Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 675 in window, 17405722 - 17405725, 4 bps 
B D                   Human  taca
B D                   Chimp  taca
B D                 Gorilla  taca
B D               Orangutan  taca
B D                  Gibbon  taca
B D                  Rhesus  taca
B D     Crab-eating macaque  taca
B D                  Baboon  taca
B D            Green monkey  taca
B D                Marmoset  taca
B D         Squirrel monkey  taca
B D                Bushbaby  -aca
         Chinese tree shrew  tacc
B D                Squirrel  --tg
               Prairie vole  --ca
B D                   Mouse  --ca
B D                     Rat  ----
B D                    Pika  atct
B D                  Alpaca  tgca
             Bactrian camel  tgca
B D                 Dolphin  taaa
               Killer whale  taaa
           Tibetan antelope  tgta
B D                     Cow  tgca
B D                   Sheep  ----
              Domestic goat  tgca
B D                   Horse  tgct
B D        White rhinoceros  tgca
B D                     Cat  tgca
B D                     Dog  tgcc
B D                 Ferret   cgga
B D                   Panda  ggga
             Pacific walrus  tgca
               Weddell seal  tgca
           Black flying-fox  caca
B D                 Megabat  caca
       David's myotis (bat)  tgca
B D                Microbat  tgca
B D                   Shrew  acaa
            Star-nosed mole  tttg
B D                Elephant  cgta
        Cape elephant shrew  tgca
B D                 Manatee  tgct
           Cape golden mole  tata
                   Aardvark  tgca
B D         Chinese hamster  ====
    Lesser Egyptian jerboa  ====
B D                  Tenrec  ====
B D                Hedgehog  ====
B D              Guinea pig  ====
          Brush-tailed rat  ====
B D          Naked mole-rat  ====
B D                     Pig  ====
                Chinchilla  ====

Inserts between block 1 and 2 in window
        Chinese tree shrew 107bp
B D                    Rat 10bp

Alignment block 2 of 675 in window, 17405726 - 17405736, 11 bps 
B D                   Human  gg-----cagaggatt
B D                   Chimp  gg-----cagaggatt
B D                 Gorilla  gg-----cagaggatt
B D               Orangutan  gg-----cagaggatt
B D                  Gibbon  gg-----cagaggatt
B D                  Rhesus  gg-----cagaggatt
B D     Crab-eating macaque  gg-----cagaggatt
B D                  Baboon  gg-----cagaggatt
B D            Green monkey  gg-----cagaggatt
B D                Marmoset  gg-----cagaggatc
B D         Squirrel monkey  gg-----cagaagatt
B D                Bushbaby  gt-----cagagaagt
         Chinese tree shrew  ag-----catagggct
B D                Squirrel  ------------aacc
               Prairie vole  ------------gcct
B D                   Mouse  ------------aact
B D                    Pika  ------------gcca
B D                  Alpaca  gg-----cagaggaca
             Bactrian camel  gg-----cagaggaca
B D                 Dolphin  gg-----cagagcaga
               Killer whale  gg-----cagagcaga
           Tibetan antelope  gg-----cagagggca
B D                     Cow  gg-----cagggggca
B D                   Sheep  -------cagagggca
              Domestic goat  gg-----cagagggca
B D                   Horse  gg-----ccgtgg---
B D        White rhinoceros  gg-----cagaggact
B D                     Cat  gg-----cagaaa---
B D                     Dog  gg-----cagaaaaca
B D                 Ferret   gg-----caaaaaaca
B D                   Panda  gggcactcaggaaagg
             Pacific walrus  gg-----cagaaaatg
               Weddell seal  gg-----cagaaaaga
           Black flying-fox  gg-----aaggggaca
B D                 Megabat  gg-----aagaggaca
       David's myotis (bat)  gg-----aggaggaca
B D                Microbat  gg-----aagaggaca
B D                   Shrew  gg--------------
            Star-nosed mole  ag-----tggaatggc
B D                Elephant  gg-----cataagacc
        Cape elephant shrew  gg--------------
B D                 Manatee  gc-----cagaggacc
           Cape golden mole  ag-----cagaggata
                   Aardvark  gg-----cagcggacc
B D                     Rat  ================
B D         Chinese hamster  ================
    Lesser Egyptian jerboa  ================
B D                  Tenrec  ================
B D                Hedgehog  ================
B D              Guinea pig  ================
          Brush-tailed rat  ================
B D          Naked mole-rat  ================
B D                     Pig  ================
                Chinchilla  ================

Inserts between block 2 and 3 in window
B D               Squirrel 21bp
              Prairie vole 19bp
B D                  Mouse 13bp
B D                   Pika 5bp

Alignment block 3 of 675 in window, 17405737 - 17405772, 36 bps 
B D                   Human  aattag----------------------------------------------------------------
B D                   Chimp  aattag----------------------------------------------------------------
B D                 Gorilla  aattag----------------------------------------------------------------
B D               Orangutan  agttag----------------------------------------------------------------
B D                  Gibbon  cattag----------------------------------------------------------------
B D                  Rhesus  aattag----------------------------------------------------------------
B D     Crab-eating macaque  aattag----------------------------------------------------------------
B D                  Baboon  aattag----------------------------------------------------------------
B D            Green monkey  aattag----------------------------------------------------------------
B D                Marmoset  c-ttag----------------------------------------------------------------
B D         Squirrel monkey  c-ttag----------------------------------------------------------------
B D                Bushbaby  g-ttag----------------------------------------------------------------
         Chinese tree shrew  aatcagtgccctcgggcccgccccgtcattagcatagggctaatagccaaccaggggaaacgcactgacc
B D                Squirrel  attcag----------------------------------------------------------------
               Prairie vole  ---cag----------------------------------------------------------------
B D         Chinese hamster  aagtac----------------------------------------------------------------
B D                   Mouse  ctgcag----------------------------------------------------------------
B D                     Rat  ctgcca----------------------------------------------------------------
B D          Naked mole-rat  --ttag----------------------------------------------------------------
B D              Guinea pig  --ttag----------------------------------------------------------------
                 Chinchilla  --ttag----------------------------------------------------------------
           Brush-tailed rat  --ttag----------------------------------------------------------------
B D                    Pika  ----ga----------------------------------------------------------------
B D                  Alpaca  gcccag----------------------------------------------------------------
             Bactrian camel  gcccag----------------------------------------------------------------
B D                 Dolphin  gcccag----------------------------------------------------------------
               Killer whale  gcccag----------------------------------------------------------------
           Tibetan antelope  g-ccag----------------------------------------------------------------
B D                     Cow  g-tcag----------------------------------------------------------------
B D                   Sheep  g-ccag----------------------------------------------------------------
              Domestic goat  g-ccag----------------------------------------------------------------
B D                   Horse  gct--g----------------------------------------------------------------
B D        White rhinoceros  gct--g----------------------------------------------------------------
B D                     Cat  -tttcg----------------------------------------------------------------
B D                     Dog  gtttag----------------------------------------------------------------
B D                 Ferret   gtttgg----------------------------------------------------------------
B D                   Panda  g-ttag----------------------------------------------------------------
             Pacific walrus  gtttag----------------------------------------------------------------
               Weddell seal  gtttaa----------------------------------------------------------------
           Black flying-fox  gtta-a----------------------------------------------------------------
B D                 Megabat  gtta-a----------------------------------------------------------------
       David's myotis (bat)  gttt-a----------------------------------------------------------------
B D                Microbat  gttt-a----------------------------------------------------------------
B D                   Shrew  ----------------------------------------------------------------------
            Star-nosed mole  tttt-c----------------------------------------------------------------
B D                Elephant  gctgag----------------------------------------------------------------
        Cape elephant shrew  gcagac----------------------------------------------------------------
B D                 Manatee  gctgag----------------------------------------------------------------
           Cape golden mole  gctgag----------------------------------------------------------------
                   Aardvark  gcggag----------------------------------------------------------------
    Lesser Egyptian jerboa  ======================================================================
B D                  Tenrec  ======================================================================
B D                Hedgehog  ======================================================================
B D                     Pig  ======================================================================

                      Human  -----------------------------------------------------gttttcagtt-------
                      Chimp  -----------------------------------------------------gctttcagtt-------
                    Gorilla  -----------------------------------------------------gctttcagtt-------
                  Orangutan  -----------------------------------------------------gctttcagtt-------
                     Gibbon  -----------------------------------------------------gctttcagtt-------
                     Rhesus  ----------------------------------------------------agctttcagtt-------
        Crab-eating macaque  ----------------------------------------------------agctttcagtt-------
                     Baboon  ----------------------------------------------------agctttcagtt-------
               Green monkey  -----------------------------------------------------gctttcagtt-------
                   Marmoset  -----------------------------------------------------gcttttagtt-------
            Squirrel monkey  -----------------------------------------------------gctgttagtt-------
                   Bushbaby  -----------------------------------------------------gctttcagtt-------
         Chinese tree shrew  tgcgggcttagcaggcatttgaataaaacatctgcaggcagagtccagctaagactttcagtt-------
                   Squirrel  ------------------------------------------------------gttttggtt-------
               Prairie vole  -----------------------------------------------------cctttcggtt-------
            Chinese hamster  -----------------------------------------------------cctttcggtt-------
                      Mouse  -----------------------------------------------------cctttcagtt-------
                        Rat  -----------------------------------------------------cctttcagtt-------
             Naked mole-rat  -----------------------------------------------------gctttcagtt-------
                 Guinea pig  -----------------------------------------------------actttcagtt-------
                 Chinchilla  -----------------------------------------------------gctttcagtt-------
           Brush-tailed rat  -----------------------------------------------------gctttcagtt-------
                       Pika  -----------------------------------------------------cccggcagtt-------
                     Alpaca  -----------------------------------------------------gctttaggtt-------
             Bactrian camel  -----------------------------------------------------gctttaggtt-------
                    Dolphin  -----------------------------------------------------gctttctgtt-------
               Killer whale  -----------------------------------------------------gctttctgtt-------
           Tibetan antelope  -----------------------------------------------------gctttcagtttaggttt
                        Cow  -----------------------------------------------------gcttgcagtt-------
                      Sheep  -----------------------------------------------------gctttcggtttaggttt
              Domestic goat  -----------------------------------------------------gcttccggtttaggttt
                      Horse  -----------------------------------------------------actttcagtt-------
           White rhinoceros  -----------------------------------------------------actttcagtt-------
                        Cat  -----------------------------------------------------gctttcagtt-------
                        Dog  -----------------------------------------------------gctttcagtt-------
                    Ferret   -----------------------------------------------------gctttcagtt-------
                      Panda  -----------------------------------------------------gctttcagtt-------
             Pacific walrus  -----------------------------------------------------gctttcagtt-------
               Weddell seal  -----------------------------------------------------gctttcagtt-------
           Black flying-fox  -----------------------------------------------------gctttcagtt-------
                    Megabat  -----------------------------------------------------gctttcagtt-------
       David's myotis (bat)  -----------------------------------------------------gctttcactt-------
                   Microbat  -----------------------------------------------------gctttcattt-------
                      Shrew  -------------------------------------------------------tttcgatt-------
            Star-nosed mole  -----------------------------------------------------actttcaatt-------
                   Elephant  -----------------------------------------------------actttcagtt-------
        Cape elephant shrew  -----------------------------------------------------acttgcagtt-------
                    Manatee  -----------------------------------------------------aatttcagtt-------
           Cape golden mole  -----------------------------------------------------attttcagtt-------
                   Aardvark  -----------------------------------------------------actttcagtt-------
     Lesser Egyptian jerboa  ======================================================================
                     Tenrec  ======================================================================
                   Hedgehog  ======================================================================
                        Pig  ======================================================================

                      Human  -------tcagttt--c---c----------c------ag-a--------------aagga--gg
                      Chimp  -------tcagttt--c---c----------c------ag-a--------------aagga--gg
                    Gorilla  -------tcagttt--c---c----------c------ag-a--------------aagga--gg
                  Orangutan  -------tcagttt--c---c----------c------ag-a--------------aagga--gg
                     Gibbon  -------tcagttt--c---c----------c------ag-a--------------aagga--gg
                     Rhesus  -------tcagttt--c---c----------c------ag-a--------------aagga--gg
        Crab-eating macaque  -------tcagttt--c---c----------c------ag-a--------------aagga--gg
                     Baboon  -------tcagttt--c---c----------c------ag-a--------------aagga--gg
               Green monkey  -------tcagttt--c---c----------c------ag-a--------------aagga--gg
                   Marmoset  -------tcagttt--c---c----------c------ag-a--------------aggga--ga
            Squirrel monkey  -------tcagttt--c---c----------c------ag-a--------------aggga--ga
                   Bushbaby  -------tcagttt------c----------c------ag-g--------------agaga--ac
         Chinese tree shrew  -------tccatttccc---c----------c------gc-a--------------aagca--gc
                   Squirrel  -------tcagttt--c---c----------c------ag-a--------------agaga--ga
               Prairie vole  -------tcttttt--c---c----------t------gg-a--------------aaggg--gg
            Chinese hamster  -------tcggttt--c---c----------t------gg-a--------------aacgg--ag
                      Mouse  -------tcatttt--c---c----------t------gg-aatgcccctagaagcaagag--aa
                        Rat  -------tcatttt--c---c----------t------gg-a--------------aaggg--ga
             Naked mole-rat  -------tcgggtt--c---c----------t------ag-c--------------aggag--g-
                 Guinea pig  -------tcgggtt--c---c----------t------ag-t--------------gggag--c-
                 Chinchilla  -------tcgggtt--c---c----------t------ag-a--------------ggaaa--g-
           Brush-tailed rat  -------tcaggtt--c---c----------t------ag-a--------------ggaag--a-
                       Pika  -------tcgattt--c---c----------c------ag-g--------------gccag--ag
                     Alpaca  -------tcggttt--c---ctttttcatttt--cccaag-a--------------aaaaa--gg
             Bactrian camel  -------tcggttt--c---c-ttttcatttt--cccaag-a--------------aaaag--gg
                    Dolphin  -------tcggttt--c---ctttttcccttt--ctcaga-a--------------aaaga--gg
               Killer whale  -------tcggttt--c---ctttttcccttt--ctcaga-a--------------aaaga--gg
           Tibetan antelope  ctaggtttcagttt--c---ctttttcctttt-cctggga-a--------------aaaaa--gg
                        Cow  -taggtttcagttt--c---ctatttcctttc-cccgggg-a--------------aaaac--gt
                      Sheep  ctaggtttcagttt--c---ctttttccttttccctgaga-g--------------aaaaa--ga
              Domestic goat  ctaggtttcagttt--c---ctttttcctttt-ccgggga-a--------------aaaaa--ga
                      Horse  -------tctgttt--c---c----------t------gc-a--------------agaga--gg
           White rhinoceros  -------tcggttt--c---c----------c------ag-a--------------agaga--gg
                        Cat  -------tctattt--c---c----------c------ag-g--------------aaaga--gg
                        Dog  -------tcgattt--c---c----------c------agag--------------gaaaa--tg
                    Ferret   -------tcaattt--c---c----------c------ag-g--------------aaaaa--gg
                      Panda  -------tcgattt--c---c----------c------ac-g--------------gaaaa--gg
             Pacific walrus  -------tcaattt--c---c----------c------gg-g--------------gaaaa--gg
               Weddell seal  -------tcaattt--c---t----------c------ag-g--------------gaaaa--gg
           Black flying-fox  -------tcagttt--c---c----------c------ag-a--------------gaaga--gg
                    Megabat  -------tcagttt--c---c----------c------ag-a--------------gaaga--gg
       David's myotis (bat)  -------tca-ttt--c---c----------c------ag-a--------------a--------
                   Microbat  -------tc--cct--c---c----------c------ag-a--------------a--------
                      Shrew  -------tcgtttc--ccagc----------t------gg-g--------------aggga--ag
            Star-nosed mole  -------tcggttt--t---c----------t------gg-a--------------aaaggccag
                   Elephant  -------tcgtttc--c---c----------t------c--g--------------aagga--gc
        Cape elephant shrew  -------tcaattc--c---c----------g------ct-g--------------gagga--gg
                    Manatee  -------tcgtttt--c---c----------t------cg-a--------------aagga--gt
           Cape golden mole  -------tcgtttt--c---c----------t------gc-a--------------caggg--at
                   Aardvark  -------tcgtttt--c---c----------t------gg-a--------------aagaa--a-
     Lesser Egyptian jerboa  =================================================================
                     Tenrec  =================================================================
                   Hedgehog  =================================================================
                        Pig  =================================================================

Inserts between block 3 and 4 in window
              Prairie vole 927bp
B D        Chinese hamster 1bp
B D                  Mouse 5bp
B D         Naked mole-rat 2bp
B D             Guinea pig 2bp
                Chinchilla 2bp
          Brush-tailed rat 2bp
      David's myotis (bat) 5bp
B D               Microbat 5bp

Alignment block 4 of 675 in window, 17405773 - 17405788, 16 bps 
B D                   Human  tgg-----------gc--t-----tt--tttttcac--
B D                   Chimp  tgg-----------gcttt-----tt--tttttcac--
B D                 Gorilla  tgg-----------gc-tt-----tt--tttttcac--
B D               Orangutan  tgg-----------gc-tt-----tt--tttttcac--
B D                  Gibbon  tgg-----------gc--------tt--tttttcac--
B D                  Rhesus  tgg-----------gc-tt-----tt--ttttcaac--
B D     Crab-eating macaque  tgg-----------gc-tt-----tt--ttttcaac--
B D                  Baboon  tgg-----------gc--t-----tt--ttttcaac--
B D            Green monkey  tgg-----------gc-tt-----tt--ttttcaac--
B D                Marmoset  tgg-----------cc--------tt--gttttcac--
B D         Squirrel monkey  tgg-----------gc--------tt--tttgccat--
B D                Bushbaby  tga-----------gt--t-----tt--gttcactc--
         Chinese tree shrew  tggcggtgagttttgc--------tt--ccttcgat--
B D                Squirrel  ------------------------ta--ggttttat--
B D         Chinese hamster  ---------------------------------cat--
B D                   Mouse  ------------------------tg--gaattcaa--
B D                     Rat  -------------------------g--gggtttac--
B D          Naked mole-rat  ------------------------cg--tcccgcat--
B D              Guinea pig  ------------------------cg--cgctgcat--
                 Chinchilla  ------------------------cg--ccctgcat--
           Brush-tailed rat  ------------------------tg--cccggcat--
B D                    Pika  ------------------tggagttg--gatctccc--
B D                  Alpaca  ------------------------tg--agttgttt--
             Bactrian camel  ------------------------tg--agttgttt--
B D                 Dolphin  ------------------------tg--ggttgttt--
               Killer whale  ------------------------tg--ggttgttt--
           Tibetan antelope  ------------------------tg--agttgctt--
B D                     Cow  ------------------------tg--ggttggtt--
B D                   Sheep  ------------------------tg--agttgctt--
              Domestic goat  ------------------------tg--agttgctt--
B D                   Horse  ------------------------tgtttttt-ttt--
B D        White rhinoceros  ------------------------tg--ggtt-ttt--
B D                     Cat  ------------------------tg--ggttattt--
B D                     Dog  ------------------------tg--ggttgctt--
B D                 Ferret   ------------------------tg--ggttgttt--
B D                   Panda  ------------------------tg--ggttgttt--
             Pacific walrus  ------------------------tg--ggttgttt--
               Weddell seal  ------------------------tg--ggttgttt--
           Black flying-fox  ------------------------tg--tgtagttt--
B D                 Megabat  ------------------------tg--tgtagttt--
B D                   Shrew  ------------------------tg--ggttattc--
            Star-nosed mole  ------------------------gg--agttgtt---
B D                Elephant  --------------------gtgttt--tgtttctgct
        Cape elephant shrew  --------------------aggttt--tgtttctctc
B D                 Manatee  --------------------agg-ag--tgcttctctc
           Cape golden mole  --------------------atgttt--catttctcac
                   Aardvark  ----------------------gtgt--cttttctcct
              Prairie vole  ======================================
    Lesser Egyptian jerboa  ======================================
B D                  Tenrec  ======================================
B D                Hedgehog  ======================================
B D                     Pig  ======================================
B D                Microbat  ======================================
      David's myotis (bat)  ======================================

Inserts between block 4 and 5 in window
B D               Squirrel 10bp
B D        Chinese hamster 14bp
B D                  Mouse 14bp
B D                    Rat 14bp
B D         Naked mole-rat 9bp
B D             Guinea pig 9bp
                Chinchilla 9bp
          Brush-tailed rat 9bp
B D                   Pika 2bp
B D                 Alpaca 6bp
            Bactrian camel 6bp
B D                Dolphin 6bp
              Killer whale 6bp
          Tibetan antelope 6bp
B D                    Cow 6bp
B D                  Sheep 6bp
             Domestic goat 6bp
B D                  Horse 6bp
B D       White rhinoceros 6bp
B D                    Cat 6bp
B D                    Dog 6bp
B D                Ferret  6bp
B D                  Panda 6bp
            Pacific walrus 6bp
              Weddell seal 6bp
          Black flying-fox 6bp
B D                Megabat 6bp
B D                  Shrew 6bp

Alignment block 5 of 675 in window, 17405789 - 17405809, 21 bps 
B D                   Human  cctgctt---taaaagcccttggg
B D                   Chimp  cctgctt---taaaagcccttggg
B D                 Gorilla  cctgctt---taaaagcccttggg
B D               Orangutan  cctgctt---taaaagcccttggg
B D                  Gibbon  cctgctt---taaaagcccttggg
B D                  Rhesus  cctgctt---taaaaggcctcggg
B D     Crab-eating macaque  cctgctt---taaaaggcctcggg
B D                  Baboon  cctgctt---taaaaggcctcggg
B D            Green monkey  cctgctt---taaaaggcctcggg
B D                Marmoset  cctgctt---taaaaggccttggg
B D         Squirrel monkey  cctactt---taaaaggccttggg
B D                Bushbaby  tctagtt---t--atggcctcagg
         Chinese tree shrew  tgagggt---ttaatgacctt-ga
B D                Squirrel  ttttcat---cctcagc----tgg
               Prairie vole  ccctgct---t-------------
B D                   Mouse  cttcgct---ggccagt-------
B D                     Rat  atgcccc---tggaag--------
B D          Naked mole-rat  ---------------------ctg
B D              Guinea pig  ---------------------ctg
                 Chinchilla  ---------------------ccc
           Brush-tailed rat  ---------------------ccc
B D                    Pika  ------------tcagctgtcctg
B D                  Alpaca  ---aatt------atagccttggg
             Bactrian camel  ---aatt------atagccttggg
B D                 Dolphin  ---aatt------atggcctcggg
               Killer whale  ---aatt------atggcctcggg
           Tibetan antelope  ---aatt------ctggccttgg-
B D                     Cow  ---aatt------ctggccttgga
B D                   Sheep  ---catt------ctggccttggg
              Domestic goat  ---aatt------ctggccttggg
B D                   Horse  ---gatt------gtggcctcggg
B D        White rhinoceros  ---aatt------atggcctcagg
B D                     Cat  ---aatt------aaaaccttgag
B D                     Dog  ---aatt------gaaaccttgag
B D                 Ferret   ---aatt------gaaaccttgag
B D                   Panda  ---aatt------ggaaccttgag
             Pacific walrus  ---aatt------gaaacctggag
               Weddell seal  ---aatt------gaaacctggag
           Black flying-fox  ---agtt-----aaagtctt--ag
B D                 Megabat  ---agat------aagtctt--ag
       David's myotis (bat)  ---acta------tgagctt--ga
B D                Microbat  ---atta------tgggctt--gg
B D                   Shrew  ---actttcacagatgcccttcgg
            Star-nosed mole  ----------tgaaagccttttgg
B D                Elephant  --------gctttagcgccccggg
        Cape elephant shrew  --------acttctcatcctttgg
B D                 Manatee  --------gcattaagactt----
           Cape golden mole  ----------------ctctccag
                   Aardvark  --------gcattaggacctcctg
B D         Chinese hamster  ========================
    Lesser Egyptian jerboa  ========================
B D                  Tenrec  ========================
B D                Hedgehog  ========================
B D                     Pig  ========================

Inserts between block 5 and 6 in window
           Star-nosed mole 983bp

Alignment block 6 of 675 in window, 17405810 - 17405811, 2 bps 
B D                   Human  cc
B D                   Chimp  cc
B D                 Gorilla  cc
B D               Orangutan  cc
B D                  Gibbon  cc
B D                  Rhesus  cc
B D     Crab-eating macaque  cc
B D                  Baboon  cc
B D            Green monkey  gc
B D                Marmoset  cc
B D         Squirrel monkey  cc
B D                Bushbaby  tc
         Chinese tree shrew  cc
B D                Squirrel  at
B D          Naked mole-rat  gc
B D              Guinea pig  gc
                 Chinchilla  gc
           Brush-tailed rat  gc
B D                    Pika  gg
B D                  Alpaca  ga
             Bactrian camel  ga
B D                 Dolphin  ac
               Killer whale  ac
           Tibetan antelope  gc
B D                     Cow  gc
B D                   Sheep  gc
              Domestic goat  gc
B D                   Horse  ct
B D        White rhinoceros  ct
B D                     Cat  ct
B D                     Dog  at
B D                 Ferret   ct
B D                   Panda  ct
             Pacific walrus  ct
               Weddell seal  ct
           Black flying-fox  tc
B D                 Megabat  tc
       David's myotis (bat)  cc
B D                Microbat  cc
B D                   Shrew  cc
B D                Elephant  tc
        Cape elephant shrew  tc
           Cape golden mole  tt
                   Aardvark  tc
              Prairie vole  --
B D                   Mouse  --
B D                     Rat  --
B D         Chinese hamster  ==
    Lesser Egyptian jerboa  ==
B D                  Tenrec  ==
B D                Hedgehog  ==
           Star-nosed mole  ==
B D                     Pig  ==
B D                 Manatee  --

Inserts between block 6 and 7 in window
B D                  Shrew 138bp

Alignment block 7 of 675 in window, 17405812 - 17405833, 22 bps 
B D                   Human  ct------tccc-------a-----------------------------g--------------ctgggt
B D                   Chimp  ct------tccc-------a-----------------------------a--------------ctgggt
B D                 Gorilla  ct------tccc-------a-----------------------------a--------------ctgggt
B D               Orangutan  ct------tccc-------a-----------------------------a--------------ctgggt
B D                  Gibbon  ct------tccc-------a-----------------------------a--------------ctgagt
B D                  Rhesus  ct------tccc-------a-----------------------------a--------------ctgggt
B D     Crab-eating macaque  ct------tccc-------a-----------------------------a--------------ctgggt
B D                  Baboon  ct------tccc-------a-----------------------------a--------------ctgggt
B D            Green monkey  cc------ttc-----------------------------------------------------------
B D                Marmoset  ct------tccc-------a-----------------------------a--------------ctgggt
B D         Squirrel monkey  ct------tccc-------a-----------------------------a--------------ctgggt
B D                Bushbaby  ct------tcct-------a-----------------------------gcagat---------cttgga
         Chinese tree shrew  ct------ttcc-------t-----------------------------g--------------ctcggt
B D                Squirrel  gc------tggc-------c-----------------------------a--------------gtgaga
               Prairie vole  -----------c-------t-----------------------------c--------------ccatgg
B D         Chinese hamster  ------------------------------------------------------------------aaag
B D                   Mouse  -----------c-------a-----------------------------c--------------ctggtg
B D                     Rat  -----------c-------a-----------------------------a--------------gagaaa
B D          Naked mole-rat  ct------ccgc-------a-----------------------------g--------------ctgggt
B D              Guinea pig  -t------ctgcctcgggat-----------------------------g--------------ctgcgt
                 Chinchilla  gt------ctgc-------g-----------------------------g--------------------
           Brush-tailed rat  gt------ttgc-------a-----------------------------g--------------ctgtgc
B D                    Pika  gg------atgc-------g-----------------------------g--------------gtgggg
B D                  Alpaca  tt------tctg-------g-----------------------------g--------------ctggat
             Bactrian camel  tt------tctg-------g-----------------------------g--------------ctggat
B D                 Dolphin  tt------tctg-------g-----------------------------g--------------ttggtt
               Killer whale  tt------tctg-------g-----------------------------g--------------ttggtt
           Tibetan antelope  tt------tctg-------g-----------------------------g--------------ttggat
B D                     Cow  tt------tctg-------g-----------------------------g--------------ttggat
B D                   Sheep  tt------tctg-------g-----------------------------g--------------ttggat
              Domestic goat  tt------tctg-------a-----------------------------g--------------ttggat
B D                   Horse  ct------cctg-------g-----------------------------g--------------ctgggt
B D        White rhinoceros  ct------tctg-------g-----------------------------g--------------ctgggt
B D                     Cat  tt------tctg-------g-----------------------------c--------------ttggtg
B D                     Dog  ttgggacgtctg-------ggtggctcagtcagtgattgatggtctgcct--------------ttggct
B D                 Ferret   tt------tccg-------g-----------------------------t--------------ttggca
B D                   Panda  tt------tagg-------g-----------------------------t--------------ttggtg
             Pacific walrus  tt------tcca-------g-----------------------------t--------------------
               Weddell seal  tt------tcca-------g-----------------------------t--------------tt----
           Black flying-fox  tt------tctg-------g-----------------------------g--------------ctgggt
B D                 Megabat  tt------tctg-------g-----------------------------g--------------ctgggt
       David's myotis (bat)  ct------tctg-------g-----------------------------g--------------ctgggt
B D                Microbat  ct------tctg-------g-----------------------------g--------------ctgggt
B D                Elephant  ----------------------------------------------------tttccctggtcgggggaa
        Cape elephant shrew  ----------------------------------------------------aatccctggttagtggga
B D                 Manatee  ---------------------------------------------------------ctggtccgtggaa
           Cape golden mole  ----------------------------------------------------gttcctgagtctgtgggc
                   Aardvark  ----------------------------------------------------gttccctggtcagtggga
    Lesser Egyptian jerboa  ======================================================================
B D                  Tenrec  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
           Star-nosed mole  ======================================================================
B D                     Pig  ======================================================================

                      Human  gccagcc-------------------a
                      Chimp  gccagcc-------------------a
                    Gorilla  gccagcc-------------------a
                  Orangutan  gccagcc-------------------a
                     Gibbon  gccagcc-------------------a
                     Rhesus  gccagcc-------------------a
        Crab-eating macaque  gccagcc-------------------a
                     Baboon  gccagcc-------------------a
               Green monkey  -----cc-------------------a
                   Marmoset  gccagccagacctcctgtagtagggaa
            Squirrel monkey  gccagccagacctcctgtagtagggaa
                   Bushbaby  tccagtg------------agagggaa
         Chinese tree shrew  gctggcc--------------agcgag
                   Squirrel  tcc------------------------
               Prairie vole  tctgagt--------------------
            Chinese hamster  tcc-agt--------------------
                      Mouse  cctgtgg--------------------
                        Rat  ctt------------------------
             Naked mole-rat  gctggcc--------------------
                 Guinea pig  gccagga--------------------
                 Chinchilla  ---agag--------------------
           Brush-tailed rat  gctgggt--------------------
                       Pika  ctcgtct--------------------
                     Alpaca  gctggcc-------------------a
             Bactrian camel  gctggcc-------------------a
                    Dolphin  gctggcc-------------------a
               Killer whale  gctggcc-------------------a
           Tibetan antelope  gctggcc-------------------a
                        Cow  gctggcc-------------------a
                      Sheep  gctggcc-------------------a
              Domestic goat  gctggcc-------------------a
                      Horse  gccag-c-------------------c
           White rhinoceros  gccag-c-------------------c
                        Cat  tccgc-a-------------------a
                        Dog  ---------------------------
                    Ferret   ---------------------------
                      Panda  ---------------------------
             Pacific walrus  ---------------------------
               Weddell seal  ---------------------------
           Black flying-fox  gctgtta-------------------g
                    Megabat  gctgtta-------------------a
       David's myotis (bat)  gctgg-a-------------------t
                   Microbat  gctggcc-------------------c
                   Elephant  gctt-----------------------
        Cape elephant shrew  gttc-----------------------
                    Manatee  gctt-----------------------
           Cape golden mole  ttta-----------------------
                   Aardvark  gctt-----------------------
     Lesser Egyptian jerboa  ===========================
                     Tenrec  ===========================
                   Hedgehog  ===========================
                      Shrew  ===========================
            Star-nosed mole  ===========================
                        Pig  ===========================

Inserts between block 7 and 8 in window
B D                 Alpaca 21bp
            Bactrian camel 21bp
B D                Dolphin 21bp
              Killer whale 21bp
          Tibetan antelope 10363bp
B D                    Cow 20bp
B D                  Sheep 20bp
             Domestic goat 20bp
B D                  Horse 21bp
B D       White rhinoceros 21bp
B D                    Cat 21bp
B D                    Dog 18bp
B D                Ferret  17bp
B D                  Panda 20bp
            Pacific walrus 10bp
              Weddell seal 17bp
          Black flying-fox 21bp
B D                Megabat 21bp
      David's myotis (bat) 16bp
B D               Microbat 17bp
B D               Elephant 11bp
       Cape elephant shrew 11bp
B D                Manatee 11bp
          Cape golden mole 11bp
                  Aardvark 11bp

Alignment block 8 of 675 in window, 17405834 - 17405851, 18 bps 
B D                   Human  actgtggctgcc-------t-g--------------------------g-----g---------ac
B D                   Chimp  actgtggctgcc-------t-g--------------------------g-----g---------ac
B D                 Gorilla  actgtggctgcc-------t-g--------------------------g-----g---------ac
B D               Orangutan  actgcggctgcc-------t-g--------------------------g-----g---------ac
B D                  Gibbon  actgtgcttgct-------t-g--------------------------g-----g---------ac
B D                  Rhesus  actgtggctgcc-------t-g--------------------------g-----g---------ag
B D     Crab-eating macaque  actgtggctgcc-------t-g--------------------------g-----g---------ag
B D                  Baboon  actgtggctgcc-------t-g--------------------------g-----g---------ag
B D            Green monkey  actgtggctgcc-------t-g--------------------------g-----g---------ac
B D                Marmoset  gctgtggctgcc-------t-g--------------------------g-----g---------ac
B D         Squirrel monkey  gctgtggctgcc-------t-g--------------------------g-----g---------ac
B D                Bushbaby  ggggggacggtc-------t-g--------------------------g-----g---------ac
         Chinese tree shrew  attcccacagcc-------t-g--------------------------g-----g---------at
B D                Squirrel  ----------cc-------t-a--------------------------g-----g---------ag
               Prairie vole  ---------gcc-------t-c------------------------------------------cc
B D         Chinese hamster  ---------gct-------t-g--------------------------------------------
B D                   Mouse  ---------gct-------t-g--------------------------g-----g---------ac
B D                     Rat  -----------c-------t-g--------------------------g-----a---------ac
B D          Naked mole-rat  ---------gcc-------g-gccagacggcgccgagg----------g-----g---------ga
B D              Guinea pig  ---------gta-------g-gccagatagcgccaagggagagactggg-----g---------ct
                 Chinchilla  ---------gct-------g-g--------------------------g-----g---------cc
           Brush-tailed rat  ---------gca-------g-gcca-----------------------g-----g---------cc
B D                    Pika  ---------gcc-------t-g--------------------------g-----g---------ac
B D                  Alpaca  gctaggactgcc-------t-g--------------------------c-----g---------ac
             Bactrian camel  gctaggactgcc-------t-g--------------------------c-----g---------ac
B D                 Dolphin  gctggggctacc-------t-g--------------------------c-----g---------ac
               Killer whale  gctggggctacc-------t-g--------------------------c-----g---------ac
           Tibetan antelope  agtggggct-cc-------t-g--------------------------g-----g---------ac
B D                     Cow  agtggggct-cc-------cgg--------------------------g-----g---------ag
B D                   Sheep  agtggggct-cc-------t-g--------------------------g-----g---------ac
              Domestic goat  aatggagct-cc-------t-g--------------------------g-----g---------ac
B D                   Horse  gttggggctgcc-------t-g--------------------------g-----g---------ac
B D        White rhinoceros  gttggggttgcc-------t-g--------------------------g-----g---------ac
B D                     Cat  gctagggctgcc-------t-g--------------------------g-----g---------ac
B D                     Dog  cccaggattgagtccagcat-g--------------------------g-----g---------gc
B D                 Ferret   gctggagcagcc-------t-g--------------------------a-----g---------tc
B D                   Panda  gctgtggctgcc-------t-g--------------------------g-----g---------aa
             Pacific walrus  gctggggctgcc--cggcgt-g--------------------------g-----gggg------ac
               Weddell seal  gccggggctgctgggggggt-g--------------------------g-----ggggcgggaaac
           Black flying-fox  ------gatgcc-------t-g--------------------------g-----g---------ac
B D                 Megabat  ------gatgcc-------t-g--------------------------g-----g---------ac
       David's myotis (bat)  ---------------------a--------------------------g-----g---------ac
B D                Microbat  ---------------------a--------------------------g-----g---------ac
B D                Elephant  gctggggccacc-------t-g--------------------------ggatacg---------cc
        Cape elephant shrew  gcagaggccggt-------g-g--------------------------g-----g---------cc
B D                 Manatee  gctggggccgcc-------t-g--------------------------g-----g---------ac
           Cape golden mole  gctggagtcact-------t-g--------------------------g-----g---------ac
                   Aardvark  gctgaggccact-------c-g--------------------------g-----g---------ac
    Lesser Egyptian jerboa  ==================================================================
B D                  Tenrec  ==================================================================
B D                Hedgehog  ==================================================================
B D                   Shrew  ==================================================================
           Star-nosed mole  ==================================================================
B D                     Pig  ==================================================================

Inserts between block 8 and 9 in window
B D               Squirrel 27bp
              Prairie vole 23bp
B D        Chinese hamster 5bp
B D                  Mouse 9bp
B D                    Rat 21bp
B D         Naked mole-rat 24bp
B D             Guinea pig 13bp
                Chinchilla 12bp
          Brush-tailed rat 85bp
B D                   Pika 23bp

Alignment block 9 of 675 in window, 17405852 - 17405858, 7 bps 
B D                   Human  ac-tccat
B D                   Chimp  ac-tccat
B D                 Gorilla  ac-tccat
B D               Orangutan  ac-tccat
B D                  Gibbon  ac-tccat
B D                  Rhesus  ac-tctat
B D     Crab-eating macaque  ac-tctat
B D                  Baboon  ac-tccat
B D            Green monkey  ac-tccat
B D                Marmoset  ac-tcca-
B D         Squirrel monkey  ac-tccat
B D                Bushbaby  ag-cacat
         Chinese tree shrew  gc-cccgt
B D                  Alpaca  ac-cccat
             Bactrian camel  ac-cccat
B D                 Dolphin  ac-cccat
               Killer whale  ac-cccat
           Tibetan antelope  ac-cccat
B D                     Cow  ac-cccaa
B D                   Sheep  ac-cccat
              Domestic goat  ac-cccat
B D                   Horse  ac-cccat
B D        White rhinoceros  ac-cccat
B D                     Cat  ac-cccat
B D                     Dog  tc-cccgc
B D                 Ferret   tg-accat
B D                   Panda  aa-cccat
             Pacific walrus  ac-cccat
               Weddell seal  ac-cccat
           Black flying-fox  aa-tccag
B D                 Megabat  aa-tccag
       David's myotis (bat)  ac-cccat
B D                Microbat  ac-cccat
B D                Elephant  agcgccag
        Cape elephant shrew  ag-gtcag
B D                 Manatee  ga-ggcag
           Cape golden mole  ct-gctat
                   Aardvark  ac-gccag
              Prairie vole  ========
B D                   Mouse  ========
B D                     Rat  ========
B D         Chinese hamster  ========
    Lesser Egyptian jerboa  ========
B D                    Pika  ========
B D                  Tenrec  ========
B D                Hedgehog  ========
B D                   Shrew  ========
B D              Guinea pig  ========
          Brush-tailed rat  ========
           Star-nosed mole  ========
B D          Naked mole-rat  ========
B D                     Pig  ========
                Chinchilla  ========
B D                Squirrel  ========

Inserts between block 9 and 10 in window
          Cape golden mole 20449bp

Alignment block 10 of 675 in window, 17405859 - 17405871, 13 bps 
B D                   Human  cttaagtccctg---------t
B D                   Chimp  cttaagtccctg---------t
B D                 Gorilla  cttaagtccctg---------t
B D               Orangutan  cttaagtccctg---------t
B D                  Gibbon  cttgagtccctg---------t
B D                  Rhesus  cttaagtccctg---------t
B D     Crab-eating macaque  cttaagtccctg---------t
B D                  Baboon  cttaagtccctg---------t
B D            Green monkey  cttaagtccctg---------t
B D                Marmoset  ctcaagtccctg---------c
B D         Squirrel monkey  ctcaagtccccg---------c
B D                Bushbaby  ctcaaatcccta---------c
         Chinese tree shrew  tgcaagtcctcg---------c
B D                Squirrel  ------gtgttg---------t
               Prairie vole  -------ccttg---------t
B D         Chinese hamster  -------ccctg---------t
B D                     Rat  -------tgctg---------a
B D          Naked mole-rat  ------cctcgg---------t
B D              Guinea pig  ------cctccg---------t
                 Chinchilla  ------tctgcg---------t
B D                    Pika  ------cccctgccttgctgct
B D                  Alpaca  ctcaagtccctg---------c
             Bactrian camel  ctcaagtccctg---------c
B D                 Dolphin  ctcaagtccctg---------c
               Killer whale  ctcaagtccctg---------c
           Tibetan antelope  gtcaggtccctg---------c
B D                     Cow  gtcaagtcctag---------c
B D                   Sheep  gtcaggtccttg---------c
              Domestic goat  gtcaagtccttg---------c
B D                   Horse  ctcaagtccctg---------c
B D        White rhinoceros  ctcaagtccctg---------c
B D                     Cat  ctcaaattcctg---------c
B D                     Dog  gagaag--cctg---------c
B D                 Ferret   ctgaagttcccg---------c
B D                   Panda  ctcaagttcctg---------c
             Pacific walrus  ctcaagttcctg---------c
               Weddell seal  ctcaagttcctg---------c
           Black flying-fox  cacaagtccctg---------c
B D                 Megabat  cacaagtcccta---------c
       David's myotis (bat)  cgaaagtccctg---------c
B D                Microbat  cgtatgtccctg---------c
B D                Elephant  ctcgtgtccctg---------c
        Cape elephant shrew  ctctgtcccctc---------c
B D                 Manatee  ctcgcgtcccgg---------t
                   Aardvark  ctccagtaccct---------c
B D                   Mouse  ======================
    Lesser Egyptian jerboa  ======================
B D                  Tenrec  ======================
B D                Hedgehog  ======================
B D                   Shrew  ======================
          Cape golden mole  ======================
          Brush-tailed rat  ======================
           Star-nosed mole  ======================
B D                     Pig  ======================

Inserts between block 10 and 11 in window
            Bactrian camel 117bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Dog 1bp
            Pacific walrus 1bp
              Weddell seal 1bp

Alignment block 11 of 675 in window, 17405872 - 17405877, 6 bps 
B D                   Human  gcctct
B D                   Chimp  gcctct
B D                 Gorilla  gcctct
B D               Orangutan  gcctct
B D                  Gibbon  gcctct
B D                  Rhesus  gcttct
B D     Crab-eating macaque  gcttct
B D                  Baboon  gcttct
B D            Green monkey  gcttct
B D                Marmoset  atctct
B D         Squirrel monkey  acctct
B D                Bushbaby  cccgct
         Chinese tree shrew  ctgtca
B D                Squirrel  cc----
               Prairie vole  cc----
B D         Chinese hamster  cc----
B D                   Mouse  -c----
B D                     Rat  tt----
B D          Naked mole-rat  cc----
B D              Guinea pig  cc----
                 Chinchilla  cc----
B D                    Pika  ct----
B D                  Alpaca  ccttct
             Bactrian camel  ccctct
B D                 Dolphin  ccttct
               Killer whale  ccttct
           Tibetan antelope  ccttct
B D                     Cow  ccttct
B D                   Sheep  ccttct
              Domestic goat  ccttct
B D                   Horse  ctgctg
B D        White rhinoceros  ctttgg
B D                     Cat  acctcc
B D                     Dog  tctccc
B D                 Ferret   ccctct
B D                   Panda  ccctct
             Pacific walrus  ccctct
               Weddell seal  ccctct
           Black flying-fox  cctttt
B D                 Megabat  cctttt
       David's myotis (bat)  ccttct
B D                Microbat  ccttct
B D                Elephant  ccctct
        Cape elephant shrew  cctttt
B D                 Manatee  cccttt
                   Aardvark  ccctca
    Lesser Egyptian jerboa  ======
B D                  Tenrec  ======
B D                Hedgehog  ======
B D                   Shrew  ======
          Cape golden mole  ======
          Brush-tailed rat  ======
           Star-nosed mole  ======
B D                     Pig  ======

Inserts between block 11 and 12 in window
B D                 Alpaca 117bp

Alignment block 12 of 675 in window, 17405878 - 17405884, 7 bps 
B D                   Human  gctg-tgt
B D                   Chimp  gctg-tgt
B D                 Gorilla  gctg-tgt
B D               Orangutan  gctg-tgt
B D                  Gibbon  gctc-tgt
B D                  Rhesus  gctg-tgt
B D     Crab-eating macaque  gctg-tgt
B D                  Baboon  gctg-tgt
B D            Green monkey  gctg-tgt
B D                Marmoset  cctg-tga
B D         Squirrel monkey  cctg-tga
B D                Bushbaby  cctg-tgt
         Chinese tree shrew  tctg-gga
               Prairie vole  -------g
B D         Chinese hamster  -------a
B D                   Mouse  -------a
B D                     Rat  -------a
B D          Naked mole-rat  -------t
B D              Guinea pig  -------t
                 Chinchilla  -------t
B D                    Pika  -------t
B D                  Alpaca  ccta-cat
             Bactrian camel  ccta-tgt
B D                 Dolphin  cctt-tat
               Killer whale  cctt-tat
           Tibetan antelope  ccta-cat
B D                     Cow  ccta-cat
B D                   Sheep  ccta-cat
              Domestic goat  ccta-cat
B D                   Horse  agtg-cta
B D        White rhinoceros  actg-cta
B D                     Cat  cctg-cag
B D                     Dog  tctg-cct
B D                 Ferret   cctg-ctc
B D                   Panda  cccg-cat
             Pacific walrus  cccg-cat
               Weddell seal  tccg-cat
           Black flying-fox  cctgttat
B D                 Megabat  cctgttat
       David's myotis (bat)  cctg-tgt
B D                Microbat  ccag-tgt
B D                Elephant  catg-cga
        Cape elephant shrew  ccag-tca
B D                 Manatee  cacg-aga
                   Aardvark  cttg-cga
    Lesser Egyptian jerboa  ========
B D                  Tenrec  ========
B D                Hedgehog  ========
B D                   Shrew  ========
          Cape golden mole  ========
          Brush-tailed rat  ========
           Star-nosed mole  ========
B D                     Pig  ========
B D                Squirrel  --------

Inserts between block 12 and 13 in window
B D                 Alpaca 22bp
            Bactrian camel 22bp
B D                Dolphin 22bp
              Killer whale 22bp
          Tibetan antelope 22bp
B D                    Cow 22bp
B D                  Sheep 22bp
             Domestic goat 22bp
B D                  Horse 18bp
B D       White rhinoceros 18bp
B D                    Cat 22bp
B D                    Dog 285bp
B D                Ferret  22bp
B D                  Panda 22bp
            Pacific walrus 22bp
              Weddell seal 22bp
          Black flying-fox 20bp
B D                Megabat 20bp
      David's myotis (bat) 20bp
B D               Microbat 20bp

Alignment block 13 of 675 in window, 17405885 - 17405936, 52 bps 
B D                   Human  --------------------------gttactgagtg---cctag-gccgtgcca---------------
B D                   Chimp  --------------------------gttactgagtg---cctag-gccgtgcca---------------
B D                 Gorilla  --------------------------gttactgagtg---cctag-gccgtgcca---------------
B D               Orangutan  --------------------------gttactgagtg---cctag-gccatgcca---------------
B D                  Gibbon  --------------------------gttactgagtg---cctag-gccatgcca---------------
B D                  Rhesus  --------------------------gttactcagtg---cctag-gccatg------------------
B D     Crab-eating macaque  --------------------------gttactgagtg---cctag-gccatg------------------
B D                  Baboon  --------------------------gttactgagtg---cctag-gccatg------------------
B D            Green monkey  --------------------------gttactgagtg---cctag-gccatg------------------
B D                Marmoset  --------------------------gttactgggtg---cctag-gccatgcca---------------
B D         Squirrel monkey  --------------------------gttactgggtg---cctag-gccatgcca---------------
B D                Bushbaby  --------------------------gtaaatg---------------catgcca---------------
         Chinese tree shrew  --------------------------gttactgagcg---cctggtgccttgaga---------------
B D                Squirrel  ----------------------------------------ctgcg-ctctcctgc---------------
               Prairie vole  --------------------------gttccagggta---cctgg-cgcttgtgg---------------
B D         Chinese hamster  --------------------------gataccggatg---cctgg-cgctggtgc---------------
B D                   Mouse  --------------------------gtggctgtccg---ccggg-cggtggtggcgcacgcctttaacc
B D                     Rat  --------------------------gttaccaggtg---cctgg-tgcttgtgg---------------
B D          Naked mole-rat  --------------------------gacccct-------cctgg-ggctcg------------------
B D              Guinea pig  --------------------------gaactcc-------cctgg-cgctcg------------------
                 Chinchilla  --------------------------gacccct-------cctgg-ggctcg------------------
B D                    Pika  --------------------------gtgtccgagtg---cctgc-tgcccgccctgcg-----------
B D                  Alpaca  --------------------------gttactgagcg---cctag-tgtatgtca---------------
             Bactrian camel  --------------------------gttactgagcg---cctag-tgtatgcca---------------
B D                 Dolphin  --------------------------gttactgagtg---tttag-tgcatgcca---------------
               Killer whale  --------------------------gttactgagtg---tttag-tgcatgcca---------------
           Tibetan antelope  --------------------------gtcactgagca---gccgg-tgcacgcca---------------
B D                     Cow  --------------------------gttattgagcg---gccgg-tgcacgcca---------------
B D                   Sheep  --------------------------gttactgagca---gccgg-tgcacgcca---------------
              Domestic goat  --------------------------gttactgagca---gccgg-tgcacgcca---------------
B D                   Horse  --------------------------gttactgagtg---cctag-tgca--------------------
B D        White rhinoceros  ---------------------------ttactgagtg---cccag-tgca--------------------
B D                     Cat  --------------------------gttacggggcg---tctgg-tgcatgtca---------------
B D                     Dog  --------------------------gttactgagca---tctca-tgcatgtca---------------
B D                 Ferret   --------------------------gttactgaacg---tctca-tgcaggcca---------------
B D                   Panda  --------------------------tttactgagcg---tctca-tgcatgtca---------------
             Pacific walrus  --------------------------gttactgaggg---tctca-tgcctgtca---------------
               Weddell seal  --------------------------gttactgaggg---tctca-tgcctgtca---------------
           Black flying-fox  --------------------------gttactgacca---cctaa-ggcatgaca---------------
B D                 Megabat  --------------------------gttactgacca---cctaa-ggcatgaca---------------
       David's myotis (bat)  --------------------------gtgac-tgtag---cctag-gccatgcca---------------
B D                Microbat  --------------------------gtgacaagaag---cctag-ggcatgcca---------------
B D                Elephant  gttctcgagggcaacaatc----gccattactgagcg---cctac-tgcatgcta---------------
        Cape elephant shrew  cttctccgcggcaacagtc---agcagttaccgagcg---cctgc-tgcatgctc---------------
B D                 Manatee  gtttctgagggccaaaatt----gcaattactgagcg---cctac-tgcacgcta---------------
                   Aardvark  gttcctgacgccaacgatctatcgcaatgactgagcgcgccttgc-tgcatgcta---------------
    Lesser Egyptian jerboa  ======================================================================
B D                  Tenrec  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
          Cape golden mole  ======================================================================
          Brush-tailed rat  ======================================================================
           Star-nosed mole  ======================================================================
B D                     Pig  ======================================================================

                      Human  -----gc-ctgtattcatctg-----------tactat-gacctg
                      Chimp  -----gc-ctgtattcatctg-----------tactat-gacctg
                    Gorilla  -----gc-ctgtattcatcta-----------tactat-gacctg
                  Orangutan  -----gc-ctgtattcatctg-----------taccat-gacctg
                     Gibbon  -----gc-ctgtattcatctg-----------taccat-gatctg
                     Rhesus  ----------gtattcatctg-----------taccat-gacctg
        Crab-eating macaque  ----------gtattcatctg-----------taccat-gacctg
                     Baboon  ----------gtattcatctg-----------taccat-gacttg
               Green monkey  ----------gtattcatc-g-----------taccat-gacctg
                   Marmoset  -----gc-ctgcattcatctg-----------taccat-gacctg
            Squirrel monkey  -----gc-ttgcattcatctg-----------taccat-gccctg
                   Bushbaby  -----gctttgtgttcctctg-----------taccat-gacttg
         Chinese tree shrew  -----tc-------gcacctg-----------tcccac-gacccg
                   Squirrel  -----acccaggcctcctcta------------------------
               Prairie vole  -----gcttggccctcatctg------------------------
            Chinese hamster  -----gcttgggactcttccg------------------------
                      Mouse  ccagcacttggga---ggcag------------------------
                        Rat  -----gtttggga-----ctg------------------------
             Naked mole-rat  -----gttcatctctaccccc------------------------
                 Guinea pig  -----cttcatttccacccac------------------------
                 Chinchilla  -----gttcatttctgctcac------------------------
                       Pika  -----ccctgcagctctgctggattacacctg-------------
                     Alpaca  -----gctttgtctccatctg-----------tcccat-gacctg
             Bactrian camel  -----gctttgtctccatctg-----------tcccat-gacctg
                    Dolphin  -----cctttgtgttcatctg-----------taccac-gacctg
               Killer whale  -----cctttgtgttcatctg-----------taccac-gacctg
           Tibetan antelope  -----gct-tgtgttcgtctg-----------tatcac-aaacgg
                        Cow  -----gctctgtgt---tctg-----------taccacaaaacgg
                      Sheep  -----gctctgtgttcatctc-----------taccac-aagcgg
              Domestic goat  -----gctctgtgttcgtctc-----------taccac-aagcgg
                      Horse  --------ttgtgttcccctg-----------tgccac-gacctg
           White rhinoceros  --------ttgtgttcatctg-----------taccac-aacctg
                        Cat  -----gcctgctgttcacgtg-----------taccag-gacctg
                        Dog  -----gccttgtgttcatgtg-----------tcccag-gacctg
                    Ferret   -----gcctcgtgttcgcggg-----------tcccag-gacccg
                      Panda  -----gcctcgtgttcatgtg-----------tcccag-gacccg
             Pacific walrus  -----gccttgtgtttgtgtg-----------tcccag-gacctg
               Weddell seal  -----gccttgtgtttgtgtg-----------tcccag-gacctg
           Black flying-fox  -----gccttgtgttcctctg-----------tactgc-gatctg
                    Megabat  -----gccttgtgttcctctg-----------tactgc-gatctg
       David's myotis (bat)  -----gcctcgggttcctgtg-----------gactgt-gacctg
                   Microbat  -----gcctcctgttcctgcg-----------gactgt-gacctg
                   Elephant  -----gcctt-----catcac-----------aacctg-------
        Cape elephant shrew  -----gccttacggacttcac-----------gatctg-------
                    Manatee  -----tc------------------------------g-------
                   Aardvark  -----gcctcgcgttcatcgc-----------cgccgg-------
     Lesser Egyptian jerboa  =============================================
                     Tenrec  =============================================
                   Hedgehog  =============================================
                      Shrew  =============================================
           Cape golden mole  =============================================
           Brush-tailed rat  =============================================
            Star-nosed mole  =============================================
                        Pig  =============================================

Inserts between block 13 and 14 in window
B D               Squirrel 17bp
              Prairie vole 15bp
B D        Chinese hamster 15bp
B D                  Mouse 5bp
B D                    Rat 5bp
B D         Naked mole-rat 4bp
B D             Guinea pig 4bp
                Chinchilla 9bp

Alignment block 14 of 675 in window, 17405937 - 17405967, 31 bps 
B D                   Human  aagaggcagaggcc----atcactgtt----ggtccggt
B D                   Chimp  aagaggcagaggcc----atcattgtt----ggtctggt
B D                 Gorilla  aagaggcagaggcc----atcattgtt----ggtccggt
B D               Orangutan  aagaggcagaggct----atcgttgtt----ggtccggt
B D                  Gibbon  aagaggcagaggcc----atcatcgtt----ggtccagt
B D                  Rhesus  aagaggcagaggcc----atcattgtt----ggtccagt
B D     Crab-eating macaque  aagaggcagaggcc----atcattgtt----ggtccagt
B D                  Baboon  aagaggcagaggcc----atcattgtt----ggtccagt
B D            Green monkey  aagaggcagaggcc----atcattgtt----ggtccagt
B D                Marmoset  aagaggcagaggcg----gtgatcgct----ggcccagt
B D         Squirrel monkey  aagaggcagaggcc----atgatcgct----ggtccagt
B D                Bushbaby  aagaggcagagacc----atcatcatt----ggtccagt
         Chinese tree shrew  aagaggcagaggtt----ttcatggtc----ggtccggt
B D                Squirrel  ------gagaggc------------at----ggtccggc
               Prairie vole  ------gagtagct----------gtt----ggtttggt
B D         Chinese hamster  ------cagttgtt----------gtt----ggttcggt
B D                   Mouse  ------ggccggtt----------gtc----ggtttggt
B D                     Rat  ------tagcggtt----------gtc----ggtttggt
B D          Naked mole-rat  ------tagagccc--------------------cccgc
B D              Guinea pig  ------gagaggccagccagcatcgta----ggtccagc
                 Chinchilla  ------gtggggcc-----gcatcgct----gggccagc
           Brush-tailed rat  ------cagaggtca-cgagcatcgct----ggtccagc
B D                    Pika  aaggggcagaggcc----actgccccg----gatccagc
B D                  Alpaca  aagaggcgaaggac-------attttt----gttccagt
             Bactrian camel  aagaggtgaaggac-------attttt----gttccagt
B D                 Dolphin  aagaggccgagggc-------attttt-ggttcccaagt
               Killer whale  aagaggccgtgggc-------attttt-ggttcccaagt
           Tibetan antelope  aagaggcagagggc-------tttttggggggcccaagt
B D                     Cow  aagaggcagagggc-------tttttgggggggccatgt
B D                   Sheep  aagaggcagagggc-------atttttggggctgcaagt
              Domestic goat  aagaggcagagggc-------atttttggggctgcaagt
B D                   Horse  aagtggcgggggcc-------attgtt----ggtccagt
B D        White rhinoceros  aagaggcagaggcc-------ggcgtt----ggtccagt
B D                     Cat  aggaggcagaagct-------gccgtt----gattcagc
B D                     Dog  aagaaacagaagct-------gccgtt----ggttcagc
B D                 Ferret   aagacatcgtggct-------gtcatt----ggctcagc
B D                   Panda  aagagacggcaact-------gtcatt----ggttcagc
             Pacific walrus  aagagacagcaact-------gtcgtt----ggctcagc
               Weddell seal  aagagacagcagct-------gtcgtt----ggctcagc
           Black flying-fox  aagaagcagaggct-------gtcatt----ggtccagt
B D                 Megabat  aagaagcagaggct-------gtcatt----ggtcccgt
       David's myotis (bat)  -agaggctgag--c-------atcatt----ggtccagt
B D                Microbat  -agaggcagag--c-------atcatt----ggtccagt
B D                Elephant  cagaagcagaggcc-------ttggtt----gg------
        Cape elephant shrew  cag-----gaggc--------------------------
B D                 Manatee  cagaagcagaggcc-------ttcatt----ga------
                   Aardvark  ccgaagcagaggcc-------ttcgtt----gg------
    Lesser Egyptian jerboa  =======================================
B D                  Tenrec  =======================================
B D                Hedgehog  =======================================
B D                   Shrew  =======================================
          Cape golden mole  =======================================
           Star-nosed mole  =======================================
B D                     Pig  =======================================

Alignment block 15 of 675 in window, 17405968 - 17405983, 16 bps 
B D                   Human  ctcca-cc--------------------tggg-gaaac
B D                   Chimp  ctcca-cc--------------------tggg-gaaac
B D                 Gorilla  ctcca-cc--------------------tggg-gaaac
B D               Orangutan  ctcca-cc--------------------tggg-gaaac
B D                  Gibbon  ctcca-cc--------------------tggg-gaaac
B D                  Rhesus  ctcca-cc--------------------tggg-gaaac
B D     Crab-eating macaque  ctcca-cc--------------------tggg-gaaac
B D                  Baboon  ctcca-cc--------------------tggg-gaaac
B D            Green monkey  ctcca-cc--------------------tggg-gaaac
B D                Marmoset  cccca-cc--------------------tggg-gaaac
B D         Squirrel monkey  tccca-cc--------------------tggg-gaaac
B D                Bushbaby  gctta-gc--------------------tggg-gaaac
         Chinese tree shrew  tccga-gc--------------------tggg-ggaac
B D                Squirrel  cacccctg--------------------ctgg-gccac
               Prairie vole  cttcg-gg--------------------tagg-gaaac
B D         Chinese hamster  ctcca-gg--------------------taag-gaaac
B D                   Mouse  ctcct-ag--------------------aagg-ggaac
B D                     Rat  ctccc------------------------------gac
B D          Naked mole-rat  acctc-gc--------------------ctgg-gcagc
B D              Guinea pig  tccca-gc--------------------ctgg-gactc
                 Chinchilla  gcctt-gc--------------------cc-g-gaagc
           Brush-tailed rat  cccta-gc--------------------ccgg-gaagc
B D                    Pika  ccctt-gc--------------------tagg-ggaac
B D                  Alpaca  cccca-ga--------------------tgaa-aaaag
             Bactrian camel  cccca-gc--------------------tgag-gaaag
B D                 Dolphin  cccca-gc--------------------tggg-gaaac
               Killer whale  cccca-gc--------------------tggg-gaaac
           Tibetan antelope  cccca-gc--------------------tgggagaaat
B D                     Cow  cccca-ac--------------------tgggagaaat
B D                   Sheep  cccca-gc--------------------tgggagaaat
              Domestic goat  ctcca-gc--------------------tgggagaaat
B D                   Horse  cccca-gctcagggagtccagttctcagtggg-gaaac
B D        White rhinoceros  cctca-gttcagtgggtccagttcacagtggg-gaaac
B D                     Cat  ctcaa-gc--------------------cgga-gaaac
B D                     Dog  tccaa-gc--------------------tgag-gaaac
B D                 Ferret   tccaa-gc--------------------tggg-gaaac
B D                   Panda  tccaa-gc--------------------tggg-gaaac
             Pacific walrus  tccaa-gc--------------------tggg-gaaac
               Weddell seal  cccaa-gc--------------------tggg-gaaac
           Black flying-fox  tctca-gc--------------------tgggaaaaac
B D                 Megabat  tctca-gc--------------------tgggaaaaac
       David's myotis (bat)  cccca-gc--------------------tggg-gaaac
B D                Microbat  cccca-gc--------------------tggg-gaaac
B D                   Shrew  ctcta-gc--------------------tggg-gaac-
B D                Elephant  -tcta-gc--------------------tggg-gaaac
        Cape elephant shrew  ----a-ga--------------------tggg-gaaac
B D                 Manatee  -tcta-gc--------------------agcg-gaaac
                   Aardvark  -tctc-gc--------------------tggg-gaaac
    Lesser Egyptian jerboa  ======================================
B D                  Tenrec  ======================================
B D                Hedgehog  ======================================
          Cape golden mole  ======================================
           Star-nosed mole  ======================================
B D                     Pig  ======================================

Alignment block 16 of 675 in window, 17405984 - 17405985, 2 bps 
B D                   Human  tg
B D                   Chimp  tg
B D                 Gorilla  tg
B D               Orangutan  tg
B D                  Gibbon  tg
B D                  Rhesus  tg
B D     Crab-eating macaque  tg
B D                  Baboon  tg
B D            Green monkey  tg
B D                Marmoset  tg
B D         Squirrel monkey  tg
B D                Bushbaby  tg
         Chinese tree shrew  tg
B D                Squirrel  t-
               Prairie vole  tg
B D         Chinese hamster  ta
B D                   Mouse  ta
B D                     Rat  ta
B D                     Pig  tg
B D                  Alpaca  tg
             Bactrian camel  tg
B D                 Dolphin  tg
               Killer whale  tg
           Tibetan antelope  ga
B D                     Cow  ga
B D                   Sheep  ga
              Domestic goat  ga
B D                   Horse  tg
B D                     Cat  tg
B D                     Dog  tg
B D                 Ferret   tg
B D                   Panda  tg
             Pacific walrus  tg
               Weddell seal  tg
           Black flying-fox  tg
B D                 Megabat  tg
       David's myotis (bat)  tg
B D                Microbat  tg
B D                   Shrew  tg
B D                Elephant  tg
        Cape elephant shrew  tg
B D                 Manatee  tg
           Cape golden mole  tc
                   Aardvark  -g
    Lesser Egyptian jerboa  ==
B D                    Pika  --
B D                  Tenrec  ==
B D                Hedgehog  ==
B D              Guinea pig  --
          Brush-tailed rat  --
           Star-nosed mole  ==
B D          Naked mole-rat  --
                Chinchilla  --
B D        White rhinoceros  --

Inserts between block 16 and 17 in window
B D                    Pig 314bp
B D                  Shrew 13bp
          Cape golden mole 19bp
                  Aardvark 1bp

Alignment block 17 of 675 in window, 17405986 - 17406004, 19 bps 
B D                   Human  aggtt----gcacagt----tgcgtgg
B D                   Chimp  aggtt----gcacagt----tgcgtgg
B D                 Gorilla  aggtt----gcacagt----tgcgtgg
B D               Orangutan  aggtt----acacagt----tgagtgg
B D                  Gibbon  aggac----tcacagt----tgagtgg
B D                  Rhesus  agatt----gcacagt----tgagtga
B D     Crab-eating macaque  agatt----gcacagt----tgagtga
B D                  Baboon  agatt----gcacagt----tgagtga
B D            Green monkey  agatt----gcacagt----tgagtga
B D                Marmoset  aggtt----tcacagt----tgagtgg
B D         Squirrel monkey  aggct----gcacagt----tgagtgg
B D                Bushbaby  aggtt----gcaaggt----tgagtgg
         Chinese tree shrew  aggtt----gcaaggt----ggaatgt
B D                Squirrel  ----c----ccgaggt----tcagccg
               Prairie vole  aagcg----gcaaggt----tgagttg
B D         Chinese hamster  aggct----gcagggt----tga---g
B D                   Mouse  agact----tcaaggt----tcagttg
B D                     Rat  agact----gcaaggt----tcagttg
B D          Naked mole-rat  gggct----gcg-agt----tgaga-g
B D              Guinea pig  aggct----gcggagc----tgggg-g
                 Chinchilla  aggct----gcgaagt----tgagg-g
           Brush-tailed rat  aggct----gcgaagt----tgaga-g
B D                    Pika  aggctacccgcttggc----tgggggg
B D                  Alpaca  aggtt----g-agagg----tgagtgg
             Bactrian camel  aggtt----g-agagg----tgagtgg
B D                 Dolphin  aggct----g-agagg----tgactag
               Killer whale  aggct----g-agagg----tgactag
           Tibetan antelope  aagct----g-aggcg----tgagtgg
B D                     Cow  aggct----g-agacg----tgagtgg
B D                   Sheep  aacct----g-agaca----cgagtgg
              Domestic goat  aacct----g-agacg----cgagtgg
B D                   Horse  aggct----g-ggtgg----caagtgg
B D        White rhinoceros  aggct----g-agagg----caagtgg
B D                     Cat  aggct----g-agagg----tgtgtgg
B D                     Dog  aggcc----a-agaag----tgtgtgg
B D                 Ferret   aggct----g-agggg----ggggggg
B D                   Panda  aggct----g-agagc----tgcctag
             Pacific walrus  aggct----g-agaga----tgagtgg
               Weddell seal  aggct----g-agagg----tgagtgg
           Black flying-fox  aggct----g-agaag----taagtgg
B D                 Megabat  aggct----g-agaag----taagtgg
       David's myotis (bat)  aggct----g-agagg----tgagtgg
B D                Microbat  aggct----g-agagg----tgagtgg
B D                   Shrew  aggct----g-tgtgg----ggggtgg
B D                Elephant  aggct----gggacgg----tgaatga
        Cape elephant shrew  aggct----gcgaggg----tcaaggg
B D                 Manatee  aggct----gtgagggtcaatgaatgg
                   Aardvark  tggct----gcggggg----tggatgg
    Lesser Egyptian jerboa  ===========================
B D                  Tenrec  ===========================
B D                Hedgehog  ===========================
          Cape golden mole  ===========================
           Star-nosed mole  ===========================
B D                     Pig  ===========================

Inserts between block 17 and 18 in window
                  Aardvark 1bp

Alignment block 18 of 675 in window, 17406005 - 17406005, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Gibbon  t
B D                Marmoset  t
B D         Squirrel monkey  t
B D                Bushbaby  t
         Chinese tree shrew  t
B D                Squirrel  t
               Prairie vole  t
B D         Chinese hamster  t
B D                   Mouse  t
B D                     Rat  t
B D          Naked mole-rat  t
B D              Guinea pig  t
                 Chinchilla  t
           Brush-tailed rat  t
B D                    Pika  t
B D                  Alpaca  t
             Bactrian camel  t
B D                 Dolphin  t
               Killer whale  t
           Tibetan antelope  t
B D                     Cow  t
B D                   Sheep  t
              Domestic goat  t
B D                   Horse  t
B D        White rhinoceros  t
B D                     Cat  a
B D                     Dog  t
B D                 Ferret   t
B D                   Panda  t
             Pacific walrus  t
               Weddell seal  t
           Black flying-fox  t
B D                 Megabat  t
       David's myotis (bat)  t
B D                Microbat  t
B D                   Shrew  g
B D                Elephant  t
        Cape elephant shrew  t
B D                 Manatee  t
           Cape golden mole  t
    Lesser Egyptian jerboa  =
B D                  Tenrec  =
B D                Hedgehog  =
B D     Crab-eating macaque  -
           Star-nosed mole  =
                  Aardvark  =
B D                     Pig  =
B D                  Baboon  -
B D            Green monkey  -
B D                  Rhesus  -

Inserts between block 18 and 19 in window
B D                   Pika 1bp
          Cape golden mole 97bp

Alignment block 19 of 675 in window, 17406006 - 17406011, 6 bps 
B D                   Human  gga------gtg
B D                   Chimp  gga------gtg
B D                 Gorilla  gga------gtg
B D               Orangutan  aga------gtg
B D                  Gibbon  ggg------gtg
B D                Marmoset  gga------gtg
B D         Squirrel monkey  gga------gtg
B D                Bushbaby  ggg------ctg
         Chinese tree shrew  gga------cca
B D                Squirrel  caa------cag
               Prairie vole  gaa------ctg
B D         Chinese hamster  gga------ctg
B D                   Mouse  gga------ctg
B D                     Rat  gga------ctg
B D          Naked mole-rat  gga------cag
B D              Guinea pig  ggg------ggg
                 Chinchilla  gga------cgg
           Brush-tailed rat  gga------cag
B D                    Pika  ggg------cag
B D                  Alpaca  gga---------
             Bactrian camel  gga---------
B D                 Dolphin  gga---------
               Killer whale  gga---------
           Tibetan antelope  -ga---------
B D                     Cow  -ga---------
B D                   Sheep  -ga---------
              Domestic goat  -ga---------
B D                   Horse  ggg---------
B D        White rhinoceros  gga---------
B D                     Cat  aga---------
B D                     Dog  aga---------
B D                 Ferret   gga---------
B D                   Panda  aga---------
             Pacific walrus  aga---------
               Weddell seal  aga---------
           Black flying-fox  agacta------
B D                 Megabat  agacta------
       David's myotis (bat)  ggactg------
B D                Microbat  ggactg------
B D                   Shrew  ggg---gtg---
       Cape elephant shrew  ------------
    Lesser Egyptian jerboa  ============
B D                  Tenrec  ============
B D                Hedgehog  ============
B D     Crab-eating macaque  ------------
          Cape golden mole  ============
           Star-nosed mole  ============
                  Aardvark  ============
B D                     Pig  ============
B D                  Baboon  ------------
B D                 Manatee  ------------
B D                Elephant  ------------
B D            Green monkey  ------------
B D                  Rhesus  ------------

Alignment block 20 of 675 in window, 17406012 - 17406021, 10 bps 
B D                   Human  --a--------------------gggcagggc
B D                   Chimp  --ag--------ggca------ggggcagggt
B D                 Gorilla  --ag--------ggcagggcctgggtctgggt
B D               Orangutan  --ag--------ggca------gggcctgggt
B D                  Gibbon  --a-----------------------------
B D                Marmoset  --g-----------------------------
B D         Squirrel monkey  --g-----------------------------
B D                Bushbaby  --g-----------------------------
         Chinese tree shrew  --gc--------atcaggatcaagg-------
B D                Squirrel  --ggg---------------------------
               Prairie vole  --aagggcaaag--------------------
B D         Chinese hamster  --aagcgcagag--------------------
B D                   Mouse  --aagaccaaag--------------------
B D                     Rat  --aaggcttaag--------------------
B D          Naked mole-rat  --ag----------------------------
B D              Guinea pig  --ga----------------------------
                 Chinchilla  --gg----------------------------
           Brush-tailed rat  --gg----------------------------
B D                    Pika  --gc----------------------------
B D                Elephant  tga-----------------------------
        Cape elephant shrew  gga-----------------------------
B D                 Manatee  gga-----------------------------
                   Aardvark  aca-----------------------------
    Lesser Egyptian jerboa  ================================
B D                  Tenrec  ================================
B D                Hedgehog  ================================
             Domestic goat  --------------------------------
B D                   Sheep  --------------------------------
B D                   Shrew  --------------------------------
B D                     Cow  --------------------------------
B D     Crab-eating macaque  --------------------------------
          Cape golden mole  ================================
          Tibetan antelope  --------------------------------
B D                 Dolphin  --------------------------------
           Star-nosed mole  ================================
              Killer whale  --------------------------------
B D                 Megabat  --------------------------------
B D                     Pig  ================================
B D                Microbat  --------------------------------
              Weddell seal  --------------------------------
B D                   Panda  --------------------------------
B D                 Ferret   --------------------------------
B D                  Baboon  --------------------------------
            Pacific walrus  --------------------------------
          Black flying-fox  --------------------------------
B D                     Dog  --------------------------------
B D                     Cat  --------------------------------
            Bactrian camel  --------------------------------
B D                  Alpaca  --------------------------------
B D        White rhinoceros  --------------------------------
B D                   Horse  --------------------------------
B D            Green monkey  --------------------------------
B D                  Rhesus  --------------------------------

Inserts between block 20 and 21 in window
B D               Squirrel 1bp
              Prairie vole 2bp
B D        Chinese hamster 20791bp
B D                  Mouse 2bp
B D                    Rat 2bp

Alignment block 21 of 675 in window, 17406022 - 17406032, 11 bps 
B D                   Human  ---ctgggtctggg
B D                   Chimp  ---ctgggtctggg
B D                 Gorilla  ---ctgggtctggg
B D               Orangutan  ---ctgggtctggg
B D                  Gibbon  -------------g
B D                  Rhesus  -------------g
B D     Crab-eating macaque  -------------g
B D                  Baboon  -------------g
B D            Green monkey  -------------g
B D                Marmoset  -------------g
B D         Squirrel monkey  -------------g
B D                Bushbaby  -------------a
         Chinese tree shrew  -------------g
B D                Squirrel  ---tggggcttg--
               Prairie vole  ---cagggtttgtg
B D                   Mouse  ---caaggtttgag
B D                     Rat  ---caaggtcgggg
B D                    Pika  ---ctggatctgat
B D                  Alpaca  ---caggg------
             Bactrian camel  ---caggg------
B D                 Dolphin  ---ctggg------
               Killer whale  ---ctggg------
           Tibetan antelope  ---ctgg-------
B D                     Cow  ---ctgg-------
B D                   Sheep  ---ctgga------
              Domestic goat  ---ctgga------
B D                   Horse  ---ctggg------
B D        White rhinoceros  ---ctagg------
B D                     Cat  ---ctggg------
B D                     Dog  ---ctggg------
B D                 Ferret   ---ctggg------
B D                   Panda  ---ctagg------
             Pacific walrus  ---ctggg------
               Weddell seal  ---ctggg------
           Black flying-fox  ----tgga------
B D                 Megabat  ----tgga------
B D                Microbat  ----ggag------
B D                   Shrew  -----ggg------
B D                Elephant  ctggtgg-------
        Cape elephant shrew  ctgat---------
B D                 Manatee  ctggtgg-------
                   Aardvark  ctgatgg-------
B D         Chinese hamster  ==============
    Lesser Egyptian jerboa  ==============
B D                  Tenrec  ==============
B D                Hedgehog  ==============
B D              Guinea pig  --------------
          Cape golden mole  ==============
          Brush-tailed rat  --------------
           Star-nosed mole  ==============
B D          Naked mole-rat  --------------
B D                     Pig  ==============
                Chinchilla  --------------

Inserts between block 21 and 22 in window
B D                    Rat 521bp
          Black flying-fox 2bp
B D                Megabat 2bp
B D               Microbat 2bp
B D                  Shrew 15bp

Alignment block 22 of 675 in window, 17406033 - 17406037, 5 bps 
B D                   Human  ggcgg
B D                   Chimp  ggcag
B D                 Gorilla  ggcag
B D               Orangutan  ggtag
B D                  Gibbon  ggcag
B D                  Rhesus  ggcag
B D     Crab-eating macaque  ggcag
B D                  Baboon  ggcgg
B D            Green monkey  ggcag
B D                Marmoset  ggcag
B D         Squirrel monkey  ggcag
B D                Bushbaby  ggcaa
         Chinese tree shrew  cgttg
B D                Squirrel  gtcgg
               Prairie vole  gtcag
B D                   Mouse  gtcag
B D                    Pika  tccag
B D                  Alpaca  ggcca
             Bactrian camel  ggcca
B D                 Dolphin  gacag
               Killer whale  gacag
           Tibetan antelope  ggcgg
B D                     Cow  ggcgg
B D                   Sheep  ggcat
              Domestic goat  ggcat
B D                   Horse  gccag
B D        White rhinoceros  ggcag
B D                     Cat  ggcag
B D                     Dog  ggcag
B D                 Ferret   ggcgg
B D                   Panda  ggcgg
             Pacific walrus  ggcgg
               Weddell seal  ggcgg
           Black flying-fox  tacaa
B D                 Megabat  tacag
B D                Microbat  ggcag
B D                   Shrew  agtag
B D                Elephant  tgcag
        Cape elephant shrew  ----g
B D                 Manatee  tgcag
                   Aardvark  ggcag
B D                     Rat  =====
B D         Chinese hamster  =====
    Lesser Egyptian jerboa  =====
B D                  Tenrec  =====
B D                Hedgehog  =====
B D              Guinea pig  -----
          Cape golden mole  =====
          Brush-tailed rat  -----
           Star-nosed mole  =====
B D          Naked mole-rat  -----
B D                     Pig  =====
                Chinchilla  -----

Inserts between block 22 and 23 in window
              Prairie vole 26844bp

Alignment block 23 of 675 in window, 17406038 - 17406039, 2 bps 
B D                   Human  gg
B D                   Chimp  gg
B D                 Gorilla  gg
B D               Orangutan  gg
B D                  Gibbon  gg
B D                  Rhesus  gg
B D     Crab-eating macaque  gg
B D                  Baboon  gg
B D            Green monkey  gg
B D                Marmoset  gg
B D         Squirrel monkey  gg
B D                Bushbaby  gg
         Chinese tree shrew  gg
B D                Squirrel  aa
B D                   Mouse  gg
B D                    Pika  aa
B D                  Alpaca  gg
             Bactrian camel  gg
B D                 Dolphin  gg
               Killer whale  gg
           Tibetan antelope  tg
B D                     Cow  tg
B D                   Sheep  ga
              Domestic goat  ga
B D                   Horse  gg
B D        White rhinoceros  gg
B D                     Cat  gg
B D                     Dog  gg
B D                 Ferret   gg
B D                   Panda  gg
             Pacific walrus  gg
               Weddell seal  ga
           Black flying-fox  gg
B D                 Megabat  gg
B D                Microbat  gg
B D                   Shrew  aa
B D                Elephant  ag
        Cape elephant shrew  aa
B D                 Manatee  ag
                   Aardvark  ag
              Prairie vole  ==
B D                     Rat  ==
B D         Chinese hamster  ==
    Lesser Egyptian jerboa  ==
B D                  Tenrec  ==
B D                Hedgehog  ==
B D              Guinea pig  --
          Cape golden mole  ==
          Brush-tailed rat  --
           Star-nosed mole  ==
B D          Naked mole-rat  --
B D                     Pig  ==
                Chinchilla  --

Inserts between block 23 and 24 in window
B D               Squirrel 4bp
B D                  Mouse 4556bp
B D                   Pika 1bp

Alignment block 24 of 675 in window, 17406040 - 17406048, 9 bps 
B D                   Human  cctgggtct
B D                   Chimp  cctgggtct
B D                 Gorilla  cctgggtct
B D               Orangutan  cctgggtct
B D                  Gibbon  cctgggtct
B D                  Rhesus  cctgggtct
B D     Crab-eating macaque  cctgggtct
B D                  Baboon  cctgggtct
B D            Green monkey  cctgggtct
B D                Marmoset  cctgggtct
B D         Squirrel monkey  cctgggcct
B D                Bushbaby  cctgagtat
         Chinese tree shrew  ttttgctcg
B D                Squirrel  ccaggtg--
B D                    Pika  ccgggatct
B D                  Alpaca  tctggatct
             Bactrian camel  tctggatct
B D                 Dolphin  tctgggtct
               Killer whale  tctgggtct
           Tibetan antelope  t-tgtttct
B D                     Cow  t-tgtgtgt
B D                   Sheep  t-tgtgtct
              Domestic goat  t-tgtgtct
B D                   Horse  cctgggtct
B D        White rhinoceros  cctgggtct
B D                     Cat  cctggctct
B D                     Dog  cttggctct
B D                 Ferret   tctggctcg
B D                   Panda  actggctcc
             Pacific walrus  cctggttct
               Weddell seal  cctggctct
           Black flying-fox  cctgggtct
B D                 Megabat  tctgggtct
B D                Microbat  ccagggtct
B D                   Shrew  cctgggt--
B D                Elephant  ccagggact
        Cape elephant shrew  cctgcatct
B D                 Manatee  cctcgggct
                   Aardvark  cctgaatct
              Prairie vole  =========
B D                   Mouse  =========
B D                     Rat  =========
B D         Chinese hamster  =========
    Lesser Egyptian jerboa  =========
B D                  Tenrec  =========
B D                Hedgehog  =========
B D              Guinea pig  ---------
          Cape golden mole  =========
          Brush-tailed rat  ---------
           Star-nosed mole  =========
B D          Naked mole-rat  ---------
B D                     Pig  =========
                Chinchilla  ---------

Inserts between block 24 and 25 in window
B D                   Pika 3bp

Alignment block 25 of 675 in window, 17406049 - 17406059, 11 bps 
B D                   Human  gaccccaggga
B D                   Chimp  gaccccaggga
B D                 Gorilla  gaccccaggga
B D               Orangutan  gaccctaggga
B D                  Gibbon  gacgctaggga
B D                  Rhesus  gaccctaggga
B D     Crab-eating macaque  gaccctaggga
B D                  Baboon  gaccctaggga
B D            Green monkey  gaccctaggga
B D                Marmoset  gaccctagaga
B D         Squirrel monkey  gaccctagaga
B D                Bushbaby  gacccaagaga
         Chinese tree shrew  ggcacatggga
B D                Squirrel  ggcccaacagg
     Lesser Egyptian jerboa  gagccagaagg
B D          Naked mole-rat  ----------c
B D              Guinea pig  ---cccaagac
                 Chinchilla  ----ccgggac
           Brush-tailed rat  ----gcaggaa
B D                    Pika  tatttgtgggg
B D                  Alpaca  gaccaaagagg
             Bactrian camel  gaccaaagagg
B D                 Dolphin  gacagaagagg
               Killer whale  gacagaagagg
           Tibetan antelope  gactgtggcga
B D                     Cow  gactgaggaga
B D                   Sheep  gactgaggaga
              Domestic goat  gactgaggaga
B D                   Horse  aacccaacagg
B D        White rhinoceros  gacccaagagg
B D                     Cat  gacccaacagg
B D                     Dog  gactcaagagg
B D                 Ferret   aaccccagagg
B D                   Panda  gaccccagagg
             Pacific walrus  gaccccggagg
               Weddell seal  gacccccgagg
           Black flying-fox  gacctaagagg
B D                 Megabat  gacctaagagg
B D                Microbat  cccccaagagg
B D                   Shrew  gacccgagg--
B D                Elephant  gacccatgagg
        Cape elephant shrew  gactcaagagg
B D                 Manatee  gacccaaaagg
                   Aardvark  gacccaggaac
              Prairie vole  ===========
B D                   Mouse  ===========
B D                     Rat  ===========
B D         Chinese hamster  ===========
B D                  Tenrec  ===========
B D                Hedgehog  ===========
          Cape golden mole  ===========
           Star-nosed mole  ===========
B D                     Pig  ===========

Alignment block 26 of 675 in window, 17406060 - 17406062, 3 bps 
B D                   Human  c---------tg
B D                   Chimp  c---------tg
B D                 Gorilla  c---------tg
B D               Orangutan  c---------tg
B D                  Gibbon  c---------tg
B D                  Rhesus  c---------tt
B D     Crab-eating macaque  c---------tt
B D                  Baboon  c---------tt
B D            Green monkey  c---------tt
B D                Marmoset  c---------ta
B D         Squirrel monkey  c---------ta
B D                Bushbaby  c---------tg
B D                Squirrel  c---------ct
     Lesser Egyptian jerboa  c---------ca
B D          Naked mole-rat  c---------tg
B D              Guinea pig  c---------tg
                 Chinchilla  c---------tg
           Brush-tailed rat  c---------tg
B D                    Pika  c---------gg
B D                     Pig  c---------tg
B D                  Alpaca  c---------tg
             Bactrian camel  c---------tg
B D                 Dolphin  c---------tg
               Killer whale  c---------tg
           Tibetan antelope  c---------tg
B D                     Cow  c---------ag
B D                   Sheep  c---------cg
              Domestic goat  c---------cg
B D                   Horse  c---------tg
B D        White rhinoceros  c---------tg
B D                     Cat  c---------tg
B D                 Ferret   c---------ca
B D                   Panda  c---------ca
             Pacific walrus  c---------ca
               Weddell seal  c---------ca
           Black flying-fox  c---------tg
B D                 Megabat  c---------tg
B D                Microbat  c---------tg
B D                   Shrew  c---------ta
B D                Elephant  c---------tg
        Cape elephant shrew  cacgaaggggtg
B D                 Manatee  c---------tg
                   Aardvark  t---------tg
              Prairie vole  ============
B D                   Mouse  ============
B D                     Rat  ============
B D         Chinese hamster  ============
B D                  Tenrec  ============
        Chinese tree shrew  ------------
B D                Hedgehog  ============
          Cape golden mole  ============
           Star-nosed mole  ============
B D                     Dog  ------------

Inserts between block 26 and 27 in window
B D                    Pig 270bp

Alignment block 27 of 675 in window, 17406063 - 17406092, 30 bps 
B D                   Human  gttt-ttgtgtt-----ca-ggtgtctct---gtggtgac
B D                   Chimp  gttt-ttgtgtt-----ca-ggtgtctct---gtggtgac
B D                 Gorilla  gttt-ttgtgtt-----ca-ggtgtctct---gtggtgac
B D               Orangutan  ggtt-ttgtgtt-----ca-ggtgtctgt---gtggtgat
B D                  Gibbon  ggtt-ttgtgtt-----ca-ggtgtctct---gtggtgac
B D                  Rhesus  ggtt-ttgtgtt-----ca-ggtgtctct---gtggtgac
B D     Crab-eating macaque  ggtt-ttgtgtt-----ca-ggtgtctct---gtggtgac
B D                  Baboon  ggtt-ttgtgtt-----ca-ggtgtctct---gtggtgac
B D            Green monkey  ggtt-ttgtgtt-----ca-ggtgtctct---gtggtgac
B D                Marmoset  ggtt-ttgtgtt-----ca-ggtgtctcc---gtggtgat
B D         Squirrel monkey  ggtt-ttgtgtt-----ca-ggtgtctcc---gtggtgat
B D                Bushbaby  ggtt-ttgtgtt----gaa-ggtgtctct---gtggtgac
         Chinese tree shrew  --------tgtt-----cacggtgtccca---gtgg----
B D                Squirrel  gatt-ttgtgtt-----cg-gggggtctc---cggggg--
     Lesser Egyptian jerboa  gggt-ttgtgat-----ca-ggagtcccc---atggagac
B D          Naked mole-rat  ggct-ttacgcc-----ca-ggggtctcc---agggcgac
B D              Guinea pig  gact-ttgcgct-----ca-ggagccttc---agagagac
                 Chinchilla  cact-ctgttgc-----ca-ggggcctcc---gtggtgac
           Brush-tailed rat  gact-ttgtgtt-----ca-gggccctcc---agggtgac
B D                    Pika  gggg-cggtgct-----ca-gggggtacc---atggtaac
B D                  Alpaca  ggtt-ttgagtt-----ca-cgggtctcc---gtggtgac
             Bactrian camel  ggtt-ttgagtt-----ca-cgggtctcc---gtggtgac
B D                 Dolphin  ggtt-ttgaatt-----ca-ggggtctcc---ctggtgac
               Killer whale  ggtt-ttgaatt-----ca-ggggtctcc---ctggtgac
           Tibetan antelope  ggtt-tagaatt-----ca-gggatct-c---ctggtgac
B D                     Cow  ggtt-gtgaatt-----ga-ggaatct-c---ctggtgac
B D                   Sheep  ggtg-tagaatt-----ca-gggatct-c---ctggtaac
              Domestic goat  ggtg-tagaatt-----ca-gggatct-c---ctggtaac
B D                   Horse  agat-ttgtgtt-----ta-ggggtctcc---agggtgac
B D        White rhinoceros  ggtt-ttgtgtt-----ca-ggggtctcc---gtggtgac
B D                     Cat  gata-ttgtgtt-----ta-ggggtctcc---gtgatgac
B D                     Dog  ---------------------gggtctctgtggtggtgac
B D                 Ferret   cctt-ttgtgtt-----ta-aggttctccatggtgg----
B D                   Panda  ggtt-ttgtgtt-----ta-gggttctccacggtggtgac
             Pacific walrus  ggtt-ttgtgtt-----ta-gtgttctccatggtggtgac
               Weddell seal  ggtt-ttgcgtt-----ta-gtgttccccatggtggtgac
           Black flying-fox  ggtt-ttgtgtt-----ca-gaggtctcc---acggtgat
B D                 Megabat  ggtt-ttgtgtt-----ca-gaggtctcc---acggtgat
B D                Microbat  gctt-tggtgtc----------actctcc---gtagtgac
B D                   Shrew  ggtt-atgtgctgggggtg-ggggtttct---gtgatgat
B D                Elephant  gggt-ttgtgtt-----ca-ggggtttct---gtggtaac
        Cape elephant shrew  gggtgtcgtgtt-----ca-ggggtttcc---gtggcggc
B D                 Manatee  gggt-ttgtttt-----ca-ggggtttcc---gtggtgat
                   Aardvark  gggt-ttgtgtt-----ca-gggctttcc---atggtgac
              Prairie vole  ========================================
B D                   Mouse  ========================================
B D                     Rat  ========================================
B D         Chinese hamster  ========================================
B D                  Tenrec  ========================================
B D                Hedgehog  ========================================
          Cape golden mole  ========================================
           Star-nosed mole  ========================================
B D                     Pig  ========================================

Inserts between block 27 and 28 in window
B D                   Pika 1bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                  Panda 1bp
            Pacific walrus 1bp
              Weddell seal 1bp
          Black flying-fox 1bp
B D                Megabat 1bp
B D               Microbat 1bp
B D                  Shrew 1bp
B D               Elephant 1bp
       Cape elephant shrew 407bp
B D                Manatee 1bp
                  Aardvark 1bp

Alignment block 28 of 675 in window, 17406093 - 17406107, 15 bps 
B D                   Human  gag------cagggcttcatc
B D                   Chimp  gag------cagggcttcatc
B D                 Gorilla  gag------cagggcttcatc
B D               Orangutan  gag------cagggcttcatc
B D                  Gibbon  gag------tagcgcttcatc
B D                  Rhesus  tag------cagggcttcatc
B D     Crab-eating macaque  tag------cagggcttcatc
B D                  Baboon  tag------cagggcttcatc
B D            Green monkey  tag------cagggcttcatc
B D                Marmoset  gat------cagggcttcatt
B D         Squirrel monkey  gag------cagggcttcatt
B D                Bushbaby  --------------------c
         Chinese tree shrew  ------------gggttcgct
B D                Squirrel  --------------------t
     Lesser Egyptian jerboa  -----------------cctt
B D          Naked mole-rat  --------------------t
B D              Guinea pig  --------------------t
                 Chinchilla  --------------------t
           Brush-tailed rat  --------------------t
B D                    Pika  cca------cagaggttcatc
B D                  Alpaca  tagacctagcaggggttcact
             Bactrian camel  tagacctagcaggggttcact
B D                 Dolphin  tag------caggggttcact
               Killer whale  tag------caggggttcact
           Tibetan antelope  ttg-------aggggttcact
B D                     Cow  ttg-------aggggttcact
B D                   Sheep  ttg-------aggggtacact
              Domestic goat  ttg-------aggggttcact
B D                   Horse  cag------caggggttcact
B D        White rhinoceros  cag------cagggcttcact
B D                     Cat  cag------ccggggctcact
B D                     Dog  cag------caggggttc---
B D                 Ferret   ----------------tcact
B D                   Panda  cag------caggggttcact
             Pacific walrus  cag------caggggttcacc
               Weddell seal  cag------caggggttcgtc
           Black flying-fox  cag------caggggttcact
B D                 Megabat  cag------caggggttcact
B D                Microbat  cag------caggagctccca
B D                   Shrew  cag------cagtgttccacc
B D                Elephant  cag------caggggttcacc
B D                 Manatee  cag------aaggggttcacc
                   Aardvark  cag------cgggggttcacc
       Cape elephant shrew  =====================
              Prairie vole  =====================
B D                   Mouse  =====================
B D                     Rat  =====================
B D         Chinese hamster  =====================
B D                  Tenrec  =====================
B D                Hedgehog  =====================
          Cape golden mole  =====================
           Star-nosed mole  =====================
B D                     Pig  =====================

Inserts between block 28 and 29 in window
B D                  Shrew 3121bp

Alignment block 29 of 675 in window, 17406108 - 17406128, 21 bps 
B D                   Human  cagtgcctc--tg-------t-----ccccac---cga
B D                   Chimp  cagtgcctc--tg-------t-----ccccac---cga
B D                 Gorilla  cagtgcctg--tg-------t-----ccccac---cga
B D               Orangutan  cagtgcccc--tg-------t-----ccccac---cga
B D                  Gibbon  cagtgctcc--tg-------t-----ccccac---cga
B D                  Rhesus  cagtgcccc--tg-------t-----ccccac---cga
B D     Crab-eating macaque  cagtgcccc--tg-------t-----ccccac---cga
B D                  Baboon  cagtgcccc--tg-------t-----ccccac---cga
B D            Green monkey  cagtgcccc--tg-------t-----ccccac---cga
B D                Marmoset  cagggccgc--tg-------t-----ccccac---cga
B D         Squirrel monkey  ctgtgctcc--tg-------t-----ccccac---cga
B D                Bushbaby  tagt---------------------------------a
         Chinese tree shrew  cagcatctc--tg-------t-----tcccaa---taa
B D                Squirrel  gagc----c--ag-------c-----agcacc---tta
     Lesser Egyptian jerboa  gagcacctc--tg-------c-----ctccac---tga
B D          Naked mole-rat  cagcacttc---g-------c-----ccccgt---cga
B D              Guinea pig  caacaccacgctg-------c-----accagc---cca
                 Chinchilla  gagcacctc--cg-------c-----ccccac---cta
           Brush-tailed rat  cagcacctc-----------c-----ccccac---cga
B D                    Pika  taacgacta--cc-------c-----ctccac---ccc
B D                  Alpaca  tagcatccc--tg-------a-----ccccgc---aaa
             Bactrian camel  tagcatccc--tg-------a-----ccaagc---aaa
B D                 Dolphin  tagcatccc--tgcccctccc-----ccccgc---caa
               Killer whale  tagcatccc--tgcccctccc-----ccccgc---caa
           Tibetan antelope  aagag--tc--tg------tc-----ccctgc---cga
B D                     Cow  tagcgactc--tg------tc-----ccctgc---cga
B D                   Sheep  tagcgtctc--tg------tc-----ccctgc---cga
              Domestic goat  tagcgtctc--tg------tc-----ccctgc---cga
B D                   Horse  --------------------------cagcac---aga
B D        White rhinoceros  --------------------------taccat---aga
B D                     Cat  tagcgtccc--tg-------g-----gcccac---cga
B D                     Dog  ttgcatccc--tg-------tgcccagcccac---tga
B D                 Ferret   tagcacccc--tg-------c-----acccac------
B D                   Panda  tagcgtccc--tg-------c-----gcccac-ggggg
             Pacific walrus  tagcatccc--tg-------c-----acccac---cga
               Weddell seal  tagcatccc--tg-------c-----ggccac---cga
           Black flying-fox  aagtatccc--tg-------c-----catagt---gga
B D                 Megabat  aagtatccc--tg-------c-----catagt---gga
B D                Microbat  tagcatccc--tg-------c-----tgctgtctcaga
B D                Elephant  cagcgcccc--tg-------c-----ctccgc---ata
B D                 Manatee  cagcgcccc--tg-------c-----ctccgc---aga
                   Aardvark  cagcgcccc--tg-------c-----ttccgt---aaa
       Cape elephant shrew  ======================================
              Prairie vole  ======================================
B D                   Mouse  ======================================
B D                     Rat  ======================================
B D         Chinese hamster  ======================================
B D                  Tenrec  ======================================
B D                Hedgehog  ======================================
B D                   Shrew  ======================================
          Cape golden mole  ======================================
           Star-nosed mole  ======================================
B D                     Pig  ======================================

Alignment block 30 of 675 in window, 17406129 - 17406129, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  g
B D                  Gibbon  g
B D                  Rhesus  g
B D     Crab-eating macaque  g
B D                  Baboon  g
B D            Green monkey  g
B D                Marmoset  g
B D         Squirrel monkey  g
B D                Bushbaby  g
         Chinese tree shrew  a
B D                Squirrel  g
     Lesser Egyptian jerboa  g
B D          Naked mole-rat  g
B D              Guinea pig  g
                 Chinchilla  g
           Brush-tailed rat  g
B D                    Pika  g
B D                  Alpaca  g
             Bactrian camel  g
B D                 Dolphin  g
               Killer whale  g
           Tibetan antelope  g
B D                     Cow  g
B D                   Sheep  g
              Domestic goat  g
B D                   Horse  g
B D        White rhinoceros  g
B D                     Cat  g
B D                     Dog  g
B D                   Panda  g
             Pacific walrus  g
               Weddell seal  g
           Black flying-fox  g
B D                 Megabat  g
B D                Microbat  g
B D                Elephant  g
B D                 Manatee  g
           Cape golden mole  a
                   Aardvark  g
       Cape elephant shrew  =
              Prairie vole  =
B D                   Mouse  =
B D                     Rat  =
B D         Chinese hamster  =
B D                  Tenrec  =
B D                Hedgehog  =
B D                   Shrew  =
           Star-nosed mole  =
B D                     Pig  =
B D                 Ferret   -

Inserts between block 30 and 31 in window
B D               Elephant 1bp
B D                Manatee 1bp
          Cape golden mole 110bp
                  Aardvark 1bp

Alignment block 31 of 675 in window, 17406130 - 17406152, 23 bps 
B D                   Human  gggact---------------------at-g---------gg---------agacat----ggaggg
B D                   Chimp  gggact---------------------gt-g---------gg---------agccat----ggaggg
B D                 Gorilla  gggact---------------------at-g---------gg---------agccat----ggaggg
B D               Orangutan  gggact---------------------at-g---------gg---------agccat----ggaggg
B D                  Gibbon  tgaact---------------------at-g---------gg---------agccat----ggaggg
B D                  Rhesus  gggact---------------------at-g---------gg---------agccat----ggaagg
B D     Crab-eating macaque  gggact---------------------at-g---------gg---------agccat----ggaagg
B D                  Baboon  gggact---------------------at-g---------gg---------agccat----ggaagg
B D            Green monkey  gggcct---------------------at-g---------ggagccatggaagccat----ggaagg
B D                Marmoset  gggact---------------------at-g------------------------------ggaggg
B D         Squirrel monkey  gggact---------------------gt-g---------gg---------agccat----ggaggg
B D                Bushbaby  gggacc---------------------at-g---------gg---------agccaa----ggaatg
         Chinese tree shrew  aggccc---------------------atag---------gg---------agccat----ggaagg
B D                Squirrel  ggggac---------------------tt-g---------gg---------agtcct----agaggg
     Lesser Egyptian jerboa  tggacc---------------------at-g---------gg---------agctat----ggagga
B D          Naked mole-rat  ggggcc---------------------g------------gg---------agccac----ggaggg
B D              Guinea pig  aggcct---------------------ag-----------gg---------agccgc----ggaggg
                 Chinchilla  cgacct----------------------------------gg---------aggcag----gcaggg
           Brush-tailed rat  ggactc---------------------cg-gccgccactagg---------gggaat----gtaggg
B D                    Pika  acgact----------------------------------g-------------cat----ggaagg
B D                  Alpaca  gggact---------------------acag---------ag---------agccat----agaggg
             Bactrian camel  gggacc---------------------acag---------ag---------agccac----agaggg
B D                 Dolphin  gggacc---------------------gtag---------gg---------tgccat----ggaggg
               Killer whale  gggacc---------------------gtag---------gg---------tgccat----ggaggg
           Tibetan antelope  cagacc---------------------atca---------gg---------ag------------gg
B D                     Cow  cggacc---------------------atca---------gg---------agccat----ggaagg
B D                   Sheep  cggac------------------------ta---------gg---------aggcat----ggaggg
              Domestic goat  cggac------------------------ta---------gg---------aggcat----ggaggg
B D                   Horse  gggacccaggacggtgtcagaggagggactg---------ga---------gcctga----ggaagg
B D        White rhinoceros  ggcacc---------------------acag---------gg---------agccat----ggaggg
B D                     Cat  gggact---------------------atag---------ga---------aaccat----gcaggg
B D                     Dog  gggacc---------------------acag---------gg---------atctgtggagggaggg
B D                 Ferret   -------------------------------------------------------------acgggg
B D                   Panda  gggacc---------------------acag---------gg---------aaccat----ggaggg
             Pacific walrus  gggacc---------------------acag---------gg---------aaccat----ggaggg
               Weddell seal  gggacc---------------------acag---------gg---------aaccat----ggaggg
           Black flying-fox  caaacc---------------------atag---------gg---------agccat----ggaggg
B D                 Megabat  caaacc---------------------atag---------gg---------agccat----ggaggg
B D                Microbat  gggacc---------------------ttag---------gg----------gccat----ggaggg
B D                Elephant  ggcgcc---------------------gtga---------gg---------agccac----ggaggg
B D                 Manatee  gtggcc---------------------ttgg---------gg---------agccat----ggaggg
                   Aardvark  gggccc---------------------atga---------ag---------agctct----ggaggg
       Cape elephant shrew  ===================================================================
              Prairie vole  ===================================================================
B D                   Mouse  ===================================================================
B D                     Rat  ===================================================================
B D         Chinese hamster  ===================================================================
B D                  Tenrec  ===================================================================
B D                Hedgehog  ===================================================================
B D                   Shrew  ===================================================================
          Cape golden mole  ===================================================================
           Star-nosed mole  ===================================================================
B D                     Pig  ===================================================================

Inserts between block 31 and 32 in window
          Brush-tailed rat 27726bp
B D                   Pika 5129bp

Alignment block 32 of 675 in window, 17406153 - 17406155, 3 bps 
B D                   Human  tgt
B D                   Chimp  tgt
B D                 Gorilla  tgt
B D               Orangutan  tgc
B D                  Gibbon  tgt
B D                  Rhesus  tgt
B D     Crab-eating macaque  tgt
B D                  Baboon  tgt
B D            Green monkey  tgt
B D                Marmoset  tgt
B D         Squirrel monkey  tgt
B D                Bushbaby  tgt
         Chinese tree shrew  tgt
B D                Squirrel  --t
     Lesser Egyptian jerboa  --t
B D          Naked mole-rat  --t
B D              Guinea pig  --t
B D                  Alpaca  tgt
             Bactrian camel  tgt
B D                 Dolphin  tgt
               Killer whale  tgt
           Tibetan antelope  tgt
B D                     Cow  tgt
B D                   Sheep  tgt
              Domestic goat  tgt
B D                   Horse  ggc
B D        White rhinoceros  tgt
B D                     Cat  tat
B D                     Dog  tgt
B D                 Ferret   tgt
B D                   Panda  tgt
             Pacific walrus  tgt
               Weddell seal  tgt
           Black flying-fox  tgt
B D                 Megabat  tat
B D                Microbat  tgt
B D                Elephant  tga
B D                 Manatee  tga
                   Aardvark  tga
       Cape elephant shrew  ===
              Prairie vole  ===
B D                   Mouse  ===
B D                     Rat  ===
B D         Chinese hamster  ===
B D                    Pika  ===
B D                  Tenrec  ===
B D                Hedgehog  ===
B D                   Shrew  ===
          Cape golden mole  ===
          Brush-tailed rat  ===
           Star-nosed mole  ===
B D                     Pig  ===
                Chinchilla  ---

Inserts between block 32 and 33 in window
B D               Microbat 63bp

Alignment block 33 of 675 in window, 17406156 - 17406171, 16 bps 
B D                   Human  gt--------------------------gagcaacag------gtgag
B D                   Chimp  gt--------------------------gagcaacag------gtgag
B D                 Gorilla  gt--------------------------gagcaacag------gtgag
B D               Orangutan  gt--------------------------gagcagcag------gtgag
B D                  Gibbon  gt--------------------------gagcagcag------gtgag
B D                  Rhesus  gt--------------------------gagcagcag------gtgag
B D     Crab-eating macaque  gt--------------------------gagcagcag------gtgag
B D                  Baboon  gt--------------------------gagcagcag------gtgag
B D            Green monkey  gt--------------------------gagcagcag------gtgag
B D                Marmoset  gt--------------------------gagcaggag------gtgag
B D         Squirrel monkey  gt--------------------------gagtgggag------gtgag
B D                Bushbaby  gc--------------------------gagccaggg------gtggg
         Chinese tree shrew  gt--------------------------gagcaggagcagagagcggg
B D                Squirrel  g--------------------------------------------ctg
     Lesser Egyptian jerboa  gt--------------------------gtgtgtgag------ccctg
B D          Naked mole-rat  gt--------------------------gtgcgaggg------ggcag
B D              Guinea pig  gt--------------------------gtgcaagag------ggcag
                 Chinchilla  -----------------------------cgtaagag------ggcag
B D                  Alpaca  --------------------------------cagag------gcagg
             Bactrian camel  --------------------------------cagag------gcagg
B D                 Dolphin  --------------------------------cagag------gaggg
               Killer whale  --------------------------------cagag------gaggg
           Tibetan antelope  --------------------------------cagag------gaccg
B D                     Cow  --------------------------------cagag------gaccg
B D                   Sheep  --------------------------------cagag------gaccg
              Domestic goat  --------------------------------cagag------gaccg
B D                   Horse  --------------------------------ggggg------ggtgg
B D        White rhinoceros  --------------------------------cagag------gaggg
B D                     Cat  --------------------------------ctgag------gaggg
B D                     Dog  --------------------------------ctgag------gaggg
B D                 Ferret   --------------------------------ctgag------gaggg
B D                   Panda  --------------------------------ctgag------gaggg
             Pacific walrus  --------------------------------ctgag------gaggg
               Weddell seal  --------------------------------ctgag------gaggg
           Black flying-fox  --------------------------------cagag------gaggg
B D                 Megabat  --------------------------------cagag------gaggg
B D                Elephant  gt--------------------------gaggagggg------agga-
B D                 Manatee  gt--------------------------gagcagggg------agga-
                   Aardvark  gtgagtgagccaaggagaaacctggagcgagcaaggg------agaa-
       Cape elephant shrew  ================================================
              Prairie vole  ================================================
B D                   Mouse  ================================================
B D                     Rat  ================================================
B D         Chinese hamster  ================================================
B D                    Pika  ================================================
B D                  Tenrec  ================================================
B D                Hedgehog  ================================================
B D                   Shrew  ================================================
          Cape golden mole  ================================================
          Brush-tailed rat  ================================================
           Star-nosed mole  ================================================
B D                     Pig  ================================================
B D                Microbat  ================================================

Inserts between block 33 and 34 in window
B D               Squirrel 1bp
    Lesser Egyptian jerboa 755bp
B D         Naked mole-rat 2bp
B D             Guinea pig 2bp
                Chinchilla 2bp

Alignment block 34 of 675 in window, 17406172 - 17406182, 11 bps 
B D                   Human  actggagcc-a-g
B D                   Chimp  actggagcc-a-g
B D                 Gorilla  actggagcc-a-g
B D               Orangutan  actggagcc-a-g
B D                  Gibbon  actggatcc-a-g
B D                  Rhesus  actggagcc-a-g
B D     Crab-eating macaque  actggagcc-a-g
B D                  Baboon  actggagcc-a-g
B D            Green monkey  actggagcc-a-g
B D                Marmoset  actggagcc-a-t
B D         Squirrel monkey  actggagcc-agc
B D                Bushbaby  attggagcctg-g
         Chinese tree shrew  actggaccc-a-g
B D                Squirrel  gctggaacc-a-g
B D          Naked mole-rat  ac-----------
B D              Guinea pig  acagaagcc-g-g
                 Chinchilla  cgggaagct-g-g
B D                  Alpaca  atcatagcc-t-g
             Bactrian camel  atcatagcc-t-g
B D                 Dolphin  accgtagcc-t-g
               Killer whale  accgtagcc-t-g
           Tibetan antelope  accagagcc-t-g
B D                     Cow  accagagcc-t-g
B D                   Sheep  accagagcc-t-g
              Domestic goat  accagagcc-t-g
B D                   Horse  ggtgggggg-t-g
B D        White rhinoceros  actggagcc-t-g
B D                     Cat  actggaggc-t-g
B D                     Dog  acctaaggc-t-g
B D                 Ferret   actgaaggc-t-g
B D                   Panda  actgaaggc-t-g
             Pacific walrus  actgaaggc-t-g
               Weddell seal  actgaaggc-t-g
           Black flying-fox  actggaacc-t-g
B D                 Megabat  actggaacc-t-g
B D                Elephant  acctgagcg-g-g
B D                 Manatee  acctgagcc-g-g
                   Aardvark  acctgagcg-c-g
       Cape elephant shrew  =============
              Prairie vole  =============
B D                   Mouse  =============
B D                     Rat  =============
B D         Chinese hamster  =============
    Lesser Egyptian jerboa  =============
B D                    Pika  =============
B D                  Tenrec  =============
B D                Hedgehog  =============
B D                   Shrew  =============
          Cape golden mole  =============
          Brush-tailed rat  =============
           Star-nosed mole  =============
B D                     Pig  =============
B D                Microbat  =============

Inserts between block 34 and 35 in window
B D               Squirrel 41bp
B D         Naked mole-rat 16bp
B D             Guinea pig 10804bp
                Chinchilla 34bp
B D                    Dog 44bp

Alignment block 35 of 675 in window, 17406183 - 17406186, 4 bps 
B D                   Human  ctga
B D                   Chimp  ctga
B D                 Gorilla  ctga
B D               Orangutan  ctga
B D                  Gibbon  ctga
B D                  Rhesus  ctga
B D     Crab-eating macaque  ctga
B D                  Baboon  ctga
B D            Green monkey  ctga
B D                Marmoset  cagg
B D         Squirrel monkey  cgga
B D                Bushbaby  ttgg
         Chinese tree shrew  tgag
B D                Squirrel  acag
B D          Naked mole-rat  ccag
                 Chinchilla  gcgg
B D                  Alpaca  gcgg
             Bactrian camel  gcgg
B D                 Dolphin  t-gg
               Killer whale  t-gg
           Tibetan antelope  cagg
B D                     Cow  cagg
B D                   Sheep  cagg
              Domestic goat  cagg
B D                   Horse  gggt
B D        White rhinoceros  acga
B D                     Cat  ggaa
B D                 Ferret   gaga
B D                   Panda  ggga
             Pacific walrus  ggga
               Weddell seal  ggga
           Black flying-fox  ctca
B D                 Megabat  ctca
B D                Elephant  cagg
B D                 Manatee  cggg
                   Aardvark  tggg
       Cape elephant shrew  ====
              Prairie vole  ====
B D                   Mouse  ====
B D                     Rat  ====
B D         Chinese hamster  ====
    Lesser Egyptian jerboa  ====
B D                    Pika  ====
B D                  Tenrec  ====
B D                Hedgehog  ====
B D                   Shrew  ====
B D              Guinea pig  ====
          Cape golden mole  ====
          Brush-tailed rat  ====
           Star-nosed mole  ====
B D                     Pig  ====
B D                Microbat  ====
B D                     Dog  ====

Inserts between block 35 and 36 in window
B D                  Horse 41bp
B D       White rhinoceros 364bp
B D                    Cat 84bp
B D                Ferret  46bp
B D                  Panda 68bp
            Pacific walrus 55bp
              Weddell seal 55bp
          Black flying-fox 52bp
B D                Megabat 52bp

Alignment block 36 of 675 in window, 17406187 - 17406197, 11 bps 
B D                   Human  a-----aac-tgggaga
B D                   Chimp  a-----aac-tgggaga
B D                 Gorilla  a-----aac-tgggaga
B D               Orangutan  a-----aac-tgggaga
B D                  Gibbon  a-----aac-tgggaga
B D                  Rhesus  a-----aac-tggggga
B D     Crab-eating macaque  a-----aac-tggggga
B D                  Baboon  a-----aac-tggggga
B D            Green monkey  a-----aac-tggggga
B D                Marmoset  a-----agc-tgggaga
B D         Squirrel monkey  a-----agc-tgggaga
B D                Bushbaby  a-----agc-tgggaga
         Chinese tree shrew  a-----agc-tgggaga
B D                Squirrel  tgccccatt-cggc---
B D          Naked mole-rat  gtttccatt-tggg---
                 Chinchilla  g-----atg-tggt---
B D                  Alpaca  -------------aagg
             Bactrian camel  -------------aagg
B D                 Dolphin  -------------gagc
               Killer whale  -------------gagc
           Tibetan antelope  -------------aaga
B D                     Cow  -------------gaga
B D                   Sheep  -------------gagg
              Domestic goat  -------------gagg
B D                   Horse  --------c-caccagg
B D                     Cat  --------c-caccagg
B D                     Dog  --------c-ccccagg
B D                 Ferret   --------c-caccagg
B D                   Panda  --------c-cactagg
             Pacific walrus  --------c-caccagg
               Weddell seal  --------c-caccagg
           Black flying-fox  --------c-catcagg
B D                 Megabat  --------c-catcagg
B D                Elephant  -----aggc-cgggagg
B D                 Manatee  -----aggcttaggaag
                   Aardvark  -----aggt-cggaagg
       Cape elephant shrew  =================
              Prairie vole  =================
B D                   Mouse  =================
B D                     Rat  =================
B D         Chinese hamster  =================
    Lesser Egyptian jerboa  =================
B D                    Pika  =================
B D                  Tenrec  =================
B D                Hedgehog  =================
B D                   Shrew  =================
B D              Guinea pig  =================
          Cape golden mole  =================
          Brush-tailed rat  =================
           Star-nosed mole  =================
B D                     Pig  =================
B D                Microbat  =================
B D        White rhinoceros  =================

Inserts between block 36 and 37 in window
B D                 Alpaca 73bp
            Bactrian camel 73bp
B D                Dolphin 64bp
              Killer whale 64bp
B D                    Cow 19bp
B D                  Sheep 20bp
             Domestic goat 20bp
B D                  Horse 2bp
B D                    Cat 2bp
B D                    Dog 1bp
B D                Ferret  1bp
B D                  Panda 1bp
            Pacific walrus 1bp
              Weddell seal 1bp
          Black flying-fox 2bp
B D                Megabat 2bp

Alignment block 37 of 675 in window, 17406198 - 17406198, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  c
B D                  Gibbon  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
B D            Green monkey  c
B D                Marmoset  c
B D         Squirrel monkey  c
B D                Bushbaby  g
         Chinese tree shrew  c
B D                  Alpaca  c
             Bactrian camel  c
B D                 Dolphin  c
               Killer whale  c
B D                     Cow  c
B D                   Sheep  c
              Domestic goat  c
B D                   Horse  c
B D                     Cat  c
B D                     Dog  a
B D                 Ferret   c
             Pacific walrus  c
               Weddell seal  c
           Black flying-fox  c
B D                 Megabat  c
B D                Elephant  c
                   Aardvark  c
       Cape elephant shrew  =
              Prairie vole  =
B D                   Mouse  =
B D                     Rat  =
B D         Chinese hamster  =
    Lesser Egyptian jerboa  =
B D                    Pika  =
B D                  Tenrec  =
B D                Hedgehog  =
B D                   Shrew  =
B D              Guinea pig  =
          Cape golden mole  =
          Tibetan antelope  -
          Brush-tailed rat  =
           Star-nosed mole  =
B D          Naked mole-rat  -
B D                     Pig  =
B D                Microbat  =
B D                   Panda  =
                Chinchilla  -
B D                 Manatee  -
B D        White rhinoceros  =
B D                Squirrel  -

Inserts between block 37 and 38 in window
B D                    Cow 44bp
B D                  Sheep 44bp
             Domestic goat 44bp
B D               Elephant 113bp
                  Aardvark 40bp

Alignment block 38 of 675 in window, 17406199 - 17406201, 3 bps 
B D                   Human  cga
B D                   Chimp  cga
B D                 Gorilla  cga
B D               Orangutan  cga
B D                  Gibbon  caa
B D                  Rhesus  tgg
B D     Crab-eating macaque  tgg
B D                  Baboon  tgg
B D            Green monkey  tgg
B D                Marmoset  ccc
B D         Squirrel monkey  ccc
B D                Bushbaby  aga
         Chinese tree shrew  tga
B D                  Alpaca  cgc
             Bactrian camel  cgc
B D                 Dolphin  tgc
               Killer whale  tgc
           Tibetan antelope  cgc
B D                     Cow  cgc
B D                   Sheep  cgc
              Domestic goat  cgc
B D                   Horse  cgc
B D                     Cat  cgc
B D                     Dog  tgc
B D                 Ferret   cgc
B D                   Panda  cgc
             Pacific walrus  cgc
               Weddell seal  cgc
           Black flying-fox  tgc
B D                 Megabat  tgc
B D                 Manatee  cgc
                   Aardvark  cgc
       Cape elephant shrew  ===
              Prairie vole  ===
B D                   Mouse  ===
B D                     Rat  ===
B D         Chinese hamster  ===
    Lesser Egyptian jerboa  ===
B D                    Pika  ===
B D                  Tenrec  ===
B D                Hedgehog  ===
B D                   Shrew  ===
B D              Guinea pig  ===
          Cape golden mole  ===
          Brush-tailed rat  ===
           Star-nosed mole  ===
B D          Naked mole-rat  ---
B D                     Pig  ===
B D                Microbat  ===
                Chinchilla  ---
B D                Elephant  ===
B D        White rhinoceros  ===
B D                Squirrel  ---

Inserts between block 38 and 39 in window
B D                 Rhesus 31bp
B D    Crab-eating macaque 31bp
B D                 Baboon 31bp
B D           Green monkey 31bp
B D               Marmoset 52bp
B D        Squirrel monkey 52bp
B D               Bushbaby 28bp
        Chinese tree shrew 725bp

Alignment block 39 of 675 in window, 17406202 - 17406235, 34 bps 
B D                   Human  cccagccaac-aaacaa----------------tgtc----ggtctctgt---------cttgg------
B D                   Chimp  cccagccaac-aaacaa----------------tgtc----ggtctctgt---------cctgg------
B D                 Gorilla  cccagccaac-aaacaa----------------tgtc----ggtctctgt---------cttgg------
B D               Orangutan  cccagccaac-aaacaa----------------tgtc----ggtctctgt---------cctgg------
B D                  Gibbon  cccagccaac-aaacaa----------------tgtt----ggtctctgt---------cctgg------
B D                  Rhesus  cccagtcaac-aaacag----------------tgtt----ggactctgt---------cctgg------
B D     Crab-eating macaque  cccagtcaac-aaacag----------------tgtt----ggactctgt---------cctgg------
B D                  Baboon  cccagtcaac-aaacag----------------tgtt----ggactctgc---------cctgg------
B D            Green monkey  cccagtcaac-aaacaa----------------tgtt----ggactctgt---------cctgg------
B D                Marmoset  cccagccaac-aaacaa----------------tatt----ggtttctgt---------cccgc------
B D         Squirrel monkey  cccagccaac-aaacga----------------tact----ggtttctgt---------cctgg------
B D                Bushbaby  cccaatttgg-ccacca----------------gggt----gctctc-----------------------
B D                Squirrel  acccggcagc-aaaccaggtacccccaccccaccccc----atcccccgccacctctgtcctgg------
B D          Naked mole-rat  cccagccagt-aaaccggtt-------------tcct----aggcgctgc---------cctgg------
                 Chinchilla  tcccgcccgc-aagc------------------tccc----gagcccg-----------cctgg------
B D                  Alpaca  cccagccaac-gaacaaggtcg-----------ccca----ggtactagt----------ctgg------
             Bactrian camel  cccagccaac-gaacaaggtcg-----------ccca----ggtactggt----------ctgg------
B D                 Dolphin  cccagccaac-aaa--------------------cca----ggtccctgt---------tctag------
               Killer whale  cccagccaac-aaa--------------------cca----ggtccctgt---------tctag------
           Tibetan antelope  accagacaac-agaca--acca-----------ccca----ggcccttgt---------cctgg------
B D                     Cow  accaggcaac-aaaca--acca------------cca----ggcccttgt---------cctgg------
B D                   Sheep  accagacaac-agaca--gcca-----------ccca----ggcccctgt---------cctgg------
              Domestic goat  accagacaac-agaca--gaca-----------ccca----ggcccctgt---------cctgg------
B D                   Horse  cccagccaac-aaacaaggtcg-----------cccc----ggccctcgg---------cgtgg------
B D                     Cat  cacagccaac-aaataaagtcg-----------ccca----ggtccctgt---------cctgg------
B D                     Dog  cccagccaac-aaatagggtcg-----------ccca----gattac-at---------cttgg------
B D                 Ferret   cctagccctcaaaataccgtct-----------ccta----gatcct-gt---------cctgg------
B D                   Panda  cccagcccac-aaataaggtct-----------ccca----gagcgg-gt---------cctag------
             Pacific walrus  cccaacccac-agagaaggtcg-----------ccag----aatttc-gt---------cctgg------
               Weddell seal  cccaactcac-agagaaggtcg-----------cctg----gatttc-gt---------cctgg------
           Black flying-fox  accagccaac-agacagggctg-----------ctga----ggcacccgt---------cctag------
B D                 Megabat  accagccaac-agatagggctg-----------ctga----ggcacccgt---------cctag------
B D                 Manatee  tctgga---c-agaagg----------------cttgagaagagactgca---------gctcctctttt
                   Aardvark  cccagacctc-aaaaga----------------ggtg----gaggcggga---------actag------
       Cape elephant shrew  ======================================================================
              Prairie vole  ======================================================================
B D                   Mouse  ======================================================================
B D                     Rat  ======================================================================
B D         Chinese hamster  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                    Pika  ======================================================================
B D                  Tenrec  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Hedgehog  ======================================================================
B D                   Shrew  ======================================================================
B D              Guinea pig  ======================================================================
          Cape golden mole  ======================================================================
          Brush-tailed rat  ======================================================================
           Star-nosed mole  ======================================================================
B D                     Pig  ======================================================================
B D                Microbat  ======================================================================
B D                Elephant  ======================================================================
B D        White rhinoceros  ======================================================================

                      Human  --
                      Chimp  --
                    Gorilla  --
                  Orangutan  --
                     Gibbon  --
                     Rhesus  --
        Crab-eating macaque  --
                     Baboon  --
               Green monkey  --
                   Marmoset  --
            Squirrel monkey  --
                   Bushbaby  --
                   Squirrel  --
             Naked mole-rat  --
                 Chinchilla  --
                     Alpaca  --
             Bactrian camel  --
                    Dolphin  --
               Killer whale  --
           Tibetan antelope  --
                        Cow  --
                      Sheep  --
              Domestic goat  --
                      Horse  --
                        Cat  --
                        Dog  --
                    Ferret   --
                      Panda  --
             Pacific walrus  --
               Weddell seal  --
           Black flying-fox  --
                    Megabat  --
                    Manatee  gg
                   Aardvark  --
        Cape elephant shrew  ==
               Prairie vole  ==
                      Mouse  ==
                        Rat  ==
            Chinese hamster  ==
     Lesser Egyptian jerboa  ==
                       Pika  ==
                     Tenrec  ==
         Chinese tree shrew  ==
                   Hedgehog  ==
                      Shrew  ==
                 Guinea pig  ==
           Cape golden mole  ==
           Brush-tailed rat  ==
            Star-nosed mole  ==
                        Pig  ==
                   Microbat  ==
                   Elephant  ==
           White rhinoceros  ==

Alignment block 40 of 675 in window, 17406236 - 17406236, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  c
B D                  Gibbon  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
B D            Green monkey  c
B D                Marmoset  c
B D         Squirrel monkey  c
B D                Squirrel  c
B D          Naked mole-rat  c
                 Chinchilla  c
B D                  Alpaca  c
             Bactrian camel  c
B D                 Dolphin  c
               Killer whale  c
           Tibetan antelope  c
B D                     Cow  c
B D                   Sheep  c
              Domestic goat  c
B D                   Horse  c
B D                     Cat  c
B D                     Dog  c
B D                 Ferret   c
B D                   Panda  c
             Pacific walrus  c
               Weddell seal  c
           Black flying-fox  c
B D                 Megabat  c
B D                 Manatee  c
           Cape golden mole  c
                   Aardvark  c
       Cape elephant shrew  =
              Prairie vole  =
B D                   Mouse  =
B D                     Rat  =
B D         Chinese hamster  =
    Lesser Egyptian jerboa  =
B D                    Pika  =
B D                  Tenrec  =
        Chinese tree shrew  =
B D                Hedgehog  =
B D                   Shrew  =
B D              Guinea pig  =
          Brush-tailed rat  =
           Star-nosed mole  =
B D                     Pig  =
B D                Microbat  =
B D                Elephant  =
B D        White rhinoceros  =
B D                Bushbaby  -

Inserts between block 40 and 41 in window
B D                Manatee 18bp
          Cape golden mole 1180bp

Alignment block 41 of 675 in window, 17406237 - 17406242, 6 bps 
B D                   Human  acctgc------------------------
B D                   Chimp  acccgc------------------------
B D                 Gorilla  acctgc------------------------
B D               Orangutan  acccgc------------------------
B D                  Gibbon  acccgc------------------------
B D                  Rhesus  acccgc------------------------
B D     Crab-eating macaque  acccgc------------------------
B D                  Baboon  acccac------------------------
B D            Green monkey  acccgc------------------------
B D                Marmoset  accggc------------------------
B D         Squirrel monkey  accggc------------------------
B D                Bushbaby  -ccagc------------------------
B D                Squirrel  tgctgc------------------------
B D          Naked mole-rat  cccag-------------------------
                 Chinchilla  agcagt------------------------
B D                  Alpaca  tccagc------------------------
             Bactrian camel  tccagc------------------------
B D                 Dolphin  tccacc------------------------
               Killer whale  tccacc------------------------
           Tibetan antelope  tccagg------------------------
B D                     Cow  tccagg------------------------
B D                   Sheep  tccagg------------------------
              Domestic goat  tccagg------------------------
B D                   Horse  tccagc------------------------
B D                     Cat  tccagc------------------------
B D                     Dog  tcctgc------------------------
B D                 Ferret   tcccgc------------------------
B D                   Panda  tcccgc------------------------
             Pacific walrus  tcccac------------------------
               Weddell seal  tcccac------------------------
           Black flying-fox  tccagc------------------------
B D                 Megabat  tccagc------------------------
B D                 Manatee  acctgaaaggggtggaggcgggaactagcc
                   Aardvark  ----------------------------cc
       Cape elephant shrew  ==============================
              Prairie vole  ==============================
B D                   Mouse  ==============================
B D                     Rat  ==============================
B D         Chinese hamster  ==============================
    Lesser Egyptian jerboa  ==============================
B D                    Pika  ==============================
B D                  Tenrec  ==============================
        Chinese tree shrew  ==============================
B D                Hedgehog  ==============================
B D                   Shrew  ==============================
B D              Guinea pig  ==============================
          Cape golden mole  ==============================
          Brush-tailed rat  ==============================
           Star-nosed mole  ==============================
B D                     Pig  ==============================
B D                Microbat  ==============================
B D                Elephant  ==============================
B D        White rhinoceros  ==============================

Inserts between block 41 and 42 in window
B D               Squirrel 272bp
B D                Manatee 7bp

Alignment block 42 of 675 in window, 17406243 - 17406258, 16 bps 
B D                   Human  --aggaaacaagctccta
B D                   Chimp  --aggaaacaagctccta
B D                 Gorilla  --aggaaacaagctccta
B D               Orangutan  --aggaaacaagctccta
B D                  Gibbon  --aggaaacaagctccta
B D                  Rhesus  --aggaaacaggcttcaa
B D     Crab-eating macaque  --aggaaacaggcttcaa
B D                  Baboon  --aggaaacaggcttcaa
B D            Green monkey  --aggaaacaggcttcaa
B D                Marmoset  --aggaaacgggctccta
B D         Squirrel monkey  --aggaaacgggctccta
B D                Bushbaby  --caggaatctacttcca
B D          Naked mole-rat  --------cgggcacgtg
                 Chinchilla  ------gacaggttcggg
B D                  Alpaca  --cagaaacagcctccta
             Bactrian camel  --cagaaacagcctcctc
B D                 Dolphin  --caggaaccggctccta
               Killer whale  --caggaaccggctccta
           Tibetan antelope  --caggaatttgcccttt
B D                     Cow  --caggaacttgctgttt
B D                   Sheep  --caggaacttgctctct
              Domestic goat  --caggaacttgcccttt
B D                   Horse  --cgcccacaggttccag
B D                     Cat  --aggaaataggctccga
B D                     Dog  --agggaataggctccta
B D                 Ferret   --agggaataggctctta
B D                   Panda  --agggaacaggctccta
             Pacific walrus  --agggaatacgctccta
               Weddell seal  --agggaatacgctccca
           Black flying-fox  ---ggaaacagcctcctt
B D                 Megabat  ---ggaaacagcctcctt
B D                 Manatee  aggtggaacgggcttgtc
                   Aardvark  aggtggaacatcctctta
       Cape elephant shrew  ==================
              Prairie vole  ==================
B D                   Mouse  ==================
B D                     Rat  ==================
B D         Chinese hamster  ==================
    Lesser Egyptian jerboa  ==================
B D                    Pika  ==================
B D                  Tenrec  ==================
        Chinese tree shrew  ==================
B D                Hedgehog  ==================
B D                   Shrew  ==================
B D              Guinea pig  ==================
          Cape golden mole  ==================
          Brush-tailed rat  ==================
           Star-nosed mole  ==================
B D                     Pig  ==================
B D                Microbat  ==================
B D                Elephant  ==================
B D        White rhinoceros  ==================
B D                Squirrel  ==================

Inserts between block 42 and 43 in window
                  Aardvark 1bp

Alignment block 43 of 675 in window, 17406259 - 17406266, 8 bps 
B D                   Human  cttccaga
B D                   Chimp  cttccaga
B D                 Gorilla  cttccaga
B D               Orangutan  cttccaga
B D                  Gibbon  cttccaga
B D                  Rhesus  ctttcaga
B D     Crab-eating macaque  ctttcaga
B D                  Baboon  atttcaga
B D            Green monkey  ctttcaga
B D                Marmoset  cttccaga
B D         Squirrel monkey  cttccaga
B D                Bushbaby  cttccaga
B D          Naked mole-rat  -gtcctgc
                 Chinchilla  tgtcccgc
B D                  Alpaca  cttccaga
             Bactrian camel  ctcccaga
B D                 Dolphin  cttccaca
               Killer whale  cttccaca
           Tibetan antelope  ctgccagc
B D                     Cow  ctgccagc
B D                   Sheep  ctgccagc
              Domestic goat  ctgccagc
B D                     Cat  cttctaga
B D                     Dog  cctctaga
B D                 Ferret   cttctaga
B D                   Panda  cttctaga
             Pacific walrus  cttctaga
               Weddell seal  cctctaga
           Black flying-fox  cttctaga
B D                 Megabat  cttctaga
B D                Elephant  cttccag-
B D                 Manatee  cttc----
                   Aardvark  cgtctgg-
       Cape elephant shrew  ========
              Prairie vole  ========
B D                   Mouse  ========
B D                     Rat  ========
B D         Chinese hamster  ========
    Lesser Egyptian jerboa  ========
B D                    Pika  ========
B D                  Tenrec  ========
        Chinese tree shrew  ========
B D                Hedgehog  ========
B D                   Shrew  ========
B D              Guinea pig  ========
          Cape golden mole  ========
          Brush-tailed rat  ========
           Star-nosed mole  ========
B D                     Pig  ========
B D                Microbat  ========
B D        White rhinoceros  ========
B D                   Horse  --------
B D                Squirrel  ========

Alignment block 44 of 675 in window, 17406267 - 17406267, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D                Bushbaby  g
B D          Naked mole-rat  c
                 Chinchilla  a
B D                     Pig  g
B D                     Cat  t
B D                     Dog  a
B D                 Ferret   a
B D                   Panda  a
             Pacific walrus  a
               Weddell seal  a
           Black flying-fox  a
B D                 Megabat  a
       Cape elephant shrew  =
              Prairie vole  =
B D                   Mouse  =
B D                     Rat  =
B D         Chinese hamster  =
    Lesser Egyptian jerboa  =
B D                    Pika  =
B D                  Tenrec  =
        Chinese tree shrew  =
B D                Hedgehog  =
             Domestic goat  -
B D                   Sheep  -
B D                   Shrew  =
B D                     Cow  -
B D              Guinea pig  =
          Cape golden mole  =
          Tibetan antelope  -
B D                 Dolphin  -
          Brush-tailed rat  =
           Star-nosed mole  =
              Killer whale  -
                  Aardvark  -
B D                Microbat  =
            Bactrian camel  -
B D                  Alpaca  -
B D                 Manatee  -
B D                Elephant  -
B D        White rhinoceros  =
B D                   Horse  -
B D                Squirrel  =

Inserts between block 44 and 45 in window
B D                Ferret  1706bp

Alignment block 45 of 675 in window, 17406268 - 17406279, 12 bps 
B D                   Human  a----a---agtgctcctg
B D                   Chimp  a----a---agtgctcctg
B D                 Gorilla  a----a---agtgctcctg
B D               Orangutan  a----a---agtgctcctg
B D                  Gibbon  a----a---agtgctcctg
B D                  Rhesus  a----a---agtgctcctg
B D     Crab-eating macaque  a----a---agtgctcctg
B D                  Baboon  a----a---agtgctcctg
B D            Green monkey  a----a---agtgctcctg
B D                Marmoset  a----a---agtgctcctg
B D         Squirrel monkey  a----a---agtgctcctg
B D                Bushbaby  t----c---tgtgcacctg
B D          Naked mole-rat  g----c---aa-gctcttg
                 Chinchilla  g----t---ag--------
B D                     Pig  gatgta---tttacttg--
B D                  Alpaca  -----a---tctgcccctg
             Bactrian camel  -----a---tctgcccctg
B D                 Dolphin  -----a---tctgccccta
               Killer whale  -----a---tctgccccta
           Tibetan antelope  -----a---tctgcctcta
B D                     Cow  -----a---tctgcctcta
B D                   Sheep  -----a---tctgtctcta
              Domestic goat  -----a---tctgtctcta
B D                   Horse  -------aatctgcccctg
B D                     Cat  ---------tctgcctct-
B D                     Dog  ---------tctgcctctg
B D                   Panda  ---------tctgcctctg
             Pacific walrus  ---------tctgcctctg
               Weddell seal  ---------tctgcctctg
           Black flying-fox  ------tctgctgcctctg
B D                 Megabat  ------tctgctgcctctg
B D                Elephant  -------aatctgcccgtg
B D                 Manatee  ----------ttgccccta
                   Aardvark  -------agtctgcccctg
       Cape elephant shrew  ===================
              Prairie vole  ===================
B D                   Mouse  ===================
B D                     Rat  ===================
B D         Chinese hamster  ===================
    Lesser Egyptian jerboa  ===================
B D                    Pika  ===================
B D                  Tenrec  ===================
        Chinese tree shrew  ===================
B D                Hedgehog  ===================
B D                   Shrew  ===================
B D              Guinea pig  ===================
          Cape golden mole  ===================
          Brush-tailed rat  ===================
           Star-nosed mole  ===================
B D                Microbat  ===================
B D                 Ferret   ===================
B D        White rhinoceros  ===================
B D                Squirrel  ===================

Inserts between block 45 and 46 in window
B D                    Pig 936bp

Alignment block 46 of 675 in window, 17406280 - 17406311, 32 bps 
B D                   Human  ggactccaggataccag--gtaaactctctgagc
B D                   Chimp  ggactccaggataccaa--gtaaactctctgagc
B D                 Gorilla  ggactccaggataccaa--gtaaactctctgagc
B D               Orangutan  ggactcaaggataccaa--gtaaactctctgagc
B D                  Gibbon  ggactccaggataccaa--gtaaactctctgagc
B D                  Rhesus  ggactccaggataccaa--gtaaactctctgagc
B D     Crab-eating macaque  ggactccaggataccaa--gtaaactctctgagc
B D                  Baboon  ggactccaggataccaa--gtaaactctctgagc
B D            Green monkey  ggactccaggataccaa--gtaaactctctgagc
B D                Marmoset  cgactccaggatgccag--gtaaa----ctgagc
B D         Squirrel monkey  ggactccaggatgccag--gtaaactctctgagc
B D                Bushbaby  ccac---------ccaa--gtgaactccctgacc
B D          Naked mole-rat  agcctgtttggtggcagtggcaggaccttgaacc
                 Chinchilla  ---ctgctcagcggatgt-gcaggcc------gc
B D                  Alpaca  ccactccagggtgcgat--gtaaaccctctaaac
             Bactrian camel  ccactccagggtgtgat--gtaaaccctttaaac
B D                 Dolphin  ccaccccaggactccac--ataaaccctctgaac
               Killer whale  ccaccccaggactccac--ataaaccctctgaac
           Tibetan antelope  ccatccccagactccac--ataaaccctctgaac
B D                     Cow  ccaccccgggactccaca-aaaaaccctctgaac
B D                   Sheep  ccacctccgcactccac--ataaaccctctgaac
              Domestic goat  ccaccacgggactccac--ataaaccctctgaac
B D                   Horse  ccgctacaggacgccaa--ataaaccctc-gaac
B D                     Cat  ctatcccagggcaccaa--gtaaaccctctgaac
B D                     Dog  ccatcccaggacaccaa--gaaaaccctctggac
B D                   Panda  ccatcccaggacgccaa--atcaaccctctcaac
             Pacific walrus  ccatcccaggaccccaa--gtaaaccctctcaac
               Weddell seal  ccatcccaggaccccaa--gtaaaccctctcaac
           Black flying-fox  ccatcccaagaggccaa--gtaaaccctcggaac
B D                 Megabat  ccatcccaagaggccaa--gtaaaccctcggaac
B D                Elephant  cgaccccaggacgccaa--gc-aaccctcggagc
B D                 Manatee  cgatcccaggacgccaa--gc-aaccctctgacc
                   Aardvark  tgactcaaatgtgccaa--gc-aaccctctgagt
       Cape elephant shrew  ==================================
              Prairie vole  ==================================
B D                   Mouse  ==================================
B D                     Rat  ==================================
B D         Chinese hamster  ==================================
    Lesser Egyptian jerboa  ==================================
B D                    Pika  ==================================
B D                  Tenrec  ==================================
        Chinese tree shrew  ==================================
B D                Hedgehog  ==================================
B D                   Shrew  ==================================
B D              Guinea pig  ==================================
          Cape golden mole  ==================================
          Brush-tailed rat  ==================================
           Star-nosed mole  ==================================
B D                     Pig  ==================================
B D                Microbat  ==================================
B D                 Ferret   ==================================
B D        White rhinoceros  ==================================
B D                Squirrel  ==================================

Inserts between block 46 and 47 in window
B D                 Alpaca 2bp
            Bactrian camel 2bp
B D                Dolphin 774bp
              Killer whale 774bp
          Tibetan antelope 11244bp
B D                    Cow 52270bp
B D                  Sheep 814bp
             Domestic goat 806bp
B D                  Horse 2bp
B D                    Cat 2bp
B D                    Dog 2bp
B D                  Panda 2bp
            Pacific walrus 2bp
              Weddell seal 2bp
          Black flying-fox 2bp
B D                Megabat 2bp

Alignment block 47 of 675 in window, 17406312 - 17406337, 26 bps 
B D                   Human  --ctgtttcttcatctgcaaagg-------gg-aat
B D                   Chimp  --ctgttccttcatctgcaaagg-------gg-aat
B D                 Gorilla  --ctgtttcttcatctgcaaagg-------gg-aat
B D               Orangutan  --ctgtttcttcatctgcaaagg-------gg-aat
B D                  Gibbon  --ctgtttcttcatctgcaaagg-------gg-aat
B D                  Rhesus  --ctgtttcttcatctgtaaagg-------gg-aat
B D     Crab-eating macaque  --ctgtttcttcatctgtaaagg-------gg-aat
B D                  Baboon  --ctgtttcttcatctgtaaagg-------gg-aat
B D            Green monkey  --ctgtttcttcatctgtagagg-------gg-aat
B D                Marmoset  --ctgcttcttcatctgtaaagg-------aacaat
B D         Squirrel monkey  --ctgcttcttcatctgtaaagg-------aacaat
B D                Bushbaby  --ttgcttcctcatttgtaaagt-------gg-gac
B D          Naked mole-rat  --cgttt---gggtttgcagggg-------cc-agc
                 Chinchilla  --ctgct---ggggcagcagggt-------gg-acc
B D                  Alpaca  --cagtttccttatctgtaaaat-------gg-ggc
             Bactrian camel  --cagtttccttatctgtaaaat-------gg-gac
B D                   Horse  --cagtttcctcatctgtagagt--------g-gac
B D                     Cat  --ccattttgtcatctgtaaagt-------gg-ggc
B D                     Dog  --cagttttcccatctgtaaaatgggggaggg-ggc
B D                   Panda  --cagttttcccatctgtaaagt-------gg-ggc
             Pacific walrus  --caattttcccatctgtaaaat-------gg-ggc
               Weddell seal  --cagttttcccatctgtgaagt-------gg-ggc
           Black flying-fox  --cagtttccccatctgtaaagt-------gg-ggc
B D                 Megabat  --cagtttccccatctgtaaagt-------gg-ggc
B D                Elephant  ctgagcttccctgtctgtaaagt-------gg-gac
B D                 Manatee  ctgagcttccctgtgtgtaaagt-------gg-ggc
                   Aardvark  aagagctgccccgtctgtgaagt-------ag-ggc
       Cape elephant shrew  ====================================
              Prairie vole  ====================================
B D                   Mouse  ====================================
B D                     Rat  ====================================
B D         Chinese hamster  ====================================
    Lesser Egyptian jerboa  ====================================
B D                    Pika  ====================================
B D                  Tenrec  ====================================
        Chinese tree shrew  ====================================
B D                Hedgehog  ====================================
             Domestic goat  ====================================
B D                   Sheep  ====================================
B D                   Shrew  ====================================
B D                     Cow  ====================================
B D              Guinea pig  ====================================
          Cape golden mole  ====================================
          Tibetan antelope  ====================================
B D                 Dolphin  ====================================
          Brush-tailed rat  ====================================
           Star-nosed mole  ====================================
              Killer whale  ====================================
B D                     Pig  ====================================
B D                Microbat  ====================================
B D                 Ferret   ====================================
B D        White rhinoceros  ====================================
B D                Squirrel  ====================================

Inserts between block 47 and 48 in window
B D                 Alpaca 3bp
            Bactrian camel 3bp
B D                  Horse 3bp
B D                    Cat 3bp
B D                    Dog 3bp
B D                  Panda 3bp
            Pacific walrus 3bp
              Weddell seal 3bp
          Black flying-fox 3bp
B D                Megabat 3bp

Alignment block 48 of 675 in window, 17406338 - 17406348, 11 bps 
B D                   Human  a---acag-----ggcc-----------------ag
B D                   Chimp  a---acag-----ggcc-----------------ag
B D                 Gorilla  a---acag-----ggcc-----------------ag
B D               Orangutan  a---acag-----ggcc-----------------ag
B D                  Gibbon  a---acag-----ggcc-----------------ag
B D                  Rhesus  a---acag-----ggcc-----------------ag
B D     Crab-eating macaque  a---acag-----ggcc-----------------ag
B D                  Baboon  a---acag-----ggcc-----------------ag
B D            Green monkey  a---acag-----ggcc-----------------ag
B D                Marmoset  a---acag-----ggcc-----------------ag
B D         Squirrel monkey  a---acag-----ggcc-----------------ag
B D                Bushbaby  aa-tacag-----aatc-----------------ag
B D          Naked mole-rat  g---ggat-----ggacgcgatggggaacctggggg
                 Chinchilla  a---ggat-----ggac-----------------gg
B D                  Alpaca  a---acag-----gagc-----------------ag
             Bactrian camel  a---acag-----gagc-----------------ag
B D                   Horse  a---acaa-----aagc-----------------ag
B D        White rhinoceros  a---gcgaggcccaagg-----------------ag
B D                     Cat  a---acag-----gagc-----------------gg
B D                     Dog  a---acag-----gagc-----------------ag
B D                   Panda  a---acaa-----gagc-----------------at
             Pacific walrus  a---acag-----gagc-----------------ag
               Weddell seal  a---acag-----gagc-----------------tg
           Black flying-fox  a---acag-----gagc-----------------ag
B D                 Megabat  a---acag-----gagc-----------------ag
B D                Elephant  -aatattg-----gacc-----------------ag
B D                 Manatee  -aataacg-----gacc-----------------aa
                   Aardvark  -aataacg-----gact-----------------aa
       Cape elephant shrew  ====================================
              Prairie vole  ====================================
B D                   Mouse  ====================================
B D                     Rat  ====================================
B D         Chinese hamster  ====================================
    Lesser Egyptian jerboa  ====================================
B D                    Pika  ====================================
B D                  Tenrec  ====================================
        Chinese tree shrew  ====================================
B D                Hedgehog  ====================================
             Domestic goat  ====================================
B D                   Sheep  ====================================
B D                   Shrew  ====================================
B D                     Cow  ====================================
B D              Guinea pig  ====================================
          Cape golden mole  ====================================
          Tibetan antelope  ====================================
B D                 Dolphin  ====================================
          Brush-tailed rat  ====================================
           Star-nosed mole  ====================================
              Killer whale  ====================================
B D                     Pig  ====================================
B D                Microbat  ====================================
B D                 Ferret   ====================================
B D                Squirrel  ====================================

Inserts between block 48 and 49 in window
B D              Orangutan 963bp
B D         Naked mole-rat 8bp
                Chinchilla 8bp

Alignment block 49 of 675 in window, 17406349 - 17406350, 2 bps 
B D                   Human  cc
B D                   Chimp  cc
B D                 Gorilla  cc
B D                  Gibbon  cc
B D                  Rhesus  cc
B D     Crab-eating macaque  cc
B D                  Baboon  cc
B D            Green monkey  cc
B D                Marmoset  cc
B D         Squirrel monkey  cc
B D                Bushbaby  cc
B D          Naked mole-rat  c-
                 Chinchilla  c-
B D                  Alpaca  cc
             Bactrian camel  cc
B D                   Horse  cc
B D        White rhinoceros  ac
B D                     Cat  cc
B D                     Dog  cc
B D                   Panda  cc
             Pacific walrus  cc
               Weddell seal  cc
           Black flying-fox  cc
B D                 Megabat  cc
B D                Elephant  cc
B D                 Manatee  tc
                   Aardvark  cc
       Cape elephant shrew  ==
              Prairie vole  ==
B D                   Mouse  ==
B D                     Rat  ==
B D         Chinese hamster  ==
    Lesser Egyptian jerboa  ==
B D                    Pika  ==
B D                  Tenrec  ==
        Chinese tree shrew  ==
B D                Hedgehog  ==
             Domestic goat  ==
B D                   Sheep  ==
B D                   Shrew  ==
B D                     Cow  ==
B D              Guinea pig  ==
          Cape golden mole  ==
          Tibetan antelope  ==
B D                 Dolphin  ==
          Brush-tailed rat  ==
           Star-nosed mole  ==
              Killer whale  ==
B D                     Pig  ==
B D                Microbat  ==
B D                 Ferret   ==
B D                Squirrel  ==
B D               Orangutan  ==

Inserts between block 49 and 50 in window
B D                  Horse 505bp
B D                  Panda 259bp

Alignment block 50 of 675 in window, 17406351 - 17406352, 2 bps 
B D                   Human  tc
B D                   Chimp  tc
B D                 Gorilla  tc
B D                  Gibbon  tc
B D                  Rhesus  tc
B D     Crab-eating macaque  tc
B D                  Baboon  tc
B D            Green monkey  tc
B D                Marmoset  tc
B D         Squirrel monkey  tc
B D                Bushbaby  tc
B D                  Alpaca  tc
             Bactrian camel  tc
B D        White rhinoceros  tc
B D                     Cat  tc
B D                     Dog  tc
             Pacific walrus  tc
               Weddell seal  tc
           Black flying-fox  tc
B D                 Megabat  tc
B D                Elephant  tt
B D                 Manatee  tt
                   Aardvark  tc
       Cape elephant shrew  ==
              Prairie vole  ==
B D                   Mouse  ==
B D                     Rat  ==
B D         Chinese hamster  ==
    Lesser Egyptian jerboa  ==
B D                    Pika  ==
B D                  Tenrec  ==
        Chinese tree shrew  ==
B D                Hedgehog  ==
             Domestic goat  ==
B D                   Sheep  ==
B D                   Shrew  ==
B D                     Cow  ==
B D              Guinea pig  ==
          Cape golden mole  ==
          Tibetan antelope  ==
B D                 Dolphin  ==
          Brush-tailed rat  ==
           Star-nosed mole  ==
              Killer whale  ==
B D          Naked mole-rat  --
B D                     Pig  ==
B D                Microbat  ==
B D                   Panda  ==
B D                 Ferret   ==
                Chinchilla  --
B D                   Horse  ==
B D                Squirrel  ==
B D               Orangutan  ==

Inserts between block 50 and 51 in window
B D                  Chimp 950bp
B D                Gorilla 881bp
B D                 Gibbon 1194bp
B D                 Rhesus 961bp
B D    Crab-eating macaque 974bp
B D                 Baboon 963bp
B D           Green monkey 966bp
B D               Marmoset 755bp
B D        Squirrel monkey 610bp
B D               Bushbaby 8650bp
B D       White rhinoceros 1bp
B D                    Dog 70bp
            Pacific walrus 141bp
              Weddell seal 141bp
B D               Elephant 117bp
B D                Manatee 121bp
                  Aardvark 143bp

Alignment block 51 of 675 in window, 17406353 - 17406353, 1 bps 
B D                   Human  a
B D          Naked mole-rat  a
                 Chinchilla  a
B D                  Alpaca  a
             Bactrian camel  a
B D        White rhinoceros  g
B D                     Dog  g
             Pacific walrus  a
               Weddell seal  a
           Black flying-fox  a
B D                 Megabat  a
B D                Elephant  a
B D                 Manatee  a
                   Aardvark  a
       Cape elephant shrew  =
              Prairie vole  =
B D                   Mouse  =
B D                     Rat  =
B D         Chinese hamster  =
    Lesser Egyptian jerboa  =
B D                    Pika  =
B D                  Tenrec  =
        Chinese tree shrew  =
B D                Hedgehog  =
             Domestic goat  =
B D                   Sheep  =
B D                   Shrew  =
B D                     Cow  =
B D              Guinea pig  =
B D                 Gorilla  =
B D     Crab-eating macaque  =
B D         Squirrel monkey  =
          Cape golden mole  =
          Tibetan antelope  =
B D                 Dolphin  =
          Brush-tailed rat  =
           Star-nosed mole  =
              Killer whale  =
B D                     Pig  =
B D                Microbat  =
B D                   Panda  =
B D                 Ferret   =
B D                  Baboon  =
B D                     Cat  -
B D                   Horse  =
B D                Squirrel  =
B D                Bushbaby  =
B D                Marmoset  =
B D            Green monkey  =
B D                  Rhesus  =
B D                  Gibbon  =
B D               Orangutan  =
B D                   Chimp  =

Inserts between block 51 and 52 in window
B D         Naked mole-rat 24bp
                Chinchilla 19bp
B D                 Alpaca 228bp
            Bactrian camel 79bp
          Black flying-fox 465bp
B D                Megabat 4bp

Alignment block 52 of 675 in window, 17406354 - 17406356, 3 bps 
B D                   Human  gac
B D          Naked mole-rat  gac
                 Chinchilla  gac
B D                  Alpaca  gac
             Bactrian camel  ggc
B D        White rhinoceros  gcc
B D                     Dog  gac
             Pacific walrus  gac
               Weddell seal  gac
B D                 Megabat  ga-
B D                Elephant  gac
B D                 Manatee  gac
                   Aardvark  gac
       Cape elephant shrew  ===
              Prairie vole  ===
B D                   Mouse  ===
B D                     Rat  ===
B D         Chinese hamster  ===
    Lesser Egyptian jerboa  ===
B D                    Pika  ===
B D                  Tenrec  ===
        Chinese tree shrew  ===
B D                Hedgehog  ===
             Domestic goat  ===
B D                   Sheep  ===
B D                   Shrew  ===
B D                     Cow  ===
B D              Guinea pig  ===
B D                 Gorilla  ===
B D     Crab-eating macaque  ===
B D         Squirrel monkey  ===
          Cape golden mole  ===
          Tibetan antelope  ===
B D                 Dolphin  ===
          Brush-tailed rat  ===
           Star-nosed mole  ===
              Killer whale  ===
B D                     Pig  ===
B D                Microbat  ===
B D                   Panda  ===
B D                 Ferret   ===
B D                  Baboon  ===
          Black flying-fox  ===
B D                     Cat  ---
B D                   Horse  ===
B D                Squirrel  ===
B D                Bushbaby  ===
B D                Marmoset  ===
B D            Green monkey  ===
B D                  Rhesus  ===
B D                  Gibbon  ===
B D               Orangutan  ===
B D                   Chimp  ===

Inserts between block 52 and 53 in window
B D         Naked mole-rat 6bp
                Chinchilla 2bp

Alignment block 53 of 675 in window, 17406357 - 17406357, 1 bps 
B D                   Human  a
         Chinese tree shrew  a
B D                  Alpaca  c
             Bactrian camel  a
B D        White rhinoceros  a
B D                     Dog  a
             Pacific walrus  g
               Weddell seal  a
B D                Elephant  a
B D                 Manatee  a
                   Aardvark  a
       Cape elephant shrew  =
              Prairie vole  =
B D                   Mouse  =
B D                     Rat  =
B D         Chinese hamster  =
    Lesser Egyptian jerboa  =
B D                    Pika  =
B D                  Tenrec  =
B D                Hedgehog  =
             Domestic goat  =
B D                   Sheep  =
B D                   Shrew  =
B D                     Cow  =
B D