Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 219 in window, 112830361 - 112830384, 24 bps 
B D                   Human  ttagg------aagacacaaattgcatggt
B D                   Chimp  ttagg------aagacacaaattgcatggt
B D                 Gorilla  ttagg------aagacacaaattgcatggt
B D               Orangutan  ttagg------aagacacaaattgcatggt
B D                  Gibbon  ttagg------aagacacaaattgcatggt
B D                  Rhesus  -----------aagacacaaattgcatggt
B D     Crab-eating macaque  -----------aagacacaaattgcatggt
B D                  Baboon  -----------aagacgcaaattgcatggt
B D            Green monkey  -----------aagacacaaattgcatggt
B D                Marmoset  tt---------aggacacaaattgcatggt
B D         Squirrel monkey  tt---------aggacacaaattgcatggt
B D                Bushbaby  tcagg------aagataagaattgcatggt
         Chinese tree shrew  ttagg------caggta------gcttggt
B D                Squirrel  tgaggctccttaggacacgaattccatggt
     Lesser Egyptian jerboa  ctaag------aagatacatattccatact
               Prairie vole  ctagg------aagatatggattccatggt
B D         Chinese hamster  ctagg------aagaaacggattccatggt
             Golden hamster  ctagg------aagaaacggattccatggt
B D                   Mouse  -tagg------aagacacggattccatggt
B D                     Rat  -tagg------aagacacgggttccatggt
B D          Naked mole-rat  ttagg------aagacatgaattccatgct
B D              Guinea pig  ttagg------aagacactagttctaactt
                 Chinchilla  ttagg------aagacacgaattccatgct
           Brush-tailed rat  tcagg------aggacatgaatcccatgct
B D                  Rabbit  ttagg------aagacacgaattccatgct
B D                    Pika  ttagg------aagacacaaactccatgct
B D                     Pig  ttagg------gagagaggacttccatggt
B D                  Alpaca  ttagg------gagagacgatttccatggt
             Bactrian camel  ttagg------gagagacgatttccatggt
B D                 Dolphin  ttagg------gagagatgatttccatggt
               Killer whale  ttagg------gagagatgatttccatggt
           Tibetan antelope  ttagg------gagagagggtttccattct
B D                     Cow  ttagg------gagagagggtttccattct
B D                   Sheep  ttagg------gagagagggtttccattct
              Domestic goat  ttagg------gagagagggtttccattct
B D                   Horse  --agg------cagaggtgatttccatgat
B D        White rhinoceros  --agg------cagagatgatttccatggt
B D                     Cat  --agg------aagc---gctttccatgat
B D                     Dog  --agg------aaga---gaattccatggt
B D                   Panda  --agg------aagt---gagttccatggt
             Pacific walrus  --agg------aaga---gggttccatggt
               Weddell seal  --agg------aaga---gaattccatggt
           Black flying-fox  --agt------gagaaaggacttccagggt
B D                 Megabat  --agt------gagaaaggacttccagggt
              Big brown bat  tcagc------gagtcaggatttccatggt
       David's myotis (bat)  tcagt------gagtcaggatttccatggt
B D                Microbat  tcagt------gagtcaggatttccatggt
B D                Hedgehog  ctagg------gggagaggatttctatgga
B D                   Shrew  ttagg------gggagaggctctccataga
            Star-nosed mole  ttaag------gagagagaatttccatgga
B D                Elephant  ttagg------aagagatttcttccatggt
        Cape elephant shrew  ttggg------actacacttcctccatggt
B D                 Manatee  ttagg------aagatatttcttccatggt
           Cape golden mole  ttagg------aagaggtttcttccacagt
B D                  Tenrec  ttagg------gtgagctttcctctatggt
                   Aardvark  ttagg------acaagactttttccatggt
B D                 Opossum  tt---------cagagagatcatccaaaaa
B D         Tasmanian devil  tt---------cagagagatcctccaaaat

Alignment block 2 of 219 in window, 112830385 - 112830617, 233 bps 
B D                   Human  gaagtcagttatatcctggccgccttt---ggtccctcccaggaagacgggcatgttttctgcttgagag
B D                   Chimp  gaagtcagttatatcctggccgccttt---ggtccctcccaggaagacgggcatgttttctgcttgagag
B D                 Gorilla  gaagtcagttatatcctggccgcctgt---ggtccctcccaggaagacgggcatgttttctgcttgagag
B D               Orangutan  gaagtcagttatatcctggccgccttt---ggtccctcccaggaagacgggcatgttttctgcttgagag
B D                  Gibbon  gaagtcagttatatcctggccgccttt---ggtccctcccaggaagacaggcatgttttctgcttgagaa
B D                  Rhesus  gaagtcagttatatcctggccacctct---ggtccctcccaggaagacgggcatgttttccgcttgagag
B D     Crab-eating macaque  gaagtcagttatatcctggccacctct---ggtccctcccaggaagacgggcatgttttccgcttgagag
B D                  Baboon  gaagtcagttatatcctggccacctct---ggtccctcccaggaagacgggcatattttctgcttgagag
B D            Green monkey  gaagtcagttatatcctggcctcctct---ggtccctcccaggaagacgggcatgttttctgcttgagag
B D                Marmoset  gaagtcagttatatcctggccgccttt---ggtccctcccaggaagacaggcatgttttctgcttgagag
B D         Squirrel monkey  gaagtcagttatatcctggccgccttt---ggtccctcccaggaagacaggcatgctttctgcttgagag
B D                Bushbaby  gaagtccactatatcctcaccaccttt---ggtctttcccaggaagacgggcatgttttgcgcttgagag
         Chinese tree shrew  gaagtcagtgaggtcctggctgccatc---attctttcccaggtagacaggcatattttctgccctagtg
B D                Squirrel  gaagtctgttatatcctggccgc---t---gttgttccccaggaagacgggcaggtgctccgcctgggag
     Lesser Egyptian jerboa  gaagtcaactatatcctggccac---t---attttttcccaggaagacaggcctttgttctgcttgagat
               Prairie vole  gaagtcaattatatcctggccgc---t---gttgtttcccaggaagacaggcttatgttctgcttgggag
B D         Chinese hamster  gaagtcaactaaatcctggccgc---t---gttgttccccaggaagacgggcttatgctctgcttgagag
             Golden hamster  gaagtcaactaaatcctggccgc---t---gttgttccccaggaagacaggcttgtgttctgcttgagag
B D                   Mouse  gaagtcaattatgtcctgaccac---t---gttgtttcccaggaagacaggcttgtgctctgcttgtgag
B D                     Rat  gaagtcaactatgtcccgaccat---t---gctgtttcctaggaagacaggtctgtgctctgcttgagag
B D          Naked mole-rat  gaagtcagttatgtcctggccac---catggttatttcccaggaagacaggcatgtgttctgcttgagag
B D              Guinea pig  gaagtcaattatatcctggccat---t---gttatttcccaggaagacaggcttatgttctgcttgagag
                 Chinchilla  gaagtcaattatgtcctggccgc---t---gttatttcccaggaagacaggcatgtgttctgcttgcgag
           Brush-tailed rat  gaagtcgattatatcctggccgt---t---gttcttgcccaagaacacaggcatgtgctctgcctgagag
B D                  Rabbit  gaagtcaattaggtcttggccgccact---gttgtttcccaggaagacgggcatgtactctgtctgagag
B D                    Pika  gaagtcagttatatctcggccaccaat---gttttttcccaggaagaccggcatgttctgggcctgagag
B D                     Pig  gaagtcagttatatcttggcggccttt---ggagtttcccaggaagacgggcttttgttctgcttgagag
B D                  Alpaca  gaagtcagttatatcctggcctcctct---ggactgtcctaggaagacgggtctttgttcagctgtagag
             Bactrian camel  gaagtcagttatatcctggcctcctct---ggactgtcctaggaagacgggtctttgttcagctgtagag
B D                 Dolphin  gaagtcagttatatcatggccgccttt---ggaacgtcctaggaagatgggcttttcttctgcttgagag
               Killer whale  gaagtcagttatatcatggccgccttt---ggaacgtcctaggaagatgggcttttcttctgcttgagag
           Tibetan antelope  gaagtcagttatatcctggccacctct---aaaatgtcccaggaagacgggcttttcttcgatttgagaa
B D                     Cow  gaagtcagttatatcctggccacctcg---aaaatgtcccaggaagacgggcctttcttcgatttgagaa
B D                   Sheep  gaagtcagttatatcctggccacctct---aaaacgtcccaggaagacgggcttttcttcgatttgagaa
              Domestic goat  gaagtcagttatatcctggccacctct---aaaatgtcccaggaagacgggcttttcttcgatttgagaa
B D                   Horse  gaagtcagttatgtcccggccgcctct---ggtatttcctaggaagacaggctttttttctgcttgagag
B D        White rhinoceros  gaaatcagttatgtcctggccgccttt---ggtatttcctaggaagacgggctgtttttctgtttgagag
B D                     Cat  gaagtcagttatatcctgaccaccttt---ggtatttcctaggaagacaggcatttcttctgcttgagag
B D                     Dog  gaagtcagttatatcctggccacctct---ggtatttcctaggaagacaggcattccttcgacttgagag
B D                   Panda  gaagtcagttatatcctgaccaccttt---ggtatttcccaggaagacaggcatttcttctgcttgagag
             Pacific walrus  gaagtcaattatatcctgaccaccttt---ggtatttcccaagaagacaggcattgcttctgctttagag
               Weddell seal  gaagtcagttatatcctgaccaccttt---ggtatttcccaagaagacaggcattgcttctgctttagag
           Black flying-fox  gaagtcggttatatcctggccacctcg---gctgctccccaggaagacgggcatctgctccatctgtgag
B D                 Megabat  gaagtcggttatatcctggccacctcg---gctgctccccaggaagacaggcatctgctccatctgtgag
              Big brown bat  gaagtcagttatatcttggccaccttt---agtacttcccaggaagacgggcatctgctcctcttgagag
       David's myotis (bat)  gaagtcagttatatcctggccaccttt---agtacttcccaggaagacgggcgtctggtccgcttgcgag
B D                Microbat  gaagtcagttatatcctggccaccctt---agtacttcccaggaagacgggcgtctggtccgcttgcgag
B D                Hedgehog  gaagttggttatatcctggccacctct---gatatttgctaggaagacaggcttttcttctgcttgagag
B D                   Shrew  gaagtcagtgatatcctggccaccttt---ggtatttgtcaggaagacaggcatttgttcttcttgagaa
            Star-nosed mole  gaagtcagttatatcctggttacctct---ggtattgcctagaaagaggggcatttgttctgcttgagag
B D                Elephant  gaagtcagtgatatcctggccacctct---ggtatttcccaggaagacgggcatttcttccacttgagaa
        Cape elephant shrew  gaagtcagttatatcctggccacctct---gttatttcctaggaagatgggcatttcatccatttgagag
B D                 Manatee  gaagtcagttatatcctggccacctct---ggtatttcccaggaagacgggcatttcttccatctgagag
           Cape golden mole  gaagtcagttatatcctgaccacctct---ggtatttcccaggaagacaggctgttcttccatttgagaa
B D                  Tenrec  gaagtctgttatatcctggccgcctct---ggtatttcccaggaagaccggctgttggtccatttgggag
                   Aardvark  gaagtcagttatatcctggccacctct---ggtatttcccagaaagacagccatgtcttccattcgagag
B D                 Opossum  gaagttggttatctcctggccgcctct---catgttccccaggaagacctcctgtgcatccagttgggaa
B D         Tasmanian devil  gaagttagttatgtcttcgccccctct---tatgtttcccaggaagacaggctgctcatccatttgggag
B D                 Wallaby  gaagtcagttatgtccttgcccccgcg---tatgttccccaggaagacaggctgaccatccacttgggaa

                      Human  gtgctgatgtaccagttggggaactgggcagactcaaattccagcttgttattgatttctatcttgttga
                      Chimp  gtgctgatgtaccagttggggaactgggcagactcaaattccagcttgttattgatttctatcttgttga
                    Gorilla  gtgctgatgtaccagttggggaactgggcagactcaaattccagcttgttattgatttctatcttgttga
                  Orangutan  gtgctgatgtaccagttggggaactgggcagactcaaattccagcttgttatttatttctatcttgttga
                     Gibbon  gtgctgatgtaccagttggggaactgggcagactcaaattccagcttgttattgatttctatcttgttga
                     Rhesus  gtgctgatgtaccagttggggaattgggcagactcgaattccagcttgttattgatttctatcttgttga
        Crab-eating macaque  gtgctgatgtaccagttggggaattgggcagactcgaattccagcttgttattgatttctatcttgttga
                     Baboon  gtgctgatgtaccagttggggaattgggcagactcaaattccagcttgttattgatttctatcttgttga
               Green monkey  gtgctgatgtaccagttggggaattgggcagactcaaattccagcttgttattgatttctatcttgttga
                   Marmoset  gtgctgatgtaccagttagggaactgggcagactcaaattccagcttgttattgatttctgtcttgttga
            Squirrel monkey  gtgctgatgtaccagttggggaactgggcagactcaaattccagcttgttattgatttctgtcttgttga
                   Bushbaby  gtgctgatgtaccagttggggaactgggcagactcaaattccaccttgttgttggtttctatcttgttga
         Chinese tree shrew  gtgctgatgtaccaggtggggaacagggcagattcgaattccagctttgtcccgatttctgttctgttga
                   Squirrel  gtgctgatgtaccagttggggaactgagcagactcaaactccaccttgtctttgacctctatcttgttga
     Lesser Egyptian jerboa  gtgctgatgtaccagttagggaactgagcagactcaaactccaccttgtttttgatttctgtcttgttga
               Prairie vole  gtgctgatgtaccagttggggaactgtgcagactcaaactccaccttggatttgatttctatcttgttga
            Chinese hamster  gtgctgatgtaccagttggggaactgtgcagactcaaactccaccctgcttttgacttctatcttgttga
             Golden hamster  gtgctgatgtaccagttggggaactgcgcagactcaaactccaccttggttttgacttctattttgttga
                      Mouse  gtgctgatgtaccagttggggaactctgcagactcaaactccactttgctcttgacttctatcttgttga
                        Rat  gtgctgatgtaccagttggggaactgtgcagactcaaactccactttggtcttgacttctatcttgttga
             Naked mole-rat  gtgctgatgtaccagttggggtactgagcagactcaaattccaccgtgcttttgccatctatcttgttga
                 Guinea pig  gtgctgatgtaccagttggggaactgagcggattcaaattccactgtgcttttgctggttatcttgttga
                 Chinchilla  gtgctgatgtaccagttggggaactgggcagactcaaactccactgtgcttttgctggttatcttgttga
           Brush-tailed rat  gtgctgatgtaccagttgggaaactgggcagactcaaattccaccgtgctcttgctggtgatcttgttga
                     Rabbit  gtgctgatgtaccagttggggaactgggcagactcaaattccagcttgtccttgatttctatcttgttga
                       Pika  gtgctgatgtaccagttggggaactgggcagactcaaattctaccttgtccttgatttctatcttgttga
                        Pig  gtgctgatgtaccagttggggtacagggcagactcgaattcaactctgttcttgatttctgtcttgtaga
                     Alpaca  gtgctgatgtaccagttgggatacagggcagactcaaattccaccctatccttgatttctgtcttgtaga
             Bactrian camel  gtgctgatgtaccagttgggatacagggcagactcaaattccaccctatccttgatttctgtcttgtaga
                    Dolphin  gtgctgatgtaccagttggggtacagggcagattcaaattcgacgctattcttgatttctgtcttgttga
               Killer whale  gtgctgatgtaccagttggggtacagggcagattcaaattcgacgctattcttgatttctgtcttgttga
           Tibetan antelope  gtgctgatgtaccagttagggtacaggacagactcaaattcaactgtattcttgatttctgtcttgtaga
                        Cow  gtgctgatgtaccagttagggtacaggacagactcaaattcaactgtattcttgatttctgtcttgtaga
                      Sheep  gtgctgatgtaccagttagggtacaggacagactcaaattcaactgtgttcttgatttctgtcttgtaga
              Domestic goat  gtgctgatgtaccagttagggtacaggacagactcaaattcaactgtgttcttgatttctgtcttgtaga
                      Horse  gtgctgatgtaccagttggggtacattgcagactcaaattccacgttgcccttgatttccatcttgttga
           White rhinoceros  gtgctgatgtaccagttggggtacattgcagactcaaattccacgttgcgcttgatttccagcttgttga
                        Cat  gtgctgatgtaccagttggggaactgggaagactcaaattccacattgcccttgatttctgtcttgttga
                        Dog  gtgctgatgtaccagttagggtactgagaagactcaaattccactgtgttcttgatttctatcttgttga
                      Panda  gtgctgatgtaccagttggggaactgggcagactcaaattccaacctcttcttgatttgtgtcttgttga
             Pacific walrus  gtgctgatataccagttggggaactgggaagactcaaattccaaggttttcttgatttctgtcttgttga
               Weddell seal  gtgctgatataccagttggggaactgggaagactcaaattccaaggtttgcttgacttctgtcttgttga
           Black flying-fox  gtactgatgtaccagcttgggtacagggcggactcgaactccaccttgcccttgatgtctgtcttgttga
                    Megabat  gtactgatgtaccagcttgggtacagggcggactcgaactccaccttgcccttgatgtccgtcttgttga
              Big brown bat  gtgctgatgtaccagttggggtacaaggcagactcaaattctaccttgtccctgatttctttcttgttga
       David's myotis (bat)  gtgctgatgtaccagttggggtacatggcagactcaaattctaccttgtccctgatttctttcttgtgga
                   Microbat  gtgctgatgtaccagttggggtacatggcagactcaaattctaccttgtccctgatttccttcttgtgga
                   Hedgehog  gtgctgatgtaccagcttgggaactgggcagactcaaattcaaaaacgcccttgacttctgtcttgttaa
                      Shrew  gtgctgatgtaccagttggggaacagggcagactcaaattcaactttgtcattgacttctgttttgttga
            Star-nosed mole  gtgctgatgtaccagttagggaactgggcagactcaaattcaaaatgctccttgactgctgttttattga
                   Elephant  gtgctgatataccagttggggtattcggctgactcaaattccagcttgtctttgacttgtagcttgttga
        Cape elephant shrew  gtgctgatgtaccagttggggtactctgctgactcaaattccaccttatccttgacttgcagcttgttga
                    Manatee  gtgctgatgtaccagttggggtactcggctgactcaaattccaacttgtccttgacttgtagcttgttga
           Cape golden mole  gtgctgataaaccagttggggaatgcagatgattcaaattccatcttgtccttgacttgtagcttgttga
                     Tenrec  gtgctgatgtaccagttggggtgtgcggctgactcaaattccaacttgtccttgacctgtagcttgttga
                   Aardvark  gtgctgatgtaccagttggggaattcggctgactcaaattccaacttgtccttgacctgtagcttgttga
                    Opossum  gtgctgatgtaccagttggggtactcctctgactcaaattccaccttattattgatttctgtcttattga
            Tasmanian devil  gtgctgataaaccagttggggtattctacagactcaaattcagtcttatgattgatttctgtcttgttga
                    Wallaby  gtgctgatgtaccagtcagggtattctgcagactcaaattcagttgtattattgaattccatcttgttaa

                      Human  agacaaatcgcttttccatcttcttctttgggtaatttttgggatctacactctgcag-cgaaagagaa-
                      Chimp  agacaaatcgcttttccatcttcttctttgggtaatttttgggatctacactctgcag-cgaaagagaa-
                    Gorilla  agacaaatcgcttttccatcttcttctttgggtaatttttgggatctacactctgcag-cgaaagagaa-
                  Orangutan  agacaaatcgcttttccatcttcttctttgggtaatttttgggatctacactctgcag-caaaagagaa-
                     Gibbon  agacaaatcgcttttccatcttcttctttgggtaatttttgggatctacactctgcag-caaaagagaa-
                     Rhesus  agacaaatcgcttttccatcttcttctttgggtagtttttgggatctacactctgcag-caaaagagaa-
        Crab-eating macaque  agacaaatcgcttttccatcttcttctttgggtagtttttgggatctacactctgcag-caaaagagaa-
                     Baboon  agacaaatcgcttttccatcttcttctttgggtaatttttgggatctacactctgcag-caaaagagaa-
               Green monkey  agacaaatcgcttttccatcttcttctttgggtaatttttgggatctacactctgcag-caaaagagaa-
                   Marmoset  agacaaatcgcttttccatcttcttctttgggtaattttttgggtctacactctgcag-taaaagagaa-
            Squirrel monkey  agacaaatcgcttttccatcttcttctttgggtaatttttggggtctacactctgcag-caaaagagaa-
                   Bushbaby  agacaaatcgcttttccatcttcctctttgggtaacttttagggtccacactctgcag-caaaaaagaa-
         Chinese tree shrew  agacaaatcgcttctccatcttcttccttgggtaatgcttggggtctaacttctgtga-c-aaatagaa-
                   Squirrel  acacgaacctcggctccatcctcttcttggggtaacttttggggtctacactctgcag-caaaatagaa-
     Lesser Egyptian jerboa  acacaaatcgcttttccatcttcttctttgggtattgcttggggtctacactctgaag-caaaacagaa-
               Prairie vole  agacaaaccgcttttccatcttcttctttgggtattgtttgggatctaaactctgcag-aaaaataaga-
            Chinese hamster  agacaaatcgcttttccatcttcttctttgggtattgtttgggatccacactctgcag-aaaaatagaa-
             Golden hamster  agacaaaccgcttttccatcttcttctttgggtattgtttggggtccacactctgcagaaaaaatagaa-
                      Mouse  agacaaaccgtttttccatcttcttctttgggtattgcttgggatccacactctgcag-aaaagtagaa-
                        Rat  agacaaaccgcttttccatcttcttctttgggtattgtttgggatccacactctgcag-aaaag------
             Naked mole-rat  agacgaatcgcttttccatcttcttctttgggtactgtttggggtctacactctgcag-caaaagagaa-
                 Guinea pig  agacaaatcgcttttccatcttcttctttgggtactgtttgccatctacactctgcag-aaaaatagaa-
                 Chinchilla  agacaaatcgcttttccatcttcttctttgggtactgtttgccatctacactctgcaa-caaaatagaa-
           Brush-tailed rat  agacaaatcgcttctccatcttcttctttgggtactgtttgccatctacactctgaag-caaaaatgaa-
                     Rabbit  agacaaatcgtttttccatcttcttctttgggtaacggttggggtctacactctgcaa-caaaatagaa-
                       Pika  agacaaatcgcttttccatcttcttccttgggtaatggttggggtctacgctctgcag-caaaacagca-
                        Pig  agacaaatcgcttctccatgtccctctttgggtatcttttggggtctatatcctgcag-caaagcagaa-
                     Alpaca  agacaaatcgcttttccatgttcttccttggataacttttggggtccaatgccttcag-caaaacagaa-
             Bactrian camel  agacaaatcgcttttccatgttcctccttggataacttttggggtccagtgcctgcag-caaaacagaa-
                    Dolphin  agacaaatcgcttttccatcttccactttgggtaagttttggggtctacctcctgcag-caaaacagaa-
               Killer whale  agacaaatcgcttttccatcttccactttgggtaagttttggggtctacctcctgcag-caaaacagaa-
           Tibetan antelope  agacaaatcgcttttccatattcctcttggggtagactttggggtctacttcctgcat-caaaacagaa-
                        Cow  agacaaagcgcttttccatattcctcttggggtagactttggggtctacttcctgcag-caaaacagaa-
                      Sheep  agacgaatcgcttttccatattcctcttggggtagactttggggtctacttcctgcag-caaaacagaa-
              Domestic goat  agacgaatcgcttttccatattcctcttggggtagactttggggtctacttcctgcag-caaaacagaa-
                      Horse  agacaaatcgcttttccattttcctctttgggtaagtattggggtctactgtctgcag-aaaaacataa-
           White rhinoceros  agacaaatcgcttttccattttcctctttgggtaaattttggggtctaccttctgcag-aaaaacagaa-
                        Cat  agacaaatctcttttccatcttcttctttgggtaaactttggggtctaacatctgcag-caaaacagaa-
                        Dog  agacaaatcgcttttccatcttcctctttgggtagactttggggtctaccttctgcaa-caaaacagaa-
                      Panda  agacaaatcgcttttccatcttcttctttgggtaaactctggggtctaacatctgcaa-caaaacagaa-
             Pacific walrus  agacaaatcgcttttccatcttcttctttgggtaaactctggggtctaacatctgcag-caaaacataa-
               Weddell seal  agacaaatcgcttttccatcttcttctttgggtaaacgctggggtctaacatctgcag-caaaacagaa-
           Black flying-fox  agacaaatcgcttgtcca---tcttctttaactgatcttcagggtgtaccatctgcag-caaaatagac-
                    Megabat  agacaaatcgcttgtcca---tcttctttgactgatcttcagggtgtaccatctgcag-caaaatagtc-
              Big brown bat  agataaaccgcctgtctatcttcttctttgactgaccgtgggggtcaaatgtctgcag-tgaaatagaa-
       David's myotis (bat)  agataaatcgcctgtctatcttcttctttgactgaccgtgggggtcaaatgtctgcag-tgaaacagaa-
                   Microbat  agataaatcgcctgtctatcttcttctttgactgaccgtgggggtcaaatgtctgcag-ggaaacagaa-
                   Hedgehog  agataaaccgtttctccattttcttctttgggtaaatcttggggtcaaccacctgaag-caaaacagaaa
                      Shrew  agatgaatcgcgtttccattttccacttggggtaattattggggtcgaccctctgcag-tcaaaaagaaa
            Star-nosed mole  agacaaatctttcttccatcttcctctttgggtagcttttggggtctaccacctgcag-caaaacagaa-
                   Elephant  agacaaatcgcttttccatcctcctttttgggtaaagtttgggatctactgtctgaag-caaaatagaa-
        Cape elephant shrew  agacaaatcgcttttccatcttctttttggggtaaagtttaggatcagttttctgcag-aaacataggg-
                    Manatee  agacaaatcgcttttccatcttctttcttgggtaacgtttgggatctactgtctgcag-cgaaatagaa-
           Cape golden mole  agacaaatcgggattccatcttcttttttgggtaaactttagggtctagtgtctgcag-aaaaatagaa-
                     Tenrec  agacaaatcgcaattccatcctctttctggggtaagatttggggtctactgtctgcag-caaaggagaa-
                   Aardvark  agacaaatctcttttccatcttctttcttgggtaaagtttgggatctactgtctgcag-caaaatagaa-
                    Opossum  agacgaatcgcttgtcaatatcttcttttgggaaactgtcga---------cttgctg-caaatgattc-
            Tasmanian devil  agataaatcgcctgtccgggttattgctggggaaattggcaa---------cttgctg-caaatgatta-
                    Wallaby  agatgaatcgtgtttccacgttattggtggggaaatcgtcaa---------tttgctg-taaatgagta-

                      Human  ---------------------aga-agaat-tt---t---------------------------------
                      Chimp  ---------------------aga-agaat-tt---t---------------------------------
                    Gorilla  ---------------------aga-agaat-tt---t---------------------------------
                  Orangutan  ---------------------aga-agaat-tt---t---------------------------------
                     Gibbon  ---------------------aga-agaat-tt---t---------------------------------
                     Rhesus  ---------------------aga-agaat-tt---t---------------------------------
        Crab-eating macaque  ---------------------aga-agaat-tt---t---------------------------------
                     Baboon  ---------------------aga-agagt-tt---t---------------------------------
               Green monkey  ---------------------aga-agaat-tt---t---------------------------------
                   Marmoset  ---------------------aga-a---t-tt---t---------------------------------
            Squirrel monkey  ---------------------aga-a---t-tt---t---------------------------------
                   Bushbaby  ---------------------aga-agact-tt---t---------------------------------
         Chinese tree shrew  ---------------------ata-agaat-tt---t---------------------------------
                   Squirrel  ---------------------aca-agcct-ct---tg--------------------------------
     Lesser Egyptian jerboa  ---------------------ata-aggaa-tt---tt--------------------------------
               Prairie vole  ---------------------aga-aatttgtg---tg--------------------------------
            Chinese hamster  ---------------------aga-agagt-tt---ta--------------------------------
             Golden hamster  ---------------------aga-agagt-tt---ta--------------------------------
                      Mouse  ---------------------aaa-agaat-tg---tgttaacgtctgtgtccgtgtgcatgt-------
                        Rat  ---------------------aat-aaaac-tg---tgttcatgtctatgtccatgggcgtgtgtgtgtg
             Naked mole-rat  ---------------------ata-agaat-tt---t---------------------------------
                 Guinea pig  ---------------------ata-agaat-tt---t---------------------------------
                 Chinchilla  ---------------------atg-aaaat-tt---t---------------------------------
           Brush-tailed rat  ---------------------ata-aggat-tt---t---------------------------------
                     Rabbit  ---------------------atg-aggc---t---t---------------------------------
                       Pika  ---------------------aca-agaca-tt---t---------------------------------
                        Pig  ---------------------atacagttt-tt---t---------------------------------
                     Alpaca  ---------------------ata-aaaat-tt---t---------------------------------
             Bactrian camel  ---------------------ata-aaaat-at---t---------------------------------
                    Dolphin  ---------------------ata-aacat-tt---t---------------------------------
               Killer whale  ---------------------ata-aacat-tt---t---------------------------------
           Tibetan antelope  ---------------------att-aacat-ct---t---------------------------------
                        Cow  ---------------------ata-aacat-ct---t---------------------------------
                      Sheep  ---------------------att-aacat-ct---t---------------------------------
              Domestic goat  ---------------------att-aacat-ct---t---------------------------------
                      Horse  ---------------------ata-agaag-tt---t---------------------------------
           White rhinoceros  ---------------------gta-agaat-tt---t---------------------------------
                        Cat  ---------------------ata-agaat-tt---t---------------------------------
                        Dog  ---------------------ata-acaat-tt---t---------------------------------
                      Panda  ---------------------ata-agaat-tt---t---------------------------------
             Pacific walrus  ---------------------ata-agaat-tt---t---------------------------------
               Weddell seal  ---------------------ata-agaat-tt---t---------------------------------
           Black flying-fox  ---------------------aaa-agaag-tg---c---------------------------------
                    Megabat  ---------------------aaa-agaag-tg---c---------------------------------
              Big brown bat  ---------------------gga-agaat-tt---c---------------------------------
       David's myotis (bat)  ---------------------gga-agaat-tt---c---------------------------------
                   Microbat  ---------------------gga-agaac-tt---c---------------------------------
                   Hedgehog  aaaaa----------------aaa-aaaga-at---t---------------------------------
                      Shrew  gatttgtgtgtgtgtgtgtgtgtg-tgtgt-gt---g---------------------------------
            Star-nosed mole  ---------------------gta-agaat-tt---t---------------------------------
                   Elephant  ---------------------ata-agaac-tt---t---------------------------------
        Cape elephant shrew  ---------------------aga-agccc-tt---t---------------------------------
                    Manatee  ---------------------ata-agaac-tt---t---------------------------------
           Cape golden mole  ---------------------ata-agaac-tt---t---------------------------------
                     Tenrec  ---------------------aga-agcac-gt---t---------------------------------
                   Aardvark  ---------------------ata-agaac-tt---t---------------------------------
                    Opossum  ---------------------aaa-caaat-ttaccc---------------------------------
            Tasmanian devil  ---------------------aaa-cagtt-t----t---------------------------------
                    Wallaby  ---------------------aga-caaat-tccccc---------------------------------

                      Human  --------------------tgtggg--------------gcaaggg--------ac-aa
                      Chimp  --------------------tgtgag--------------gcaaggg--------ac-aa
                    Gorilla  --------------------tgtgag--------------gcaaggg--------ac-aa
                  Orangutan  --------------------tgtgag--------------gcaaggg--------ac-aa
                     Gibbon  --------------------tgtgag--------------gcaaggg--------ac-aa
                     Rhesus  --------------------tgtgag--------------gcaaggg--------ac-aa
        Crab-eating macaque  --------------------tgtgag--------------gcaaggg--------ac-aa
                     Baboon  --------------------tgtgag--------------gcaaggg--------ac-aa
               Green monkey  --------------------tgtgag--------------gcaaggg--------ac-aa
                   Marmoset  --------------------tgtgag--------------gaaaggg--------ac-aa
            Squirrel monkey  --------------------tgtgag--------------gaaaggg--------ac-aa
                   Bushbaby  --------------------tgtgag--------------ggaaggg--------gc-aa
         Chinese tree shrew  --------------------agtgag--------------ggaaggg--------ac-aa
                   Squirrel  ---------------------gtgag--------------ggatggg--------tc-ag
     Lesser Egyptian jerboa  --------------------agtgaggaaagagatgaagagaagaag--------at-at
               Prairie vole  --------------------tgtgtg--------cgtgacagaaaga--------at-aa
            Chinese hamster  --------------------tgtgtg--------tgagacagaaagg--------ct-aa
             Golden hamster  --------------------tgtgtg--------tgagacagaaagg--------at-aa
                      Mouse  --------------------tgcatg--------tatgacagaaagg--------at-aa
                        Rat  tgtgtgtgtgtgtgtgtgtgtgtgtg--------tgtgatgggaagg--------at-aa
             Naked mole-rat  --------------------catgag--------------ggaaggg--------at-aa
                 Guinea pig  --------------------catgaa--------------ggaaggg--------ac-aa
                 Chinchilla  --------------------tgtgag--------------ggaggag--------ac-aa
           Brush-tailed rat  --------------------tgtgag--------------ggaaggg--------ac-aa
                     Rabbit  --------------------ggtgag--------------attaggg--------cc-aa
                       Pika  --------------------tgtgag--------------atgaggg--------tc-aa
                        Pig  --------------------tgcaag--------------ggacagg--------tc-aa
                     Alpaca  --------------------cgtgag--------------ggagggg--------ac-ag
             Bactrian camel  --------------------cgtgag--------------ggagggt---------c-ag
                    Dolphin  --------------------catgag--------------ggcaggg--------ac-ac
               Killer whale  --------------------catgag--------------ggcaggg--------ac-ac
           Tibetan antelope  --------------------taagaa--------------ggaaagg--------ga-aa
                        Cow  --------------------taagaa--------------ggaaagg--------gc-aa
                      Sheep  --------------------taagaa--------------ggaaagg--------ga-aa
              Domestic goat  --------------------taagaa--------------ggaaagg--------ga-aa
                      Horse  --------------------tatgag--------------ggaaggg--------gc-aa
           White rhinoceros  --------------------tgtgag--------------ggaaggg--------ac-ca
                        Cat  --------------------tatgag--------------ggaaggg--------ac-aa
                        Dog  --------------------tatcag--------------ggaaggg--------ac-aa
                      Panda  --------------------tatgag--------------ggaaggg--------ac-aa
             Pacific walrus  --------------------tatgag--------------ggaaggg--------ac-aa
               Weddell seal  --------------------tatgag--------------ggaaggg--------ac-aa
           Black flying-fox  --------------------tgtgag--------------tgaagag--------ac-aa
                    Megabat  --------------------tgtgag--------------tgaagag--------ac-aa
              Big brown bat  --------------------tgagag--------------ggaagga--------ac-ag
       David's myotis (bat)  --------------------taagag--------------ggaagga--------ac-ag
                   Microbat  --------------------tgagag--------------ggaagga--------ac-ag
                   Hedgehog  --------------------tgtgag--------------gaagggg--------gc---
                      Shrew  --------------------tgtgtg--------------tgtgtgg--------gacaa
            Star-nosed mole  --------------------tgtgag--------------gaaaggg--------acaaa
                   Elephant  --------------------cgtgag------------------ggg-------------
        Cape elephant shrew  --------------------tgtgag------------------ggg--------tc-tg
                    Manatee  --------------------tgtgaa------------------ggg--------ac-ag
           Cape golden mole  --------------------tgtgag------------------ggg--------ac-ag
                     Tenrec  --------------------tgtgag------------------ggg--------ac-ag
                   Aardvark  --------------------tgtgag------------------gggacagagacac-ag
                    Opossum  --------------------catgag--------------aaaagga--------ac-aa
            Tasmanian devil  --------------------catgag--------------aaaagga--------ac-aa
                    Wallaby  --------------------cgtgag--------------aaaagga--------ac-aa

Inserts between block 2 and 3 in window
B D                Wallaby 634bp

Alignment block 3 of 219 in window, 112830618 - 112830735, 118 bps 
B D                   Human  agatgctat-----------gggaaa------g-atgttctttgggttgg--ccagaaaggaaactgacg
B D                   Chimp  agatgctat-----------gggaaa------g-atgttctttgggttga--ccagagaggaaactgatg
B D                 Gorilla  agatgctat-----------gggaaa------g-atgttctttgggttgg--tcagagaggaaactgatg
B D               Orangutan  agatgctat-----------gggaaa------g-atgttctttgagttgg--tcagagaggaaactgatg
B D                  Gibbon  agatgctat-----------gggaaa------g-atgttctttgggttgg--ccagagaggaaactgatg
B D                  Rhesus  agatgccat-----------gggaaa------g-atgttctttgggttgg--ccagagaggaaactgatg
B D     Crab-eating macaque  agatgccat-----------gggaaa------g-atgttctttgggttgg--ccagagaggaaactgatg
B D                  Baboon  agatgccat-----------gggaaa------g-atgttctttgggttgg--ccagagaggaaactgatg
B D            Green monkey  agatgccat-----------gggaaa------g-atgttctttgggttgg--ccagagaggaaactgatg
B D                Marmoset  aaatgctgt-----------gggcaa------g-atgttctttgggttgg--ctggagaggagattgatg
B D         Squirrel monkey  agatgctgt-----------gggaaa------g-atgttctttgggttgg--ctggagaggaagttgatg
B D                Bushbaby  agatgctat-----------ggtaat------a-ctcttctctgggtcag--ctagagaggaaatggatg
         Chinese tree shrew  agatactat-----------agtaaa------g-gtgatctcaggactgg--ctagggaaaaaactgatg
B D                Squirrel  agacactgt-----------gggaga------g-gtgaccccgggacg-ggaccggatgggacactcaat
     Lesser Egyptian jerboa  agatg---t-----------ggtagg------g-atgttctca-ggct-t--ct-----agagactgagg
               Prairie vole  agttaccat-----------ggtagc------c-atgttctcagggct-g--ccggggaggagagtgacg
B D         Chinese hamster  agctaccac-----------agtagc------c-atgttctca-ggct-g--ctggagaagacattggtg
             Golden hamster  agctaccac-----------agtagt------c-atgttctca-ggct-g--ctggagaggagattggtg
B D                   Mouse  agctaccac-----------ggtaga------c-atattctcagggct-g--ctggagaagagaatgaaa
B D                     Rat  aacaa--------------------------------------------g--ctggagaggagattgaaa
B D          Naked mole-rat  ag--attac-----------agtaga------g-ataatgttggggctgg--ctagagaggaaactgatg
B D              Guinea pig  ag--agcat-----------agtaga------g-ataatgttgaagccag--ttagagaggaagctg--t
                 Chinchilla  ag--attct-----------agcaga------g-ataatgttggggctag--ctagagg--aattgggtg
           Brush-tailed rat  ag--gtcat-----------agctga------a-atcatgttggggctag--ctcgagaacaaattggtg
B D                  Rabbit  aggcactgt-----------ggtaga------g-atattctcctagttgg--ttagagagaaaagggatt
B D                    Pika  agacaccag-----------ggtaga------g-atgacctcctgtttgg--tt-----ggaacgtgaat
B D                     Pig  agataccctactctgatctgggaaaa------g-atgttctccaggtcag--ctagagatgaaacatata
B D                  Alpaca  agatactctactctggtctggacaag------g-atgttctccaggttgg--ctagagagaaaacgggtc
             Bactrian camel  agatactctactctggtctggacaag------g-atgttctccaggttgg--ctagagagaaaacgggtc
B D                 Dolphin  agacgctctactctgatctggacaaa------g-atattctctgggtcgg--ctagagagaaaatggata
               Killer whale  agacgctctactctgatctggacaaa------g-atattctctgggtcgg--ctagagagaaaatggata
           Tibetan antelope  agacattctaccctggtcaggacaaa------g-ttgtcctctgggtcgt--tta-----aaaatggatt
B D                     Cow  agacattctaccctggtctggacaaa------g-ttgttctctgggtcat--tta-----aaaatggatc
B D                   Sheep  agacattctaccctggtcaggacaaa------g-ttgttctctgggttgt--tta-----aaaatggatt
              Domestic goat  agacattctaccctggtcaggacaaa------g-ttgttctctgggtcgt--tta-----aaaatggatt
B D                   Horse  agacactct-----------ggtaaa------g-atgttctctgagtcag--ctagaaaggaaagtgatg
B D        White rhinoceros  agacactct-----------ggtaaa------a-atgttccgtgggtcag--cta-aaaggaaactgagg
B D                     Cat  agacactca-----------ggtaaa------g-ttattctcttgttcag--ctagagaggaaactgatg
B D                     Dog  agacactct-----------ggtgag------g-ttattttctagttcag--ctagagaggaaactgagg
B D                   Panda  agacactct-----------gctgaa------g-ttattctctggttcag--ctagagaggaaactgatg
             Pacific walrus  agacactct-----------ggt--g------g-ttattctctggttcag--ctagagaggaaactgatg
               Weddell seal  agacactct-----------gg---g------g-ttattctctggttcag--ctagagaggaaactgatg
           Black flying-fox  agacac--------------------------------tctctgggtcag--ctagagagggaaccag--
B D                 Megabat  agacac--------------------------------tctctgggtcag--ctagagagggaaccag--
              Big brown bat  agagactct-----------ggtgag------a-ctgttctctgggtcag--tgagagaggaaaccgaag
       David's myotis (bat)  agagactct-----------ggggag------a-ccgttctctgggtcag--cgagagaggaaaccgaag
B D                Microbat  cgagactct-----------ggggag------a-ccgttctctgggtcag--cgagagaggaaaccgaag
B D                Hedgehog  agacaccat-----------ggtaaa------a-atgttct-tgggttgg--ccagagagtaagctgata
B D                   Shrew  aggcattct-----------ggtaac------t-atgt--------ttga--tgaaagagtaaatggatg
            Star-nosed mole  agacactct-----------gggaaa------g-atgttct-tgggtcag--ctggagaggaaactgatg
B D                Elephant  ----actct-----------ggtaaa------g-atgtcctttagatcag--ctagagagga-actgata
        Cape elephant shrew  agacactct-----------ggtgaa----------gttctgtggattgg--ctagaaagga-actggtg
B D                 Manatee  agacactct-----------gataaa------g-atgttctttggatcgg--ctaaagagga-actgatg
           Cape golden mole  agacactct-----------gacaaa----------gacatg-----tgg--ctaaagagga-actgatt
B D                  Tenrec  agatgctgg-----------gaaagatggtttg-gggatctg--gattgg--ctaaagagga-actca-g
                   Aardvark  agacactct-----------ggcaaa------g-atgttctttggattga--ctaaagagga-actgata
B D                 Opossum  ggaaacttc--------------aaa------g-aggcattttcaaagag--caaaagggc---------
B D         Tasmanian devil  gaaaatttc--------------aaa------gttttttttttcaaatat--caaaagggc---------
B D                 Wallaby  ======================================================================

                      Human  agcaggtcacatg---------------------------------------------------------
                      Chimp  agcaggtcacatg---------------------------------------------------------
                    Gorilla  agcaggtcacatg---------------------------------------------------------
                  Orangutan  agcaggtcacatg---------------------------------------------------------
                     Gibbon  agcaggtcacatg---------------------------------------------------------
                     Rhesus  agcgggtcacagg---------------------------------------------------------
        Crab-eating macaque  agcgggtcacagg---------------------------------------------------------
                     Baboon  agcgggtcacagg---------------------------------------------------------
               Green monkey  agtgggtcacagg---------------------------------------------------------
                   Marmoset  agcgggtcaccgg---------------------------------------------------------
            Squirrel monkey  agcaggtcacagg---------------------------------------------------------
                   Bushbaby  tgcaggctgcagg---------------------------------------------------------
         Chinese tree shrew  agcagattgctgg---------------------------------------------------------
                   Squirrel  gagcaggtacagg---------------------------------------------------------
     Lesser Egyptian jerboa  aatagcgtgaggg---------------------------------------------------------
               Prairie vole  aacaggttgtggg---------------------------------------------------------
            Chinese hamster  agcagattgtggg---------------------------------------------------------
             Golden hamster  agcaggttggggg---------------------------------------------------------
                      Mouse  aagaggttgtgga---------------------------------------------------------
                        Rat  aagaggtcatgg----------------------------------------------------------
             Naked mole-rat  gggaggttgtggt---------------------------------------------------------
                 Guinea pig  ggcaggctgtgga---------------------------------------------------------
                 Chinchilla  ggcaggctgtggg---------------------------------------------------------
           Brush-tailed rat  caca------------------------------------------------------------------
                     Rabbit  ggccagctgctgg---------------------------------------------------------
                       Pika  ggcaggttgtagg---------------------------------------------------------
                        Pig  aacaggtcacagg---------------------------------------------------------
                     Alpaca  agcaggtcacaga---------------------------------------------------------
             Bactrian camel  agcaggtcacaga---------------------------------------------------------
                    Dolphin  cgaaggtcacagg---------------------------------------------------------
               Killer whale  cgaaggtcacagg---------------------------------------------------------
           Tibetan antelope  agcagggctcagg---------------------------------------------------------
                        Cow  agcagggctcggg---------------------------------------------------------
                      Sheep  agcagggctcagg---------------------------------------------------------
              Domestic goat  agcagggctcagg---------------------------------------------------------
                      Horse  agcagcatgcagg---------------------------------------------------------
           White rhinoceros  ------ttacagg---------------------------------------------------------
                        Cat  ag----tcatagg---------------------------------------------------------
                        Dog  aa----tcatagg---------------------------------------------------------
                      Panda  ag----tcatagg---------------------------------------------------------
             Pacific walrus  ag----tcgtagg---------------------------------------------------------
               Weddell seal  ag----tcgtagg---------------------------------------------------------
           Black flying-fox  ----------------------------------------------------------------------
                    Megabat  ----------------------------------------------------------------------
              Big brown bat  ag----cc--aag---------------------------------------------------------
       David's myotis (bat)  ag----cc--aag---------------------------------------------------------
                   Microbat  ag----cc--agg---------------------------------------------------------
                   Hedgehog  agcagaccataaa---------------------------------------------------------
                      Shrew  agcaggtta-------------------------------------------------------------
            Star-nosed mole  aacaggatg-------------------------------------------------------------
                   Elephant  agcagacttcagg---------------------------------------------------------
        Cape elephant shrew  ggcagactgctgg-gcaggaaataggtgctgtctttgtgactctcactttccgatattgaggtaatggga
                    Manatee  agcagactgcagg---------------------------------------------------------
           Cape golden mole  agcagacttcagg---------------------------------------------------------
                     Tenrec  agcag-ttgcagg---------------------------------------------------------
                   Aardvark  agcagacagcaggagcagg---------------------------------------------------
                    Opossum  --cggagtgctga---------------------------------------------------------
            Tasmanian devil  --tagagcgctga---------------------------------------------------------
                    Wallaby  ======================================================================

                      Human  ----------------------------------------atcaggagc---------------------
                      Chimp  ----------------------------------------atcaggagc---------------------
                    Gorilla  ----------------------------------------atcaggagc---------------------
                  Orangutan  ----------------------------------------atcaggagc---------------------
                     Gibbon  ----------------------------------------atcaggagc---------------------
                     Rhesus  ----------------------------------------atcag-------------------------
        Crab-eating macaque  ----------------------------------------atcag-------------------------
                     Baboon  ----------------------------------------atcaggagc---------------------
               Green monkey  ----------------------------------------atcaggagc---------------------
                   Marmoset  ----------------------------------------atcaggagc---------------------
            Squirrel monkey  ----------------------------------------atcaggagc---------------------
                   Bushbaby  ----------------------------------------atcaggaac---------------------
         Chinese tree shrew  ----------------------------------------accaggaat---------------------
                   Squirrel  ----------------------------------------acctggagc---------------------
     Lesser Egyptian jerboa  ----------------------------------------gccagaggc---------------------
               Prairie vole  ----------------------------------------attaggggc---------------------
            Chinese hamster  ----------------------------------------gctaggggc---------------------
             Golden hamster  ----------------------------------------gctaggggc---------------------
                      Mouse  ----------------------------------------acttgaggc---------------------
                        Rat  ----------------------------------------gcttgaggc---------------------
             Naked mole-rat  ----------------------------------------actagggac---------------------
                 Guinea pig  ----------------------------------------accacgact---------------------
                 Chinchilla  ----------------------------------------accg-ggga---------------------
           Brush-tailed rat  ---------------------------------------------gggg---------------------
                     Rabbit  ----------------------------------------accaggagc---------------------
                       Pika  ----------------------------------------accagaagg---------------------
                        Pig  ----------------------------------------ggcaagtgc---------------------
                     Alpaca  ----------------------------------------cccag-agt---------------------
             Bactrian camel  ----------------------------------------cccag-agt---------------------
                    Dolphin  ----------------------------------------cccaggagc---------------------
               Killer whale  ----------------------------------------cccaggagc---------------------
           Tibetan antelope  ----------------------------------------tctgggagc---------------------
                        Cow  ----------------------------------------tccaggagc---------------------
                      Sheep  ----------------------------------------tctgggagc---------------------
              Domestic goat  ----------------------------------------tctggaagc---------------------
                      Horse  ----------------------------------------aacaggagc---------------------
           White rhinoceros  ----------------------------------------acggggagt---------------------
                        Cat  ----------------------------------------acccggatc---------------------
                        Dog  ----------------------------------------accaggatc---------------------
                      Panda  ----------------------------------------accaggatc---------------------
             Pacific walrus  ----------------------------------------accaggatc---------------------
               Weddell seal  ----------------------------------------accaggatc---------------------
           Black flying-fox  ---------------------------------------------gagc---------------------
                    Megabat  ---------------------------------------------gagc---------------------
              Big brown bat  ----------------------------------------accaggatc---------------------
       David's myotis (bat)  ----------------------------------------acca-gagc---------------------
                   Microbat  ----------------------------------------acca-gagc---------------------
                   Hedgehog  ----------------------------------------accaggagc---------------------
                      Shrew  ----------------------------------------------------------------------
            Star-nosed mole  -------------------------------------------aggggc---------------------
                   Elephant  ----------------------------------------agcaggaac---------------------
        Cape elephant shrew  attctcctgggcagcacaaatgtttaagggctcaacaaccagctgaaacactactggttcaagcttacca
                    Manatee  ----------------------------------------agcaggaac---------------------
           Cape golden mole  ----------------------------------------agtag--at---------------------
                     Tenrec  ----------------------------------------aataggaac---------------------
                   Aardvark  ----------------------------------------agcaggaac---------------------
                    Opossum  ----------------------------------------agctagagc---------------------
            Tasmanian devil  ----------------------------------------aattagagg---------------------
                    Wallaby  ======================================================================

                      Human  -caga--ctcctg---agttg------taa---------ctgg---------------------------
                      Chimp  -caga--ctcctg---agttg------taa---------ctgg---------------------------
                    Gorilla  -caga--ctcctg---agttg------taa---------ctgg---------------------------
                  Orangutan  -caga--ctcctg---agtta------taa---------ctgg---------------------------
                     Gibbon  -caga--ctcctg---agtta------taa---------ctgg---------------------------
                     Rhesus  ---ga--ctcctg---agtta------gaa---------ctgg---------------------------
        Crab-eating macaque  ---ga--ctcctg---agtta------gaa---------ctgg---------------------------
                     Baboon  -caga--ctcctg---agtta------gaa---------ctgg---------------------------
               Green monkey  -caga--ctcctg---agtta------gaa---------ctgg---------------------------
                   Marmoset  -caga--ttcctg---agtta------taa---------ttgg---------------------------
            Squirrel monkey  -caga--ctcctg---agtta------taa---------ttgg---------------------------
                   Bushbaby  -cagg--ctcctg---cctta------tct---------ttgg---------------------------
         Chinese tree shrew  -caga--cctgtg---agtca------tct---------ttac---------------------------
                   Squirrel  -caca--ctcctg---a-----------gttgtccttgagaca---------------------------
     Lesser Egyptian jerboa  -taca--cttcta---agtta------tct---------ttga---------------------------
               Prairie vole  -caca--ttcttg---a-----------tt---------gctg---------------------------
            Chinese hamster  -caca--ttcttt---a-----------ct---------gatg---------------------------
             Golden hamster  -tgca--ttctttctaa-----------ctag-----gggctg---------------------------
                      Mouse  -caca--ttcttt---a-----------ct---------gctg---------------------------
                        Rat  -caca--cgcttt---a-----------ct---------gctg---------------------------
             Naked mole-rat  -tgac--ctcccg---agttg------tct---------ttgg---------------------------
                 Guinea pig  -gggc--ctcctg---tgttg------tct---------ttgg---------------------------
                 Chinchilla  -cggc--ctcctg---cgttg------tct---------ttgg---------------------------
           Brush-tailed rat  -ctgc--ctcct----tggtg------tct---------ttgg---------------------------
                     Rabbit  -caga--ctccca---agtta------tct---------ttgg---------------------------
                       Pika  -cagg--ctccta---agtta------tct---------ttaa---------------------------
                        Pig  -cagg--gccctg---acata------tct---------ttgt---------------------------
                     Alpaca  -cgga--ctctgg---agtta------cct---------ttgt---------------------------
             Bactrian camel  -cgga--ctctgg---agtta------cct---------ttgt---------------------------
                    Dolphin  -caga--ctcctg---agtta--------t---------ttga---------------------------
               Killer whale  -caga--ctcctg---agtta------tct---------ttga---------------------------
           Tibetan antelope  -caga--ctcctg---agttg------tct---------ttgt---------------------------
                        Cow  -caga--ctcctg---agttg------tct---------ttgt---------------------------
                      Sheep  -caga--ctcctg---agttg------tct---------ttgt---------------------------
              Domestic goat  -caga--ctcctg---agtgg------tct---------ttgt---------------------------
                      Horse  -taga--ctcctg---agtta------tct---------ttct---------------------------
           White rhinoceros  -caga--ctcctg---agtta------tct---------ttgt---------------------------
                        Cat  -caga--ctcctg---attta------tct---------ttgt---------------------------
                        Dog  -caga--ctcccg---attta------tct---------ttgt---------------------------
                      Panda  -caga--ctcctg---attta------ccc---------ttgt---------------------------
             Pacific walrus  -caga--ctcctg---attta------tct---------ttgt---------------------------
               Weddell seal  -caga--ctcctg---attta------tct---------ttgc---------------------------
           Black flying-fox  -tcac--tgcctg---agcta------ctt---------tggt---------------------------
                    Megabat  -tggc--tgcctg---agcta------ctt---------tggt---------------------------
              Big brown bat  -caga--cgcccc---aggga------gct---------tcat---------------------------
       David's myotis (bat)  -caga--ctcccg---aggga------tct---------ctgt---------------------------
                   Microbat  -caga--ctcccg---gggga------tcg---------ctgt---------------------------
                   Hedgehog  -taga--tgccta---aatta------ccc---------tgga---------------------------
                      Shrew  -caga--tatctg---------------------------tga---------------------------
            Star-nosed mole  -caga--ctcctg---agttg------ttg---------ttgt---------------------------
                   Elephant  -caga--ctcctg---agtta------tct---------ttgt---------------------------
        Cape elephant shrew  atagg--ctcccg---agatg------acc---------tcgttttgaaaggagctcctctactctgtac
                    Manatee  -caga--ctcttg---agtta------cct---------ttgt---------------------------
           Cape golden mole  -caga--cacctg---agttc------tct---------ttgt---------------------------
                     Tenrec  -taga--ccccag---cgtta-------at---------tcgg---------------------------
                   Aardvark  -ctga--ctcccg---agtta------tct---------ttgt---------------------------
                    Opossum  -cagatacagctg---aattaaaatccttc---------cttt---------------------------
            Tasmanian devil  -cagaacaacttg---aattcaaatcctgc---------cttt---------------------------
                    Wallaby  ======================================================================

                      Human  -------g---c--c-cccaactttccgtgtga---ttat
                      Chimp  -------g---c--c-cccacctttccgtgtga---ttat
                    Gorilla  -------g---c--c-cccaactttacgtgtga---ttat
                  Orangutan  -------g---c--c-cccaactttccgtgtga---ttat
                     Gibbon  -------g---c--c-cccaactttccatgtga---ttat
                     Rhesus  -------g---c--c-cccaactttctgtgtgg---ttac
        Crab-eating macaque  -------g---c--c-cccaactttctgtgtgg---ttac
                     Baboon  -------g---c--c-cccaactttctgtgtgg---ttac
               Green monkey  -------g---c--c-cccaactttctgtgtgg---ttac
                   Marmoset  -------g---c--c-cccaactttctgtatgt---ttac
            Squirrel monkey  -------a---c--c-cccaactttctgtatgt---ttac
                   Bushbaby  -------ggctc--c-tccacctttttgtgggc---ttgc
         Chinese tree shrew  -------a---a--c-cccgactttctgtgtgg---ttac
                   Squirrel  -------g---a--c-cccagctttctgtgtag---acac
     Lesser Egyptian jerboa  -------g---a--c-ctcaactttctatatag---tcac
               Prairie vole  -------g---a--c-ccaatctttctatccaa---gcat
            Chinese hamster  -------g---a--c-cccatctttctatctaa---tcct
             Golden hamster  -------g---a--c-cccatctttctaactaa------t
                      Mouse  -------a---a--c-cccatctttcta--taa---tcac
                        Rat  -------a---a--c-cccatctttcta--taa---tcac
             Naked mole-rat  -------g---a--c-cccaca--------tag---tcac
                 Guinea pig  -------g---g--t-gccata--------tag---ttac
                 Chinchilla  -------g---a--g-cccaca--------tag---tcac
           Brush-tailed rat  -------g---a--c-cccaca--------tgg---tcat
                     Rabbit  -------g---accc-ttcaaa---------ga---ttcc
                       Pika  -------g---g-tc-tccaacgtcccatgtgg---ctct
                        Pig  -------g---a--c-cccagccttcggtatgg---tgac
                     Alpaca  -------g---a--c-cccagccttctgtatcg---cgac
             Bactrian camel  -------g---a--c-cccagccttctgtatcg---cgac
                    Dolphin  -------g---a--c-cccaggtttctatgtgg---tgac
               Killer whale  -------g---a--c-cccaggtttctatgtgg---tgac
           Tibetan antelope  -------g---a--c-cctggccttctgtgtgg---tgac
                        Cow  -------g---a--c-cccggccttctgtgcgg---tgac
                      Sheep  -------g---a--c-cctggccttctgtgtgg---tgac
              Domestic goat  -------g---a--c-cctggctttctgtgtgg---tgac
                      Horse  -------g---a--c-cataactttctgtgtga---tgac
           White rhinoceros  -------g---a--c-cctaactttctgtgtgg---tgac
                        Cat  -------g---a--t-accaactttctgtgtag---tgac
                        Dog  -------g---g--c-cccaattttctgtgtag---tgat
                      Panda  -------g---a--c-cccaactttctgtgtag---tgcc
             Pacific walrus  -------g---a--c-cccaactttctgtgtag---tgac
               Weddell seal  -------g---a--c-cccaattttctgtgtag---tgac
           Black flying-fox  -------g---a----cccagctttctgtgtag---tgac
                    Megabat  -------g---a----cccagctttctgtgtag---tgac
              Big brown bat  -------g---a--c-cccaactttccacgtgg---tgac
       David's myotis (bat)  -------g---a--c-cccagctttccaagtgg---tgtc
                   Microbat  -------g---a--c-cccaactttccatgtgg---tgtc
                   Hedgehog  -------g---a--c-cctagcttatggtgtga---agac
                      Shrew  -------a---a--c-cccgatttcttgggtgg---tgac
            Star-nosed mole  -------g---a--c-ccagctttc-tgtaagg---aagc
                   Elephant  -------g---a-----ctgactttctgtgtgg---ttgt
        Cape elephant shrew  acaccaga---a-----ctgact-------tga---tggc
                    Manatee  -------g---a--c-tctgactttctgtgtag---ttat
           Cape golden mole  -------g---a--ctcttggttttctatgtgg---ttat
                     Tenrec  -------g---a--c-cctgcctttctgcctga---ctgt
                   Aardvark  -------g---a--c-tctgactttctttgtgg---ttat
                    Opossum  -------g---a--c-acctattacctatgtaacat----
            Tasmanian devil  -------g---a--t-gctggctacttaggtag-------
                    Wallaby  ========================================

Inserts between block 3 and 4 in window
B D                 Tenrec 159bp

Alignment block 4 of 219 in window, 112830736 - 112830743, 8 bps 
B D                   Human  taa-----aaga----------------------------g
B D                   Chimp  taa-----aaga----------------------------g
B D                 Gorilla  taa-----aaga----------------------------g
B D               Orangutan  taa-----aaga----------------------------g
B D                  Gibbon  taa-----aaga----------------------------g
B D                  Rhesus  taa-----aaga----------------------------g
B D     Crab-eating macaque  taa-----aaga----------------------------g
B D                  Baboon  taa-----aaga----------------------------g
B D            Green monkey  taa-----aaga----------------------------g
B D                Marmoset  tga-----aaga----------------------------g
B D         Squirrel monkey  tga-----aaga----------------------------g
B D                Bushbaby  tga-----aaga----------------------------g
         Chinese tree shrew  tga-----aaca----------------------------g
B D                Squirrel  tga-----aaga----------------------------a
     Lesser Egyptian jerboa  cgagtcttaggactaatgttggggagcatgatgtaggtcca
               Prairie vole  cga-----aaga----------------------------a
B D         Chinese hamster  tga-----agga----------------------------g
             Golden hamster  tga-----agga----------------------------g
B D                   Mouse  tga-----agga----------------------------a
B D                     Rat  cga-----agga----------------------------a
B D          Naked mole-rat  tg------aaga----------------------------g
B D              Guinea pig  tg------aaga----------------------------g
                 Chinchilla  tg------aaga----------------------------g
           Brush-tailed rat  tg------agga----------------------------g
B D                  Rabbit  tga-----aaga----------------------------a
B D                    Pika  tgt-----aaga----------------------------a
B D                     Pig  caa-----aaga----------------------------g
B D                  Alpaca  tgg-----aagg----------------------------a
             Bactrian camel  tgg-----aagg----------------------------a
B D                 Dolphin  tga-----aggt----------------------------g
               Killer whale  tga-----aggt----------------------------g
           Tibetan antelope  aga-----agac----------------------------a
B D                     Cow  aga-----aggc----------------------------a
B D                   Sheep  aga-----agac----------------------------a
              Domestic goat  aga-----agac----------------------------a
B D                   Horse  taa-----agga----------------------------t
B D        White rhinoceros  taa-----agga----------------------------g
B D                     Cat  taa-----aaga----------------------------g
B D                     Dog  tga-----aaga----------------------------g
B D                   Panda  tga-----aaaa----------------------------g
             Pacific walrus  tga-----aaga----------------------------g
               Weddell seal  tga-----aaga----------------------------g
           Black flying-fox  tga-----agga----------------------------g
B D                 Megabat  tga-----agga----------------------------g
              Big brown bat  tga-----agga----------------------------g
       David's myotis (bat)  tga-----cgga----------------------------g
B D                Microbat  tga-----cgga----------------------------g
B D                Hedgehog  tcg-----agt------------------------------
B D                   Shrew  tga-----aata----------------------------g
            Star-nosed mole  tga-----agta----------------------------a
B D                Elephant  tga-----ggga----------------------------g
        Cape elephant shrew  taa-----ggaa-----------------------------
B D                 Manatee  taa-----gagg----------------------------g
           Cape golden mole  tga-----ggga----------------------------g
B D                  Tenrec  taa-----ggaa----------------------------a
                   Aardvark  tga-----ggaa----------------------------g
B D                 Opossum  -----------------------------tagacagg----
B D                 Wallaby  =========================================
B D         Tasmanian devil  -----------------------------------------

Inserts between block 4 and 5 in window
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                Dolphin 1bp
              Killer whale 1bp
B D               Elephant 217bp
B D                Manatee 217bp
          Cape golden mole 205bp
                  Aardvark 102bp

Alignment block 5 of 219 in window, 112830744 - 112830750, 7 bps 
B D                   Human  c-cctt----------ct
B D                   Chimp  c-cctt----------ct
B D                 Gorilla  c-cctt----------ct
B D               Orangutan  c-cctt----------ct
B D                  Gibbon  c-cctt----------ct
B D                  Rhesus  c-tctt----------ct
B D     Crab-eating macaque  c-tctt----------ct
B D                  Baboon  c-tctt----------ct
B D            Green monkey  c-tctt----------ct
B D                Marmoset  c-cctt----------ct
B D         Squirrel monkey  c-cctt----------at
B D                Bushbaby  c-cctt----------at
         Chinese tree shrew  c-cctt----------c-
B D                Squirrel  c-cctt----------cg
     Lesser Egyptian jerboa  c-tttt----------ta
               Prairie vole  c-cctt----------tg
B D         Chinese hamster  c-cgtt----------ta
             Golden hamster  c-catt----------tg
B D                   Mouse  c-ctttgttatatatata
B D                     Rat  c-cctt----------tg
B D          Naked mole-rat  c-cctt----------tg
B D              Guinea pig  t-cctt----------tg
                 Chinchilla  c-cctt----------tg
           Brush-tailed rat  a-cctt----------tg
B D                  Rabbit  t-attt----------tg
B D                    Pika  t-cttt----------ca
B D                     Pig  c-cctc----------at
B D                  Alpaca  a-cctt----------at
             Bactrian camel  a-cctt----------at
B D                 Dolphin  c-cctt----------at
               Killer whale  c-cctt----------at
           Tibetan antelope  c-actt----------at
B D                     Cow  c-actt----------at
B D                   Sheep  c-actt----------at
              Domestic goat  c-actt----------at
B D                   Horse  c-tctt----------at
B D        White rhinoceros  c-cctt----------at
B D                     Cat  c-tttt----------tc
B D                     Dog  c-tctt----------ac
B D                   Panda  c-tcct----------ac
             Pacific walrus  c-tctt----------ac
               Weddell seal  c-cctt----------ac
           Black flying-fox  c-cctt----------ac
B D                 Megabat  c-cctt----------ac
              Big brown bat  c-tctc----------ag
       David's myotis (bat)  c-tctt----------at
B D                Microbat  c-tctt----------at
B D                Hedgehog  --cctt----------at
B D                   Shrew  a-actt----------ac
            Star-nosed mole  t-ttgt----------a-
B D                Elephant  c-tctt----------at
        Cape elephant shrew  c-tctt----------at
B D                 Manatee  c-tctt----------at
           Cape golden mole  --cctt----------at
B D                  Tenrec  c-cctt----------ac
                   Aardvark  t-gctt----------ct
B D                 Opossum  ctactt----------a-
B D         Tasmanian devil  --actt----------a-
B D                 Wallaby  ==================

Inserts between block 5 and 6 in window
                  Aardvark 114bp

Alignment block 6 of 219 in window, 112830751 - 112830799, 49 bps 
B D                   Human  tc-tt-----------------------------------------------------------------
B D                   Chimp  tc-tt-----------------------------------------------------------------
B D                 Gorilla  tc-tt-----------------------------------------------------------------
B D               Orangutan  tc-tt-----------------------------------------------------------------
B D                  Gibbon  tc-tt-----------------------------------------------------------------
B D                  Rhesus  tc-tt-----------------------------------------------------------------
B D     Crab-eating macaque  tc-tt-----------------------------------------------------------------
B D                  Baboon  tc-tt-----------------------------------------------------------------
B D            Green monkey  tc-tt-----------------------------------------------------------------
B D                Marmoset  tc-tt-----------------------------------------------------------------
B D         Squirrel monkey  tc-tt-----------------------------------------------------------------
B D                Bushbaby  tc-tc-----------------------------------------------------------------
         Chinese tree shrew  -a-tt-----------------------------------------------------------------
B D                Squirrel  cc-tt-----------------------------------------------------------------
     Lesser Egyptian jerboa  tt-ttttaaggtagggtctcactcttgcccaggctgacctgcaactcactatgtagtatcagggtggcct
               Prairie vole  tt-ct-----------------------------------------------------------------
B D         Chinese hamster  tt-tt-----------------------------------------------------------------
             Golden hamster  tt-tt-----------------------------------------------------------------
B D                   Mouse  tt-tt-----------------------------------------------------------------
B D                     Rat  tt-ct-----------------------------------------------------------------
B D          Naked mole-rat  tc-tt-----------------------------------------------------------------
B D              Guinea pig  tg-tt-----------------------------------------------------------------
                 Chinchilla  tc-tt-----------------------------------------------------------------
           Brush-tailed rat  tt-tt-----------------------------------------------------------------
B D                  Rabbit  tc-tt-----------------------------------------------------------------
B D                    Pika  tt-tt-----------------------------------------------------------------
B D                     Pig  cc-tt-----------------------------------------------------------------
B D                  Alpaca  cc-tt-----------------------------------------------------------------
             Bactrian camel  cc-tt-----------------------------------------------------------------
B D                 Dolphin  cc-tc-----------------------------------------------------------------
               Killer whale  cc-tc-----------------------------------------------------------------
           Tibetan antelope  cc-tt-----------------------------------------------------------------
B D                     Cow  cc-tt-----------------------------------------------------------------
B D                   Sheep  cc-tt-----------------------------------------------------------------
              Domestic goat  cc-tt-----------------------------------------------------------------
B D                   Horse  ac-t------------------------------------------------------------------
B D        White rhinoceros  cc-tc-----------------------------------------------------------------
B D                     Cat  tc-tt-----------------------------------------------------------------
B D                     Dog  tc-tt-----------------------------------------------------------------
B D                   Panda  tc-tt-----------------------------------------------------------------
             Pacific walrus  tc-tt-----------------------------------------------------------------
               Weddell seal  tc-tt-----------------------------------------------------------------
           Black flying-fox  tt-tt-----------------------------------------------------------------
B D                 Megabat  tt-tt-----------------------------------------------------------------
              Big brown bat  cc-tt-----------------------------------------------------------------
       David's myotis (bat)  cc-tt-----------------------------------------------------------------
B D                Microbat  cc-tt-----------------------------------------------------------------
B D                Hedgehog  ct-gg-----------------------------------------------------------------
B D                   Shrew  cc-tt-----------------------------------------------------------------
            Star-nosed mole  ct-tt-----------------------------------------------------------------
B D                Elephant  tc-tt-----------------------------------------------------------------
        Cape elephant shrew  ca-ta-----------------------------------------------------------------
B D                 Manatee  tc-tt-----------------------------------------------------------------
           Cape golden mole  tcttt-----------------------------------------------------------------
B D                  Tenrec  tc-tt-----------------------------------------------------------------
                   Aardvark  tc-tt-----------------------------------------------------------------
B D                 Opossum  tt-tt-----------------------------------------------------------------
B D         Tasmanian devil  gt-tt-----------------------------------------------------------------
B D                 Wallaby  ======================================================================

                      Human  -----------------------ttctaaa--------------acttagtg-------ccaaatgct--
                      Chimp  -----------------------ttctaaa--------------acttagtg-------ccaaatgct--
                    Gorilla  -----------------------ttctaaa--------------acttagtg-------ccaaatgct--
                  Orangutan  -----------------------ttctaaa--------------acttagtg-------ccaaatgct--
                     Gibbon  -----------------------ttctaaa--------------acttagtg-------ccaaatgct--
                     Rhesus  -----------------------ttctaaa--------------gcttagtg-------ccaaatgct--
        Crab-eating macaque  -----------------------ttctaaa--------------gcttagtg-------ccaaatgct--
                     Baboon  -----------------------ttctaaa--------------gcttagtg-------ccaaatgct--
               Green monkey  -----------------------ttctaaa--------------gcttagtg-------ccaaatgct--
                   Marmoset  -----------------------ttctaaa--------------acttagtg-------ccaaatact--
            Squirrel monkey  -----------------------ttctaaa--------------acttagtg-------ccaaatgct--
                   Bushbaby  -----------------------t----ga--------------acttagta-------taaaattct--
         Chinese tree shrew  -----------------------ttctgaa--------------gcgtggta-------ccaaatgcc--
                   Squirrel  -----------------------ccctgaa--------------ttcttagg-------atcattgct--
     Lesser Egyptian jerboa  caaactcattgcaatcttcctacctctgcc--------------tcccaagtgctgggattaa-------
               Prairie vole  -----------------------ctctgaa--------------cccaaagc-------ccga-------
            Chinese hamster  -----------------------ctctgaa--------------tcctaagc-------ccaa-------
             Golden hamster  -----------------------ctctgaa--------------tcctaagc-------ttga-------
                      Mouse  -----------------------ttctgaa--------------tcct----------------------
                        Rat  -----------------------ttctgaa--------------tcctga--------------------
             Naked mole-rat  -----------------------ttctgaa--------------tctaagga-------ccaa-tact--
                 Guinea pig  -----------------------ttctata--------------tctgagaa-------ccaa-tacc--
                 Chinchilla  -----------------------ttctaaa--------------tctgagga-------ccaa-tact--
           Brush-tailed rat  -----------------------ttctaat--------------tgtgagac-------ccaa-cact--
                     Rabbit  -----------------------ttcaaaa--------------tcttagga-------ccaaatgct--
                       Pika  -----------------------ctt--aa--------------tcttagga-------tcaaattct--
                        Pig  -----------------------ttctgaa--------------ac--agtg-------ccaaatggt--
                     Alpaca  -----------------------ttctgaa--------------acttcgta-------ttgaatgct--
             Bactrian camel  -----------------------ttctgaa--------------acttcgta-------ttgaatgct--
                    Dolphin  -----------------------ttctgaa--------------acttagca-------tcaaatgc---
               Killer whale  -----------------------ttctgaa--------------acttagca-------tcaaatgc---
           Tibetan antelope  -----------------------ctctgaa--------------acttagca-------tcaaatgct--
                        Cow  -----------------------ctctgaa--------------acttagca-------tcaaatgct--
                      Sheep  -----------------------ctctgaa--------------acttcgca-------tcaaatgct--
              Domestic goat  -----------------------ctctgaa--------------acttagca-------tcaaatgct--
                      Horse  -----------------------tcctgaa--------------agttagta-------tcaaatgct--
           White rhinoceros  -----------------------ttgtgaa--------------acttagta-------tcaaattct--
                        Cat  -----------------------ttctgaa--------------acttaata-------tcaaatggt--
                        Dog  -----------------------ttctgaa--------------acttagta-------tcaaatgat--
                      Panda  -----------------------ttctgaa--------------acttagta-------tcaaatggt--
             Pacific walrus  -----------------------ttctgaa--------------acttagta-------tcaaatggt--
               Weddell seal  -----------------------ttctgaa--------------acttacta-------tcaaatggt--
           Black flying-fox  -----------------------tactgaa--------------actgagtg-------tcaggtggt--
                    Megabat  -----------------------tactgaa--------------accgagtg-------tcacgtggt--
              Big brown bat  -----------------------ttctaga--------------actgagtg-------tc---------
       David's myotis (bat)  -----------------------tcctaga--------------actgagcg-------tcagatggt--
                   Microbat  -----------------------tcctaga--------------actgagcg-------tcagatggc--
                   Hedgehog  -----------------------ttctgaa--------------acgcaata-------t-gtatgtttt
                      Shrew  -----------------------ttctgaa--------------acttaata-------tgggatgct--
            Star-nosed mole  -----------------------ctctgtg--------------acttaata-------taggatgct--
                   Elephant  -----------------------ttctgaa--------------gcttaggc-------ccaagtgct--
        Cape elephant shrew  -----------------------tactgaa--------------gcttagtc-------tcaagtgct--
                    Manatee  -----------------------ttctgaa--------------gcttagag-------ccaaatgct--
           Cape golden mole  -----------------------tttttaa--------------tcttactc-------ccaaattct--
                     Tenrec  -----------------------ttctcga--------------gcctagtc-------cccagtgct--
                   Aardvark  -----------------------ttctgaagcttagtcccccgtgcttagtc-------cccagtgcc--
                    Opossum  -----------------------cactgat--------------tctcag--------------------
            Tasmanian devil  -----------------------cattgga--------------cctcag--------------------
                    Wallaby  ======================================================================

                      Human  ------------gaggagcataa-----------tgtaggtgag
                      Chimp  ------------gaggagcataa-----------tgtaggtgag
                    Gorilla  ------------gaggagaataa-----------tgtaggtgag
                  Orangutan  ------------gaggagcataa-----------tgtaggtgag
                     Gibbon  ------------gaggagcataa-----------tgtaggtgag
                     Rhesus  ------------gaggagcataa-----------tgtaggtgaa
        Crab-eating macaque  ------------gaggagcataa-----------tgtaggtgaa
                     Baboon  ------------gaggagcataa-----------tgtaggtgaa
               Green monkey  ------------gaggagcataa-----------tgtaggtgaa
                   Marmoset  ------------gaggagtagaa-----------tgtaggtgag
            Squirrel monkey  ------------gaggagcataa-----------tgtaggtgag
                   Bushbaby  ------------ga--agcataa-----------tcttagtgag
         Chinese tree shrew  ------------gggaagcacaa-----------agtaggtgag
                   Squirrel  ------------ggggaacatca-----------tggaggtgtg
     Lesser Egyptian jerboa  ------------aggtgtgctcaaccacacccagtttaggtgca
               Prairie vole  ------------gggggagata-------------atgggtgga
            Chinese hamster  ------------ggggaggatca-----------tatgggtaga
             Golden hamster  ------------ggggaggatca-----------tatgggtaga
                      Mouse  -------------------acca-----------tatggg----
                        Rat  -------------gggaggatca-----------tatggg----
             Naked mole-rat  ------------ggggaacagca-----------tgtaggtgca
                 Guinea pig  ------------agggagcatca-----------tatagatgc-
                 Chinchilla  ------------ggggaacattg-----------tgtaggtgca
           Brush-tailed rat  ------------ggggaacatta-----------tgtacatgcg
                     Rabbit  ------------ggggagcat-t-----------tgtaggtgaa
                       Pika  ------------ggggaacatct-----------tgtgggtgag
                        Pig  ------------agggagcatga-----------cacagatggg
                     Alpaca  ------------ggggagcataa-----------tatgggtggg
             Bactrian camel  ------------ggggagcataa-----------tatgggcggg
                    Dolphin  ------------------------------------taggtggg
               Killer whale  ------------------------------------taggtggg
           Tibetan antelope  ------------agggtgtataa-----------tataggtgga
                        Cow  ------------agtgtgtataa-----------tataggtgga
                      Sheep  ------------agggtgtataa-----------tataggtgga
              Domestic goat  ------------agggtgtataa-----------tataggtgga
                      Horse  ------------aaggagcataa-----------cttagcagag
           White rhinoceros  ------------ggggagtacaa-----------cataggtggg
                        Cat  ------------agggagcataa-----------tataagtgag
                        Dog  ------------agggagcaaaa-----------tataggtggg
                      Panda  ------------agggagcataa-----------tataagtggg
             Pacific walrus  ------------agggagcataa-----------tataggtggg
               Weddell seal  ------------agggagcataa-----------tataggtggg
           Black flying-fox  ------------tgggggcagaa-----------tgtaggtggg
                    Megabat  ------------tgggggcagaa-----------tgaaggtggg
              Big brown bat  --------------------------------------------
       David's myotis (bat)  ------------ggagagcataa-----------tataggtggg
                   Microbat  ------------ggggagcataa-----------tataggtggg
                   Hedgehog  ttatttccatacatggattagaa-----------tataggtgaa
                      Shrew  ------------agagaacataa-----------tgaagatggc
            Star-nosed mole  ------------agaaagc-------------------------
                   Elephant  ------------ggggagcataa-----------tgtaggtggg
        Cape elephant shrew  ------------ggggagcataa-----------tgggagttgg
                    Manatee  ------------ggggagcgtaa-----------tgtaggtggg
           Cape golden mole  ------------ggggagcatac-----------tgtgggtggg
                     Tenrec  ------------ggggggcatga-----------taggggtgag
                   Aardvark  ------------ggggagcataa-----------agtgggtggg
                    Opossum  --------------------------------------------
            Tasmanian devil  --------------------------------------------
                    Wallaby  ============================================

Inserts between block 6 and 7 in window
B D        Squirrel monkey 7bp
B D                   Pika 102bp
B D               Hedgehog 1bp
B D                  Shrew 3bp

Alignment block 7 of 219 in window, 112830800 - 112830803, 4 bps 
B D                   Human  aa--tt-
B D                   Chimp  aa--tt-
B D                 Gorilla  aa--tt-
B D               Orangutan  aa--tt-
B D                  Gibbon  aa--tt-
B D                  Rhesus  ----tt-
B D     Crab-eating macaque  ----tt-
B D                  Baboon  tt--tt-
B D            Green monkey  -t--tt-
B D                Marmoset  aa--tt-
B D         Squirrel monkey  tt--tt-
B D                Bushbaby  aa--tt-
         Chinese tree shrew  aa--tt-
B D                Squirrel  ga-----
     Lesser Egyptian jerboa  aa-----
               Prairie vole  aa-----
B D         Chinese hamster  aa-----
             Golden hamster  aa-----
B D          Naked mole-rat  aa-----
B D              Guinea pig  aa-----
                 Chinchilla  aa-----
           Brush-tailed rat  aa-----
B D                  Rabbit  actt---
B D                    Pika  aatc---
B D                     Pig  ---aag-
B D                  Alpaca  ---aat-
             Bactrian camel  ---aat-
B D                 Dolphin  ---cat-
               Killer whale  ---aat-
           Tibetan antelope  ---aat-
B D                     Cow  ---aat-
B D                   Sheep  ---aat-
              Domestic goat  ---aat-
B D                   Horse  ---att-
B D        White rhinoceros  ---aag-
B D                     Cat  ---aat-
B D                     Dog  ---aat-
B D                   Panda  ---aat-
             Pacific walrus  ---aat-
               Weddell seal  ---agt-
           Black flying-fox  ---cat-
B D                 Megabat  ---cat-
       David's myotis (bat)  ---cat-
B D                Microbat  ---cat-
B D                Hedgehog  ---act-
B D                   Shrew  ---aat-
            Star-nosed mole  ---aat-
B D                Elephant  ---gtt-
        Cape elephant shrew  ---att-
B D                 Manatee  ---aat-
           Cape golden mole  ---aat-
B D                  Tenrec  ---aat-
                   Aardvark  ---aat-
B D                 Opossum  ----atc
B D         Tasmanian devil  ----att
B D                     Rat  -------
B D                   Mouse  -------
B D                 Wallaby  =======
             Big brown bat  -------

Inserts between block 7 and 8 in window
B D               Squirrel 3bp
B D         Naked mole-rat 3bp
B D             Guinea pig 3bp
                Chinchilla 3bp
          Brush-tailed rat 3bp
B D                 Rabbit 925bp
B D                   Pika 21bp
B D                    Pig 1bp
B D                 Alpaca 2bp
            Bactrian camel 2bp
B D                Dolphin 2bp
              Killer whale 2bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 28bp
B D                    Dog 1bp
B D                  Panda 1bp
            Pacific walrus 1bp
              Weddell seal 1bp
          Black flying-fox 1bp
B D                Megabat 1bp
      David's myotis (bat) 1bp
B D               Microbat 1bp
B D               Hedgehog 1bp
B D                  Shrew 1bp
           Star-nosed mole 1bp
B D               Elephant 4bp
       Cape elephant shrew 3bp
B D                Manatee 3bp
          Cape golden mole 3bp
B D                 Tenrec 3bp
                  Aardvark 23bp

Alignment block 8 of 219 in window, 112830804 - 112830805, 2 bps 
B D                   Human  tt-
B D                   Chimp  tt-
B D                 Gorilla  tt-
B D               Orangutan  tt-
B D                  Gibbon  tt-
B D                  Rhesus  tt-
B D     Crab-eating macaque  tt-
B D                  Baboon  tt-
B D            Green monkey  tt-
B D                Marmoset  cg-
B D         Squirrel monkey  tt-
B D                Bushbaby  tt-
         Chinese tree shrew  tt-
B D                Squirrel  tt-
     Lesser Egyptian jerboa  tt-
               Prairie vole  ta-
B D         Chinese hamster  ta-
             Golden hamster  ta-
B D          Naked mole-rat  aa-
B D              Guinea pig  aa-
                 Chinchilla  aa-
           Brush-tailed rat  aa-
B D                    Pika  ta-
B D                     Pig  -t-
B D                  Alpaca  -t-
             Bactrian camel  -t-
B D                 Dolphin  -t-
               Killer whale  -t-
           Tibetan antelope  -t-
B D                     Cow  -t-
B D                   Sheep  -t-
              Domestic goat  -t-
B D                   Horse  -t-
B D        White rhinoceros  -c-
B D                     Cat  -t-
B D                     Dog  -t-
B D                   Panda  -t-
             Pacific walrus  -t-
               Weddell seal  -t-
           Black flying-fox  -t-
B D                 Megabat  -t-
       David's myotis (bat)  -t-
B D                Microbat  -t-
B D                Hedgehog  -t-
B D                   Shrew  -t-
            Star-nosed mole  -t-
B D                 Opossum  -cc
B D         Tasmanian devil  -tc
B D                     Rat  ---
B D                   Mouse  ---
       Cape elephant shrew  ===
B D                 Wallaby  ===
             Big brown bat  ---
B D                  Rabbit  ===
B D                  Tenrec  ===
                  Aardvark  ===
B D                Elephant  ===
B D                 Manatee  ===
          Cape golden mole  ===

Alignment block 9 of 219 in window, 112830806 - 112830808, 3 bps 
B D                   Human  ttt
B D                   Chimp  ttt
B D                 Gorilla  ttt
B D               Orangutan  ttt
B D                  Gibbon  ttt
B D                  Rhesus  ttt
B D     Crab-eating macaque  ttt
B D                  Baboon  ttt
B D            Green monkey  ttt
B D                Marmoset  tct
B D         Squirrel monkey  ttt
B D                Bushbaby  ttt
         Chinese tree shrew  aga
B D                Squirrel  ttt
     Lesser Egyptian jerboa  ttt
               Prairie vole  ttt
B D         Chinese hamster  ttt
             Golden hamster  ttt
B D          Naked mole-rat  aga
B D              Guinea pig  aga
                 Chinchilla  aga
           Brush-tailed rat  aca
B D                    Pika  ttt
B D                     Pig  tgt
B D                  Alpaca  ttt
             Bactrian camel  ttt
B D                 Dolphin  ttt
               Killer whale  ttt
           Tibetan antelope  ttt
B D                     Cow  ttt
B D                   Sheep  ttt
              Domestic goat  ttt
B D                   Horse  ttt
B D        White rhinoceros  ttt
B D                     Cat  tat
B D                     Dog  tat
B D                   Panda  tat
             Pacific walrus  tat
               Weddell seal  tat
           Black flying-fox  ttt
B D                 Megabat  ttt
       David's myotis (bat)  ttt
B D                Microbat  ttt
B D                Hedgehog  ttt
B D                   Shrew  ttt
            Star-nosed mole  ttt
B D                 Manatee  --c
B D                 Opossum  ttc
B D         Tasmanian devil  ttc
B D                     Rat  ---
B D                   Mouse  ---
       Cape elephant shrew  ===
B D                 Wallaby  ===
             Big brown bat  ---
B D                  Rabbit  ===
B D                  Tenrec  ===
                  Aardvark  ===
B D                Elephant  ===
          Cape golden mole  ===

Inserts between block 9 and 10 in window
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 192bp
B D                    Dog 1bp
B D                  Panda 1bp
            Pacific walrus 188bp
              Weddell seal 1bp
B D               Hedgehog 2bp
B D                  Shrew 2bp
           Star-nosed mole 2bp
B D                Manatee 11bp

Alignment block 10 of 219 in window, 112830809 - 112830813, 5 bps 
B D                   Human  ----ttttt
B D                   Chimp  ----ttttt
B D                 Gorilla  ----ttttg
B D               Orangutan  ----ttttt
B D                  Gibbon  ----g----
B D                  Rhesus  ----t----
B D     Crab-eating macaque  ----t----
B D                  Baboon  ----t----
B D            Green monkey  ----t----
B D                Marmoset  ----ttttt
B D         Squirrel monkey  ----ttttt
B D                Bushbaby  ----taa--
         Chinese tree shrew  ----aaaa-
B D                Squirrel  ----t----
     Lesser Egyptian jerboa  ----t----
               Prairie vole  ----t----
B D         Chinese hamster  ----t----
             Golden hamster  ----t----
B D          Naked mole-rat  ----a----
B D              Guinea pig  ----a----
                 Chinchilla  ----a----
           Brush-tailed rat  ----a----
B D                    Pika  ----t----
B D                     Pig  ----t----
B D                  Alpaca  ----a----
             Bactrian camel  ----a----
B D                 Dolphin  ----c----
               Killer whale  ----c----
           Tibetan antelope  ----c----
B D                     Cow  ----c----
B D                   Sheep  ----c----
              Domestic goat  ----c----
B D                     Cat  ----t----
B D                Hedgehog  ----t----
B D                   Shrew  ----c----
            Star-nosed mole  ----t----
B D                Elephant  ----a----
        Cape elephant shrew  ----t----
B D                 Manatee  ----c----
           Cape golden mole  ----a----
B D                  Tenrec  ----a----
B D                 Opossum  tctgt----
B D         Tasmanian devil  -ctat----
B D                     Rat  ---------
B D                   Mouse  ---------
B D                   Panda  =========
B D                 Wallaby  =========
B D                Microbat  ---------
      David's myotis (bat)  ---------
             Big brown bat  ---------
          Black flying-fox  ---------
B D                 Megabat  ---------
B D                  Rabbit  =========
            Pacific walrus  =========
B D                     Dog  =========
                  Aardvark  =========
B D                   Horse  =========
              Weddell seal  =========
B D        White rhinoceros  =========

Inserts between block 10 and 11 in window
B D                    Cat 5bp
B D               Hedgehog 362bp
B D                  Shrew 94bp
           Star-nosed mole 2bp

Alignment block 11 of 219 in window, 112830814 - 112830819, 6 bps 
B D                   Human  ggg--ggg--
B D                   Chimp  tttttggg--
B D                 Gorilla  gg---ggg--
B D               Orangutan  ttgggggg--
B D                  Gibbon  -----ggg--
B D                  Rhesus  -----taa--
B D     Crab-eating macaque  -----taa--
B D                  Baboon  -----taa--
B D            Green monkey  -----taa--
B D                Marmoset  ttttttaa--
B D         Squirrel monkey  ttttttaa--
B D                Bushbaby  -----aaa--
         Chinese tree shrew  -----aaa--
B D                Squirrel  -----taa--
     Lesser Egyptian jerboa  -----taa--
               Prairie vole  -----aaa--
B D         Chinese hamster  -----taa--
             Golden hamster  -----taa--
B D          Naked mole-rat  -----gaa--
B D              Guinea pig  -----aag--
                 Chinchilla  -----aag--
           Brush-tailed rat  -----aag--
B D                    Pika  -----ggg--
B D                     Pig  -----gaa--
B D                  Alpaca  -----aaa--
             Bactrian camel  -----aaa--
B D                 Dolphin  -----aaa--
               Killer whale  -----aaa--
           Tibetan antelope  -----aaa--
B D                     Cow  -----aaa--
B D                   Sheep  -----aaa--
              Domestic goat  -----aaa--
B D                   Horse  -----aaa--
B D        White rhinoceros  -----aaa--
B D                     Cat  -----aaa--
B D                     Dog  -----aaa--
B D                   Panda  -----aaa--
             Pacific walrus  -----aat--
               Weddell seal  -----aaa--
           Black flying-fox  -----aag--
B D                 Megabat  -----aag--
       David's myotis (bat)  -----aaa--
B D                Microbat  -----taa--
B D                   Shrew  ---tggga--
            Star-nosed mole  ---tgaaa--
B D                Elephant  --aaaaaa--
        Cape elephant shrew  --tctaaa--
B D                 Manatee  --aaaaaa--
           Cape golden mole  --aaaaaa--
B D                  Tenrec  --aaaaaa--
B D                 Opossum  ----aaaatg
B D         Tasmanian devil  ----aaaatg
B D                Hedgehog  ==========
B D                     Rat  ----------
B D                   Mouse  ----------
B D                 Wallaby  ==========
             Big brown bat  ----------
B D                  Rabbit  ==========
                  Aardvark  ==========

Inserts between block 11 and 12 in window
B D               Squirrel 2bp
    Lesser Egyptian jerboa 2bp
              Prairie vole 2bp
B D        Chinese hamster 2bp
            Golden hamster 2bp
B D         Naked mole-rat 2bp
B D             Guinea pig 2bp
                Chinchilla 2bp
          Brush-tailed rat 2bp
B D                   Pika 188bp
B D                    Pig 1bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 2bp
B D       White rhinoceros 2bp
B D                    Cat 2bp
B D                    Dog 2bp
B D                  Panda 2bp
            Pacific walrus 2bp
              Weddell seal 2bp
          Black flying-fox 1bp
B D                Megabat 1bp
      David's myotis (bat) 1bp
B D               Microbat 207bp
B D                  Shrew 1bp
           Star-nosed mole 1bp

Alignment block 12 of 219 in window, 112830820 - 112830820, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  g
B D                  Gibbon  g
B D                  Rhesus  g
B D     Crab-eating macaque  g
B D                  Baboon  g
B D            Green monkey  g
B D                Bushbaby  a
         Chinese tree shrew  g
B D                Squirrel  g
               Prairie vole  g
B D         Chinese hamster  a
             Golden hamster  a
B D          Naked mole-rat  g
B D              Guinea pig  g
                 Chinchilla  g
           Brush-tailed rat  g
B D                    Pika  a
B D                     Pig  g
B D                  Alpaca  g
             Bactrian camel  g
B D                 Dolphin  g
               Killer whale  g
           Tibetan antelope  g
B D                     Cow  g
B D                   Sheep  g
              Domestic goat  g
B D                   Horse  g
B D        White rhinoceros  g
B D                     Cat  g
B D                     Dog  g
B D                   Panda  g
             Pacific walrus  a
               Weddell seal  g
           Black flying-fox  g
B D                 Megabat  g
       David's myotis (bat)  g
B D                Microbat  g
B D                   Shrew  t
            Star-nosed mole  a
B D                Elephant  g
        Cape elephant shrew  g
B D                 Manatee  g
           Cape golden mole  a
B D                  Tenrec  a
B D                 Opossum  a
B D         Tasmanian devil  a
B D                Hedgehog  =
B D                     Rat  -
B D                   Mouse  -
B D                 Wallaby  =
             Big brown bat  -
B D         Squirrel monkey  -
B D                  Rabbit  =
    Lesser Egyptian jerboa  =
                  Aardvark  =
B D                Marmoset  -

Inserts between block 12 and 13 in window
          Cape golden mole 4bp

Alignment block 13 of 219 in window, 112830821 - 112830822, 2 bps 
B D                   Human  tg
B D                   Chimp  tg
B D                 Gorilla  tg
B D               Orangutan  tg
B D                  Gibbon  tg
B D                  Rhesus  tg
B D     Crab-eating macaque  tg
B D                  Baboon  tg
B D            Green monkey  tg
B D                Bushbaby  tg
         Chinese tree shrew  tg
B D                Squirrel  ta
     Lesser Egyptian jerboa  cg
               Prairie vole  tg
B D         Chinese hamster  tg
             Golden hamster  tg
B D                   Mouse  tg
B D                     Rat  tg
B D          Naked mole-rat  ta
B D              Guinea pig  ta
                 Chinchilla  ta
           Brush-tailed rat  tg
B D                    Pika  tt
B D                     Pig  tg
B D                  Alpaca  tg
             Bactrian camel  tg
B D                 Dolphin  tg
               Killer whale  tg
           Tibetan antelope  tg
B D                     Cow  tg
B D                   Sheep  tg
              Domestic goat  tg
B D                   Horse  tg
B D        White rhinoceros  tg
B D                     Cat  tg
B D                     Dog  tg
B D                   Panda  tg
             Pacific walrus  ta
               Weddell seal  tg
           Black flying-fox  ca
B D                 Megabat  ca
       David's myotis (bat)  tg
B D                Microbat  tg
B D                   Shrew  tg
            Star-nosed mole  tg
B D                Elephant  ta
        Cape elephant shrew  tg
B D                 Manatee  ta
           Cape golden mole  ta
B D                  Tenrec  tc
                   Aardvark  tg
B D                 Opossum  ag
B D         Tasmanian devil  ag
B D                Hedgehog  ==
B D                 Wallaby  ==
             Big brown bat  --
B D         Squirrel monkey  --
B D                  Rabbit  ==
B D                Marmoset  --

Inserts between block 13 and 14 in window
B D                  Shrew 60bp
           Star-nosed mole 7bp

Alignment block 14 of 219 in window, 112830823 - 112830868, 46 bps 
B D                   Human  aaaattaagct-ag--------------a-----gcttcttgaag----tacctag----tttc------
B D                   Chimp  aaaattaagct-ag--------------a-----gcttcttgaag----tacctag----tttc------
B D                 Gorilla  aaaattaagct-ag--------------a-----gcttcttgaag----tacctag----tttc------
B D               Orangutan  aaaattaagct-ag--------------a-----gcttcttgaag----tacctag----tttc------
B D                  Gibbon  aaaattaagct-ac--------------a-----gcttcttgaag----tacctag----tttc------
B D                  Rhesus  aaaattaggct-ag--------------a-----gcttcttgaag----tacctat----tttc------
B D     Crab-eating macaque  aaaattaggct-ag--------------a-----gcttcttgaag----tacctat----tttc------
B D                  Baboon  aaaattaggct-ag--------------a-----gcttcttgaag----tacctat----tttc------
B D            Green monkey  aaaattaggct-ag--------------a-----gcttcttgaag----tacctat----tttc------
B D                Marmoset  ------aggct-ag--------------a-----ccttctcgagg----tacctag----tttc------
B D         Squirrel monkey  ------aggct-ag--------------a-----gcttcttaagg----tacctag----tttc------
B D                Bushbaby  aaaattaacct-aa--------------a-----gcttcttatgt----ttcatag----ttgc------
         Chinese tree shrew  aaaattaaact-aa--------------a-------------atg----ta---aa----attc------
B D                Squirrel  aaacttaggtc-aa--------------a-----gcttctaggag----tatgtag----tttc------
     Lesser Egyptian jerboa  aaaattcggct-aa--------------g-----gcttctagtag----tacctag----tttc------
               Prairie vole  gaaattatatt-aa--------------a-----gctctcaagac----tacttag----tttc------
B D         Chinese hamster  aaaattataataaa--------------a-----tattctaagaa----tacctag----tttc------
             Golden hamster  aaaattataat-aa--------------a-----tcttctaagaa----taactag----tttc------
B D                   Mouse  agaattatatt-aa--------------a-----gctcccaaggg----tacccag----tttc------
B D                     Rat  agaattatatt-aa--------------a-----gcttccatgaa----tgcctag----tttc------
B D          Naked mole-rat  aaaattaggct-ga--------------a-----gcttctaggag----tacctag----tttc------
B D              Guinea pig  aacattaggtg-aa--------------a-----gcttcatggag----tacctag----cttc-----t
                 Chinchilla  aaacttaggct-aa--------------a-----gcttctaggag----tacctag----tttt------
           Brush-tailed rat  a---------------------------------------------------------------------
B D                    Pika  aacattaagcc-aa--------------a-----gtttccaggta----tacctagaagcttttactagt
B D                     Pig  aaaattagatg-aa--------------a-----gcttctggaag----tacctag----gatc------
B D                  Alpaca  aaaatgagttt-aa--------------a-----gcttctaggag----gacctag----gttc------
             Bactrian camel  aaaatgagttt-aa--------------a-----gcttctaggag----gacctag----gttc------
B D                 Dolphin  aaaattagatt-aa--------------a-----gctcctaggcg----tatct-g----tttg------
               Killer whale  aaaattagatt-aa--------------a-----actcctaggcg----tatct-g----tttg------
           Tibetan antelope  aaaattaggta-aa--------------a-----gcttctaggtg----tagctag----tttc------
B D                     Cow  aaaattaggta-aa--------------a-----gcttctaggtg----tagctag----tttc------
B D                   Sheep  aaaattaggta-aa--------------a-----gcttctaggtg----tagctag----tttc------
              Domestic goat  aaaattaggta-aa--------------a-----gcttctaggtg----tagctag----tttc------
B D                   Horse  aaaattaagta-aa--------------a-----gcttccagaat----tatgtgg----tttc------
B D        White rhinoceros  aaaattacgtt-aa--------------a-----ccttctaggat----tatctag----tttt------
B D                     Cat  aacattaggtg-aa--------------a-----acttgtaggac----tacctaa----tttc------
B D                     Dog  agaattagatt-aa--------------a-----atttctaagag----tagctag---ctttc------
B D                   Panda  aaaattggatt-aa--------------a-----acttctaggag----tagcgag----tttc------
             Pacific walrus  aaatct---tt-aaaaaaaaacaaaaaca-----aaaactaggag----tagctag----tttc------
               Weddell seal  aaaattgggtt-aa--------------a-----acttctaggag----tagctag----tttc------
           Black flying-fox  gaaatgatgtt-aa--------------a-----gcttctaggag----tacctag----ttcc------
B D                 Megabat  gaaatgatgtt-aa--------------a-----gcttctaggag----tacctag----ttcc------
              Big brown bat  ------aggtt-aa--------------g-----gctgccaggag----tgcctag----tttc------
       David's myotis (bat)  aaaattaggtt-aa--------------g-----gcatccaggag----tgtctcg----tttc------
B D                Microbat  aaaattaggtt-aa--------------g-----gcttccaggag----tgcctcg----tttc------
B D                Hedgehog  aaaat--aaaa-aa--------------g-----acttctataag----tacttag----tttc------
B D                   Shrew  cagat--ggct-ta--------------a-----tttttttaaag----ta---ag----tttc------
            Star-nosed mole  -------ggtt-aa--------------a-----ccttctaggag----tgcacat----tttc------
B D                Elephant  aaaagcaggtt-aa--------------a-----acttctagggc----tacctag----tttc------
        Cape elephant shrew  caaagtaaatt-aa--------------a-----actcc-------------------------------
B D                 Manatee  aaaagtaggtt-aa--------------a-----acttctagtac----tacccag----tttc------
           Cape golden mole  aaaagtaggtt-aa--------------aattttattttaaggac----tacctga----tttc------
B D                  Tenrec  aaaagtagatg-aa--------------a-----actttcaggac----caactag----tgtc------
                   Aardvark  aaaagtaggtt-aa--------------a-----ttgtctaggat----tacctgg----tttc------
B D                 Opossum  -gcatttgtct-ag--------------a-----aggcctctaaagttccttctag----cttc------
B D         Tasmanian devil  -acattggact-ag--------------g-----tattctctaaggttctttctaa----tccc------
B D                 Wallaby  ======================================================================
B D                  Rabbit  ======================================================================

                      Human  ---caggggcttt
                      Chimp  ---caggggcttt
                    Gorilla  ---caggggcttt
                  Orangutan  ---caggggcttt
                     Gibbon  ---caggggcttt
                     Rhesus  ---caggggcttt
        Crab-eating macaque  ---caggggcttt
                     Baboon  ---cacgggcttt
               Green monkey  ---caggggcttt
                   Marmoset  ---cagggacttt
            Squirrel monkey  ---cagggacttt
                   Bushbaby  ---caggggc-tt
         Chinese tree shrew  ---cagggac-tt
                   Squirrel  ---taggtac-tt
     Lesser Egyptian jerboa  ---catggat-tt
               Prairie vole  ---caggga--ct
            Chinese hamster  ---tgggtat-tt
             Golden hamster  ---tgggtat-tt
                      Mouse  ---caggcat-tt
                        Rat  ---caggcat-tt
             Naked mole-rat  ---caggtac-tt
                 Guinea pig  aggtaggtac-tt
                 Chinchilla  ---caggtac-at
           Brush-tailed rat  -------------
                       Pika  caacaggtac-tt
                        Pig  ---cagggac-tt
                     Alpaca  ---cagggac-tt
             Bactrian camel  ---cagggac-tt
                    Dolphin  ---cagggac-tt
               Killer whale  ---cagggac-tt
           Tibetan antelope  ---cagggac-tt
                        Cow  ---cagggac-tt
                      Sheep  ---cagggac-tt
              Domestic goat  ---cagggac-tt
                      Horse  ---ttgagac---
           White rhinoceros  ---cagagac---
                        Cat  ---cagggac-tt
                        Dog  ---cagcgac-tt
                      Panda  ---cagggac-tt
             Pacific walrus  ---cagggac-tt
               Weddell seal  ---cagggac-tt
           Black flying-fox  ---t-gggac-tt
                    Megabat  ---t-gggac-tt
              Big brown bat  ---tggggat-tt
       David's myotis (bat)  ---cagggat-tt
                   Microbat  ---cagggat-tt
                   Hedgehog  ---cagggcc-tt
                      Shrew  ---caaggtc-tt
            Star-nosed mole  ---taagggt-tt
                   Elephant  ---cagggac-tt
        Cape elephant shrew  -------------
                    Manatee  ---cagggac-tt
           Cape golden mole  ---caatgac-tt
                     Tenrec  ---caagggc--t
                   Aardvark  ---cagggac-tt
                    Opossum  ---caaacaa---
            Tasmanian devil  ---caaatta---
                    Wallaby  =============
                     Rabbit  =============

Inserts between block 14 and 15 in window
B D                    Rat 11bp
B D               Hedgehog 3bp
B D                  Shrew 151bp

Alignment block 15 of 219 in window, 112830869 - 112831026, 158 bps 
B D                   Human  ttattgta----t--------------------tt-t---------------------------------
B D                   Chimp  ttattgta----t--------------------tt-t---------------------------------
B D                 Gorilla  ttattgta----t--------------------tt-t---------------------------------
B D               Orangutan  ttattgta----t--------------------tt-t---------------------------------
B D                  Gibbon  ttattgta----t--------------------tt-t---------------------------------
B D                  Rhesus  ttactgta----t--------------------tt-t---------------------------------
B D     Crab-eating macaque  ttactgta----t--------------------tt-t---------------------------------
B D                  Baboon  ttactgta----t--------------------tt-t---------------------------------
B D            Green monkey  ttactgta----t--------------------tt-t---------------------------------
B D                Marmoset  ttactgta----g--------------------tt-t---------------------------------
B D         Squirrel monkey  ttactgtc----a--------------------tt-t---------------------------------
B D                Bushbaby  ctgctgta----t--------------------tt-t---------------------------------
         Chinese tree shrew  tgattata----a--------------------tt-t---------------------------------
B D                Squirrel  ttgcagtt--att--------------------ta-t---------------------------------
     Lesser Egyptian jerboa  ttgttatt-------------------------tt-t---------------------------------
               Prairie vole  ttgtcaca--ttt--------------------tt-c---------------------------------
B D         Chinese hamster  ttgtcacc--ttt--------------------tc-c---------------------------------
             Golden hamster  ttgtcaca--ttt--------------------t--t---------------------------------
B D                   Mouse  ttgtcaca----g--------------------tt-c---------------------------------
B D                     Rat  ttgtcaca-------------------------tc-t---------------------------------
B D          Naked mole-rat  ttgctata-------------------------gt-t---------------------------------
B D              Guinea pig  tggatgtg-------------------------gt-t---------------------------------
                 Chinchilla  ttgctgta-------------------------gt-t---------------------------------
           Brush-tailed rat  ----------------------------------------------------------------------
B D                    Pika  tt-ttact--tat--------------------ct-t---------------------------------
B D                     Pig  gtgctgtg----t--------------------at-t---------------------------------
B D                  Alpaca  tttctgaa----t--------------------ttgt---------------------------------
             Bactrian camel  tttctgaa----t--------------------ttgt---------------------------------
B D                 Dolphin  -tgctgta-------------------------tt-t---------------------------------
               Killer whale  -tgctgta-------------------------tt-g---------------------------------
           Tibetan antelope  atcctgtg----t--------------------tt-t---------------------------------
B D                     Cow  atcctgtg----t--------------------tt-t---------------------------------
B D                   Sheep  atcctgtg----t--------------------tt-t---------------------------------
              Domestic goat  atcctgtg----t--------------------tt-t---------------------------------
B D                   Horse  ---------------------------------tt-t---------------------------------
B D        White rhinoceros  ---------------------------------tt-t---------------------------------
B D                     Cat  ttgctgta----t--------------------tt-t---------------------------------
B D                     Dog  ttgctgta----t--------------------tt-t---------------------------------
B D                   Panda  ttgctgga----t--------------------tt-t---------------------------------
             Pacific walrus  ttgctgta----t--------------------tt-t---------------------------------
               Weddell seal  ttgctgta----t--------------------tt-t---------------------------------
           Black flying-fox  tggct----------------------------tt-t-----------ttttttttttt-----------
B D                 Megabat  tggct----------------------------tt-t-----------ttttttttttttt---------
              Big brown bat  ttgttgtg----ttgtgt---------------tg-t-----------tttttttttgtaa-aattaaaa
       David's myotis (bat)  ttgctgtg----ttgt-----------------tg-tgtgtgtgtgtgtgtgtgtgtgtttaaattaaat
B D                Microbat  ttgctgtg----ttgtgtgtgtgtgtgtgtgtgtg-tgtgtgtgtgtgtgtgtgtgtgttt-aattaaat
B D                Hedgehog  tcacattt----t--------------------ta-t---------------------------------
B D                   Shrew  gtattttggcaat--------------------tt-t---------------------------------
            Star-nosed mole  ttgctgtg----t--------------------tt-t---------------------------------
B D                Elephant  ttgccata----t--------------------at-t---------------------------------
        Cape elephant shrew  ----------------------------------------------------------------------
B D                 Manatee  ttgccata----t--------------------at-t---------------------------------
           Cape golden mole  ttgct-tc----t--------------------gt-t---------------------------------
B D                  Tenrec  ttgct-ca----t--------------------at-t---------------------------------
                   Aardvark  ttgcaata----t--------------------at-t---------------------------------
B D                 Opossum  ------------------------------tgatt-t---------------------------------
B D         Tasmanian devil  ------------------------------tgact-t---------------------------------
B D                 Wallaby  ======================================================================
B D                  Rabbit  ======================================================================

                      Human  -tccttat------------ggtc---------c-------tagaa-tgacatc-a----acttggaaat
                      Chimp  -tccttat------------ggtc---------c-------tagaa-tgacatc-a----acttggaaat
                    Gorilla  -tccttat------------ggtc---------c-------tagaa-tgacatc-a----acttggaaat
                  Orangutan  -tccttat------------ggtc---------c-------tagaa-tgacatc-a----acttggaaat
                     Gibbon  -tccttat------------ggtt---------c-------tagaa-tgacatc-a----acttggaaat
                     Rhesus  -tccctat------------ggtc---------c-------tagaa-tgacatc-a----acttggaaat
        Crab-eating macaque  -tccctat------------ggtc---------c-------tagaa-tgacatc-a----acttggaaat
                     Baboon  -tccctat------------ggtc---------c-------tagaa-tgacatc-a----acttggaaat
               Green monkey  -tccctat------------ggtc---------c-------tagaa-tgacatc-a----acttggaaat
                   Marmoset  -tccttat------------ggtc---------c-------tagaa-tgacatc-a----acttggaaat
            Squirrel monkey  -tccttat------------tgtc---------c-------tagaa-tgacatc-a----atttggaaat
                   Bushbaby  -cccttat------------gttacggttctggc-------tagaa-taacatc-a----agttggaaat
         Chinese tree shrew  -tcctcct------------ggcc-----ctgtc-------tagag-tgacatc-a----gcttggaaat
                   Squirrel  -ttattag-----------------------------------aaa-tgacatc-a----a-ttggaaat
     Lesser Egyptian jerboa  -gtcttaa------------ggtc---------c--tag-ctagaa-tgacatt-g----acttgggaac
               Prairie vole  -cccctaa------------agta---------t---------gaa-tggcatc-a----g---------
            Chinese hamster  -cccctaa------------aacc---------t---------gaa-tggcatc-a----gcttaggaat
             Golden hamster  -tccctaa------------accc---------t---------gaa-tggcatc-a----gcttgagaat
                      Mouse  -cccctaa------------atcc---------c--tgg-atagag-tggcatc-a----gcttggaaat
                        Rat  -cccctaa------------agcc---------c--tgg-atggaa-tggcatc-a----gctcaggaat
             Naked mole-rat  -tttctat------------ggtc---------c--tgg-ctagaa-tgtcatc-a----gtatgacaat
                 Guinea pig  -tttctat------------ggtc---------c--tgg-gtagaa-tgacatc-c----atagaacagt
                 Chinchilla  -tttctct------------ggtc---------c--tgg-ctagaa-tgacatc-a----atatgccaat
           Brush-tailed rat  ---------------------ttc---------c--tgc-cta-aa-tgacatc-a----ttatgataat
                       Pika  -tcttggt------------ggat---------c--cag-atagaa-cgagatc-a----acttagaaat
                        Pig  -tcctcat------------ggcc---------c--tgg-ctagaa-tgacttc-a----acttggagag
                     Alpaca  -ttcctgt------------ggct---------c--tgg-ctagaa-tgacttc-a----acttggaaat
             Bactrian camel  -ttcccgt------------ggct---------c--tgg-ctagaa-tgacttc-a----acttggaaat
                    Dolphin  -tcctcat------------ggcc---------ctgtgg-ctagaa-tgacttc-a----gcttggaaat
               Killer whale  -tcctcat------------ggcc---------ctgtgg-ctagaa-tgacttc-a----gcttggaaat
           Tibetan antelope  -tcctcat------------ggct---------c--tgg-ctagaa-tgacttc-a----agttggacat
                        Cow  -tcctcat------------ggct---------c--tgg-ctagaa-tgacttc-a----agttggacat
                      Sheep  -tcctcat------------ggct---------c--tgg-ctagaa-tgacttc-a----agttggacat
              Domestic goat  -tcctcat------------ggct---------c--tgg-ctagaa-tgacttc-a----agttggacat
                      Horse  -tccttat------------ggca---------c--tgg-ccagag-tgactttga----acttggaatt
           White rhinoceros  -tcctt-t------------ggcc---------t--tgg-ctagaa-tgggtttga----acttggaaat
                        Cat  -tctctat------------ggcc---------c--tgg-ttagaa-tgacttc-a----acttagaatt
                        Dog  -tccatat------------ggcc---------c--tgg-ctagaa-tgacttc-acaatgactagacat
                      Panda  -tccttat------------ggcc---------t--tgg-ctagaa-tgacttc-a----acttagaaat
             Pacific walrus  -tccttat------------agcc---------c--tgg-ctagaa-tgacttc-a----acttagaaat
               Weddell seal  -t-cttat------------ggcc---------c--tgg-ctagaa-tgacttc-a----acttagaaat
           Black flying-fox  -tcctcat------------ggcc---------t--cgg-ctgcag-tgacctc-a----acttggaaat
                    Megabat  ctcctctt------------ggcc---------t--tgg-ctgcag-tgacctc-a----acttggaaat
              Big brown bat  attttaat------------ggcc---------t--tgg-ctaaaa-tgatttc-a----acttggaaat
       David's myotis (bat)  ttttgcat------------ggcc---------t--tgg-ctaaag-cgacttc-a----acttggaaat
                   Microbat  ttttgaat------------ggcc---------t--cgg-ctaaaa-cgacttc-a----acttggaaat
                   Hedgehog  -ttcttat------------agtt---------t--ggt-ctagaa-tgaca-c-t----gtttgacatt
                      Shrew  -ttcctgt------------gacc---------c--tgt-ctaaaa-agatata-c----acgtggaaaa
            Star-nosed mole  -tccttat------------gacc---------c--tgg-agagaattgacatc-a----gcttgggaac
                   Elephant  -tctttat------------agcc---------c--tgg-ctaaaa-tgacatc-a----acttggaaac
        Cape elephant shrew  -tcttatt------------ag--------------------------gacatc-a----aattggaaac
                    Manatee  -tctttat------------agcc---------c--tgg-ctagaa-tgacatc-a----acttggaaac
           Cape golden mole  -tctttat------------a-cc---------c--tgg-agagaa-tgatact-a----acatggaaat
                     Tenrec  ctttttat------------a-ca---------c--tcg-ctggca-tgaaatc-c----acttggaaac
                   Aardvark  -tctttat------------agcc---------c--t-----agaa-tgatatc-a----acttggaaac
                    Opossum  -catttct------------ggtg---------c--ttgaatagga-gatgatt----------------
            Tasmanian devil  -catctttggtacttaagtaggag---------c--tggttaagaa-ggtcctt-a----ggttggccaa
                    Wallaby  ======================================================================
                     Rabbit  ======================================================================

                      Human  -gaagc-ttttgctgagaa-------agctgg--------aggt--gatagt-------ggtggtaattt
                      Chimp  -gaagc-ttttgctgagaa-------agctgg--------aggt--gatagt-------ggtggtgattt
                    Gorilla  -gaagc-ttttgctgagaa-------agctgg--------aggt--gatagt-------ggtggtgattt
                  Orangutan  -gaagc-ttttgctgagaa-------agctgg--------aggt--gatagt-------ggtggtgattt
                     Gibbon  -gaagc-ttttgctgagaa-------agctgg--------aggt--gatagt-------ggtggtgattt
                     Rhesus  -gtagc-ttttgctgggaa-------agctgg--------aggt--gatagt-------ggtggtgattt
        Crab-eating macaque  -gtagc-ttttgctgggaa-------agctgg--------aggt--gatagt-------ggtggtgattt
                     Baboon  -gtagc-ttttgctgggaa-------agctgg--------aggt--gatagt-------ggtggtgattt
               Green monkey  -gtagc-ttttgctgggaa-------agctgg--------aggt--gatagt-------ggtggtgattt
                   Marmoset  -gaagc-ttttgctgggaa-------agctga--------agtt--gataat-------aggggtgattt
            Squirrel monkey  -gaagc-ttttgctgggaa-------agctga--------agtc--gatagt-------aggggtgattt
                   Bushbaby  -gaagc-ttttgctgggaa-------agctgg--------agtt--tgtggt-------ggtggga----
         Chinese tree shrew  -gaagc-ttt---ttggaa-------agttgg--------aggt--gatgg--------gggagaaatct
                   Squirrel  -gaagc-ttttgctggaaa-------agctgc--------aggt--g-tgggtgt---ggggggtgatct
     Lesser Egyptian jerboa  -aaaac-ttatgctaagaa-------agctac--------aagt--ggtgatggt-----actgtgattt
               Prairie vole  -----c-ttttggtaggaa-------tgctgc--------aaga--ggtagg------------------
            Chinese hamster  -gaagc-ttttggtaggaa-------tgttac--------aagt--ggtgggcct---------------
             Golden hamster  -gaaac-ttttggtagaaa-------tgttac--------aaga--gatgggcat---------------
                      Mouse  -gaagc-ttttgttaggaa-------tgtcac--------aagt--gccagt------------------
                        Rat  -gaagc-ttttgttaggaa-------agcttc--------aggt--gctagg------------------
             Naked mole-rat  -aaagt-ttttgctaggaa-------agctgc--------aggt--ggtggt--------gatgcaattt
                 Guinea pig  -ga-gt-ttttgctaggaa-------agctgc--------aagt--ggtggt--------ggtgggattg
                 Chinchilla  -gacgt-ttctgcaaggaa-------agctgc--------aagt--ggtggt--------ggggggattt
           Brush-tailed rat  -gaagt-ttttattaggaa-------agcttt--------aagg--gatggt--------ggtgggatat
                       Pika  -gaagctttttgctaggaa-------acctgg--------tggt--ggttgtggtggaggagggacattc
                        Pig  -gaagc-ttttgctgggaa-------tgctgg--------tgga-----ggc-------aagtatgatgt
                     Alpaca  -gaagc-ttttgctgggaa-------agctgg--------agag-----ggg-------aggtgtgattt
             Bactrian camel  -gaagc-ttttgctgggaa-------agctgg--------agag-----ggg-------aggtgtgattt
                    Dolphin  -gaagc-ttttgctgggaa-------agcggg--------tgag-----ggg-------aggtgtgattt
               Killer whale  -gaagc-ttttgctgggaa-------agcggg--------tgag-----ggg-------aggtgtgattt
           Tibetan antelope  -gaaat-ttttgctgggaa-------aactgg--------tggg--aggagg-------aggtgtgattt
                        Cow  -gaaat-ttttgctgggaa-------aactgg--------tggg--aaaagg-------aggtgtggttt
                      Sheep  -gaaat-ttttgctgggga-------aactgg--------tggg--aggagg-------aggtgtgattt
              Domestic goat  -gaaat-ttttgctgggaa-------aactgg--------tggg--aggagg-------aggtgtgattt
                      Horse  -gaagg-ttttgctgggaa-------tgctgg----gggctg----agggag-------gtgggtgattt
           White rhinoceros  -gatgg-ttttgctgggaa-------agcagg----ggg------------g-------gagggtgatta
                        Cat  -gaaac-ttttgctggcaa-------agctggttagggg---ggt-ggggtg-------gcaggtgattt
                        Dog  -gaaac-ttttgctgggac-------agctggtt----gtcagg--agaggg-------gaaggtgattt
                      Panda  -gaaac-ttttgctgggaa-------agcttgttgggggtgaggt-agggta-------gagggtgattt
             Pacific walrus  -gaaac-ttttgttgggaa-------agctggttgggggtggggt-agggtg-------gagggtgattt
               Weddell seal  -gaaac-ttttgttgggaa-------agctggttgggggtggggt-agggtg-------gagggtgattt
           Black flying-fox  -gaagc-ttttgctgggaa-------ggctgg--------gaggt-gggagg-------gagggtgattt
                    Megabat  -gaagc-ttttgctgggaa-------ggctgg--------gaggt-gggagg-------gagggtgattt
              Big brown bat  -gaagc-tttagctaagaa-------ggctgg--------aaagt-gggaag-------gattgtgatgt
       David's myotis (bat)  -gaagc-tttagct----a-------atctgg--------aaggt-gggaag-------aattgtgatgt
                   Microbat  -gaagc-tttagctaagaa-------acctgg--------aaggt-gggaat-------aattgtgatgt
                   Hedgehog  -gacac-ttctactaggga-------agctgg--------ggga-------------------attaatc
                      Shrew  -aaaac-ttttgttgagaa-------agtagg--------gttg-------------------ggtattg
            Star-nosed mole  -gagac-ttttgctgggtacactggtagttgg--------ggga-------------------ggatttt
                   Elephant  -aaatc-ttttgctgggaa-------agttgt--------atgg-------g-------gagagtgattt
        Cape elephant shrew  -aaaac-tttggctggcaa-------agttgt--------gtgg-------g-------gagagtga---
                    Manatee  -aaaac-ttttgctggaaa-------agtttt--------gtgg-------g-------gagagtgattt
           Cape golden mole  -aaaac----tattgggaa-------agttgt--------gtag-------g-------gagaat-----
                     Tenrec  -aaagc-ttttgttgggaa-------agttgc--------ccga-------a-------gagagtgcttt
                   Aardvark  -aaagc-ttttgtttggaa-------agttgt--------acga-------a-------gagagtgattg
                    Opossum  -gaaaa-ggtccttaggct-------gactgg--------a-----gaagaa-------attgatggccc
            Tasmanian devil  agaaaa-aatcgatgttac-------aatgag--------ataatggtaaaa-------aggcatgggtt
                    Wallaby  ======================================================================
                     Rabbit  ======================================================================

                      Human  tgg-gagt-ggagtggacat-gataa-tg------------ggacccttta-----agtcatctatt---
                      Chimp  tgg-gagt-ggagtggacgt-gataa-tg------------ggacccttta-----agtcatttatt---
                    Gorilla  tgg-gagt-ggagtggacgt-gataa-tg------------ggacccttta-----agtcatttatt---
                  Orangutan  tgg-gagt-ggagtggacgt-gataa-tg------------ggacccttta-----agtcatttata---
                     Gibbon  tgg-gagt-ggagtgggcgt-gataa-tg------------ggacccttta-----agtcatttatt---
                     Rhesus  tgg-gagt-ggagaggatgt-gacaa-tg------------ggatccttta-----agtcatttatt---
        Crab-eating macaque  tgg-gagt-ggagaggatgt-gacaa-tg------------ggatccttta-----agtcatttatt---
                     Baboon  tgg-gagt-ggagtggacgt-gataa-tg------------ggatccttta-----agtcatttatt---
               Green monkey  tgg-gagt-ggagtggacgt-gataa-tg------------ggatccttta-----agtcatttatt---
                   Marmoset  ggg-gagt-ggagcggatgt-gatta-tg------------cgatccttta-----ggtcatttatt---
            Squirrel monkey  ggg-gagt-ggagtggacgt-gatta-tg------------cgatccttta-----ggtcattcatt---
                   Bushbaby  -gg-ggac-aatgtggggaa-gatgc-ta------------agtccttttg---------attggtt---
         Chinese tree shrew  tgg-gggt-ggtacggtgat-gatgg-ca------------ggttccttta---------gttaatt---
                   Squirrel  tgg-aag------tggagattgatga-ca------------ggtcccttca-----gtggatgagtt---
     Lesser Egyptian jerboa  tgg-aatt-gaagtgaagatgggtag-ca------------ggtcccttta-----attcattagtt---
               Prairie vole  -----aat-ggcccagagatggatgg-tg------------attcccaata-----actgagtagtt---
            Chinese hamster  ----cggc-tacctcgggactgatgg-tg---attcactttaatcacttta-----attg------t---
             Golden hamster  ----taat-tcccttgggactgctgg-cg------------aatcactttg-----attgggtagtt---
                      Mouse  -----aca-ggtctgaggatcgttggttg------------aacc-ctttc-----actg---catt---
                        Rat  -----aga-ggactgaggattgatga-tg------------aacc-ctgtc-----actt---agtt---
             Naked mole-rat  tgg-aagt-ggagtggagattaatga-ca------------ggttccttta-----actgattaatt---
                 Guinea pig  tgg-aagt-gtggtagagattaatga-ca------------gatttcttta-----attgg---------
                 Chinchilla  tgg-aagt-gcagcagagattaatga-ga------------ggttccttta-----attgattggtt---
           Brush-tailed rat  tgg-aagt-gtagcagagattaatga-ca------------ggtcccttta-----atcaa----tg---
                       Pika  tgg-aaat-gacgtggagactggaga-cc------------cattctttca-----gttgtttggct---
                        Pig  tgg-gagt-ggcatggagat-gatga-ca---ggtgaca--ggtgctttga-----attaattaagt---
                     Alpaca  ggg-gagt-ggagtggagat-gatga-ca---ggtgaca--gatcccttga-----atcgattaagt---
             Bactrian camel  ggg-gagt-ggagtggagat-gatga-ca---ggtgaca--gatcccttga-----atcgattaagt---
                    Dolphin  tgg-gaga-gggttggaaat-gatga-ca---ggtgact--ggtcccctga-----gcagattaagt---
               Killer whale  tgg-gaga-gggttggaaat-gatgg-ca---ggtgaca--ggtcccctga-----gcagattaagt---
           Tibetan antelope  tgg-gagt-gcagtgga----gatgg-ca----gtgact--ggtcccttga-----actggttaagt---
                        Cow  tgg-gagt-gcagtgga----gatgg-ca----gtgact--ggtcccttga-----accgattaagt---
                      Sheep  tgg-gagt-gcagtgga----gatgg-ca----gtgact--ggtcccttga-----actgattaagt---
              Domestic goat  tgg-gagt-gcagtgga----gatgg-ca----gtgact--ggtcccttga-----actgattaagt---
                      Horse  tgg-gcgt-ggagtggagat-gatga-ct---gatg--------------------acagcccatcc---
           White rhinoceros  tgg-gagt-agagtggagtt-gatga-ca---ggtg---------ccttga-----attgcttaatt---
                        Cat  tga-------gagtggagga-gatga-ca---ggtgaca--gctcccttga-----attgattaatt---
                        Dog  tgg-------gagtggagga-gatga-ca---agtgata--gctcccttga-----attgattaatt---
                      Panda  tgg-------gagtggagga-gatga-ca---agtggca--gctcccttga-----attgattaatt---
             Pacific walrus  tgg-------gagtggagga-gatga-ca---ggtgaca--gctccc----------ttgattaatt---
               Weddell seal  tgg-------gagtggagga-gatga-ca---ggtgaca---ctcccttga-----attgattaatt---
           Black flying-fox  ggg-gagt-gatgtggagat-gacaa-ca---ggtggca--ggtctcttga-----attgattcatt---
                    Megabat  ggg-gagt-gatgcggagat-gacaa-ca---ggtggca--ggtctcttga-----attgattcatt---
              Big brown bat  tgg-gagt-agagtggagat-gacaa-ca---ggtgaca--gctctcttga-----attgattaatt---
       David's myotis (bat)  tgg-gagt-agagtggagat-gacaa-ca---ggtgaca--actctcttga-----attgattaatt---
                   Microbat  tgg-gagt-agagtggaggt-gacaa-ca---ggtgaca--actctcttga-----attgattaatt---
                   Hedgehog  aat-tcaa-taagtgaatta-ttttt-tt---cattcca--ctcccc---------------aaactacc
                      Shrew  gga-acagaaaagtggagga-gatga-ca---gatgata--ggtcccttga-----attgataaatt---
            Star-nosed mole  tgg-gcag-tgagtggagag-aatga-ca---ggtgaca--ggtctcttga-----atgggtacatt---
                   Elephant  gag-ggat-ggagtggagaa-gatgg-ta---ggtgtcctttctcccttta-----attgattaact---
        Cape elephant shrew  ----------------agaa-tatgg-tg---gatg-actgtcttccctta-----actagttgatt---
                    Manatee  gag-gggt-ggagtggagaa-gatgg-ca---ggtgtcctttctcccttta-----att-tttaatt---
           Cape golden mole  ------gt-ggagtggagga-gatga-ca---gctgtcttttctcccttta-----attgattattt---
                     Tenrec  gag-gggt-ggcgtggagaa-gatga-cc---tttgtcctttctcttttta-----acggattaatt---
                   Aardvark  gag-a-gt-ggaatggagaa-gatga-ca---ggtgtcctcgctcccttta-----attgattaatt---
                    Opossum  catcagat-aaggataaaaa-ggcaa-agctagaattca--taattcctggcgtccatttattggtt---
            Tasmanian devil  tgt-attt-tggggtgatta-gaggg-ag---aatttca--ttcttctttgtagctaagtcttaggt---
                    Wallaby  ======================================================================
                     Rabbit  ======================================================================

                      Human  ----------tccc----------------aaggtg---tc---tatcaaatg------------
                      Chimp  ----------tccc----------------aaggtg---tc---tatcaaatg------------
                    Gorilla  ----------tccc----------------aaggtg---tc---tatgaaatg------------
                  Orangutan  ----------tccc----------------aaggtg---tc---tatcaaatg------------
                     Gibbon  ----------tccc----------------aaggtg---tc---tatcaaatg------------
                     Rhesus  ----------tccc----------------aaagtg---tc---tatcaaatg------------
        Crab-eating macaque  ----------tccc----------------aaagtg---tc---tatcaaatg------------
                     Baboon  ----------tccc----------------aaagtg---tc---tatcaaatg------------
               Green monkey  ----------tccc----------------aaagtg---tc---tgtcaaatg------------
                   Marmoset  ----------ttcc----------------aaagtg---tc---tatcaaatg------------
            Squirrel monkey  ----------ttcc----------------aaagtg---tc---tatcaaatg------------
                   Bushbaby  ----------tccc----------------gaagtgtcatc---tattaaact------------
         Chinese tree shrew  ----------ccct----------------taggtg---tcatttctaatata------------
                   Squirrel  ---------ccccc----------------aaagtgtcatc---ccggaaatg------------
     Lesser Egyptian jerboa  ----------accc----------------aatctgtcatc---tatcaagtg------------
               Prairie vole  ----------ctcc----------------aaactctcctc---taccaaatg------------
            Chinese hamster  ----------ctcc----------------aaactgtcctc---tgacaaatg------------
             Golden hamster  ----------ctcc----------------aaactgtcctc---cgccaaatg------------
                      Mouse  ----------ctcc----------------aaactgttctc---tgtcaaagg------------
                        Rat  ----------cttc----------------aaactgt--cc---tgtcaaatg------------
             Naked mole-rat  ----------tctt----------------aaattgtcatc---agtcaaaca------------
                 Guinea pig  --------------------------------------------------ata------------
                 Chinchilla  ----------tctt----------------aaattgtcatc---actcaaata------------
           Brush-tailed rat  ----------cctt----------------aaattgtcatt---gatcaaaca------------
                       Pika  ----------ccct----------------aaagtgcctcc---taccaaatg------------
                        Pig  ----------tccc----------------atagtgtcatc---catcagatg------------
                     Alpaca  ----------tccc----------------aaagtgtcatc---tgtcaaatg------------
             Bactrian camel  ----------tccc----------------aaagtgtcatc---tgtcaaatg------------
                    Dolphin  ----------tccc----------------aaaacgtcatc---taacaagtg------------
               Killer whale  ----------tccc----------------aaaacgtcatc---taacaagtg------------
           Tibetan antelope  ----------cccc----------------aaagtgtcatc---tatcaaatg------------
                        Cow  ----------cctc----------------aaagtgtcatc---tatcaaatg------------
                      Sheep  ----------cccc----------------aaagtgtcatc---tatcaaatg------------
              Domestic goat  ----------cccc----------------aaagtgtcatc---tatcaaatg------------
                      Horse  ----------tttc----------------a----------------------------------
           White rhinoceros  ----------tccc----------------aaagtgtcatc---tatcaaatg------------
                        Cat  ----------tcct----------------gaggtgtcatt---tatcaaatg------------
                        Dog  ----------tccc----------------aaggtgtcatt---tatcaaatg------------
                      Panda  ----------tccc----------------aaagtgtcatt---tatcaaatg------------
             Pacific walrus  ----------tccc----------------aaagtgtcatt---tatcaaatg------------
               Weddell seal  ----------tccc----------------aaagtgtcatt---tatcaaatg------------
           Black flying-fox  ----------tccc----------------aaagtgtcacc---tgtcaaatg------------
                    Megabat  ----------tccc----------------aaagtgtcacc---tgtcaaatg------------
              Big brown bat  ----------tccc----------------aaagtgtcatg---tatcaaatg------------
       David's myotis (bat)  ----------tccc----------------aaagtgtcatg---tatcaaatg------------
                   Microbat  ----------tccc----------------aaagtgtcatg---tatcaaatg------------
                   Hedgehog  ctccccacaacccc----------------aaagtattacc---tgccaagta------------
                      Shrew  ----------cctt----------------aaaggaccatc---tatcaaatg------------
            Star-nosed mole  ----------cttc----------------aaagtgtgatc---tatc-catg------------
                   Elephant  ----------tccc----------------aaagtatcatc---tatcaaatg------------
        Cape elephant shrew  ----------tatg----------------aaaatattatc---tatcagttg------------
                    Manatee  ----------tccc----------------gaagtatcatc---tatcaaatg------------
           Cape golden mole  ----------tccc----------------caagtatcgtc---tattagatg------------
                     Tenrec  ----------tccc----------------aaagtaccatc---tgtcaaatg------------
                   Aardvark  ----------tccc----------------aaagtatcatt---tagcaaatg------------
                    Opossum  ----------tacatttttaagtgattagagggaggatccc---cttcttctttggggctaagtc
            Tasmanian devil  ----------ctctt---------------gggatatgtta---ctttgaattttgtacaaagt-
                    Wallaby  =================================================================
                     Rabbit  =================================================================

Inserts between block 15 and 16 in window
B D                    Cow 221bp

Alignment block 16 of 219 in window, 112831027 - 112831027, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D                Bushbaby  a
         Chinese tree shrew  a
B D                Squirrel  g
     Lesser Egyptian jerboa  a
               Prairie vole  a
B D         Chinese hamster  a
             Golden hamster  a
B D                   Mouse  a
B D                     Rat  a
B D          Naked mole-rat  a
                 Chinchilla  a
           Brush-tailed rat  g
B D                    Pika  a
           Tibetan antelope  a
B D                     Cow  g
B D                   Sheep  a
              Domestic goat  a
B D                Elephant  a
B D                 Manatee  a
           Cape golden mole  a
B D                  Tenrec  a
                   Aardvark  a
B D                 Opossum  a
           Star-nosed mole  -
B D                Hedgehog  -
B D                   Shrew  -
B D              Guinea pig  -
       Cape elephant shrew  -
B D                   Panda  -
B D                 Wallaby  =
B D         Tasmanian devil  -
B D                Microbat  -
      David's myotis (bat)  -
             Big brown bat  -
          Black flying-fox  -
B D                 Megabat  -
B D                     Pig  -
B D                  Rabbit  =
            Pacific walrus  -
            Bactrian camel  -
B D                  Alpaca  -
B D                     Dog  -
B D                     Cat  -
B D                   Horse  -
              Weddell seal  -
B D        White rhinoceros  -
              Killer whale  -
B D                 Dolphin  -

Inserts between block 16 and 17 in window
          Tibetan antelope 209bp
B D                  Sheep 107bp
             Domestic goat 208bp

Alignment block 17 of 219 in window, 112831028 - 112831032, 5 bps 
B D                   Human  --gag-------------------------------------------------ca
B D                   Chimp  --gag-------------------------------------------------ca
B D                 Gorilla  --gag-------------------------------------------------ca
B D               Orangutan  --gag-------------------------------------------------ca
B D                  Gibbon  --gag-------------------------------------------------ta
B D                  Rhesus  --gag-------------------------------------------------ca
B D     Crab-eating macaque  --gag-------------------------------------------------ca
B D                  Baboon  --gag-------------------------------------------------ca
B D            Green monkey  --gag-------------------------------------------------ca
B D                Marmoset  --gag-------------------------------------------------ca
B D         Squirrel monkey  --gag-------------------------------------------------ca
B D                Bushbaby  --gag-------------------------------------------------ca
         Chinese tree shrew  --gag-------------------------------------------------ta
B D                Squirrel  --ag-------------------------agaccctcccggtgtataatgcaccta
     Lesser Egyptian jerboa  --ag-------------------------gaaacataacaatatagaatacttcca
               Prairie vole  --gaaaaaacaaaaaccaaaaccaaaaccaaactgtagccacaggcgaccttctca
B D         Chinese hamster  --ggaaa----------------------aaactgtagccatatgcaaccctttca
             Golden hamster  --ggaaa----------------------aagctgtagtcatatgcaatcctttca
B D                   Mouse  --ggaa-----------------------aaactgtcaccatatacaactctttca
B D                     Rat  --gcaa-----------------------aaactgtcaccacatacaaccctttca
B D          Naked mole-rat  --ggg------------------------aactccaaaaggttt---attcttgta
B D              Guinea pig  -----------------------------------taaaggttt--aatccttgca
                 Chinchilla  --gag------------------------aaatcctaaaggtct--gatccttgta
           Brush-tailed rat  --gag------------------------cagtcctgaaggcat--aatctttgtg
B D                    Pika  --gag-------------------------------------------------ca
B D                     Pig  --gag-------------------------------------------------ca
B D                  Alpaca  --gag-------------------------------------------------ca
             Bactrian camel  --gag-------------------------------------------------ca
B D                 Dolphin  --gag-------------------------------------------------ca
               Killer whale  --gag-------------------------------------------------ca
           Tibetan antelope  --gag-------------------------------------------------ga
B D                     Cow  --gag-------------------------------------------------ga
B D                   Sheep  ------------------------------------------------------ga
              Domestic goat  --gag-------------------------------------------------ga
B D        White rhinoceros  --gag-------------------------------------------------ca
B D                     Cat  --aag-------------------------------------------------ta
B D                     Dog  --gag-------------------------------------------------ta
B D                   Panda  --gag-------------------------------------------------ca
             Pacific walrus  --gag-------------------------------------------------ta
               Weddell seal  --gag-------------------------------------------------ta
           Black flying-fox  --gag-------------------------------------------------ca
B D                 Megabat  --gag-------------------------------------------------ca
              Big brown bat  --gag-------------------------------------------------ca
       David's myotis (bat)  --gag-------------------------------------------------ca
B D                Microbat  --gag-------------------------------------------------ca
B D                Hedgehog  --gag-------------------------------------------------ca
B D                   Shrew  --gag-------------------------------------------------ca
            Star-nosed mole  --gaa-------------------------------------------------ca
B D                Elephant  --gag-------------------------------------------------ca
        Cape elephant shrew  --gag-------------------------------------------------ca
B D                 Manatee  --gaa-------------------------------------------------ca
           Cape golden mole  --gag-------------------------------------------------ta
B D                  Tenrec  --gag-------------------------------------------------ca
                   Aardvark  --gag-------------------------------------------------ca
B D                 Opossum  cagat---------------------------------------------------
B D         Tasmanian devil  -agat---------------------------------------------------
B D                 Wallaby  ========================================================
B D                  Rabbit  ========================================================
B D                   Horse  --------------------------------------------------------

Inserts between block 17 and 18 in window
B D       White rhinoceros 20984bp
B D                    Cat 26bp
B D                    Dog 26bp
B D                  Panda 26bp
            Pacific walrus 26bp
              Weddell seal 26bp

Alignment block 18 of 219 in window, 112831033 - 112831035, 3 bps 
B D                   Human  --gc--c
B D                   Chimp  --gc--c
B D                 Gorilla  --gc--c
B D               Orangutan  --gc--c
B D                  Gibbon  --gc--c
B D                  Rhesus  --gc--c
B D     Crab-eating macaque  --gc--c
B D                  Baboon  --gc--c
B D            Green monkey  --gc--c
B D                Marmoset  --gc--c
B D         Squirrel monkey  --gc--c
B D                Bushbaby  --ac--c
         Chinese tree shrew  --at--g
B D                Squirrel  --gt--c
     Lesser Egyptian jerboa  --gg--t
               Prairie vole  --gc--c
B D         Chinese hamster  --tc--c
             Golden hamster  --tc--c
B D                   Mouse  --tc--c
B D                     Rat  --tc--c
B D          Naked mole-rat  --gc--c
B D              Guinea pig  --gc--c
                 Chinchilla  --gc--t
           Brush-tailed rat  --ac--c
B D                    Pika  --ac--c
B D                     Pig  --ac--c
B D                  Alpaca  --gc--c
             Bactrian camel  --gc--c
B D                 Dolphin  --ac--c
               Killer whale  --ac--c
           Tibetan antelope  --at--t
B D                     Cow  --ac--t
B D                   Sheep  --gt--t
              Domestic goat  --at--t
B D                   Horse  --ac--t
B D        White rhinoceros  --ac--c
B D                     Cat  --ac--c
B D                     Dog  --ac--c
B D                   Panda  --ac--c
             Pacific walrus  --ac--c
               Weddell seal  --ac--c
           Black flying-fox  --ac--t
B D                 Megabat  --ac--t
              Big brown bat  --gc--c
       David's myotis (bat)  --tc--c
B D                Microbat  --gc--c
B D                Hedgehog  ---a--c
B D                   Shrew  ---a--t
            Star-nosed mole  ---c--c
B D                Elephant  --ac--c
        Cape elephant shrew  --ag--c
B D                 Manatee  --ac--t
           Cape golden mole  --ataat
B D                  Tenrec  --ac--c
                   Aardvark  --ac--c
B D                 Opossum  gt-----
B D         Tasmanian devil  g------
B D                 Wallaby  =======
B D                  Rabbit  =======

Inserts between block 18 and 19 in window
B D                    Rat 1bp
B D                    Pig 25bp
B D                 Alpaca 25bp
            Bactrian camel 25bp
B D                  Sheep 104bp
B D               Hedgehog 26bp
B D                  Shrew 26bp
           Star-nosed mole 25bp

Alignment block 19 of 219 in window, 112831036 - 112831056, 21 bps 
B D                   Human  ctaacaata---tataatc--------------------------------------------tgttg
B D                   Chimp  ctaacaata---tataatc--------------------------------------------tgttg
B D                 Gorilla  ctaacaata---tataatc--------------------------------------------tgttg
B D               Orangutan  ctaacaata---tataatc--------------------------------------------tgttg
B D                  Gibbon  ctaacagta---tataatc--------------------------------------------tgttg
B D                  Rhesus  ctgacaata---tataatc--------------------------------------------tgttg
B D     Crab-eating macaque  ctgacaata---tataatc--------------------------------------------tgttg
B D                  Baboon  ctgacaata---tataatc--------------------------------------------tgttg
B D            Green monkey  ctaacaata---tataatc--------------------------------------------tgttg
B D                Marmoset  ctaacaatg---cataatc--------------------------------------------ta-ca
B D         Squirrel monkey  ctaacaata---tataatc--------------------------------------------tg-ca
B D                Bushbaby  ctaacaa-a---cataatc--------------------------------------------tgctg
         Chinese tree shrew  ctgacaata---tataatccttttaatcctaacactggtttacattatagttgggttatagtttgttg
B D                Squirrel  ttaacaggg---tctgatc--------------------------------------------tgttg
     Lesser Egyptian jerboa  tttacattg---tatgatc--------------------------------------------acttg
               Prairie vole  ttgaccctg---catgatg--------------------------------------------tgttg
B D         Chinese hamster  ttaacactg---tacgata--------------------------------------------tattg
             Golden hamster  ttaacactg---tatgata--------------------------------------------tattg
B D                   Mouse  ttgatgcta---cgacttc--------------------------------------------tgttg
B D                     Rat  ttgacactg---caagttc--------------------------------------------tgttg
B D          Naked mole-rat  ttaacattg---catgatc--------------------------------------------tattg
B D              Guinea pig  ttcacactg---aacaacc--------------------------------------------tgtca
                 Chinchilla  ttaacactg---cacaatt--------------------------------------------tattg
           Brush-tailed rat  ttaacattg---caaaatc--------------------------------------------tattg
B D                    Pika  ccaa----------------------------------------------------------------
B D                     Pig  ctaacattg---tataatc--------------------------------------------agttg
B D                  Alpaca  ctaacactg---cagaatc--------------------------------------------tgccg
             Bactrian camel  ctaacactg---cagaatc--------------------------------------------tgccg
B D                 Dolphin  ctagcactg---tataatc--------------------------------------------tgttg
               Killer whale  ctagcaatg---tataatc--------------------------------------------tattg
           Tibetan antelope  ctaacaatg---tataatc--------------------------------------------ttttg
B D                     Cow  ctaacaatg---tataatc--------------------------------------------tgttt
B D                   Sheep  ctaacaatg---tataatc--------------------------------------------tgttg
              Domestic goat  ctaacaatg---tataatc--------------------------------------------tgttg
B D                   Horse  gtagcattg---tgtaatc--------------------------------------------agtgg
B D        White rhinoceros  ctaacattg---tataatc--------------------------------------------agttg
B D                     Cat  ctaacactg---tataatc--------------------------------------------tgttg
B D                     Dog  ctaacattg---tataatc--------------------------------------------tgtta
B D                   Panda  ctaacattg---tgtcatc--------------------------------------------tgttt
             Pacific walrus  ctaacattg---tatcatc--------------------------------------------tgttg
               Weddell seal  ctaacattg---tatcatc--------------------------------------------tgttg
           Black flying-fox  ctaagactt---tgttatc--------------------------------------------agctg
B D                 Megabat  ctaacactt---tgttatc--------------------------------------------agctg
              Big brown bat  ctaacactg---catcatc--------------------------------------------tgttg
       David's myotis (bat)  ctagcactg---catcctc--------------------------------------------tgttg
B D                Microbat  ctagcactg---catcctc--------------------------------------------tgttg
B D                Hedgehog  ttaatatta---tataatt--------------------------------------------ttttg
B D                   Shrew  ccaacactg---tatattt--------------------------------------------ctttg
            Star-nosed mole  cacatgttg---cataatg--------------------------------------------tgttg
B D                Elephant  tgaacaatg---tacacac--------------------------------------------cttcc
        Cape elephant shrew  ccgataatgattgataatc--------------------------------------------ttccc
B D                 Manatee  ctgacaata---tatactc--------------------------------------------cttcc
           Cape golden mole  gtattaatg---tgtaatc--------------------------------------------ctccc
B D                  Tenrec  ccaacaatg---tctaagc--------------------------------------------c-acc
                   Aardvark  ctaacaatg---tataacc--------------------------------------------cattt
B D                 Opossum  ctag--gga---catgatg--------------------------------------------cttta
B D         Tasmanian devil  ctaa--ata---aatattt--------------------------------------------attca
B D                 Wallaby  ====================================================================
B D                  Rabbit  ====================================================================

Inserts between block 19 and 20 in window
B D               Elephant 25bp
       Cape elephant shrew 9bp
B D                Manatee 25bp
          Cape golden mole 25bp
B D                 Tenrec 25bp
                  Aardvark 221bp

Alignment block 20 of 219 in window, 112831057 - 112831063, 7 bps 
B D                   Human  g-ggttg----t
B D                   Chimp  g-ggttg----t
B D                 Gorilla  g-ggttg----t
B D               Orangutan  g-ggttg----t
B D                  Gibbon  g-ggttg----t
B D                  Rhesus  g-ggtca----t
B D     Crab-eating macaque  g-ggtca----t
B D                  Baboon  g-ggtca----t
B D            Green monkey  g-ggtca----t
B D                Marmoset  g-agtcg----t
B D         Squirrel monkey  g-ggttg----t
B D                Bushbaby  g-ggtgg----t
         Chinese tree shrew  g-gatgg----t
B D                Squirrel  g-cacgg----t
     Lesser Egyptian jerboa  g-gatga----t
               Prairie vole  ggggtta----t
B D         Chinese hamster  tcggcca----t
             Golden hamster  ttgccta----t
B D                   Mouse  ggggtga----t
B D                     Rat  gcggtgagaatg
B D          Naked mole-rat  g-agtgg----g
B D              Guinea pig  g-agtgg----g
                 Chinchilla  g-ggtga----g
           Brush-tailed rat  t-ggtgg----g
B D                    Pika  --gcttg-----
B D                     Pig  --ggggc----t
B D                  Alpaca  --ggtgg----t
             Bactrian camel  --ggtgg----t
B D                 Dolphin  --ggtgg----t
               Killer whale  --ggtgg----t
           Tibetan antelope  --ggt-------
B D                     Cow  --ggt-------
B D                   Sheep  --ggt-------
              Domestic goat  --ggt-------
B D                   Horse  --ggtgg----t
B D        White rhinoceros  --ggtgt----t
B D                     Cat  --ggtgg----t
B D                     Dog  --ggtgg----t
B D                   Panda  --ggtgg----t
             Pacific walrus  --ggtgg----t
               Weddell seal  --ggtga----t
           Black flying-fox  --ggctg----t
B D                 Megabat  --ggctg----t
              Big brown bat  --ggcgt----t
       David's myotis (bat)  --gatgt----t
B D                Microbat  --ggtgt----t
B D                Hedgehog  ggggtgg----t
B D                   Shrew  g-ggtgg----c
            Star-nosed mole  gaggtgg----t
B D                Elephant  g-ggagg----t
        Cape elephant shrew  -----gg----c
B D                 Manatee  g-gatgg----t
           Cape golden mole  --ggtca----t
B D                  Tenrec  ---gtgg----t
                   Aardvark  g-ggtag----t
B D                 Opossum  -catttt----t
B D         Tasmanian devil  --agttc----c
B D                 Wallaby  ============
B D                  Rabbit  ============

Inserts between block 20 and 21 in window
              Weddell seal 197bp

Alignment block 21 of 219 in window, 112831064 - 112831211, 148 bps 
B D                   Human  aactatggtaggacat-----aataa---catcggcaaa----atgatttaattt--tc-tgcagcag--
B D                   Chimp  aactatggtaggacat-----aataa---catcagcaaa----atgatttaattt--tt-tgcagcag--
B D                 Gorilla  aactatggtaggacat-----aataa---catcagcaaa----atgatttaattt--tc-tgcagcag--
B D               Orangutan  aactatggtaggacat-----aataa---catcagcaaa----atgatttaattt--tc-tgcagcag--
B D                  Gibbon  aactatggtaggacat-----aataa---catcagcaaa----atgatttaattt--tc-tgcagcag--
B D                  Rhesus  aactatggtaggatac-----gataa---catcagaaaa----atgatttaattt--tc-tgcagcag--
B D     Crab-eating macaque  aactatggtaggatac-----gataa---catcagaaaa----atgatttaattt--tc-tgcagcag--
B D                  Baboon  aactatgctaggatac-----aataa---catcagaaaa----atgatttaattt--tc-tgcagcag--
B D            Green monkey  aactatggtaggatac-----aataa---catcagaaaa----atgatttaattt--tc-tgcagcag--
B D                Marmoset  aactacggtaggacat-----aatga---caccagcaaa-------gtgtcattt--tc-tgcagcag--
B D         Squirrel monkey  aactacggtaggatat-----aataa---caccagcaaa----aagatttaattt--tc-tgcagcag--
B D                Bushbaby  aacaatggcaggacat-----aataa---catcaacaaa----atgatttgattg--tc-tacagtgg--
         Chinese tree shrew  aaaaatggtaagccat-----aa-aa---catcagcaaa----ataatttaattt--tc-tgtggtgg--
B D                Squirrel  aacaatggctgggcat-----gaggc---cggcagcgagcgaccaggtttaattt--tc-tgccgggg--
     Lesser Egyptian jerboa  aa-----------cat-----aataa---atgcaaaaaa----gaaatttaattt--tc-cttggttg--
               Prairie vole  aacagtggcagtacatgatgagatga---gaacagcaaa----atggcttcgtttctcc-cacggagg--
B D         Chinese hamster  agccatggcaggacat-----gataa---gaacagcaaa----atggcttaatttcccc-catcgagg--
             Golden hamster  aactatggcagggcat-----gataa---gaacagcaaa----atggcttaatttctcc-catggagg--
B D                   Mouse  aacggtggcctgacat-----gacaa---cagcatcaaa----aaggattgattt--cc-catggtgg--
B D                     Rat  aatggtggctgggcat-----gacaa----ggcatcaga----aaggattacttt--cc-catggtgg--
B D          Naked mole-rat  aacaatggcaaaacat-----gataa---cagtggcaaa----atggtttagttt--tc-tgcagtag--
B D              Guinea pig  aacaatggcagaacac-----actaa---cagggacaca----agggtttaattt--tc-tgcagtag--
                 Chinchilla  aacaatggtagaacat-----gatag---cagtggcaaa----atgatttaattt--cc-ctgagtag--
           Brush-tailed rat  aacaatggcagaacat-----gataa---cactgacaaa----atgatttaattt--tc-tggagtag--
B D                    Pika  -------------tac-----aagga---tgtttccaaa-----------acttt---------gtgg--
B D                     Pig  aacaatgtcatgatgt-----aagca---catcagcaga----atgatttaactt--gc-cacaatgg--
B D                  Alpaca  aaccacggcaggacgt-----gagga---cacccgcacg----atggtttcatcc--tc-tgtggtgg--
             Bactrian camel  aaccacggcaggatgt-----gagga---cacccgcaca----atggtttcatcc--tc-tgtggtgg--
B D                 Dolphin  cacaatggcaagacac-----aagaa---catctacata----atgatttaattt--tc-tgtggtgg--
               Killer whale  cacgacggcaagacac-----aagaa---catctacata----atgatttaattt--tc-tgtggtgg--
           Tibetan antelope  ------ggcaagatgg-----aagaa---aatctgcaga----ataatttatttt--ttgtgtgatgg--
B D                     Cow  ------ggcaagacgg-----aaaaa---aatctgcaga----ataatttacttt--ttgtgttatgg--
B D                   Sheep  ------gccaagacgg-----aagaa---attctgcaga----ataatttatttt--ttgtgtgatgg--
              Domestic goat  ------ggcaagacgg-----aagaa---aatctgcaga----ataatttatttt--ttgtgtgatgg--
B D                   Horse  aacaatagtaggacat-----actaa---catcagtagg----atgatttcattt--tc-cttagttg--
B D        White rhinoceros  aacaatggcaggaaat-----aataa---catcagcaaa----atgatttaattt--tc-tgtagcgg--
B D                     Cat  cacaatggcaggacat-----aataa---catcagcaaa----atgacttaattt--tc-cgtggtgg--
B D                     Dog  aacaatgccaggacat-----a---a---tatcagaaaa----atgacttaattt--tc-tgtggtgg--
B D                   Panda  aacaatggcaggatat-----aat-a---tttcagcaaa----atgac----ttt--tc-tgtggtgg--
             Pacific walrus  aacaatggcaggacat-----aataa---tatcagcaaa----atgacttaattt--tc-tgtggtgg--
               Weddell seal  aacaatggcaggacat-----aataa---tatcagcaaa----atgacttaattt--tc-tgtggtgg--
           Black flying-fox  gacaatgcaagaacat-----aataa---catcagcaaa----atgatttaattg--tc-tatggtgg--
B D                 Megabat  gacaatgcaagaacat-----aataa---tatcagcaaa----atgatttaattg--tc-tatggtgg--
              Big brown bat  gac------tgggcat-----aatag---catcagtgaa----atgatttaattt--tc-tgc-------
       David's myotis (bat)  gac------tgggcat-----aatat---cattagtgaa----atgatttaattt--tc-tgcggtgg--
B D                Microbat  gac------tgggcat-----aatat---catcagtgaa----gtgatttaattt--tc-tgcggtgg--
B D                Hedgehog  aaaaccg-caggacat-----aataa---tatcagcaaa----gtgattgaattt--tc-tgtggcag--
B D                   Shrew  aacactgccagggatt-----tctaa---cactagtgaa----aggatttacttt--tc-agtggtgg--
            Star-nosed mole  aacaatggcaggatgt-----aggag---cttcagcaaa----gtaatttaattt--tc-tgtggtgg--
B D                Elephant  -acgataacaggacat-----aataa---catcagcaaa----atgatgtaatta--tc-tgtagtgg--
        Cape elephant shrew  -acaagaac---attt-----catat---catcagcaaa----atgatgtcattg-----------at--
B D                 Manatee  -aagatggca--ggct-----aataa---catcagcaaa----atgatgtaatta--tc-tgtagtgg--
           Cape golden mole  -acagtggtaggataa-----aataa---catcag-aaa----atgatgtaatta--tc-acaagtgg--
B D                  Tenrec  -acattggcaggacat-----aagaa---catcagcaag----atgatgtaa-tg--tc-tgtagcgg--
                   Aardvark  -aaaatggcagggcat-----aacaa---cataagcaaa----atgatgtaatta--tc-tgtagtgg--
B D                 Opossum  gacaaaggaggtactt-----aataaatgtttatttaaa----taaaggtcaaat--ca-gtggttggaa
B D         Tasmanian devil  gattaagtgagagatt-----ggaaaatacatgaatgaa----ccaatattattt--tc-tcatttgg--
B D                 Wallaby  ======================================================================
B D                  Rabbit  ======================================================================

                      Human  -------gattgaa--------------------------ggtt--gcacgcagtt--------------
                      Chimp  -------gattgaa--------------------------ggtt--gcacgcagtt--------------
                    Gorilla  -------gattgaa--------------------------ggtt--gcactcagtt--------------
                  Orangutan  -------gattgaa--------------------------ggtt--gcacgcattt--------------
                     Gibbon  -------gattgaa--------------------------ggtt--gcacgcattt--------------
                     Rhesus  -------gattgaa--------------------------agtt--gcatgcactt--------------
        Crab-eating macaque  -------gattgaa--------------------------agtt--gcatgcactt--------------
                     Baboon  -------gattgaa--------------------------agct--gcatgcactt--------------
               Green monkey  -------gattgaa--------------------------agtt--gcatgcactt--------------
                   Marmoset  -------gattgaa--------------------------ggtt--gcatgcattt--------------
            Squirrel monkey  -------gattgaa--------------------------ggtt--gcatgcattt--------------
                   Bushbaby  -------gagtgaa--------------------------gctt--gcatgcattt--------------
         Chinese tree shrew  -------gagtgaa--------------------------ggtt--gcatatattt--------------
                   Squirrel  -------tagtgat--------------------------gttt--gcatgcgtt---------------
     Lesser Egyptian jerboa  -------gagtgag--------------------------gatg--gcatgcattc--------------
               Prairie vole  -------gagtgag--------------------------cttt--gcatgcattt--------------
            Chinese hamster  -------gagtgag--------------------------gttt--acatgcattt--------------
             Golden hamster  -------gagtgag--------------------------g-tt--acatgcatttaaaagttatgctag
                      Mouse  -------cagtgag--------------------------gttt--atgtgcactt--------------
                        Rat  -------cagtgag--------------------------gttt--atctgcactt--------------
             Naked mole-rat  -------gagtgaa--------------------------attt--gtgtgcactt--------------
                 Guinea pig  -------gagtgac--------------------------cttt--gcatgcactt--------------
                 Chinchilla  -------gagtgaa--------------------------attt--gcatgtgctt--------------
           Brush-tailed rat  -------gagtgaa--------------------------gttt--gcatacactt--------------
                       Pika  -------aaaagaa--------------------------ct----------------------------
                        Pig  -------gagtgaa--------------------------agtt--acctgca-tt--------------
                     Alpaca  -------gagtgaa--------------------------cgtt--gcgtgcactt--------------
             Bactrian camel  -------gagtgaa--------------------------cgtt--gcgtgcactt--------------
                    Dolphin  -------gagtgaa--------------------------agtt--gcatgcattg--------------
               Killer whale  -------gagtgaa--------------------------agtt--gcatgcattt--------------
           Tibetan antelope  -------gagtaaa--------------------------agct--acatgcattt--------------
                        Cow  -------gagtgaa--------------------------agct--acatgcattt--------------
                      Sheep  -------gagtaaa--------------------------agct--acatgcattt--------------
              Domestic goat  -------gagtaaa--------------------------agct--acatgcattt--------------
                      Horse  -------gagtgaa--------------------------attt--gcatgcattt--------------
           White rhinoceros  -------gagtgaa--------------------------agtt--gcatgtgtgt--------------
                        Cat  -------gagtgaa--------------------------agtt--tcatgcattt--------------
                        Dog  -------aggtgga--------------------------agtt--gcatacattt--------------
                      Panda  -------gagtgaa--------------------------agtt--gcatgcatct--------------
             Pacific walrus  -------gagtgaa--------------------------agtt--gcatacatct--------------
               Weddell seal  -------gagtgaa--------------------------agtt--gcatacatct--------------
           Black flying-fox  -------gagtgaa--------------------------agtt--gtgtgtgttt--------------
                    Megabat  -------gagtgaa--------------------------agtt--gtgtgtgttt--------------
              Big brown bat  --------agtgaa--------------------------agtt--gcatgcattt--------------
       David's myotis (bat)  -------aagtgaa--------------------------ggtt--gcatgcattt--------------
                   Microbat  -------aagtgaa--------------------------agtt--gcatgcattt--------------
                   Hedgehog  -------cagtgaa--------------------------agtt--acatgcattt--------------
                      Shrew  -------cagtgaa--------------------------agtt--gcttgcattt--------------
            Star-nosed mole  -------cagtgaa--------------------------agtt--gcatgcattt--------------
                   Elephant  -------gagtgaa-------aaaaacaaaaaggagccctggtggctcatgcattt--------------
        Cape elephant shrew  -------gagtaaa--------------------------------tgctgcatt---------------
                    Manatee  -------gagtgaagaaaacaaaaaacgaaaaggagccctggtcgcgcatgcattt--------------
           Cape golden mole  -------gagtgaa--------------------------ggtt--gcatgtactt--------------
                     Tenrec  -------gagagaa--------------------------ggtt--gcacgtactt--------------
                   Aardvark  -------gagtgaa--------------------------ggtt--gtgtgcactt--------------
                    Opossum  aatgcacgaatgaa-------------------------tcagt--gttttcattt--------------
            Tasmanian devil  ---------------------------------------------------cat----------------
                    Wallaby  ======================================================================
                     Rabbit  ======================================================================

                      Human  ----------------------------------------------------aaaaa-ttat--------
                      Chimp  ----------------------------------------------------aaaaa-ttat--------
                    Gorilla  ----------------------------------------------------aaaaa-ttat--------
                  Orangutan  ----------------------------------------------------aaaaa-ttat--------
                     Gibbon  ----------------------------------------------------aaaaa-ttat--------
                     Rhesus  ----------------------------------------------------aaaaa-ttat--------
        Crab-eating macaque  ----------------------------------------------------aaaaa-ttat--------
                     Baboon  ----------------------------------------------------aaaaa-ttct--------
               Green monkey  ----------------------------------------------------aaaaa-ttat--------
                   Marmoset  ----------------------------------------------------ataaa-ttac--------
            Squirrel monkey  ----------------------------------------------------ataaa-ttat--------
                   Bushbaby  ----------------------------------------------------aaaaacttac--------
         Chinese tree shrew  ----------------------------------------------------a-aaa-ttac--------
                   Squirrel  ----------------------------------------------------aaaaa-tcac--------
     Lesser Egyptian jerboa  ----------------------------------------------------aaaaa--tac--------
               Prairie vole  ----------------------------------------------------aaaag-ttat--------
            Chinese hamster  ----------------------------------------------------aaaag-ttat--------
             Golden hamster  ttttattctatattaatttctcccatggagggagtgaggcttacatgcatttaaaag-ttat--------
                      Mouse  ----------------------------------------------------aaaag-ttat--------
                        Rat  ----------------------------------------------------aaaag-ttac--------
             Naked mole-rat  ----------------------------------------------------aaaat-ttat--------
                 Guinea pig  ----------------------------------------------------aaaaa-ttat--------
                 Chinchilla  ----------------------------------------------------aaaaa-ttat--------
           Brush-tailed rat  ----------------------------------------------------aaaaa-ttat--------
                       Pika  ----------------------------------------------------ggaag-atct--------
                        Pig  ----------------------------------------------------aaccc-ttacctgaactt
                     Alpaca  ----------------------------------------------------aacac-ttag--------
             Bactrian camel  ----------------------------------------------------aacac-tgac--------
                    Dolphin  ----------------------------------------------------aacac-ttac--------
               Killer whale  ----------------------------------------------------aacac-ttac--------
           Tibetan antelope  ----------------------------------------------------gacac-ttac--------
                        Cow  ----------------------------------------------------gacac-ttac--------
                      Sheep  ----------------------------------------------------gacac-ttac--------
              Domestic goat  ----------------------------------------------------gacac-ttac--------
                      Horse  ----------------------------------------------------agcac-ttac--------
           White rhinoceros  ----------------------------------------------------aacaa-ttgc--------
                        Cat  ----------------------------------------------------ggtag-ttac--------
                        Dog  ----------------------------------------------------aacaa-ttat--------
                      Panda  ----------------------------------------------------aacaa-ttac--------
             Pacific walrus  ----------------------------------------------------aacaa-ttac--------
               Weddell seal  ----------------------------------------------------aataa-ttac--------
           Black flying-fox  ----------------------------------------------------aacaa-ttac--------
                    Megabat  ----------------------------------------------------aacaa-ttac--------
              Big brown bat  ----------------------------------------------------agcaa-ttgc--------
       David's myotis (bat)  ----------------------------------------------------agcaa-ttgc--------
                   Microbat  ----------------------------------------------------agcaa-ttgc--------
                   Hedgehog  ----------------------------------------------------agca--------------
                      Shrew  ----------------------------------------------------aacac-cat---------
            Star-nosed mole  ----------------------------------------------------aacaa-tttc--------
                   Elephant  ----------------------------------------------------aacaa-ttat--------
        Cape elephant shrew  --------------------------------------------------------a-ttat--------
                    Manatee  ----------------------------------------------------aacaa-ttat--------
           Cape golden mole  ----------------------------------------------------aacaa-tcat--------
                     Tenrec  ----------------------------------------------------agcaa-ttac--------
                   Aardvark  ----------------------------------------------------aacaa-ttat--------
                    Opossum  ----------------------------------------------------ggaac-tgga--------
            Tasmanian devil  --------------------------------------------------------c-agga--------
                    Wallaby  ======================================================================
                     Rabbit  ======================================================================

                      Human  -----gtta-------aatttatt-tacatt-----aatgcaaaattgtcaaatagacctgttcccagct
                      Chimp  -----gtta-------aatttatt-tacatt-----aatgcaaaattgtcaaatagacctgttcccagct
                    Gorilla  -----gtta-------aatttatt-tacatt-----aatgcaaaattgtcaaatagacctgttcccagct
                  Orangutan  -----gtta-------aatttatt-tacatt-----aatgcaaaattgtcaaatagacctgttcccagct
                     Gibbon  -----gtta-------aatttatt-tacatt-----aatgcaaaattgtcaaatagacctgttcccagct
                     Rhesus  -----gtta-------aatttatt-tacatt-----aatgcaacattgtcaaatagacctgttcccagct
        Crab-eating macaque  -----gtta-------aatttatt-tacatt-----aatgcaacattgtcaaatagacctgttcccagct
                     Baboon  -----gtta-------aatttatt-tacgtt-----aatgcaacattgtcaaatagacctgttcccagct
               Green monkey  -----gtta-------aatttatt-tacatt-----aatgcaacattgtcaaatagacctgttcccagct
                   Marmoset  -----gtta-------aattcatt-tatgtt-----aattaaacattgtcaaataggcctgttctcagct
            Squirrel monkey  -----gtta-------aattcatt-tatgtt-----aattcaacattgtcaaataggcctgttctcagct
                   Bushbaby  -----atta-------aatttact-tatgtt-----gatgcaacattgttaaatagacctgttccccgat
         Chinese tree shrew  -----atta-------aatttatt-tacact-----tatggaaagttgtcaaatagacttgctctcagat
                   Squirrel  -----gttg-------aatttatttgacatt-----tatgtaaagttgtcaagcagcccagctcccagat
     Lesser Egyptian jerboa  -----atca-------aatttattttacatt-----tatgcaacactttcaaggagacatgctccgaaat
               Prairie vole  -----gctc-------cttttattctatatt-----catgtaa-cttgtcgagaagac---ctcctacgt
            Chinese hamster  -----gcta-------attttattctatttt----------------------aagac---ctctggcat
             Golden hamster  -----gcta-------gttttattctatatt----------------------aagac---ctctgacat
                      Mouse  -----gcta-------attttattctatatt-----tatgtaa-atcgtcaagaagac---ctctaatgt
                        Rat  -----gcta-------attttattctagatt-----tatgtag-atcgtc-agaagac---ctc-gacgg
             Naked mole-rat  -----gtta-------aatccattttacatt-----tatgcaaaattgcaaagcagacgtgctctcagat
                 Guinea pig  -----gtta-------agtccattttaaatt-----tatgcagaattgtcaggcagacctgctctcagat
                 Chinchilla  -----gtta-------aatccattttacatt-----tatgcaaaattgttaagcagacttgctctcagac
           Brush-tailed rat  -----gtta-------aatctactttatgtt-----tatgtacaactgtcaagcagaccttctctcagat
                       Pika  -----gttt-------atcttgttgcaaat------------------------aggc------------
                        Pig  attatattc-------aacttatt-tacaca-----tctggaaaactatcaagtaggtcttctcccagac
                     Alpaca  -----atta-------aatgtatt-tacata-----tatgcaaaattgtcaaggagatctgctcccagag
             Bactrian camel  -----atta-------aatgtatt-tacata-----tatgcaaaattgtcaaggagatctgctcccagag
                    Dolphin  -----atta-------aacttatt-tacatc-----tatgcaaaattatcaagtagctctgctcccagag
               Killer whale  -----atta-------aacttatt-tacatc-----tatgcaaagttatcaagtagctctgctcccagag
           Tibetan antelope  -----atta-------aattaatt-tccatt-----tatgcaaaattatcatttagatctactcccagag
                        Cow  -----atta-------aattgatt-tccatt-----tatgcaaaattatcatgtagatctactcccagag
                      Sheep  -----atta-------aattaatt-tccatt-----tatgcaaaattatcatttagatctactcccagag
              Domestic goat  -----atta-------aattaatt-tccatt-----tatgcaaaattatcatttagatctactcccagag
                      Horse  -----atta-------aatttatt-tacatt-----tatgcaaaattgtcaaatacatctgctcccagat
           White rhinoceros  -----atta-------aatttatt-cacatt-----tatgcaaatttgtcaaatacatgtgcttccagat
                        Cat  -----atta-------aatgtatt-tacatt-----tatgcaaaattaccaagtaggtatgctcccatat
                        Dog  -----atta-------aatttgtt-gacatt-----tatgcagaattatcaagtagat---ctcccagat
                      Panda  -----atta-------aacttatt-tacatt-----tatgcaaaattatcaagtagctctgctcccagat
             Pacific walrus  -----atta-------aatttatt-tacatt-----tatgcaaaattatcaagtagctctgctcccagat
               Weddell seal  -----atta-------aatttatt-tacatt-----tatgcaaaattaacaagtagctctgctcccagat
           Black flying-fox  -----aaga-------catttatt-tatatg-----tgcgaagggttgtca-------------------
                    Megabat  -----aaga-------catttatt-tatatg-----tgtgaagggttgtca-------------------
              Big brown bat  -----a--------------tatt-tacagt-----tccgcaaaattgtcaagtaggtctgccacca-gt
       David's myotis (bat)  -----a--------------tatt-tacaat-----tctgc-aaattgtcaagtagatctgcccccaggt
                   Microbat  -----a--------------tatt-tacagt-----tctgc-aaattgtcaagtagatctgcctccaggt
                   Hedgehog  -----atta-------cattactt-t----------tatgcaaaattgtcaagtagatctgtttccagat
                      Shrew  -----atta-------aatttatt-tgcattaaatgcatgcaaaactgctcagtagctctgctttcagat
            Star-nosed mole  -----attc-------aatttatt-tacaat-----tgtacacaattgtcaagtaggtctgctccctg--
                   Elephant  -----gtta-------aatttatg-tacatt-----tatat-aaattatcacctagactggctcccagat
        Cape elephant shrew  -----gaaatgaaactgatttttt-tatagg-----tacac-aaattgtcgggtagattggtccctagat
                    Manatee  -----gtta-------aatttatg-tacatt-----tatat--aattgtcaagtagaacagctcctagat
           Cape golden mole  -----gtaa-------aatttatg-tacatt-----tatat-aaacaatcaagtagaccagctcccagat
                     Tenrec  -----gtta-------agtttgtg-cgcatg-----tgcat-aaattataggggacactggctcctgg--
                   Aardvark  -----gtca-------aatttatg-tacaat-----tgcat-aaattatcaaatggagcagttcccagat
                    Opossum  -----gcta-------ga-------aaagtt-----tatgctaatgactaaaattcaggtactccattaa
            Tasmanian devil  -----gctt-------gg-------gaaatt-----tatgcaaatgaatcaaatccaggtcctctatcat
                    Wallaby  ======================================================================
                     Rabbit  ======================================================================

                      Human  ttt------cctagg-------------------------------------------------------
                      Chimp  ttt------cctagg-------------------------------------------------------
                    Gorilla  ttt------cctagg-------------------------------------------------------
                  Orangutan  ttt------cctggg-------------------------------------------------------
                     Gibbon  ttt------cctagg-------------------------------------------------------
                     Rhesus  ttt------cctagg-------------------------------------------------------
        Crab-eating macaque  ttt------cctagg-------------------------------------------------------
                     Baboon  ttt------cctagg-------------------------------------------------------
               Green monkey  ttt------cctagg-------------------------------------------------------
                   Marmoset  ttt------cctagg-------------------------------------------------------
            Squirrel monkey  ttt------cctagg-------------------------------------------------------
                   Bushbaby  tt---------cagg-------------------------------------------------------
         Chinese tree shrew  tt-------cctggg-------------------------------------------------------
                   Squirrel  ttttaggggctgg-g-------------------------------------------------------
     Lesser Egyptian jerboa  ttt------ctgg-g-------------------------------------------------------
               Prairie vole  ttt------ctggaa-------------------------------------------------------
            Chinese hamster  ttt------ctggag-------------------------------------------------------
             Golden hamster  ttt------ctggag-------------------------------------------------------
                      Mouse  ttt------ctggcg-------------------------------------------------------
                        Rat  ttt------ctggca-------------------------------------------------------
             Naked mole-rat  tgt------ccaggg-------------------------------------------------------
                 Guinea pig  ttt------ccatgg-------------------------------------------------------
                 Chinchilla  ttt------ccgggg-------------------------------------------------------
           Brush-tailed rat  ttt------aaaggg-------------------------------------------------------
                       Pika  ----------------------------------------------------------------------
                        Pig  ctt------ctgggg-------------------------------------------------------
                     Alpaca  ttt------t------------------------------------------------------------
             Bactrian camel  ttc------t------------------------------------------------------------
                    Dolphin  ttt------ct-----------------------------------------------------------
               Killer whale  ttt------ct-----------------------------------------------------------
           Tibetan antelope  gtt------ctgggg-------------------------------------------------------
                        Cow  gtt------ctgggg-------------------------------------------------------
                      Sheep  gtt------ctgggg-------------------------------------------------------
              Domestic goat  gtt------ctgggg-------------------------------------------------------
                      Horse  atg------a------------------------------------------------------------
           White rhinoceros  ttt------c------------------------------------------------------------
                        Cat  ttt------c------------------------------------------------------------
                        Dog  ttc------c------------------------------------------------------------
                      Panda  ttc------ctggtgggg----------------------------------------------------
             Pacific walrus  ttc------c------------------------------------------------------------
               Weddell seal  tcc------c------------------------------------------------------------
           Black flying-fox  ----------------------------------------------------------------------
                    Megabat  ----------------------------------------------------------------------
              Big brown bat  ttt------tcggagggcgggggtg---------------------------------------------
       David's myotis (bat)  ttt------ctgggcggcggtggcagcggg----------------------------------------
                   Microbat  ttt------ccgggtggcggtggtggcgggggtgggggggt-----------------------------
                   Hedgehog  ttt-------------------------------------------------------------------
                      Shrew  ttt------tttttggtttctgggtcacacacccagcgatgcacagggattactcctggctcatgcactc
            Star-nosed mole  ------------------------------actcagagagg-----------------------------
                   Elephant  ttt------c------------------------------------------------------------
        Cape elephant shrew  ttt------c------------------------------------------------------------
                    Manatee  ttt------c------------------------------------------------------------
           Cape golden mole  tt--------------------------------------------------------------------
                     Tenrec  ----------------------------------------------------------------------
                   Aardvark  ttt------c------------------------------------------------------------
                    Opossum  ttt------gctggg-------------------------------------------------------
            Tasmanian devil  ttt------actgg--------------------------------------------------------
                    Wallaby  ======================================================================
                     Rabbit  ======================================================================

                      Human  ---------------------g--atg
                      Chimp  ---------------------g--atg
                    Gorilla  ---------------------g--atg
                  Orangutan  ---------------------g--atg
                     Gibbon  ---------------------g--atg
                     Rhesus  ---------------------g--atg
        Crab-eating macaque  ---------------------g--atg
                     Baboon  ---------------------g--atg
               Green monkey  ---------------------g--atg
                   Marmoset  ---------------------g--gtg
            Squirrel monkey  ---------------------g--gtg
                   Bushbaby  ---------------------g--ggt
         Chinese tree shrew  ---------------------a--ttg
                   Squirrel  ---------------------g-----
     Lesser Egyptian jerboa  ---------------------t-----
               Prairie vole  ---------------------g-----
            Chinese hamster  ---------------------g-----
             Golden hamster  ---------------------g-----
                      Mouse  ---------------------g-----
                        Rat  ---------------------g-----
             Naked mole-rat  ---------------------gtg---
                 Guinea pig  ---------------------gtg---
                 Chinchilla  ---------------------g-----
           Brush-tailed rat  ---------------------gtg---
                       Pika  ---------------------------
                        Pig  -----------------gtgg------
                     Alpaca  ---------------------------
             Bactrian camel  ---------------------------
                    Dolphin  ---------------------------
               Killer whale  ---------------------------
           Tibetan antelope  ---------------------------
                        Cow  ---------------------------
                      Sheep  ---------------------------
              Domestic goat  ---------------------------
                      Horse  ---------------------------
           White rhinoceros  ---------------------------
                        Cat  ---------------------------
                        Dog  ---------------------------
                      Panda  -----------------tggg------
             Pacific walrus  ---------------------------
               Weddell seal  ---------------------------
           Black flying-fox  -----------------gggt------
                    Megabat  -----------------gggt------
              Big brown bat  -----------------gggt------
       David's myotis (bat)  -----------------gggt------
                   Microbat  -----------------gggt------
                   Hedgehog  ---------------------------
                      Shrew  aggaatcactcttagcagtgc------
            Star-nosed mole  ---------------------------
                   Elephant  ---------------------------
        Cape elephant shrew  ---------------------------
                    Manatee  ---------------------------
           Cape golden mole  ---------------------------
                     Tenrec  ---------------------------
                   Aardvark  ---------------------------
                    Opossum  ---------------------------
            Tasmanian devil  ---------------------------
                    Wallaby  ===========================
                     Rabbit  ===========================

Alignment block 22 of 219 in window, 112831212 - 112831267, 56 bps 
B D                   Human  ggggc-----ggg-----ga--g--------a--------------------------------------
B D                   Chimp  ggggc-----ggg-----ga--g--------a--------------------------------------
B D                 Gorilla  ggggc-----ggg-----ga--g--------a--------------------------------------
B D               Orangutan  ggggc-----ggg-----ga--g--------a--------------------------------------
B D                  Gibbon  ggggc-----ggg-----ga--g--------a--------------------------------------
B D                  Rhesus  ggggc-----ggg-----ga--a--------a--------------------------------------
B D     Crab-eating macaque  ggggc-----ggg-----ga--g--------a--------------------------------------
B D                  Baboon  ggggc-----ggg-----ga--g--------a--------------------------------------
B D            Green monkey  ggggc-----ggg-----ga--g--------a--------------------------------------
B D                Marmoset  agggt-----agg-----ga--g--------a--------------------------------------
B D         Squirrel monkey  -gggc-----agg-----ga--g--------a--------------------------------------
B D                Bushbaby  caggt-----ggg-----ga--c--------a--------------------------------------
         Chinese tree shrew  agggt-----ggggtggtga--g--------a--------------------------------------
B D                Squirrel  ----------gtg-----ggagg--------c--------------------------------------
     Lesser Egyptian jerboa  ----------gtg-----gg--gatcatgtct--------------------------------------
               Prairie vole  ----------gcg-----gg--g--------c--------------------------------------
B D         Chinese hamster  ----------gtg-----gga-g--------c--------------------------------------
             Golden hamster  ----------gca-----gg--g--------c--------------------------------------
B D                   Mouse  ----------gtc-----ag--g--------c--------------------------------------
B D                     Rat  ----------gtg-----gg--g--------t--------------------------------------
B D          Naked mole-rat  -----caggtggg-----gc--a--------c--------------------------------------
B D              Guinea pig  -----caggtggg-----ga--g--------c--------------------------------------
                 Chinchilla  ----------------------------------------------------------------------
           Brush-tailed rat  -----cggg-agg-----ga--g--------c--------------------------------------
B D                  Rabbit  ggggcca---gga-----ga--g--------c--------------------------------------
B D                    Pika  ---gaca---ggg-----ga--a--------c--------------------------------------
B D                     Pig  gtagg-----ggg-----ga--a--------g--------------------------------------
B D                  Alpaca  ----g-----ggg-----ga--a--------g--------------------------------------
             Bactrian camel  ---gg-----ggg-----ga--a--------g--------------------------------------
B D                 Dolphin  ---aa-----ggg-----ga--a--------g--------------------------------------
               Killer whale  ---aa-----ggg-----ga--a--------g--------------------------------------
           Tibetan antelope  ---aa-----ggg-----gg--a--------a--------------------------------------
B D                     Cow  ---aa-----gga-----gg--a--------a--------------------------------------
B D                   Sheep  ---aa-----ggg-----gg--a--------a--------------------------------------
              Domestic goat  ---aa-----ggg-----gg--a--------a--------------------------------------
B D                   Horse  -tgag------gg-----ga--g--------a--------------------------------------
B D        White rhinoceros  -tgtg------gg-----ga--g--------a--------------------------------------
B D                     Cat  -tgag------ca-----aa--a--------a--------------------------------------
B D                     Dog  -tggg-------g-----gg--a--------a--------------------------------------
B D                   Panda  gtggg-----gtg-----gg--g--------a--------------------------------------
             Pacific walrus  -tggg-----gag-----ga--a--------a--------------------------------------
               Weddell seal  -tggg-----gag-----ga--a--------a--------------------------------------
           Black flying-fox  gtcta-----ggg-----ga--g--------a--------------------------------------
B D                 Megabat  gtcta-----ggg-----ga--g--------a--------------------------------------
              Big brown bat  gtggg-----ggg-----ga--g--------a--------------------------------------
       David's myotis (bat)  ttggg-----gga-----ga--g--------a--------------------------------------
B D                Microbat  tggag-----gga-----ga--g--------a--------------------------------------
B D                Hedgehog  -tgag-----ggg-----ga--a--------a--------------------------------------
B D                   Shrew  ttggg-----gga-----cc--a--------tatgggacgctgggaatcgaacccgggttgtccacatgc
            Star-nosed mole  -tggg-----gag-----gc--a--------t--------------------------------------
B D                Elephant  -aggg-----gag-----ga--g--------a--------------------------------------
        Cape elephant shrew  -tggg-----gag-----ga--g--------a--------------------------------------
B D                 Manatee  -tggg-----aag-----ga--g--------a--------------------------------------
           Cape golden mole  -gggg-----aag-----ga--g--------a--------------------------------------
B D                  Tenrec  ----------------------------------------------------------------------
                   Aardvark  -tggg-----gag-----ga--g--------a--------------------------------------
B D                 Opossum  ----------aga-----aa--a--------a--------------------------------------
B D         Tasmanian devil  -----------gg-----aa--a--------a--------------------------------------
B D                 Wallaby  ======================================================================

                      Human  ----------------------------------------------------------------agg---
                      Chimp  ----------------------------------------------------------------agg---
                    Gorilla  ----------------------------------------------------------------agg---
                  Orangutan  ----------------------------------------------------------------agg---
                     Gibbon  ----------------------------------------------------------------aag---
                     Rhesus  ----------------------------------------------------------------agg---
        Crab-eating macaque  ----------------------------------------------------------------agg---
                     Baboon  ----------------------------------------------------------------agg---
               Green monkey  ----------------------------------------------------------------agg---
                   Marmoset  ----------------------------------------------------------------aga---
            Squirrel monkey  ----------------------------------------------------------------agg---
                   Bushbaby  ----------------------------------------------------------------agg---
         Chinese tree shrew  ----------------------------------------------------------------agg---
                   Squirrel  ----------------------------------------------------------------agg---
     Lesser Egyptian jerboa  ----------------------------------------------------------------agg---
               Prairie vole  ----------------------------------------------------------------agg---
            Chinese hamster  ----------------------------------------------------------------agg---
             Golden hamster  ----------------------------------------------------------------agg---
                      Mouse  ----------------------------------------------------------------agg---
                        Rat  ----------------------------------------------------------------aag---
             Naked mole-rat  ----------------------------------------------------------------agg---
                 Guinea pig  ----------------------------------------------------------------agg---
                 Chinchilla  ----------------------------------------------------------------------
           Brush-tailed rat  ----------------------------------------------------------------agg---
                     Rabbit  ---------------------------------------------------------------aaga---
                       Pika  ----------------------------------------------------------------aga---
                        Pig  ----------------------------------------------------------------agg---
                     Alpaca  ----------------------------------------------------------------agg---
             Bactrian camel  ----------------------------------------------------------------agg---
                    Dolphin  ----------------------------------------------------------------agg---
               Killer whale  ----------------------------------------------------------------agg---
           Tibetan antelope  ----------------------------------------------------------------agt---
                        Cow  ----------------------------------------------------------------agt---
                      Sheep  ----------------------------------------------------------------agt---
              Domestic goat  ----------------------------------------------------------------agt---
                      Horse  ----------------------------------------------------------------agg---
           White rhinoceros  ----------------------------------------------------------------agg---
                        Cat  ----------------------------------------------------------------agg---
                        Dog  ----------------------------------------------------------------aag---
                      Panda  ----------------------------------------------------------------agg---
             Pacific walrus  ----------------------------------------------------------------agg---
               Weddell seal  ----------------------------------------------------------------agg---
           Black flying-fox  ----------------------------------------------------------------aggtag
                    Megabat  ----------------------------------------------------------------aggtag
              Big brown bat  ----------------------------------------------------------------agg---
       David's myotis (bat)  ----------------------------------------------------------------agg---
                   Microbat  ----------------------------------------------------------------agg---
                   Hedgehog  ----------------------------------------------------------------------
                      Shrew  aaggcaaataccctacccgctgtgctattgctccagcccctgctttcagattttctgagggcaaaag---
            Star-nosed mole  ----------------------------------------------------------------------
                   Elephant  ----------------------------------------------------------------agg---
        Cape elephant shrew  ----------------------------------------------------------------agg---
                    Manatee  ----------------------------------------------------------------agg---
           Cape golden mole  ----------------------------------------------------------------agg---
                     Tenrec  ----------------------------------------------------------------------
                   Aardvark  ----------------------------------------------------------------agg---
                    Opossum  ----------------------------------------------------------------gat---
            Tasmanian devil  ----------------------------------------------------------------att---
                    Wallaby  ======================================================================

                      Human  -tggttgt------------c----------------tgggaa-taagtggtagca--ggag--gctga-
                      Chimp  -tggttgt------------c----------------tgggaa-taagtggtagca--ggag--gctga-
                    Gorilla  -tggttgt------------c----------------tgggaa-taagtggtagca--ggag--gctaa-
                  Orangutan  -tggttgt------------c----------------tgggaa-taagtggtagca--ggag--gctga-
                     Gibbon  -tggttgt------------c----------------tgggaa-taagtggtagca--ggag--gctga-
                     Rhesus  -tggttgtgagtgatagaagg----------------tggtta-taagtgatagct--ggag--actga-
        Crab-eating macaque  -tggttgtgagtgatagaagg----------------tggtta-taagtgatagct--ggag--actga-
                     Baboon  -tggttgtgagtgatagaagg----------------tggtta-taagtgatagct--ggag--actga-
               Green monkey  -tggttgtgagtgatagaagg----------------tggtta-taagtgatagct--ggag--actga-
                   Marmoset  -tggttgc------------c----------------tgggaa-tatctgatacct--ggag--gctga-
            Squirrel monkey  -tggttgt------------c----------------tgggaa-tatgtgatagct--ggag--gctga-
                   Bushbaby  ------------------------------------------a-gaagggacagct--ggat--gttga-
         Chinese tree shrew  -tggttgt------------c----------------tgatg---aagtcatggctaagggt--gtttc-
                   Squirrel  -tggtatc------------c----------------tgggaagcagggggcggcc--acggctgcccc-
     Lesser Egyptian jerboa  -ttgatgt------------c----------------tgggaagtgaaagatggct--gagg--gtcttt
               Prairie vole  -cagatgt------------c----------------tgggaagtacaggatggct--gagc--gtctt-
            Chinese hamster  -aagatgt------------c----------------tgggaagtacggaatggct--gaga--gtctc-
             Golden hamster  -aggatgt------------c----------------tgggaagtacggattagct--gaga--gtctt-
                      Mouse  -tggatgt------------c----------------tgggaagtaagtaaaggc----aga--gtctt-
                        Rat  -tggatgt------------c----------------tgggaaatgagtaaaggtg--aaga--gtctc-
             Naked mole-rat  -tgattgt------------t----------------ggggaagtaaatgatggtg--gagggtgcttc-
                 Guinea pig  -gagttgt-----------------------------ggggaaggaagtgatggct--tagggtgcttc-
                 Chinchilla  -----------------------------------------aaggaagtgatggct--gaggacgtttc-
           Brush-tailed rat  -tggttgt--------------------------------tggggaagtgataggt--gagggtgcctc-
                     Rabbit  -tgcctgt------------g----------------tgggaagtgagtgatggct--gggc-tgttcc-
                       Pika  -tggct-----------------------------------------gtgatggcc--aggc-tgtcct-
                        Pig  -tcactgt------------c----------------ttggaagta----atggct--gggggtgcttc-
                     Alpaca  -tagctga------------c----------------ttggaagcgggtgatggct--aggggtgcctc-
             Bactrian camel  -tagctga------------c----------------ttggaagtgggtgatggct--aggggtgcctc-
                    Dolphin  -tagttgt------------c----------------ttggaagaaagtgatggct--aggcgtccttc-
               Killer whale  -tagttgt------------c----------------ttggaagaaagtgatggct--aggcgtccttc-
           Tibetan antelope  -tagttgt------------c----------------tttgaagtaagtgatgcct--agggatgcccc-
                        Cow  -tagttgt------------c----------------tgtgaagtaagtgatggct--agggatgcccc-
                      Sheep  -tagttgt------------c----------------tttgaagtaagtgatggct--agggatgcccc-
              Domestic goat  -tagttgt------------t----------------tttgaagtaagtgatgcct--agggatgcccc-
                      Horse  -tggttgt------------c----------------ttggaagtaagggatggct--aggggtgcttc-
           White rhinoceros  -tggctgt------------c----------------ttggaagtaagtgatgggt--aagggtgcttc-
                        Cat  -tggttgt------------t----------------ttggaaataaatgagggct--aaatgtgcttc-
                        Dog  -tggttgt------------c----------------ttggaagtaagtgagggct--aaggttgtttg-
                      Panda  -tggatat------------c----------------ctggaagtaagtgaggcct--gggagtggttg-
             Pacific walrus  -tggttgt------------c----------------ttggaagtaagtgaggcct--aatggtgtttg-
               Weddell seal  -tggttgt------------c----------------ttggaagtaagtgaggcct--aatggtgtttg-
           Black flying-fox  ctggctat------------c----------------ttggaagttggtggtggcc--aggggcccttg-
                    Megabat  ctggctgt------------c----------------ttggaagttggtggtggcc--aggggcccttg-
              Big brown bat  -tggctgt------------c----------------ttggaagtcagtgatggct--aggtgtgcttc-
       David's myotis (bat)  -tggttgt------------c----------------ttggaagtcagtgatggct--aggggtgcttc-
                   Microbat  -tggttgt------------c----------------ttggaagtcagtgatggct--tggggtgcttc-
                   Hedgehog  -----------------------------------------aggtgat-------------ggtacttc-
                      Shrew  -tgattgt------------c----------------tta-aagtaactgatgctt--aggagtgcctc-
            Star-nosed mole  ----ttgt------------c----------------ttagaagtgagtgatgact--aggggtactgc-
                   Elephant  -aggttgc------------c----------------ttggaagtaagtgatagaa--gggggttcttt-
        Cape elephant shrew  -aggttgg------------c----------------ctcgaagtaa-tagtggag--gag----cttc-
                    Manatee  -aggttgt------------c----------------ttggaagtaagtgatggtg--ggg-gtgcttt-
           Cape golden mole  -agtttgt------------c----------------ttgaaagtaagtcatggct--ggggaggcatt-
                     Tenrec  -----tat------------c----------------ct---------ttttgtct--tgggtcccttc-
                   Aardvark  -aggttgt------------c----------------tttgaagtaaatgatggct--agaggtgcttt-
                    Opossum  -tgaccat------------ctaaaatcacctgactgtgagaaacaaggg--------------------
            Tasmanian devil  -tggccat------------cttgaactacctggctgtgggagacaagtg--------------------
                    Wallaby  ======================================================================

                      Human  ---ga----------a---ggg
                      Chimp  ---ga----------a---ggg
                    Gorilla  ---ga----------a---ggg
                  Orangutan  ---ga----------a---ggg
                     Gibbon  ---ga----------a---ggg
                     Rhesus  ---ga----------a---ggg
        Crab-eating macaque  ---ga----------a---ggg
                     Baboon  ---ga----------a---ggg
               Green monkey  ---ga----------a---ggg
                   Marmoset  ---ga----------a---ggg
            Squirrel monkey  ---ga----------a---ggg
                   Bushbaby  ---ga----------a---ggg
         Chinese tree shrew  ---aa----------a---ggg
                   Squirrel  ---cggggt-gctg-a---agg
     Lesser Egyptian jerboa  cagaggaga-ccca------gc
               Prairie vole  ---aagaga-acaa-g---gga
            Chinese hamster  ---aagaga-acaa-g---ggg
             Golden hamster  ---aagagg-acaa-g---ggg
                      Mouse  ---cggtga-gcagtg---ggg
                        Rat  ---aggtga-gcaatg---ggg
             Naked mole-rat  ---agagga-ggct-gagaagg
                 Guinea pig  ---agagga-agct-g---agg
                 Chinchilla  ---agagga-ggct-g---agg
           Brush-tailed rat  ---ggtggc-ggct-g---agg
                     Rabbit  ---agagga-gggc-t---ggg
                       Pika  ---agaata-ggct-g---agg
                        Pig  ---agtgaa-gccc-a---aga
                     Alpaca  ---agagga-gcct-g---aga
             Bactrian camel  ---agagga-gcct-g---aga
                    Dolphin  ---agagga-gcct-g---aga
               Killer whale  ---agagga-gcct-g---aga
           Tibetan antelope  ---agaaga-gcct-g---aga
                        Cow  ---agaaaa-gcct-g---aga
                      Sheep  ---agaaga-gcct-g---aga
              Domestic goat  ---agaaga-gcct-g---aga
                      Horse  ---agagaa-gcct-g---aga
           White rhinoceros  ---agaaga-gcca-g---aga
                        Cat  ---agtgaa-gcct-a---gga
                        Dog  ---agagga-gcct-g---gga
                      Panda  ---agagga-gcct-g---gga
             Pacific walrus  ---agagga-gcct-g---gga
               Weddell seal  ---agagga-gcct-g---gga
           Black flying-fox  ---gaggag-c-ct-g---ggg
                    Megabat  ---gaggag-c-ct-g---ggg
              Big brown bat  ---agagga-g-tt-g---aga
       David's myotis (bat)  ---agagaa-g-tt-g---aga
                   Microbat  ---agagga-g-tt-g---aga
                   Hedgehog  ---agtaga-attt-g---aca
                      Shrew  ---tgggga-gtct-g---gca
            Star-nosed mole  ---ggagga-gtct-g---aga
                   Elephant  ---ggaggacgccc-g---aga
        Cape elephant shrew  ---agagaa-gcct-g---aga
                    Manatee  ---gaaggatgcct-g---aga
           Cape golden mole  ---ggaggaggcct-a---aga
                     Tenrec  ---agaggagg-ct-g---aga
                   Aardvark  ---ggaagaggcct-g---aga
                    Opossum  ----------------------
            Tasmanian devil  ----------------------
                    Wallaby  ======================

Inserts between block 22 and 23 in window
              Prairie vole 2bp
B D                Opossum 27bp
B D        Tasmanian devil 28bp

Alignment block 23 of 219 in window, 112831268 - 112831430, 163 bps 
B D                   Human  c-----ttca-ttc---catag--cattcacttacctccagctgtagagtgggcttatcatctttcaaca
B D                   Chimp  c-----ttca-ttc---catag--cattcacttacctccagctgtagagtcggcttatcatctttcaaca
B D                 Gorilla  c-----ttca-ttc---catag--cattcacttacctccagctgtagagtgggcttatcatctttcaaca
B D               Orangutan  c-----ttca-ttc---catag--cattcacttacctccagctgtagagtgggcttatcatctttcaaca
B D                  Gibbon  c-----ttca-ttc---catag--cattcacttacctccagctgtagagtgggcttatcatctttcaaca
B D                  Rhesus  c-----ttca-ttc---catag--cattcacttacctccagctgtagcgtgggcttatcatctttcaaca
B D     Crab-eating macaque  c-----ttca-ttc---catag--cattcacttacctccagctgtagtgtgggcttatcatctttcaaca
B D                  Baboon  c-----ttca-ttc---catag--cattcacttacctccagctgtagcgtgggcttatcatctttcaaca
B D            Green monkey  c-----ttca-ttc---catag--cattcacttacctccagctgtagagtgggcttatcatctttcaaca
B D                Marmoset  c-----ttca-ttc---catag--ca-tcacttacctccagctgtagagtgggcttcttatctttcagca
B D         Squirrel monkey  a-----ttca-ttc---catag--ca-tcacttacctccagctgtagagtgggcttattatctttcagca
B D                Bushbaby  c-----ttca-gcc---cctga--ca----ctcacctctagctgtaggatgggcttctcatccttcatca
         Chinese tree shrew  --------------------ga--cacccacttacctccagctgcagggtgggcttattgtcttgcatta
B D                Squirrel  a-----cctc-ccc---tc-gt---cttgactcacctccagctgcagggtgggcttgtcccccttcatca
     Lesser Egyptian jerboa  t-----aggc-ttc---catgtgggatgtgctcacctccagctgaagggtgggcttctcctctttcatca
               Prairie vole  g-----tggc-ttc---tctgg---cttcactcacctccagctgcagggtgggcatgccacctttcagca
B D         Chinese hamster  a-----tggctttc---tctgt---catcactcacctccagctgcagggtgggcatgtcacctttcatca
             Golden hamster  a-----tggc-ttc---tcagc---tgtcactcacctccagctgcagggtgggcgtgtcacctttcatga
B D                   Mouse  g-----aggc-ttc---tctac-tgatggactcacctccagctgcagggtgggtgtgccgtctttcatta
B D                     Rat  g-----ccga-ttc---tctgtgccatgcactcacctccagctgcagggtgggtgtgccgtctttcatca
B D          Naked mole-rat  g-----tttc-ctt---cttgg--tatttgcttacctcaagctgtaggacaggtttatcatctttcatca
B D              Guinea pig  c-----tgtc-ctt---tttgg--tatctgcttacctccagctgcaggacaggtttaccatctttcatca
                 Chinchilla  g-----cctc-cac---cgtgc--tatttgcttacctccagctgcaggataggtttatcatctttcatca
           Brush-tailed rat  g---ctcctc-ctc---cgagc-----ttgcttacctccagctgcaggacgggtttatcatctttcatca
B D                  Rabbit  a-----gggc-ttcagtccagg--tacccactcacctccagctgcagggtaggtttatcgtctttcatca
B D                    Pika  a-----gggg-ctcagccttgg--tccccactcacctccagctgcagggtgggcttctcgtccttcatca
B D                     Pig  agggccttca-gcc---cttgg--tactcactcacctccagctgcagggtgggcgtgttatctttcatca
B D                  Alpaca  a-------------------gg--tatccacttacctccagctgcagggtgggcttatcccctttcatca
             Bactrian camel  a-------------------gg--tatccacttacctccagctgcagggtgggcttatcccctttcatca
B D                 Dolphin  agggccttca-gcc---cctgg--tacccactcacctccagctgcaggatgggcctatcgcctttcatca
               Killer whale  agggccttca-gcc---cctgg--tacccactcacctccagctgcaggatgggcctatcgcctttcatca
           Tibetan antelope  aggaccttca-gcc---cctgg--tattcactcacctccagctgcagggtcggcgtatcaccttttttca
B D                     Cow  agggccttca-gcc---cctgg--tattcactcacctccagctgcagggtgggcgtatcaccttttttca
B D                   Sheep  aggaccttca-gcc---cccgg--tattcactcacctccagctgcagggtcggtgtatcaccttttttca
              Domestic goat  aggaccttca-gcc---cctgg--tattcactcacctccagctgcagtgtcggcgtatcaccttttttca
B D                   Horse  agggccagca-gcc---cctgg--tattcactcacctccagctgcaggatgggcttcccatctttcgtcc
B D        White rhinoceros  agggcctgca-gcc---cctgg--t----actcacctccagctgcaggatgggcttcccgtccttcatcc
B D                     Cat  a--gccttca-gcc---cctgg--tactc----acctccagctgtagggtgggtttcccatctttcatca
B D                     Dog  a--gccttta-gcc---actcg--tactcactcacctctagctgtagggtgggctttccatccttcatca
B D                   Panda  a--ggcttca-gcc---cctga--tactcactcacctccagctgcagggtgggcttcccgtctttcatca
             Pacific walrus  a--gccttca-gcc---cctgg--tactcacttacctctagctgcagggtgggcttcccatctttcatca
               Weddell seal  a--gccttca-gtc---cctgg--tactcacttacctctagctgcagggtgggcttcccatctttcatca
           Black flying-fox  agggctgtca-gcc---tctgc--cactcactcacctccagctgcagagtgggcttcctgtccttcatca
B D                 Megabat  agggctgtca-gcc---tctgc--cgctcactcacctccagctgcagagtgggcttcctgtccttcatca
              Big brown bat  agggcctttg-gct---gcggg--tgctcactcacctccagctgcagggtgggcttcttgtcctttacca
       David's myotis (bat)  agggcctttg-gct---gctgg--tgctcactcacctccagctgcagggtgggcttcttgtccttcacca
B D                Microbat  agggcctttg-gct---gct-g--tgctcactcacctccagctgcagggtgggcttcttgtccttcacca
B D                Hedgehog  aaggctttca-act---cctgt--t----actaacctccaaatgcagagtaggcttctcatctttcataa
B D                   Shrew  acaactttcc-gtc---ccagg--t----actcacctccagttgcagagtgggtgtgccatctatctttg
            Star-nosed mole  agggccctca-gtc---cctgc--tattcactcacctccagctgcagggtgggctttccgtctttcatca
B D                Elephant  aggaccctca-gtt---tctgg--tactcactcacctccagctgcagggtaggcttcccatcattcatca
        Cape elephant shrew  gga--tatta-act---cctgg--t----actcacctccagctgcagggtgggcttcccatcactcatca
B D                 Manatee  aggaccctca-gtc---tctgg--tactcactcacctccagttgcagggtgggcttcccattactcatca
           Cape golden mole  agggccctca-gcc---tctgg--tactcactcacctccagctgcagggtgggtttcccatcaatcatca
B D                  Tenrec  aaggtc------------tagg--gactcactcacctccagctgcagcgtgggcttcccgttgctcatca
                   Aardvark  agacctttta-gcc---catgg--t----actcacctccagctgcagagtgggcttcccattattccaca
B D                 Opossum  ------cttt-att---cctag--gat--gctcacctctagctgcaggatgggcttcccatcacgcttca
B D         Tasmanian devil  ------cttt-att---cttag--tat--ccttacctctagctgtagaatgggcttcccgttacgcttca
B D                 Wallaby  ------cttt-att---cctag--tat--gctcacctccagttgcaggatgggcttctcgccacgcttca

                      Human  cgcaggacaggtacagattcttttccttgaggcccaaggccacaggtattttgtcattactttcttctcc
                      Chimp  cgcaggacaggtacagattcttttccttgaggcccaaggccacaggtattttgtcattactttcttctcc
                    Gorilla  cgcaggacaggtacagattcttttccttgaggcccaaggccacaggtattttgtcattactttcttctcc
                  Orangutan  cgcaggacaggtacagattcttttccttgaggcccaaggccacaggtattttgtcattactttcttctcc
                     Gibbon  cgcaggacaggtacagattcttttccttgaggcccaaggccacaggtattttgtcattactttcttctcc
                     Rhesus  cacaggacaggtacagattctttgccttgaggcccaaggccacaggtattttgtcattactttcttctcc
        Crab-eating macaque  cacaggacaggtacagattctttgccttgaggcccaaggccacaggtattttgtcattactttcttctcc
                     Baboon  cgcaggacaggtacaggttctttgccttgaggcccaaggccacaggtactttgtcattactttcttctcc
               Green monkey  cgcaggacaggtacaggttctttgccttgaggcccaaggccacaggtactttgtcattactttcttctcc
                   Marmoset  cacaggacaggtacagattcttttctttgaggcccaaggccacaggtattttgtcattactttcttctcc
            Squirrel monkey  cacaggacaggtacagattcttttccttgaggcccaaggccacaggtattttgtcgttactttcttctcc
                   Bushbaby  cgcaggaaaggtacagattcttttccttgaggcccagcgccacaggtattttgtcactattttcatctcc
         Chinese tree shrew  tacaggacaggtacagattctttcccttgaggctcaagaccacaggtgttttctcactattttcatctcc
                   Squirrel  cgcaggtcaggtacaggttcttccccttgatgcccaaggccacgggtgtcttgctgtcattcccttctcc
     Lesser Egyptian jerboa  cacaggataggtacagattctttcccctgagggccaaggccacaggtattttgtcattagtatcttctcc
               Prairie vole  cacaggacaggtacagattcttccccttgactcccaaggccacagggatcttgttgttgcttgtttcccc
            Chinese hamster  cacaggacaagtacaggttctttcccttgatgcccaaggccacaggtgtcttgttgctgcttgtttctcc
             Golden hamster  cacaggacaggtacaggttctttccctttaggcccagggccacaggtatcttgttgttgcttgtttctcc
                      Mouse  cacaggacaggtatagattctttcctttgaggcccaaggccacaggtattttgtcgttgcttggttctcc
                        Rat  cacaggacaggtatagattcttccccttgaggcccaaggccacagggattttgtcgttgcttgtctctcc
             Naked mole-rat  cacaggacaggtacagattctttcccttgaggcccaaagcaacagggattttgtcatctcttctttctcc
                 Guinea pig  cacaggacaggtacagattcttccccttgaggcccaaggcaacgggcattttgttatcacttctttctcc
                 Chinchilla  cacaggacaggtatagattctttcccttgaggcccaaggcaacagggattttgtcatcgcttctttctcc
           Brush-tailed rat  cacaggacaagtacagattcttccccttgaggcccaaggcaacagggattttgttgttgcttttttctcc
                     Rabbit  cgcaggacaggtacagattcttccccctgaggcccaaggccacaggtatcttgtcgttactttcttctcc
                       Pika  cacaggacagatacagattcttccccctgagccccagcgctacaggtatcttgtcaatactttcttctcc
                        Pig  cacaagacaggtacagattctttcccttgatccctaaggtcacaggtatcttgttgttgctatcatctcc
                     Alpaca  cacaagacaggtatagattcttctccttgaggcccaagaccacaggtgtcttgctgttgttttcgtcccc
             Bactrian camel  cacaagacaggtatagattcttctccttgaggcccaagaccacaggtatcttgctgttgctttcgtcccc
                    Dolphin  cacaagacaggtatagattcttttccttgaggcctaaggccacaggtatcttgtcgttactttcatctcc
               Killer whale  cacaagacaggtatagattcttttccttgaggcctaaggccacaggtatcttgtcgttactttcatctcc
           Tibetan antelope  cacaagacaggtatagattcttgtccctgatacccaaggccacaggaatcttgttgtctctttcctctcc
                        Cow  cacaagacaggtatagattcttgtccttgatacccaaggccacaggaatcttgttgtctctttcctctcc
                      Sheep  cacaagacaggtatagattcttgtccctgatacccaaggccacaggaatcttgttgtctctttcctctcc
              Domestic goat  cacaagacaggtatagattcttgtccctgatacccaaggccacaggaatcttgttgtctctttcctctcc
                      Horse  cacaagacaggtacagattctttcccttgaggcccaaggccacaggtatcttgtcagtctcttcttctcc
           White rhinoceros  cacacgacaggtacagattctttcccttgaggcccagggccacaggtatcttgttggtctcttcttctcc
                        Cat  cacaggacaggtacaggttatttttcttgatgcacaacactactggtatcttcttactattttcctcccc
                        Dog  cacaggacaggtacagattcttttgtttgatgcccaagaccacaggtatcttgttattactttcatcccc
                      Panda  cacaggacaggtacagattcttttccttgatgcacaaggccacaggtatcttgttactactttcatcccc
             Pacific walrus  cacaggacaggtacagattcttttctttgatgcacaaggtcacaggtatcttgttactattttcatcccc
               Weddell seal  cacaggacaggtacagattcttttccttgatgcacaaggccacaggtatcttgttactattttcatcccc
           Black flying-fox  cacaggacaggtacaggttcttttccttgatgcccaaggccactgggatcttgtcatcgttctcttctcc
                    Megabat  cacaggacaggtacaggttcttttccttgatgcccaaggccactgggatcttgtcatcgttctcttctcc
              Big brown bat  cgcaagataggtacagattcttttccttgatgcccaaggccacgggtatcttgtcgatattctcgtctcc
       David's myotis (bat)  cgcaagacaagtacaggttcttttccttgatgcccaaggccacgggtatcttgtcgatattctcatctcc
                   Microbat  cgcaagacaggtacaggttcttttccttgatacccaaggccacgggtatcttgtcgatattctcgtctcc
                   Hedgehog  tacaagacaggtacagattcttatccttgagccccaacgccacagggatcttttctccagattcttctcc
                      Shrew  cacaagacaggtacatattcttatccttgagacccaaagctacaggcgtcttgtgttcgtggtattttcc
            Star-nosed mole  cacatgacaggtacatattcttatccttgaggcccaaggccacgggtatcttgtcatcagtttcttctcc
                   Elephant  tacaggacaggtacacattctttcccttgaggcccaaggccacaggtgtcttctcttgacttatttctcc
        Cape elephant shrew  cacaggacaggtacaaactatttcccttgaggcccaaggccacagggatcttctcttgacttatttctcc
                    Manatee  cacaggacaggtacacattctttcccctgaggcccaaggccacaggtatcttctcttgatttatttctcc
           Cape golden mole  cacaggacaggtacaaattatttctcctgagggccaaggccacaggtattttctcttgacttatttctcc
                     Tenrec  cacaggacaggtacagattctttcccttgagacccaaggccaccggcatcttctcttgacttacttctcc
                   Aardvark  cacaggacaggtacaaattctttcccctgagccccaaggccacaggcatcttttcttcacttatttctcc
                    Opossum  cacaagacagatagagattatttttcttgatacataagacaacatgtgttttctgggagcctacctcacc
            Tasmanian devil  cacaagacagatagaaattatttttcttgatacagaggacaacatgtgttttctgggagcctatctcacc
                    Wallaby  cacaagacagatagagattatttttcttgatacacaggacaacatgtgttttcttggatcctattttacc

                      Human  ttgtacaaaggacatggagaacaccactgaagaa
                      Chimp  ttgtacaaaggacatggagaacaccactgaagaa
                    Gorilla  ttgtacaaaggacatggagaacaccactgaagaa
                  Orangutan  ttgtacaaaggacatggagaacaccactgaagaa
                     Gibbon  ttgtacaaaggacatggagaacaccactgaagaa
                     Rhesus  ttgtacaaaggacatggagaacaccactgaagaa
        Crab-eating macaque  ttgtacaaaggacatggagaacaccactgaagaa
                     Baboon  ttgtacaaaggacatggagaacaccactgaagaa
               Green monkey  ttgtacaaaggacatggagaacaccactgaagaa
                   Marmoset  ttgcacaaaggacatggagaacaccactgaagaa
            Squirrel monkey  ttgcacaaaggacatggagaacaccactgaagaa
                   Bushbaby  ttgtacaaagctcatggaaaacaccactgaagaa
         Chinese tree shrew  ttgcacaatgctcatggtgatcaccactgaagaa
                   Squirrel  cagcacaaagctcatggagaacaccactggggac
     Lesser Egyptian jerboa  ttgcacgaagctcatggagaataccactggagaa
               Prairie vole  ctgcacgtagctcatggaaaagatcactgcagga
            Chinese hamster  ctgtacaaagctcatggagaataccactggagga
             Golden hamster  ctgtacaaagctcatggagaacaccactggaaga
                      Mouse  ttgtacaaagctcatggagaatatcactggagaa
                        Rat  ttgtacaaagctcatggagaataccactggag--
             Naked mole-rat  ttgtacaaagctcatggagaacaccactgcagaa
                 Guinea pig  ttgtacgaagctcatggagaacaccactggagaa
                 Chinchilla  ttgcacaaagctcatggagaacaccactggagaa
           Brush-tailed rat  ttgtacaaagctcatggagaacaccactagagag
                     Rabbit  ttgcacaaaactcatggagaacaccactaaagaa
                       Pika  ttgtacaaagttcatagaaaacaccactaaagaa
                        Pig  ttgcacaaagctcatgcagaacaccactgaggga
                     Alpaca  ttgcacaaagctcatgcagaacaccactggggaa
             Bactrian camel  ttgcacaaagctcatgcagaacaccactggggaa
                    Dolphin  ttgcacgaagctcatgcagaaaaccactggggag
               Killer whale  ttgcacgaagctcatgcagaaaaccactggggag
           Tibetan antelope  ttgtacgaagctcatgcagaacaccactaggtag
                        Cow  ttgcacaaagctcatgcagaacaccactggggag
                      Sheep  ttgtacgaagctcatgcagaacaccactaggtag
              Domestic goat  ttgtacgaagctcatgcagaacaccactaggtag
                      Horse  ttgcacaaagctcatgcagaacaccactggagaa
           White rhinoceros  ttgcacgaagctcatgcagaacaccactgaagaa
                        Cat  gtgcacaaagctcatgcggaacaccactagagaa
                        Dog  gtgcacaaagctcatgtggaacaccactagggaa
                      Panda  ttgcacaaagctcatgcggaacaccgctagagaa
             Pacific walrus  ttgcacaaagctcattcggaacaccgctagagaa
               Weddell seal  ttgcacaaagctcatgcggaacaccgctagagaa
           Black flying-fox  tggcatgaagctcatgcagaacaccactggggag
                    Megabat  tggcatgaagctcatgcagaacaccactggggag
              Big brown bat  tggcacgaagctcatgcagaacaccactggagaa
       David's myotis (bat)  tggcacgaagctcatgcagaacaccactggagga
                   Microbat  tggcacgaagctcatgcagaacaccactggagga
                   Hedgehog  ttgcacattgctcatggagaacaccactgcagaa
                      Shrew  ttcgacaaggcttatgtagaacacagctggagaa
            Star-nosed mole  ttgcacatagctcatgcagaacaccactggagaa
                   Elephant  ttgcacaaaggtcatggagaacacgactggagaa
        Cape elephant shrew  ttgtacaaacaccatggagaacaccactggagaa
                    Manatee  ttgcacaaagatcatggagaacacgactggagaa
           Cape golden mole  ttgcacaaagatcatggagaacacaactgaagaa
                     Tenrec  ttgtacaaagaccatggagaacaccactgcagag
                   Aardvark  ttgcacaaagatcatggagaacaccactggagga
                    Opossum  aaggtagcacttcatgctgaaaattactgaaaaa
            Tasmanian devil  aaggaagtacttcatgctgaaaattactgaaaaa
                    Wallaby  aaggaggcgcttcatgctgaaaatcactggaaaa

Inserts between block 23 and 24 in window
B D                Opossum 3bp
B D        Tasmanian devil 3bp
B D                Wallaby 385bp

Alignment block 24 of 219 in window, 112831431 - 112831468, 38 bps 
B D                   Human  a-gaag--ggggtcttgtggttaggg--acacagcagtgcagg
B D                   Chimp  a-gaag--ggggtcttgtggttaggg--acacagcagtgcagg
B D                 Gorilla  a-gaag--ggggtcttgtggttaggg--acatagcagtgcagg
B D               Orangutan  a-gaag--ggggtcttgtggttaggg--acacagcagtgcagg
B D                  Gibbon  a-gaag--ggagtcttgtggttaggg--acacagcagtgcagg
B D                  Rhesus  a-gaag--ggggtcttgtggttaggg--acacagcagtgcagg
B D     Crab-eating macaque  a-gaag--ggggtcttgtggttaggg--acacagcagtgcagg
B D                  Baboon  a-gaag--ggggtcttgtggttaggg--acacagcagtgcagg
B D            Green monkey  a-gaag--ggggtcttgtggttaggg--acacagcagtgcagg
B D                Marmoset  a-gaag--ggggtcttgtggttaggg--acacagcagtgcaag
B D         Squirrel monkey  a-gaag--agggtcttgtggttaggg--acacagcagtgcaag
B D                Bushbaby  a-agaggtggggtcttgtggttagga--acacagcggtgcagg
         Chinese tree shrew  a-agaga-gggaccttgtgattagag--acccagtagtgcagg
B D                Squirrel  a-agggc-ggggtctc--tggtcagg--ccac-gccgtgcagg
     Lesser Egyptian jerboa  a-ggaga-ggagtctg-tggtcaggg--acacagcagtgcatg
               Prairie vole  agggaga-gcaaactg--ggtcaagg--atacagccctgctgg
B D         Chinese hamster  a-ggaaa-acaaa-gg--ggttgagg--atacagcagtgctgg
             Golden hamster  a-ggaga-gcaaactg--ggtcaggg--atacagcagtgctgg
B D                   Mouse  a-ggaga-ggagtctg--ggtcaagg--gaacagcaatgcagg
B D                     Rat  a-ggaaa-ggagtctg--ggtcaagg--gcacagcagtgcagg
B D          Naked mole-rat  a-ggaga-gggatcttgtggtcaagg--acacagcattgccag
B D              Guinea pig  a-ggaga-gggaccttgtggttaggg--acacagcattgccag
                 Chinchilla  a-ggaga-gggaccttgtggtcaggg--gaacagtgttgccag
           Brush-tailed rat  g-agaga-gggatctcgtggttagcg--atgcagcagtgccag
B D                  Rabbit  a-ggaga-gaggcct-----tcaggg--gcgcagcagtgaagg
B D                    Pika  a-ggaaa-gggatcctgtggtcaggg--acatggcagcgcagg
B D                     Pig  a-ggaga-ggggcct-gtggtcaggg--acatagcactgcaga
B D                  Alpaca  a-ggaga-cgggtctagtggtcagggacatgcagcaccgcagg
             Bactrian camel  a-ggaga-agggcctagtggtcagggacatggagcaccgcagg
B D                 Dolphin  a-ggaaa-ggggtctcatggttagggacacacagcactgcaga
               Killer whale  a-ggaaa-ggggtctcatggttagggacacacagcactgcagg
           Tibetan antelope  a-ggaga-ggggtcttgc-gtcaggg--atatggcactgcagg
B D                     Cow  a-ggaga-agggtcttgtggtcaggg--atatggcactgcagg
B D                   Sheep  a-ggaga-ggggtcttgc-gtcaggg--atatggcactgcagg
              Domestic goat  a-ggaga-ggggtcttgc-gtcaggg--atatggcactgcagg
B D                   Horse  a-ggaga-ggggccttgtggtcagggacacacagcagtgcagg
B D        White rhinoceros  a-ggaga-ggggcctcgtggtcagggacacacagcagtgcggg
B D                     Cat  c-ggaaa-ggggccttgtggtcaggaacgcacagccatgcagg
B D                     Dog  a-agaag-ggggccttgtggtcaggaacacataacagtgcagg
B D                   Panda  a-agaaa-ggggccttgtggttaggaacacacagcagtgcaga
             Pacific walrus  a-gaaaa-ggggccttgtggtcaggaacacacagcagtgcaga
               Weddell seal  a-gaaaa-ggggccttgtggtcaggaacacacagcagtgcaga
           Black flying-fox  a-gga----gggccctgtggtcagggacacgcggccatacagg
B D                 Megabat  a-gga----gggccctgtggtcagggacacgcggccatgcagg
              Big brown bat  a-gaaga-ggggccttgtgcttagggatgcacagcagggcagg
       David's myotis (bat)  a-gaaga-ggggccttgtgctcagggatgcacagcagggcagg
B D                Microbat  a-gaaga-ggggccttgtgctcagggatgcacagcagggcagg
B D                Hedgehog  a-acaga-ggaactttgtggttagggacacacagcaatacctg
B D                   Shrew  a-ggaga--gggctgtatggtcagggatacataccagtacagg
            Star-nosed mole  g-gaaga-ggggccttgtggtcagggacacacagcagtgaagg
B D                Elephant  a-gaaga-gaggccttgtggtcaggtacttagagcagtgcagg
        Cape elephant shrew  a-gaaca-gaga--ttgtggtctagt-----------------
B D                 Manatee  a-gaaga-gaggccttgtggtcaggtacatagagcagtgcagg
           Cape golden mole  a-gaaga-gaggccttgaggtcagatatacatagcagtacaag
B D                  Tenrec  a-gaaga-gaggctttggggtcagggacttctagtag------
                   Aardvark  a-gaaga-gaggccttttgttctggtacatatagcagtgcagg
B D                 Opossum  --acaaa-ggaacagtgtggtgaatga-aaatcccagagcagg
B D         Tasmanian devil  --aaaaa-gaaacagtgtgatcaatgg-taattccagagcagg
B D                 Wallaby  ===========================================

Inserts between block 24 and 25 in window
B D                Opossum 1147bp

Alignment block 25 of 219 in window, 112831469 - 112831514, 46 bps 
B D                   Human  gtcaccccaacc----------cctagg-ccccatg-agtaggatacatgt-aatt---------tgg
B D                   Chimp  gtcaccccaacc----------cctagg-ccccatg-agtaggatacatgt-aatt---------tgg
B D                 Gorilla  gtcaccccaacc----------cctagg-ccccatg-agtaggatacatgt-aatt---------tgg
B D               Orangutan  gtcagcccaacc----------cctggg-ccccatg-agtaggatacatgt-aatt---------tgg
B D                  Gibbon  gtcagcccaacc----------cctgggcccccatg-agtaggatacatgt-aatt---------tgg
B D                  Rhesus  gtcagcccaacc----------cctggg-ccccatg-agtaggacacatgt-aatt---------tgg
B D     Crab-eating macaque  gtcagcccaacc----------cctggg-ccccatg-agtaggacacatgt-aatt---------tgg
B D                  Baboon  gtcagcccaacc----------cctggg-ccccatg-agtaggacacatgt-aatt---------tgg
B D            Green monkey  ----gcccaacc----------cctggg-ccccatg-agtaggacacatgt-aatt---------tgg
B D                Marmoset  gtcagcccaacc----------cctggc-ccccatg-agtaggatacatgc-aatg---------tgg
B D         Squirrel monkey  gtcagcccaacc----------cctggg-ccccatg-agtgggatacatgc-aatt---------tgg
B D                Bushbaby  gccagcccaacc----------cctgga-cctcatg-ggcaggacttgtac-aatg---------tag
         Chinese tree shrew  gtcaatatcacc----------cctggg-ccttacataacagtatttgtac-aagt---------tag
B D                Squirrel  gtgggcccaagc----------actgcc-cgccaaa-cccgggacccacacaagttagc---------
     Lesser Egyptian jerboa  gtggcctcaagc----------acctgt-ctccatg-tgtaggacccatag-agtc------------
               Prairie vole  gaggttgcaagc----------cccaga-cttgata-gacaaagtccatac-agtc------------
B D         Chinese hamster  gaggactcaaac----------tccaga-cttgaca-ggcaa--------------------------
             Golden hamster  gcggactcaaac----------tcggga-cttgaca-ggcaaagcccacat-agtcag----------
B D                   Mouse  gtgggctcaagc----------attaga-cgtgaca-ggcaaagcctatgc-agtc------------
B D                     Rat  gtggactcaagc----------attaga-cccacca-ggcaaaccccatgc-agtc------------
B D          Naked mole-rat  gtgagcccaacc----------gctgga-ctctaca-tacagaactcagac-aatt---tta------
B D              Guinea pig  gtgggcccaacc----------actgga-ctgcata-tgtagaacttagac-aatt---taa------
                 Chinchilla  gtgggtccac-c----------actggc-ctccacg-at-agaactcagat-catt---tta------
           Brush-tailed rat  gtgggcccaagt----------gctaga-ctccaca-gcgagaactcag-----tt---tta------
B D                  Rabbit  gtggtcccggct----------gctgga-ccccaca-ctcacgactcgtgc-agct------gaa---
B D                    Pika  gccgacccaact----------gctgga-ccccaca-tgtgggactcacacaaact------gag---
B D                     Pig  gttggaccaagc----------actgga-cccttag-cctaggactggtgc-catt---------tag
B D                  Alpaca  gtcggcccaacc----------actggg-ccccaag-cccaggactcatac-aatt---------tag
             Bactrian camel  gtcggcccaacc----------actggg-ccccaag-cccaggactcatac-aatt---------tag
B D                 Dolphin  ------------------------------------------gactcttac-aatt---------tag
               Killer whale  ------------------------------------------gactcttac-aatt---------tag
           Tibetan antelope  gtcagcccaatc----------cctgaa-ccccaag-cccaagactcgtac--gta---------tag
B D                     Cow  gtcagcccaatc----------cctgga-ccccaag-cccaagactcatac-agta---------tag
B D                   Sheep  gtcagcccaatc----------cctgaa-ccccaag-cccaagactcatac-agta---------tag
              Domestic goat  gtcagcccaatc----------cctgaa-ccccaag-cccaagactcgtac-agta---------tag
B D                   Horse  gttggcccaacc----------attgga-ccccaac-tccaggactcctac-aatt---------tag
B D        White rhinoceros  gttggcccagcc----------attggc-ccccaag-ccccggactcgtag-agtt---------tag
B D                     Cat  gctggcccaaca----------gctgga-cctcgag-cccaggactcatac-aa-t---------taa
B D                     Dog  gttagcccagct----------actaga-ccccaaa-cccaggactcatac-aa-t---------taa
B D                   Panda  gttggcacaacc----------actgga-ctccaag-cccgggactcatac-aa-t---------taa
             Pacific walrus  gttggcccaacc----------actgga-ccccaag-cccaggactcatac-aa-t---------taa
               Weddell seal  gttggcccaacc----------actgga-ccccaag-cccaggactcatac-aa-t---------taa
           Black flying-fox  gccagccc-acc----------aaggca-tcccaag-cccaggacctgtat-aac-------------
B D                 Megabat  gccagccc-acc----------aaggga-tcccaag-cccaggacctgtat-aac-------------
              Big brown bat  gttggcccaacc----------actgga-ccccaag-cccaaaactcatct-aatt---------tag
       David's myotis (bat)  gttggcccaatc----------actgga-ccccaag-cccaagactcatct-aatt---------tag
B D                Microbat  gatggtccaatc----------acagga-ccccaag-cccaagactcatct-aatt---------tag
B D                Hedgehog  gctgatccaacc----------agtggc-ccctgaa-cccaggacccataa-cata---------aac
B D                   Shrew  actggcctaacc----------actgga-ccccaag-tccagaatctgtac-agca---------tag
            Star-nosed mole  gttggccca-------------actgga-ccctgag-cccagggcccacac-actg---------tgg
B D                Elephant  ctggacccaacc----------gctgaa-cccctat-ttcaggaccagtac-aagt---------cag
        Cape elephant shrew  -----------------------ttaat-ttcctgt-tccaggatcagtag-aaat---------tga
B D                 Manatee  ctggacctaacag---------gttgaa-cccctat-tccaggaccagtac-aagt---------tag
           Cape golden mole  ctggacccaatc-----------accaa-atccctc-ttcaggaccagtac-aagt---------tag
B D                  Tenrec  -ggaacccaacc-----------ccca-------tc-tccaagaccagtgc-ac-t---------tgg
                   Aardvark  ctggacccaatc----------actgaa-cccctat-tccaggaccagtac-aagt---------taa
B D         Tasmanian devil  -tattcttaatcttatttgtaccatgga-cttcttg-agta-gtcttgtga-ggtc---------taa
B D                 Wallaby  ====================================================================
B D                 Opossum  ====================================================================

Inserts between block 25 and 26 in window
B D         Naked mole-rat 1bp
B D             Guinea pig 1bp
                Chinchilla 179bp
          Brush-tailed rat 1bp

Alignment block 26 of 219 in window, 112831515 - 112831587, 73 bps 
B D                   Human  tagcctctgt-ggg------------------------aacc--cacagt----gaggttcc-ttggc--
B D                   Chimp  tagcctctgt-ggg------------------------aacc--cacagt----gaggttcc-ttggc--
B D                 Gorilla  taccctctgt-ggg------------------------aacc--cacagt----gaggttcc-ttggc--
B D               Orangutan  tagcctctgt-ggg------------------------aacc--cacagt----gaggttcc-ttggc--
B D                  Gibbon  tagcctctgt-ggg------------------------aacc--cacagt----gaggttcc-ttggc--
B D                  Rhesus  tatcctctgt-ggg------------------------aacc--cacagt----gaggctcc-ttggc--
B D     Crab-eating macaque  tatcctctgt-ggg------------------------aacc--cacagt----gaggctcc-ttggc--
B D                  Baboon  tatcctctgt-ggg------------------------aacc--cacagt----gaggttcc-ttggc--
B D            Green monkey  tatcctctgt-ggg------------------------aacc--cacagt----gaggttcc-ttggc--
B D                Marmoset  tagcccctgt-ggg------------------------aaca--cacagt----gaggctcc-ttggc--
B D         Squirrel monkey  tagcccctgt-ggg------------------------aaca--cacagt----gaggttcc-ttggt--
B D                Bushbaby  catcctctgt-ggg------------------------aacc--cacagt----gaggctct-ttggc--
         Chinese tree shrew  catcctctgt-ggg------------------------aacc--cacagg----aagtttcctttagc--
B D                Squirrel  -tctccctgt-ggg------------------------aacc----------------------------
     Lesser Egyptian jerboa  ----ctctgt-ggg------------------------aacc--tgcagt----aagcttcctttctc--
               Prairie vole  ----ctctgt-ggg------------------------gacc--cagaag----gagcttccctgggt--
B D         Chinese hamster  --------------------------------------agcc--cagaag----gagcttcctctggc--
             Golden hamster  --tactctgt-ggg------------------------agcc--cagaag----gagcttccacaggc--
B D                   Mouse  ----ccccgt-gtg------------------------aacc--cagaat----gagcctcctcagac--
B D                     Rat  ----ctctgt-ggg------------------------accc--cagaat----gagcttcctcagac--
B D          Naked mole-rat  catcccctat-gag------------------------aaac--cacagt----gaggcccatttggc--
B D              Guinea pig  catcctccat-ggg------------------------aaac--cacagt----gagggccctttggc--
           Brush-tailed rat  catcctccat-ggg------------------------ggat--cacagtgagggagggctctttggc--
B D                  Rabbit  cctcctctgt-ggg------------------------aacc--tacatt----gagtgtcctttggc--
B D                    Pika  catcctctgt-ggg------------------------agcc--cacagt----aaggttcctttggc--
B D                     Pig  gatcctcttt-ag-------------------------catc--ca---------aaattcctatggc--
B D                  Alpaca  catcctctgt-ggg------------------------aacc--cacacc----gaggttcctgtggc--
             Bactrian camel  catcctctgt-ggg------------------------aacc--cacacc----gaggttcctgtggc--
B D                 Dolphin  catcctctgc-gga------------------------aacc--cacacc----gaggtccctatggc--
               Killer whale  catcctctgc-gga------------------------aacc--cacacc----gaggttcctgtggc--
           Tibetan antelope  caccctctgt-gggaactgacactgaggttcctatggcaacc--cacact----gaggttcctacagc--
B D                     Cow  catcctctgt-gggaacccacactgaggttcttatggcaacc--cacact----gaggttcctacagc--
B D                   Sheep  catcctctgt-gggaactgacactgaggttcctatggcaacc--cacact----gaggttcctacagc--
              Domestic goat  caacctctgt-gggaactgacactgaggttcctatggcaacc--cacact----gaggttcctacagc--
B D                   Horse  catcctctgt-gga------------------------aacc--cacact----cgggttcctatggc--
B D        White rhinoceros  catcctctgt-gga------------------------aacc--cacatt----gagtttcctgtggc--
B D                     Cat  catcttctgt-ggg------------------------aacc--cacact----aagattcttatggc--
B D                     Dog  catcttctgt-gag------------------------agcc--cacact----gaggtccccatggc--
B D                   Panda  catcttctgt-ggg------------------------aacc--cgcact----gaggttcctgtggc--
             Pacific walrus  ca---tctgt-ggg------------------------aacc--cacact----gaggttctcatggc--
               Weddell seal  catcttctgt-ggg------------------------aacc--cacact----gaggttctcatggc--
           Black flying-fox  -ctcctctgt-ggg------------------------agcc--cccat---------------------
B D                 Megabat  -ctcctctgt-ggg------------------------agcc--cccat---------------------
              Big brown bat  cctcctctgt-ggg------------------------aacc--tccct---------------------
       David's myotis (bat)  gttcttctgt-aag------------------------gacc--tccct---------------------
B D                Microbat  gctcttctgt-aag------------------------aacc--tccgt---------------------
B D                Hedgehog  cattctttgt-gag------------------------aa------------------gtcctgtgac--
B D                   Shrew  catcctttgtgatg------------------------aa-g--ttttct----gagaattttaggacag
            Star-nosed mole  catcccctgc-agg------------------------ga-c--tacact----gtg-atcctatgac--
B D                Elephant  cattctctgt-ggg------------------------aagc--cgcaca----g--tttcctcccac--
        Cape elephant shrew  catactctgt-ggg------------------------aactcacacaca----g--atccttttggc--
B D                 Manatee  cgtccactgc-cgg------------------------aagc--cacaca----g--tttcctctggc--
           Cape golden mole  catcctctgt-ggg------------------------aacc--cataca----gagatttctctaac--
B D                  Tenrec  catcctcact-ggg------------------------cccc--cgcaaa----ggcgtttttttagt--
                   Aardvark  catactctgt-ggg------------------------aagc--tgtaca----gaggttcctttagc--
B D         Tasmanian devil  -------------------------------agatcacttct--cagaat----aaggtcct--------
                Chinchilla  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Opossum  ======================================================================

                      Human  --ctaagacacaggat------aacttgacttc----------tcacagac-aat-a
                      Chimp  --ctaagacacaggat------aacttgacttc----------tcacagac-aat-a
                    Gorilla  --ctaagacacaggat------aacttgacttc----------tcacagac-aat-a
                  Orangutan  --ctaagagacaggat------aacttgacttc----------tcacagac-aat-a
                     Gibbon  --ctaagagacaggat------aacttgacttc----------tcacagac-aat-a
                     Rhesus  --ctaagagacaggat------aacttgacttc----------tcacagac-aat-a
        Crab-eating macaque  --ctaagagacaggat------aacttgacttc----------tcacagac-aat-a
                     Baboon  --ctaagagacaggat------aacttgacttc----------tcacagac-aat-a
               Green monkey  --ctaagagacaggat------aacttgacttc----------tcacagat-agt-a
                   Marmoset  --ctaagagacaggat------agcttgacttc----------tcacagacaagc-a
            Squirrel monkey  --ctaagagacaggat------aacttgacttc----------tcacagac-ggc-a
                   Bushbaby  --ctgacagaaaggat------agcttggctcc----------ttacagat-gat-a
         Chinese tree shrew  --ctaaaagacaggat------aacttggcttc----------tca-aaac-tat-a
                   Squirrel  -----------------------gctggcctgc----------------ac-aac-a
     Lesser Egyptian jerboa  --atagcagatgaggt------aactgtgcttt----------tcacagac-aac-a
               Prairie vole  --acaga--cagggct------agcagggcttc----------gcatagat-agt-a
            Chinese hamster  --acaga--ctgggct------aacacggcttc----------tcatagac-agt-a
             Golden hamster  --acaga--atgggct------agcagggcctc----------tcatagac-agt-a
                      Mouse  --acaagatatggact------agcagggctatacagtcatagtcatagac-agt-a
                        Rat  --acaagatatggact------agtagtgctagacaatcatagtcatatac-agt-a
             Naked mole-rat  --cccacagataggat------ca-atggcttc----------tcatggat-aat-a
                 Guinea pig  --cttgcaaataagac------ag-gtaacttt----------tcaccgat-tat-a
           Brush-tailed rat  --ttcacagaaaggtt------aa-aagactcc----------tcacagat-aac-a
                     Rabbit  --ctaacagacagaac------cactgggcttc----------tcacagac-aat-a
                       Pika  --ctagtagaaaaggt------aactgggcttc----------ccacagct-aac-a
                        Pig  --ctcatagacaggag------ag-ctggcttc----------tcccagac-aat-a
                     Alpaca  --ccaacagacaggat------atcctggcttc----------tcacagac-aat-a
             Bactrian camel  --ccaacagacaggat------atcctggcttc----------tcacagac-aat-a
                    Dolphin  --ttaacagacagggt------aatggggcttc----------tcacagat-cat-a
               Killer whale  --ttaacagacagggt------aatggggcttc----------tcacagat-cat-a
           Tibetan antelope  --ctaacagatagggt------aa-------tc----------ccacagat-cat-a
                        Cow  --ctaacagatagggt------aa-------tc----------ccacagat-cat-a
                      Sheep  --ctaacagatagggt------aa-------tc----------ccacagat-cat-a
              Domestic goat  --ctaacagataaggt------aa-------tc----------ccacagat-cat-a
                      Horse  --ctaacagataggat------aacttggcttc----------tcacagac-aat-a
           White rhinoceros  --ctaacagatagaat------aactgggcttc----------tcacag--------
                        Cat  --ctaacagacaggat------aacttggcttg----------tcacagac-ggt-a
                        Dog  --ctaacagataggat------aacttggcttc----------tcataggc-aat-a
                      Panda  --ctaacaggtaggat------aacttggcttc----------ccacagac-aat-a
             Pacific walrus  --ccaacagatgggat------aacttggcttc----------ccacaggc-aataa
               Weddell seal  --ctaacagatgggat------aacttggcttc----------ccacagac-aat-a
           Black flying-fox  --------------------------cggcttc----------tcacag----ac-a
                    Megabat  --------------------------cggcttc----------tcacag----ac-a
              Big brown bat  -------------------------atggattc----------tcatgggt-tat-a
       David's myotis (bat)  -------------------------atggattt----------tcactggt-tat-a
                   Microbat  -------------------------atggattc----------tcactggt-tat-a
                   Hedgehog  --ctagtaaccaggat------accttggtctt----------tcacagac-aaa-t
                      Shrew  taataacagacaggac------aacttagcttc----------tcacaggc-agt-a
            Star-nosed mole  --ctaactggcaggac------aacttagcttc----------tcataaat-aac-a
                   Elephant  --ctaacagacaagat------cacttggtttc----------tcacagag-aat-c
        Cape elephant shrew  --ctaataggaaaggt------gacctggcttc----------tcccagac-aat-a
                    Manatee  --ccaacagacaagat------cactttgcttc----------tcacagag-aat-a
           Cape golden mole  --ctaataggcaagat------cacttggcttc------------------------
                     Tenrec  --ccaccagacaaggtt---ggcacagaggcta------------------------
                   Aardvark  --ctaatagacaagac------cacttgacttc----------tcacaatt-a----
            Tasmanian devil  --taaatatataaaattttaaaaatataagaat----------acatagga-aat-c
                 Chinchilla  =========================================================
                    Wallaby  =========================================================
                    Opossum  =========================================================

Inserts between block 26 and 27 in window
       Cape elephant shrew 1276bp

Alignment block 27 of 219 in window, 112831588 - 112831607, 20 bps 
B D                   Human  ----gcagggtcattttgttgatt
B D                   Chimp  ----gcagggtcatttcgttgatt
B D                 Gorilla  ----gcagggtcatttcgttgatt
B D               Orangutan  ----gcaggatcatttcgttgatt
B D                  Gibbon  ----gcagggtcctttcgttgatt
B D                  Rhesus  ----gcagggtcatttcattgatt
B D     Crab-eating macaque  ----gcagggtcatttcattgatt
B D                  Baboon  ----gcagggtcatttcattgatt
B D            Green monkey  ----gcagggtcatttcattgatt
B D                Marmoset  ----gcagggtcatttggttgatt
B D         Squirrel monkey  ----gcagggtcatttggttgatt
B D                Bushbaby  ----gtgggatcaatttattcttt
         Chinese tree shrew  ----gtagggttggttggttgatt
B D                Squirrel  ----gcagggtcgggggctggttc
     Lesser Egyptian jerboa  ----gtatggtgatttggttgatt
               Prairie vole  ----gcaaggtcaggaggctgctc
B D         Chinese hamster  ----tcaaggtcaggcggttgagc
             Golden hamster  ----ctgaggtcgggcaactgagt
B D                   Mouse  ----gcaaggtcagtaggccgatc
B D                     Rat  ----gcaaggtcagtgggctgatc
B D          Naked mole-rat  ----gctgagt-------------
B D              Guinea pig  ----gctgggctagttggttgatc
           Brush-tailed rat  ----gctgggtcagttggttgatt
B D                  Rabbit  ----gcagggtcactcggatgatt
B D                    Pika  ----gtagggtcacttggttgatt
B D                     Pig  ----acaggttcagttggttgaat
B D                  Alpaca  ----gccagttcaggtggttacat
             Bactrian camel  ----gccagttcaggtggttacat
B D                 Dolphin  ----gcaggttcagttggttgaaa
               Killer whale  ----gcaggttcagttggttgaaa
           Tibetan antelope  ----gcagcttcagtttcttgaaa
B D                     Cow  ----gcagcttcagtttcttgaaa
B D                   Sheep  ----gcagcttcagtttcttgaaa
              Domestic goat  ----gcagcttcagtttcttgaaa
B D                   Horse  ----tcacggccacttggttgatt
B D        White rhinoceros  --------ggtcagttggttgctt
B D                     Cat  ----gcagggttagttgcctgatt
B D                     Dog  ----gcagggttagttggttgatt
B D                   Panda  ----ccagggtcaattggttgatt
             Pacific walrus  ----gcagggttagttggttgatt
               Weddell seal  ----gcagggttagttggttgatt
           Black flying-fox  ----gca-tgtcagtgggttgatt
B D                 Megabat  ----gca-tgtcagtgggttgatt
              Big brown bat  ----gcagggtcagttggttgatt
       David's myotis (bat)  ----gcagggtcagtt-gtttatt
B D                Microbat  ----gcagggtcagttggttgatt
B D                Hedgehog  ----gtaaacttagttgcctaatt
B D                   Shrew  ----gcaggattaatcaaattatt
            Star-nosed mole  ----tcagggtctgttggttgatt
B D                Elephant  ----ccagggctagttggttgttt
B D                 Manatee  ----gctgggttagttggttgatt
           Cape golden mole  ----tcagggttagctgcttggtc
B D                  Tenrec  ----ggagggtgagttggtgggtt
                   Aardvark  ----gcagagttagttggttggtt
B D         Tasmanian devil  acttctagtgaaattctattgt--
                Chinchilla  ========================
       Cape elephant shrew  ========================
B D                 Wallaby  ========================
B D                 Opossum  ========================

Alignment block 28 of 219 in window, 112831608 - 112831659, 52 bps 
B D                   Human  t---agggt-ttcccc-tca--aaggcctg--agggtttctc------a------------------gag
B D                   Chimp  t---agggt-ttcccc-tca--aaggcctg--agggtttctc------a------------------gag
B D                 Gorilla  t---agggt-ttcccc-tca--aaggcctg--agggtttctc------a------------------gag
B D               Orangutan  t---agggt-ttcccc-tca--aaggcctg--agggtttctc------a------------------gag
B D                  Gibbon  t---agggt-ttcccc-tca--aaggcctg--agggtttctc------a------------------gag
B D                  Rhesus  t---agggt-ttcccc-tca--aaggcctg--agggtttctc------a------------------gag
B D     Crab-eating macaque  t---agggt-ttcccc-tca--aaggcctg--agggtttctc------a------------------gag
B D                  Baboon  t---agggt-ttcccc-tca--aaggcctg--agggtttctc------a------------------gag
B D            Green monkey  t---agggt-ttcccc-tca--aaggcctg--agggtttctc------a------------------gag
B D                Marmoset  t---agggt-ttcccc-caa--aaggcctg--agggt---------------------------------
B D         Squirrel monkey  t---agggt-ttcccc-caa--aaggcctg--agggtttctc------t------------------gag
B D                Bushbaby  c---aaggt-ttccccagta--aaggtccc--agggtttctt------a------------------ggt
         Chinese tree shrew  c---a--gt-ttcccc-acag-aaggtcta--aaggtttctt------a------------------gag
B D                Squirrel  c---gggat-tcccca-gag--aaggcccg--ataggttcac------a------------------aag
     Lesser Egyptian jerboa  c---agggt-ttgtca-agg--aacacatg--aaggtttctc------a------------------gag
               Prairie vole  c---aggct---------------------------ttcctc------g------------------gaa
B D         Chinese hamster  c---aggat---------------------------ccactc------a------------------gaa
             Golden hamster  c---aggat---------------------------ccactc------a------------------gaa
B D                   Mouse  c---aggat---------------------------tccctc------a------------------gga
B D                     Rat  c---agggt---------------------------ttcctc------a------------------ggg
B D          Naked mole-rat  ----------------------------------------------------------------------
B D                  Rabbit  c---agtttttccccg-aag--aaaggctg--aagatttctttatgaac------------------gtg
B D                    Pika  c---aggctttttccc-caa--aaggtcag--aaggttcctatttgaag------------------gtg
B D                     Pig  c---aggtt-tttccccaaagaagggtctg--ggggcttctc------a------------------gag
B D                  Alpaca  c---agatt-tttccccaaa----gatcta--gaggcttctc------a------------------gag
             Bactrian camel  c---agatt-tttccccaaa----gatcta--gaggcttctc------a------------------gag
B D                 Dolphin  c---aggtt-tttccccaaag-aaggtcta--ggggcttctc------a------------------gag
               Killer whale  c---aggtt-tttccccagag-aaggtcta--ggggcttctc------a------------------gag
           Tibetan antelope  c---aggtt-ttcccctcaa--atggtctg--ggggcttctc------a------------------aag
B D                     Cow  c---aggtg-tttccctcaa--atggtctg--ggggcttctc------a------------------gag
B D                   Sheep  c---aggtt-ttcccctcaa--atggtctg--ggggcttctc------a------------------aag
              Domestic goat  c---aagtt-ttcccctcaa--atggtctg--ggggcttctc------a------------------aag
B D                   Horse  c---aagtt-tccatcccaa--aatgtcta--ggggtttctc------a------------------gag
B D        White rhinoceros  c---aggtt-ttccccaaag--aacgtcta--ggggtttctc------a------------------gag
B D                     Cat  tc--atatt-ttctagaaag--aaggtctgcaggggtttctt------a------------------gag
B D                     Dog  c------tt-ttctccaaag--aatgtctg--ggggtttctt------a------------------aag
B D                   Panda  c------tt-ttctccaaag--agggtctg--ggggtttctt------a------------------aag
             Pacific walrus  c------tt-ttctccaaag--aaggtctg--ggggtttctt------a------------------gag
               Weddell seal  c------tt-ttctccaaag--aaggtctg--ggggtttctt------a------------------gag
           Black flying-fox  ----aagtt-tttcccacag--aagctctg--agggcctcac------a------------------gag
B D                 Megabat  ----aagtt-tttcccacag--aagctctg--agggcctcac------a------------------gag
              Big brown bat  c---cagtt-tttcctagag--aaggtctg--gggacttccc------a------------------gag
       David's myotis (bat)  c---cagtt-tttcccagag--aaggtctg--gggacttccc------a------------------gaa
B D                Microbat  c---cagtt-tttcccagag--aaggtctg--gggacttccc------a------------------gag
B D                Hedgehog  c---agatt-ttctc-acag--aaggaaag--aggatttctt------gccccaaaaggtatttttcaga
B D                   Shrew  c---caact-g-----aaag--aaggtagg--gagatttctt------a------------------gag
            Star-nosed mole  a---tgagt-gtccccacag--aaagtcta--gggg-ttctc------a------------------gtg
B D                Elephant  c---agagt-ttcctcaaag--aaggtctg--agggcttctc------a------------------gtg
B D                 Manatee  c---agggt-ttcctccaag--aaggtctg--agggtttctc------a------------------gtg
           Cape golden mole  c---aagtt-tttctcagag--a---tctg--aaagtttttc------a------------------gag
B D                  Tenrec  c---agggt-ttcctccaag--aaggcttg--agagtgtctc------a------------------gag
                   Aardvark  c---agcat-ttcttccaag--aaggtctg--agagtttctc------a------------------gag
B D         Tasmanian devil  -taaattat-ttttttaaaa--aaagttca--gg------------------------------------
B D              Guinea pig  ----------------------------------------------------------------------
          Brush-tailed rat  ----------------------------------------------------------------------
                Chinchilla  ======================================================================
       Cape elephant shrew  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Opossum  ======================================================================

                      Human  cctcatagcagtagg
                      Chimp  cctcatagcagtagg
                    Gorilla  cctcatagcagtagg
                  Orangutan  cctcatagcagtagg
                     Gibbon  cctcatagcagtagg
                     Rhesus  cctcatagaagtgga
        Crab-eating macaque  cctcatagaagtgga
                     Baboon  cctcatagaagtgga
               Green monkey  cctcatagaagtgca
                   Marmoset  -ttcagag-ggtaac
            Squirrel monkey  cttcagag-ggtaat
                   Bushbaby  cctcatagcagtggc
         Chinese tree shrew  acttttagtagtgtt
                   Squirrel  cctctt-------ga
     Lesser Egyptian jerboa  tctcttaattgtggt
               Prairie vole  cctcttagtagcggt
            Chinese hamster  cctcttagtagcagc
             Golden hamster  cctcttagtagcagc
                      Mouse  cctcttaggagcagc
                        Rat  cctcttaggagcagc
             Naked mole-rat  --------tagtggg
                     Rabbit  cctctttatggtagt
                       Pika  ccttttcatagcaga
                        Pig  cctcaccacagtggc
                     Alpaca  cctcatcacagtgac
             Bactrian camel  cctcatcacagtgac
                    Dolphin  cctcaccacagcggc
               Killer whale  cctcaccacagtggc
           Tibetan antelope  actcatcctagtggc
                        Cow  actcatcatagtggc
                      Sheep  actcatcctagtggc
              Domestic goat  actcatcctagtggc
                      Horse  cttcatcacagtggc
           White rhinoceros  ctttgtcaccgtggc
                        Cat  cctcatcacagtggc
                        Dog  cctcatcata-tggc
                      Panda  cctcattacagtggc
             Pacific walrus  cctcatcacagtggc
               Weddell seal  cctcatcacagtggc
           Black flying-fox  cctcaccaccatggt
                    Megabat  cctcaccaccatggt
              Big brown bat  cct-attacagtggc
       David's myotis (bat)  cct-attacagtggc
                   Microbat  cct-attacagtggc
                   Hedgehog  ctttatcacagtggt
                      Shrew  acttaccttagaggc
            Star-nosed mole  tctcattgcagtggc
                   Elephant  cctcacaacagtgac
                    Manatee  cctcacagtaatgac
           Cape golden mole  cctcacaataatgat
                     Tenrec  ccttttgagggtgac
                   Aardvark  cttcatagaaatggc
            Tasmanian devil  ---------------
                 Guinea pig  ---------------
           Brush-tailed rat  ---------------
                 Chinchilla  ===============
        Cape elephant shrew  ===============
                    Wallaby  ===============
                    Opossum  ===============

Alignment block 29 of 219 in window, 112831660 - 112831682, 23 bps 
B D                   Human  -------aacggagaatg----------------------------------------------------
B D                   Chimp  -------aacggagaatg----------------------------------------------------
B D                 Gorilla  -------aacggagaatg----------------------------------------------------
B D               Orangutan  -------aatggagaatg----------------------------------------------------
B D                  Gibbon  -------aatggagaacg----------------------------------------------------
B D                  Rhesus  -------aatggagaatg----------------------------------------------------
B D     Crab-eating macaque  -------aatggagaatg----------------------------------------------------
B D                  Baboon  -------aatggagaatg----------------------------------------------------
B D            Green monkey  -------aatggagaatg----------------------------------------------------
B D                Marmoset  -------ggtggagaatg----------------------------------------------------
B D         Squirrel monkey  -------agtggagaatg----------------------------------------------------
B D                Bushbaby  -------aatgaagaata----------------------------------------------------
         Chinese tree shrew  -------aatgaagaatg----------------------------------------------------
B D                Squirrel  -------aatggggacta----------------------------------------------------
     Lesser Egyptian jerboa  -------aattaagaatg----------------------------------------------------
               Prairie vole  -------aacaaagaggg----------------------------------------------------
B D         Chinese hamster  -------aatgaagaatg----------------------------------------------------
             Golden hamster  -------aacgaagaatg----------------------------------------------------
B D                   Mouse  -------aatgaagaacg----------------------------------------------------
B D                     Rat  -------aatggagagga----------------------------------------------------
B D              Guinea pig  -------aatgtagaggg----------------------------------------------------
B D                  Rabbit  -------aatgaaaggga----------------------------------------------------
B D                    Pika  -------aatgaagagtg----------------------------------------------------
B D                     Pig  -------aataaacaatt----------------------------------------------------
B D                  Alpaca  -------agtgaagaattcgggggcttggggaagggaagggtatagctcagtggtagaatacatgcctag
             Bactrian camel  -------agtgaagaattagggggcttggggaggggaagggtatatctcagtggtagaatacatgcctag
B D                 Dolphin  -------aatgaagaatc----------------------------------------------------
               Killer whale  -------aatgaagaatc----------------------------------------------------
           Tibetan antelope  -------agtgaaaaatc----------------------------------------------------
B D                     Cow  -------aatgaaaaatc----------------------------------------------------
B D                   Sheep  -------aatgaaaaatc----------------------------------------------------
              Domestic goat  -------aatgaaaaatc----------------------------------------------------
B D                   Horse  -------aatgaagaatt----------------------------------------------------
B D        White rhinoceros  -------aatgaagaatt----------------------------------------------------
B D                     Cat  -------aatgaagaatt----------------------------------------------------
B D                     Dog  -------aatgaagaatt----------------------------------------------------
B D                   Panda  -------aatgaagaatt----------------------------------------------------
             Pacific walrus  -------agtgaagaatt----------------------------------------------------
               Weddell seal  -------aatgaagaatt----------------------------------------------------
           Black flying-fox  -------aatgaa---tt----------------------------------------------------
B D                 Megabat  -------aatgaa---tt----------------------------------------------------
              Big brown bat  -------agtgaagaatt----------------------------------------------------
       David's myotis (bat)  -------agggaagagtg----------------------------------------------------
B D                Microbat  -------agagaagagtt----------------------------------------------------
B D                Hedgehog  -------aactgagaatt----------------------------------------------------
B D                   Shrew  -------aataaggtatt----------------------------------------------------
            Star-nosed mole  -------agtggagcatt----------------------------------------------------
B D                Elephant  -------aacgaagaatt----------------------------------------------------
B D                 Manatee  -------aatgaagaatt----------------------------------------------------
           Cape golden mole  -------aatgaagaatt----------------------------------------------------
B D                  Tenrec  -------agtgaaggatt----------------------------------------------------
                   Aardvark  -------aatgaagaatt----------------------------------------------------
B D         Tasmanian devil  aaccccaagttaagaact----------------------------------------------------
          Brush-tailed rat  ----------------------------------------------------------------------
B D          Naked mole-rat  ----------------------------------------------------------------------
                Chinchilla  ======================================================================
       Cape elephant shrew  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Opossum  ======================================================================

                      Human  ----------------------------------------------------------------------
                      Chimp  ----------------------------------------------------------------------
                    Gorilla  ----------------------------------------------------------------------
                  Orangutan  ----------------------------------------------------------------------
                     Gibbon  ----------------------------------------------------------------------
                     Rhesus  ----------------------------------------------------------------------
        Crab-eating macaque  ----------------------------------------------------------------------
                     Baboon  ----------------------------------------------------------------------
               Green monkey  ----------------------------------------------------------------------
                   Marmoset  ----------------------------------------------------------------------
            Squirrel monkey  ----------------------------------------------------------------------
                   Bushbaby  ----------------------------------------------------------------------
         Chinese tree shrew  ----------------------------------------------------------------------
                   Squirrel  ----------------------------------------------------------------------
     Lesser Egyptian jerboa  ----------------------------------------------------------------------
               Prairie vole  ----------------------------------------------------------------------
            Chinese hamster  ----------------------------------------------------------------------
             Golden hamster  ----------------------------------------------------------------------
                      Mouse  ----------------------------------------------------------------------
                        Rat  ----------------------------------------------------------------------
                 Guinea pig  ----------------------------------------------------------------------
                     Rabbit  ----------------------------------------------------------------------
                       Pika  ----------------------------------------------------------------------
                        Pig  ----------------------------------------------------------------------
                     Alpaca  catgcatgaggtcctggcttcaatccccagtacctccattaaaaataaataaataaacctaattacctcc
             Bactrian camel  catgcatgaggtcctggcttcaatccccagtacctccattaaaaataaataaataaacctaattacctcc
                    Dolphin  ----------------------------------------------------------------------
               Killer whale  ----------------------------------------------------------------------
           Tibetan antelope  ----------------------------------------------------------------------
                        Cow  ----------------------------------------------------------------------
                      Sheep  ----------------------------------------------------------------------
              Domestic goat  ----------------------------------------------------------------------
                      Horse  ----------------------------------------------------------------------
           White rhinoceros  ----------------------------------------------------------------------
                        Cat  ----------------------------------------------------------------------
                        Dog  ----------------------------------------------------------------------
                      Panda  ----------------------------------------------------------------------
             Pacific walrus  ----------------------------------------------------------------------
               Weddell seal  ----------------------------------------------------------------------
           Black flying-fox  ----------------------------------------------------------------------
                    Megabat  ----------------------------------------------------------------------
              Big brown bat  ----------------------------------------------------------------------
       David's myotis (bat)  ----------------------------------------------------------------------
                   Microbat  ----------------------------------------------------------------------
                   Hedgehog  ----------------------------------------------------------------------
                      Shrew  ----------------------------------------------------------------------
            Star-nosed mole  ----------------------------------------------------------------------
                   Elephant  ----------------------------------------------------------------------
                    Manatee  ----------------------------------------------------------------------
           Cape golden mole  ----------------------------------------------------------------------
                     Tenrec  ----------------------------------------------------------------------
                   Aardvark  ----------------------------------------------------------------------
            Tasmanian devil  ----------------------------------------------------------------------
           Brush-tailed rat  ----------------------------------------------------------------------
             Naked mole-rat  ----------------------------------------------------------------------
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
                    Wallaby  ======================================================================
                    Opossum  ======================================================================

                      Human  ----------------------------------------------------------------------
                      Chimp  ----------------------------------------------------------------------
                    Gorilla  ----------------------------------------------------------------------
                  Orangutan  ----------------------------------------------------------------------
                     Gibbon  ----------------------------------------------------------------------
                     Rhesus  ----------------------------------------------------------------------
        Crab-eating macaque  ----------------------------------------------------------------------
                     Baboon  ----------------------------------------------------------------------
               Green monkey  ----------------------------------------------------------------------
                   Marmoset  ----------------------------------------------------------------------
            Squirrel monkey  ----------------------------------------------------------------------
                   Bushbaby  ----------------------------------------------------------------------
         Chinese tree shrew  ----------------------------------------------------------------------
                   Squirrel  ----------------------------------------------------------------------
     Lesser Egyptian jerboa  ----------------------------------------------------------------------
               Prairie vole  ----------------------------------------------------------------------
            Chinese hamster  ----------------------------------------------------------------------
             Golden hamster  ----------------------------------------------------------------------
                      Mouse  ----------------------------------------------------------------------
                        Rat  ----------------------------------------------------------------------
                 Guinea pig  ----------------------------------------------------------------------
                     Rabbit  ----------------------------------------------------------------------
                       Pika  ----------------------------------------------------------------------
                        Pig  ----------------------------------------------------------------------
                     Alpaca  ccgccaccaataaataataaataaataaaatggagaaagagaaatataaaaaataataataaaaaagaat
             Bactrian camel  ccgccatcaataaataataaataagtaaaatggagaaagagaaatataaaaaataataataaaaa-----
                    Dolphin  ----------------------------------------------------------------------
               Killer whale  ----------------------------------------------------------------------
           Tibetan antelope  ----------------------------------------------------------------------
                        Cow  ----------------------------------------------------------------------
                      Sheep  ----------------------------------------------------------------------
              Domestic goat  ----------------------------------------------------------------------
                      Horse  ----------------------------------------------------------------------
           White rhinoceros  ----------------------------------------------------------------------
                        Cat  ----------------------------------------------------------------------
                        Dog  ----------------------------------------------------------------------
                      Panda  ----------------------------------------------------------------------
             Pacific walrus  ----------------------------------------------------------------------
               Weddell seal  ----------------------------------------------------------------------
           Black flying-fox  ----------------------------------------------------------------------
                    Megabat  ----------------------------------------------------------------------
              Big brown bat  ----------------------------------------------------------------------
       David's myotis (bat)  ----------------------------------------------------------------------
                   Microbat  ----------------------------------------------------------------------
                   Hedgehog  ----------------------------------------------------------------------
                      Shrew  ----------------------------------------------------------------------
            Star-nosed mole  ----------------------------------------------------------------------
                   Elephant  ----------------------------------------------------------------------
                    Manatee  ----------------------------------------------------------------------
           Cape golden mole  ----------------------------------------------------------------------
                     Tenrec  ----------------------------------------------------------------------
                   Aardvark  ----------------------------------------------------------------------
            Tasmanian devil  ----------------------------------------------------------------------
           Brush-tailed rat  ----------------------------------------------------------------------
             Naked mole-rat  ----------------------------------------------------------------------
                 Chinchilla  ======================================================================
        Cape elephant shrew  ======================================================================
                    Wallaby  ======================================================================
                    Opossum  ======================================================================

                      Human  -------aa--a---gagggtc-------ta
                      Chimp  -------aa--a---gagggtc-------ta
                    Gorilla  -------aa--a---gagggtg-------ta
                  Orangutan  -------aa--a---gacggtc-------ta
                     Gibbon  -------aa--a---ga--gtc-------ta
                     Rhesus  -------aa--a---gagggtc-------tg
        Crab-eating macaque  -------aa--a---gagggtc-------tg
                     Baboon  -------aa--a---gagggtc-------tg
               Green monkey  -------aa--a---gagggtc-------tg
                   Marmoset  -------aa--g---aagggtc-------tg
            Squirrel monkey  -------aa--g---gagggtc-------ta
                   Bushbaby  -------aa--g---gagggcc-------ta
         Chinese tree shrew  -------aa--t---gggggct-------tc
                   Squirrel  -------ag--g---gggacct-------tg
     Lesser Egyptian jerboa  -------aa--a---aggg-----------g
               Prairie vole  -------ga--aaatgagacaa-------ct
            Chinese hamster  -------aa--a---ggggttt-------ca
             Golden hamster  -------aa--a---ggggtct-------ca
                      Mouse  -------aa--a---ggtgtct-------aa
                        Rat  -------ga--a---ggtgtct-------ag
                 Guinea pig  -------cc--a---ggagtcg-------tg
                     Rabbit  -------aa--c---taatttt-------aa
                       Pika  -------aa--t---gagatcc-------ca
                        Pig  -------ag--a---agctctg---------
                     Alpaca  t------ag--g---gggtata---------
             Bactrian camel  -agaattag--g---gggtata---------
                    Dolphin  -------ag--g---gggtctg---------
               Killer whale  -------ag--g---gggtctg---------
           Tibetan antelope  -------ag--g---gggtcta---------
                        Cow  -------ag--g---gggtcta---------
                      Sheep  -------ag--g---gg-tcta---------
              Domestic goat  -------ag--g---ggatcta---------
                      Horse  -------a---g---aggtcta---------
           White rhinoceros  -------ag--g---gggtcta---------
                        Cat  -------ag--g---gggtctg---------
                        Dog  -------ag--g---gagtcta---------
                      Panda  -------ag--g---gggtctg---------
             Pacific walrus  -------ag--g---gagtcta---------
               Weddell seal  -------ag--g---gagtcta---------
           Black flying-fox  -------ag--g---gagtgta---------
                    Megabat  -------ag--g---gagtgta---------
              Big brown bat  -------ag--g---gggtcta---------
       David's myotis (bat)  -------ag--g---gagtcta---------
                   Microbat  -------ag--g---gggtcta---------
                   Hedgehog  -------aggag---ggggctt---------
                      Shrew  -------ag--t---gggtgtg---------
            Star-nosed mole  -------ag--g---acatcct---------
                   Elephant  -------aa--g---ggagagctatcattta
                    Manatee  -------aa--a---agagggc-------ta
           Cape golden mole  -------aa--g---ggagggc-------ta
                     Tenrec  -------aa--a---ggagggt-------cc
                   Aardvark  -------ga--a---gaagggc-------ta
            Tasmanian devil  -------t-----------------------
           Brush-tailed rat  -------------------------------
             Naked mole-rat  -------------------------------
                 Chinchilla  ===============================
        Cape elephant shrew  ===============================
                    Wallaby  ===============================
                    Opossum  ===============================

Inserts between block 29 and 30 in window
B D               Bushbaby 311bp

Alignment block 30 of 219 in window, 112831683 - 112831686, 4 bps 
B D                   Human  catt
B D                   Chimp  catt
B D                 Gorilla  catt
B D               Orangutan  catt
B D                  Gibbon  catt
B D                  Rhesus  cgtc
B D     Crab-eating macaque  cgtc
B D                  Baboon  tgtc
B D            Green monkey  cgtc
B D                Marmoset  catt
B D         Squirrel monkey  catt
         Chinese tree shrew  -att
B D                Squirrel  ---a
     Lesser Egyptian jerboa  ---t
               Prairie vole  ---t
B D         Chinese hamster  ---c
             Golden hamster  ---t
B D                   Mouse  ---c
B D                     Rat  ---t
B D              Guinea pig  ---t
B D                  Rabbit  ---a
B D                     Pig  attt
B D                  Alpaca  attt
             Bactrian camel  attt
B D                 Dolphin  attt
               Killer whale  attt
           Tibetan antelope  attt
B D                     Cow  attt
B D                   Sheep  attt
              Domestic goat  attt
B D                   Horse  attt
B D        White rhinoceros  attt
B D                     Cat  attt
B D                     Dog  agtt
B D                   Panda  agtt
             Pacific walrus  agtt
               Weddell seal  agtt
           Black flying-fox  ggtt
B D                 Megabat  ggtt
              Big brown bat  attt
       David's myotis (bat)  attt
B D                Microbat  attt
B D                Hedgehog  aatt
B D                   Shrew  gatg
            Star-nosed mole  aatt
B D                Elephant  -att
B D                 Manatee  -gtt
           Cape golden mole  -att
B D                  Tenrec  -att
                   Aardvark  -att
B D         Tasmanian devil  cttt
          Brush-tailed rat  ----
B D          Naked mole-rat  ----
                Chinchilla  ====
       Cape elephant shrew  ====
B D                 Wallaby  ====
B D                 Opossum  ====
B D                    Pika  ----
B D                Bushbaby  ====

Inserts between block 30 and 31 in window
B D               Squirrel 8bp
B D                  Mouse 2bp
B D                    Rat 2bp
B D                 Rabbit 1bp
B D               Elephant 1bp
B D                Manatee 1bp
          Cape golden mole 540bp
B D                 Tenrec 1bp
                  Aardvark 1bp

Alignment block 31 of 219 in window, 112831687 - 112831695, 9 bps 
B D                   Human  ttaaatg-----ct
B D                   Chimp  ttaaatg-----ct
B D                 Gorilla  ttaaatg-----ct
B D               Orangutan  ttaaatg-----tg
B D                  Gibbon  ttaaatg-----ct
B D                  Rhesus  ttaaatg-----ct
B D     Crab-eating macaque  ttaaatg-----ct
B D                  Baboon  ttaaatg-----ct
B D            Green monkey  ttaaatg-----ct
B D                Marmoset  ttaaatg-----gt
B D         Squirrel monkey  ttaaggg-----gt
         Chinese tree shrew  cttaaat-----tt
B D                Squirrel  ctaaggt-----ct
     Lesser Egyptian jerboa  caaaatt-----tt
               Prairie vole  ttaagct-----ct
B D         Chinese hamster  ctaagct-----ct
             Golden hamster  ctaagct-----ct
B D                   Mouse  ttaagct-----ct
B D                     Rat  ttaatct-----cc
B D              Guinea pig  -----cc-----cc
B D                  Rabbit  tgaccgg-----gc
B D                     Pig  ttagaag-----a-
B D                  Alpaca  ttagaaa-----ct
             Bactrian camel  ttagaaa-----ct
B D                 Dolphin  ttagaaa-----ct
               Killer whale  ttagaaa-----ct
           Tibetan antelope  ttaaaaa-----ta
B D                     Cow  ttaaaaa-----ta
B D                   Sheep  ttaaaaa-----tg
              Domestic goat  ttaaaaa-----ta
B D                   Horse  ttaacaa-----ct
B D        White rhinoceros  ttaa-aa-----ct
B D                     Cat  ttaaatg-----ct
B D                     Dog  ttaaaaa-----ct
B D                   Panda  ttgaaaa-----ct
             Pacific walrus  ttgaaaa-----cg
               Weddell seal  ttgaaaa-----c-
           Black flying-fox  ttaagaa-------
B D                 Megabat  ttaagaa-------
              Big brown bat  ttaaaaa-----ct
       David's myotis (bat)  ttaaaaa-----tt
B D                Microbat  ttaaaaa-----tt
B D                Hedgehog  tttaaat-------
B D                   Shrew  tttataagtgtt--
            Star-nosed mole  tttgaat-------
B D                Elephant  ttaaatg-----tt
B D                 Manatee  ttaaacg-----ct
           Cape golden mole  ttaaatg-----ct
B D                  Tenrec  ttaaatg-----ct
                   Aardvark  ttaaatg-----ct
B D         Tasmanian devil  ttaga---------
          Brush-tailed rat  --------------
B D          Naked mole-rat  --------------
                Chinchilla  ==============
       Cape elephant shrew  ==============
B D                 Wallaby  ==============
B D                 Opossum  ==============
B D                    Pika  --------------
B D                Bushbaby  ==============

Inserts between block 31 and 32 in window
B D                 Gibbon 21bp
B D                  Shrew 922bp

Alignment block 32 of 219 in window, 112831696 - 112831729, 34 bps 
B D                   Human  gaaggaaggaag--------------------g-----aa--gg----aagcc-----a-----------
B D                   Chimp  gaaggaaggaag--------------------g-----aa--gg----aagcc-----a-----------
B D                 Gorilla  gaaggaaggaag--------------------g-----aa--gg----aagcc-----a-----------
B D               Orangutan  gaaggaaggaag--------------------g-----aa--ggaagcaagcc-----a-----------
B D                  Gibbon  gaaggaaggaag--------------------g-----aa--gg----aagcc-----a-----------
B D                  Rhesus  gaaggaaggaag--------------------g-----aa--gg----aagcc-----a-----------
B D     Crab-eating macaque  gaaggaaggaag--------------------g-----aa--gg----aagcc-----a-----------
B D                  Baboon  gaaggaaggaag--------------------g-----aa--gg----aagcc-----a-----------
B D            Green monkey  gaaggaaggaag--------------------g-----aa--gg----aagcc-----a-----------
B D                Marmoset  ----aaaggaag--------------------g-----aa--gg----aagcc-----a-----------
B D         Squirrel monkey  ----aaaggaag--------------------g-----aa--gg----aagcc-----a-----------
         Chinese tree shrew  -----------g--------------------g-----aa--gg----aagcc-----a-----------
B D                Squirrel  ---------aaa--------------------c-----gc--tg----aagga-----cggcaggaagtg
     Lesser Egyptian jerboa  ---------aag--------------------c-----ac--tg----aagct-----g-----------
               Prairie vole  ---------aag--------------------g-----aa--tg----aagct-----c-----------
B D         Chinese hamster  ---------aag--------------------g-----aa--ta----aagct-----c-----------
             Golden hamster  ---------aag--------------------g-----ga--ta----aagct-----c-----------
B D                   Mouse  ---------aag--------------------g-----gc--ta----aagct-----g-----------
B D                     Rat  ---------aag--------------------g-----aa--ta----aggc------------------
B D                  Rabbit  ---------aag--------------------g-----ga--gg----atgcc-----c-----------
B D                    Pika  ---------aaa--------------------g-----ga--gg----aagct-----t-----------
B D                     Pig  --------------------------------------aa--gc----aagcc-----a-----------
B D                  Alpaca  --------------------------------gagaacaa--ga----aagtc-----a-----------
             Bactrian camel  --------------------------------gagaacaa--ga----aagtc-----g-----------
B D                 Dolphin  --------------------------------g-----ca--ga----aagtc-----a-----------
               Killer whale  --------------------------------g-----ca--ga----aagtc-----a-----------
           Tibetan antelope  --------------------------------g-----ga--gc----aagct-----c-----------
B D                     Cow  --------------------------------g-----ga--ga----aagct-----c-----------
B D                   Sheep  --------------------------------g-----ga--ga----aagct-----c-----------
              Domestic goat  --------------------------------g-----ga--ga----aagct-----c-----------
B D                   Horse  --------gaaggaaa----------------a-----ca--gg----aagcc-----t-----------
B D        White rhinoceros  --------gaagaaaagagggaaagaaggaatg-----aa--gg----aagccggtgtc-----------
B D                     Cat  --------gaaa--------------------g-----aa--gg----aagcc-----a-----------
B D                     Dog  --------gaag--------------------g-----aa--gg----aagcc-----a-----------
B D                   Panda  --------gaag--------------------g-----aa--gg----aagcc-----a-----------
             Pacific walrus  --------gaag--------------------g-----aa--gg----aagcc-----a-----------
               Weddell seal  --------gaag--------------------g-----aa--gg----aagcc-----a-----------
           Black flying-fox  --------ggaagaaa----------------g-----gc--ag----aaact-----g-----------
B D                 Megabat  --------ggaagaaa----------------g-----gc--ag----aaact-----g-----------
              Big brown bat  --------gaaggaag----------------g-----aa--gg----aagcc-----a-----------
       David's myotis (bat)  --------gaaggaag----------------g-----aa--gg----aagcc-----a-----------
B D                Microbat  --------gaaggaag----------------g-----aa--gg----aagcc-----a-----------
B D                Hedgehog  -----aatgaag--------------------g-----aa--gg----aagtt-----a-----------
            Star-nosed mole  -agtgaaggaag--------------------c-----aa--gg----aagtc-----g-----------
B D                Elephant  -----gacggaa--------------------g-----aa--gg----aagcc-----a-----------
B D                 Manatee  -----gaaggaa--------------------g-----aa--ga----aagcc-----a-----------
           Cape golden mole  -----aaaggaa--------------------g-----ctggag----aagcc-----a-----------
B D                  Tenrec  -----gcaaaaa--------------------g-----ac--ag----aaact-----c-----------
                   Aardvark  -----gaaggaa--------------------g-----aa--gg----aagcc-----a-----------
B D         Tasmanian devil  -------------------------------------------g----aagtt-----g-----------
B D                   Shrew  ======================================================================
B D              Guinea pig  ----------------------------------------------------------------------
          Brush-tailed rat  ----------------------------------------------------------------------
B D          Naked mole-rat  ----------------------------------------------------------------------
                Chinchilla  ======================================================================
       Cape elephant shrew  ======================================================================
B D                 Wallaby  ======================================================================
B D                 Opossum  ======================================================================
B D                Bushbaby  ======================================================================

                      Human  -ttgtgtcactg
                      Chimp  -ttgtgtcactg
                    Gorilla  -ttgtgtcactg
                  Orangutan  -ttgtgtcactg
                     Gibbon  -ttgtgtcactg
                     Rhesus  -ttgtgtcactg
        Crab-eating macaque  -ttgtgtcactg
                     Baboon  -ttgtgtcactg
               Green monkey  -ttgtgtcactg
                   Marmoset  -ttgtgccactg
            Squirrel monkey  -ttgtgccactg
         Chinese tree shrew  -tcttgtcactg
                   Squirrel  atcttgtcactg
     Lesser Egyptian jerboa  -tattgtcactg
               Prairie vole  -tt---tcattg
            Chinese hamster  -ttatgtcactt
             Golden hamster  -ttatgtcactg
                      Mouse  -ttatgtggctg
                        Rat  ------------
                     Rabbit  -aggtgtcactg
                       Pika  -tgttgtctctg
                        Pig  -tcttgcccctg
                     Alpaca  -tcttgtccctg
             Bactrian camel  -tcttgtccctg
                    Dolphin  -tcttgtccctg
               Killer whale  -tcttgtccctg
           Tibetan antelope  -tcatgtccctg
                        Cow  -tcatgtccctg
                      Sheep  -tcatgtccctg
              Domestic goat  -tcatgtccctg
                      Horse  -tcttgtcaatg
           White rhinoceros  -acttgtcactg
                        Cat  -ttttgtgactg
                        Dog  -tttcatgactg
                      Panda  -tttggtgactg
             Pacific walrus  -ttttgtgactg
               Weddell seal  -ttttgtgac--
           Black flying-fox  -tcttgtcact-
                    Megabat  -tcttgtcact-
              Big brown bat  -tcttgtcat--
       David's myotis (bat)  -tcttgtcat--
                   Microbat  -tcttgtcat--
                   Hedgehog  -tcttgtcacct
            Star-nosed mole  -tcatgtcactg
                   Elephant  -tctggtcactg
                    Manatee  -tcttgtcatta
           Cape golden mole  -tcttgttattg
                     Tenrec  -tcttgctattg
                   Aardvark  -tcttgtcattg
            Tasmanian devil  -ttg--------
                      Shrew  ============
                 Guinea pig  ------------
           Brush-tailed rat  ------------
             Naked mole-rat  ------------
                 Chinchilla  ============
        Cape elephant shrew  ============
                    Wallaby  ============
                    Opossum  ============
                   Bushbaby  ============

Alignment block 33 of 219 in window, 112831730 - 112831741, 12 bps 
B D                   Human  gctggcaatgtg
B D                   Chimp  gctggcaatgtg
B D                 Gorilla  gctggcaatgtg
B D               Orangutan  gctggcaatgtg
B D                  Gibbon  gttggcaatgtg
B D                  Rhesus  gctggcaatgtg
B D     Crab-eating macaque  gctggcaatgtg
B D                  Baboon  gctggcaatgtg
B D            Green monkey  gctggcaatgtg
B D                Marmoset  gctggcaatgtg
B D         Squirrel monkey  gctggcaatgtg
B D                Bushbaby  actggcagtgtg
         Chinese tree shrew  gctgtcagtatg
B D                Squirrel  gccg-ctgtgtg
     Lesser Egyptian jerboa  ttgatctgtgca
               Prairie vole  gcaggctgtgtg
B D         Chinese hamster  gtgggctgtgtg
             Golden hamster  gtgggctgtgtg
B D                   Mouse  gcaggctgtgtg
B D                  Rabbit  gcaggcagtgtg
B D                    Pika  gcaggcagcatg
B D                     Pig  cctggtgatgtg
B D                  Alpaca  tctggtgatgtg
             Bactrian camel  tctggtgatgtg
B D                 Dolphin  acgggtgatgtg
               Killer whale  acgggtgatgtg
           Tibetan antelope  actgg-------
B D                     Cow  actga-------
B D                   Sheep  actgg-------
              Domestic goat  actgg-------
B D                   Horse  gccagtgaagtg
B D        White rhinoceros  gccagtcatgtg
B D                     Cat  gccagtggtgtg
B D                     Dog  gtcagtggtgtg
B D                   Panda  gccggtggtgtg
             Pacific walrus  gccagtggtgtc
               Weddell seal  --------tgtg
           Black flying-fox  ggcagtgatgtg
B D                 Megabat  ggcagtgatgtg
              Big brown bat  -gtggtgatggg
       David's myotis (bat)  -gtgatgatggg
B D                Microbat  -gtggtgatggg
B D                Hedgehog  gtaggtgacatg
            Star-nosed mole  gcaggtgatgc-
B D                Elephant  gccagtgatgta
B D                 Manatee  gccagcgatgtg
           Cape golden mole  accaatgatgtg
B D                  Tenrec  gtcaagatggtg
                   Aardvark  gccagtgatgtg
B D         Tasmanian devil  ---ggaaaggtg
B D                     Rat  ------------
B D                   Shrew  ============
B D              Guinea pig  ------------
          Brush-tailed rat  ------------
B D          Naked mole-rat  ------------
                Chinchilla  ============
       Cape elephant shrew  ============
B D                 Wallaby  ============
B D                 Opossum  ============

Alignment block 34 of 219 in window, 112831742 - 112831763, 22 bps 
B D                   Human  cccatccacagg---agc-ggaacaa
B D                   Chimp  cccatccacagg---agc-ggaacaa
B D                 Gorilla  cccatccacagg---agc-ggaacaa
B D               Orangutan  cccatccacagg---agc-ggaacaa
B D                  Gibbon  cccatccacagg---agc-agaacaa
B D                  Rhesus  cgcatccacagg---agc-agtacga
B D     Crab-eating macaque  cgcatccacagg---agc-agtacga
B D                  Baboon  cgcatccacagg---agc-agtacga
B D            Green monkey  cgcatccacagg---agc-agtacga
B D                Marmoset  cccatccagagg---agc-agaataa
B D         Squirrel monkey  cccatccagaga---agc-agaataa
B D                Bushbaby  tccatctgtgta---agt-agaacaa
         Chinese tree shrew  cccaactgctcg---agt-agaacaa
B D                Squirrel  cccatcctcaag---agt-agaacaa
     Lesser Egyptian jerboa  ctcatctgtagg---agc-acaacaa
               Prairie vole  cccattaacatg---aga-agttaat
B D         Chinese hamster  cccattaacatg---aga-agtacag
             Golden hamster  cccattagcttg---aga-agcacaa
B D                   Mouse  tccgtctacgtg---aga-agtacag
B D                     Rat  --------------------acacgg
                 Chinchilla  ctcatagataat---agctgggtcag
B D                  Rabbit  cccatctatgtg---agc-agaacaa
B D                    Pika  cccatcagtgtg---agc-agagcaa
B D                     Pig  cctatccacaac---acc-agaacag
B D                  Alpaca  cccatccacaag---agc-cgagcaa
             Bactrian camel  cccatccacaag---agc-cgagcaa
B D                 Dolphin  tccatccacaag---agc-acaataa
               Killer whale  tccatccacaag---agc-acaataa
           Tibetan antelope  ----tccacaag---aac-agaacag
B D                     Cow  ----tccacaag---aac-agaacag
B D                   Sheep  ----tccacaag---aac-agaacag
              Domestic goat  ----tccacaag---aac-agaacag
B D                   Horse  ccca-ctgcatg---agc-ggaatgc
B D        White rhinoceros  cccatctgcata---ggc-agaacaa
B D                     Cat  cccatccgtatg---ggc-agaacaa
B D                     Dog  cccaaccacatg---agc-aaaacaa
B D                   Panda  gccatccgaatg---agc-ggaataa
             Pacific walrus  cccatccaaatg---agc-aaaacga
               Weddell seal  cccatccaaatg---agc-aaaacaa
           Black flying-fox  cccatct-catg---agc-agaacaa
B D                 Megabat  cctatct-catg---agc-agaacaa
              Big brown bat  cccatct-catg---aga-agaacaa
       David's myotis (bat)  cccatct-cacg---aac-agaacga
B D                Microbat  cccatct-cacg---agc-agaacga
B D                Hedgehog  tccatctatatt---agc-a------
            Star-nosed mole  ----------------ac-a------
B D                Elephant  cacataggcatg---agc-agaacag
B D                 Manatee  tacataggcattagcagc-agaacag
           Cape golden mole  catataggcatt---ggc-agaacag
B D                  Tenrec  caca------------gc-agaacaa
                   Aardvark  cacatcggcatg---agc-agaaaaa
B D         Tasmanian devil  accaacc-cagg---ag---------
B D                   Shrew  ==========================
B D              Guinea pig  --------------------------
          Brush-tailed rat  --------------------------
B D          Naked mole-rat  --------------------------
       Cape elephant shrew  ==========================
B D                 Wallaby  ==========================
B D                 Opossum  ==========================

Alignment block 35 of 219 in window, 112831764 - 112831764, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  t
B D                  Gibbon  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
B D            Green monkey  c
B D                Marmoset  t
B D         Squirrel monkey  t
B D                Bushbaby  t
         Chinese tree shrew  t
B D                Squirrel  c
     Lesser Egyptian jerboa  t
B D         Chinese hamster  t
B D                   Mouse  t
B D                     Rat  t
B D                  Rabbit  t
B D                    Pika  t
B D                     Pig  t
B D                  Alpaca  t
             Bactrian camel  t
B D                 Dolphin  t
               Killer whale  t
           Tibetan antelope  t
B D                     Cow  t
B D                   Sheep  t
              Domestic goat  t
B D                   Horse  t
B D        White rhinoceros  t
B D                     Cat  t
B D                     Dog  t
B D                   Panda  t
             Pacific walrus  t
               Weddell seal  t
              Big brown bat  t
       David's myotis (bat)  t
B D                Microbat  t
B D                Elephant  t
B D                 Manatee  t
           Cape golden mole  t
B D                  Tenrec  t
                   Aardvark  g
           Star-nosed mole  -
            Golden hamster  -
B D                Hedgehog  -
B D                   Shrew  =
B D              Guinea pig  -
          Brush-tailed rat  -
B D          Naked mole-rat  -
                Chinchilla  -
              Prairie vole  -
       Cape elephant shrew  =
B D                 Wallaby  =
B D         Tasmanian devil  -
          Black flying-fox  -
B D                 Megabat  -
B D                 Opossum  =

Alignment block 36 of 219 in window, 112831765 - 112831771, 7 bps 
B D                   Human  ttgatca
B D                   Chimp  ttgatca
B D                 Gorilla  ttgatca
B D               Orangutan  ttgatca
B D                  Gibbon  ttgatca
B D                  Rhesus  ttgatca
B D     Crab-eating macaque  ttgatca
B D                  Baboon  ttgatca
B D            Green monkey  ttgatca
B D                Marmoset  ttgatca
B D         Squirrel monkey  ttgatca
B D                Bushbaby  ttgatca
         Chinese tree shrew  gtgatca
B D                Squirrel  ctgatca
     Lesser Egyptian jerboa  ttggtcg
               Prairie vole  ttggtca
B D         Chinese hamster  ttggtca
             Golden hamster  ttggtca
B D                   Mouse  ttggtcg
B D                     Rat  ttggttg
B D          Naked mole-rat  ttgatcg
                 Chinchilla  ttggtgg
B D                  Rabbit  ttgatca
B D                    Pika  ttggtca
B D                     Pig  ctgatca
B D                  Alpaca  ttaatca
             Bactrian camel  ttaatca
B D                 Dolphin  ttgatca
               Killer whale  ttgatca
           Tibetan antelope  atgatca
B D                     Cow  atgatca
B D                   Sheep  atgatca
              Domestic goat  atgatca
B D                   Horse  ttgatca
B D        White rhinoceros  ttgatcc
B D                     Cat  ttgatca
B D                     Dog  ttgatca
B D                   Panda  ctgatcc
             Pacific walrus  ttgatca
               Weddell seal  ttgatca
              Big brown bat  ttgatca
       David's myotis (bat)  ttgatca
B D                Microbat  ttgatca
B D                Hedgehog  --gaatg
            Star-nosed mole  --gatca
B D                Elephant  ttgat-a
B D                 Manatee  ttgatca
           Cape golden mole  ttgatca
B D                  Tenrec  ttgatta
                   Aardvark  tgaatta
B D                   Shrew  =======
B D              Guinea pig  -------
          Brush-tailed rat  -------
       Cape elephant shrew  =======
B D                 Wallaby  =======
B D         Tasmanian devil  -------
          Black flying-fox  -------
B D                 Megabat  -------
B D                 Opossum  =======

Inserts between block 36 and 37 in window
                Chinchilla 3bp

Alignment block 37 of 219 in window, 112831772 - 112831811, 40 bps 
B D                   Human  atgtggaag-gaaaggaa--a----------gaggtgaagc--tgtact----tc-tgcc
B D                   Chimp  atgtggaag-gaaaggaa--a----------gaggtgaagc--tgtact----tc-tgcc
B D                 Gorilla  atgtggaag-gaaaggaa--a----------gaggtgaagc--tgtact----tc-tgcc
B D               Orangutan  atgtggaag-gaaaggaa--a----------gaggtgaagc--tgtact----tc-tgcc
B D                  Gibbon  atgtggaag-gaaaggaa--a----------gaggtgaagc--tgtact----tc-tgcc
B D                  Rhesus  atgtggaag-gcaaggaa--a----------gaggtgaagc--tgtact----tc-tgcc
B D     Crab-eating macaque  atgtgcaag-gcaaggaa--a----------gaggtgaagc--tgtact----tc-tgcc
B D                  Baboon  atgtggaag-gcaaggaa--a----------gaggtgaagc--tgtact----tc-tgcc
B D            Green monkey  atgtggaag-gcaaggaa--a----------gaggtgaagc--tgtact----tc-tgcc
B D                Marmoset  atgtggaag-ataaggaa--a----------gaggtaaatc--tgtact----tc-tgcc
B D         Squirrel monkey  atgtggaag-acaaggaa--a----------gaggtaaatc--tgtact----tc-tgct
B D                Bushbaby  atgtggaaa-gctaggaa--a----------gaggtgaagc--agagct----gc-tgca
         Chinese tree shrew  aagtggaag-gcaa-gaa--a----------gcagtaaagc--tgggct----tc-tgaa
B D                Squirrel  ----------ctacagaagga----------cagggaaggc--agtggt-----------
     Lesser Egyptian jerboa  ----------atatacac--a----------cacataaagc--tgggct-----c-taac
               Prairie vole  ----------ccatggaa--a----------caggtaaagc--tatgct----cc-taca
B D         Chinese hamster  ----------ctatgaaa--c----------caggtaaagc--tatgct----cc-taga
             Golden hamster  ----------ctatgaaa--c----------caggtaaagctatatgct----cc-taga
B D                   Mouse  ----------ctatgaaa--a----------c----aaagc--tgtgct----cc-taaa
B D                     Rat  ----------ctatgaaa--g----------c----aaagc--tgtgct----cc-taaa
B D          Naked mole-rat  atgcagggggccaggaaa--g----------agttaaaagc--tgtatt----tc-caaa
B D              Guinea pig  ---------------aaa--g----------agttagaaat--tgtgtt----ct-caaa
                 Chinchilla  atgtagaaggccaggcag--g----------agttagaagc--tgtgtt----tc-caaa
           Brush-tailed rat  atgcagaaggccaggaca--g----------agttagaagc--tgtgtt----cc-caca
B D                  Rabbit  ----------atgtggag--g--------------tagcat--caggct----cc-caaa
B D                    Pika  ----------atgtgaaa--ggcaagggtagaacttaacac--caggct----cctcaaa
B D                     Pig  gcgtgaaaa------gaa--a----------gaagtaaaac--cagatt----cc-caaa
B D                  Alpaca  acttggaag--tgagaaa--a----------gaggttaaac--caggct----cc-cgaa
             Bactrian camel  acttggaag--tgagaaa--a----------gaggttaaac--cgggct----cc-caaa
B D                 Dolphin  acgtgaaaa-gcgagaaa--a----------gagagaaagc--tgggtc----cc-ggaa
               Killer whale  acatgaaaa-gcgagaaa--a----------gagagaaagc--tgggtc----cc-ggaa
           Tibetan antelope  acatgaaaa-ttgagaaa--a----------gagataaagc--tgggct----cc-tgaa
B D                     Cow  acatgaaaa-ttgagaaa--a----------gagataaagc--tgggct----cc-tgaa
B D                   Sheep  acgtgaaaa-ttgagaaa--a----------gagataaagc--tgggct----cc-tgaa
              Domestic goat  acatgaaaa-ttgagaaa--a----------gagataaagc--tgggct----cc-tgaa
B D                   Horse  gtgtgaaag-gcaagaaa--a----------gagatcaagc--tgggct----cc-tgaa
B D        White rhinoceros  atgtgaaag-gcgagaaa--a----------gaggtcaagc--tgggct----cc-cgaa
B D                     Cat  atgtgcaag-gcaagaaa--a----------gaggtagatc--agggat----cc-cgaa
B D                     Dog  atgtgaaag-gcaagaaa--a----------gaggtagatc--agggtt----cc-tgaa
B D                   Panda  atgtgaaag-gcaagaaa--a----------gaggtagatc--agggct----cc-caaa
             Pacific walrus  atgtgaaag-gcaagaaa--a----------gaggtagatc--agggct----cc-caaa
               Weddell seal  atgtgaaag-gcaagaaa--a----------gaggtagatc--agggct----cc-caaa
              Big brown bat  acatgaaag-gcaagcaa--a----------gaggttaagc--tgggct----cc-tgaa
       David's myotis (bat)  atgtgaaag-gcaagcaa--a----------gaggttaagc--tggcct----cc-cgaa
B D                Microbat  atgtgaaag-gcaagcaa--a----------gaggttaagc--tggcct----cc-ggaa
B D                Hedgehog  atgcgaagg-gcaaggaa--a----------gagataaaaa--tttacc-----------
            Star-nosed mole  atgtataaa-gcaaggaa--a----------gcgataaagt--gggaccataa-------
B D                Elephant  atgctgat--gcaagaaa--a----------gaggttaagt--tgggct----cc-tgaa
B D                 Man