Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 339 in window, 27212027 - 27212038, 12 bps 
B D                     Human  ggatggagg----g-gc
B D                     Chimp  ggatggagg----g-gc
B D                   Gorilla  ggatggagg----g-ac
B D                 Orangutan  ggatggagg----g-gc
B D                    Gibbon  ggatggagg----g-gc
B D       Crab-eating macaque  ggatggagg----a-ac
B D                    Baboon  ggatggagg----a-ac
B D              Green monkey  ggatggagg----a-ac
B D                  Marmoset  ggatggacg----g-gc
B D           Squirrel monkey  ggatggacc----g-gc
B D                  Bushbaby  agacggagt----c-tc
           Chinese tree shrew  ggatggggt----g-gc
B D                  Squirrel  ggatggaga----g-gc
       Lesser Egyptian jerboa  ggacggagc----g-gc
                 Prairie vole  ggatggaga----g-tc
B D           Chinese hamster  ggatggaga----g-gc
               Golden hamster  ggatggaga----g-gc
B D                     Mouse  ggatggagc----t-gc
B D                       Rat  ggatggagc----t-g-
B D            Naked mole-rat  ggatgaagc----g-gc
B D                Guinea pig  aggtgagag----g-gc
                   Chinchilla  ggatgaagc----g-gc
             Brush-tailed rat  ggatgaagc----g-gt
B D                    Rabbit  aactgaagg----c-ac
B D                      Pika  atatgaagg----aggc
B D                       Pig  ggaaggatc----g-gc
B D                    Alpaca  ggatggatt----g-tc
B D                   Dolphin  aaatggatt----a-ac
                 Killer whale  aaatggatt----a-ac
             Tibetan antelope  agatggatt----a-ac
B D                       Cow  agatggatt----a-ac
B D                     Sheep  agatggatt----a-aa
B D                     Horse  gaacggaga---gg-gc
B D          White rhinoceros  ggacggagc---gg-g-
B D                       Cat  ---cggcgg---ga-gc
B D                       Dog  ggacggagt---gg-gc
B D                   Ferret   gaacggaga---ag-gc
B D                     Panda  agacggagt---gg-gc
               Pacific walrus  ggacggcgt---gg-gc
                 Weddell seal  ggacggagt---gg-gc
             Black flying-fox  agatggagt----g-gc
B D                   Megabat  agatggagt----g-gc
                Big brown bat  tggcggtgt----a-gc
B D                  Microbat  cggt-gtgt----a-tc
B D                  Hedgehog  aga--------------
              Star-nosed mole  ggatggag---------
B D                  Elephant  ggatgg-----------
          Cape elephant shrew  agatggaat--------
B D                   Manatee  ggatggagcggc-----
             Cape golden mole  ggatggagt--------
                     Aardvark  ggatagagtggc-----
B D                 Armadillo  ggcccgg----------
B D                   Opossum  aagtt------------
B D           Tasmanian devil  -----------------
  D              Saker falcon  ggacagc----------
  D          Peregrine falcon  agcctgc----------
  D    White-throated sparrow  cggccgg----------
B D               Zebra finch  ggacaga----------
B D                Budgerigar  -gcctgt----------
  D                    Parrot  ggagagc----------
B D                    Turkey  ggtgggc----------
B D        American alligator  aggcggc----------
B D                     Shrew  =================
    Mexican tetra (cavefish)  =================
          Southern platyfish  =================
B D       Medium ground finch  =================
  D            Painted turtle  =================
  D       Collared flycatcher  =================
               Domestic goat  =================
B D                   Wallaby  =================
B D                  Platypus  =================
  D           Green seaturtle  =================
        David's myotis (bat)  =================
              Bactrian camel  -----------------
B D                    Tenrec  NNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNN

Inserts between block 1 and 2 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
B D                    Horse 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
B D                 Microbat 1bp
B D          Tasmanian devil 1bp

Alignment block 2 of 339 in window, 27212039 - 27212040, 2 bps 
B D                     Human  cc
B D                     Chimp  cc
B D                   Gorilla  cc
B D                 Orangutan  cc
B D                    Gibbon  ca
B D       Crab-eating macaque  cc
B D                    Baboon  cc
B D              Green monkey  cc
B D                  Marmoset  cc
B D           Squirrel monkey  cc
B D                  Bushbaby  cc
           Chinese tree shrew  tc
B D                  Squirrel  cc
       Lesser Egyptian jerboa  ca
                 Prairie vole  cc
B D           Chinese hamster  cc
               Golden hamster  cc
B D                     Mouse  cc
B D                       Rat  -a
B D            Naked mole-rat  cc
B D                Guinea pig  cc
                   Chinchilla  cc
             Brush-tailed rat  cc
B D                    Rabbit  cc
B D                      Pika  ct
B D                       Pig  cc
B D                    Alpaca  gc
B D                   Dolphin  cc
                 Killer whale  cc
             Tibetan antelope  cc
B D                       Cow  cc
B D                     Sheep  cc
                Domestic goat  cc
B D                     Horse  cc
B D                       Cat  gc
B D                       Dog  cc
B D                   Ferret   cc
B D                     Panda  cc
               Pacific walrus  cc
                 Weddell seal  cc
             Black flying-fox  cc
B D                   Megabat  cc
                Big brown bat  ca
B D                  Microbat  ca
              Star-nosed mole  -t
B D                   Manatee  ct
                     Aardvark  tc
B D                   Opossum  ct
  D              Saker falcon  cc
  D          Peregrine falcon  cc
B D               Zebra finch  ct
B D                Budgerigar  cc
  D                    Parrot  cc
B D                    Turkey  tc
B D        American alligator  gc
B D                  Hedgehog  --
B D                     Shrew  ==
    Mexican tetra (cavefish)  ==
          Southern platyfish  ==
B D       Medium ground finch  ==
  D            Painted turtle  ==
  D       Collared flycatcher  ==
  D    White-throated sparrow  --
         Cape elephant shrew  --
B D                   Wallaby  ==
B D           Tasmanian devil  ==
B D                  Platypus  ==
  D           Green seaturtle  ==
        David's myotis (bat)  ==
              Bactrian camel  --
B D                    Tenrec  NN
B D                 Armadillo  --
B D                  Elephant  --
B D          White rhinoceros  --
B D                    Rhesus  NN
            Cape golden mole  --

Inserts between block 2 and 3 in window
          Chinese tree shrew 835bp
B D                  Opossum 11bp

Alignment block 3 of 339 in window, 27212041 - 27212092, 52 bps 
B D                     Human  ---------g-agtttctg-----------------------------cga------ag---ccgcgacc
B D                     Chimp  ---------g-agtttctg-----------------------------cga------ag---ccgcgacc
B D                   Gorilla  ---------g-agtttctg-----------------------------cga------ag---ccgcgacc
B D                 Orangutan  ---------g-agtttctg-----------------------------cga------ag---acgcgacc
B D                    Gibbon  ---------g-agtttctg-----------------------------cga------ag---gcgcgacc
B D       Crab-eating macaque  ---------g-agtctctt-----------------------------cga------ag---gcgcgacc
B D                    Baboon  ---------g-agtctctt-----------------------------cga------ag---gcgcgacc
B D              Green monkey  ---------g-agtctctt-----------------------------cga------ag---gcgcgacc
B D                  Marmoset  ---------g-agtctccg-----------------------------tgg------ag---acgcgacc
B D           Squirrel monkey  ---------g-agtctccg-----------------------------cgg------ag---acgcgacc
B D                  Bushbaby  ---------g-agcctctg-----------------------------cgt------ag---acgcgatc
           Chinese tree shrew  ---------g-agccgctg-----------------------------gag------ag---gcgcgatc
B D                  Squirrel  ---------g-aatcgctg-----------------------------cgg------ag---gctcaacc
       Lesser Egyptian jerboa  ---------c-tttg---g---------------------------------------------------
                 Prairie vole  ---------a-gttgtccg---------------------------------------------------
B D           Chinese hamster  ---------a-gctgtccg---------------------------------------------------
               Golden hamster  ---------a-gctgtccg---------------------------------------------------
B D                     Mouse  ---------g-ggcgtccg---------------------------------------------------
B D                       Rat  ---------g-gaagttc----------------------------------------------------
B D            Naked mole-rat  ---------g-agaagctg-----------------------------tag------ag---gcgcgacc
B D                Guinea pig  ---------g-agt--------------------------------------------------------
                   Chinchilla  ---------g-agtcgcga-----------------------------tag------aa---gcgcgacc
             Brush-tailed rat  ---------g-agtcgcaa-----------------------------ccg------tg---gtgcggcc
B D                    Rabbit  ---------g-agccgctg-----------------------------tgc------gg---acgccacc
B D                      Pika  ---------g-ggttgctg-----------------------------gcca-----ag---acgcaact
B D                       Pig  ---------a-aggcgctg-----------------------------cgg------cg---acgcgacc
B D                    Alpaca  ---------g-aactgttg-----------------------------c-g------gg---acgcgacc
               Bactrian camel  --------------------------------------------------g------tg---gcgagacc
B D                   Dolphin  ---------c-agccgcta-----------------------------cgg------at---acgcgact
                 Killer whale  ---------c-agccgcta-----------------------------cgg------at---acgcgact
             Tibetan antelope  ---------g-agtagctt-----------------------------cag------ag---acgctacc
B D                       Cow  ---------g-agctgctt-----------------------------cag------ag---acgctacc
B D                     Sheep  ---------g-agtagctt-----------------------------cag------ag---acgctccc
                Domestic goat  ---------g-agtagctt-----------------------------cgg------ag---acgctacc
B D                     Horse  -----------agctgctg-----------------------------cgg------ag---aagtgacc
B D          White rhinoceros  ---------------------------------------------------------------------c
B D                       Cat  ---------a-agtcgttg-----------------------------cgg------tg---acgcgacc
B D                       Dog  ---------g-agccacag-----------------------------cgg------tg---acgcgacc
B D                   Ferret   ---------g-gaccacgg-----------------------------cgg------tg---gcgcaacc
B D                     Panda  ---------g-agccactg-----------------------------cgg------tg---acgcgacc
               Pacific walrus  ---------g-agccactg-----------------------------cgg------ta---acgcgacc
                 Weddell seal  ---------g-agccactg-----------------------------cgg------tg---atgcgacc
             Black flying-fox  ---------g-agacactg-----------------------------cgg------ag---acgcgacc
B D                   Megabat  ---------g-agacactg-----------------------------cgg------ag---acgcgacc
                Big brown bat  ---------g-agacccgg-----------------------------cgg------ag---acgcgccc
B D                  Microbat  ---------a-aa--ccag-----------------------------cgg------ag---acgcgacc
B D                  Hedgehog  ---------g-aaggcggg-----------------------------cag------------cgctgcc
              Star-nosed mole  ---------a-ggggtggg-----------------------------cag------aa---acgccgcc
B D                  Elephant  -----------agcttcag-----------------------------cag------aa---acgtgacc
          Cape elephant shrew  -----------agtctcgg------------------------agcctctg------ag---acgggatc
B D                   Manatee  ---------ggagcctctg-----------------------------cag------ag---acgcgacg
             Cape golden mole  -----------ggcctcag-------------------------tctactg------ag---acgtgacc
                     Aardvark  ---------tgagcctctg-----------------------------cgg------ag---acgcaact
B D                 Armadillo  -----------cgcggagg-----------------------------tga------ag---acgcgccg
B D                   Opossum  ---------g-ggtctcta-----------------------------aagggtcccag---gagct---
B D           Tasmanian devil  ---------g-ggtttctc-----------------------------gga------ag---gagctact
  D              Saker falcon  a--------g-catccctg--------------------------------------gg---gacagccc
  D          Peregrine falcon  aggcaggagg-agtgcctg--------------------------------------agtttggctgtgc
  D    White-throated sparrow  ---------------------------------------------------------gc---tccgagcc
B D               Zebra finch  g--------c-tgcccctg-----------------------------ctt------gc---ccccacac
B D                Budgerigar  c--------t--gtcccgg-----------------------------atc------ag---gtctgtgc
  D                    Parrot  c--------t-ggtccctg--------------------------------------gg---atttgaac
B D                    Turkey  ctgccaggcc-agcaccgg--------------------------------------gacctgccactgc
B D        American alligator  aggagctgca-cccccccgtggagcgcgagctgcagcctgatgccaaccgc------ag---gccggtgc
B D                     Shrew  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
          Southern platyfish  ======================================================================
B D       Medium ground finch  ======================================================================
  D            Painted turtle  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Platypus  ======================================================================
  D           Green seaturtle  ======================================================================
        David's myotis (bat)  ======================================================================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  tcggcgtccggacgcgggg--aacacc------gggct
                        Chimp  tcggcgtccggacgcgggg--aacacc------gggct
                      Gorilla  tcggcgtccggacgcgggg--aacacc------gggct
                    Orangutan  tcggcgtccggacgcgggg--aacacc------gggct
                       Gibbon  tcggcgtccggacgcgggg--aacacc------gggct
          Crab-eating macaque  ttggcttccggacgcgggg--aacacc------cggct
                       Baboon  ttggcttccggacgcgggg--aacacc------cggct
                 Green monkey  ttggcttccggacgcgggg--aacacc------gggct
                     Marmoset  tcgacatccaggcgcgggg--aacgct------gggct
              Squirrel monkey  tcgacatccagacgcgcgg--aacgcc------gggct
                     Bushbaby  tcggagtcagcgcgcgggg--aacgca------aggct
           Chinese tree shrew  tcggcgttcgg--gagggg--gacact-----------
                     Squirrel  ttggcatctggactagcag--aacgcg------ggccg
       Lesser Egyptian jerboa  -----------------------cgtc------ggggt
                 Prairie vole  -----------------------cacc------gtgct
              Chinese hamster  -----------------------cacc------gtgct
               Golden hamster  -----------------------cacc------gagct
                        Mouse  -----------------------cacc------gggct
                          Rat  -------------------------cc------gggct
               Naked mole-rat  tcggcgtccaggcgcacag--aacgag------gggct
                   Guinea pig  --------------cgcag--aacgcg------gggtt
                   Chinchilla  tcggcggccaggt-tacaa--aacgcg------gggct
             Brush-tailed rat  tcggcgacccaatgtgcag--aacgcg------gggct
                       Rabbit  gtggcgtccggacgcggga--gacgcg------gggct
                         Pika  ccggtttccaggcgcggcg-------------------
                          Pig  tcggcgtccaggctggagg--aacgcg------ggtct
                       Alpaca  ccgacgtccgtgcgagagg--aacgca------gggcc
               Bactrian camel  actactacttcgc----------cgct------gg---
                      Dolphin  ccggc-tccaagcgcaagg--aacacg------gggct
                 Killer whale  ccggc-tccaagcgcaagg--aacacg------gggct
             Tibetan antelope  ccgacgtccgggcgcgtgg--aacgcg------tcgct
                          Cow  ccgacgtccgggagcatgg--aacgcg------gcgct
                        Sheep  ccgccgtccgggcgcgtgg--aacgcg------tcgct
                Domestic goat  ccgacgtccgggcgcgtgg--aacgcg------tcgct
                        Horse  tcggcgtctgggcacgagg--agcgcg------cagct
             White rhinoceros  ttggcgcctcggcgcgaga--gaagcg------gggct
                          Cat  tcggcatccggaagcgagg--aacgcg------gagct
                          Dog  tcggcgtccggaagcgagg--aatgcg------gagct
                      Ferret   tcggcgtccggaagcgagg--agtgcg------cagct
                        Panda  tcggcgtccggaagcgagg--aatgcg------gagct
               Pacific walrus  tcggcgtccggaagcgagg--aatacg------gagct
                 Weddell seal  tcggcgtccggaagcgagg--aatacg------gagct
             Black flying-fox  tcggcgtctgggcgcgagg--gcc--------------
                      Megabat  tcggcgtctgggcgcgagg--gcc--------------
                Big brown bat  tcggtgtcccggcgcaagg--ctctcg------ggggt
                     Microbat  tcggcgtcccggcgcgagg--cgctcg------gggcc
                     Hedgehog  ------tccgggcgcgcgg--ggctcg------gggtc
              Star-nosed mole  acggcgccggagcgtgcga--aattcg------gggtt
                     Elephant  tcggagtccaggcttagag--aaggca------aggct
          Cape elephant shrew  acgacgtagaggctcctta--gatgta------gggtc
                      Manatee  ttggcgtccaggcgcgggg--aacgca------ggact
             Cape golden mole  tcagcgttcaggaacgggc--aacaca------gagct
                     Aardvark  tcggcgtccagggaggggatttccgca------aggct
                    Armadillo  ccgggg---------------aagccg------gggcc
                      Opossum  ----------ggcgccgag--aatgggatgaagggact
              Tasmanian devil  c---------ggggccggg--agcgcgc-----ggcct
                 Saker falcon  ggcacccactg--ggac---------------------
             Peregrine falcon  tggacatgctg-cgcat---------------------
       White-throated sparrow  tcggggggcgg---------------------------
                  Zebra finch  ccagaggactg---------------------------
                   Budgerigar  tgagcagccgggtggat---------------------
                       Parrot  ccagcttgtggccttgt---------------------
                       Turkey  cgggaggaccc---------------------------
           American alligator  tgacgcgggaggtgcct---------------------
                        Shrew  ======================================
     Mexican tetra (cavefish)  ======================================
           Southern platyfish  ======================================
          Medium ground finch  ======================================
               Painted turtle  ======================================
          Collared flycatcher  ======================================
                      Wallaby  ======================================
                     Platypus  ======================================
              Green seaturtle  ======================================
         David's myotis (bat)  ======================================
                       Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 3 and 4 in window
  D             Saker falcon 14bp
  D         Peregrine falcon 25bp
  D   White-throated sparrow 15bp
B D              Zebra finch 30bp
B D               Budgerigar 33bp
  D                   Parrot 65bp
B D                   Turkey 4bp
B D       American alligator 4bp

Alignment block 4 of 339 in window, 27212093 - 27212131, 39 bps 
B D                     Human  ga----ggg-----------agt-------ctgcagtcggctc---------------------------
B D                     Chimp  ga----ggg-----------agt-------ctgcagtcggctc---------------------------
B D                   Gorilla  ga----ggg-----------agt-------ctgcagtcggctc---------------------------
B D                 Orangutan  ga----ggg-----------agt-------ctgcactcggctc---------------------------
B D                    Gibbon  ga----ggg-----------agt-------ctgcagtcggctc---------------------------
B D       Crab-eating macaque  ga----ggg-----------agc-------ctgcagtcggctc---------------------------
B D                    Baboon  ga----ggg-----------agc-------ctgcagtcggctc---------------------------
B D              Green monkey  ga----ggg-----------agc-------ctacagtcggctc---------------------------
B D                  Marmoset  ga----aga-----------agc-------ctgcagtaggctc---------------------------
B D           Squirrel monkey  ga----aga-----------agc-------ctgcagtcggccc---------------------------
B D                  Bushbaby  aa----agg-----------agc-------ctgaagtcg-------------------------------
           Chinese tree shrew  ---------------------------------cagttggct----------------------------
B D                  Squirrel  ga----gag-----------agt-------ctgcagtcggctc---------------------------
       Lesser Egyptian jerboa  gc----gta-----------ggctactggggtgagggag-ctc---------------------------
                 Prairie vole  ga----gga-----------agc-------atgcagtagactc---------------------------
B D           Chinese hamster  ga----gga-----------agc-------gtgcagtagactc---------------------------
               Golden hamster  ga----gga-----------agc-------atgcagtagactc---------------------------
B D                     Mouse  ga----ggg------------tc-------atgcagtag-ctc---------------------------
B D                       Rat  ga----ggg-----------aac-------ttgcagtag-ctc---------------------------
B D            Naked mole-rat  ga----caa------------gc-------ctgcactcggctc---------------------------
B D                Guinea pig  ga----cga------------gc-------ctgcatttggctc---------------------------
                   Chinchilla  ga----cga------------gc-------ctgcggttggctg---------------------------
             Brush-tailed rat  ---------------------------------cgg----------------------------------
B D                    Rabbit  gg----agg-----------atc-------ccgcagt---------------------------------
B D                      Pika  ----------------------c-------ctgcagt---------------------------------
B D                       Pig  ga----gag-----------agc-----------------------------------------------
B D                    Alpaca  ga----gag-----------agc-----------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
B D                   Dolphin  ga----ggg-----------agc-----------------------------------------------
                 Killer whale  ga----ggg-----------agc-----------------------------------------------
             Tibetan antelope  ga----gaa-----------agc-----------------------------------------------
B D                       Cow  ga----gaa-----------aac-----------------------------------------------
B D                     Sheep  ga----gaa-----------agc-----------------------------------------------
                Domestic goat  ga----gaa-----------agc-----------------------------------------------
B D                     Horse  ga----aag-----------agt-----------------------------------------------
B D          White rhinoceros  ga----aag-----------agc-----------------------------------------------
B D                       Cat  ga----gag-----------agc-----------------------------------------------
B D                       Dog  ga----gag-----------agc-----------------------------------------------
B D                   Ferret   ga----aag-----------agc-----------------------------------------------
B D                     Panda  ga----aag-----------agc-----------------------------------------------
               Pacific walrus  ga----aag-----------agc-----------------------------------------------
                 Weddell seal  ga----aag-----------agc-----------------------------------------------
B D                  Hedgehog  gagagggag-----------agc-----------------------------------------------
              Star-nosed mole  ga----gtg-----------cgc-----------------------------------------------
B D                  Elephant  ga----gga-----------agc-------ctgcaatcggctt---------------------------
          Cape elephant shrew  ga----agg-----------agt-------ccgtaagccgctc---------------------------
B D                   Manatee  ga----gga-----------agc-------ctgcagtcggcta---------------------------
             Cape golden mole  ga---gggg-----------agg-------ctgctgttgactc---------------------------
                     Aardvark  ga----ggg-----------agc-------ctgtagtggagtc---------------------------
B D                 Armadillo  gc----cgg------------gc-------cggcagtcggctc---------------------------
B D                   Opossum  gt----gggtctgggatccaatc-------tctcctcccccct---------------------------
B D           Tasmanian devil  ga----tga---------caccc-------ctgccgttgccct---------------------------
  D              Saker falcon  --------------------------------gggaacatcct------------------------ggc
  D          Peregrine falcon  --------------------------------gacgaggtcttcagccatatcaggtga--gctgggggc
  D    White-throated sparrow  ----------------------------------------------------------------------
B D               Zebra finch  ----------------------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------------------
B D                    Turkey  ---------------------------------------------------aaaggtgagtgctgggggc
B D        American alligator  ----------------------------------------------------ggggccggggctggggcc
B D                     Shrew  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D                    Parrot  ======================================================================
          Southern platyfish  ======================================================================
B D       Medium ground finch  ======================================================================
  D            Painted turtle  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Platypus  ======================================================================
  D           Green seaturtle  ======================================================================
B D                  Microbat  ----------------------------------------------------------------------
        David's myotis (bat)  ======================================================================
               Big brown bat  ----------------------------------------------------------------------
            Black flying-fox  ----------------------------------------------------------------------
B D                   Megabat  ----------------------------------------------------------------------
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ----cggg-aagccgcgc----ggc----ga
                        Chimp  ----cggg-aagccgcgc----ggc----ga
                      Gorilla  ----cggg-aagccgcgc----ggc----ga
                    Orangutan  ----cggg-aagccgcgc----ggc----ga
                       Gibbon  ----cggg-aagccgcgc----ggc----ga
          Crab-eating macaque  ----tggg-aagccgcgc----ggc----ga
                       Baboon  ----tggg-aagccgcgc----ggc----ga
                 Green monkey  ----cggg-aagccgcgc----ggc----ga
                     Marmoset  ----tagg-aagcggcgc----ggc----ga
              Squirrel monkey  ----tagg-aagccgcgc----ggc----ga
                     Bushbaby  -------------cgagc----ggt----ga
           Chinese tree shrew  -------------------------------
                     Squirrel  ----aggg-gagctgagc----ggc----ta
       Lesser Egyptian jerboa  ----aaag-ggacagacg----gacgggaga
                 Prairie vole  ----caag-caactaagc----ggc----gc
              Chinese hamster  ----caag-caactaagc----ggc----gc
               Golden hamster  ----caag-caactaagc----ggc----gg
                        Mouse  ----aagg-caactaagc----gct----aa
                          Rat  ----aagg-caactaagt----gct----aa
               Naked mole-rat  ----agag-gagctgagt----gac----gt
                   Guinea pig  ----agag-ttgctgatt----agc----gt
                   Chinchilla  ----aaaa-gagccgagt----ggc----gt
             Brush-tailed rat  ------gg-gatctgagt----ggc----ga
                       Rabbit  ------------------------c----tg
                         Pika  ------------------------c----ta
                          Pig  ----------------------ggt----cg
                       Alpaca  ----------------------ggc----ag
               Bactrian camel  ----------------------ggc----ag
                      Dolphin  ----------------------agt----ga
                 Killer whale  ----------------------agt----ga
             Tibetan antelope  ----------------------ggt----gg
                          Cow  ----------------------ggt----gg
                        Sheep  ----------------------ggt----gg
                Domestic goat  ----------------------ggt----gg
                        Horse  ----------------------ggt----gg
             White rhinoceros  ----------------------ggc----gc
                          Cat  ----------------------ggc----gg
                          Dog  ----------------------ggc----ac
                      Ferret   ----------------------ggc----gg
                        Panda  ----------------------ggc----gg
               Pacific walrus  ----------------------ggc----gg
                 Weddell seal  ----------------------ggc----gg
                     Hedgehog  ----------------------ggc----gc
              Star-nosed mole  ----------------------gct----gg
                     Elephant  ----agag-gagccgagc----ggc----gg
          Cape elephant shrew  ----aaag-gagccgaga----ggc----ag
                      Manatee  ----aaag-cagccgagc----ggc----ag
             Cape golden mole  ----atag-gagccaagt----gac----ga
                     Aardvark  ----agaa-gagccgagc----ggc----aa
                    Armadillo  ----cggg-ga--------------------
                      Opossum  ----cccg-agcctgtcaaaggaac----ca
              Tasmanian devil  ----cgcg--gcctcgca----ttc----ca
                 Saker falcon  ataactgg-gggcagccc----agc----at
             Peregrine falcon  ttggtggg-ggacagccc----ggc----at
       White-throated sparrow  ----cgga-gcatcacct----cgt----a-
                  Zebra finch  ----tgga-tacccccct----tgc----ag
                   Budgerigar  ----cacaggaatcgccc----tgg----at
                       Turkey  a---ctgg-gaggggacg----ggc----ag
           American alligator  agggcagg-gagaggcgc----cgc----ag
                        Shrew  ===============================
     Mexican tetra (cavefish)  ===============================
                       Parrot  ===============================
           Southern platyfish  ===============================
          Medium ground finch  ===============================
               Painted turtle  ===============================
          Collared flycatcher  ===============================
                      Wallaby  ===============================
                     Platypus  ===============================
              Green seaturtle  ===============================
                     Microbat  -------------------------------
         David's myotis (bat)  ===============================
                Big brown bat  -------------------------------
             Black flying-fox  -------------------------------
                      Megabat  -------------------------------
                       Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 4 and 5 in window
  D             Saker falcon 4bp
  D         Peregrine falcon 4bp
  D   White-throated sparrow 9bp
B D              Zebra finch 22bp
B D               Budgerigar 13bp
B D                   Turkey 1bp
B D       American alligator 3bp

Alignment block 5 of 339 in window, 27212132 - 27212139, 8 bps 
B D                     Human  cgggggag--
B D                     Chimp  cgggggag--
B D                   Gorilla  cgggggag--
B D                 Orangutan  cgggggag--
B D                    Gibbon  cgggggag--
B D       Crab-eating macaque  caggggtc--
B D                    Baboon  caggggtc--
B D              Green monkey  caggggtc--
B D                  Marmoset  cggcggag--
B D           Squirrel monkey  cggcggag--
B D                  Bushbaby  cgaggaag--
           Chinese tree shrew  tagagggg--
B D                  Squirrel  cagg---g--
       Lesser Egyptian jerboa  ccagggag--
                 Prairie vole  ctggggag--
B D           Chinese hamster  ctggggcg--
               Golden hamster  ctggggcg--
B D                     Mouse  ctggacag--
B D                       Rat  gtggacag--
B D            Naked mole-rat  c-ggagga--
B D                Guinea pig  c-ggagga--
                   Chinchilla  c-ggagga--
             Brush-tailed rat  a-ggagga--
B D                    Rabbit  c-acaggc--
B D                      Pika  c-acaggg--
B D                       Pig  t-ggggag--
B D                    Alpaca  c-ggggag--
               Bactrian camel  c-ggggag--
B D                   Dolphin  c-ggggag--
                 Killer whale  c-ggggag--
             Tibetan antelope  c-agggag--
B D                       Cow  c-aaggag--
B D                     Sheep  c-agggag--
                Domestic goat  c-agggag--
B D                     Horse  t-ggggga--
B D          White rhinoceros  g-gggggc--
B D                       Cat  c-tgggag--
B D                       Dog  c-ggggta--
B D                   Ferret   c-ggggcg--
B D                     Panda  c-ggggag--
               Pacific walrus  c-ggggag--
                 Weddell seal  c-ggggag--
             Black flying-fox  -----gaa--
B D                   Megabat  -----gaa--
                Big brown bat  ---ggaag--
B D                  Microbat  ---gagat--
B D                  Hedgehog  c-ggggag--
              Star-nosed mole  c-gggaaa--
B D                  Elephant  cgag------
          Cape elephant shrew  ggagaga---
B D                   Manatee  gaggcggg--
             Cape golden mole  atagtagg--
                     Aardvark  gcggg-----
B D                   Opossum  g-caggag--
B D           Tasmanian devil  c-caggag--
  D              Saker falcon  --tggggcag
  D          Peregrine falcon  --ggggacag
  D    White-throated sparrow  --cgcgacaa
B D               Zebra finch  --cgggggac
B D                Budgerigar  -------gag
  D                    Parrot  --ggttagag
B D                     Shrew  ==========
    Mexican tetra (cavefish)  ==========
          Southern platyfish  ==========
B D       Medium ground finch  ==========
B D                    Turkey  ==========
  D            Painted turtle  ==========
  D       Collared flycatcher  ==========
B D        American alligator  ==========
B D                   Wallaby  ==========
B D                  Platypus  ==========
  D           Green seaturtle  ==========
        David's myotis (bat)  ==========
B D                    Tenrec  NNNNNNNNNN
B D                 Armadillo  ----------
B D                    Rhesus  NNNNNNNNNN

Inserts between block 5 and 6 in window
B D                      Pig 1bp
B D                 Elephant 7bp
         Cape elephant shrew 8bp
B D                  Manatee 12bp
            Cape golden mole 23bp
B D                  Opossum 33bp

Alignment block 6 of 339 in window, 27212140 - 27212143, 4 bps 
B D                     Human  g----------cct--------
B D                     Chimp  g----------cct--------
B D                   Gorilla  g----------cct--------
B D                 Orangutan  g----------cct--------
B D                    Gibbon  g----------cct--------
B D       Crab-eating macaque  g----------cct--------
B D                    Baboon  g----------cct--------
B D              Green monkey  g----------cct--------
B D                  Marmoset  g----------cct--------
B D           Squirrel monkey  g----------cct--------
B D                  Bushbaby  g----------cct--------
           Chinese tree shrew  a----------cct--------
B D                  Squirrel  g----------cgt--------
       Lesser Egyptian jerboa  g----------ctc--------
                 Prairie vole  g----------cct--------
B D           Chinese hamster  g----------cct--------
               Golden hamster  g----------cct--------
B D                     Mouse  g----------cct--------
B D                       Rat  g----------cct--------
B D            Naked mole-rat  g----------ctt--------
B D                Guinea pig  g----------ctt--------
                   Chinchilla  a----------ctt--------
             Brush-tailed rat  g----------ctt--------
B D                    Rabbit  g----------cct--------
B D                      Pika  g----------cct--------
B D                       Pig  g----------cct--------
B D                    Alpaca  g----------cct--------
               Bactrian camel  g----------cct--------
B D                   Dolphin  g----------cct--------
                 Killer whale  g----------cct--------
             Tibetan antelope  g----------cct--------
B D                       Cow  g----------tct--------
B D                     Sheep  g----------cct--------
                Domestic goat  g----------cct--------
B D                     Horse  gg---------cct--------
B D          White rhinoceros  gggggggagaacct--------
B D                       Cat  g----------cct--------
B D                       Dog  g----------cct--------
B D                   Ferret   g----------cct--------
B D                     Panda  g----------cct--------
               Pacific walrus  g----------cct--------
                 Weddell seal  g----------cct--------
             Black flying-fox  g---------------------
B D                   Megabat  g---------------------
                Big brown bat  g---------------------
B D                  Microbat  g---------------------
B D                  Hedgehog  g----------ccc--------
              Star-nosed mole  g----------cct--------
B D                   Opossum  g----------ccc--------
  D              Saker falcon  -----------ccc-------a
  D          Peregrine falcon  -----------ccc-------g
  D    White-throated sparrow  -----------ctt-------c
B D               Zebra finch  -----------cct-------c
B D        American alligator  -----------ccctggggtgc
B D                     Shrew  ======================
    Mexican tetra (cavefish)  ======================
  D                    Parrot  ----------------------
B D                Budgerigar  ----------------------
          Southern platyfish  ======================
B D       Medium ground finch  ======================
B D                    Turkey  ======================
  D            Painted turtle  ======================
  D       Collared flycatcher  ======================
         Cape elephant shrew  ======================
B D                   Wallaby  ======================
B D           Tasmanian devil  NNNNNNNNNNNNNNNNNNNNNN
B D                  Platypus  ======================
  D           Green seaturtle  ======================
        David's myotis (bat)  ======================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNN
B D                 Armadillo  ----------------------
                    Aardvark  ----------------------
B D                  Elephant  ======================
B D                   Manatee  ======================
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNN
            Cape golden mole  ======================

Alignment block 7 of 339 in window, 27212144 - 27212155, 12 bps 
B D                     Human  tcact----------aa----agggg
B D                     Chimp  tcact----------aa----agggg
B D                   Gorilla  tcact----------aa----agggg
B D                 Orangutan  tcact----------aa----agggg
B D                    Rhesus  tcatt----------aa----agggg
B D       Crab-eating macaque  tcatt----------aa----agggg
B D                    Baboon  tcatt----------aa----agggg
B D              Green monkey  tcatt----------aa----agggg
B D                  Marmoset  tcact----------aa----agggg
B D           Squirrel monkey  tcact----------aa----aggac
B D                  Bushbaby  tcact----------aa----aggag
           Chinese tree shrew  tcaca----------aa----ccggg
B D                  Squirrel  atgcc----------aa----agggg
       Lesser Egyptian jerboa  gcgct----------aa----aggga
                 Prairie vole  gcgct----------cc----cggaa
B D           Chinese hamster  gagct----------cc----cggaa
               Golden hamster  gcgcg----------ac----cggaa
B D                     Mouse  gcgct----------cc----aggaa
B D                       Rat  gcgct----------ac----aggaa
B D            Naked mole-rat  ccgct----------aa----aaggg
B D                Guinea pig  ccact----------aa----aaggg
                   Chinchilla  ctagt----------ga----aaggg
             Brush-tailed rat  ccatt----------aa----agggg
B D                    Rabbit  tcgc----------------------
B D                      Pika  tggct----------aa----agggg
B D                       Pig  tcatg----------ta----acagg
B D                    Alpaca  tcgct----------ta----agggg
               Bactrian camel  tcgct----------ta----agagg
B D                   Dolphin  tcgct----------ta----agggg
                 Killer whale  tcgct----------ta----agggg
             Tibetan antelope  tcgct----------ta----agggg
B D                       Cow  tcgct----------ta----agggg
B D                     Sheep  tcgct----------ta----agggg
                Domestic goat  tcgct----------ta----agggg
B D                     Horse  tcggt----------ga----atgga
B D          White rhinoceros  ttgct----------ga----agcga
B D                       Cat  tcgct----------aa----c-ggg
B D                       Dog  tcgct----------at----caggg
B D                   Ferret   tctct----------ag----caggg
B D                     Panda  tcgct----------aa----cacgg
               Pacific walrus  gcgct----------aa----caggg
                 Weddell seal  tcgct----------aa----caggg
             Black flying-fox  ------------------------gg
B D                   Megabat  ------------------------gg
                Big brown bat  ------------------------gg
B D                  Microbat  ------------------------gg
B D                  Hedgehog  gcgct----------gc----cgggg
              Star-nosed mole  ttgct----------aa----aagag
B D                  Elephant  ttgct----------aa----agggg
          Cape elephant shrew  tttctcataggagagaa----aaaga
B D                   Manatee  ttgct----------aa----agggg
             Cape golden mole  tggct----------aat---ggaga
                     Aardvark  ---------------ag----aggga
B D                 Armadillo  ---------------ag---------
B D                   Opossum  -----------------cccctgggg
  D              Saker falcon  gcacc----------ca----ctggg
  D          Peregrine falcon  gcacc----------ca----ctggg
  D    White-throated sparrow  tcccc----------cc----gctgg
B D               Zebra finch  tgttc----------ca----gcagg
B D                Budgerigar  ----c----------cc----gcatg
  D                    Parrot  ---------------ca----gcaga
B D        American alligator  tcccc----------tg----agcgg
B D                     Shrew  ==========================
    Mexican tetra (cavefish)  ==========================
          Southern platyfish  ==========================
B D       Medium ground finch  ==========================
B D                    Turkey  ==========================
  D            Painted turtle  ==========================
  D       Collared flycatcher  ==========================
B D                   Wallaby  ==========================
B D           Tasmanian devil  NNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Platypus  ==========================
  D           Green seaturtle  ==========================
        David's myotis (bat)  ==========================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 7 and 8 in window
B D               Guinea pig 170bp
                  Chinchilla 163bp
B D                  Opossum 1bp
B D              Zebra finch 13bp

Alignment block 8 of 339 in window, 27212156 - 27212206, 51 bps 
B D                     Human  a--------------------------------------aa-ag-----gaag-a-g-------------
B D                     Chimp  a--------------------------------------aa-ag-----gaag-a-g-------------
B D                   Gorilla  a--------------------------------------aa-ag-----gaag-a-g-------------
B D                 Orangutan  a--------------------------------------aa-ag-----gaag-a-g-------------
B D                    Rhesus  a--------------------------------------aa-ag-----gaat-a-a-------------
B D       Crab-eating macaque  a--------------------------------------aa-ag-----gaat-a-a-------------
B D                    Baboon  a--------------------------------------aa-ag-----gaat-a-a-------------
B D              Green monkey  a--------------------------------------aa-ag-----gaat-a-a-------------
B D                  Marmoset  a--------------------------------------aa-ag-----gaag-a-g-------------
B D           Squirrel monkey  a--------------------------------------aa-ag-----gagg-a-g-------------
B D                  Bushbaby  g--------------------------------------gt-at-----ggag-a-g-------------
           Chinese tree shrew  g--------------------------------------aa-at-----ggag-a-g-------------
B D                  Squirrel  ---------------------------------------ga-ag-----tgaa-a-a-------------
       Lesser Egyptian jerboa  ---------------------------------------gacat-----ggag-a-a-------------
                 Prairie vole  ---------------------------------------ga-at-----ggcg-g-g-------------
B D           Chinese hamster  ---------------------------------------ga-at-----ggag-g-g-------------
               Golden hamster  ---------------------------------------gg-at-----ggag-g-g-------------
B D                     Mouse  ---------------------------------------ga-at-----ggag-a-g-------------
B D                       Rat  ---------------------------------------ga-at-----ggag-a-g-------------
B D            Naked mole-rat  ---------------------------------------ga-aa-----atgg-t-gt------------
B D                Guinea pig  aaaaa----------------------------------ga-ag-----ggcg-a-gtccatagggc---
                   Chinchilla  aaaat----------------------------------ga-ag-----aggg-a-gtccataagac---
             Brush-tailed rat  aaaatggtgcgtcgcacgcctgtaatctcagcgcacttggg-ag-----gggg-a-agcaggaggtctca
B D                    Rabbit  ----------------------------------------------------------------------
B D                      Pika  ----------------------------------------------------------------------
B D                       Pig  --------------------------------------ga----------aaa-g-a-------------
B D                    Alpaca  --------------------------------------gaa-aa-----ggag-a-a-------------
               Bactrian camel  --------------------------------------gaa-aa-----ggag-a-a-------------
B D                   Dolphin  --------------------------------------gaa-aa-----agag-a-a-------------
                 Killer whale  --------------------------------------gaa-aa-----ggag-a-a-------------
             Tibetan antelope  --------------------------------------t-----------gaa-a-a-------------
B D                       Cow  --------------------------------------g-----------gag-a-a-------------
B D                     Sheep  --------------------------------------t-----------gaa-a-a-------------
                Domestic goat  --------------------------------------t-----------gaa-a-a-------------
B D                     Horse  --------------------------------------aaa-a------ggag-a-g-------------
B D          White rhinoceros  --------------------------------------aag-ac-----ggac-a-g-------------
B D                       Cat  --------------------------------------gga-aa-----ggag-a-g-------------
B D                       Dog  --------------------------------------aaa-aa-----ggag-a-a-------------
B D                   Ferret   --------------------------------------gaa-aa-----cgag-a-g-------------
B D                     Panda  --------------------------------------gaa-aa-----ggag-a-g-------------
               Pacific walrus  --------------------------------------gaa-aa-----ggag-agg-------------
                 Weddell seal  --------------------------------------gaa-aa-----ggag-a-g-------------
             Black flying-fox  --------------------------------------gtg-aa-----agag-c-g-------------
B D                   Megabat  --------------------------------------gtg-aa-----agag-c-g-------------
                Big brown bat  --------------------------------------gag-ca-----gga--g-a-------------
B D                  Microbat  --------------------------------------gag-ca-----ggag-g-g-------------
B D                  Hedgehog  --------------------------------------ggc-gg-----gaac-a-g-------------
              Star-nosed mole  --------------------------------------gac-aagtc--gcgg-c-g-------------
B D                  Elephant  ----------------------------------------a-aa-----agag-c-a-------------
          Cape elephant shrew  ----------------------------------------a-at-----ggag-c-c-------------
B D                   Manatee  ----------------------------------------g-aa-----aaagaa-c-------------
             Cape golden mole  ----------------------------------------a-ac-----agag-a-a-------------
                     Aardvark  ----------------------------------------g-aa-----agag-a-a-------------
B D                 Armadillo  ----------------------------------------------------g-c-c-------------
B D                   Opossum  --------------------------------------------atccggaag-a-g-------------
  D              Saker falcon  ----------------------------------------------------------------------
  D          Peregrine falcon  ----------------------------------------------------------------------
  D    White-throated sparrow  ----------------------------------------------------------------------
B D               Zebra finch  --------------------------------------------------------------------ca
B D                Budgerigar  ----------------------------------------------------------------------
  D                    Parrot  ----------------------------------------------------------------------
B D                    Turkey  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
B D                     Shrew  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
          Southern platyfish  ======================================================================
B D       Medium ground finch  ======================================================================
  D            Painted turtle  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Platypus  ======================================================================
  D           Green seaturtle  ======================================================================
        David's myotis (bat)  ======================================================================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  g---------------gggt---c---------ggc-cagtat--ccc-c--g-----------------
                        Chimp  g---------------gggt---c---------ggc-cagtgt--ccc-c--g-----------------
                      Gorilla  g---------------gggt---c---------ggc-cagtgt--ccc-c--g-----------------
                    Orangutan  g---------------gggt---c---------ggc-cagtgt--ccc-c--g-----------------
                       Rhesus  g---------------ggg----t---------agc-cagtgt--ccc-c--g-----------------
          Crab-eating macaque  g---------------ggg----t---------agc-cagtgt--ccc-c--g-----------------
                       Baboon  g---------------ggg----c---------agc-cagtgt--ccc-c--g-----------------
                 Green monkey  g---------------ggg----c---------ggc-cagtgt--ccc-c--g-----------------
                     Marmoset  g---------------tggt---c---------ggc-cagtgt--ccc-c--g-----------------
              Squirrel monkey  g---------------gggt---c---------ggc-cagtgt--ccc-g--g-----------------
                     Bushbaby  g---------------gaat---a---------ggc-cagtgt--ctc-c--g-----------------
           Chinese tree shrew  a---------------gacc---c---------agc-tag--t--ccc-c--g-----------------
                     Squirrel  g-------------gcgagt---g---------ggt-ctgtcc--acc-c-cg-----------------
       Lesser Egyptian jerboa  a---------------ggat---g---------ggt-ctgtcc--ccc-a--g-----------------
                 Prairie vole  a---------------ggtt---g---------ggt-ctgccc--gcc-a-gg-----------------
              Chinese hamster  a---------------gggc---g---------ggt-ctgccc--acc-a-gg-----------------
               Golden hamster  agggtg-ggtctgcccgggt---g---------ggt-ctgccc--acc-a-gg-----------------
                        Mouse  a---------------tggt---g---------ggt-ctgtcc--acc-g-cg-----------------
                          Rat  a---------------tgtt---g---------ggt-cattcc--acc-a-cg-----------------
               Naked mole-rat  g---------------gtgc---a---------cgc-ctgtaa--tcc-c-agcactcttgggaggctga
                   Guinea pig  a---------------atgt---g---------cgt-gtccat--tcc-g-aa-----------------
                   Chinchilla  a---------------gtgt---g---------cgc-gtccat--tcc-t-aa-----------------
             Brush-tailed rat  a---------------gtat---g---------ag--gttcgc--cct-t-ggcaatttagcgagaccct
                       Rabbit  -------------------------------------cagtcc--cct-c-ag-----------------
                         Pika  -aaaagaggaatggggggtc---c---------tgt-cagtgc--cctcc-aa-----------------
                          Pig  a---------------gggg---c---------ggt-ctggcc--ccc-c--a-----------------
                       Alpaca  g---------------gggt---t---------ggt-tagtct--ccc-c--g-----------------
               Bactrian camel  g---------------gggt---t---------ggt-caatct--ccc-c--g-----------------
                      Dolphin  g---------------aggg---t---------ggt-cagtcc--cacgc--g-----------------
                 Killer whale  g---------------gggg---t---------ggt-cagtcc--cccgc--g-----------------
             Tibetan antelope  g---------------gatg---t---------ggt-cagtcc--cc--t--g-----------------
                          Cow  g---------------ggtg---t---------ggt-tagtcc--cc--c--g-----------------
                        Sheep  g---------------gatg---t---------ggt-cagtcc--cc--c--g-----------------
                Domestic goat  g---------------gatg---t---------ggt-cagtcc--cc--c--g-----------------
                        Horse  g---------------gggt---c---------ggc-cagtgt--ccc-c--t-----------------
             White rhinoceros  g---------------gatt---c---------ggctcagtat---cc-c--t-----------------
                          Cat  g---------------gggt---t---------ggc-cagtcc--tct-c--t-----------------
                          Dog  a---------------gagt---t---------gac-cagtcc--tcc-c--c-----------------
                      Ferret   g---------------acgt---t---------ggg-ccgtcc--gcc-g--t-----------------
                        Panda  g---------------gagt---t---------gac-cagtcc--gcc-c--t-----------------
               Pacific walrus  g---------------gggt---t---------ggc-cagtcc--gcc-c--t-----------------
                 Weddell seal  g---------------gggt---t---------ggc-cagtcc--gcc-c--t-----------------
             Black flying-fox  g---------------cgtc---a---------ggg-agg-----cct-t--c-----------------
                      Megabat  g---------------cgtc---a---------ggg-agg-----cct-t--c-----------------
                Big brown bat  g---------------gggc---a---------ggc-cagttt--ccc-c--t-----------------
                     Microbat  g---------------gggc---a---------ggg-cagttc--ccc-t--c-----------------
                     Hedgehog  g---------------acgcc--c---------ggc-cggcgc--ccc-t--c-----------------
              Star-nosed mole  g---------------acggcgtc---------ggc-cagtcc--tcc-c--a-----------------
                     Elephant  g---------------gg-----t---------gac-cattct--tcc-ccag-----------------
          Cape elephant shrew  a---------------ag-----t---------ga-----tct--tcc-ccag-----------------
                      Manatee  a---------------gg-----c---------gac-aagttt--tcc-cgag-----------------
             Cape golden mole  a---------------gggc---c---------gac-cagtct--ttc-ccag-----------------
                     Aardvark  a---------------gggc---c---------gac-cagtct--tgc-ccag-----------------
                    Armadillo  c---------------gcgc---c---------gac----------gc-cggg-----------------
                      Opossum  a---------------aaaccccc---------aaa-ctgtag--cca-c--------------------
                 Saker falcon  a---------------cagt---c---------cag-cat-----ccc-t--g-----------------
             Peregrine falcon  a---------------cagc---c---------cgg-cat-----ccc-t--g-ggaacatcccggcat-
       White-throated sparrow  c---------------gcgg---a---------ggg-cgg-----gtg-t--g-----------------
                  Zebra finch  c---------------aggg---a---------gga-caa-----gtc-t--g-----------------
                   Budgerigar  a---------------gagg---a---------gaa-cggcagc-gcc-c--g-----------------
                       Parrot  a---------------aagg---gaaaaacaacgag-cggtggctgct-g--g-----------------
                       Turkey  ----------------------------------------------------------------------
           American alligator  a---------------gggg---t---------ggg-ggg-----tcc-t--gccgggctaaccccccg-
                        Shrew  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
           Southern platyfish  ======================================================================
          Medium ground finch  ======================================================================
               Painted turtle  ======================================================================
          Collared flycatcher  ======================================================================
                      Wallaby  ======================================================================
              Tasmanian devil  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Platypus  ======================================================================
              Green seaturtle  ======================================================================
         David's myotis (bat)  ======================================================================
                       Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  a---aagagg----gcta------------------------------------------------ggg-
                        Chimp  a---aagagg----gctg------------------------------------------------ggg-
                      Gorilla  a---aagagg----gctg------------------------------------------------ggg-
                    Orangutan  a---aagagg----gctg------------------------------------------------ggg-
                       Rhesus  a---aagagg----gctg------------------------------------------------ggg-
          Crab-eating macaque  a---aagagg----gctg------------------------------------------------ggg-
                       Baboon  a---aagagg----gctg------------------------------------------------ggg-
                 Green monkey  a---aagagg----gctg------------------------------------------------ggg-
                     Marmoset  a---aagaag----gctg------------------------------------------------ggg-
              Squirrel monkey  a---aagaag----gctg------------------------------------------------ggg-
                     Bushbaby  a---actagg----gctg------------------------------------------------gga-
           Chinese tree shrew  gcacacaagg----actg------------------------------------------------tgg-
                     Squirrel  a---atgagc----actg------------------------------------------------gag-
       Lesser Egyptian jerboa  a---acgaac----acgg------------------------------------------------cag-
                 Prairie vole  a---acaggc----accg------------------------------------------------ggg-
              Chinese hamster  a---ccaggc----acag------------------------------------------------tgg-
               Golden hamster  g--cccaggc----acag------------------------------------------------tgg-
                        Mouse  a---gcaagc----gca-----------------------------------------------------
                          Rat  a---acaagc----gcgg------------------------------------------------ggg-
               Naked mole-rat  g---gcagga----gatc---gcaaacatgagttccgcctgggcaatctagcgaaacgctatctcaaaa-
                   Guinea pig  a---gcgggt----cggg------------------------------------------------gag-
                   Chinchilla  a---gcagag----gacg------------------------------------------------gcg-
             Brush-tailed rat  a---tcagaa----aacgaatggggatgt-agctcagtgcaaaggccctaggttga----acccccgag-
                       Rabbit  a---acgaaa----actg------------------------------------------------ggg-
                         Pika  a---atgaag----atcg------------------------------------------------ggg-
                          Pig  a---aggagg----acga------------------------------------------------agg-
                       Alpaca  a---acgagg----actg------------------------------------------------ggg-
               Bactrian camel  a---acgagg----actg------------------------------------------------ggg-
                      Dolphin  a---acgagg----actg------------------------------------------------ggg-
                 Killer whale  a---acgagg----actg------------------------------------------------ggg-
             Tibetan antelope  a---actagg----actg------------------------------------------------ggaa
                          Cow  a---actagg----actg------------------------------------------------gggc
                        Sheep  a---actagg----actg------------------------------------------------ggaa
                Domestic goat  a---actagg----actg------------------------------------------------ggaa
                        Horse  a---accagg----accg------------------------------------------------ggg-
             White rhinoceros  a---accacg----actg------------------------------------------------ggg-
                          Cat  a---acgggg----actg------------------------------------------------gga-
                          Dog  a---acgggg----actg------------------------------------------------ggg-
                      Ferret   a---acgggg----atta------------------------------------------------gag-
                        Panda  a---acgggg----acta------------------------------------------------gtg-
               Pacific walrus  a---acgggg----accg------------------------------------------------ggg-
                 Weddell seal  a---acgggg----acag------------------------------------------------ggg-
             Black flying-fox  a---aagggggaaaagta------------------------------------------------gag-
                      Megabat  a---aagggggaaaagta------------------------------------------------gag-
                Big brown bat  a---acgagg----cctg------------------------------------------------ggg-
                     Microbat  -----cgggg----accg------------------------------------------------ggg-
                     Hedgehog  g---acacag----cccg------------------------------------------------ggg-
              Star-nosed mole  g---acgtaa----gctg------------------------------------------------cgt-
                     Elephant  a---aggagg----cctg------------------------------------------------agg-
          Cape elephant shrew  g---agga-------ttg------------------------------------------------agg-
                      Manatee  g---acgagg----acta------------------------------------------------gag-
             Cape golden mole  a---ccaaga----acta------------------------------------------------gga-
                     Aardvark  g---acgagg----actg------------------------------------------------gga-
                    Armadillo  g---aggag-------------------------------------------------------------
                      Opossum  c---tcgaga----gctg----------------------------------------------------
                 Saker falcon  ----------------------------------------------------------------------
             Peregrine falcon  a---actggg----ggca------------------------------------------------gcc-
       White-throated sparrow  ------cggg----gacg------------------------------------------------cgg-
                  Zebra finch  g---actggg----ggtg------------------------------------------------gca-
                   Budgerigar  g---cccggc----cgct------------------------------------------------ccc-
                       Parrot  g---cccagc----caca------------------------------------------------tcc-
                       Turkey  ------cggg----ggtg------------------------------------------------gct-
           American alligator  t---ccttgc----agtg------------------------------------------------cct-
                        Shrew  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
           Southern platyfish  ======================================================================
          Medium ground finch  ======================================================================
               Painted turtle  ======================================================================
          Collared flycatcher  ======================================================================
                      Wallaby  ======================================================================
              Tasmanian devil  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Platypus  ======================================================================
              Green seaturtle  ======================================================================
         David's myotis (bat)  ======================================================================
                       Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ---------cgcatg-----------------------
                        Chimp  ---------cgcatg-----------------------
                      Gorilla  ---------cgcatg-----------------------
                    Orangutan  ---------cgcacg-----------------------
                       Rhesus  ---------cgcatg-----------------------
          Crab-eating macaque  ---------cgcatg-----------------------
                       Baboon  ---------cgcatg-----------------------
                 Green monkey  ---------cgcatg-----------------------
                     Marmoset  ---------ctccta-----------------------
              Squirrel monkey  ---------cgcctg-----------------------
                     Bushbaby  ---------ctcatg-----------------------
           Chinese tree shrew  ---------cgcacg-----------------------
                     Squirrel  ---------cgcacc-----------------------
       Lesser Egyptian jerboa  ---------cgtgcc-----------------------
                 Prairie vole  ---------agcgcg-----------------------
              Chinese hamster  ---------agcgca-----------------------
               Golden hamster  ---------aacgca-----------------------
                        Mouse  --------------g-----------------------
                          Rat  ---------agcgcg-----------------------
               Naked mole-rat  ---------taaaaa-----------------------
                   Guinea pig  ---------cgagaa-----------------------
                   Chinchilla  ---------catgaa-----------------------
             Brush-tailed rat  ---------tatgac-----------------------
                       Rabbit  ---------cgcacg-----------------------
                         Pika  ---------cacacg-----------------------
                          Pig  ---------cccaca-----------------------
                       Alpaca  ---------cgctcg-----------------------
               Bactrian camel  ---------cactcg-----------------------
                      Dolphin  ---------cacata-----------------------
                 Killer whale  ---------cacata-----------------------
             Tibetan antelope  gcctaacaacaacca-----------------------
                          Cow  ccccaacgacaacaa-----------------------
                        Sheep  gcccaacaacaacca-----------------------
                Domestic goat  gcccaacaacaacca-----------------------
                        Horse  ---------cgcacg-----------------------
             White rhinoceros  ---------cgcacg-----------------------
                          Cat  ---------cgcact-----------------------
                          Dog  ---------cgcaca-----------------------
                      Ferret   ---------tg--ca-----------------------
                        Panda  ---------tgccca-----------------------
               Pacific walrus  ---------cgcgca-----------------------
                 Weddell seal  ---------ggcgca-----------------------
             Black flying-fox  ---------ggagtg-----------------------
                      Megabat  ---------ggagtg-----------------------
                Big brown bat  ---------cgcacg-----------------------
                     Microbat  ---------cgcacg-----------------------
                     Hedgehog  ---------cgcacg-----------------------
              Star-nosed mole  ---------tgcttg-----------------------
                     Elephant  --------gcgcaca-----------------------
          Cape elephant shrew  --------gagcacg-----------------------
                      Manatee  --------gcgcacg-----------------------
             Cape golden mole  --------acacgca-----------------------
                     Aardvark  --------acgcacg-----------------------
                    Armadillo  --------------------------------------
                      Opossum  --------------------------------------
                 Saker falcon  -------------------------ggggca-------
             Peregrine falcon  -----------ca---gcatcccttggggca-------
       White-throated sparrow  ---------gacac--g--------cgcgcac------
                  Zebra finch  ---------gcca---g--------ggagtg-------
                   Budgerigar  --------------------------------------
                       Parrot  ---------gtca---g--------cgggtacgtgcga
                       Turkey  ---------gtcacctg--------aaagcagagccac
           American alligator  ---------gccccncc--------atggcc-------
                        Shrew  ======================================
     Mexican tetra (cavefish)  ======================================
           Southern platyfish  ======================================
          Medium ground finch  ======================================
               Painted turtle  ======================================
          Collared flycatcher  ======================================
                      Wallaby  ======================================
              Tasmanian devil  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Platypus  ======================================
              Green seaturtle  ======================================
         David's myotis (bat)  ======================================
                       Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Gibbon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 8 and 9 in window
B D                  Opossum 5bp

Alignment block 9 of 339 in window, 27212207 - 27212239, 33 bps 
B D                     Human  -------------------aagaccag--------c-gcag-a-g-ctcc---acgag------------
B D                     Chimp  -------------------aagaccag--------c-gcag-a-g-ctcc---acgag------------
B D                   Gorilla  -------------------aagaccag--------c-gcag-a-g-ctcc---acgag------------
B D                 Orangutan  -------------------aagaccag--------c-gcag-a-g-ctcc---acgag------------
B D                    Gibbon  -------------------aagatcag--------c-gcagaa-g-ctcc---acgag------------
B D                    Rhesus  -------------------aagaccag--------c-gcag-a-g-ctcc---gcgag------------
B D       Crab-eating macaque  -------------------aagaccag--------c-gcag-a-g-ctcc---gcgag------------
B D                    Baboon  -------------------aagaccag--------c-gcag-a-g-ctcc---gcgag------------
B D              Green monkey  -------------------aagaccag--------c-gcag-a-g-ctcc---gcaag------------
B D                  Marmoset  -------------------aagaccaa--------a-gctg-a-g-ctcc---ccgag------------
B D           Squirrel monkey  -------------------aagaccaa--------c-gctg-a-g-ctcc---ccgag------------
B D                  Bushbaby  -------------------gagatgaa--------c-acgg-acc-cccc---acggc------------
           Chinese tree shrew  -------------------aaaaccag--------t-gctg-a-t-ctca---acaag------------
B D                  Squirrel  -------------------gaaactag--------c-acgg-a-a-ctc---------------------
       Lesser Egyptian jerboa  -------------------aagacgag--------g-tctg-a-c-ctcc---gcata------------
                 Prairie vole  -------------------gacatgag--------c-ccag-a-a-gaca---gggag------------
B D           Chinese hamster  -------------------gacatgat--------c-ccag-g-a-gtcg---gcgag------------
               Golden hamster  -------------------gacatgag--------c-ccag-g-g-ttcc---gcgag------------
B D                     Mouse  -------------------gacaggag--------c-tcag-a-a-ttcc---gcgag------------
B D                       Rat  -------------------gacaaggg--------c-ccag-a-a-ttcc---gcgag------------
B D            Naked mole-rat  -------------------aggaatggggaggtagc-tcag-t---gcaaagtccgta------------
B D                Guinea pig  -------------------gacggacg--------c-tctc-c-gcgcca---gctta------------
                   Chinchilla  -------------------gacgagag--------c-taac-t-g-gcga---gcgt-------------
             Brush-tailed rat  -------------------aaaaagaggacggagtc-caga-g-a-gcaatgtgcgtgtccattccgaaa
B D                    Rabbit  -------------------gaaacgcg-----------cgg-t-a-cccc---acgca------------
B D                      Pika  -------------------gacgcgag----------ccgc-t-g-ccct---acgca------------
B D                       Pig  -------------------aagaagag--------c-gctg-g-c-ctcc---gcgcg------------
B D                    Alpaca  -------------------gagaagag--------c-gctg-a-c-ctcc---gcaag------------
               Bactrian camel  -------------------gagaagag--------c-gctg-a-c-ctcc---gcaag------------
B D                   Dolphin  -------------------gagaagag--------c-gctg-a-c-ctcc---gcgac------------
                 Killer whale  -------------------gagaagag--------c-gctg-a-c-ctcc---gcgac------------
             Tibetan antelope  -------------------aaaaaatg--------c-gctg-a-c-ctcc---acgac------------
B D                       Cow  -------------------aaaaaatg--------c-gctg-a-c-cccc---acgac------------
B D                     Sheep  -------------------aaaaaatg--------c-gctg-a-c-ctcc---acgac------------
                Domestic goat  -------------------aaaaaatg--------c-gctg-a-c-ctcc---acgac------------
B D                     Horse  -------------------gagaagag--------c-gctg-a-c-ctct---gccag------------
B D          White rhinoceros  -------------------gagaagaa--------c-gctg-a-c-ctcc---cgcag------------
B D                       Cat  -------------------gaaaagag--------c-tctg-a-c-ctcc---tcaac------------
B D                       Dog  -------------------gagaagag--------c-tctg-a-c-c------tcaag------------
B D                   Ferret   -------------------gagaagag--------c-tctg-a-c-ctct---tcaag------------
B D                     Panda  -------------------aaaaagag--------c-tctg-a-c-ctcc---tcaag------------
               Pacific walrus  -------------------gagaaaag--------c-tctg-a-c-ctcc---tcgag------------
                 Weddell seal  -------------------gagaagag--------c-tcta-a-c-ctcc---tcgag------------
             Black flying-fox  -------------------gaagagga--------gcgctg-a-c-ctcc---gcgag------------
B D                   Megabat  -------------------gaagagga--------gcgctg-a-c-ctcc---gcgag------------
                Big brown bat  -------------------gaggagaa--------a-gtgg-a-c-cccg---gcagg------------
B D                  Microbat  -------------------cagaagga--------a-gttg-a-c-ctcg---gcggg------------
B D                  Hedgehog  -------------------gaggagag--------c-gcc------------------------------
              Star-nosed mole  -------------------gtagggag--------c-gccg-a-c-ctcc---gcgag------------
B D                  Elephant  -------------------gagaagag--------t-gctg-a-c-ctcg---gccag------------
          Cape elephant shrew  -------------------cagtaaag--------c-gcag-a-c-c-----------------------
B D                   Manatee  -------------------gagaagaa--------t-gctg-c-c-cctg---gccag------------
             Cape golden mole  -------------------gagaaaag--------c-gcag-a-c-ctag---acctg------------
                     Aardvark  -------------------gagaagct--------a-gcga-g-c-ttcc---tccgg------------
B D                 Armadillo  ----------------------------------------------------------------------
B D                   Opossum  -------------------gggaaggg--------c-tcct-t-c-gcca---gcaaa------------
  D              Saker falcon  -----gcccagcacccatgggggc----------------------------------------------
  D          Peregrine falcon  -----gcccagcacccactgggac----------------------------------------------
  D    White-throated sparrow  -----acgcagtgc-----ggggccg--------------------------------------------
B D               Zebra finch  -----gcacagtgc------ccacca--------------------------------------------
B D                Budgerigar  -----gagcgctcc----ggggaccg--------------------------------------------
  D                    Parrot  tgc-tgcacggcac----agggacca--------------------------------------------
B D                    Turkey  tatgtgcacagggctgggagggaaca--------------------------------------------
B D        American alligator  -----ccactgggc----gaagaca---------------------------------------------
B D                     Shrew  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
          Southern platyfish  ======================================================================
B D       Medium ground finch  ======================================================================
  D            Painted turtle  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Platypus  ======================================================================
  D           Green seaturtle  ======================================================================
        David's myotis (bat)  ======================================================================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                 Green monkey  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  ----------------------------------------------------------------------
              Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
                        Mouse  ----------------------------------------------------------------------
                          Rat  ----------------------------------------------------------------------
               Naked mole-rat  --ggttcaacccccagtgtcgcaaagagaaggaggagtccataaggcaatgtgcgtgtccattccgatag
                   Guinea pig  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  gcggaggaaggcgca----cggaaagaacctctgctagtt------------------------------
                       Rabbit  ----------------------------------------------------------------------
                         Pika  ----------------------------------------------------------------------
                          Pig  ----------------------------------------------------------------------
                       Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
                      Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
                          Cow  ----------------------------------------------------------------------
                        Sheep  ----------------------------------------------------------------------
                Domestic goat  ----------------------------------------------------------------------
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                          Cat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
                        Panda  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ----------------------------------------------------------------------
                     Hedgehog  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
          Cape elephant shrew  ----------------------------------------------------------------------
                      Manatee  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
                    Armadillo  ----------------------------------------------------------------------
                      Opossum  ----------------------------------------------------------------------
                 Saker falcon  ----------------------------------------------------------------------
             Peregrine falcon  ----------------------------------------------------------------------
       White-throated sparrow  ----------------------------------------------------------------------
                  Zebra finch  ----------------------------------------------------------------------
                   Budgerigar  ----------------------------------------------------------------------
                       Parrot  ----------------------------------------------------------------------
                       Turkey  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------
                        Shrew  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
           Southern platyfish  ======================================================================
          Medium ground finch  ======================================================================
               Painted turtle  ======================================================================
          Collared flycatcher  ======================================================================
                      Wallaby  ======================================================================
              Tasmanian devil  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Platypus  ======================================================================
              Green seaturtle  ======================================================================
         David's myotis (bat)  ======================================================================
                       Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  -------------------cag-gaaaag
                        Chimp  -------------------cag-gaaaag
                      Gorilla  -------------------cag-gaaaag
                    Orangutan  -------------------cag-gacaaa
                       Gibbon  -------------------cag-gaaaa-
                       Rhesus  -------------------cag-gagaaa
          Crab-eating macaque  -------------------cag-gagaaa
                       Baboon  -------------------cag-gagaaa
                 Green monkey  -------------------cag-gagaaa
                     Marmoset  -------------------cag-gagcag
              Squirrel monkey  -------------------cag-gagcag
                     Bushbaby  -------------------cag-caacta
           Chinese tree shrew  -------------------cag-cagcgg
                     Squirrel  -----------------------------
       Lesser Egyptian jerboa  -------------------cag-ctgcaa
                 Prairie vole  -------------------cac-cagccg
              Chinese hamster  -------------------cag-cagcgg
               Golden hamster  -------------------ctg-cagccg
                        Mouse  -------------------cag-cccgaa
                          Rat  -------------------cag-cccgag
               Naked mole-rat  cggacctccgggagctgtggag-gtccag
                   Guinea pig  -------------------gag-gtccag
                   Chinchilla  -------------------gag-gtccag
             Brush-tailed rat  ------------------tgag-gtccgg
                       Rabbit  -----------------------------
                         Pika  -----------------------------
                          Pig  -------------------cta-cggcaa
                       Alpaca  -------------------ccg-caaagc
               Bactrian camel  -------------------ccg-caacga
                      Dolphin  -------------------tag-cagcga
                 Killer whale  -------------------tag-cagcgt
             Tibetan antelope  -------------------tag-cggtaa
                          Cow  -------------------taa-aggtaa
                        Sheep  -------------------tag-cggcaa
                Domestic goat  -------------------tag-cggtaa
                        Horse  -------------------cag-caccaa
             White rhinoceros  -------------------caa-caggaa
                          Cat  -------------------ccg-cagcaa
                          Dog  -------------------cag-cagtaa
                      Ferret   -------------------cag-cggcaa
                        Panda  -------------------cgg-cggcaa
               Pacific walrus  -------------------cag-ccgcaa
                 Weddell seal  -------------------cag-ccgcaa
             Black flying-fox  -------------------ctg-ccccta
                      Megabat  -------------------ctg-ccccta
                Big brown bat  -------------------cag-cggcac
                     Microbat  -------------------cag-cag---
                     Hedgehog  -----------------------------
              Star-nosed mole  -------------------ctg-cggcgg
                     Elephant  -------------------cag-cagacg
          Cape elephant shrew  -------------------------aaca
                      Manatee  -------------------cag-caagca
             Cape golden mole  -------------------cag-tgggag
                     Aardvark  -------------------ctgttaagag
                    Armadillo  -----------------------aaggcg
                      Opossum  -------------------gaa-agagca
                 Saker falcon  -----------------------------
             Peregrine falcon  -----------------------------
       White-throated sparrow  -----------------------------
                  Zebra finch  -----------------------------
                   Budgerigar  -----------------------------
                       Parrot  -----------------------------
                       Turkey  -----------------------------
           American alligator  -----------------------------
                        Shrew  =============================
     Mexican tetra (cavefish)  =============================
           Southern platyfish  =============================
          Medium ground finch  =============================
               Painted turtle  =============================
          Collared flycatcher  =============================
                      Wallaby  =============================
              Tasmanian devil  NNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Platypus  =============================
              Green seaturtle  =============================
         David's myotis (bat)  =============================
                       Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 9 and 10 in window
  D             Saker falcon 22bp
  D         Peregrine falcon 62bp
  D   White-throated sparrow 29bp
B D              Zebra finch 42bp
B D               Budgerigar 25bp
  D                   Parrot 32bp

Alignment block 10 of 339 in window, 27212240 - 27212263, 24 bps 
B D                     Human  c-----ccc---caag------------------ca----------------g--------------cc-
B D                     Chimp  c-----cgc---caag------------------ca----------------g--------------cc-
B D                   Gorilla  c-----ccc---caag------------------ca----------------g--------------cc-
B D                 Orangutan  c-----ccc---caag------------------ca----------------g--------------cc-
B D                    Gibbon  c-----ccc---caag------------------ca----------------g--------------cc-
B D                    Rhesus  c-----ccc---cagc------------------ca----------------g--------------cc-
B D       Crab-eating macaque  c-----ccc---cagc------------------ca----------------g--------------cc-
B D                    Baboon  c-----ccc---cagc------------------ca----------------g--------------cc-
B D              Green monkey  c-----ccc---cagc------------------ca----------------g--------------cc-
B D                  Marmoset  c-----ccc---cacc------------------ca----------------g--------------cc-
B D           Squirrel monkey  c-----ccc---caac------------------cc----------------g--------------cc-
B D                  Bushbaby  c-----tca---cagc------------------ca-------------------------------cc-
           Chinese tree shrew  c-----tcc---caca------------------cg----------------------------------
B D                  Squirrel  --------g---taga------------------ga---tgtc------c--g--------------cc-
       Lesser Egyptian jerboa  a-----ccg---cgaagggacgcgtcgccacgaccg---tgtttagccac--g--------------cc-
                 Prairie vole  c-----gct---ctgg------------------ca---aaccctgccac--g--------------cc-
B D           Chinese hamster  c-----gct---ctgg------------------ca---gattaggccac--g--------------cc-
               Golden hamster  c-----gcg---cggg------------------ca---ggttaggccac--g--------------cc-
B D                     Mouse  c-----ctg---cggg------------------ca---aattacgcctcggg--------------ct-
B D                       Rat  c-----cct---ccgg------------------ca---catcacgcggc--g--------------ct-
B D            Naked mole-rat  a-----------cgaa------------------cgtccgatgaagcaac--a--------------cc-
B D                Guinea pig  a-----g-t---tggg------------------cg---ggttaaactac--g--------------cc-
                   Chinchilla  a-----t-t---tgag------------------cg---cattgaagcat--a--------------cc-
             Brush-tailed rat  a-----t-t---tggg------------------cg---gattaaaccag--g--------------ct-
B D                    Rabbit  --------a---ccag------------------ca---g--caactcac--a--------------gc-
B D                      Pika  --------a---gaga------------------ca---g--caacccgc--c--------------gt-
B D                       Pig  c-----ccc---cagc------------------c-----------------------------------
B D                    Alpaca  c-----cct---cagc------------------ct----------------g--------------ct-
               Bactrian camel  c-----cct---cagc------------------ct----------------g--------------ct-
B D                   Dolphin  c-----cccagggagc------------------cc----------------t--------------cc-
                 Killer whale  c-----ccc---tagc------------------cc----------------t--------------cc-
             Tibetan antelope  c-----ccc---cggc------------------cc----------------t--------------cc-
B D                       Cow  ------ccc---cagc------------------cc----------------t--------------cc-
B D                     Sheep  c-----ccc---cagc------------------gc----------------t--------------cc-
                Domestic goat  c-----ccc---cagc------------------cc----------------t--------------cc-
B D                     Horse  c-----cca---cagc------------------cc----------------g--------------cc-
B D          White rhinoceros  c-----ccc---acgc------------------cc----------------g--------------tc-
B D                       Cat  t----cccc---cagc------------------cc----------------g--------------ct-
B D                       Dog  g-----ccc---cagc------------------cc----------------g--------------tg-
B D                   Ferret   g-----ccc---caac------------------ca----------------g--------------tg-
B D                     Panda  g-----ccc---tagc------------------cc----------------a--------------tg-
               Pacific walrus  g-----tcc---cagc------------------cc----------------g--------------tg-
                 Weddell seal  g-----ccc---cagc------------------cc----------------g--------------ta-
             Black flying-fox  c-----ccc---cagc------------------cc----------------g--------------cc-
B D                   Megabat  c-----ccc---cagc------------------cc----------------g--------------cc-
                Big brown bat  c-----ccc---tagt------------------cc----------------a---------------g-
B D                  Microbat  c-----ccc---tagt------------------cc----------------a---------------g-
B D                  Hedgehog  -------cc---caac------------------cc----------------g--------------cct
              Star-nosed mole  cgcccggcc---cggc------------------cc----------------g--------------cc-
B D                  Elephant  g-----ccc---cagc------------------cc----------------g--------------cc-
          Cape elephant shrew  c-----tac---cttc------------------ct----------------g-----------------
B D                   Manatee  g-----ccc---cagc------------------cc----------------g--------------cc-
             Cape golden mole  c-----ccct--ccac------------------cc----------------g--------------cc-
                     Aardvark  t-----ccc---cagc------------------cc----------------t--------------ct-
B D                 Armadillo  c-----ccc---gcgc------------------cg----------------------------------
B D                   Opossum  t-----ctc---ccaa------------------ag----------------c--------------cc-
  D              Saker falcon  -------------------------------------------------------------------cc-
  D          Peregrine falcon  -------------------------------------------------------------------cc-
  D    White-throated sparrow  -------------------------------------------------------------------ct-
B D               Zebra finch  -------------------------------------------------------------------ct-
B D                Budgerigar  -------------------------------------------------------------------ca-
  D                    Parrot  -------------------------------------------------------------------ca-
B D        American alligator  -----------------------------------------------------cccccctgatggggca-
B D                     Shrew  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
          Southern platyfish  ======================================================================
B D       Medium ground finch  ======================================================================
  D            Painted turtle  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Platypus  ======================================================================
  D           Green seaturtle  ======================================================================
        David's myotis (bat)  ======================================================================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ---cc-----a-----------------------gggcgact--------------
                        Chimp  ---cc-----a-----------------------ggccgact--------------
                      Gorilla  ---cc-----a-----------------------gggcgact--------------
                    Orangutan  ---cc-----a-----------------------gggcgact--------------
                       Gibbon  ---cc-----a-----------------------cggcgact--------------
                       Rhesus  ---cc-----a-----------------------gggctaat--------------
          Crab-eating macaque  ---cc-----a-----------------------gggcgaat--------------
                       Baboon  ---cc-----a-----------------------gggcgaat--------------
                 Green monkey  ---cc-----a-----------------------gggcgact--------------
                     Marmoset  ---cc-----a-----------------------gggctact--------------
              Squirrel monkey  ---cc-----a-----------------------gggcgact--------------
                     Bushbaby  ---cc-----c-----------------------ggacaact--------------
           Chinese tree shrew  ---tc-----a-----------------------agccaacc--------------
                     Squirrel  ---cc-----tcggcgacctgacccgtccgact-aagccacg--------------
       Lesser Egyptian jerboa  ---cccgcccccagcgaatgcatcaggtcgact-aggccacg--------------
                 Prairie vole  ---cc-----agggcggcagccgaggactgatt-aggccacg--------------
              Chinese hamster  ---cc-----gcggcgccggccgaagaccgatt-aggccacg--------------
               Golden hamster  ---cc-------------------agatc---------------------------
                        Mouse  ---cc-----acggctcgtgccc-----cgggc-ggaccagg--------------
                          Rat  ---cg-----agagcgcatgcatgggggcgggcaaggccacg--------------
               Naked mole-rat  ---ct-----g-----------------------aggtgac---------------
                   Guinea pig  ---ct-----g-----------------------aggtgac---------------
                   Chinchilla  ---ct-----g-----------------------agatgac---------------
             Brush-tailed rat  ---tt-----g-----------------------aggtcac---------------
                       Rabbit  ---cc-----gccc--------------------cggccgc---------------
                         Pika  ---cc-----gtc-------------------------------------------
                          Pig  ----------------------------------ggcggac---------------
                       Alpaca  ---cc-----g-----------------------ggagcac---------------
               Bactrian camel  ---ct-----g-----------------------ggagcat---------------
                      Dolphin  ---cc-----g-----------------------gaccgac---------------
                 Killer whale  ---cc-----g-----------------------gaccgac---------------
             Tibetan antelope  ---ca-----g-----------------------caccgac---------------
                          Cow  ---ca-----g-----------------------caccgac---------------
                        Sheep  ---tg-----g-----------------------caccgac---------------
                Domestic goat  ---tg-----g-----------------------caccgac---------------
                        Horse  ---cc-----g-----------------------ggccacc---------------
             White rhinoceros  ---cc-----g-----------------------ggccatc---------------
                          Cat  ---tc-----g-----------------------ggcc------------------
                          Dog  ---cg-----g-----------------------ggc-------------------
                      Ferret   ---cg-----g-----------------------ggc-------------------
                        Panda  ---cc-----g-----------------------ggc-------------------
               Pacific walrus  ---ct-----g-----------------------ggg-------------------
                 Weddell seal  ---cc-----g-----------------------ggc-------------------
             Black flying-fox  ---cc-----a-----------------------ggcctac---------------
                      Megabat  ---cc-----a-----------------------ggccaac---------------
                Big brown bat  ---cc-----g-----------------------ggccaac---------------
                     Microbat  ---cc-----g-----------------------ggccaac---------------
                     Hedgehog  tgacc-----g-----------------------ggc-------------------
              Star-nosed mole  ---cc-----g-----------------------ggc-------------------
                     Elephant  ---ca-----a-----------------------tg--------------------
          Cape elephant shrew  --------------------------------------------------------
                      Manatee  ---cc-----g-----------------------gg--------------------
             Cape golden mole  ---ca-----g---------------------------------------------
                     Aardvark  ---aa-----g---------------------------------------------
                    Armadillo  --------------------------------------------------------
                      Opossum  ---tc-----g-----------------------ggattccc--------------
                 Saker falcon  ---ca-----g-----------------------cacccactgg--------gaca
             Peregrine falcon  ---ca-----g-----------------------cacccactgg--------gaca
       White-throated sparrow  ---cg-----g-----------------------cggc------------------
                  Zebra finch  ---tg-----g-----------------------cggcattaggctg-----agcc
                   Budgerigar  ---cg-----g-----------------------aggcaccagccggg----agca
                       Parrot  ---ca-----a-----------------------cagcaccggc--------agca
           American alligator  ---ct-----g-----------------------ctccagcagcctgtcctccacc
                        Shrew  ========================================================
     Mexican tetra (cavefish)  ========================================================
           Southern platyfish  ========================================================
          Medium ground finch  ========================================================
               Painted turtle  ========================================================
          Collared flycatcher  ========================================================
                      Wallaby  ========================================================
              Tasmanian devil  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Platypus  ========================================================
              Green seaturtle  ========================================================
         David's myotis (bat)  ========================================================
                       Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 10 and 11 in window
B D                 Squirrel 13bp
      Lesser Egyptian jerboa 13bp
                Prairie vole 13bp
B D          Chinese hamster 13bp
              Golden hamster 4bp
B D                    Mouse 10bp
B D                      Rat 13bp
B D                   Rabbit 2bp
B D                  Opossum 16bp

Alignment block 11 of 339 in window, 27212264 - 27212284, 21 bps 
B D                     Human  gga-------ccggg-c-------------------------cgctta----ggc--------c---ac
B D                     Chimp  gga-------ccggg-c-------------------------cgctta----ggc--------c---ac
B D                   Gorilla  gga-------ctggg-c-------------------------cgctta----ggc--------c---ac
B D                 Orangutan  gga-------ccagg-c-------------------------cgctta----ggc--------c---ac
B D                    Gibbon  gga-------ccgggcc-------------------------cgctta----ggc--------c---ac
B D                    Rhesus  gga-------ccggg-t-------------------------cgctta----ggc--------c---ac
B D       Crab-eating macaque  gga-------ccggg-t-------------------------cgctta----ggc--------c---ac
B D                    Baboon  gga-------ccggg-t-------------------------cgctta----ggc--------c---ac
B D              Green monkey  gga-------ccggg-t-------------------------cgctta----ggc--------c---ac
B D                  Marmoset  aaa-------cccgg-c-------------------------cgttta----ggc--------c---ac
B D           Squirrel monkey  gga-------cccgg-c-------------------------cgttta----ggc--------c---ac
B D                  Bushbaby  aga-------cccgg-a-------------------------cgccta----ggc--------c---ac
           Chinese tree shrew  gac-------cccgg-c-------------------------ggcgga----ggc--------c---ac
B D                  Squirrel  gca-------ctaga-a-------------------------gggtta----gat--------c---ac
       Lesser Egyptian jerboa  gga-------cctgg-a-------------------------cggacaatccggc--------c---cc
                 Prairie vole  ggc-------tttgc-a-------------------------aaatta----ggc--------c---cc
B D           Chinese hamster  gga-------tttgg-g-------------------------agacta----ggt--------c---cc
               Golden hamster  gga-------ttcgg-g-------------------------agacta----ggc--------c---cc
B D                     Mouse  gagtgacaggatttg-g-------------------------aagcta----agc--------c---tc
B D                       Rat  ggg-------atttg-g-------------------------gagcta----aac--------c---ac
B D            Naked mole-rat  agc-------gccgg-g-------------------------ccgata----ggc--------c---ac
B D                Guinea pig  agc-------gccgg-g-------------------------ccgata----ggc--------c---ac
                   Chinchilla  agc-------cc-ag-a-------------------------ccctta----ggc--------c---ac
             Brush-tailed rat  agc-------acgag-g-------------------------ccctta----ggc--------c---ac
B D                    Rabbit  gga-------gccgg-c-------------------------cgacta----agc--------c---ac
B D                      Pika  -----------ccgg-c-------------------------cgagta----ggc--------c---ac
B D                       Pig  tgg-------ccggg-ccgacggaccgctc-------------aacta----g-c--------c---ac
B D                    Alpaca  tgg-------ccttg-cggagtagcggggct--------ggaggacta----ggc--------c---cc
               Bactrian camel  tgg-------ccatg-cggagtagcggggct--------ggaggacta----gac--------c---cc
B D                   Dolphin  ggg-------cccaa-cggactagcctggc------------agacta----ggc--------c---ac
                 Killer whale  ggg-------cccaa-cggactagcctggc------------agacta----ggc--------c---ac
             Tibetan antelope  cgg-------cccgc-ccggc-----aggc------------gggcca----ggc--------c---ac
B D                       Cow  caa-------cccac-ctgactagcggggc------------gggcca----ggc--------c---ac
B D                     Sheep  cgg-------cccac-ctgactagccgggc------------gggcca----ggc--------c---ac
                Domestic goat  cgg-------cccac-ccgactagccgggc------------gggcca----gac--------c---ac
B D                     Horse  c-------------c-c-------------------------gggcga----ggg--------cgtgac
B D          White rhinoceros  c-------------c-c-------------------------ggggga----ggg--------cgtgac
B D                       Cat  -------------------------------------------gactg----ggc--------c---ac
B D                       Dog  --------------------------------------------acta----ggc--------c---ac
B D                   Ferret   -------------------------------------------gacta----gac--------c---ac
B D                     Panda  -------------------------------------------gacta----ggc--------c---ac
               Pacific walrus  -------------------------------------------gacta----ggc--------c---ac
                 Weddell seal  -------------------------------------------gacta----ggc--------c---ac
             Black flying-fox  tgg-------ccctc-a-------------------------gcgcta----ctc--------c---ac
B D                   Megabat  tgg-------ccctc-a-------------------------gcgcta----ctc--------c---ac
                Big brown bat  cgg-------ccggc-a-------------------------accccctagtccc--------c---gc
B D                  Microbat  cag-------ccggc---------------------------accccctagtccc--------c---gc
B D                  Hedgehog  ------------------------------------------cgcc-t----ggc--------c---ac
              Star-nosed mole  ------------------------------------------cgacgg----ggc--------c---ac
B D                  Elephant  cga-------------c-------------------------tggacc----ggccggctcgac---ac
          Cape elephant shrew  -gg-------------c-------------------------tgaccc----agt--------c---ac
B D                   Manatee  cga-------------c-------------------------tggatc----ggcaggctcggc---cc
             Cape golden mole  -gg-------------c-------------------------tgattc----ggt--------c---ac
                     Aardvark  -gg-------------c-------------------------cgtcta----ggc--------t---ac
B D                 Armadillo  -gc-------------c-------------------------tcgcct----cgc--------c---gc
B D                   Opossum  gga-------tacta-t-------------------------tcaaaa----gac--------c---gg
B D                  Platypus  ------------------------------------------ggaccg----gac--------c---at
  D              Saker falcon  ---------------------gcccgatacccac-----cctactttg----ctt--------c---cc
  D          Peregrine falcon  ---------------------gcccgatacccac-----cctactttg----ctt--------c---cc
  D    White-throated sparrow  -------------------------------------------tccgg----cgc--------t---cc
B D               Zebra finch  -----------------------------cc-----------tcctgg----cac--------c---cc
B D                Budgerigar  ---------------------gccgcagacc--------ggttatctc----cat--------c---cc
  D                    Parrot  ----------------------caatgggcctg------ggttgatgg----ggc--------c---ac
B D        American alligator  ---------------------gaggcgggcatgctgcaggtgcacctg----tac--------c---ac
B D                     Shrew  =====================================================================
    Mexican tetra (cavefish)  =====================================================================
          Southern platyfish  =====================================================================
B D       Medium ground finch  =====================================================================
  D            Painted turtle  =====================================================================
  D       Collared flycatcher  =====================================================================
B D                   Wallaby  =====================================================================
B D           Tasmanian devil  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D           Green seaturtle  =====================================================================
        David's myotis (bat)  =====================================================================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 11 and 12 in window
B D       American alligator 140bp

Alignment block 12 of 339 in window, 27212285 - 27212313, 29 bps 
B D                     Human  g--ccc---g----------------g-gga-----------------------a-gagggcctgacgcg
B D                     Chimp  g--ccc---g----------------g-gga-----------------------a-gagggcctgacgcg
B D                   Gorilla  g--ccc---g----------------g-gga-----------------------a-gagggcctgacgcg
B D                 Orangutan  g--ccc---g----------------g-gga-----------------------a-gagggcctgacgcg
B D                    Gibbon  g--ccc---g----------------g-gga-----------------------a-gagggcctgacgcg
B D                    Rhesus  g--ccc---g----------------g-gga-----------------------a-gagggcctgacgcg
B D       Crab-eating macaque  g--ccc---g----------------g-gga-----------------------a-gagggcctgacgcg
B D                    Baboon  g--ccc---g----------------a-gga-----------------------a-gagggcctgacgcg
B D              Green monkey  g--ccc---g----------------g-gga-----------------------a-gagggcctgacgcg
B D                  Marmoset  g--ccc---g----------------g-cga-----------------------a-gggggcctgacgcg
B D           Squirrel monkey  g--ccc---g----------------g-gga-----------------------a-gggggcctgacgcg
B D                  Bushbaby  g--ccc-------------------------------------------------------cctcgcgca
           Chinese tree shrew  a--ccc---c----------------c-ggg-----------------------c-gggggcgtgac-tg
B D                  Squirrel  gcacct---t----------------t-a---------------------------gagggcgtggcgct
       Lesser Egyptian jerboa  g--ccc---c----------------g-acg-----------------------c-gaaggcgtcacgcg
                 Prairie vole  a--ccc---c----------------a-agg-----------------------c-tgaggcgtgatgcg
B D           Chinese hamster  g--cct---c----------------g-a---------------------------------gtgacgcg
               Golden hamster  g--cct---c----------------a-a---------------------------------gcgacgcg
B D                     Mouse  g--cct---c----------------a-agg-----------------------c-tggcgcgtgacacg
B D                       Rat  g--cct---c----------------a-agg-----------------------c-ggaggcgtgacacg
B D            Naked mole-rat  g---cc---c----------------a-cga-----------------------cgtaggacgtgatgcg
B D                Guinea pig  g--ccc---c----------------a-gga-----------------------cgcagggcgtgacgcg
                   Chinchilla  g--ccc---c----------------a-gga-----------------------cgccggccgtgacgcg
             Brush-tailed rat  g---cc---c----------------a-cga-----------------------cgtgaggcctgacgcg
B D                    Rabbit  g--ccc---c----------------g-ggg---------------------------------------
B D                      Pika  g--ccc---c----------------g-ggg---------------------gac-gcgagcgtgaggcg
B D                       Pig  a--ccc---c----------------cggga---agggccagaggcggtggg------------------
B D                    Alpaca  g--ccc---g----------------g-gcg---agggcgctacagggtagg------------------
               Bactrian camel  g--ccc---g----------------g-gcg---aaggcgctacagggtagg------------------
B D                   Dolphin  g--ccc---c----------------g-gcg---agggcgtgacacggtggg------------------
                 Killer whale  g--ccc---c----------------g-gcg---agggcgtgacacggtggg------------------
             Tibetan antelope  g--ccc---c----------------gcaca---ggagcgtgacacggtggg------------------
B D                       Cow  g--ccc---c----------------gcacg---ggggcgtgacacggtggg------------------
B D                     Sheep  g--ccc---c----------------gcaca---ggggcgtgacacggtggg------------------
                Domestic goat  g--ccc---c----------------gcaca---ggggcgtgacacggtggg------------------
B D                     Horse  g--cac--------------------g-ggg---------------------------------------
B D          White rhinoceros  g--caccggg----------------g-ggg---------------------------------------
B D                       Cat  a--ccc---g----------------c-gga---------------------------------------
B D                       Dog  g--ccc---g----------------g-gga---------------------------------------
B D                   Ferret   g--ccc---g----------------g-gga---------------------------------------
B D                     Panda  g--ccc---g----------------g-tga---------------------------------------
               Pacific walrus  g--ccc---t----------------g-gca---------------------------------------
                 Weddell seal  g--ccc---t----------------g-gca---------------------------------------
             Black flying-fox  c--ccc---c----------------g-ggagtg------------------------------------
B D                   Megabat  t--ccc---c----------------g-ggagtg------------------------------------
                Big brown bat  c--ccc---c----------------g-g-----------------------------------------
B D                  Microbat  c--ccc---c----------------g-g-----------------------------------------
B D                  Hedgehog  g--ccc---c---cggcgagggc---g-gg----------------------------------------
              Star-nosed mole  g--ccc---cgaggggcggggccccgg-ag----------------------------------------
B D                  Elephant  g--ccc---c----------------t-ggg-----------------------a-gagggcgagacgca
          Cape elephant shrew  g--ccc---c----------------c-gag-----------------------c-gtgggcgtgacgca
B D                   Manatee  g--ccc---c----------------g-ggg-----------------------t-gagggcgtgacgcg
             Cape golden mole  g--ccc---c------------------------------------------------------------
                     Aardvark  g--ccc---c----------------c-agg-----------------------c-gagga-gtgacgct
B D                 Armadillo  c--tcc---c----------------g-gga-----------------------c-gtggtcctgacgcg
B D                   Opossum  a--tag---g----------------a-gag---------------------------------------
B D                  Platypus  tttctc---c----------------g-ggg-------------------------ggggggaagtctcg
  D              Saker falcon  ----------------------------------------------------------catcgccgg---
  D          Peregrine falcon  ----------------------------------------------------------catcgccgg---
  D    White-throated sparrow  ----------------------------------------------------------cggtggagt---
B D               Zebra finch  ----------------------------------------------------------tggcacagc---
B D                Budgerigar  ----------------------------------------------------------aacccgaaccaa
  D                    Parrot  ----------------------------------------------------------taccggggtgaa
B D                     Shrew  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
          Southern platyfish  ======================================================================
B D       Medium ground finch  ======================================================================
  D            Painted turtle  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D           Green seaturtle  ======================================================================
        David's myotis (bat)  ======================================================================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ctg----cg-------------------------------
                        Chimp  ctg----cg-------------------------------
                      Gorilla  ctg----cg-------------------------------
                    Orangutan  ctg----cg-------------------------------
                       Gibbon  ctg----cg-------------------------------
                       Rhesus  ctg----cg-------------------------------
          Crab-eating macaque  ctg----cg-------------------------------
                       Baboon  ctg----cg-------------------------------
                 Green monkey  ctg----cg-------------------------------
                     Marmoset  ccg----tg-------------------------------
              Squirrel monkey  ccg----tg-------------------------------
                     Bushbaby  cca----gt-------------------------------
           Chinese tree shrew  cca----gg-------------------------------
                     Squirrel  ccg-----g-------------------------------
       Lesser Egyptian jerboa  ----------------------------------------
                 Prairie vole  -cg-----g-------------------------------
              Chinese hamster  -tg-----g-------------------------------
               Golden hamster  -tg-----g-------------------------------
                        Mouse  ctg-----g-------------------------------
                          Rat  ctg-----g-------------------------------
               Naked mole-rat  tc------g-------------------------------
                   Guinea pig  tcg-----g-------------------------------
                   Chinchilla  tcg-----g-------------------------------
             Brush-tailed rat  tcg-----g-------------------------------
                       Rabbit  -cg-----g-------------------------------
                         Pika  ctg-----t-------------------------------
                          Pig  ----------------------------------------
                       Alpaca  ----------------------------------------
               Bactrian camel  ----------------------------------------
                      Dolphin  ----------------------------------------
                 Killer whale  ----------------------------------------
             Tibetan antelope  ----------------------------------------
                          Cow  ----------------------------------------
                        Sheep  ----------------------------------------
                Domestic goat  ----------------------------------------
                        Horse  ----------------------------------------
             White rhinoceros  ----------------------------------------
                          Cat  ----------------------------------------
                          Dog  ----------------------------------------
                      Ferret   ----------------------------------------
                        Panda  ----------------------------------------
               Pacific walrus  ----------------------------------------
                 Weddell seal  ----------------------------------------
             Black flying-fox  ----------------------------------------
                      Megabat  ----------------------------------------
                Big brown bat  ----------------------------------------
                     Microbat  ----------------------------------------
                     Hedgehog  ----------------------------------------
              Star-nosed mole  ----------------------------------------
                     Elephant  cc--------------------------------------
          Cape elephant shrew  cg--------------------------------------
                      Manatee  ct--------------------------------------
             Cape golden mole  ----------------------------------------
                     Aardvark  cc--------------------------------------
                    Armadillo  ccg-------------------------------------
                      Opossum  ----------------------------------------
                     Platypus  ccggctgcg-------------------------------
                 Saker falcon  ----------cagct---a--caagt---cctgca-tc-c
             Peregrine falcon  ----------cagct---a--caagt---cctgca-tc-c
       White-throated sparrow  ----------tgggt---g--ccggc---cgcggg-gctc
                  Zebra finch  ----------ctgcctcgg--cctgcctgcacagg-gc-c
                   Budgerigar  accttgacccggagcagag--caggg---cggcggagc-c
                       Parrot  ----------ggggctgagcccatct---cagtgg-gc-t
                        Shrew  ========================================
     Mexican tetra (cavefish)  ========================================
           Southern platyfish  ========================================
          Medium ground finch  ========================================
               Painted turtle  ========================================
          Collared flycatcher  ========================================
           American alligator  ========================================
                      Wallaby  ========================================
              Tasmanian devil  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Green seaturtle  ========================================
         David's myotis (bat)  ========================================
                       Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 12 and 13 in window
B D                 Elephant 2bp
         Cape elephant shrew 2bp
B D                  Manatee 2bp
            Cape golden mole 2bp
                    Aardvark 2bp
B D                Armadillo 2bp
B D                  Opossum 5bp
B D                 Platypus 10bp

Alignment block 13 of 339 in window, 27212314 - 27212374, 61 bps 
B D                     Human  gggcg---gggccg------------cggg---gc-cgggt---------cgcgcgagcagc---g----
B D                     Chimp  gggcg---gggccg------------cggg---gc-cgggt---------cgcgcgagcagc---g----
B D                   Gorilla  gggcg---gggccg------------cggg---gc-cgggt---------cgcgcgaacagc---g----
B D                 Orangutan  gggcg---gggccg------------cgga---gc-tgggt---------cgcgcgagcagc---g----
B D                    Gibbon  gggcg---gggccg------------cggg---gc-cgggt---------cgcgcgagcagc---g----
B D                    Rhesus  gggcg---gggccg------------cggg---gc-cgggt---------cgcgtgagcacc---g----
B D       Crab-eating macaque  gggcg---gggccg------------cggg---gc-cgggt---------cgcgtgagcacc---g----
B D                    Baboon  gggcg---gggccg------------cggg---gc-cgggt---------cgcgtgagcacc---g----
B D              Green monkey  gggcg---gggccg------------cggg---gc-cgggt---------cgcgtgagcacc---g----
B D                  Marmoset  gggcg---gggctg------------cggg--ggt-cgggt---------cgcgctagcggc---g----
B D           Squirrel monkey  gggcg---gggctg------------cggg--tgt-cgggt---------cgcgctagcagc---g----
B D                  Bushbaby  gggcg---gagccg------------cgca--cgc-caggt---------t-tgcttgcctccaag----
           Chinese tree shrew  gggcg---ggacca------------cgcg------cagct---------ctcgcgagcattaggg----
B D                  Squirrel  aggcg---ggaccc------------cgcg---ct---gct---------ctcgcgagctgt---c----
       Lesser Egyptian jerboa  ----------------------------cg---cg-cagct---------ctcgcgagctgt---caaga
                 Prairie vole  gggcg---gggcct------------cgcg---ct-cggct---------ctcgcgagctgt---c----
B D           Chinese hamster  gggcg---gggcct------------cgcg---ct-tggct---------ctcgcgagctgt---c----
               Golden hamster  gggcg---gggcct------------cgcg---ct-cggct---------ctcgcgagctgt---c----
B D                     Mouse  gggcg---gagcct------------cgcg---ct-cggtt---------ctcgcgagctgt---c----
B D                       Rat  gggcg---gagcct------------cgcg---ct-cagct---------ctcgcgagctgt---c----
B D            Naked mole-rat  gggcg---gggccg------------cgcg---cc---gct---------ctcgcgagcggt---c----
B D                Guinea pig  gggcg---gggccg------------cgcg---ct---gct---------ctcgcgagctgt---c----
                   Chinchilla  gggtg---gggccc------------cgcg--------gct---------ctcgcgaggggt---c----
             Brush-tailed rat  gggcg---gggccg------------cgcg---ct---gct---------ctcgcgagctgt---c----
B D                    Rabbit  gggcg---gggccg------------cggt---gt---ggt---------ctcgcgaggcac---a----
B D                      Pika  gggcg---gggtcg------------cgct---cc---ggt---------ctcgcgagctcc---t----
B D                       Pig  -ggcg---gggcca------------cact---ct-caagt---------ctcgcgatcagc---t----
B D                    Alpaca  -ggcg---gggcca------------cacg---cg-caagt---------ctcgcgatctcc---t----
               Bactrian camel  -ggcg---gggcca------------cacg---cg-caagt---------ctcgcgatcgcc---t----
B D                   Dolphin  aggcg---gggcca------------cacg---cg-caagt---------ctcgcgatcagc---c----
                 Killer whale  aggcg---gggcca------------cacg---cg-caagt---------ctcgcgatcagc---c----
             Tibetan antelope  aggcg---aggccg------------cacg---cg-caagt---------ctcgcgatcagt---g----
B D                       Cow  aggca---gggccg------------cacg---cg-c--gt---------ctcgtgatcagt---g----
B D                     Sheep  aggcg---gggccg------------cccg---gg-caagt---------ctcgcgatcagt--------
                Domestic goat  aggcg---gggccg------------cccg---cg-caagt---------ctcgcgatcagt---g----
B D                     Horse  gggcg---gggcca------------cacg---cg-caagt---------ctcgcgagcagc---t----
B D          White rhinoceros  ggggg---ggggcaggggggcggagccaca---cg-caaat---------ctcgcgaggagc---t----
B D                       Cat  gggcg---gagcca------------cacg---cg-caaat---------ctcgcgaggcgc---t----
B D                       Dog  gggct---ggacca------------cacg---cg-caaat---------ctcgcgaggcgc---t----
B D                   Ferret   gggcg---gagcca------------cgcg---cg-ccagt---------ctcgcgaggcgc---t----
B D                     Panda  gggcg---gagcca------------cact---cg-caagt---------atcgcgaggcgt---t----
               Pacific walrus  gggcg---gagcca------------tacg---cg-caagt---------ctcgcgaggcgc---a----
                 Weddell seal  gggcg---gagcca------------cacg---cg-caagt---------ctcgcgaggcgc---t----
             Black flying-fox  gggcg---gagcca------------cata---ct-caagt---------ctcgcgagctgc---t----
B D                   Megabat  gggcg---gagcca------------cata---ct-caagt---------ctcgcgagctgc---t----
                Big brown bat  gggcg---gagcca------------cc-g---cg-ccagt---------ctcgcgaga-gc---t----
         David's myotis (bat)  gggcg---gggccg------------cg-g---cg-caagt---------ctcgcgaga-gc---t----
B D                  Microbat  gggcg---gggccg------------cg-g---cg-caagt---------ctcgcgaga-gc---t----
B D                  Hedgehog  gggcg---gagcct------------cgag---ca---ggt---------ctcgcga-cagc---t----
              Star-nosed mole  gggcg---gggcca------------agga---cg-c-cgt---------ctcgcg---agt---c----
B D                  Elephant  gggcg---gggcca-----------tcacg---cg-cagat---------ttcgcgagctgc---t----
          Cape elephant shrew  gggcg---gagcta------------cggg---ct-caggt---------ttctccagttgc---t----
B D                   Manatee  gggcg---gggcca-----------tcgcg---cg-caggt---------gttacgagctgc---t----
             Cape golden mole  gggcg---gagcca-----------ccgca---ca-caggt---------tccgtgaggggc---t----
                     Aardvark  gggcg---gagctt-----------tcacg---cg-ca----------------------gc---t----
B D                 Armadillo  gggcg---gagccg-----------tcgcg---gg-gagat---------cacgcgagcggc---g----
B D                   Opossum  gggcgtcatggcta------------cgct---ct-cacgtagtctccaacacgtgatgatc---g----
B D                  Platypus  gagag---gacccg-----------ccacg---tgacaggg---------gccgtgggcggc---c----
  D              Saker falcon  ctgag---tcgctg------------cggt---gc-cagat---------ccagcag--------c----
  D          Peregrine falcon  ctgag---tcgctg------------cggt---gc-cagat---------ccagcag--------c----
  D    White-throated sparrow  ggcgg---cgg----------------------ac-gcggc---------gct------------c----
B D               Zebra finch  ggggg---cagctg------------agctggcac-acggc---------tctgcag--------c----
B D                Budgerigar  gggtc---cggttg------------tgcc---tc-ggggt---------cctgcag----c---c----
  D                    Parrot  gagtg---gggcag------------ggac-------ggtc---------tcagcaa----t---c----
B D                     Shrew  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
          Southern platyfish  ======================================================================
B D       Medium ground finch  ======================================================================
  D            Painted turtle  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D           Green seaturtle  ======================================================================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  -------------gagcaccaagg--------gaac--ggaaaatggcg-
                        Chimp  -------------gagcaccaagg--------gaac--ggaaaatggcg-
                      Gorilla  -------------gagcaccaagg--------gaac--ggaaaatggcg-
                    Orangutan  -------------gagcaccaagg--------gaac--ggaaaatggcg-
                       Gibbon  -------------gagcaccaagg--------gaac--ggaaaatggcg-
                       Rhesus  -------------gagaactaagg--------gagc--ggaaaatggcg-
          Crab-eating macaque  -------------gagaactaagg--------gagc--ggaaaatggcg-
                       Baboon  -------------gagaactaagg--------gagc--ggaaaatggcg-
                 Green monkey  -------------gagaactaagg--------gagc--ggaaaatggcg-
                     Marmoset  -------------gagaaccaagg--------gagc--ggaaaatggcg-
              Squirrel monkey  -------------gagaaccaagg--------gagc--ggaaaatggcg-
                     Bushbaby  -------------aaggatgtagg--------gaac--ggaaaatggct-
           Chinese tree shrew  -------------aagaacggagg--------gatc--ggaaaatggcg-
                     Squirrel  -aa---------ggaggtcggaga--------gggc--ggaaaatggcg-
       Lesser Egyptian jerboa  aaa---------gaaggtcgaagc--------gagt--gcaaaatggcg-
                 Prairie vole  -------------aaggttgaaag--------gagt--ggaaaatggcg-
              Chinese hamster  -aa---------gaaggtcgaaag--------gagt--ggaaaatggcg-
               Golden hamster  -aa---------gaaggtcgaaag--------gagt--ggaaaatggcg-
                        Mouse  -aa---------gacggtggaaag--------cagt--gggaaatggcg-
                          Rat  -aa---------gaagcttgaaag--------cagt--ggaaaatggcg-
               Naked mole-rat  -ga---------gaaggtcgatcg--------agtc--ggaaaatggtg-
                   Guinea pig  -------------aaggtcgaagg--------gatc--cgaaaatggcg-
                   Chinchilla  -------------gaggtcaaagg--------gagc--cgaaaatggcg-
             Brush-tailed rat  -------------caggtcgaaag--------gagc--ggaaaatgtcg-
                       Rabbit  -ga---------aaaggtcgaagg--------aagc--gaaaaatggcg-
                         Pika  -ga---------gaaggtcgtagg--------aagc--gaaacatggcg-
                          Pig  -ga---------gaaggacggagg--------gagc--agaaaatggcc-
                       Alpaca  -gg---------gaaggacgaagg--------gaaa--ggaaaatggcc-
               Bactrian camel  -gg---------gaaggacgaagg--------gaac--ggaaaatggcc-
                      Dolphin  -aa---------gaaggacagagg--------gagc--ggaaaatggcc-
                 Killer whale  -aa---------gaaggacagagg--------aagc--ggaaaatggcc-
             Tibetan antelope  -ga--------tgaaggtcggaag--------gagc--gaaaaatggcc-
                          Cow  -ga---------gaaggtcggaag--------gagc--gaaaaatggcc-
                        Sheep  ----------------gtcggaag--------gagc--ggaacatggcc-
                Domestic goat  -ga---------gaaggtcggacg--------gagc--gaaaaatggcc-
                        Horse  -ga---------gaaggacgaagg--------gagc--ggaaaatggcc-
             White rhinoceros  -ga---------gaaagacgaagg--------gaac--cgaaaatggct-
                          Cat  -ga---------gaaggacaaagg--------gagc--gaaaaatggct-
                          Dog  -ga---------gaaggacgaagg--------gagcaaaaaaaatggct-
                      Ferret   -ga---------aaaggacggagg--------gagc--gaaaaatggct-
                        Panda  -ga---------aaaggacgaagg--------gagc--aaaaaatggct-
               Pacific walrus  -ga---------gaaggacgaagg--------gagc--aaaaaatggct-
                 Weddell seal  -ga---------gaaggacgaaag--------gagc--aaaaaatgtct-
             Black flying-fox  -ga---------gaaggacgaagg--------aag-ggagaaaatgttc-
                      Megabat  -ga---------gaaggacgaagg--------aag-ggagaaaatgttc-
                Big brown bat  -ga---------gaaggacacaga--------gggccggaaaaatgtcc-
         David's myotis (bat)  -ga---------gaaggacacaga--------gggccggaaaaatgtcc-
                     Microbat  -ga---------gaaggacaccga--------gggccggaaaaatgtcc-
                     Hedgehog  -gg---------gaagaacccaca--------gagc--cgaaaatggcc-
              Star-nosed mole  -gc---------tgaggacgcagg--------gatc--ggaaaatggcc-
                     Elephant  -ga---------gaaagaaaaaag--------ccgg--gccaaatggcg-
          Cape elephant shrew  -ga---------gatgcaccgagg--------ctcc--ggaaaatggcg-
                      Manatee  -ga---------gaaggaggaagg--------cagc--ggaaaatggcg-
             Cape golden mole  -ga---------gaagaacgaaga--------cagc--ggaaaatggcg-
                     Aardvark  -gg---------gaaggacgaagg--------cagc--ggaaaatggcg-
                    Armadillo  -cc---------caaggacggagg--------gagt--ggaaaatggcg-
                      Opossum  -acgtcacgcgctaaggagaacga--------ggaa--ggaaaatggtg-
                     Platypus  -ct---------cgagg----aga--------agcc--ggaaaatggcg-
                 Saker falcon  -ac---------ag------------------------------------
             Peregrine falcon  -ac---------ag------------------------------------
       White-throated sparrow  -gg---------gggcttttccggcgccgctcgggt--gaggggcacccc
                  Zebra finch  -ag---------cggcagcgccagcagtgtctgggt--ggggaatg-ggg
                   Budgerigar  -gc---------gggcggcgccag--------gggc--agg---------
                       Parrot  -ga---------gtgcagtg--ga--------gggc--aggaagca----
                        Shrew  ==================================================
     Mexican tetra (cavefish)  ==================================================
           Southern platyfish  ==================================================
          Medium ground finch  ==================================================
               Painted turtle  ==================================================
          Collared flycatcher  ==================================================
           American alligator  ==================================================
                      Wallaby  ==================================================
              Tasmanian devil  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Green seaturtle  ==================================================
                       Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 13 and 14 in window
  D             Saker falcon 3bp
  D         Peregrine falcon 3bp
  D   White-throated sparrow 13bp
B D              Zebra finch 13bp
B D               Budgerigar 1bp
  D                   Parrot 1bp

Alignment block 14 of 339 in window, 27212375 - 27212401, 27 bps 
B D                     Human  cctcacgacccgggtagtcttacgacc
B D                     Chimp  cctcacggcccgggtagtcttacgacc
B D                   Gorilla  cctcacggcccgggtagtcttacgacc
B D                 Orangutan  cctcacggcccggatagtcttacgacc
B D                    Gibbon  cctcacggcccgggtagtcttacgacc
B D                    Rhesus  tctcacggcccgggtagtcttacgact
B D       Crab-eating macaque  cctcacggcccgggtagtcttacgact
B D                    Baboon  cctcacggcccgggtagtcttacgacc
B D              Green monkey  cctcacggcccgggtagtcttacgacc
B D                  Marmoset  cctcgcggccggggtactcttacgatc
B D           Squirrel monkey  cctcgcgaccggggtagtcttacgatc
B D                  Bushbaby  cctcgctggccgggcactcttaagagt
           Chinese tree shrew  cccagcgggcaagggtctcctacgagc
B D                  Squirrel  cctatcgttcctagtagtggtgcaagc
       Lesser Egyptian jerboa  tcccgtgagccgggcagttctgtaaag
                 Prairie vole  tctcgcgagccaggcagttctgcgcgc
B D           Chinese hamster  tcgcgcgagccaggcagttctgtgaac
               Golden hamster  ccgagcgagccgggcggttctgtgaac
B D                     Mouse  tctcgggagtcaggcggct--------
B D                       Rat  tctcgggagccaggcagttctgtgagc
B D            Naked mole-rat  ccgggcgagcctctcaatcgttccaac
B D                Guinea pig  ccgcgcgagcctggcagtggtatcgac
                   Chinchilla  ccgagcgggcctggcaaccttatcaac
             Brush-tailed rat  tcgcgcgagtctggcaagcgtatcgac
B D                    Rabbit  cttcgcgagccgggcaatcgtacctgc
B D                      Pika  cttcacgagctgggccgtcgtccggcc
B D                       Pig  cgtcccggtttccgcagtccctcgagc
B D                    Alpaca  cctggcagggtctgcagtgacttgagc
               Bactrian camel  cctggcagggtctacagtgacttgagc
B D                   Dolphin  cttcgcgggctcgacagtcctttgacc
                 Killer whale  cttcgcgggctcgacagtcctttgacc
             Tibetan antelope  ccttgcgggcttggcagttctttgagc
B D                       Cow  ccttgcgggctcggcagtcctttgagc
B D                     Sheep  ccttgcgggctcggcagttctttgagc
                Domestic goat  ccttgcgggctcggcagttctttgagc
B D                     Horse  tttcgcgagcggggacgtccttcgagc
B D          White rhinoceros  cctcgcgaccggggtagtccttcaagt
B D                       Cat  cctcgcgggccgggtagtccttcgaac
B D                       Dog  cttcacgggtcgcgcggttcttcgttc
B D                   Ferret   cttcgtgggcagggttgtgcttcattc
B D                     Panda  cctcgcaggctggggagtccttcgttc
               Pacific walrus  ccttgcgggccgggctgtttttcgttc
                 Weddell seal  cctcgcgggccgggcagtccttcgttc
             Black flying-fox  ccttgcgggcctggcagtccttcgatc
B D                   Megabat  ccttgcgggcctggcagtccttcgatc
                Big brown bat  cctcgcggtccgggcggccctccgatc
         David's myotis (bat)  cctcgcggtcctggcagcgctccgatc
B D                  Microbat  cctcgcggtcctggcagcgctccgatc
B D                  Hedgehog  tctcgcgggccgggaggcctttggagc
              Star-nosed mole  cctcgctggccgggcagcccttgggcc
B D                  Elephant  cgtcgcaggcccggcggtcctacgagc
          Cape elephant shrew  cttcgcaggccgggtaccactgcgaac
B D                   Manatee  cctcgcgggccaggcggtcctacgagc
             Cape golden mole  catccctggcccagcagtccgtggagc
                     Aardvark  ccacgcaggccggccagtcctaagagc
B D                 Armadillo  ccccggggaccccgcggcctggcccgc
B D                   Opossum  ttgaagggactcgcggggtttctggcc
B D                  Platypus  ggtgcagggggggggag----------
  D              Saker falcon  cctcacccgcaagcgcatc---cg---
  D          Peregrine falcon  cctcacccgcaagcgcatc---cg---
  D       Collared flycatcher  ccctgctcgcgg----------cg---
  D    White-throated sparrow  cctgacccgcgg----------ca---
B D               Zebra finch  tctcgtctgc------------ca---
B D                Budgerigar  tcaagccgtcgg----------gg---
  D                    Parrot  ccagtccctt-----------------
B D                     Shrew  ===========================
    Mexican tetra (cavefish)  ===========================
          Southern platyfish  ===========================
B D       Medium ground finch  ===========================
  D            Painted turtle  ===========================
B D        American alligator  ===========================
B D                   Wallaby  ===========================
B D           Tasmanian devil  NNNNNNNNNNNNNNNNNNNNNNNNNNN
  D           Green seaturtle  ===========================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 15 of 339 in window, 27212402 - 27212431, 30 bps 
B D                     Human  ctggtg------ccctgg---gctgccgcc--ctgctcctc
B D                     Chimp  ctggtg------ccctgg---gctgccgcc--ctgctcctc
B D                   Gorilla  ctggtg------ccctgg---gctgccgcc--ctgctcctc
B D                 Orangutan  ctggtg------ccctgg---gctgccgcc--ctgctcctc
B D                    Gibbon  ctggtg------ccctgg---gctgccgcc--ctgctcctc
B D                    Rhesus  ctggtg------cgctgg---gctgccgcc--ctgctcctc
B D       Crab-eating macaque  ctggtg------cgctgg---gctgccgcc--ctgctcctc
B D                    Baboon  ctggta------cgctgg---gctgccgcc--ctgctcctc
B D              Green monkey  ctggtg------cgctgg---gctgccgcc--ctgctcctc
B D                  Marmoset  ctggtg------cgctgg---gctgccacc--ctgctcctt
B D           Squirrel monkey  ctggtg------cgctgg---gctgccgcc--ctgctcctc
B D                  Bushbaby  ctgatt------ctctgg---gttggggcc--ctactcctc
           Chinese tree shrew  caggtg------ctcttg---gctgcggcc--ctgctcctc
B D                  Squirrel  ctggtt------tccagg---gctatggcc--ctgctcctc
       Lesser Egyptian jerboa  ctgcct------ccctgggctgctgctgcc--ctgctcctg
                 Prairie vole  tcgata------ccttgg---gttgctacc--ctgctcctg
B D           Chinese hamster  ccggtg------ccttgg---gctgctgcc--ctgctcctg
               Golden hamster  ccggta------ccttgg---gctgctgcc--ctgctcctg
B D                     Mouse  -------------ctcgg---gcggccgcc--ctgctcctg
B D                       Rat  ccgata------ccttgg---gcggttacc--ctgctcctg
B D            Naked mole-rat  ctcgtt------tgctgg---gttatggtc--ctgttcctc
B D                Guinea pig  ttggta------cgctgg---gctctggcc--ctgctcctc
                   Chinchilla  ctggta------tgctgg---gctttggcc--ctgctcctc
             Brush-tailed rat  ctgcag------tgctgg---cctatggcc--ctgctcctc
B D                    Rabbit  ccggtg------cgctgg---gctgcggcc--ctgctcctc
B D                      Pika  ccggtg------tgctgg---gctgctgcc--ctgttcctc
B D                       Pig  ttggtg------ccccgg---gctgcagcc--ctgctcctc
B D                    Alpaca  ttggtg------ccctgg---gctgcagcc--ctgctcctg
               Bactrian camel  ttggtg------ccctgg---gctgcagcc--ctgctcctg
B D                   Dolphin  gtggtg------ccctgg---gctgcagcc--ctactcctc
                 Killer whale  gtggtg------ccctgg---gctgcaacc--ctactcctc
             Tibetan antelope  ttggtt------ctctgg---gctgcagcc--ctgctcttc
B D                       Cow  ttggtt------ccctgg---gctgcagcc--ctgctcttc
B D                     Sheep  ttggtt------ctctgg---gctgcagcc--ctgctcttc
                Domestic goat  ttggtt------ctctgg---gctgcagcc--ctgctcttc
B D                     Horse  ctggtg------gcctgg---gctgccgcc--ctgctgctc
B D          White rhinoceros  ctggtg------agctgg---gctgcggcc--ctgctcctc
B D                       Cat  ctggtg------ccttgg---gcagctgcc--gtgctcctt
B D                       Dog  ctggtg------ccttgg---gcagcggcc--gtgctcctc
B D                   Ferret   ctggtc------ccttgg---gcagcgacc--ctgctcctc
B D                     Panda  gtggtc------ccttgg---gcagcgacc--ctgctcctc
               Pacific walrus  ctggtc------ccttgg---gcagcgacc--ctgctcctc
                 Weddell seal  ctggtc------ccttgg---gcagcgacc--ctgctcctc
             Black flying-fox  ccggta------ccttgg---gctgcggcc--ctgctcctc
B D                   Megabat  ccggta------ccctgg---gctgcggcc--ctgctcctc
                Big brown bat  ccgctg------ccctgg---gccgcggcc--ctgctcctc
         David's myotis (bat)  ccgctg------cccttg---gccgcggcc--ctgctcctc
B D                  Microbat  ccgctg------cccttg---gccgcggcc--ctgctcctc
B D                  Hedgehog  ttgctc------ccttgg---gctgtggcc--ctgctcctc
              Star-nosed mole  ctggtt------ccctgg---gctgcggcc--ctgctcctc
B D                  Elephant  ctggtg------ctctgt---gcaaccgcc--ctgctcctc
          Cape elephant shrew  ctgttg------ccctgt---gctgccgcc--ctgatcctc
B D                   Manatee  ttggtg------ccctgt---gctgccgcc--ctgctcctc
             Cape golden mole  ctagtg------ctctgt---gttgccgcc--ctactcctc
                     Aardvark  ctggtg------ccctgt---gctgccgct--ctgctcctc
B D                 Armadillo  cggccg------ccttgg---gcggccgcc--ctgctcctc
B D                   Opossum  tgggtg------tccagg---gctatggcc--ctgctcctc
B D                  Platypus  --gggc------agctgg---ggcctgcac--ctgctcctg
  D              Saker falcon  ccaccg------cttcca---caaatccct--gcggaag--
  D          Peregrine falcon  ccaccg------cttcca---caaatccct--gcggaag--
  D       Collared flycatcher  ccgctg------cccagc---gctatcccc--ggtgtcc--
  D    White-throated sparrow  gcg--ggagggaccctgg------gtccctcggagcggt--
B D               Zebra finch  ccg--g------ccctgg---cctgtccct--gaccagg--
B D                Budgerigar  agggaa------ccttgg---agcgtt-----ggggggc--
  D                    Parrot  -----a------ccctgc---acagtg-----aggtggg--
B D        American alligator  ctgggg------ccctgg------gtggct--gcgctgt--
B D                     Shrew  =========================================
    Mexican tetra (cavefish)  =========================================
          Southern platyfish  =========================================
B D       Medium ground finch  =========================================
  D            Painted turtle  =========================================
B D                   Wallaby  =========================================
B D           Tasmanian devil  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D           Green seaturtle  =========================================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 15 and 16 in window
B D                 Platypus 6bp

Alignment block 16 of 339 in window, 27212432 - 27212446, 15 bps 
B D                     Human  gctctgggcgtggaa------------------
B D                     Chimp  gctctgggcgtggaa------------------
B D                   Gorilla  gctctgggcgtggaa------------------
B D                 Orangutan  gctctgggcgtggaa------------------
B D                    Gibbon  gctctgggcgtggaa------------------
B D                    Rhesus  gctctgggcgtggaa------------------
B D       Crab-eating macaque  gctctgggcgtggaa------------------
B D                    Baboon  gctctgggcgtggaa------------------
B D              Green monkey  gctctgggcgtggaa------------------
B D                  Marmoset  gctctgggcgtggaa------------------
B D           Squirrel monkey  gctctgggcgtggaa------------------
B D                  Bushbaby  gctctgggcgtggaa------------------
           Chinese tree shrew  gctctgggcgtggaa------------------
B D                  Squirrel  gctctgggcgtggaa------------------
       Lesser Egyptian jerboa  gctctgagcgtggaa------------------
                 Prairie vole  gctgtgggcgtggag------------------
B D           Chinese hamster  gttgtgggcatggaa------------------
               Golden hamster  gctgtgggcatggaa------------------
B D                     Mouse  gttctgggcgtggag------------------
B D                       Rat  gttctaggcatggaa------------------
B D            Naked mole-rat  gctctgggcatggaa------------------
B D                Guinea pig  gctctgtgcgtggaa------------------
                   Chinchilla  gctctgggcgtggaa------------------
             Brush-tailed rat  gctttgggcgttgaa------------------
B D                    Rabbit  gctctgggcgtggaa------------------
B D                      Pika  gccctgggcgtggaa------------------
B D                       Pig  gttctgagcgtgcca------------------
B D                    Alpaca  gttcttatcgtggaa------------------
               Bactrian camel  gttcttatcgtggaa------------------
B D                   Dolphin  gttctgagcgtggaa------------------
                 Killer whale  gttctgagcgtggaa------------------
             Tibetan antelope  gttctgagcgtggga------------------
B D                       Cow  gttctgagcgtggga------------------
B D                     Sheep  gttctgagcgtggga------------------
                Domestic goat  gttctgagcgtggga------------------
B D                     Horse  gctctgggcgtggaa------------------
B D          White rhinoceros  gctctgggcgtggaa------------------
B D                       Cat  gttgtgggcgcgaaa------------------
B D                       Dog  gctctgggcgcggaa------------------
B D                   Ferret   gctctgggcgcggaa------------------
B D                     Panda  gctctgggcgcggaa------------------
               Pacific walrus  gctctgggcgcggaa------------------
                 Weddell seal  gctctgggcgcggaa------------------
             Black flying-fox  gctctgggcgtggaa------------------
B D                   Megabat  gctctgggcgtggaa------------------
                Big brown bat  gctctgcgcgtggga------------------
         David's myotis (bat)  gctctgcgcgtggga------------------
B D                  Microbat  gctctgcgcgtggga------------------
B D                  Hedgehog  gct------gtggaa------------------
              Star-nosed mole  gctctgggcgtggaa------------------
B D                  Elephant  gctctgggggtggaa------------------
          Cape elephant shrew  gctctgggcgtggag------------------
B D                   Manatee  gctctgggcgtggaa------------------
             Cape golden mole  gctctgggcgtggaa------------------
                     Aardvark  gctctgggcgtagaa------------------
B D                 Armadillo  gcgctgggcgcggca------------------
B D                   Opossum  gttctgagcgcggga------------------
B D           Tasmanian devil  gctctgggcgcggga------------------
B D                  Platypus  atcctcagcctggga------------------
  D              Saker falcon  --------------atcagcggc-tgcc----a
  D          Peregrine falcon  --------------atcagcggc-tgcc----a
  D       Collared flycatcher  --------------tca----------------
  D    White-throated sparrow  --------------gcgcggg------------
B D               Zebra finch  --------------aca----------------
B D                Budgerigar  --------------agt----------------
  D                    Parrot  --------------aca----------------
B D        American alligator  --------------gcccccagcatggcatgaa
B D                     Shrew  =================================
    Mexican tetra (cavefish)  =================================
          Southern platyfish  =================================
B D       Medium ground finch  =================================
  D            Painted turtle  =================================
B D                   Wallaby  =================================
  D           Green seaturtle  =================================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 17 of 339 in window, 27212447 - 27212466, 20 bps 
B D                     Human  agggctctggcgctaccc-------ga
B D                     Chimp  agggctctggcgctaccc-------ga
B D                   Gorilla  agggctctggcgctaccc-------ga
B D                 Orangutan  ggggctctggcgctaccc-------ga
B D                    Gibbon  agggctctggcgctaccc-------ga
B D                    Rhesus  agggctctggcgctaccc-------ga
B D       Crab-eating macaque  agggctctggcgctaccc-------ga
B D                    Baboon  agggctctggcgctaccc-------ga
B D              Green monkey  agggctctggcgctaccc-------ga
B D                  Marmoset  agggctctggctctaccc-------ga
B D           Squirrel monkey  agggctctggctctaccc-------ga
B D                  Bushbaby  aaggctctggcgctaccc-------ga
           Chinese tree shrew  agggctctggcgctacct-------ga
B D                  Squirrel  agggctctggcgctaccc-------ga
       Lesser Egyptian jerboa  agggctctggcgctcccc-------ga
                 Prairie vole  agggccctggctctacct-------ga
B D           Chinese hamster  agggctctggctctacct-------ga
               Golden hamster  ggggctctggctctacct-------ga
B D                     Mouse  agggccctggctctacct-------ga
B D                       Rat  agggccctggctctacct-------ga
B D            Naked mole-rat  ggggctctggctctaccc-------ga
B D                Guinea pig  aggggcctggcgctaccg-------ga
                   Chinchilla  agggcgctggcgcttccc-------ga
             Brush-tailed rat  ggggctctggcgctaccc-------ga
B D                    Rabbit  agggctgtggcgctaccc-------ga
B D                      Pika  cgggctctggcgctcccc-------ga
B D                       Pig  agggctttggcgttaccc-------ga
B D                    Alpaca  agggctttggcgctaccc-------ga
               Bactrian camel  agggctttggcgctaccc-------ga
B D                   Dolphin  agggctttggcgctaccc-------ga
                 Killer whale  agggctttggcgctaccc-------ga
             Tibetan antelope  aggggtttggcgctaccc-------ga
B D                       Cow  agggctttggcgctaccc-------ga
B D                     Sheep  aggggtttggcgctaccc-------ga
                Domestic goat  aggggtttggcgctaccc-------ga
B D                     Horse  agggctctggcgctaccc-------ga
B D          White rhinoceros  gggggtatggcgctaccc-------ga
B D                       Cat  agggccctggcgctaccc-------ga
B D                       Dog  agggccctggcgctaccc-------ga
B D                   Ferret   agggctctggcgctaccc-------ga
B D                     Panda  agggctctggcgctaccc-------ga
               Pacific walrus  agggctctggcgctaccc-------ga
                 Weddell seal  agggctctggcgctaccc-------ga
             Black flying-fox  agggctctggcgataccc-------ga
B D                   Megabat  agggctctggcgataccc-------ga
                Big brown bat  agggctctggcgctaccc-------ga
         David's myotis (bat)  agggctctggcgctcccc-------ga
B D                  Microbat  agggctctggcgctcccc-------ga
B D                  Hedgehog  atggctctggcgctaccc-------ga
              Star-nosed mole  ggggctctggcgctaccc-------ga
B D                  Elephant  agggctctggcgctaccc-------ga
          Cape elephant shrew  agggttttggcgctaccc-------ga
B D                   Manatee  agggctctggcgttaccc-------ga
             Cape golden mole  ggggctctggcgctaccc-------ga
B D                    Tenrec  agggctctggcgcaaccc-------ga
                     Aardvark  agggctctggcgctaccc-------ga
B D                 Armadillo  agggctctggcgctcccc-------ga
B D                   Opossum  aggtccctggcggtgccc-------ga
B D           Tasmanian devil  agggccccggcgctgccc-------ga
B D                  Platypus  cgggccctggagccaccc-------ga
  D              Saker falcon  gacggacaggcgctacct-------ga
  D          Peregrine falcon  gacggacaggcgctacct-------ga
  D       Collared flycatcher  ----tcccggggctctga-------gg
  D    White-throated sparrow  ---gatgcggagccctgt-------gg
B D               Zebra finch  --------ggctccacgt-------gc
B D                Budgerigar  ----gtccataaccccttccctcccgc
  D                    Parrot  ----ggatggggccctg--------gc
B D        American alligator  gaggggccgggttctccc-------ct
B D                     Shrew  ===========================
    Mexican tetra (cavefish)  ===========================
          Southern platyfish  ===========================
B D       Medium ground finch  ===========================
  D            Painted turtle  ===========================
B D                   Wallaby  ===========================
  D           Green seaturtle  ===========================

Inserts between block 17 and 18 in window
  D             Saker falcon 18bp
  D         Peregrine falcon 18bp
  D      Collared flycatcher 19bp
  D   White-throated sparrow 21bp
B D              Zebra finch 10bp
B D               Budgerigar 30bp
  D                   Parrot 31bp
B D       American alligator 40bp

Alignment block 18 of 339 in window, 27212467 - 27212494, 28 bps 
B D                     Human  ggtacagaagc-----aa----g-----tt-tga--ggtcgggct------
B D                     Chimp  ggtacagaagc-----aa----g-----tt-tga--ggtcgggct------
B D                   Gorilla  ggtacagaagc-----aa----g-----tt-tga--ggtcgggct------
B D                 Orangutan  ggtacagaagc-----aa----g-----tt-tga--ggtcgggct------
B D                    Gibbon  ggtacagaagc-----aa----g-----tt-tga--ggtcgggct------
B D                    Rhesus  ggtacagaagc-----aa----g-----tt-tga--ggtcgggct------
B D       Crab-eating macaque  ggtacagaagc-----aa----g-----tt-tga--ggtcgggct------
B D                    Baboon  ggtacagaagc-----aa----g-----tt-tga--ggtcgggct------
B D              Green monkey  ggtacagaagc-----aa----g-----tt-tga--ggtcgggct------
B D                  Marmoset  ggtacagaagc-----aa----g-----tt-tga--agtccggct------
B D           Squirrel monkey  ggtacagaagc-----aa----g-----tt-tga--ggtcgggct------
B D                  Bushbaby  ggtacacaagc-----aa----g-----tt-tga--tgtcaggct------
           Chinese tree shrew  ggtacagaagc-----aa----a-----tt-gga--ggtcgggct------
B D                  Squirrel  ggtacagaagc-----aa----a------t-tga--agccgggct------
       Lesser Egyptian jerboa  ggtacagaaga-----aa----g------c-aga--ggtcgggct------
                 Prairie vole  ggtacagaaga-----aagctgg-----tt-tga--gatctggct------
B D           Chinese hamster  ggtacaggaga-----aa----g-----tc-tga--gatatgtct------
               Golden hamster  ggtacagcaga-----aa----g-----gt-tga--ggtctggct------
B D                     Mouse  ggtacagaaga-----aa----g-----tt-tga--gatctggct------
B D                       Rat  ggtacagaaga-----aa----g-----tc-tga--gatctggct------
B D            Naked mole-rat  ggtacagaaac-----ca----a-----tt-tat--ggtcctggt------
B D                Guinea pig  ggtacagaaat-----ca----a-----tt-tgt--ggttgggct------
                   Chinchilla  ggtacagaaac-----ca----a-----tt-tgt--ggttgggct------
             Brush-tailed rat  ggtaccggaac-----ca----a-----tt-tgt--tgttgggct------
B D                    Rabbit  ggtacaggagc-----aa----g-----tt-tga--ggtcgggct------
B D                      Pika  ggtacaggcgc-----ga----t-----tt-tga--ggtccggct------
B D                       Pig  ggtactgaagc-----aa----a-----tt-aga--ggctgggtt------
B D                    Alpaca  ggtactgaagc-----aa----a-----tt-aga--ggttgggtt------
               Bactrian camel  ggtactgaagc-----aa----a-----tt-aga--ggttgggtt------
B D                   Dolphin  ggtactgaagc-----aa----a-----tt-aaa--ggttgggtt------
                 Killer whale  ggtactgaagc-----aa----a-----tt-aaa--ggttgggtt------
             Tibetan antelope  ggtactgaagc-----ag----a-----tt-aaa--ggttgggtt------
B D                       Cow  ggtactgaagc-----ag----a-----tt-aaa--ggttgggtt------
B D                     Sheep  ggtactgaagc-----ag----a-----tt-aaa--ggttgggtt------
                Domestic goat  ggtactgaagc-----ag----a-----tt-aaa--ggttgggtt------
B D                     Horse  ggtacagaagc-----aa----c-----tt-aga--agtctggcc------
B D          White rhinoceros  ggtacagaagc-----aa----g-----tt-tga--agtcgggct------
B D                       Cat  ggtacagaaac-----aa----g-----tt-aga--ggtcggact------
B D                       Dog  ggtacagaagc-----aa----g-----ct-aga--ggtcgggcc------
B D                   Ferret   ggtacagaagc-----aa----g-----tt-aga--ggtcgggct------
B D                     Panda  ggtacagaagc-----aa----g-----tt-aga--ggtcgggct------
               Pacific walrus  ggtacagaagc-----aa----g-----tt-aga--ggtcgggct------
                 Weddell seal  ggtacagaagc-----aa----g-----tt-aga--ggtcgggct------
             Black flying-fox  ggtatagaagc-----aa----g-----tt-aga--ggttggatt------
B D                   Megabat  ggtatagaagc-----aa----g-----tt-aga--ggttggaat------
                Big brown bat  ggtacagcagc-----gg----g-----tc-cga--gggccgcct------
         David's myotis (bat)  ggtacagcagc-----gg----g-----tc-aga---ggtcgccc------
B D                  Microbat  ggtacagcagc-----gg----g-----tc-aga---ggccgccc------
B D                  Hedgehog  ggtacagaagc-----ag----g-----tt-cga--agtcgggct------
              Star-nosed mole  ggtacagaagc-----aa----g-----ct-aga--ggtcgagct------
B D                  Elephant  ggtaccgaagc-----aa----g-----tc-aga--ggtcggact------
          Cape elephant shrew  ggtacaggaac-----aa----c-----ttaaga--ggtggcgcc------
B D                   Manatee  ggtaccgaagc-----aa----g-----tt-aga--ggtcggact------
             Cape golden mole  ggtacagaagc-----aa----g-----tt-aga--agtcacgca------
B D                    Tenrec  ggtacagaagc-----aa----g-----tt-gtc--ggtcgcgcc------
                     Aardvark  ggtacacaagc-----aa----g-----tt-aga--ggtcgcgct------
B D                 Armadillo  ggtacagaagc-----ca----a-----tc-gga--ggtcgggcc------
B D                   Opossum  ggtactgaagtcattgag----g-----tc-ggg--gggtgtgga------
B D           Tasmanian devil  ggtactgaagaca---gg----g-----tc-ggg--gggggggga------
B D                  Platypus  ggtacccaggg-----ca-----------t-tgg--gcacgggct------
  D              Saker falcon  -----------------a----c-----ct-ggagcggctgcagcggcact
  D          Peregrine falcon  -----------------a----c-----ct-ggagcggctgcagcggcact
  D       Collared flycatcher  -----------------g----gtgtcccc-ggt--gctcgcggtgcctct
  D    White-throated sparrow  -----------------g----g-----cc-gga--ggtcgggatgt----
B D               Zebra finch  -----------------g----g-----cc-ag---ggtc-----------
B D                Budgerigar  -----------------c----g-----ca-g-----cctgggggagcaca
  D                    Parrot  -----------------c----a-----cc-gga--tgctgtggcaggacc
B D                     Shrew  ===================================================
    Mexican tetra (cavefish)  ===================================================
          Southern platyfish  ===================================================
B D       Medium ground finch  ===================================================
  D            Painted turtle  ===================================================
B D        American alligator  ===================================================
B D                   Wallaby  ===================================================
  D           Green seaturtle  ===================================================

Inserts between block 18 and 19 in window
B D                  Opossum 1bp
B D                 Platypus 2296bp

Alignment block 19 of 339 in window, 27212495 - 27212502, 8 bps 
B D                     Human  gaagcagg
B D                     Chimp  gaagcagg
B D                   Gorilla  gaagcagg
B D                 Orangutan  gaagcagg
B D                    Gibbon  gaagcagg
B D                    Rhesus  gaagcagg
B D       Crab-eating macaque  gaagcagg
B D                    Baboon  gaagcagg
B D              Green monkey  gaagcagg
B D                  Marmoset  gaagcagg
B D           Squirrel monkey  gaagcagg
B D                  Bushbaby  gaaacagg
           Chinese tree shrew  gaagtagg
B D                  Squirrel  gaagtagg
       Lesser Egyptian jerboa  gaag----
                 Prairie vole  gaagaagg
B D           Chinese hamster  gaagaagg
               Golden hamster  gaagaagg
B D                     Mouse  gaagaagg
B D                       Rat  gaagaagg
B D            Naked mole-rat  gaagtaga
B D                Guinea pig  gaagtagg
                   Chinchilla  gaagtagg
             Brush-tailed rat  gaagtagg
B D                    Rabbit  gaagcagg
B D                      Pika  gaagaagg
B D                       Pig  gaaacaga
B D                    Alpaca  gaaacaga
               Bactrian camel  gaaacaga
B D                   Dolphin  gaaacaga
                 Killer whale  gaaacaga
             Tibetan antelope  gaaaaaga
B D                       Cow  gaaaaaga
B D                     Sheep  gaaaaaga
                Domestic goat  gaaaaaga
B D                     Horse  gaagccga
B D          White rhinoceros  gaagcaga
B D                       Cat  gcagcata
B D                       Dog  gaagcaga
B D                   Ferret   gaagcaga
B D                     Panda  gaagcaga
               Pacific walrus  gaagcaga
                 Weddell seal  gaagcaga
             Black flying-fox  gaagcaga
B D                   Megabat  gaagcaga
                Big brown bat  gaggcgga
         David's myotis (bat)  gcaaccga
B D                  Microbat  gcagccga
B D                  Hedgehog  caagtcga
              Star-nosed mole  gaagccgg
B D                  Elephant  gaagcgga
          Cape elephant shrew  gaagcaga
B D                   Manatee  gaagcaga
             Cape golden mole  gaatcaga
B D                    Tenrec  gaagtaga
                     Aardvark  gaagcaga
B D                 Armadillo  gcagccga
B D                   Opossum  gaag----
B D           Tasmanian devil  gaag----
  D              Saker falcon  gggcagag
  D          Peregrine falcon  gggcagag
  D       Collared flycatcher  aacacagg
  D    White-throated sparrow  --ggcagg
B D               Zebra finch  ----caag
B D                Budgerigar  gggatgga
  D                    Parrot  aggaagga
B D                     Shrew  ========
    Mexican tetra (cavefish)  ========
          Southern platyfish  ========
B D       Medium ground finch  ========
  D            Painted turtle  ========
B D        American alligator  ========
B D                   Wallaby  ========
B D                  Platypus  ========
  D           Green seaturtle  ========

Inserts between block 19 and 20 in window
  D             Saker falcon 4bp
  D         Peregrine falcon 4bp
  D      Collared flycatcher 4bp
  D   White-throated sparrow 4bp
B D              Zebra finch 4bp
B D               Budgerigar 4bp
  D                   Parrot 4bp

Alignment block 20 of 339 in window, 27212503 - 27212559, 57 bps 
B D                     Human  g-------------------tcg-----------ctgg---ccagcc-gtgcgt---cgcgc----tcgc
B D                     Chimp  g-------------------tcg-----------ctgg---ccagcc-gtgcgt---cgcgc----tcgc
B D                   Gorilla  g-------------------tcg-----------ctgg---ccagcc-gtgcgt---cgcgc----tcgc
B D                 Orangutan  g-------------------tcg-----------ctgg---ccagcc-gtgcgt---cgcgc----tcgc
B D                    Gibbon  g-------------------tcg-----------ctgg---ctagcc-atgcgt---cgcgc----ttgc
B D                    Rhesus  g-------------------tcg-----------ctcg---ccagcc-gtgcgt---ctcgc----tcgc
B D       Crab-eating macaque  g-------------------tcg-----------ctcg---ccagcc-gtgcgt---ctcgc----tcgc
B D                    Baboon  g-------------------tcg-----------ctcg---ccagcc-gtgcgt---ctcgc----tcgc
B D              Green monkey  g-------------------tcg-----------ctcg---ccagcc-gtgcgt---ctcgc----tcgc
B D                  Marmoset  g-------------------tcg-----------atgg---ccagc----gctt---cgcgc----tcgc
B D           Squirrel monkey  g-------------------tcg-----------atgg---ccagcc-gtgctt---cgcgc----tcgc
B D                  Bushbaby  g-------------------tta-----------ctag---ccagtg-gtgtgt---gttgc----ttgc
           Chinese tree shrew  a-------------------ttg-----------cctg---tgtgtc-gcgc------tcgc----ccgc
B D                  Squirrel  gt------------------ttg-----------ttgaccctctg----tgtgt---cgcgc----ttgc
       Lesser Egyptian jerboa  -----------------------------------------ccacct-ttgtgt---tgtgc----ttgc
                 Prairie vole  --------------------ttg-----------ccgatcgtcagcc-ttgtgt---cgagc----tcgc
B D           Chinese hamster  --------------------ctg-----------ctgatcgtcagcc-tggcgt---cgagc----tcgc
               Golden hamster  --------------------ctg-----------ctgatcttcagcc-ttgcgt---cgagc----tcgc
B D                     Mouse  --------------------ttg-----------ctggccgtcagcc-cggaat---ccagc----tcgc
B D                       Rat  --------------------ttg-----------ctggtcgtcagtc-ttgagt---cgagt----tcgc
B D            Naked mole-rat  g-------------------ttg-----------ctgg---gcagcc-ttctgt---cgcgc----ccgc
B D                Guinea pig  g-------------------ttt-----------ctgg---gcagcc-ttgtgt---cgcgc----tcgc
                   Chinchilla  g-------------------ttg-----------ctga---gcagcc-ttgtgt----gcgc----tcgc
             Brush-tailed rat  g-------------------ttg-----------ctgg---gcagcc-ttgtgt---cgctg----ttgc
B D                    Rabbit  g-------------------ccg-----------ctgg---cctgccggtgtgt---cgcgc----ccgc
B D                      Pika  g-------------------ttg-----------ctgg---cctgccggtgtat---ggcgctcggccgc
B D                       Pig  g-------------------ttg-----------c-------------------------------tcgc
B D                    Alpaca  a-------------------ttg-----------c-------------------------------tcgc
               Bactrian camel  a-------------------ttg-----------c-------------------------------tcgc
B D                   Dolphin  g-------------------ttg-----------c-------------------------------ttgc
                 Killer whale  g-------------------ttg-----------c-------------------------------ttgc
             Tibetan antelope  a-------------------ttg-----------c-------------------------------tcgc
B D                       Cow  a-------------------ttg-----------c-------------------------------tcgc
B D                     Sheep  a-------------------ttg-----------c-------------------------------tcgc
                Domestic goat  a-------------------ttg-----------c-------------------------------tcgc
B D                     Horse  g-------------------ttg-----------ctgg---tcagct-gtgtgt---cttgc----tcgc
B D          White rhinoceros  g-------------------ttg-----------ctgg---ccctct-gtgtgt---ctcgt----tcgc
B D                       Cat  g-------------------ttc-----------ctgg---gcagcc-ttgttt---cgcgc----tcgc
B D                       Dog  g-------------------ttg-----------ctgg---gcagcc-tcgctt---cgcga----tcgc
B D                   Ferret   g-------------------ctg-----------ctgg---gcaacc-ttgttt---cgcgc----tctc
B D                     Panda  g-------------------ctg-----------ctgg---gcaatg-ttcttt---cgtgc----tcgc
               Pacific walrus  g-------------------ctg-----------ctgg---gcaacc-ttgtgt---cgcgc----tcgc
                 Weddell seal  g-------------------ctg-----------ctgg---gcaacc-ttgttt---cgcgc----tcgc
             Black flying-fox  g-------------------ctg-----------ctgg---ccagcc-gtgtgt---cgcgc----tcgc
B D                   Megabat  g-------------------ctg-----------ctgg---ccagcc-gtgtgt---cgcgc----tcgc
                Big brown bat  g-------------------gcg-----------ctgg---gccggc-gtgtgt---cgcgc----tcgc
         David's myotis (bat)  g-------------------gcg-----------ctgg---gccggc-gggtgt---cgcgc----tcgc
B D                  Microbat  g-------------------gcg-----------cggg---gccggc-gggtgt---cgcgc----tcgc
B D                  Hedgehog  g-------------------tca-----------cttg---cccgc------------------------
              Star-nosed mole  c-------------------ttg-----------ctgg---tcagcc-gtggct---cccgt----tagc
B D                  Elephant  g-------------------ttg-----------cggg---caagctggtgtat---agcgt----tcgc
          Cape elephant shrew  a-------------------ttg-----------ctag---caagccgatgtat---tgctt----t--c
B D                   Manatee  g-------------------ttg-----------cggg---caagctggtgtat---cgcgc----tcgc
             Cape golden mole  g-------------------ttg-----------ccgg---caagccgctgtct---cgtgc----tcac
B D                    Tenrec  c-------------------aag-----------ttgg---caagccgggggtt---cgc----------
                     Aardvark  g-------------------ttgccggcaagcaactgg---caagctggtgtat---cgcgt----tcgc
B D                 Armadillo  g-------------------tcg-----------ccgg---ctcgccggggtgg---cgcgc----tcgc
B D                   Opossum  --------------------ccg-----------gtaa---tcggcc-ccggcc---cctga----cctg
B D           Tasmanian devil  --------------------ggg-----------ataa---tcggcc-ccaggc---cttgc----ccag
  D              Saker falcon  -gtt----------------tct-----------gtgt---ccgctt-gcctgg-------c----tctg
  D          Peregrine falcon  -gtt----------------tct-----------gtgt---ccgctt-gcctgg-------c----tctg
  D       Collared flycatcher  -tgctccctgtccccgctgtccc-----------cggt---gccccc-atcccgggagccgg----cccg
  D    White-throated sparrow  ---------------------cc-----------gggt---accccc-ttgccg--caccct----ccgg
B D               Zebra finch  -ctc----------------ccc-----------acat---tccccc-atgcag---actaa----acat
B D                Budgerigar  -g--------------------------------------------t-ggatgg---gatgt----gtgt
  D                    Parrot  -ggt----------------cca-----------ttgg---ggtgcc-cggtgg---ggtgc----ccag
B D        American alligator  ---------------------ct-----------caat---gccctg-acgggg--caatgc----ccgc
B D                     Shrew  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
          Southern platyfish  ======================================================================
B D       Medium ground finch  ======================================================================
  D            Painted turtle  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Platypus  ======================================================================
  D           Green seaturtle  ======================================================================

                        Human  cagc----g--------------------gctccccctt--------ctcctcgg-cgggc-
                        Chimp  cagc----g--------------------gctccccctt--------ctcctcgg-cgggc-
                      Gorilla  cagc----g--------------------gctccccctt--------ctcctcgg-cgggc-
                    Orangutan  ccgc----g--------------------gctccccttt-----------ctcgg-cgggc-
                       Gibbon  ccgc----g--------------------gctccccctt--------ctcctcgg-cgggc-
                       Rhesus  ccgc----g--------------------gctccccctt--------cccctcgg-ccggc-
          Crab-eating macaque  ccgc----g--------------------gctccccctt--------cccctcgg-ccggc-
                       Baboon  ccgc----g--------------------gctccccctt--------cccctcgg-ccggc-
                 Green monkey  ccgc----g--------------------gctccccttt--------cccctcgg-ccggc-
                     Marmoset  ccgc----g--------------------gctccccctt--------cccctctg-ccggc-
              Squirrel monkey  ccgc----t--------------------gctccccctg--------cccctctg-ccggc-
                     Bushbaby  ccgc----g--------------------gctcttccct--------ccccacag-------
           Chinese tree shrew  ccgc----g--------------------gctctcccct--------accct-ag-ccggc-
                     Squirrel  ccgc----g--------------------gttctcccct--------cc-ctctg-ccgg--
       Lesser Egyptian jerboa  ccgc----c--------------------cgtacctgtc--------cc-tttc--tcggc-
                 Prairie vole  tcgc----c--------------------ggtggctgtc-----------------ccag--
              Chinese hamster  ccgc----c--------------------ggtggctgtc-----------------ccagc-
               Golden hamster  ccgc----c--------------------ggtggctgtc-----------------ccagc-
                        Mouse  ccgc----c--------------------ggtgtctgtc--------cc-tttgg-ccagt-
                          Rat  ccgc----c--------------------agtgtctgtc--------tc-tttag-ccagc-
               Naked mole-rat  ccgc----a--------------------gctaatccct--------tccccctg-ccggc-
                   Guinea pig  ccac----a--------------------gctgctcctt--------ttcctctg-ccggc-
                   Chinchilla  tcgc----a--------------------cctattccct--------tctccctg-ccggc-
             Brush-tailed rat  ccgt----a--------------------gttatttctt--------tc-ccctc-ccggc-
                       Rabbit  ccgc----g--------------------gcagtcccct--------ccccgacg-ccggc-
                         Pika  ccgt----t--------------------cccgtccctt--------cccccagg-ctggc-
                          Pig  cggccctcg--------------------gctctcccctcttggcctctcccctg-ccagc-
                       Alpaca  ctgccctcg--------------------actctcccct--------ctaccctg-cctgc-
               Bactrian camel  ctgccctcg--------------------actctccccc--------ctaccctgccctgc-
                      Dolphin  cggccctcg--------------------gctctcccca-----------ctctg-cttcc-
                 Killer whale  cggccctcg--------------------gctctcccca--------ctcctctg-cttcc-
             Tibetan antelope  cggcactgg--------------------gctctcccct--------ctcccttg-cctgc-
                          Cow  cggcactcg--------------------gctctcccct--------ctcccctg-cctgc-
                        Sheep  cggcactgg--------------------gctctcccct--------ctcccctg-cctgc-
                Domestic goat  cggcactgg--------------------gctctcccct--------ctcccctg-cctgc-
                        Horse  ccgcccttg--------------------gctctcccgt--------ctctccag-ccggc-
             White rhinoceros  ccgcccttg-------------gctctccgctctcccct--------ctccccag-ccggc-
                          Cat  ccgccctgg--------------------tctctcggct--------ctccccag-cccgc-
                          Dog  ccgccctcg--------------------cctctccgct--------ctccccag-cccgc-
                      Ferret   ccgccctcg--------------------gatctcccct--------ctccccaa-cccgc-
                        Panda  ctgccctcg--------------------gctctcccct--------ctcgccag-ccagc-
               Pacific walrus  cggccctcg--------------------gctct---ct--------ctccccag-cccgc-
                 Weddell seal  ccgtcctcg--------------------gctctcccct--------ctccccag-cccgc-
             Black flying-fox  tcgccctcg--------------------gctct---------------cttctg-cgggc-
                      Megabat  tcgccctcg--------------------gctct---------------cttctg-cgggc-
                Big brown bat  -cgacctcg--------------------gccct---------------ccccgg-ccggc-
         David's myotis (bat)  -cgccctcg--------------------gccct----------------cccag-ccggc-
                     Microbat  -cgccctcg--------------------gccct---------------ccccag-ccggc-
                     Hedgehog  ----cttcg--------------------cctctcccct--------cgtcccag-tcgcc-
              Star-nosed mole  ccg-cctcg--------------------gctcgcccct--------gtgcccag-cgggc-
                     Elephant  a-------c--------------------gccctgcccc--------------ag-ccggc-
          Cape elephant shrew  a-------c--------------------gccctgctcc--------------cg-------
                      Manatee  a-------c--------------------gccctgcccc--------------ag-ccggc-
             Cape golden mole  agagactgc--------------------gccc----cc--------------ag-ccggc-
                       Tenrec  --------c--------------------cccc----gc--------------ag-ccggt-
                     Aardvark  a-------c--------------------gccctgcccc------------caag-gcgcc-
                    Armadillo  --------c--------------------gccc----gc-----------------------
                      Opossum  tcgg----g--------------------gtcttcgcct--------gtc-cctg-ccggg-
              Tasmanian devil  gcgc----c--------------------gccaccgccg--------ctcgcctt-ccggg-
                 Saker falcon  ccat----g--------------------gccatcacca--------tccacgtg-gccggc
             Peregrine falcon  ccac----g--------------------gccatcacca--------tccacgtg-gccggc
          Collared flycatcher  cccc----g--------------------gtc--cccgt--------tgcccgcg-gtgccc
       White-throated sparrow  cggc----g--------------------gtc----cgg--------tgtgcggt-gcggct
                  Zebra finch  ggga----g--------------------gtc-acaccg--------cgtcccca-gcgggc
                   Budgerigar  cacc----g--------------------gct-tcctcg--------ttccctgc-ccggca
                       Parrot  cacc----gagtggggtgccccactccctgcc-ccttca--------ccccctgg-ctggtc
           American alligator  cgtc----t--------------------cgcacccctg--------cgcccctc-caggc-
                        Shrew  ==============================================================
     Mexican tetra (cavefish)  ==============================================================
           Southern platyfish  ==============================================================
          Medium ground finch  ==============================================================
               Painted turtle  ==============================================================
                      Wallaby  ==============================================================
                     Platypus  ==============================================================
              Green seaturtle  ==============================================================

Alignment block 21 of 339 in window, 27212560 - 27212560, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                      Pika  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  g
                 Killer whale  g
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  g
              Star-nosed mole  g
B D                  Elephant  c
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  c
                     Aardvark  t
B D                   Opossum  c
B D           Tasmanian devil  c
B D                     Shrew  =
  D          Peregrine falcon  =
  D              Saker falcon  =
    Mexican tetra (cavefish)  =
  D                    Parrot  -
B D                Budgerigar  -
          Southern platyfish  =
B D       Medium ground finch  =
  D            Painted turtle  =
B D               Zebra finch  -
  D       Collared flycatcher  -
B D        American alligator  -
  D    White-throated sparrow  -
         Cape elephant shrew  -
               Domestic goat  -
B D                     Sheep  -
B D                   Wallaby  =
B D                  Platypus  =
  D           Green seaturtle  =
B D                       Cow  -
            Tibetan antelope  -
B D                 Armadillo  -
B D                  Bushbaby  -

Inserts between block 21 and 22 in window
B D                  Opossum 1244bp

Alignment block 22 of 339 in window, 27212561 - 27212581, 21 bps 
B D                     Human  tgc-ggtt-------ctga-tttc----g---tccct
B D                     Chimp  tgc-ggct-------ctga-tttc----g---tccct
B D                   Gorilla  tgc-ggct-------ctga-tttc----g---tccct
B D                 Orangutan  tgc-ggct-------ctga-tttc----g---tccct
B D                    Gibbon  tgc-ggct-------ctga-tttc----g---tccct
B D                    Rhesus  tgc-ggct-------ctga-tttc----g---tccct
B D       Crab-eating macaque  tgc-ggct-------ctga-tttc----g---tccct
B D                    Baboon  tgc-ggct-------ctga-tttc----g---tccct
B D              Green monkey  tgc-ggct-------ctga-tttc----g---tccca
B D                  Marmoset  tgc-ggct-------ctga-tttc----g---tccct
B D           Squirrel monkey  tgc-ggct-------ctga-tttt----g---tccct
B D                  Bushbaby  ---------------ctga-cttc----g---tccct
           Chinese tree shrew  c-c-aact-------cgga-tttt----g---tcctc
B D                  Squirrel  tca-agct-------cgga-tttc----c---tcctc
       Lesser Egyptian jerboa  cga-gctt-------caga-tttg----g---cccct
                 Prairie vole  aga-agct-------caga-tttc----a---ccctt
B D           Chinese hamster  cca-agcc-------caga-tttc----t---ccctc
               Golden hamster  cca-agct-------caga-tttc----t---ccctt
B D                     Mouse  gga-agct-------cagattttt----g---tccct
B D                       Rat  cga-agct-------ccga-tttt----g---tccct
B D            Naked mole-rat  tga-agct-------cagg-ttta----g---ttctt
B D                Guinea pig  tca-aact-------caga-ttta----a---ttctt
                   Chinchilla  tca-aact-------c--a-ttta----a---ttttt
             Brush-tailed rat  tca-aact-------caga-ttta----a---ttctt
B D                    Rabbit  ttg-cgcc-------ccgg-cttc----g---tccct
B D                      Pika  cct-agct-------ctgg-tttc----g---tccct
B D                       Pig  cgc-agcc-------cgga-tttc----g---tccct
B D                    Alpaca  cgc-agcc-------ccga-tttc----a---tccct
               Bactrian camel  cgc-agcc-------ccga-tttc----g---tccct
B D                   Dolphin  cgc-agcc-------ccga-tttc----g---tccct
                 Killer whale  cgc-agcc-------ccga-tttc----g---tccct
             Tibetan antelope  cgc-agcc-------ccga-tttc----g---tccct
B D                       Cow  cgc-agcc-------ccga-tttc----g---ttcct
B D                     Sheep  cgc-agcc-------tcga-tttc----g---tccct
                Domestic goat  cgc-agcc-------tcga-tttc----g---tccct
B D                     Horse  cgc-agct-------ccga-tttc----g---ccccc
B D          White rhinoceros  cgc-agct-------ccat-tttc----g---tccct
B D                       Cat  ggt-ggcg-------acga-tttc----g---tccct
B D                       Dog  agt-gggt-------cgga-tttg----g---tcctt
B D                   Ferret   cgt-ggct-------cggg-ttcg----g---tcccc
B D                     Panda  cgt-gggt-------cgga-tttg----g---tccct
               Pacific walrus  cgt-ggct-------ccga-tttg----g---tccct
                 Weddell seal  c-t-ggct-------cgga-tttg----g---tccct
             Black flying-fox  ggc-agct-------ctga-ttgc----g---accct
B D                   Megabat  ggc-agct-------ctga-ttgc----g---tccct
                Big brown bat  cgc-agcg-------ccga-tttt----g---ccctt
         David's myotis (bat)  cgc-agcc-------ccgg-tttc----g---ccctt
B D                  Microbat  cgc-agcc-------ccgg-tttt----g---ccctt
              Star-nosed mole  cca-ggct-------cggg-tttc----t---tccct
B D                  Elephant  cgc-agct-------caga-tttc----g---tccct
          Cape elephant shrew  ----------------gga-tttg----g---tccct
B D                   Manatee  cgc-agct-------ccaa-tttc----g---tccct
             Cape golden mole  cgc-agct-------cgga--ttc----g---tcccc
B D                    Tenrec  tgc-agct-------ccga-cttc----g---ccccg
                     Aardvark  ctcgagcc-------cgga-tttcgttag---tcccc
B D                 Armadillo  ----gcct-------ccaa-tttg----g---tcccc
B D           Tasmanian devil  tga-agca-------cagg-acgg----gggcccccc
  D       Collared flycatcher  ---------------ccgg------------------
  D    White-throated sparrow  ---------------ctgc------------------
B D               Zebra finch  ---------------acac------------------
B D                Budgerigar  ---------------cctg------------------
  D                    Parrot  ---------------cctg------------------
B D        American alligator  ----atcctgcccgtctgc------------------
B D                  Hedgehog  -------------------------------------
B D                     Shrew  =====================================
  D          Peregrine falcon  =====================================
  D              Saker falcon  =====================================
    Mexican tetra (cavefish)  =====================================
          Southern platyfish  =====================================
B D       Medium ground finch  =====================================
  D            Painted turtle  =====================================
B D                   Wallaby  =====================================
B D                  Platypus  =====================================
  D           Green seaturtle  =====================================
B D                   Opossum  =====================================

Inserts between block 22 and 23 in window
B D          Chinese hamster 3bp
  D      Collared flycatcher 10bp
  D   White-throated sparrow 10bp
B D              Zebra finch 6bp
  D                   Parrot 26bp
B D       American alligator 4bp

Alignment block 23 of 339 in window, 27212582 - 27212588, 7 bps 
B D                     Human  gacgctt
B D                     Chimp  gacgctt
B D                   Gorilla  gacgctt
B D                 Orangutan  gacgctt
B D                    Gibbon  gacgctt
B D                    Rhesus  gaccctt
B D       Crab-eating macaque  gaccctt
B D                    Baboon  gaccctt
B D              Green monkey  gaccctt
B D                  Marmoset  gacgctt
B D           Squirrel monkey  gacgctt
B D                  Bushbaby  ggaacc-
           Chinese tree shrew  gaagctt
B D                  Squirrel  gaggcct
       Lesser Egyptian jerboa  ga-----
                 Prairie vole  gaagatt
B D           Chinese hamster  gaggatt
B D                     Mouse  gaagctt
B D                       Rat  gaagctt
B D            Naked mole-rat  gaagcct
B D                Guinea pig  gaagcct
                   Chinchilla  gaagccg
             Brush-tailed rat  gaagcct
B D                    Rabbit  ggagg-g
B D                      Pika  tcaggtg
B D                       Pig  ggggcct
B D                    Alpaca  ggggcct
               Bactrian camel  ggggcct
B D                   Dolphin  ggggcct
                 Killer whale  ggggcct
             Tibetan antelope  ggggcct
B D                       Cow  ggggcct
B D                     Sheep  ggggcct
                Domestic goat  ggggcct
B D                     Horse  gaggcct
B D          White rhinoceros  gaggtcg
B D                       Cat  gaggctt
B D                       Dog  gaggctt
B D                   Ferret   gaggctt
B D                     Panda  gaggctt
               Pacific walrus  gagactt
                 Weddell seal  gaggctt
             Black flying-fox  gaggcct
B D                   Megabat  gaggcct
                Big brown bat  gaggcct
         David's myotis (bat)  gaggcct
B D                  Microbat  gaggcct
              Star-nosed mole  gaggccg
B D                  Elephant  gaagcct
          Cape elephant shrew  taggcct
B D                   Manatee  gaggcct
             Cape golden mole  agggcct
B D                    Tenrec  gaggcct
                     Aardvark  ttggtct
B D                 Armadillo  gaggcct
B D           Tasmanian devil  gagccat
  D       Collared flycatcher  ---ag--
  D    White-throated sparrow  ---gt--
  D                    Parrot  cgcac--
B D        American alligator  ---gc--
              Golden hamster  -------
B D                  Hedgehog  -------
B D                     Shrew  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
    Mexican tetra (cavefish)  =======
B D                Budgerigar  =======
          Southern platyfish  =======
B D       Medium ground finch  =======
  D            Painted turtle  =======
B D               Zebra finch  =======
B D                   Wallaby  =======
B D                  Platypus  =======
  D           Green seaturtle  =======
B D                   Opossum  =======

Inserts between block 23 and 24 in window
B D                    Mouse 1bp
B D                      Rat 1bp
B D                      Pig 2bp
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 2bp
               Domestic goat 2bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                      Dog 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 2bp
        David's myotis (bat) 2bp
B D                 Microbat 2bp
             Star-nosed mole 6bp
B D                  Manatee 3bp
            Cape golden mole 3bp
B D                   Tenrec 3bp
                    Aardvark 3bp
B D                Armadillo 3bp
  D      Collared flycatcher 12bp
B D       American alligator 8bp

Alignment block 24 of 339 in window, 27212589 - 27212608, 20 bps 
B D                     Human  cccgaccctg--------------cc-ca-----gc-----c----------a-gg-----
B D                     Chimp  cccgaccctg--------------cc-ca-----gc-----c----------a-gg-----
B D                   Gorilla  cccgaccctg--------------cc-ca-----gc-----c----------a-cg-----
B D                 Orangutan  cccgaccctg--------------cc-ca-----gc-----c----------a-gg-----
B D                    Gibbon  cccaaccctg--------------cc-ca-----gc-----c----------a-gg-----
B D                    Rhesus  tccgaccctg--------------cc-ca-----gc-----c----------g-gg-----
B D       Crab-eating macaque  tccgaccctg--------------cc-ca-----gc-----c----------g-gg-----
B D                    Baboon  tccgaccttg--------------cc-ca-----gc-----c----------g-gg-----
B D              Green monkey  tccgaccctg--------------cc-ca-----gc-----c----------a-gg-----
B D                  Marmoset  cccgaccctg--------------cc-ca-----gc-----c----------a-gg-----
B D           Squirrel monkey  cccgaccctg--------------cc-ca-----gc-----c----------a-gg-----
B D                  Bushbaby  ----acctta--------------ccaca-----ac-----c----------g-gg-----
           Chinese tree shrew  cggaaccccagccc-cagctgtaccc-aa-----gc-----c----------g-gg-----
B D                  Squirrel  ccagatcctagt------------cc-ca-----gg----aataccccaaacg-ga-----
       Lesser Egyptian jerboa  -----cccttgt------------gt-tt-----gc-----g----------g-ga-----
                 Prairie vole  ccctagccctgt------------cc-ca-----gc----gg----------g-ga-----
B D           Chinese hamster  ccctagccctgt------------cc-ca-----gc----gg----------g-aa-----
               Golden hamster  -----gccctgt------------cc-ca-----gc----gg----------g-ga-----
B D                     Mouse  cccgggccctgt------------gc-ct-----gc----gg----------g-ga-----
B D                       Rat  ccctagccctgt------------gc-ct-----gc----ag----------g-ga-----
B D            Naked mole-rat  ccgaaaacca-t------------gc-cg-----gc----------------cgga-----
B D                Guinea pig  gtaaaccgcagg------------gc-ca-----tg----------------c-ca-----
                   Chinchilla  gtaaaccccagt------------gc-ca-----gc----------------c-ca-----
             Brush-tailed rat  gtaaa---cagt------------gc-ca-----gc----------------c-ca-----
B D                    Rabbit  cagccgccggga------------tc-cc-----gc----------------a-gc-----
B D                      Pika  cagc---------------------c-cc-----gc----------------g-gg-----
B D                       Pig  ctagc-gtaa--------------cc-ca-----gt-----c----------g-gc-----
B D                    Alpaca  cccgcggtag--------------cc-ca-----gc-----c----------g-gc-----
               Bactrian camel  cccgcggtag--------------ct-ca-----gc-----c----------g-gc-----
B D                   Dolphin  ctagacgtag--------------cc-ca-----ta-----c----------a-gc-----
                 Killer whale  ctagacgtag--------------cc-ca-----ta-----c----------a-gc-----
             Tibetan antelope  ctagccgtca--------------cc-ca-----gc-----c----------g-gc-----
B D                       Cow  ctacccgtca--------------cc-ta-----gc-----c----------g-gc-----
B D                     Sheep  ctagccgtca--------------cc-ca-----gc-----c----------g-gc-----
                Domestic goat  ctagccgcca--------------cc-ca-----gc-----c----------g-gc-----
B D                     Horse  ccagccggag--------------ca-ga-----gc-----a----------g-gc-----
B D          White rhinoceros  ccttccgaag--------------cc-gg-----gc-----a----------g-gc-----
B D                       Cat  ctcgctgtag--------------cc-cc-----gc-----c----------g-gc-----
B D                       Dog  ccagctgtag--------------cc-ca-----gc-----c----------g-gc-----
B D                   Ferret   ctagctgtag--------------cc-ca-----gc-----c----------g-gc-----
B D                     Panda  ctagctgtag--------------cc-ca-----gc-----c----------g-gc-----
               Pacific walrus  ctagctgtag--------------cc-ca-----gc-----c----------g-gc-----
                 Weddell seal  ctagctgtag--------------cc-ca-----gc-----c----------g-gc-----
             Black flying-fox  ccagcggtag--------------cg-ca-----gg-----c----------g-gc-----
B D                   Megabat  ccaggggtag--------------cg-ca-----gg-----c----------g-gc-----
                Big brown bat  ccagccccag--------------cc-ca-----gc-----g----------g-gc-----
         David's myotis (bat)  ccagtcctag--------------at-gactagtat-----g----------a-cc-----
B D                  Microbat  ccagccctag--------------at-gactagtat-----g----------a-cc-----
B D                  Hedgehog  cctgctccag--------------gc-c---------------------------------
B D                     Shrew  ccggccgcag---------------------------------------------------
              Star-nosed mole  cctgccgtag--------------cc-ca-----gc-----c----------a-gc-----
B D                  Elephant  -------------------------c-ct-----tc-----c----------g-gg-----
          Cape elephant shrew  ---------------------------cg-----tc-----c----------g-gc-----
B D                   Manatee  cctgaccccggccg-------aagtc-ca-----tc-----c----------g-gg-----
             Cape golden mole  ctctacccaggctt-------ttgtc-ca-----ac-----g----------g-gg-----
B D                    Tenrec  ttcgaacc--------------------------gc-----g----------g-gg-----
                     Aardvark  tccgacctcggccg-------tagtc-ca-----gc-----c----------g-gg-----
B D                 Armadillo  ccccgccccggcctcccgctcccgcc-cg-----gc-----c----------g-cg-----
B D           Tasmanian devil  ----cccgag--------------gc-tc-----ct-----c----------g-gc-----
  D       Collared flycatcher  ------------------------cc-cg-----gcggtccc----------g-gtgcga-
B D               Zebra finch  ------------------------cc-ca-----gc--ctcc----------t-ggacgg-
  D                    Parrot  ------------------------cc-ca-aactgccctccc----------t-tgccagg
B D        American alligator  ------------------------cc-tg-----gc--cacc----------g-agg----
  D          Peregrine falcon  =============================================================
  D              Saker falcon  =============================================================
    Mexican tetra (cavefish)  =============================================================
B D                Budgerigar  =============================================================
          Southern platyfish  =============================================================
B D       Medium ground finch  =============================================================
  D            Painted turtle  =============================================================
B D                   Wallaby  =============================================================
B D                  Platypus  =============================================================
  D           Green seaturtle  =============================================================
B D                   Opossum  =============================================================

Alignment block 25 of 339 in window, 27212609 - 27212646, 38 bps 
B D                     Human  tc---------------c-tg-----tt------ccca---------agt-ac-----------------
B D                     Chimp  tc---------------c-tg-----tt------ccca---------agt-ac-----------------
B D                   Gorilla  tc---------------c-tg-----tt------ccca---------agt-ac-----------------
B D                 Orangutan  tc---------------c-tg-----tt------ccca---------agt-ac-----------------
B D                    Gibbon  tc---------------c-ta-----tt------ccca---------agt-ac-----------------
B D                    Rhesus  tc---------------c-tg-----tt------cccg---------agt-gc-----------------
B D       Crab-eating macaque  tc---------------c-tg-----tt------cccg---------agt-gc-----------------
B D                    Baboon  tc---------------c-tg-----tt------cccg---------agt-gc-----------------
B D              Green monkey  tc---------------c-tg-----tt------cccg---------agt-gc-----------------
B D                  Marmoset  tc---------------c-ta-----tt------cccg---------agt-gc-----------------
B D           Squirrel monkey  tc---------------c-ta-----tt------cccc---------agt-gc-----------------
B D                  Bushbaby  tc---------------c-tg--tt-tt------cctg---------agc-ac-----------------
           Chinese tree shrew  cc---------------c-tg-----cc------cctg---------aat-ac-----------------
B D                  Squirrel  tc---------------c-ta-----ct------cccgagtactcacagt-ac-----------------
       Lesser Egyptian jerboa  tc---------------c-gg-----ac------cccg---------agt-cc-----------------
                 Prairie vole  tc---------------g-tg-----ct------cctc---------agt-ac-----------------
B D           Chinese hamster  tc---------------g-tgctct-ct------ctcg---------agt-gc-----------------
               Golden hamster  tc---------------g-tg-----ct------ctcg---------agt-ac-----------------
B D                     Mouse  tg---------------g-tg-----tt------gtcc---------agt-ac-----------------
B D                       Rat  tc---------------g-tg-----ct------cccg---------agt-ac-----------------
B D            Naked mole-rat  tc---------------c-tg-----ct------ctt------------t-ac-----------------
B D                Guinea pig  tc---------------cttg-----ct------cttg---------agt-ac-----------------
                   Chinchilla  tc---------------c-tg-----ct------catg---------agt-ac-----------------
             Brush-tailed rat  cc---------------c-tg-----ct------cttg---------agt-ac-----------------
B D                    Rabbit  cg---------------c-gt-----ccggctcgcggc---------gac-ac-----------------
B D                      Pika  tg---------------c-ta-----cc------cagg---------gac-gc-----------------
B D                       Pig  tccacggctccacggctc-ca-----cg------ccgg---------agt-ac-----------------
B D                    Alpaca  tc---------------c-ca-----ct------cccg---------agt-ac-----------------
               Bactrian camel  tc---------------c-ca-----ct------cccg---------agt-ac-----------------
B D                   Dolphin  tc---------------c-ca-----ct-------ccg---------agt-ac-----------------
                 Killer whale  tc---------------c-ca-----ct-------ccg---------agt-ac-----------------
             Tibetan antelope  tc---------------c-ca-----ct------cccg---------agt-ac-----------------
B D                       Cow  tc---------------c-ca-----ct------cccg---------agt-ac-----------------
B D                     Sheep  tc---------------c-ca-----ct------cccg---------agt-ac-----------------
                Domestic goat  tc---------------c-ca-----ct------cccg---------agt-ac-----------------
B D                     Horse  tc---------------c-gg-----ct------cccc---------agt-ac-----------------
B D          White rhinoceros  tc---------------c-tg-----ct------cccg---------agt-ac-----------------
B D                       Cat  tc---------------c-cg-----ct------cccg---------tgt-ac-----------------
B D                       Dog  tg---------------c-gg-----ct------cccg---------agt-cc-----------------
B D                   Ferret   -c---------------c-gg-----ct------cccg---------agt-ac-----------------
B D                     Panda  tc---------------c-gg-----ct------cttt---------agt-ac-----------------
               Pacific walrus  tc---------------c-gg-----ct------cctg---------agt-ac-----------------
                 Weddell seal  tc---------------c-gg-----ct------cttg---------agt-ac-----------------
             Black flying-fox  tc---------------c-cg-----ct------cctg---------att-ac-----------------
B D                   Megabat  tc---------------c-cg-----ct------cctg---------att-ac-----------------
                Big brown bat  tc---------------c-cg-----ct------caag---------atg-ac-----------------
         David's myotis (bat)  tc---------------c-cg-----ct------cacg---------gtg-ac-----------------
B D                  Microbat  tc---------------c-cg-----ct------cacg---------gtg-ac-----------------
B D                  Hedgehog  -------------------gg-----cc------ccgg---------agc-ac-----------------
B D                     Shrew  -------------------gg-----gt------ccgc---------ggccac-----------------
              Star-nosed mole  tc---------------t-tg-----ct------ccgg---------agc--a-----------------
B D                  Elephant  cc---------------t-gg-----ct------ccgg---------agt-tc-----------------
          Cape elephant shrew  tc---------------c-gg-----ct------ccgggctct----agt-cccaccgggctgactcacc
B D                   Manatee  cc---------------c-cg-----ct------ccgg---------agt-tc-----------------
             Cape golden mole  tc---------------c-ca-----ct------ctcg---------agt-tc-----------------
B D                    Tenrec  ----------------------------------------------------c-----------------
                     Aardvark  -c---------------c-gg-----ct------ccct---------ggt-gc-----------------
B D                 Armadillo  tc---------------c-gg-----ct------cccg---------ggg-ac-----------------
B D           Tasmanian devil  ac---------------c-tt-----ct------cccg---------gac-tg-----------------
  D       Collared flycatcher  ---------------------cactcac------cggc---------agc-gt-----------------
B D               Zebra finch  ---------------------ccctggc------ccaa---------ggc-tc-----------------
B D        American alligator  --------------------------ac------ctga---------gcg-gc-----------------
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                Budgerigar  ======================================================================
          Southern platyfish  ======================================================================
B D       Medium ground finch  ======================================================================
  D            Painted turtle  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Platypus  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================

                        Human  -----tc-acgt-cg----t----------gcaggc---ctt-----------cggc
                        Chimp  -----tc-acgt-cg----t----------gcaggc---ctt-----------cggc
                      Gorilla  -----tt-acgt-cg----t----------gcaggc---ctt-----------cggc
                    Orangutan  -----tc-aagt-cg----t----------gcaggc---ctt-----------cggc
                       Gibbon  -----tcaacgt-cg----t----------gcaggc---ctt-----------cggc
                       Rhesus  -----tc-acgt-cg----t----------gcaggc---ttt-----------cggc
          Crab-eating macaque  -----tt-acgt-cg----t----------gcaggc---ttt-----------cggc
                       Baboon  -----tc-acgt-cg----t----------gcaggc---ttt-----------cggc
                 Green monkey  -----tc-acgt-cg----t----------gcaggc---ctt-----------cggc
                     Marmoset  -----tc-acgt-cg----t----------gcaggc---ctt-----------cgac
              Squirrel monkey  -----tc-acgt-cg----t----------gcaggc---ctt-----------cggc
                     Bushbaby  -----tc-aa-------------------------------------------ccat
           Chinese tree shrew  -----tc-acgt-ag----c----------gcaagc---ctc-----------tggc
                     Squirrel  -----tc-acgt-tg----c----------ccaggc---ctc-----------cggc
       Lesser Egyptian jerboa  -----tc-acac-cg----c----------gcag-----------------------
                 Prairie vole  -----tc-tcgt-ag----c----------gccggc---cac-----------tggc
              Chinese hamster  -----tc-acgt-ag----t----------gccggc---cac-----------tggc
               Golden hamster  -----tc-acgt-ag----c----------gcaggc---cac-----------tggc
                        Mouse  -----tc-acgt-ag----t----------gcaggc---cac-----------tagc
                          Rat  -----tc-acat-ag----t----------gctggt---cac-----------tagc
               Naked mole-rat  -----tc-acat-tg----c----------ccaggc---atc-----------cgga
                   Guinea pig  -----tc-ccgt-tg----c----------ccagac---atc-----------cgga
                   Chinchilla  -----tc-acat-cg----g----------ccagtc---atc-----------cgga
             Brush-tailed rat  -----tc-acat-tg----c----------ccaggc---atc-----------cgga
                       Rabbit  -----tc-tcgt-ca----c----------tctggc---ctc-----------gggc
                         Pika  -----ct---------------------------gc---ctc-----------aggt
                          Pig  -----tc-acgc-tg----c----------t---gt---ctc----------ccagc
                       Alpaca  -----tc-acgc-tg----c----------t---gt---ctc----------ccagc
               Bactrian camel  -----tc-acgc-tg----c----------t---gt---ctc----------ccagc
                      Dolphin  -----tc-aggc-cg----c----------t---gt---ctc----------gcagc
                 Killer whale  -----tc-aggc-cg----c----------t---gt---ctc----------gcagc
             Tibetan antelope  -----tccacgc-cg----c----------t---gtcatctc----------ccagc
                          Cow  -----tcaacgc-ct----c----------t---gt---ctc----------ccagc
                        Sheep  -----tccacgc-cg----c----------t---gtcgcctc----------ccagc
                Domestic goat  -----tccacgc-cg----c----------t---gtcgcctc----------ccagc
                        Horse  -----tc-acgc-tg----c----------gcgggt---ctc----------ccagc
             White rhinoceros  -----tc-acgc-tgcgctc----------gctggt---ctc----------ccagc
                          Cat  -----tc-acgc-tg----c----------gtaggt---ccc----------ccagt
                          Dog  -----gc-acgc-tg----c----------gcaggt---ctc----------ccagt
                      Ferret   -----tc-acgc-tg----c----------tcaggt---ctc----------ccggt
                        Panda  -----tc-acgc-tg----c----------gcaggt---gtc----------ccgct
               Pacific walrus  -----tc-acgc-cg----c----------gcaggt---ctc----------ccggt
                 Weddell seal  -----tc-acgc-cg----c----------gcaggt---ctc----------ccggt
             Black flying-fox  -----tc-aggc-tg----c----------acagtt---ttc----------ccagc
                      Megabat  -----tc-aggc-tg----c----------acagtt---ttc----------ccagc
                Big brown bat  -----tc-actc-tg----c----------gcaggt---ttc----------cca--
         David's myotis (bat)  -----tc-actc-tg----c----------gcaggt---ttc----------ccagc
                     Microbat  -----tc-actc-tg----c----------gcaggt---ttc----------ccagc
                     Hedgehog  -----cg-acgctgg----c----------actggt---ctc----------ccg--
                        Shrew  -----tc-acgc-cc----c----------gccgct---ctc----------ccggc
              Star-nosed mole  -----tc-acgc-gg----c----------gctgag---ctt----------acggc
                     Elephant  ------------------------------gcacgc---ctc----------ctggc
          Cape elephant shrew  agcgatc-acga-ta----actctgtgcaggcctcc---ctc----------ccggc
                      Manatee  -----tc-acgg-ca----c----------gcgagc---ctc----------caggc
             Cape golden mole  -----tc-ccgc-tg----t----------gcaggc---ttc----------ctagc
                       Tenrec  -----ct-ccaa-cg----c----------gccggc---ctc----------ccggc
                     Aardvark  -----tc-acgc-tt----t----------gcaagc---ctc----------ccggc
                    Armadillo  -----tc-acgc-cg----c----------tccggc---ctt----------ccggc
              Tasmanian devil  -----tc-gccc-tt----c----------cccgac---ccc-----------ccca
          Collared flycatcher  -----tc-accc-ca----t----------gtgagc---ccg-----------cagc
                  Zebra finch  -----cc-gtgc-cc----c----------acagac---ccc-----------cggc
           American alligator  -----tg-gtac-cc----c----------cccaac---cacgtcttcacngtcagc
             Peregrine falcon  =========================================================
                 Saker falcon  =========================================================
     Mexican tetra (cavefish)  =========================================================
                   Budgerigar  =========================================================
           Southern platyfish  =========================================================
          Medium ground finch  =========================================================
               Painted turtle  =========================================================
                      Wallaby  =========================================================
                     Platypus  =========================================================
              Green seaturtle  =========================================================
                      Opossum  =========================================================

Inserts between block 25 and 26 in window
  D      Collared flycatcher 4468bp
B D       American alligator 3bp

Alignment block 26 of 339 in window, 27212647 - 27212658, 12 bps 
B D                     Human  gcccc--------a---gtcctg
B D                     Chimp  gcccc--------a---gtcctg
B D                   Gorilla  gcccc--------a---gtcctg
B D                 Orangutan  gcccc--------a---gtcctg
B D                    Gibbon  gcccc--------c---gtcctg
B D                    Rhesus  gcccc--------a---gtcctg
B D       Crab-eating macaque  gcccc--------a---gtcctg
B D                    Baboon  gcccc--------a---gtcctg
B D              Green monkey  gcccc--------a---gtcctg
B D                  Marmoset  gcccc--------c---gtcctg
B D           Squirrel monkey  gcccc--------a---gtcctg
B D                  Bushbaby  gcccc--------c---gccctg
           Chinese tree shrew  g-ccc--------a---gctctg
B D                  Squirrel  gccct--------c---gccttg
       Lesser Egyptian jerboa  --cct--------c---gc--tg
                 Prairie vole  acctt--------c---gccctg
B D           Chinese hamster  acctt--------t---gccttg
               Golden hamster  acctt--------t---gccttg
B D                     Mouse  acctt--------c---gccctg
B D                       Rat  acttt--------c---gccctg
B D            Naked mole-rat  gtcct--------c---gccctg
B D                Guinea pig  gccct--------c---gccctg
                   Chinchilla  gccct--------c---gtcctg
             Brush-tailed rat  gctct---------------ctg
B D                    Rabbit  gctcg--------c---gccgac
B D                      Pika  gcccc--------c---gccccg
B D                       Pig  gcctc--------c---gcgctg
B D                    Alpaca  acctt--------c---acccag
               Bactrian camel  acctt--------c---accctg
B D                   Dolphin  gcctt--------c---tccttg
                 Killer whale  gcctt--------c---tccttg
             Tibetan antelope  gcttt--------c---gccctc
B D                       Cow  gcttt--------c---gccctg
B D                     Sheep  gcttt--------c---gccctc
                Domestic goat  gcttt--------c---gccctc
B D                     Horse  accct--------c---gccctg
B D          White rhinoceros  gccctcgccctgcc---gccctg
B D                       Cat  gacct--------c---gccttg
B D                       Dog  gccct--------c---gacctg
B D                   Ferret   gccct--------c---gccctg
B D                     Panda  gccct--------c----ccctg
               Pacific walrus  gtcct--------c---gccctg
                 Weddell seal  gccct--------c---gccctg
             Black flying-fox  gccct--------c---gcattg
B D                   Megabat  gccct--------c---gcattg
                Big brown bat  -----------------gccctg
         David's myotis (bat)  gccct--------g---gccctg
B D                  Microbat  gccct--------g---gccctg
B D                     Shrew  gtctc--------g---gggtcg
              Star-nosed mole  tctct--------g---gccctg
B D                  Elephant  gcccc--------c---gccctg
          Cape elephant shrew  gcccc--------c---gccctg
B D                   Manatee  gcctc--------c---gccctg
             Cape golden mole  gatcc--------c---accttg
B D                    Tenrec  gaccc--------c---gtccgt
                     Aardvark  gtctc--------c---gccctg
B D                 Armadillo  gcccc--------a---gccccg
B D           Tasmanian devil  gcccc--------c---gccccg
B D               Zebra finch  gcccc--------cgaggctctg
B D        American alligator  gccac--------c---accctg
B D                  Hedgehog  -----------------------
  D          Peregrine falcon  =======================
  D              Saker falcon  =======================
    Mexican tetra (cavefish)  =======================
B D                Budgerigar  =======================
          Southern platyfish  =======================
B D       Medium ground finch  =======================
  D            Painted turtle  =======================
  D       Collared flycatcher  =======================
B D                   Wallaby  =======================
B D                  Platypus  =======================
  D           Green seaturtle  =======================
B D                   Opossum  =======================

Inserts between block 26 and 27 in window
B D          Tasmanian devil 1242bp

Alignment block 27 of 339 in window, 27212659 - 27212664, 6 bps 
B D                     Human  ccgact
B D                     Chimp  ccgact
B D                   Gorilla  ccgact
B D                 Orangutan  ccgact
B D                    Gibbon  ccgact
B D                    Rhesus  ccaact
B D       Crab-eating macaque  ccaact
B D                    Baboon  ccgact
B D              Green monkey  ccgact
B D                  Marmoset  ccgact
B D           Squirrel monkey  ctgact
B D                  Bushbaby  tcaatg
           Chinese tree shrew  ctgact
B D                  Squirrel  cccaca
       Lesser Egyptian jerboa  cccat-
                 Prairie vole  cccaca
B D           Chinese hamster  cccaca
               Golden hamster  cccaca
B D                     Mouse  cccaca
B D                       Rat  cccaca
B D            Naked mole-rat  cccgcc
B D                Guinea pig  cccg--
                   Chinchilla  cccgca
             Brush-tailed rat  cccgca
B D                    Rabbit  accacg
B D                      Pika  actatg
B D                       Pig  ccgatg
B D                    Alpaca  ctgacg
               Bactrian camel  ctgacg
B D                   Dolphin  ccgacg
                 Killer whale  ccgacg
             Tibetan antelope  ctgacg
B D                       Cow  ctgacg
B D                     Sheep  ctgacg
                Domestic goat  ctgacg
B D                     Horse  ccgacg
B D          White rhinoceros  ccgacg
B D                       Cat  ctgacg
B D                       Dog  ctgacg
B D                   Ferret   ctgacg
B D                     Panda  ctgacg
               Pacific walrus  ctgacg
                 Weddell seal  ctgacg
             Black flying-fox  cctacg
B D                   Megabat  cctacg
                Big brown bat  ccgagg
         David's myotis (bat)  ccgaca
B D                  Microbat  ccgaca
B D                  Hedgehog  ---gag
B D                     Shrew  ctcgga
              Star-nosed mole  ccagcg
B D                  Elephant  cctacc
          Cape elephant shrew  cctacc
B D                   Manatee  cctacc
             Cape golden mole  cctacc
B D                    Tenrec  cctacc
                     Aardvark  cctacc
B D                 Armadillo  ctgcag
B D               Zebra finch  ctgcct
  D          Peregrine falcon  ======
  D              Saker falcon  ======
    Mexican tetra (cavefish)  ======
B D                Budgerigar  ======
          Southern platyfish  ======
B D       Medium ground finch  ======
  D            Painted turtle  ======
  D       Collared flycatcher  ======
B D                   Wallaby  ======
B D           Tasmanian devil  ======
B D                  Platypus  ======
  D           Green seaturtle  ======
B D                   Opossum  ======

Inserts between block 27 and 28 in window
B D              Zebra finch 4537bp

Alignment block 28 of 339 in window, 27212665 - 27212812, 148 bps 
B D                     Human  ttcaaagacctgtgaaa-cttgatttc---gcc-----c----cttaat-tt--tagaataactttaa--
B D                     Chimp  ttcaaagacctgtgaaa-cttgatttc---gcc-----c----cttaat-tt--tagaataactttaa--
B D                   Gorilla  ttcaaagacctgtgaaa-cttgatttc---gcc-----c----cttaat-tt--tagaataactttaa--
B D                 Orangutan  ttcaaagacctgtgaaa-cttgatctc---gcc-----c----cttaat-tt--ttgaataactttaa--
B D                    Gibbon  ttcaaagatctgtg-aa-cttgatctc---gcc-----c----cttaat-tt--ttgaataactttaa--
B D                    Rhesus  tccaaagatctgtgaaa-cttgatctc---gtc-----c----cttaat-tt--ttgagtaactttaa--
B D       Crab-eating macaque  tccaaagatctgtgaaa-cttgatctc---gtc-----c----cttaat-tt--ttgagtaactttaa--
B D                    Baboon  tccaaagatctgtgaaa-cttgatctc---gtc-----c----cttaat-tt--ttgagtaactttaa--
B D              Green monkey  tccaaagatctgtgaaa-cttgatctc---gtc-----c----cttaat-tt--ttgagtaactttac--
B D                  Marmoset  ttcaaagacctgtgaaa-cttgatctc---ttt-----c----cttaat-tt--tagaataa--------
B D           Squirrel monkey  ttcaaagacctgtgaaa-cttgatctc---gtt-----c----cttaat-tt--tagaataa--------
B D                  Bushbaby  ttaaaagacctgtgaaa-cttcgactccttgtt-----g----tttaac-ct--tttaataa--------
           Chinese tree shrew  ttcagagccgtttggaa-tttaacctt----------------------------tgagtaaattcaa-g
B D                  Squirrel  ttcaaagacctatgaaa-ttcgacctc---ctc--tctc----ctcagc-ct--ttgaataattttaa-a
       Lesser Egyptian jerboa  ------------------tttgatctc---ctt--------------gctcc--ctaaatgacttcaa-g
                 Prairie vole  ttcagagacctttgaaa-tttgatctc---ctt--------------gcttt--ttgaataactttaa-a
B D           Chinese hamster  ttcagagacctttgaaa-ttggatctc---ctt--------------gc-tt--ttgagtaacttta---
               Golden hamster  ttcagagacctttgaca-tctgatctc---ctt--------------gc-tt--ttgagtaactttat-a
B D                     Mouse  ttcagagtcctttgaaa-tttgatctc---ctt--------------gc-tt--ttgaataattttaa-a
B D                       Rat  ttcagagacctttgaaa-tttgatctc---ctt--------------gc-tt--ctgaataactttaa-a
B D            Naked mole-rat  ttcaaagacatttgaaa-tttgatttc---tta--gctc----cttaat-ct--ttgaat-------a-a
B D                Guinea pig  --caaagacctttgcaa-tttaatttc---ttc--tttc----cctaat-ct--ttgagtaacttt-a-a
                   Chinchilla  ttcaaagacctttgaaa-tttaatttc---ttt--tctc----cttaat-ct--ttgaataact---a-a
             Brush-tailed rat  ttcaaagacctttgaaa-tttaagttc---tg-----gc----cttaat-ct--ttgagtagcttg-a-a
B D                    Rabbit  ttcaaaggcctttgaaa-tttgatctc---ctc--gctg----cttcat-ct--ttgaatgacttaaa-a
B D                      Pika  tccagaagcctttgaag-tgaaat------ctc--gctg----tttcat-ct--ttggatcacttaaa-a
B D                       Pig  tccaaagacctttgaaa-tttgacctc---ctc--cctc----ctcaat-gt--ttgagtaacttttaag
B D                    Alpaca  tccacagaactttgaaa-tctgaccct---ttt--actc----cttaat-ct--ttgaataactttaa-g
               Bactrian camel  tccacagaactttgaaa-tctgacctt---ttt--actc----cttaat-ct--ttgaataactttaa-g
B D                   Dolphin  tccaaagaccttctaaa-tttgacctc---ctt--gcac----cttaaa-atcgttgaataactttaa-g
                 Killer whale  tccaaagaccttctaaa-tttgacctc---ctt--gcac----cttaaa-atcgttgaataactttaa-g
             Tibetan antelope  tccaaagacgtttgaaa-tttgacctc---ctc--gctc----cttagt-at--tcgaataactataa--
B D                       Cow  tccaaagacgtttgaaa-tttgacctc---ctc--gctcgaatagttat-at--tggaataactataa--
B D                     Sheep  tccaaagacgtttgaaa-tttgacctc---ctc--gcac----cttagt-at--tcgaataactatga--
                Domestic goat  tccaaagacgtttgaaa-tttgacctc---ctc--gctc----cttagt-at--tcgaataactatga--
B D                     Horse  tccaaagacctttgaaa-tttgatctc---ctc--gctc----cttaat-ct--ttgaataa--------
B D          White rhinoceros  tccaaagagctttgaaa-tttgat------ctc--gctc----cttaat-gt--ttgaataattttaa-g
B D                       Cat  t----ggacctttaaaa-tttgatctc---ctt--gctc----ttt---------tgaataattgtaa-a
B D                       Dog  t----agacctttaaaa-tgtgatctc---ctt--cttc----cttaat-ct--ttgaataactttaa-a
B D                   Ferret   t----agacctttaaaa-tctgatttc---ctt--gttc----cttaat-c----tgagtaactttaa-a
B D                     Panda  t----agacctttaaat-tttgatctc---ctt--gttc----cttaat-ct--ttgaataacttgaa-g
               Pacific walrus  t----agacctttaaaa-tttgatctc---ctt--tttc----cttaat-ct--ttgaataaccttaa-g
                 Weddell seal  a----agacctttaaaa-tttgatctc---ctt--gttc----cttaat-ct--ttgaataactttaa-a
             Black flying-fox  tccaaaagcctttgaac-tttgacctt---ctc--tctc----ctttat-ct--ttgaataatattaa-a
B D                   Megabat  tccaaaagcctttgaac-tttgacctt---ctc--tctc----ctttat-ct--ttggataatattaa-a
                Big brown bat  tcccaagacctttcaac-tttgacctc---ctc--gcgc----ctggat-ct--ttgaataacttaa---
         David's myotis (bat)  gcctcagacctttcacc-tttgacctc---ctc--gcgc----ctggat-ct--ctgaataact------
B D                  Microbat  gccccagacctttcacc-tttgacctc---ctc--gcgc----ctggat-ct--ctgaataact------
B D                  Hedgehog  cccgcggatgtttgaga-tcggacctc---ttctcgccc----ctcact-gt--gggaacaacttcga-a
B D                     Shrew  tccacaaacctttgcac-tttgacccc---ctc--gctc----caaaat-ct--tggaatagctttga-g
              Star-nosed mole  tccaaaggcctttgaaa-tttgatctc---ctc-------------aat-ct--ttgaataacttgaa-g
B D                  Elephant  tttaaagac--ttgaaa-tttgacctc---ctc--a-------ctcagt-tt--ttgaagagcttgaa-g
          Cape elephant shrew  ttgaaagacctttgaaa-tgtgacctt---ct-----------cttaat-ct--ttgaagagcttgat-g
B D                   Manatee  tttaaagacctttgaaa-tttgacctc---ctc--actc----cttaat-ct--ttgaa----------g
             Cape golden mole  ttaagagaccgttgaaaatctgagctc---ctc--actg----cttaat-ct--ttgaacagtttgac-g
B D                    Tenrec  tttcgaggcctttgaagtttcgatggt---ctc--gc-g----cctcag-ct--cggaagcgctggac-g
                     Aardvark  ttgaaagacctttgaaa-ttttgtctc---ctt--actc----cttaat-ct--ttaaagagcttcaa-g
B D                 Armadillo  ctcaggaacctttgaaa-tttga---c---ctc--gctc----cttact-ct--ttaaataactttaa-a
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                Budgerigar  ======================================================================
          Southern platyfish  ======================================================================
B D       Medium ground finch  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================

                        Human  --gttc-tttc--tacaga-cgggtcctct----gcctc-ttgtgtaat----ctc-tctacgca----c
                        Chimp  --gttc-tttc--tacaga-cgggtcctct----ggctc-ttgtgtaat----ctc-tctacgca----c
                      Gorilla  --gttc-tttc--tacaga-cgggtcctct----gcctc-ttgtgtaat----ctc-tctacgca----c
                    Orangutan  --gttc-tttc--tacaga-cgggtcctct----ggctc-ttgtgtaat----ctc-tctacgca----c
                       Gibbon  --gttc-tttc--tacaga-cgggtcctct----ggctc-ttgtataat----ctc-tctacgca----c
                       Rhesus  --gtta-tttc--tacaga-cgggtcctct----ggctc-ttgtgaaag----ctc-tctacgcc----t
          Crab-eating macaque  --gtta-tttc--tacaga-cgggtcctct----ggctc-ttgtgaaag----ctc-tctacgcc----c
                       Baboon  --gtta-tttc--tacaga-cgggtcctct----ggctc-ttgtgcaag----ctc-tctacgcc----c
                 Green monkey  --atta-tttc--tacaga-cgggtcctct----ggctc-ttgtgcaag----ctc-tctacgcc----c
                     Marmoset  --gctc-tttc--tacaga-cgggtcctct----ggctctttgtgtaag------c-tctacgta----c
              Squirrel monkey  --gttc-tttc--t--aga-ggggtcctct----ggctctttgtgcaag------c-tctacgca----c
                     Bushbaby  --gttc-tttc--tacaga-cgagtcttct----ggctc-t--tccaag----ctc-tcgactca----c
           Chinese tree shrew  tcgttc-tttt--tacgaa-cgagtcggcc----ggctc-ttctgcatg----ctc-tgcacgca----c
                     Squirrel  t---tc-ttcg--tgcgga-tgagtcctat----gactc-ttttgcaag----ctg-tccagtca----c
       Lesser Egyptian jerboa  ttgctc-ttcc--cacgga-tccgtcctct----ggctc-ttcagccaa----ctg-tccatgca----g
                 Prairie vole  ttgttc-ttcc--cactct-agagtcccc-----ggctc-ctctgccag----ctg-tccttgca----c
              Chinese hamster  -----------------cc-agagtccccc----ggccc-ctcggccagctgtctg-tccttgca----c
               Golden hamster  ttgttc-ttct--cactcc-agagtcccct----ggctc-ctcggccag----ctg-tccttgca----c
                        Mouse  tagtgc-ttcc--cagac---gagtcccag----ggttc-ttctgccag----ctc-tccttgca----c
                          Rat  ttgttc-ttcc--cactcc-agagtcccat----ggttc-ttctgctaa----cca-ctgttgca----c
               Naked mole-rat  ctgtgc-ttcg--taatac--gagtcttct----ggctg-tactgcgag----ccg-tccacgca----c
                   Guinea pig  ctgtat-ctcc--tga------cgtcctgt----ggccc-ttctgcgag----ctg-tccatgca----c
                   Chinchilla  ctgtgc-ctcc--tgaaac--gagtcttct----ggccc-ttctgtgag----ctg-tccacgcg----c
             Brush-tailed rat  ctgtgc-ctct--tgcatc--gagccttcc----ggccc-ttccgtgag----ctg-aggacgcgcgccc
                       Rabbit  acattg-ttgg--aacgga-cgggtc-tct----ggctc-tcgggctcg----ctg-tccacgca----c
                         Pika  ttgttc-ttag--a--------------ca----agttc-t-----------------------------
                          Pig  ttttcc-tttc--taccaa-caagtcctct----ggtta-ttctgcaaa----atc-acgacgca----c
                       Alpaca  ttgttc-tttc--cacaaa-cgagtcctct----ggcca-ttctg-------------------a----c
               Bactrian camel  ttgttc-tttc--cacaaa-cgagtcctct----ggcca-ttctg-------------------a----c
                      Dolphin  tcgttc-tttc--tacaaa-cgagacctct----ggcca-ttctgcaag----cttaacagcgta----c
                 Killer whale  tcgttc-tttc--tacaaa-cgagacctct----ggcca-ttctgcaag----cttaacagcgta----c
             Tibetan antelope  --gttc-tttc--cac-aa-tgggtcctcc----ggccg-ttctgcaag----ctt-gctgcgtt----c
                          Cow  --gttc-tttc--cacaaa-tgagccctcc----ggccg-ttctgcaag----ctt-gctgcgtt----c
                        Sheep  --gttc-tttc--cac-aa-tgggtcttcc----ggccg-ttctgcaag----ctt-gctgcgtt----c
                Domestic goat  --gttc-tttc--cgc-aa-tgggtcttcc----ggccg-ttctgcaag----ctt-gctgcgtc----c
                        Horse  --gttt-tttc--taca----gagtcctct----ggctc-ttgtgcaag----ctc-gccacgga----c
             White rhinoceros  ttgtta-tttc--tacgga-cgagtgcact----ggctc-ttctgagag----ctc-gccacgct----g
                          Cat  t-tgtt-cttc--taccga-cgagtcctct----gactg-tacttcacc----ctc-gtcacgcg----c
                          Dog  t-gttt-cgac--tactgaccgagtcctct----ggctc-ctcttcaag----ctc-gtcacgcg----c
                      Ferret   a-tttt-cggc--tacggt-cgagttctct----ggctc-t---tcaag----ctc-atcacgcg----c
                        Panda  t-tttt-cggc--taccga-cgagtc--ct----ggctc-t---tcaag----ctc-gtcactcg----c
               Pacific walrus  t-tttt-cggt--taccg--cgagccctct----ggctc-ttcttcaag----ctc-gtcaggcg----c
                 Weddell seal  t-tttt-cggc--taccga-cgagtcctct----ggctc-ttcctcaag----ctc-gtcacgcg----c
             Black flying-fox  ttgttc-tttg--tacaga-cgagtcctct----ggctc-ttctgctgg----ctc-tccacgca----c
                      Megabat  ttgttc-tttg--tacaga-cgagtcctct----ggctc-ttctgctgg----ctc-tccatgca----c
                Big brown bat  --gttc-tttc--tgcgga-tgagcccttt----ggctc-ttccgcagg----ctc-tccacgca----c
         David's myotis (bat)  -----------------aa-tgagcccttt----ggcgc-ttgtgcagg----ctc-tccacgca----c
                     Microbat  -----------------aa-tgagcccttt----ggctc-ttgtgcagg----ctc-tccacgca----c
                     Hedgehog  ccgttc-tttg--caccga-agagtcctctgcaagactc-ttctgcaag----ctc-accgcata----c
                        Shrew  ttgccc-tttg--tccgga-cgcagc--------ggg------tgcgag----tcc-gc----------g
              Star-nosed mole  ttgttc-tttg--tacaga-catgtccct-----ggatg-ttctgcaag----ctc-gcctcgca----c
                     Elephant  cttgtc-tttc--aacaga-gcagtcttgt----ggctc-ttctgtaag----ctg-tgcgcgca----c
          Cape elephant shrew  ttaata-tttc--aataga-cgagttttct----gacca-ttc--taaa----ctg-tccacacg----g
                      Manatee  ttattc-tttc--aacaga-ccagtcttct----ggctc-ttctgtaag----ctg-tgcgcgca----c
             Cape golden mole  ttgttc-tgtc--aacaga-ttagtctcct----ggctt-ctctgtaaa----ctg-tccacgca----c
                       Tenrec  ttgttc-tttc--cgcaga-ggagtctccg----ggctc-ttccct-aa----ctg-tccacgca----t
                     Aardvark  ttactcttttc--agtaga-cgagtcttct----ggctc-tgctgtacg----ctc-tccacgca----c
                    Armadillo  ttatcc-tttcaaaacaca-cgagccttgc----ggctc-tttgataag----cgc-tccacgcc----a
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                   Budgerigar  ======================================================================
           Southern platyfish  ======================================================================
          Medium ground finch  ======================================================================
               Painted turtle  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================
                      Wallaby  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
              Green seaturtle  ======================================================================
                      Opossum  ======================================================================

                        Human  gaacg----ccat---atat--cgtgcggtggtagggct-------------------------------
                        Chimp  gaacg----ccat---atat--cgtgcggtggtagggct-------------------------------
                      Gorilla  gaacg----ccat---atat--cgtgcggtggtagggct-------------------------------
                    Orangutan  gaacg----ccat---atat--cgtgcggtggtagggct-------------------------------
                       Gibbon  gaacg----ccat---atat--cgtgcggtggtagggct-------------------------------
                       Rhesus  gaaca----ccat---atat--cgtgcagtggtaggact-------------------------------
          Crab-eating macaque  gaaca----ccat---atat--cgtgcagtggtagggct-------------------------------
                       Baboon  gaaca----ctat---atat--cgtgcagtggtagggct-------------------------------
                 Green monkey  gagca----ccat---atat--cgtgcagtggtagggct-------------------------------
                     Marmoset  gaatg----ccgt---gtat--cgtgcggtggtagggct-------------------------------
              Squirrel monkey  gaaag----ccgt---gtat--cgtgcggtggtagggct-------------------------------
                     Bushbaby  gaata----ccgt-acatat--cgtgcggtggtagaact-------------------------------
           Chinese tree shrew  taatg----ctgt---acat--cgtgcggtggtaggacc-------------------------------
                     Squirrel  gaatg----ccgt---gcgt--ggtgcggtgataggact-------------------------------
       Lesser Egyptian jerboa  gcatgcctccctt---ccat--gctgcagtggtagcgct-------------------------------
                 Prairie vole  gaata----ccgt---gcgt--gctgcaatggcatgact-------------------------------
              Chinese hamster  ggata----ctgt---gcgt--g-tgcattggcaggact-------------------------------
               Golden hamster  gaata----ttgt---ccgt--actgctttggcatgact-------------------------------
                        Mouse  gaatg----ctgt---gcgt--ggtgcaatggcacgactatctatctatctatctatctatctatctatc
                          Rat  gaatg----ctgt---gcgt--ggtgcaacggcacgact-------------------------------
               Naked mole-rat  aagtg----ccgt---acct--ggtcctgcagtagaact-------------------------------
                   Guinea pig  g-gta----ccgt---gcct--ggt-ctgcggtagaact-------------------------------
                   Chinchilla  gagtg----cctt---acct--ggtcctgcggtag-acc-------------------------------
             Brush-tailed rat  gaatg----ccgt---acct--ggtcctgcggtagaact-------------------------------
                       Rabbit  ---tg-------------------tgccgcggttggacg-------------------------------
                         Pika  ----------------------------------------------------------------------
                          Pig  gaacg----ccgt---atac--cctgcggtggctggact-------------------------------
                       Alpaca  gaatg----ccat---atat--cgtgtggtggcaggac--------------------------------
               Bactrian camel  gaatg----ccat---atat--cgtgtggtggcaggac--------------------------------
                      Dolphin  gaatg----ccgt---atat--cgtgcgttggcaggact-------------------------------
                 Killer whale  gaatg----ccgt---gtat--cgtgcgttggcaggact-------------------------------
             Tibetan antelope  taatg----ccgctggatag--catgcgttggtaggact-------------------------------
                          Cow  taatg----ccgctggatag--cgtgcgttggtaggact-------------------------------
                        Sheep  taatg----ccgctggatag--cgtgcgttggtaggact-------------------------------
                Domestic goat  taatg----ccgctggatag--cgtgcgttggtaggact-------------------------------
                        Horse  gaatg----ccgt---atat--cgtgccgtggcgggact-------------------------------
             White rhinoceros  aaatg----ccgt---atgc--cgtgcggtggcaggact-------------------------------
                          Cat  gaatg----ccgt---atat--cgtgccctggcaggact-------------------------------
                          Dog  gaatg----ccgt---atat--cgtgcccgggcagtact-------------------------------
                      Ferret   aaatg----ccgt---atat--tgtgctcgggcagtact-------------------------------
                        Panda  gaatg----cagt---atgt--cgcgctctggcagtact-------------------------------
               Pacific walrus  ggatg----ccgt---atat--tgtgctctggcagtact-------------------------------
                 Weddell seal  caatg----ccgt---atat--cgtgctctggcagtact-------------------------------
             Black flying-fox  aaatg----tcgc---atat--cgtgcggtgataggact-------------------------------
                      Megabat  aaatg----tcgc---atat--cgtgcggtgataggact-------------------------------
                Big brown bat  gaatg----ccgc--agtgtggagtgcggtggccggact-------------------------------
         David's myotis (bat)  gaatg----ccgc---gtgtgcagtgcggtggcaggact-------------------------------
                     Microbat  ggctg----ccgc---gtgtgcagtgcgggggcaggact-------------------------------
                     Hedgehog  gaatg----tcat---gcgt--tgg--cgggcctgtact-------------------------------
                        Shrew  gggtg----ccgc---ttgc--ggagccgcgtcc---ct-------------------------------
              Star-nosed mole  gagcg----ccgc---gttt--tgagcggtggcagggct-------------------------------
                     Elephant  gaatg----cagt---attt--cgtgcgtgggcaggact-------------------------------
          Cape elephant shrew  gaacg----ctgg---attt--tgtgcggcagctgggct-------------------------------
                      Manatee  gaatg----cctt---actt--cgtgcggcggcaggact-------------------------------
             Cape golden mole  gaatg----ccgt--gaact--cgtgcgacggcaggact-------------------------------
                       Tenrec  gaatg----tcgc---cttt--cgtgccgcagcaagact-------------------------------
                     Aardvark  gaatg----ccgt---attt--cgcgcggcggcaagact-------------------------------
                    Armadillo  gagtg----ccgt---gcct--cgtgggacggcacgacc-------------------------------
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                   Budgerigar  ======================================================================
           Southern platyfish  ======================================================================
          Medium ground finch  ======================================================================
               Painted turtle  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================
                      Wallaby  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
              Green seaturtle  ======================================================================
                      Opossum  ======================================================================

                        Human  ---------------------------------------gt--actttt-----g-taatgct---
                        Chimp  ---------------------------------------gt--acttttcttttg-taatgct---
                      Gorilla  ---------------------------------------gt--acttttcttttg-taatgct---
                    Orangutan  ---------------------------------------gt--acttttcttttg-taatgct---
                       Gibbon  ---------------------------------------gt--acttttctgttg-taatgct---
                       Rhesus  ---------------------------------------gt--actttg-ttttg-taatgct---
          Crab-eating macaque  ---------------------------------------gt--actttg-ttttg-taatgct---
                       Baboon  ---------------------------------------gt--actttg-ttttg-taatgct---
                 Green monkey  ---------------------------------------gt--actttg-ctttg-taatgct---
                     Marmoset  ---------------------------------------gc--acttta-ttttg-taatgct---
              Squirrel monkey  ---------------------------------------gt--acttta-ttttg-taatgct---
                     Bushbaby  ---------------------------------------at--tcttcc----tg-tgatgct---
           Chinese tree shrew  ---------------------------------------gt--actttg----tg-taacgct---
                     Squirrel  ---------------------------------------attctttctg-------taatgct---
       Lesser Egyptian jerboa  ---------------------------------------gc--gcttgg-----t-tgatgct---
                 Prairie vole  ------------------------------------------------------------------
              Chinese hamster  ---------------------------------------gt--attctg-------tgatgct---
               Golden hamster  ---------------------------------------gt--attctg-------cgatgct---
                        Mouse  tatctatctatctatctatctatctatctatctatctaaat--atatag-------tgatgct---
                          Rat  ---------------------------------------at--atagtg-------tgatgct---
               Naked mole-rat  ---------------------------------------gt--attc---------taatgct---
                   Guinea pig  ---------------------------------------ga--acccgg-------taatgct---
                   Chinchilla  ---------------------------------------gt--actctg-------taatgcc---
             Brush-tailed rat  ---------------------------------------gt--actgtg-------caatgcc---
                       Rabbit  ---------------------------------------gtaccttctg-------tggagct---
                         Pika  ---------------------------------------gtacgttctg-------tgatgtt---
                          Pig  ---------------------------------------gt--acgttc----tg-ttatgct---
                       Alpaca  ----------------------------------------t--actttc----tg-taatgct---
               Bactrian camel  ----------------------------------------t--actttc----tg-taatgct---
                      Dolphin  ---------------------------------------gt--actttc----tg-taatgct---
                 Killer whale  ---------------------------------------gt--actttc----tg-taatgct---
             Tibetan antelope  ---------------------------------------gt--actttc----tg-taatgct---
                          Cow  ---------------------------------------gt--actttc----tg-taatgct---
                        Sheep  ---------------------------------------gt--actttc----tg-taatgct---
                Domestic goat  ---------------------------------------gt--actttc----tg-taacgct---
                        Horse  ---------------------------------------gt--cccttc----tg-taatgcttga
             White rhinoceros  ---------------------------------------gt--actttc----tg-taatgctcga
                          Cat  ---------------------------------------gt--actttc----tg-taatgct---
                          Dog  ---------------------------------------gt--actttg----tg-taaagct---
                      Ferret   ---------------------------------------gt--accttg----tg-taaagct---
                        Panda  ---------------------------------------gt--actttg----tg-taaagct---
               Pacific walrus  ---------------------------------------gt--accttg----tg-taaagct---
                 Weddell seal  ---------------------------------------gt--accttg----tg-taaagct---
             Black flying-fox  ---------------------------------------gt--actttc----tg-taatgct---
                      Megabat  ---------------------------------------gt--actttc----tg-taatgct---
                Big brown bat  ---------------------------------------gt--gctttc----tg-taatgct---
         David's myotis (bat)  ---------------------------------------gt--cctgtc----tg-taatgct---
                     Microbat  ---------------------------------------gt--cctgtc----tc-taaggct---
                     Hedgehog  ---------------------------------------tt--t----t----tgataatgcc---
                        Shrew  ---------------------------------------gc--c----g----tg-cggtccc---
              Star-nosed mole  ---------------------------------------gc--c---------tg-taatgcc---
                     Elephant  ---------------------------------------tt--actttc----cg-gaatgtt---
          Cape elephant shrew  ---------------------------------------gg--actgtt----tg-taacgct---
                      Manatee  ---------------------------------------gt--actttc----tg-gaatgtt---
             Cape golden mole  ---------------------------------------gt--actttc----tc-taatgct---
                       Tenrec  ---------------------------------------gc--gctttc----tg-taatgtt---
                     Aardvark  ---------------------------------------gt--actttc----tg-taatgtt---
                    Armadillo  ---------------------------------------gt--gcattt----tg-taacgtt---
             Peregrine falcon  ==================================================================
                 Saker falcon  ==================================================================
     Mexican tetra (cavefish)  ==================================================================
                   Budgerigar  ==================================================================
           Southern platyfish  ==================================================================
          Medium ground finch  ==================================================================
               Painted turtle  ==================================================================
                  Zebra finch  ==================================================================
          Collared flycatcher  ==================================================================
                      Wallaby  ==================================================================
              Tasmanian devil  ==================================================================
                     Platypus  ==================================================================
              Green seaturtle  ==================================================================
                      Opossum  ==================================================================

Alignment block 29 of 339 in window, 27212813 - 27212894, 82 bps 
B D                     Human  tgatga----gtt-ctttacgtac---c----tgcggtcg-ttttacaccgcgccaaa--ctagggctgt
B D                     Chimp  tgatga----gtt-ctttacgtac---c----tgcggtcc-ttttacaccgcgccaaa--ctagggctgt
B D                   Gorilla  tgatga----gtt-ctttacgtac---c----tgcggtcc-ttttacaccgcgccaaa--ctagggctgt
B D                 Orangutan  tgatga----gtt-ctttacgtac---c----tgcggtcc-ttttacaccgggccaaa--ctagggctgt
B D                    Gibbon  tgatga----gtt-ctttacgtac---c----tgcggtcc-ttttacaccgggccaaa--ctggggctgt
B D                    Rhesus  tgatga----gtt-atttacctac---c----tccggtcc-ttttaaaccaggccaaa--ctgggac---
B D       Crab-eating macaque  tgatga----gtt-atttatctac---c----tccggtcc-ttttaaaccaggccaaa--ctgggac---
B D                    Baboon  tgatga----gtt-atttacctac---c----tccggtcc-ttttaaaccaggccaaa--ctgggac---
B D              Green monkey  tgatga----gtt-atttacctac---c----tccggtcc-ttttaaaccaggccaaa--ctgggac---
B D                  Marmoset  tgatga----gtt-c-ttacatac---c-----gcggtcc-ttttacaccgggacaaa--ctgaggctgt
B D           Squirrel monkey  tgatga----gtt-ctttacgtac---c-----gcggtcc-ttttacaccgggacaaa--ctgaggctgt
B D                  Bushbaby  tgatgc----gtt-ctttttgtac---c----tg-agttc-ttttacacccagctaaa--c--aggttgt
           Chinese tree shrew  tgatga----gtt-c--ggtgtac---c----tgcagttc-tttggcgcccgcccaaa--cccgggctgt
B D                  Squirrel  tgacga----gtt-cttggtgttc---c----tgcagtcc-ttttacgctcggctaaa--ctggggctgc
       Lesser Egyptian jerboa  tgatga----gta-ccttgtgttc---c----tgcagcc-------------gccaca--ccgcggcgat
                 Prairie vole  ----ga----gta-ctttgtgtac---ccgcgtgcagctc-tttaacactt-gccaaa--gcatgcctgt
B D           Chinese hamster  ---gga----gca-ctctgag-ac---ctgcatgcagccc-tctaacactt-gccaaa--ccatgcctgt
               Golden hamster  ---tga----ata-ctctgtgtac---ctgcatgcagccc-tttaacactt-gccaag--ccatgcctgt
B D                     Mouse  ---tga----gta-cgctgtgtac---c----tgcagccc-tttaacactt-gccaaa--ccatgcctgt
B D                       Rat  ---cga----gta-cgctgtgtac---c----tgcagccc-tttaacactt-gccaaa--ctattcatgt
B D            Naked mole-rat  tgatgg----gtt-ctttgtgtac---c----agcagctt-tttacacctg-gccaat--caggggttat
B D                Guinea pig  tgctga----gtt-ctttgtgtac---c----tacagcct-ttgacacctg-gccaat--ccggggctgt
                   Chinchilla  tgatgg----gtt-ctttgtgtac---c----tgcagcct-gctacacctg-gccaat--ccagggctgt
             Brush-tailed rat  tggcga----gtt-ctttgtgtac---c----tgcagcct-tttacg-ctg-gccaat--ccacggctgt
B D                    Rabbit  tgatga----gtt-ctcggagtac---c----cgcagcct-ctttacaccc-ggccag--gtggggctgt
B D                      Pika  tgac-a----ggt-gtctgtgtac---c----tgcccttc-cttagcaccc-gatcaa--atgggactgt
B D                       Pig  tgatga----gat-ctttgtgtac---c----tgcagtcc-ttttatacccggtcaaa--tcgcggctgg
B D                    Alpaca  taatga----gtt-ctttgtgtac---t----tgcagttc-ttttacaccctgccaaa--tcggggctgg
               Bactrian camel  taatgc----gtt-ctttgtgtac---c----tgcagtcc-ttttacacccggccaaa--tcggggctgg
B D                   Dolphin  tgatga----gtt-ctttgtgtac---c----tgcagtcc-ttttacacccgccaaat--c-ggggctgg
                 Killer whale  tgatga----gtt-ctttgtgtac---c----tgcagtcc-ttttacacccgccaaat--c-ggggctgg
             Tibetan antelope  tgatga----gtt-ctttgtgtac---c----tgcagtcc-ttttacacccggtcaca--t-ggggctgg
B D                       Cow  tgatga----gtt-ctttgtgtac---c----tgcagtcc-ttttacacccggtcaca--t-ggggctgg
B D                     Sheep  tgatga----gtt-ctttgtgtac---c----tgcagtcc-ttttacacccggtcaca--t-ggggctgg
                Domestic goat  tgatga----gtt-ctttgtgtac---c----tgcggtcc-ttttacacccggtcaca--t-ggggctgg
B D                     Horse  tgatga----gtt-ctttgtgtac---c----tgcaattc-ttttacacccggccaaa--cccgg-ctgt
B D          White rhinoceros  tgatga----gtt-ctttgtgtac---c----tgcagtcc-tattacacccggccaaa--tcgggcctgt
B D                       Cat  tgatga----ctt-ctttgtatac---c----tgcagtgc-ttttatacctggccaag--ccgggtctgt
B D                       Dog  cgatga----gtt-ct-------------------------ttttatacctggccaaa--ccgggtctgt
B D                   Ferret   tgatga----gtt-ctttgtgtac---c----tgcagtgc-ttttatacctggccaaa--ccgggtctgt
B D                     Panda  tgatga----gttcctttgtgtac---c----tgcagtgc-ttttatacctggccaaa--ccgggtctgt
               Pacific walrus  tgatga----gtt-ctttgtatgc---c----ggcggtgc-ttttatacctggccaaa--ccgggtctgt
                 Weddell seal  tgatga----gtt-ctttgta----------------tgc-ttttatacctggccaaa--ccgggtctgt
             Black flying-fox  tgatga----gtt-ctttgtgtac---c----tgcagtcctttttacacccagtcaca--ccg---gggc
B D                   Megabat  tgatga----gtt-ctttgtgtac---c----tgcagtcctttttacacccagtcaca--ccg---gggc
                Big brown bat  tgagga----g------tgtgtac---c----tgcagtcc-tttcacaccccgccaagccccg---ctgt
         David's myotis (bat)  tgctga----g------tgtgtac---c----tgcagtcc-tgtcacaccccgccaaaccccg---ctgt
B D                  Microbat  tgatga----g------tgtgtac---c----tgcagtcc-tgtcacaccccgccaaagcccg---ctgt
B D                  Hedgehog  cgatga----gtt-ccttgtgtac---c----tgca---c-ttgtgcacctggccaca--ctggggctgg
B D                     Shrew  cgtcggccgagtt-gcaggtgtcc---------------------------------g--gcggggaagt
              Star-nosed mole  tgatgg----gtt-ctttatgttc---t----ttta---c-t-----------ccaaa--ctggggctgt
B D                  Elephant  cgatga----gtt-cattgtgtaccttc----tt--gttc-ttatacacccggtcaaa--ccggagctgt
          Cape elephant shrew  tgatga----ggt-ttttctgtac---c----tt--gttc-ttttacaccaggctgaa--cccgacctct
B D                   Manatee  tgatga----gtt-cattgtgtaccttc----tt--gacc-ttttacacccggtcaaa--ccggagctgt
             Cape golden mole  cgacga----gtt-ctttgtgtcc---c----tt--acca-atttatacccgaccaaa--ccggaattgt
B D                    Tenrec  tgatga----gtt-ccttgtgtac---c----tt--gtcc-ctttataccagaccgaa--ctggcgctga
                     Aardvark  tgatga-----tt-ctttgcgtac---c----tt--gtcc-atttatatcaggccaaa--cctgag-tgt
B D                 Armadillo  tgatgg----gtt-ttttgtgtacctgc----cg--gccc-tttcccaccgggccaaa--ccggagctgt
B D                   Opossum  tgttga----gtt-ctt----------g----taaaaacc-ttttatgtccatccaaa--tcaatgttta
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                Budgerigar  ======================================================================
          Southern platyfish  ======================================================================
B D       Medium ground finch  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ======================================================================
  D           Green seaturtle  ======================================================================

                        Human  cag-----attgagaag-tctctgcagaaag--ca
                        Chimp  cag-----attgagaag-tctctgcagaaag--ca
                      Gorilla  cag-----attgagaag-tctctgcagaaag--ca
                    Orangutan  cag-----attgagaag-tctctgcagaaag--cg
                       Gibbon  cag-----attgagaag-tctctgcagaaag--cg
                       Rhesus  ---------ttgagaag-tctttgcagagag--ca
          Crab-eating macaque  ---------ttgagaag-tctttgcagagag--ca
                       Baboon  ---------ttgagaag-tctttgcagagag--ca
                 Green monkey  ---------ttgagaag-tctttgcagagag--ca
                     Marmoset  cag-----attgagaag-tctctgcagaggg--ca
              Squirrel monkey  cag-----attgagaag-tctctgcagaggg--ca
                     Bushbaby  cag-----a---ataaa-tctctggagagag--ca
           Chinese tree shrew  gtg-----attaagaag-tccctgaagagagcaca
                     Squirrel  caa-----gatgcgaag-tctctggagaaac--ca
       Lesser Egyptian jerboa  cag-----gttgagaag---tctggagaggg--cg
                 Prairie vole  cag-----gtggagaag-tctctggaaagga--ca
              Chinese hamster  cag-----gcggagaag-tctctggagagga--ca
               Golden hamster  cag-----gtggagaag-tctctggagagga--ca
                        Mouse  cag-----gtggagaag-tctctggagagga--ca
                          Rat  tag-----gtggagaag-cctctggagagga--ct
               Naked mole-rat  cag-----attgacaag-tctttggagaagg--ca
                   Guinea pig  cag-----attgagaag-tctttggagaagg--ca
                   Chinchilla  caa-----atggagaag-tctttgcagaagg--ca
             Brush-tailed rat  cag-----actgaaaag-tgtttggagaagg--ca
                       Rabbit  ctg-----aaggaggcg-gctctggggaggg--ca
                         Pika  cac-----aataagacg----ccggaggggg--cg
                          Pig  cag-----attgagaag-tcattggagaggg--ca
                       Alpaca  cag-----attgagaag-tcattggagaggt--ca
               Bactrian camel  cag-----attgagaag-tcattggagaggt--ca
                      Dolphin  cag-----attgagaag-tcattggagaggg--ca
                 Killer whale  cag-----attgagaag-tcattggagaggg--ca
             Tibetan antelope  cag-----gttgaaaag-tcgttggagaggg--ca
                          Cow  cag-----gttgagaag-tcgttggagaggg--ca
                        Sheep  cag-----gttgaaaag-tcgttggagaggg--ca
                Domestic goat  cag-----gttgaaaag-tcgttggagaggg--ca
                        Horse  cag-----attgagaaa-tcactggagaggg--ca
             White rhinoceros  cag-----attgagaaa-tcactggagaggg--ca
                          Cat  cag-----attgagaag-tcactggataggg--ca
                          Dog  cag-----attgagaag-tcaatggggaggg--ca
                      Ferret   tag-----attgaaaag-tcactggagagag--ca
                        Panda  cag-----atagagaag-tcactggagaggg--ca
               Pacific walrus  cag-----attgagaag-tcactggagaggg--ca
                 Weddell seal  cag-----attgagaag-tcactggagaggg--ca
             Black flying-fox  taa-----gttgagaag-tccctggagagga--ca
                      Megabat  taa-----gttgagaag-tcactggagagga--ta
                Big brown bat  cag-----gttgcaaagtttactggggagga--ca
         David's myotis (bat)  cag-----gttgagaag-tcactggagggga--ca
                     Microbat  ccg-----gttgagaag-tcactg-----------
                     Hedgehog  cag-----attgagagg-tcaatggagaggg--ca
                        Shrew  cag-----gcggggaag-tcacggggaaggg--ca
              Star-nosed mole  cag-----gttgagaag-tcaccggagaaag--ca
                     Elephant  cag-----attgagaag-tcactggagaggg--ca
          Cape elephant shrew  cgg-----attgggaag-tcactggaaaggg--ca
                      Manatee  cag-----attgagaag-tcactagaggggg--ta
             Cape golden mole  tag-----attgcgaag-tcactgaaaagag--ca
                       Tenrec  cgg-----gttgagaaa-tcaccggagaggg--ca
                     Aardvark  cag-----attgagaag-gcactggagagga--cc
                    Armadillo  cag-----gctgagaag-tcactggaaggtg--ca
                      Opossum  cggtttacatttataag-ttaatgtacttac--t-
             Peregrine falcon  ===================================
                 Saker falcon  ===================================
     Mexican tetra (cavefish)  ===================================
                   Budgerigar  ===================================
           Southern platyfish  ===================================
          Medium ground finch  ===================================
               Painted turtle  ===================================
                  Zebra finch  ===================================
          Collared flycatcher  ===================================
                      Wallaby  ===================================
              Tasmanian devil  ===================================
                     Platypus  ===================================
              Green seaturtle  ===================================

Alignment block 30 of 339 in window, 27212895 - 27212932, 38 bps 
B D                     Human  taataaat------aagt---tcga---atagt-gatcttcag--agatgagg
B D                     Chimp  taataaat------atgt---tcga---atagt-gatcttcag--agatgagg
B D                   Gorilla  taataaat------atgt---tcga---atagt-gatcttcag--agatgagg
B D                 Orangutan  taataaat------atgt---tcga---atagt-gatctaaag--agatgagg
B D                    Gibbon  taataaat------atgt---tcaa---atagt-gatcttcag--agatgagg
B D                    Rhesus  taataaat------atgt---ttga---atagt-gatcttcag--agatgagg
B D       Crab-eating macaque  taataaat------atgt---ttga---atagt-gatcttcag--agatgagg
B D                    Baboon  taataaat------atgt---ttga---atagt-gatcttcag--agatgagg
B D              Green monkey  taataaat------atgt---ttga---atagt-gatcttcag--agatgagg
B D                  Marmoset  taataaat------atgt---tcga---atagt-aatcttcag--aaatgagg
B D           Squirrel monkey  taataaat------atgt---tcga---atagt-aatcttcag--aaatgagg
B D                  Bushbaby  taataaat------atgc---tcga---gtagt-ga-----------------
           Chinese tree shrew  tagtaaat------acgt---tcga---atagt-aa---------agacgaag
B D                  Squirrel  t----agt------aaaaaccttgt---gtagt-aatcctcaa--agataaag
       Lesser Egyptian jerboa  t----aat------agat---tcac---gtctt--gtcctcaa--ggatgagc
                 Prairie vole  t----aat------ttag---tcaa---gtaat-gattcttct--agatgagg
B D           Chinese hamster  t----aat------aggg---tcaa---gtaat-gattctcac--agatgagg
               Golden hamster  t----aat------aggg---tcaa---gtaat--------------------
B D                     Mouse  c----agt------atag---tcaa---gtaat-aatgcacaa--acacgagg
B D                       Rat  t----aat------attg---tcaa---gtaat-gattctcaa--acgtgagg
B D            Naked mole-rat  tagtaaat------gtgt---tcaa---ctagt-aattctcaa--agatgagg
B D                Guinea pig  tagtaaat------atat---tcga---ctagt-aactctcaa--agatgaga
                   Chinchilla  taggaaat------atat---ttaa---ctagt-aactctcag--agatgaag
             Brush-tailed rat  caggaaat------atgt---ttga---ctaat-aa--ctcag--agacgaag
B D                    Rabbit  tagcaaag------acat---c----------c-cctccctggccagctgt--
B D                      Pika  tgacgaat------aaat---caga---atagt-gatccttga--aggtgtga
B D                       Pig  taataaat------atgt---tcca---atagt-aattctcaa--agatgagg
B D                    Alpaca  taataaat------atgt---tcga---atagt-aattctcat--agatgacg
               Bactrian camel  taataaat------atgt---tcga---atagt-aattctcat--agatgacg
B D                   Dolphin  taatatgt------atgt---ccga---atagt-gattctcaa--agatgagg
                 Killer whale  taatatgt------atgt---ctga---atagt-gattctcaa--agatgagg
             Tibetan antelope  ttataattataaacgtgt---tcga---atagt-aattctcag--agatgaga
B D                       Cow  ttataagt------gtgt---tcga---atagt-aattctcag--agatgaga
B D                     Sheep  ttataattataaacgtgt---tcga---atagt-aattctcag--agatgaga
                Domestic goat  ttataattataaacgtgt---tcga---atagt-aattctccg--agatgaga
B D                     Horse  taataagt------atgt---tcta---aaactaaaccctcaa--agaagagg
B D          White rhinoceros  taataaata-----atgt---tcta---atagtaaattctcaa--agaagagg
B D                       Cat  taataaat------attg---tcga---atggt-gatcctcga--agacgagg
B D                       Dog  taataagt------atgc---ccaa---gcagt-gatcctcga--agatgagg
B D                   Ferret   taataagt------atgt---tcga---acagt-gatcttaaa--agat---g
B D                     Panda  taataaat------gtgt---ttga---acagt-gatcttcga--agatgagg
               Pacific walrus  taataaat------atgt---tcga---acagt-gatcttcaa--agatgagg
                 Weddell seal  taagaaat------atgt---tcga---atagt-gatcttcaa--agatgagg
             Black flying-fox  taataaat------atgt---tcaa---acagt-gatcctcaa--agatgagc
B D                   Megabat  taataaat------atgt---tcaa---acagt-gatcctcaa--agatgagc
                Big brown bat  taataaat------gtgt---cccg---atagt-gatcttcaa--gaacgaga
         David's myotis (bat)  taataaat------acgt---tccc---atagt-ggtctttaa--ggacgagg
B D                  Microbat  taataaat------acgt---tccc---atagt-gatcttcaa--ggaccaga
B D                  Hedgehog  taagaaat------acgt---tcaa---atagt-catcctcag--cggcgaag
B D                     Shrew  cgagggag------ccgt---ccga---gtggc-cgtcctcga--agatgagg
              Star-nosed mole  taatacat------ttgt---ttga---ttagt-gatcctcaa--agacagg-
B D                  Elephant  taataaat------atgg---tcga---atact-gtttttcaa--agatgaaa
          Cape elephant shrew  taataaac------atg--------------------cttcaa--agataa--
B D                   Manatee  taataaat------atgt---tcga---atagt-aatcttcaa--agatgaag
             Cape golden mole  tcataaat------ttgt---tcca---aaagt-gatcttcaa--agatgagg
B D                    Tenrec  taataagt------cgtc---ttcggacagggc-gatctttag--agatgagg
                     Aardvark  ttataaat------atgt---tcga---atagt-gatcttcca--agataacg
B D                 Armadillo  tagtaagt------aggt---tcgg---atcgtgggttctcca--agatgagg
B D                   Opossum  taataaat------gatt---ttaa---gtgat-gatctactagtgggtgagg
B D           Tasmanian devil  taataaat------attt---ttaa---atggt--acatataagtaggtgaag
  D          Peregrine falcon  =====================================================
  D              Saker falcon  =====================================================
    Mexican tetra (cavefish)  =====================================================
B D                Budgerigar  =====================================================
          Southern platyfish  =====================================================
B D       Medium ground finch  =====================================================
  D            Painted turtle  =====================================================
B D               Zebra finch  =====================================================
  D       Collared flycatcher  =====================================================
B D                   Wallaby  =====================================================
B D                  Platypus  =====================================================
  D           Green seaturtle  =====================================================

Inserts between block 30 and 31 in window
B D                 Hedgehog 3bp
B D                    Shrew 70bp

Alignment block 31 of 339 in window, 27212933 - 27213029, 97 bps 
B D                     Human  acctt--ccctgtgc--ga--------tatctgg-tac-tg--aaag-tgtc---gggagct--------
B D                     Chimp  acctt--ccctgtgc--ga--------tatctgg-tac-tg--aaag-tgtc---gggagct--------
B D                   Gorilla  accttccccctgtgc--ga--------tatctgg-tac-tg--aaag-tgtc---gggagct--------
B D                 Orangutan  acatt--ccctgggc--ga--------tatctgg-tac-tg--aaag-tgtc---gggagct--------
B D                    Gibbon  acctt--ccctgggc--ga--------tatctgg-tac-tg--aaag-tgtc-tggggagct--------
B D                    Rhesus  acctt--ccctggct--ga--------tgtctgg-tac-tg--aaag-tgtc-tggagagct--------
B D       Crab-eating macaque  acctt--ccctggct--ga--------tgtctgg-tac-tg--aaa---gtc-tggagagct--------
B D                    Baboon  acctt--ccctggct--ga--------tgtctgg-tac-tg--aaag-tgtc-tggagagct--------
B D              Green monkey  acctt--ctctggct--ga--------tgtctgg-tac-tg--aaag-tgtc-tggagagct--------
B D                  Marmoset  acctt-cccctgggc--ga--------tgtctgt-tac-tg-aaaag-tctc-tggggagct--------
B D           Squirrel monkey  acctt-cccctgggc--ga--------tgtctgt-tac-tg--aaag-tctc-tggggagct--------
B D                  Bushbaby  ------------------------------------ac-tg--tatg-tctc-tggtgag----------
           Chinese tree shrew  acctt--ccctgggc--ga--------gatctag-tac-ag--aaaa-cctg------------------
B D                  Squirrel  atctt--tcctgtgt--ga--------agactgg-tac-tgaaaatc-tg-----acgcact--------
       Lesser Egyptian jerboa  acctt--cccagggc--gg--------------------------------------aggct--------
                 Prairie vole  acctt--ctttcgtg--aaagacttgtagacttg-tat-ag---------------tgcact--------
B D           Chinese hamster  acctg--ctctcggg--aa--------ggacttg-cac-ag---------------ggcgct--------
               Golden hamster  ------------------------------------------------------------tc--------
B D                     Mouse  atctt--ctctcg----------------------tac-ag---------------tgcgct--------
B D                       Rat  atctc--ctctcggc--at--------gaactca-tac-ag---------------tgcgcc--------
B D            Naked mole-rat  acctt--gcttaggc--ga--------ggagtgg-tac-tg--aatg-tg-----gagtgct--------
B D                Guinea pig  acctt--ccttaggc--ga--------ggactgg-tgc-tg--aatg-tg-----gggtgct--------
                   Chinchilla  acctt--ccttaggc--ga--------ggactgg-ta-----------------------ct--------
             Brush-tailed rat  acctt--ccttaggc--ga--------ggactgg-tac-tg--aatg-tg-----aggtgct--------
B D                    Rabbit  ----------------------------------------------------------------------
B D                      Pika  ----------tagga--gt----------------tgg-gg-----------------------------
B D                       Pig  tcctt--ccctggat--ga--------gatctgg-tac-ag--aaat-tctc-tggtgccct--------
B D                    Alpaca  tcctt--atctgagt--ga--------ggtctgg-tac-ag--tatt-tctc-aggtgcgct--------
               Bactrian camel  tcctt--atctgagt--ga--------agtctgg-tac-ag--aatt-tctc-aggtgcgct--------
B D                   Dolphin  tcctt--ccctggac--aa--------gatctgg-tac-ag--aaat-tctc-tggtgcgct--------
                 Killer whale  tcctt--ccctggac--aa--------gatctgg-tac-ag--aaat-tctc-tggtgcgct--------
             Tibetan antelope  tcctt--ccctggac--aa--------gatccgg-tac-ag--aaat-tctc-cggtgagct--------
B D                       Cow  tcctt--ccctggac--aa--------gatccgg-tac-gg--aaat-tctc-cggtgcgct--------
B D                     Sheep  tcctt---cctggac--aa--------gatctgg-tac-ag--aaat-tctc-cggtgcgct--------
                Domestic goat  tcctt---cctggac--aa--------gatctgg-tac-ag--aaat-tctc-cggtgcgct--------
B D                     Horse  gcctt--ccctgagt--ga--------ggtctgg-tac-ag--aaag-tctc-tggtgcgcc--------
B D          White rhinoceros  gcctt--ccctgggc--ga--------cgtctgg-tac-at--aaac-tctc-gggtgcgct--------
B D                       Cat  gcctg--tcctgggt--ga--------gctctgg-tac-ag--aaag-tctc-tagtgtgct--------
B D                       Dog  gcctt--tcctgggc--aa--------ggtgtgg-tgc-ag--aaag---tc-tagtgtgtt--------
B D                   Ferret   tcctt--tcctggac--aa--------ggtctgg-tgc-ag--caag-cctc-tagtgtgct--------
B D                     Panda  gcctt--tcctgggc--aa--------ggtctgg-tct-ag--aaag-tctc-tagtgtgct--------
               Pacific walrus  gcttt--tcctgggc--aa--------ggtctgg-ggc-ag--aaag---tc-tagtatgct--------
                 Weddell seal  gcctt--tcctgggc--aa--------ggtctgg-tgc-ag--aaag-tctc-tagtatgct--------
             Black flying-fox  gcctt--ctctgggt--aa--------ggtctggttgc-ag--aaag---tc-tggtgctct--------
B D                   Megabat  gcctt--ctctgggt--aa--------ggtctggttgc-ag--aaag---tc-tggtgctct--------
                Big brown bat  gcttt--ccccgggt--gt--------ggtctgg-tgc-tg--agag-gctc-tggtgcgct--------
         David's myotis (bat)  gcttt---cctgggt--gt--------ggtctgg-ggc-tg--gaag-gccc-tggtgcgct--------
B D                  Microbat  gcttt--ccctgggt--gt--------ggtctgg-ggc-tg--gaag-gccc-tggtgcgct--------
B D                  Hedgehog  tcctc--ccctgggc--ca--------ggtcgag-tgc-ag--aaag-tctc-cgcgacttt--------
              Star-nosed mole  -------------at--tt--------tatctgg-tac-ag--aaag-tctctcgcgggctg--------
B D                  Elephant  gtatt--ttcttgga--ga--------gggctgg-taa-tg--gaag-tgtt-tgatgcgct--------
          Cape elephant shrew  ----t--ctttgggt--gg--------ggactgg-aaa-ta--aaagatctt-aggtgccct--------
B D                   Manatee  gtctt--atctgggc--aa--------gggctgg-tac-tg--aaag-tctc-tgatgtgct--------
             Cape golden mole  gtctt--ctgtggaccaga--------gagc------------atcg-cttc-tgt--gttt--------
B D                    Tenrec  g------ccgcaggcc-gg--------gtgctg----------atcg-tctc-agttgagcc--------
                     Aardvark  gcctt--ttctgggc--ga--------tggctgg-taactg--aaag-accc---atggggt--------
B D                 Armadillo  gcctt--ccctggaa--gt--------gggctgg-tgc-cg--aaag-gttg-tcaggcgcc--------
B D                   Opossum  gcctt--ttcctaac--ac--------attcagg-ttt-gg--aaag-agtg-gagcataacagctggaa
B D           Tasmanian devil  aactt--ttatcaac--a---------attcagg-ttt-gg--aaag-agtg-gagagtagt-ttttgaa
B D                     Shrew  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                Budgerigar  ======================================================================
          Southern platyfish  ======================================================================
B D       Medium ground finch  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Platypus  ======================================================================
  D           Green seaturtle  ======================================================================

                        Human  ------------------ga--ttcggcg-c-aggactct-----gga-------gg--aagagatg---
                        Chimp  ------------------ga--ttcggcg-c-aggactct-----gga-------gg--aagaaatg---
                      Gorilla  ------------------ga--ttcggcg-c-aggactct-----gga-------gg--aagaaatg---
                    Orangutan  ------------------ga--ttcggcg-c-cggactct-----aga-------ga--aagaaatg---
                       Gibbon  ------------------ga--ttcggcg-c-cggactct-----aga-------gg--aagaaatg---
                       Rhesus  ------------------ga--ttcggcg-c-cggactct-----agg-------gg--aagacatg---
          Crab-eating macaque  ------------------ga--ttcggcg-c-cggactct-----agg-------gg--aagacatg---
                       Baboon  ------------------ga--ttcggcg-c-cggactct-----agg-------gg--aagacatg---
                 Green monkey  ------------------ga--ttcggcg-c-cggactct-----agg-------gg--aagacatg---
                     Marmoset  ------------------ga--ttgggca-c-cggactct-----aga-------gg--aagaaatg---
              Squirrel monkey  ------------------ga--ttgggca-c-cggactct-----aga-------gg--aagaaatg---
                     Bushbaby  ------------------------------------ctct-----agg-------aa--aagaaatg---
           Chinese tree shrew  ------------------------------------ctct-----agg-------ga--aacaaatg---
                     Squirrel  ------------------ca--ttcagcg-c-ccagcttt-----agg-------ag--aagaaatg---
       Lesser Egyptian jerboa  ------------------ga--ctcgctg-c-cccgctgt-----agg-------gg--gagaaatt---
                 Prairie vole  ------------------ga--tttggtg-c-cctgtggt-----agc-------cg--aagaaatg---
              Chinese hamster  ------------------ga--tttggtg-c-ccggttgt-----agg-------gg--aagaaatg---
               Golden hamster  ------------------ga--ttaggtg-c-ccggttgt-----aga-------gg--aagaagtg---
                        Mouse  ------------------ga--tttggtg-cgggggtttt----aagg-------ga--aaaaaatg---
                          Rat  ------------------ga--tttgatg-c-cgggttgt----aagg-------ga--aagaaatg---
               Naked mole-rat  ------------------ga--ttcagtg-c-ctggct-------agg-------gg--aataaatg---
                   Guinea pig  ------------------ga--ttctgtg-t-ctgact-------ggg-------gg--aactaatg---
                   Chinchilla  ------------------ga--ttccgtg-t-ctgact-------agg-------gg--aacaaatggca
             Brush-tailed rat  ------------------ga--ttcagtgtt-ttgact-------agg-------gg--aacaaatg---
                       Rabbit  -------------------------ggca-c-c------------c----------------aagtg---
                         Pika  -------------------------ggcg-t-c------------cgg-------ga--aagaagtg---
                          Pig  ------------------gt--tttggca-c-ctggctcc--------------------agaaacg---
                       Alpaca  ------------------gt--tttggcg-c-ctggctcc----aggg-------gg--aagaaatg---
               Bactrian camel  ------------------gt--tttggcg-c-ctggctcc----aggg-------gg--aagaaatg---
                      Dolphin  ------------------gt--tttggcg-c-ctggttcc----aagg-------gg--aagaaatg---
                 Killer whale  ------------------gt--tttggcg-c-ctggttcc----aagg-------gg--aagaaatg---
             Tibetan antelope  ------------------gt--tttggcg-c-ctggttcc-----aga-------gg--aagaaata---
                          Cow  ------------------gt--tttggcg-c-ctggttcc-----aga-------gg--aagaaata---
                        Sheep  ------------------gt--tttggcg-c-ctggttcc-----aga-------gg--aagaaata---
                Domestic goat  ------------------gt--tttggcg-c-ctggttcc-----aga-------gg--aagaaata---
                        Horse  ------------------tt--tttggcg-c-ttggctct-----agg-------gg--aagaaata---
             White rhinoceros  ------------------ga--ttgggcg-c-ttggctct-----agg-------ga--aagaaatg---
                          Cat  ------------------ga--tttggct-c-ctggctct-----agg-------cg--aagaaatg---
                          Dog  ------------------ga--tttggct-c-ctggctct-----agg-------ag--aagaaacg---
                      Ferret   ------------------gatttttggct-t-ctgactcg-----agg-------cg--aagaaatg---
                        Panda  ------------------ga--tttggct-c-ttggctgt-----agg-------cg--aagaaatg---
               Pacific walrus  ------------------ga--tttagct-c-ctggctct-----agg-------cg--aagaaatg---
                 Weddell seal  ------------------ga--tttagct-c-ctggctct-----agg-------cg--aagaaatg---
             Black flying-fox  ------------------ga--ttgggca-c-ctggttct-----agg-------gggaaaaaaatg---
                      Megabat  ------------------ga--ttgggca-c-ctggttct-----agg-------ggg-aaaaaatg---
                Big brown bat  ------------------ga--tttggcg-c-ctg------------------------ggaagaca---
         David's myotis (bat)  ------------------ga--tttggcg-c-ctg------------------------ggaagata---
                     Microbat  ------------------ga--tgtggcg-c-ctg------------------------ggaagata---
                     Hedgehog  ------------------aa--tttgacc-c-ctggttct-----aag-------gg--aagaaatg---
              Star-nosed mole  ------------------gt--ttgggcc-a---ggctct-----agg-------gg--acgaaaaa---
                     Elephant  ------------------gc--tttgcct-c-t------------agg-------ga--aagaaaga---
          Cape elephant shrew  ------------------ga--tttacat-t-t------------ag--------------aaaaga---
                      Manatee  ------------------gc--tttgcct-c-t------------agg-------aa--aagaaagg---
             Cape golden mole  ------------------gg--ttcggcc-g-t------------agg-------ga--aagaaa-----
                       Tenrec  ------------------gg--tttggcc-c-g------------aag-------ca--aagaaagg---
                     Aardvark  ------------------gg--tttgact-c-t------------agt-------ga--aagaaaga---