Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 782 in window, 13906203 - 13906226, 24 bps 
B D                     Human  agtt-tcgg---c-tc------------ggc-agacc---cgg-cg
B D                     Chimp  agtt-tcgg---c-tc------------ggc-agacc---cgg-cg
B D                   Gorilla  agtt-tcgg---c-tc------------ggc-agacc---cgg-cg
B D                 Orangutan  agtt-tcgg---c-tc------------ggc-cgacc---cgg-cg
B D                    Gibbon  agtt-tcgg---c-tc------------ggc-ggacc---cgg-cg
B D                    Rhesus  agtt-tcgg---c-tc------------ggc-ggacc---cgg-cg
B D       Crab-eating macaque  agtt-tcgg---c-tc------------ggc-ggacc---cgg-cg
B D                    Baboon  agtt-tcgg---c-tc------------ggc-ggacc---cgg-cg
B D              Green monkey  agtt-tcgg---c-tc------------ggc-ggacc---cgg-cg
B D                  Marmoset  agtt-tcga---c-gc------------ggt-ggacc---cgg-cg
B D           Squirrel monkey  agtt-tcgg---c-gc------------agt-ggacc---cgg-cg
B D                  Bushbaby  agtt-tcgg---t-gc------------ggc-aggcc---cgg-ca
B D                  Squirrel  agtt-tcgg---t-ga------------ggc-gggcc---cgg-ct
       Lesser Egyptian jerboa  agtc-tccc---c-ac------------ggc-gatcc---tag-cg
                 Prairie vole  agtt-tagt---g-ac------------tga-gatcc---c-g-cg
B D           Chinese hamster  agtt-tagt---t---------------aga-gatcc---c-g-cg
               Golden hamster  agtt-tagt---tggc------------aga-gat-c---c-g-cg
B D                     Mouse  agtt-taac---t---------------aga-gagcc---c-a-cg
B D                       Rat  agtt-tagt---t-gc------------aga-gtgcc---c-a-ag
B D            Naked mole-rat  agtt-tcga---c-ga------------ggc-gggcc---cgg-cg
B D                Guinea pig  agtt-tcga---c-ga------------ggc-ggccc---cgg-tg
                   Chinchilla  agtt-tcga---c-ga------------gaa-gggcc---cgg-cg
             Brush-tailed rat  agtt-tcac---c-ga------------ggc-gggcc---cgg-cg
B D                      Pika  agtt-tccg---t-ga------------agc-tggcc---cggttt
B D                       Pig  agtt-tcag---t-gc------------ggc-gggcc---cgg-ca
B D                    Alpaca  agtt-tcag---t-gg------------ggc-gggcc---cgg-ca
               Bactrian camel  agtt-tcag---tggg------------ggt-gggcc---cgg-ca
B D                   Dolphin  agtt-tcag---t-gc------------ggc-gggcc---ctg-ca
                 Killer whale  agtt-tcag---t-gc------------ggc-gggcc---ctg-ca
             Tibetan antelope  agtt-tctg---t-gt------------tgcggggcc---cgg-ca
B D                       Cow  agtt-tctg---t-gt------------tgt-gggcc---cgg-ca
B D                     Sheep  agtt-tctg---t-gt------------tgtggggcc---cgg-ca
                Domestic goat  agtt-tctg---t-gt------------tgtggggcc---cgg-ca
B D                     Horse  agtt-tcag---t-gc------------ggc-gggcc---cgg-c-
B D          White rhinoceros  agtt-tcag---c-gt------------ggt-gggcc---cgg-ca
B D                       Dog  agtt-tcag---t-gc------------ggc-gggcc---cag-ca
B D                   Ferret   agtt-tcat---t-gc------------ggc-gggcc---cag-ta
B D                     Panda  agtt-tcag---c-gc------------ggc-gggcc---cag-ca
               Pacific walrus  agtt-tcag---t-gc------------ggc-gggcc---cag-ca
                 Weddell seal  agtt-tcag---t-gc------------ggc-gggcc---cag-ca
             Black flying-fox  agtt-tcag---g-gc------------tgc-gggct---ggg-ca
B D                   Megabat  agtt-tcag---t-gc------------tgc-gggct---ggg-ca
                Big brown bat  agtt-tcaa---t-gc------------ggc-gggcc---ccg-ca
B D                  Microbat  agtt-tcaa---t-gc------------ggc-gggcc---ccg-ca
B D                  Hedgehog  agttcccga---g-gc------------gcc-cagcc--gcag-cc
B D                     Shrew  agtt-tcgg---t-gc------------ggc-gggcc---cgg-ca
              Star-nosed mole  agtt-tcag---t-gt------------gac-cggtt---cgg-cg
B D                  Elephant  agtt-c-gg---c-ac------------ggc-gggcc---agg-cg
          Cape elephant shrew  agtt-t-gg---c-tc------------ggc-gggccgggagg-cg
B D                   Manatee  agtt-c-gg---c-gc------------ggc-gggca---ggg-tg
             Cape golden mole  agtt-t-gc---c-ga------------gga-gggcc---aag-ca
B D                    Tenrec  agtt-c-ga---c-gc------------gac-gggtc---agg-ca
                     Aardvark  agtt-t-gt---t-gc------------ggc-ggctc---gga-ca
B D                   Opossum  attc-ccgc---c-ca------------------------------
B D           Tasmanian devil  agtc-cggccttc-cg------------------------------
B D               Zebra finch  cgct-g----------------------------------------
           Tibetan ground jay  cggg-g----------------------------------------
B D        American alligator  ----------------------------------------------
B D             X. tropicalis  agtt-cccc---c-gctgtcacgtcagatgc-ggac----------
B D                    Medaka  ==============================================
    Mexican tetra (cavefish)  ==============================================
          Chinese tree shrew  ==============================================
B D                 Zebrafish  ==============================================
      Yellowbelly pufferfish  ==============================================
B D                      Fugu  ==============================================
B D                   Wallaby  ==============================================
  D       Collared flycatcher  ==============================================
B D                   Chicken  ==============================================
  D          Peregrine falcon  ==============================================
  D  Chinese softshell turtle  ==============================================
  D           Green seaturtle  ==============================================
  D            Painted turtle  ==============================================
B D                 Tetraodon  ==============================================
B D              Atlantic cod  ==============================================
B D               Stickleback  ==============================================
          Southern platyfish  ==============================================
         Pundamilia nyererei  ==============================================
                 Zebra mbuna  ==============================================
       Burton's mouthbreeder  ==============================================
         Princess of Burundi  ==============================================
B D              Nile tilapia  ==============================================
                 Spotted gar  ==============================================
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                       Cat  ==============================================

Alignment block 2 of 782 in window, 13906227 - 13906264, 38 bps 
B D                     Human  agc--------ccag----tggc----------------c----------gcgct--ccgg-tgcggcgg
B D                     Chimp  agc--------ccag----tggc----------------c----------gcgct--ccgg-tgcggcgg
B D                   Gorilla  agt--------ccag----tggc----------------c----------gcgct--ccgg-tgcggcgg
B D                 Orangutan  agt--------ccag----tggc----------------c----------gcact--ccgg-tgcggcgg
B D                    Gibbon  agt--------ccag----tggc----------------c----------gcgct--ccgg-tgcggcgg
B D                    Rhesus  agt--------ccag----tggc----------------c----------gcgct--ccgg-tgcagcgg
B D       Crab-eating macaque  agt--------ccag----tggc----------------c----------gcgct--ccgg-tgcagcgg
B D                    Baboon  agt--------ccag----tggc----------------c----------gcgct--ccgg-tgcagcgg
B D              Green monkey  agt--------ccag----tggc----------------c----------gctct--ccgg-tgcagcgg
B D                  Marmoset  agt--------ccgg----tggc----------------c----------ccgct--ccgg-tgctgcgg
B D           Squirrel monkey  agt--------ccag----tggc----------------c----------gcgct--ccgg-tgctgcgg
B D                  Bushbaby  agt--------ccag----tggc----------------c----------tcgct--cagg-tagagagg
B D                  Squirrel  agt--------ccag----tggc----------------c----------gcgct--ccgg-tgtcgcgg
       Lesser Egyptian jerboa  aat--------ccag----tggc----------------c----------acgct---cgg-ggttgagg
                 Prairie vole  aat--------cctg----cggc----------------c----------gtgct---------------
B D           Chinese hamster  aat--------cctg----tggc----------------c----------gcgct---------------
               Golden hamster  aat--------cctg----tggc----------------c----------gcgct---------------
B D                     Mouse  aat--------ccag----ccgc----------------c----------gcgct---------------
B D                       Rat  aat--------ccag----tggc----------------c----------gcgct---------------
B D            Naked mole-rat  agt--------ccaagggtgggt----------------g----------gcgcgctccgg-tgcggcag
B D                Guinea pig  agt--------ccgg----gagt----------------g----------gcgctctccgg-ttcagcga
                   Chinchilla  agt--------ccag----aggt----------------g----------gtgcgctcagg-ttcggcgg
             Brush-tailed rat  agt--------ccac----gggt----------------g----------gcgagctccgg-ttcggcgg
B D                      Pika  aat--------ccag----tggc----------------c----------aggct--ccgg-tgccgcgg
B D                       Pig  agt--------ccag----ttgc----------------t----------gtgct--cagg-tgccgcgg
B D                    Alpaca  agt--------ccag----tggc----------------t----------gcgct--ccgg-taccgcgg
               Bactrian camel  agt--------ccag----tggc----------------t----------gcgct--ccgg-taccgcgg
B D                   Dolphin  agt--------ccgg----tggc----------------t----------gcgct--cggg-ttccgcgg
                 Killer whale  agt--------ccgg----tggc----------------t----------gcgct--cggg-ttccgcgg
             Tibetan antelope  agt--------ccag----tggc----------------t----------gagct--ccgg-tgccttgg
B D                       Cow  agt--------ccag----gggc----------------t----------gagct--ccgg-taccgcgg
B D                     Sheep  agt--------ccgg----tggc----------------t----------gagct--ccgg-tgccgcgg
                Domestic goat  agt--------ccgg----tggc----------------t----------gagct--ccgg-tgccgcgg
B D                     Horse  agt--------ccag----tggc----------------c----------gagct--ctgg-tgccgagg
B D          White rhinoceros  agt--------ctgg----tggc----------------c----------gagtt--cagg-tgccgcgg
B D                       Cat  agt--------ccag----tggc----------------t----------gcgct--ccgg-tgccgcgg
B D                       Dog  att--------ccag----tggc----------------t----------gcgct--ccgg-taccgcgg
B D                   Ferret   agt--------ccag----tggc----------------t----------gcgct--gcgg-tgccgcgg
B D                     Panda  agtccagtgggccag----tggc----------------t----------gcgct--ctgg-tgccgcgg
               Pacific walrus  agt--------ccag----tggc----------------t----------gcgct--ccgg-tgccgcgg
                 Weddell seal  agt--------ccag----tggc----------------t----------gcgct--ccgg-tgccgcgg
             Black flying-fox  agt--------ccag----tggc----------------c----------gcgtt--ccgg-tgccgcgg
B D                   Megabat  agt--------ccag----tggc----------------c----------gcgct--ccgg-tgccgcgg
                Big brown bat  agt--------ccag----tggc----------------c----------gcgct--tcgg-tgccgcgg
B D                  Microbat  agt--------ccag----tggc----------------c----------gcgct--ccgg-tgccgcgg
B D                  Hedgehog  agt--------ccag----cggc----------------t----------gtgct--cggg-tgaggtgc
B D                     Shrew  agt--------cccg----gtgc----------------c----------gaggt--tccg-tgcggcga
              Star-nosed mole  agt--------cgag----tgac----------------c----------gcgct--cctg-tgcagagg
B D                  Elephant  agt--------ccag----tagt----------------a---------caggcg--ccgg-taccgcgg
          Cape elephant shrew  agt--------ccag----tagt------------agtaa---------cgcgct--cagg-tgtcgcga
B D                   Manatee  agt--------ccag----tagt----------------a----------gagct--ccgg-tgccgcgg
             Cape golden mole  agt--------ccag----tagt----------------a----------ggtct--cggg-tgctgtgc
B D                    Tenrec  agt--------cctg----gact----------------c----------gggct--ccgg-tgctgcgg
                     Aardvark  agt--------ccag----ttgt----------------a----------acgct--ccgg-tgtcgcgg
B D                   Opossum  -------atc-ccca----taacaccctgcgcctactcag----------gcaag--tc--------cgg
B D           Tasmanian devil  -------ttctcccg----cgcc----------------g----------gcgcg--tc--------tgg
B D               Zebra finch  aac--------tcgg----tggc----------------catccaccagaccatg--ctgg-tgctgcgg
           Tibetan ground jay  ggc--------ccgg----cggc----------------cgg--gctggggtgcg--cggg-tggcgcgg
B D        American alligator  -------------gg----cggc----------------c-tcttccaagatg-g--ctga-gggagcct
B D             X. tropicalis  --------------g----cgga----------------a----------gtgtt--atggttacagcag
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
          Chinese tree shrew  ======================================================================
B D                 Zebrafish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Wallaby  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
                 Spotted gar  ======================================================================
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  cgc------ccga--gg
                        Chimp  cgc------ccga--gg
                      Gorilla  cgc------ccga--gg
                    Orangutan  cgc------cgga--gg
                       Gibbon  cgc------ccga--gg
                       Rhesus  cgc------ccga--gg
          Crab-eating macaque  cgc------ccga--gg
                       Baboon  cgc------ccga--gg
                 Green monkey  cgc------ccga--gg
                     Marmoset  cgc------ccta--gg
              Squirrel monkey  cgc------ccga--gg
                     Bushbaby  cga------ccgg--ag
                     Squirrel  ccc------caga--ag
       Lesser Egyptian jerboa  cac------ccga--ag
                 Prairie vole  --c------ccga--ag
              Chinese hamster  --c------ccga--ag
               Golden hamster  --c------ccga--ag
                        Mouse  --c------ctga--ag
                          Rat  --c------ccga--ag
               Naked mole-rat  cgc------ctaa--ag
                   Guinea pig  cga------ccaa--ag
                   Chinchilla  cga------ccaa--ag
             Brush-tailed rat  cga------ctaa--ag
                         Pika  cgc------ccaa--gg
                          Pig  cgc------ccaa--gg
                       Alpaca  cgc------ccaa--gg
               Bactrian camel  cgc------ccaa--gg
                      Dolphin  agc------ccaa--gg
                 Killer whale  agc------ccaa--gg
             Tibetan antelope  cgc------ccga--gg
                          Cow  cgc------ccga--gg
                        Sheep  cgc------ccga--gg
                Domestic goat  cgc------ccga--gg
                        Horse  cgc------ccaa--ag
             White rhinoceros  cgc------ctga--gg
                          Cat  cgc------c--g--ag
                          Dog  cgc------ccga--gg
                      Ferret   cgc------ctga--gg
                        Panda  agc------ccga--gg
               Pacific walrus  cgc------ccca--gg
                 Weddell seal  cgc------ccca--ga
             Black flying-fox  cgc------ctga--ac
                      Megabat  cgc------ctga--ac
                Big brown bat  tgc------ccaa--gg
                     Microbat  tgc------ccaa--gg
                     Hedgehog  ---------ccag--ga
                        Shrew  ctc------ctga--gg
              Star-nosed mole  cg-------ctgg--ag
                     Elephant  cgc------cgga--gg
          Cape elephant shrew  cgt------ctga--gg
                      Manatee  cgc------tgga--gg
             Cape golden mole  cgc------ccga--gg
                       Tenrec  tgc------ccga--gg
                     Aardvark  cgc------caga--gg
                      Opossum  cgc------acac--g-
              Tasmanian devil  tgc------ccgctgg-
                  Zebra finch  -----------------
           Tibetan ground jay  -----------------
           American alligator  -----------------
                X. tropicalis  agctgccttctca--g-
                       Medaka  =================
     Mexican tetra (cavefish)  =================
           Chinese tree shrew  =================
                    Zebrafish  =================
       Yellowbelly pufferfish  =================
                         Fugu  =================
                      Wallaby  =================
          Collared flycatcher  =================
                      Chicken  =================
             Peregrine falcon  =================
     Chinese softshell turtle  =================
              Green seaturtle  =================
               Painted turtle  =================
                    Tetraodon  =================
                 Atlantic cod  =================
                  Stickleback  =================
           Southern platyfish  =================
          Pundamilia nyererei  =================
                  Zebra mbuna  =================
        Burton's mouthbreeder  =================
          Princess of Burundi  =================
                 Nile tilapia  =================
                  Spotted gar  =================
         David's myotis (bat)  NNNNNNNNNNNNNNNNN

Alignment block 3 of 782 in window, 13906265 - 13906268, 4 bps 
B D                     Human  c-ccg-
B D                     Chimp  c-ccg-
B D                   Gorilla  c-ccg-
B D                 Orangutan  c-ccg-
B D                    Gibbon  c-ccg-
B D                    Rhesus  c-ccg-
B D       Crab-eating macaque  c-ccg-
B D                    Baboon  c-ccg-
B D              Green monkey  c-ccg-
B D                  Marmoset  c-ccg-
B D           Squirrel monkey  c-ccg-
B D                  Bushbaby  g-cca-
B D                  Squirrel  g-ccg-
       Lesser Egyptian jerboa  gccca-
                 Prairie vole  g-cca-
B D           Chinese hamster  g-cca-
               Golden hamster  g-cca-
B D                     Mouse  g-cca-
B D                       Rat  g-cca-
B D            Naked mole-rat  g-ccg-
B D                Guinea pig  g-cca-
                   Chinchilla  g-cca-
             Brush-tailed rat  g-cca-
B D                      Pika  g-tcg-
B D                       Pig  g-ccg-
B D                    Alpaca  g-ccg-
B D                   Dolphin  g-ccg-
                 Killer whale  g-ccg-
             Tibetan antelope  g-ccg-
B D                       Cow  g-cca-
B D                     Sheep  g-ccg-
                Domestic goat  g-ccg-
B D                     Horse  g-ccg-
B D          White rhinoceros  g-ccg-
B D                       Cat  g-ccg-
B D                       Dog  g-cca-
B D                   Ferret   g-ccg-
B D                     Panda  g-ccg-
               Pacific walrus  g-ccg-
                 Weddell seal  g-ccg-
             Black flying-fox  g-acg-
B D                   Megabat  g-acg-
                Big brown bat  g-acg-
B D                  Microbat  g-acg-
B D                  Hedgehog  a-ccc-
B D                     Shrew  g-ccc-
              Star-nosed mole  g-cca-
B D                  Elephant  g-ccg-
          Cape elephant shrew  g-ccg-
B D                   Manatee  g-ccg-
             Cape golden mole  g-ctc-
B D                    Tenrec  g-ccg-
                     Aardvark  g-cca-
B D                   Opossum  ---ca-
B D           Tasmanian devil  ---ca-
B D               Zebra finch  -cgca-
           Tibetan ground jay  -agcg-
B D        American alligator  -cccg-
B D             X. tropicalis  --tcgg
B D                    Medaka  ======
    Mexican tetra (cavefish)  ======
          Chinese tree shrew  ======
B D                 Zebrafish  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
B D                   Wallaby  ======
  D       Collared flycatcher  ======
B D                   Chicken  ======
  D          Peregrine falcon  ======
  D  Chinese softshell turtle  ======
  D           Green seaturtle  ======
  D            Painted turtle  ======
B D                 Tetraodon  ======
B D              Atlantic cod  ======
B D               Stickleback  ======
          Southern platyfish  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
                 Spotted gar  ======
        David's myotis (bat)  NNNNNN
              Bactrian camel  NNNNNN

Inserts between block 3 and 4 in window
B D              Zebra finch 9bp
B D       American alligator 4bp
B D            X. tropicalis 3bp

Alignment block 4 of 782 in window, 13906269 - 13906296, 28 bps 
B D                     Human  ag---gcgg--a----------agtgggac-----------ggcca-----agc----------------
B D                     Chimp  ag---gcgg--a----------agtgggac-----------ggcca-----agc----------------
B D                   Gorilla  ag---gcgg--a----------agtgggac-----------ggcca-----agc----------------
B D                 Orangutan  ag---gcgg--a----------agtgggac-----------ggtca-----agc----------------
B D                    Gibbon  ag---gcgg--a----------agtgggac-----------ggcca-----agc----------------
B D                    Rhesus  ag---gcgg--a----------agtggggc-----------ggcca-----agc----------------
B D       Crab-eating macaque  ag---gcgg--a----------agtggggc-----------ggcca-----agc----------------
B D                    Baboon  ag---gcgg--a----------agtggggc-----------ggcca-----agc----------------
B D              Green monkey  ag---gcgg--a----------agtggggc-----------ggcca-----agc----------------
B D                  Marmoset  ag---gcgg--a----------agtgcggc-----------ggcca-----agc----------------
B D           Squirrel monkey  ag---gcgg--a----------agtgcggc-----------ggcca-----agc----------------
B D                  Bushbaby  ag---gcgg--a----------agtgaggc-----------ggcta-----acc----------------
B D                  Squirrel  ag---gcgg--a----------agtggaac-----------ggcca-----ccc----------------
       Lesser Egyptian jerboa  ag---gcgg--a----------agtggagc-----------agccacctccccc----------------
                 Prairie vole  ag---gcgg--a----------agccgggc-----------tgcca------------------------
B D           Chinese hamster  ag---gcgg--a----------agcagggt-----------ggcca------------------------
               Golden hamster  ag---gcgg--a----------agcagggt-----------ggccg------------------------
B D                     Mouse  ag---gcgg--a----------agctgggc-----------ggccc------------------------
B D                       Rat  ag---gcgg--a----------agctgggc-----------ggcca------------------------
B D            Naked mole-rat  ag---acgg--a----------agtcgggc-----------ggccg-----ccc----------------
B D                Guinea pig  ag---gcgg--a----------agtggggc-----------aacca-----ctc----------------
                   Chinchilla  ag---gcgg--a----------agtgggac-----------agcca-----ccc----------------
             Brush-tailed rat  ag---gcgg--a----------agtggggc-----------agcca-----ccc----------------
B D                      Pika  ag---gcgg--a----------agtagggc-----------agcta-----cctggcggcggacagagtt
B D                       Pig  ag---gcgg--a----------agtagggc-----------ggcca-----ctt----------------
B D                    Alpaca  ag---gcgg--a----------agttgggc-----------cgcca-----ccc----------------
B D                   Dolphin  ag---gcgg--a----------agtggggc-----------ggcca-----ccc----------------
                 Killer whale  ag---gcgg--a----------agtggggc-----------ggcca-----ccc----------------
             Tibetan antelope  ag---gcgg--a----------agtggggc-----------agcca-----cct----------------
B D                       Cow  ag---gcgg--a----------agtggggc-----------agcca-----cct----------------
B D                     Sheep  ag---gcgg--a----------agtggggc-----------agcca-----cct----------------
                Domestic goat  ag---gcgg--a----------agtggggc-----------agcca-----cct----------------
B D                     Horse  aa---gtgg--a----------agtggggc-----------ggcga-----ccc----------------
B D          White rhinoceros  ag---gccg--a----------agtggggc-----------agcca-----ccc----------------
B D                       Cat  ag---gcgg--a----------agtggggc-----------ggcca-----ccc----------------
B D                       Dog  ag---gcgg--a----------agtggggc-----------ggccg-----ccc----------------
B D                   Ferret   ag---gcgg--a----------agtgaggc-----------ggcca-----cac----------------
B D                     Panda  ag---gcgg--a----------agtgaggc-----------ggcca-----ccc----------------
               Pacific walrus  ag---gcgg--a----------agtgaggc-----------ggcca-----ccc----------------
                 Weddell seal  ag---gcgg--a----------agtgagac-----------ggcca-----ctc----------------
             Black flying-fox  ag---gcgg--a----------agtaggac-----------ggaca-----ctc----------------
B D                   Megabat  ag---gcgg--a----------agtaggac-----------ggaca-----ctc----------------
                Big brown bat  ag---gcgg--a----------agtagggt-----------ggcca-----ccc----------------
B D                  Microbat  ag---gcgg--a----------agtagggt-----------ggcca-----ccc----------------
B D                  Hedgehog  ag---gcgg--a----------agtggggc-----------gcccc-cctcccc----------------
B D                     Shrew  gg---tcgg--a----------aggggacc-----------gtcca-----ccc----------------
              Star-nosed mole  ag---gcgg--a----------agtgggat-----------ggcca------cc----------------
B D                  Elephant  aa---gcgg--a----------agtcgggc-----------ggcca-----cac----------------
          Cape elephant shrew  ag---gcgg--a----------agtggggc-----------gccca-----aac----------------
B D                   Manatee  ag---gcgg--a----------agtggggc-----------ggccg-----cac----------------
             Cape golden mole  ag---gcgg--a----------agtggggc-----------ggtca-----cac----------------
B D                    Tenrec  aa---gcgg--a----------agtggggc-----------ggcca-----cat----------------
                     Aardvark  ag---gcgg--a----------agtggagc-----------ggcca-----cat----------------
B D                   Opossum  tgtgtgtgcgta----------ggtagagt-----------tatcg-----cgg----------------
B D           Tasmanian devil  cg---gcgag-a----------ggcggggc-----------gtcca-----cct----------------
B D               Zebra finch  -----------c----------agcggggc----------------------------------------
           Tibetan ground jay  aa---gcag--a----------agtggggcaataatattaa-----------------------------
B D        American alligator  -------at--c----------agagagga----------------------------------------
B D             X. tropicalis  aa---tcgg--attgtatctctgctggggc-----------agcca------------------------
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
          Chinese tree shrew  ======================================================================
B D                 Zebrafish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Wallaby  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
                 Spotted gar  ======================================================================
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  -agg--ga
                        Chimp  -agg--ga
                      Gorilla  -agg--ga
                    Orangutan  -agg--ga
                       Gibbon  -agg--ga
                       Rhesus  -agg--ga
          Crab-eating macaque  -agg--ga
                       Baboon  -agg--ga
                 Green monkey  -agg--ga
                     Marmoset  -agg--ga
              Squirrel monkey  -agg--ga
                     Bushbaby  -tgg--ga
                     Squirrel  -cgg--gt
       Lesser Egyptian jerboa  -cgg--g-
                 Prairie vole  --------
              Chinese hamster  --------
               Golden hamster  --------
                        Mouse  --------
                          Rat  --------
               Naked mole-rat  -cgg--ga
                   Guinea pig  -tgg--ga
                   Chinchilla  -cgg--ga
             Brush-tailed rat  -ggt--ga
                         Pika  gggg--ga
                          Pig  -gag--gg
                       Alpaca  -gtg--gg
                      Dolphin  -ggg--ag
                 Killer whale  -gtg--ag
             Tibetan antelope  -ggg---g
                          Cow  -ggg---g
                        Sheep  -ggg---g
                Domestic goat  -ggg---g
                        Horse  -cgg--gg
             White rhinoceros  -cgg--ga
                          Cat  -ccg--gg
                          Dog  -cgg--gg
                      Ferret   -cgg--gg
                        Panda  -cgg--gg
               Pacific walrus  -cgg--gg
                 Weddell seal  -cgg--gg
             Black flying-fox  -ggg--ag
                      Megabat  -ggg--ag
                Big brown bat  -cgg--gg
                     Microbat  -cgg--gg
                     Hedgehog  -agactgg
                        Shrew  -cgacagg
              Star-nosed mole  -tggtgag
                     Elephant  -cga--gg
          Cape elephant shrew  -cag--gg
                      Manatee  -cgg--ga
             Cape golden mole  -cag--ga
                       Tenrec  -ctg--gc
                     Aardvark  -tgg--gg
                      Opossum  -gag--ga
              Tasmanian devil  -ggg--ga
                  Zebra finch  --------
           Tibetan ground jay  --------
           American alligator  --------
                X. tropicalis  --------
                       Medaka  ========
     Mexican tetra (cavefish)  ========
           Chinese tree shrew  ========
                    Zebrafish  ========
       Yellowbelly pufferfish  ========
                         Fugu  ========
                      Wallaby  ========
          Collared flycatcher  ========
                      Chicken  ========
             Peregrine falcon  ========
     Chinese softshell turtle  ========
              Green seaturtle  ========
               Painted turtle  ========
                    Tetraodon  ========
                 Atlantic cod  ========
                  Stickleback  ========
           Southern platyfish  ========
          Pundamilia nyererei  ========
                  Zebra mbuna  ========
        Burton's mouthbreeder  ========
          Princess of Burundi  ========
                 Nile tilapia  ========
                  Spotted gar  ========
         David's myotis (bat)  NNNNNNNN
               Bactrian camel  NNNNNNNN

Alignment block 5 of 782 in window, 13906297 - 13906329, 33 bps 
B D                     Human  agc------gagggc------t--cggga-tcgac-ggccgcg----------gggcgc
B D                     Chimp  agc------gagggc------t--cggga-tcgac-ggccgcg----------gggcgc
B D                   Gorilla  agc------gagggc------t--cggga-tcgac-ggccacg----------gggcgc
B D                 Orangutan  ggc------gagggc------t--cggga-tctac-ggccgcg----------gggcgc
B D                    Gibbon  ggc------gagggc------t--cggga-tcgac-ggccgcg----------gggcgc
B D       Crab-eating macaque  ggc------gagggc------t--cggga-tcgac-ggccgcg----------tagcgc
B D                    Baboon  ggc------gagggc------t--cggga-tcgac-ggccgcg----------gagcgc
B D              Green monkey  ggc------gaggac------t--cggga-tcgac-ggccgcg----------gagcac
B D                  Marmoset  ggc------gagggc------t--cggga-tcgac-ggccgcg----------gggcgc
B D           Squirrel monkey  ggc------gagggt------t--cggga-tccac-ggccgcg----------gggcgc
B D                  Bushbaby  ggg------gaggac------a--caggg-ttggc-agtcgct----------gggcgc
B D                  Squirrel  agc------gagggc------g--cgggg-tcagc-gggcgcg----------ggttgc
       Lesser Egyptian jerboa  -----------agag------g--cgagg-gcgcc-ggggttcagg-------ggtcgc
                 Prairie vole  -----------gaac------t--cgcga-atccc-gggggcc----------gggctc
B D           Chinese hamster  -----------aaac------t--cgaaa-attcc-gggggcc----------gggcac
               Golden hamster  -----------aaac------t--ggaga-attcc-gggggcc----------gggtac
B D                     Mouse  -----------aaac------t--cgaga-atcccggggggcc----------gggcgc
B D                       Rat  -----------aaag------t--cgaga-atccc-aggggcc----------ggtcgc
B D            Naked mole-rat  aac------aagggc------g--caggg-ttgac-gggcgcg----------ggacac
B D                Guinea pig  aac------gagggc------gc-ccggg-ttgac-ggacgcg----------ggatac
                   Chinchilla  aac------gggggc------g--aggga-ttgac-ggacgcg----------ggacac
             Brush-tailed rat  aac------taggga------g--cgggg-ttgac-ggacgcg----------ggacac
B D                      Pika  gac------gaggac------g--ccggg-ttggc-ggtcgcgaggcgcgggcgggtac
B D                       Pig  gca------gagggt------a--cgcgg-tcggc-ggtcgcg----------gggtgc
B D                    Alpaca  gct------gagggc------g--cggga--cggc-ggtcgcc----------aggcgc
B D                   Dolphin  gcc------gagggt------g--cgagg-tcggc-ggttgcg----------gggcgc
                 Killer whale  gcc------gagggc------g--ggagg-tcggc-ggttgcg----------gggcgc
             Tibetan antelope  gcc------tagggc------g--tgggg-tcggg-ggtcttg----------aggcgc
B D                       Cow  gcc------gagggc------g--tgggg-tcggc-ggtctcc----------gggcac
B D                     Sheep  gcc------gagggc------g--tgggg-tcggc-ggtctcg----------aggcgc
                Domestic goat  gcc------gagggc------g--cgggg-gcggc-ggtcccg----------aggcgc
B D                     Horse  ggc------gacgga------g--cgggg-tcgct-gggcgcc----------aggcgc
B D          White rhinoceros  gcc------aagggt------g--cgggg-tcggc-ggtcgcc----------gggcgc
B D                       Cat  gtc------gagggc------g--cgggg-tcagc-ggtcgcg----------gggcgc
B D                       Dog  gt------------c------g--cgggg-tcagc-ggtcgcg----------gggcgc
B D                   Ferret   gtc------gagggc------g--caggg-tcagc-ggtcgcg----------gggagc
B D                     Panda  gtc------gagggc------g--cgggg-tcagc-ggtcgcg----------gggcgc
               Pacific walrus  ctc------gagggc------g--cgggg-tcagc-ggtcgcg----------gggcac
                 Weddell seal  gtc------gagggc------g--cgggg-tcagc-ggtcgca----------gggcac
             Black flying-fox  acc------caggac------g--cggga-ttggc-ggtcgcg----------gggcgc
B D                   Megabat  acc------caggac------g--cggga-ttggc-ggtcgcg----------gggcgc
                Big brown bat  acc------gaggac------c--ctgggttcggc-ggtcgcg----------gggcgc
B D                  Microbat  acc------gaggac------g--ctggg-tcggc-ggtcgcg----------gggcgc
B D                  Hedgehog  ggccgcggtgaaggc------g--acctg-tgggt-gatcgag----------aggtgc
B D                     Shrew  gac------gagggc------g--cggca-tcgcc-ggccgca----------gggcgc
              Star-nosed mole  ggc------caggac------t--ctctg-tcggt-tttagtg----------aggttc
B D                  Elephant  ggc------gagagc------g--caggg-gcggt-gatcgcg----------gggtga
          Cape elephant shrew  ggc------gagggc------a--ccggg-acagc-gattgta----------gggtga
B D                   Manatee  ggc------gagagc------g--cgggg-tcagt-gatcgtg----------gggtga
             Cape golden mole  ggc------gaaggt------g--ctggg-acaac-gattgcg----------gtgtga
B D                    Tenrec  agc------gagggtgagggcg--taggg-acgag-gattacg----------gggtga
                     Aardvark  ggc------gagggc------g--tggga-gtggt-gatcgcg----------aggtga
B D                   Opossum  -----------------------------------------ca----------gagtgc
B D           Tasmanian devil  -----------------------------------------cc----------gg--gc
B D               Zebra finch  ------------------------cgggg-ctggt-ggcgctg----------gaggtg
           Tibetan ground jay  ----------------------atcgaaa-gtggg-agtcccg----------gaggag
B D        American alligator  ------------------------ggagg-gcggg-g--cccg----------gaagcg
B D             X. tropicalis  --------tgagcgg------t--cggaa--agaa-gtccgtg----------gggga-
B D                    Medaka  ===========================================================
    Mexican tetra (cavefish)  ===========================================================
          Chinese tree shrew  ===========================================================
B D                 Zebrafish  ===========================================================
      Yellowbelly pufferfish  ===========================================================
B D                      Fugu  ===========================================================
B D                   Wallaby  ===========================================================
  D       Collared flycatcher  ===========================================================
B D                   Chicken  ===========================================================
  D          Peregrine falcon  ===========================================================
  D  Chinese softshell turtle  ===========================================================
  D           Green seaturtle  ===========================================================
  D            Painted turtle  ===========================================================
B D                 Tetraodon  ===========================================================
B D              Atlantic cod  ===========================================================
B D               Stickleback  ===========================================================
          Southern platyfish  ===========================================================
         Pundamilia nyererei  ===========================================================
                 Zebra mbuna  ===========================================================
       Burton's mouthbreeder  ===========================================================
         Princess of Burundi  ===========================================================
B D              Nile tilapia  ===========================================================
                 Spotted gar  ===========================================================
        David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 5 and 6 in window
B D                  Gorilla 21bp
B D              Zebra finch 8bp
          Tibetan ground jay 3bp
B D       American alligator 8bp

Alignment block 6 of 782 in window, 13906330 - 13906332, 3 bps 
B D                     Human  c-------ga
B D                     Chimp  c-------ga
B D                   Gorilla  c-------ga
B D                 Orangutan  c-------ga
B D                    Gibbon  c-------ga
B D       Crab-eating macaque  c-------ga
B D                    Baboon  c-------ga
B D              Green monkey  c-------ga
B D                  Marmoset  t-------ga
B D           Squirrel monkey  t-------ga
B D                  Bushbaby  t-------ga
B D                  Squirrel  c-------ga
       Lesser Egyptian jerboa  gtcgtagcga
                 Prairie vole  g-------ga
B D           Chinese hamster  g-------ga
               Golden hamster  g-------ga
B D                     Mouse  g-------ga
B D                       Rat  a-------ga
B D            Naked mole-rat  t-------ga
B D                Guinea pig  c-------ga
                   Chinchilla  c-------ga
             Brush-tailed rat  t-------ga
B D                      Pika  g-------ga
B D                       Pig  c-------aa
B D                    Alpaca  c-------aa
B D                   Dolphin  c-------ag
                 Killer whale  c-------ag
             Tibetan antelope  c-------ga
B D                       Cow  c-------ga
B D                     Sheep  c-------ga
                Domestic goat  c-------ga
B D                     Horse  c-------aa
B D          White rhinoceros  c-------aa
B D                       Cat  c-------aa
B D                       Dog  c-------aa
B D                   Ferret   t-------ca
B D                     Panda  c-------aa
               Pacific walrus  c-------ag
                 Weddell seal  c-------ag
             Black flying-fox  c-------gg
B D                   Megabat  c-------gg
                Big brown bat  c-------gg
         David's myotis (bat)  c-------gg
B D                  Microbat  c-------gg
B D                  Hedgehog  c-------gg
B D                     Shrew  c-------ga
              Star-nosed mole  a-------ga
B D                  Elephant  c-------ga
          Cape elephant shrew  c-------ga
B D                   Manatee  c-------ga
             Cape golden mole  c-------ga
B D                    Tenrec  c-------ga
                     Aardvark  c-------aa
B D                   Opossum  t-------ta
B D           Tasmanian devil  c-------ta
B D               Zebra finch  c---------
           Tibetan ground jay  c---------
B D        American alligator  c---------
B D             X. tropicalis  -------gga
B D                    Medaka  ==========
    Mexican tetra (cavefish)  ==========
          Chinese tree shrew  ==========
B D                 Zebrafish  ==========
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
B D                   Wallaby  ==========
  D       Collared flycatcher  ==========
B D                   Chicken  ==========
  D          Peregrine falcon  ==========
  D  Chinese softshell turtle  ==========
  D           Green seaturtle  ==========
  D            Painted turtle  ==========
B D                 Tetraodon  ==========
B D              Atlantic cod  ==========
B D               Stickleback  ==========
          Southern platyfish  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D              Nile tilapia  ==========
                 Spotted gar  ==========
              Bactrian camel  NNNNNNNNNN
B D                    Rhesus  NNNNNNNNNN

Inserts between block 6 and 7 in window
               Domestic goat 70bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 1bp
B D                  Opossum 1bp
B D          Tasmanian devil 1bp

Alignment block 7 of 782 in window, 13906333 - 13906349, 17 bps 
B D                     Human  cga--ggagtgcaggact-c
B D                     Chimp  cga--ggagtgcaggact-c
B D                   Gorilla  cga--ggggtgcaggact-c
B D                 Orangutan  cga--ggggtgcaggact-c
B D                    Gibbon  cga--ggggtgcaggact-c
B D       Crab-eating macaque  cga--gggttgcaggact-c
B D                    Baboon  cga--gggttgcaggact-c
B D              Green monkey  cga--gggttgcaggact-c
B D                  Marmoset  cga--ggggtgcaggact-c
B D           Squirrel monkey  cga--ggggtgcaggact-c
B D                  Bushbaby  aga--ggggcgcagggct-c
B D                  Squirrel  gga--ggggctcagggct-c
       Lesser Egyptian jerboa  cac--gggacgcagggct-c
                 Prairie vole  gga--gggactccgagct-c
B D           Chinese hamster  gga--gggactcggggct-c
               Golden hamster  gga--gggactcagggct-c
B D                     Mouse  gga--gggactcagggct-c
B D                       Rat  gaa--ggaactcggggct-c
B D            Naked mole-rat  agg--ggggcccaggact-c
B D                Guinea pig  aga--ggggcccaggact-a
                   Chinchilla  aga--ggggcccaggact-g
             Brush-tailed rat  aga--agggcctaggact-c
B D                      Pika  cga--gagctgcgagact-c
B D                       Pig  cga--ggggcgcgggact-c
B D                    Alpaca  cga--ggggcgcggggtt-c
B D                   Dolphin  cga--ggggcgtgggatt-c
                 Killer whale  cga--ggggcgtgggatt-c
             Tibetan antelope  caa--ggggcgtgggact-c
B D                       Cow  caa--ggggcgtgggact-c
B D                     Sheep  caa--ggggcgtgggact-c
B D                     Horse  caa--gggacgcggggtt-c
B D          White rhinoceros  aga--gaggcgcggggtt-c
B D                       Cat  cca--ggggcgcggggct-c
B D                       Dog  cga--ggggcactgggct-c
B D                   Ferret   cga--ggggcgcggggct-c
B D                     Panda  cga--ggggcgcggggct-t
               Pacific walrus  cga--ggggcacggggct-c
                 Weddell seal  cga--ggggcgcggggct-c
             Black flying-fox  cga--g-------gggct-c
B D                   Megabat  cga--g-------gggct-c
                Big brown bat  cga--ggggcgcagggct-c
         David's myotis (bat)  cga--ggggcggagggct-c
B D                  Microbat  cga--ggggcgccgggct-c
B D                  Hedgehog  caa--ggctcgttgagct-c
B D                     Shrew  ggc--ggggcgctgagct-g
              Star-nosed mole  cga--gaggaacccagct-c
B D                  Elephant  cga--ggggcgcggagctcc
          Cape elephant shrew  cga--ggggcgcagagttcc
B D                   Manatee  gga--ggagcgcggagctcc
             Cape golden mole  caa--ggggcgcagaa-ttc
B D                    Tenrec  caa--ggggcgcggagctcc
                     Aardvark  cga--ggggcgcggagctcc
B D                   Opossum  -----------cgggaat-t
B D           Tasmanian devil  -----------ccggaag-t
B D               Zebra finch  cga--gtgcccgtgggct-g
           Tibetan ground jay  tga--cgggcc--gggct-g
B D        American alligator  caaacatggcc----gcc-g
B D             X. tropicalis  aaa--ggggctccggcgg-c
B D                    Medaka  ====================
    Mexican tetra (cavefish)  ====================
          Chinese tree shrew  ====================
               Domestic goat  ====================
B D                 Zebrafish  ====================
      Yellowbelly pufferfish  ====================
B D                      Fugu  ====================
B D                   Wallaby  ====================
  D       Collared flycatcher  ====================
B D                   Chicken  ====================
  D          Peregrine falcon  ====================
  D  Chinese softshell turtle  ====================
  D           Green seaturtle  ====================
  D            Painted turtle  ====================
B D                 Tetraodon  ====================
B D              Atlantic cod  ====================
B D               Stickleback  ====================
          Southern platyfish  ====================
         Pundamilia nyererei  ====================
                 Zebra mbuna  ====================
       Burton's mouthbreeder  ====================
         Princess of Burundi  ====================
B D              Nile tilapia  ====================
                 Spotted gar  ====================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNN

Inserts between block 7 and 8 in window
B D                  Opossum 21bp
B D          Tasmanian devil 9bp

Alignment block 8 of 782 in window, 13906350 - 13906361, 12 bps 
B D                     Human  aggaagggcg--ag
B D                     Chimp  aggaagggcg--ag
B D                   Gorilla  aggaagggcg--ag
B D                 Orangutan  aggaagggcg--ag
B D                    Gibbon  aggaagggcg--ag
B D       Crab-eating macaque  aggaagggcg--cg
B D                    Baboon  aggaagggcg--cg
B D              Green monkey  aggaagggcg--cg
B D                  Marmoset  aggaagggca--cg
B D           Squirrel monkey  aggaagggca--cg
B D                  Bushbaby  gggaagggcg--cg
B D                  Squirrel  aggaagggcg--cg
       Lesser Egyptian jerboa  aggaacagcg--cg
                 Prairie vole  aggaacacgg--cg
B D           Chinese hamster  aggagcacag--cg
               Golden hamster  tggagcacgg--ca
B D                     Mouse  aggaacagcg--cg
B D                       Rat  aggcacagcg--cg
B D            Naked mole-rat  gggaggggtg--tg
B D                Guinea pig  gggaagggcg--cg
                   Chinchilla  aggaagggcg--cg
             Brush-tailed rat  gggaagggcg--cg
B D                      Pika  gccaaggggg--cg
B D                       Pig  aggaagggcg--cg
B D                    Alpaca  aggaaggtcg--cg
B D                   Dolphin  aggaagggct--cg
                 Killer whale  aggaagggct--cg
             Tibetan antelope  aggaagggcg--tg
B D                       Cow  aggaagggcg--tg
B D                     Sheep  aggaagggcg--tg
B D                     Horse  aagaagggcg--cg
B D          White rhinoceros  aggaagggcg--cg
B D                       Cat  aggaagtgcg--cg
B D                       Dog  aggaagtgcg--cg
B D                   Ferret   aggaagtgcg--cg
B D                     Panda  aggaagtgcg--cg
               Pacific walrus  aggaagtgcg--cg
                 Weddell seal  aggaagtgcg--cg
             Black flying-fox  aggaaaggcg--cg
B D                   Megabat  aggaaaggcg--cg
                Big brown bat  tggaagggcg--cg
         David's myotis (bat)  tggaagggcg--cg
B D                  Microbat  tggaagggcg--cg
B D                  Hedgehog  aggcggggcgatcg
B D                     Shrew  cggaacggcg--cg
              Star-nosed mole  aagaagggcg--cg
B D                  Elephant  gggaagggcg--cg
          Cape elephant shrew  gagaagggcg--tg
B D                   Manatee  gggaagggtg--tg
             Cape golden mole  gggaagggcg--cc
B D                    Tenrec  tggaagggcg--cg
                     Aardvark  ggaaagggcg--cg
B D                   Opossum  agcgcccgcg--cg
B D           Tasmanian devil  agggagggcg--gt
B D                   Wallaby  agggaggcgg--gg
B D               Zebra finch  --tacctgcg--tc
           Tibetan ground jay  --ggaaagcg--c-
B D        American alligator  --gggcgtcg--cc
B D             X. tropicalis  caagagggtg--ag
B D                    Medaka  ==============
    Mexican tetra (cavefish)  ==============
          Chinese tree shrew  ==============
               Domestic goat  ==============
B D                 Zebrafish  ==============
      Yellowbelly pufferfish  ==============
B D                      Fugu  ==============
  D       Collared flycatcher  ==============
B D                   Chicken  ==============
  D          Peregrine falcon  ==============
  D  Chinese softshell turtle  ==============
  D           Green seaturtle  ==============
  D            Painted turtle  ==============
B D                 Tetraodon  ==============
B D              Atlantic cod  ==============
B D               Stickleback  ==============
          Southern platyfish  ==============
         Pundamilia nyererei  ==============
                 Zebra mbuna  ==============
       Burton's mouthbreeder  ==============
         Princess of Burundi  ==============
B D              Nile tilapia  ==============
                 Spotted gar  ==============
              Bactrian camel  NNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNN

Inserts between block 8 and 9 in window
B D            X. tropicalis 1621bp

Alignment block 9 of 782 in window, 13906362 - 13906371, 10 bps 
B D                     Human  tgcgcggcga
B D                     Chimp  tgcgcggcga
B D                   Gorilla  tgcgtggcga
B D                 Orangutan  tgcgcggcga
B D                    Gibbon  tgcacggcga
B D       Crab-eating macaque  tgcgcggcga
B D                    Baboon  tgcgcggcga
B D              Green monkey  tgcgcggcga
B D                  Marmoset  tgcgcggcta
B D           Squirrel monkey  tgcgcggcga
B D                  Bushbaby  tgcgtcgcga
B D                  Squirrel  tgcgcggcga
       Lesser Egyptian jerboa  tgcgcggaga
                 Prairie vole  agctcagaga
B D           Chinese hamster  agctcagaaa
               Golden hamster  agcacagaga
B D                     Mouse  agctctgaga
B D                       Rat  agctctgaga
B D            Naked mole-rat  tgtgcggcga
B D                Guinea pig  tgt-----ga
                   Chinchilla  agt-----ga
             Brush-tailed rat  agt-----ga
B D                      Pika  tgcacggcga
B D                       Pig  tgcgcggcca
B D                    Alpaca  tgcgcggcca
B D                   Dolphin  tgcgcggcca
                 Killer whale  tgcgcggcca
             Tibetan antelope  tgcgctgcca
B D                       Cow  tgcgctgcca
B D                     Sheep  tgcggtgcca
B D                     Horse  tgcgcggcga
B D          White rhinoceros  tgcgcggcga
B D                       Cat  tgcgcggcga
B D                       Dog  tgcgcgggga
B D                   Ferret   tgcgcggcaa
B D                     Panda  tgcgcggcga
               Pacific walrus  tgcgcggcga
                 Weddell seal  tgcgcggcga
             Black flying-fox  tgcgcagcta
B D                   Megabat  tgcgcagcta
                Big brown bat  tgcgcggcca
         David's myotis (bat)  tgcgcggcca
B D                  Microbat  tgcgcggcca
B D                  Hedgehog  atcactgccc
B D                     Shrew  tgcgcggcga
              Star-nosed mole  tgcgcagcgg
B D                  Elephant  tgcgcgggga
          Cape elephant shrew  tgcgcgagga
B D                   Manatee  tgcgtgggga
             Cape golden mole  tgcgcgagga
B D                    Tenrec  tgcgcgagta
                     Aardvark  tgcgcgagga
B D                   Opossum  tctactgtcc
B D           Tasmanian devil  cctg------
B D                   Wallaby  tgtgcaccgg
B D        American alligator  gg--------
B D                    Medaka  ==========
    Mexican tetra (cavefish)  ==========
          Chinese tree shrew  ==========
               Domestic goat  ==========
B D                 Zebrafish  ==========
B D             X. tropicalis  ==========
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
B D               Zebra finch  ----------
  D       Collared flycatcher  ==========
B D                   Chicken  ==========
  D          Peregrine falcon  ==========
  D  Chinese softshell turtle  ==========
  D           Green seaturtle  ==========
  D            Painted turtle  ==========
B D                 Tetraodon  ==========
B D              Atlantic cod  ==========
B D               Stickleback  ==========
          Southern platyfish  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D              Nile tilapia  ==========
                 Spotted gar  ==========
          Tibetan ground jay  ----------
              Bactrian camel  NNNNNNNNNN
B D                    Rhesus  NNNNNNNNNN

Alignment block 10 of 782 in window, 13906372 - 13906430, 59 bps 
B D                     Human  caga-----------------------gcc-----cg---ggg------aag----------------g-
B D                     Chimp  caga-----------------------gcc-----cg---ggg------aag----------------g-
B D                   Gorilla  cagg-----------------------gcc-----cg---ggg------aag----------------g-
B D                 Orangutan  cagg-----------------------gcc-----cg---ggg------aag----------------g-
B D                    Gibbon  cagg-----------------------gcc-----cg---ggg------aag----------------g-
B D       Crab-eating macaque  cagg-----------------------gcc-----cg---ggg------aag----------------g-
B D                    Baboon  cagg-----------------------gcc-----cg---ggg------aag----------------g-
B D              Green monkey  cagg-----------------------gcc-----cg---ggg------aag----------------g-
B D                  Marmoset  cagg-----------------------gcc-----cg---ggg------aag----------------g-
B D           Squirrel monkey  cagg-----------------------gcc-----cg---ggg------aag----------------g-
B D                  Bushbaby  cagg-----------------------ccc-----cg---gag------gag----------------g-
B D                  Squirrel  cagt-----------------------ctc-----cg---ggg------gag----------------g-
       Lesser Egyptian jerboa  ccgt-----------------------ccc-----tc---cga------gaaggaggaggaggacgagg-
                 Prairie vole  ccca-----------------------gct-----tc---agg------gaa----------------g-
B D           Chinese hamster  cccg-----------------------gct-----tc---ggg------gaa----------------g-
               Golden hamster  gccg-----------------------ggt-----tc---ggg------gaa----------------g-
B D                     Mouse  ctcg-----------------------act-----tc---ggt------gaa----------------g-
B D                       Rat  cgcg-----------------------act-----tc---ggt------gaa----------------g-
B D            Naked mole-rat  cagt-----------------------ctc-----ag---ggt------gaa----------------g-
B D                Guinea pig  cagt-----------------------cca-----gg---agt------gaa----------------g-
                   Chinchilla  cagt-----------------------ccc-----ag---agt------gaa----------------g-
             Brush-tailed rat  cagt-----------------------ccc-----ag---agt------aaa----------------g-
B D                      Pika  cagg-----------------------ccc-----ct---ggg------gag----------------g-
B D                       Pig  tagg-----------------------ccc-----cg---ggg------gag----------------a-
B D                    Alpaca  tagg-----------------------ccc-----gg---ggg------gag----------------g-
B D                   Dolphin  tagg-----------------------ccc-----cg---ggg------gag----------------g-
                 Killer whale  tagg-----------------------ccc-----cg---ggg------gag----------------g-
             Tibetan antelope  tagg-----------------------ccc-----cg---ggg------gag----------------g-
B D                       Cow  tagg-----------------------ccc-----cg---ggg------tag----------------g-
B D                     Sheep  tagg-----------------------ccc-----cg---ggg------gag----------------g-
B D                     Horse  tagg-----------------------ccc-----cg---ggg------gag----------------g-
B D          White rhinoceros  tagg-----------------------ccc-----cg---ggg------tag----------------g-
B D                       Cat  tagg-----------------------ccc-----ca---ggg------gag----------------g-
B D                       Dog  gagg-----------------------ccc-----cg---ggg------gaa----------------g-
B D                   Ferret   tagg-----------------------ccc-----cg---ggg------gag----------------g-
B D                     Panda  tagg-----------------------ccc-----cg---ggg------gag----------------g-
               Pacific walrus  tagg-----------------------ccc-----cg---ggg------gag----------------g-
                 Weddell seal  tagg-----------------------ccc-----cg---ggg------gag----------------g-
             Black flying-fox  tagg-----------------------gcc-----cg---ggg------gaa----------------g-
B D                   Megabat  tagg-----------------------gcc-----cg---ggg------gaa----------------g-
                Big brown bat  tagg-----------------------ccc-----cg---ggg------gag----------------g-
         David's myotis (bat)  tagg-----------------------ccc-----cg---ggg------gag----------------g-
B D                  Microbat  tagg-----------------------ccc-----cg---ggg------gag----------------g-
B D                  Hedgehog  cccg-----------------------cct-----cc---tgggtagg-gag----------------ga
B D                     Shrew  gagg-----------------------ccc-----tg---ggggtgggagag----------------g-
              Star-nosed mole  taga-----------------------cca-----cg---gggttggg-ggg----------------g-
B D                  Elephant  caga----------------------ccct-----cg---ggg------gag----------------a-
          Cape elephant shrew  cagaccccttttacgc----ccccctcccc-----cg---ggg------aag----------------g-
B D                   Manatee  caga----------------------ctct-----cg---ggg------gag----------------a-
             Cape golden mole  ctga-----tcaaccc----ccccctccct-----cg---ggg------gag----------------g-
B D                    Tenrec  ggga-----gacaccccgcgcccgccctcc-----ca---ggg------gag----------------g-
                     Aardvark  caga--cagtaccccc----cccccattcc-----cg---agg------gaa----------------g-
B D                   Opossum  gcgg-----------------------gca-----cggcaagg------ggc----------------g-
B D           Tasmanian devil  --------------------------------------------------------------------g-
B D                   Wallaby  gcgg-----------------------g------------ggg------gac----------------g-
B D               Zebra finch  -ctg-----------------------ccc-----cg---cac------ggc----------------g-
           Tibetan ground jay  ----------------------------------------aaa------gga----------------g-
B D        American alligator  -cag-----------------------gcc-----ca---ggg------cgg----------------g-
                  Spotted gar  caga-----------------------gccgctggcg---ggg------gtg----------------a-
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
          Chinese tree shrew  ======================================================================
               Domestic goat  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ------------aggcag----------------------ggcaaggcc-gggct-tgggg---------
                        Chimp  ------------aggcag----------------------ggcaaggcc-gggct-tgggg---------
                      Gorilla  ------------aggcag----------------------ggcaaggcc-gggct-tgggg---------
                    Orangutan  ------------aggaag----------------------ggcaaggcc-gggct-tgggg---------
                       Gibbon  ------------aggcag----------------------ggcaaggcc-gggct-tgggg---------
          Crab-eating macaque  ------------aggcag----------------------ggcaaggcc-gggct-tgggg---------
                       Baboon  ------------aggcag----------------------ggcaaggcc-gggct-tgggg---------
                 Green monkey  ------------aggcag----------------------ggcaaggcc-gggct-tgggg---------
                     Marmoset  ------------aggcag----------------------agcaaggcc-gggct-taggg---------
              Squirrel monkey  ------------aggcag----------------------agcaaggcc-gggct-tgggg---------
                     Bushbaby  ------------aggcag----------------------ggaaaggcc-gggcg-ccggg---------
                     Squirrel  ------------aggcag----------------------ggcaaggct-aggcg-ccggg---------
       Lesser Egyptian jerboa  ------------aggcag----------------------ggccaggcc-aggtg-ccggg---------
                 Prairie vole  ------------aggcag----------------------ggcaaggccaaggat-caggg---------
              Chinese hamster  ------------aggcag----------------------agtaagaccaaggtg-ccagg---------
               Golden hamster  ------------aggcag----------------------agtaagactaaggta-ccagg---------
                        Mouse  ------------aggcaa----------------------ggcaaggcaaaggtg-caggg---------
                          Rat  ------------aggcaa----------------------ggcaaggcaaaggtg-caggg---------
               Naked mole-rat  ------------aggtag----------------------ggcaaggcc-aggcgccgggg---------
                   Guinea pig  ------------agctag----------------------ggcaaggcc-aggcg-caggg---------
                   Chinchilla  ------------agatag----------------------ggcaaggcc-aggcg-caggg---------
             Brush-tailed rat  ------------agacag----------------------ggcaaggcc-aggag-caggg---------
                         Pika  ------------aggccg----------------------ggcaaggcc-gggcg-caggg---------
                          Pig  ------------aggccg----------------------ggcaaggcc-aggcc-agggg---------
                       Alpaca  ------------agtcag----------------------ggcaaggcc-aggcc-agggg---------
                      Dolphin  -----------------------------------------------cc-aggcc-agggg---------
                 Killer whale  -----------------------------------------------cc-aggcc-aaggg---------
             Tibetan antelope  ------------aggcag----------------------ggcaagacc-aggcc-agggg---------
                          Cow  ------------aggcag----------------------ggcaaggcc-aggcc-agggg---------
                        Sheep  ------------aggcag----------------------ggcaagacc-aggcc-agggg---------
                        Horse  ------------aggcag----------------------ggcaaggcc-aggcg-agggg---------
             White rhinoceros  ------------agacag----------------------ggcaaggcc-aggcg-agggg---------
                          Cat  ------------aggcag----------------------ggcaaggcc-aggcg-aggtg---------
                          Dog  ------------aggcag----------------------ggcaaggcc-aggcg-aggtg---------
                      Ferret   ------------aggcag----------------------ggcaaggcc-tggcg-aggtg---------
                        Panda  ------------aggcag----------------------ggcaaggcc-aggcg-aggtg---------
               Pacific walrus  ------------aggca-----------------------ggcaaggcc-aggcg-aggtg---------
                 Weddell seal  ------------aggcag----------------------ggcaaggcc-aggcg-aggtg---------
             Black flying-fox  ------------aggcag----------------------ggcaaggcg-aggcg-aaggg---------
                      Megabat  ------------aggcag----------------------ggcaaggcg-aggcg-aaggg---------
                Big brown bat  ------------aggcag----------------------ggcaaggcc-aggcg-tgggg---------
         David's myotis (bat)  ------------aggcag----------------------ggcaaggcc-aggcg-agggg---------
                     Microbat  ------------aggcag----------------------ggcaaggcc-aggcg-agggg---------
                     Hedgehog  gtgccaggagg-aggcag----------------------ggccgggct-aggcc-aggggggccgggca
                        Shrew  -----gggcag-agacag----------------------ggcctggcc-gggag-agggg---------
              Star-nosed mole  -----tgtagg-aggcag----------------------ggcaaggcc-aggc--aaggg---------
                     Elephant  ------------aggcag----------------------ggcaaggcc-ggacg-cgggg---------
          Cape elephant shrew  ------------aggcag----------------------ggcaaggcc-gga---caggg---------
                      Manatee  ------------aggcag----------------------ggcaaggcc-ggacg-cgggg---------
             Cape golden mole  ------------aggcag----------------------ggcaaggcc-ggacg-tgtgg---------
                       Tenrec  -----aagaggcaggcgg----------------------ggcaaggcc-ggaca-cgggg---------
                     Aardvark  ------------aggcag----------------------ggcaaggcc-gaact-cgggg---------
                      Opossum  ------------gggcgtctgaggacagggcctagccggaagtgagcct-acgag-agagg---------
              Tasmanian devil  ------------ggtccc----------------------------------------------------
                      Wallaby  ------------gggcctagccgga---------------agtgaaccg-acgag-ggagg---------
                  Zebra finch  ------------cgctga----------------------gcccgcacc-gggca-ccgcg---------
           Tibetan ground jay  ------------cggcgg----------------------gagagcccc-ggg-a-acgag---------
           American alligator  ------------cagggg----------------------gcggggccg-ggaga-aagtg---------
                  Spotted gar  ------------cgtcag----------------------cgctatatc-gcgat-tcaga---------
                       Medaka  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
           Chinese tree shrew  ======================================================================
                Domestic goat  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
          Collared flycatcher  ======================================================================
                      Chicken  ======================================================================
             Peregrine falcon  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
                    Tetraodon  ======================================================================
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  --------g----cag--gtggtccg--ggcatc
                        Chimp  --------g----cag--gtggtccg--ggcatc
                      Gorilla  --------g----cag--gtggtcca--ggcatc
                    Orangutan  --------g----cag--gtggtccg--ggcatc
                       Gibbon  --------g----cag--gcggtccg--ggcatc
          Crab-eating macaque  --------g----cag--gtggttcg--ggcatc
                       Baboon  --------g----cag--gtggttcg--ggcatc
                 Green monkey  --------g----cag--gtggttcg--ggcatc
                     Marmoset  --------g----ccg--gtggtccg--ggcatc
              Squirrel monkey  --------g----ccg--gtggtccg--ggcatc
                     Bushbaby  --------g----tcg--acggtccg--gggatc
                     Squirrel  ------gtg----ctg--gtggtcgg--ggtatc
       Lesser Egyptian jerboa  --------a----ctg--gtggtcca--ggcatc
                 Prairie vole  --------g----ctg--gtagtacg--ggcttc
              Chinese hamster  --------g----ctg--atagtcca--ggcttc
               Golden hamster  --------g----ctg--atagtccg--gacttc
                        Mouse  --------g----ctg--gtagtccg--ggcttc
                          Rat  --------g----ctg--gtagtccg--ggcttc
               Naked mole-rat  --------g----ccg--gtggtccg--ggcatc
                   Guinea pig  --------g----ccg--gtggtctg--aacatc
                   Chinchilla  --------g----tcg--gtggtctg--ggcatc
             Brush-tailed rat  --------g----ccg--gtggtctg--ggcatc
                         Pika  --------a-gactcg--gtggtcct--ggcacc
                          Pig  --------g----ccg--gtggtccg--agtatc
                       Alpaca  -------------cca--gtggtcca--agtatc
                      Dolphin  --------t----ccg--gtggtccg--agtatc
                 Killer whale  --------t----ccg--gtggtccg--agtatc
             Tibetan antelope  --------t----cca--gtggtccg--agtagc
                          Cow  --------t----cca--gtggtccg--agtagc
                        Sheep  --------t----cca--gtggtccg--agtagc
                        Horse  --------g----cgg--gtggtccg--ggcgtc
             White rhinoceros  --------g----ctg--gtggcctg--ggcatc
                          Cat  --------g----cca--gtggtctg--ggcatc
                          Dog  --------g----cca--gtggcccg--ggcatc
                      Ferret   --------g----cca--gtggcctg--ggcatc
                        Panda  --------g----caa--gtggcccg--ggcatt
               Pacific walrus  --------g----cca--gtggcccg--ggcgtc
                 Weddell seal  --------g----cca--gtggcccg--ggcatc
             Black flying-fox  --------g----ccg--gtggtccg--ggcatc
                      Megabat  --------g----ccg--gtggtccg--ggcatc
                Big brown bat  --------g----cc---gtggcctg--gccatc
         David's myotis (bat)  --------g----cc---gtggtctg--ggcatc
                     Microbat  --------g----cc---gtggtctg--ggcatc
                     Hedgehog  gactgactg----cag--gacagccg--gacata
                        Shrew  --------g----cgg--gtgatctg--gacacc
              Star-nosed mole  --------g----cca--gtgatccg--gacatc
                     Elephant  --------g----ccg--gtggtctg--ggcacc
          Cape elephant shrew  --------t----cca--gttgtcca--ggcatc
                      Manatee  --------g----ccg--gtggtcca--ggcatc
             Cape golden mole  --------t----ccg--gttgtctg--ggcatc
                       Tenrec  --------g----ctg--gttgtccg--ggcatc
                     Aardvark  --------t----ccg--gttgtcca--gggatc
                      Opossum  --------gcggtcct--ggggcccc--cgcccc
              Tasmanian devil  ----------------------------cgcccc
                      Wallaby  --------gcggtcct--ggggtccc--cgcccc
                  Zebra finch  --------c----ac---cccgcccg--tgcttg
           Tibetan ground jay  --------c----ccggtcccgtccg--agcctg
           American alligator  --------a----aagtgcccgagcggcggcctg
                  Spotted gar  -------------ccg--gagttt----------
                       Medaka  ==================================
     Mexican tetra (cavefish)  ==================================
           Chinese tree shrew  ==================================
                Domestic goat  ==================================
                    Zebrafish  ==================================
                X. tropicalis  ==================================
       Yellowbelly pufferfish  ==================================
                         Fugu  ==================================
          Collared flycatcher  ==================================
                      Chicken  ==================================
             Peregrine falcon  ==================================
     Chinese softshell turtle  ==================================
              Green seaturtle  ==================================
               Painted turtle  ==================================
                    Tetraodon  ==================================
                 Atlantic cod  ==================================
                  Stickleback  ==================================
           Southern platyfish  ==================================
          Pundamilia nyererei  ==================================
                  Zebra mbuna  ==================================
        Burton's mouthbreeder  ==================================
          Princess of Burundi  ==================================
                 Nile tilapia  ==================================
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 10 and 11 in window
B D                  Opossum 11bp
B D          Tasmanian devil 11bp
B D                  Wallaby 11bp
B D              Zebra finch 12bp
          Tibetan ground jay 12bp
B D       American alligator 4bp

Alignment block 11 of 782 in window, 13906431 - 13906439, 9 bps 
B D                     Human  cagcct-tga
B D                     Chimp  cagcct-tga
B D                   Gorilla  cagcct-tga
B D                 Orangutan  cagcct-tga
B D                    Gibbon  cagcct-tga
B D       Crab-eating macaque  cagcct-gga
B D                    Baboon  cggcct-gga
B D              Green monkey  cagcct-gga
B D                  Marmoset  cagcct-gga
B D           Squirrel monkey  cagcct-gga
B D                  Bushbaby  cagcct-gga
       Lesser Egyptian jerboa  aagcctaaga
                 Prairie vole  gacccg-gga
B D           Chinese hamster  gaccct-gga
               Golden hamster  gatcct-gga
B D                     Mouse  gagcct-gga
B D                       Rat  gagcct-gga
B D            Naked mole-rat  caggct-gga
B D                Guinea pig  cagcct-gga
                   Chinchilla  caggct-gga
             Brush-tailed rat  cagcct-gga
B D                      Pika  cagcct-gga
B D                       Pig  cagctt-ggg
B D                    Alpaca  cagcct-gga
B D                   Dolphin  cagcct-gga
                 Killer whale  cagcct-gga
             Tibetan antelope  caacct-gga
B D                       Cow  cagcct-gga
B D                     Sheep  caacct-gga
B D                     Horse  cagcct-gga
B D          White rhinoceros  ccgcct-gga
B D                       Cat  ctgcct-gga
B D                       Dog  cagcct-gga
B D                   Ferret   cagcct-gga
B D                     Panda  cagcct-gga
               Pacific walrus  cagcct-gaa
                 Weddell seal  cagcct-gga
             Black flying-fox  ttgcct-gga
B D                   Megabat  ttgcct-gga
                Big brown bat  tatcct-gga
         David's myotis (bat)  tagcct-gga
B D                  Microbat  tagcct-gga
B D                  Hedgehog  cggcca-gg-
B D                     Shrew  cagccg-gga
              Star-nosed mole  cagcct-gga
B D                  Elephant  cagctt-aga
          Cape elephant shrew  cagctt-aga
B D                   Manatee  cagcct-aga
             Cape golden mole  cagcct-aga
B D                    Tenrec  cagcct-aga
                     Aardvark  catcct-aga
B D                   Opossum  cagccc-cga
B D           Tasmanian devil  ccggct-cga
B D                   Wallaby  cagccc-cga
B D               Zebra finch  -------cga
           Tibetan ground jay  -------gag
B D        American alligator  -------cag
                  Spotted gar  ctgtcg-gca
B D                    Medaka  ==========
    Mexican tetra (cavefish)  ==========
          Chinese tree shrew  ==========
               Domestic goat  ==========
B D                 Zebrafish  ==========
B D             X. tropicalis  ==========
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
  D       Collared flycatcher  ==========
B D                   Chicken  ==========
  D          Peregrine falcon  ==========
  D  Chinese softshell turtle  ==========
  D           Green seaturtle  ==========
  D            Painted turtle  ==========
B D                 Tetraodon  ==========
B D              Atlantic cod  ==========
B D               Stickleback  ==========
          Southern platyfish  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D              Nile tilapia  ==========
              Bactrian camel  NNNNNNNNNN
B D                  Squirrel  NNNNNNNNNN
B D                    Rhesus  NNNNNNNNNN

Inserts between block 11 and 12 in window
B D              Zebra finch 89bp
          Tibetan ground jay 17bp
B D       American alligator 1bp

Alignment block 12 of 782 in window, 13906440 - 13906466, 27 bps 
B D                     Human  ag-----atgcacaagaggaaaggacccccgg--
B D                     Chimp  ag-----atgcacaagaggaaaggacccccgg--
B D                   Gorilla  ag-----atgcacaagaggaaaggacccccgg--
B D                 Orangutan  ag-----atgcacaagaggaaaggacccccgg--
B D                    Gibbon  ag-----atgcacaagaggaaaggacccccgg--
B D       Crab-eating macaque  ag-----atgcacaagaggaaaggacccccgg--
B D                    Baboon  ag-----atgcacaagaggaaaggacccccgg--
B D              Green monkey  ag-----atgcacaagaggaaaggacccccgg--
B D                  Marmoset  ag-----atgcacaagaggaaaggacccccgg--
B D           Squirrel monkey  ag-----atgcacaagaggaaaggacccccgg--
B D                  Bushbaby  ag-----atgcacaggaggaagggacctccgg--
       Lesser Egyptian jerboa  ag-----atgcacaagaggaagggaccaccag--
                 Prairie vole  ag-----atgcacaagaggaatggacccccgg--
B D           Chinese hamster  ag-----atgcacaagaggaatggacccccgg--
               Golden hamster  ag-----atgcacaagaggaatggacccccgg--
B D                     Mouse  ag-----atgcacaagaggaatggaccccagg--
B D                       Rat  ag-----atgcacaagaggaatggaccccagg--
B D            Naked mole-rat  aa-----atgcacaagaggaagggacccccgg--
B D                Guinea pig  aa-----atgcacaagaggaagggacccccgg--
                   Chinchilla  aa-----atgcacaagaggaagggacccccgg--
             Brush-tailed rat  aa-----atgcacaagaggaaggggcccccgg--
B D                      Pika  cg-----atgcacaagaggaaggga---------
B D                       Pig  ag-----atgcacaagaagaagggaccttcgg--
B D                    Alpaca  ag-----atgcacaagaggaagggacccccgg--
B D                   Dolphin  ag-----atgcacaagaggaagggaccctcgg--
                 Killer whale  ag-----atgcacaagaggaagggaccctcag--
             Tibetan antelope  ag-----atgcacaagaggaagggacccccgg--
B D                       Cow  ag-----atgcacaagaagaagggacccccgg--
B D                     Sheep  ag-----atgcacaagaggaagggacccccgg--
B D                     Horse  ag-----atgcacaagaggaagggacccccgg--
B D          White rhinoceros  ag-----atgcacaagaggaaaggacccccgg--
B D                       Cat  ag-----atgcacaagaggaagggacccccgg--
B D                       Dog  ag-----atgcacaagaggaagggacccccgg--
B D                   Ferret   aa-----atgcacaagaggaagggacccccgg--
B D                     Panda  ag-----atgcacaagaggaagggacccccgg--
               Pacific walrus  ag-----atgcacaagaggaagggacccccgg--
                 Weddell seal  ag-----atgcacaagaggaagggacccccgg--
             Black flying-fox  aa-----atgcacaagagtaagggaccccctg--
B D                   Megabat  aa-----atgcacaagagtaagggaccccctg--
                Big brown bat  ag-----atgcacaagaggaagggaaccccgg--
         David's myotis (bat)  ag-----atgcacaagaggaagggaaccccgg--
B D                  Microbat  ag-----atgcacaagaggaagggaaccccgg--
B D                  Hedgehog  ag-----atgcaaaagagaaaggggcctcccg--
B D                     Shrew  ag-----atgcacaagaggaagggatcttccg--
              Star-nosed mole  ag-----atgcacaagaggaag---------g--
B D                  Elephant  ag-----atgcacaagaggaag---------g--
          Cape elephant shrew  ag-----atgcacaagaggaag---------g--
B D                   Manatee  ag-----atgcacaagaggaag---------g--
             Cape golden mole  ag-----atgcacaagaggaagggacccccag--
B D                    Tenrec  ag-----atgcacaagaggaagggtcccccag--
                     Aardvark  ag-----atgcacaagaggaag---------g--
B D                   Opossum  cggaaacatgcacaagaagaaggcgcccccgg--
B D           Tasmanian devil  cggaaatatgcataagaagaaggcgcccccgg--
B D                   Wallaby  aggaaacatgcataagaagaaggcggccccga--
           Tibetan ground jay  -----------caaggggaaccgg----------
B D        American alligator  -------acggcggcgggggctgg----------
  D  Chinese softshell turtle  -------aaatgaacaagaacagg----------
                  Spotted gar  tg-----agtcgcagtcgg--------cccgctc
B D                    Medaka  ==================================
    Mexican tetra (cavefish)  ==================================
          Chinese tree shrew  ==================================
               Domestic goat  ==================================
B D                 Zebrafish  ==================================
B D             X. tropicalis  ==================================
      Yellowbelly pufferfish  ==================================
B D                      Fugu  ==================================
B D               Zebra finch  ==================================
  D       Collared flycatcher  ==================================
B D                   Chicken  ==================================
  D          Peregrine falcon  ==================================
  D           Green seaturtle  ==================================
  D            Painted turtle  ==================================
B D                 Tetraodon  ==================================
B D              Atlantic cod  ==================================
B D               Stickleback  ==================================
          Southern platyfish  ==================================
         Pundamilia nyererei  ==================================
                 Zebra mbuna  ==================================
       Burton's mouthbreeder  ==================================
         Princess of Burundi  ==================================
B D              Nile tilapia  ==================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 12 and 13 in window
          Tibetan ground jay 9bp
B D       American alligator 8bp
  D Chinese softshell turtle 10bp

Alignment block 13 of 782 in window, 13906467 - 13906490, 24 bps 
B D                     Human  gacccc------------cgggcagaggcgccgcgg
B D                     Chimp  gacccc------------cgggcagaggcgccgcgg
B D                   Gorilla  gacccc------------cgggcagaggcgccgcgg
B D                 Orangutan  gaccac------------cgggcagaggcgccgcgg
B D                    Gibbon  gacccc------------cgggcagaggcgccgcgg
B D       Crab-eating macaque  gacccc------------cgggcagaggcgccgcgg
B D                    Baboon  gacccc------------cgggcagaggcgccgcgg
B D              Green monkey  gacccc------------cgggcagaggcgccgcgg
B D                  Marmoset  gacccc------------cgggcagaggcgccgcgg
B D           Squirrel monkey  gacccc------------cgggcagaggcgccgcgg
B D                  Bushbaby  gacccc------------caggccgaggcgctgtcg
       Lesser Egyptian jerboa  gacccc------------cgggccggggcgctgccg
                 Prairie vole  cacccc------------cgggccgaggcgctgtca
B D           Chinese hamster  cacccc------------cgggccgaggcgctgtca
               Golden hamster  cgcccc------------caggccgaggcgctgtca
B D                     Mouse  cacccc------------cgggccgaggtgctgtca
B D                       Rat  cacccc------------cgggccgaggtgctgtca
B D            Naked mole-rat  gacccc------------caggccgaggcgccgctg
B D                Guinea pig  ggccac------------ccggccgaggcgctgctg
                   Chinchilla  ggcccc------------caggccgaggcgccgctg
             Brush-tailed rat  gacccc------------caggccgaggtgctgctg
B D                      Pika  --cccc------------caggccgaggcgctgcag
B D                       Pig  gacctc------------caggccgaggtgccgcca
B D                    Alpaca  gacctc------------caggccgaggcgctgcca
B D                   Dolphin  gaaccc------------cgggccgaggagccgcca
                 Killer whale  gaaccc------------cgggccgaggagccgcca
             Tibetan antelope  gacccc------------cgggccgaggcgccgcca
B D                       Cow  gacccc------------cgggtcgaggcgccgcca
B D                     Sheep  gacccc------------cgggccgaggcgccgcca
B D                     Horse  cacccc------------cgggccgaggcgccgccg
B D          White rhinoceros  cacccc------------cgggccgaggcgccgccg
B D                       Cat  ggcccc------------ccggccgaggtgccgccg
B D                       Dog  gacccc------------caggccgaggtgctgccg
B D                   Ferret   gacccc------------caggacgaggtgccgccg
B D                     Panda  gacccc------------caggccgaggtgccgccg
               Pacific walrus  gacccc------------caggccgaggtgccgccg
                 Weddell seal  gacccc------------caggccgaggtgccgccg
             Black flying-fox  gacccc------------cgggccgaggcgccgccg
B D                   Megabat  gacccc------------cgggccgaggcgccgccg
                Big brown bat  gacccc------------cgggccgaggcgccgccg
         David's myotis (bat)  gacccc------------cgggccgaggcgccgccg
B D                  Microbat  gacccc------------cgggccgaggcgccgccg
B D                  Hedgehog  cagccc------------cgggacggggcgccgccg
B D                     Shrew  gacccc------------cagggcgggccgccgcgg
              Star-nosed mole  gacccc------------caggtcgaggcgccgcag
B D                  Elephant  gacccc------------caggtcgaggcgccgcca
          Cape elephant shrew  gccccc------------cgggtcgtggcgccgccg
B D                   Manatee  gacccc------------caggccgaggcgccgccg
             Cape golden mole  gacccc------------caggccgaggcgctgccg
B D                    Tenrec  gccccc------------caggccgaggagccgccg
                     Aardvark  gacccc------------caggccgaggcgccgccg
B D                   Opossum  gacctc------------cgggacgcggcgcggctg
B D           Tasmanian devil  cacccc------------cggggcgcggcgcggccg
B D                   Wallaby  gacccc------------caggacgcggcgcggcca
B D               Zebra finch  gacccccaccacacccacc-----------------
           Tibetan ground jay  agctccggacacggggaccggggagcgccggagccc
B D        American alligator  gacccc------------------------------
  D  Chinese softshell turtle  --cacc----------accaggcagtggtgctgcca
                  Spotted gar  gaagca------------ggggacagggagccgcgg
B D                    Medaka  ====================================
    Mexican tetra (cavefish)  ====================================
          Chinese tree shrew  ====================================
               Domestic goat  ====================================
B D                 Zebrafish  ====================================
B D             X. tropicalis  ====================================
      Yellowbelly pufferfish  ====================================
B D                      Fugu  ====================================
  D       Collared flycatcher  ====================================
B D                   Chicken  ====================================
  D          Peregrine falcon  ====================================
  D           Green seaturtle  ====================================
  D            Painted turtle  ====================================
B D                 Tetraodon  ====================================
B D              Atlantic cod  ====================================
B D               Stickleback  ====================================
          Southern platyfish  ====================================
         Pundamilia nyererei  ====================================
                 Zebra mbuna  ====================================
       Burton's mouthbreeder  ====================================
         Princess of Burundi  ====================================
B D              Nile tilapia  ====================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 14 of 782 in window, 13906491 - 13906548, 58 bps 
B D                     Human  cc---------gcccgccaggtgagt-----ttgcgcc---------c-ca---------------cgg-
B D                     Chimp  cc---------gcccgccaggtgagt-----ctgcacc---------c-ca---------------cgg-
B D                   Gorilla  cc---------gcccgccaggtgagt-----ctgcgcc---------c-ca---------------cgg-
B D                 Orangutan  cc---------gcccgtcaggtgagt-----ctgcgcc---------c-ca---------------cgg-
B D                    Gibbon  cc---------gcccgccaggtgagt-----ctgcgcc---------c-ca---------------cgg-
B D       Crab-eating macaque  cc---------gcccgccaggtgagt-----ctgcgcc---------c-ca---------------cgg-
B D                    Baboon  cc---------gcccgccaggtgagt-----ctgcgcc---------c-ca---------------tgg-
B D              Green monkey  cc---------gcccgccaggtgagt-----ctgcgcc---------c-ca---------------cgg-
B D                  Marmoset  cc---------gcccgccaggtgagt-----ctgcacc---------c-ca---------------cgg-
B D           Squirrel monkey  cc---------gcccgccaggtgagt-----ctgcgcc---------c-ca---------------cgg-
B D                  Bushbaby  cc---------gcccgccaggtgaga-----ctgcgtc---------c-ca---------------cgg-
       Lesser Egyptian jerboa  ct---------gcccgccaggtaagt-----tgactcc---------t-gt---------------ctg-
                 Prairie vole  cc---------gcccgccaggtgagt-----gtgcgcc---------c-ct---------------ctg-
B D           Chinese hamster  cc---------gcccgccaggtgagt-----gtgcgcc---------a-ct---------------ctg-
               Golden hamster  cc---------gcccgccaggtgagt-----gcgcgcc---------a-ct---------------ctg-
B D                     Mouse  ct---------gcccgccaggtgagt-----gtgtgcc---------c-ct---------------cta-
B D                       Rat  cc---------gcccgccaggtgagt-----gtgtgcc---------c-ct---------------ctg-
B D            Naked mole-rat  cc---------gcccgccaggtgagt-----gtgcgcc---------ctca---------------cgg-
B D                Guinea pig  cc---------gcccgccaggtgagt-----gtgtgcc---------c-cg---------------cgg-
                   Chinchilla  cc---------gcccgccaggtgagt-----gtgcgcc---------c-tg---------------cgg-
             Brush-tailed rat  ct---------gcccgccaggtgagt-----gtgcgcc---------c-ca---------------cgg-
B D                      Pika  ct---------gcccgccaggtgagt-----ctggggg---------a-t--------------------
B D                       Pig  cc---------gctcgccaggtgagt-----ctgtact---------c-ca---------------cgg-
B D                    Alpaca  cc---------gcccgccaggtgagt-----ctgtatc---------c-ca---------------tgg-
B D                   Dolphin  cc---------gcccgccaggtgagt-----ctgtacc---------c-ca---------------cgg-
                 Killer whale  cc---------gcccgccaggtgagt-----ctgtacc---------c-ca---------------cgg-
             Tibetan antelope  cc---------gcccgccaggtgagt-----ctgtatc---------c-ca---------------tgg-
B D                       Cow  cc---------gcccgccaggtgagt-----ctgtatc---------c-ca---------------tgg-
B D                     Sheep  cc---------gcccgccaggtgagt-----ctgtatc---------c-ca---------------tgg-
                Domestic goat  cc---------gcccgccaggtgagt-----ctgtatc---------c-ca---------------tgg-
B D                     Horse  cc---------gcccgccaggtgagt-----ctgtacc---------c-cacctaccccgcacccccgg-
B D          White rhinoceros  cc---------gcccgccaggtgagt-----ctgtacc---------c-cccgcgccccccacccccgg-
B D                       Cat  cc---------gcccgccaggtgagt-----ctatacc---------c-ca---------------cgg-
B D                       Dog  cc---------gcccgccaggtgagt-----ctgtacc---------c-ca---------------cgg-
B D                   Ferret   cc---------gcccgccaggtgagt-----ttgtacc---------c-ca---------------cgg-
B D                     Panda  cc---------gcccgccaggtgagt-----ctgtacc---------c-ca---------------cgg-
               Pacific walrus  cc---------gcccgccaggtgagt-----ctgtacc---------c-ca---------------cgg-
                 Weddell seal  cc---------gcccgccaggtgagt-----ctgtacc---------c-ca---------------cgg-
             Black flying-fox  cc---------gcccgccaggtgagt-----ctgtcttta-------c-ca---------------cta-
B D                   Megabat  cc---------gcccgccaggtgagt-----ctgtcttta-------c-ca---------------ctac
                Big brown bat  ct---------gcccgccaggtaagt-----ctgtacc---------c-cg---------------cgg-
         David's myotis (bat)  cc---------gcccgccaggtgagt-----ctgtatc---------c-cg---------------cgg-
B D                  Microbat  cc---------gcccgccaggtgagt-----ctgtacc---------c-cg---------------cgg-
B D                  Hedgehog  ca---------gcccggcaggtgagc-----ttgcacc---------c-ca---------------cga-
B D                     Shrew  ct---------acccaccaggtgagt-----ctgtgcc---------c-ct---------------cgg-
              Star-nosed mole  ct---------gcccgccaggtgagt-----ctgtgcc---------c-ca---------------ggg-
B D                  Elephant  cc---------gcccgtcaggtgagt-----ctgcgcc---------c-ta---------------tgg-
          Cape elephant shrew  ca---------gcccgccaggtgagt-----ctgagct---------c-ca---------------cgg-
B D                   Manatee  cc---------gcccgccaggtgagt-----ctgcgcc---------c-ta---------------cgg-
             Cape golden mole  ca---------gcccgccaggtaagt-----ctatgtc---------c-ta---------------cgg-
B D                    Tenrec  ca---------gcccgccaggtgagt-----ctgcgtc---------c-ta---------------tgg-
                     Aardvark  ca---------gcccgccaggtgagt-----ctgcgcc---------c-ta---------------cgg-
B D                   Opossum  ca---------gccagacaggtgagg-----cctcctc---------c-ca---------------caa-
B D           Tasmanian devil  ca---------gccagacaggtgaag-----ccccccccctccccctc-cc---------------taa-
B D                   Wallaby  ca---------gccagacaggtgagg-----cctcccctc-------c-cc---------------caa-
B D               Zebra finch  -----------cccagccatgtcagc---------gcc---------c-ca---------------cgg-
           Tibetan ground jay  ggagccgggcacctgggaacgagagc---gtttttgcc---------c-cg---------------tag-
B D        American alligator  -----------ccccaacaggcggg----------acc---------c-cc---------------tcc-
  D  Chinese softshell turtle  ga---------gccagacaggtgagtcatgggtttcct---------t-tt---------------ttg-
                  Spotted gar  ca---------gccagacaggtgaac-----ctgca-----------g-ga---------------cgg-
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
          Chinese tree shrew  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ---------------------cccg---------------------------------------------
                        Chimp  ---------------------cccg---------------------------------------------
                      Gorilla  ---------------------cccg---------------------------------------------
                    Orangutan  ---------------------cccg---------------------------------------------
                       Gibbon  ---------------------cccg---------------------------------------------
          Crab-eating macaque  ---------------------cgcg---------------------------------------------
                       Baboon  ---------------------cgcg---------------------------------------------
                 Green monkey  ---------------------cgcg---------------------------------------------
                     Marmoset  ---------------------cccg---------------------------------------------
              Squirrel monkey  ---------------------cccg---------------------------------------------
                     Bushbaby  ---------------------cccc---------------------------------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  ----------------------ccc---------------------------------------------
              Chinese hamster  ----------------------ccc---------------------------------------------
               Golden hamster  ----------------------ccc---------------------------------------------
                        Mouse  ----------------------ccc---------------------------------------------
                          Rat  ----------------------cct---------------------------------------------
               Naked mole-rat  ---------------------accc---------------------------------------------
                   Guinea pig  ---------------------gccc---------------------------------------------
                   Chinchilla  ---------------------acct---------------------------------------------
             Brush-tailed rat  ---------------------actc---------------------------------------------
                         Pika  ----------------------ccc---------------------------------------------
                          Pig  ---------------------ccgg---------------------------------------------
                       Alpaca  ---------------------ctcg---------------------------------------------
                      Dolphin  ---------------------cccg---------------------------------------------
                 Killer whale  ---------------------cccg---------------------------------------------
             Tibetan antelope  ---------------------cccc---------------------------------------------
                          Cow  ---------------------cccc---------------------------------------------
                        Sheep  ---------------------cccc---------------------------------------------
                Domestic goat  ---------------------cccc---------------------------------------------
                        Horse  ---------------------cccc---------------------------------------------
             White rhinoceros  ---------------------ccct---------------------------------------------
                          Cat  ---------------------cccc---------------------------------------------
                          Dog  ---------------------cctc---------------------------------------------
                      Ferret   ---------------------cctc---------------------------------------------
                        Panda  ---------------------cctc---------------------------------------------
               Pacific walrus  ---------------------cctt---------------------------------------------
                 Weddell seal  ---------------------cctt---------------------------------------------
             Black flying-fox  ---------------------caccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                      Megabat  ccccccacccccccacccccccacc---------------------------------------------
                Big brown bat  ---------------------cccc---------------------------------------------
         David's myotis (bat)  ---------------------cccc---------------------------------------------
                     Microbat  ---------------------cccc---------------------------------------------
                     Hedgehog  ---------------------tccc---------------------------------------------
                        Shrew  ---------------------ttcc---------------------------------------------
              Star-nosed mole  ---------------------cccg---------------------------------------------
                     Elephant  ---------------------cccc---------------------------------------------
          Cape elephant shrew  ---------------------ccct---------------------------------------------
                      Manatee  ---------------------cccc---------------------------------------------
             Cape golden mole  ---------------------cccc---------------------------------------------
                       Tenrec  ---------------------cccc---------------------------------------------
                     Aardvark  ----------------------cct---------------------------------------------
                      Opossum  ---------------------ggta---------------------------------------------
              Tasmanian devil  ---------------------gaga---------------------------------------------
                      Wallaby  ---------------------gaga---------------------------------------------
                  Zebra finch  ---------------------ccag---------------------------------------------
           Tibetan ground jay  ---------------------cgag---------------------------------------------
           American alligator  ---------------------ccct---------------------------------------------
     Chinese softshell turtle  ---------------------cttc---------------------------------------------
                  Spotted gar  ---------------------gcca---------------------------------------------
                       Medaka  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
           Chinese tree shrew  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
          Collared flycatcher  ======================================================================
                      Chicken  ======================================================================
             Peregrine falcon  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
                    Tetraodon  ======================================================================
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Squirrel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ----------acc-t-----------gg-g------gatcc-ctccccac--------------------
                        Chimp  ----------acc-t-----------gg-g------gatcc-ctccccac--------------------
                      Gorilla  ----------acc-t-----------gg-g------gatcc-ctccccac--------------------
                    Orangutan  ----------acc-t-----------gg-g------gatcc-ctccccac--------------------
                       Gibbon  ----------acc-t-----------gg-g------gatcc-ctccccac--------------------
          Crab-eating macaque  ----------acc-t-----------gg-g------gatcc-ctccccac--------------------
                       Baboon  ----------acc-t-----------gg-g------gatcc-ctccccac--------------------
                 Green monkey  ----------acc-t-----------gg-g------gatcc-ctccccac--------------------
                     Marmoset  ----------acc-t-----------ga-g------gatcc-ctccccac--------------------
              Squirrel monkey  ----------acc-t-----------ga-g------gatcc-ctccccac--------------------
                     Bushbaby  ----------actgg-----------gg-g------gatac-ctcccaat--------------------
       Lesser Egyptian jerboa  ------------------------------------gctct-tgccaccccccagctcaggggagggccc
                 Prairie vole  ----------acc-t-----------gg-ggggggcggtct-cctcccacccttcctcaaggtctctcct
              Chinese hamster  ----------acc-t-----------ag-g------ggtct-ctccgcacccttcctcagggtctgtccc
               Golden hamster  ----------acc-t-----------ag-g------ggtct-cttcccacccttcctcagggtctgtccc
                        Mouse  ----------acc-g-----------ag-g------ggtac-ctgcccacccttcctcagagtctctctc
                          Rat  ----------acc-t-----------ag-g------ggtac-ctacccacccttcctcagggtctctccc
               Naked mole-rat  ----------acg-g-----------gg-g------agctc-ctccccac--------------------
                   Guinea pig  ----------cct-g-----------gg-g------agcgc-ctctccac-----------------cgc
                   Chinchilla  ----------acc-g-----------gg-g------agctc-gtctccac--------------------
             Brush-tailed rat  ----------acc-g-----------gg-g------agctc-ctttccac--------------------
                         Pika  ----------gcg-g-----------gg-g------gatcc-ctcctcag-----------------ccc
                          Pig  ----------gcc-g-----------ag-a------gaacc-cttcccac--------------------
                       Alpaca  ----------act-g-----------ag-g------gaaac-cttcccac-------------ccttccg
                      Dolphin  ----------gcc-c-----------ag-g------gggcc-cttcccac--------------------
                 Killer whale  ----------gcc-c-----------ag-g------ggacc-cttcccac--------------------
             Tibetan antelope  ----------gcc-g-----------ag-g------tatcc-catcccac--------------------
                          Cow  ----------gcc-g-----------ag-g------tatcc-catcccac--------------------
                        Sheep  ----------gcc-g-----------ag-g------tatcc-catcccac--------------------
                Domestic goat  ----------gcc-g-----------ag-g------tatcc-catcccac--------------------
                        Horse  ----------gcc-g-----------ga-g------gaact-ct-ctcac--------------------
             White rhinoceros  ----------gct-g-----------aa-g------gtatc-ct-cccca--------------------
                          Cat  ----------gcc-t-----------ag-a------gaacc-gttctcac--------------------
                          Dog  ----------gcc-t-----------ag-a------gaacc-ctactcac--------------------
                      Ferret   ----------gcc-t-----------ag-g------gaacc-ctactcag--------------------
                        Panda  ----------gcc-t-----------ac-a------gaacc-ctactcat--------------------
               Pacific walrus  ----------gcc-t-----------ac-g------gaacc-ctactcac--------------------
                 Weddell seal  ----------gcc-t-----------ag-g------gaacc-ctactcac--------------------
             Black flying-fox  nnnnnnngctacc-c-----------ga-g------aaacc-ctccctat--------------------
                      Megabat  --ccctggctacc-c-----------gagg------aaacc-ctccctat--------------------
                Big brown bat  ----------acc-t-----------aa-g------gaacc-ctccccac--------------------
         David's myotis (bat)  ----------gcc-g-----------aa-g------gaacc-ctccccac--------------------
                     Microbat  ----------gcc-g-----------aa-g------gaacc-gtccccac--------------------
                     Hedgehog  ----------tcc-c-----------cc-g------ga-cc-cccccca---------------------
                        Shrew  ----------gcc-c-----------at-a------ga-ac-ctccgcac--------------------
              Star-nosed mole  ----------act-g-----------ag-g------aa-cc-ctccgcac--------------------
                     Elephant  ----------gcc-------------gg-g------gggtcgctcccgaa--------------------
          Cape elephant shrew  ----------gcc-------------tg-g------agatc-ctcctgat--------------------
                      Manatee  ----------gcc-------------gg-g------ggacc-ctcccgaa--------------------
             Cape golden mole  ----------gcc-a-----------gg-g------ggacc-ctctggaa--------------------
                       Tenrec  ----------gcc-a-----------gg-g------ggacc-ctccggaa--------------------
                     Aardvark  ----------gcc-------------ag-g------ggacc-ccccccaa--------------------
                      Opossum  ----------gtc-c-----------tg-g------cacct-tcgctctc--------------------
              Tasmanian devil  ----------gac-t-----------tg-g------cccc--tcggtttt--------------------
                      Wallaby  ----------ggc-c-----------tg-g------cccct-tcgctctt--------------------
                  Zebra finch  ----------acc-ctg---------tg-a------gtgtt-g---------------------------
           Tibetan ground jay  ----------gcc-ccgaggagccccag-g------gaacc-g---------------------------
           American alligator  ----------ccc-ccggggcccccacg-g------gaatc-c---------------------------
     Chinese softshell turtle  ----------tcc-ctggtctgtgtgag-g------aaaca-c---------------------------
                  Spotted gar  ----------gcc-c-----------gc-t------gcttc-cagagcct--------------------
                       Medaka  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
           Chinese tree shrew  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
          Collared flycatcher  ======================================================================
                      Chicken  ======================================================================
             Peregrine falcon  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
                    Tetraodon  ======================================================================
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Squirrel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  --cccc
                        Chimp  --cccc
                      Gorilla  --cccc
                    Orangutan  --cccc
                       Gibbon  --cccc
          Crab-eating macaque  --cccg
                       Baboon  --cccg
                 Green monkey  --cctg
                     Marmoset  --ctct
              Squirrel monkey  --cccc
                     Bushbaby  --cccc
       Lesser Egyptian jerboa  cacctc
                 Prairie vole  caccct
              Chinese hamster  caccct
               Golden hamster  caccct
                        Mouse  caccct
                          Rat  cacctt
               Naked mole-rat  -----c
                   Guinea pig  cccccc
                   Chinchilla  ------
             Brush-tailed rat  ------
                         Pika  tgccct
                          Pig  --cctt
                       Alpaca  atcctt
                      Dolphin  --cctt
                 Killer whale  --cctt
             Tibetan antelope  --cctt
                          Cow  --cctt
                        Sheep  --cctt
                Domestic goat  --cctt
                        Horse  --ctcc
             White rhinoceros  --cccc
                          Cat  --ccct
                          Dog  --ccct
                      Ferret   --ccct
                        Panda  --ccct
               Pacific walrus  --ccgt
                 Weddell seal  --ccct
             Black flying-fox  --ccct
                      Megabat  --ccct
                Big brown bat  --ccct
         David's myotis (bat)  --ccct
                     Microbat  --ccct
                     Hedgehog  ------
                        Shrew  --ccct
              Star-nosed mole  --cctt
                     Elephant  --cccg
          Cape elephant shrew  --cgca
                      Manatee  --cccc
             Cape golden mole  --tctc
                       Tenrec  ---ccc
                     Aardvark  --cccc
                      Opossum  --cctc
              Tasmanian devil  --tgcc
                      Wallaby  --tgcc
                  Zebra finch  ------
           Tibetan ground jay  ------
           American alligator  ------
     Chinese softshell turtle  ------
                  Spotted gar  --ctct
                       Medaka  ======
     Mexican tetra (cavefish)  ======
           Chinese tree shrew  ======
                    Zebrafish  ======
                X. tropicalis  ======
       Yellowbelly pufferfish  ======
                         Fugu  ======
          Collared flycatcher  ======
                      Chicken  ======
             Peregrine falcon  ======
              Green seaturtle  ======
               Painted turtle  ======
                    Tetraodon  ======
                 Atlantic cod  ======
                  Stickleback  ======
           Southern platyfish  ======
          Pundamilia nyererei  ======
                  Zebra mbuna  ======
        Burton's mouthbreeder  ======
          Princess of Burundi  ======
                 Nile tilapia  ======
               Bactrian camel  NNNNNN
                     Squirrel  NNNNNN
                       Rhesus  NNNNNN

Inserts between block 14 and 15 in window
B D              Zebra finch 5bp
          Tibetan ground jay 5bp
B D       American alligator 18bp
  D Chinese softshell turtle 89bp

Alignment block 15 of 782 in window, 13906549 - 13906555, 7 bps 
B D                     Human  gtcac--tc
B D                     Chimp  gtcac--tc
B D                   Gorilla  gtcac--tc
B D                 Orangutan  gtcac--tc
B D                    Gibbon  gtcac--tc
B D       Crab-eating macaque  gtcac--ac
B D                    Baboon  gtcac--ac
B D              Green monkey  gtcac--ac
B D                  Marmoset  gatacagac
B D           Squirrel monkey  gatacagac
B D                  Bushbaby  gccat--at
                 Prairie vole  tcttc--ac
B D           Chinese hamster  tcctc--ac
               Golden hamster  tcttc--ac
B D                     Mouse  tcctc--ac
B D                       Rat  tcttc--ac
B D            Naked mole-rat  ctcgt--at
B D                Guinea pig  ccacc--gt
                   Chinchilla  accct--gt
             Brush-tailed rat  -ccct--gt
B D                      Pika  gccac--tc
B D                       Pig  gtc------
B D                    Alpaca  ttcac--ac
B D                   Dolphin  gtcac--aa
                 Killer whale  gtcac--ac
             Tibetan antelope  gtcac--ac
B D                       Cow  gtcac--ac
B D                     Sheep  gtcac--ac
                Domestic goat  gtcac--ac
B D                     Horse  gtcac--ag
B D          White rhinoceros  gtctc--ac
B D                       Cat  atcac--ag
B D                       Dog  atcac--ag
B D                   Ferret   atcac--ag
B D                     Panda  atctc--ag
               Pacific walrus  atcac--ag
                 Weddell seal  atcac--ag
             Black flying-fox  gtcac--ac
B D                   Megabat  gtcac--ac
B D                     Shrew  gtcac--cc
              Star-nosed mole  gttac--tg
B D                  Elephant  gtcac--ac
          Cape elephant shrew  gtcac--ac
B D                   Manatee  gtcac--ac
             Cape golden mole  gtcac--at
B D                    Tenrec  gtcac--ag
                     Aardvark  gtcac--ag
B D                   Opossum  cttcc--ct
B D           Tasmanian devil  ttatc--tt
B D                   Wallaby  ctcca--tt
B D               Zebra finch  actg-----
           Tibetan ground jay  gccg-----
B D        American alligator  acca-----
                  Spotted gar  ctctc--tc
B D                    Medaka  =========
    Mexican tetra (cavefish)  =========
      Lesser Egyptian jerboa  ---------
          Chinese tree shrew  =========
B D                  Hedgehog  ---------
               Big brown bat  ---------
B D                 Zebrafish  =========
B D             X. tropicalis  =========
      Yellowbelly pufferfish  =========
B D                      Fugu  =========
  D       Collared flycatcher  =========
B D                   Chicken  =========
  D          Peregrine falcon  =========
  D  Chinese softshell turtle  =========
  D           Green seaturtle  =========
  D            Painted turtle  =========
B D                 Tetraodon  =========
B D              Atlantic cod  =========
B D               Stickleback  =========
          Southern platyfish  =========
         Pundamilia nyererei  =========
                 Zebra mbuna  =========
       Burton's mouthbreeder  =========
         Princess of Burundi  =========
B D              Nile tilapia  =========
B D                  Microbat  ---------
        David's myotis (bat)  ---------
              Bactrian camel  NNNNNNNNN
B D                  Squirrel  NNNNNNNNN
B D                    Rhesus  NNNNNNNNN

Alignment block 16 of 782 in window, 13906556 - 13906559, 4 bps 
B D                     Human  gctc
B D                     Chimp  gctc
B D                   Gorilla  gctc
B D                 Orangutan  gctc
B D                    Gibbon  gctc
B D       Crab-eating macaque  actc
B D                    Baboon  actc
B D              Green monkey  actc
B D                  Marmoset  gctc
B D           Squirrel monkey  gctc
B D                  Bushbaby  gctc
                 Prairie vole  actc
B D           Chinese hamster  actc
               Golden hamster  actc
B D                     Mouse  actc
B D                       Rat  actc
B D            Naked mole-rat  acac
B D                Guinea pig  accc
                   Chinchilla  accc
             Brush-tailed rat  acgc
B D                      Pika  gccc
B D                       Pig  ---c
B D                    Alpaca  gttc
B D                   Dolphin  attc
                 Killer whale  attc
             Tibetan antelope  gttc
B D                       Cow  gttc
B D                     Sheep  gttc
                Domestic goat  gttc
B D                     Horse  gttc
B D          White rhinoceros  gttc
B D                       Cat  gttc
B D                       Dog  gttt
B D                   Ferret   gttc
B D                     Panda  gttc
               Pacific walrus  gttc
                 Weddell seal  gttc
             Black flying-fox  attt
B D                   Megabat  attt
B D                     Shrew  tc--
              Star-nosed mole  ttca
B D                  Elephant  gcac
          Cape elephant shrew  gttc
B D                   Manatee  gctc
             Cape golden mole  gctc
B D                    Tenrec  gct-
                     Aardvark  gctt
B D                   Opossum  gctt
B D           Tasmanian devil  gccc
B D                   Wallaby  gctc
B D                    Medaka  ====
    Mexican tetra (cavefish)  ====
      Lesser Egyptian jerboa  ----
          Chinese tree shrew  ====
B D                  Hedgehog  ----
               Big brown bat  ----
B D                 Zebrafish  ====
B D             X. tropicalis  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D               Zebra finch  ----
  D       Collared flycatcher  ====
B D                   Chicken  ====
  D          Peregrine falcon  ====
  D  Chinese softshell turtle  ====
  D           Green seaturtle  ====
  D            Painted turtle  ====
B D                 Tetraodon  ====
B D              Atlantic cod  ====
B D               Stickleback  ====
          Southern platyfish  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
                 Spotted gar  NNNN
B D        American alligator  ----
          Tibetan ground jay  ----
B D                  Microbat  ----
        David's myotis (bat)  ----
              Bactrian camel  NNNN
B D                  Squirrel  NNNN
B D                    Rhesus  NNNN

Inserts between block 16 and 17 in window
B D                    Shrew 2bp
B D                  Opossum 2bp
B D          Tasmanian devil 8bp
B D                  Wallaby 690bp

Alignment block 17 of 782 in window, 13906560 - 13906560, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  a
B D                       Pig  a
B D                    Alpaca  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  g
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  g
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
              Star-nosed mole  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  a
B D               Zebra finch  g
           Tibetan ground jay  g
B D        American alligator  g
B D                    Medaka  =
    Mexican tetra (cavefish)  =
      Lesser Egyptian jerboa  -
B D                      Pika  -
          Chinese tree shrew  =
B D                  Hedgehog  -
               Big brown bat  -
B D                     Shrew  =
B D                 Zebrafish  =
B D             X. tropicalis  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                   Wallaby  =
B D           Tasmanian devil  =
  D       Collared flycatcher  =
B D                   Opossum  =
B D                   Chicken  =
  D          Peregrine falcon  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D              Atlantic cod  =
B D               Stickleback  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
                 Spotted gar  N
B D                  Microbat  -
        David's myotis (bat)  -
              Bactrian camel  N
B D                  Squirrel  N
B D                    Rhesus  N

Inserts between block 17 and 18 in window
             Star-nosed mole 2bp
          Tibetan ground jay 6bp

Alignment block 18 of 782 in window, 13906561 - 13906576, 16 bps 
B D                     Human  g--gga------ag-------------gg-------cccca------ccc
B D                     Chimp  g--gga------ag-------------gg-------cccca------ccc
B D                   Gorilla  g--gga------ag-------------gg-------cccca------ccc
B D                 Orangutan  g--gga------ag-------------gg-------cccca------ccc
B D                    Gibbon  g--gga------ag-------------gg-------cccca------ccc
B D       Crab-eating macaque  g--gga------ag-------------gg-------cccca------ccc
B D                    Baboon  g--gga------ag-------------gg-------cccca------ccc
B D              Green monkey  g--gga------ag-------------gg-------cccca------ccc
B D                  Marmoset  g--gga------ag-------------gg-------cccca------ccc
B D           Squirrel monkey  g--gga------ag-------------ag-------cccca------ccc
B D                  Bushbaby  g--ggc------ag--------------g-------cccca------caa
       Lesser Egyptian jerboa  -----------------------------------------------cc-
                 Prairie vole  aa-ggg------ag-------------tg-------cccca------cc-
B D           Chinese hamster  ag-ggg------cg-------------tg-------cccta------cc-
               Golden hamster  cg-ggg------cg-------------tg-------cccca------cc-
B D                     Mouse  cg-ggg------ag-------------tg-------cccca------cc-
B D                       Rat  cc-ggt------ag-------------tg-------cccca------cc-
B D            Naked mole-rat  ctcggg------ga-------------ag-------ccccc-----ccc-
B D                Guinea pig  ct-ggg------gg-------------ag-------cccca-----ccc-
                   Chinchilla  ctgggg------ag-------------gg-------cccca-----ccc-
             Brush-tailed rat  ct-ggg------ag-------------gg-------cccca-----ccc-
B D                      Pika  cg-tgg------ag-------------cg-------ccctgcctccctc-
B D                       Pig  a--ggt------ag-------------gg-------cccca------ccc
B D                    Alpaca  a--agg------agccctgcccacccctg-------ccccc------gcc
B D                   Dolphin  a--ggg------aa-------------gg-------cccca-------cc
                 Killer whale  a--ggg------ag-------------gg-------cccca-------cc
             Tibetan antelope  a--ggg------ag-------------gg-------cccca------ccc
B D                       Cow  a--ggg------ag-------------gg-------cccca------ccc
B D                     Sheep  a--ggg------ag-------------gg-------cccca------ccc
                Domestic goat  a--ggg------ag-------------gg-------cccca------ccc
B D                     Horse  g--cgg------cg-------------gg-------cccca------ccc
B D          White rhinoceros  g--ggg------tg-------------gg-------cccca------ccc
B D                       Cat  g--agg------ag-------------gg-------cccca------ccc
B D                       Dog  g--agg------ag-------------gg-------cccca------ccc
B D                   Ferret   t--tag------ag-------------gg-------cccca------ccc
B D                     Panda  g--ggg------ag-------------ga-------cccca------ccc
               Pacific walrus  g--ggg------ag-------------gt-------cccca------ccc
                 Weddell seal  g--ggg------ag-------------gg-------cccca------ccc
             Black flying-fox  g--ggg------ag-------------gg-------cccta------cct
B D                   Megabat  g--ggg------ag-------------gg-------cccta------cct
B D                  Hedgehog  g--ggc------ag-------------aa-------tccca------tcc
B D                     Shrew  t--gga------cc-------------ag-------cccca------ccc
              Star-nosed mole  g--agg------ag-------------gg-------cccca------ccc
B D                  Elephant  g--gga------ag-------------gg-------accca------cc-
          Cape elephant shrew  g--gag------ag-------------gg-------cccca------cc-
B D                   Manatee  g--ggg------ag-------------ga-------cccca------cc-
             Cape golden mole  g--ggg------ag-------------gg-------cccca------cc-
B D                    Tenrec  g--cgg------ag-------------aa-------cccca------cc-
                     Aardvark  g--ggg------tg-------------ga-------cccca------cc-
B D                   Opossum  ------tttttctg-------------gc-------cccct------tc-
B D           Tasmanian devil  ------------tg-------------gc-------ctcct------cc-
           Tibetan ground jay  ----gg------ag-------------cgctgccagccccg------cag
B D        American alligator  ---gga------ag-------------ccc------cccca------ccc
B D                    Medaka  ==================================================
    Mexican tetra (cavefish)  ==================================================
          Chinese tree shrew  ==================================================
               Big brown bat  --------------------------------------------------
B D                 Zebrafish  ==================================================
B D             X. tropicalis  ==================================================
      Yellowbelly pufferfish  ==================================================
B D                      Fugu  ==================================================
B D                   Wallaby  ==================================================
  D       Collared flycatcher  ==================================================
B D                   Chicken  ==================================================
  D          Peregrine falcon  ==================================================
  D  Chinese softshell turtle  ==================================================
  D           Green seaturtle  ==================================================
  D            Painted turtle  ==================================================
B D                 Tetraodon  ==================================================
B D              Atlantic cod  ==================================================
B D               Stickleback  ==================================================
          Southern platyfish  ==================================================
         Pundamilia nyererei  ==================================================
                 Zebra mbuna  ==================================================
       Burton's mouthbreeder  ==================================================
         Princess of Burundi  ==================================================
B D              Nile tilapia  ==================================================
                 Spotted gar  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Microbat  --------------------------------------------------
        David's myotis (bat)  --------------------------------------------------
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 19 of 782 in window, 13906577 - 13906594, 18 bps 
B D                     Human  cccag--ggaagc-cc-----gatct
B D                     Chimp  cgcag--ggaagc-cc-----gatct
B D                   Gorilla  cccag--ggaagc-cc-----gatct
B D                 Orangutan  cccag--ggaagc-cc-----gatct
B D                    Gibbon  cccag--ggaagc-cc-----gatct
B D       Crab-eating macaque  cccag--ggaggc-cc-----gatct
B D                    Baboon  cccag--ggaggc-cc-----gatct
B D              Green monkey  cccag--ggaggc-cc-----gatct
B D                  Marmoset  cgcgg--ggaagc-cc-----gatct
B D           Squirrel monkey  cccgg--ggaagc-cc-----gatct
B D                  Bushbaby  cct-g--gaaagc-cc-----gatct
           Chinese tree shrew  cccag--ggaggc-tc-----gatct
       Lesser Egyptian jerboa  cccag--gtaagt-ct-----gatcc
                 Prairie vole  cccag--aaaagc-ct-----gattc
B D           Chinese hamster  cccag--aaaagc-ct-----gatcc
               Golden hamster  cccaga-aaaagc-ct-----gattc
B D                     Mouse  cccag--aaaagc-ct-----gatcc
B D                       Rat  cccag--aaaaaa-ca-----gatcc
B D            Naked mole-rat  ccccg--cgacgc-ca-----aatct
B D                Guinea pig  cccag--ggacgt-cc-----gatct
                   Chinchilla  cgcag--ggtcac-tc-----gatct
             Brush-tailed rat  cccag--ggtctc-t------gatct
B D                      Pika  tccgc--ggaagc-ct-----g----
B D                       Pig  cctag--aggagt-ca-----gatct
B D                    Alpaca  ccccg--tggaat-ct-----gatct
B D                   Dolphin  cccag--gggagc-cc-----gatct
                 Killer whale  cccaa--gggagc-cc-----gatct
             Tibetan antelope  cccat--gggaac-cg-----gctct
B D                       Cow  cccgg--gggaac-cg-----gctct
B D                     Sheep  cccag--gggaac-cg-----gctct
                Domestic goat  cccag--gggaac-cg-----gctct
B D                     Horse  -ccag--gggaac-cc-----gatct
B D          White rhinoceros  tccag--gtgaac-ca-----gatct
B D                       Cat  accag--gggaac-c------gatca
B D                       Dog  ctcag--gggaac-ct-----gatca
B D                   Ferret   cccag--gggaac-cc-----gatca
B D                     Panda  cccgg--gggaat-ca-----gatca
               Pacific walrus  cccag--gggaac-cc-----gatca
                 Weddell seal  cccag--gggaac-cc-----gatca
             Black flying-fox  cccag--gggaac-ct-----gatcg
B D                   Megabat  cccag--gggaac-ct-----gatcg
                Big brown bat  ---ca--gggaac-ct-----gatct
         David's myotis (bat)  ---ca--gggaac-ct-----gatct
B D                  Microbat  ---ca--gggaac-ct-----gatct
B D                  Hedgehog  ccc----ccaggt-aa-----gcgcc
B D                     Shrew  cccaccccccggc-ct-----cgtcc
              Star-nosed mole  ccca---agaaac-cc-----gatcc
B D                  Elephant  ctcag--g-gagc-cc-----gattc
          Cape elephant shrew  cccag--gagaga-ct-----gattc
B D                   Manatee  cccac--g-gagt-cg-----gattc
             Cape golden mole  tccag--gggagt-cc-----gattc
B D                    Tenrec  cccag--gggatc-cg-----gattc
                     Aardvark  cccag--gagaag-gt-----gtttc
B D                   Opossum  ------------cacc-----tgtct
B D           Tasmanian devil  ------------c-ct-----tgtcc
           Tibetan ground jay  cccca--gcaggt-cccggagccccc
B D        American alligator  cccag--gcaagc-cc-----cctcc
B D                    Medaka  ==========================
    Mexican tetra (cavefish)  ==========================
B D                 Zebrafish  ==========================
B D             X. tropicalis  ==========================
      Yellowbelly pufferfish  ==========================
B D                      Fugu  ==========================
B D                   Wallaby  ==========================
  D       Collared flycatcher  ==========================
B D                   Chicken  ==========================
  D          Peregrine falcon  ==========================
  D  Chinese softshell turtle  ==========================
  D           Green seaturtle  ==========================
  D            Painted turtle  ==========================
B D                 Tetraodon  ==========================
B D              Atlantic cod  ==========================
B D               Stickleback  ==========================
          Southern platyfish  ==========================
         Pundamilia nyererei  ==========================
                 Zebra mbuna  ==========================
       Burton's mouthbreeder  ==========================
         Princess of Burundi  ==========================
B D              Nile tilapia  ==========================
                 Spotted gar  NNNNNNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  NNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 19 and 20 in window
B D                  Opossum 35bp
B D          Tasmanian devil 23bp
          Tibetan ground jay 2bp

Alignment block 20 of 782 in window, 13906595 - 13906615, 21 bps 
B D                     Human  -ccg----------cccc-ac-ag-gtaagcc-ccg
B D                     Chimp  -ccg----------cccc-cc-ag-gtaagcc-ccg
B D                   Gorilla  -ccg----------cccc-cc-ag-gtaagcc-ccg
B D                 Orangutan  -ccg----------cccc-cc-ag-gtaagct-ccg
B D                    Gibbon  -ccg----------ccct--c-ag-gtaagcc-ccg
B D       Crab-eating macaque  -ccg----------cccc-cc-ag-gtaaacc-ccg
B D                    Baboon  -ccg----------cccc-cc-ag-gtaaacc-ccg
B D              Green monkey  -ccg----------cccc-cc-ag-gtaagcc-gcg
B D                  Marmoset  -ccg----------cccc-cc-ag-gtgagcc-ccg
B D           Squirrel monkey  -ccg----------cccc-cc-ag-gtgagcc-ccg
B D                  Bushbaby  -ccg----------ccccact-aa-gtgagac-cct
           Chinese tree shrew  -ccg----------cccc-ccttg-gtgagct-tca
B D                  Squirrel  -ccg----------cctc--ctag-gtgagcc-tgg
       Lesser Egyptian jerboa  -ccgcccccctcacccgc--c-ag-atgaacc-cgg
                 Prairie vole  -tcg----------ccac--c-ag-gtgagcc-tag
B D           Chinese hamster  -tcg----------ctaa--c-aa-gtgaacc-caa
               Golden hamster  -tc-----------ctaa--c-aa-gtgaacc-caa
B D                     Mouse  -tcg----------ccac--c-ag-gtgaacc-ctg
B D                       Rat  -ccg----------ccac--c-ag-gtgaacc-ctg
B D            Naked mole-rat  -cc---------------------------------
B D                Guinea pig  -ccg----------cccc--t-ct-cccatcc-cca
                   Chinchilla  -ctc----------cccc--c-cg-ccccccg-cca
             Brush-tailed rat  -ccg----------cccc--c-at-ccctttg-agc
B D                      Pika  -ctg----------ccct--t-ag-gtgagtcgctg
B D                       Pig  -cca----------cccc--c-ag-gtgagcc-ccg
B D                    Alpaca  -tca----------cccc--c-ag-gtgagcc-cgg
B D                   Dolphin  -tca----------c-cc--c-ag-gtgagcc-ccg
                 Killer whale  -tca----------c-cc--c-ag-gtgagtc-ccg
             Tibetan antelope  -tca----------ctcc--c-ag-gtgagcc-cac
B D                       Cow  -cca----------ctcc--c-ag-gtgagcc-cac
B D                     Sheep  -cca----------ctcc--c-ag-gtgagcc-cac
                Domestic goat  -cca----------ctcc--c-ag-gtgagcc-cac
B D                     Horse  -cca----------accc--c-ag-gtgagcc-ccg
B D          White rhinoceros  -cca----------accc--c-ag-gtgagcc-cct
B D                       Cat  -cca----------cccc--c-ag-gtgagcc-ccg
B D                       Dog  -cca----------cccc--c-ag-gtgaacc-cct
B D                   Ferret   -cca----------cctg--c-ag-gtaagcc-ctg
B D                     Panda  -cca----------cccc--c-tg-gtgagcc-cgg
               Pacific walrus  -cca----------cccc--c-cg-gtcagcc-ccg
                 Weddell seal  -cca----------cccc--c-aa-gtgagcc-cct
             Black flying-fox  -cca----------ctcc--t-ag-gtgatct-ctg
B D                   Megabat  -cca----------ctcc--t-ag-gtgatcc-ctg
                Big brown bat  -cca----------cccc-ac-ag-gtgagtc-ccg
         David's myotis (bat)  -cta----------cccc-cc-ag-gtgagcc-acg
B D                  Microbat  -cca----------cccc-cc-ag-gtgagcc-acg
B D                  Hedgehog  -c-------------tcc--c-ag-gtgagcc-c--
B D                     Shrew  -ccg----------cccc--c-ag-gtgagcc-cct
              Star-nosed mole  -cca----------gccc--c-ag-ctgaacc-cta
B D                  Elephant  -ccg----------cccc-ct-tg-gtgagcc-cc-
          Cape elephant shrew  -ccg----------cccc-tc-ag-gtgag-c-ct-
B D                   Manatee  -ccg----------cccc-ct-ag-gcgaacc-gc-
             Cape golden mole  -ccg----------cccc-ca-ggtgagagcc-tt-
B D                    Tenrec  -ccg----------cccc-ct-gg-gtgagcc-tc-
                     Aardvark  -ccg----------cacc-tc-ag-gtgagcc-cc-
B D                   Opossum  -ccg----------cccc-tc-ta-gc---cc-ccc
B D           Tasmanian devil  -ctg----------tccc-tc-cg-gt---cc-tca
           Tibetan ground jay  cccg----------tccc--t-gc-ggccgct-ccg
B D        American alligator  ccca----------cccc--t-ag-ggaatcc-ccg
B D                    Medaka  ====================================
    Mexican tetra (cavefish)  ====================================
B D                 Zebrafish  ====================================
B D             X. tropicalis  ====================================
      Yellowbelly pufferfish  ====================================
B D                      Fugu  ====================================
B D                   Wallaby  ====================================
  D       Collared flycatcher  ====================================
B D                   Chicken  ====================================
  D          Peregrine falcon  ====================================
  D  Chinese softshell turtle  ====================================
  D           Green seaturtle  ====================================
  D            Painted turtle  ====================================
B D                 Tetraodon  ====================================
B D              Atlantic cod  ====================================
B D               Stickleback  ====================================
          Southern platyfish  ====================================
         Pundamilia nyererei  ====================================
                 Zebra mbuna  ====================================
       Burton's mouthbreeder  ====================================
         Princess of Burundi  ====================================
B D              Nile tilapia  ====================================
                 Spotted gar  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 20 and 21 in window
          Tibetan ground jay 2bp

Alignment block 21 of 782 in window, 13906616 - 13906617, 2 bps 
B D                     Human  gt
B D                     Chimp  gt
B D                   Gorilla  gt
B D                 Orangutan  gt
B D                    Gibbon  gt
B D       Crab-eating macaque  gt
B D                    Baboon  gt
B D              Green monkey  gt
B D                  Marmoset  gt
B D           Squirrel monkey  gt
B D                  Bushbaby  gt
           Chinese tree shrew  gt
B D                  Squirrel  gt
       Lesser Egyptian jerboa  gc
                 Prairie vole  gt
B D           Chinese hamster  gt
               Golden hamster  gt
B D                     Mouse  gt
B D                       Rat  gt
B D                Guinea pig  gt
                   Chinchilla  gt
             Brush-tailed rat  ag
B D                      Pika  tt
B D                       Pig  gt
B D                    Alpaca  gt
B D                   Dolphin  gt
                 Killer whale  gt
             Tibetan antelope  gt
B D                       Cow  gt
B D                     Sheep  gt
                Domestic goat  gt
B D                     Horse  gt
B D          White rhinoceros  gt
B D                       Cat  gt
B D                       Dog  tt
B D                   Ferret   gt
B D                     Panda  gt
               Pacific walrus  gt
                 Weddell seal  gt
             Black flying-fox  at
B D                   Megabat  at
                Big brown bat  gt
         David's myotis (bat)  gt
B D                  Microbat  gt
B D                  Hedgehog  gg
B D                     Shrew  ga
              Star-nosed mole  gt
B D                  Elephant  at
          Cape elephant shrew  gc
B D                   Manatee  at
             Cape golden mole  gt
B D                    Tenrec  gt
                     Aardvark  gt
B D                   Opossum  tc
B D           Tasmanian devil  ac
           Tibetan ground jay  gt
B D                    Medaka  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D             X. tropicalis  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                   Wallaby  ==
  D       Collared flycatcher  ==
B D                   Chicken  ==
  D          Peregrine falcon  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D              Atlantic cod  ==
B D               Stickleback  ==
          Southern platyfish  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
                 Spotted gar  NN
B D            Naked mole-rat  --
              Bactrian camel  NN
B D                    Rhesus  NN

Inserts between block 21 and 22 in window
          Tibetan ground jay 7bp

Alignment block 22 of 782 in window, 13906618 - 13906673, 56 bps 
B D                     Human  -----cccc-----------------g----cctcc-----cccc-a--ggtgaggctcca---a-----
B D                     Chimp  -----cccc-----------------g----cctcc-----cccc-a--ggtgaggctcca---a-----
B D                   Gorilla  -----cccc-----------------g----cctcc-----cccc-a--ggtgaggctcca---a-----
B D                 Orangutan  -----cccc-----------------g---cccccc-----cccc-a--ggtgaggctcca---a-----
B D                    Gibbon  -----cccc-----------------g-------cc-----cccc-a--ggtgaggctcca---a-----
B D       Crab-eating macaque  -----cccc-----------------g---cccccc-----ctcc-a--ggtgagacccca---a-----
B D                    Baboon  -----cccc-----------------g---cccccc-----ctcc-a--ggtgaggcccca---a-----
B D              Green monkey  -----cccc-----------------gccccccccc-----ctcc-a--ggtgaggcccca---a-----
B D                  Marmoset  -----cccc-----------------g-----cccg-----tccc-a--agtgagactcca---a-----
B D           Squirrel monkey  -----cccc-----------------g-----cccg-----tccc-a--agcgagactcca---a-----
B D                  Bushbaby  -----cccc-----------------g-------cc-----tccc-a--aatgaggctccg---------
           Chinese tree shrew  -----ctca-----------------g------ccc-----cccc-a--ggtgaaactcga---a-----
B D                  Squirrel  -----ccct-----------------g-------cc------ccc-a--ggtaaggcctga---a-----
       Lesser Egyptian jerboa  -----cccc-----------------g-------cc----cctc-----ggtgagactggc---t-----
                 Prairie vole  -----cccc-----------------g-------cc----ccccg-a--ggtgaggctcgc---t-----
B D           Chinese hamster  -----cccc-----------------g-------cc-----cccc-a--ggtgaggcttgc---t-----
               Golden hamster  -----cccc-----------------g-------cc----tctcc-a--ggtgaggctcgc---t-----
B D                     Mouse  -----ctcc-----------------g-------ccccgcccccg-a--ggtgag---------------
B D                       Rat  -----ctcc-----------------g-------ccccgcccccg-a--agtgaggcttgc---t-----
B D            Naked mole-rat  --------------------------g-------cc-----ccct-a--agtgagccttgc---t-----
B D                Guinea pig  -----ccccctggggaacccatctcgg-------tc-----cctt-a--aatgagccttgt---c-----
                   Chinchilla  -----gtct-----------------g-------cc-----ccct-a--aatgagtcttgc---t-----
             Brush-tailed rat  -----gtcttgggg-------tcttcg-------cc-----ttct-a--aatgagtcttgc---t-----
B D                      Pika  -----cccc-----------------g-------cc-----ctcc-a--gttgaggctcga---ctctcc
B D                       Pig  -----cccc-----------------g-------cc-----ccctca--ggttagcgtcaa---c-----
B D                    Alpaca  -----cccc-----------------g-------cc-----cccc-a--ggttaggttcaactcc-----
B D                   Dolphin  -----cccc-----------------g-------cc-----cccc-t--ggttaggttcga---c-----
                 Killer whale  -----cccc-----------------g-------cc-----cccc-t--ggttaggttcga---c-----
             Tibetan antelope  -----cccc-----------------g-------cc-----ccct-a--ggttaggtttga---c-----
B D                       Cow  -----ccct-----------------g-------cc-----ccct-a--ggttaggttcga---c-----
B D                     Sheep  -----cccc-----------------g-------cc-----ccct-a--ggttaggtttga---c-----
                Domestic goat  -----cccc-----------------g-------cc-----ccct-a--ggttaggtttga---c-----
B D                     Horse  -----cccc-----------------g-------cc-----cccc-a--gatgaggtgaac---c-----
B D          White rhinoceros  -----cccc-----------------g-------cc-----cacc-a--ggtgagcttcgc---c-----
B D                       Cat  -----cccc-----------------g-------cc-----ttcc-a--gatgaggttctg---c-----
B D                       Dog  -----gccc-----------------g-------cc-----ctcc-a--gaggaggttctg---c-----
B D                   Ferret   -----cccc-----------------g-------cc-----ctcc-a--gatgaggttctg---c-----
B D                     Panda  -----ccct-----------------g-------cc-----ctcc-a--gatgaggttctg---t-----
               Pacific walrus  -----cccc-----------------g-------cc-----ctcc-a--gatgaggttctg---c-----
                 Weddell seal  -----cccc-----------------g-------cc-----ctcc-a--gatgaggttctg---c-----
             Black flying-fox  -----cccc-----------------g-------cc-----tccc-a--ggtgaggttcta---t-----
B D                   Megabat  -----cccc-----------------g-------cc-----tccc-a--ggtgaggttcta---t-----
                Big brown bat  -----cccc-----------------g-------cc-----cccc-a--agtgaggttcga---c-----
         David's myotis (bat)  -----cccc-----------------g-------cc-----cccc-a--agtgcggttcga--cc-----
B D                  Microbat  -----cccc-----------------g-------cc-----cccc-a--agtgcggttcga--cc-----
B D                  Hedgehog  -----cccc-----------------g-------cc-----ccct-gcaggtgagctttgc---a-----
B D                     Shrew  -----tccc----------------------------------------ggtgaggcttga---c-----
              Star-nosed mole  -----tccc-----------------g-------cc-----ccct-g--ggggacatttga---c-----
B D                  Elephant  -----cccc-----------------g-------cc-----cccc-a--ggtgaggctagg---c-----
          Cape elephant shrew  -----tcca-----------------g-------cc-----cctg-c--agtgaagcccag---c-----
B D                   Manatee  -----cccc-----------------g-------tc-----cccc-a--ggtgaggctggg---c-----
             Cape golden mole  -----tctc-----------------g-------cc-----cct--c--agtctgaccagg---c-----
B D                    Tenrec  -----cccg-----------------c-------cc-----ccc--a--ggtgcggccggg---c-----
                     Aardvark  -----cccc-----------------g-------cc-----ccct-a--ggtgagccctgg---t-----
B D                   Opossum  -----ccct-----------------g---gccccg-----cccc-t--tct-agccccac---t-----
B D           Tasmanian devil  -----cctc-----------------a---g---cg-----accc-t--gct---tcccgc---t-----
           Tibetan ground jay  gccggccct-----------------g-------cc-----c-------gctggg-----g---t-----
  D  Chinese softshell turtle  ccttgtcct-----------------g-------cc-----cc---a--gataag---cca---t-----
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Wallaby  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
                 Spotted gar  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ----------------------ca------cc-------accc------aagtgt--ggc---ctact--
                        Chimp  ----------------------cc------cc-------accc------aagtgt--ggc---ctact--
                      Gorilla  ----------------------cc------cc-------accc------aagtgt--ggc---ctact--
                    Orangutan  ----------------------cc------cc-------accc------aagtgt--ggc---ctact--
                       Gibbon  ----------------------cc------cc-------accc------aaatgt--ggc---ctact--
          Crab-eating macaque  ----------------------cc------cc-------actc------aagtgt--ggtctactact--
                       Baboon  ----------------------cc------cc-------actc------aagtgt--ggt---ctact--
                 Green monkey  ----------------------cc------cc-------actc------aagtgt--ggt---ctact--
                     Marmoset  ----------------------ccaccg--cc-------cccc---ac-aagtgt--ggc---ctaca--
              Squirrel monkey  ----------------------ccacca--cc-------tcccccaac-aagggt--ggc---ctaca--
                     Bushbaby  ------------------------------cc-------cccc------aatggttgggc---ctgct--
           Chinese tree shrew  ----------------------cc------cc-------cccc---acaaagtgc--ggc---cttct--
                     Squirrel  --------------------cccc------cg-------a----------agtac--ggc---ctgct--
       Lesser Egyptian jerboa  --------------------gtcc------at-------a---------tagtga--ggc---ctacc--
                 Prairie vole  ----------------------cc------cg-------a---------ctgtag--ggc---ctact--
              Chinese hamster  -----------------------c------cg-------a---------ctgtag--ggc---ctact--
               Golden hamster  ----------------------cc------cg-------a---------ctgtag--ggc---ctact--
                        Mouse  -------------------------------------------------gtgtat--ggc---ctact--
                          Rat  ----------------------ct------cg-------ac--------gtgtat--ggc---ctact--
               Naked mole-rat  ----------------------cc------cc-------t---------aggtgc--ggc---caagg--
                   Guinea pig  ----------------------cc------aa-------a---------aggtgc--gat---ctagg--
                   Chinchilla  ----------------------cc------cc-------a---------aggtgc--ggc---ctagg--
             Brush-tailed rat  ----------------------tc------cc-------a---------aggtgt--ggc---ctagg--
                         Pika  ctcacccccatcctgcccgtaccc------cc-------g---------aagtgc--ggc---ctgct--
                          Pig  ----------------------cc------cc-------a---------aaatgg--ggc---ctact--
                       Alpaca  ----------------------cc------cc-------a---------aagtgc--ggc---ctact--
                      Dolphin  ----------------------tc------cc-------a---------aagtgc--ggc---ctatt--
                 Killer whale  ----------------------tc------cc-------a---------aagtgc--ggc---ctatt--
             Tibetan antelope  ----------------------cc------cc-------a---------cagtaa--ggc---ctgtt--
                          Cow  ----------------------cc------cc-------a---------cagtaa--ggc---ctgtt--
                        Sheep  ----------------------cc------cc-------a---------cagtaa--ggc---ctgtt--
                Domestic goat  ----------------------cc------cc-------a---------cagtaa--ggc---ctgtt--
                        Horse  ----------------------ct------cc-------a---------gagtgc--ggc---ctact--
             White rhinoceros  ----------------------c-------cc-------a---------cggtgc--ggc---ctacc--
                          Cat  ----------------------cc------cc-------a---------aagtgg--ggc---ctagt--
                          Dog  ----------------------cc------cc-------a---------aagtgc--ggc---ctgct--
                      Ferret   ----------------------cc------cc-------a---------gagtgg--ggc---ctgct--
                        Panda  ----------------------cc------cc-------c---------aagtgc--cgc---ctgct--
               Pacific walrus  ----------------------tc------cc-------a---------aagtgc--ggc---ctgct--
                 Weddell seal  ----------------------cc------cc-------a---------aagtgc--ggc---ctgct--
             Black flying-fox  ----------------------tc------cc-------a---------aagtgt--ggc---ctact--
                      Megabat  ----------------------tc------cc-------a---------aagtgt--ggc---ctact--
                Big brown bat  ----------------------cc------cc-------a---------aagtgc--ggc---ctact--
         David's myotis (bat)  ----------------------cc------cc-------g---------aagtgc--ggc---ctacg--
                     Microbat  ----------------------cc------cc-------a---------aagtgc--gac---ctact--
                     Hedgehog  ----------------------cccccgcacc-------c---------cgctgc--ggc---ctgct--
                        Shrew  ----------------------ccaccctccc-------g---------aagtgc--gca---ctcct--
              Star-nosed mole  ----------------------cc-----cca-------a---------aagtgc--ggc---ctact--
                     Elephant  -------------accccttgtcg------cc-------a---------aagtcc--cac---ctgct--
          Cape elephant shrew  -------------acctttcgtct------cc-------a---------gagtgc--ggc---ctgca--
                      Manatee  -------------acccctcatcc------cc-------a---------aagtga--ggc---ctcct--
             Cape golden mole  -------------gctcctcttct------cc-------a---------aagtga--ggc---ctgct--
                       Tenrec  -------------agcccttgtcc------cc-------t---------aggtgt--ggc---ctact--
                     Aardvark  -------------aaccctctttt------cc-------a---------aagtgc--ggc---ctgct--
                      Opossum  ----------------------ct------ctctgggagatct------gattct--tcc---ccccc--
              Tasmanian devil  ----------------------gt------cc-------acct------cgcccc--cgc---cccct--
           Tibetan ground jay  ----------------------cc------gg-------g---------gagcgg--agt---cggcg--
     Chinese softshell turtle  ----------------------ct------at-------g---------aagtaa--cct---ttgtgtg
                       Medaka  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                      Wallaby  ======================================================================
          Collared flycatcher  ======================================================================
                      Chicken  ======================================================================
             Peregrine falcon  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
                    Tetraodon  ======================================================================
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                  Spotted gar  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ------gg--------cctt
                        Chimp  ------gg--------cctt
                      Gorilla  ------gg--------cctt
                    Orangutan  ------gg--------cctt
                       Gibbon  ------gg--------cctt
          Crab-eating macaque  ------gg--------cctt
                       Baboon  ------gg--------cctt
                 Green monkey  ------gg--------cctt
                     Marmoset  ------gg--------cctt
              Squirrel monkey  ------gg--------cctt
                     Bushbaby  ------gg--------ccta
           Chinese tree shrew  ------tg--------cttt
                     Squirrel  ------gg--------cgtt
       Lesser Egyptian jerboa  ------gg--------cctt
                 Prairie vole  ------gg--------cctg
              Chinese hamster  ------gg--------cctg
               Golden hamster  ------gg--------ccag
                        Mouse  ------gg--------gttg
                          Rat  ------gg--------tctg
               Naked mole-rat  ------gg--------tcct
                   Guinea pig  ------tg--------tctt
                   Chinchilla  ------gg--------tcct
             Brush-tailed rat  ------gg--------tcct
                         Pika  ------gg--------catt
                          Pig  ------ta--------cttc
                       Alpaca  ------ag--------cccc
                      Dolphin  ------gg--------cccc
                 Killer whale  ------gg--------cccc
             Tibetan antelope  ------gg--------cccg
                          Cow  ------gg--------cccg
                        Sheep  ------gg--------cccg
                Domestic goat  ------gg--------cccg
                        Horse  ------gg--------ccac
             White rhinoceros  ------gg--------cccc
                          Cat  ------ggccccggctcccc
                          Dog  ------ga--------cccc
                      Ferret   ------ggccctggctcccc
                        Panda  ------ggcccctgctcccc
               Pacific walrus  ------ggcccctgctcccc
                 Weddell seal  ------ggcccctgctcccc
             Black flying-fox  ------gg--------ccct
                      Megabat  ------gg--------ccct
                Big brown bat  ------gg--------acct
         David's myotis (bat)  ------gg--------acct
                     Microbat  ------gg--------acct
                     Hedgehog  ------gt--------cacc
                        Shrew  ------gg--------ctct
              Star-nosed mole  ------gg--------ctcc
                     Elephant  ------gg--------ctcc
          Cape elephant shrew  ------gg--------tccc
                      Manatee  ------gg--------cagg
             Cape golden mole  ------gg--------atct
                       Tenrec  ------gg--------ctct
                     Aardvark  ------gg--------ccct
                      Opossum  ------tt--------ccct
              Tasmanian devil  ------aa--------cccc
           Tibetan ground jay  ---gccgg--------acgc
     Chinese softshell turtle  tataaagg--------cccc
                       Medaka  ====================
     Mexican tetra (cavefish)  ====================
                    Zebrafish  ====================
                X. tropicalis  ====================
       Yellowbelly pufferfish  ====================
                         Fugu  ====================
                      Wallaby  ====================
          Collared flycatcher  ====================
                      Chicken  ====================
             Peregrine falcon  ====================
              Green seaturtle  ====================
               Painted turtle  ====================
                    Tetraodon  ====================
                 Atlantic cod  ====================
                  Stickleback  ====================
           Southern platyfish  ====================
          Pundamilia nyererei  ====================
                  Zebra mbuna  ====================
        Burton's mouthbreeder  ====================
          Princess of Burundi  ====================
                 Nile tilapia  ====================
                  Spotted gar  NNNNNNNNNNNNNNNNNNNN
               Bactrian camel  NNNNNNNNNNNNNNNNNNNN
                       Rhesus  NNNNNNNNNNNNNNNNNNNN

Alignment block 23 of 782 in window, 13906674 - 13906688, 15 bps 
B D                     Human  g--------g-----ctcc-c---cagctcct
B D                     Chimp  g--------g-----ctcc-c---cagctcct
B D                   Gorilla  g--------g-----ctcc-c---cagctcct
B D                 Orangutan  g--------g-----ctcc-c---cagctcct
B D                    Gibbon  g--------g-----cacc-c---cagctcct
B D       Crab-eating macaque  g--------g-----ctcc-c---cagctcct
B D                    Baboon  g--------g-----ctcc-c---cagctcct
B D              Green monkey  g--------g-----ctcc-c---cagctcct
B D                  Marmoset  g--------g-----ctcc-c---cagcttct
B D           Squirrel monkey  g--------g-----ctcc-c---cagcttct
B D                  Bushbaby  g--------a-----cacctt---cagcactt
           Chinese tree shrew  g--------tc----ctcc-c---cagctact
B D                  Squirrel  gcatccccca-----cccc-c---cgactcgt
       Lesser Egyptian jerboa  g--------g-----ccac-cccacagcttgt
                 Prairie vole  g--------g-----ccat-c---cagcttct
B D           Chinese hamster  a--------g-----ccat-g---cagcttct
               Golden hamster  g--------g-----ccat-c---cagcatct
B D                     Mouse  g--------g-----ccat-c---cagcttct
B D                       Rat  g--------g-----ccat-t---cagcttct
B D            Naked mole-rat  g----cccgc-----ctcc-c---cagctcct
B D                Guinea pig  gcctgccccc-----cccc-t---cagctgct
                   Chinchilla  g----cccga-----cccc-a---caactgct
             Brush-tailed rat  g-----ccgc-----ccca-c---cagctgct
B D                      Pika  t--------g-----ctcc-c---cagctcct
B D                       Pig  g--------t-----ctcc-c---cagctcct
B D                    Alpaca  g--------g-----ctcc-c---cagctcct
               Bactrian camel  g--------g-----ctcc-c---cagctcct
B D                   Dolphin  g--------g-----ctcc-c---cagcttct
                 Killer whale  g--------g-----ctcc-c---cagcttct
             Tibetan antelope  g--------g-----ctcc-c---cagctcct
B D                       Cow  g--------g-----ctcc-c---cagctcct
B D                     Sheep  g--------g-----ctcc-c---cagctcct
                Domestic goat  g--------g-----ctcc-c---cagctcct
B D                     Horse  g--------g-----ttcc-c---cagcttct
B D          White rhinoceros  a--------g-----ctcc-c---cagctcct
B D                       Cat  a--------g-----ctcc-t---cagctctt
B D                       Dog  a--------g-----ctcc-t---cagctctt
B D                   Ferret   a--------g-----cttc-t---cagctctt
B D                     Panda  a--------g-----ctcc-t---cagctctt
               Pacific walrus  a--------g-----ctcc-t---cagctctt
                 Weddell seal  a--------g-----ctcc-t---cagctctt
             Black flying-fox  g--------g-----ctcc-c---cagctcgt
B D                   Megabat  g--------g-----ctcc-c---cagctcgt
                Big brown bat  g--------g-----ctcc-c---cagctaat
         David's myotis (bat)  g--------g-----ctcc-c---cagcttct
B D                  Microbat  g--------g-----ctcc-c---cagcttct
B D                  Hedgehog  t--------g-----tccc-c---ggccccct
B D                     Shrew  g--------g-----cctc-c---cagttccc
              Star-nosed mole  t--------g-----ccca-c---cagttcca
B D                  Elephant  g--------a-----cctc-c---cagctg-t
          Cape elephant shrew  a--------g-----cccc-c---gagctg-t
B D                   Manatee  g--------a-----cctc-c---catcta-t
             Cape golden mole  g--------g-----cctc-c---cagcta-t
B D                    Tenrec  g--------g-----cctc-t---cgccta-t
                     Aardvark  c--------g-----cctc-c---cagcca-t
B D                   Opossum  ----------t-----tcc-t---tttctcta
B D           Tasmanian devil  ----------tctggcccc-t---gctctccc
           Tibetan ground jay  g--------a-----cttt-c---cagccccc
  D  Chinese softshell turtle  a--------a-----ccct-g---ctactttt
B D                    Medaka  ================================
    Mexican tetra (cavefish)  ================================
B D                 Zebrafish  ================================
B D             X. tropicalis  ================================
      Yellowbelly pufferfish  ================================
B D                      Fugu  ================================
B D                   Wallaby  ================================
  D       Collared flycatcher  ================================
B D                   Chicken  ================================
  D          Peregrine falcon  ================================
  D           Green seaturtle  ================================
  D            Painted turtle  ================================
B D                 Tetraodon  ================================
B D              Atlantic cod  ================================
B D               Stickleback  ================================
          Southern platyfish  ================================
         Pundamilia nyererei  ================================
                 Zebra mbuna  ================================
       Burton's mouthbreeder  ================================
         Princess of Burundi  ================================
B D              Nile tilapia  ================================
                 Spotted gar  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 23 and 24 in window
          Tibetan ground jay 1bp
  D Chinese softshell turtle 7bp

Alignment block 24 of 782 in window, 13906689 - 13906699, 11 bps 
B D                     Human  gggg--ccctg-cc
B D                     Chimp  gggg--ccctg-cc
B D                   Gorilla  gggg--ccctg-cc
B D                 Orangutan  gggg--ccctg-cc
B D                    Gibbon  gggg--ccctg-cc
B D       Crab-eating macaque  gggg--ccctg-cc
B D                    Baboon  gggg--ccgtg-cc
B D              Green monkey  gggg--ccctg-cc
B D                  Marmoset  gggg--ctccg-cc
B D           Squirrel monkey  gggg--ctccg-cc
B D                  Bushbaby  ggcgcacacag-cc
           Chinese tree shrew  gtcg--ccccg-cc
B D                  Squirrel  ggct--ctcca-cc
       Lesser Egyptian jerboa  ggct--cccca-cc
                 Prairie vole  ggct--cccca-cc
B D           Chinese hamster  ggct--cccca-cc
               Golden hamster  ggct--cccca-cc
B D                     Mouse  agct--tcaca-cc
B D                       Rat  ggct--tccca-cc
B D            Naked mole-rat  ggcg--tcccg-cc
B D                Guinea pig  ggcg--ctccg-cc
                   Chinchilla  ggcg--ccccg-cc
             Brush-tailed rat  ggcg--ccccg-tc
B D                      Pika  ggca--ccccg-cc
B D                       Pig  tatg--ccccg-ct
B D                    Alpaca  ggcg--ccccg-cc
               Bactrian camel  ggcg--ccccg-cc
B D                   Dolphin  ggcg--cccct-cc
                 Killer whale  ggcg--cccct-cc
             Tibetan antelope  ggcg--ccccg-cc
B D                       Cow  ggcg--ccccg-cc
B D                     Sheep  ggcg--ccccg-cc
                Domestic goat  ggcg--ccccg-cc
B D                     Horse  ggcg--cgcca-cc
B D          White rhinoceros  ggcg--ccctg-cc
B D                       Cat  ggcg--ccccg-cc
B D                       Dog  ggcg--ctgcg-cc
B D                   Ferret   ggcg--ccccg-cc
B D                     Panda  ggcg--ccccg-cc
               Pacific walrus  ggcg--ccccg-cc
                 Weddell seal  ggcg--ccccg-cc
             Black flying-fox  ggcg--ccccg-cc
B D                   Megabat  ggcg--ccccg-cc
                Big brown bat  ggcg--ccccg-cc
         David's myotis (bat)  ggcg--ccccg-cc
B D                  Microbat  ggcg--ccccg-cc
B D                  Hedgehog  ggcg--c-----cc
B D                     Shrew  ggag--ccccg-cc
              Star-nosed mole  ggca--ccacg-cc
B D                  Elephant  gccg--ctccaccc
          Cape elephant shrew  gcca--ccccatcc
B D                   Manatee  gccg--cccca-cc
             Cape golden mole  gcca--cccca-cc
B D                    Tenrec  gaca--cccca-cc
                     Aardvark  gcca--ctctatcc
B D                   Opossum  tgga--ccctt-cc
B D           Tasmanian devil  gggc--ccctg-cc
           Tibetan ground jay  gcgg--ccgtt-ct
B D                   Chicken  gggg--tcaca-ct
  D  Chinese softshell turtle  gcag--gcgca-gg
B D                    Medaka  ==============
    Mexican tetra (cavefish)  ==============
B D                 Zebrafish  ==============
B D             X. tropicalis  ==============
      Yellowbelly pufferfish  ==============
B D                      Fugu  ==============
B D                   Wallaby  ==============
  D       Collared flycatcher  ==============
  D          Peregrine falcon  ==============
  D           Green seaturtle  ==============
  D            Painted turtle  ==============
B D                 Tetraodon  ==============
B D              Atlantic cod  ==============
B D               Stickleback  ==============
          Southern platyfish  ==============
         Pundamilia nyererei  ==============
                 Zebra mbuna  ==============
       Burton's mouthbreeder  ==============
         Princess of Burundi  ==============
B D              Nile tilapia  ==============
                 Spotted gar  NNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNN

Inserts between block 24 and 25 in window
B D                  Opossum 2bp
B D          Tasmanian devil 971bp

Alignment block 25 of 782 in window, 13906700 - 13906711, 12 bps 
B D                     Human  ccgg--gttcgggg
B D                     Chimp  ccgg--gttcgggg
B D                   Gorilla  ccgg--gttcgggg
B D                 Orangutan  ccgg--gttcgggg
B D                    Gibbon  ccgg--tttcgggg
B D       Crab-eating macaque  ccag--gttcgggg
B D                    Baboon  ccag--gttcgggg
B D              Green monkey  ccag--gttcgggg
B D                  Marmoset  ccgg--gttcgggc
B D           Squirrel monkey  ccgg--gttcgggg
B D                  Bushbaby  ccgg--gttgggg-
           Chinese tree shrew  cccg--gctcaaag
B D                  Squirrel  cctt--gttcaggg
       Lesser Egyptian jerboa  ctcg--attcgggg
                 Prairie vole  ctgg--ttatgggg
B D           Chinese hamster  cagg--ttttgggt
               Golden hamster  ctgg--ttttgggt
B D                     Mouse  ccag--attcaggg
B D                       Rat  ccgg--tttcgggc
B D            Naked mole-rat  ccct--ttccaggg
B D                Guinea pig  cccg--tttcaggg
                   Chinchilla  cccc--tttcacag
             Brush-tailed rat  cccg--tttcagga
B D                      Pika  ctgg--gctcggag
B D                       Pig  cagg--gattaggg
B D                    Alpaca  caga--gctcagag
               Bactrian camel  caga--gttcagag
B D                   Dolphin  cagg--tctcaggg
                 Killer whale  cagg--gctcaggg
             Tibetan antelope  cagg--gctcaggg
B D                       Cow  cagg--gcttaggg
B D                     Sheep  cagg--gctcaggg
                Domestic goat  cagg--gctcaggg
B D                     Horse  ccgg--gctcaggg
B D          White rhinoceros  ccga--gctgaggg
B D                       Cat  ctgg--gctcagag
B D                       Dog  ctgg--gctcaggg
B D                   Ferret   ctgg--gctcaggg
B D                     Panda  ctgg--gctcaggg
               Pacific walrus  ctgg--gctcaggg
                 Weddell seal  atgg--gctcaggg
             Black flying-fox  ccag--gctcaggg
B D                   Megabat  ccag--gctcaggg
                Big brown bat  cgag--gctcaggg
         David's myotis (bat)  ctag--gctcaggg
B D                  Microbat  ctag--gctcaggg
B D                  Hedgehog  cagg--gctcccgg
B D                     Shrew  ccgg--gctcgggg
              Star-nosed mole  ccgg--actggggg
B D                  Elephant  ccta--caccctgg
          Cape elephant shrew  cccg--cccctgag
B D                   Manatee  ccca--cccccgct
             Cape golden mole  ccca--cctctgaa
B D                    Tenrec  cccacccctccggg
                     Aardvark  tcca--cccctgga
B D                   Opossum  ctat--cctctg--
           Tibetan ground jay  ccat--ccccagga
B D                   Chicken  ctgg--tgttggtg
  D  Chinese softshell turtle  ttcc--ggcctgca
B D                    Medaka  ==============
    Mexican tetra (cavefish)  ==============
B D                 Zebrafish  ==============
B D             X. tropicalis  ==============
      Yellowbelly pufferfish  ==============
B D                      Fugu  ==============
B D                   Wallaby  ==============
B D           Tasmanian devil  ==============
  D       Collared flycatcher  ==============
  D          Peregrine falcon  ==============
  D           Green seaturtle  ==============
  D            Painted turtle  ==============
B D                 Tetraodon  ==============
B D              Atlantic cod  ==============
B D               Stickleback  ==============
          Southern platyfish  ==============
         Pundamilia nyererei  ==============
                 Zebra mbuna  ==============
       Burton's mouthbreeder  ==============
         Princess of Burundi  ==============
B D              Nile tilapia  ==============
                 Spotted gar  NNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNN

Inserts between block 25 and 26 in window
B D                 Elephant 6bp
         Cape elephant shrew 6bp
B D                  Manatee 6bp
            Cape golden mole 5bp
B D                   Tenrec 6bp
                    Aardvark 6bp

Alignment block 26 of 782 in window, 13906712 - 13906723, 12 bps 
B D                     Human  c----cacctgttgcc
B D                     Chimp  c----cacctgttgcc
B D                   Gorilla  c----cacctgttgcc
B D                 Orangutan  c----cacctgttgcc
B D                    Gibbon  c----cacctgttgcc
B D                    Rhesus  c----cacctgttgcc
B D       Crab-eating macaque  c----cacctgttgcc
B D                    Baboon  c----cacctgttgcc
B D              Green monkey  c----cacctgttgcc
B D                  Marmoset  c----cacctgttgcc
B D           Squirrel monkey  c----cacctgttgcc
B D                  Bushbaby  c----cacctgttgaa
           Chinese tree shrew  c----cacctgttgcc
B D                  Squirrel  c----cacctgttgcc
       Lesser Egyptian jerboa  ca---cacctgttgct
                 Prairie vole  aa---cacctgttgct
B D           Chinese hamster  aa---cacctgttgct
               Golden hamster  aa---cacctgttgct
B D                     Mouse  aa---cacctgttgct
B D                       Rat  aa---cacctgttgct
B D            Naked mole-rat  c----cacctgttgtc
B D                Guinea pig  c----cacctgttgtc
                   Chinchilla  c----cacctgttgtc
             Brush-tailed rat  c----cacctgttgtc
B D                      Pika  ggggccacctgttgct
B D                       Pig  ----ccacctgttgcc
B D                    Alpaca  ----ccacctgttgcc
               Bactrian camel  ----ccacctgttgca
B D                   Dolphin  ----ccacctgttgcc
                 Killer whale  ----ccacctgttgcc
             Tibetan antelope  ----ccacctgttgca
B D                       Cow  ----ccacctgttgca
B D                     Sheep  ----ccacctgttgca
                Domestic goat  ----ccacctgttgca
B D                     Horse  ----ccacctgttgcc
B D          White rhinoceros  ----ccacctgttgcc
B D                       Cat  ----ccacctgttgcc
B D                       Dog  ----ccacctgttgcc
B D                   Ferret   ----ccacctgttgcc
B D                     Panda  ----ccacctgttgcc
               Pacific walrus  ----ccacctgttgcc
                 Weddell seal  ----ccacctgttgcc
             Black flying-fox  ----ccacctgttgct
B D                   Megabat  ----ccacctgttgct
                Big brown bat  ----ccacctgttgcc
         David's myotis (bat)  ----ccacctgttgcc
B D                  Microbat  ----ccacctgttgcc
B D                  Hedgehog  ----acacctgttgcc
B D                     Shrew  ----acacctgttgcc
              Star-nosed mole  ----ccacctgttgct
B D                  Elephant  ----ccacctgttgct
          Cape elephant shrew  ----ccacctgttgcg
B D                   Manatee  ----ccacctgttgct
             Cape golden mole  ----ccacctgttgcc
B D                    Tenrec  ----ccacctgttgcc
                     Aardvark  ----ccacctgttgcg
B D                   Opossum  ----ccttccctagcc
           Tibetan ground jay  ------acggggaccc
B D                   Chicken  ----tcacctgtggtc
  D  Chinese softshell turtle  ------gtttgtaaag
B D                    Medaka  ================
    Mexican tetra (cavefish)  ================
B D                 Zebrafish  ================
B D             X. tropicalis  ================
      Yellowbelly pufferfish  ================
B D                      Fugu  ================
B D                   Wallaby  ================
B D           Tasmanian devil  ================
  D       Collared flycatcher  ================
  D          Peregrine falcon  ================
  D           Green seaturtle  ================
  D            Painted turtle  ================
B D                 Tetraodon  ================
B D              Atlantic cod  ================
B D               Stickleback  ================
          Southern platyfish  ================
         Pundamilia nyererei  ================
                 Zebra mbuna  ================
       Burton's mouthbreeder  ================
         Princess of Burundi  ================
B D              Nile tilapia  ================
                 Spotted gar  NNNNNNNNNNNNNNNN

Inserts between block 26 and 27 in window
B D                 Hedgehog 3274bp

Alignment block 27 of 782 in window, 13906724 - 13906729, 6 bps 
B D                     Human  ac-agct
B D                     Chimp  ac-agct
B D                   Gorilla  ac-agct
B D                 Orangutan  ac-agct
B D                    Gibbon  ac-agct
B D                    Rhesus  ac-agct
B D       Crab-eating macaque  ac-agct
B D                    Baboon  ac-agct
B D              Green monkey  at-agct
B D                  Marmoset  gc-agca
B D           Squirrel monkey  gc-agca
B D                  Bushbaby  gc-agca
           Chinese tree shrew  ta-agca
B D                  Squirrel  gc-aacg
       Lesser Egyptian jerboa  ac-agct
                 Prairie vole  gc-agta
B D           Chinese hamster  gc-agca
               Golden hamster  gc-agca
B D                     Mouse  gc-agca
B D                       Rat  ac-atca
B D            Naked mole-rat  gc-agca
B D                Guinea pig  cc-agca
                   Chinchilla  ac-ag--
             Brush-tailed rat  at-agca
B D                      Pika  gc-atta
B D                       Pig  gt-ggca
B D                    Alpaca  gc-agca
               Bactrian camel  gc-agca
B D                   Dolphin  gc-agca
                 Killer whale  gc-agca
             Tibetan antelope  gt-agca
B D                       Cow  gt-agca
B D                     Sheep  gt-agca
                Domestic goat  gt-agca
B D                     Horse  gc-agca
B D          White rhinoceros  gc-ggca
B D                       Cat  ga-agcc
B D                       Dog  gc-agcc
B D                   Ferret   gc-agcc
B D                     Panda  gc-agcc
               Pacific walrus  gc-agcc
                 Weddell seal  gc-agcc
             Black flying-fox  gc-agca
B D                   Megabat  gc-agca
                Big brown bat  ac-a-ca
         David's myotis (bat)  ac-a-ca
B D                  Microbat  ac-a-ca
B D                     Shrew  ctgagca
              Star-nosed mole  gc-agca
B D                  Elephant  gc-agct
          Cape elephant shrew  gc-atca
B D                   Manatee  gc-agca
             Cape golden mole  gc-agca
B D                    Tenrec  gc-ctca
                     Aardvark  gc-agta
B D                   Opossum  -c-cgcc
           Tibetan ground jay  gc-cgct
B D                   Chicken  ac-cgct
  D  Chinese softshell turtle  tt-tg--
B D                    Medaka  =======
    Mexican tetra (cavefish)  =======
B D                  Hedgehog  =======
B D                 Zebrafish  =======
B D             X. tropicalis  =======
      Yellowbelly pufferfish  =======
B D                      Fugu  =======
B D                   Wallaby  =======
B D           Tasmanian devil  =======
  D       Collared flycatcher  =======
  D          Peregrine falcon  =======
  D           Green seaturtle  =======
  D            Painted turtle  =======
B D                 Tetraodon  =======
B D              Atlantic cod  =======
B D               Stickleback  =======
          Southern platyfish  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D              Nile tilapia  =======
                 Spotted gar  NNNNNNN

Inserts between block 27 and 28 in window
B D                  Opossum 1518bp

Alignment block 28 of 782 in window, 13906730 - 13906730, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  c
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
             Brush-tailed rat  c
B D                      Pika  g
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                     Shrew  g
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  t
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
           Tibetan ground jay  c
B D                   Chicken  g
B D                    Medaka  =
    Mexican tetra (cavefish)  =
B D                  Hedgehog  =
B D                 Zebrafish  =
B D             X. tropicalis  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                   Wallaby  =
B D           Tasmanian devil  =
  D       Collared flycatcher  =
B D                   Opossum  =
  D          Peregrine falcon  =
  D  Chinese softshell turtle  -
  D           Green seaturtle  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D              Atlantic cod  =
B D               Stickleback  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
                 Spotted gar  N
                  Chinchilla  -

Inserts between block 28 and 29 in window
          Tibetan ground jay 4bp
B D                  Chicken 4890bp

Alignment block 29 of 782 in window, 13906731 - 13906754, 24 bps 
B D                     Human  ctccagt-cg---------aggaggggcagtcc----t
B D                     Chimp  ctccagt-cg---------aggaggggcagtcc----t
B D                   Gorilla  ctccagt-cg---------gggaggggcagtcc----t
B D                 Orangutan  ctccagt-ca---------gggaggggcagtcc----t
B D                    Gibbon  ctccagt-cg---------gggaggggcagtcc----t
B D                    Rhesus  ctccagt-cg---------gggaggggcagtcc----t
B D       Crab-eating macaque  ctccagt-cg---------gggaggggcagtcc----t
B D                    Baboon  ctccagt-cg---------gggaggggcagtcc----t
B D              Green monkey  ctccagt-cg---------gggaggggcagtcc----t
B D                  Marmoset  ctccact-ca---------gggaggggcagtcc----t
B D           Squirrel monkey  ctccagt-ca---------gggaggggcagtcc----t
B D                  Bushbaby  ttccagt-ggggaagagaagggaggggcagccc----t
           Chinese tree shrew  ctccagtccg---------gggaggggcagtcagtcgt
B D                  Squirrel  ctccaat-ca---------gggaggggcagcag----g
       Lesser Egyptian jerboa  ctccagt-ta---------gggaggg------------
                 Prairie vole  tttcagc-ct---------ggaagagacagcaa----t
B D           Chinese hamster  ttccagc-cg---------agcagaggcagcca----t
               Golden hamster  ttccagc-cc---------agaagaggcagcca----c
B D                     Mouse  ttccaac-cg---------ggaagggaaagcaa----t
B D                       Rat  ttccaac-cg---------ggaagggaaagcaa----t
B D            Naked mole-rat  ctacagg-aa---------gggaatggtagcaa----t
B D                Guinea pig  ctttagg-aa---------gggaggggcagcag----t
                   Chinchilla  cttgagg-aa---------gggaggggccgcag----t
             Brush-tailed rat  cttcagg-ga---------gggaggagcaataa----t
B D                      Pika  ctccagt-tt---------gggaggggcaggcc----c
B D                       Pig  ctactgt-cg---------gggaggggaaggcc----t
B D                    Alpaca  ctccagt-ct---------aggagaggaaggcc----t
               Bactrian camel  ctccagt-ct---------aggagaggaaggcc----t
B D                   Dolphin  ctccagt-tc---------gggaggggaaggcc----t
                 Killer whale  ctccagt-tc---------gggaggggaaggcc----t
             Tibetan antelope  ctccagt-cg---------gggaggagaaggcc----t
B D                       Cow  ctccagt-cc---------gggaggagaaggcc----t
B D                     Sheep  ctccagt-cg---------gagaggagaaggcc----t
                Domestic goat  ctccagt-cg---------gggaggagaaggcc----t
B D                     Horse  ctccact-cg---------gggaggggaaggcc----t
B D          White rhinoceros  ctcgcgt-cc---------agga-gggaaggcc----t
B D                       Cat  ctccagt-tt---------gggaggggaaggcc----t
B D                       Dog  ctccagt-tt---------gggaggggaaggcc----t
B D                   Ferret   ctccagt-tt---------gggaggggaaggcc----t
B D                     Panda  ctccagt-tt---------gggaggggaaggcc----t
               Pacific walrus  caccagt-tt---------gggaggggaaggcc----t
                 Weddell seal  ctccagt-tt---------gggaggggaaggcc----t
             Black flying-fox  ctccagt-cc---------tggaggggaaggcc----t
B D                   Megabat  ctccagt-cc---------tggaggggaaggcc----t
                Big brown bat  ctccagt-a----------gggaggggaaggcc----t
         David's myotis (bat)  ccccagt-ag---------gggaggggaaggcc----t
B D                  Microbat  ccccagt-ag---------gggaggggaaggcc----t
B D                     Shrew  ctgcagt-cc---------gggagggaaaggcc----t
              Star-nosed mole  ttcctgt-tg---------ggaaggggaaggcc----t
B D                  Elephant  ctccagt-cg---------ggaaagggcaggca----t
          Cape elephant shrew  ctccatt-tg---------ggaaggggcaggcc----t
B D                   Manatee  ctccagt-tg---------ggaaggggcatgcg----t
             Cape golden mole  ctctagt-tg---------ggaaggggcaggcc----t
B D                    Tenrec  ctccaat-tg---------gaaaggagcaggcc----t
                     Aardvark  ctccaat-gg---------gtaaggggcaggtc----t
           Tibetan ground jay  -----cc-cc---------gggccg----gtcc----c
  D  Chinese softshell turtle  agctcct-tt---------aggatgagaagtcc----t
B D                    Medaka  ======================================
    Mexican tetra (cavefish)  ======================================
B D                  Hedgehog  ======================================
B D                 Zebrafish  ======================================
B D             X. tropicalis  ======================================
      Yellowbelly pufferfish  ======================================
B D                      Fugu  ======================================
B D                   Wallaby  ======================================
B D           Tasmanian devil  ======================================
  D       Collared flycatcher  ======================================
B D                   Opossum  ======================================
B D                   Chicken  ======================================
  D          Peregrine falcon  ======================================
  D           Green seaturtle  ======================================
  D            Painted turtle  ======================================
B D                 Tetraodon  ======================================
B D              Atlantic cod  ======================================
B D               Stickleback  ======================================
          Southern platyfish  ======================================
         Pundamilia nyererei  ======================================
                 Zebra mbuna  ======================================
       Burton's mouthbreeder  ======================================
         Princess of Burundi  ======================================
B D              Nile tilapia  ======================================
                 Spotted gar  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 29 and 30 in window
  D Chinese softshell turtle 2948bp

Alignment block 30 of 782 in window, 13906755 - 13906796, 42 bps 
B D                     Human  cggacttgac-----------------------------------------------------acat-ca
B D                     Chimp  cggacttgac-----------------------------------------------------acat-ca
B D                   Gorilla  cggacttgac-----------------------------------------------------acat-ca
B D                 Orangutan  ccgacttgac-----------------------------------------------------acat-ca
B D                    Gibbon  cggacttgac-----------------------------------------------------acat-ca
B D                    Rhesus  cggacttgac-----------------------------------------------------acat-ca
B D       Crab-eating macaque  cggacttgac-----------------------------------------------------acat-ca
B D                    Baboon  cggacttgac-----------------------------------------------------acat-ca
B D              Green monkey  cggacttgac-----------------------------------------------------acat-ca
B D                  Marmoset  cggacttggc-----------------------------------------------------acat-cg
B D           Squirrel monkey  cggacttggc-----------------------------------------------------acat-ca
B D                  Bushbaby  cggaccaggt-----------------------------------------------------ttgt-ca
           Chinese tree shrew  cagacctaa------------------------------------------------------gcat-gg
B D                  Squirrel  cagacg-gcc-----------------------------------------------------acat-ca
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  cagacc-agc-----------------------------------------------------tttt-ca
B D           Chinese hamster  cagacc-agc-----------------------------------------------------tttt-cc
               Golden hamster  cagacc-agc-----------------------------------------------------tttt-ca
B D                     Mouse  cagacc-ggc-----------------------------------------------------tttt-ca
B D                       Rat  cagacc-ggc-----------------------------------------------------tttt-ca
B D            Naked mole-rat  taga------------------------------------------------------------------
B D                Guinea pig  caga------------------------------------------------------------------
                   Chinchilla  caga------------------------------------------------------------------
             Brush-tailed rat  caga------------------------------------------------------------------
B D                      Pika  tggg------------------------------------------------------------------
B D                       Pig  cggacctgga---gtaagaaag-gcagttattaccctct--tggcctg----------agcactgat-gg
B D                    Alpaca  cggaccttgg---gtag--------------tgctcacc--tgacctg----------agcacttgc-ag
               Bactrian camel  cggacctggg---gtag--------------tgctcacc--tgacctg----------agcacttgc-ag
B D                   Dolphin  cggacctggg---gtaagaaag-gcagttacgggtctcc--tggcctg----------agcactcgt-gg
                 Killer whale  cggacctggg---gtaagaaag-acagttacgggtctcc--tggcctg----------agcactcgt-gg
             Tibetan antelope  cgaacctggg---ataagaaag-acagttacggctttcc--tggactg----------agcact-gt-gg
B D                       Cow  cgaacctggg---ataagaaag-acagttatggctttcc--tggactg----------agcactcgt-gg
B D                     Sheep  cgaacctggg---ataagaaag-acagttatggctttcc--tggactg----------agcact-gt-gg
                Domestic goat  cgaacctgag---ataagaaag-acagttatggctttcc--tggactg----------agcact-gt-gg
B D                     Horse  cggacatgtg---gtaggaagtcccagttactgctc-cc--cgggccc----------agcgccctt-cc
B D          White rhinoceros  gggacctggg---gtaagaagg-ccagctactgtgcgcc--tggcccc----------agcgccaat-cc
B D                       Cat  cggacctgag---ataaggata----gttaatgtactcc--tggtttg----------gacactcat-gg
B D                       Dog  cggacctagg---ataaggata--------ctgcactcc--tggcctg----------aacacccgt-gg
B D                   Ferret   ccgacctggg---atatggata----gttcctgcactcc--tggccca----------aacacgcac-gg
B D                     Panda  cggacctggg---ataaggata----gttactgcactcc--tggcctg----------aacacgcat-gg
               Pacific walrus  cggacctggg---ctaaggata----gttactgcactcc--tggcctg----------aacacgcac-gg
                 Weddell seal  cggacctggg---ataaggata----gttactgcactcc--tggcctg----------aacacgcac-gg
             Black flying-fox  c-cacctggggtaagaaggaca----gttactgctcccc--aggcctg----------agcacgctt-tg
B D                   Megabat  c-cacctggggtaagaaggaca----gttactgctcccc--aggcctg----------agcacgctt-tg
                Big brown bat  c-gacttggg---agaaggaca----ggtactgctcccc--tgacctg----------agca-gctt-tg
         David's myotis (bat)  c-gacttggg---ataaggaca----ggtgctgctcccc--tgcccgg----------agca-gctt-tg
B D                  Microbat  c-gacttggg---atacggaca----ggtactgctcccc--tgatggg----------agca-gctt-tg
B D                     Shrew  gggacccggg---atctgg-----------------tcc--tgagctg---------------ccgt-cg
              Star-nosed mole  gggacctggg---gtaaggata----accactg-ttccc--ctggctg----------ag-gcctgt-ag
B D                  Elephant  gggacctggg---gtagtaagg-acagtaactgctccccctcggtctc----------tgtgcgcct-gg
          Cape elephant shrew  tggacctggg---gtaataagg-acagtacctgttctctcctgggttcccctgggccatttgcaccc-ca
B D                   Manatee  cggacctggg---gtaataagg-acagtaactgctccccctcggcctg----------tgtacgcct-gg
             Cape golden mole  aggacctggg---gtaatcaag-acagtaactgctcacaggtggcttg----------tgtgagcct-gg
B D                    Tenrec  tggacctggg---ttaataagg-accgtaattgctcatcttcggcctg----------cctgcgcca-ga
                     Aardvark  gggacttgga---gtaaaaggg-accctagctcctccccctcggcctg----------tgtgtgactggg
           Tibetan ground jay  ----------------------------------------------------------------------
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                  Hedgehog  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Opossum  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
                 Spotted gar  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  aacccttgcatcagtc-----g--ggccatgt-c
                        Chimp  aacccttgcatcagtc-----g--ggccatgt-c
                      Gorilla  aacccttgcatcagtc-----g--ggccatgt-c
                    Orangutan  aacccttgcatcagtc-----g--ggccatgt-c
                       Gibbon  aacccttgcatcagtg-----g--ggccatgt-c
                       Rhesus  aacccttgcatcagtc-----g--ggccatgc-c
          Crab-eating macaque  aacccttgcatcagtc-----g--ggccatgc-c
                       Baboon  aacccttgcatcagtc-----g--ggccatgc-c
                 Green monkey  aacccttgcatcagtc-----g--ggccatgc-c
                     Marmoset  aagccttgcatcagtc-----g--ggccctgt-c
              Squirrel monkey  aagccttgcgtcagtc-----g--ggccctgtga
                     Bushbaby  aacgcttgcattagat-----g--gacaatgt-c
           Chinese tree shrew  aacccttgcagtagcc-----g--ggcgaggt-c
                     Squirrel  aacccttgcatcagcc-----t--gttcaggt-c
       Lesser Egyptian jerboa  -------gcatcagcc-----t--gctcaggc-c
                 Prairie vole  agcctttgaatcagct-----g--ggccaggc-c
              Chinese hamster  agcctttgcatcaact-----g--ggccaggc-c
               Golden hamster  agcctttgcatcaact-----g--ggccaggt-c
                        Mouse  ggcctttgcattaact-----g--ggtcaggc-c
                          Rat  ggcctttgcatcaact-----g--cgtcaggc-t
               Naked mole-rat  --cccttggattggca-----g--ggccaatt-c
                   Guinea pig  --cctg----------------------------
                   Chinchilla  --cccttgcatctgcc-----g--ggccagtt-c
             Brush-tailed rat  --tccaggcaaatgcc-----t--ccccaatt-c
                         Pika  --ccttaggacccccc----------ctgggc-t
                          Pig  aaccctctcatcagtc-----g--ggccaggt-c
                       Alpaca  aaccctcgcattagcc-----g--ggccaggt-c
               Bactrian camel  aaccctcgcatcaacc-----g--ggccgggt-c
                      Dolphin  aaccctcgcatcagcc-----t--ggccaggt-c
                 Killer whale  aaccctcgcatcagtc-----t--ggccaggt-c
             Tibetan antelope  aaccctggcatcagct-----t--ggccaggt-c
                          Cow  aaccctggcgtcagct-----t--ggccagat-c
                        Sheep  aaccctggcatcagct-----t--ggccaggt-c
                Domestic goat  aaccctgacatcagct-----t--ggccagg---
                        Horse  aaccctcgcatcagcc-----ggtggccaggt-c
             White rhinoceros  aaccctggcatcagcc--------agccaggt-c
                          Cat  aa-cctcgcatcagcc-----a--ggccaagt-c
                          Dog  aa-ccttgcatcagcc-----a--ggctaagt-c
                      Ferret   aa-cctcccatcggcc-----a--ggccagat-c
                        Panda  aa-cctcgcatcagcc-----a--ggccaagt-c
               Pacific walrus  aa-cctcgcgtctgcc-----a--ggccaagt-c
                 Weddell seal  aa-cctcgcgtctgcc-----a--ggccaagt-c
             Black flying-fox  aatcctcacatcagcc-----a--ggccagga-c
                      Megabat  aatcctcacatcagcc-----a--ggccagga-c
                Big brown bat  aaccctcccatcagcc-----a--ggccaggt-c
         David's myotis (bat)  aaccctcccatcagcc-----a--ggccaggt-c
                     Microbat  aacccttccatcagcc-----a--ggccaggt-c
                        Shrew  ggcaggcccgggag----------ga--agga-c
              Star-nosed mole  agccctcacagaag----------gaccatgg-c
                     Elephant  atctctcttatcagcc-----t--ggccagga-c
          Cape elephant shrew  ccctctcgcatcagcc-----a--ggtcaggc-c
                      Manatee  aactctcgcatcagcc-----c--agccaggt-c
             Cape golden mole  aact--ggcgacagcc-----a--agccaagt-c
                       Tenrec  aactcacacaccaccc-----a--aaccaggc-c
                     Aardvark  aactctcacgtcagccagtcta--ggtcaggt-c
           Tibetan ground jay  cgccgtcgcggcagcg-----g--ggccaggt-c
                       Medaka  ==================================
     Mexican tetra (cavefish)  ==================================
                     Hedgehog  ==================================
                    Zebrafish  ==================================
                X. tropicalis  ==================================
       Yellowbelly pufferfish  ==================================
                         Fugu  ==================================
                      Wallaby  ==================================
              Tasmanian devil  ==================================
          Collared flycatcher  ==================================
                      Opossum  ==================================
                      Chicken  ==================================
             Peregrine falcon  ==================================
     Chinese softshell turtle  ==================================
              Green seaturtle  ==================================
               Painted turtle  ==================================
                    Tetraodon  ==================================
                 Atlantic cod  ==================================
                  Stickleback  ==================================
           Southern platyfish  ==================================
          Pundamilia nyererei  ==================================
                  Zebra mbuna  ==================================
        Burton's mouthbreeder  ==================================
          Princess of Burundi  ==================================
                 Nile tilapia  ==================================
                  Spotted gar  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 31 of 782 in window, 13906797 - 13906889, 93 bps 
B D                     Human  a-ga--c-----------------tcttttt---a-tt-c-cattgtacagatgagga---c-tttgaga
B D                     Chimp  a-ga--c-----------------tcttttt---a-tt-c-cattgtacagatgagga---c-tttgaga
B D                   Gorilla  a-ga--c-----------------tcttttt---a-tt-c-cattgtacagatgagga---c-tttgaga
B D                 Orangutan  a-ga--c-----------------tcttttt---a-tt-c-cattgtacagatgagga---c-tttgaga
B D                    Gibbon  a-ga--c-----------------tcttttt---a-tt-c-cattgtacagatgagga---c-tttgaga
B D                    Rhesus  a-ga--c---------------------tct---a-tt-c-cattgtacagatgagga---c-gttgaga
B D       Crab-eating macaque  a-ga--c---------------------tct---a-tt-c-cattgtacagatgagga---c-gttgaga
B D                    Baboon  a-ga--c---------------------tct---a-tt-c-cattgtacagatgagga---c-tttgaga
B D              Green monkey  a-ga--c-----------------ttttttt---a-tt-c-cattgtacagatgagga---c-tttgaga
B D                  Marmoset  a-ga--c-----------------tcttttt---a-tt-c-cattatacagatgagga---c-tttgaga
B D           Squirrel monkey  a-ga--c-----------------tcttttt---a-tt-c-cattatacagatgagga---cttttgaga
B D                  Bushbaby  a-ga--c-----------------tcctttt---a-ttcc-cattgtacatatgagga---c-actgagg
           Chinese tree shrew  a-ga--c-----------------tcttttt---a-tt-ctcactgcacaggtaggga---c-cctggag
B D                  Squirrel  a-cg--c-----------------tctttat-----tc-c-cattgttaggatgagca---c-actgagg
       Lesser Egyptian jerboa  g-catgc-----------------tccgtat-----tg-c-cattgtacagatgagga---c-gttgagg
                 Prairie vole  a-ca--c-----------------tccttac-----tc-c-cattgtatggatgagta---c-accgcga
B D           Chinese hamster  a-ca--c-----------------tctttac-----tc-c-cattgtattgatgagga---c-actgagg
               Golden hamster  a-ca--c-----------------tctttac-----tc-c-cattgtatagatgagga---c-attgagg
B D                     Mouse  a-ca--c-----------------tctaca-------c-c-cattgtacagatgagga---c-actaagg
B D                       Rat  a-ca--c-----------------tctgta-------t-c-cattgtacagatgagga---c-actgagg
B D            Naked mole-rat  c-ga--------------------tct-tat-----tc-c-cactgtacacatgaaga---c-actgagc
B D                Guinea pig  ----------------------------tat-----tc-c-cattgtacagatgaaga---c-actgagg
                   Chinchilla  a-ga--c-----------------tgt-tat-----tc-c-cattgtgcagatgagga---c-actgagg
             Brush-tailed rat  a-ca--c-----------------tct-tat-----gc-c-cattgtacagatgaaga---c-gctgagg
B D                      Pika  ------c-----------------tgttgat-----tc-c-cggcgcagagagatgtgtccc-actgagg
B D                       Pig  a-ga--c-----------------tcttt-----atcc-c-cattgtgcagatgggga---c-gctgagg
B D                    Alpaca  a-ga--c-----------------ttttttc---atcc-c-cattgtacagacgagga---c-actgagg
               Bactrian camel  a-ga--c-----------------tcttttt---atcc-c-cattgtacagacgagga---c-actgagg
B D                   Dolphin  a-ga--c-----------------tctttt----atcc-c-cattgtacagttgagga---c-actgaga
                 Killer whale  a-ga--c-----------------tctttt----atcc-c-cattgtacagatgagga---c-actgaga
             Tibetan antelope  a-ta--c-----------------tttttt----atcc-c-cattgtacagatgagga---c-actgagg
B D                       Cow  a-ta--c-----------------tttttt----atcc-c-cattgtacagatgagga---c-actgagg
B D                     Sheep  a-ta--c-----------------tttttt----atcc-c-cattgtacagatgagga---c-actgagg
                Domestic goat  ---g--t-----------------tttttt----atcc-c-cattgtacagatgagga---c-actgagg
B D                     Horse  a-ga--c-----------------tcttttg---atcc-c-cattgtacggacgagga---c-actgagg
B D          White rhinoceros  a-ga--c-----------------tcttttg---gtcc-c-cattgtacagatgagga---c-actgagg
B D                       Cat  a-ga---------------------ctttct---atcc-c-cactgtacagatgagga---c-actgagg
B D                       Dog  t-ga--c-----------------tcttttt---atcc-c-cactgtacagatgagga---c-actgagg
B D                   Ferret   a-ga--c-----------------tcttttt---atcc-c-cactgtacagatgagga---c-actgagg
B D                     Panda  a-ga--c-----------------tctcttt---atcc-c-cactgtacagatgagga---c-actgagg
               Pacific walrus  a-ga--c-----------------tcttttt---atcc-c-cactgtacagatgagga---c-actgagg
                 Weddell seal  a-ga--c-----------------tcttttt---atcc-c-cactgtacagatgagga---c-actgagg
             Black flying-fox  a-ga--c-----------------tcttttt---atcc-c-tattgtacagatgaaga---c-actgaga
B D                   Megabat  a-ga--c-----------------tcttttt---atgc-c-tattgtacagatgaaga---c-actgaga
                Big brown bat  a-ga--c-----------------tc-tttt---atcc-c-cattataaagatgagga---c-actgagg
         David's myotis (bat)  a-ga--c-----------------tcttttt---atcc-c-cattataaggatgaggg---c-actgagg
B D                  Microbat  a-ga--c-----------------tcttttt---atct-c-cattataaggatgaggg---c-accgagg
B D                     Shrew  g-ga--c-----------------------t---ctaa-c-cattgtacagagaggga---c-actaagg
              Star-nosed mole  a-ga--c-----------------tattttt---atcc-c-cattatatagatgagga---c-actgagg
B D                  Elephant  atga--c-----------------ttatttt---atcc-c-cactgtacagatgagga---c-actgagg
          Cape elephant shrew  tcaa--c-----------------tcctttt---attc-c-cattatatagatgggaa---c-actgagg
B D                   Manatee  acaa--c-----------------tcttttt---atcc-c-cgttgtacagatgagga---c-actgagg
             Cape golden mole  tcta--cctttttttttttttttttccctttcaaatct-c-cattgtacagatgagga---c-actgagg
B D                    Tenrec  ------------------------acctttgaagatcc-c-caatgtacagatgagga---c-actgagg
                     Aardvark  gcaa--g-----------------tcttttg---attc-c-cattgtacagaggagga---t-actgagt
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                  Hedgehog  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Opossum  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
                 Spotted gar  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
          Tibetan ground jay  ======================================================================

                        Human  ctc-agagacgtg-aaga----catctgcccaaggtcatagg-----gatt-----aac--agcttggcc
                        Chimp  ctc-agagacgtg-aaga----catctgcccaaggtcatagg-----gatt-----aac--agcttggcc
                      Gorilla  ctc-agagacgtg-aaga----catctgcccaaggtcatagg-----gatt-----aac--agcttggcc
                    Orangutan  ctc-agagacgtg-aaga----catctgcccaaggtcatagg-----gatt-----aac--agcttggcc
                       Gibbon  ctc-agagacgtg-aaga----catctgcccaaggtcatagg-----gatt-----aac--agcttggcc
                       Rhesus  ctc-acagacgtg-aaga----catctgcccaaggtcatagg-----gatt-----aac--agcttggcc
          Crab-eating macaque  ctc-acagacgtg-aaga----catctgcccaaggtcatagg-----gatt-----aac--agcttggcc
                       Baboon  ctc-agagacgtg-aaga----catctgcccaaggtcatagg-----gatt-----aac--agcttggcc
                 Green monkey  ctc-agagacgtg-aaga----catctgcccaaggtcatagg-----gatt-----aac--agcttggcc
                     Marmoset  ctc-agagacgtg-aaga----tatctgcccaaggtcatagg-----gatt-----atc--agtttggcc
              Squirrel monkey  ctc-agagacgtg-aaga----tatctgcccaaggtcatagg-----gatt-----aac--agcttggcc
                     Bushbaby  ctc-agagaggtg-aaga----tgtctgcccaaggtgataag-----gact-----aac--agcttctct
           Chinese tree shrew  ccc-caagaggtg-aaga----catctggccaaggtcgcagg-----gact-----gac--agcttggcc
                     Squirrel  ccc-agagaggtg-aaga----cacctccccaaggtcatagg-----gatc-----agc--agcctggcc
       Lesser Egyptian jerboa  ctc-agagaaatg-aaaa----catctgaccaaggtctcagg-----aatgagcctaac--agcctgacc
                 Prairie vole  ctc-tgggagac--aagt----caactaaccaaggtcggaag-----aatg-----aac--aggctggcc
              Chinese hamster  ctc-agggagacg-aaga----cctttaaccaaggtcataag-----atcg-----aac--agcctggcc
               Golden hamster  ctc-agggagacg-aaga----cctctaacaaaggtcataag-----attg-----agc--agccttgcc
                        Mouse  ata-agggaggcg-cagagatctatctagtcaaggtcacaag-----gatg-----aag--cacctggcc
                          Rat  atc-agcgaggtg-aaga----cacctaaccaaggtcataag-----gatg-----aac--aacctggcc
               Naked mole-rat  ctcaagagaggtg-aaga----catcagcccaaggtcatagg-----gatt-----aac--aacctgacc
                   Guinea pig  ctcaaaagagctg-aagg----cgtctgcccgaggtggtagg---------------at--ggcctggcc
                   Chinchilla  ctcaagagaggta-aagg----catctgccggaggtgatagg-----gttt-----aac--agcctggcc
             Brush-tailed rat  ctcaagagaggtg-aagg----catctgtggaaggtgataga-----gatt-----aac--agactggcc
                         Pika  ccc-agacaggtg-aagg----cagccagccaaggtcacagg-----gatg-----act--ggagtacac
                          Pig  ccc-agagagaag-aaga----cacctgcccaaggtcacagggcagagcta-----agt--tgcttggcc
                       Alpaca  ccc-agagaggta-aaga----cacctgcccaaggtcatagg-----gatt-----aac--tgcttggcc
               Bactrian camel  ccc-agagaggta-aaga----cacctgcccaaggtcatagg-----gatt-----aac--tgcttggcc
                      Dolphin  ccc-agagaagtg-aaga----cacctgcccaaggtcatagg-----gatt-----aac--tgcttggcc
                 Killer whale  ccc-agagaagtg-aaga----cacctgcccaaggtcataag-----gatt-----aaa--tgcttggcc
             Tibetan antelope  ccc-agagaggtg-aaga----taactgtccaaggtcatagg-----gatc-----aac--tgcttggcc
                          Cow  ccc-agagaggcg-aaga----cacctgtccaaggtcatagg-----gatc-----aac--tgcttggcc
                        Sheep  ccc-agagaggtg-aaga----taactgtccaaggtcatagg-----gatc-----aac--tgcttggcc
                Domestic goat  ccc-agagaggtg-aaga----taactgtccaaggtcatagg-----gatc-----aac--tgcttggcc
                        Horse  ccc-agagtagtg-aaga----ca-cctgccaaggtcacagg-----gatt-----aac--agcttggcc
             White rhinoceros  ccc-agagaggtg-aaga----c--cctgctgcggtcatagg-----gatt-----aac--agcttggcc
                          Cat  ccc-agagaggtg-aaga----cagcttcccaaggtcatagg-----gatt-----aac--agcttggcc
                          Dog  ccc-aaagaggtg-aaga----cagtttcccaaggtcatagg-----gatt-----aac--agcttggcc
                      Ferret   tcc-agagaggtg-aaga----cagtttcccaaggtcatagg-----gatt-----aac--agcttggcc
                        Panda  ccc-agagaggtg-aaaa----cagcttcccaaggtcatagg-----gatt-----aac--agtttggcc
               Pacific walrus  ccc-agagaggtg-aaga----cagcttcccaaggtcatagg-----gatt-----aac--ggcttggcc
                 Weddell seal  ccc-agagaggtg-aaga----cagcttcccaaggtcatagg-----gatt-----aac--ggcttggcc
             Black flying-fox  cct-agagaggtg-aaga----cacctacccaaggtcataag-----aatt-----aac--agcttggcc
                      Megabat  cct-agagaggtg-aaga----cacctacccaaggtcattag-----aatt-----aac--agcttggcc
                Big brown bat  ccc-agaaaggta-aaga----cacctggccaaggtcatggg-----gatt-----aac--aggttggcc
         David's myotis (bat)  ccc-agaaaggta-aaga----cacctggccaaggtcatggg-----gatt-----gac--aggttggcc
                     Microbat  ccc-agaaaggta-aaga----cacctggccaaggtcatggg-----gatt-----aac--aggttggcc
                        Shrew  cca-ggagagata-gaag----cacct--ccaaggtcacggg-----gatt-----tac--agcttag-c
              Star-nosed mole  ccc-agagaggtg-aagc----catctgctcaaggtcatagg-----gatt-----aattagattcat-c
                     Elephant  ccc-agagaagtatctgg----gacttgtccaaggtcatagg-----gatt-----aac--agcttggtc
          Cape elephant shrew  ccc-agagaggtatctga----gacttgctcaaggtcatagg-----gatc-----aag--agcctggcc
                      Manatee  ccc-agagaggtgtctgg----gacttgtccaaggtcacagg-----gatt-----aac--agtttggcc
             Cape golden mole  ccc-agagaggtgtctgg----gaattgtccaaggtcataag-----gatt-----agc--agtttagct
                       Tenrec  ccc-agagaggtgtctga----gacttgtccaaggtcataag-----gatt-----agc--agcctcgcc
                     Aardvark  ctc-agagagatgtctgg----gacttatccaaggtcatagg-----gata-----aac--attttagcc
                       Medaka  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                     Hedgehog  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                      Wallaby  ======================================================================
              Tasmanian devil  ======================================================================
          Collared flycatcher  ======================================================================
                      Opossum  ======================================================================
                      Chicken  ======================================================================
             Peregrine falcon  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
                    Tetraodon  ======================================================================
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                  Spotted gar  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
           Tibetan ground jay  ======================================================================

                        Human  a
                        Chimp  a
                      Gorilla  a
                    Orangutan  a
                       Gibbon  a
                       Rhesus  a
          Crab-eating macaque  a
                       Baboon  a
                 Green monkey  a
                     Marmoset  a
              Squirrel monkey  a
                     Bushbaby  a
           Chinese tree shrew  a
                     Squirrel  a
       Lesser Egyptian jerboa  g
                 Prairie vole  a
              Chinese hamster  a
               Golden hamster  a
                        Mouse  a
                          Rat  a
               Naked mole-rat  a
                   Guinea pig  t
                   Chinchilla  a
             Brush-tailed rat  a
                         Pika  c
                          Pig  a
                       Alpaca  a
               Bactrian camel  a
                      Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
                          Cow  a
                        Sheep  a
                Domestic goat  a
                        Horse  a
             White rhinoceros  a
                          Cat  a
                          Dog  a
                      Ferret   a
                        Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
                      Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
                     Microbat  a
                        Shrew  a
              Star-nosed mole  a
                     Elephant  a
          Cape elephant shrew  a
                      Manatee  a
             Cape golden mole  a
                       Tenrec  a
                     Aardvark  a
                       Medaka  =
     Mexican tetra (cavefish)  =
                     Hedgehog  =
                    Zebrafish  =
                X. tropicalis  =
       Yellowbelly pufferfish  =
                         Fugu  =
                      Wallaby  =
              Tasmanian devil  =
          Collared flycatcher  =
                      Opossum  =
                      Chicken  =
             Peregrine falcon  =
     Chinese softshell turtle  =
              Green seaturtle  =
               Painted turtle  =
                    Tetraodon  =
                 Atlantic cod  =
                  Stickleback  =
           Southern platyfish  =
          Pundamilia nyererei  =
                  Zebra mbuna  =
        Burton's mouthbreeder  =
          Princess of Burundi  =
                 Nile tilapia  =
                  Spotted gar  N
           Tibetan ground jay  =

Alignment block 32 of 782 in window, 13906890 - 13906890, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                      Pika  c
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                     Shrew  g
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  a
                     Aardvark  g
B D                    Medaka  =
    Mexican tetra (cavefish)  =
B D                    Tenrec  -
B D                  Hedgehog  =
B D                 Zebrafish  =
B D             X. tropicalis  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                   Wallaby  =
B D           Tasmanian devil  =
  D       Collared flycatcher  =
B D                   Opossum  =
B D                   Chicken  =
  D          Peregrine falcon  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D              Atlantic cod  =
B D               Stickleback  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
                 Spotted gar  N
          Tibetan ground jay  =

Inserts between block 32 and 33 in window
         Cape elephant shrew 131bp

Alignment block 33 of 782 in window, 13906891 - 13906936, 46 bps 
B D                     Human  ggctaagcac-aaatccagggct------------g------------cagc------------------
B D                     Chimp  agctaatcac-aaatccagggct------------g------------cagc------------------
B D                   Gorilla  agctaagcac-aaatccagggct------------g------------cagc------------------
B D                 Orangutan  agctaagcac-aaatccagggct------------g------------cagc------------------
B D                    Gibbon  ggctaaacac-aaatccagggct------------g------------cagc------------------
B D                    Rhesus  agctaagcac-aaatccagggcc------------g------------cagc------------------
B D       Crab-eating macaque  agctaagcac-aaatccagggcc------------g------------cagc------------------
B D                    Baboon  agctaagcac-aaatccagggcc------------g------------cagc------------------
B D              Green monkey  agctaagcac-aaatccaggacc------------g------------cagc------------------
B D                  Marmoset  agctaagctc-aaatccaggact------------g------------cagg------------------
B D           Squirrel monkey  agctaagctc-aaatccagggct------------g------------cagc------------------
B D                  Bushbaby  agctaaatgc-aaatccagaact------------g------------cagc------------------
           Chinese tree shrew  agct----------------gct------------g------------c--c------------------
B D                  Squirrel  caccaggtgc-acatccagagct------------acatcccttgtcccacc------------------
       Lesser Egyptian jerboa  agctaagggc-aaatccagagct------------g------------tat-------------------
                 Prairie vole  acagaaatgt-cggtccagaggc------------g------------taca------------------
B D           Chinese hamster  acagaaatgt-cagttcagaggt------------g----------------------------------
               Golden hamster  acagacatgc-cagcccagaagt------------g------------taca------------------
B D                     Mouse  acagaaatgt-cagtccagaggt------------g------------taca------------------
B D                       Rat  attgaaatgt-cagtccagaggt------------g------------caca------------------
B D            Naked mole-rat  a-------gg-aaatccaagcct------------g------------catc------------------
B D                Guinea pig  ggctcggggc-agagccagagct------------g------------catc------------------
                   Chinchilla  agctctgggc-aaattcagagct------------g------------catc------------------
             Brush-tailed rat  agctcagggc-aaatccagagct------------g------------catc------------------
B D                      Pika  acacctactg-ccatccatgggt------------g------------cacc------------------
B D                       Pig  aactaagtgc-aaatccagagcc------------g------------ctgc------------------
B D                    Alpaca  agctaagcgc-aaatccagagct------------g------------ctgc------------------
               Bactrian camel  agctaagcac-aaatccagagct------------g------------ctgc------------------
B D                   Dolphin  agctaagcac-aaatccagagct------------g------------ctgc------------------
                 Killer whale  agctaagcac-aaatccagagct------------g------------ctgc------------------
             Tibetan antelope  acctaagggc-aaatccagtctg------------t------------ttgc------------------
B D                       Cow  agctaagggc-aaatccggactg------------c------------ctgc------------------
B D                     Sheep  acctaagggc-aaatccagtctg------------t------------ttgc------------------
                Domestic goat  acctaagggc-aaatccagtctg------------t------------ttgc------------------
B D                     Horse  agctaagtgc-agatccagaagc------------a------------ccgc------------------
B D          White rhinoceros  agctaagtgc-agatccagagct------------g------------cctc------------------
B D                       Cat  ggctaagtgcaaaatccagagcg------------g------------ctgc------------------
B D                       Dog  agcaaagtgc-aaatccagagct------------g------------ctgc------------------
B D                   Ferret   agctaagtgc-aaatccagagct------------g------------ctgc------------------
B D                     Panda  agctaagtgc-aaatcctgagct------------a------------cggc------------------
               Pacific walrus  agtgaagtgc-aaatccagagct------------g------------ctgc------------------
                 Weddell seal  agtgaagtgc-aaatccagagct------------g------------ctgc------------------
             Black flying-fox  agttaagtgc-aaatccagagct------------g------------ctgc------------------
B D                   Megabat  agttaagtgc-aaatccagagct------------g------------ctgc------------------
                Big brown bat  agctaagtgc-aaatccagaact------------g------------ctgc------------------
         David's myotis (bat)  agctaagtgc-aaatccagagct------------g------------ctgc------------------
B D                  Microbat  agctaagtgc-aaatccagagct------------g------------ctgc------------------
B D                     Shrew  agctgagtgc-agatgcagggct-----------------------------------------------
              Star-nosed mole  ag--aagtgc-aaattgggagct------------g------------ctgc------------------
B D                  Elephant  agctaagtgc-aaatcctgagct------------g------------ccgc------------------
B D                   Manatee  agctaagtgc-aaatcctgagct------------g------------ctgccctag-------------
             Cape golden mole  acctaagtgc-aaatcctgagct------------g------------caggccttgagcccccaggact
                     Aardvark  agctaaatgc-aaattttgagctcacaggactgtgg------------ct--------------------
         Cape elephant shrew  ======================================================================
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================