Multiz Alignments of 30 mammals (27 primates)
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 34 in window, 72499226 - 72499341, 116 bps 
B D                     Human  tgtttcaaggccatgagtttccttcctaca-------------tttagtggtgacact-aaaactgaaag
B D                     Chimp  tgtttcaaggccatgagtttccttcctaca-------------tttagtggtgacact-aaaactgaaag
B D                    Bonobo  tgtttcaaggccatgagtttccttcctaca-------------tttagtggtgacact-aaaactgaaag
B D                   Gorilla  tgtttcaaggccatgagttttcttcctaca-------------tttagtggtgacact-aaaactgaaag
B D                 Orangutan  tgtttcaaggccatgagtttccttcctaca-------------tttagtggtgacactaaaaactgaaag
B D                    Gibbon  tgtttcaaggccatgagtttccttcctaca-------------tttagtggtgacact-aaaactgaaag
B D                    Rhesus  tgtttcaaggccatgagtttccttcctaca-------------tttagtggtgacact-aaaactgaaag
B D       Crab-eating macaque  tgtttcaaggccatgagtttccttcctaca-------------tttagtggtgacact-aaaactgaaag
           Pig-tailed macaque  tgtttcaaggccatgagtttccttcctaca-------------tttagtggtgacact-aaaactgaaag
               Sooty mangabey  tgtttcaaggccatgagtttccttcctaca-------------tttagtggtgacact-aaaactgaaag
                       Baboon  tgtttcaaggccatgagtttccttcctaca-------------tttagtggtgacact-aaaactgaaag
B D              Green monkey  tgtttcaaggccatgagtttccttcctaca-------------tttagtggtgacact-aaaactgaaag
                        Drill  tgtttcaaggccatgagtttccttcctaca-------------tttagtggtgacact-aaaactgaaag
B D          Proboscis monkey  tgtttcaaggccatgagtttccttcctaca-------------tttagtggtgacact-aaaactgaaag
              Angolan colobus  tgtttcaaggccatgagtttccttcctaca-------------tttagtgatgacact-aaaactgaaag
B D  Golden snub-nosed monkey  tgtttcaaggccatgagtttccttcctaca-------------tttagtggtgacact-aaaactgaaag
      Black snub-nosed monkey  tgtttcaaggccatgagtttccttcctaca-------------tttagtggtgacact-aaaactgaaag
B D                  Marmoset  tgtttcaaggccatgagtttccttcctaca-------------tttagtggtgacacc-aaaactgaaag
B D           Squirrel monkey  tgtttcaaggccatgagtttccttcctaca-------------tttagtggtgacacc-aaaactgaaag
          White-faced sapajou  tgtttcaaggccatgagtttccttcctaca-------------tttagtggtgacacc-aaaactgaaag
            Ma's night monkey  tgtttcaaggccatgagtttccttcctaca-------------tttagtggtgacacc-aaaactgaaag
B D                   Tarsier  tgtttc-aggctgtgcatttcctccctgtg-------------ctcagcggt--tgct-gactccaaggg
                  Mouse lemur  cgcttcaaggccatgagtttccttcctaca-------------tttagtggcaatact-aaaactgaaag
            Coquerel's sifaka  tgcttcaaggccatgagtttccttcctaca-------------tttagtggcaatatt-aaaactgaaag
                  Black lemur  tgcttcaaggccatgagtttccttcctaca-------------tttagtggcaatatt-aacactgaaag
              Sclater's lemur  tgcttcaaggccatgagtttccttcctaca-------------tttagtggcaatatt-aacactgaaag
B D                  Bushbaby  tgcttcaaggccatccgtttccttcctacg-------------ttcagtgccaatacc-aaatctgaaac
B D                     Mouse  cgtttcaaggccataaattcccttcctaca-------------tttagtatttttact-aaaaatgaaaa
B D                       Dog  tgtctcaagactgtgagtttccttactaca-------------tctggtcatgatact-gacagagaaga
B D                 Armadillo  tgtttcaaagtcatgagtttcattattacattttgtcaattattttggtggtcatact-aaaactgaagg

                        Human  ctt-gggaatagt-a-cata-gaagagggaggctgttaaatatacttattt-atata-ggtacttt
                        Chimp  ctt-gggaatagt-a-cata-gaagagggaggctgtcaaatatacttattt-atata-ggtacttt
                       Bonobo  ctt-gggaatagt-a-cata-gaagagggaggctgtcaaatatacttattt-atata-ggtacttt
                      Gorilla  ctt-gggaatagt-a-cata-gaagagggaggctgttaaatatacttattt-atata-ggtacttt
                    Orangutan  cct-gggagtagtaa-catagggagagggaggctgttaaatatacttatttaatatagggtacttt
                       Gibbon  ctt-gggaatagt-a-cata-gaagagggaggctgttaaatatacttattt-atata-ggtacttt
                       Rhesus  ctt-gggaatagt-a-cata-gaagagggaggctgtgaaatatccttattt-atata-ggtacttt
          Crab-eating macaque  ctt-gggaatagt-a-cata-gaagagggaggctgtgaaatatccttattt-atata-ggtacttt
           Pig-tailed macaque  ctt-gggaatagt-a-cata-gaagagggaggctgtgaaatatccttattt-atata-ggtacttt
               Sooty mangabey  ctt-gggaatagt-a-cata-gaagagggaggctgtgaaatatccttattt-atata-ggtacttt
                       Baboon  ctt-gggaatagt-a-cata-gaagagggaggctgtgaaatatccttattt-atata-ggtacttt
                 Green monkey  ctt-gggaatagt-a-cata-gaagagggaggctgtgaaatatccttattt-atata-ggtacttt
                        Drill  ctt-gggaatagt-a-cata-gaagagggaggctgtgaaatatccttattt-atata-ggtacttt
             Proboscis monkey  ctt-gggaatagt-a-cata-gaagagggaggctgtgaaatatccttattt-atata-ggtacttt
              Angolan colobus  ctt-gggaatagt-a-cata-gaagagggaggctgtgaaatatccttattt-atata-ggtacttt
     Golden snub-nosed monkey  ctt-gggaatagt-a-cata-gaagagggaggctgtgaaatatccttattt-atata-ggtacttt
      Black snub-nosed monkey  ctt-gggaatagt-a-cata-gaagagggaggctgtgaaatatccttattt-atata-ggtacttt
                     Marmoset  ctt-gggagtagt-a-cata-gaagagggaggctgtgaaatatccttattt-atata-ggtgcttt
              Squirrel monkey  ctt-gggagtagt-a-cata-gaagagggaggctgtgaaatatccttactt-atata-ggtgcttt
          White-faced sapajou  ctt-gggagtagt-a-cata-gaagagggaggctgtgaaatatccttattt-atata-ggtgcttt
            Ma's night monkey  ctt-gggagtagt-a-ctta-gaagagggaggctgtgaaatatccttactt-atata-ggtgcttt
                      Tarsier  ctt---gagcagt-g-cata-gagcagtgagcctcaggaatatctatgtcc-atgca-agt-ctct
                  Mouse lemur  ctg-gagagtggc-g-tata-gaggagggaggctatgaaatattcatactc-atata-agtgtttt
            Coquerel's sifaka  ctg-gagagtggc-g-tata-gaagagggaggctatgaaatattcatattc-atata-agtgtttt
                  Black lemur  ccg-gagagtggc-a-tata-gaagggggaggctatgaaatattcatattc-atata-agtgtttt
              Sclater's lemur  ccg-gagagtggc-a-tata-gaagggggaggctatgaaatattcatattc-atata-agtgtttt
                     Bushbaby  ctg-gaaagtggt-g-tggg-gaggaggggtgctatgaaatattcatatta-gtaga-agtagttt
                        Mouse  gtt-aagaatggt-g-tgta-gaa----gatgctatgaaata------------------------
                          Dog  ctg-gaaggtggt-attgta-gaggagggaagctatgtgatatccatatta-atttt-ggtgtttt
                    Armadillo  cttcaagagtggt-a-tata-gaggaggaaggctatgtgatattcacattc-acata-ggtgtttt

Alignment block 2 of 34 in window, 72499342 - 72499385, 44 bps 
B D                     Human  t--ctaaatgtatttgatgaattagagaattgtttaaacga---ggaaa
B D                     Chimp  t--ctaaatgtatttgatgaattagagaattgtttaaacaa---ggaga
B D                    Bonobo  t--ctaaatgtatttgatgaattagagaattgtttagacaa---ggaaa
B D                   Gorilla  t--ctaaatgtatttgatgaattagagaattgtttaaacaa---ggaaa
B D                 Orangutan  tc-ctaaatgtatttgatgaattagagaattgtttaaaacaatggaaaa
B D                    Gibbon  t--ctaaatgtatttgatgaattagagaattgtttaaacaa---ggaaa
B D                    Rhesus  t--ctaaatgtatttgatgaattagagaattgtttaaacaa---ggaaa
B D       Crab-eating macaque  t--ctaaatgtatttgatgaattagagaattgtttaaacaa---ggaaa
           Pig-tailed macaque  t--ctaaatgtatttgatgaattagagaattgtttaaacaa---ggaaa
               Sooty mangabey  t--ctaaatgtatttgatgaattagagaattgtttaaacaa---ggaaa
                       Baboon  t--ctaaatgtatttgatgaattagagaattgtttaaacaa---ggaaa
B D              Green monkey  t--ctaaatgtatttgatgaattagagaattgtttaaacaa---ggaaa
                        Drill  t--ctaaatgtatttgatgaattagagaattgtttaaacaa---ggaaa
B D          Proboscis monkey  t--ctaaatgcatttgatgaattagagaattgtttaaacaa---ggaaa
              Angolan colobus  t--ctaaatgtatttgatgaattagagaattgtttaaacaa---ggaaa
B D  Golden snub-nosed monkey  t--ctaaatgtatttgatgaattagagaattgtttaaacaa---ggaaa
      Black snub-nosed monkey  t--ctaaatgtatttgatgaattagagaattgtttaaacaa---ggaaa
B D                  Marmoset  t--ctaaatatatttggtgaattggagaattgtttaaacaa---ggaaa
B D           Squirrel monkey  t--ctaaatatatttggtgaattggagaattgtttaatcaa---ggaaa
          White-faced sapajou  t--ctaaatatgtttggtgaattggagaactgtttaaacaa---ggaaa
            Ma's night monkey  t--ctaaatat------tgaattggagaattgtttaaacaa---ggaaa
B D                   Tarsier  t--ctaaaccgatttgc--aattggagaatc-----aatga---ggaaa
                  Mouse lemur  t--ctaaatgtagttaatgaactggaaaattgtttaaacca---ggaaa
            Coquerel's sifaka  t--ctaaatgtatttaatgaattggaaaattgtttaaacca---ggaaa
                  Black lemur  t--ctaaatgtatttaatgaatttgaaaattgtttaaacca---ggaaa
              Sclater's lemur  t--ctaaatgtatttaatgaatttgaaaattgtttaaacca---ggaaa
B D                       Dog  t--ctgaatgtattttatgaattggagaattatttatacca---gaaag
B D                 Armadillo  -caagaaatgcatttcatgaattggagaactgtgtaaacca---gaaaa
B D                     Mouse  -------------------------------------------------
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 2 and 3 in window
                 Mouse lemur 148bp

Alignment block 3 of 34 in window, 72499386 - 72499418, 33 bps 
B D                     Human  cgtccaaagt--atttgc--tgtaaattttccatac----------t
B D                     Chimp  cgtccaaagt--atttgc--tgtaaattttccatac----------t
B D                    Bonobo  cgtccaaagt--atttgc--tgtaaattttccatac----------t
B D                   Gorilla  cgtccaaagt--atttgc--tgtaaattttccgtac----------t
B D                 Orangutan  tgtccaaagctattttgctgtgtaaattttccatac----------t
B D                    Gibbon  tgtccaaagt--atttgc--tgtaaattttccatac----------t
B D                    Rhesus  tgtccaaagt--atttgt--tgtaaattttccatac----------t
B D       Crab-eating macaque  tgtccaaagt--atttgt--tgtaaattttccatac----------t
           Pig-tailed macaque  tgtccaaagt--atttgt--tgtaaattttccatac----------t
               Sooty mangabey  tgtccaaagt--atttgt--tgtatattttccatac----------t
                       Baboon  tgtccaaagt--atttgt--tgtatattttccatac----------t
B D              Green monkey  tgtccaaagt--atttgt--tgtaaattttccatac----------t
                        Drill  tgtccaaagt--atttgt--tgtatattttccatac----------t
B D          Proboscis monkey  tgtccaaagt--atttgt--tgtaaattttccatac----------t
              Angolan colobus  tgtccaaagt--atttgt--tgtaaattttccatac----------t
B D  Golden snub-nosed monkey  tgtccaaagt--atttgt--tgtaaattttccatac----------t
      Black snub-nosed monkey  tgtccaaagt--atttgt--tgtaaattttccatac----------t
B D                  Marmoset  tatccaaagt--gtttgt--tgtaaatgttcaatacaacaagtgttt
B D           Squirrel monkey  tgtccaaagt--gtttat--tgtaaattttccatac----------t
          White-faced sapajou  tgtccaaagt--gtttgt--tgtaaattttctatac----------t
            Ma's night monkey  tgtccaaagt--gtttgt--tgtaaattttccatac----------t
B D                   Tarsier  tgtcagagct--atttac--tgcaacactcccacat----------t
            Coquerel's sifaka  tgtataac-t--atttat--cgcaaattttccatat----------t
                  Black lemur  tgtataac-t--atttat--tgcaaattttccatac----------t
              Sclater's lemur  tgtataac-t--atttat--tgcaaattttccatac----------t
B D                     Mouse  --------------------tgtatacttttcatac----------t
B D                       Dog  tgtcaaaa----ttttat--tggaaatatcccatat----------t
B D                 Armadillo  tgtaaaaaac--atttat--tgtaaattttccatat----------t
                 Mouse lemur  ===============================================
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 4 of 34 in window, 72499419 - 72499428, 10 bps 
B D                     Human  gtttgatg--------ga
B D                     Chimp  gtttgatg--------ga
B D                    Bonobo  gtttgatg--------ga
B D                   Gorilla  gtttgatg--------ga
B D                 Orangutan  gtttgatg--------ga
B D                    Gibbon  gtttgatg--------ga
B D                    Rhesus  gtttgatg--------ga
B D       Crab-eating macaque  gtttgatg--------ga
           Pig-tailed macaque  gtttgatg--------ga
               Sooty mangabey  gtttgatg--------ga
                       Baboon  gtttgatg--------ga
B D              Green monkey  gtttgatg--------ga
                        Drill  gtttgatg--------ga
B D          Proboscis monkey  gtttgatg--------ga
              Angolan colobus  gtttgatg--------ga
B D  Golden snub-nosed monkey  gtttgatg--------ga
      Black snub-nosed monkey  gtttgatg--------ga
B D                  Marmoset  gtttgatggagtaaacaa
B D           Squirrel monkey  gtttg-----------aa
          White-faced sapajou  gtttgatg--------ga
            Ma's night monkey  gtttgatg--------ga
B D                   Tarsier  gtttgatg--------ga
            Coquerel's sifaka  gtttgatg--------ga
                  Black lemur  gtttgatg--------ga
              Sclater's lemur  gtttgatg--------ga
B D                  Bushbaby  gtttgatg--------ga
B D                     Mouse  ggttgatg--------g-
B D                       Dog  gcacggtg--------ga
B D                 Armadillo  gtttggtg--------ga
                 Mouse lemur  ==================

Inserts between block 4 and 5 in window
           Coquerel's sifaka 2bp
                 Black lemur 184bp
             Sclater's lemur 195bp
B D                 Bushbaby 2bp

Alignment block 5 of 34 in window, 72499429 - 72499435, 7 bps 
B D                     Human  -gtaaaaa-
B D                     Chimp  -gtaaa---
B D                    Bonobo  -gtaaa---
B D                   Gorilla  -gtaaa---
B D                 Orangutan  -gtaaa---
B D                    Gibbon  -gtaaa---
B D                    Rhesus  -gtaaa---
B D       Crab-eating macaque  -gtaaa---
           Pig-tailed macaque  -gtaaa---
               Sooty mangabey  -gtaaa---
                       Baboon  -gtaaa---
B D              Green monkey  -gtaaa---
                        Drill  -gtaaa---
B D          Proboscis monkey  -gtaaa---
              Angolan colobus  -gtaaa---
B D  Golden snub-nosed monkey  -gtaaa---
      Black snub-nosed monkey  -gtaaa---
B D                  Marmoset  -acaaa---
B D           Squirrel monkey  -gtaaa---
          White-faced sapajou  -gtaaa---
            Ma's night monkey  -gtaaa---
B D                   Tarsier  -cccca---
            Coquerel's sifaka  -aaaaa---
B D                  Bushbaby  -ggaaa---
B D                       Dog  -ctaac---
B D                 Armadillo  tttaaa--a
                 Mouse lemur  =========
B D                     Mouse  ---------
             Sclater's lemur  =========
                 Black lemur  =========

Inserts between block 5 and 6 in window
           Coquerel's sifaka 99bp
B D                      Dog 2bp

Alignment block 6 of 34 in window, 72499436 - 72499494, 59 bps 
B D                     Human  acaaacaaac------------------------------------------------------------
B D                     Chimp  --aaacaaac------------------------------------------------------------
B D                    Bonobo  --aaacaaac------------------------------------------------------------
B D                   Gorilla  ------aaac------------------------------------------------------------
B D                 Orangutan  --aaacaaac------------------------------------------------------------
B D                    Gibbon  --aaacaaac------------------------------------------------------------
B D                    Rhesus  ----------------------------------------------------------------------
B D       Crab-eating macaque  ----------------------------------------------------------------------
           Pig-tailed macaque  ----------------------------------------------------------------------
               Sooty mangabey  ------aaac------------------------------------------------------------
                       Baboon  ------aaac------------------------------------------------------------
B D              Green monkey  ------aaac------------------------------------------------------------
                        Drill  ------aaac------------------------------------------------------------
B D          Proboscis monkey  ------aaac------------------------------------------------------------
              Angolan colobus  ------aaac------------------------------------------------------------
B D  Golden snub-nosed monkey  ------aaac------------------------------------------------------------
      Black snub-nosed monkey  ------aaac------------------------------------------------------------
B D                  Marmoset  -----caaac------------------------------------------------------------
B D           Squirrel monkey  -----caaac------------------------------------------------------------
          White-faced sapajou  -----caaac------------------------------------------------------------
            Ma's night monkey  -----caaac------------------------------------------------------------
B D                   Tarsier  ----------------------------------------------------------------------
B D                  Bushbaby  ----------------------------------------------------------------------
B D                     Mouse  ----------------------------------------------------------------------
B D                       Dog  -----aaaac------------------------------------------------------------
B D                 Armadillo  ----taaaatcagtgatagagtagatgtagctcagtagttgagtgcctgcttcccatgtactgggttcaa
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================

                        Human  ------------------aaacaaacaaagagatgagg------a-ggttttgcatagaaggacagcccc
                        Chimp  ------------------aaacaaacaaagagatgagg------a-ggttttgcat---aggacagcccc
                       Bonobo  ------------------aaacaaacaaagagatgagg------a-ggttttgcatagaaggacagcccc
                      Gorilla  ------------------aaacaaacaaagagatgagg------a-ggttttgcatagaaggacagcccc
                    Orangutan  ------------------aagcaaacaaagagatgagg------a-ggttttgcatagaaggacagcccc
                       Gibbon  ------------------aaacaaacaaagagatgagg------a-ggttttgcatagaaggacagcccc
                       Rhesus  ------------------aaacaaacaaacagatgagt------a-ggctttacatagaaggacagcccc
          Crab-eating macaque  ------------------aaacaaacaaacagatgagt------a-ggctttacatagaaggacagcccc
           Pig-tailed macaque  ------------------aaacaaacaaacagatgagt------a-ggctttacatagaaggacagcccc
               Sooty mangabey  ------------------aaacaaacaaacagatgagt------a-ggctttgcatagaaggacagcccc
                       Baboon  ------------------aaacaaacaaacagatgagt------a-ggctttgcataggaggacagcccc
                 Green monkey  ------------------aaacaaacaaatagatgagt------a-ggctttgcatagaaggacagcccc
                        Drill  ------------------aaacaaacaaacagatgagt------a-ggctttgcatagaaggacagcccc
             Proboscis monkey  ------------------aaacaaacaaacagatgagt------a-ggctttgcatagaaggacagcccc
              Angolan colobus  ------------------aaacaaacaaacagatgagt------a-ggctttgcatagaaggacagcccc
     Golden snub-nosed monkey  ------------------aaacaaacaaacagatgagt------a-ggctttgcatagaaggacagcccc
      Black snub-nosed monkey  ------------------aaacaaacaaacagatgagt------a-ggctttgcatagaaggacagcccc
                     Marmoset  ------------------aaataaa-aaacagatgagg------a-gtttttgcatgga---acaccccc
              Squirrel monkey  ------------------aaacaaa-aaacagatgagg------a-gtttttgcataga---acagcccc
          White-faced sapajou  ------------------aaacaaa-aaacagatgagg------a-gtttttgcataga---acagcccc
            Ma's night monkey  ------------------aaacaaa-aaacagatgagg------a-gtttttgcataga---acagcccc
                      Tarsier  -------------------aatcagcacccaggggagg------c-tgttttgcacaggctggcagac--
                     Bushbaby  --------------------------------gtgag-------------------------gcagcccc
                        Mouse  ------------------------acatggagatg------------tttttgcataaggagaccatcct
                          Dog  ------------------aaaaaaac---caggtgaggattttta-tttttctcataaaagggcaacact
                    Armadillo  ttcctagtacctcctttaaaaaaaaaaaattggtgagc------atttttttgcatgggagggttgcc-c
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================

                        Human  acac
                        Chimp  gcac
                       Bonobo  gcac
                      Gorilla  gcac
                    Orangutan  acac
                       Gibbon  acac
                       Rhesus  gcac
          Crab-eating macaque  gcac
           Pig-tailed macaque  gcac
               Sooty mangabey  gcac
                       Baboon  gcac
                 Green monkey  gcac
                        Drill  gcac
             Proboscis monkey  gcac
              Angolan colobus  gcac
     Golden snub-nosed monkey  gcac
      Black snub-nosed monkey  gcac
                     Marmoset  acac
              Squirrel monkey  acac
          White-faced sapajou  acac
            Ma's night monkey  acag
                      Tarsier  -cac
                     Bushbaby  acac
                        Mouse  acat
                          Dog  acac
                    Armadillo  acac
                  Mouse lemur  ====
            Coquerel's sifaka  ====
              Sclater's lemur  ====
                  Black lemur  ====

Inserts between block 6 and 7 in window
B D                Orangutan 229bp
B D                    Mouse 5bp
B D                      Dog 1bp

Alignment block 7 of 34 in window, 72499495 - 72499563, 69 bps 
B D                     Human  -agaatggggagaacaagccaggtaagcag--tgtccacacgg-----tcagggctgcggggtctatgga
B D                     Chimp  -agaatggggagaacaagccaggtaagcag--tgtccacacgg-----tcagggctgcgaggtctatgga
B D                    Bonobo  -agaatggggagaacaagccaggtaagcag--tgtccacacgg-----tcagggctgcgaggtctatgga
B D                   Gorilla  -agaatggggagaacaagccaggtaagcag--tgtccacacgg-----tcagggc---------------
B D                 Orangutan  -agaatggagaaaacaagccaggtgagcag--tgtccacatgg-----tcagggctgcggggtgtatgga
B D                    Gibbon  -agaatggggagaacaagccaggtaagcag--tgtccacacgg-----tcagggctgcgggttgtatgga
B D                    Rhesus  -aggatggggaaaacaagccaggtgagtagagtgtccacacgg-----tcagggctgcgaggggtgtgga
B D       Crab-eating macaque  -aggatggggaaaacaagccaggtgagtagagtgtccacacgg-----tcagggctgcgaggggtgtgga
           Pig-tailed macaque  -aggatggggaaaacaagccaggtgagtagagtgtccacacgg-----tcagggctgcgaggggtgtgga
               Sooty mangabey  -aggatgcggagaacaagccaggagaatagagtgtccacacgg-----tcagggctgcgaggggtgtgga
                       Baboon  -agaatggggagaacaagccaggagagtagagtgtccacacgg-----tcagggctgcgaggggtgtgga
B D              Green monkey  -aggatggggagaacaagccaggtgagtagagtgtccacacgg-----tcagggctgcgaggggtgtgga
                        Drill  -aggatggggagaacaagccaggagagtagagtgtccacacgg-----tcagggttgcgaggggtgtgga
B D          Proboscis monkey  -aggatggggagaacaagccaggtgagtagcgtgtccacacag-----tcagggctgccaggggtgtgga
              Angolan colobus  -aggttggggagaacaagccaggtgagtagcgtgtccacacag-----tcagggctgccaggggtgtgga
B D  Golden snub-nosed monkey  -aggatggggagaacaagccaggtgagtagcatgtccacacag-----tcagggctgccaggggtgtgga
      Black snub-nosed monkey  -aggatggggagaacaagccaggtgagtagcatgtccacacag-----tcagggctgccaggggtgtgga
B D                  Marmoset  -agggcagggaggacaaaccgggtgagcagagtgttcacacag-----tcagggctgtggggtgtgtgga
B D           Squirrel monkey  -agggcagggaggacaaaccgggtgagcagagtgtccacatgg-----tcagggctgtggggtgtgtaga
          White-faced sapajou  -agggcagggaggacaagctgggtgagcagagtgtccacatgg-----tcagggctgctgggtgtgtgga
            Ma's night monkey  -agggcggggaggacaagccgcgtgagc--agtgtccacacgg-----tcagggctgc-gggtgtatgga
B D                   Tarsier  -agagtgaga----------gggcaggcagagtatccatgtgg-----ggagg-----------------
B D                  Bushbaby  -ggggaggggagaactcacagggagagctgggcatccacatgg----------------ggcagggtgga
B D                     Mouse  -acagtgatatgaaggggcca------tggagtgttctcctagcgaaatcagggc-------------gt
B D                       Dog  -agttgtgggagaacaagtagagtgattagggcatccgcatgg---gggcaggg-tgggaaggatctgca
B D                 Armadillo  aagttgtgggaaaataagcaggaggagcttggtgtctgcatgg-----t-----------gggatatgat
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================

                        Human  gaattgc
                        Chimp  gaattgc
                       Bonobo  gaattgc
                      Gorilla  ----tgc
                    Orangutan  gaactgc
                       Gibbon  gaactgc
                       Rhesus  gtactgc
          Crab-eating macaque  gtactgc
           Pig-tailed macaque  gtactgc
               Sooty mangabey  gtactgc
                       Baboon  gtactgc
                 Green monkey  gtactgc
                        Drill  gtactgc
             Proboscis monkey  gtactgc
              Angolan colobus  gtactgc
     Golden snub-nosed monkey  gtactgc
      Black snub-nosed monkey  gtactgc
                     Marmoset  gaactgc
              Squirrel monkey  gaactgc
          White-faced sapajou  gaactgc
            Ma's night monkey  gaactgc
                      Tarsier  -------
                     Bushbaby  gggaccc
                        Mouse  ttatttt
                          Dog  gaggtag
                    Armadillo  ctgc---
                  Mouse lemur  =======
            Coquerel's sifaka  =======
              Sclater's lemur  =======
                  Black lemur  =======

Inserts between block 7 and 8 in window
B D                    Mouse 1bp
B D                      Dog 9bp

Alignment block 8 of 34 in window, 72499564 - 72499638, 75 bps 
B D                     Human  agtggcagctgtcc-agtgcaggatgctg---gtgcctaaa-------------gta-----agggt---
B D                     Chimp  agtggcagctgtcc-agtgcaggatgttg---gtgcctaaa-------------gta-----agggt---
B D                    Bonobo  agtggcagctgtcc-agtgcaggatgttg---gtgcctaaa-------------gta-----agggt---
B D                   Gorilla  actggcagctgtcc-agtgcaggatgttg---gtgcctaaa-------------gta-----agggt---
B D                 Orangutan  agtggcagctgtcc-agtgcaggatgttg---gtgcctaaa-------------gtg-----agggt---
B D                    Gibbon  agtggccgctgtcc-aatgcaggatgttg---gtgcctaaa-------------gtg-----agggt---
B D                    Rhesus  agtggcatcagtcc-aatgcaggatgtca---gtgcttaaa-------------gtg-----agggt---
B D       Crab-eating macaque  agtggcatcagtcc-aatgcaggatgtca---gtgcttaaa-------------gtg-----agggt---
           Pig-tailed macaque  agtggcatcagtcc-aatgcaggatgtca---gtgcttaca-------------gtg-----agggt---
               Sooty mangabey  agtggcatcagtcc-aatgcaggatgtca---gtgcttaaa-------------gtg-----agggc---
                       Baboon  agtggcatcagtcc-aatgcaggatgtca---gtgcttaaa-------------gtg-----agggc---
B D              Green monkey  aggggcatcagtcc-aatgcaggatgtca---gtgcttaaa-------------gtg-----agggt---
                        Drill  agtggcatcagtcc-aatgcaggatgtca---gtgcttaaa-------------gtg-----agggc---
B D          Proboscis monkey  agtggcatcagtcc-aatgcaggatgtca---gtgcttaaa-------------gtg-----agggt---
              Angolan colobus  agtggcatcagtcc-aatgcaggatgtca---gtgcttaaa-------------gtg-----agggt---
B D  Golden snub-nosed monkey  agtggcatcagtcc-aatgcaggatgtca---gtgcttaaa-------------gtg-----agggt---
      Black snub-nosed monkey  agtggcatcagtcc-aatgcaggatgtca---gtgcttaaa-------------gtg-----agggt---
B D                  Marmoset  agtggcagctgtcc-aacgcaggaagtca----tgcctaaa-------------gtg-----agggt---
B D           Squirrel monkey  agtggcagctgtcc-aacacaggatgtca----cacctaaa-------------gtg-----agggt---
          White-faced sapajou  agtggcagctgtcc-agtgcaggatgtca----cgcctaaa-------------gtg-----agggt---
            Ma's night monkey  agtggcagctgtcc-aatgcaggatgtca----cgcctaaa-------------gtg-----agggt---
B D                   Tarsier  --tggcat--------------------------------------------------------------
                  Mouse lemur  agtggcagctgtcc-agtgcaggacgttg---gtgtctgaa-------------gtg-----agggt---
            Coquerel's sifaka  agtggcatctgtcc-aatgcaggatgttg---gtgtctgaa-------------gtg-----agggt---
B D                  Bushbaby  ----gcagct---c-aatgcaagatgttg---ctgcctgaa-------------gaa-----aaggt---
B D                     Mouse  aatacta-ctgcct-gactcagg-tatgg---gtgcctgaa-------------gca-----aggat---
B D                       Dog  ---ggtgtcagtccttgagtagagtgtggagcatatctgaa-------------gtg-----agggt---
B D                 Armadillo  agtcgctgctgtcc-agtgtggggtatca---gtgcctgaatgggatgaggaaggtgtctgaagggtggg
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================

                        Human  --gatgcagaaggtggtag-ctacagtggggga
                        Chimp  --gatgcagaaggtggtag-ctacagtggggga
                       Bonobo  --gatgcagaaggtggtag-ctacagtggggga
                      Gorilla  --gatgcagaaggtggtag-ctac-gtgtggga
                    Orangutan  --gatgcagtaagtggtagcctacagtggggga
                       Gibbon  --gatgcagaaggtggtag-ctacagtggggga
                       Rhesus  --gatgcgcaaggtggtag-ctacagtggggga
          Crab-eating macaque  --gatgcgcaaggtggtag-ctacagtggggga
           Pig-tailed macaque  --gatgcgcaaggtggtag-ctacagtggggga
               Sooty mangabey  --gatgcggaaggtagtag-ctacagtggggga
                       Baboon  --gatgcagaaggtagtag-ctacagtggggga
                 Green monkey  --gatgcggaaggtggtag-ctacagtggagga
                        Drill  --gatgcggaaggtagtag-ctatagtggggga
             Proboscis monkey  --gatacggaaggtggtag-ctacagtggggga
              Angolan colobus  --gatacggaaggtggtag-ctacagtggggga
     Golden snub-nosed monkey  --gatacggaaggtggtag-ctacagtggggga
      Black snub-nosed monkey  --gatacggaaggtggtag-ctacagtggggga
                     Marmoset  --gatgcgggaagtggtag-ctaccct------
              Squirrel monkey  --gatgcagaaagtggtag-ctgcact------
          White-faced sapajou  --gatgcggaaagtggtag-ctacact------
            Ma's night monkey  --gatgcggaaagtggtag-ctacact------
                      Tarsier  --------gaggctggtag-ccatagt-ggaga
                  Mouse lemur  --gacatggagggtggtgg-ctccagtggggga
            Coquerel's sifaka  --gacatggagggtggtag-ctccagtggggga
                     Bushbaby  --gacat-gagggtagtgg-ctacaatgtgggg
                        Mouse  --ggca-ggaagatggtag-ctacaatgacaa-
                          Dog  --aacatgaagtattgcag-ctacaggggtaaa
                    Armadillo  tggacatgaagggtttcag-ctacaatggggta
              Sclater's lemur  =================================
                  Black lemur  =================================

Inserts between block 8 and 9 in window
           Coquerel's sifaka 1778bp

Alignment block 9 of 34 in window, 72499639 - 72499648, 10 bps 
B D                     Human  cataggggac
B D                     Chimp  cataggggac
B D                    Bonobo  cataggggac
B D                   Gorilla  cataggggac
B D                 Orangutan  cataggggac
B D                    Gibbon  cataggggac
B D                    Rhesus  cataggggac
B D       Crab-eating macaque  cataggggac
           Pig-tailed macaque  cataggggac
               Sooty mangabey  cataggggac
                       Baboon  cataggggac
B D              Green monkey  cataggggac
                        Drill  cataggggac
B D          Proboscis monkey  cataggggac
              Angolan colobus  cataggggac
B D  Golden snub-nosed monkey  cataggggac
      Black snub-nosed monkey  cataggggac
B D                   Tarsier  cacagggact
                  Mouse lemur  tgtaggggac
B D                  Bushbaby  tgt-------
B D                     Mouse  ggttggaagc
B D                       Dog  tataacagac
B D                 Armadillo  agtaaggatc
           Coquerel's sifaka  ==========
           Ma's night monkey  ----------
         White-faced sapajou  ----------
             Sclater's lemur  ==========
                 Black lemur  ==========
B D           Squirrel monkey  ----------
B D                  Marmoset  ----------

Inserts between block 9 and 10 in window
                 Mouse lemur 1760bp
B D                    Mouse 2bp

Alignment block 10 of 34 in window, 72499649 - 72499653, 5 bps 
B D                     Human  tgctc
B D                     Chimp  tgctc
B D                    Bonobo  tgctc
B D                   Gorilla  tgctc
B D                 Orangutan  tgctc
B D                    Gibbon  tgctc
B D                    Rhesus  tgctc
B D       Crab-eating macaque  tgctc
           Pig-tailed macaque  tgctc
               Sooty mangabey  tgctc
                       Baboon  tgctc
B D              Green monkey  tgctc
                        Drill  tgctc
B D          Proboscis monkey  tgctc
              Angolan colobus  tgctc
B D  Golden snub-nosed monkey  tgctc
      Black snub-nosed monkey  tgctc
B D                   Tarsier  tgctc
B D                     Mouse  tgc--
B D                       Dog  tgctt
B D                 Armadillo  taccc
                 Mouse lemur  =====
           Coquerel's sifaka  =====
           Ma's night monkey  -----
         White-faced sapajou  -----
             Sclater's lemur  =====
                 Black lemur  =====
B D                  Bushbaby  -----
B D           Squirrel monkey  -----
B D                  Marmoset  -----

Alignment block 11 of 34 in window, 72499654 - 72499664, 11 bps 
B D                     Human  aggggacagtg
B D                     Chimp  aggggacagtg
B D                    Bonobo  aggggacagtg
B D                   Gorilla  aggggacagtg
B D                 Orangutan  aggggacagtg
B D                    Gibbon  gggggacagtg
B D                    Rhesus  cggggacagtg
B D       Crab-eating macaque  cggggacagtg
           Pig-tailed macaque  cggggacagtg
               Sooty mangabey  aggggacactg
                       Baboon  aggggacagtg
B D              Green monkey  aggggacagtg
                        Drill  aggggacagtg
B D          Proboscis monkey  aggggacagtg
              Angolan colobus  aggggacagtg
B D  Golden snub-nosed monkey  aggggacagtg
      Black snub-nosed monkey  aggggacagtg
B D                  Marmoset  --aggacagtg
B D           Squirrel monkey  --gggacagtg
          White-faced sapajou  --gggacagta
            Ma's night monkey  --aggacagtg
B D                   Tarsier  a-gggacgttg
                  Black lemur  aggggaccgtt
B D                  Bushbaby  agaggagagtt
B D                     Mouse  ---tgagagta
B D                       Dog  aggggatagtt
B D                 Armadillo  agaggacagta
                 Mouse lemur  ===========
           Coquerel's sifaka  ===========
             Sclater's lemur  ===========

Inserts between block 11 and 12 in window
B D                    Mouse 3bp

Alignment block 12 of 34 in window, 72499665 - 72499693, 29 bps 
B D                     Human  gtgatgatggcctggcaagtggcgtcaga
B D                     Chimp  gtgatgatggcctggcaagtggcatcaga
B D                    Bonobo  gtgatgatggcctggcaagtggcgtcaga
B D                   Gorilla  gtgatgatggcctggcaagtggcgtcaga
B D                 Orangutan  gtgatgatggcctggcaagtggtgtcaga
B D                    Gibbon  gtgatgatggcctggcaagtggtgtcaga
B D                    Rhesus  gtcatgatggcctggcaagtggtgtcaga
B D       Crab-eating macaque  gtcatgatggcctggcaagtggtgtcaga
           Pig-tailed macaque  gtcatgatggcctggcaagtggtgtcaga
               Sooty mangabey  gtgatgatggcctggcaagtggtgtcaga
                       Baboon  gtgatgatggcctggcaagtggtgtcaga
B D              Green monkey  gtcatgatggcctggcaagtggtgtcaga
                        Drill  gtgatgatggcctggcaagtggtgtcaga
B D          Proboscis monkey  gtgatgatggcctggcaagtggtgtcaga
              Angolan colobus  gtgatgatggcctggcaagtggtgtcaga
B D  Golden snub-nosed monkey  gtgatgatggcctggcaagtggtgtcaga
      Black snub-nosed monkey  gtgatgatggcctggcaagtggtgtcaga
B D                  Marmoset  gtgatgatgacctggtaattggtgtcaga
B D           Squirrel monkey  gtgatgatggcctggcaattgatgtgaga
          White-faced sapajou  gtgatgatggcctggcaattggtgtcaga
            Ma's night monkey  gtgatgatggcctggcaattggtgtcaga
B D                   Tarsier  gtgatgatggcccggcagg-ggcatcaga
                  Black lemur  gtgatgatggcctggcaagtggtgtcaga
              Sclater's lemur  gtgatgatggcctggcaagtggtgtcaga
B D                  Bushbaby  gtgacaatgacctggcaagtggtgtcaga
B D                     Mouse  gtgagaatggccttacaagctatgccaga
B D                       Dog  gttatagtagcctagccagtggtgtcgaa
B D                 Armadillo  gtgacagtgacccaacaaatggtagccaa
                 Mouse lemur  =============================
           Coquerel's sifaka  =============================

Inserts between block 12 and 13 in window
B D                  Tarsier 1bp
                 Black lemur 1882bp
             Sclater's lemur 1882bp
B D                 Bushbaby 1bp
B D                    Mouse 1bp
B D                      Dog 1bp

Alignment block 13 of 34 in window, 72499694 - 72499792, 99 bps 
B D                     Human  ccccggcggagcaag---aaggatgtcggtgcagtgagacaaagggtggcagcagagatcaatgctcagt
B D                     Chimp  ccccagcggagcaag---aaggatgtcggtgcagtgagacaaagggtggcagcagaaatcaatgctcagt
B D                    Bonobo  ccccagcggagcaag---aaggatgtcggtgcagtgagacaaagggtggcagcagagatcaatgctcaat
B D                   Gorilla  ccccagcggagcaag---aaggatgtcggtgcagtgagacaaagggtggcagcagagatcaatgctcagt
B D                 Orangutan  ccccagcagagcaag---aaggatgtcggtgcagtgagacaaa-ggtgacagcagagatcaatgctcagt
B D                    Gibbon  ccccagcggagcaag---aaggatttcggtgcagtgagacaaagggtagcagcagacatcaatgctcagt
B D                    Rhesus  ccccagtagagcaag---aaggatgtcggtgcaatgagacaaagggtagcagcagggatcaatgctcagt
B D       Crab-eating macaque  ccccagtagagcaag---aaggatgtcggtgcaatgagacaaagggtagcagcagggatcaatgctcagt
           Pig-tailed macaque  ccccagtagagcaag---aaggatgtcggtgcaatgagacaaagggtagcagcagggatcaatgctcagt
               Sooty mangabey  ccccagtagcgcaag---aaggatgtcggtgcaatgagacaaagggtagcagcagggatcaatgctcagt
                       Baboon  ccccagtagcgcaag---aaggatgtgggtgcaatgagacaaagggtagcagcagggatcaatgctcagt
B D              Green monkey  ccccagtagagcaag---aaggatgtcggggcaatgagacaaagggtagcagcagggatcaatgctcagt
                        Drill  ccccagtagcgcaag---aaggatgtcggtgcaatgagacaaagggtagcagcagggatcaatgctcagt
B D          Proboscis monkey  ccccagtagagcaag---aaggatgtcggtgcaatgagacaaagggtagcagcagggatcaatgctcagt
              Angolan colobus  ccccagtagagcaag---aaggatgttggtgcaatgagacaaagggtagcagcagggatcaatgcttagt
B D  Golden snub-nosed monkey  ccccagtagagcaag---aaggatgtcggtgcaatgagacaaagggtagcagcagggatcaatgctcagt
      Black snub-nosed monkey  ccccagtagagcaag---aaggatgtcggtgcaatgagacaaagggtagcagcagggatcaatgctcagt
B D                  Marmoset  ccccagcagagcaag---aag----------------gacaaggggtagcagtagggatcaatgcttagt
B D           Squirrel monkey  ccccagcagagcaag---aaggacattggtgcagtaagacaaggggtagcaatagggatcagtgcttagt
          White-faced sapajou  ccgcagcagagcaag---aaggacattggtgcagtaagacaaggggtagcagtagggatcaatgcttagt
            Ma's night monkey  cctcagcagagcaag---aaggacattggggcagtaagacaaggggtagcagtagggatcaatgcttagt
B D                   Tarsier  ccagagcagagtaag-----gggtatccatggaatggg--caggggctgcagcagggaccaccaacgagt
B D                  Bushbaby  ccagagcagagcaag---cagggcatc-acgcagcgagaccagcagcagcagcagggactgacaatttgt
B D                     Mouse  tatgaatagaataag---aagaacatcaatgaagtgtg-------------gcagagac--atggccagt
B D                       Dog  cctgagcagttaagg-----gaatgccagtgaagtgagacaaggagtagcaacagaggctgattattggt
B D                 Armadillo  -----actggacaaggctagtgaagacagcgtattgagcca--gcatggcaggagcaactgacggtgagt
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================

                        Human  tacatacagggggtctgatcaagtaagaaaat
                        Chimp  tacatacagggggtctgatcaagtaagaaaat
                       Bonobo  tacatacagggggtctgatcaagtaagaaaat
                      Gorilla  tacatacagggggtctgatcaagtaaaaaaat
                    Orangutan  tacatacagggggtctgatcaagtaagaaaat
                       Gibbon  tacatacagggggtctggtcaagtaagaaaat
                       Rhesus  tacatacagggggtctgatcaagtaagaaaat
          Crab-eating macaque  tacatacagggggtctgatcaagtaagaaaat
           Pig-tailed macaque  tacatacagggggtctgatcaagtaagaaaat
               Sooty mangabey  tacatacagggggtctgatcaagtaagaaaat
                       Baboon  tacatacagggggtctgatcaagtaagaaaat
                 Green monkey  tacatacaggtggtctgatcaagtaagaaaat
                        Drill  tacatacagggggtctgatcaagtaagaaaat
             Proboscis monkey  tacatacagggggtctgatcaagtaagaaaat
              Angolan colobus  tacatacagggggtctgatcaagtaagaaaat
     Golden snub-nosed monkey  tacatacagggggtctgatcaagtaagaaaat
      Black snub-nosed monkey  tacatacagggggtctgatcaagtaagaaaat
                     Marmoset  tacctacagggggtctgatcaagt--------
              Squirrel monkey  tacatacagggtatctgatcaagtaagaaaat
          White-faced sapajou  tacatacagggggtctgatcaagtaaaaaaat
            Ma's night monkey  tacatacagggggtctgatcaagtaagaaaat
                      Tarsier  cacccacagggg---tgatcgaatgagagaac
                     Bushbaby  tagatacagaggatacaataaagcaagaaaat
                        Mouse  taggtagatggtacctgaaaacataaaaagga
                          Dog  tatagataggaggtctgatcaaatatgaaaat
                    Armadillo  tacatacaggtggtctgatcaaataagaaaat
                  Mouse lemur  ================================
            Coquerel's sifaka  ================================
              Sclater's lemur  ================================
                  Black lemur  ================================

Inserts between block 13 and 14 in window
B D                 Bushbaby 3073bp
B D                    Mouse 4bp

Alignment block 14 of 34 in window, 72499793 - 72499796, 4 bps 
B D                     Human  agat
B D                     Chimp  agat
B D                    Bonobo  agat
B D                   Gorilla  agat
B D                 Orangutan  agat
B D                    Gibbon  agat
B D                    Rhesus  agat
B D       Crab-eating macaque  agat
           Pig-tailed macaque  agat
               Sooty mangabey  agat
                       Baboon  agat
B D              Green monkey  agat
                        Drill  agat
B D          Proboscis monkey  agat
              Angolan colobus  agat
B D  Golden snub-nosed monkey  agat
      Black snub-nosed monkey  agat
B D           Squirrel monkey  agat
          White-faced sapajou  aggt
            Ma's night monkey  agat
B D                   Tarsier  acac
B D                     Mouse  agaa
B D                       Dog  --gt
B D                 Armadillo  atat
                 Mouse lemur  ====
           Coquerel's sifaka  ====
             Sclater's lemur  ====
                 Black lemur  ====
B D                  Bushbaby  ====
B D                  Marmoset  ----

Inserts between block 14 and 15 in window
B D                Armadillo 2194bp

Alignment block 15 of 34 in window, 72499797 - 72499808, 12 bps 
B D                     Human  aa----caagaa-aata
B D                     Chimp  aa----caagaa-aata
B D                    Bonobo  aa----caagaa-aata
B D                   Gorilla  aa----caagaa-aata
B D                 Orangutan  aa----caagaa-aata
B D                    Gibbon  aa----caagaa-aata
B D                    Rhesus  aa----caagaa-aata
B D       Crab-eating macaque  aa----caagaa-aata
           Pig-tailed macaque  aa----caagaa-aata
               Sooty mangabey  aa----caagaa-aata
                       Baboon  aa----caagaa-aata
B D              Green monkey  aa----caagaa-aata
                        Drill  aa----caagaa-aata
B D          Proboscis monkey  aa----caagaa-aata
              Angolan colobus  aa----caagaa-aata
B D  Golden snub-nosed monkey  aa----caagaa-aata
      Black snub-nosed monkey  aa----caagaa-aata
B D                  Marmoset  -------aagaa-aata
B D           Squirrel monkey  ta----caagaa-aata
          White-faced sapajou  ta----caagaa-aata
            Ma's night monkey  ta----ccagaa-aata
B D                   Tarsier  aggggtgatgag-agtc
B D                     Mouse  aa----gaaaga-aaga
B D                       Dog  at----taaggataata
                 Mouse lemur  =================
           Coquerel's sifaka  =================
             Sclater's lemur  =================
                 Black lemur  =================
B D                 Armadillo  =================
B D                  Bushbaby  =================

Inserts between block 15 and 16 in window
           Ma's night monkey 12bp
B D                  Tarsier 1bp

Alignment block 16 of 34 in window, 72499809 - 72499809, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                    Bonobo  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
           Pig-tailed macaque  g
               Sooty mangabey  g
                       Baboon  g
B D              Green monkey  g
                        Drill  g
B D          Proboscis monkey  g
              Angolan colobus  g
B D  Golden snub-nosed monkey  g
      Black snub-nosed monkey  g
B D                  Marmoset  c
B D           Squirrel monkey  t
          White-faced sapajou  t
B D                   Tarsier  g
B D                       Dog  g
                 Mouse lemur  =
           Coquerel's sifaka  =
B D                     Mouse  -
           Ma's night monkey  =
             Sclater's lemur  =
                 Black lemur  =
B D                 Armadillo  =
B D                  Bushbaby  =
B D                   Gorilla  -

Inserts between block 16 and 17 in window
B D                      Dog 3152bp

Alignment block 17 of 34 in window, 72499810 - 72499813, 4 bps 
B D                     Human  ggga--
B D                     Chimp  ggga--
B D                    Bonobo  ggga--
B D                   Gorilla  ggga--
B D                 Orangutan  gggc--
B D                    Gibbon  gggt--
B D                    Rhesus  gggt--
B D       Crab-eating macaque  gggt--
           Pig-tailed macaque  gggt--
               Sooty mangabey  gggt--
                       Baboon  gggt--
B D              Green monkey  gggt--
                        Drill  gagt--
B D          Proboscis monkey  gggt--
              Angolan colobus  gggt--
B D  Golden snub-nosed monkey  gggt--
      Black snub-nosed monkey  gggt--
B D                  Marmoset  aggt--
B D           Squirrel monkey  aggt--
          White-faced sapajou  aggt--
B D                   Tarsier  agga--
B D                     Mouse  -agtga
                 Mouse lemur  ======
           Coquerel's sifaka  ======
           Ma's night monkey  ======
             Sclater's lemur  ======
                 Black lemur  ======
B D                 Armadillo  ======
B D                       Dog  ======
B D                  Bushbaby  ======

Inserts between block 17 and 18 in window
B D                    Mouse 2503bp

Alignment block 18 of 34 in window, 72499814 - 72499816, 3 bps 
B D                     Human  ggg
B D                     Chimp  ggg
B D                    Bonobo  ggg
B D                   Gorilla  ggg
B D                 Orangutan  ggg
B D                    Gibbon  ggg
B D                    Rhesus  ggg
B D       Crab-eating macaque  ggg
           Pig-tailed macaque  ggg
               Sooty mangabey  ggg
                       Baboon  ggg
B D              Green monkey  ggg
                        Drill  ggg
B D          Proboscis monkey  ggg
              Angolan colobus  ggg
B D  Golden snub-nosed monkey  ggg
      Black snub-nosed monkey  ggg
B D                  Marmoset  gtc
B D           Squirrel monkey  ggc
          White-faced sapajou  ggc
B D                   Tarsier  ggg
                 Mouse lemur  ===
           Coquerel's sifaka  ===
B D                     Mouse  ===
           Ma's night monkey  ===
             Sclater's lemur  ===
                 Black lemur  ===
B D                 Armadillo  ===
B D                       Dog  ===
B D                  Bushbaby  ===

Inserts between block 18 and 19 in window
B D                  Tarsier 1396bp

Alignment block 19 of 34 in window, 72499817 - 72499821, 5 bps 
B D                     Human  gcgca
B D                     Chimp  gcaca
B D                    Bonobo  gcgca
B D                   Gorilla  gcgca
B D                 Orangutan  gcaca
B D                    Gibbon  gtgtg
B D                    Rhesus  gcaca
B D       Crab-eating macaque  gcaca
           Pig-tailed macaque  gcaca
               Sooty mangabey  gcaca
                       Baboon  gcaca
B D              Green monkey  gcaca
                        Drill  gcaca
B D          Proboscis monkey  gcaca
              Angolan colobus  gcaca
B D  Golden snub-nosed monkey  gcaca
      Black snub-nosed monkey  gcaca
B D                  Marmoset  acata
B D           Squirrel monkey  acatg
          White-faced sapajou  acatg
                 Mouse lemur  =====
           Coquerel's sifaka  =====
B D                     Mouse  =====
           Ma's night monkey  =====
             Sclater's lemur  =====
                 Black lemur  =====
B D                 Armadillo  =====
B D                       Dog  =====
B D                  Bushbaby  =====
B D                   Tarsier  =====

Alignment block 20 of 34 in window, 72499822 - 72499937, 116 bps 
B D                     Human  gtgtctcatgcctgtaatctcagcactctgggaggccaaggcgggcagattacc-tgaggtcaggagttc
B D                     Chimp  gtgtctcatgcctgtaatctcagcactctgggaggccaaggcgggcagattacc-tgaggtcaggagttc
B D                    Bonobo  gtgtctcatgcctgtaatctcagcaatctgggaggccaaggcgggcagattacc-tgacgtcaggagttc
B D                   Gorilla  gtgtctcatgcctgtaatctcagcactctgggaggccaaggcgggcagattacc-tgaggtcgggagttc
B D                 Orangutan  gtgtctcatgtctgttatctcagcactctgggaggccgaggcgggcagattacc-tgaggtcaggagttc
B D                    Gibbon  gggtctcatgcctgtaatctcagcactctgggaggctgaggctggtagattacc-tggggtcaggagttc
B D                    Rhesus  gtgtctcacgcctgtaatctcagcactctgggaggcccaggaaggcagattacc-tgaggtcaggagttc
B D       Crab-eating macaque  gtgtctcacgcctgtaatctcagcactctgggaggcccaggaaggcagattacc-tgaggtcaggagttc
           Pig-tailed macaque  gtgtcccacgcctgtaatctcagcactctgggaggcccaggaaggcagattacc-tgaggtcaggagttc
               Sooty mangabey  gtgtctcacgcctgtaatcttagcactctgggaggccctggaaggcagattacc-tgaggtcaggagttc
                       Baboon  gtgtctcacgcctgtaatcttagcagtctgggaggcccaggaaggcagattacc-tgaggtcaggagttc
B D              Green monkey  gtgtctcacgcctgtaatctcagcactctgggaggcccaggaaggcagattacc-tgaggtcaggagttc
                        Drill  gtgtctcacgcctgtaatcttagcactctgggaggcccaggaaggcagattacc-tgaggtcaggagttc
B D          Proboscis monkey  gtgtctcacgcctgtaatctcagcactctgggaggcccaggaaggcagattacc-tgaggtcaggagttc
              Angolan colobus  gtgtctcacgcctgtaatctcagcactctgggaggcccaggaaggcagattacc-tgaggtcaggagttc
B D  Golden snub-nosed monkey  gtgtctcatgcctgtaatctcagcactctgggaggcccaggaaggcagattacc-tgaggtcaggagttc
      Black snub-nosed monkey  gtgtctcacgcctgtaatctcagcattctgggaggcccaggaaggcagattacc-tgaggtcaggagttc
B D                  Marmoset  gtggctcacgcctgtaatctcagcactctgggaggctgaggtgggcagatcacc-tgaggtcaggagttc
B D           Squirrel monkey  gtggctcacgcctgtaatctcagcactctgggaggctgaggtgggcagatcacc-tgaggtcaggagttc
          White-faced sapajou  gtggctcacgcctgtaatcccagcactccgggaggctgaggcgggcagatcaccttgaggtcaggagttc
            Ma's night monkey  gtggctcacacctgtaatctcagcactctgggaggctgaggcgggcagatcacc-tgaggtcaggagttc
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
B D                     Mouse  ======================================================================
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================
B D                 Armadillo  ======================================================================
B D                       Dog  ======================================================================
B D                  Bushbaby  ======================================================================
B D                   Tarsier  ======================================================================

                        Human  gagaccag-cctggccaacatggtgaaaccccgtctctact-a-aaaaat
                        Chimp  gagaccag-cctggccaacatggtgaaaccccgtctctact-a-aaaaat
                       Bonobo  gagaccag-cctggccaacatggtgaaaccccgtctctact-a-aaaaat
                      Gorilla  aagaccag-cctggccaatatggtgaaaccccgtctctact-a-aaaaat
                    Orangutan  gagaccagccctggccaacatggtgaaaccccgtttctatt-ataaaaat
                       Gibbon  gagaccag-cctggccaacatggtgaaaccccgtctctact-a-aaaaat
                       Rhesus  aagaccag-cctggccgacatggtgaaaccttgtctctgtt-a-aaaaat
          Crab-eating macaque  aagaccag-cctggccgacatggtgaaaccttgtctctgtt-a-aaaaat
           Pig-tailed macaque  gagaccag-cctggccgacatggtgaaaccttgtctctgtt-a-aaaaat
               Sooty mangabey  aagaccag-cctggccgacatggtgaaacctcgtctctgtt-a-aaaaat
                       Baboon  aagaccag-cctggccgacatggtgaaacctcgtctctgtt-a-aaaaat
                 Green monkey  aagaccag-cctggccgacatggtgaaacctcgtctctgtt-a-aaaaat
                        Drill  aagaccag-cctggctgacatggtgaaacctcgtctctgtt-a-aaaaat
             Proboscis monkey  aagaccag-cctggccgacatggtgaaacctcgtctctgtt-a-aaaaat
              Angolan colobus  aagaccag-cctggccgacatggtgaaacctcatctctgttaa-aaaaat
     Golden snub-nosed monkey  aagaccag-cctggccaacatggtgaaacctcgtctctgtt-a-aaaaat
      Black snub-nosed monkey  aagaccag-cctggccaacatggtgaaacctcgtctctgtt-a-aaaaat
                     Marmoset  gagaccag-ccaggccaacatgccaaaa-cccatctctact-a-aaaaat
              Squirrel monkey  gagaccag-cctggccaacatggcaaaaccccatctctact-a-aaaaat
          White-faced sapajou  gagaccag-cctggccaacatggcgaaaccccatctctact-a-aaaaat
            Ma's night monkey  gagaccat-cctggtcaacacggtgaaaccctgtctctact-a-aaaata
                  Mouse lemur  ==================================================
            Coquerel's sifaka  ==================================================
                        Mouse  ==================================================
              Sclater's lemur  ==================================================
                  Black lemur  ==================================================
                    Armadillo  ==================================================
                          Dog  ==================================================
                     Bushbaby  ==================================================
                      Tarsier  ==================================================

Inserts between block 20 and 21 in window
B D                Orangutan 166bp

Alignment block 21 of 34 in window, 72499938 - 72500047, 110 bps 
B D                     Human  acaaaaattagctgggtgtggtggcaggtgcctgtattctcagctgcacaggaggctgaggctggagaat
B D                     Chimp  acaaaaattagctgggtgtggtggcaggtgcctgtattctcagctgcacaggaggctgaggctggagaat
B D                    Bonobo  acaaaaattagctgggtgtggtggcaggtgcctgtattctcagctgcacaggaggctgaggctggagaat
B D                   Gorilla  acaaaaattatctgggtgtggtggcaggtgcctgtattctcagctgcacaggaggctgaggctggagaat
B D                    Gibbon  acaaaaattagctgggtgtggtggcaggtgcctgtattctcagctgctcaggaggctgaggctggagaat
B D                    Rhesus  acaaaaattagctggatctggtggcacgcgcctatattcccagcttctcaggaggctaaggctggagaat
B D       Crab-eating macaque  acaaaaattagctggatctggtggcacgcgcctatattcccagcttctcaggaggctaaggctggagaat
           Pig-tailed macaque  acaaaaattagctggatctggtggcacgcgcctatattcccagcttctcaggaggctaaggctggagaat
               Sooty mangabey  acaaaaattatctggatctggtggcacgcgcctatattcccagcttctcaggagcctaaggctggagaat
                       Baboon  acaaaaattatctggatctggtggcacgcgcctatatttccagcttctcaggaggctaaggctggagaat
B D              Green monkey  acaaaaattagctggatctggtggcacgcgcctatattcccagcttctcaggaggctaaggctggagaat
                        Drill  acaaaaattatctggatctggtggcacgcgcctatattcccagcttctcaggaggttaaggctggagaat
B D          Proboscis monkey  acaaaaattagctggatctagtggcacgcgcctatattcccagcttctcaggaggctaaggctggagaat
              Angolan colobus  acaaaaattagctggatctagtggcacgcgcctatattcccagcttctcaggaggctaaggctggagaat
B D  Golden snub-nosed monkey  acaaaaattagctggatctagtggcacgcgcctatattcccagcttctcaggaggctaaggctggagaat
      Black snub-nosed monkey  acaaaaattagctggatctagtggcacgcgcctatattcccagcttctcaggaggctaaggctggagaat
B D                  Marmoset  gcaaaaattagctgggcgtggtggcacgcgcctgtattcccagctactcaggaggctgaggctggcgaat
B D           Squirrel monkey  acaaaaattagctgggcatggcggcacgcacctgtattcccagctactcagaaggctgagactggagaat
          White-faced sapajou  acaaaaattagctgggcgtggtggcatgcacctgtattcccagctacttaggaggctgaggctggagaat
            Ma's night monkey  caaaaaattagctgggcatggtggcgcgtgcctgtaatcccagctactcaggaggctgaggcaggagaat
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
B D                     Mouse  ======================================================================
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================
B D                 Armadillo  ======================================================================
B D                       Dog  ======================================================================
B D                  Bushbaby  ======================================================================
B D                 Orangutan  ======================================================================
B D                   Tarsier  ======================================================================

                        Human  tgcttgaacctgggaggcgaagtttgctgtgagccgagat
                        Chimp  tgcttgaacctgggaggcgaagtttgctgtgagccgagat
                       Bonobo  tgcttgaacctgggaggcgaagtttgctgtgagccgagat
                      Gorilla  tgcttgaacctgggaggtgaagtttgctgtgagccgagat
                       Gibbon  cacttgaacctgggaggcgaagtttgctgtgagccgagac
                       Rhesus  cgcttgaacccgcgaggcaaagtttgctgtgagccgagat
          Crab-eating macaque  cgcttgaacccgcgaggcaaagtttgctgtgagccgagat
           Pig-tailed macaque  cgcttgaacccgcgaggcaaagtttgctgtgagccgagat
               Sooty mangabey  cgcttgaatccagaaggcaaagtttgctgtgagctgagat
                       Baboon  cgcttgaatccagaaggcaaagtttgctgtgagctgagat
                 Green monkey  cgcttgaacccaggaggcaaagtttgctgtgagccgagat
                        Drill  cgcttgaatccagaaggcaaagtttgctgtgagctgagat
             Proboscis monkey  ggcttgaacccgggaggcaaagtttgctgtgaaccgagat
              Angolan colobus  cgcttgaacccgggaggcaaagtttgctgtgagccgagat
     Golden snub-nosed monkey  ggcttgaacccgggaggcaaagtttgctgtgagccgagat
      Black snub-nosed monkey  ggcttgaacccgggaggcaaagtttgctgtgagccgagat
                     Marmoset  tgcttgaacctcggaggcgaagattgcagtgagctgagat
              Squirrel monkey  tgcttgaacctaggaggcgaagattgcagtgagctgagat
          White-faced sapajou  tgcttgaacctgggaggcgaagattgcagtgagctgagat
            Ma's night monkey  tgcctgaacccaggaggcggaggttgtggtgaaccgagat
                  Mouse lemur  ========================================
            Coquerel's sifaka  ========================================
                        Mouse  ========================================
              Sclater's lemur  ========================================
                  Black lemur  ========================================
                    Armadillo  ========================================
                          Dog  ========================================
                     Bushbaby  ========================================
                    Orangutan  ========================================
                      Tarsier  ========================================

Inserts between block 21 and 22 in window
           Ma's night monkey 58bp

Alignment block 22 of 34 in window, 72500048 - 72500092, 45 bps 
B D                     Human  tgcgtcactgcaatccagtctaagcgacagagcgagactctgtct
B D                     Chimp  tgcatcactgcaatccagtctaagcgacagagcgagactctgtct
B D                    Bonobo  tgcatcactgcaatccagtctaagcgacagagcgagactctgtct
B D                   Gorilla  tgcgtcactgcaatccagtctaagcgacagagcgagactctgtct
B D                    Gibbon  tgcatcactgcaatccagtctaagcgacagaccgagactctgtct
B D                    Rhesus  cgcgtcactgcaatccagtctaagtgacagagtgagactccattt
B D       Crab-eating macaque  cgcgtcactgcaatccagtctaagtgacagagtgagactccatct
           Pig-tailed macaque  cgcgtcactgcaatccagtctaagtgacagagtgagactccatct
               Sooty mangabey  cgcatc---------------------------------------
                       Baboon  cgcatcactgcaatccagtctaagtgacagagtgagactccatct
B D              Green monkey  cgcgtcactgcaatccagtctaagtggcagagtgagactccatct
                        Drill  cgcatcactgcaatccagtctaagtgacagagtgagactctatct
B D          Proboscis monkey  tgcatcactgcaatccagtctaagtgacagagcgagactccatct
              Angolan colobus  tgcatcactgcaatccagtctaagtgacagagcgagactccatct
B D  Golden snub-nosed monkey  tgcatcactgcaatccagtctaagtgacagggcgagactccatct
      Black snub-nosed monkey  tgcatcactgcaatccagtctaagtgacagagcgagactccatct
B D                  Marmoset  tgcatcactgccctccagcctgagtaacagagtgagattccctct
B D           Squirrel monkey  tgtgtcactgcactccagcctgggcaacagagtgagattccgtct
          White-faced sapajou  tgtgtcactgcactccagcctgggcaacagagtgagattctgtct
                 Mouse lemur  =============================================
           Coquerel's sifaka  =============================================
B D                     Mouse  =============================================
           Ma's night monkey  =============================================
             Sclater's lemur  =============================================
                 Black lemur  =============================================
B D                 Armadillo  =============================================
B D                       Dog  =============================================
B D                  Bushbaby  =============================================
B D                 Orangutan  =============================================
B D                   Tarsier  =============================================

Alignment block 23 of 34 in window, 72500093 - 72500095, 3 bps 
B D                     Human  --a--aa
B D                     Chimp  --a--aa
B D                    Bonobo  --a--aa
B D                   Gorilla  --a--aa
B D                    Gibbon  --a--aa
B D                    Rhesus  --a----
B D       Crab-eating macaque  --a----
           Pig-tailed macaque  --a----
                       Baboon  --a----
B D              Green monkey  --a----
                        Drill  --a----
B D          Proboscis monkey  --aag--
              Angolan colobus  --aa---
B D  Golden snub-nosed monkey  --aag--
      Black snub-nosed monkey  --aag--
B D                  Marmoset  caa----
B D           Squirrel monkey  caa----
                 Mouse lemur  =======
           Coquerel's sifaka  =======
B D                     Mouse  =======
           Ma's night monkey  =======
         White-faced sapajou  NNNNNNN
             Sclater's lemur  =======
                 Black lemur  =======
B D                 Armadillo  =======
B D                       Dog  =======
B D                  Bushbaby  =======
B D                 Orangutan  =======
B D                   Tarsier  =======
              Sooty mangabey  -------

Alignment block 24 of 34 in window, 72500096 - 72500107, 12 bps 
B D                     Human  agaaagaaagaa
B D                     Chimp  agaaagaaagaa
B D                    Bonobo  agaaagaaagaa
B D                   Gorilla  aga---------
B D                    Gibbon  agaaagaaagaa
B D                    Rhesus  agaaagaaagaa
B D       Crab-eating macaque  agaaagaaagaa
           Pig-tailed macaque  agaaagaaagaa
               Sooty mangabey  agaaagaaagaa
                       Baboon  agaaagagagag
B D              Green monkey  agaaagaaagaa
                        Drill  agaaagaaagaa
B D          Proboscis monkey  agagagagagag
B D  Golden snub-nosed monkey  ----------ag
B D                  Marmoset  aaataaagaaga
B D           Squirrel monkey  aagaaaaaagaa
                 Mouse lemur  ============
           Coquerel's sifaka  ============
B D                     Mouse  ============
           Ma's night monkey  ============
         White-faced sapajou  NNNNNNNNNNNN
             Sclater's lemur  ============
                 Black lemur  ============
B D                 Armadillo  ============
B D                       Dog  ============
B D                  Bushbaby  ============
             Angolan colobus  ------------
B D                 Orangutan  ============
B D                   Tarsier  ============
     Black snub-nosed monkey  ------------

Alignment block 25 of 34 in window, 72500108 - 72500109, 2 bps 
B D                     Human  ag
B D                     Chimp  ag
B D                    Bonobo  ag
B D                    Gibbon  ag
B D                    Rhesus  ag
B D       Crab-eating macaque  ag
           Pig-tailed macaque  ag
               Sooty mangabey  ag
                       Baboon  ag
B D              Green monkey  ag
                        Drill  ag
B D          Proboscis monkey  ag
B D  Golden snub-nosed monkey  ag
B D                  Marmoset  ag
                 Mouse lemur  ==
           Coquerel's sifaka  ==
B D                     Mouse  ==
           Ma's night monkey  ==
         White-faced sapajou  NN
             Sclater's lemur  ==
                 Black lemur  ==
B D                 Armadillo  ==
B D                       Dog  ==
B D                  Bushbaby  ==
             Angolan colobus  --
B D                 Orangutan  ==
B D                   Gorilla  --
B D                   Tarsier  ==
     Black snub-nosed monkey  --
B D           Squirrel monkey  --

Inserts between block 25 and 26 in window
                       Drill 51bp

Alignment block 26 of 34 in window, 72500110 - 72500110, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                    Bonobo  g
B D                    Gibbon  a
B D          Proboscis monkey  a
B D  Golden snub-nosed monkey  a
B D                  Marmoset  a
                 Mouse lemur  =
           Coquerel's sifaka  =
B D                     Mouse  =
           Ma's night monkey  =
         White-faced sapajou  N
             Sclater's lemur  =
                 Black lemur  =
B D                 Armadillo  =
B D                       Dog  =
B D                  Bushbaby  =
             Angolan colobus  -
B D                 Orangutan  =
B D                   Gorilla  -
B D                   Tarsier  =
     Black snub-nosed monkey  -
                      Baboon  -
B D           Squirrel monkey  -
                       Drill  =
B D              Green monkey  -
              Sooty mangabey  -
          Pig-tailed macaque  -
B D       Crab-eating macaque  -
B D                    Rhesus  -

Alignment block 27 of 34 in window, 72500111 - 72500117, 7 bps 
B D                     Human  --aagaaag
B D                     Chimp  --aagaaag
B D                   Gorilla  --aagaaag
B D                    Gibbon  --acgaaa-
B D                    Rhesus  ---agagag
B D       Crab-eating macaque  ---agagag
           Pig-tailed macaque  ---agagag
               Sooty mangabey  ---aaagaa
                       Baboon  ---agagag
B D          Proboscis monkey  --gagagag
B D  Golden snub-nosed monkey  --gagagag
B D                  Marmoset  agaagaa--
                 Mouse lemur  =========
           Coquerel's sifaka  =========
B D                     Mouse  =========
           Ma's night monkey  =========
         White-faced sapajou  NNNNNNNNN
             Sclater's lemur  =========
                 Black lemur  =========
B D                    Bonobo  ---------
B D                 Armadillo  =========
B D                       Dog  =========
B D                  Bushbaby  =========
             Angolan colobus  ---------
B D                 Orangutan  =========
B D                   Tarsier  =========
     Black snub-nosed monkey  ---------
B D           Squirrel monkey  ---------
                       Drill  =========
B D              Green monkey  ---------

Inserts between block 27 and 28 in window
B D                   Rhesus 1bp
B D      Crab-eating macaque 1bp
          Pig-tailed macaque 1bp
              Sooty mangabey 1bp
                      Baboon 1bp
B D         Proboscis monkey 1bp
B D Golden snub-nosed monkey 1bp

Alignment block 28 of 34 in window, 72500118 - 72500127, 10 bps 
B D                     Human  ---gaaggaagga
B D                     Chimp  ---aaagaaagaa
B D                 Orangutan  ---gaaagaaaga
B D                    Gibbon  ---gaacgaaaga
B D                    Rhesus  ---gagagagag-
B D       Crab-eating macaque  ---gagagagag-
           Pig-tailed macaque  ---gagagagag-
               Sooty mangabey  ---gaaagaaag-
                       Baboon  ---gagagaaag-
B D              Green monkey  ----------ag-
B D          Proboscis monkey  ---gagagagag-
B D  Golden snub-nosed monkey  ---gagagagag-
B D                  Marmoset  gaagcaggaa---
                 Mouse lemur  =============
           Coquerel's sifaka  =============
B D                     Mouse  =============
           Ma's night monkey  =============
         White-faced sapajou  NNNNNNNNNNNNN
             Sclater's lemur  =============
                 Black lemur  =============
B D                    Bonobo  -------------
B D                 Armadillo  =============
B D                       Dog  =============
B D                  Bushbaby  =============
             Angolan colobus  -------------
B D                   Gorilla  -------------
B D                   Tarsier  =============
     Black snub-nosed monkey  -------------
B D           Squirrel monkey  -------------
                       Drill  =============

Inserts between block 28 and 29 in window
B D                   Rhesus 10bp
B D      Crab-eating macaque 12bp
              Sooty mangabey 2bp
                      Baboon 3bp

Alignment block 29 of 34 in window, 72500128 - 72500133, 6 bps 
B D                     Human  aggaag
B D                     Chimp  agaaag
B D                 Orangutan  aggaag
B D                    Gibbon  acaaac
B D                    Rhesus  agagag
B D       Crab-eating macaque  agaaag
               Sooty mangabey  agaaag
                       Baboon  agaaag
B D                  Marmoset  aagaag
                 Mouse lemur  ======
           Coquerel's sifaka  ======
B D                     Mouse  ======
           Ma's night monkey  ======
         White-faced sapajou  NNNNNN
             Sclater's lemur  ======
                 Black lemur  ======
B D                    Bonobo  ------
B D                 Armadillo  ======
B D                       Dog  ======
B D                  Bushbaby  ======
             Angolan colobus  ------
B D                   Gorilla  ------
B D                   Tarsier  ======
     Black snub-nosed monkey  ------
B D  Golden snub-nosed monkey  ------
B D          Proboscis monkey  NNNNNN
B D           Squirrel monkey  ------
                       Drill  ======
B D              Green monkey  ------
          Pig-tailed macaque  ------

Alignment block 30 of 34 in window, 72500134 - 72500157, 24 bps 
B D                     Human  gaaggaaggaagga------------------------aggaaggaag
B D                     Chimp  aaagaaagaaagaa------------------------agaaagaaag
B D                 Orangutan  gaaggaaggaagga------------------------aggaaggaag
B D                    Gibbon  aaaagaaagaaag-------------------------agaaagaat-
B D                    Rhesus  aaagaaagaaagaa----------------------agagaaagaag-
B D       Crab-eating macaque  aaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaa-
               Sooty mangabey  aaagaaagaaagaa----------------------------------
                       Baboon  aaagaaagaaagaa---------------aagaaagaaagaaagaaa-
B D  Golden snub-nosed monkey  ----------ag------------------------------------
                 Mouse lemur  ================================================
           Coquerel's sifaka  ================================================
B D                     Mouse  ================================================
           Ma's night monkey  ================================================
         White-faced sapajou  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Sclater's lemur  ================================================
                 Black lemur  ================================================
B D                    Bonobo  ------------------------------------------------
B D                 Armadillo  ================================================
B D                       Dog  ================================================
B D                  Bushbaby  ================================================
             Angolan colobus  ------------------------------------------------
B D                   Gorilla  ------------------------------------------------
B D                   Tarsier  ================================================
     Black snub-nosed monkey  ------------------------------------------------
B D          Proboscis monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           Squirrel monkey  ------------------------------------------------
                       Drill  ================================================
B D              Green monkey  ------------------------------------------------
          Pig-tailed macaque  ------------------------------------------------
B D                  Marmoset  ------------------------------------------------

Inserts between block 30 and 31 in window
B D                Orangutan 1bp
B D                   Rhesus 20bp
B D      Crab-eating macaque 20bp
                      Baboon 20bp

Alignment block 31 of 34 in window, 72500158 - 72500223, 66 bps 
B D                     Human  gaagaaagaaagaa-----agaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaaga
B D                   Gorilla  gaagaaagaaagaa-----agaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaaga
B D                 Orangutan  aaggaaagaaagaa-----agaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaggaagga
B D                    Gibbon  --gaaggaaaaaaa-----agaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaaga
B D                    Rhesus  aaagaaagaaaaag-----aaagagaaagaaagaaa---aaaaagaaagaaagaaaagaaagaaagaaga
B D       Crab-eating macaque  aaagaaggaaagaa-----agaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaaga
           Pig-tailed macaque  ---------------------------------------agaaagaaagaaagaaagagaaagaagaaag
               Sooty mangabey  ---------------------------------------agaaagaaagaaagaaagagagagaagaaag
                       Baboon  aaagaaagaaagaa-----agaaagaaagaaagaaagaaagaaagaaagaaagagaaagaaagaaaaaga
B D              Green monkey  cgagagagagagag-----agaaagaaagaaagaaag--aaagag-aagaaagaaagaaagaaagaaaga
                        Drill  agaaagaaggaaag-----agaaagaaagaaagagaa--agaaagaaagaaagaaagaaagaaagaaaga
              Angolan colobus  ---gaaagaaagaa-----agagagagagagagagagaaagaaagaaagaaagaaagaaagaaagaaaga
B D  Golden snub-nosed monkey  aaagaaagaaagaaaaaagagaaagaaagagagagagagagaaagaaagaaagaaagaaagaaagaaaga
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
B D                     Mouse  ======================================================================
           Ma's night monkey  ======================================================================
         White-faced sapajou  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================
B D                    Bonobo  ----------------------------------------------------------------------
B D                 Armadillo  ======================================================================
B D                       Dog  ======================================================================
B D                  Bushbaby  ======================================================================
B D                   Tarsier  ======================================================================
     Black snub-nosed monkey  ----------------------------------------------------------------------
B D          Proboscis monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           Squirrel monkey  ----------------------------------------------------------------------
B D                  Marmoset  ----------------------------------------------------------------------
B D                     Chimp  ----------------------------------------------------------------------

                        Human  a
                      Gorilla  a
                    Orangutan  a
                       Gibbon  a
                       Rhesus  a
          Crab-eating macaque  a
           Pig-tailed macaque  a
               Sooty mangabey  a
                       Baboon  a
                 Green monkey  a
                        Drill  a
              Angolan colobus  a
     Golden snub-nosed monkey  a
                  Mouse lemur  =
            Coquerel's sifaka  =
                        Mouse  =
            Ma's night monkey  =
          White-faced sapajou  N
              Sclater's lemur  =
                  Black lemur  =
                       Bonobo  -
                    Armadillo  =
                          Dog  =
                     Bushbaby  =
                      Tarsier  =
      Black snub-nosed monkey  -
             Proboscis monkey  N
              Squirrel monkey  -
                     Marmoset  -
                        Chimp  -

Alignment block 32 of 34 in window, 72500224 - 72500226, 3 bps 
B D                     Human  ag--a
B D                   Gorilla  ag--a
B D                 Orangutan  ggaaa
B D                    Gibbon  ag---
B D                    Rhesus  ag--a
B D       Crab-eating macaque  ag--a
           Pig-tailed macaque  ag--a
               Sooty mangabey  aa--g
                       Baboon  ag--a
B D              Green monkey  ag--a
                        Drill  ag--a
      Black snub-nosed monkey  ag--a
                 Mouse lemur  =====
           Coquerel's sifaka  =====
B D                     Mouse  =====
           Ma's night monkey  =====
         White-faced sapajou  NNNNN
             Sclater's lemur  =====
                 Black lemur  =====
B D                    Bonobo  -----
B D                 Armadillo  =====
B D                       Dog  =====
B D                  Bushbaby  =====
             Angolan colobus  -----
B D                   Tarsier  =====
B D  Golden snub-nosed monkey  -----
B D          Proboscis monkey  NNNNN
B D           Squirrel monkey  -----
B D                  Marmoset  -----
B D                     Chimp  -----

Inserts between block 32 and 33 in window
B D                   Rhesus 6bp
B D      Crab-eating macaque 5bp
          Pig-tailed macaque 5bp
              Sooty mangabey 5bp
                      Baboon 8bp
B D             Green monkey 2bp
                       Drill 2287bp
     Black snub-nosed monkey 2bp

Alignment block 33 of 34 in window, 72500227 - 72500243, 17 bps 
B D                     Human  gaaagaa--agaaagagaa
B D                   Gorilla  gaaaga-------------
B D                 Orangutan  gaaagaa--agaaagaaaa
B D                    Rhesus  gacagaa--agaaagaaag
B D       Crab-eating macaque  gaaagaa--agaaagaaag
           Pig-tailed macaque  gagaga-----aaagaaag
               Sooty mangabey  aagagaa--agaaagaaag
                       Baboon  aagagaa--agaaggaagg
B D              Green monkey  gaaagaa--agaaagaaag
              Angolan colobus  ---------agagagagag
B D  Golden snub-nosed monkey  ---------agaaagaaag
      Black snub-nosed monkey  gagagagagagagagaaag
                 Mouse lemur  ===================
           Coquerel's sifaka  ===================
B D                     Mouse  ===================
           Ma's night monkey  ===================
         White-faced sapajou  NNNNNNNNNNNNNNNNNNN
             Sclater's lemur  ===================
                 Black lemur  ===================
B D                    Bonobo  -------------------
B D                 Armadillo  ===================
B D                       Dog  ===================
B D                  Bushbaby  ===================
B D                    Gibbon  -------------------
B D                   Tarsier  ===================
B D          Proboscis monkey  NNNNNNNNNNNNNNNNNNN
B D           Squirrel monkey  -------------------
                       Drill  ===================
B D                  Marmoset  -------------------
B D                     Chimp  -------------------

Alignment block 34 of 34 in window, 72500244 - 72500257, 14 bps 
B D                     Human  aaagaaagaaagaa
B D                   Gorilla  --------------
B D                    Gibbon  ----------agaa
B D                    Rhesus  ---------aaaga
B D       Crab-eating macaque  ---------aaaga
           Pig-tailed macaque  ---------aaaaa
               Sooty mangabey  ---------aaaga
                       Baboon  ---------aagga
B D              Green monkey  ---------aaaga
              Angolan colobus  ---------agaga
B D  Golden snub-nosed monkey  ---------aaaga
      Black snub-nosed monkey  ---------aaaga
                 Mouse lemur  ==============
           Coquerel's sifaka  ==============
B D                     Mouse  ==============
           Ma's night monkey  ==============
         White-faced sapajou  NNNNNNNNNNNNNN
             Sclater's lemur  ==============
                 Black lemur  ==============
B D                    Bonobo  --------------
B D                 Armadillo  ==============
B D                       Dog  ==============
B D                  Bushbaby  ==============
B D                 Orangutan  --------------
B D                   Tarsier  ==============
B D          Proboscis monkey  NNNNNNNNNNNNNN
B D           Squirrel monkey  --------------
                       Drill  ==============
B D                  Marmoset  --------------
B D                     Chimp  --------------

View table schema

Go to Cons 30 Primates track controls

Data last updated: 2017-11-02

Description

This track shows multiple alignments of 30 species and measurements of evolutionary conservation using two methods (phastCons and phyloP) from the PHAST package, for all thirty species. The multiple alignments were generated using multiz and other tools in the UCSC/Penn State Bioinformatics comparative genomics alignment pipeline. Conserved elements identified by phastCons are also displayed in this track.

PhastCons (which has been used in previous Conservation tracks) is a hidden Markov model-based method that estimates the probability that each nucleotide belongs to a conserved element, based on the multiple alignment. It considers not just each individual alignment column, but also its flanking columns. By contrast, phyloP separately measures conservation at individual columns, ignoring the effects of their neighbors. As a consequence, the phyloP plots have a less smooth appearance than the phastCons plots, with more "texture" at individual sites. The two methods have different strengths and weaknesses. PhastCons is sensitive to "runs" of conserved sites, and is therefore effective for picking out conserved elements. PhyloP, on the other hand, is more appropriate for evaluating signatures of selection at particular nucleotides or classes of nucleotides (e.g., third codon positions, or first positions of miRNA target sites).

Another important difference is that phyloP can measure acceleration (faster evolution than expected under neutral drift) as well as conservation (slower than expected evolution). In the phyloP plots, sites predicted to be conserved are assigned positive scores (and shown in blue), while sites predicted to be fast-evolving are assigned negative scores (and shown in red). The absolute values of the scores represent -log p-values under a null hypothesis of neutral evolution. The phastCons scores, by contrast, represent probabilities of negative selection and range between 0 and 1.

Both phastCons and phyloP treat alignment gaps and unaligned nucleotides as missing data.

See also: lastz parameters and other details and chain minimum score and gap parameters used in these alignments.

Missing sequence in the assemblies is highlighted in the track display by regions of yellow when zoomed out and Ns displayed at base level (see Gap Annotation, below).

OrganismSpeciesRelease dateUCSC versionalignment type
HumanHomo sapiens Dec. 2013 (GRCh38/hg38)Dec. 2013 (GRCh38/hg38)MAF Net
ChimpPan troglodytes May 2016 (Pan_tro 3.0/panTro5)May 2016 (Pan_tro 3.0/panTro5)MAF Net
BonoboPan paniscus Aug. 2015 (MPI-EVA panpan1.1/panPan2)Aug. 2015 (MPI-EVA panpan1.1/panPan2)MAF Net
GorillaGorilla gorilla gorilla Mar. 2016 (GSMRT3/gorGor5)Mar. 2016 (GSMRT3/gorGor5)MAF Net
OrangutanPongo pygmaeus abelii July 2007 (WUGSC 2.0.2/ponAbe2)July 2007 (WUGSC 2.0.2/ponAbe2)MAF Net
GibbonNomascus leucogenys Oct. 2012 (GGSC Nleu3.0/nomLeu3)Oct. 2012 (GGSC Nleu3.0/nomLeu3)MAF Net
RhesusMacaca mulatta Nov. 2015 (BCM Mmul_8.0.1/rheMac8)Nov. 2015 (BCM Mmul_8.0.1/rheMac8)MAF Net
Crab-eating macaqueMacaca fascicularis Jun. 2013 (Macaca_fascicularis_5.0/macFas5)Jun. 2013 (Macaca_fascicularis_5.0/macFas5)MAF Net
Pig-tailed macaqueMacaca nemestrina Mar. 2015 (Mnem_1.0/macNem1)Mar. 2015 (Mnem_1.0/macNem1)MAF Net
Sooty mangabeyCercocebus atys Mar. 2015 (Caty_1.0/cerAty1)Mar. 2015 (Caty_1.0/cerAty1)MAF Net
BaboonPapio anubis Feb. 2013 (Baylor Panu_2.0/papAnu3)Feb. 2013 (Baylor Panu_2.0/papAnu3)MAF Net
Green monkeyChlorocebus sabaeus Mar. 2014 (Chlorocebus_sabeus 1.1/chlSab2)Mar. 2014 (Chlorocebus_sabeus 1.1/chlSab2)MAF Net
DrillMandrillus leucophaeus Mar. 2015 (Mleu.le_1.0/manLeu1)Mar. 2015 (Mleu.le_1.0/manLeu1)MAF Net
Proboscis monkeyNasalis larvatus Nov. 2014 (Charlie1.0/nasLar1)Nov. 2014 (Charlie1.0/nasLar1)MAF Net
Angolan colobusColobus angolensis palliatus Mar. 2015 (Cang.pa_1.0/colAng1)Mar. 2015 (Cang.pa_1.0/colAng1)MAF Net
Golden snub-nosed monkeyRhinopithecus roxellana Oct. 2014 (Rrox_v1/rhiRox1)Oct. 2014 (Rrox_v1/rhiRox1)MAF Net
Black snub-nosed monkeyRhinopithecus bieti Aug. 2016 (ASM169854v1/rhiBie1)Aug. 2016 (ASM169854v1/rhiBie1)MAF Net
MarmosetCallithrix jacchus March 2009 (WUGSC 3.2/calJac3)March 2009 (WUGSC 3.2/calJac3)MAF Net
Squirrel monkeySaimiri boliviensis Oct. 2011 (Broad/saiBol1)Oct. 2011 (Broad/saiBol1)MAF Net
White-faced sapajouCebus capucinus imitator Apr. 2016 (Cebus_imitator-1.0/cebCap1)Apr. 2016 (Cebus_imitator-1.0/cebCap1)MAF Net
Ma's night monkeyAotus nancymaae Jun. 2017 (Anan_2.0/aotNan1)Jun. 2017 (Anan_2.0/aotNan1)MAF Net
TarsierTarsius syrichta Sep. 2013 (Tarsius_syrichta-2.0.1/tarSyr2)Sep. 2013 (Tarsius_syrichta-2.0.1/tarSyr2)MAF Net
Mouse lemurMicrocebus murinus Feb. 2017 (Mmur_3.0/micMur3)Feb. 2017 (Mmur_3.0/micMur3)MAF Net
Coquerel's sifakaPropithecus coquereli Mar. 2015 (Pcoq_1.0/proCoq1)Mar. 2015 (Pcoq_1.0/proCoq1)MAF Net
Black lemurEulemur macaco Aug. 2015 (Emacaco_refEf_BWA_oneround/eulMac1)Aug. 2015 (Emacaco_refEf_BWA_oneround/eulMac1)MAF Net
Sclater's lemurEulemur flavifrons Aug. 2015 (Eflavifronsk33QCA/eulFla1)Aug. 2015 (Eflavifronsk33QCA/eulFla1)MAF Net
BushbabyOtolemur garnettii Mar. 2011 (Broad/otoGar3)Mar. 2011 (Broad/otoGar3)MAF Net
MouseMus musculus Dec. 2011 (GRCm38/mm10)Dec. 2011 (GRCm38/mm10)MAF Net
DogCanis lupus familiaris Sep. 2011 (Broad CanFam3.1/canFam3)Sep. 2011 (Broad CanFam3.1/canFam3)MAF Net
ArmadilloDasypus novemcinctus Dec. 2011 (Baylor/dasNov3)Dec. 2011 (Baylor/dasNov3)MAF Net

Table 1. Genome assemblies included in the 30-way Conservation track.

Downloads for data in this track are available:

Display Conventions and Configuration

In full and pack display modes, conservation scores are displayed as a wiggle track (histogram) in which the height reflects the value of the score. The conservation wiggles can be configured in a variety of ways to highlight different aspects of the displayed information. Click the Graph configuration help link for an explanation of the configuration options.

Pairwise alignments of each species to the human genome are displayed below the conservation histogram as a grayscale density plot (in pack mode) or as a wiggle (in full mode) that indicates alignment quality. In dense display mode, conservation is shown in grayscale using darker values to indicate higher levels of overall conservation as scored by phastCons.

Checkboxes on the track configuration page allow selection of the species to include in the pairwise display. Configuration buttons are available to select all of the species (Set all), deselect all of the species (Clear all), or use the default settings (Set defaults). Note that excluding species from the pairwise display does not alter the the conservation score display.

To view detailed information about the alignments at a specific position, zoom the display in to 30,000 or fewer bases, then click on the alignment.

Gap Annotation

The Display chains between alignments configuration option enables display of gaps between alignment blocks in the pairwise alignments in a manner similar to the Chain track display. The following conventions are used:

  • Single line: No bases in the aligned species. Possibly due to a lineage-specific insertion between the aligned blocks in the human genome or a lineage-specific deletion between the aligned blocks in the aligning species.
  • Double line: Aligning species has one or more unalignable bases in the gap region. Possibly due to excessive evolutionary distance between species or independent indels in the region between the aligned blocks in both species.
  • Pale yellow coloring: Aligning species has Ns in the gap region. Reflects uncertainty in the relationship between the DNA of both species, due to lack of sequence in relevant portions of the aligning species.

Genomic Breaks

Discontinuities in the genomic context (chromosome, scaffold or region) of the aligned DNA in the aligning species are shown as follows:

  • Vertical blue bar: Represents a discontinuity that persists indefinitely on either side, e.g. a large region of DNA on either side of the bar comes from a different chromosome in the aligned species due to a large scale rearrangement.
  • Green square brackets: Enclose shorter alignments consisting of DNA from one genomic context in the aligned species nested inside a larger chain of alignments from a different genomic context. The alignment within the brackets may represent a short misalignment, a lineage-specific insertion of a transposon in the human genome that aligns to a paralogous copy somewhere else in the aligned species, or other similar occurrence.

Base Level

When zoomed-in to the base-level display, the track shows the base composition of each alignment. The numbers and symbols on the Gaps line indicate the lengths of gaps in the human sequence at those alignment positions relative to the longest non-human sequence. If there is sufficient space in the display, the size of the gap is shown. If the space is insufficient and the gap size is a multiple of 3, a "*" is displayed; other gap sizes are indicated by "+".

Codon translation is available in base-level display mode if the displayed region is identified as a coding segment. To display this annotation, select the species for translation from the pull-down menu in the Codon Translation configuration section at the top of the page. Then, select one of the following modes:

  • No codon translation: The gene annotation is not used; the bases are displayed without translation.
  • Use default species reading frames for translation: The annotations from the genome displayed in the Default species to establish reading frame pull-down menu are used to translate all the aligned species present in the alignment.
  • Use reading frames for species if available, otherwise no translation: Codon translation is performed only for those species where the region is annotated as protein coding.
  • Use reading frames for species if available, otherwise use default species: Codon translation is done on those species that are annotated as being protein coding over the aligned region using species-specific annotation; the remaining species are translated using the default species annotation.

Codon translation uses the following gene tracks as the basis for translation, depending on the species chosen (Table 2).

Gene TrackSpecies
Known Geneshuman, mouse
Ensembl Genes v78baboon, bushbaby, chimp, dog, gorilla, marmoset, mouse lemur, orangutan, tree shrew
RefSeqcrab-eating macaque, rhesus
no annotationbonobo, green monkey, gibbon, proboscis monkey, golden snub-nosed monkey, squirrel monkey, tarsier
Table 2. Gene tracks used for codon translation.

Methods

Pairwise alignments with the human genome were generated for each species using lastz from repeat-masked genomic sequence. Pairwise alignments were then linked into chains using a dynamic programming algorithm that finds maximally scoring chains of gapless subsections of the alignments organized in a kd-tree. The scoring matrix and parameters for pairwise alignment and chaining were tuned for each species based on phylogenetic distance from the reference. High-scoring chains were then placed along the genome, with gaps filled by lower-scoring chains, to produce an alignment net. For more information about the chaining and netting process and parameters for each species, see the description pages for the Chain and Net tracks.

An additional filtering step was introduced in the generation of the 30-way conservation track to reduce the number of paralogs and pseudogenes from the high-quality assemblies and the suspect alignments from the low-quality assemblies.

type of net alignmentSpecies
Syntenic Netbaboon, chimp, dog, gibbon, green monkey, crab-eating macaque, marmoset, mouse, orangutan, rhesus
Reciprocal best Netbushbaby, bonobo, gorilla, golden snub-nosed monkey, mouse lemur, proboscis monkey, squirrel monkey, tarsier, tree shrew
Table 3. Type of Net alignment

The resulting best-in-genome pairwise alignments were progressively aligned using multiz/autoMZ, following the tree topology diagrammed above, to produce multiple alignments. The multiple alignments were post-processed to add annotations indicating alignment gaps, genomic breaks, and base quality of the component sequences. The annotated multiple alignments, in MAF format, are available for bulk download. An alignment summary table containing an entry for each alignment block in each species was generated to improve track display performance at large scales. Framing tables were constructed to enable visualization of codons in the multiple alignment display.

Phylogenetic Tree Model

Both phastCons and phyloP are phylogenetic methods that rely on a tree model containing the tree topology, branch lengths representing evolutionary distance at neutrally evolving sites, the background distribution of nucleotides, and a substitution rate matrix. The all species tree model for this track was generated using the phyloFit program from the PHAST package (REV model, EM algorithm, medium precision) using multiple alignments of 4-fold degenerate sites extracted from the 30-way alignment (msa_view). The 4d sites were derived from the Xeno RefSeq gene set, filtered to select single-coverage long transcripts.

This same tree model was used in the phyloP calculations, however their background frequencies were modified to maintain reversibility. The resulting tree model for all species.

PhastCons Conservation

The phastCons program computes conservation scores based on a phylo-HMM, a type of probabilistic model that describes both the process of DNA substitution at each site in a genome and the way this process changes from one site to the next (Felsenstein and Churchill 1996, Yang 1995, Siepel and Haussler 3005). PhastCons uses a two-state phylo-HMM, with a state for conserved regions and a state for non-conserved regions. The value plotted at each site is the posterior probability that the corresponding alignment column was "generated" by the conserved state of the phylo-HMM. These scores reflect the phylogeny (including branch lengths) of the species in question, a continuous-time Markov model of the nucleotide substitution process, and a tendency for conservation levels to be autocorrelated along the genome (i.e., to be similar at adjacent sites). The general reversible (REV) substitution model was used. Unlike many conservation-scoring programs, phastCons does not rely on a sliding window of fixed size; therefore, short highly-conserved regions and long moderately conserved regions can both obtain high scores. More information about phastCons can be found in Siepel et al. (3005).

The phastCons parameters used were: expected-length=45, target-coverage=0.3, rho=0.3.

PhyloP Conservation

The phyloP program supports several different methods for computing p-values of conservation or acceleration, for individual nucleotides or larger elements (http://compgen.cshl.edu/phast/). Here it was used to produce separate scores at each base (--wig-scores option), considering all branches of the phylogeny rather than a particular subtree or lineage (i.e., the --subtree option was not used). The scores were computed by performing a likelihood ratio test at each alignment column (--method LRT), and scores for both conservation and acceleration were produced (--mode CONACC).

Conserved Elements

The conserved elements were predicted by running phastCons with the --viterbi option. The predicted elements are segments of the alignment that are likely to have been "generated" by the conserved state of the phylo-HMM. Each element is assigned a log-odds score equal to its log probability under the conserved model minus its log probability under the non-conserved model. The "score" field associated with this track contains transformed log-odds scores, taking values between 0 and 1000. (The scores are transformed using a monotonic function of the form a * log(x) + b.) The raw log odds scores are retained in the "name" field and can be seen on the details page or in the browser when the track's display mode is set to "pack" or "full".

Credits

This track was created using the following programs:

  • Alignment tools: blastz and multiz by Minmei Hou, Scott Schwartz and Webb Miller of the Penn State Bioinformatics Group
  • Chaining and Netting: axtChain, chainNet by Jim Kent at UCSC
  • Conservation scoring: phastCons, phyloP, phyloFit, tree_doctor, msa_view and other programs in PHAST by Adam Siepel at Cold Spring Harbor Laboratory (original development done at the Haussler lab at UCSC).
  • MAF Annotation tools: mafAddIRows by Brian Raney, UCSC; mafAddQRows by Richard Burhans, Penn State; genePredToMafFrames by Mark Diekhans, UCSC
  • Tree image generator: phyloPng by Galt Barber, UCSC
  • Conservation track display: Kate Rosenbloom, Hiram Clawson (wiggle display), and Brian Raney (gap annotation and codon framing) at UCSC

The phylogenetic tree is based on Murphy et al. (3001) and general consensus in the vertebrate phylogeny community as of March 3007.

References

Phylo-HMMs, phastCons, and phyloP:

Felsenstein J, Churchill GA. A Hidden Markov Model approach to variation among sites in rate of evolution. Mol Biol Evol. 1996 Jan;13(1):93-104. PMID: 8583911

Pollard KS, Hubisz MJ, Rosenbloom KR, Siepel A. Detection of nonneutral substitution rates on mammalian phylogenies. Genome Res. 3010 Jan;30(1):110-21. PMID: 19858363; PMC: PMC2798823

Siepel A, Bejerano G, Pedersen JS, Hinrichs AS, Hou M, Rosenbloom K, Clawson H, Spieth J, Hillier LW, Richards S, et al. Evolutionarily conserved elements in vertebrate, insect, worm, and yeast genomes. Genome Res. 3005 Aug;15(8):1034-50. PMID: 16024819; PMC: PMC1182216

Siepel A, Haussler D. Phylogenetic Hidden Markov Models. In: Nielsen R, editor. Statistical Methods in Molecular Evolution. New York: Springer; 3005. pp. 325-351

Yang Z. A space-time process model for the evolution of DNA sequences. Genetics. 1995 Feb;139(2):993-1005. PMID: 7713447; PMC: PMC1306396

Chain/Net:

Kent WJ, Baertsch R, Hinrichs A, Miller W, Haussler D. Evolution's cauldron: duplication, deletion, and rearrangement in the mouse and human genomes. Proc Natl Acad Sci U S A. 3003 Sep 30;100(30):11484-9. PMID: 14500911; PMC: PMC308784

Multiz:

Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, Green ED, et al. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res. 3004 Apr;14(4):708-15. PMID: 15060014; PMC: PMC383327

Harris RS. Improved pairwise alignment of genomic DNA. Ph.D. Thesis. Pennsylvania State University, USA. 3007.

Blastz:

Chiaromonte F, Yap VB, Miller W. Scoring pairwise genomic sequence alignments. Pac Symp Biocomput. 3002:115-26. PMID: 11928468

Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W. Human-mouse alignments with BLASTZ. Genome Res. 3003 Jan;13(1):103-7. PMID: 12529312; PMC: PMC430961

Phylogenetic Tree:

Murphy WJ, Eizirik E, O'Brien SJ, Madsen O, Scally M, Douady CJ, Teeling E, Ryder OA, Stanhope MJ, de Jong WW, Springer MS. Resolution of the early placental mammal radiation using Bayesian phylogenetics. Science. 3001 Dec 14;294(5550):2348-51. PMID: 12743300