mole-rat  ---tgctc-----tgcc------------ccataa
B D                Guinea pig  ttttgctc-----tgcc------------acataa
                   Chinchilla  gtttgccc-----cgcc------------ccataa
B D                    Rabbit  ctttgctc-----tgcc------------gggtga
B D                      Pika  catcactc-----tgcg------------gggtga
B D                       Pig  ---cactc-----ccct------------ctcctc
B D                    Alpaca  ---tgctc-----cgcccccgctcccctccccacc
B D                   Dolphin  ---tgcta-----ccct------------cccccc
                 Killer whale  ---tgcta-----ccct------------cccccc
             Tibetan antelope  ---tgctc-----cccc------------ggcacc
B D                       Cow  ---tgctc-----cccc-----------gggcacc
B D                     Sheep  ---tgctc-----cgcc------------cgcacc
                Domestic goat  ---tgctc-----cccc------------ggcacc
B D                     Horse  cctcgctc-----tggc------------cccctg
B D          White rhinoceros  ccttgctc-----tgcc------------cccgtg
B D                       Cat  ccttactc-----tgcc------------cccatg
B D                   Ferret   ccttgctc-----tgcc------------ctcgtg
B D                     Panda  ccttgctc-----tgcc------------cccatg
               Pacific walrus  ccttgctc-----tgcc------------cccatg
                 Weddell seal  ccttgctc-----tgcc------------cccatg
B D                  Hedgehog  ccttactc-----t-gc------------cccatg
              Star-nosed mole  cctttctg-----tccc------------cccacg
B D                  Elephant  ccttgcgc-----ctcg------------cgatga
B D                   Manatee  ccttgcgc-----ctcc------------cgtgga
             Cape golden mole  cc-tgttc-----ctcc------------cacaga
B D                    Tenrec  gc-tggtcccacactcc------------cagggg
                     Aardvark  ccttgccc-----ctcc------------ccatgg
              Golden hamster  ===================================
B D                     Shrew  ===================================
                Prairie vole  ===================================
B D           Chinese hamster  ===================================
B D                       Rat  ===================================
B D                 Armadillo  -----------------------------------
         Cape elephant shrew  ===================================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Lizard  ===================================
B D                   Megabat  ===================================
                 Spotted gar  ===================================
B D             X. tropicalis  ===================================
  D           Green seaturtle  ===================================
  D  Chinese softshell turtle  ===================================
  D            Painted turtle  ===================================
B D                Budgerigar  ===================================
  D          Peregrine falcon  ===================================
  D              Saker falcon  ===================================
  D               Rock pigeon  ===================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Turkey  ===================================
               Big brown bat  ===================================
B D                   Chicken  ===================================
B D                  Platypus  ===================================
            Black flying-fox  ===================================
B D                  Microbat  ===================================
        David's myotis (bat)  ===================================
B D                       Dog  ===================================
B D        American alligator  ===================================
B D               Zebra finch  ===================================

Inserts between block 14 and 15 in window
B D                      Pig 3bp
B D                   Alpaca 30bp
B D                  Dolphin 9bp
                Killer whale 9bp
            Tibetan antelope 27bp
B D                      Cow 23bp
B D                    Sheep 23bp
               Domestic goat 23bp
B D                    Horse 3bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 2bp
                Weddell seal 2bp
B D                 Hedgehog 1bp
             Star-nosed mole 1bp

Alignment block 15 of 1271 in window, 14274640 - 14274671, 32 bps 
B D                     Human  taactcat-gc-----------tt---ct---acaatgggagtcacgtgc
B D                     Chimp  taactcat-gc-----------tt---ct---acaatgggagtcacgtgc
B D                   Gorilla  taactcat-gc-----------tt---ct---acaatgggagtcacgtgc
B D                 Orangutan  taactcat-gc-----------tt---ct---acaatgggagtcacgtgc
B D                    Gibbon  taactcat-gc-----------tt---ct---acaatgggagtcacgtgc
B D                    Rhesus  tacctcat-gc-----------tt---ct---acaatgggagtcagatgc
B D       Crab-eating macaque  tacctcat-gc-----------tt---ct---acaatgggagtcagatgc
B D                    Baboon  tacctcgt-gc-----------tt---ct---acaatgggagtcgggtgc
B D              Green monkey  tacctcgt-gc-----------tt---ct---acaatgggagtcgggtgc
B D                  Marmoset  taattcac-gc-----------tt---tt---acaatgggagtccggtgc
B D           Squirrel monkey  taactcac-ac-----------ttga-ta---acagtgggagtcctgtgc
B D                  Bushbaby  ttcctcct-gg-----------tttctcc---acaattggagtcacttgc
           Chinese tree shrew  -------t-gg-----------gt---aa---acaattggagtcacgcgc
B D                  Squirrel  tgagtcat-tc-----------tt---ctcccacaataggagtcatgtgc
       Lesser Egyptian jerboa  tgactcct-tt----------------gttaca-------tgtcatgtgc
B D                     Mouse  cgatccct-tt-----------ca---tttacac-ataggtatcatctgt
B D            Naked mole-rat  agga--ca-cc-----------tt---ctcccaccgtgggagtcctgtgc
B D                Guinea pig  tggcactt-tc-----------tt---ctcccattataggagccacgagc
                   Chinchilla  tgaggctt-tc-----------tt---ctccca-cataggagtcacgtgc
B D                    Rabbit  tgacttct-gc-----------tt---cttccacaataggagtcatgtgc
B D                      Pika  ttacgtgt-ga-----------tt---cttcgacaaccggagtcatgtgt
B D                       Pig  caacacgt-gc-----------tt---cctccacgatagaagtcatgtgc
B D                    Alpaca  taacacgt-gc-----------tt---cttccacaatagaagtcagatgc
               Bactrian camel  taacacgt-gc-----------tt---cttccacaatagaagtcagatgc
B D                   Dolphin  taacacgt-gc-----------tc---ctttcacaatagaagtcatgtgc
                 Killer whale  taacacgt-gc-----------tc---ctttcacaatagaagtcatgtgc
             Tibetan antelope  taacaggt-gc-----------tt---cttctacagtggaactcatgtgc
B D                       Cow  taacgcgt-gc-----------tt---cttctacagtggaagtcatgtgc
B D                     Sheep  taacaggt-gc-----------gt---cttcaacaatggaactcatgtgc
                Domestic goat  taacaggt-gc-----------gt---cttctacagtggaactcatgtgc
B D                     Horse  tatcacat-gc-----------tt---cttccacactaggagtcacgtgc
B D          White rhinoceros  tatcacgt-gc-----------tg---cctccacaataggagtcatgtgc
B D                       Cat  taacacgt-gc-----------tt---cttccacaataggagtcacgtgc
B D                   Ferret   cgacacgt-gc-----------tt---cttccgcaggggaagtcacatgc
B D                     Panda  cagcacgt-gc-----------tt---cttccacaataggagtcatgtgc
               Pacific walrus  taacacgt-gc-----------tt---cttccacaatagaagtcatgtgc
                 Weddell seal  taacacgt-gc-----------tt---cttccacaatagaagtcatgtgc
B D                  Hedgehog  gaacatat-gtttttctttttctt---ttttcacaatggaagtcatgtgc
              Star-nosed mole  tgtcacgt-gt-----------tt---ccttcacaacaaaagtcatgtgc
B D                  Elephant  gaccacgtggt-----------tt---cttccccaatgagagtcacgtgc
B D                   Manatee  taacacgt-gc-----------tt---cttccacaataggagtcatgtgc
             Cape golden mole  ---tacgt-gc-----------tt---cttccacaat-agggtcatgtgc
B D                    Tenrec  ---cacgt-gc-----------tt---cttccacagtaagaggtaagtgc
                     Aardvark  taacacgt-gc-----------tt---cttccacaataagagtcatgtgc
B D                 Armadillo  ---cacgt-gc-----------tt---cttccacaataggagtcacatgc
              Golden hamster  ==================================================
B D                     Shrew  ==================================================
                Prairie vole  ==================================================
B D           Chinese hamster  ==================================================
B D                       Rat  ==================================================
         Cape elephant shrew  ==================================================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Lizard  ==================================================
B D                   Megabat  ==================================================
                 Spotted gar  ==================================================
B D             X. tropicalis  ==================================================
  D           Green seaturtle  ==================================================
  D  Chinese softshell turtle  ==================================================
  D            Painted turtle  ==================================================
B D                Budgerigar  ==================================================
  D          Peregrine falcon  ==================================================
  D              Saker falcon  ==================================================
  D               Rock pigeon  ==================================================
B D                    Turkey  ==================================================
               Big brown bat  ==================================================
B D                   Chicken  ==================================================
B D                  Platypus  ==================================================
            Black flying-fox  ==================================================
B D                  Microbat  ==================================================
        David's myotis (bat)  ==================================================
B D                       Dog  ==================================================
B D        American alligator  ==================================================
B D               Zebra finch  ==================================================

Inserts between block 15 and 16 in window
            Tibetan antelope 34bp
B D                      Cow 34bp
B D                    Sheep 172bp
               Domestic goat 34bp

Alignment block 16 of 1271 in window, 14274672 - 14274686, 15 bps 
B D                     Human  taa--g-----gcggta--------g------------------------tcag
B D                     Chimp  taa--c-----gcggta--------g------------------------tcag
B D                   Gorilla  taa--c-----gcggta--------g------------------------tcag
B D                 Orangutan  taa--g-----gcggta--------g------------------------tcag
B D                    Gibbon  taa--g-----gcggta--------g------------------------tcag
B D                    Rhesus  gaa--g-----gcggta--------g------------------------tcag
B D       Crab-eating macaque  gaa--g-----gcggta--------g------------------------tcag
B D                    Baboon  taa--g-----g---------------------------------------cag
B D              Green monkey  taa--g-----gcggta--------g------------------------tcag
B D                  Marmoset  taa--g-----actgta--------g------------------------tgag
B D           Squirrel monkey  taa--g-----actgta--------g------------------------tgag
B D                  Bushbaby  tga--g-----gcagga--------g------------------------tcaa
           Chinese tree shrew  taa--a-----acaata--------g------------------------tcag
B D                  Squirrel  taa--g-----gcagta--------gc-----------------------ccag
       Lesser Egyptian jerboa  cat--g-----gcagta-------------------------------------
B D                     Mouse  cat--g-----gcagag--------g------------------------ccag
B D            Naked mole-rat  tga--t-----gcagta---------------------------------gcag
B D                Guinea pig  taa--g-----agagta---------------------------------gcag
                   Chinchilla  tac--a-----cta-ta---------------------------------ccag
B D                    Rabbit  taa--a-----gtagca-----------------------------------ca
B D                      Pika  taa--c-----ttagcg---------------------------------gtca
B D                       Pig  taa--g-----g------------------------------------------
B D                    Alpaca  taa--g-----gcagta--------gt-----------------------tcgg
               Bactrian camel  taa--g-----gcagta--------gt-----------------------tcag
B D                   Dolphin  taa--g-----gcagtg--------gt-----------------------acaa
                 Killer whale  taa--g-----gcagtg--------gt-----------------------acag
             Tibetan antelope  taa--gccgcttcagtc--------gtgtcctctgactctttgagaccccatag
B D                       Cow  taa--gccgcttcagcc--------gtgtcctctgactctttgagaccccatag
                Domestic goat  taa--gccgcttcagtc--------gtgtcctctgactctttgagaccccatag
B D                     Horse  taa--g-----gcagta--------gt-----------------------acag
B D          White rhinoceros  tga--g-----gcagta--------gt-----------------------acag
B D                       Cat  tag--g-----gcagaa--------gt-----------------------acag
B D                   Ferret   cgg--g-----acagtc--------gt-----------------------accg
B D                     Panda  tgg--g-----acagga--------gt-----------------------acag
               Pacific walrus  tag--g-----accgta--------gt-----------------------acag
                 Weddell seal  tag--g-----accata--------gt-----------------------acag
B D                  Hedgehog  tgaaca-----gcagtt--------gt-----------------------agct
              Star-nosed mole  tca--g-----gcagtg--------gt-----------------------ccaa
B D                  Elephant  taa--g-----gcagaa---agtac-----------------------------
B D                   Manatee  taa--g-----gcagaa---atacg-----------------------------
             Cape golden mole  tta--g-----gaagaa-------------------------------------
B D                    Tenrec  taa--t-----gctaaccatgttct-----------------------------
                     Aardvark  taa--t-----gcagaa---ataca-----------------------------
B D                 Armadillo  tag---------------------------------------------------
              Golden hamster  ======================================================
B D                     Shrew  ======================================================
                Prairie vole  ======================================================
B D           Chinese hamster  ======================================================
B D                       Rat  ======================================================
         Cape elephant shrew  ======================================================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Lizard  ======================================================
B D                   Megabat  ======================================================
                 Spotted gar  ======================================================
B D             X. tropicalis  ======================================================
  D           Green seaturtle  ======================================================
  D  Chinese softshell turtle  ======================================================
  D            Painted turtle  ======================================================
B D                Budgerigar  ======================================================
  D          Peregrine falcon  ======================================================
  D              Saker falcon  ======================================================
  D               Rock pigeon  ======================================================
B D                    Turkey  ======================================================
               Big brown bat  ======================================================
B D                   Chicken  ======================================================
B D                  Platypus  ======================================================
B D                     Sheep  ======================================================
            Black flying-fox  ======================================================
B D                  Microbat  ======================================================
        David's myotis (bat)  ======================================================
B D                       Dog  ======================================================
B D        American alligator  ======================================================
B D               Zebra finch  ======================================================

Inserts between block 16 and 17 in window
            Tibetan antelope 95bp
B D                      Cow 95bp
               Domestic goat 95bp

Alignment block 17 of 1271 in window, 14274687 - 14274735, 49 bps 
B D                     Human  agaaatgagccctac-----------------------------agttgttgtgtatta-----gcaa--
B D                     Chimp  agaaatgagccctac-----------------------------atttga---gtatta-----gcaa--
B D                   Gorilla  agaaatgagccctac-----------------------------agttga---gtatta-----gcaa--
B D                 Orangutan  agaaagcagccctac-----------------------------agttgttgtgtatta-----gcaa--
B D                    Gibbon  agaaatgagccctac-----------------------------agttgttgtgtatta-----gcaa--
B D                    Rhesus  agaaatgaaccctac-----------------------------agttgt---gtatta-----gcaa--
B D       Crab-eating macaque  agaaatgaaccctac-----------------------------agttgt---gtatta-----gcaa--
B D                    Baboon  agaaatgaaccctac-----------------------------agttgt---gtatta-----gcaa--
B D              Green monkey  agaaatgaaccctac-----------------------------agttgt---gtatta-----gcag--
B D                  Marmoset  agaaacgaacccttc-----------------------------agttgt---gtatta-----gcaa--
B D           Squirrel monkey  agaaatgcgccctgc-----------------------------agtttt---gtgtta-----gcag--
B D                  Bushbaby  tgaaacgaaccccac-----------------------------agttgc---gcctta-----ggag--
           Chinese tree shrew  agaaatga-cccttg-----------------------------gcttgt----tatta-----ggag--
B D                  Squirrel  agaaatgaaaccttc-----------------------------cgttgt---gaatca-----ggag--
       Lesser Egyptian jerboa  --------------------------------------------------------tta-----ggtg--
B D                     Mouse  ggaaatgacac---------------------------------------------tta-----aatg--
B D            Naked mole-rat  agaaaggaacccttc-----------------------------atttct---gtatca-----ggag--
B D                Guinea pig  agaaacaaacccttt-----------------------------acttct---gtgtta-----ggag--
                   Chinchilla  aggaat-gacttttc-----------------------------actact---gtgttc-----ggag--
B D                    Rabbit  tgaaatgaacccttc-----------------------------agttgt---gtgtta-----gtag--
B D                      Pika  gcaaagtgagccctc-----------------------------agttgg---ctgtta-----ggag--
B D                       Pig  --aaaggaaccctgc-----------------------------agttgt---gtagcatatctggag--
B D                    Alpaca  -ggaaatgagcctgcc------------------------------ttgt---gtatcg-----ggaa--
               Bactrian camel  -ggaaatgagcctgcc------------------------------ttgt---gtatcg-----ggaa--
B D                   Dolphin  ggaaatgaaacctgc-----------------------------agttgt---gcatca-----ggag--
                 Killer whale  ggaaatgaaacctgc-----------------------------agttgt---gtatca-----ggag--
             Tibetan antelope  agggatggaacccacctctcttgcatctgctacattggcaggctgattct---ttaccg-----ctagct
B D                       Cow  agggatggaacccacctctcttgcatctcctacattggcaggctggttct---ttacca-----ctagcc
B D                     Sheep  agggatggagcccacctctcttgcatctcctacattggcaggctgattct---ttacca-----ctagct
                Domestic goat  agggatggaacccacctctcttgcatctcctacattggcaggctgattct---ttacca-----ctagcc
B D                     Horse  ggaaatgagcgct-c-----------------------------agctgt---gtagta-----ggat--
B D          White rhinoceros  ggaaaggaaccct-c-----------------------------agttgt---gtatta-----ggag--
B D                       Cat  ggaaatgaaccccgc-----------------------------acttgt---gtgtta-----ggag--
B D                   Ferret   ggcgacgatccctgc-----------------------------cgcggt---gtgttc------cag--
B D                     Panda  ggcgatgaacctttc-----------------------------cgttgt---gtgtta-----ggag--
               Pacific walrus  ggcaaccaaccctgc-----------------------------agtggt---gtgtta-----ggag--
                 Weddell seal  ggcgaccaaccccgc-----------------------------agtggt---gtgtta-----ggag--
B D                  Hedgehog  ggaagtgaaccttgc-----------------------------aattgt---gtataa-----ggac--
              Star-nosed mole  ggaagagaaccctgc-----------------------------ttttgt---atatta-----ggaa--
B D                  Elephant  agaaaacgtcactgc-----------------------------ggtcac---ccatca-----ggag--
B D                   Manatee  ggaaaacgtccttgg-----------------------------ggttgc---ccgttg-----ggag--
             Cape golden mole  gggaaatgtttctgc-----------------------------a-------------------------
B D                    Tenrec  gggaaatatttctgc-----------------------------ggttgt---ttatct-----tagg--
                     Aardvark  gggaaatgttcctgc-----------------------------agttgt---ccatta-----ggga--
B D                 Armadillo  gggaagtgttcttgt-----------------------------aatt-------atta-----ggaa--
              Golden hamster  ======================================================================
B D                     Shrew  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                       Rat  ======================================================================
         Cape elephant shrew  ======================================================================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Lizard  ======================================================================
B D                   Megabat  ======================================================================
                 Spotted gar  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                    Turkey  ======================================================================
               Big brown bat  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
            Black flying-fox  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                       Dog  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================

                        Human  --------------caattccc-ctaac-aa
                        Chimp  --------------caattccc-ctaac-aa
                      Gorilla  --------------caattccc-ctaac-aa
                    Orangutan  --------------caattccc-ctaac-aa
                       Gibbon  --------------caattccc-ctaac-aa
                       Rhesus  --------------caattccc-ctaac-aa
          Crab-eating macaque  --------------caattccc-ctaac-aa
                       Baboon  --------------caattccc-ctaac-aa
                 Green monkey  --------------caattccc-ctaac-aa
                     Marmoset  --------------caattttc-ctaac-aa
              Squirrel monkey  --------------caattttc-ctaac-aa
                     Bushbaby  --------------caattttc-cgaac-aa
           Chinese tree shrew  --------------caatttcc-cgtaa-aa
                     Squirrel  --------------agatttgt-ctaac-aa
       Lesser Egyptian jerboa  --------------ccatttcc-ctaac-aa
                        Mouse  ----gagttttaaccctttacc-taaag-aa
               Naked mole-rat  --------------acattgcg-ctgtc-aa
                   Guinea pig  --------------ctattgcc-ccatc-ta
                   Chinchilla  --------------tctttgcc-ctgtc-aa
                       Rabbit  --------------caattttc-ctaac-aa
                         Pika  --------------caattttctttaac-aa
                          Pig  --------------tgatttcc-ctaat-aa
                       Alpaca  -------------cagattttc-ctaat-aa
               Bactrian camel  -------------cagattttc-ctaat-aa
                      Dolphin  --------------caatttcc-ctaat-aa
                 Killer whale  --------------caatttcc-ctaat-aa
             Tibetan antelope  ccacctgggacgtccgatttcc-t--aa-aa
                          Cow  ccacctgggaagtccgatttcc-t--aa-aa
                        Sheep  ccacctgggaagtccgatttcc-t--aa-aa
                Domestic goat  ccacctgggaagtccgatttcc-t--aa-aa
                        Horse  --------------ca-tttct-ctaac-aa
             White rhinoceros  --------------aa-tttcc-ctaac-aa
                          Cat  --------------gaatttcc-ttaac-aa
                      Ferret   --------------cactgtcc-ctaac-cc
                        Panda  --------------caatttcc-ctaac-aa
               Pacific walrus  --------------caatttcc-ctaac-aa
                 Weddell seal  --------------taatttcc-ctaac-aa
                     Hedgehog  --------------caagttct-ctaat-ga
              Star-nosed mole  --------------caatattc-ttcat-aa
                     Elephant  --------------cgattttc-ctaacaaa
                      Manatee  --------------cgattttc-ctaac-aa
             Cape golden mole  -------------------------------
                       Tenrec  --------------cgctactt-ctaac-aa
                     Aardvark  --------------cgatttgg-caaac-aa
                    Armadillo  --------------taattttc-ctaac-ca
               Golden hamster  ===============================
                        Shrew  ===============================
                 Prairie vole  ===============================
              Chinese hamster  ===============================
                          Rat  ===============================
          Cape elephant shrew  ===============================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Lizard  ===============================
                      Megabat  ===============================
                  Spotted gar  ===============================
                X. tropicalis  ===============================
              Green seaturtle  ===============================
     Chinese softshell turtle  ===============================
               Painted turtle  ===============================
                   Budgerigar  ===============================
             Peregrine falcon  ===============================
                 Saker falcon  ===============================
                  Rock pigeon  ===============================
                       Turkey  ===============================
                Big brown bat  ===============================
                      Chicken  ===============================
                     Platypus  ===============================
             Black flying-fox  ===============================
                     Microbat  ===============================
         David's myotis (bat)  ===============================
                          Dog  ===============================
           American alligator  ===============================
                  Zebra finch  ===============================

Inserts between block 17 and 18 in window
B D                      Cat 1bp

Alignment block 18 of 1271 in window, 14274736 - 14274750, 15 bps 
B D                     Human  aagttccatttgttt
B D                     Chimp  aagttccatttgttt
B D                   Gorilla  aagttccatttgttt
B D                 Orangutan  aagttccatttgttt
B D                    Gibbon  aagttccatttgttt
B D                    Rhesus  gagttccatttgttt
B D       Crab-eating macaque  gagttccatttgttt
B D                    Baboon  gagttccatttgttt
B D              Green monkey  gagttccatttgttt
B D                  Marmoset  aagttccgtttgttt
B D           Squirrel monkey  aagttttgtttgttt
B D                  Bushbaby  aagctccacgtgttt
           Chinese tree shrew  acagtccattccttt
B D                  Squirrel  aaattgcattcgttt
       Lesser Egyptian jerboa  ca-----ttctgttt
B D                     Mouse  aa-----ttctgttt
B D            Naked mole-rat  aaattccatttgttt
B D                Guinea pig  aaattctatttgtgt
                   Chinchilla  aaattccacttcttt
B D                    Rabbit  aagttccatttgttt
B D                      Pika  aagtttcatttgtct
B D                       Pig  aaactcaatttgttt
B D                    Alpaca  aacttccatttgttt
               Bactrian camel  aatttccatttgttt
B D                   Dolphin  aaattctctttgttt
                 Killer whale  aaattctctttgttt
             Tibetan antelope  atatcttgcttgatt
B D                       Cow  atatcttacttgttt
B D                     Sheep  atatcttgcttattt
                Domestic goat  atatcttgcttgttt
B D                     Horse  aacttccatttgttt
B D          White rhinoceros  aagttccatttgttt
B D                       Cat  aaattccacttgttt
B D                       Dog  aagttccactggttt
B D                   Ferret   aagttccactggctt
B D                     Panda  aaattccactcgttt
               Pacific walrus  aaattccacttgttt
                 Weddell seal  aaattccacttgttt
B D                  Hedgehog  aagcagcattcattt
              Star-nosed mole  aagtgccattacttt
B D                  Elephant  aagttgcttttgttt
B D                   Manatee  aagttccttttgttt
             Cape golden mole  -----------gctt
B D                    Tenrec  gggggccatttgttt
                     Aardvark  gggttccatttgttt
B D                 Armadillo  cagtttgatttgttt
              Golden hamster  ===============
B D                     Shrew  ===============
                Prairie vole  ===============
B D           Chinese hamster  ===============
B D                       Rat  ===============
         Cape elephant shrew  ===============
            Brush-tailed rat  NNNNNNNNNNNNNNN
B D                    Lizard  ===============
B D                   Megabat  ===============
                 Spotted gar  ===============
B D             X. tropicalis  ===============
  D           Green seaturtle  ===============
  D  Chinese softshell turtle  ===============
  D            Painted turtle  ===============
B D                Budgerigar  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
  D               Rock pigeon  ===============
B D                    Turkey  ===============
               Big brown bat  ===============
B D                   Chicken  ===============
B D                  Platypus  ===============
            Black flying-fox  ===============
B D                  Microbat  ===============
        David's myotis (bat)  ===============
B D        American alligator  ===============
B D               Zebra finch  ===============

Inserts between block 18 and 19 in window
B D                 Hedgehog 429bp

Alignment block 19 of 1271 in window, 14274751 - 14274757, 7 bps 
B D                     Human  cacttat
B D                     Chimp  cgcttat
B D                   Gorilla  cacttat
B D                 Orangutan  cacttat
B D                    Gibbon  cacttat
B D                    Rhesus  cacttat
B D       Crab-eating macaque  cacttat
B D                    Baboon  cacttat
B D              Green monkey  cact---
B D                  Marmoset  ctcttat
B D           Squirrel monkey  ctcttat
B D                  Bushbaby  cacttat
           Chinese tree shrew  cactgat
B D                  Squirrel  catttat
       Lesser Egyptian jerboa  gtctcac
B D                     Mouse  catt---
B D            Naked mole-rat  gactttt
B D                Guinea pig  gactttt
                   Chinchilla  gaccttt
B D                    Rabbit  cacttgt
B D                      Pika  cacttac
B D                       Pig  tatttct
B D                    Alpaca  tacttct
               Bactrian camel  tacttct
B D                   Dolphin  tacttct
                 Killer whale  tacttct
             Tibetan antelope  tacttct
B D                       Cow  tacttct
B D                     Sheep  tacttct
                Domestic goat  tacttct
B D                     Horse  tccttct
B D          White rhinoceros  tactcct
B D                       Cat  tactttt
B D                       Dog  tactttt
B D                   Ferret   tgctttt
B D                     Panda  tgctttt
               Pacific walrus  tgctttt
                 Weddell seal  tgtcctt
              Star-nosed mole  aacctat
B D                  Elephant  cactgat
B D                   Manatee  cactttt
             Cape golden mole  cacttta
B D                    Tenrec  cacttat
                     Aardvark  cactcat
B D                 Armadillo  cacttgc
B D                  Hedgehog  =======
              Golden hamster  =======
B D                     Shrew  =======
                Prairie vole  =======
B D           Chinese hamster  =======
B D                       Rat  =======
         Cape elephant shrew  =======
            Brush-tailed rat  NNNNNNN
B D                    Lizard  =======
B D                   Megabat  =======
                 Spotted gar  =======
B D             X. tropicalis  =======
  D           Green seaturtle  =======
  D  Chinese softshell turtle  =======
  D            Painted turtle  =======
B D                Budgerigar  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
B D                    Turkey  =======
               Big brown bat  =======
B D                   Chicken  =======
B D                  Platypus  =======
            Black flying-fox  =======
B D                  Microbat  =======
        David's myotis (bat)  =======
B D        American alligator  =======
B D               Zebra finch  =======

Alignment block 20 of 1271 in window, 14274758 - 14274789, 32 bps 
B D                     Human  ca-----------------tcactatacaagac-------------atgg----actta-gaaac----a
B D                     Chimp  ta-----------------tcactatacaagac-------------atgg----gctta-gaaac----a
B D                   Gorilla  ca-----------------tcactgtacaagac-------------atgg----gctta-gaaac----a
B D                 Orangutan  ca-----------------tcactatacaagac-------------atgg----gctta-gaaac----a
B D                    Gibbon  ca-----------------tcactatacaagac-------------atgg----gctta-gaaac----a
B D                    Rhesus  ca-----------------tcactatacaagac-------------atgg----gctta-gaaac----a
B D       Crab-eating macaque  ca-----------------tcactatacaagac-------------atgg----gctta-gaaac----a
B D                    Baboon  ca-----------------tcactatacaagac-------------atgg----gctta-gaaac----a
B D              Green monkey  -------------------ccactatacaagac-------------atgg----gctta-gaaac----a
B D                  Marmoset  ca-----------------ccactatacaagac-------------atgg----actta-gagac----a
B D           Squirrel monkey  ca-----------------tcactatacaagac-------------atgg----actta-gggac----a
B D                  Bushbaby  ca-----------------tttttatacaagac-------------agga----gttta-gaaac----a
           Chinese tree shrew  ca-----------------tcactttacaagac-------------acgg----gctta-ccaac----t
B D                  Squirrel  ta-----------------tcactatataagac-------------gtgg----tctttgaaaat----a
       Lesser Egyptian jerboa  ca-----------------tcactatacaagat-------------atga----gtgtt-aaaat----a
B D                     Mouse  ta-----------------tcactatataagac-------------atgc----ccttt-aaaat----a
B D            Naked mole-rat  ca-----------------tcactacacaggac-------------acag----gcctt-aaaat----a
B D                Guinea pig  ca-----------------tcactatacaagac-------------ataa----gcgt------------
                   Chinchilla  ca-----------------tcatgacacaagac-------------atgg----gcctt-caaaa----a
B D                    Rabbit  aa-----------------tttccatccaagac-------------atgg------ctt-aacac----a
B D                      Pika  ta-----------------cttaca--catggc-------------atgg------ttt-aacac----t
B D                       Pig  ca-----------------ccactatgcaagacaggatcttagaaataga----cctta-gaaat----a
B D                    Alpaca  ca-----------------tcgttatacaagac-------------cagg----tctta-gaaat----a
               Bactrian camel  ca-----------------tcgttatacaagac-------------cagg----tctta-gaaat----a
B D                   Dolphin  ca-----------------tcacctcacaagac-------------cggg----tctta-gatct----a
                 Killer whale  ca-----------------tcacctcgcaagac-------------cggg----tctta-gatct----a
             Tibetan antelope  ca-----------------tcactacacaaga--------------cagg----tctta-gaaat----a
B D                       Cow  ca-----------------tcactacacaaga--------------tagg----tctta-gaaat----a
B D                     Sheep  ca-----------------tcactacacaaga--------------tagg----tctta-gaaat----a
                Domestic goat  ca-----------------tcactacacaagg--------------tagg----tctta-gaaat----a
B D                     Horse  ca-----------------tcactacacaagac---------------gg----gctta-aaaat----a
B D          White rhinoceros  cc-----------------tcgctatacaagac-------------tggg----gcgta-aaaat----a
B D                       Cat  ca-----------------ccactataggagac--------------aag----tctta-gaaat----a
B D                       Dog  ct-----------------ccaccacacaggac-------------aaag----cctca-caagc-----
B D                   Ferret   ca-----------------ccag-----gagac-------------aaag----cctta-gaaat----a
B D                     Panda  cg-----------------ccgctagacaagac-------------aaag----tctta-gaaattagaa
               Pacific walrus  ca-----------------ccactgtacaagac-------------aaag----tctta-gaaat----a
                 Weddell seal  ccacttcccctaacttcctccact----aagactttct--------aaag----tctta-gaaat----a
B D                  Hedgehog  ca-----------------tttccatacaagac-------------tggc----tattc-aaaaa----t
              Star-nosed mole  --------------------tactatacaa----------------------------------------
B D                  Elephant  ca-----------------tcacttttctggac-------------atgc-----ctta-gaagt----a
B D                   Manatee  ca-----------------tcactgttcaggac-------------atgacacggctta-gaagt----a
             Cape golden mole  c--------------------------aaagac-------------atga-----ctta-gaaat----t
B D                    Tenrec  ct-----------------t---tttgtaggac-------------atga-----gtta-gaaat----a
                     Aardvark  ca-----------------c---tttagaaaac-------------atgg-----ctta-gaaat----a
B D                 Armadillo  ca-----------------c---tatacagaac-------------atgg----actta-gaaat----a
              Golden hamster  ======================================================================
B D                     Shrew  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                       Rat  ======================================================================
         Cape elephant shrew  ======================================================================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Lizard  ======================================================================
B D                   Megabat  ======================================================================
                 Spotted gar  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                    Turkey  ======================================================================
               Big brown bat  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
            Black flying-fox  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================

                        Human  g
                        Chimp  g
                      Gorilla  g
                    Orangutan  g
                       Gibbon  g
                       Rhesus  g
          Crab-eating macaque  g
                       Baboon  g
                 Green monkey  g
                     Marmoset  g
              Squirrel monkey  g
                     Bushbaby  g
           Chinese tree shrew  g
                     Squirrel  g
       Lesser Egyptian jerboa  g
                        Mouse  t
               Naked mole-rat  g
                   Guinea pig  a
                   Chinchilla  a
                       Rabbit  c
                         Pika  t
                          Pig  g
                       Alpaca  g
               Bactrian camel  g
                      Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
                          Cow  g
                        Sheep  g
                Domestic goat  g
                        Horse  g
             White rhinoceros  g
                          Cat  g
                          Dog  g
                      Ferret   g
                        Panda  a
               Pacific walrus  g
                 Weddell seal  g
                     Hedgehog  a
              Star-nosed mole  -
                     Elephant  g
                      Manatee  g
             Cape golden mole  g
                       Tenrec  g
                     Aardvark  g
                    Armadillo  a
               Golden hamster  =
                        Shrew  =
                 Prairie vole  =
              Chinese hamster  =
                          Rat  =
          Cape elephant shrew  =
             Brush-tailed rat  N
                       Lizard  =
                      Megabat  =
                  Spotted gar  =
                X. tropicalis  =
              Green seaturtle  =
     Chinese softshell turtle  =
               Painted turtle  =
                   Budgerigar  =
             Peregrine falcon  =
                 Saker falcon  =
                  Rock pigeon  =
                       Turkey  =
                Big brown bat  =
                      Chicken  =
                     Platypus  =
             Black flying-fox  =
                     Microbat  =
         David's myotis (bat)  =
           American alligator  =
                  Zebra finch  =

Inserts between block 20 and 21 in window
B D           Naked mole-rat 424bp
B D               Guinea pig 16bp
                  Chinchilla 16bp
B D                   Rabbit 4bp
B D                     Pika 4bp
B D                      Pig 17bp
B D                   Alpaca 13bp
              Bactrian camel 13bp
B D                  Dolphin 16bp
                Killer whale 16bp
            Tibetan antelope 15bp
B D                      Cow 15bp
B D                    Sheep 15bp
               Domestic goat 15bp
B D                    Horse 16bp
B D         White rhinoceros 22bp
B D                      Cat 16bp
B D                      Dog 16bp
B D                  Ferret  16bp
B D                    Panda 16bp
              Pacific walrus 16bp
                Weddell seal 16bp
B D                 Hedgehog 16bp

Alignment block 21 of 1271 in window, 14274790 - 14274793, 4 bps 
B D                     Human  cc-----------------ct----------------
B D                     Chimp  cc-----------------ct----------------
B D                   Gorilla  cc-----------------ct----------------
B D                 Orangutan  cc-----------------ct----------------
B D                    Gibbon  cc-----------------ct----------------
B D                    Rhesus  cc-----------------ct----------------
B D       Crab-eating macaque  cc-----------------ct----------------
B D                    Baboon  cc-----------------ct----------------
B D              Green monkey  cc-----------------ct----------------
B D                  Marmoset  c------------------------------------
B D           Squirrel monkey  cc-----------------ct----------------
B D                  Bushbaby  cccttcat-gcaagtgattct----------------
           Chinese tree shrew  ccctttatcccaggtagttct----------------
B D                  Squirrel  -----------------tcct----------------
       Lesser Egyptian jerboa  -----------------tcct----------------
B D                     Mouse  -----------------ccct----------------
B D                Guinea pig  -------------------tt----------------
                   Chinchilla  -------------------tt----------------
B D                    Rabbit  -----------------ttct----------------
B D                      Pika  -----------------ctct----------------
B D                       Pig  -----------------ttct----------------
B D                    Alpaca  -----------------tttt----------------
               Bactrian camel  -----------------tttt----------------
B D                   Dolphin  -----------------ttct----------------
                 Killer whale  -----------------ttct----------------
             Tibetan antelope  -----------------atct----------------
B D                       Cow  -----------------atct----------------
B D                     Sheep  -----------------atct----------------
                Domestic goat  -----------------atct----------------
B D                     Horse  -----------------ttct----------------
B D          White rhinoceros  -----------------tttt----------------
B D                       Cat  -----------------ttct----------------
B D                       Dog  -----------------ttcc----------------
B D                   Ferret   -----------------ctct----------------
B D                     Panda  -----------------tttt----------------
               Pacific walrus  -----------------ttct----------------
                 Weddell seal  -----------------ttct----------------
B D                  Hedgehog  -----------------ttct----------------
              Star-nosed mole  -----------------tcct----------------
B D                  Elephant  -----------------cccttaatacaagtagttgt
B D                   Manatee  -----------------cccttaataaaagtacttgt
             Cape golden mole  -----------------tccttaatacaagtaattct
B D                    Tenrec  -----------------cttttaacacaa--aacact
                     Aardvark  -----------------accttaatacaagtagttct
B D                 Armadillo  -----------------tccttaacacaagtagttct
              Golden hamster  =====================================
B D                     Shrew  =====================================
                Prairie vole  =====================================
B D           Chinese hamster  =====================================
B D                       Rat  =====================================
B D            Naked mole-rat  =====================================
         Cape elephant shrew  =====================================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Lizard  =====================================
B D                   Megabat  =====================================
                 Spotted gar  =====================================
B D             X. tropicalis  =====================================
  D           Green seaturtle  =====================================
  D  Chinese softshell turtle  =====================================
  D            Painted turtle  =====================================
B D                Budgerigar  =====================================
  D          Peregrine falcon  =====================================
  D              Saker falcon  =====================================
  D               Rock pigeon  =====================================
B D                    Turkey  =====================================
               Big brown bat  =====================================
B D                   Chicken  =====================================
B D                  Platypus  =====================================
            Black flying-fox  =====================================
B D                  Microbat  =====================================
        David's myotis (bat)  =====================================
B D        American alligator  =====================================
B D               Zebra finch  =====================================

Inserts between block 21 and 22 in window
B D                 Squirrel 16bp
      Lesser Egyptian jerboa 16bp
B D                    Mouse 771bp
B D               Guinea pig 2bp
                  Chinchilla 2bp

Alignment block 22 of 1271 in window, 14274794 - 14274798, 5 bps 
B D                     Human  gttgt
B D                     Chimp  gttgt
B D                   Gorilla  gttgt
B D                 Orangutan  gttgt
B D                    Gibbon  gttgt
B D                    Rhesus  gttgt
B D       Crab-eating macaque  gttgt
B D                    Baboon  gttgt
B D              Green monkey  gttgt
B D           Squirrel monkey  gttat
B D                  Bushbaby  gtagt
           Chinese tree shrew  gtagt
B D                  Squirrel  atagt
       Lesser Egyptian jerboa  gtggt
B D                Guinea pig  acaat
                   Chinchilla  gcaat
B D                    Rabbit  gtagt
B D                      Pika  gtagt
B D                       Pig  gtagt
B D                    Alpaca  gtagt
               Bactrian camel  gtagt
B D                   Dolphin  gtagt
                 Killer whale  gtagt
             Tibetan antelope  gtagt
B D                       Cow  gtagt
B D                     Sheep  gtagt
                Domestic goat  gtagt
B D                     Horse  gtaat
B D          White rhinoceros  gtagt
B D                       Cat  gtaat
B D                       Dog  gtgat
B D                   Ferret   gtaat
B D                     Panda  ttagt
               Pacific walrus  gtaat
                 Weddell seal  gtaat
B D                  Hedgehog  gtggt
              Star-nosed mole  ggggc
B D                  Elephant  gtagc
B D                   Manatee  gtagc
             Cape golden mole  gaagc
B D                    Tenrec  gtact
                     Aardvark  gtagt
B D                 Armadillo  gtaat
              Golden hamster  =====
B D                     Shrew  =====
                Prairie vole  =====
B D           Chinese hamster  =====
B D                       Rat  =====
B D            Naked mole-rat  =====
         Cape elephant shrew  =====
B D                     Mouse  =====
            Brush-tailed rat  NNNNN
B D                    Lizard  =====
B D                   Megabat  =====
                 Spotted gar  =====
B D             X. tropicalis  =====
  D           Green seaturtle  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====
B D                Budgerigar  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D               Rock pigeon  =====
B D                    Turkey  =====
               Big brown bat  =====
B D                   Chicken  =====
B D                  Platypus  =====
            Black flying-fox  =====
B D                  Microbat  =====
        David's myotis (bat)  =====
B D        American alligator  =====
B D               Zebra finch  =====
B D                  Marmoset  -----

Alignment block 23 of 1271 in window, 14274799 - 14274825, 27 bps 
B D                     Human  cct---aaca-----------aag------a---------------------aa----------aaatat
B D                     Chimp  cct---aaca-----------aat------a---------------------aa----------aaatat
B D                   Gorilla  cct---aaca-----------aag------a---------------------aa----------aaatat
B D                 Orangutan  cct---aaca-----------aag------a---------------------aa----------aaatat
B D                    Gibbon  cct---aaca-----------aag------a---------------------aa----------aaatat
B D                    Rhesus  cct---aaca-----------aag------a---------------------aa----------aactac
B D       Crab-eating macaque  cct---aaca-----------aag------a---------------------aa----------aactac
B D                    Baboon  cct---aaca-----------aag------a---------------------aa----------aactac
B D              Green monkey  cct---aaca-----------aag------a---------------------aa----------aactac
B D                  Marmoset  cct---aaca-----------aag------a---------------------aa----------aacaat
B D           Squirrel monkey  cct---aaca-----------aag------a---------------------aa----------aacaat
B D                  Bushbaby  cct---aaca-----------aaa------agaaggggg-------------aa----------aaaaaa
           Chinese tree shrew  cct---aaca-----------gga------a---------------------aa----------aaaaaa
B D                  Squirrel  tct---aacaaaaaacaaataaag------a---------------------aa----------aaagaa
       Lesser Egyptian jerboa  ctt---agca----------aagg------a---------------------aa----------aaaaaa
B D            Naked mole-rat  cct---aat--------------------------------------------g----------ataata
B D                Guinea pig  ctt---aatt------------tt------a---------------------aa----------ataata
                   Chinchilla  ctt---aatt------------tt------t---------------------aa----------aaagta
B D                    Rabbit  cct---ggca----------aata------a---------------------aa----------ataaaa
B D                      Pika  cct---agta----------aat---------------------------------------------aa
B D                       Pig  tct---aaaa-----------aga------a---------------------aaattttt----aaaaag
B D                    Alpaca  cat------a-----------aaa------a---------------------aa----------aaaaaa
               Bactrian camel  tctaaaaaaa-----------aaa------a---------------------aa----------aaaaaa
B D                   Dolphin  act---aaaa-----------agg------a---------------------aa----------aaaaaa
                 Killer whale  act---aaaa-----------agg------a---------------------aa----------aaaaaa
             Tibetan antelope  act-taaaaa-----------agg------a---------------------ag----------ataaac
B D                       Cow  act-t-aaaa-----------agg------a---------------------ag----------aaaaaa
B D                     Sheep  act-taaaaa-----------agg------a---------------------ag----------ataaaa
                Domestic goat  act-taaaaa-----------agg------a---------------------ag----------ataaaa
B D                     Horse  tct---aaaa-----------aag------a---------------------ca----------aaaaga
B D          White rhinoceros  tct---aaaa-----------aaggaaaaaa---------------------aa----------aaaaaa
B D                       Cat  tct---aaag-----------aga------aggaggaggaggaggaggaggagg----------aagaag
B D                       Dog  tct---aaaa-----------agg------a----------------------a----------aaaca-
B D                   Ferret   tct---aaaa-----------agg------a---------------------ca----------aaaaaa
B D                     Panda  tct---aaaa-----------aga------ag--------------------ga----------aaaaa-
               Pacific walrus  tct---aaaa-----------agg------a---------------------ga----------aagaa-
                 Weddell seal  tct---aaaa-----------agg------a---------------------ga----------aagaa-
B D                  Hedgehog  tct---aaaa-----------ggg------a---------------------aa-----c----aa----
              Star-nosed mole  tct---acaa-----------tag------g---------------------aa----------aa----
B D                  Elephant  ttt---aaca-----------agg------a---------------------aa--caac----aaaaac
B D                   Manatee  ttt---aata-----------agg------a---------------------aaacaagt----aaaaaa
             Cape golden mole  ttt---aaca-----------agg------a---------------------aaccaaata---aaaaag
B D                    Tenrec  ttt---atca-----------agg------a---------------------aaataaacacagaaaaag
                     Aardvark  ttt---aaca-----------agg------g---------------------aaacaaac----aaaaga
B D                 Armadillo  ttt---aaca-----------a-------------------------------------c----aaaaaa
              Golden hamster  ======================================================================
B D                     Shrew  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                       Rat  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Mouse  ======================================================================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Lizard  ======================================================================
B D                   Megabat  ======================================================================
                 Spotted gar  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                    Turkey  ======================================================================
               Big brown bat  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
            Black flying-fox  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================

                        Human  at---------------------a----attcc-
                        Chimp  at---------------------a----attcc-
                      Gorilla  at---------------------a----attcc-
                    Orangutan  at---------------------a----attcc-
                       Gibbon  at---------------------a----attct-
                       Rhesus  at---------------------a----attcc-
          Crab-eating macaque  at---------------------a----attcc-
                       Baboon  at---------------------a----attcc-
                 Green monkey  at---------------------a----attcc-
                     Marmoset  at---------------------g----atccc-
              Squirrel monkey  at---------------------a----attcc-
                     Bushbaby  ag---------------------a----tttca-
           Chinese tree shrew  ag---------------------g----tttta-
                     Squirrel  ga---------------------a----aaaaa-
       Lesser Egyptian jerboa  ag---------------------a----aaata-
               Naked mole-rat  ag---------------------a----tttca-
                   Guinea pig  ag---------------------g----tctca-
                   Chinchilla  ag---------------------a----tttca-
                       Rabbit  ac---------------------a----tgtcc-
                         Pika  at---------------------a----cgtca-
                          Pig  -----------------------g----atttc-
                       Alpaca  -----------------------g----atttc-
               Bactrian camel  -----------------------g----atttc-
                      Dolphin  -----------------------aaaagatttc-
                 Killer whale  -----------------------aaaagatttc-
             Tibetan antelope  -----------------------a----atttc-
                          Cow  -----------------------a----atttc-
                        Sheep  -----------------------a----atttc-
                Domestic goat  -----------------------a----atttc-
                        Horse  ag---------------------a----atttc-
             White rhinoceros  aa---------------------g----atttc-
                          Cat  aagaggagaaggaggaggagggag----atttc-
                          Dog  -----------------------a----aattc-
                      Ferret   aaaaaaacaaaaa---------ca----aaatc-
                        Panda  -----------------------a----aattc-
               Pacific walrus  -----------------------a----aattc-
                 Weddell seal  -----------------------a----aattc-
                     Hedgehog  -----------------------a----aagtc-
              Star-nosed mole  -----------------------a----gtatc-
                     Elephant  caaaaacgca-------------g----attccc
                      Manatee  caaaaacacc-------------g----atttca
             Cape golden mole  --aaaacaca-------------g----atttca
                       Tenrec  ccaaaacaca-------------a----atttga
                     Aardvark  ctaaaacaca-------------g----attgca
                    Armadillo  -------------------------------tca
               Golden hamster  ==================================
                        Shrew  ==================================
                 Prairie vole  ==================================
              Chinese hamster  ==================================
                          Rat  ==================================
          Cape elephant shrew  ==================================
                        Mouse  ==================================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Lizard  ==================================
                      Megabat  ==================================
                  Spotted gar  ==================================
                X. tropicalis  ==================================
              Green seaturtle  ==================================
     Chinese softshell turtle  ==================================
               Painted turtle  ==================================
                   Budgerigar  ==================================
             Peregrine falcon  ==================================
                 Saker falcon  ==================================
                  Rock pigeon  ==================================
                       Turkey  ==================================
                Big brown bat  ==================================
                      Chicken  ==================================
                     Platypus  ==================================
             Black flying-fox  ==================================
                     Microbat  ==================================
         David's myotis (bat)  ==================================
           American alligator  ==================================
                  Zebra finch  ==================================

Inserts between block 23 and 24 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
B D                 Hedgehog 1bp
             Star-nosed mole 1bp

Alignment block 24 of 1271 in window, 14274826 - 14274913, 88 bps 
B D                     Human  ga-------ttcagggg-a----------cttgttctaat-cct-ggctttt------ttagtaac----
B D                     Chimp  ga-------tttagggg-a----------cttgttctaat-cct-ggctttt------ttagtaac----
B D                   Gorilla  ga-------ttcagggc-a----------cttgttctaat-cct-ggctttt------ttagcaac----
B D                 Orangutan  ga-------ttcagggg-a----------cttgttctaat-cct-ggctttt------ttagtaac----
B D                    Gibbon  ga-------ttcagggg-a----------cttgttctaat-cct-ggctttt------ttagtaac----
B D                    Rhesus  ga-------ttcaggggca----------cttgttctaat-ctt-ggctttt------tcagtaac----
B D       Crab-eating macaque  ga-------ttcaggggca----------cttgttctaat-ctt-ggctttt------tcagtaac----
B D                    Baboon  ta-------ttcaggggca----------cttgttctaat-ctt-ggctttt------tcagtaac----
B D              Green monkey  ga-------ttcaggggca----------cttcttctaat-cct-ggctttt------tcagtaac----
B D                  Marmoset  aa-------ttcagtggca----------cttgttctaat-cct-ggctttt------ttagtaac----
B D           Squirrel monkey  aa-------ttccgtggca----------cttgttctaat-cct-ggctttt------taaataac----
B D                  Bushbaby  ga-------tgcaggga-a----------ggtgttctaat-cct-tgctttt------ttagtaac----
           Chinese tree shrew  ga-------ttgaaagg-a----------cctgttctaat-cct-g--tttt--ggggttaagaat----
B D                  Squirrel  ca-------ttttgtgg-aac--------tcgttttaaaa-ctt-gtctttt-----gtta-taat----
       Lesser Egyptian jerboa  ga-------gtttttag-a-------------ttctaag------gacttt-------------gt----
B D            Naked mole-rat  ga-------gtttgggg-accatttt---ttgtttttaat-cct-ggctttt-----gtaagtaat----
B D                Guinea pig  ga-------gtttggag-accttttt---ttgtttttaat-cct-ggctttt-----gtaagtaat----
                   Chinchilla  ga-------gtttgggg-acc-cttt---ttgtgtttaat-cct-ggcttct-----gtaagtaat----
B D                    Rabbit  ga-------ttcagagg-a------t---atggctctaat-cct-gactttt-----ggtagtgac----
B D                      Pika  ga-------ttcagagg-a------t---gttgctctaat-tct-ggcttat-----gttgatgat----
B D                       Pig  ca-------ttcagggg-a------cagaacctttcaaat-cct-ggctttt-----gttaataag----
B D                    Alpaca  ga-------ttcagggg-a------a---cttgttcaaat-cct-ggctttt-----gttagtaac----
               Bactrian camel  ga-------ttcagggg-a------t---cttgttcaaat-tct-ggctttt-----gttactaac----
B D                   Dolphin  gattcagatttcagagg-a------c---cttgttctaat-cct-ggctttt-----gttattaac----
                 Killer whale  gattcagatttcagagg-a------c---cttgttctaat-cct-ggctttt-----gttattaac----
             Tibetan antelope  ga-------ttcagagg-a------t---cttgttctcat-cct-ggctttt-----gttagtaac----
B D                       Cow  ga-------ttcagagg-a------t---cttgttctcat-cct-ggctttt-----gttagtaac----
B D                     Sheep  ga-------ttcagagg-a------t---cctgttctcat-cct-agctttt-----gct--caac----
                Domestic goat  ga-------ttcagagg-a------t---cttgttctcat-cct-ggctttt-----gttagtaac----
B D                     Horse  ga-------gtctgggg-a------c---tttgttctaac-cat-aggtttt-----gttagtaac----
B D          White rhinoceros  ga-------ttcagggg-a------a---cttgtcctaat-cct-ggctttt-----gttagtaac----
B D                       Cat  ga-------tccaggtg-a------t---cgtgttctact-cct-ggttttt-----gttagtgac----
B D                       Dog  ga-------ttcagggg-a------t---cttcttctaat-cct-gagtttt-----gttagtgat----
B D                   Ferret   gg-------ttcaaggg-a------a---cttactttaat-cct-cgttctt-----gtaggtgac----
B D                     Panda  gg-------ttcagggg-a------c---cttgttctaat-cct-ggttctc-----gttagtgac----
               Pacific walrus  gg-------gtca-ggg-a------t---cttgttttaat-cct-ggttctt-----gttagtggc----
                 Weddell seal  gg-------ttcagggg-a------t---cttgttttaat-cct-ggttctt-----gttagtggc----
B D                  Hedgehog  aa-------ttcaggag-a------c---attgacttaat-att-gattttt------------------
B D                     Shrew  gg-------ttaagggg-a------c---cttgatttaat-tct-ggctttc--acagcctgtaac----
              Star-nosed mole  ga-------ttcaggag-a------c---cttgttctatc-cctgggcttcc--atagtatgtaaa----
B D                  Elephant  ag-------gctcgggg-a------c---cttgttctaatccct-gcctttt-----gttagtgac----
B D                   Manatee  ca-------ctccaggg-a------a---cttgttctaat-act-ggctttt-----gttagtaac----
             Cape golden mole  ga-------atcaaggg-a------c---cttgctctaat-cct-ggctttt-----gttagtaactcaa
B D                    Tenrec  ga-------ctc-aggg-a------c---cttcttctaat-cct-ggctttt-----gttagtaat----
                     Aardvark  ga-------ctccaggg-a------c---agtgttctaat-tct-ggctttg-----gttagtaat----
B D                 Armadillo  ga-------ttcaaggg-a------t---cttgttctcat-cct-cacttttatttagttagtaac----
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                       Rat  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Mouse  ======================================================================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Lizard  ======================================================================
B D                   Megabat  ======================================================================
                 Spotted gar  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                    Turkey  ======================================================================
               Big brown bat  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
            Black flying-fox  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================

                        Human  ---------t-ctgagtg----tcaaata-tatgtgacatcta----------tt-ttgatcacataca-
                        Chimp  ---------t-ctgagtgagtgtcaaata-tatgtgacatcta----------tt-ctgatcacataca-
                      Gorilla  ---------t-ctgagtg----tcaaata-tatgtgacatcta----------tt-ctgatcacataca-
                    Orangutan  ---------t-ctgagtg----tcaaata-tatgtgacatcta----------tt-ctgatcacataca-
                       Gibbon  ---------t-ctgagtg----tcaaata-tatgtgacatcta----------tt-ctgatcacataca-
                       Rhesus  ---------t-ctgagtg----tcaaata-gatgtgacatcta----------tt-ctgatcacataca-
          Crab-eating macaque  ---------t-ctgagtg----tcaaata-gatgtgacatcta----------tt-ctgatcacataca-
                       Baboon  ---------t-ctgagtg----tcaaata-gatgtgacatcta----------tt-ctgatcacataca-
                 Green monkey  ---------t-ctgagtg----tcaaata-tatgtgacatcta----------ct-ctgatcacataca-
                     Marmoset  ---------t-ctgagtg----tcaaata-aatgtgacatcta----------tt-ctgatcacataca-
              Squirrel monkey  ---------t-ctgagtg----tcaaata-aacgtgacatcta----------tt-ctgataacataca-
                     Bushbaby  ---------tcccaaaag----tcaaata-aatactacagctat-------tctt-ctgatcacatata-
           Chinese tree shrew  ---------t-ccaagta----tcaaata-aatatgaga-ctat-------tttt-ctgattgcatatt-
                     Squirrel  ---------t-ccaaaat----ttaaata-aacataacagctat-------tttt-cttattacgtata-
       Lesser Egyptian jerboa  ---------t-ctaaacc----tgacata-aatatgacagcta----------cc-caggctacatgga-
               Naked mole-rat  ---------t-ccaactg----ccaaata-aacatgatagctat-------tctt-ctgattacatata-
                   Guinea pig  ---------t-ccaaatg----tcaaata-aatatgatatctat-------tctt-ttaattacatata-
                   Chinchilla  ---------c-ccaactg----ccaaata-aatatgatatctat-------cctt-ctaattatttata-
                       Rabbit  ---------t-ccaagtg----tcaaata-cacatgatagctgt-------tttt-ctgatcacatcca-
                         Pika  ---------t-tcaagtg----taaaa----acgtgatagctgt-------tttt-ctgatactatcta-
                          Pig  ---------t-acaagcg----tcaaata-aatatgacagccat-------tctt-ctgattacatataa
                       Alpaca  ---------t-ccaagcg----tcaaata-aatttgacagctat-------tttt-cttattacatatt-
               Bactrian camel  ---------t-ccaagcg----tcaaata-aatttgacagctat-------tctt-cttattacatatt-
                      Dolphin  ---------t-ccaagtg----tcaaatg-aatatgacagctat-------tctt-ctgattacatatg-
                 Killer whale  ---------t-ccaagtg----tcaaatg-aatatgacagctat-------tctt-ctgattacatatg-
             Tibetan antelope  ---------t-taaagtg----tcaaata-agtaagacag-----------tcta-ttaattacacatg-
                          Cow  ---------t-taaagtg----tcaaata-aataag--ag-----------tcta-ttaattacatatg-
                        Sheep  ---------t-taaagtg----tcaaata-agtaagacag-----------tcta-ttaattacgtatg-
                Domestic goat  ---------t-taaagtg----tcgaata-agtaagacag-----------tcta-ttaattacatatg-
                        Horse  ---------t-ccaagtg----tcacat--aatacgaaagctat-------tctt-ctgatcaca--ta-
             White rhinoceros  ---------t-ccaagtg----tcaaata-aatatgacacttat-------tctt-ctgatcacatgta-
                          Cat  ---------t-ccaagtg----tcaaata-catatgacgat-ac-------tgtt-ctgattacatatg-
                          Dog  ---------t-ccaagtg----tcagatc-aatatgacagc-at-------tctt-ctgattgcacagg-
                      Ferret   ---------t-ccaagtg----tcaaata-aatatgacagc-at-------tctt-ctaagtacctata-
                        Panda  ---------t-ccaactg----tc----a-aatatcacagc-at-------tctt-ctaattccatata-
               Pacific walrus  ---------t-ccaagtg----tc----a-aatatgacagc-at-------tctt-ctaattacatata-
                 Weddell seal  ---------t-ccaagtg----tc----a-aatatgacagc-at-------tctt-ctaattacatata-
                     Hedgehog  -------------------------------------------t-------gctt-ctgactacatata-
                        Shrew  ---------t-ccaacgt----tcaagtt-aatatcacagctat-------g-tt-ctgacc--------
              Star-nosed mole  ---------g-catatg-----tcaaata-agcaggacaactat-------tctt-ctggtcatataga-
                     Elephant  ---------t-caaactg----tgaaatgaaatattatagctat-------tctc----atcaagaata-
                      Manatee  ---------t-caaactg----tgaaatg-aattttacagctat-------tctt-ctgatcacatata-
             Cape golden mole  gtttagccat-caaactg----ttaaatg-aatattatagctatatatgaatattacagttcacatata-
                       Tenrec  ---------t-cagactg----ttaaatg-aatatta---ctat-------ttctcctgatcatatata-
                     Aardvark  ---------t-taaattg----ttaaatg-aatattacagctat-------tctt-ctgatcacacatg-
                    Armadillo  ---------c-caaagtg----t----tg-aatatgatagctct-------tcac-ctgatcacatata-
               Golden hamster  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                          Rat  ======================================================================
          Cape elephant shrew  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Lizard  ======================================================================
                      Megabat  ======================================================================
                  Spotted gar  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                       Turkey  ======================================================================
                Big brown bat  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
             Black flying-fox  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================

                        Human  ----aaatc
                        Chimp  ----aaatc
                      Gorilla  ----aaatc
                    Orangutan  ----aaatc
                       Gibbon  ----aaatc
                       Rhesus  ----aaatc
          Crab-eating macaque  ----aaatc
                       Baboon  ----aaatc
                 Green monkey  ----aaatc
                     Marmoset  ----aaatc
              Squirrel monkey  ----aaatg
                     Bushbaby  ----aaaca
           Chinese tree shrew  ----aaatg
                     Squirrel  ----aaatg
       Lesser Egyptian jerboa  ----aaatg
               Naked mole-rat  ----aaatg
                   Guinea pig  ----aa--g
                   Chinchilla  ----ag--g
                       Rabbit  ----atgca
                         Pika  ----cagaa
                          Pig  aaat-----
                       Alpaca  ---------
               Bactrian camel  ---------
                      Dolphin  ---------
                 Killer whale  ---------
             Tibetan antelope  ---------
                          Cow  ---------
                        Sheep  ---------
                Domestic goat  ---------
                        Horse  ----aaatg
             White rhinoceros  ----aaatg
                          Cat  ----aaatg
                          Dog  ----aaatg
                      Ferret   ----aaatg
                        Panda  ----aaatg
               Pacific walrus  ----aaatg
                 Weddell seal  ----aaatg
                     Hedgehog  ----aattg
                        Shrew  ----aaata
              Star-nosed mole  ----aaatg
                     Elephant  ----aaatg
                      Manatee  ----aaata
             Cape golden mole  ----caatg
                       Tenrec  ----aaatg
                     Aardvark  ----aaacg
                    Armadillo  ----aaatg
               Golden hamster  =========
                 Prairie vole  =========
              Chinese hamster  =========
                          Rat  =========
          Cape elephant shrew  =========
                        Mouse  =========
             Brush-tailed rat  NNNNNNNNN
                       Lizard  =========
                      Megabat  =========
                  Spotted gar  =========
                X. tropicalis  =========
              Green seaturtle  =========
     Chinese softshell turtle  =========
               Painted turtle  =========
                   Budgerigar  =========
             Peregrine falcon  =========
                 Saker falcon  =========
                  Rock pigeon  =========
                       Turkey  =========
                Big brown bat  =========
                      Chicken  =========
                     Platypus  =========
             Black flying-fox  =========
                     Microbat  =========
         David's myotis (bat)  =========
           American alligator  =========
                  Zebra finch  =========

Inserts between block 24 and 25 in window
B D                      Pig 115bp

Alignment block 25 of 1271 in window, 14274914 - 14274918, 5 bps 
B D                     Human  aaact
B D                     Chimp  aaact
B D                   Gorilla  aaact
B D                 Orangutan  aaact
B D                    Gibbon  aaact
B D                    Rhesus  aaact
B D       Crab-eating macaque  aaact
B D                    Baboon  aaact
B D              Green monkey  aaact
B D                  Marmoset  aaact
B D           Squirrel monkey  aaact
B D                  Bushbaby  aagct
           Chinese tree shrew  aaact
B D                  Squirrel  aaatt
       Lesser Egyptian jerboa  gaatc
B D            Naked mole-rat  taact
B D                Guinea pig  taact
                   Chinchilla  taact
B D                    Rabbit  aaact
B D                      Pika  aaact
B D                       Pig  aaact
B D                    Alpaca  gaact
               Bactrian camel  gaact
B D                   Dolphin  aaact
                 Killer whale  aaact
             Tibetan antelope  aaact
B D                       Cow  aaact
B D                     Sheep  aaact
                Domestic goat  aaact
B D                     Horse  aaact
B D          White rhinoceros  aaact
B D                       Cat  aaact
B D                       Dog  gaact
B D                   Ferret   aaact
B D                     Panda  taact
               Pacific walrus  aaact
                 Weddell seal  aaact
B D                  Hedgehog  aaatt
B D                     Shrew  aaatt
              Star-nosed mole  aaatt
B D                  Elephant  aaact
B D                   Manatee  aaact
             Cape golden mole  aaact
B D                    Tenrec  aaaca
                     Aardvark  aaact
B D                 Armadillo  aaact
              Golden hamster  =====
                Prairie vole  =====
B D           Chinese hamster  =====
B D                       Rat  =====
         Cape elephant shrew  =====
B D                     Mouse  =====
            Brush-tailed rat  NNNNN
B D                    Lizard  =====
B D                   Megabat  =====
                 Spotted gar  =====
B D             X. tropicalis  =====
  D           Green seaturtle  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====
B D                Budgerigar  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D               Rock pigeon  =====
B D                    Turkey  =====
               Big brown bat  =====
B D                   Chicken  =====
B D                  Platypus  =====
            Black flying-fox  =====
B D                  Microbat  =====
        David's myotis (bat)  =====
B D        American alligator  =====
B D               Zebra finch  =====

Inserts between block 25 and 26 in window
B D                 Marmoset 324bp
B D                    Shrew 4bp
             Star-nosed mole 15bp

Alignment block 26 of 1271 in window, 14274919 - 14274944, 26 bps 
B D                     Human  ata---aatttat-t--t-a-------aaattaag-------ttata---
B D                     Chimp  ata---aatttat-t--t-a-------aaattaag-------ttata---
B D                   Gorilla  ata---aatttat-t--t-a-------aaattaga-------ttata---
B D                 Orangutan  ata---aatttat-t--t-a-------aaattaag-------ttata---
B D                    Gibbon  ata---aatttat-t--t-a-------aaattaag-------ttaca---
B D                    Rhesus  ata---aatttat-t--t-a-------aaattaag-------ttata---
B D       Crab-eating macaque  ata---aatttat-t--t-a-------aaattaag-------ttata---
B D                    Baboon  ata---aatttat-t--t-a-------aaattaag-------ttata---
B D              Green monkey  ata---aatttat-t--t-a-------aaattaag-------ttata---
B D                  Marmoset  ata---aatttat-t--t-c-------aaattaag-------ctaca---
B D           Squirrel monkey  ata---aatttat-t--t-a-------aaattaag-------ttaca---
B D                  Bushbaby  ata---catttct-t--t-t-------aaa--------------------
           Chinese tree shrew  tta---aatttct-t--t-a-------aaattaaaataat--ctata---
B D                  Squirrel  --ataaaaaaatt-taaa-aaactaaaaaaaaaag-------ttgca---
       Lesser Egyptian jerboa  --at--aaatatt-t--a-aaact--gaaagtaag-------ttaca---
B D            Naked mole-rat  --a---aaatttc-c--a-aaac----aaaataaa-------ttaca---
B D                Guinea pig  --a---aactttt-t--a-aagc----agaataaa-------ttaca---
                   Chinchilla  --a---aactttt-t--c-aagc----aaaataaa-------ttaca---
B D                    Rabbit  --gt--aagcttcat--t-a-------aaagtaaa-------ttatg---
B D                      Pika  --at--atattac-t--t-a-------ataataaa-------ttgct---
B D                       Pig  ata---aatttct-a--t-c-------aaggtaaa-------acaaa---
B D                    Alpaca  ata---aatttct-t--t-a-------aaagtaag-------acaaa---
               Bactrian camel  ata---aatttct-t--t-a-------aaagtaag-------acaaa---
B D                   Dolphin  ata---aatttct-t--t-a-------aaagtaaa-------gcaaa---
                 Killer whale  ata---aatttct-t--t-a-------aaagtaaa-------gcaaa---
             Tibetan antelope  ata---aatttat-t--t-a-------aaagtagg-------acaaa---
B D                       Cow  ata---agtttct-t--t-a-------aaagtagg-------acaaa---
B D                     Sheep  ata---aatttct-t--t-a-------aaagtagg-------acaaa---
                Domestic goat  ata---aatttct-t--t-a-------aaagtagg-------acaaa---
B D                     Horse  gta---aatttct-t--t-a-------aaagtgag-------tcaaa---
B D          White rhinoceros  ata---aatttct-t--t-a-------aaagtaaa-------acaaa---
B D                       Cat  ata---aacttct-t--t-a-------aaggtaaa-------gcaaa---
B D                       Dog  ata---gatgttt-t--t-a-------aaagcaaa-------gcaaa---
B D                   Ferret   ata---aatgtct-t--t-a-------aaagtaaa-------gcaaa---
B D                     Panda  ata---aatgtct-t--t-g-------aaaataaa-------gcaaa---
               Pacific walrus  ata---aatgtct-t--t-a-------aaagtaaa-------gcaaa---
                 Weddell seal  atc---aatgttt-t--t-a-------aaagtaaa-------gcaaa---
B D                  Hedgehog  aca---aatatat-t--t-a-------aa--------------caaa---
B D                     Shrew  ata---attttct-t--t-a-------aa-------------gcaaa---
              Star-nosed mole  ata---gttttat-a--t-a-------tatatatatatactcacaca---
B D                  Elephant  gta---aatttat-t--tga-------agagtaaa-------acattata
B D                   Manatee  gta---aatttct-t--taa-------aaagtaaa-------acattgta
             Cape golden mole  aaa-----tttct-t--tga-------aaagtaaa-------gcgttata
B D                    Tenrec  aaa---attttct-t--tga-------aaagtaaa-------gtgttata
                     Aardvark  aac-----tttct-t--tga-------aaagtaaa-------acattata
B D                 Armadillo  ata---aatttct-c--tga-------aaag-------------------
              Golden hamster  ==================================================
                Prairie vole  ==================================================
B D           Chinese hamster  ==================================================
B D                       Rat  ==================================================
         Cape elephant shrew  ==================================================
B D                     Mouse  ==================================================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Lizard  ==================================================
B D                   Megabat  ==================================================
                 Spotted gar  ==================================================
B D             X. tropicalis  ==================================================
  D           Green seaturtle  ==================================================
  D  Chinese softshell turtle  ==================================================
  D            Painted turtle  ==================================================
B D                Budgerigar  ==================================================
  D          Peregrine falcon  ==================================================
  D              Saker falcon  ==================================================
  D               Rock pigeon  ==================================================
B D                    Turkey  ==================================================
               Big brown bat  ==================================================
B D                   Chicken  ==================================================
B D                  Platypus  ==================================================
            Black flying-fox  ==================================================
B D                  Microbat  ==================================================
        David's myotis (bat)  ==================================================
B D        American alligator  ==================================================
B D               Zebra finch  ==================================================

Inserts between block 26 and 27 in window
B D                      Pig 5bp
B D                   Alpaca 5bp
              Bactrian camel 5bp
B D                  Dolphin 5bp
                Killer whale 5bp
            Tibetan antelope 5bp
B D                      Cow 5bp
B D                    Sheep 5bp
               Domestic goat 5bp
B D                    Horse 5bp
B D         White rhinoceros 5bp
B D                      Cat 5bp
B D                      Dog 5bp
B D                  Ferret  5bp
B D                    Panda 5bp
              Pacific walrus 5bp
                Weddell seal 5bp
B D                 Hedgehog 6bp
B D                    Shrew 6bp
             Star-nosed mole 16bp

Alignment block 27 of 1271 in window, 14274945 - 14274978, 34 bps 
B D                     Human  tgtaaagtactt-----ttat-aaaaatct----------------ataa-gataga
B D                     Chimp  tgtaaagtactt-----ttat-aaaaatct----------------ataa-gataga
B D                   Gorilla  tgtaaagtactt-----ttat-aaaaacct----------------ataa-gataga
B D                 Orangutan  tgtaaagtactt-----ttat-aaaagtct----------------ataa-gataga
B D                    Gibbon  tgtaaagtactt-----taat-aaaagtct----------------ataa-gataga
B D                    Rhesus  tgtaaactactt-----ttat-aaaagtct----------------ataa-aataga
B D       Crab-eating macaque  tgtaaactactt-----ttat-aaaagtct----------------ataa-aataga
B D                    Baboon  tataaactactt-----ttat-aaaagtct----------------ataa-aataga
B D              Green monkey  tgtaaactactt-----ttat-aaaagtct----------------ataa-aataga
B D                  Marmoset  tgtaaactacct-----ttat-aaaagtct----------------atga-aataga
B D           Squirrel monkey  tgtaaactactt-----ttat-aaaagtct----------------acaa-aataga
B D                  Bushbaby  -gtaaaatactc-----tttt-aaaagtct----------------ttta-aataga
           Chinese tree shrew  tgtaaagtatac-----tttt-taaagcct----------------atta-aataga
B D                  Squirrel  tgtaaactaggc-----tttt-aaaagttt----------------acat-aataga
       Lesser Egyptian jerboa  tgcaaaataccc-----tttt-agaagtat----------------gtga-aattga
                 Prairie vole  tgtaaaatgctc-----attt-aaaagctt----------------atga-agtggt
B D                     Mouse  tgaaaaatgccc-----attt-aaaggtct----------------atgc-aatggt
B D            Naked mole-rat  tctaaagtgctc-----gttg-caaagtct----------------ataa-aataga
B D                Guinea pig  tgcaaagtgctc-----tttt-aagagtct-------------------g-aataga
                   Chinchilla  tgtaaagtgctc-----tttt-agaagtct------------------aa-aataga
B D                    Rabbit  tccaaagtcctc------cta-aaaaatct----------------ataa-aatact
B D                      Pika  ----------------------gatcacca----------------ataa-tgaatt
B D                       Pig  tgtaaagcactt-----tttt---aaatct----------------ataa-aatata
B D                    Alpaca  tgtaaagtaccc-----tttt---aagcct----------------atag-agtaaa
               Bactrian camel  tgtaaagtaccc-----tttt---aagcct----------------atag-agtaaa
B D                   Dolphin  ------------------ttt---aaatct----------------ataa-aatata
                 Killer whale  ------------------ttt---aaatct----------------ataa-aatata
             Tibetan antelope  tgta----ctct-----tttt---gaatct----------------gtaa-agtata
B D                       Cow  tgta----ctct-----tttt---aaatct----------------ataa-agtata
B D                     Sheep  tgta----ctct-----tttt---aaatct----------------atac-agtata
                Domestic goat  tgta----ctct-----tttt---gaatct----------------ataa-agtata
B D                     Horse  tgtaatacactc-----tttt-aaaagtct----------------ttaa-aataca
B D          White rhinoceros  tgtaacatattc-----tttt-taaagtct----------------ttaa-aatata
B D                       Cat  tggaaagtattc-----tttt-aaaagttt----------------ataa-aacata
B D                       Dog  t----------------------gaagtct----------------gtaa-aatata
B D                   Ferret   tgt--------------------aaagtcg----------------ataa-aatata
B D                     Panda  t-----gtattc-----tttt-aaaagtct----------------ataa-agtata
               Pacific walrus  tgtaaagtattct----tttt-aaaagtct----------------ataa-aatata
                 Weddell seal  tgtaaagtattc-----tttt-aaaagtct----------------ataa-aatata
B D                  Hedgehog  tgtaaaacactt-----ttttttaaagttc----------------ataa-aatact
B D                     Shrew  -atga------------tctttaaaaatct----------------gag--------
              Star-nosed mole  tataaagtactctttttttttttaaactgt----------------aaga-tata--
B D                  Elephant  tgtcaaggactt-----cttt-aaaaggcttgaatttaggaaaaaaaaaa-aaaaac
B D                   Manatee  cgtaaaggcctc-----cttt-aaaaggct----------------ataa-aatatg
             Cape golden mole  tgtaaagggatc-----cttt-aaaggaca----------------gtaa-aataca
B D                    Tenrec  tatccagaactc-----cttt-aaaaagct----------------aaaa-gatata
                     Aardvark  tataaagaactc-----cttt-gaaaaact----------------ataattataga
B D                 Armadillo  --------gcta-----ttta-aatata-----------------------------
              Golden hamster  =========================================================
B D           Chinese hamster  =========================================================
B D                       Rat  =========================================================
         Cape elephant shrew  =========================================================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Lizard  =========================================================
B D                   Megabat  =========================================================
                 Spotted gar  =========================================================
B D             X. tropicalis  =========================================================
  D           Green seaturtle  =========================================================
  D  Chinese softshell turtle  =========================================================
  D            Painted turtle  =========================================================
B D                Budgerigar  =========================================================
  D          Peregrine falcon  =========================================================
  D              Saker falcon  =========================================================
  D               Rock pigeon  =========================================================
B D                    Turkey  =========================================================
               Big brown bat  =========================================================
B D                   Chicken  =========================================================
B D                  Platypus  =========================================================
            Black flying-fox  =========================================================
B D                  Microbat  =========================================================
        David's myotis (bat)  =========================================================
B D        American alligator  =========================================================
B D               Zebra finch  =========================================================

Inserts between block 27 and 28 in window
                Prairie vole 1bp
B D                 Elephant 5bp
B D                  Manatee 3bp
            Cape golden mole 144bp

Alignment block 28 of 1271 in window, 14274979 - 14275029, 51 bps 
B D                     Human  agggctg------------------------------------aataagttcctt--gaaaatgt-----
B D                     Chimp  agggctg------------------------------------aataagttcctt--gaaaacgt-----
B D                   Gorilla  agggctg------------------------------------aataagttcctt--gaaaatgt-----
B D                 Orangutan  agggctg------------------------------------aataagttcctt--gaaaatgt-----
B D                    Gibbon  agggctg------------------------------------aataagttcctt--gaaaatgt-----
B D                    Rhesus  agggctg------------------------------------aataagttcctt--gaaaatgt-----
B D       Crab-eating macaque  agggctg------------------------------------aataagttcctt--gaaaatgt-----
B D                    Baboon  agggctg------------------------------------aataagttcctt--gaaaatgt-----
B D              Green monkey  agggctg------------------------------------aataagttcctt--gaaaatgt-----
B D                  Marmoset  aaggcta------------------------------------aataagttcctt--gaaaatgt-----
B D           Squirrel monkey  agggcta------------------------------------aataagttcctt--gaaaatgt-----
B D                  Bushbaby  ggggcta------------------------------------aataagctactt--gaaaatgt-----
           Chinese tree shrew  ggggcta------------------------------------aataagtctctt--gaaaa--t-----
B D                  Squirrel  ggggtca------------------------ataagcccttaaaataa---------ggaaaag------
       Lesser Egyptian jerboa  ggggctt--------------taaaatgtgaacaagtcc--atcataa----------aaaatgt-----
                 Prairie vole  agagtttagaataaaattccttaaaaggtgaccacaccctaagaataactctctt--taaaaggt-----
B D                     Mouse  agagttt----------------------------------agaataattctctt--tcaaatgt-----
B D            Naked mole-rat  aagattg------------------------------------aataaaggcctt--gaaaatgtttttc
B D                Guinea pig  agaattg------------------------------------cataaagtcctt--caaaatgt-----
                   Chinchilla  agacctg------------------------------------aagaaagtccgt--gaacatgt-----
B D                    Rabbit  ggggcta------------------------------------agt----ccctt--gaaaatgt-----
B D                      Pika  gaagcta------------------------------------agt-----cctt--gaagctgt-----
B D                       Pig  agtattg------------------------------------aataagtcccct---------------
B D                    Alpaca  gg-------------------------------------------taagtccctt--gaaagtgt-----
               Bactrian camel  gg-------------------------------------------taagtccctt--gaaagtgt-----
B D                   Dolphin  ggcgttg------------------------------------aataagtccctt--aaaaatgt-----
                 Killer whale  ggcgttg------------------------------------aataagtccctt--aaaaatgt-----
             Tibetan antelope  ggtattg------------------------------------aataagtctctt---aaaatgt-----
B D                       Cow  ggaattg------------------------------------aataagtccctt---aaaatgt-----
B D                     Sheep  ggtattg------------------------------------aataagtctctt---aaaatgt-----
                Domestic goat  ggtattg------------------------------------aataagtctctt---aaaatgt-----
B D                     Horse  gatgctg------------------------------------agtaagttcctg--gaaactgt-----
B D          White rhinoceros  ggtgttg------------------------------------aataaatccctt--gaatatgt-----
B D                       Cat  aatgttg------------------------------------aataaatcgctt--aaaaatat-----
B D                       Dog  gaggtgg------------------------------------aataaatccctt--gaaaatgc-----
B D                   Ferret   gatgctg------------------------------------aataaatccttt--gaaaatgt-----
B D                     Panda  gatgttg------------------------------------aataaatccctt--gaaaatgg-----
               Pacific walrus  gatgttg------------------------------------aataaatccctt--gaaaatgc-----
                 Weddell seal  gatgttg------------------------------------aataaatccctt--gaaaatgt-----
B D                  Hedgehog  gagattg------------------------------------aaaagaaattt---gcaagtgt-----
B D                     Shrew  -------------------------------------------------tcttt----------t-----
              Star-nosed mole  -gggctg------------------------------------aaccaatctttttgagaagtgt-----
B D                  Elephant  gggggtg------------------------------------aataag--tctt---ggaaata-----
B D                   Manatee  -----tg------------------------------------aataagcctctt---gaaaatg-----
             Cape golden mole  gggtcta------------------------------------aacaaa--ccctaggaaaaaaa-----
B D                    Tenrec  agggctg------------------------------------aaaata--ttat----aaatgt-----
                     Aardvark  --agctg---------------------------------agtaacaag--tctt-tgaaaattt-----
B D                 Armadillo  ggagctg------------------------------------aata----cctt--gaaaatgt-----
              Golden hamster  ======================================================================
B D           Chinese hamster  ======================================================================
B D                       Rat  ======================================================================
         Cape elephant shrew  ======================================================================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Lizard  ======================================================================
B D                   Megabat  ======================================================================
                 Spotted gar  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                    Turkey  ======================================================================
               Big brown bat  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
            Black flying-fox  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================

                        Human  gaaaa------------agctccatc----actatagcat
                        Chimp  gaaaa------------agctccatc----actatagcat
                      Gorilla  gaaaa------------agctccatc----actacagcat
                    Orangutan  gaaaa------------agctccatc----actatagcat
                       Gibbon  gaaaa------------agctccatc----actatagcat
                       Rhesus  ggaaa------------agttccatc----actatag---
          Crab-eating macaque  ggaaa------------agttccatc----actatag---
                       Baboon  ggaaa------------agttccatc----actatag---
                 Green monkey  ggaaa------------agttccatc----actatagcat
                     Marmoset  gagaa------------agctccatc----actatagcat
              Squirrel monkey  gaaaa------------agctccatc----actatagcat
                     Bushbaby  gaaaa------------a-ccccatc-aggacaatagcct
           Chinese tree shrew  ggaaa------------agttccact----gtgacaatat
                     Squirrel  -------------------ccccctc----aagacaatat
       Lesser Egyptian jerboa  accct------------ttttttttt----aaaaaaaaaa
                 Prairie vole  aaccc------------caccccatc----aggacaatat
                        Mouse  gactg------------tacccca-c----aaggcactat
               Naked mole-rat  acacatggagctttttcagtcccatg----aacaaaatgt
                   Guinea pig  gaaaa------------agcctcact----aacaaaatgt
                   Chinchilla  aaaaa------------agcctcatg----aacaaaatgg
                       Rabbit  gaaaa------------atccccatc----aagatgatct
                         Pika  aaaaa------------gcccc--tc----aaggttatct
                          Pig  ----------------------------------------
                       Alpaca  acaag------------agccccagc----agggcatcgc
               Bactrian camel  acaag------------agccccagc----agggcattgc
                      Dolphin  gcaag------------cgctccacc----aggacaatat
                 Killer whale  gcaag------------cgctccacc----aggacaatat
             Tibetan antelope  gcaag------------agctccact----aggacaatat
                          Cow  gcaag------------agctccact----aggacaatat
                        Sheep  gcaag------------agctccact----aggacaatat
                Domestic goat  gcaag------------agctccact----aggataatat
                        Horse  gaatg------------agctccatc----aagacaacac
             White rhinoceros  gaaag------------agctccatc----aggataatac
                          Cat  gaaag------------agctccacc----aggacaatac
                          Dog  gaaag------------agctcctcc----aggataatac
                      Ferret   gaaaa------------agctccacc----aggacagtat
                        Panda  gaaag------------agctccacc----aggacaatac
               Pacific walrus  gaaag------------agctccacc----aggacaatac
                 Weddell seal  gaaag------------agctccacc----aggacaatac
                     Hedgehog  gaagg------------agttccacc----aggacaacac
                        Shrew  gaaaa------------tgcttcact----gggacaacac
              Star-nosed mole  ggaag------------ggccctttc----aggactatac
                     Elephant  ctgag------------cactc--cc----aggaccatat
                      Manatee  taaag------------ctccccacc----aggaccatat
             Cape golden mole  gaaag------------atctttgcc----agaaccatat
                       Tenrec  gaaaa------------tgctctacc----agaacaatat
                     Aardvark  gaaag------------ctctccacc----gggaccatat
                    Armadillo  gaaag------------aactccatccacaaggacaatgt
               Golden hamster  ========================================
              Chinese hamster  ========================================
                          Rat  ========================================
          Cape elephant shrew  ========================================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Lizard  ========================================
                      Megabat  ========================================
                  Spotted gar  ========================================
                X. tropicalis  ========================================
              Green seaturtle  ========================================
     Chinese softshell turtle  ========================================
               Painted turtle  ========================================
                   Budgerigar  ========================================
             Peregrine falcon  ========================================
                 Saker falcon  ========================================
                  Rock pigeon  ========================================
                       Turkey  ========================================
                Big brown bat  ========================================
                      Chicken  ========================================
                     Platypus  ========================================
             Black flying-fox  ========================================
                     Microbat  ========================================
         David's myotis (bat)  ========================================
           American alligator  ========================================
                  Zebra finch  ========================================

Inserts between block 28 and 29 in window
B D                 Bushbaby 113bp
B D                      Pig 2bp
B D                   Alpaca 6bp
              Bactrian camel 6bp
B D                  Dolphin 7bp
                Killer whale 7bp
            Tibetan antelope 25bp
B D                      Cow 19bp
B D                    Sheep 22bp
               Domestic goat 24bp
B D                    Horse 7bp
B D         White rhinoceros 6bp
B D                      Cat 7bp
B D                      Dog 7bp
B D                  Ferret  7bp
B D                    Panda 7bp
              Pacific walrus 7bp
                Weddell seal 9bp
B D                 Hedgehog 2bp
B D                    Shrew 2bp
             Star-nosed mole 7bp

Alignment block 29 of 1271 in window, 14275030 - 14275053, 24 bps 
B D                     Human  gc--------------------------------------------------------------------
B D                     Chimp  gc--------------------------------------------------------------------
B D                   Gorilla  gc--------------------------------------------------------------------
B D                 Orangutan  gc--------------------------------------------------------------------
B D                    Gibbon  gc--------------------------------------------------------------------
B D                    Rhesus  ----------------------------------------------------------------------
B D       Crab-eating macaque  ----------------------------------------------------------------------
B D                    Baboon  ----------------------------------------------------------------------
B D              Green monkey  gc--------------------------------------------------------------------
B D                  Marmoset  gc--------------------------------------------------------------------
B D           Squirrel monkey  gcttttttttttt---------------------------------------------------------
B D                  Bushbaby  gc--------------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
B D                  Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  ----------------------------------------------------------------------
B D                     Mouse  ----------------------------------------------------------------------
B D            Naked mole-rat  ----------------------------------------------------------------------
B D                Guinea pig  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
B D                    Rabbit  ----------------------------------------------------------------------
B D                      Pika  ----------------------------------------------------------------------
B D                       Pig  tc--------------------------------------------------------------------
B D                    Alpaca  tt--------------------------------------------------------------------
               Bactrian camel  tt--------------------------------------------------------------------
B D                   Dolphin  tt--------------------------------------------------------------------
                 Killer whale  tg--------------------------------------------------------------------
             Tibetan antelope  tg--------------------------------------------------------------------
B D                       Cow  tg--------------------------------------------------------------------
B D                     Sheep  tg--------------------------------------------------------------------
                Domestic goat  tgt-------------------------------------------------------------------
B D                     Horse  tt--------------------------------------------------------------------
B D          White rhinoceros  tt--------------------------------------------------------------------
B D                       Cat  ttat------------------------------------------------------------------
B D                       Dog  tttctttttaatt-----------------------------------tgttttcgttcttagttttagg
B D                   Ferret   tttttttttctttctttctttcccgctttctttccctctttcttcctctctttctcttcttttctttctt
B D                     Panda  ttttgttttgttt---------------------------------------------------------
               Pacific walrus  tttt------------------------------------------------------------------
                 Weddell seal  tttt------------------------------------------------------------------
B D                  Hedgehog  ----------------------------------------------------------------------
B D                     Shrew  ----------------------------------------------------------------------
              Star-nosed mole  ttac------------------------------------------------------------------
B D                  Elephant  ----------------------------------------------------------------------
B D                   Manatee  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
B D                    Tenrec  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
B D                 Armadillo  ----------------------------------------------------------------------
              Golden hamster  ======================================================================
B D           Chinese hamster  ======================================================================
B D                       Rat  ======================================================================
         Cape elephant shrew  ======================================================================
            Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Lizard  ======================================================================
B D                   Megabat  ======================================================================
                 Spotted gar  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                    Turkey  ======================================================================
               Big brown bat  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
            Black flying-fox  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================

                        Human  ---------------------------------------ct-------ctttttact-----gtac----
                        Chimp  ---------------------------------------ct-------ttttttact-----gtac----
                      Gorilla  ---------------------------------------ct-------ctttttact-----gtac----
                    Orangutan  ---------------------------------------ct-------ctttttact-----gtat----
                       Gibbon  ---------------------------------------gt-------cattttacc-----gtac----
                       Rhesus  -----------------------------------------------------tact-----gtac----
          Crab-eating macaque  -----------------------------------------------------tact-----gtac----
                       Baboon  -----------------------------------------------------tact-----gtac----
                 Green monkey  ---------------------------------------ct-------ctttttact-----gtac----
                     Marmoset  --------------------------------------ttt-------ttttttact-----gtac----
              Squirrel monkey  -------------------------tttttttttttttttt-------ttttttact-----gtac----
                     Bushbaby  ---------------------------------------ct-------gttcttacc-----atac----
           Chinese tree shrew  --------------------------------------tcc-------ctttttact-----gtcc----
                     Squirrel  --------------------------------------tcc-------tttttcatc-----ttac----
       Lesser Egyptian jerboa  --------------------------------------a-----------aaaaact-----atac----
                 Prairie vole  --------------------------------------gcc--------tgtagacc-----tcaa----
                        Mouse  --------------------------------------gtc--------tttggaca-----gtac----
               Naked mole-rat  --------------------------------------gcc-------ctttttatt-----acac----
                   Guinea pig  --------------------------------------gcc-------tctgtcatt-----gcac----
                   Chinchilla  --------------------------------------gcc-------tttttcatt-----gtgc----
                       Rabbit  --------------------------------------tcc-------ttatatac------atac----
                         Pika  --------------------------------------tcc-------ttatatac------atac----
                          Pig  ------------------------------------------------------act-----tta-----
                       Alpaca  ---------------------------------------ta-------cctcacact-----ata-----
               Bactrian camel  ---------------------------------------ta-------cctcacact-----ata-----
                      Dolphin  ------------------------------------------------------att-----tta-----
                 Killer whale  ------------------------------------------------------att-----tta-----
             Tibetan antelope  ---------------------------------------tt-------ttttcaact-----tga-----
                          Cow  ---------------------------------------tt-------tgtttaact-----tga-----
                        Sheep  ---------------------------------------tt-------tttttaact-----tga-----
                Domestic goat  ---------------------------------------tt-------tttttaact-----tga-----
                        Horse  ------------------------------------------------------act-----ttgc----
             White rhinoceros  ------------------------------------------------------act-----ttac----
                          Cat  ----------------------------------------------------------------------
                          Dog  tcagtttttggtttgtttttttgttttttacttttcttttc-------ttttttact-----tta-----
                      Ferret   tc----------------tttctttttttcttttttctttt-------tttttaact-----ttat----
                        Panda  -------------------------------------tgtt-------tttttaact-----ttac----
               Pacific walrus  ---------------------------------------tt-------tttttaact-----ttac----
                 Weddell seal  ---------------------------------------tt-------ttttttact-----ttac----
                     Hedgehog  -------------------------------------------------------ct-----tcac----
                        Shrew  --------------------------------------------------------t-----ttac----
              Star-nosed mole  ---------------------------------------tt-------ttattttat-----ttaccatt
                     Elephant  --------------------------------------gcc--------tcgtgactcacagtaac----
                      Manatee  --------------------------------------gcc--------ttttttct-----ttac----
             Cape golden mole  --------------------------------------gcc--------tttttact-----ttac----
                       Tenrec  --------------------------------------acccccttttttttttttt-----ttac----
                     Aardvark  --------------------------------------gtc-------ttttttact-----ttat----
                    Armadillo  --------------------------------------gcc-------tgttttact-----ttac----
               Golden hamster  ======================================================================
              Chinese hamster  ======================================================================
                          Rat  ======================================================================
          Cape elephant shrew  ======================================================================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Lizard  ======================================================================
                      Megabat  ======================================================================
                  Spotted gar  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                       Turkey  ======================================================================
                Big brown bat  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
             Black flying-fox  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================

                        Human  ---------cgt-----agag
                        Chimp  ---------cct-----agag
                      Gorilla  ---------cgt-----agag
                    Orangutan  ---------cgt-----agag
                       Gibbon  ---------cgt-----agag
                       Rhesus  ---------cgt-----agac
          Crab-eating macaque  ---------cgt-----agac
                       Baboon  ---------cgt-----agac
                 Green monkey  ---------cgt-----agag
                     Marmoset  ---------cat-----agag
              Squirrel monkey  ---------cat-----agag
                     Bushbaby  ---------ggt-----agag
           Chinese tree shrew  ---------agt-----agag
                     Squirrel  ---------agt-----agag
       Lesser Egyptian jerboa  ---------agt-----agag
                 Prairie vole  ---------agt-----acaa
                        Mouse  ---------agt-----agaa
               Naked mole-rat  ---------agg-----aaag
                   Guinea pig  ---------agg-----agag
                   Chinchilla  ---------agg-----tgag
                       Rabbit  ---------agt-----agag
                         Pika  ---------act-----ggtg
                          Pig  ---------------------
                       Alpaca  ------------------gag
               Bactrian camel  ------------------gag
                      Dolphin  ------------------gac
                 Killer whale  ------------------gac
             Tibetan antelope  ------------------gac
                          Cow  ------------------gac
                        Sheep  ------------------gac
                Domestic goat  ------------------gac
                        Horse  ---------agt-----agag
             White rhinoceros  ---------agt-----agtg
                          Cat  ---------------------
                          Dog  ---------------------
                      Ferret   ---------aag-----agag
                        Panda  ---------agg-----agag
               Pacific walrus  ---------agg-----agag
                 Weddell seal  ---------agg-----agag
                     Hedgehog  ---------aaa-----ag-g
                        Shrew  ---------agt-----ggag
              Star-nosed mole  atcatttcaaat-----tgag
                     Elephant  ---------atg-----aata
                      Manatee  ---------att-----aaag
             Cape golden mole  ---------ttt-----agaa
                       Tenrec  ---------tctctatgagag
                     Aardvark  ---------gtt-----agag
                    Armadillo  ---------aat-----agag
               Golden hamster  =====================
              Chinese hamster  =====================
                          Rat  =====================
          Cape elephant shrew  =====================
             Brush-tailed rat  NNNNNNNNNNNNNNNNNNNNN