Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 467 in window, 180552749 - 180552872, 124 bps 
B D                   Human  agttgagagtcat-agt-gtg----gacaagggcagg-------taggc----aagact--aga------
B D                   Chimp  agttgagagtcat-agt-gtg----gacaagggcagg-------taggc----aagact--aga------
B D                 Gorilla  agttgagagtcat-agt-gtg----gacaagggcagg-------taggc----aagact--aga------
B D               Orangutan  agttgagagtcat-agt-gtg----gacaaagacagg-------taggc----aagact--aga------
B D                  Gibbon  agttgagagtcat-agt-gtg----gacaaggacagg-------taggc----aagact--aga------
B D                  Rhesus  agttgagagccac-agt-gtg----gacaaggacagg-------ccggc----aagact--aga------
B D     Crab-eating macaque  agttgagagccac-agt-gtg----gacaaggacagg-------tcggc----aagact--aga------
B D                  Baboon  agttgagagccat-agt-gtg----gacaaggacagg-------tcggc----aagact--aga------
B D            Green monkey  agttgagagccat-agt-gtg----gacaaggacagg-------tcggc----aagact--aga------
B D                Marmoset  aattgagagccat-agt-gtg----gacaaggacagc-------taggc----acgact--aga------
B D         Squirrel monkey  agttgagagccat-agt-gtg----gacaagggcagc-------taggc----atgact--aga------
B D                Bushbaby  agttgagagccat-ggt-gta----gacaaggacaga-------tgggc----aagact--aga------
         Chinese tree shrew  atttgaaagctat-ggt-gtg----gacaaggacagg-------taggt----agggat--aga------
B D                Squirrel  agctgaggaccat-gat-gct----gacagggacagg-------tgggc----aggact--cga------
     Lesser Egyptian jerboa  agctgagagtcat-gat-gta----caccaggacagg-------taggc----aggact--aga------
               Prairie vole  agttgagaagcag-gat--tg----cacaagaacagg-------taggc----agggct--gga------
B D         Chinese hamster  agttgagaagcag-tat-gtg----aacaaggacagg-------taggc----agggct--aga------
             Golden hamster  agttgagaagcag-gat-gtg----aacaaggacagg-------taggc----agggct--agg------
B D                   Mouse  agttgagaagcag-gac-aca----ggtaagggcagg-------tcggc----agggct--gga------
B D                     Rat  agttgagaagcag-gat-tca----ggtaaggacagg-------taggc----agtgct--gga------
B D          Naked mole-rat  agctaaaagtcat-gat-gta----gacgaagacagg-------taagc----agaagt--aga------
B D              Guinea pig  agctaaaagccac-aat-gta----gacaaggacagg-------taggc----agaact--agg------
                 Chinchilla  agtagcgagccat-gat-gta-----gcaaagatagg-------taggc----agaacc--aga------
           Brush-tailed rat  agctg-aagtcat-gat-gtacatagacaaggacagg-------taggc----agaact--aga------
B D                    Pika  ----gagggccat-ggg-gac----gacaagaacagc-------t-ggc----aggact--aga------
B D                     Pig  aattaagaaccat-gataaca----gactaaaacagg-----------cgggtaggat---aga------
B D                  Alpaca  agttaaagaccac-gat-atg----gacaaagacagg-----------c----aggag---aga------
             Bactrian camel  agttaaagaccac-gat-atg----gacgaagacagg-----------c----aggat---aga------
B D                 Dolphin  agttaaggaccat-cat-atg----gacaaagacagg-----------c----aggtt---aga------
               Killer whale  agttaaggaccat-cat-atg----gacaaagacagg-----------c----aggtt---aga------
           Tibetan antelope  cgttaaggaccat-gac-atg----gacaaaaacagg-----------c----aggac---aga------
B D                     Cow  agttaaggaccat-gat-atg----gacaaagacagg-----------c----aggac---aga------
B D                   Sheep  agctaaggaccat-gat-atg----gacaaagacagg-----------c----aggac---aga------
              Domestic goat  agctaaggaccat-gat-atg----gacaaagacagg-----------c----aggac---aga------
B D                   Horse  gcttaaggcccat-gat-gtg----gacaaagagaga-------taggc----aggat---aga------
B D        White rhinoceros  acttaaggaccat-gat-gcg----gacaaagacaga-------taggc----aggag---aga------
B D                     Cat  -----aatcccaa-g------------------caggctccacactgtc----agcat---gga------
B D                     Dog  agttaaaggctat-gat-ggg----gacaaagacaga---tataaaggc----aaaat---aga------
B D                 Ferret   -----aagactgt-gtt-gtg----gacaaagacaga---tataaaggc----a-aat---aga------
B D                   Panda  -----aagactat-gat-gtg----gacaaagacaga---aataaagac----agaat---aga------
             Pacific walrus  -----tagactat-gat-gtg----gacaaagacag-------aaaggc----agaat---agctggctc
               Weddell seal  -----tagactat-gat-atg----gacaaagacaga---tatacaggc----agaat---agctggcta
B D                Hedgehog  agttgagagtcat-gat-gtt----gataaagacaag-------gaggc----aggact--aca------
            Star-nosed mole  agttcaaagtcac-taa-g--------gacagacagg-------gaggc----aggactggaga------
B D                Elephant  agttgagagccat-ggt-ata----gacatggacagg-------ttgac----agaact--aga------
B D                 Manatee  agttgagaaccat-ggt-gta----gacgtggacagg-------taggc----agaact--aga------
           Cape golden mole  agatgagagccat-ggt-gta----gacaaggacaga-------tagg-----caaaca--caa------
B D                  Tenrec  agttgagagtcatgggg-gta----gccaagaacaag-------taggc----caaact--caa------
                   Aardvark  agttgagagccat-ggt-gta----gacaaggacagg-------taggc----agaaca--aga------
B D               Armadillo  agttgagagccac-tg----g----gacaaggacagg-------taggt----agaact--aga------
B D                  Rabbit  ======================================================================
B D                 Megabat  ======================================================================
B D         Tasmanian devil  ======================================================================
B D      American alligator  ======================================================================
B D                 Opossum  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================
          Black flying-fox  ======================================================================
      David's myotis (bat)  ----------------------------------------------------------------------
             Big brown bat  ----------------------------------------------------------------------
B D                Microbat  ----------------------------------------------------------------------

                      Human  -ccaagacagg--------tccggaaggctaa--------------------taa-tttagtccctcttc
                      Chimp  -ccaagacagg--------tccggaaggctaa--------------------taa-tttagtccctcttc
                    Gorilla  -ccaagacagg--------tccggaaggctaa--------------------taa-tttagtccctcttc
                  Orangutan  -ccaagacagg--------tccggaaggctaa--------------------taa-tttagtccctcttc
                     Gibbon  -ccaagacagg--------tccagaaggctaa--------------------taa-tttagtccctcttc
                     Rhesus  -ccaagacagg--------ttcggaaggctaa--------------------taa-ttcagtccctcttc
        Crab-eating macaque  -ccaagacagg--------ttcggaaggctaa--------------------taa-ttcagtccctcttc
                     Baboon  -ccaagacagg--------ttcggaaggctaa--------------------taa-ttcagtccctcttc
               Green monkey  -tcaagacagg--------ttcggaaggctaa--------------------taa-ttcagttcctcttc
                   Marmoset  -ccaagacagc--------tcaggagggctga--------------------taa-ttcagtcccttttc
            Squirrel monkey  -ccaagacggc--------tcaggagggctga--------------------caa-tttagtcccttttc
                   Bushbaby  -ccacgacaga--------ccaaggagtccag--------------------taa-tttagcccctcttc
         Chinese tree shrew  -ccaagacaag--------tcaggaaggctaa--------------------taa-tat-gcctcttatc
                   Squirrel  -ccaaaacagg--------tctggaaagctaa--------------------taa-ggtagcccctcttt
     Lesser Egyptian jerboa  -ccaagatggg--------ttgagaagcttaa--------------------taa-tttagcctctcttc
               Prairie vole  -tccagacagg--------tcaggaaacctag--------------------gaa-gttagtttctcttc
            Chinese hamster  -tcctgaccgg--------tccggaaacctag--------------------taa-cttagccgctcttc
             Golden hamster  -tccagaccgg--------cccggaaacctag--------------------taa-cgtagctgctcttc
                      Mouse  -tccagacagg--------tcaggaagcctga--------------------taa-cttagcctcctttc
                        Rat  -tacagacagg--------tcaggaagcctaa--------------------taa-tttagcctcctttc
             Naked mole-rat  -ccaagacagg--------tcaggaatgctaa---------------tacagtca-ttttaccttaattc
                 Guinea pig  -ccaagacaat--------tcaggaaggctaa---------------tgtggtaa-ttttatctctcttc
                 Chinchilla  -ccaagacagg--------tcaggaaggctaagatcaggaaggctattacagtaa-tcttacctcccttc
           Brush-tailed rat  -tcaagatata--------tcaggaagtgcaa---------------tccagtaatttttactgctcttc
                       Pika  -cccaaacaga--------ccagaaagaccaa--------------------tac-ttca----------
                        Pig  -acaaaacagatggatacctcaggaagcctaa--------------------aaa-ttcagtccttcttc
                     Alpaca  -ccaaaacaggtggctaccttaggaaggctaa--------------------aaa-ttcggcccctcttc
             Bactrian camel  -ccaaaacaggtggctaccttaggaaggctaa--------------------aaa-ttcggcccctcttc
                    Dolphin  -acaaaataagtggc-acctcaggaaggctaa--------------------aaa-tgtggcccctcttc
               Killer whale  -acaaaataagtggc-acctcaggaaggctaa--------------------aaa-tgtggcccctcttc
           Tibetan antelope  -ccaaaataggtggc-acctcaggaaggctaa--------------------aaa-tttagtccctcttc
                        Cow  -ccaaaataggtggc-acctcaggaaggctaa--------------------aaa-tttagtccctcttc
                      Sheep  -ccaaaataggtggc-acctcaggaaggctaa--------------------aaa-tttagtccctcttc
              Domestic goat  -ccaaaataggtggc-acctcaggaaggctaa--------------------aaa-tttagtccctgttc
                      Horse  -ccaaaataggtggctacctcaagaaggctaa--------------------tga-tttggcccctcttc
           White rhinoceros  -acaaaataggtggctacctcaggaaggctaa--------------------taa-tttggcccctcttg
                        Cat  -gctcagttcagggctcgaactcacagactgt--------------------gag-atcgtgatctgagc
                        Dog  -ccaaag-aggtgactctttcaggaagtctac--------------------taa-tttgactcctcttc
                    Ferret   -ccataacatgtggctcgctcaggaagtctag--------------------taa-tctggcccttcttc
                      Panda  -ccaaaacaggtggctccgtcaggaagtctaa--------------------taa-tttggcccctcttc
             Pacific walrus  ttcagaa----tggctctctcaggaagtctaa--------------------tga-tttagcccctcttc
               Weddell seal  ttcagaa----tggctctttcaggaagtctaa--------------------taa-tttagcccctcttc
                   Hedgehog  -cagattctgggggctacctcaggaaggttca--------------------cca-ttcagccattctcc
            Star-nosed mole  -gaggggtggggggctacattagaagggcttg--------------------tca-tttagcccctctca
                   Elephant  -ccatggcagct--------------------------------------------ttgggcccctcttc
                    Manatee  -ccatagcaact--------------------------------------------ttgggcccctcttc
           Cape golden mole  -ccaaggcagt---------------------------------------------tttggtccctcttc
                     Tenrec  -ctttggcagca--------------------------------------------tttggcccctcttc
                   Aardvark  -tcatgacagtt--------------------------------------------tttggcccctcttc
                  Armadillo  -gcaagatagatgaccacctcaagaag-ctga--------------------tta-tttggtccctcttc
                     Rabbit  ======================================================================
                    Megabat  ======================================================================
            Tasmanian devil  ======================================================================
         American alligator  ======================================================================
                    Opossum  ======================================================================
        Cape elephant shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
           Black flying-fox  ======================================================================
       David's myotis (bat)  ----------------------------------------------------------------------
              Big brown bat  ----------------------------------------------------------------------
                   Microbat  ----------------------------------------------------------------------

                      Human  aaacc---aa---------------tgctc-tttagatg-ttgattca----------------------
                      Chimp  aaacc---aa---------------tgctc-tttagatg-ttcattca----------------------
                    Gorilla  aaacc---aa---------------tgctc-tttagatg-ttcattca----------------------
                  Orangutan  aagcc---aa---------------tgctc-tttagatg-ttcattca----------------------
                     Gibbon  aagcc---aa---------------tgctc-tttagatg-ttcattca----------------------
                     Rhesus  aagcc---aa---------------tgctc-tttagatg-ttcattca----------------------
        Crab-eating macaque  aagcc---aa---------------tgctc-tttagatg-ttcattca----------------------
                     Baboon  aagcc---aa---------------tgctc-tttagatg-ttcattca----------------------
               Green monkey  aagcc---aa---------------tgct--tttagatg-ttcattca----------------------
                   Marmoset  aagcc---aa---------------tcctc-tttagatg-ttcattca----------------------
            Squirrel monkey  aagcc---aa---------------tcctc-tttgaatg-ttcattca----------------------
                   Bushbaby  aaact---aa---------------tactc-ttcaggta-ttcattca----------------------
         Chinese tree shrew  aaaccaataa---------------tacca-tttggata-tttcttca----------------------
                   Squirrel  agacc---aa---------------tactt-ttgaaata-tttattca----------------------
     Lesser Egyptian jerboa  aaacc---aa---------------gactc-tttaaa-a-gctactca----------------------
               Prairie vole  agatc---aa---------------tgctc-tttaaata-tttattga----------------------
            Chinese hamster  aaatc---aa---------------tgctc-tttaaata-tttattca----------------------
             Golden hamster  aaatc---aa---------------tgctt-tttaaata-tttatcca----------------------
                      Mouse  aaatc---aa---------------tgctc-tttagaga-tttattca----------------------
                        Rat  aaatc---aa---------------tgctc-tttaaaga-ttcattca----------------------
             Naked mole-rat  aaatg---ta---------------catgc-tctaaata-tttattca----------------------
                 Guinea pig  aaact---ta---------------catac-tctaaaca-tttattca----------------------
                 Chinchilla  aaaat---ta---------------catgt-gctaaatg-tttattca----------------------
           Brush-tailed rat  aaact---tg---------------catgc-tctaaatg--------agagagagagagagagagagaga
                       Pika  ----------------------------cc-tcttggtg-tttgctca----------------------
                        Pig  aagtc---aa---------------tactc-tttagata-tttgttca----------------------
                     Alpaca  cagtc---ag---------------tactc-tttagaaa-tttgttca----------------------
             Bactrian camel  cagtc---ag---------------tactc-tttagaaa-tttgttta----------------------
                    Dolphin  aagtc---aa---------------tactc-gttaggta-tttgttca----------------------
               Killer whale  aagtc---aa---------------tactc-tttaggta-tttgttca----------------------
           Tibetan antelope  aagtc---aa---------------tactc-tttagata-tttgtttt----------------------
                        Cow  aagcc---aa---------------tactc-tttagata-tttgttta----------------------
                      Sheep  aagtc---aa---------------tactc-tttagata-tttgtttg----------------------
              Domestic goat  aagtc---aa---------------tactc-tttagata-tttgttta----------------------
                      Horse  aagcc---aa---------------tactc-tttagata-tttgttca----------------------
           White rhinoceros  aagcc---aa---------------cactc-tttagata-tttgttca----------------------
                        Cat  aagcc---aa---------------tgctc-tttagata-tttgttca----------------------
                        Dog  cagcc---aagagtacttctaaaagtactcttttagata-cttgttca----------------------
                    Ferret   aagcc---aa---------------tacta-tatgggta-tttgttca----------------------
                      Panda  aagcc---ga---------------tactc-tttagata-tttgttca----------------------
             Pacific walrus  aagcc---aa---------------tactc-tttagata-tttgttca----------------------
               Weddell seal  aagcc---aa---------------tactc-tttagata-tttgttca----------------------
                   Hedgehog  aagcc---ca---------------cactc-ttgagatattttatcca----------------------
            Star-nosed mole  gggc---------------------aatac-ttgtagta-tttgttca----------------------
                   Elephant  aaatc---ag---------------tactc-tttagata-tttgttca----------------------
                    Manatee  aaatc---aa---------------tactc---tagata-ttc-ttca----------------------
           Cape golden mole  aaatc---aa---------------cactc-cttagata-tttgttca----------------------
                     Tenrec  aaatc---aa---------------tactc-ttcaaata-tttgttca----------------------
                   Aardvark  aaatc---aa---------------tactc-tttaggta-ttttttca----------------------
                  Armadillo  aaaac---ac---------------taccc-tttagatg-tttgctca----------------------
                     Rabbit  ======================================================================
                    Megabat  ======================================================================
            Tasmanian devil  ======================================================================
         American alligator  ======================================================================
                    Opossum  ======================================================================
        Cape elephant shrew  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
           Black flying-fox  ======================================================================
       David's myotis (bat)  ----------------------------------------------------------------------
              Big brown bat  ----------------------------------------------------------------------
                   Microbat  ----------------------------------------------------------------------

                      Human  ---------a-tatttattt-t
                      Chimp  ---------a-tatttattt-t
                    Gorilla  ---------a-tatttattt-t
                  Orangutan  ---------a-tatttattt-t
                     Gibbon  ---------a-tatttattt-t
                     Rhesus  ---------a-tatttgttt-t
        Crab-eating macaque  ---------a-tatttgttt-t
                     Baboon  ---------a-tatttgttt-t
               Green monkey  ---------a-tatttattt-t
                   Marmoset  ---------a-catttattt-a
            Squirrel monkey  ---------a-catttattt-a
                   Bushbaby  ---------a-tatttactt-a
         Chinese tree shrew  ---------a-tatttattt-a
                   Squirrel  ---------c-tatttattc-a
     Lesser Egyptian jerboa  ---------a-tatatagtt-a
               Prairie vole  ---------a-tatttattt-a
            Chinese hamster  ---------a-tatttattt-a
             Golden hamster  ---------a-tatttattt-a
                      Mouse  ---------g-tatttactt-a
                        Rat  ---------g-tatttactt-a
             Naked mole-rat  ---------a-tat-tattt-a
                 Guinea pig  ---------a-ca--tattc-a
                 Chinchilla  ---------a-ta--tattt-a
           Brush-tailed rat  gagagagaga-ga--gagag-a
                       Pika  ---------a-gatttacgt-a
                        Pig  ---------g-gttttttttt-
                     Alpaca  ---------a-tatttattt--
             Bactrian camel  ---------a-tatttattt--
                    Dolphin  ---------a-tatttattt--
               Killer whale  ---------a-tatttattt--
           Tibetan antelope  ---------a-tgtttgttt--
                        Cow  ---------a-tatttgttt--
                      Sheep  ---------a-tatttgttt--
              Domestic goat  ---------a-tatttgttt--
                      Horse  ---------a-tatttattg-a
           White rhinoceros  ---------a-tatttattt-a
                        Cat  ---------a-aatctcttt-a
                        Dog  ---------a-tatttctcc-a
                    Ferret   ---------a-tatttcttt-a
                      Panda  ---------a-tatttcttt-a
             Pacific walrus  ---------a-tatttcttt-c
               Weddell seal  ---------g-tatttcttc-c
                   Hedgehog  ---------t-tatttactt-a
            Star-nosed mole  ---------a-tagttatgt-a
                   Elephant  ---------attatttatta-a
                    Manatee  ---------a-tatttattt-a
           Cape golden mole  ---------g-tagttgttt-a
                     Tenrec  ---------a-aattaattt-a
                   Aardvark  ---------a-tatttattt-g
                  Armadillo  ---------a-tgtttactt-a
                     Rabbit  ======================
                    Megabat  ======================
            Tasmanian devil  ======================
         American alligator  ======================
                    Opossum  ======================
        Cape elephant shrew  ======================
                   Platypus  ======================
                    Wallaby  ======================
           Black flying-fox  ======================
       David's myotis (bat)  ----------------------
              Big brown bat  ----------------------
                   Microbat  ----------------------

Inserts between block 1 and 2 in window
B D                    Pig 157bp

Alignment block 2 of 467 in window, 180552873 - 180552878, 6 bps 
B D                   Human  gtggga
B D                   Chimp  gtggga
B D                 Gorilla  gtggga
B D               Orangutan  gtgaga
B D                  Gibbon  gtggga
B D                  Rhesus  gtggga
B D     Crab-eating macaque  gtggga
B D                  Baboon  gtggga
B D            Green monkey  gtggga
B D                Marmoset  gtggga
B D         Squirrel monkey  ggggga
B D                Bushbaby  gtggga
         Chinese tree shrew  atgggt
B D                Squirrel  ttggga
     Lesser Egyptian jerboa  gtagga
               Prairie vole  gtggga
B D         Chinese hamster  gtgtga
             Golden hamster  gtgcga
B D                   Mouse  gtggga
B D                     Rat  gtggga
B D          Naked mole-rat  gtggga
B D              Guinea pig  gtagga
                 Chinchilla  gtagga
           Brush-tailed rat  gagaga
B D                    Pika  gtagag
B D                     Pig  attgga
B D                  Alpaca  atggga
             Bactrian camel  atggga
B D                 Dolphin  atggga
               Killer whale  atggga
           Tibetan antelope  atggga
B D                     Cow  atggga
B D                   Sheep  atggga
              Domestic goat  atggga
B D                   Horse  gtggga
B D        White rhinoceros  gtggga
B D                     Cat  gtggga
B D                     Dog  gtggga
B D                 Ferret   gtcgga
B D                   Panda  gtggga
             Pacific walrus  ctggga
               Weddell seal  ctggga
B D                Hedgehog  gtgata
            Star-nosed mole  atggta
B D                Elephant  gggg-a
B D                 Manatee  gtca-a
           Cape golden mole  gtggca
B D                  Tenrec  gtgaga
                   Aardvark  gtggga
B D               Armadillo  gtaggt
B D                  Rabbit  ======
B D                 Megabat  ======
B D         Tasmanian devil  ======
B D      American alligator  ======
B D                 Opossum  ======
       Cape elephant shrew  ======
B D                Platypus  ======
B D                 Wallaby  ======
          Black flying-fox  ======
      David's myotis (bat)  ------
             Big brown bat  ------
B D                Microbat  ------

Inserts between block 2 and 3 in window
B D        Squirrel monkey 336bp

Alignment block 3 of 467 in window, 180552879 - 180552881, 3 bps 
B D                   Human  gag
B D                   Chimp  gag
B D                 Gorilla  gag
B D               Orangutan  gag
B D                  Gibbon  gag
B D                  Rhesus  gag
B D     Crab-eating macaque  gag
B D                  Baboon  gag
B D            Green monkey  gag
B D                Marmoset  gag
B D         Squirrel monkey  gag
B D                Bushbaby  gag
         Chinese tree shrew  gag
B D                Squirrel  gag
     Lesser Egyptian jerboa  gaa
               Prairie vole  gaa
B D         Chinese hamster  gaa
             Golden hamster  g-a
B D                   Mouse  gaa
B D                     Rat  gaa
B D          Naked mole-rat  gag
B D              Guinea pig  gag
                 Chinchilla  ggg
           Brush-tailed rat  gag
B D                    Pika  aag
B D                     Pig  cag
B D                  Alpaca  cag
             Bactrian camel  cag
B D                 Dolphin  cag
               Killer whale  cag
           Tibetan antelope  caa
B D                     Cow  caa
B D                   Sheep  caa
              Domestic goat  caa
B D                   Horse  cag
B D        White rhinoceros  cag
B D                     Cat  cag
B D                     Dog  cag
B D                 Ferret   tag
B D                   Panda  cag
             Pacific walrus  cag
               Weddell seal  caa
B D                Hedgehog  tag
            Star-nosed mole  cag
B D                Elephant  gga
B D                 Manatee  gag
           Cape golden mole  gag
B D                  Tenrec  gag
                   Aardvark  aag
B D               Armadillo  gag
B D                  Rabbit  ===
B D                 Megabat  ===
B D         Tasmanian devil  ===
B D      American alligator  ===
B D                 Opossum  ===
       Cape elephant shrew  ===
B D                Platypus  ===
B D                 Wallaby  ===
          Black flying-fox  ===
      David's myotis (bat)  ---
             Big brown bat  ---
B D                Microbat  ---

Inserts between block 3 and 4 in window
        Chinese tree shrew 696bp

Alignment block 4 of 467 in window, 180552882 - 180552915, 34 bps 
B D                   Human  aaata-----ttt---------------------------------------------------------
B D                   Chimp  aaata-----ttt---------------------------------------------------------
B D                 Gorilla  aaata-----ttt---------------------------------------------------------
B D               Orangutan  aaata-----ttt---------------------------------------------------------
B D                  Gibbon  aaata-----ttt---------------------------------------------------------
B D                  Rhesus  aaata-----ttt---------------------------------------------------------
B D     Crab-eating macaque  aaata-----ttt---------------------------------------------------------
B D                  Baboon  aaata-----ttt---------------------------------------------------------
B D            Green monkey  aaata-----ttt---------------------------------------------------------
B D                Marmoset  aaata-----ttt---------------------------------------------------------
B D         Squirrel monkey  aaata-----ttt---------------------------------------------------------
B D                Bushbaby  gacta-----ttt---------------------------------------------------------
B D                Squirrel  gaata------tt---------------------------------------------------------
     Lesser Egyptian jerboa  gcata-----ttt---------------------------------------------------------
               Prairie vole  aaata-----ttt---------------------------------------------------------
B D         Chinese hamster  aaatat----ttt---------------------------------------------------------
             Golden hamster  aaatat----ttt---------------------------------------------------------
B D                   Mouse  aaata-----ttt---------------------------------------------------------
B D                     Rat  aaata-----ttt---------------------------------------------------------
B D          Naked mole-rat  taatacagtattt---------------------------------------------------------
B D              Guinea pig  gaatacagtattt---------------------------------------------------------
                 Chinchilla  gaatgcagtattt---------------------------------------------------------
           Brush-tailed rat  aaatacagtattt---------------------------------------------------------
B D                    Pika  gaata-----ctc---------------------------------------------------------
B D                     Pig  gaata-----ttt---------------------------------------------------------
B D                  Alpaca  gaata-----ttt---------------------------------------------------------
             Bactrian camel  gaata-----ttt---------------------------------------------------------
B D                 Dolphin  gaata-----tct---------------------------------------------------------
               Killer whale  gaata-----tct---------------------------------------------------------
           Tibetan antelope  gaata-----tct---------------------------------------------------------
B D                     Cow  gaata-----tct---------------------------------------------------------
B D                   Sheep  gaata-----tct---------------------------------------------------------
              Domestic goat  gaata-----tct---------------------------------------------------------
B D                   Horse  gaaca-----ttt---------------------------------------------------------
B D        White rhinoceros  gaata-----ttt---------------------------------------------------------
B D                     Cat  acgta-----ttttaaaattccatttgagttactgcaaaaaaaataaataaataaataaaataaaaaaat
B D                     Dog  aaata-----ttt---------------------------------------------------------
B D                 Ferret   aaata-----ttt---------------------------------------------------------
B D                   Panda  aaata-----ttt---------------------------------------------------------
             Pacific walrus  aaata-----ttt---------------------------------------------------------
               Weddell seal  aaata-----ttt---------------------------------------------------------
B D                Hedgehog  aagta-----ttt---------------------------------------------------------
            Star-nosed mole  gaata-----ttt---------------------------------------------------------
B D                Elephant  gaata-----ttt---------------------------------------------------------
B D                 Manatee  gaata-----ttt---------------------------------------------------------
           Cape golden mole  gaata-----ttt---------------------------------------------------------
B D                  Tenrec  gaata-----------------------------------------------------------------
                   Aardvark  gaata-----ttt---------------------------------------------------------
B D               Armadillo  gaata-----ttt---------------------------------------------------------
B D                  Rabbit  ======================================================================
B D                 Megabat  ======================================================================
B D         Tasmanian devil  ======================================================================
B D      American alligator  ======================================================================
B D                 Opossum  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================
          Black flying-fox  ======================================================================
      David's myotis (bat)  ----------------------------------------------------------------------
             Big brown bat  ----------------------------------------------------------------------
B D                Microbat  ----------------------------------------------------------------------

                      Human  ----------taaaatttccacttgagattactatc
                      Chimp  ----------taaaatttccacttgagattactatc
                    Gorilla  ----------taaaatttccacttgagattactatc
                  Orangutan  ----------taaaatttccacttgagattactatc
                     Gibbon  ----------taaaatttccacttgagattactgtg
                     Rhesus  ----------taaaattttcatttgaggttactatc
        Crab-eating macaque  ----------taaaattttcatttgagattactatc
                     Baboon  ----------taaaatttccatttgagattactatc
               Green monkey  ----------taaaatttccatttgagattactatc
                   Marmoset  ----------ttaaatttccatttgaggttactatt
            Squirrel monkey  ----------ttaaatttccgtttgaggttactatt
                   Bushbaby  ----------taaaatttcaatttcagattactatc
                   Squirrel  ----------tcaaattcacatatcagatcactatc
     Lesser Egyptian jerboa  ----------ttaaattcccatctgagctcgctgtc
               Prairie vole  ----------ttaagttcccagttgaggatgctatc
            Chinese hamster  ----------ttaagttcccattaggggatgctatc
             Golden hamster  ----------ttaagttcccatttgaggatgctatc
                      Mouse  ----------tgaagctcccatttgaggatgctgtc
                        Rat  ----------tgaagctcccatttgaggcctctgtc
             Naked mole-rat  ----------ttgaattcctacttgagattactatc
                 Guinea pig  ----------taacattcccactcaagattgccatc
                 Chinchilla  ----------ttaaattcccacttgagattattatc
           Brush-tailed rat  ----------ttaaattcccacttgagattactatc
                       Pika  ----------caaactttctatgcaaggttgctatt
                        Pig  ----------taaaatttccattttaga-tactgtc
                     Alpaca  ----------tgaaatttccatttgaga-tactgtc
             Bactrian camel  ----------tgaaatttccatttgaga-tactgtc
                    Dolphin  ----------taaattttccatttgaga-tactgtc
               Killer whale  ----------taaattttccatttgaga-cactgtc
           Tibetan antelope  ----------taaatttttcatttgaga-tactgtc
                        Cow  ----------taaatttttcatttgaga-tactgtc
                      Sheep  ----------taaatttttcatttgaga-tactgtc
              Domestic goat  ----------taaatttttcatttgaga-tactgtc
                      Horse  ----------ttaaatttctatttgagattactgtc
           White rhinoceros  ----------ttaaatttctatttgagcttactgtc
                        Cat  aaaaaaaaaataaaaattccatttgagattactgtc
                        Dog  ----------ttaaaattccatttgagattgctgtc
                    Ferret   ----------ttaaaattccatttgagattactgtc
                      Panda  ----------ttaaaattccatttgacattactgtc
             Pacific walrus  ----------ttaaaattccatttgagattaatgtc
               Weddell seal  ----------ttaaaattccatttgagattactgtc
                   Hedgehog  ----------taaaatttatacttgggatctctgtc
            Star-nosed mole  ----------ttaaatttccatttaggattaatgtt
                   Elephant  ----------ttaaatttccatttgagaataatttc
                    Manatee  ----------ttaaatttccatttgagattactgtc
           Cape golden mole  ----------ttcattttccattt-aaattatggtc
                     Tenrec  ---------------cgtccatttgagatgatggtt
                   Aardvark  ----------ttaaattttcacttgagattacagtc
                  Armadillo  ----------taaattttccatttgagattactgtt
                     Rabbit  ====================================
                    Megabat  ====================================
            Tasmanian devil  ====================================
         American alligator  ====================================
                    Opossum  ====================================
        Cape elephant shrew  ====================================
         Chinese tree shrew  ====================================
                   Platypus  ====================================
                    Wallaby  ====================================
           Black flying-fox  ====================================
       David's myotis (bat)  ------------------------------------
              Big brown bat  ------------------------------------
                   Microbat  ------------------------------------

Alignment block 5 of 467 in window, 180552916 - 180552971, 56 bps 
B D                   Human  tagtttgatgagagtacgac-tgaattttatt-----ttagccaactatat-aaaaattctct
B D                   Chimp  tagtttgatgagagtacgac-tgaattttatt-----ttagccaactacat-aaaaattctct
B D                 Gorilla  tggtttgatgagagtacgac-tgaattttatt-----ttagacaactatat-aaaaattctct
B D               Orangutan  tagtttgatgagagaatgac-tgaattttatt-----ttagccagctataa-aaaaattctct
B D                  Gibbon  tagtttgatgagagtgcgac-tgaattatatt-----ttagccagctatat-aaaaattctct
B D                  Rhesus  tagtttgatgagagtatgac-tgaattatatt-----ttagccagctatat-aaaaattctct
B D     Crab-eating macaque  tagtttgatgagagtatgac-tgaattatatt-----ttagccagctatat-aaaaattctct
B D                  Baboon  tagtttgatgagagtatgac-tgaattatatt-----ttagccagctatat-aaaaattctct
B D            Green monkey  tggtttgatgagagtatgac-tgaattatatt-----ttagccagctatat-aaaaattctct
B D                Marmoset  tagtttgatgagagcatgac-tgaattatatt-----ttagccagctgcat-gaaaattctct
B D         Squirrel monkey  tagtttgatgagagcacgac-tgaattatatt-----ttagccagctgtat-gaaaattct-t
B D                Bushbaby  tagtttgatggaaatatgat-gaaattacatt-----ttagccagttatct-ataaagtctgt
         Chinese tree shrew  tagtttggtgggagtacaac-caaattacatt-----ttaaccagttacat-aaaaatgctct
B D                Squirrel  tagtttgatgggagtacaac-tg-gctacatc-----ttagcccgttgtataagaaattctct
     Lesser Egyptian jerboa  tagctcgataagaacacaac-tgcattacatt-----ttagccagttgtataaaacattctct
               Prairie vole  ttgtttgatgagaacacaaa-tgcatttcctt-----ttagccagtcatataaaaaattctcc
B D         Chinese hamster  ttgtttgatgagaatacaaa-tgcattacctt-----ttagccagttgtataaaaaattctcc
             Golden hamster  ttgtttgatgagagtacaaa-tgcattacctt-----ttagccggttgtataaaacattctct
B D                   Mouse  ttgtttgatgagaacacaag-cgtcctacctt-----ttagccagttctat-aaaaattctct
B D                     Rat  ttgtttgatgagaacacaag-cgtactacctt-----ttagccggttctataaaaaattctct
B D          Naked mole-rat  tagtttgatagaaatacaac-tacattacatt-----ttatccagttatattaaaaattctct
B D              Guinea pig  tagtctgatgggaatacaac-tacgttgcatt-----ttgtccagttacattaaaaattctct
                 Chinchilla  tagtttaatggggatacaac-cacattgcatt-----ttgtccagtcatattaaaaattctct
           Brush-tailed rat  tagtttggtgggaatatacc-tacactgcgtt-----ttgcccagttatattaaaaattctct
B D                    Pika  ttgttcaaaagacatgtgacttgaattacatttttgattgttcaattgtgttat-tattctct
B D                     Pig  tcatttggtaggaatacgac-caaattataca-----tcctcaagttatat-aaaaattctct
B D                  Alpaca  tagttttgtgggaatatgg--caaattacata-----ttcaccagttacat-aaaaattatct
             Bactrian camel  tagtttggtgggaatatgg--caaattacata-----ttcaccagttacat-aaaaattatct
B D                 Dolphin  tcgtttggtgggagtatgac-caaattacata-----ttccccagttacat-aaaaattctct
               Killer whale  tcgtttggtgggagtatgac-caaattacata-----ttccccagttacat-aaaaattctct
           Tibetan antelope  tcatttggaggggg-atgac-caaattgtgta-----tttaccagtaatat-aaaaattctct
B D                     Cow  tcatttggaggggg-atgac-caaattgtgta-----tttaccagtaatat-aaaaactctct
B D                   Sheep  tcatttggaggtgg-atgac-caaattgtgta-----tttaccagtaatat-aaaaattctct
              Domestic goat  tcatttggaggtgg-atgac-caaattgtgta-----tttaccagtaatat-aaaaattctct
B D                   Horse  tagtttggtgggagtacaac-caaattacatt-----ttcaccagttatat-aaaaattctct
B D        White rhinoceros  tagtttggtgggaatatgac-caaattacctt-----ttcgacagttatat-aaaaattttct
B D                     Cat  tagtctggtgggagtatgac-caaattacgct-----ttcaccagttgtat-aaaaatcctcc
B D                     Dog  tagtttggtgagtatatgat-caaattacatt-----ttcaccagttacat-aaaaattctcc
B D                 Ferret   tagtttggtgagagtaggac-caaattacatt-----ttcaccagttctat-aaaaattctcc
B D                   Panda  tagtttggtgagagtatgac-caaattacatt-----ttcaccagttatat-aaaaattctcc
             Pacific walrus  tagtttggtgagagtatgac-caaattacatt-----ttcaccagttatat-aaaaattctcc
               Weddell seal  tagtttggtgagaatatgac-caaattacatt-----ttcaccagttatat-aaaaattctcc
B D                Hedgehog  cagtttggtgagagtacaaa-caaattgcact-----tgagctagttatat-aaaaattctca
            Star-nosed mole  tattttggtaggagtatgac-caaattacttt-----ttaacaagccatac-aaaaattctct
B D                Elephant  tagtttggcagaaatacaac-caaactgtatt-----ttagccagttataa-aagaattctct
B D                 Manatee  tagtttggtgggaatacaac-caaattatatt-----ttagccagttatat-aag-actctct
           Cape golden mole  tagtttggtgataatactac-taaattatatt-----gtagtcaattatat-aataattccct
B D                  Tenrec  tagtttggtgggaatacaac-cacattgtatt-----gtagccagttgtat-aagaagtctct
                   Aardvark  tagtttggagggaatgcaac-caaattatatt-----ttagccaggtatat-aagaattctct
B D               Armadillo  tagtttggtgggagttaaat-gaaactacact-----ttagccaggtatgt-aagagttctct
B D                  Rabbit  ===============================================================
B D                 Megabat  ===============================================================
B D         Tasmanian devil  ===============================================================
B D      American alligator  ===============================================================
B D                 Opossum  ===============================================================
       Cape elephant shrew  ===============================================================
B D                Platypus  ===============================================================
B D                 Wallaby  ===============================================================
          Black flying-fox  ===============================================================
      David's myotis (bat)  ---------------------------------------------------------------
             Big brown bat  ---------------------------------------------------------------
B D                Microbat  ---------------------------------------------------------------

Inserts between block 5 and 6 in window
B D                   Pika 6bp

Alignment block 6 of 467 in window, 180552972 - 180552996, 25 bps 
B D                   Human  tgtggagacctgcattaactgccac
B D                   Chimp  tgtggagacctgcattaactgccac
B D                 Gorilla  tgtggagacctgcattaactgccac
B D               Orangutan  tgtggagacctgcattaactgccac
B D                  Gibbon  tgtggagacctgcattaactgccac
B D                  Rhesus  tgtggagacctgcgttaactgccac
B D     Crab-eating macaque  tgtggagacctgcgttaactgccac
B D                  Baboon  tgtggagacctgcgttaactgccac
B D            Green monkey  tgtggagacctgcgttaactgccac
B D                Marmoset  tgtagagacctgcgttaactgccac
B D         Squirrel monkey  tgtagagacctgcactaactgccac
B D                Bushbaby  tgtagagacctgcagaaactgtcac
         Chinese tree shrew  tgtggagacctgcattaactgacac
B D                Squirrel  tgtggagacctgcattaattgacac
     Lesser Egyptian jerboa  tgtggagacctgcattaattgacac
               Prairie vole  cgtgaagacctgcattaattgatac
B D         Chinese hamster  tgtgaaggcctgcattaattgatac
             Golden hamster  cgtgaagacctgcattaattgatac
B D                   Mouse  tgtgaaggactgcattaattgacac
B D                     Rat  catgaaggcccgcattaactgacac
B D          Naked mole-rat  tatagagtactgcactaattgatac
B D              Guinea pig  tgtagagatctgcagtaattgacat
                 Chinchilla  tgtagagatctgcactaattgacac
           Brush-tailed rat  tgtagagatttgcactaattgacac
B D                     Pig  tgcggacatctgcattaacttacac
B D                  Alpaca  tgtggagatctgcattaacttacac
             Bactrian camel  tgtggagatctgcattaacttacac
B D                 Dolphin  tgtggaga-ctgcattaacttacac
               Killer whale  tgtggaga-ctgcattaacttacac
           Tibetan antelope  tgtggagagctgcattaacttacac
B D                     Cow  tgtggagagctgcattaacttacac
B D                   Sheep  tgtggagatctgcattaacttacac
              Domestic goat  tgtggagatctgcattaacttacac
B D                   Horse  tgtggacgtctgcattaacttacac
B D        White rhinoceros  tgtggtgatctgcatcaacttacac
B D                     Cat  tatgaagatctgcattgactgacac
B D                     Dog  tgtgaagatctgcattaatttgcac
B D                 Ferret   catgaagatctgcattaatttgcac
B D                   Panda  tgtgaagatctgcattaatttacac
             Pacific walrus  tgtgaagatctgcattaatttacac
               Weddell seal  catgaagatctgcattaatttacac
B D                Hedgehog  tagggagatctgtgttaagtaatat
            Star-nosed mole  agtggccgtcttcattagctaacct
B D                Elephant  tgtggagaccaacattaactgatac
B D                 Manatee  tatggagaccaacattaactgatac
           Cape golden mole  tgtggagatctacattaactgacac
B D                  Tenrec  tggggagatctgcattaaatgacac
                   Aardvark  tgtggagtactacattaactgatac
B D               Armadillo  tgtagagatctgaattaactgacat
B D                    Pika  =========================
B D                  Rabbit  =========================
B D                 Megabat  =========================
B D         Tasmanian devil  =========================
B D      American alligator  =========================
B D                 Opossum  =========================
       Cape elephant shrew  =========================
B D                Platypus  =========================
B D                 Wallaby  =========================
          Black flying-fox  =========================
      David's myotis (bat)  -------------------------
             Big brown bat  -------------------------
B D                Microbat  -------------------------

Inserts between block 6 and 7 in window
                  Aardvark 105bp

Alignment block 7 of 467 in window, 180552997 - 180553015, 19 bps 
B D                   Human  catatagccaatgtactct
B D                   Chimp  catatagccaatgtactct
B D                 Gorilla  catatagccaatgtactct
B D               Orangutan  catatagccaatgtattct
B D                  Gibbon  catatagccaatgtattct
B D                  Rhesus  catatagccaatgtattct
B D     Crab-eating macaque  catatagccaatgtattct
B D                  Baboon  catatagccaatgtattct
B D            Green monkey  catatagccaatgtattct
B D                Marmoset  catatagacaatgtattct
B D         Squirrel monkey  catatagacaatatattct
B D                Bushbaby  catatagccaatgtgttct
         Chinese tree shrew  cgtatagccaatgtagcct
B D                Squirrel  cgtataggcaatgtattct
     Lesser Egyptian jerboa  catagaagcaatgtattct
               Prairie vole  tgtataagcaatgtattct
B D         Chinese hamster  catataagcaatgtattct
             Golden hamster  catataagcaatgtattct
B D                   Mouse  cagataagcaatatattct
B D                     Rat  cagataagcaatgtattct
B D          Naked mole-rat  catataggcaatgtattct
B D              Guinea pig  cgtataggcaatgtattct
                 Chinchilla  catataggcaatgtattct
           Brush-tailed rat  catataggcaatgtattct
B D                     Pig  catatagccaaagtattcc
B D                  Alpaca  catataggcaatgtattcc
             Bactrian camel  catataggcaatgtattcc
B D                 Dolphin  catatagccaatgtattcc
               Killer whale  catatagccaatgtattcc
           Tibetan antelope  catatggccaatgtattcc
B D                     Cow  catatggccaatgtattct
B D                   Sheep  catatggccaatgtattcc
              Domestic goat  catatggccaatgtattcc
B D                   Horse  catatatccaatgtattca
B D        White rhinoceros  catatagtaaatgtagtct
B D                     Cat  catatagccaatgtattcc
B D                     Dog  catttagccaatgtattcc
B D                 Ferret   catttagccaatgtattct
B D                   Panda  catttagccaatgtattcc
             Pacific walrus  catttagccaatgtagtcc
               Weddell seal  catttagccaatgtattcc
B D                Hedgehog  agca-----aatatattct
            Star-nosed mole  tgtatcctcaatgtattct
B D                Elephant  catatatccagtgtattct
B D                 Manatee  catatatccagtgtattct
           Cape golden mole  catatattcaatgtattct
B D                  Tenrec  catgtatccagaatagtcc
                   Aardvark  catatatccaatatattct
B D               Armadillo  cctatatccaatgtattct
B D                    Pika  ===================
B D                  Rabbit  ===================
B D                 Megabat  ===================
B D         Tasmanian devil  ===================
B D      American alligator  ===================
B D                 Opossum  ===================
       Cape elephant shrew  ===================
B D                Platypus  ===================
B D                 Wallaby  ===================
          Black flying-fox  ===================
      David's myotis (bat)  -------------------
             Big brown bat  -------------------
B D                Microbat  -------------------

Alignment block 8 of 467 in window, 180553016 - 180553020, 5 bps 
B D                   Human  attga
B D                   Chimp  attga
B D                 Gorilla  attga
B D               Orangutan  attga
B D                  Gibbon  attga
B D                  Rhesus  attga
B D     Crab-eating macaque  attga
B D                  Baboon  attga
B D            Green monkey  attga
B D                Marmoset  attga
B D         Squirrel monkey  attga
B D                Bushbaby  gttgc
         Chinese tree shrew  atcga
B D                Squirrel  attga
     Lesser Egyptian jerboa  attga
               Prairie vole  attga
B D         Chinese hamster  attga
             Golden hamster  attga
B D                   Mouse  attga
B D                     Rat  attga
B D          Naked mole-rat  attga
B D              Guinea pig  attga
                 Chinchilla  attga
           Brush-tailed rat  attga
B D                     Pig  attga
B D                  Alpaca  attga
             Bactrian camel  gttga
B D                 Dolphin  acaga
               Killer whale  acaga
           Tibetan antelope  attga
B D                     Cow  attga
B D                   Sheep  attga
              Domestic goat  attga
B D                   Horse  attga
B D        White rhinoceros  attga
B D                     Cat  attga
B D                     Dog  attga
B D                 Ferret   attga
B D                   Panda  attga
             Pacific walrus  attga
               Weddell seal  attga
B D                Hedgehog  atcgg
            Star-nosed mole  attga
B D                Elephant  attga
        Cape elephant shrew  attga
B D                 Manatee  gttgc
           Cape golden mole  attga
B D                  Tenrec  actga
                   Aardvark  attga
B D               Armadillo  actga
B D                    Pika  =====
B D                  Rabbit  =====
B D                 Megabat  =====
B D         Tasmanian devil  =====
B D      American alligator  =====
B D                 Opossum  =====
B D                Platypus  =====
B D                 Wallaby  =====
          Black flying-fox  =====
      David's myotis (bat)  -----
             Big brown bat  -----
B D                Microbat  -----

Inserts between block 8 and 9 in window
          Tibetan antelope 450bp
B D                    Cow 463bp
B D                  Sheep 453bp
             Domestic goat 458bp
B D                    Cat 5bp
B D                    Dog 1bp
B D                Ferret  7bp
B D                  Panda 2bp
            Pacific walrus 2bp
              Weddell seal 3bp

Alignment block 9 of 467 in window, 180553021 - 180553190, 170 bps 
B D                   Human  tgttttcttgcctacttattaatag----gtgccctgggcatctgcacagctggtacactccttcatcca
B D                   Chimp  tgttttcttgcctacttattaatag----gtgccctgggcatctgcacagctggtacactccttaatcca
B D                 Gorilla  tgttttcttgcctacttattaatag----gtgccctgggcatctgcacagctggtacactccttaatcca
B D               Orangutan  tgctttcttgcctacttattaatag----gtgccctgggcatctgcacagctggtacactccttaatcca
B D                  Gibbon  tgttttc-tgcctacttattaacag----gtgccctgggcatctgcacagctggtacactcctcaatcca
B D                  Rhesus  tgttttcttgcctacttattactag----gtgccctgggcatctgcacagctggtacactccttaatcca
B D     Crab-eating macaque  tgttttcttgcctacttattactag----gtgccctgggcatctgcacagctggtacactccttaatcca
B D                  Baboon  tgttttcttgcctacttattactag----gtgccctgggcatctgcacagctggtacactccttaatcca
B D            Green monkey  tgttttcttgcctacttattactgg----gtgccctgggcatctgcacagctggtacactccttaatcca
B D                Marmoset  tgttttcttgcctacttattaatag----gtgccctgggcatctgcacagctggtgtgctccttaatcca
B D         Squirrel monkey  tgttttcttgcctacttattaatag----gtgccctgggcatctgcacagctggtgtgctccttaatcca
B D                Bushbaby  tgttttactgcctgcttgctaattg----gtgccttgggtatctccccagctggtacactccttaatcca
         Chinese tree shrew  tgttttgttgcttacttattcattg----gtgccctgggcatctacccagctggtatactccttaatcca
B D                Squirrel  tgtttcactgcctacttattaattg----atgccctgggcatccacccagctggaacactccttaatcca
     Lesser Egyptian jerboa  tgtttttctgcctacttattaattg----atgctctgggcgtctacccagctggtacactccttaatcca
               Prairie vole  tgttttacagcctacttattaattg----atgctctgggcatctacccagctggtatactccttaatcca
B D         Chinese hamster  tgtcttactgcctacttattaattg----atgctctgggcgtctacccagctggtatattccttaatcca
             Golden hamster  tgtcttactgcctacttattaattg----atgctctgggcatctacccagctggtatatcccttaatcca
B D                   Mouse  tgcttttctgcctacttattaattg----atgctctgggcatctacccagctgctatattccttaatcca
B D                     Rat  tgttttactgcatactgattaattg----atgctctgggcgtctacccagctgctatattccttaatcca
B D          Naked mole-rat  tgttttactgcctgcttattaattg----atgtcctgggcagctagccagctggtatactccttaatcta
B D              Guinea pig  tgttttactgcctacttattaattg----atgtcctgggcatct-cccagctggtatactccttaatcca
                 Chinchilla  tgttctactacctacttattaattg----atgtcctgggcatctacccagctggtctactccttaatcca
           Brush-tailed rat  tgttctatggcctacttattaattg----atgtcctgggcatccacccagctagtatactccctaatcca
B D                     Pig  tgtttta----ttacttattaatta----gtgccctgggcatctacccagctggcacactccttaattca
B D                  Alpaca  tggttaactgcttacttattaattg----ataccctgggcatctacccaactggcacactccttactcca
             Bactrian camel  tggttaactgcttacttattaattg----gtaccctgggcatctacccagctggcacactccttactcca
B D                 Dolphin  tgttttactgcttacttattaattg----gtgccctgggcatctacccagctggcacactccttaattca
               Killer whale  tgttttactgcttacttattaattg----gcgccctgggcatctacccagctggcacactccttaattca
           Tibetan antelope  tattttactgattatttattga----------------gtaagtacccagctggcacactccttaattca
B D                     Cow  tattttactgattatttattaa----------------gtaagtacctggctggcatattccttaattca
B D                   Sheep  tattttactgaatatttattaa----------------gtaagtacccagctggcatactccttaattca
              Domestic goat  tattttactgaatatttattaa----------------gtaagtacccagctggcatactccttaattca
B D                   Horse  tgttttactgcttacttattaattg----gtgccctgggcatctacccagctgggacactccttaatcca
B D        White rhinoceros  tgttttattgcttacttattaattg----gtgccccaggcatctacccagctggcacactctttaatcca
B D                     Cat  ttttccactgtttacttattaattg----gtgctctgggcgcctactcagctggcacactccttaatcca
B D                     Dog  ttttttactgcttccttattaattg----gtgccctgggcatctactcagctggcacactccttaatcca
B D                 Ferret   tcttttactgcttacttattaattg----gtgccctgagcatctgctcagctggtacacttcttaatcca
B D                   Panda  ttttttactgctcacttattaatta----gtgccctgggcatctagtcagctggcacactccttaatcca
             Pacific walrus  ttttttactgcttacttattaattg----gtgccctggacatctactcagctggcatactccttaatcca
               Weddell seal  ttttttactgcttacttattaattg----gtgccctgggcatctactcagctggcatacttcttaatcca
B D                Hedgehog  tgttttactgcttgcttattaattg----gtaccctaggcatctactcagctggcacacttcttaatcca
            Star-nosed mole  tgttttactgcttacttgttaattg----gcactatgggcatatatccagctgacataacccttaatcca
B D                Elephant  tgtcttacggtccacttattaattg----gcgccctgggcatctacccagctggcacactccttaatcca
        Cape elephant shrew  tgtctcactgcctacttattaattg----gcatcctgggcatctgcccagctggcacacttcttaatcca
B D                 Manatee  tgtcttactgcctacttattaattg----gcgccctgggcatctacccagctggcacactccttaatcca
           Cape golden mole  tatcttactgccttcttattaattg----ataccatggacatctacccagctgacatgctccttaatcca
B D                  Tenrec  tgtcttcctacctacttattaattggcgtgcaccctgggcacctacccagctggcacattccttaatcca
                   Aardvark  tgtcttactgcctgcttattaattg----gcaccctgggcatctacccagctggcatactccttaatcca
B D               Armadillo  tgttttactgcctacttattaattg----gtgccctgggcatctacccaactggcacactccttaattca
B D                    Pika  ======================================================================
B D                  Rabbit  ======================================================================
B D                 Megabat  ======================================================================
B D         Tasmanian devil  ======================================================================
B D      American alligator  ======================================================================
B D                 Opossum  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================
          Black flying-fox  ======================================================================
      David's myotis (bat)  ----------------------------------------------------------------------
             Big brown bat  ----------------------------------------------------------------------
B D                Microbat  ----------------------------------------------------------------------

                      Human  aagtttga-----tcaaga-caaaggaaaacataatta-ggagctcaggg-taagaaag-t-atgataaa
                      Chimp  aagtttga-----tcaaga-caaaggaaaacataatta-ggagctcaggg-taagaaag-t-atgataaa
                    Gorilla  aagtttga-----tcaaga-caaaggaaaacataatta-ggagctcaggg-taagaaag-t-atgataaa
                  Orangutan  aagtttga-----tcagga-caaaggaaaacataatta-ggagctcaggg-taagaaag-t-atgataaa
                     Gibbon  aagtttga-----tcagga-caaaggaaaacataatta-ggagctcaggg-taagagag-t-atgataaa
                     Rhesus  aagtttga-----tcagga-caaaggaaaaagtaatta-ggagctcaggg-taaaagag-t-atgataaa
        Crab-eating macaque  aagtttga-----tcagga-caaaggaaaaaataatta-ggagctcaggg-taaaagag-t-atgataaa
                     Baboon  aagtttga-----tcagga-caaaggaaaaaataatta-ggagctcaggg-taaaagag-t-atgataaa
               Green monkey  aagtttga-----tcagga-caaaggaaaaaataatta-ggagctcaggg-taaaagag-t-atgataaa
                   Marmoset  aagtttga-----tcagga-caaaggaaaaaataatta-ggagctcaggg-taagagag-t-atgataaa
            Squirrel monkey  aagtttaa-----tcagga-caaaggaaaaaataatta-ggagctcagga-taagagag-t-atgataaa
                   Bushbaby  gattttga-----tcagaatcaaggaaaaaaataatta-ggagctcaggg-taggagag-t-atgataga
         Chinese tree shrew  gattttga-----tcagga-tgaaggaaaaagtcatta-ggagctcagtg-tgggagag-t-atgacaaa
                   Squirrel  gattttga-----tcagga-aaaaggaaaatgtaatta-ggagctgagag-tgggagagtt-atgagaaa
     Lesser Egyptian jerboa  gattttgatcaggtcagga-taaaggaaaatgcaatta-ggaactcaggg-tgggagaa-t-atgagaaa
               Prairie vole  gattttga-----acagga-taaaggaaaatgcaatga-ggagcccaggg-tagtagag-a-atgagaga
            Chinese hamster  gattttga-----acagga-taaaggaaaatgcaatta-ggagctcaggg-tggtaaaa-t-atgagaga
             Golden hamster  gatttcca-----acagga-taaaggaaaatgcaatta-ggagctcaggg-tagtaaaa-t-atgagaaa
                      Mouse  gattttga-----tcagga-tgaaggaacgtgcaattaagaagctcgggg-tagtaggg-t-atgagaga
                        Rat  gattttga-----tcagga-tgaagggatgtgcgattagggagctcaggg-tagaaggg-t-atgagaga
             Naked mole-rat  gattttga-----tcagaa-aaaaggaaaacataatta-a----tcaggg-tgggagag-t-ataagaaa
                 Guinea pig  gattttga-----tctgga-aaaaggaaatcataatga-agtgttcaggg-tgggagag-a-ataaaaag
                 Chinchilla  gattttga-----tgtgga-aaaagggaaacataatta-ggagttcaagg-tgggagag-c-agaagaaa
           Brush-tailed rat  gattttga-----tctgga-aaaaggaaaacataatta-ggagttc-agg-tgggaaag-c-ataagaaa
                        Pig  gattttga-----tcagga-taaaggaatacataatta-agagctcagggttgagagag-t-atggtaaa
                     Alpaca  gattttga-----tcagga-taaaggaataagtaatta-ggaactcaggg-tgggaggg-t-ttggtaaa
             Bactrian camel  gattttga-----tcagga-taaaggaataagtaatta-ggagctcaggg-tgggaggg-t-ttggtaaa
                    Dolphin  tattttga-----tcagca-taaaggaataagtaatta-ggagctcaggg-cgggagaa-t-atagtaaa
               Killer whale  tattttga-----tcagca-taaaggaataagtaatta-ggagctcaggg-cgggagaa-g-atagtaaa
           Tibetan antelope  tagtttga-----tcagga-caaaggaataagtaattg-ggagctcaggg-tgggagag-t-atagtaaa
                        Cow  tagtttga-----t-agga-taaaggaataagtaatta-ggagctcaggg-tgggagag-t-ctagtaaa
                      Sheep  tagtttga-----tcagga-taaaggaataagtaatta-ggagctcaggg-tgggagag-t-atagtaaa
              Domestic goat  tagtttga-----tcagga-taaaggaataagtaatta-ggagctcaggg-tgggagag-t-atagtaaa
                      Horse  cattttga-----ttagga-taaaggaaaaagtaatta-ggagctcaggg-tgagagag-a-atgataaa
           White rhinoceros  cattttgg-----tcagga-taaaggaataagtaattg-ggaactcaggg-t-aaagag-a-atgataaa
                        Cat  gattttga-----tcagga-taaaggaataagtaatta-gaagctcaggg-taggagaa-t-atgataaa
                        Dog  gattttga-----tcagga-tagaagaataagtaatta-gaagctgaggg-tgggagag-t-atgataaa
                    Ferret   gattttga-----tcagaa-taaaagaataagtaatta-g--------gg-tgggagag-t-atgataaa
                      Panda  gattttga-----tcagga-taaaagaataagtaatta-gaagctcaggg-tgggagag-t-atgataaa
             Pacific walrus  gattttga-----tcagga-taaaagaataag----ta-gaagctca-----------------------
               Weddell seal  gattttga-----tcagga-taaaagaataagtaatta-gaagctcaggg-tgggagag-t-atcataaa
                   Hedgehog  gattttga-----tcagga-taaaggaataattaatta-gaagctcaggg-tgggagag-t-tttataca
            Star-nosed mole  gattttga-----tcaagattaaagaagtaagtaatta-gaagcttaggg-tgggaaat-t-attataca
                   Elephant  gattttga-----tcagga-taaagaaatcagtaatta-ggagctcagga-tgggagag-c-a-gataaa
        Cape elephant shrew  gattttga-----tcagga-taaaggaataaataatta-ggagctcaggg-tgggaaag-c-a-gataaa
                    Manatee  gattttga-----tcagga-tgaagaaataagtaatta-ggagctcaggg-tgggagag-c-a-gataaa
           Cape golden mole  gattttga-----gcaaga-taaaggaataagtaatta-ggagctcaggg-tgagaaag-c-a-attcaa
                     Tenrec  gattttga-----tcagga-tagcagactaagtaatta-ggagctcaggg-tgggactg-g-a-gagaaa
                   Aardvark  gattttga-----tcagga-taagggaataagtaatta-gaagctcaggg-tgggaggg-c-a-gataaa
                  Armadillo  gat-----------cagga-taaagggataagtaatta-ggagttcaggg-taggagag-caa-gacaaa
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                    Megabat  ======================================================================
            Tasmanian devil  ======================================================================
         American alligator  ======================================================================
                    Opossum  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
           Black flying-fox  ======================================================================
       David's myotis (bat)  ----------------------------------------------------------------------
              Big brown bat  ----------------------------------------------------------------------
                   Microbat  ----------------------------------------------------------------------

                      Human  gcctggtgggctat-gggctattgcc-tt--------gt-----ttt---------------t-tgtt--
                      Chimp  gcctggtgggctat-gggctattgcc-tt--------gt-----ttt---------------t-tgtt--
                    Gorilla  gcctcgtgggctat-gggctattgcc-tt--------gt-----ttt---------------t-tgtt--
                  Orangutan  gcctggtgggctat-gggctattgcc-tt--------gt-----ttt---------------t-tgtt--
                     Gibbon  gcctggtgggctat-gggccattgcc-tt--------gt-----ttt---------------t-tgtt--
                     Rhesus  gcctggtgggctat-gggctattgcc-tt--------gt-----ttt---------------t-tgtt--
        Crab-eating macaque  gcctggtgggctat-gggctattgcc-tt--------gt-----ttt---------------t-tgtt--
                     Baboon  gcctggtgggctat-gggctattgcc-tt--------gt-----ttt---------------t-tgtt--
               Green monkey  gcctggtgggctat-gggctattgcc-tt--------gt-----ttt---------------t-tgtt--
                   Marmoset  gcctggtgggctat-gggctattgcc-tt--------gt-----ttt---------------t-tgtt--
            Squirrel monkey  tcctggtgggctac-gggctattgcc-tt--------gt-----ttt---------------t-tgtt--
                   Bushbaby  tgctggtggactat-gggctattgcc-tt--------gt-----ttt---------------t-tatttc
         Chinese tree shrew  gcctggcagacaat-gggctattgcc-tc--------gt-----ttt---------------t-cttt--
                   Squirrel  gcctggtggactgt-gggctatttcc------------ttggttt-----------------t-tgtt--
     Lesser Egyptian jerboa  acctggtaattg-a-gggctattgcc------------------------------------c-tggt--
               Prairie vole  gcctggtagacc-a-aagctatggcc-tt--------tttgatttat---------------c-tgtt--
            Chinese hamster  gcctggtagaca-a-aagctgtggccttt--------tttgatctgt---------------c-tgtc--
             Golden hamster  gcctggtagaca-a-atgctgaggcc-tt--------tttgattcat---------------c-tgtt--
                      Mouse  tcctggaagacc-a-aagctatgacc-tt--------tgtgatttgtttctttcttcctttct-ttct--
                        Rat  cccctgaagaccaa-aagccatggcc-tt--------ttttgtttgt---------------t-ttgt--
             Naked mole-rat  gcctg--------------tattgcc-tt--------g------ttt---------------t-tgtt--
                 Guinea pig  gcctg--------------tattgcc-tc--------g------ttt---------------t-tgtt--
                 Chinchilla  tccta--------------tattgcc-tt--------gtttttattt---------------t-tgtt--
           Brush-tailed rat  gcctg--------------tattgtc-tt--------g------ttt---------------t-tgtt--
                        Pig  gcctgatggactgt-gg----ttgcc-tt--------tt-----ttt---------------t-tttt--
                     Alpaca  gcctgctggactat-gg----ttgac-tt--------gt-----ttt---------------t-ggtt--
             Bactrian camel  gccggctggactac-ag----ttgcc-tt--------gt-----ttt---------------t-ggtt--
                    Dolphin  gcctggtggactat-gg----ttgcc-tt--------gt-----ttt---------------t-tgtc--
               Killer whale  gcctggtggactat-gg----ttgcc-tt--------gt-----ttt---------------t-tgtt--
           Tibetan antelope  gccttgtagactat-gg----ttgcc-tt--------gc-----ttt---------------t-ggtt--
                        Cow  gctttgtagactat-gg----ttgcc-tt--------gc-----ttt---------------t-tgtt--
                      Sheep  gccttgtagactat-gg----ttgcc-tt--------gc-----ttt---------------a-tgtt--
              Domestic goat  gccttatagactat-gg----ttgcc-tt--------gc-----ttt---------------a-tgtt--
                      Horse  gcctggtggactat-gggctatttct-tt--------gt-----ttt---------------t-tgtt--
           White rhinoceros  gcctggtggacttt-aggctattgcc-tt--------gt-----ttt---------------t-tgtt--
                        Cat  gcctgatggagtat-gggcgactgcc-tt--------a------ttt---------------c-tgtt--
                        Dog  gcctggtggactat-gggctattgcc-tt--------at-----ttt---------------c-tgtt--
                    Ferret   acctggtagactat-gagctattgct-tt--------at-----ttt---------------c-tgtt--
                      Panda  gcctggtagactat-ggactattgct-tt--------at-----ttt---------------c-tgtt--
             Pacific walrus  ----ggtagactat-gggctattgcc-tt--------at-----ttt---------------c-tgtt--
               Weddell seal  gcctggtagactat-gggctattgcc-tt--------at-----ttt---------------c-tgtt--
                   Hedgehog  gtctactagactgt-gagctcttgct-tt--------gt-----ttt---------------t-tgtt--
            Star-nosed mole  tcttggtggatggt-ggatcacagcc-t------------------------------------------
                   Elephant  gcctggt-gactatggggctattgcc-tt--------gt-----ttt---------------t-tcct--
        Cape elephant shrew  gcatggt-gactac-aggctattgct-ttgtggtgtggt-----ttt---------------t-tccc--
                    Manatee  gcctggt-gactat-gggctattgct-tt--------gt-----ttt---------------t-tctt--
           Cape golden mole  gtctgat-gactat-ggcctattgc---------------------------------------tatc--
                     Tenrec  atctggt-gattat-ggactattgcc-tt--------gt-----ttt---------------tttctt--
                   Aardvark  gcctggt-gactat-gggctgttgcc-tt--------gt-----ttt---------------t-------
                  Armadillo  gtttggtggactgt-aggctattgcc-at--------ta-----ttt---------------t-------
                       Pika  ======================================================================
                     Rabbit  ======================================================================
                    Megabat  ======================================================================
            Tasmanian devil  ======================================================================
         American alligator  ======================================================================
                    Opossum  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
           Black flying-fox  ======================================================================
       David's myotis (bat)  ----------------------------------------------------------------------
              Big brown bat  ----------------------------------------------------------------------
                   Microbat  ----------------------------------------------------------------------

                      Human  tctgttc--
                      Chimp  tctgttc--
                    Gorilla  tctgttc--
                  Orangutan  tctgttc--
                     Gibbon  tctgttc--
                     Rhesus  tctgttc--
        Crab-eating macaque  tctgttc--
                     Baboon  tctgttc--
               Green monkey  tctgttc--
                   Marmoset  tctgttc--
            Squirrel monkey  tctgttc--
                   Bushbaby  tctattc--
         Chinese tree shrew  cttgtcc--
                   Squirrel  tcagttt--
     Lesser Egyptian jerboa  t--------
               Prairie vole  tcaatta--
            Chinese hamster  tcaattc--
             Golden hamster  tcaattc--
                      Mouse  ttctttc--
                        Rat  ttagttc--
             Naked mole-rat  tctgttc--
                 Guinea pig  tctggtc--
                 Chinchilla  tctgttc--
           Brush-tailed rat  tctgttc--
                        Pig  tagggcc--
                     Alpaca  tctgttg--
             Bactrian camel  tctgttg--
                    Dolphin  tctgttg--
               Killer whale  tctgttg--
           Tibetan antelope  tctgttg--
                        Cow  tctgttg--
                      Sheep  tctgttg--
              Domestic goat  tctgttg--
                      Horse  tctgttg--
           White rhinoceros  tctgttg--
                        Cat  tctgttg--
                        Dog  tctgttg--
                    Ferret   tccgttg--
                      Panda  tctgttg--
             Pacific walrus  tctgttg--
               Weddell seal  tctgttg--
                   Hedgehog  tctgttt--
            Star-nosed mole  ---------
                   Elephant  tttgttgct
        Cape elephant shrew  cctttt--t
                    Manatee  tttgttgtt
           Cape golden mole  tttgttgat
                     Tenrec  gttgttgtt
                   Aardvark  ---------
                  Armadillo  ---------
                       Pika  =========
                     Rabbit  =========
                    Megabat  =========
            Tasmanian devil  =========
         American alligator  =========
                    Opossum  =========
                   Platypus  =========
                    Wallaby  =========
           Black flying-fox  =========
       David's myotis (bat)  ---------
              Big brown bat  ---------
                   Microbat  ---------

Inserts between block 9 and 10 in window
B D                    Pig 294bp
B D                 Alpaca 6bp
            Bactrian camel 6bp
B D                Dolphin 6bp
              Killer whale 6bp
          Tibetan antelope 6bp
B D                    Cow 6bp
B D                  Sheep 6bp
             Domestic goat 6bp
B D                  Horse 6bp
B D       White rhinoceros 6bp
B D                    Cat 6bp
B D                    Dog 6bp
B D                Ferret  6bp
B D                  Panda 6bp
            Pacific walrus 6bp
              Weddell seal 6bp
B D               Hedgehog 4bp

Alignment block 10 of 467 in window, 180553191 - 180553221, 31 bps 
B D                   Human  a-----------ttt--tttcttt---------ttgtt-------------attttaac-----------
B D                   Chimp  a-----------ttt--tttcttt---------ttgtt-------------attttaac-----------
B D                 Gorilla  a-----------ttt--tttcttt---------ttgtt-------------attttaac-----------
B D               Orangutan  a-----------ttt--tttcttt---------ttgtt-------------attttaac-----------
B D                  Gibbon  atttt----ttcttt--tttcttt---------ttgtt-------------attttaac-----------
B D                  Rhesus  atttt----ttcttt--tttcttt---------ttgtt-------------attttaac-----------
B D     Crab-eating macaque  atttt----ttcttt--tttcttt---------ttgtt-------------attttaac-----------
B D                  Baboon  atttt----ttcttt--tttcttt---------ttgtt-------------attttaac-----------
B D            Green monkey  atttt----ttcttt--tttcttt---------ttgtt-------------attttaac-----------
B D                Marmoset  atttt----ttcttt--attcttt---------ttgtt-------------attttaac-----------
B D         Squirrel monkey  atttt----ttcttc--attcttt---------ttgtt-------------attttaac-----------
B D                Bushbaby  tttttca--ttttct--tttgttg---------ttatt-------------gttttagt-----------
         Chinese tree shrew  tttttcatttcattt--ttttcca---------ctgtt-------------gttttaac-----------
B D                Squirrel  tttttt---tttttt--tttttcacttaaaaaattgtggtttggggctagggctataactcagtggcaga
     Lesser Egyptian jerboa  ---------tcgatt--tttgtta---------ttgttatt----------gttgtttc-----------
               Prairie vole  tttttca--tttttc--tttgttg---------ttgta-------------tttttaat-----------
B D         Chinese hamster  ttt------attttc--tttgtta---------ttgtattt----------tttttaac-----------
             Golden hamster  ttt------attttc--tttgtta---------ttgtg--t----------tttttaac-----------
B D                   Mouse  tttctt---tctttc--tttctttc--------tttctttc----------tttctttc-----------
B D                     Rat  gaatat---tttttc--gttgtct---------ttgctgtg----------gttgtaac-----------
B D          Naked mole-rat  atgttc---atcttc--ttttt-----------ttgtt-------------gttttaaa-----------
B D              Guinea pig  attttc---attttc-tttttttg---------tggtt-------------gttttaac-----------
                 Chinchilla  attttc---attttc--ttttttg---------tggtt-------------gttttcac-----------
           Brush-tailed rat  attttc---attttc--ttttttg---------tggtt-------------gttttaac-----------
B D                  Alpaca  -----------atcg--ctttttg---------ttggt-------------attttaac-----------
             Bactrian camel  -----------attg--ctttttg---------ttggt-------------actttaac-----------
B D                 Dolphin  -----------attg--cctt---------------tt-------------gttttaac-----------
               Killer whale  -----------attg--cctt---------------tt-------------gttttaac-----------
           Tibetan antelope  -----------attg--cctttca---------ttgtt-------------g-tttagc-----------
B D                     Cow  -----------attg--cctttca---------ttgtt-------------gttttagc-----------
B D                   Sheep  -----------ataa--cctttca---------ttgtt-------------gttttagc-----------
              Domestic goat  -----------ataa--cctttca---------ttgtt-------------gttttagc-----------
B D                   Horse  -----------gttg--tcttttg---------ttgtt-------------gttttaac-----------
B D        White rhinoceros  -----------attg--ccttttg---------ttgtt-------------gttttaac-----------
B D                     Cat  -----------attg--cttctta---------ttatt-------------gttttaac-----------
B D                     Dog  -----------attg--ccttttg---------tcatt-------------g-tttaac-----------
B D                 Ferret   -----------attg--ccttttg---------tcact-------------g-tttaac-----------
B D                   Panda  -----------attg--ccttttg---------ccatt-------------g-tttaac-----------
             Pacific walrus  -----------attg--ctttttg---------tcatt-------------g-tttaat-----------
               Weddell seal  -----------attg--ctttttg---------tca------------------ttaac-----------
B D                Hedgehog  -----------attg--tcttttg---------ttgt----------------tttaac-----------
B D                Elephant  --------gttcctt--tggtttg---------ttatt---------------tttaac-----------
        Cape elephant shrew  --------gttctct--tgtttta---------ttgtt-------------aatttaac-----------
B D                 Manatee  --------gttcctt--tgttttg---------tagtt--------------tttttac-----------
           Cape golden mole  --------gttattc---------------------tt-------------agtttaac-----------
B D                  Tenrec  --------gttactctttgttttg---------ttgtt-------------attttaat-----------
                   Aardvark  -----------cctt--tgttttg---------ttatt----------------ttaac-----------
B D               Armadillo  --------gtttgtt--tgtttta---------ttgct---------------gttaac-----------
B D                    Pika  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
B D                 Megabat  ======================================================================
B D         Tasmanian devil  ======================================================================
B D      American alligator  ======================================================================
B D                 Opossum  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================
           Star-nosed mole  ----------------------------------------------------------------------
          Black flying-fox  ======================================================================
      David's myotis (bat)  ----------------------------------------------------------------------
             Big brown bat  ----------------------------------------------------------------------
B D                Microbat  ----------------------------------------------------------------------

                      Human  ----------------------------------------------------------------------
                      Chimp  ----------------------------------------------------------------------
                    Gorilla  ----------------------------------------------------------------------
                  Orangutan  ----------------------------------------------------------------------
                     Gibbon  ----------------------------------------------------------------------
                     Rhesus  ----------------------------------------------------------------------
        Crab-eating macaque  ----------------------------------------------------------------------
                     Baboon  ----------------------------------------------------------------------
               Green monkey  ----------------------------------------------------------------------
                   Marmoset  ----------------------------------------------------------------------
            Squirrel monkey  ----------------------------------------------------------------------
                   Bushbaby  ----------------------------------------------------------------------
         Chinese tree shrew  ----------------------------------------------------------------------
                   Squirrel  gtgcttgcctcgcatatgtgaggcactgggttcaatcctcagcaacacataaaaaaaaataaaaaataaa
     Lesser Egyptian jerboa  ----------------------------------------------------------------------
               Prairie vole  ----------------------------------------------------------------------
            Chinese hamster  ----------------------------------------------------------------------
             Golden hamster  ----------------------------------------------------------------------
                      Mouse  ----------------------------------------------------------------------
                        Rat  ----------------------------------------------------------------------
             Naked mole-rat  ----------------------------------------------------------------------
                 Guinea pig  ----------------------------------------------------------------------
                 Chinchilla  ----------------------------------------------------------------------
           Brush-tailed rat  ----------------------------------------------------------------------
                     Alpaca  ----------------------------------------------------------------------
             Bactrian camel  ----------------------------------------------------------------------
                    Dolphin  ----------------------------------------------------------------------
               Killer whale  ----------------------------------------------------------------------
           Tibetan antelope  ----------------------------------------------------------------------
                        Cow  ----------------------------------------------------------------------
                      Sheep  ----------------------------------------------------------------------
              Domestic goat  ----------------------------------------------------------------------
                      Horse  ----------------------------------------------------------------------
           White rhinoceros  ----------------------------------------------------------------------
                        Cat  ----------------------------------------------------------------------
                        Dog  ----------------------------------------------------------------------
                    Ferret   ----------------------------------------------------------------------
                      Panda  ----------------------------------------------------------------------
             Pacific walrus  ----------------------------------------------------------------------
               Weddell seal  ----------------------------------------------------------------------
                   Hedgehog  ----------------------------------------------------------------------
                   Elephant  ----------------------------------------------------------------------
        Cape elephant shrew  ----------------------------------------------------------------------
                    Manatee  ----------------------------------------------------------------------
           Cape golden mole  ----------------------------------------------------------------------
                     Tenrec  ----------------------------------------------------------------------
                   Aardvark  ----------------------------------------------------------------------
                  Armadillo  ----------------------------------------------------------------------
                       Pika  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
                    Megabat  ======================================================================
            Tasmanian devil  ======================================================================
         American alligator  ======================================================================
                    Opossum  ======================================================================
                   Platypus  ======================================================================
                    Wallaby  ======================================================================
            Star-nosed mole  ----------------------------------------------------------------------
           Black flying-fox  ======================================================================
       David's myotis (bat)  ----------------------------------------------------------------------
              Big brown bat  ----------------------------------------------------------------------
                   Microbat  ----------------------------------------------------------------------

                      Human  ----tgttatg
                      Chimp  ----tgttatg
                    Gorilla  ----tgttatg
                  Orangutan  ----tgttaag
                     Gibbon  ----tgttatg
                     Rhesus  ----tgttgtg
        Crab-eating macaque  ----tgttgtg
                     Baboon  ----tgttgtg
               Green monkey  ----tgttgtg
                   Marmoset  ----tcttatg
            Squirrel monkey  ----tcttctg
                   Bushbaby  ----tgttata
         Chinese tree shrew  ----tgttact
                   Squirrel  ggcatgttgtc
     Lesser Egyptian jerboa  ----tactctt
               Prairie vole  ----tattaca
            Chinese hamster  ----tattgca
             Golden hamster  ----tattaca
                      Mouse  ----tttcttt
                        Rat  ----cattgca
             Naked mole-rat  ----cattatg
                 Guinea pig  ----tgttatg
                 Chinchilla  ----tgttatg
           Brush-tailed rat  ----tgttgtg
                     Alpaca  ----cattatg
             Bactrian camel  ----cattatg
                    Dolphin  ----tattatg
               Killer whale  ----tattatg
           Tibetan antelope  ----tattatg
                        Cow  ----tatta--
                      Sheep  ----tgttatg
              Domestic goat  ----tgttatg
                      Horse  ----tattagg
           White rhinoceros  ----tattagg
                        Cat  ----tattatg
                        Dog  ----tattatg
                    Ferret   ----tattatg
                      Panda  ----tattatg
             Pacific walrus  ----ta-----
               Weddell seal  ----ta-----
                   Hedgehog  ----tattatg
                   Elephant  ----tgtgatg
        Cape elephant shrew  ----tgtaatg
                    Manatee  ----tgttatg
           Cape golden mole  ----tgttatg
                     Tenrec  ----tgttctg
                   Aardvark  ----tattatg
                  Armadillo  ----tgttatg
                       Pika  ===========
                        Pig  ===========
                     Rabbit  ===========
                    Megabat  ===========
            Tasmanian devil  ===========
         American alligator  ===========
                    Opossum  ===========
                   Platypus  ===========
                    Wallaby  ===========
            Star-nosed mole  -----------
           Black flying-fox  ===========
       David's myotis (bat)  -----------
              Big brown bat  -----------
                   Microbat  -----------

Inserts between block 10 and 11 in window
B D                    Cow 2bp
            Pacific walrus 1bp
              Weddell seal 1bp
       Cape elephant shrew 10373bp

Alignment block 11 of 467 in window, 180553222 - 180553225, 4 bps 
B D                   Human  ctct
B D                   Chimp  ctct
B D                 Gorilla  ctct
B D               Orangutan  ctct
B D                  Gibbon  ctct
B D                  Rhesus  ctct
B D     Crab-eating macaque  ctct
B D                  Baboon  ctct
B D            Green monkey  ctct
B D                Marmoset  tgct
B D         Squirrel monkey  tgct
B D                Bushbaby  ctct
         Chinese tree shrew  ctct
B D                Squirrel  catc
     Lesser Egyptian jerboa  catt
               Prairie vole  ctgt
B D         Chinese hamster  ctct
             Golden hamster  cttt
B D                   Mouse  cttt
B D                     Rat  ctct
B D          Naked mole-rat  ctct
B D              Guinea pig  ctct
                 Chinchilla  ctct
           Brush-tailed rat  ctat
B D                  Alpaca  ttct
             Bactrian camel  ttct
B D                 Dolphin  cttt
               Killer whale  cttt
           Tibetan antelope  gttt
B D                   Sheep  gttt
              Domestic goat  gttt
B D                   Horse  ctct
B D        White rhinoceros  ccct
B D                     Cat  ctct
B D                     Dog  ctct
B D                 Ferret   ctct
B D                   Panda  ctct
B D                Hedgehog  ttct
            Star-nosed mole  tttt
B D                Elephant  ctct
B D                 Manatee  ctct
           Cape golden mole  ctct
B D                  Tenrec  ctct
                   Aardvark  ctgt
B D               Armadillo  ctct
B D                    Pika  ====
              Weddell seal  ====
B D                     Pig  ====
B D                  Rabbit  ====
B D                 Megabat  ====
B D         Tasmanian devil  ====
B D      American alligator  ====
B D                 Opossum  ====
       Cape elephant shrew  ====
B D                Platypus  ====
B D                 Wallaby  ====
            Pacific walrus  ====
          Black flying-fox  ====
      David's myotis (bat)  ----
             Big brown bat  ----
B D                Microbat  ----
B D                     Cow  ====

Inserts between block 11 and 12 in window
B D                Dolphin 2bp
B D                  Horse 3bp
B D       White rhinoceros 3bp
B D                    Cat 3bp
B D                    Dog 3bp
B D                Ferret  7bp
B D                  Panda 8bp
B D               Hedgehog 1bp
           Star-nosed mole 1bp
B D                 Tenrec 26bp

Alignment block 12 of 467 in window, 180553226 - 180553229, 4 bps 
B D                   Human  a---ctt
B D                   Chimp  a---ctt
B D                 Gorilla  a---ctt
B D               Orangutan  a---ctt
B D                  Gibbon  a---ctt
B D                  Rhesus  a---ctt
B D     Crab-eating macaque  a---ctt
B D                  Baboon  a---gtt
B D            Green monkey  a---ctt
B D                Marmoset  a---ctt
B D         Squirrel monkey  a---cgt
B D                Bushbaby  a---ctt
         Chinese tree shrew  t---ttt
B D                Squirrel  t------
     Lesser Egyptian jerboa  t------
               Prairie vole  t------
B D         Chinese hamster  t------
             Golden hamster  t------
B D                   Mouse  c------
B D                     Rat  t------
B D          Naked mole-rat  gccc---
B D              Guinea pig  gca----
                 Chinchilla  gcct---
           Brush-tailed rat  gcc----
B D                  Alpaca  ------t
             Bactrian camel  ------t
B D                 Dolphin  ------g
           Tibetan antelope  ------t
B D                   Sheep  ------t
              Domestic goat  ------t
B D                Elephant  ---attt
B D                 Manatee  ---actt
           Cape golden mole  ---atgt
                   Aardvark  ---acgt
B D               Armadillo  ---actt
B D                    Pika  =======
              Weddell seal  =======
B D                Hedgehog  =======
B D                     Pig  =======
B D                  Rabbit  =======
B D                 Megabat  =======
B D         Tasmanian devil  =======
B D      American alligator  =======
B D                 Opossum  =======
       Cape elephant shrew  =======
B D                Platypus  =======
B D                 Wallaby  =======
B D                  Tenrec  =======
B D                     Cat  =======
B D                 Ferret   =======
           Star-nosed mole  =======
            Pacific walrus  =======
B D                   Panda  =======
              Killer whale  -------
B D                     Dog  =======
          Black flying-fox  =======
B D        White rhinoceros  =======
B D                   Horse  =======
      David's myotis (bat)  -------
             Big brown bat  -------
B D                Microbat  -------
B D                     Cow  =======

Inserts between block 12 and 13 in window
B D               Bushbaby 12bp
B D               Squirrel 17bp
    Lesser Egyptian jerboa 1bp
              Prairie vole 20bp
B D        Chinese hamster 37bp
            Golden hamster 67bp
B D                  Mouse 3bp
B D                    Rat 3bp
B D                 Alpaca 3bp
            Bactrian camel 3bp
B D                Dolphin 3bp
          Tibetan antelope 2bp
B D                  Sheep 3bp
             Domestic goat 3bp

Alignment block 13 of 467 in window, 180553230 - 180553230, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  g
B D                  Gibbon  g
B D                  Rhesus  g
B D     Crab-eating macaque  g
B D                  Baboon  g
B D            Green monkey  g
B D                Marmoset  g
B D         Squirrel monkey  g
B D          Naked mole-rat  t
B D              Guinea pig  t
                 Chinchilla  t
           Brush-tailed rat  t
B D                  Alpaca  t
             Bactrian camel  t
B D                 Dolphin  g
B D                     Cow  t
B D                   Sheep  t
              Domestic goat  t
B D                   Horse  t
B D        White rhinoceros  t
B D                     Cat  t
B D                     Dog  t
B D                 Ferret   t
             Pacific walrus  g
               Weddell seal  g
B D                Hedgehog  t
            Star-nosed mole  t
B D                Elephant  t
B D                 Manatee  t
           Cape golden mole  g
                   Aardvark  t
B D               Armadillo  t
B D                     Rat  =
              Prairie vole  =
            Golden hamster  =
B D                   Mouse  =
    Lesser Egyptian jerboa  =
B D                    Pika  =
B D                     Pig  =
B D                  Rabbit  =
B D                 Megabat  =
B D         Tasmanian devil  =
B D      American alligator  =
B D                 Opossum  =
       Cape elephant shrew  =
        Chinese tree shrew  -
B D                Platypus  =
B D                 Wallaby  =
B D         Chinese hamster  =
B D                  Tenrec  =
B D                Bushbaby  =
          Tibetan antelope  =
B D                   Panda  =
              Killer whale  -
          Black flying-fox  =
B D                Squirrel  =
      David's myotis (bat)  -
             Big brown bat  -
B D                Microbat  -

Inserts between block 13 and 14 in window
          Cape golden mole 347bp
                  Aardvark 2bp

Alignment block 14 of 467 in window, 180553231 - 180553233, 3 bps 
B D                   Human  ----------ttt
B D                   Chimp  ----------ttt
B D                 Gorilla  ----------ttt
B D               Orangutan  ----------ttt
B D                  Gibbon  ----------ttt
B D                  Rhesus  ----------ttt
B D     Crab-eating macaque  ----------ttt
B D                  Baboon  ----------ttt
B D            Green monkey  ----------ttt
B D                Marmoset  ----------ttt
B D         Squirrel monkey  ----------ttt
         Chinese tree shrew  -----------gt
B D          Naked mole-rat  ----------ttc
B D              Guinea pig  ----------ttg
                 Chinchilla  ----------ttt
           Brush-tailed rat  ----------ttt
B D                  Alpaca  ----------ttt
             Bactrian camel  ----------ttt
B D                 Dolphin  ----------tgt
B D                     Cow  ----------ttt
B D                   Sheep  ----------ttt
              Domestic goat  ----------ttt
B D                   Horse  ----------ttt
B D        White rhinoceros  ----------ttt
B D                     Cat  ----------ttt
B D                     Dog  ----------ttt
B D                 Ferret   ----------ttt
             Pacific walrus  ----------ttt
               Weddell seal  ----------ttt
B D                Hedgehog  ----------ttt
            Star-nosed mole  ----------ttt
B D                Elephant  tgtgtgtgtgtg-
B D                 Manatee  t---------tt-
                   Aardvark  ----------tt-
B D               Armadillo  ----------tt-
B D                     Rat  =============
              Prairie vole  =============
            Golden hamster  =============
B D                   Mouse  =============
    Lesser Egyptian jerboa  =============
B D                    Pika  =============
B D                     Pig  =============
B D                  Rabbit  =============
          Cape golden mole  =============
B D                 Megabat  =============
B D         Tasmanian devil  =============
B D      American alligator  =============
B D                 Opossum  =============
       Cape elephant shrew  =============
B D                Platypus  =============
B D                 Wallaby  =============
B D         Chinese hamster  =============
B D                  Tenrec  =============
B D                Bushbaby  =============
          Tibetan antelope  =============
B D                   Panda  =============
              Killer whale  -------------
          Black flying-fox  =============
B D                Squirrel  =============
      David's myotis (bat)  -------------
             Big brown bat  -------------
B D                Microbat  -------------

Inserts between block 14 and 15 in window
B D                  Horse 1bp
B D       White rhinoceros 2bp
B D               Hedgehog 1bp
           Star-nosed mole 1bp
                  Aardvark 1bp
B D              Armadillo 1bp

Alignment block 15 of 467 in window, 180553234 - 180553234, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
B D            Green monkey  t
B D                Marmoset  t
B D         Squirrel monkey  t
         Chinese tree shrew  g
B D          Naked mole-rat  t
B D              Guinea pig  t
                 Chinchilla  t
           Brush-tailed rat  t
B D                  Alpaca  t
             Bactrian camel  t
B D                 Dolphin  g
B D                     Cow  t
B D                   Sheep  t
              Domestic goat  t
B D                   Horse  t
B D                     Cat  t
B D                     Dog  t
B D                 Ferret   t
             Pacific walrus  t
               Weddell seal  t
B D                Hedgehog  t
            Star-nosed mole  g
B D                Elephant  t
B D                 Manatee  t
B D               Armadillo  t
B D                     Rat  =
              Prairie vole  =
            Golden hamster  =
B D                   Mouse  =
    Lesser Egyptian jerboa  =
B D                    Pika  =
B D                     Pig  =
B D                  Rabbit  =
          Cape golden mole  =
                  Aardvark  =
B D                 Megabat  =
B D         Tasmanian devil  =
B D      American alligator  =
B D                 Opossum  =
       Cape elephant shrew  =
B D                Platypus  =
B D                 Wallaby  =
B D         Chinese hamster  =
B D                  Tenrec  =
B D                Bushbaby  =
          Tibetan antelope  =
B D                   Panda  =
              Killer whale  -
          Black flying-fox  =
B D        White rhinoceros  =
B D                Squirrel  =
      David's myotis (bat)  -
             Big brown bat  -
B D                Microbat  -

Inserts between block 15 and 16 in window
B D                 Alpaca 11bp
B D                Dolphin 5bp
B D                    Cow 5bp
B D                  Sheep 5bp
             Domestic goat 5bp
B D                  Horse 2bp
B D                    Cat 1bp
B D                    Dog 2bp
B D                Ferret  2bp
            Pacific walrus 2bp
              Weddell seal 2bp

Alignment block 16 of 467 in window, 180553235 - 180553237, 3 bps 
B D                   Human  --gca
B D                   Chimp  --gca
B D                 Gorilla  --gca
B D               Orangutan  --gca
B D                  Gibbon  --gca
B D                  Rhesus  --gca
B D     Crab-eating macaque  --gca
B D                  Baboon  --gca
B D            Green monkey  --gca
B D                Marmoset  --gca
B D         Squirrel monkey  --gca
         Chinese tree shrew  --gtg
B D          Naked mole-rat  --gtg
B D              Guinea pig  --gtc
                 Chinchilla  --gtg
           Brush-tailed rat  --gtg
B D                 Dolphin  --g--
B D                     Cow  --g--
B D                   Sheep  --g--
              Domestic goat  --g--
B D                   Horse  --a--
B D                     Dog  --a--
B D                 Ferret   --g--
             Pacific walrus  --a--
               Weddell seal  --a--
B D                Hedgehog  --g--
            Star-nosed mole  --g--
B D                Elephant  gtg--
B D                 Manatee  gtg--
B D               Armadillo  gtg--
B D                     Rat  =====
              Prairie vole  =====
            Golden hamster  =====
B D                   Mouse  =====
    Lesser Egyptian jerboa  =====
B D                    Pika  =====
B D                     Pig  =====
B D                  Rabbit  =====
          Cape golden mole  =====
                  Aardvark  =====
B D                 Megabat  =====
B D         Tasmanian devil  =====
B D      American alligator  =====
B D                 Opossum  =====
       Cape elephant shrew  =====
B D                Platypus  =====
B D                 Wallaby  =====
B D         Chinese hamster  =====
B D                  Tenrec  =====
B D                     Cat  =====
B D                Bushbaby  =====
          Tibetan antelope  =====
            Bactrian camel  -----
B D                  Alpaca  =====
B D                   Panda  =====
              Killer whale  -----
          Black flying-fox  =====
B D        White rhinoceros  =====
B D                Squirrel  =====
      David's myotis (bat)  -----
             Big brown bat  -----
B D                Microbat  -----

Inserts between block 16 and 17 in window
B D                    Dog 2bp
B D               Hedgehog 2bp
           Star-nosed mole 2bp

Alignment block 17 of 467 in window, 180553238 - 180553238, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
         Chinese tree shrew  a
B D          Naked mole-rat  a
B D              Guinea pig  a
                 Chinchilla  a
           Brush-tailed rat  a
B D                 Dolphin  a
B D                     Cow  a
B D                   Sheep  a
              Domestic goat  a
B D                   Horse  a
B D                     Dog  g
             Pacific walrus  a
               Weddell seal  a
B D                Hedgehog  g
            Star-nosed mole  a
B D                Elephant  a
B D                 Manatee  a
B D               Armadillo  a
B D                     Rat  =
              Prairie vole  =
            Golden hamster  =
B D                   Mouse  =
    Lesser Egyptian jerboa  =
B D                    Pika  =
B D                     Pig  =
B D                  Rabbit  =
          Cape golden mole  =
                  Aardvark  =
B D                 Megabat  =
B D         Tasmanian devil  =
B D      American alligator  =
B D                 Opossum  =
       Cape elephant shrew  =
B D                Platypus  =
B D                 Wallaby  =
B D         Chinese hamster  =
B D                  Tenrec  =
B D                     Cat  =
B D                Bushbaby  =
B D                 Ferret   -
          Tibetan antelope  =
            Bactrian camel  -
B D                  Alpaca  =
B D                   Panda  =
              Killer whale  -
          Black flying-fox  =
B D        White rhinoceros  =
B D                Squirrel  =
      David's myotis (bat)  -
             Big brown bat  -
B D                Microbat  -

Inserts between block 17 and 18 in window
            Pacific walrus 20bp

Alignment block 18 of 467 in window, 180553239 - 180553242, 4 bps 
B D                   Human  ct---at
B D                   Chimp  ct---at
B D                 Gorilla  ct---at
B D               Orangutan  ct---at
B D                  Gibbon  ct---at
B D                  Rhesus  ct---at
B D     Crab-eating macaque  ct---at
B D                  Baboon  ct---at
B D            Green monkey  ct---at
B D                Marmoset  ct---gt
B D         Squirrel monkey  ct---gt
         Chinese tree shrew  ct---at
B D          Naked mole-rat  ct---at
B D              Guinea pig  ct---at
                 Chinchilla  ct---at
           Brush-tailed rat  ct---at
B D                 Dolphin  ct---at
B D                     Cow  ct---at
B D                   Sheep  ct---at
              Domestic goat  ct---at
B D                   Horse  ct---at
B D                     Dog  ct---at
               Weddell seal  ctaaaaa
B D                Hedgehog  ---tgat
            Star-nosed mole  ---agat
B D                Elephant  ca---at
B D                 Manatee  ca---ac
B D               Armadillo  tt---at
B D                     Rat  =======
              Prairie vole  =======
            Golden hamster  =======
B D                   Mouse  =======
    Lesser Egyptian jerboa  =======
B D                    Pika  =======
B D                     Pig  =======
B D                  Rabbit  =======
          Cape golden mole  =======
                  Aardvark  =======
B D                 Megabat  =======
B D         Tasmanian devil  =======
B D      American alligator  =======
B D                 Opossum  =======
       Cape elephant shrew  =======
B D                Platypus  =======
B D                 Wallaby  =======
B D         Chinese hamster  =======
B D                  Tenrec  =======
B D                     Cat  =======
B D                Bushbaby  =======
B D                 Ferret   -------
          Tibetan antelope  =======
            Bactrian camel  -------
B D                  Alpaca  =======
            Pacific walrus  =======
B D                   Panda  =======
              Killer whale  -------
          Black flying-fox  =======
B D        White rhinoceros  =======
B D                Squirrel  =======
      David's myotis (bat)  -------
             Big brown bat  -------
B D                Microbat  -------

Alignment block 19 of 467 in window, 180553243 - 180553245, 3 bps 
B D                   Human  a-------ct
B D                   Chimp  a-------ct
B D                 Gorilla  a-------ct
B D               Orangutan  a-------ct
B D                  Gibbon  attattattt
B D                  Rhesus  a-------ct
B D     Crab-eating macaque  a-------ct
B D                  Baboon  a-------ct
B D            Green monkey  a-------ct
B D                Marmoset  a-------ca
B D         Squirrel monkey  a-------cc
         Chinese tree shrew  a-------cc
B D          Naked mole-rat  a-------cc
B D              Guinea pig  a-------ac
                 Chinchilla  a-------cc
           Brush-tailed rat  a-------cc
             Bactrian camel  --------tt
               Killer whale  --------tt
B D                     Cow  a-------tt
B D                   Sheep  a-------tt
              Domestic goat  a-------tt
B D                   Horse  a-------ct
B D                     Cat  --------tt
B D                     Dog  a-------ct
               Weddell seal  a-------ct
B D                Hedgehog  a-------ac
B D                Elephant  a-------cc
B D                 Manatee  c-------ct
B D               Armadillo  a-------cc
B D                     Rat  ==========
              Prairie vole  ==========
            Golden hamster  ==========
B D                   Mouse  ==========
    Lesser Egyptian jerboa  ==========
B D                    Pika  ==========
B D                     Pig  ==========
B D                  Rabbit  ==========
          Cape golden mole  ==========
                  Aardvark  ==========
B D                 Megabat  ==========
B D                 Dolphin  ----------
B D         Tasmanian devil  ==========
B D      American alligator  ==========
B D                 Opossum  ==========
       Cape elephant shrew  ==========
B D                Platypus  ==========
B D                 Wallaby  ==========
B D         Chinese hamster  ==========
B D                  Tenrec  ==========
B D                Bushbaby  ==========
B D                 Ferret   ----------
           Star-nosed mole  ----------
          Tibetan antelope  ==========
B D                  Alpaca  ==========
            Pacific walrus  ==========
B D                   Panda  ==========
          Black flying-fox  ==========
B D        White rhinoceros  ==========
B D                Squirrel  ==========
      David's myotis (bat)  ----------
             Big brown bat  ----------
B D                Microbat  ----------

Inserts between block 19 and 20 in window
B D                Manatee 1516bp

Alignment block 20 of 467 in window, 180553246 - 180553249, 4 bps 
B D                   Human  at----tt
B D                   Chimp  at----tt
B D                 Gorilla  at----tt
B D               Orangutan  ac----tt
B D                  Gibbon  at----tt
B D                  Rhesus  at----tt
B D     Crab-eating macaque  at----tt
B D                  Baboon  at----tt
B D            Green monkey  at----tt
B D                Marmoset  ct----tt
B D         Squirrel monkey  ct----tt
         Chinese tree shrew  ct----tt
B D          Naked mole-rat  g-------
B D              Guinea pig  c-------
                 Chinchilla  c-------
           Brush-tailed rat  c-------
             Bactrian camel  tt------
               Killer whale  gt------
B D                     Cow  ct------
B D                   Sheep  ct------
              Domestic goat  ct------
B D                   Horse  tt------
B D                     Cat  tt------
B D                     Dog  ct------
               Weddell seal  cc------
B D                Hedgehog  cttta---
B D                Elephant  ----cttt
B D               Armadillo  ----atgt
B D                     Rat  ========
              Prairie vole  ========
            Golden hamster  ========
B D                   Mouse  ========
    Lesser Egyptian jerboa  ========
B D                    Pika  ========
B D                     Pig  ========
B D                  Rabbit  ========
          Cape golden mole  ========
                  Aardvark  ========
B D                 Megabat  ========
B D                 Dolphin  --------
B D         Tasmanian devil  ========
B D      American alligator  ========
B D                 Opossum  ========
       Cape elephant shrew  ========
B D                Platypus  ========
B D                 Wallaby  ========
B D                 Manatee  ========
B D         Chinese hamster  ========
B D                  Tenrec  ========
B D                Bushbaby  ========
B D                 Ferret   --------
           Star-nosed mole  --------
          Tibetan antelope  ========
B D                  Alpaca  ========
            Pacific walrus  ========
B D                   Panda  ========
          Black flying-fox  ========
B D        White rhinoceros  ========
B D                Squirrel  ========
      David's myotis (bat)  --------
             Big brown bat  --------
B D                Microbat  --------

Inserts between block 20 and 21 in window
B D         Naked mole-rat 1bp
B D             Guinea pig 1bp
                Chinchilla 1bp
              Killer whale 3bp
B D                    Cow 131bp
B D                  Sheep 188bp
             Domestic goat 162bp
B D                  Horse 99bp
B D                    Dog 5bp

Alignment block 21 of 467 in window, 180553250 - 180553250, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
         Chinese tree shrew  a
B D                Elephant  a
B D                     Rat  =
              Prairie vole  =
            Golden hamster  =
B D                   Mouse  =
    Lesser Egyptian jerboa  =
B D                    Pika  =
              Weddell seal  -
B D                Hedgehog  -
B D              Guinea pig  =
B D                     Pig  =
B D                  Rabbit  =
          Cape golden mole  =
                  Aardvark  =
B D                 Megabat  =
B D                 Dolphin  -
B D         Tasmanian devil  =
B D      American alligator  =
B D                 Opossum  =
B D          Naked mole-rat  =
          Brush-tailed rat  -
                Chinchilla  =
       Cape elephant shrew  =
B D                Platypus  =
B D                 Wallaby  =
B D                 Manatee  =
B D         Chinese hamster  =
B D                  Tenrec  =
B D                     Cat  -
B D                Bushbaby  =
B D                 Ferret   -
           Star-nosed mole  -
             Domestic goat  =
B D                   Sheep  =
          Tibetan antelope  =
            Bactrian camel  -
B D                  Alpaca  =
            Pacific walrus  =
B D                   Panda  =
              Killer whale  =
B D                     Dog  =
          Black flying-fox  =
B D        White rhinoceros  =
B D                   Horse  =
B D                Squirrel  =
B D               Armadillo  -
      David's myotis (bat)  -
             Big brown bat  -
B D                Microbat  -
B D                     Cow  =

Inserts between block 21 and 22 in window
        Chinese tree shrew 142bp
B D               Elephant 1231bp

Alignment block 22 of 467 in window, 180553251 - 180553253, 3 bps 
B D                   Human  ttt
B D                   Chimp  ttt
B D                 Gorilla  ttt
B D               Orangutan  ttt
B D                  Gibbon  ttt
B D                  Rhesus  ttt
B D     Crab-eating macaque  ttt
B D                  Baboon  ttt
B D            Green monkey  ttt
B D                Marmoset  ttt
B D         Squirrel monkey  ttt
B D                     Cat  --t
B D                     Rat  ===
              Prairie vole  ===
            Golden hamster  ===
B D                   Mouse  ===
    Lesser Egyptian jerboa  ===
B D                    Pika  ===
              Weddell seal  ---
B D                Hedgehog  ---
B D              Guinea pig  ===
B D                     Pig  ===
B D                  Rabbit  ===
          Cape golden mole  ===
                  Aardvark  ===
B D                 Megabat  ===
B D                 Dolphin  ---
B D         Tasmanian devil  ===
B D      American alligator  ===
B D                 Opossum  ===
B D          Naked mole-rat  ===
          Brush-tailed rat  ---
                Chinchilla  ===
       Cape elephant shrew  ===
        Chinese tree shrew  ===
B D                Platypus  ===
B D                 Wallaby  ===
B D                 Manatee  ===
B D                Elephant  ===
B D         Chinese hamster  ===
B D                  Tenrec  ===
B D                Bushbaby  ===
B D                 Ferret   ---
           Star-nosed mole  ---
             Domestic goat  ===
B D                   Sheep  ===
          Tibetan antelope  ===
            Bactrian camel  ---
B D                  Alpaca  ===
            Pacific walrus  ===
B D                   Panda  ===
              Killer whale  ===
B D                     Dog  ===
          Black flying-fox  ===
B D        White rhinoceros  ===
B D                   Horse  ===
B D                Squirrel  ===
B D               Armadillo  ---
      David's myotis (bat)  ---
             Big brown bat  ---
B D                Microbat  ---
B D                     Cow  ===

Alignment block 23 of 467 in window, 180553254 - 180553257, 4 bps 
B D                   Human  attt--
B D                   Chimp  attt--
B D                 Gorilla  attt--
B D               Orangutan  at----
B D                  Gibbon  attt--
B D                  Rhesus  attt--
B D     Crab-eating macaque  attt--
B D                  Baboon  attt--
B D            Green monkey  attt--
B D                Marmoset  attt--
B D         Squirrel monkey  -ttt--
B D                Squirrel  gt----
     Lesser Egyptian jerboa  ct----
               Prairie vole  tt----
B D         Chinese hamster  at----
B D                   Mouse  ct----
B D                     Rat  gt----
             Bactrian camel  -----t
               Killer whale  ---tgt
           Tibetan antelope  ----tt
B D                     Cat  --tttt
B D                Hedgehog  -----a
            Golden hamster  ======
B D                    Pika  ======
              Weddell seal  ------
B D              Guinea pig  ======
B D                     Pig  ======
B D                  Rabbit  ======
          Cape golden mole  ======
                  Aardvark  ======
B D                 Megabat  ======
B D                 Dolphin  ------
B D         Tasmanian devil  ======
B D      American alligator  ======
B D                 Opossum  ======
B D          Naked mole-rat  ======
          Brush-tailed rat  ------
                Chinchilla  ======
       Cape elephant shrew  ======
        Chinese tree shrew  ======
B D                Platypus  ======
B D                 Wallaby  ======
B D                 Manatee  ======
B D                Elephant  ======
B D                  Tenrec  ======
B D                Bushbaby  ======
B D                 Ferret   ------
           Star-nosed mole  ------
             Domestic goat  ======
B D                   Sheep  ======
B D                  Alpaca  ======
            Pacific walrus  ======
B D                   Panda  ======
B D                     Dog  ======
          Black flying-fox  ======
B D        White rhinoceros  ======
B D                   Horse  ======
B D               Armadillo  ------
      David's myotis (bat)  ------
             Big brown bat  ------
B D                Microbat  ------
B D                     Cow  ======

Inserts between block 23 and 24 in window
B D                 Rhesus 193bp
    Lesser Egyptian jerboa 1bp
              Prairie vole 69bp
B D                  Mouse 1bp
B D                    Rat 1bp

Alignment block 24 of 467 in window, 180553258 - 180553259, 2 bps 
B D                   Human  at
B D                   Chimp  at
B D                 Gorilla  at
B D                  Gibbon  at
B D                Marmoset  at
B D         Squirrel monkey  at
B D                Squirrel  gt
     Lesser Egyptian jerboa  tt
B D         Chinese hamster  at
B D                   Mouse  tc
B D                     Rat  at
             Bactrian camel  tt
               Killer whale  gt
           Tibetan antelope  tt
B D                     Cat  tt
B D                Hedgehog  at
              Prairie vole  ==
            Golden hamster  ==
B D                    Pika  ==
              Weddell seal  --
B D              Guinea pig  ==
B D                  Baboon  --
B D                     Pig  ==
B D                  Rabbit  ==
          Cape golden mole  ==
                  Aardvark  ==
B D                 Megabat  ==
B D                 Dolphin  --
B D            Green monkey  --
B D     Crab-eating macaque  --
B D                  Rhesus  ==
B D         Tasmanian devil  ==
B D      American alligator  ==
B D                 Opossum  ==
B D          Naked mole-rat  ==
          Brush-tailed rat  --
                Chinchilla  ==
       Cape elephant shrew  ==
        Chinese tree shrew  ==
B D                Platypus  ==
B D                 Wallaby  ==
B D                 Manatee  ==
B D                Elephant  ==
B D                  Tenrec  ==
B D                Bushbaby  ==
B D                 Ferret   --
B D               Orangutan  --
           Star-nosed mole  --
             Domestic goat  ==
B D                   Sheep  ==
B D                  Alpaca  ==
            Pacific walrus  ==
B D                   Panda  ==
B D                     Dog  ==
          Black flying-fox  ==
B D        White rhinoceros  ==
B D                   Horse  ==
B D               Armadillo  --
      David's myotis (bat)  --
             Big brown bat  --
B D                Microbat  --
B D                     Cow  ==

Inserts between block 24 and 25 in window
B D               Squirrel 21bp
    Lesser Egyptian jerboa 11bp
B D        Chinese hamster 16bp
B D                  Mouse 17bp
B D                    Rat 72bp
B D               Hedgehog 6bp

Alignment block 25 of 467 in window, 180553260 - 180553274, 15 bps 
B D                   Human  ttatttatttattta
B D                   Chimp  ttatttat-------
B D                 Gorilla  ttatttat-------
B D                  Gibbon  ttatttat-------
B D                Marmoset  ttatat---------
B D         Squirrel monkey  ttattt---------
B D                Squirrel  ttatttattgtggta
     Lesser Egyptian jerboa  ttaattattacgtaa
B D         Chinese hamster  atacatatatatata
B D                   Mouse  ttctttctttcttcc
B D          Naked mole-rat  ttacatactaat-ca
B D              Guinea pig  ttatataataatgca
                 Chinchilla  ttatgtagtgatgta
           Brush-tailed rat  ttacataggaatgca
             Bactrian camel  tttt-----------
               Killer whale  gtgtgtgactatata
           Tibetan antelope  ttttctgactacatt
B D                     Cat  ttttgtggctatacc
               Weddell seal  ttttttggctataat
B D                Hedgehog  ctatccagttacgta
            Star-nosed mole  ttacttacttataca
B D                     Rat  ===============
              Prairie vole  ===============
            Golden hamster  ===============
B D                    Pika  ===============
B D                  Baboon  ---------------
B D                     Pig  ===============
B D                  Rabbit  ===============
          Cape golden mole  ===============
                  Aardvark  ===============
B D                 Megabat  ===============
B D                 Dolphin  ---------------
B D            Green monkey  ---------------
B D     Crab-eating macaque  ---------------
B D                  Rhesus  ===============
B D         Tasmanian devil  ===============
B D      American alligator  ===============
B D                 Opossum  ===============
       Cape elephant shrew  ===============
        Chinese tree shrew  ===============
B D                Platypus  ===============
B D                 Wallaby  ===============
B D                 Manatee  ===============
B D                Elephant  ===============
B D                  Tenrec  ===============
B D                Bushbaby  ===============
B D                 Ferret   ---------------
B D               Orangutan  ---------------
             Domestic goat  ===============
B D                   Sheep  ===============
B D                  Alpaca  ===============
            Pacific walrus  ===============
B D                   Panda  ===============
B D                     Dog  ===============
          Black flying-fox  ===============
B D        White rhinoceros  ===============
B D                   Horse  ===============
B D               Armadillo  ---------------
      David's myotis (bat)  ---------------
             Big brown bat  ---------------
B D                Microbat  ---------------
B D                     Cow  ===============

Inserts between block 25 and 26 in window
              Killer whale 4bp
          Tibetan antelope 190bp
B D                    Cat 1bp
              Weddell seal 1bp

Alignment block 26 of 467 in window, 180553275 - 180553275, 1 bps 
B D                   Human  -t
B D          Naked mole-rat  -g
B D              Guinea pig  -g
                 Chinchilla  -g
           Brush-tailed rat  -a
B D                     Cat  t-
               Weddell seal  t-
B D                Hedgehog  t-
            Star-nosed mole  t-
B D                     Rat  ==
              Prairie vole  ==
            Golden hamster  ==
B D                   Mouse  --
    Lesser Egyptian jerboa  --
B D                    Pika  ==
B D                 Gorilla  --
B D                  Baboon  --
B D                     Pig  ==
B D                  Rabbit  ==
          Cape golden mole  ==
                  Aardvark  ==
B D                 Megabat  ==
B D                 Dolphin  --
B D            Green monkey  --
B D     Crab-eating macaque  --
B D                  Rhesus  ==
B D                  Gibbon  --
B D         Tasmanian devil  ==
B D      American alligator  ==
B D                 Opossum  ==
       Cape elephant shrew  ==
        Chinese tree shrew  ==
B D                Platypus  ==
B D                 Wallaby  ==
B D                 Manatee  ==
B D                Elephant  ==
B D         Chinese hamster  --
B D                  Tenrec  ==
B D                Bushbaby  ==
B D                 Ferret   --
B D               Orangutan  --
             Domestic goat  ==
B D                   Sheep  ==
          Tibetan antelope  ==
            Bactrian camel  --
B D                  Alpaca  ==
            Pacific walrus  ==
B D                   Panda  ==
              Killer whale  ==
B D                     Dog  ==
          Black flying-fox  ==
B D        White rhinoceros  ==
B D                   Horse  ==
B D                Squirrel  --
B D               Armadillo  --
      David's myotis (bat)  --
             Big brown bat  --
B D                Microbat  --
B D         Squirrel monkey  --
B D                Marmoset  --
B D                     Cow  ==
B D                   Chimp  --

Inserts between block 26 and 27 in window
B D               Hedgehog 5626bp

Alignment block 27 of 467 in window, 180553276 - 180553281, 6 bps 
B D                   Human  ttagtt
B D          Naked mole-rat  ccactt
B D              Guinea pig  cca---
                 Chinchilla  ccagtt
           Brush-tailed rat  ccagtt
               Killer whale  ttaagt
B D                     Cat  ttaact
               Weddell seal  ttaagt
B D                     Rat  ======
              Prairie vole  ======
            Golden hamster  ======
B D                   Mouse  ------
    Lesser Egyptian jerboa  ------
B D                    Pika  ======
B D                 Gorilla  ------
B D                Hedgehog  ======
B D                  Baboon  ------
B D                     Pig  ======
B D                  Rabbit  ======
          Cape golden mole  ======
                  Aardvark  ======
B D                 Megabat  ======
B D                 Dolphin  ------
B D            Green monkey  ------
B D     Crab-eating macaque  ------
B D                  Rhesus  ======
B D                  Gibbon  ------
B D         Tasmanian devil  ======
B D      American alligator  ======
B D                 Opossum  ======
       Cape elephant shrew  ======
        Chinese tree shrew  ======
B D                Platypus  ======
B D                 Wallaby  ======
B D                 Manatee  ======
B D                Elephant  ======
B D         Chinese hamster  ------
B D                  Tenrec  ======
B D                Bushbaby  ======
B D                 Ferret   ------
B D               Orangutan  ------
           Star-nosed mole  ------
             Domestic goat  ======
B D                   Sheep  ======
          Tibetan antelope  ======
            Bactrian camel  ------
B D                  Alpaca  ======
            Pacific walrus  ======
B D                   Panda  ======
B D                     Dog  ======
          Black flying-fox  ======
B D        White rhinoceros  ======
B D                   Horse  ======
B D                Squirrel  ------
B D               Armadillo  ------
      David's myotis (bat)  ------
             Big brown bat  ------
B D                Microbat  ------
B D         Squirrel monkey  ------
B D                Marmoset  ------
B D                     Cow  ======
B D                   Chimp  ------

Inserts between block 27 and 28 in window
              Killer whale 89bp

Alignment block 28 of 467 in window, 180553282 - 180553290, 9 bps 
B D                   Human  ----agttagtta
B D                   Chimp  ------ttagtta
B D                  Gibbon  ------ttattta
B D          Naked mole-rat  ----attta----
                 Chinchilla  ----agtta----
           Brush-tailed rat  ----agtta----
B D                     Cat  accaaagga----
               Weddell seal  atcaaaata----
B D                     Rat  =============
              Prairie vole  =============
            Golden hamster  =============
B D                   Mouse  -------------
    Lesser Egyptian jerboa  -------------
B D                    Pika  =============
B D                 Gorilla  -------------
B D                Hedgehog  =============
B D              Guinea pig  -------------
B D                  Baboon  -------------
B D                     Pig  =============
B D                  Rabbit  =============
          Cape golden mole  =============
                  Aardvark  =============
B D                 Megabat  =============
B D                 Dolphin  -------------
B D            Green monkey  -------------
B D     Crab-eating macaque  -------------
B D                  Rhesus  =============
B D         Tasmanian devil  =============
B D      American alligator  =============
B D                 Opossum  =============
       Cape elephant shrew  =============
        Chinese tree shrew  =============
B D                Platypus  =============
B D                 Wallaby  =============
B D                 Manatee  =============
B D                Elephant  =============
B D         Chinese hamster  -------------
B D                  Tenrec  =============
B D                Bushbaby  =============
B D                 Ferret   -------------
B D               Orangutan  -------------
           Star-nosed mole  -------------
             Domestic goat  =============
B D                   Sheep  =============
          Tibetan antelope  =============
            Bactrian camel  -------------
B D                  Alpaca  =============
            Pacific walrus  =============
B D                   Panda  =============
              Killer whale  =============
B D                     Dog  =============
          Black flying-fox  =============
B D        White rhinoceros  =============
B D                   Horse  =============
B D                Squirrel  -------------
B D               Armadillo  -------------
      David's myotis (bat)  -------------
             Big brown bat  -------------
B D                Microbat  -------------
B D         Squirrel monkey  -------------
B D                Marmoset  -------------
B D                     Cow  =============

Inserts between block 28 and 29 in window
B D         Naked mole-rat 5bp
                Chinchilla 74bp
              Weddell seal 19226bp

Alignment block 29 of 467 in window, 180553291 - 180553297, 7 bps 
B D                   Human  gttagtt
B D                   Chimp  gttagtt
B D                 Gorilla  -ttagtt
B D               Orangutan  -ttagtt
B D                  Gibbon  tttattt
B D            Green monkey  atttatt
B D                Marmoset  -ttattt
B D         Squirrel monkey  -ttgttt
B D                Squirrel  ctgggta
     Lesser Egyptian jerboa  gctaggc
B D         Chinese hamster  tatattc
B D                   Mouse  tttcttc
B D              Guinea pig  gttagtt
B D                     Cat  gctagtt
B D                     Rat  =======
              Prairie vole  =======
            Golden hamster  =======
B D                    Pika  =======
              Weddell seal  =======
B D                Hedgehog  =======
B D                  Baboon  -------
B D                     Pig  =======
B D                  Rabbit  =======
          Cape golden mole  =======
                  Aardvark  =======
B D                 Megabat  =======
B D                 Dolphin  -------
B D     Crab-eating macaque  -------
B D                  Rhesus  =======
B D         Tasmanian devil  =======
B D      American alligator  =======
B D                 Opossum  =======
B D          Naked mole-rat  =======
          Brush-tailed rat  -------
                Chinchilla  =======
       Cape elephant shrew  =======
        Chinese tree shrew  =======
B D                Platypus  =======
B D                 Wallaby  =======
B D                 Manatee  =======
B D                Elephant  =======
B D                  Tenrec  =======
B D                Bushbaby  =======
B D                 Ferret   -------
           Star-nosed mole  -------
             Domestic goat  =======
B D                   Sheep  =======
          Tibetan antelope  =======
            Bactrian camel  -------
B D                  Alpaca  =======
            Pacific walrus  =======
B D                   Panda  =======
              Killer whale  =======
B D                     Dog  =======
          Black flying-fox  =======
B D        White rhinoceros  =======
B D                   Horse  =======
B D               Armadillo  -------
      David's myotis (bat)  -------
             Big brown bat  -------
B D                Microbat  -------
B D                     Cow  =======

Inserts between block 29 and 30 in window
B D                    Cat 66bp

Alignment block 30 of 467 in window, 180553298 - 180553300, 3 bps 
B D                   Human  ttt
B D                   Chimp  ttt
B D                 Gorilla  ttt
B D               Orangutan  ttt
B D                  Gibbon  att
B D     Crab-eating macaque  -tt
B D                  Baboon  -tt
B D            Green monkey  ttt
B D                Marmoset  ttt
B D         Squirrel monkey  ttt
B D                Squirrel  ttg
     Lesser Egyptian jerboa  gtg
B D         Chinese hamster  ata
B D                   Mouse  ctt
B D              Guinea pig  ccc
           Brush-tailed rat  -ct
B D                     Rat  ===
              Prairie vole  ===
            Golden hamster  ===
B D                    Pika  ===
              Weddell seal  ===
B D                Hedgehog  ===
B D                     Pig  ===
B D                  Rabbit  ===
          Cape golden mole  ===
                  Aardvark  ===
B D                 Megabat  ===
B D                 Dolphin  ---
B D                  Rhesus  ===
B D         Tasmanian devil  ===
B D      American alligator  ===
B D                 Opossum  ===
B D          Naked mole-rat  ===
                Chinchilla  ===
       Cape elephant shrew  ===
        Chinese tree shrew  ===
B D                Platypus  ===
B D                 Wallaby  ===
B D                 Manatee  ===
B D                Elephant  ===
B D                  Tenrec  ===
B D                     Cat  ===
B D                Bushbaby  ===
B D                 Ferret   ---
           Star-nosed mole  ---
             Domestic goat  ===
B D                   Sheep  ===
          Tibetan antelope  ===
            Bactrian camel  ---
B D                  Alpaca  ===
            Pacific walrus  ===
B D                   Panda  ===
              Killer whale  ===
B D                     Dog  ===
          Black flying-fox  ===
B D        White rhinoceros  ===
B D                   Horse  ===
B D               Armadillo  ---
      David's myotis (bat)  ---
             Big brown bat  ---
B D                Microbat  ---
B D                     Cow  ===

Inserts between block 30 and 31 in window
B D                  Mouse 213bp

Alignment block 31 of 467 in window, 180553301 - 180553306, 6 bps 
B D                   Human  gagaca
B D                   Chimp  gagaca
B D                 Gorilla  gagaca
B D               Orangutan  gagaca
B D                  Gibbon  gagatg
B D     Crab-eating macaque  gagaca
B D                  Baboon  gagaca
B D            Green monkey  gagacg
B D                Marmoset  gagatg
B D         Squirrel monkey  gagatg
B D                Squirrel  -----a
     Lesser Egyptian jerboa  gtggcg
B D         Chinese hamster  ----ca
B D              Guinea pig  ----tg
           Brush-tailed rat  ----tg
            Star-nosed mole  ---aca
B D                     Rat  ======
              Prairie vole  ======
            Golden hamster  ======
B D                   Mouse  ======
B D                    Pika  ======
              Weddell seal  ======
B D                Hedgehog  ======
B D                     Pig  ======
B D                  Rabbit  ======
          Cape golden mole  ======
                  Aardvark  ======
B D                 Megabat  ======
B D                 Dolphin  ------
B D                  Rhesus  ======
B D         Tasmanian devil  ======
B D      American alligator  ======
B D                 Opossum  ======
B D          Naked mole-rat  ======
                Chinchilla  ======
       Cape elephant shrew  ======
        Chinese tree shrew  ======
B D                Platypus  ======
B D                 Wallaby  ======
B D                 Manatee  ======
B D                Elephant  ======
B D                  Tenrec  ======
B D                     Cat  ======
B D                Bushbaby  ======
B D                 Ferret   ------
             Domestic goat  ======
B D                   Sheep  ======
          Tibetan antelope  ======
            Bactrian camel  ------
B D                  Alpaca  ======
            Pacific walrus  ======
B D                   Panda  ======
              Killer whale  ======
B D                     Dog  ======
          Black flying-fox  ======
B D        White rhinoceros  ======
B D                   Horse  ======
B D               Armadillo  ------
      David's myotis (bat)  ------
             Big brown bat  ------
B D                Microbat  ------
B D                     Cow  ======

Inserts between block 31 and 32 in window
B D               Squirrel 5bp
    Lesser Egyptian jerboa 4bp
B D        Chinese hamster 113bp
B D             Guinea pig 4bp
          Brush-tailed rat 1bp

Alignment block 32 of 467 in window, 180553307 - 180553311, 5 bps 
B D                   Human  gagtc
B D                   Chimp  gagtc
B D                 Gorilla  gagtc
B D               Orangutan  gagtc
B D                  Gibbon  gagtc
B D     Crab-eating macaque  gagtc
B D                  Baboon  gagtc
B D            Green monkey  gagtc
B D                Marmoset  gagtc
B D         Squirrel monkey  gagtc
B D                Squirrel  gagtg
     Lesser Egyptian jerboa  gagtt
B D              Guinea pig  gtgtt
            Star-nosed mole  gaa--
B D                     Rat  =====
              Prairie vole  =====
            Golden hamster  =====
B D                   Mouse  =====
B D                    Pika  =====
              Weddell seal  =====
B D                Hedgehog  =====
B D                     Pig  =====
B D                  Rabbit  =====
          Cape golden mole  =====
                  Aardvark  =====
B D                 Megabat  =====
B D                 Dolphin  -----
B D                  Rhesus  =====
B D         Tasmanian devil  =====
B D      American alligator  =====
B D                 Opossum  =====
B D          Naked mole-rat  =====
          Brush-tailed rat  =====
                Chinchilla  =====
       Cape elephant shrew  =====
        Chinese tree shrew  =====
B D                Platypus  =====
B D                 Wallaby  =====
B D                 Manatee  =====
B D                Elephant  =====
B D         Chinese hamster  =====
B D                  Tenrec  =====
B D                     Cat  =====
B D                Bushbaby  =====
B D                 Ferret   -----
             Domestic goat  =====
B D                   Sheep  =====
          Tibetan antelope  =====
            Bactrian camel  -----
B D                  Alpaca  =====
            Pacific walrus  =====
B D                   Panda  =====
              Killer whale  =====
B D                     Dog  =====
          Black flying-fox  =====
B D        White rhinoceros  =====
B D                   Horse  =====
B D               Armadillo  -----
      David's myotis (bat)  -----
             Big brown bat  -----
B D                Microbat  -----
B D                     Cow  =====

Inserts between block 32 and 33 in window
B D               Squirrel 23bp
    Lesser Egyptian jerboa 16bp
B D             Guinea pig 159bp

Alignment block 33 of 467 in window, 180553312 - 180553344, 33 bps 
B D                   Human  tcactctgttgcccaggctagagtgcag--------------tggtg
B D                   Chimp  tcactctgtcgcccaggctagagtgcaa--------------tggtg
B D                 Gorilla  tcactctgtcacccaggctagagtgcag--------------tggtg
B D               Orangutan  tcactctgtcgcccaggctagagtgcag--------------tggtg
B D                  Gibbon  tcactctgtcgcccaggctagagtgcag--------------tggtg
B D     Crab-eating macaque  tcactctgtcacccaggctggagtgtag--------------tggtg
B D                  Baboon  tcactctgtcacccaggctggagtgcag--------------tggtg
B D            Green monkey  tcactctgtcacccaggctggagtgcag--------------tggtg
B D                Marmoset  tcactctgtcacccaggctggagtgcag--------------tggtg
B D         Squirrel monkey  tcactctgtcacccaggctggagtgcga--------------tggtg
B D                Squirrel  --gtgcttttt----------tttgaaa--------------cagtg
     Lesser Egyptian jerboa  --gtac---------------------a--------------tagtg
B D          Naked mole-rat  --gcactgtta----------actacac--------------tggaa
           Brush-tailed rat  --acactgtta----------agtatgc--------------tagaa
             Bactrian camel  ------------------------------------------tggtg
            Star-nosed mole  -----------------ctggagtacaggccagaagtgtggggggtg
B D                     Rat  ===============================================
              Prairie vole  ===============================================
            Golden hamster  ===============================================
B D                   Mouse  ===============================================
B D                    Pika  ===============================================
              Weddell seal  ===============================================
B D                Hedgehog  ===============================================
B D              Guinea pig  ===============================================
B D                     Pig  ===============================================
B D                  Rabbit  ===============================================
          Cape golden mole  ===============================================
                  Aardvark  ===============================================
B D                 Megabat  ===============================================
B D                 Dolphin  -----------------------------------------------
B D                  Rhesus  ===============================================
B D         Tasmanian devil  ===============================================
B D      American alligator  ===============================================
B D                 Opossum  ===============================================
                Chinchilla  ===============================================
       Cape elephant shrew  ===============================================
        Chinese tree shrew  ===============================================
B D                Platypus  ===============================================
B D                 Wallaby  ===============================================
B D                 Manatee  ===============================================
B D                Elephant  ===============================================
B D         Chinese hamster  ===============================================
B D                  Tenrec  ===============================================
B D                     Cat  ===============================================
B D                Bushbaby  ===============================================
B D                 Ferret   -----------------------------------------------
             Domestic goat  ===============================================
B D                   Sheep  ===============================================
          Tibetan antelope  ===============================================
B D                  Alpaca  ===============================================
            Pacific walrus  ===============================================
B D                   Panda  ===============================================
              Killer whale  ===============================================
B D                     Dog  ===============================================
          Black flying-fox  ===============================================
B D        White rhinoceros  ===============================================
B D                   Horse  ===============================================
B D               Armadillo  -----------------------------------------------
      David's myotis (bat)  -----------------------------------------------
             Big brown bat  -----------------------------------------------
B D                Microbat  -----------------------------------------------
B D                     Cow  ===============================================

Alignment block 34 of 467 in window, 180553345 - 180553347, 3 bps 
B D                   Human  aga
B D                   Chimp  aga
B D                 Gorilla  aga
B D               Orangutan  aga
B D                  Gibbon  ata
B D     Crab-eating macaque  aga
B D                  Baboon  aga
B D            Green monkey  aga
B D                Marmoset  tga
B D         Squirrel monkey  tga
B D                Squirrel  tct
     Lesser Egyptian jerboa  aat
B D          Naked mole-rat  aat
           Brush-tailed rat  aat
            Star-nosed mole  aga
B D                     Rat  ===
              Prairie vole  ===
            Golden hamster  ===
B D                   Mouse  ===
B D                    Pika  ===
              Weddell seal  ===
B D                Hedgehog  ===
B D              Guinea pig  ===
B D                     Pig  ===
B D                  Rabbit  ===
          Cape golden mole  ===
                  Aardvark  ===
B D                 Megabat  ===
B D                 Dolphin  ---
B D                  Rhesus  ===
B D         Tasmanian devil  ===
B D      American alligator  ===
B D                 Opossum  ===
                Chinchilla  ===
       Cape elephant shrew  ===
        Chinese tree shrew  ===
B D                Platypus  ===
B D                 Wallaby  ===
B D                 Manatee  ===
B D                Elephant  ===
B D         Chinese hamster  ===
B D                  Tenrec  ===
B D                     Cat  ===
B D                Bushbaby  ===
B D                 Ferret   ---
             Domestic goat  ===
B D                   Sheep  ===
          Tibetan antelope  ===
            Bactrian camel  ---
B D                  Alpaca  ===
            Pacific walrus  ===
B D                   Panda  ===
              Killer whale  ===
B D                     Dog  ===
          Black flying-fox  ===
B D        White rhinoceros  ===
B D                   Horse  ===
B D               Armadillo  ---
      David's myotis (bat)  ---
             Big brown bat  ---
B D                Microbat  ---
B D                     Cow  ===

Inserts between block 34 and 35 in window
           Star-nosed mole 121bp

Alignment block 35 of 467 in window, 180553348 - 180553366, 19 bps 
B D                   Human  tcttggctcactgcaacct
B D                   Chimp  tctcggctcactgcaacct
B D                 Gorilla  tctcggctcactgcaacct
B D               Orangutan  tcttggctcactgtaacct
B D                  Gibbon  tctcggctcactgcaacct
B D     Crab-eating macaque  tctcggctcactgcagcct
B D                  Baboon  tctcggctcactgcagcct
B D            Green monkey  tctcggctcactgcaacct
B D                Marmoset  tctcagctcactgcaatct
B D         Squirrel monkey  tctcggctcactgcaatct
B D                Squirrel  cactaa------gttgccc
     Lesser Egyptian jerboa  tccagg------ttagcct
B D          Naked mole-rat  t------------------
           Brush-tailed rat  tct---------gcaacct
B D                     Rat  ===================
              Prairie vole  ===================
            Golden hamster  ===================
B D                   Mouse  ===================
B D                    Pika  ===================
              Weddell seal  ===================
B D                Hedgehog  ===================
B D              Guinea pig  ===================
B D                     Pig  ===================
B D                  Rabbit  ===================
          Cape golden mole  ===================
                  Aardvark  ===================
B D                 Megabat  ===================
B D                 Dolphin  -------------------
B D                  Rhesus  ===================
B D         Tasmanian devil  ===================
B D      American alligator  ===================
B D                 Opossum  ===================
                Chinchilla  ===================
       Cape elephant shrew  ===================
        Chinese tree shrew  ===================
B D                Platypus  ===================
B D                 Wallaby  ===================
B D                 Manatee  ===================
B D                Elephant  ===================
B D         Chinese hamster  ===================
B D                  Tenrec  ===================
B D                     Cat  ===================
B D                Bushbaby  ===================
B D                 Ferret   -------------------
           Star-nosed mole  ===================
             Domestic goat  ===================
B D                   Sheep  ===================
          Tibetan antelope  ===================
            Bactrian camel  -------------------
B D                  Alpaca  ===================
            Pacific walrus  ===================
B D                   Panda  ===================
              Killer whale  ===================
B D                     Dog  ===================
          Black flying-fox  ===================
B D        White rhinoceros  ===================
B D                   Horse  ===================
B D               Armadillo  -------------------
      David's myotis (bat)  -------------------
             Big brown bat  -------------------
B D                Microbat  -------------------
B D                     Cow  ===================

Alignment block 36 of 467 in window, 180553367 - 180553392, 26 bps 
B D                   Human  ctgcct---------cctgggttcaagcta---------------------ttcac----
B D                   Chimp  ctgcct---------cccgggttcaagcta---------------------ttcac----
B D                 Gorilla  ctgcct---------cccgggttcaagcta---------------------ttcac----
B D               Orangutan  ctgcct---------cccgggttcaagcta---------------------ttcac----
B D                  Gibbon  ctgcct---------cccgggttcaagcta---------------------ttcac----
B D     Crab-eating macaque  ctgcct---------cctgggttcaagcta---------------------ttcac----
B D                  Baboon  ctgcct---------cctgggttcaagcta---------------------ttcac----
B D            Green monkey  ctgcct---------cctgggttcaagcta---------------------ttcac----
B D                Marmoset  ctgcct---------cccaggtgcaagtga---------------------atcac----
B D         Squirrel monkey  ctgcct---------cgcaggtgcaagtga---------------------ttcac----
B D                Squirrel  -aggct------------gacctggaactg---------------------gtcatcctc
     Lesser Egyptian jerboa  -gggctagagtaagacccaacctcaaataaacaacaacaagaaagtactatgttctactt
B D          Naked mole-rat  --------------------ctgcaactta---------------------atattaggt
B D                     Rat  ============================================================
              Prairie vole  ============================================================
            Golden hamster  ============================================================
B D                   Mouse  ============================================================
B D                    Pika  ============================================================
              Weddell seal  ============================================================
B D                Hedgehog  ============================================================
B D              Guinea pig  ============================================================
B D                     Pig  ============================================================
B D                  Rabbit  ============================================================
          Cape golden mole  ============================================================
                  Aardvark  ============================================================
B D                 Megabat  ============================================================
B D                 Dolphin  ------------------------------------------------------------
B D                  Rhesus  ============================================================
B D         Tasmanian devil  ============================================================
B D      American alligator  ============================================================
B D                 Opossum  ============================================================
          Brush-tailed rat  ------------------------------------------------------------
                Chinchilla  ============================================================
       Cape elephant shrew  ============================================================
        Chinese tree shrew  ============================================================
B D                Platypus  ============================================================
B D                 Wallaby  ============================================================
B D                 Manatee  ============================================================
B D                Elephant  ============================================================
B D         Chinese hamster  ============================================================
B D                  Tenrec  ============================================================
B D                     Cat  ============================================================
B D                Bushbaby  ============================================================
B D                 Ferret   ------------------------------------------------------------
           Star-nosed mole  ============================================================
             Domestic goat  ============================================================
B D                   Sheep  ============================================================
          Tibetan antelope  ============================================================
            Bactrian camel  ------------------------------------------------------------
B D                  Alpaca  ============================================================
            Pacific walrus  ============================================================
B D                   Panda  ============================================================
              Killer whale  ============================================================
B D                     Dog  ============================================================
          Black flying-fox  ============================================================
B D        White rhinoceros  ============================================================
B D                   Horse  ============================================================
B D               Armadillo  ------------------------------------------------------------
      David's myotis (bat)  ------------------------------------------------------------
             Big brown bat  ------------------------------------------------------------
B D                Microbat  ------------------------------------------------------------
B D                     Cow  ============================================================

Alignment block 37 of 467 in window, 180553393 - 180553449, 57 bps 
B D                   Human  ctgcctcggccttccca------------gtagctgg-------gatt--acaggcacccaccgctatac
B D                   Chimp  ttgcctcggcctcccca------------gtagctgg-------gatt--acaggcacccaccgccatac
B D                 Gorilla  ctgcctcggcctcccca------------gtagctgg-------gatt--acaggcacccaccgccatac
B D               Orangutan  ctgcctcagcctccccg------------gtagctgg-------gatt--acaggcacccaccgccatag
B D                  Gibbon  ctgcctcagcctcccca------------gtagctgg-------gatt--acaggcacctgccgccatgc
B D                  Rhesus  ctgcctgggcctcccca------------gcagctgg-------gatt--ataggcacccgccaccatgc
B D     Crab-eating macaque  ctgcctgggcctcccca------------gtagctgg-------gatt--ataggcacccgccaccatgc
B D                  Baboon  ctgcctgggcctcccca------------gtagctgg-------gatt--ataggcacccgccaccatgc
B D            Green monkey  ctgcccgggcctcccca------------gtagctgg-------gatt--acaggcacccgccaccatgc
B D                Marmoset  gtgcctcagcctcccca------------gtagctgg-------gagt--acaggagctcaccaccatgc
B D         Squirrel monkey  ctgcttcagcctcccca------------gtagctgg-------gatt--acaggagctcgccaccatgc
B D                Squirrel  ctgcctcagcctcccct------------gtagctag-------gatt--acaggtgtgcgccacaatgc
     Lesser Egyptian jerboa  ttttttgactataccctttacatgtcaaagcagccagttaacatgacc--actggaaaattctacaag--
B D          Naked mole-rat  ttttcttagaattgctt---------------ttcaa-------gatcttttagatgcgtactacca---
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
B D                    Pika  ======================================================================
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D              Guinea pig  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Megabat  ======================================================================
B D                 Dolphin  ----------------------------------------------------------------------
B D         Tasmanian devil  ======================================================================
B D      American alligator  ======================================================================
B D                 Opossum  ======================================================================
          Brush-tailed rat  ----------------------------------------------------------------------
                Chinchilla  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Platypus  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                  Tenrec  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
B D                 Ferret   ----------------------------------------------------------------------
           Star-nosed mole  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ----------------------------------------------------------------------
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                     Dog  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D               Armadillo  ----------------------------------------------------------------------
      David's myotis (bat)  ----------------------------------------------------------------------
             Big brown bat  ----------------------------------------------------------------------
B D                Microbat  ----------------------------------------------------------------------
B D                     Cow  ======================================================================

                      Human  ttggctag
                      Chimp  ttggctag
                    Gorilla  ttggctag
                  Orangutan  ttggctag
                     Gibbon  ttggctag
                     Rhesus  ttggctag
        Crab-eating macaque  ttggctag
                     Baboon  ttggctag
               Green monkey  ttggctag
                   Marmoset  ttggctaa
            Squirrel monkey  ttggctga
                   Squirrel  ctggctcg
     Lesser Egyptian jerboa  --------
             Naked mole-rat  --------
                        Rat  ========
               Prairie vole  ========
             Golden hamster  ========
                      Mouse  ========
                       Pika  ========
               Weddell seal  ========
                   Hedgehog  ========
                 Guinea pig  ========
                        Pig  ========
                     Rabbit  ========
           Cape golden mole  ========
                   Aardvark  ========
                    Megabat  ========
                    Dolphin  --------
            Tasmanian devil  ========
         American alligator  ========
                    Opossum  ========
           Brush-tailed rat  --------
                 Chinchilla  ========
        Cape elephant shrew  ========
         Chinese tree shrew  ========
                   Platypus  ========
                    Wallaby  ========
                    Manatee  ========
                   Elephant  ========
            Chinese hamster  ========
                     Tenrec  ========
                        Cat  ========
                   Bushbaby  ========
                    Ferret   --------
            Star-nosed mole  ========
              Domestic goat  ========
                      Sheep  ========
           Tibetan antelope  ========
             Bactrian camel  --------
                     Alpaca  ========
             Pacific walrus  ========
                      Panda  ========
               Killer whale  ========
                        Dog  ========
           Black flying-fox  ========
           White rhinoceros  ========
                      Horse  ========
                  Armadillo  --------
       David's myotis (bat)  --------
              Big brown bat  --------
                   Microbat  --------
                        Cow  ========

Alignment block 38 of 467 in window, 180553450 - 180553456, 7 bps 
B D                   Human  ttatttt
B D                   Chimp  ttatttt
B D                 Gorilla  ttatttt
B D               Orangutan  ttattgt
B D                  Gibbon  ttattgt
B D                  Rhesus  ttattgt
B D     Crab-eating macaque  ttattgt
B D                  Baboon  ttattgt
B D            Green monkey  ttattgt
B D                Marmoset  tttttgt
B D         Squirrel monkey  tttttgt
B D                Squirrel  tcatttt
     Lesser Egyptian jerboa  ctatttt
B D                   Mouse  ttgtttt
B D          Naked mole-rat  ttattta
                 Chinchilla  ttatttt
B D                     Rat  =======
              Prairie vole  =======
            Golden hamster  =======
B D                    Pika  =======
              Weddell seal  =======
B D                Hedgehog  =======
B D              Guinea pig  =======
B D                     Pig  =======
B D                  Rabbit  =======
          Cape golden mole  =======
                  Aardvark  =======
B D                 Megabat  =======
B D                 Dolphin  -------
B D         Tasmanian devil  =======
B D      American alligator  =======
B D                 Opossum  =======
          Brush-tailed rat  -------
       Cape elephant shrew  =======
        Chinese tree shrew  =======
B D                Platypus  =======
B D                 Wallaby  =======
B D                 Manatee  =======
B D                Elephant  =======
B D         Chinese hamster  =======
B D                  Tenrec  =======
B D                     Cat  =======
B D                Bushbaby  =======
B D                 Ferret   -------
           Star-nosed mole  =======
             Domestic goat  =======
B D                   Sheep  =======
          Tibetan antelope  =======
            Bactrian camel  -------
B D                  Alpaca  =======
            Pacific walrus  =======
B D                   Panda  =======
              Killer whale  =======
B D                     Dog  =======
          Black flying-fox  =======
B D        White rhinoceros  =======
B D                   Horse  =======
B D               Armadillo  -------
      David's myotis (bat)  -------
             Big brown bat  -------
B D                Microbat  -------
B D                     Cow  =======

Inserts between block 38 and 39 in window
B D                  Mouse 1bp

Alignment block 39 of 467 in window, 180553457 - 180553465, 9 bps 
B D                   Human  atttttagc
B D                   Chimp  atttttagc
B D                 Gorilla  atttttagc
B D               Orangutan  atttttagt
B D                  Gibbon  atttttagt
B D                  Rhesus  atttttagt
B D     Crab-eating macaque  atttttagt
B D                  Baboon  atttttagt
B D            Green monkey  atttttagt
B D                Marmoset  atttttagt
B D         Squirrel monkey  atttttagt
B D                Squirrel  ---cttttt
     Lesser Egyptian jerboa  ---tttttt
               Prairie vole  ---ttttgt
B D                   Mouse  ---tttttt
B D          Naked mole-rat  gtgtttgg-
                 Chinchilla  gtgtttgg-
B D                     Rat  =========
            Golden hamster  =========
B D                    Pika  =========
              Weddell seal  =========
B D                Hedgehog  =========
B D              Guinea pig  =========
B D                     Pig  =========
B D                  Rabbit  =========
          Cape golden mole  =========
                  Aardvark  =========
B D                 Megabat  =========
B D                 Dolphin  ---------
B D         Tasmanian devil  =========
B D      American alligator  =========
B D                 Opossum  =========
          Brush-tailed rat  ---------
       Cape elephant shrew  =========
        Chinese tree shrew  =========
B D                Platypus  =========
B D                 Wallaby  =========
B D                 Manatee  =========
B D                Elephant  =========
B D         Chinese hamster  =========
B D                  Tenrec  =========
B D                     Cat  =========
B D                Bushbaby  =========
B D                 Ferret   ---------
           Star-nosed mole  =========
             Domestic goat  =========
B D                   Sheep  =========
          Tibetan antelope  =========
            Bactrian camel  ---------
B D                  Alpaca  =========
            Pacific walrus  =========
B D                   Panda  =========
              Killer whale  =========
B D                     Dog  =========
          Black flying-fox  =========
B D        White rhinoceros  =========
B D                   Horse  =========
B D               Armadillo  ---------
      David's myotis (bat)  ---------
             Big brown bat  ---------
B D                Microbat  ---------
B D                     Cow  =========

Inserts between block 39 and 40 in window
    Lesser Egyptian jerboa 220bp

Alignment block 40 of 467 in window, 180553466 - 180553499, 34 bps 
B D                   Human  agagacggaatttcaccatgt---tggcca-gctgttc
B D                   Chimp  agagacggaatttcaccatgt---tggcca-gctgttc
B D                 Gorilla  agagacggaatttcaccatgt---tggcca-gctgttc
B D               Orangutan  agagatggaatttcaccatgt---aggcca-gctgttc
B D                  Gibbon  agagatggggtttcaccatgt---tggcca-gctgttc
B D                  Rhesus  agagacggggtttcaccacgt---tggcca-gctgttc
B D     Crab-eating macaque  agagacggggtttcaccacgt---tggcca-gctgttc
B D                  Baboon  agagacggggtttcaccacgt---tggcca-gctgttc
B D            Green monkey  agagatggggtttcaccatgt---tggcca-gctgttc
B D                Marmoset  aaagacaaagtttcaccatgt---tggccaggctgttc
B D         Squirrel monkey  aaagacagagtttcaccatgt---tggccaggctgttc
B D                Squirrel  -----tattattactt--tga---ctgtta-g------
               Prairie vole  aaaaattcagtttcaa--tgt---ttctca-ggtgtgc
B D                   Mouse  tgagacagggtttctc--tgtatagtcctg-gctgtcc
B D          Naked mole-rat  -----------------------------------ttc
                 Chinchilla  -----------------------------------ttc
B D                     Rat  ======================================
            Golden hamster  ======================================
    Lesser Egyptian jerboa  ======================================
B D                    Pika  ======================================
              Weddell seal  ======================================
B D                Hedgehog  ======================================
B D              Guinea pig  ======================================
B D                     Pig  ======================================
B D                  Rabbit  ======================================
          Cape golden mole  ======================================
                  Aardvark  ======================================
B D                 Megabat  ======================================
B D                 Dolphin  --------------------------------------
B D         Tasmanian devil  ======================================
B D      American alligator  ======================================
B D                 Opossum  ======================================
          Brush-tailed rat  --------------------------------------
       Cape elephant shrew  ======================================
        Chinese tree shrew  ======================================
B D                Platypus  ======================================
B D                 Wallaby  ======================================
B D                 Manatee  ======================================
B D                Elephant  ======================================
B D         Chinese hamster  ======================================
B D                  Tenrec  ======================================
B D                     Cat  ======================================
B D                Bushbaby  ======================================
B D                 Ferret   --------------------------------------
           Star-nosed mole  ======================================
             Domestic goat  ======================================
B D                   Sheep  ======================================
          Tibetan antelope  ======================================
            Bactrian camel  --------------------------------------
B D                  Alpaca  ======================================
            Pacific walrus  ======================================
B D                   Panda  ======================================
              Killer whale  ======================================
B D                     Dog  ======================================
          Black flying-fox  ======================================
B D        White rhinoceros  ======================================
B D                   Horse  ======================================
B D               Armadillo  --------------------------------------
      David's myotis (bat)  --------------------------------------
             Big brown bat  --------------------------------------
B D                Microbat  --------------------------------------
B D                     Cow  ======================================

Alignment block 41 of 467 in window, 180553500 - 180553521, 22 bps 
B D                   Human  ttgaact---------------tctgacctcagg-----tga
B D                   Chimp  ttgaact---------------tctgacctcagg-----tga
B D                 Gorilla  ttgaact---------------tctgacctcagg-----tga
B D               Orangutan  ttgaact---------------tctgacctcagg-----tga
B D                  Gibbon  ttgaact---------------tctgacctcagg-----tga
B D                  Rhesus  ttgaact---------------tctgaccttagg-----tga
B D     Crab-eating macaque  ttgaact---------------tctgaccttagg-----tga
B D                  Baboon  ttgaact---------------tctgaccttagg-----tga
B D            Green monkey  ttgaact---------------tctgaccttagg-----tga
B D                Marmoset  tccaact---------------tctgacctcata-----tga
B D         Squirrel monkey  tcgaact---------------tctgacctcagg-----tga
B D                Squirrel  ----------------------gct--------------taa
               Prairie vole  ----------------------gct--------------aca
B D                   Mouse  tggaactcactttgtagaccaggctggcctcgaactcagaaa
B D          Naked mole-rat  ----------------------ccc--------------ata
                 Chinchilla  ----------------------acc--------------aga
            Star-nosed mole  ttgaact---------------catg--ctgaag-----tg-
B D                     Rat  ==========================================
            Golden hamster  ==========================================
    Lesser Egyptian jerboa  ==========================================
B D                    Pika  ==========================================
              Weddell seal  ==========================================
B D                Hedgehog  ==========================================
B D              Guinea pig  ==========================================
B D                     Pig  ==========================================
B D                  Rabbit  ==========================================
          Cape golden mole  ==========================================
                  Aardvark  ==========================================
B D                 Megabat  ==========================================
B D                 Dolphin  ------------------------------------------
B D         Tasmanian devil  ==========================================
B D      American alligator  ==========================================
B D                 Opossum  ==========================================
          Brush-tailed rat  ------------------------------------------
       Cape elephant shrew  ==========================================
        Chinese tree shrew  ==========================================
B D                Platypus  ==========================================
B D                 Wallaby  ==========================================
B D                 Manatee  ==========================================
B D                Elephant  ==========================================
B D         Chinese hamster  ==========================================
B D                  Tenrec  ==========================================
B D                     Cat  ==========================================
B D                Bushbaby  ==========================================
B D                 Ferret   ------------------------------------------
             Domestic goat  ==========================================
B D                   Sheep  ==========================================
          Tibetan antelope  ==========================================
            Bactrian camel  ------------------------------------------
B D                  Alpaca  ==========================================
            Pacific walrus  ==========================================
B D                   Panda  ==========================================
              Killer whale  ==========================================
B D                     Dog  ==========================================
          Black flying-fox  ==========================================
B D        White rhinoceros  ==========================================
B D                   Horse  ==========================================
B D               Armadillo  ------------------------------------------
      David's myotis (bat)  ------------------------------------------
             Big brown bat  ------------------------------------------
B D                Microbat  ------------------------------------------
B D                     Cow  ==========================================

Alignment block 42 of 467 in window, 180553522 - 180553543, 22 bps 
B D                   Human  tccacccgcctcggcctc--cca-------------------a
B D                   Chimp  tccacccacctcggcctc--cca-------------------a
B D                 Gorilla  tccacccgcctcggcctc--cca-------------------a
B D               Orangutan  tccaccctcctctgtctc--cca-------------------a
B D                  Gibbon  tccacccgcctcggcctc--cca-------------------g
B D                  Rhesus  tccatccgcctcggcctc--ccg-------------------a
B D     Crab-eating macaque  tccatccgcctcggcctc--ccg-------------------a
B D                  Baboon  tccacccgcctcggcttc--ccg-------------------a
B D            Green monkey  tccacctgccccggcctc--ccg-------------------a
B D                Marmoset  tccatccggctcggcctc--cca-------------------a
B D         Squirrel monkey  tccatccagctcagcctc--cca-------------------a
B D                Squirrel  ctttttt------------------------------------
               Prairie vole  tttctttagtgttggttt--cct--------------------
B D                   Mouse  tctgcctgcctctgcctt--cca--------------------
B D          Naked mole-rat  attgatttcatatgctcc--ctcagtcagttctgttacctaa-
                 Chinchilla  cttg---------------------------------------
B D                     Cow  ---------tccatcctccacc---------------------
            Star-nosed mole  -------gctttagcttc--ac---------------------
B D                     Rat  ===========================================
            Golden hamster  ===========================================
    Lesser Egyptian jerboa  ===========================================
B D                    Pika  ===========================================
              Weddell seal  ===========================================
B D                Hedgehog  ===========================================
B D              Guinea pig  ===========================================
B D                     Pig  ===========================================
B D                  Rabbit  ===========================================
          Cape golden mole  ===========================================
                  Aardvark  ===========================================
B D                 Megabat  ===========================================
B D                 Dolphin  -------------------------------------------
B D         Tasmanian devil  ===========================================
B D      American alligator  ===========================================
B D                 Opossum  ===========================================
          Brush-tailed rat  -------------------------------------------
       Cape elephant shrew  ===========================================
        Chinese tree shrew  ===========================================
B D                Platypus  ===========================================
B D                 Wallaby  ===========================================
B D                 Manatee  ===========================================
B D                Elephant  ===========================================
B D         Chinese hamster  ===========================================
B D                  Tenrec  ===========================================
B D                     Cat  ===========================================
B D                Bushbaby  ===========================================
B D                 Ferret   -------------------------------------------
             Domestic goat  ===========================================
B D                   Sheep  ===========================================
          Tibetan antelope  ===========================================
            Bactrian camel  -------------------------------------------
B D                  Alpaca  ===========================================
            Pacific walrus  ===========================================
B D                   Panda  ===========================================
              Killer whale  ===========================================
B D                     Dog  ===========================================
          Black flying-fox  ===========================================
B D        White rhinoceros  ===========================================
B D                   Horse  ===========================================
B D               Armadillo  -------------------------------------------
      David's myotis (bat)  -------------------------------------------
             Big brown bat  -------------------------------------------
B D                Microbat  -------------------------------------------

Alignment block 43 of 467 in window, 180553544 - 180553569, 26 bps 
B D                   Human  agtgttgggattacag---g--cgtaagcca
B D                   Chimp  agtgttgggattacag---g--cgtaagcca
B D                 Gorilla  agtgttgggattacag---g--cgtaagaca
B D               Orangutan  agtgttgggattacag---g--cgtgagcca
B D                  Gibbon  agtgttgggataacag---g--tgtgagcca
B D                  Rhesus  agtgttgggattacag---g--tgtgagcca
B D     Crab-eating macaque  agtgttgggattacag---g--tgtgagcca
B D                  Baboon  agtgttgggattacag---g--tgtgagcca
B D            Green monkey  agagttggaattacag---g--tgtaagcca
B D                Marmoset  agttctgggattacag---g--tgtgagcca
B D         Squirrel monkey  agtgctgggattacag---g--cgtgagcca
               Prairie vole  agaact--gatta------------------
B D                   Mouse  agtgctgggattaaag---g----tgtgccc
B D          Naked mole-rat  --tcca--atttatag---gcccataggccc
B D                     Cow  aattcccagagtttac---------------
            Star-nosed mole  agtactgtgctttaacctg------------
B D                     Rat  ===============================
            Golden hamster  ===============================
    Lesser Egyptian jerboa  ===============================
B D                    Pika  ===============================
              Weddell seal  ===============================
B D                Hedgehog  ===============================
B D              Guinea pig  ===============================
B D                     Pig  ===============================
B D                  Rabbit  ===============================
          Cape golden mole  ===============================
                  Aardvark  ===============================
B D                 Megabat  ===============================
B D                 Dolphin  -------------------------------
B D         Tasmanian devil  ===============================
B D      American alligator  ===============================
B D                 Opossum  ===============================
          Brush-tailed rat  -------------------------------
                Chinchilla  -------------------------------
       Cape elephant shrew  ===============================
        Chinese tree shrew  ===============================
B D                Platypus  ===============================
B D                 Wallaby  ===============================
B D                 Manatee  ===============================
B D                Elephant  ===============================
B D         Chinese hamster  ===============================
B D                  Tenrec  ===============================
B D                     Cat  ===============================
B D                Bushbaby  ===============================
B D                 Ferret   -------------------------------
             Domestic goat  ===============================
B D                   Sheep  ===============================
          Tibetan antelope  ===============================
            Bactrian camel  -------------------------------
B D                  Alpaca  ===============================
            Pacific walrus  ===============================
B D                   Panda  ===============================
              Killer whale  ===============================
B D                     Dog  ===============================
          Black flying-fox  ===============================
B D        White rhinoceros  ===============================
B D                   Horse  ===============================
B D                Squirrel  -------------------------------
B D               Armadillo  -------------------------------
      David's myotis (bat)  -------------------------------
             Big brown bat  -------------------------------
B D                Microbat  -------------------------------

Alignment block 44 of 467 in window, 180553570 - 180553570, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  c
B D                  Gibbon  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
B D            Green monkey  c
B D                Marmoset  c
B D         Squirrel monkey  c
B D                   Mouse  c
B D          Naked mole-rat  c
B D                     Pig  c
            Star-nosed mole  c
B D                     Rat  =
              Prairie vole  -
            Golden hamster  =
    Lesser Egyptian jerboa  =
B D                    Pika  =
              Weddell seal  =
B D                Hedgehog  =
B D              Guinea pig  =
B D                  Rabbit  =
          Cape golden mole  =
                  Aardvark  =
B D                 Megabat  =
B D                 Dolphin  -
B