Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 185 in window, 203867943 - 203868058, 116 bps 
B D                     Human  atggcttgccttggatttcagcggcacaaggc----tc-ag-ctgaacctggctaccaggacctggccct
B D                     Chimp  atggcttgccttggatttcagcggcacaaggc----tc-ag-ctgaacctggctaccaggacctggccct
B D                   Gorilla  atggcttgccttggatttcagcggcacaaggc----tc-ag-ctgaacctggctaccaggacctggccct
B D                 Orangutan  atggcttgccttggatttcagcggcacaaggc----tc-ag-ctgaaccttgctaccaggacctggccct
B D                    Gibbon  atggcttgccttggatttcagcggcacacggc----tc-ag-ctgaacctggctaccaggacctggccct
B D                    Rhesus  atggcttgccttggatttcagcggcacaaggc----tc-gg-ctcaacctggctaccaggacccggccct
B D       Crab-eating macaque  atggcttgccttggatttcagcggcacaaggc----tc-gg-ctcaacctggctaccaggacccggccct
B D                    Baboon  atggcttgccttggatttcagcggcacaaggc----tc-ag-ctcaacctggctaccaggacccggccct
B D              Green monkey  atggcttgccttggatttcagtggcacaaggc----tc-gg-ctgaacctggctaccagaactcggccct
B D                  Marmoset  atggcttgccttggatttcggaggcacaaggc----tc-ag-ctggacctggctaccaggacctggccct
B D           Squirrel monkey  atggcttgccttggatttcagaggcacaaggc----tc-ag-ctggacctggctaccaggacctggccct
B D                  Bushbaby  atggcttgccttggattccagaggcaagaggc----ag-gg-ctagacctggcttccaggacttggtcct
           Chinese tree shrew  atggcttgccttagattccagaagcacaaggc----tc-ag-cgggacctggcttccaggacatggccct
B D                  Squirrel  atggcttgccttggattccagaggcctgaggc----tg-gc-ttggagccagcttccagggcctggtcct
       Lesser Egyptian jerboa  atggcttgtcatggagtccagaggtccaaagc----tc-ag-ctggagctggcttccagaacctggttct
                 Prairie vole  atggctcgtcttggagtcgagaggagcaaggt----cc-aa-ctgcagctggcttctaggacttggccct
B D           Chinese hamster  atggctggtcttggagtccagaggtgcagagc----tc-aa-ctgcagctggcttctaggacttggccct
               Golden hamster  atggctcgtcttggagtccagaggtgcaaggc----tc-aa-ctgcagctagcttctagaacttggccca
B D                     Mouse  atggcttgtcttggactccggaggtacaaagc----tc-aa-ctgcagctgccttctaggacttggcctt
B D                       Rat  atggctcgtcttggagtccagaggtacaaaac----tc-ac-ctgcagctgccttctaggacttggcctt
B D            Naked mole-rat  atggcttgccttgggctccggaggcaccaggc----tt-gg-ctgcagctgtttcccaagacctggccct
B D                Guinea pig  atggctcgccttgagctccggagacaccaagt----tc-ag-ctgtggctgcttcccaagacctggccct
                   Chinchilla  atggcttgccttgggctccggaggcaccaggt----tc-ag-ctgcagctgcttccaaggacctggccct
             Brush-tailed rat  atggcttgccttgggctccggaggcaccaggt----tc-ag-ctgcagatgcttcccaagacctggccct
B D                    Rabbit  atggctcgccttggattccagaggcaggggac----tc-ag-ctggatctggcttccaggacttggtcct
B D                      Pika  atggcttgctttggattccagaggcaggaggc----tc-ag-ctggttgtggcttccaggagctggtccc
B D                       Pig  atggcttgctttggattccggagccatggggc----tt-gg-ctggagcttacttctaggacctggccct
B D                    Alpaca  atggtttggtttggattccggagccatggggc----tc-gg-ctggacctggcttctgggacctggccct
               Bactrian camel  atggtttggtttggattctggagccatggggc----tc-gg-ctggacctggcttctgggacctggccct
B D                   Dolphin  atggcttgctttggcttccagagtcatggggc----tc-gg-ctggacctggcttctgggacctggccct
                 Killer whale  atggcttgctttggcttccagagtcatggggc----tc-gg-ctggacctggcttctgggacctggccct
             Tibetan antelope  atggcttgctctggattccagagtcatgggac----tt-gg-------tggacttctcagacctggccct
B D                       Cow  atggcttgctctggattccagagtcatgggac----tt-gg-------tggacatctaggacctggccct
B D                     Sheep  atggcttgctctggattccagagtcatgggac----tt-gg-------cggacttctcggacctggccct
                Domestic goat  atggcttgctctggatcccagagtcatgggac----tt-gg-------cggacttctcggacctggccct
B D                     Horse  atggctggcttcgggttccggaggcgtggggc----ac-gg-ctggatccggctcccaggacctggccct
B D          White rhinoceros  atggcttgtgttgggttccggaggtgtgcggc----tc-gg-ctggacccggctcccaggacctggccct
B D                       Cat  atggcttgctttggattccggaggcatggggc----tc-ag-ctggacctggcttctaggacctggccct
B D                       Dog  atggctggctttggattccggaggcatggggc----tc-ag-ccggacctggcttctaggacctggccct
B D                   Ferret   atggcttgtttcggattccggaggcatggggt----tc-ag-ccggaccggtcttctaggacctggccct
B D                     Panda  atggcttgctttggattccggaggcatggggc----tc-ag-ctggacctggcttctaggacctggccct
               Pacific walrus  atggcttgctttggattccggaggcatggggt----tc-ag-ccggatctggcttctaggacctggccct
                 Weddell seal  atggcttgctttggattccggaggcatggggc----tc-ag-cgggacctggcttctaggacctggccct
             Black flying-fox  atggcttgctttggattccggaggcacgaggc----tc-gg-ctagacctggcttttaggacctggccct
B D                   Megabat  atggcttgctttggattccggaggcacgaggc----tc-gg-ctagacctggcttttaggacctggccct
                Big brown bat  atggctggctttgggttcccgaggcgcggggc----tc-cg-gggcacctgccccccaggacctggccct
         David's myotis (bat)  atggccggcttcgggttccagaggcgcggggc----tc-cc-ggcgacctgcctggcaggacctggccct
B D                  Microbat  atggccggcttggggttccagaggcgcggggc----tc-cc-ggcgacctgcctcgcaggacctggccct
B D                  Hedgehog  atgccttgctttggattctggagatctggggc----cc-ag-tgggaactgatgtctggactgtggtcct
B D                     Shrew  atgccttgctttggatcccagggacacggggc----tc-ag-ttggacttgactcctgggaccttgccct
              Star-nosed mole  atgcctcactttggattccagaggcccggagc----tt-gg-ctggacctgccttctgggacctggcctt
B D                  Elephant  atggcttacattgtattccacaggtgtggggc----tc-ag-ctgcaccag---cccaggacctggccct
          Cape elephant shrew  atggctcggactggattcctcaagtgtggggt----tc-ag-ctgcactgg---cccaggacctggccct
B D                   Manatee  atggcttgcgctggattccgcaggtgcggggc----tc-aa-ctgcaccag---cccaggacctggccct
             Cape golden mole  atggcttgcattggattcttcaggcctggggt----tc-ag-cagcacctg---cccaggacctggccct
B D                    Tenrec  atggcttgcgttggattccacaactgtgcggc----tc-ag-ctgcccgcg---cccaggacccggctcc
                     Aardvark  atggcttgcattggattccgcaggtgtggggc----tc-ag-ctgcaccca---cccagaaccttgtcct
B D                 Armadillo  atggtttgctttggattccggaggcacgcggc----tt-gg-tcgcacccc---ctcaggacctggccct
B D                   Opossum  atgcttctcctgggatccaggagagaaatggg----aa-ag-cttcacc---atcccatgaattggccct
B D           Tasmanian devil  atggttctcctgagatccaggagacaaatggg----aa-ag-cttcacc---atcccaagaactggccct
B D                   Wallaby  atggttctcctgggatccaggagacaaatgga----aa-ag-gttcacc---ctcccaagaactggccct
B D                  Platypus  atgatccgccttggatccaagaggcaaataag----ag-aa-cgtcatc---attacaggaacaggtcct
  D               Rock pigeon  cctgcttgtccttaagtctgtaggca-tcaccaccttc-ag-ac--------ccctcagcatccatccca
  D              Saker falcon  ccagtttgtcttaaagtctgaaggcaccagccaccttc-ag-cc--------ccttcagcatctgttcca
  D          Peregrine falcon  ccagtttgtcttaaagtctgaaggcaccagccaccttc-ag-cc--------ccttcagcatctgttcca
  D       Collared flycatcher  ccagtttatcttaaagtctgaaggcatccg--accttc-ag-cc--------tcttcagcatctgtccca
  D    White-throated sparrow  ccagtttgtcttaaactctaagggca----------tc-ag-ca--------ccttcagc--ctgtccca
B D       Medium ground finch  ccagtttgtcttaaagtctaaaggca----------tc-ag-ca--------ccttcagc--ctgtccca
B D               Zebra finch  ccggtttgtccttaagtctgaaggca----------tt-ag-ca--------ccttcagcctctgtccca
           Tibetan ground jay  ccagtttgtcttaaagtctgaagtcatcagacactgtc-ag-cc--------ccttcagcatctgtccca
B D                Budgerigar  ccagtttgtcttacagttggaaggca----------tc-agcca--------ccttcagcctctgtccca
  D                    Parrot  ccagtttgtcttaaagtcgggaggca----------tc-agcca--------ccttcagcttctgtccca
  D             Scarlet macaw  ccagtttgtcttaaagtcggaaggca----------tc-agcca--------ccttcagcttctgtccca
  D              Mallard duck  ccagtttgtcttaacgtctgaaggcatcagacaccttc-ag-tc--------ccttcagcatctgtccca
B D                   Chicken  ccagtttgtcttaaagtctgaaggcatcagatacttcc-ag-ct--------ccgtcagcatctgtcccg
B D                    Turkey  ccagtttgtcttaaagtctgaaggcatcagatattttc-ag-ca--------ccttcagcacctgtccca
B D        American alligator  ccagcttggtctggagtcagaggacatcagccaacttt-gt-cc--------cctttgatatccatctct
  D           Green seaturtle  ccatctggacttggcgttagagtgcaacaggcaacttcaaa-c---------tttctaacggctgtctct
  D            Painted turtle  ccatctggacttggcgttagaagacaacaggcaacttc-aa-c---------tttctaacgtctgtctct
  D  Chinese softshell turtle  ccagctagacttggctttagacggtaacgagcaacttc-ag-c---------tttctatcatctgtttct
  D    Spiny softshell turtle  ccagctagacttggctttagacggtaacgagcaacttc-aa-c---------tttctatcatctgtctct
B D             X. tropicalis  ======================================================================

                        Human  gcactctcctgttt---tttcttctcttcatccctgtct---------------------tctgca--aa
                        Chimp  gcactctcctgttt---tttcttctcttcatccctgtct---------------------tctgca--aa
                      Gorilla  gcactctcctgttt---tttcttctcttcatccctgtct---------------------tctgca--aa
                    Orangutan  gcactctcctgttt---tttcttctcttcatccctgtct---------------------tctgca--aa
                       Gibbon  gcactctactgttt---tttcttctcttcatccctgtct---------------------tctgca--aa
                       Rhesus  acactctcctgttt---tctcttctcttcatccctgtct---------------------tctcca--aa
          Crab-eating macaque  acactctcctgttt---tctcttctcttcatccctgtct---------------------tctcca--aa
                       Baboon  acactctcctgttt---tctcttctcttcatccctgtct---------------------tctcca--aa
                 Green monkey  acagtctcctgttt---tctcttctcttcatccctgtct---------------------tctcca--aa
                     Marmoset  gcacgctcctgttt---tctcttctcttcatccctgtct---------------------tctcca--ac
              Squirrel monkey  gcatgctcctgttt---tctcttctcttcatccctgtct---------------------tctcca--ac
                     Bushbaby  gcatcatcctattt---tcttttctcttcattcctgtct---------------------tcacca--aa
           Chinese tree shrew  gcactgccctgttc---tcttttctcttcatccctgtct---------------------tttcca--aa
                     Squirrel  gcactgccctgctt---tctcttctcttcatccccatct---------------------tctcca--aa
       Lesser Egyptian jerboa  atgtggtcctgttt---gctcttgtcttcatccctgtcc---------------------tgacca--aa
                 Prairie vole  ttgtagtcctgctt---gcttttctcttcatcccaactt---------------------tgtcca--aa
              Chinese hamster  ttgaagccctgctt---gcttttcttttcatcccgacct---------------------tctcca--aa
               Golden hamster  ttgaagccttgctt---gcttttcttttcgtcccgacct---------------------tctcca--aa
                        Mouse  ttgtagccctgctc---actcttcttttcatcccagtct---------------------tctctg--aa
                          Rat  ttggagtcctgctt---tctcttctcttcatcccaatct---------------------tctctg--aa
               Naked mole-rat  gctctgccctcttt---tctcttctcttcctgcctgcct---------------------tctgta--aa
                   Guinea pig  gctctgctcttctc---tctctcctcgtcatgcctgtct---------------------tctcta--aa
                   Chinchilla  gctctgccctcttc---tctcttctcttcatgcctgtct---------------------tctcta--aa
             Brush-tailed rat  gttctgccctcttt---tctcttctcttcatgcctgtgt---------------------tctgta--aa
                       Rabbit  gcgctgccctgttt---tctcttctcttcctcccggtct---------------------tctcta--aa
                         Pika  accctgctctgttt---tctctcctcttcctccctgtct---------------------tctcta--aa
                          Pig  gtacagctctgttt---tctcttctcttcatccctgtct---------------------tctcca--aa
                       Alpaca  gcactgccctgttt---tctcttctcttcatccctgtct---------------------tctcca--aa
               Bactrian camel  gcactgccctgttt---tctcttctcttcatccctgtct---------------------tctcca--aa
                      Dolphin  gtactgccctgttt---tctcttctcttcatccccgttt---------------------tctcta--aa
                 Killer whale  gtactgccctgttt---tctcttctcttcatccccgttt---------------------tctcta--aa
             Tibetan antelope  gcactgccctgttt---tttcttctcttcattcctgttt---------------------tctcta--aa
                          Cow  gcactgccctattt---tttcttgtcttcattcctgttt---------------------tctcta--aa
                        Sheep  gcactgccctgttt---tttcttctcttcattcctgttt---------------------tctcta--aa
                Domestic goat  ggactgccctggtt---tcccttctcttcattcctgttt---------------------tctcta--aa
                        Horse  gcaccgcgctattt---tctcttctcttcatgcccgtct---------------------tctcca--aa
             White rhinoceros  gcactgccctattt---tctctcctcttcatccccgtct---------------------tctcca--aa
                          Cat  gcactgctctgttt---tctcttctctttatccccgtct---------------------tctcca--aa
                          Dog  gcactgctctgttt---tctcttctctttatccccgtct---------------------tctcca--aa
                      Ferret   gcaccgctctgttt---tctcttctatttatccccgtct---------------------tctcca--aa
                        Panda  gcaccgctctgttt---tctcttctatttatcccagtct---------------------tctcca--aa
               Pacific walrus  gcacggctctgttt---tctcttctttttatccctgtct---------------------tctcca--aa
                 Weddell seal  gcacggctctgttt---tctcttctatttatccctgtct---------------------tctcca--aa
             Black flying-fox  gcactgccctgttt---tctcttctcttcatccctgtct---------------------tctcca--aa
                      Megabat  gcactgccctgttt---tctcttctcttcatccctgtct---------------------tctcca--aa
                Big brown bat  gcaccgcgctgctt---tctcttcttttcatccctgtct---------------------tctcca--aa
         David's myotis (bat)  gcaccgcgctcttt---tctctgcttttcatccctgtct---------------------tctcca--aa
                     Microbat  gcaccgcgctcttt---tctctgcttttcatccctgtct---------------------tctcca--aa
                     Hedgehog  gcactgtcctgttt---tttcttctcttcattcctgctc---------------------tctcca--aa
                        Shrew  gcactgccctgctg---tctctgctcttcatccctatct---------------------tctcca--aa
              Star-nosed mole  gcactgccttattt---tctcttctcttcatccctgtct---------------------tctcca--aa
                     Elephant  gcactgcaatgctt---tctcttctcttcattcccatct---------------------gctcca--aa
          Cape elephant shrew  gcaatgcactgctt---tctctactcttcattcccatct---------------------gctcca--ca
                      Manatee  gcactgctatgctt---tctcttctcttcattcccgtct---------------------gctcca--aa
             Cape golden mole  acactgttgtgctt---tctcttctcttcattcccatct---------------------gctcca--aa
                       Tenrec  ccaccattctactt---tctcttctcttcatccccatct---------------------gctcca--aa
                     Aardvark  gcactgctatgctt---tctcttctcttcattcccatct---------------------actcca--aa
                    Armadillo  gctctgccctgttt---tctctgctcttcattcctggct---------------------tctcca--aa
                      Opossum  gcacagcaatgctc---tcattgctctttatcccaagca---------------------tctcca--aa
              Tasmanian devil  gcacagcaatgctc---tctcttctctttattccaagta---------------------tctcta--aa
                      Wallaby  gcacggcaatgctc---tctctgctctttatcccaagta---------------------tctcca--aa
                     Platypus  ggtcggtgatggtc---tcattcctgtttgtcgctggcttcgggggccctgctgctggtctcgctg--aa
                  Rock pigeon  gcataggaatgctc---tcgatattggtcaccgtgggct---------------------ttctctgcac
                 Saker falcon  gcacaggaatgctc---tcaatattggtcaccgtgggct---------------------ttctctgcac
             Peregrine falcon  gcacaggaatgctc---tcaatattggtcaccgtgggct---------------------ttctctgcac
          Collared flycatcher  gcacaggaatgatc---tcaattttggtcaccgtgggct---------------------ttctctgcac
       White-throated sparrow  gcacaggaatgctc---tcaatattggtcaccgtgagct---------------------ttctctgcac
          Medium ground finch  gcacaggaatgctc---tcaatattggtcaccgtgggct---------------------ttctctgcac
                  Zebra finch  gcacaggaatgctc---tcaatattggtcaccatgggct---------------------ttctctgcac
           Tibetan ground jay  gcacaggaatgctc---tcaatattggtcaccgtgggct---------------------ttctctgcac
                   Budgerigar  ccacaggaatgctc---tcgatattggtcaccgtgggct---------------------ttctctgcac
                       Parrot  gcacaggaatgatc---tcaatattggtcaccgtgggct---------------------ttctctgcac
                Scarlet macaw  gcacaggaatgatc---tcaatattggtcaccgtgggct---------------------ttctctgcac
                 Mallard duck  gcgcaggaatgctc---tcaatattgatcaccgtgggat---------------------ttctctgcac
                      Chicken  gtgcaggaatgctc---tcagcatgggtcaccgtgagct---------------------ttctctgcgc
                       Turkey  gcgcaggaatgctc---tcagcatgggtcatcgtgagct---------------------ttctctgtgc
           American alligator  gcattggaatgatt---gcgctattgatcaccatcggct---------------------ttctctgcac
              Green seaturtle  tcgctggaatgctc---acgctattgaccaccattggct---------------------ttctcagcac
               Painted turtle  tcgctggaatgctc---acgctattgatcaccattggct---------------------tcctcagcac
     Chinese softshell turtle  tcgctggaatgctcctactactactgaccaccattggct---------------------tcctcagcac
       Spiny softshell turtle  tcgctggaatgctcctactactactgaccaccattggct---------------------tcctcagcac
                X. tropicalis  ======================================================================

                        Human  g----gtgagtg
                        Chimp  g----gtgagtg
                      Gorilla  g----gtgagtg
                    Orangutan  g----gtgagtg
                       Gibbon  g----gtgagtg
                       Rhesus  g----gtgagtg
          Crab-eating macaque  g----gtgagtg
                       Baboon  g----gtaagtg
                 Green monkey  g----gtgagtg
                     Marmoset  g----gtgagtg
              Squirrel monkey  g----gtgagtg
                     Bushbaby  g----gtgagtg
           Chinese tree shrew  g----gtgagta
                     Squirrel  g----gtgagtg
       Lesser Egyptian jerboa  g----gtgagtg
                 Prairie vole  g----gtgagtg
              Chinese hamster  g----gtgagtg
               Golden hamster  g----gtgagtg
                        Mouse  g----gtgagtg
                          Rat  g----gtgagtg
               Naked mole-rat  g----gtaagtg
                   Guinea pig  g----gtgagtg
                   Chinchilla  g----gtgagtg
             Brush-tailed rat  g----gtgagtg
                       Rabbit  g----gtgagtg
                         Pika  g----gtgagtg
                          Pig  g----gtgagtg
                       Alpaca  g----gtgagtg
               Bactrian camel  g----gtgagtg
                      Dolphin  g----gtgagtg
                 Killer whale  g----gtgagtg
             Tibetan antelope  g----gtgagtg
                          Cow  g----gtgagtg
                        Sheep  g----gtgagcg
                Domestic goat  g----gtgagtg
                        Horse  g----gtgagtg
             White rhinoceros  g----gtgagtg
                          Cat  g----gtgagtg
                          Dog  g----gtgagtg
                      Ferret   g----gtgagta
                        Panda  g----gtgagtg
               Pacific walrus  g----gtgagtg
                 Weddell seal  g----gtgagtg
             Black flying-fox  g----gtgag--
                      Megabat  g----gtgag--
                Big brown bat  g----gtgag--
         David's myotis (bat)  g----gtgag--
                     Microbat  g----gtgag--
                     Hedgehog  g----gtgagtg
                        Shrew  g----gtgagtg
              Star-nosed mole  g----gtgagtg
                     Elephant  g----gtgagtg
          Cape elephant shrew  g----gtgagtg
                      Manatee  g----gtgagtg
             Cape golden mole  g----gtgagtg
                       Tenrec  g----gtgagtg
                     Aardvark  g----gtgagtg
                    Armadillo  ggtgagtgagtg
                      Opossum  g----gtgagtg
              Tasmanian devil  g----gtgagtg
                      Wallaby  g----gtgagtg
                     Platypus  g----gtgagtg
                  Rock pigeon  a----gccagca
                 Saker falcon  a----gctactg
             Peregrine falcon  a----gctactg
          Collared flycatcher  a----gccactg
       White-throated sparrow  a----gccactg
          Medium ground finch  a----gccgctg
                  Zebra finch  a----gccactg
           Tibetan ground jay  a----gccactg
                   Budgerigar  a----gccactg
                       Parrot  a----gccactg
                Scarlet macaw  a----gccactg
                 Mallard duck  a----gccactg
                      Chicken  a----gccaccg
                       Turkey  a----gccactg
           American alligator  a----gccactg
              Green seaturtle  a----gccactg
               Painted turtle  a----gccactg
     Chinese softshell turtle  a----gccagtg
       Spiny softshell turtle  a----gccagtg
                X. tropicalis  ============

Inserts between block 1 and 2 in window
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                  Wallaby 39bp

Alignment block 2 of 185 in window, 203868059 - 203868087, 29 bps 
B D                     Human  -agacttttggagcatga---agatg--------gagga-gg
B D                     Chimp  -agacttttggagcatga---agatg--------gagga-gg
B D                   Gorilla  -agacttttggagcatga---agatg--------gagga-gg
B D                 Orangutan  -agacttttggagcatga---agatg--------gagga-gg
B D                    Gibbon  -agacttttggagcatga---agatg--------gagga-gg
B D                    Rhesus  -agacttttggagcatga---agatg--------gagga-gg
B D       Crab-eating macaque  -agacttttggagcatga---agatg--------gagga-gg
B D                    Baboon  -agacttttggagcatga---agatg--------gagga-gg
B D              Green monkey  -agacttttggagcatga---agatg--------gagga-gg
B D                  Marmoset  -agacttttggatcatga---agatg--------gagga-gg
B D           Squirrel monkey  -agacttttggatcatga---agatg--------gagga-gg
B D                  Bushbaby  -agactttgggagaatga---aggtg--------gagga-gg
           Chinese tree shrew  -aaattgttggagtgtga---atgtg--------gagga-gg
B D                  Squirrel  -agatttctggagcatga---aggtg--------gagga-gg
       Lesser Egyptian jerboa  -aggcttctggaacatga---agg-g--------gagga-tg
                 Prairie vole  -agacttctggagcatgg---aggta--------aagga-gg
B D           Chinese hamster  -tgacttctggagcatgg---aggtg--------gaggg-gg
               Golden hamster  -tgacttctggagcatgg---aggtg--------gaggg-gg
B D                     Mouse  -agacttctggaacatgg---aggtg--------gagga-gg
B D                       Rat  -agacttctggaacatgg---aggtg--------gaaaa-gg
B D            Naked mole-rat  -agtct--tggaacatga---agaca--------gagga-ag
B D                Guinea pig  -agac---tggaaca-aa---aggca--------gagga-ag
                   Chinchilla  -agact--tggaacagga---aggca--------gagga-ag
             Brush-tailed rat  -agact--tggaacatga---aggcg--------gagga-ag
B D                    Rabbit  -agactcttggagcatga---aggtg--------gagga-gg
B D                      Pika  -aggctcttggagcacga---aggtg--------gagga-gg
B D                       Pig  -agacttttggagcatga---aggtg--------gagga-gg
B D                    Alpaca  -aggattttggagcacga---aattg--------gagga-gg
               Bactrian camel  -aggattttggagcatga---agttg--------gagga-gg
B D                   Dolphin  -aggctattggagcatgg---aggtg--------gagga-gg
                 Killer whale  -aggctattggagcatgg---aggtg--------gagga-gg
             Tibetan antelope  -agacttttggagcatga---aggtg--------gagga-gg
B D                       Cow  -aggcttttggagcatga---aggtg--------gagga-gg
B D                     Sheep  -agacttttggagcatga---aggtg--------gagga-gg
                Domestic goat  -agacttttggagcatga---aggtg--------gagga-gg
B D                     Horse  -aggcttttggagcctga---agctg--------gagga-gg
B D          White rhinoceros  -aggctcttggagcctga---aggtg--------gagga-ag
B D                       Cat  -aggcttttggagcatga---aggtg--------gagga-gg
B D                       Dog  -aggcttttggaggatga---aggtg--------gagga-gg
B D                   Ferret   -aggcttttgcaggatga---aggtg--------gagga-gg
B D                     Panda  -aggtttttggaggatga---aggtg--------gagga-gg
               Pacific walrus  -aggcttttggaggatga---aggtg--------gaggacgg
                 Weddell seal  -aggcttttggaggatga---aggtg--------gagga-gg
             Black flying-fox  ---gtttttggagcatga---aggtg--------gagga-gg
B D                   Megabat  ---gtttttggagcatga---aggtg--------gagga-gg
                Big brown bat  ---------tgaccacga---aggtg--------gagga-gg
         David's myotis (bat)  ---------tgaacacga---aggtg--------gagga-gg
B D                  Microbat  ---------tgagcacaa---aggtg--------gagga-gg
B D                  Hedgehog  -atggttttagagcatga---aggt-----------gga-gg
B D                     Shrew  -aagcgtttggagcatga---atgtg--------gagga-gg
              Star-nosed mole  -aggcttttggagaagga---gggtg--------gagga-gg
B D                  Elephant  -aggattttggaacacga---aggtg--------gagga-gg
          Cape elephant shrew  -aggctgttggaacacga---aggtg--------gagga-gg
B D                   Manatee  -aggattttggaacacga---aggtg--------gagga-gg
             Cape golden mole  -aggcttttggaacgtga---aggtg--------gagga-gg
B D                    Tenrec  -aggcttttggaacacga---aggtg--------aagga-gg
                     Aardvark  -atgcttttggaacatga---aggtg--------gagga-gg
B D                 Armadillo  -aggcgtttggagtgtga---aggtg--------gagga-gg
B D                   Opossum  ----ctttaaaaaacttc---aaa----------gagta---
B D           Tasmanian devil  ----ccttcaaagactta---aga----------gaata---
B D                  Platypus  --aggttaaaaaacaagactgaggtg--------gagga-gg
  D               Rock pigeon  ccatggccgaaggtgggt---tgata--------aagga-ga
  D              Saker falcon  ccattgccgaaggtgggt---agatg--------aagga-gg
  D          Peregrine falcon  ccattgccgaaggtgggt---agatg--------aagga-gg
  D       Collared flycatcher  ccattgctgaaggtgggt---agatg--------aagga-ag
  D    White-throated sparrow  ccattgctgaaggtgggt---agatg--------aagga-gg
B D       Medium ground finch  ccattgctgaaggtgggt---agatg--------aagga-gg
B D               Zebra finch  ccattgctgaaggtgggt---agatg--------aagga-gg
           Tibetan ground jay  ccattgctgaaggtgggt---agatg--------aagga-gg
B D                Budgerigar  ccattgtccaaggtgggt---agatg--------cagaa-gg
  D                    Parrot  ccattgtccaaggtgggt---agatg--------aagaa-gg
  D             Scarlet macaw  ccattgtccaaggtgggt---agatg--------aagaa-ga
  D              Mallard duck  ccattgcagaaggtgggt---agatgaaggaggcaaggt-ag
B D                   Chicken  ccactgccgaaggtgggt---agatg--------aaggt-ag
B D                    Turkey  ccactgccaaaggtgggt---agatg--------aaggt-a-
B D        American alligator  gcatcgctaaaggtgggt---agata--------aaggt-ga
  D           Green seaturtle  gcatcaccaaaggtgggt---agatc--------aagga-ga
  D            Painted turtle  gcatcgccaaaggtgggt---agatc--------aagaa-ga
  D  Chinese softshell turtle  gcatcaccagaggtgggt---agttg--------aagaa-ga
  D    Spiny softshell turtle  gcatcaccagaggtgggt---agatg--------aagaa-ga
B D             X. tropicalis  ==========================================
B D                   Wallaby  ==========================================

Inserts between block 2 and 3 in window
  D              Rock pigeon 15bp
  D             Saker falcon 15bp
  D         Peregrine falcon 15bp
  D      Collared flycatcher 1174bp
  D   White-throated sparrow 14bp
B D      Medium ground finch 15bp
B D              Zebra finch 15bp
          Tibetan ground jay 1142bp
B D               Budgerigar 15bp
  D                   Parrot 15bp
  D            Scarlet macaw 15bp
  D             Mallard duck 7bp
B D                  Chicken 7bp
B D       American alligator 15bp
  D          Green seaturtle 17bp
  D           Painted turtle 17bp
  D Chinese softshell turtle 17bp
  D   Spiny softshell turtle 17bp

Alignment block 3 of 185 in window, 203868088 - 203868116, 29 bps 
B D                     Human  tgtttctcctacctgggtttca---------tttgtt---t
B D                     Chimp  tgtttctcccacctgggtttca---------tttgtt---t
B D                   Gorilla  tgtttctcccacctgggtttca---------tttgtt---t
B D                 Orangutan  tgtttctcccacctgggtttca---------tttgtt---t
B D                    Gibbon  tgtttctcccacctgggtttca---------tttctt---t
B D                    Rhesus  tgtttctcccacctgggtttca---------tttctt---t
B D       Crab-eating macaque  tgtttctcccacctgggtttca---------tttctt---t
B D                    Baboon  tgtttctcccacctgggtttca---------tttctt---t
B D              Green monkey  tgtttctcccacctgggtttca---------tttctt---t
B D                  Marmoset  tgtttctcccacctgggtttca--------ttttttt---t
B D           Squirrel monkey  tgtttctcccacctgagtttca---------tttctt---t
B D                  Bushbaby  tgtttctcccaccctggtttca---------tttctt---a
           Chinese tree shrew  tgtttctcccacct-ggtttca---------ttcctt---t
B D                  Squirrel  tgtttctcccacctgggtttca---------tttctt---t
       Lesser Egyptian jerboa  tg-ttttctcacctgagtttca---------tttctt---t
                 Prairie vole  tgattttcctacatgggtttca---------tttctt---t
B D           Chinese hamster  tgtttttcctacacgggtttca---------tttctt---t
               Golden hamster  tgtttttcctacacgggtttca---------tttctt---t
B D                     Mouse  tgtttttcctacatgggtttcgttttttttttttctt---t
B D                       Rat  tgtttttcctacatgggtttca---------tttctt---t
B D            Naked mole-rat  tgtttctctcacctgcattgca---------tttctt---t
B D                Guinea pig  tgtttctcccacct-tgtttca---------tttcgt---t
                   Chinchilla  cgtttctcccacct-tgtttca---------tttctt---t
             Brush-tailed rat  catttctcccacct-tgtttca---------tttctt---t
B D                    Rabbit  tgtttctcccacctgggtttca---------tttctt---t
B D                      Pika  tgtttctccca-ctgagtttca---------tttctt---t
B D                       Pig  tgtttctcccacccgggtttca---------tttctt---t
B D                    Alpaca  tgtttctcccacctgggtttca---------tttctt---t
               Bactrian camel  tgtttctcccacctgggtttca---------tttctt---t
B D                   Dolphin  tgtttctcccacctgggtttca---------ttcctt---t
                 Killer whale  tgtttctcccacctgggtttca---------ttcctt---t
             Tibetan antelope  tgtttctccca-ctgggtttca---------tttctt---t
B D                       Cow  tgtttctccca-ctgggtttca---------tttctt---t
B D                     Sheep  tgtttctccca-ctgggtttca---------tttctt---t
                Domestic goat  tgtttctccca-ctgggtttca---------tttctt---t
B D                     Horse  tgcttctcccacctgggtttca---------ttggtt---t
B D          White rhinoceros  tccttctcccacctgggtttca---------tttctt---t
B D                       Cat  tgtttctcccacctgggtttca---------tttctt---t
B D                       Dog  tgtttctcccacctgtgtttca---------tttctt---t
B D                   Ferret   tgtttctcccacctgcgtttca---------tttctt---t
B D                     Panda  tgtttctcccacctgcgtttca---------tttctt---t
               Pacific walrus  ggtgtctcccacctgcgtttca---------tttctt---t
                 Weddell seal  ggtttctcccacctgcgtttca---------tttctt---t
             Black flying-fox  tgtttctctcacctgggtttca---------tttatt---t
B D                   Megabat  tgtttctctcacctgggtttca---------tttatt---t
                Big brown bat  tgtttctcccgcccggctttca---------tttctt---c
         David's myotis (bat)  tgtttctcccacccgggtttca---------tttctc---t
B D                  Microbat  tgtttctccca-ccgggtttca---------tttctc---t
B D                  Hedgehog  tgttttgcccaccaggctttct---------ttttct---t
B D                     Shrew  tgtttcttccaccagggtttca---------tttctt---t
              Star-nosed mole  tttttttcccaccagggtttca---------tttctt---t
B D                  Elephant  tgtttctcccatctgggtttca---------tttctt---t
          Cape elephant shrew  tgtttctcccatttgggtttca---------tttctt---t
B D                   Manatee  tgtttctcccatctgggtttca---------tttctt---t
             Cape golden mole  tgtttctcccatctgagtttca---------tttctt---t
B D                    Tenrec  tatttctcccatctgggtttcg---------tttctt---t
                     Aardvark  tgtttatcctatatgagtttca---------tttctt---t
B D                 Armadillo  tgtttctcccacttgggtttca---------tttctt---c
B D                   Opossum  ------------cagatctcca---------ttgttt----
B D           Tasmanian devil  ------------c-gatcttca---------ctatttcca-
B D                  Platypus  cgtttccataatctccgtttca---------tcggcg---t
  D               Rock pigeon  tgccttcattttctcggtttca---------gctttt---t
  D              Saker falcon  tgtctaaattttct---------------------------
  D          Peregrine falcon  tgtctaaattttct---------------------------
  D    White-throated sparrow  tgttgacttgttttcagtttca---------tgtcct---t
B D       Medium ground finch  tgttgacttgttttcagtttca---------tgtcct---t
B D               Zebra finch  tgttgacttgttttcagtttca---------tgtcct---t
B D                Budgerigar  tgtctacattttctcggtttca---------catctt---t
  D                    Parrot  tgtctacattttctcggtttca---------catctt---t
  D             Scarlet macaw  tgtctacattttctcggtttca---------tatctt---t
  D              Mallard duck  tatctgcattttctcagtttca---------catctt---t
B D                   Chicken  tgtctacaatttctcattttca---------catctt---t
B D                    Turkey  -gtctacaatttctcattctca---------catctt---t
B D        American alligator  tgtctgcattttctcagtttca---------cctcta---t
  D           Green seaturtle  tgttgacattttctcagtttca---------cccctt---t
  D            Painted turtle  tgtttacattttctcagtttca---------cccctt---t
  D  Chinese softshell turtle  tgtttatgttttctcggtttca---------cccctt---t
  D    Spiny softshell turtle  ------tgttttctcggtttca---------cccctt---t
B D             X. tropicalis  =========================================
  D       Collared flycatcher  =========================================
          Tibetan ground jay  =========================================
B D                   Wallaby  =========================================

Inserts between block 3 and 4 in window
B D          Tasmanian devil 1bp
  D   White-throated sparrow 1bp
B D      Medium ground finch 1bp
B D              Zebra finch 1bp
B D               Budgerigar 1071bp
  D                   Parrot 1bp
  D            Scarlet macaw 1108bp

Alignment block 4 of 185 in window, 203868117 - 203868119, 3 bps 
B D                     Human  c-----------------ag
B D                     Chimp  c-----------------ag
B D                   Gorilla  c-----------------ag
B D                 Orangutan  c-----------------ag
B D                    Gibbon  c-----------------ag
B D                    Rhesus  c-----------------ag
B D       Crab-eating macaque  c-----------------ag
B D                    Baboon  c-----------------ag
B D              Green monkey  c-----------------ag
B D                  Marmoset  c-----------------ag
B D           Squirrel monkey  c-----------------ag
B D                  Bushbaby  t-----------------tg
           Chinese tree shrew  c-----------------ag
B D                  Squirrel  c-----------------ag
       Lesser Egyptian jerboa  c-----------------ag
                 Prairie vole  c-----------------ag
B D           Chinese hamster  c-----------------ag
               Golden hamster  c-----------------ag
B D                     Mouse  c-----------------ag
B D                       Rat  c-----------------ag
B D            Naked mole-rat  c-----------------ag
B D                Guinea pig  c-----------------ag
                   Chinchilla  c-----------------ag
             Brush-tailed rat  c-----------------ag
B D                    Rabbit  c-----------------ag
B D                      Pika  c-----------------ag
B D                       Pig  t-----------------ag
B D                    Alpaca  t-----------------ag
               Bactrian camel  t-----------------ag
B D                   Dolphin  t-----------------ag
                 Killer whale  t-----------------ag
             Tibetan antelope  t-----------------ct
B D                       Cow  t-----------------ct
B D                     Sheep  t-----------------ct
                Domestic goat  t-----------------ct
B D                     Horse  c-----------------ag
B D          White rhinoceros  c-----------------ag
B D                       Cat  c-----------------ag
B D                       Dog  c-----------------ag
B D                   Ferret   t-----------------ag
B D                     Panda  t-----------------ag
               Pacific walrus  t-----------------ag
                 Weddell seal  t-----------------ag
             Black flying-fox  c-----------------ag
B D                   Megabat  c-----------------ag
                Big brown bat  c-----------------cg
         David's myotis (bat)  c-----------------ag
B D                  Microbat  c-----------------ag
B D                  Hedgehog  tttttctttttttcatcagt
B D                     Shrew  t------------------g
              Star-nosed mole  t-----------------ag
B D                  Elephant  c-----------------ga
          Cape elephant shrew  c-----------------ag
B D                   Manatee  c-----------------aa
             Cape golden mole  a-----------------gt
B D                    Tenrec  c-----------------ag
                     Aardvark  c-----------------ag
B D                 Armadillo  c-----------------ag
B D                  Platypus  t-----------------gg
  D               Rock pigeon  ------------------g-
  D              Saker falcon  ----------------cag-
  D          Peregrine falcon  ----------------cag-
  D    White-throated sparrow  ----------------cag-
B D       Medium ground finch  ----------------cag-
B D               Zebra finch  ----------------cag-
  D                    Parrot  ----------------cag-
  D              Mallard duck  ------------------g-
B D                   Chicken  ------------------g-
B D                    Turkey  ------------------g-
B D        American alligator  ------------------g-
  D           Green seaturtle  ------------------g-
  D            Painted turtle  ------------------g-
  D  Chinese softshell turtle  ------------------g-
  D    Spiny softshell turtle  ------------------g-
B D                Budgerigar  ====================
B D             X. tropicalis  ====================
  D       Collared flycatcher  ====================
          Tibetan ground jay  ====================
  D             Scarlet macaw  ====================
B D                   Wallaby  ====================
B D           Tasmanian devil  ====================
B D                   Opossum  --------------------

Inserts between block 4 and 5 in window
  D             Saker falcon 1100bp
  D         Peregrine falcon 1100bp

Alignment block 5 of 185 in window, 203868120 - 203868134, 15 bps 
B D                     Human  cagtcaaaggcag----tg
B D                     Chimp  cagtcaagggcag----tg
B D                   Gorilla  cagtcaagggcag----tg
B D                 Orangutan  cagtcaagggcag----tg
B D                    Gibbon  cagtcaagggcgg----tg
B D                    Rhesus  cagtcaagggcag----tg
B D       Crab-eating macaque  cagtcaagggcag----tg
B D                    Baboon  cagtcaagggcag----tg
B D              Green monkey  cagtcaagggcag----tg
B D                  Marmoset  cagtcaagggcag----tg
B D           Squirrel monkey  cagtcaagggcag----tg
B D                  Bushbaby  cagtcaagggcag----tg
           Chinese tree shrew  tagtcaagggaag----tg
B D                  Squirrel  cagttcagggcag----tg
       Lesser Egyptian jerboa  cagcccagggcaa----tg
                 Prairie vole  cagctaagaacag----tg
B D           Chinese hamster  cagctaaggacag----tg
               Golden hamster  cagccaaggacag----tg
B D                     Mouse  aagctgaggacag----tg
B D                       Rat  aagctaaggacag----tg
B D            Naked mole-rat  cactcaagggcag----gg
B D                Guinea pig  cactcaagggcag----tg
                   Chinchilla  cactcaagggcag----tg
             Brush-tailed rat  cactcaagggcag----tg
B D                    Rabbit  cagtcaaggacag----tg
B D                      Pika  cagtcaaggacag----tg
B D                       Pig  cagtcaagggcag----tg
B D                    Alpaca  cagtc-agggcag----tg
               Bactrian camel  cagtcaagggcag----tg
B D                   Dolphin  cagtcaagggcag----tg
                 Killer whale  cagtcaagggcag----tg
             Tibetan antelope  cagtcaagggcag----ag
B D                       Cow  cagtcaagggcag----ag
B D                     Sheep  cagtcaagggcag----ag
                Domestic goat  cagtcaagggcag----ag
B D                     Horse  cagccaagggcag----tg
B D          White rhinoceros  cagccaagggcag----tg
B D                       Cat  cagtcaagggcag----tg
B D                       Dog  cagtcaaggacag----tg
B D                   Ferret   cagtcaaggacag----tg
B D                     Panda  cagtcaagggcagtgattg
               Pacific walrus  cagtcaaggacag----tg
                 Weddell seal  cagtcaaggacag----tg
             Black flying-fox  cagtcaaagacag----tg
B D                   Megabat  cagtcaaagacag----tg
                Big brown bat  cagtcaagggcag----tg
         David's myotis (bat)  cagtcacgggcag----tg
B D                  Microbat  cagtcgagggcag----tg
B D                  Hedgehog  tagtcagggacag----tg
B D                     Shrew  ctgt----gatgg----tg
              Star-nosed mole  cagtaaaggacag----tg
B D                  Elephant  cagtcaagggcag----tg
          Cape elephant shrew  cagttaggggctg----tg
B D                   Manatee  cagtcaagggcag----tg
             Cape golden mole  aat-caagggcag----tg
B D                    Tenrec  cag-cgagtgcag----tg
                     Aardvark  cagtcgagggcag----tg
B D                 Armadillo  tagtcaagggcag----tg
B D                   Opossum  ctttctagggcat----gg
B D           Tasmanian devil  ---tatagggcat----gg
B D                   Wallaby  cattctagggcat----gt
B D                  Platypus  taatctaggaaag----tg
  D               Rock pigeon  ---caggagaggg----ac
  D    White-throated sparrow  ------gagtcag----ac
B D       Medium ground finch  ------gagacag----ac
B D               Zebra finch  ------gagacag----ac
  D                    Parrot  ------gaaatag----ac
  D              Mallard duck  -----taggacag----gg
B D                   Chicken  -----caggacag----gg
B D                    Turkey  -----caggacag----gt
B D        American alligator  -----caggacaa----tg
  D           Green seaturtle  -----caggacag----tg
  D            Painted turtle  -----caggacag----tt
  D  Chinese softshell turtle  -----caggacag----tg
  D    Spiny softshell turtle  -----caggacag----tg
  D          Peregrine falcon  ===================
  D              Saker falcon  ===================
B D                Budgerigar  ===================
B D             X. tropicalis  ===================
  D       Collared flycatcher  ===================
          Tibetan ground jay  ===================
  D             Scarlet macaw  ===================

Inserts between block 5 and 6 in window
  D              Rock pigeon 3bp
  D   White-throated sparrow 25bp
B D      Medium ground finch 23bp
B D              Zebra finch 16bp
  D                   Parrot 1021bp

Alignment block 6 of 185 in window, 203868135 - 203868153, 19 bps 
B D                     Human  a-tttatagcaaagccagaa
B D                     Chimp  a-tttatagcaaagccagaa
B D                   Gorilla  a-tttatagcaaagccagaa
B D                 Orangutan  a-tttatagcaaagccagaa
B D                    Gibbon  a-tttatagcaaagccagaa
B D                    Rhesus  a-tttatagcaaagccagaa
B D       Crab-eating macaque  a-tttatagcaaagccagaa
B D                    Baboon  a-tttatagcaaagccagaa
B D              Green monkey  a-tttatagcaaagccagaa
B D                  Marmoset  a-tttatagcagagccagaa
B D           Squirrel monkey  a-tttatagcaaagccagaa
B D                  Bushbaby  a-tttatagcaaggccagaa
           Chinese tree shrew  a-tttatagcaaagccagac
B D                  Squirrel  a-tttatagcagaaacaaaa
       Lesser Egyptian jerboa  a-tttatagcaaagccagaa
                 Prairie vole  a-tttaaagaagagccatac
B D           Chinese hamster  a-tttgtagaagagccagaa
               Golden hamster  a-tttgtagaagagccagaa
B D                     Mouse  a-tttatagaaatgccagaa
B D                       Rat  a-tttatagtaatgccaaaa
B D            Naked mole-rat  a-tttctagcaaagccagaa
B D                Guinea pig  a-tttctagcaaagccag-a
                   Chinchilla  a-tttttagcaaagccagaa
             Brush-tailed rat  a-tttctagcaaagccaaaa
B D                    Rabbit  a-tttagag-gatgccagaa
B D                      Pika  a-tttatag-aaagccagag
B D                       Pig  a-tttatagcaaagccagaa
B D                    Alpaca  a-tttatagcaaagccagaa
               Bactrian camel  a-tttatagcaaagccagaa
B D                   Dolphin  a-tttatagcaaatccagaa
                 Killer whale  a-tttatagcaaatccagaa
             Tibetan antelope  a-tttatagcaaagccagaa
B D                       Cow  a-tttacagcaaagccagaa
B D                     Sheep  a-tttatagcaaagccagaa
                Domestic goat  a-tttatagcaaagccagaa
B D                     Horse  a-tttaaagcaaagccagaa
B D          White rhinoceros  a-tttaaagcaaagccagaa
B D                       Cat  a-tttataacaaagccagaa
B D                       Dog  a-tttataaccaagccagaa
B D                   Ferret   a-tttataacaaagccagaa
B D                     Panda  a-tttataacaaggccagag
               Pacific walrus  a-tttataacaaagccagaa
                 Weddell seal  a-tttataacaaagccagaa
             Black flying-fox  a-tttctagcaaagccagac
B D                   Megabat  a-tttctagcaaagccagac
                Big brown bat  a-tttctagcaaagccagaa
         David's myotis (bat)  a-tttctagcaaagccagaa
B D                  Microbat  a-tttctagcaaagccagaa
B D                  Hedgehog  a-tttatagcaaattcagaa
B D                     Shrew  a-t---tagcaaagcgagaa
              Star-nosed mole  a-tttataacaaagccagaa
B D                  Elephant  a-tttacagcaaagccagaa
          Cape elephant shrew  a-tttttagcaaagccataa
B D                   Manatee  a-tttatagcaaagccagaa
             Cape golden mole  a-tttataacaaagccagaa
B D                    Tenrec  a-tttagagtaaagcccaga
                     Aardvark  a-tttatagcaaagccagaa
B D                 Armadillo  attttatagcacagccagac
B D                   Opossum  t-ctcacactaggaccagaa
B D           Tasmanian devil  t-ttcacaacaggaccagaa
B D                   Wallaby  t-ctcacaatagggccagaa
B D                  Platypus  a-tttaccgagacttcaggg
  D               Rock pigeon  ----------------gtat
  D              Mallard duck  -------------gctgggt
B D                   Chicken  -------------actgggt
B D                    Turkey  -------------actgggt
B D        American alligator  ---actcagtattacaaggt
  D           Green seaturtle  ---attcagtatagcaagga
  D            Painted turtle  ---attcagtgtagcaagga
  D  Chinese softshell turtle  ---atttagtacagcaagga
  D    Spiny softshell turtle  ---atttagtacagcaagga
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
  D                    Parrot  ====================
B D                Budgerigar  ====================
B D       Medium ground finch  ====================
B D             X. tropicalis  ====================
B D               Zebra finch  ====================
  D       Collared flycatcher  ====================
          Tibetan ground jay  ====================
  D             Scarlet macaw  ====================
  D    White-throated sparrow  ====================

Inserts between block 6 and 7 in window
B D       American alligator 1128bp
  D          Green seaturtle 1262bp
  D           Painted turtle 1178bp
  D Chinese softshell turtle 8bp
  D   Spiny softshell turtle 6bp

Alignment block 7 of 185 in window, 203868154 - 203868168, 15 bps 
B D                     Human  gttaaagg----t-aaaact
B D                     Chimp  gttaaagg----t-aaaact
B D                   Gorilla  gttaaagg----t-aaaact
B D                 Orangutan  gttaaagg----t-aaaact
B D                    Gibbon  gttaaagg----t-aaaact
B D                    Rhesus  gttaaagg----t-aaaact
B D       Crab-eating macaque  gttaaagg----t-aaaact
B D                    Baboon  gttaaagg----t-aaaact
B D              Green monkey  gttaaagg----t-aaaact
B D                  Marmoset  gttaaagg----t-aaaact
B D           Squirrel monkey  gttaaagg----t-agaact
B D                  Bushbaby  gttaaagg----t-aaaagt
           Chinese tree shrew  attaaaga----t-caaacg
B D                  Squirrel  ggtaaagg----t-gaatct
       Lesser Egyptian jerboa  gtgaaagg----c-----tc
                 Prairie vole  gtgaaagg----c-aaa-tc
B D           Chinese hamster  gtgaaagg----c-aaa-tc
               Golden hamster  gtgaaagg----c-aaa-cc
B D                     Mouse  gttaaagc----c-aaaccc
B D                       Rat  gtgaaagg----c-aaaccc
B D            Naked mole-rat  gttcaagg----t-aagcct
B D                Guinea pig  gttcaagg----t-aagtct
                   Chinchilla  gttcaagg----t-aagtct
             Brush-tailed rat  gtgtaagg----t-aagtct
B D                    Rabbit  attaaagg----t-aagact
B D                      Pika  gttgaagg----t-aagact
B D                       Pig  gctaaagt----t-aagact
B D                    Alpaca  gctcaagg----t-aagact
               Bactrian camel  gctcaggg----t-aagact
B D                   Dolphin  gctaaagg----t-gagact
                 Killer whale  gctaaagg----t-gagact
             Tibetan antelope  gctaaagg----t-gagact
B D                       Cow  gctaaagg----t-gagact
B D                     Sheep  gctaaagg----t-gagact
                Domestic goat  gctaaagg----t-gagact
B D                     Horse  gatagagg----t-aaaact
B D          White rhinoceros  catagagg----t-aaaact
B D                       Cat  gctaaagg----t-aaaact
B D                       Dog  gccaaagg----t-aagact
B D                   Ferret   gctaaagg----t-aaaact
B D                     Panda  gcttaagg----t-aaaact
               Pacific walrus  actaaagc----t-aaaa--
                 Weddell seal  gctaaagc----t-aaaa--
             Black flying-fox  actaaagg----taaaaact
B D                   Megabat  actaaagg----taaaaact
                Big brown bat  gctgcagg----t-aaccct
         David's myotis (bat)  gccacagg----t--accac
B D                  Microbat  gccacagg----t--accac
B D                  Hedgehog  actaaagc----t--aaaat
B D                     Shrew  actaaaga----t--aaatt
              Star-nosed mole  gctaaata----a--aaact
B D                  Elephant  gctaaagg----t-aaaact
          Cape elephant shrew  atgaaaga----t-aaaact
B D                   Manatee  gctaaagg----t-aaaact
             Cape golden mole  gttacagg----t-acaact
B D                    Tenrec  gctaaagg----t-caaac-
                     Aardvark  gctagaag----t-aaaact
B D                 Armadillo  gctaaagg----t-aaaaca
B D                   Opossum  actaaaaa----c-aaagct
B D           Tasmanian devil  gctaaaaa----t-ataact
B D                   Wallaby  gctaaaaa----c-aaatcc
B D                  Platypus  gcccaggg----a-ggctgg
  D               Rock pigeon  aacaggga------------
  D    White-throated sparrow  actaatgg------------
B D       Medium ground finch  actaatgg------------
  D              Mallard duck  acaagaggga----------
B D                   Chicken  acaagagg------------
B D                    Turkey  aaaagagg------------
  D  Chinese softshell turtle  atttgagg--ct--------
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
  D                    Parrot  ====================
B D                Budgerigar  ====================
B D             X. tropicalis  ====================
  D            Painted turtle  ====================
B D               Zebra finch  ====================
  D       Collared flycatcher  ====================
B D        American alligator  ====================
          Tibetan ground jay  ====================
  D             Scarlet macaw  ====================
  D    Spiny softshell turtle  ====================
  D           Green seaturtle  ====================

Inserts between block 7 and 8 in window
  D Chinese softshell turtle 1211bp

Alignment block 8 of 185 in window, 203868169 - 203868208, 40 bps 
B D                     Human  c--c-------------aatc---t---ggctt--ggct-------------------------------
B D                     Chimp  c--c-------------agtc---t---ggctt--ggct-------------------------------
B D                   Gorilla  c--c-------------aatc---t---ggctt--ggct-------------------------------
B D                 Orangutan  c--c-------------aatc---t---ggctt--ggct-------------------------------
B D                    Gibbon  c--c-------------aatc---t---ggctt--ggct-------------------------------
B D                    Rhesus  c--c-------------agtc---t---ggctt--ggct-------------------------------
B D       Crab-eating macaque  c--c-------------agtc---t---ggctt--ggct-------------------------------
B D                    Baboon  c--c-------------agtc---t---ggctt--ggct-------------------------------
B D              Green monkey  c--c-------------agtc---t---ggctt--ggct-------------------------------
B D                  Marmoset  c--c-------------gatc---t---ggctt--ggct-------------------------------
B D           Squirrel monkey  c--c-------------aatc---t---ggctt--ggct-------------------------------
B D                  Bushbaby  c--c-------------agtctctt---gggtt--ggtt-------------------------------
           Chinese tree shrew  c--c-------------aatc---tccaggctc--taat-------------------------------
B D                  Squirrel  c--c-------------tgtc---c-cctggcc-ggggt-------------------------------
       Lesser Egyptian jerboa  a--c-------------tgcc---t-tt------------------------------------------
                 Prairie vole  t--c-------------tacc---t-ttcggct--tagc-------------------------------
B D           Chinese hamster  t--c-------------tatc---t-ttgggct--tacc-------------------------------
               Golden hamster  t--c-------------tacc---t-ttgggct--taca-------------------------------
B D                     Mouse  t--c-------------tact---t-tttggtt--taac-------------------------------
B D                       Rat  t--c-------------tacc---c-tttggtt--taac-------------------------------
B D            Naked mole-rat  c--c-------------aatc---ccctggctt--ggat-------------------------------
B D                Guinea pig  c--c-------------cact---c-ctggctt--ggac-------------------------------
                   Chinchilla  c--c-------------aacc---cgctggctt--ggat-------------------------------
             Brush-tailed rat  a--c-------------aacc---c-ttggctt--ggat-------------------------------
B D                    Rabbit  c--c-------------agtc---tcctagctt--gggt-------------------------------
B D                      Pika  c--c-------------agtc---tcctggctt--ggat-------------------------------
B D                       Pig  c--c-------------agtc---tcctgactt--ggac-------------------------------
B D                    Alpaca  c--c-------------aatc---tcctagctt--gggc-------------------------------
               Bactrian camel  c--c-------------aatc---tcctagctt--gggc-------------------------------
B D                   Dolphin  c--c-------------aatc---tcctggcgt--gggc-------------------------------
                 Killer whale  c--c-------------aatc---tcctggcgt--gggc-------------------------------
             Tibetan antelope  c--c-------------agtc---tcctggttt--gggc-------------------------------
B D                       Cow  c--c-------------agtc---tcctggttt--gggc-------------------------------
B D                     Sheep  c--c-------------agtc---tcctggttt--gggc-------------------------------
                Domestic goat  c--c-------------agtc---tcctggttt--gggc-------------------------------
B D                     Horse  c--c-------------agtc---tccaggctt--ggat-------------------------------
B D          White rhinoceros  c--c-------------agtc---tcctggctt--ggat-------------------------------
B D                       Cat  c--c-------------aaac---tcctggctt--ggat-------------------------------
B D                       Dog  c--c-------------agtc---tcctagctc--ggat-------------------------------
B D                   Ferret   c--c-------------agtc---tcctgggtt--ggat-------------------------------
B D                     Panda  c--c-------------gatc---tcctgggtt--ggat-------------------------------
               Pacific walrus  --------------------c---tcctggctt--ggat-------------------------------
                 Weddell seal  --------------------c---tcctggctt--ggat-------------------------------
             Black flying-fox  c--t-------------agtc---tcttggctt--ggat-------------------------------
B D                   Megabat  c--c-------------agtc---tcttggctt--ggat-------------------------------
                Big brown bat  g--c-------------aacc---tccaggctc--tgc--------------------------------
         David's myotis (bat)  g--g-------------agcc---tcccggctg--gggc-------------------------------
B D                  Microbat  a--g-------------ag---------------------------------------------------
B D                  Hedgehog  ctac-------------actc---tccagattc--agag-------------------------------
B D                     Shrew  c--c-------------agtc---tcctggttt--agat-------------------------------
              Star-nosed mole  c--c-------------aagt---gtttgattt--agat-------------------------------
B D                  Elephant  t--c-------------catc---tcccggctt--ggat-------------------------------
          Cape elephant shrew  c--t-------------aatc---tcccagatt--gaat-------------------------------
B D                   Manatee  t--c-------------aatc---tcccagctt--cgat-------------------------------
             Cape golden mole  t--a-------------attc---tcctggctt--ggat-------------------------------
B D                    Tenrec  ------------------tgc---tcctggcag--ggat-------------------------------
                     Aardvark  c--c-------------aatc---tcccagctc--agat-------------------------------
B D                 Armadillo  c--tgaagctaaaggtgaatc---tcctggctt--ggat-------------------------------
B D                   Opossum  t--a-------------ggtc---ttcttggccctgggc-------------------------------
B D           Tasmanian devil  t--t-------------ggtg---tccttgactctagac-------------------------------
B D                   Wallaby  t--g-------------tgtt---tcttt-------ggc-------------------------------
B D                  Platypus  g--a-------------agtg---ttttgtcac--aggc-------------------------------
  D               Rock pigeon  ----------------------------ggggg--ggat-------------------------------
  D    White-throated sparrow  ----------------------------gagcg--aggtcttggtgcactgcaagatgtctggaaaacca
B D       Medium ground finch  ----------------------------gagcg--aggtcttggtgcactgcaagatgtctggaaaacca
B D               Zebra finch  -----------------------------agga--aggt-------------------------------
  D              Mallard duck  ----------------------------gagga--agat-------------------------------
B D                   Chicken  -----------------------------------agat-------------------------------
B D                    Turkey  -----------------------------------agat-------------------------------
  D    Spiny softshell turtle  -------------------------------------------------------atattt---------
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
  D             Scarlet macaw  ======================================================================
  D           Green seaturtle  ======================================================================

                        Human  ggctctg----------t--------at-------tcca------gggcca---g-cag----
                        Chimp  ggctctg----------t--------at-------tcca------gggcca---g-cag----
                      Gorilla  ggctctg----------t--------at-------tcca------gggcca---g-cag----
                    Orangutan  ggctctg----------t--------at-------tcca------gggcca---g-cag----
                       Gibbon  ggctctg----------t--------at-------tcca------gggcca---g-cag----
                       Rhesus  ggctctg----------t--------at-------tcca------gggtca---g-cag----
          Crab-eating macaque  ggctctg----------t--------at-------tcca------gggtca---g-cag----
                       Baboon  ggctctg----------t--------at-------tcca------gggtca---g-cag----
                 Green monkey  ggctctg----------t--------at-------tcca------gggtca---g-cag----
                     Marmoset  ggctctg----------t--------at-------tcca------ggacca---g-cag----
              Squirrel monkey  ggctctg----------t--------at-------tcca------tggcca---g-cag----
                     Bushbaby  ggctctg----------a--------at-------tcca------aggcaa---g-cag----
           Chinese tree shrew  ggctctg----------t--------at-------tcca------agacta---g-cag----
                     Squirrel  ggctctg----------c--------gt-------tccg------aggcaa---g-cag----
       Lesser Egyptian jerboa  ------g----------t--------tt-------tctg------aggcaa---g-cag----
                 Prairie vole  agctctg----------t--------gt-------tcca------agacag---g-tga----
              Chinese hamster  agctctg----------t--------gt-------tcca------agaaag---g-tgg----
               Golden hamster  agctctg----------t--------gt-------tcca------agaaag---g-tgg----
                        Mouse  agcttcc----------tacagacaagt-------tcca------agaaga---a-tat----
                          Rat  agcttct----------taaagacaagt-------tcca------agaaga---g-tag----
               Naked mole-rat  ggctctg----------t--------at-------tcca------aggcaa---g-cag----
                   Guinea pig  agctctg----------t--------at-------tccc------------------------
                   Chinchilla  ggctcta----------t--------at-------ttca------agacaa---g-ca-----
             Brush-tailed rat  ggctctg----------t--------ac-------tcca------agacaa---g-cag----
                       Rabbit  gact--g----------t--------ct-------tcca------aggcaa---g-cag----
                         Pika  gacc--a----------t--------at-------tcca------agggaa---g-tag----
                          Pig  agctctg----------t--------at-------tctg------aggcag---g-cac----
                       Alpaca  agctctg----------t--------at-------tcca------aggcag---g-cag----
               Bactrian camel  agctctg----------t--------at-------tcca------aggcag---g-cag----
                      Dolphin  agctctg----------t--------at-------tcca------aggcag---g-cag----
                 Killer whale  agctctg----------t--------at-------tcca------aggcag---g-cag----
             Tibetan antelope  agctttg----------t--------at-------tcca------aggcag---g-caa----
                          Cow  agctctg----------t--------at-------tcca------aggcag---g-caa----
                        Sheep  agctttg----------t--------at-------tcca------aggcag---g-caa----
                Domestic goat  agctttg----------t--------at-------tcca------aggcag---g-caa----
                        Horse  agctctg----------t--------gt-------tcca------aggcag---a-c-g----
             White rhinoceros  agctctg----------t--------at-------tcca------aggcag---a-tag----
                          Cat  aactctg----------t--------at-------tcca------agacagc--a-aag----
                          Dog  agctctg----------t--------at-------tcta------gggcag---g-cgg----
                      Ferret   ggttctg----------t--------at-------tcca------aggcaa---g-cag----
                        Panda  ggctctg----------t--------at-------tcca------aggcaa---t-cag----
               Pacific walrus  ggctctg----------t--------at-------tcca------aggcag---g-gag----
                 Weddell seal  ggctctg----------t--------ac-------tcca------aggcag---g-gaa----
             Black flying-fox  agctctg----------t--------at-------tcca------aggcag---g-ctg----
                      Megabat  agctctg----------t--------at-------tcca------aggcag---g-ctg----
                Big brown bat  --------------------------gg-------tcca------cgctgg---g-tag----
         David's myotis (bat)  agctctg----------tgt------cc-------tcca------cgctgg---g-gag----
                     Microbat  --------------------------cc-------tcca------agctgg---g-gag----
                     Hedgehog  ggcat-------------------------------------------------g-tag----
                        Shrew  agctttg----------a--------at-------tccagctttgaattccaagg-aag----
              Star-nosed mole  ggctctg----------g--------ac-------tcca------agatct---g-cag----
                     Elephant  ggctctg----------g--------------------a------a--------g-cag----
          Cape elephant shrew  ggctctg----------g--------------------a------a--------a-cag----
                      Manatee  ggctccg----------g--------------------a------a--------g-cag----
             Cape golden mole  ggctctg----------a--------------------a------a--------g-tgg----
                       Tenrec  ggctcag----------g--------------------a------a--------g-cag----
                     Aardvark  ggctctg----------g--------------------a------a--------a-cag----
                    Armadillo  ggctctgaag----tcca--------------------a------g--------g-cag----
                      Opossum  agctctgagaaattttct--------at-------tcca------gtccag---g-caa----
              Tasmanian devil  agctctgagaaaatttct--------at-------tcct------ggtcag------------
                      Wallaby  agctctgagagattttct--------gt-------tcca------gtccaa---g-cag----
                     Platypus  gggtggg--------------------------------------------------------
                  Rock pigeon  gacatgg----------g--------acccctccatgcg------gggaag---a-tggtttt
       White-throated sparrow  gacacag----------a--------ct-------ttag------agcagt---a-ctatttg
          Medium ground finch  gacacag----------a--------tt-------ttag------tggagt---a-ctatctg
                  Zebra finch  gacatag----------g--------ac-------taat------gggagc---a-aagtctt
                 Mallard duck  gacatgg----------a--------gcc------tctt------cgcagg---a-cagactg
                      Chicken  gacatgg----------g--------atc------tctc------catagg---a-cagtctg
                       Turkey  gacatgg----------g--------atc------tctc------catagg---a-cagtctg
       Spiny softshell turtle  gaggctg----------g--------gtc------tctg------aatagc---accagggtg
             Peregrine falcon  ===============================================================
                 Saker falcon  ===============================================================
                       Parrot  ===============================================================
                   Budgerigar  ===============================================================
     Chinese softshell turtle  ===============================================================
                X. tropicalis  ===============================================================
               Painted turtle  ===============================================================
          Collared flycatcher  ===============================================================
           American alligator  ===============================================================
           Tibetan ground jay  ===============================================================
                Scarlet macaw  ===============================================================
              Green seaturtle  ===============================================================

Inserts between block 8 and 9 in window
B D          Tasmanian devil 4bp
B D                  Wallaby 1375bp
B D      Medium ground finch 1bp

Alignment block 9 of 185 in window, 203868209 - 203868234, 26 bps 
B D                     Human  -gga-----------gc----agt-tg--------g---gc-------------ggca-----gcaaata
B D                     Chimp  -gga-----------gc----agt-tg--------g---gc-------------ggca-----gcaaata
B D                   Gorilla  -gga-----------gc----agt-tg--------g---gc-------------ggca-----gcaaata
B D                 Orangutan  -gga-----------ac----agt-tg--------g---gc-------------ggca-----gcaaata
B D                    Gibbon  -gga-----------ac----agt-tg--------g---gc-------------ggca-----gcaaata
B D                    Rhesus  -gga-----------ac----agt-tg--------g---gc-------------ggca-----gcaaata
B D       Crab-eating macaque  -gga-----------ac----agt-tg--------g---gc-------------ggca-----gcaaata
B D                    Baboon  -gga-----------ac----agt-tg--------g---gc-------------ggca-----gcaaata
B D              Green monkey  -gga-----------ac----agt-tg--------g---gc-------------ggca-----gcaaata
B D                  Marmoset  -gga-----------ac----agc-tg--------g---gc-------------agca-----gcaaata
B D           Squirrel monkey  -gga-----------ac----agt-tg--------g---gc-------------agca-----gcaaata
B D                  Bushbaby  -ggg-----------ac----aca-gg--------g---gc-------------cgca-----gcaaata
           Chinese tree shrew  -ggg-----------ac----agc-t---------g---tc-------------agca-----gtaaata
B D                  Squirrel  -ggg-----------ac----agg-t---------g---ga-------------agca-----gccagta
       Lesser Egyptian jerboa  -ggg-----------ac----agc-t---------t---ag-------------aata-----gcaaaga
                 Prairie vole  -aga-----------gg----agt-t---------a---gc-------------agca-----gcaaaca
B D           Chinese hamster  -agg-----------cg----agc-t---------t---gc-------------aaca-----gcccagg
               Golden hamster  -agg-----------gg----agc-t---------t---gc-------------agca-----gcccagg
B D                     Mouse  -agg-----------ag----gtc-t---------a---gc-------------agta-----gcgaagg
B D                       Rat  -agg-----------ag----atc-t---------a---gc-------------agta-----gcaaagg
B D            Naked mole-rat  -ggc-----------ac----agc-t---------a---ac-------------agca-----ccgaata
B D                Guinea pig  -tgg-----------at----gcc-t---------g---gc-------------agca-----gccaa-g
                   Chinchilla  -ggg-----------ac----agc-t---------g---gc-------------agca-----gacaacg
             Brush-tailed rat  -ggg-----------ac----agc-t---------g---gc-------------agta-----gccaacg
B D                    Rabbit  -gga-----------gc----agc-t---------g---gc-------------agca-----gtaaatg
B D                      Pika  -ggt-----------gc----agc-t---------g---ac-------------agca-----gcaaata
B D                       Pig  -ggg-----------ac----agc-t---------g---gc-------------agca-----gcaaatc
B D                    Alpaca  -ggg-----------ac----agc-t---------g---gc-------------agca-----gcaaatc
               Bactrian camel  -ggg-----------ac----agc-t---------g---gc-------------atca-----gcaaatc
B D                   Dolphin  -ggg-----------ac----agc-c---------g---ac-------------agca-----gcgaatc
                 Killer whale  -ggg-----------ac----agc-t---------g---ac-------------agca-----gcaaatc
             Tibetan antelope  -ggg-----------ac----agc-t---------g---ga-------------agga-----gcaaacc
B D                       Cow  -ggg-----------ac----agc-t---------g---ga-------------agga-----gcaaaac
B D                     Sheep  -ggg-----------ac----agc-t---------g---ga-------------agga-----gcaaacc
                Domestic goat  -ggg-----------ac----agc-t---------a---ga-------------agga-----gcaaacc
B D                     Horse  -ggg-----------ac----agc-t---------g---gc-------------ggca-----gcaaata
B D          White rhinoceros  -ggg-----------at----agc-t---------g---gt-------------ggaa-----gcaaata
B D                       Cat  -ggg-----------ac----agc-t---------g---gc-------------agca-----gcaaatg
B D                       Dog  -gga-----------ac----agc-t---------g---gc-------------agca-----gcaaata
B D                   Ferret   -gag-----------ac----atc-t---------g---gc-------------agca-----gcaaata
B D                     Panda  -ggg-----------ac----agc-t---------g---gc-------------agca-----gcaaata
               Pacific walrus  -ggc-----------aa----agc-t---------g---ac-------------agca-----gcaaaga
                 Weddell seal  -ggg-----------aa----agc-t---------g---ac-------------agca-----gcaaata
             Black flying-fox  -ggg-----------ac----agc-t---------g---gc-------------ggca-----gcaaata
B D                   Megabat  -ggg-----------ac----agc-t---------g---gc-------------ggca-----gcaaata
                Big brown bat  -ggc-----------ac----agcgg---------g---gc-------------ggca-----gcgcacg
         David's myotis (bat)  -ggc-----------ac----cgc-g---------g---gc-------------agca-----gctcaga
B D                  Microbat  -ggc-----------gc----agc----------------------------------------------
B D                  Hedgehog  -ggg-----------ac----ag--c---------a---gt-------------ggca-----gcaagga
B D                     Shrew  -gga-----------ag----agg-c---------a---at-------------agca-----gtagaga
              Star-nosed mole  -ggg-----------ac----agt-t---------g---gt-------------agta-----gtgaaga
B D                  Elephant  -gga-----------ac----agc-c---------a---gc-------------agca-----gcaaata
          Cape elephant shrew  -gat-----------tc----aaa-c---------aa-gga-------------gaca-----ctatatg
B D                   Manatee  -ggg-----------ac----agc-c---------a---gc-------------aaaa-----gcaaata
             Cape golden mole  -gag-----------ac----aac-c---------agcagc-------------agaa-----gcaagta
B D                    Tenrec  -gag-----------gc----agc-c---------agcagc-------------atca-----gcagaca
                     Aardvark  -aca-----------ac----agc-c---------a---gc-------------agca-----gcaagta
B D                 Armadillo  -gaa-----------gcggagagc-c---------agcagcagcaaagcagcaaagca-----gcaaagc
B D                   Opossum  -cta-----------aa----agt-a---------g---tc-------------agca-----gagaata
B D           Tasmanian devil  -cag-----------aa----aga-a---------g---tc-------------agca-----aagaata
B D                  Platypus  ----------------c----aac-c---------g---gc-------------tggatactggcagagt
  D               Rock pigeon  gggg------------c----acc-a---------g---ga-------------ggta-----tctggca
  D    White-throated sparrow  aggg-----------ac----act-gggcaacattc---ag-------------agta-----gctcaag
B D       Medium ground finch  aggg-----------ac----act-gggcaacattc---ag-------------agta-----gctcaag
B D               Zebra finch  agtg------------c----act-g---------c---aa-------------gctg-----tctagaa
  D              Mallard duck  agaa------------------ct-g---------a---ga-------------ggtg-----tctggaa
B D                   Chicken  ggaatgaggtctagggc----tct-g---------a---ga-------------gatg-----tctggaa
B D                    Turkey  ggaaagtggtctagggc----tct-g---------a---ga-------------ggtg-----tttggaa
  D    Spiny softshell turtle  ggaa-----------ag----tct-a---------g---gg-------------attc-----tcaatag
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                   Wallaby  ======================================================================
  D           Green seaturtle  ======================================================================

                        Human  ag-
                        Chimp  ag-
                      Gorilla  ag-
                    Orangutan  ag-
                       Gibbon  ag-
                       Rhesus  a--
          Crab-eating macaque  a--
                       Baboon  a--
                 Green monkey  a--
                     Marmoset  a--
              Squirrel monkey  a--
                     Bushbaby  a--
           Chinese tree shrew  a--
                     Squirrel  a--
       Lesser Egyptian jerboa  c--
                 Prairie vole  a--
              Chinese hamster  a--
               Golden hamster  a--
                        Mouse  a--
                          Rat  a--
               Naked mole-rat  a--
                   Guinea pig  g--
                   Chinchilla  a--
             Brush-tailed rat  a--
                       Rabbit  c--
                         Pika  t--
                          Pig  a--
                       Alpaca  a--
               Bactrian camel  a--
                      Dolphin  a--
                 Killer whale  a--
             Tibetan antelope  a--
                          Cow  a--
                        Sheep  a--
                Domestic goat  a--
                        Horse  a--
             White rhinoceros  a--
                          Cat  a--
                          Dog  a--
                      Ferret   a--
                        Panda  a--
               Pacific walrus  a--
                 Weddell seal  a--
             Black flying-fox  a--
                      Megabat  a--
                Big brown bat  a--
         David's myotis (bat)  c--
                     Microbat  ---
                     Hedgehog  a--
                        Shrew  ---
              Star-nosed mole  a--
                     Elephant  a--
          Cape elephant shrew  a--
                      Manatee  a--
             Cape golden mole  a--
                       Tenrec  g--
                     Aardvark  a--
                    Armadillo  a--
                      Opossum  g--
              Tasmanian devil  g--
                     Platypus  t--
                  Rock pigeon  a-a
       White-throated sparrow  a-a
          Medium ground finch  a-a
                  Zebra finch  a-a
                 Mallard duck  a-a
                      Chicken  a-g
                       Turkey  a-a
       Spiny softshell turtle  g--
             Peregrine falcon  ===
                 Saker falcon  ===
                       Parrot  ===
                   Budgerigar  ===
     Chinese softshell turtle  ===
                X. tropicalis  ===
               Painted turtle  ===
          Collared flycatcher  ===
           American alligator  ===
           Tibetan ground jay  ===
                Scarlet macaw  ===
                      Wallaby  ===
              Green seaturtle  ===

Inserts between block 9 and 10 in window
  D   Spiny softshell turtle 1156bp

Alignment block 10 of 185 in window, 203868235 - 203868257, 23 bps 
B D                     Human  gcaaaga-gatagc----tcagaa-------cag--a
B D                     Chimp  gcaaaga-gatagc----tcagaa-------cag--a
B D                   Gorilla  gcaaaga-gatagc----tcagaa-------cag--a
B D                 Orangutan  gcaaaga-gatagc----tcagaa-------cag--a
B D                    Gibbon  gcaaaga-gatagc----tcagaa-------ccg--a
B D                    Rhesus  gcaaaga-gatacc----tcagaa-------cag--a
B D       Crab-eating macaque  gcaaaga-gatacc----tcagaa-------cag--a
B D                    Baboon  gcaaaga-gatacc----tcagaa-------cag--a
B D              Green monkey  gcaaaga-gatacc----tcagaa-------cag--a
B D                  Marmoset  gcaaaga-catagc----tcagag-------cag--a
B D           Squirrel monkey  gcaaagg-catagc----tcagag-------cag--a
B D                  Bushbaby  gcaga--------------------------------
           Chinese tree shrew  acagaga-tatcgc----tcatag-------cac--a
B D                  Squirrel  gcaaagc-tatagc----tcattg-------cag--a
       Lesser Egyptian jerboa  gcagag---ac---------agag-------cgc--c
                 Prairie vole  gcagag---accac----taatag-------cag--a
B D           Chinese hamster  gcagag---gctac----tcacag-------cag--a
               Golden hamster  acagag---actac----tcacag-------cag--a
B D                     Mouse  gctgag---actag----ccacag-------cag--c
B D                       Rat  actgag---actgc----ccgcag-------cag--c
B D            Naked mole-rat  gcagagg-tatagc----tcatag-------cag--a
B D                Guinea pig  gcagagg-tagagc----tcagag-------cag--a
                   Chinchilla  gcagagg-tagtgc----tcagaa-------cag--a
             Brush-tailed rat  gcagaag-tagagc----tcagaa-------cag--a
B D                    Rabbit  gtggaga-cctagc----tcactg-------cac--a
B D                      Pika  gcagaca-cttagc----acac---------------
B D                       Pig  gtagaaa-ggcagc----tcatag-------cat--t
B D                    Alpaca  gcagaga-catggc----tcagag-------cag---
               Bactrian camel  gcagaga-catggc----tcagag-------cag---
B D                   Dolphin  gcagaga-cacagc----tcttag-------cag--t
                 Killer whale  gcagaga-cacagc----tcttag-------cag--t
             Tibetan antelope  gcagaga-cacagc----tagcaa-------ccg--c
B D                       Cow  gcagaga-cacagc----tagtaa-------cag--c
B D                     Sheep  gcagaga-cacagc----tagcaa-------cag--c
                Domestic goat  gcagaga-cacagc----tagcaa-------cag--c
B D                     Horse  gcaaaga-tacagc----tcacag-------cag--a
B D          White rhinoceros  gcagaga-tacagc----tcctag-------cag--a
B D                       Cat  gcagaga-tacagc----tcatag-------cag--a
B D                       Dog  gcagaga-tacatc----tcatag-------tgg--a
B D                   Ferret   gcagaga-taaggc----tcatag-------tgg--a
B D                     Panda  gcagaga-tacagc----tcatag-------cgg--a
               Pacific walrus  gcagagc-tggagc----tcatag-------cag--a
                 Weddell seal  gcagagc-tagagc----tcatag-------cac--a
             Black flying-fox  acagaga-tacagc----tcatag-------cag--a
B D                   Megabat  acagaga-tacagc----tcatag-------cag--a
                Big brown bat  gcgcagg-tgcagc----ccatcg-------cag--g
         David's myotis (bat)  gcacagg-tgcagccggtgggtcg-------cag--a
B D                  Microbat  ------------------gggtcg-------cag--a
B D                  Hedgehog  gcagagc-tacagc----tcctag-------aag--a
B D                     Shrew  ---gaga-tacagc----ttctag-------------
              Star-nosed mole  gc-ggga-tatggt----tcccag-------------
B D                  Elephant  gcagaga-tacagc----tcatag-------cagaga
          Cape elephant shrew  gc-------acagc----ac----------------a
B D                   Manatee  gcagagc-tactgc----tcatag-------cagaga
             Cape golden mole  gcagaca-tacagc----tcatgg-------ctg--a
B D                    Tenrec  tcagata-catcgt----ttagag-------cag--a
                     Aardvark  gaagaca-gacaga----tcttag-------aag--a
B D                 Armadillo  gcagaga-cacagc----tcatag-------cag--a
B D                   Opossum  atggagctcgctgt----atcaagtgcctaccac--a
B D           Tasmanian devil  aagaaga-agctct----atatag-------ctc--a
B D                  Platypus  gggaagg-ggttga----gtgaag-------ctg--a
  D               Rock pigeon  ccagact-cagact----ttagag-------cag--a
  D    White-throated sparrow  ggaagaa-aagatc----ttgaaa-------aac--c
B D       Medium ground finch  ggaagaa-aacatc----ttgaaa-------aac--c
B D               Zebra finch  ccagaca-cagact----ttagag-------cag--t
  D              Mallard duck  ccagacg-cagact----tcagag-------cag---
B D                   Chicken  ccagata-cagact----tcagag-------caa--a
B D                    Turkey  ccagatg-cagact----taagag-------caa--a
  D          Peregrine falcon  =====================================
  D              Saker falcon  =====================================
  D                    Parrot  =====================================
B D                Budgerigar  =====================================
  D  Chinese softshell turtle  =====================================
B D             X. tropicalis  =====================================
  D            Painted turtle  =====================================
  D       Collared flycatcher  =====================================
B D        American alligator  =====================================
          Tibetan ground jay  =====================================
  D             Scarlet macaw  =====================================
B D                   Wallaby  =====================================
  D    Spiny softshell turtle  =====================================
  D           Green seaturtle  =====================================

Inserts between block 10 and 11 in window
  D              Rock pigeon 1076bp

Alignment block 11 of 185 in window, 203868258 - 203868258, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  a
             Brush-tailed rat  g
B D                    Rabbit  g
B D                       Pig  t
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
B D                  Hedgehog  a
              Star-nosed mole  c
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                   Opossum  g
B D           Tasmanian devil  g
B D                  Platypus  a
  D    White-throated sparrow  a
B D       Medium ground finch  a
B D               Zebra finch  a
B D                   Chicken  g
B D                    Turkey  g
B D                     Shrew  -
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                Budgerigar  =
  D               Rock pigeon  =
  D              Mallard duck  -
  D  Chinese softshell turtle  =
B D             X. tropicalis  =
  D            Painted turtle  =
  D       Collared flycatcher  =
B D        American alligator  =
          Tibetan ground jay  =
  D             Scarlet macaw  =
B D                   Wallaby  =
  D    Spiny softshell turtle  =
  D           Green seaturtle  =
B D                  Microbat  -
        David's myotis (bat)  -
               Big brown bat  -
B D                      Pika  -
B D                  Bushbaby  -

Inserts between block 11 and 12 in window
B D                  Chicken 1004bp
B D                   Turkey 37bp

Alignment block 12 of 185 in window, 203868259 - 203868330, 72 bps 
B D                     Human  cgccaggtatttag------------------------tagg-------------------------g--
B D                     Chimp  tgccaggtatttag------------------------tagg-------------------------g--
B D                   Gorilla  tgccaggtatttag------------------------tagg-------------------------g--
B D                 Orangutan  tgccaggtatttag------------------------tagg-------------------------g--
B D                    Gibbon  tgccgggtatttag------------------------tagg-------------------------g--
B D                    Rhesus  tgccaggtatttag------------------------tagg-------------------------g--
B D       Crab-eating macaque  tgccaggtatttag------------------------tagg-------------------------g--
B D                    Baboon  tgccaggtatttag------------------------tagg-------------------------g--
B D              Green monkey  tgccaggtatttag------------------------tagg-------------------------g--
B D                  Marmoset  tgccaggtatttag------------------------cagg-------------------------g--
B D           Squirrel monkey  tgccacgtatttag------------------------cagg-------------------------g--
B D                  Bushbaby  -------tatttaa------------------------cagc-------------------------a--
           Chinese tree shrew  tgccaggtatttat------------------------cagg-------------------------g--
B D                  Squirrel  taccaggtttttag------------------------cagg-------------------------g--
       Lesser Egyptian jerboa  agcagtg-------------------------------ccag-------------------------g--
                 Prairie vole  tg-ggggattccagacagaactccagaatccatgaaatctga-------------------------g--
B D           Chinese hamster  ggctgccattctggacag--------------------ctgg-------------------------g--
               Golden hamster  ggctggcattctggacag--------------------ctgg-------------------------g--
B D                     Mouse  tgctgggatctcag------------------------ctgg-------------------------g--
B D                       Rat  tgctgggacccagg------------------------ctgg-------------------------g--
B D            Naked mole-rat  tgccaggtttctgg------------------------cagg-------------------------g--
B D                Guinea pig  tggtaggcttttag------------------------cagg-------------------------g--
                   Chinchilla  ctctaggtttttag------------------------caag-------------------------g--
             Brush-tailed rat  tactaggtttttag------------------------cagt-------------------------g--
B D                    Rabbit  tgctaggtatttag------------------------cagc-------------------------a--
B D                      Pika  ------------ag------------------------cagc-------------------------a--
B D                       Pig  tgccaggcatggag------------------------cagg-------------------------cgc
B D                    Alpaca  tgccgggcatggag------------------------gggg-------------------------c--
               Bactrian camel  tgccgggcatggag------------------------gggg-------------------------c--
B D                   Dolphin  tgctgggcatggag------------------------tggg-------------------------a--
                 Killer whale  tgctgggcatggag------------------------tggg-------------------------a--
             Tibetan antelope  tactgggcatggag------------------------tgga-------------------------a--
B D                       Cow  tactgggcatggag------------------------tgga-------------------------a--
B D                     Sheep  tactgggcatggag------------------------tgga-------------------------a--
                Domestic goat  tactgggcatggag------------------------tgga-------------------------a--
B D                     Horse  tgccaggcatcttg------------------------taag-------------------------a--
B D          White rhinoceros  tgccaggcatctag------------------------taag-------------------------g--
B D                       Cat  tcccaggcactgac------------------------tagg-------------------------a--
B D                       Dog  caccaggcattgac------------------------gagg-------------------------a--
B D                   Ferret   cgccaggcattgac------------------------tagg-------------------------a--
B D                     Panda  caccaggcattgac------------------------t----------------------------a--
               Pacific walrus  caccaggcattgac------------------------tagg-------------------------a--
                 Weddell seal  caccaggcattgac------------------------tagg-------------------------a--
             Black flying-fox  tgccaggcattgag------------------------tagg-------------------------g--
B D                   Megabat  tgccaggcattgag------------------------tagg-------------------------g--
                Big brown bat  tgccaggcactgcg------------------------caga-------------------------g--
         David's myotis (bat)  -gccaggcaccgag------------------------gaga-------------------------g--
B D                  Microbat  -gccaggcaccgag------------------------gaga-------------------------g--
B D                  Hedgehog  tgtcaggcatttat------------------------caag-------------------------g--
B D                     Shrew  -------cagaaca------------------------cagg-------------------------t--
              Star-nosed mole  tgt--gccagctct------------------------tagg-------------------------g--
B D                  Elephant  tgccaggtgtataa------------------------tatg-------------------------t--
          Cape elephant shrew  tgccagataaacag------------------------taag-------------------------t--
B D                   Manatee  tgccaggtatatag------------------------tgtg-------------------------t--
             Cape golden mole  aactagtagtatgc------------------------tata-------------------------t--
B D                    Tenrec  ggccagggagatcc------------------------cgcg-------------------------c--
                     Aardvark  tgccaggcatacag------------------------t----------------------------t--
B D                 Armadillo  tgccgagc-tctaa------------------------ggag-------------------------c--
B D                   Opossum  tcttgaatatgtca------------------------cagg-------------------------t--
B D           Tasmanian devil  tcttaaatacatca------------------------tatg-------------------------t--
B D                  Platypus  gtcggggaaggtta------------------------cagg-------------------------t--
  D    White-throated sparrow  -------------------------------------------------------------------g--
B D       Medium ground finch  -------------------------------------------------------------------g--
B D               Zebra finch  -------------------------------------------------------------------c--
  D              Mallard duck  -----------------------------------------------aggcatctgcagagaggctgg--
B D                    Turkey  --------------------------------------catgaagtaagaaatattttgacaaactag--
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                   Wallaby  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================

                        Human  ----gctt----catgaatgcat----gt--------ga-gtt---ggttta------------------
                        Chimp  ----gctt----catgaatgcat----gt--------ga-gtt---ggttca------------------
                      Gorilla  ----gctt----catgaatgcat----gt--------ga-gtt---ggtgta------------------
                    Orangutan  ----gctt----catgaatgcat----gt--------ga-gtt---ggttta------------------
                       Gibbon  ----gctt----catgaatgcat----gt--------ga-gtt---ggttta------------------
                       Rhesus  ----gctt----catgaatgcat----gt--------ga-gtt---ggttta------------------
          Crab-eating macaque  ----gctt----catgaatgcat----gt--------ga-gtt---ggttta------------------
                       Baboon  ----gctt----catgaatgcat----gt--------ga-gtt---ggttta------------------
                 Green monkey  ----gctt----catgaatgcat----gt--------ga-gtt---ggttta------------------
                     Marmoset  ----actt----catgagtgcat----ga--------ga-gtt---ggttta------------------
              Squirrel monkey  ----attt----catttatgcat----ga--------ga-gtt---ggttta------------------
                     Bushbaby  ----actt----aatggagg-at----gt--------ga-gtt---ggtttg------------------
           Chinese tree shrew  ----ggct----ggcgaatacct----gc--------aa-att---ggtttg------------------
                     Squirrel  ----gatg----aatgaacacat----gt--------ga-gtt---ggtttg------------------
       Lesser Egyptian jerboa  ----gcct-----------ccat----gagcagcctgga-gtg---ggtttg------------------
                 Prairie vole  ----aatt----aatgaatccat----ga--------ga-gct---ggtttg------------------
              Chinese hamster  ----ggttagtgagtgaatccat----aa--------gactct---tgttta------------------
               Golden hamster  ----gctt----aaagaatccat----aa--------gatgct---tgttta------------------
                        Mouse  ----actt----aaggaa-ccat----ga--------ga-gtt---ccttaa---------------gtc
                          Rat  ----gctg----aaggag-ccat----ga--------ga-gct---gatcta------------------
               Naked mole-rat  ----gctt----agtgaacatat----gt--------ga-g-t---ggtagg------------------
                   Guinea pig  ----gcta----aagtaacacag----ct--------ga-g-t---ggtagg------------------
                   Chinchilla  ----gatt----aatgaacatat----gt--------ga-g-t---ggtagg------------------
             Brush-tailed rat  ----gctt----aatgaacatat----gt--------ga-g-t---ggtagg------------------
                       Rabbit  ----gtat----aatgaatatgt----gt--------ga-gtt---ggattg------------------
                         Pika  ----tttt----aatgaacatcc----gt--------gg-att---gcttta------------------
                          Pig  ttatgctt----aacgaatgcat----tt--------ga-att---ggtttg------------------
                       Alpaca  ----actt----cgtgaatacaa----gc--------ga-gtt---ggtttg------------------
               Bactrian camel  ----gctt----cgtgaatacac----gc--------ga-gtt---ggtttg------------------
                      Dolphin  ----gctt----aatgaatacgt----gt--------ga-gtt---ggtctg------------------
                 Killer whale  ----gctt----aatgaatacgt----gt--------ga-gtt---ggtctg------------------
             Tibetan antelope  ----gctt----aatgagtatat----gt--------ga-gtt---ggtctg------------------
                          Cow  ----gctt----agtgagtacat----gt--------ga-gtt---ggtctg------------------
                        Sheep  ----gctt----aatgagtatat----gt--------ga-gtt---ggtctg------------------
                Domestic goat  ----gctt----aatgagtatat----gt--------ga-gtt---ggtctg------------------
                        Horse  ----gcct----aatgaatactc----ct--------ga-gtt---ggtttg------------------
             White rhinoceros  ----gctt----aatgaatactt----ct--------ga-gtt---ggtttg------------------
                          Cat  ----gctt----aacagatacat----ct--------ga-gtt---ggtttg------------------
                          Dog  ----gctt----aatgaatatat----ct--------ga-gtt---ggtttg------------------
                      Ferret   ----gctt----aatgaatatat----ct--------ga-gtt---ggtttg------------------
                        Panda  ----gctt----aatggatgtat----ct--------ga-gtt---ggtctg------------------
               Pacific walrus  ----gctt----aatgaatacat----tt--------ga-gtt---ggtctg------------------
                 Weddell seal  ----gctt----aatgaatacat----ct--------ga-gtt---ggtctg------------------
             Black flying-fox  ----gctt----aatgaatatat----ct--------ga-gtt---ggtttg------------------
                      Megabat  ----gctt----aatgaatatat----ct--------ga-gtt---ggtttg------------------
                Big brown bat  ----gatg----aagaaattcct----ct--------ga-gtt---ggtt--------------------
         David's myotis (bat)  ----ggtg----aagaagtacct----ct--------ga-gtt---gggt--------------------
                     Microbat  ----ggtg----aggaagtacct----ct--------ga-gtt---gggt--------------------
                     Hedgehog  ----gcat----aatgaatatgt----ct--------ga-gtt---ggttta------------------
                        Shrew  ----attt----aacaaagagat----ct--------gc-att---gatttgaaatatttggacaatttg
              Star-nosed mole  ----actt----aaagaatatat----ct--------ga-att---agtttg------------------
                     Elephant  ----gctt----aatgaatacat----gg--------ga-gtt---ggtttg------------------
          Cape elephant shrew  ----attc------tgagtatat----gt--------ga-gtt---ggtttg------------------
                      Manatee  ----gctt----aatgaatatgt----gt--------ga-gtt---ggtttg------------------
             Cape golden mole  ----acgt----aatgagtacat----gt--------ta-gat---gatttg------------------
                       Tenrec  ----tcct----aatgagtacat----gt--------ga-gtc---catttg------------------
                     Aardvark  ----gctt----aatgagtacat----gt--------ga-gtt---ggtttg------------------
                    Armadillo  ----gctt---tagcgaacatat----tt--------ga-gtt---ggtttt------------------
                      Opossum  ----gaactttatctatttcctg----gt--------ct-gtt---catctt------------------
              Tasmanian devil  ----gaac----tatgattcctg----aa--------at-ggt---tgcttg------------------
                     Platypus  ----gcct----taactctccct----tg--------aa-gattccagttag------------------
       White-throated sparrow  ----gccc----tgcaagtgaagttgtga--------ca-gct---gataac------------------
          Medium ground finch  ----gccc----tgcaagtgaagttgtga--------ca-gct---gataac------------------
                  Zebra finch  ----tacc----tgcagg---------ga--------ca-ctg---ggcaac------------------
                 Mallard duck  ----gca--------ggattcag----ag--------ta-gct-----caag------------------
                       Turkey  ----gcct----tgtgggtgaagtt--gg--------ca-gct---gacaag------------------
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Chicken  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ======================================================================
          Collared flycatcher  ======================================================================
           American alligator  ======================================================================
           Tibetan ground jay  ======================================================================
                Scarlet macaw  ======================================================================
                      Wallaby  ======================================================================
       Spiny softshell turtle  ======================================================================
              Green seaturtle  ======================================================================

                        Human  --------gtagag---ag------acac--------------ag-gcaat----ttcag------a---
                        Chimp  --------gtagag---ag------acac--------------ag-gcaat----ttcag------a---
                      Gorilla  --------gtagag---ag------acac--------------ag-gcaat----ttcag------a---
                    Orangutan  --------gtagag---ag------acac--------------ag-gcaat----ttcag------a---
                       Gibbon  --------gtagag---ag------atac--------------ag-gcaat----ttcag------a---
                       Rhesus  --------ggagag---ag------acac--------------ag-gcaat----ttcag------a---
          Crab-eating macaque  --------ggagag---ag------acac--------------ag-gcaat----ttcag------a---
                       Baboon  --------ggagag---ag------acac--------------ag-gcaat----ttcag------a---
                 Green monkey  --------ggagag---ag------acac--------------ag-gcaat----ttcag------a---
                     Marmoset  --------g----g---ag------acac--------------ag-gcaat----ttcag------a---
              Squirrel monkey  --------g----g---ag------acac--------------ag-gcaat----ttcag------a---
                     Bushbaby  --------g----g---ag------acat---------------g-gcaat----ttcag------a---
           Chinese tree shrew  --------g----g---aa------acac--------------gg-gtaat----ttcag------a---
                     Squirrel  --------g----g---ag------acac--------------gg-gccat----ttcag------a---
       Lesser Egyptian jerboa  --------g----g---ag------acaa--------------gg-gcagt----ttcag------g---
                 Prairie vole  --------g----g---a---------ga--------------ga-acaag----ttcag------a---
              Chinese hamster  --------t----g-------------ga--------------ga-acaag----ttcag------a---
               Golden hamster  --------g----g-------------ga--------------ga-acaag----ttcag------a---
                        Mouse  ccatatggg----g-------------ga--------------ga-acaa--------------------
                          Rat  --------g----g-------------ga--------------ga-gcaac----ttcag----------
               Naked mole-rat  --------a----g-agag------acat--------------ga-gcaat----ttcag------a---
                   Guinea pig  --------c----g---ag------acac--------------aa-gtgat----ttcag------a---
                   Chinchilla  --------a----g-atag------acat--------------ga-gcaat----ttcag------a---
             Brush-tailed rat  --------a----g-ggag------acat--------------ga-gcagt----ttcag------a---
                       Rabbit  --------g----g---ag------acac--------------ag-gcaat----ttcag------a---
                         Pika  --------g----g---ag------acgcaggtggctggacatag-gtaac----ttcag------a---
                          Pig  --------g----g---ag------acat--------------ga-gcatt----ttcag------a---
                       Alpaca  --------a----g---aa------gcat--------------ga-gcgat----ttcag------g---
               Bactrian camel  --------a----g---aa------acat--------------ga-gcgat----ttcag------g---
                      Dolphin  --------g----g---ag------acat--------------ga-gcaat----ttcag------a---
                 Killer whale  --------g----g---ag------acat--------------ga-gcaat----ttcag------a---
             Tibetan antelope  --------g----g---ag------acag--------------ga-gaaat----ttcag------a---
                          Cow  --------g----g---ag------acag--------------ga-gaaat----ttcag------a---
                        Sheep  --------g----g---ag------acag--------------ga-gaaat----ttcag------a---
                Domestic goat  --------g----g---ag------acag--------------ga-gaaat----ttcag------a---
                        Horse  --------g----g---ag------acat--------------aa-ggaat----ttcag------a---
             White rhinoceros  --------g----g---ag------acat--------------ga-gcaat----ttcac------a---
                          Cat  --------g----g---ag--------ac--------------aa-gcaat----ttcat------a---
                          Dog  --------g----g---ag--------at--------------ga-gcaat----ttcag------a---
                      Ferret   --------g----t---ag--------at--------------ga-gcaat----ttcag------a---
                        Panda  --------a----g---ag--------at--------------ga-gcaat----ttcag------a---
               Pacific walrus  --------g----g---ag--------at--------------ga-gtgat----ttcag------a---
                 Weddell seal  --------g----g---ag--------at--------------ga-gcaat----ttcag------a---
             Black flying-fox  --------a----g---ac------acat--------------ga-gcaat----ttcag------a---
                      Megabat  --------a----g---ac------acat--------------ga-gcaat----ttcag------a---
                Big brown bat  --------------------------------------------------t----ttcat------g---
         David's myotis (bat)  --------------------------------------------------t----ttcag------g---
                     Microbat  --------------------------------------------------t----ttcag------g---
                     Hedgehog  --------g----g---aa--------ac--------------ta---------------------g---
                        Shrew  gaatatttg----g---ac--------at--------------catatatc----tcttataagata---
              Star-nosed mole  --------g----g---ag--------at--------------caaacaat----ttctg------a---
                     Elephant  --------g----g---ag------acac--------------tg-gcaat--ctttaag------g---
          Cape elephant shrew  --------g----g---ag------aaaa--------------tt-ggtatgatcttatg------g---
                      Manatee  --------g----g---ag------acat--------------tg-gcaat-actttaag------a---
             Cape golden mole  --------g----g---ag------acgc--------------tg-gcaat-actttaag------g---
                       Tenrec  --------g----g---ag------acac--------------tg-gcagt-atttgaag------g---
                     Aardvark  --------g----g---ag------acac--------------tg-gcaat-actctaag------g---
                    Armadillo  --------g----g---at------acag--------------tg-gcaat----ttcaa------g---
                      Opossum  --------g----g-------------ag--------------ag-agaat----tcctg------a---
              Tasmanian devil  --------a----g-------------tt--------------ag-acagc----ttcag------a---
                     Platypus  --------a----g---ag------acga--------------gg-ggatt----ctcag------a---
       White-throated sparrow  --------a----t---gg------gtat--------------ag-gggtt----tgaat------gcat
          Medium ground finch  --------a----t---gg------gtat--------------ag-gagtt----tgaat------gtat
                  Zebra finch  --------a----ttcaga------gtag----------ctcaag-aagga----agaat------g--t
                 Mallard duck  --------a----a---gg-------gag--------------aa-atatt----ttgac------aaac
                       Turkey  --------g----t---ggagatggagat--------------ag-atgtt----tgaat------ggat
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Chicken  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ======================================================================
          Collared flycatcher  ======================================================================
           American alligator  ======================================================================
           Tibetan ground jay  ======================================================================
                Scarlet macaw  ======================================================================
                      Wallaby  ======================================================================
       Spiny softshell turtle  ======================================================================
              Green seaturtle  ======================================================================

                        Human  ------------
                        Chimp  ------------
                      Gorilla  ------------
                    Orangutan  ------------
                       Gibbon  ------------
                       Rhesus  ------------
          Crab-eating macaque  ------------
                       Baboon  ------------
                 Green monkey  ------------
                     Marmoset  ------------
              Squirrel monkey  ------------
                     Bushbaby  ------------
           Chinese tree shrew  ------------
                     Squirrel  ------------
       Lesser Egyptian jerboa  ------------
                 Prairie vole  ------------
              Chinese hamster  ------------
               Golden hamster  ------------
                        Mouse  ------------
                          Rat  ------------
               Naked mole-rat  ------------
                   Guinea pig  ------------
                   Chinchilla  ------------
             Brush-tailed rat  ------------
                       Rabbit  ------------
                         Pika  ------------
                          Pig  ------------
                       Alpaca  ------------
               Bactrian camel  ------------
                      Dolphin  ------------
                 Killer whale  ------------
             Tibetan antelope  ------------
                          Cow  ------------
                        Sheep  ------------
                Domestic goat  ------------
                        Horse  ------------
             White rhinoceros  ------------
                          Cat  ------------
                          Dog  ------------
                      Ferret   ------------
                        Panda  ------------
               Pacific walrus  ------------
                 Weddell seal  ------------
             Black flying-fox  ------------
                      Megabat  ------------
                Big brown bat  ------------
         David's myotis (bat)  ------------
                     Microbat  ------------
                     Hedgehog  ------------
                        Shrew  ------------
              Star-nosed mole  ------------
                     Elephant  ------------
          Cape elephant shrew  ------------
                      Manatee  ------------
             Cape golden mole  ------------
                       Tenrec  ------------
                     Aardvark  ------------
                    Armadillo  ------------
                      Opossum  ------------
              Tasmanian devil  ------------
                     Platypus  ------------
       White-throated sparrow  ggagaaattcta
          Medium ground finch  tgagaaattcta
                  Zebra finch  tgaaaaaccagg
                 Mallard duck  tagg--------
                       Turkey  ggagagatttta
             Peregrine falcon  ============
                 Saker falcon  ============
                       Parrot  ============
                   Budgerigar  ============
                  Rock pigeon  ============
     Chinese softshell turtle  ============
                      Chicken  ============
                X. tropicalis  ============
               Painted turtle  ============
          Collared flycatcher  ============
           American alligator  ============
           Tibetan ground jay  ============
                Scarlet macaw  ============
                      Wallaby  ============
       Spiny softshell turtle  ============
              Green seaturtle  ============

Inserts between block 12 and 13 in window
B D                 Platypus 1139bp

Alignment block 13 of 185 in window, 203868331 - 203868367, 37 bps 
B D                     Human  c-------cctt----------------------------------ct-----a---tgag---------
B D                     Chimp  c-------cctt----------------------------------ct-----a---tgag---------
B D                   Gorilla  c-------cctt----------------------------------ct-----a---tgag---------
B D                 Orangutan  c-------cctt----------------------------------ct-----a---tgag---------
B D                    Gibbon  c-------cctt----------------------------------ct-----a---tgag---------
B D                    Rhesus  c-------cctt----------------------------------ct-----a---tgag---------
B D       Crab-eating macaque  c-------cctt----------------------------------ct-----a---tgag---------
B D                    Baboon  c-------cctt----------------------------------ct-----a---tgag---------
B D              Green monkey  c-------cctt----------------------------------ct-----a---tgag---------
B D                  Marmoset  c-------cctt----------------------------------ct-----a---tgag---------
B D           Squirrel monkey  c-------cctt----------------------------------cc-----a---tgag---------
B D                  Bushbaby  g-------actt----------------------------------ct-----a---tagg---------
           Chinese tree shrew  c-------actt----------------------------------tt-----a---taag---------
B D                  Squirrel  c-------tctt----------------------------------ca-----a---taac---------
       Lesser Egyptian jerboa  t-------agtt----------------------------------ct-----a---tcat---------
                 Prairie vole  t-------actt----------------------------------tt-----g---taac---------
B D           Chinese hamster  t-------attt----------------------------------ct-----a---taaa---------
               Golden hamster  t-------attt----------------------------------ct-----a---taac---------
B D                     Mouse  ---------gtt----------------------------------ct-----t---tgtc---------
B D                       Rat  ---------ggt----------------------------------ct-----t---cact---------
B D            Naked mole-rat  c-------atat----------------------------------ct-----a---taac---------
B D                Guinea pig  c-------atag----------------------------------ct-----a---cagc---------
                   Chinchilla  g-------atag----------------------------------ct-----a---tagc---------
             Brush-tailed rat  t-------atag----------------------------------gt-----a---tagc---------
B D                    Rabbit  c-------actt----------------------------------ta-----a---taaa---------
B D                      Pika  ct------tttt----------------------------------ta-----a---cagg---------
B D                       Pig  c-------actt----------------------------------ct-----a---taag---------
B D                    Alpaca  c-------aatt----------------------------------ct-----a---caag---------
               Bactrian camel  c-------gatt----------------------------------ct-----a---caag---------
B D                   Dolphin  c-------actt----------------------------------ct-----a---taag---------
                 Killer whale  c-------actt----------------------------------ct-----a---taag---------
             Tibetan antelope  c-------attt----------------------------------ct-----a---taag---------
B D                       Cow  c-------actt----------------------------------ct-----a---taag---------
B D                     Sheep  c-------actt----------------------------------ct-----a---taag---------
                Domestic goat  c-------actt----------------------------------cc-----a---taag---------
B D                     Horse  c-------actt----------------------------------ct-----a---taag---------
B D          White rhinoceros  c-------actt----------------------------------ct-----a---taag---------
B D                       Cat  c-------actt----------------------------------ct-----g---tatg---------
B D                       Dog  c-------attt----------------------------------ct-----g---taag---------
B D                   Ferret   c-------actt----------------------------------ct-----g---tcag---------
B D                     Panda  c-------actt----------------------------------ct-----a---taag---------
               Pacific walrus  c-------actt----------------------------------ct-----a---taag---------
                 Weddell seal  c-------actt----------------------------------ct-----a---taag---------
             Black flying-fox  c-------actt----------------------------------ct-----g---tatg---------
B D                   Megabat  c-------actt----------------------------------ct-----g---tatg---------
                Big brown bat  c-------actt----------------------------------cg-----g---taag---------
         David's myotis (bat)  c-------actt----------------------------------cg-----g---taag---------
B D                  Microbat  c-------actt----------------------------------cg-----g---taag---------
B D                  Hedgehog  c-------at------------------------------------------------------------
B D                     Shrew  t-------attt----------------------------------tt-----a---taaa---------
              Star-nosed mole  c-------attt----------------------------------ct-----a---taag---------
B D                  Elephant  t-------attt----------------------cctcccaatcttct-----g---tgaa---------
          Cape elephant shrew  t-------attt----------------------tctttccatcttct-----g---taag---------
B D                   Manatee  t-------attt----------------------cctctcaaccttct-----a---tgag---------
             Cape golden mole  t-------attt----------------------tcttccaatcttcc-----a---gaag---------
B D                    Tenrec  t-------atttttcccccaattctccacccacctcccccaatcttct-----g---taagatcttactt
                     Aardvark  t-------attt----------------------tcttccaattttcttcagaa---gaag---------
B D                 Armadillo  c-------acta----------------------------------ct-----a---taag---------
B D                   Opossum  ccaagaggggta----------------------------------gt-----agctcaag---------
B D           Tasmanian devil  t-------attt----------------------------------ct-----atgttgat---------
  D    White-throated sparrow  ----------------------------------------------------------------------
B D       Medium ground finch  ----------------------------------------------------------------------
B D               Zebra finch  ----------------------------------------------------------------------
  D              Mallard duck  ----------------------------------------------------------------------
B D                    Turkey  ----------------------------------------------------------------------
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Platypus  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================

                        Human  -------a-----ctg-g-------------------------aagtgat-------------------t
                        Chimp  -------a-----ctg-g-------------------------aagtgat-------------------t
                      Gorilla  -------a-----ctg-g-------------------------aagtgat-------------------t
                    Orangutan  -------a-----ctg-g-------------------------aagtgat-------------------t
                       Gibbon  -------a-----ctg-g-------------------------aagtgat-------------------t
                       Rhesus  -------a-----ctg-g-------------------------aagtaat-------------------t
          Crab-eating macaque  -------a-----ctg-g-------------------------aagtaat-------------------t
                       Baboon  -------a-----ccg-g-------------------------aagtaat-------------------t
                 Green monkey  -------a-----ctg-g-------------------------aagtaat-------------------t
                     Marmoset  -------a-----ctg-g-------------------------aagcga--------------------t
              Squirrel monkey  -------a-----ttg-g-------------------------aagtga--------------------t
                     Bushbaby  -------a-----ttg-g--aag-----------aagt----taagtgat-------------------t
           Chinese tree shrew  -------a-----ttg-g--aaggaaatattataaagc----taggtgaa-------------------t
                     Squirrel  -------a-----tta-ggaaaaaaaatactctaaaat----taaatgat-------------------t
       Lesser Egyptian jerboa  -------g-----ctg-t--aagaaactgctatgccat----gaagggac-------------------t
                 Prairie vole  -------a-----tta-g--gaggacatactgcaaaac----taagaaat-------------------t
              Chinese hamster  -------a-----ttg-g--aaggaaatgctgtaaaac----tgagagat-------------------t
               Golden hamster  -------t-----ctg-g--aaggaaatactgtaaaat----tgagagat-------------------t
                        Mouse  -------a-----ctg-c--tagaaaatcctgtaaagt----taagagat-------------------t
                          Rat  -------a-----cta-t--tagaaaatactgtaaaat----taagagat-------------------t
               Naked mole-rat  -------att---ttg-g--aagaaaatactgtaaaa------aaatgat-------------------t
                   Guinea pig  -------att---ttg-g--aagagaatactgtacagt----taaatgat-------------------t
                   Chinchilla  -------att---ttg-a--aagaaaatactgtagagt----taaatgat-------------------t
             Brush-tailed rat  -------att---ttg-a--aagagaatactgtaaagt----taaatgat-------------------t
                       Rabbit  -------a-----ctg-g--aagcaaacactgtaaagg----taagagat-------------------t
                         Pika  -------a-----ctg-a--aagaaaacattataaaac----taagtgat-------------------t
                          Pig  -------a-----cagaa--aagaaagtcctgtcaaat----taagtgat-------------------t
                       Alpaca  -------a-----ttg-g--aaggaaatcctgtaaagt----caagtgat-------------------t
               Bactrian camel  -------a-----ttg-g--aaggaaatcctgtaaagt----caagtgat-------------------t
                      Dolphin  -------a-----tga-g--aagaaaatactgcaaagt----taagtgat-------------------t
                 Killer whale  -------a-----tga-g--aagaaaatactgcaaagt----taagtgat-------------------t
             Tibetan antelope  -------a-----ctg-g--aagaaaatactgtaaagg----taagtgat-------------------g
                          Cow  -------a-----ctg-g--aagaaaatactgtaaagg----taagtgat-------------------g
                        Sheep  -------a-----ctg-g--aagaaaatactgtaaagg----taagcgat-------------------g
                Domestic goat  -------a-----ctg-g--aagaaaatactgtaaagg----taagcgat-------------------g
                        Horse  -------a-----ttg-g--aagaaaatactgtctagt----taagtgat-------------------t
             White rhinoceros  -------a-----ttg-g--aagaaaatactgtcaagt----taagtgat-------------------t
                          Cat  -------a-----ttg-g--aagaaattactgtaaagt----taagtgag-------------------t
                          Dog  -------a-----ttg-g--aagaaaatactgtaaggt----taagtgac-------------------t
                      Ferret   -------a-----ttg-g--aagaaaatactgtaaagt----taagcaat-------------------t
                        Panda  -------a-----ttg-g--aagaaaatactgtaaatt----taagtgat-------------------t
               Pacific walrus  -------a-----ttg-g--aagaaaatactgtaaagt----taagcgat-------------------t
                 Weddell seal  -------a-----ttg-g--aagaaaatac-gtaaggt----taaacgat-------------------t
             Black flying-fox  -------a-----ttg-a--aagaaaacactgttaagt---------gat-------------------t
                      Megabat  -------a-----ttg-a--aagaaaacactgttcagt---------gat-------------------t
                Big brown bat  -------a-----cgg-a--agggaaatactgtaaagttaatgacgtgat-------------------t
         David's myotis (bat)  -------g-----ctg-c--aggcaaatactgtcaagttaatgaagcgat-------------------t
                     Microbat  -------a-----ctg-c--aggcaaatactgtaaagtgaatgaagcgac-------------------t
                     Hedgehog  -------------------------aacgttataacgt----taaaggat-------------------t
                        Shrew  -------a-----ttg-a--aaaggaataatgtaaagt----tg-atgat-------------------t
              Star-nosed mole  -------a-----tag-g--aagaaaatattgtaaagt----tatgagat-------------------t
                     Elephant  -------g-----ttg-a--aagtaaatatcttaaagt----aaaaggat-------------------t
          Cape elephant shrew  -------a-----tgg-a------atatatattaaagt----gaagggat-------------------t
                      Manatee  -------a-----tag-g--aagaaaatatcttaaagt----ggaaggat-------------------t
             Cape golden mole  -------a-----gta-a--aagaaaataccttaaggt----aaagagat-------------------t
                       Tenrec  ctgtgcaa-----ttg-g--aagaaaagatcttacagg----gaagcaat-------------------t
                     Aardvark  -------a-----ttg-g--aagaaaataacttaaagt----aaagggat-------------------t
                    Armadillo  -------a-----ttg-g--aagaaaatactgtagagt----taagggat-------------------t
                      Opossum  -------a-----tag-g----------------------------------------------------
              Tasmanian devil  -------a-----tta-a----------------------------------------------------
       White-throated sparrow  ---------c---tct-t--catctggaattcttgcat----tgcagaac-------------------t
          Medium ground finch  ---------c---tct-t--catctggaattcttgcac----tgcagaac-------------------t
                  Zebra finch  ---------c---cct-g--cagatgaagttgtgacag----ctgaaaacatgggtatagaggtttgaat
                 Mallard duck  -------------cct-c--g--------tgagtgaag----ctgacagc-------------------t
                       Turkey  ---------cttatct-c--c--------ttcttgcac----tgcagaac-------------------t
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Chicken  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ======================================================================
          Collared flycatcher  ======================================================================
           American alligator  ======================================================================
           Tibetan ground jay  ======================================================================
                Scarlet macaw  ======================================================================
                      Wallaby  ======================================================================
                     Platypus  ======================================================================
       Spiny softshell turtle  ======================================================================
              Green seaturtle  ======================================================================

                        Human  taagagggaaag
                        Chimp  taagagggaaag
                      Gorilla  taggagggaaag
                    Orangutan  taagagggaaag
                       Gibbon  taagagggaaag
                       Rhesus  taagagggaaag
          Crab-eating macaque  taagagggaaag
                       Baboon  taagagggaaag
                 Green monkey  taagagggaaag
                     Marmoset  taagaggaaaag
              Squirrel monkey  taagaggaaaag
                     Bushbaby  taagagggaaag
           Chinese tree shrew  taagaggaaaaa
                     Squirrel  taaaagggaaa-
       Lesser Egyptian jerboa  tgagagagaaaa
                 Prairie vole  taag--------
              Chinese hamster  taagtggggaaa
               Golden hamster  taagtggtaaaa
                        Mouse  taagggg-----
                          Rat  taaggtgggaaa
               Naked mole-rat  taagcaggaaaa
                   Guinea pig  taagcggaaaaa
                   Chinchilla  taagtgggaaaa
             Brush-tailed rat  taagtgggaaaa
                       Rabbit  taaaagggaaaa
                         Pika  tgaaaggaaaag
                          Pig  taagagagaaaa
                       Alpaca  taagagagaaaa
               Bactrian camel  taagagagaaaa
                      Dolphin  taagagagcaaa
                 Killer whale  taagagagcaaa
             Tibetan antelope  taagagagaaga
                          Cow  taagagagaaga
                        Sheep  taagagagaaga
                Domestic goat  taagagagaaga
                        Horse  taagagagaaaa
             White rhinoceros  taagacagaaaa
                          Cat  ta--agaggaaa
                          Dog  taagagaggaag
                      Ferret   taagagaggaaa
                        Panda  taagagaggaaa
               Pacific walrus  taagagaggaaa
                 Weddell seal  taagagaggaaa
             Black flying-fox  taagagagaaaa
                      Megabat  taagagagaaaa
                Big brown bat  taagagagaaaa
         David's myotis (bat)  taagagagaaaa
                     Microbat  taagagagaaaa
                     Hedgehog  taaaagaacaaa
                        Shrew  taagacaggaaa
              Star-nosed mole  taagaggaaaaa
                     Elephant  ttggagggaaaa
          Cape elephant shrew  ttcaagggaaaa
                      Manatee  taagaaggaaaa
             Cape golden mole  taggagggaaaa
                       Tenrec  taggaggga---
                     Aardvark  taggaggga---
                    Armadillo  taggaggagaaa
                      Opossum  --------taga
              Tasmanian devil  --------aagg
       White-throated sparrow  gacaa-------
          Medium ground finch  gacaa-------
                  Zebra finch  gtatg-------
                 Mallard duck  gatga-------
                       Turkey  gaaga-------
             Peregrine falcon  ============
                 Saker falcon  ============
                       Parrot  ============
                   Budgerigar  ============
                  Rock pigeon  ============
     Chinese softshell turtle  ============
                      Chicken  ============
                X. tropicalis  ============
               Painted turtle  ============
          Collared flycatcher  ============
           American alligator  ============
           Tibetan ground jay  ============
                Scarlet macaw  ============
                      Wallaby  ============
                     Platypus  ============
       Spiny softshell turtle  ============
              Green seaturtle  ============

Inserts between block 13 and 14 in window
  D             Mallard duck 656bp
B D                   Turkey 1bp

Alignment block 14 of 185 in window, 203868368 - 203868392, 25 bps 
B D                     Human  gat-agc-catagtcc-------tg---aat-acattt
B D                     Chimp  gat-agc-catagtcc-------tg---aat-acattt
B D                   Gorilla  gat-agc-catagtcc-------tg---aat-acattt
B D                 Orangutan  gat-agc-tgtagtcc-------tg---aat-acattt
B D                    Gibbon  gat-atc-catagtcc-------tg---aat-acattt
B D                    Rhesus  gat-atc-catagtcc-------tg---aat-acattt
B D       Crab-eating macaque  gat-atc-catagtcc-------tg---aat-acattt
B D                    Baboon  gat-atc-catagtcc-------tg---aat-acattt
B D              Green monkey  gat-atc-catagtcc-------tg---aat-acattt
B D                  Marmoset  gat-atc-cacagtcc-------tg---aat-acattt
B D           Squirrel monkey  gat-atc-cacaggcc-------tg---aat-acattt
B D                  Bushbaby  gat-aac-cctaatc------------------cattc
           Chinese tree shrew  gat-aca-cacagtgc-------tg---aat-acattt
B D                  Squirrel  aac-atc-cacagtcc-------ta---aat-gcgtgt
       Lesser Egyptian jerboa  gtc-atc-tgcaacgc-------tg---aat-atagtt
                 Prairie vole  ggc-ttc-tgaaatcc-------tg---agt-atattt
B D           Chinese hamster  ggt-ttc-tgaaatcc-------tg---agt-atattt
               Golden hamster  ggc-ttc-tgaaatcc--------g---agt-atattt
B D                     Mouse  ggc-att-tgaaatcg-------tg---agt-acattt
B D                       Rat  ggc-att-tgaaattc-------tg---agt-atatct
B D            Naked mole-rat  gac-attgtgcagtcc-------tg---aat-atgtat
B D                Guinea pig  gac-attgtgtagtcc-------tg---aat-atattt
                   Chinchilla  gac-attatgcactcc-------ta---aat-atattt
             Brush-tailed rat  gac-cctacgcagttc-------tg---aat-atattt
B D                    Rabbit  gac-atc-tgcagtcc-------tgaataat-aatttt
B D                      Pika  gat-atc-tgcagtct-------taaagaac-acattt
B D                       Pig  gat-acc-cagggtcc-------tg---aat-acattt
B D                    Alpaca  gat-acc-cacggtcc-------ga---aat-acattt
               Bactrian camel  gat-acc-cacggttc-------ta---aat-acattt
B D                   Dolphin  gat-acc-caccatcc-------ta---aat-ccattt
                 Killer whale  gat-acc-caccatcc-------ta---aat-ccattt
             Tibetan antelope  gag------accatcc-------ta---aat-ccattt
B D                       Cow  gag------accatcc-------ta---aat-ccatct
B D                     Sheep  gag------accatcc-------ta---aat-ccattt
                Domestic goat  gag------accatcc-------ta---aat-ccattt
B D                     Horse  gat-atc-cacagtcc-------ta---aat-acactg
B D          White rhinoceros  gat-atc-cacagttc-------ta---aat-acattt
B D                       Cat  gat-ctc-tacagtcc-------tt---aat-atattt
B D                       Dog  ggt-atc-cgtagccc-------tt---cac-gtgttt
B D                   Ferret   gat-atc-cgtagctc-------ct---aat-gtattt
B D                     Panda  gat-atc-tgtagccc-------tt---aat-gtattt
               Pacific walrus  gat-atc-cgtagccc-------tt---aat-gcattt
                 Weddell seal  gat-atc-cgtagccc-------tt---aat-gcattt
             Black flying-fox  gat-atc-cagaaccc-------tg---aat-acatct
B D                   Megabat  gat-atc-cagaaccc-------tg---aat-acatct
                Big brown bat  gat-atc-tgcagtcc-------tg---aac-acatct
         David's myotis (bat)  gat-atc-cgcagtcc-------tg---aac-acatct
B D                  Microbat  gat-atc-cgcagtcc-------tg---gac-acatct
B D                  Hedgehog  gataatc-cacagttc-------tg---aat-acactt
B D                     Shrew  gat-gtc-tacagatc-------tg---aat-acattt
              Star-nosed mole  gat-atc-cacagtcc-------tt---aat-acattt
B D                  Elephant  gat-atc-cacagtcc-------tg---aat-gcattt
          Cape elephant shrew  gat-att---cagtct-------tg---ata-gctact
B D                   Manatee  gat-tca---cagtcc-------tg---aat-gcattt
             Cape golden mole  gat-atc-cacaatcc-------ta---aat-gcactg
B D                    Tenrec  -----------aatcc-------tg---aat-gcattt
                     Aardvark  ----att-cacaagcc-------tg---gat-gcattt
B D                 Armadillo  gat-atc-tacagtac-------tg---cat-acattt
B D                   Opossum  gtt-tca-catatttc-------ta---ggc-tcatgt
B D           Tasmanian devil  gtt-ttt-taaagttc-------ta---gttattatat
  D    White-throated sparrow  gat-aaa-ccctgccc--caaaatg---gac-tgatat
B D       Medium ground finch  gat-aaa-ccctgccc--caaaatg---gac-tgatat
B D               Zebra finch  gag-aaa-ttctactcttcatctgg---aat-tcttgc
B D                    Turkey  ggt-aaa-ctcagccc--agaaatg---gac-ttttta
  D          Peregrine falcon  ======================================
  D              Saker falcon  ======================================
  D                    Parrot  ======================================
B D                Budgerigar  ======================================
  D               Rock pigeon  ======================================
  D              Mallard duck  ======================================
  D  Chinese softshell turtle  ======================================
B D                   Chicken  ======================================
B D             X. tropicalis  ======================================
  D            Painted turtle  ======================================
  D       Collared flycatcher  ======================================
B D        American alligator  ======================================
          Tibetan ground jay  ======================================
  D             Scarlet macaw  ======================================
B D                   Wallaby  ======================================
B D                  Platypus  ======================================
  D    Spiny softshell turtle  ======================================
  D           Green seaturtle  ======================================

Inserts between block 14 and 15 in window
B D                  Opossum 1191bp
B D          Tasmanian devil 2bp

Alignment block 15 of 185 in window, 203868393 - 203868405, 13 bps 
B D                     Human  -----gag---ctgggtttca
B D                     Chimp  -----gag---ctgggtttca
B D                   Gorilla  -----gag---ctgggtttca
B D                 Orangutan  -----gag---ctgggtttca
B D                    Gibbon  -----gag---ctgggtttca
B D                    Rhesus  -----gag---ctgggtttca
B D       Crab-eating macaque  -----gag---ctgggtttca
B D                    Baboon  -----gtg---ctgggtttca
B D              Green monkey  -----gag---ctgggtttca
B D                  Marmoset  -----gca---ctgggtttca
B D           Squirrel monkey  -----gag---ctgggtttca
B D                  Bushbaby  -----agg--tttggatatca
           Chinese tree shrew  -----gag---cttgttatca
B D                  Squirrel  -----gag---cttggtatca
       Lesser Egyptian jerboa  -----ggt---cttgatatca
                 Prairie vole  -----gat---cttggtatca
B D           Chinese hamster  -----gat---cttgatatca
               Golden hamster  -----gat---cttgatatca
B D                     Mouse  -----gat---cttgatatca
B D                       Rat  -----gat---cttgatatca
B D            Naked mole-rat  -----gagcttcttatta---
B D                Guinea pig  -----gag---cttattg---
                   Chinchilla  -----gag---cttactg---
             Brush-tailed rat  -----gag---cttattg---
B D                    Rabbit  -----gat---cctgatatca
B D                      Pika  -----gat---attggcatca
B D                       Pig  -----ggg---cttggaatca
B D                    Alpaca  -----ggg---cttggaatca
               Bactrian camel  -----ggg---cttggaatca
B D                   Dolphin  -----ggg---cttggaatca
                 Killer whale  -----ggg---cttggaatca
             Tibetan antelope  -----ggg---cttggaataa
B D                       Cow  -----ggg---cttggaataa
B D                     Sheep  -----ggg---cttggaataa
                Domestic goat  -----ggg---cttggaataa
B D                     Horse  -----gag---cttaggatga
B D          White rhinoceros  -----gag---cttaggatca
B D                       Cat  -----gag---cttggaatca
B D                       Dog  -----aag---tttggaatca
B D                   Ferret   -----aag---cttggaatca
B D                     Panda  -----aag---cttggaatca
               Pacific walrus  -----aag---tttggaaaca
                 Weddell seal  -----aag---tttggaatca
             Black flying-fox  -----gag---cttggaatca
B D                   Megabat  -----gag---cttggaatca
                Big brown bat  -----ggg---cttggaatca
         David's myotis (bat)  -----gag---cttggaatca
B D                  Microbat  -----gag---cttggaatca
B D                  Hedgehog  -----gaa---cttggaatca
B D                     Shrew  -----gcg---cttggaatca
              Star-nosed mole  -----gaa---tttggaatta
B D                  Elephant  -----gag---ctgggtatca
          Cape elephant shrew  -----g---------------
B D                   Manatee  -----gag---ctgggtatca
             Cape golden mole  -----gag---cttggtatca
B D                    Tenrec  -----gag---tttgctgtca
                     Aardvark  -----gag---gttggtatca
B D                 Armadillo  -----gaa---cttggtattg
B D           Tasmanian devil  --------ttactttttaa--
  D    White-throated sparrow  aaaataag---att-a-----
B D       Medium ground finch  aaaatgag---attga-----
B D               Zebra finch  attgcaga---actga-----
B D                    Turkey  aatatgaa---attga-----
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
  D                    Parrot  =====================
B D                Budgerigar  =====================
  D               Rock pigeon  =====================
  D              Mallard duck  =====================
  D  Chinese softshell turtle  =====================
B D                   Chicken  =====================
B D             X. tropicalis  =====================
  D            Painted turtle  =====================
  D       Collared flycatcher  =====================
B D        American alligator  =====================
          Tibetan ground jay  =====================
  D             Scarlet macaw  =====================
B D                   Wallaby  =====================
B D                  Platypus  =====================
  D    Spiny softshell turtle  =====================
  D           Green seaturtle  =====================
B D                   Opossum  =====================

Inserts between block 15 and 16 in window
B D                    Mouse 864bp
         Cape elephant shrew 3bp

Alignment block 16 of 185 in window, 203868406 - 203868424, 19 bps 
B D                     Human  --gg---atgagctcacaa-gt-------tcc
B D                     Chimp  --gg---atgagctcacaa-gt-------tcc
B D                   Gorilla  --gg---atgagctcacaa-gt-------tcc
B D                 Orangutan  --gg---atgagctcacaa-gt-------tcc
B D                    Gibbon  --gg---atgagctctcaa-gt-------tcc
B D                    Rhesus  --gg---atgagctcacaa-gt-------tcc
B D       Crab-eating macaque  --gg---atgagctcacaa-gt-------tcc
B D                    Baboon  --gg---atgagctcacaa-gt-------tcc
B D              Green monkey  --gg---atgagctcacaa-gt-------tcc
B D                  Marmoset  --gg---atgagctcacaa-gt-------tcc
B D           Squirrel monkey  --gg---atgagctcacaa-gt-------tcc
B D                  Bushbaby  --ga---gtggtttcaaaa-tt-------tcc
           Chinese tree shrew  --gg---atgaattcaagatat-------tcc
B D                  Squirrel  ---g---ggaatttcaaga-tt-------tcc
       Lesser Egyptian jerboa  --ca---gtcctcttgaga-tt-------ttt
                 Prairie vole  --ga---gggaccttaaga-tt-------ttc
B D           Chinese hamster  --ga---gggaccttgtgt-tt-------ttt
               Golden hamster  --ga---gggaccttgtga-tt-------ttc
B D                       Rat  --ca---gtgaccttaaga-tt-------ttt
B D            Naked mole-rat  --gg---gtaagcccaaga-tt-------tcc
B D                Guinea pig  --cg---gtaattccaaga--t-------tcc
                   Chinchilla  --gg---gtaatcccaaga-tt-------tcc
             Brush-tailed rat  --gg---gcaatctcaaga-tt-------tat
B D                    Rabbit  ----------------aga-tt-------tta
B D                      Pika  ----------------aaa-tt-------tta
B D                       Pig  --gg---gttagtttaaga-gt-------taa
B D                    Alpaca  --cg---gttggctcaaga-tt-------tcc
               Bactrian camel  --tg---gttggctcaaga-tt-------tcc
B D                   Dolphin  --tg---gttagctcaaga-tt-------tcc
                 Killer whale  --gg---gttagctcaaga-tt-------tcc
             Tibetan antelope  --gg---gttagctcaagg-tt-------tcc
B D                       Cow  --gg---gttagctcaagg-tt-------tcc
B D                     Sheep  --gg---gttagctcaagg-tt-------tcc
                Domestic goat  --gg---gttagctcaagg-tt-------tcc
B D                     Horse  --tg---gtgatcctaag-------------c
B D          White rhinoceros  --tg---gtgagttcaaga-tt-------tcc
B D                       Cat  --gg---gtgagctcaaga-tt-------tcc
B D                       Dog  --gg---gtgaactcagga-at-------ttc
B D                   Ferret   --gg---gtgaactcaa-a-at-------ttc
B D                     Panda  --gg---gtaaacgcaaga-at-------ttc
               Pacific walrus  --gg---gtgaactcaaga-at-------ttc
                 Weddell seal  --gg---gtgaactcgagg-at-------ttc
             Black flying-fox  --gg---gtgagatcaaaa-tt-------ttt
B D                   Megabat  --tg---gtgagatcaaaa-tt-------ttt
                Big brown bat  --gg---acaagct-agga-tt-------ttt
         David's myotis (bat)  --gg---acaagctcagga-tt-------ttt
B D                  Microbat  --gg---acaagctcagga-tt-------ttt
B D                  Hedgehog  --ga---gtaagtttgaga-tt-------ttt
B D                     Shrew  --gg-----tagctcaata-tt-------tct
              Star-nosed mole  --gg---acaagctcaaaa-tt---------t
B D                  Elephant  --gg---gagaagccaaga-tt-------tcc
B D                   Manatee  --gg---gtagactcaagg-tt-------tcc
             Cape golden mole  --ag---ataaactccaga-tt-------tcc
B D                    Tenrec  --gg---atgaacttgaga-ttctttctcccc
                     Aardvark  --ggtgaatgtactcaaga-tt----------
B D                 Armadillo  --gg---gtatactcaaga-tt-------tgc
B D           Tasmanian devil  ----------agatgaaga-tt-------tt-
  D    White-throated sparrow  aaaa---acaatgctgagt-cc-------t--
B D       Medium ground finch  aaaa---acaatgctgagt-cc-------t--
B D               Zebra finch  gaag---ataaaccctgct-c-----------
B D                    Turkey  ataa---ataatgctgagc-ac-------t--
B D                     Mouse  ================================
  D          Peregrine falcon  ================================
  D              Saker falcon  ================================
  D                    Parrot  ================================
B D                Budgerigar  ================================
  D               Rock pigeon  ================================
  D              Mallard duck  ================================
  D  Chinese softshell turtle  ================================
B D                   Chicken  ================================
B D             X. tropicalis  ================================
  D            Painted turtle  ================================
  D       Collared flycatcher  ================================
B D        American alligator  ================================
          Tibetan ground jay  ================================
  D             Scarlet macaw  ================================
         Cape elephant shrew  ================================
B D                   Wallaby  ================================
B D                  Platypus  ================================
  D    Spiny softshell turtle  ================================
  D           Green seaturtle  ================================
B D                   Opossum  ================================

Inserts between block 16 and 17 in window
B D                   Rhesus 6bp
B D      Crab-eating macaque 7bp
B D                   Baboon 9bp
B D             Green monkey 7bp
B D                 Marmoset 9bp
B D          Squirrel monkey 9bp
B D                      Pig 3bp
B D                   Alpaca 3bp
              Bactrian camel 3bp
                Killer whale 553bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 2bp
               Domestic goat 2bp
B D                 Hedgehog 2bp
B D                    Shrew 2bp
             Star-nosed mole 2bp
B D                 Elephant 3bp
B D                  Manatee 7bp
            Cape golden mole 3bp
B D                   Tenrec 5bp
                    Aardvark 3bp
B D                Armadillo 3bp

Alignment block 17 of 185 in window, 203868425 - 203868427, 3 bps 
B D                     Human  ttt
B D                     Chimp  ttt
B D                   Gorilla  ttt
B D                 Orangutan  ttt
B D                    Gibbon  ttt
B D                    Rhesus  ttt
B D       Crab-eating macaque  ttt
B D                    Baboon  ttt
B D              Green monkey  ttt
B D                  Marmoset  ttt
B D           Squirrel monkey  ttt
B D                  Bushbaby  ctt
           Chinese tree shrew  ttt
B D                  Squirrel  ctc
       Lesser Egyptian jerboa  cct
                 Prairie vole  ctc
B D           Chinese hamster  ctt
               Golden hamster  ctc
B D                       Rat  ctc
B D            Naked mole-rat  ctc
B D                Guinea pig  ctc
                   Chinchilla  ctc
             Brush-tailed rat  ctc
B D                    Rabbit  c-t
B D                      Pika  ctt
B D                       Pig  tat
B D                    Alpaca  ttt
               Bactrian camel  ttt
B D                   Dolphin  ctt
                 Killer whale  ttt
             Tibetan antelope  ctt
B D                       Cow  ttt
B D                     Sheep  ttt
                Domestic goat  ttt
B D                     Horse  ttt
B D          White rhinoceros  ttt
B D                       Cat  ctt
B D                       Dog  ctt
B D                   Ferret   ctt
B D                     Panda  ctt
               Pacific walrus  ctt
                 Weddell seal  ctt
             Black flying-fox  ctt
B D                   Megabat  ctt
                Big brown bat  ctt
         David's myotis (bat)  ctt
B D                  Microbat  ctt
B D                  Hedgehog  ttt
B D                     Shrew  ttt
              Star-nosed mole  ttt
B D                  Elephant  ttt
          Cape elephant shrew  ttt
B D                   Manatee  ttt
             Cape golden mole  ttt
B D                    Tenrec  ttt
                     Aardvark  tta
B D                 Armadillo  t--
B D           Tasmanian devil  cta
B D                     Mouse  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
B D                Budgerigar  ===
  D               Rock pigeon  ===
  D              Mallard duck  ===
  D  Chinese softshell turtle  ===
B D                   Chicken  ===
B D       Medium ground finch  ---
B D                    Turkey  ---
B D             X. tropicalis  ===
  D            Painted turtle  ===
B D               Zebra finch  ---
  D       Collared flycatcher  ===
B D        American alligator  ===
          Tibetan ground jay  ===
  D             Scarlet macaw  ===
  D    White-throated sparrow  ---
B D                   Wallaby  ===
B D                  Platypus  ===
  D    Spiny softshell turtle  ===
  D           Green seaturtle  ===
B D                   Opossum  ===

Inserts between block 17 and 18 in window
B D                 Marmoset 63bp
B D          Squirrel monkey 28bp
          Chinese tree shrew 2bp
B D                  Dolphin 7783bp
B D                    Horse 3bp
B D         White rhinoceros 3bp
B D                      Cat 3bp
B D                      Dog 3bp
B D                  Ferret  3bp
B D                    Panda 3bp
              Pacific walrus 3bp
                Weddell seal 3bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 3bp
        David's myotis (bat) 32bp
B D                 Microbat 3bp
B D                    Shrew 1bp
             Star-nosed mole 1bp
B D                   Tenrec 2bp
B D                Armadillo 6bp

Alignment block 18 of 185 in window, 203868428 - 203868434, 7 bps 
B D                     Human  aaaa----a---------------------aa
B D                     Chimp  aaaa----a---------------------aa
B D                   Gorilla  aaaa----a---------------------aa
B D                 Orangutan  aaaa----a---------------------aa
B D                    Gibbon  aaaac---a---------------------aa
B D                    Rhesus  tttt----t---------------------ta
B D       Crab-eating macaque  tttt----t---------------------ta
B D                    Baboon  tttt----t---------------------ta
B D              Green monkey  tttt----t---------------------ta
B D                  Marmoset  aaca----a---------------------ac
B D           Squirrel monkey  aaca----a---------------------ac
B D                  Bushbaby  taaa----a---------------------aa
           Chinese tree shrew  aaaa----a---------------------at
B D                  Squirrel  ttat----a---------------------aa
       Lesser Egyptian jerboa  ctta----a---------------------aa
                 Prairie vole  cttt----a---------------------aa
B D           Chinese hamster  cctt----a---------------------aa
               Golden hamster  ctta----agaaaacgaaaacaacaacaacaa
B D                       Rat  ctat----t-----------ccacccccccaa
B D            Naked mole-rat  ttta----a---------------------aa
B D                Guinea pig  tttt----a---------------------aa
                   Chinchilla  ttta----a---------------------aa
             Brush-tailed rat  -tta----t---------------------aa
B D                    Rabbit  ttta----a---------------------aa
B D                      Pika  ttta----a---------------------ga
B D                       Pig  ------------------------------aa
B D                    Alpaca  ------------------------------aa
               Bactrian camel  ------------------------------aa
                 Killer whale  ------------------------------ga
             Tibetan antelope  ------------------------------aa
B D                       Cow  ------------------------------aa
B D                     Sheep  ------------------------------aa
                Domestic goat  ------------------------------aa
B D                     Horse  ------------------------------aa
B D          White rhinoceros  ------------------------------aa
B D                       Cat  ------------------------------ca
B D                       Dog  ------------------------------gc
B D                   Ferret   ------------------------------ta
B D                     Panda  ------------------------------aa
               Pacific walrus  ------------------------------aa
                 Weddell seal  ------------------------------aa
                Big brown bat  ------------------------------aa
B D                  Microbat  -------------------------------a
B D                     Shrew  ------------------------------ca
              Star-nosed mole  ------------------------------aa
B D                  Elephant  ------------------------------aa
          Cape elephant shrew  ------------------------------aa
B D                   Manatee  ------------------------------aa
             Cape golden mole  ------------------------------aa
                     Aardvark  ------------------------------aa
B D           Tasmanian devil  ----atgga---------------------ga
  D    White-throated sparrow  -------ca---------------------ca
B D       Medium ground finch  -------ca---------------------ca
B D               Zebra finch  -------ca---------------------aa
B D                    Turkey  -------ca---------------------ca
B D                  Hedgehog  --------------------------------
B D                     Mouse  ================================
  D          Peregrine falcon  ================================
  D              Saker falcon  ================================
  D                    Parrot  ================================
B D                Budgerigar  ================================
  D               Rock pigeon  ================================
  D              Mallard duck  ================================
  D  Chinese softshell turtle  ================================
B D                   Chicken  ================================
B D             X. tropicalis  ================================
  D            Painted turtle  ================================
  D       Collared flycatcher  ================================
B D        American alligator  ================================
          Tibetan ground jay  ================================
  D             Scarlet macaw  ================================
B D                   Wallaby  ================================
B D                  Platypus  ================================
  D    Spiny softshell turtle  ================================
  D           Green seaturtle  ================================
        David's myotis (bat)  ================================
            Black flying-fox  ================================
B D                   Megabat  ================================
B D                   Opossum  ================================
B D                    Tenrec  ================================
B D                 Armadillo  ================================
B D                   Dolphin  ================================

Inserts between block 18 and 19 in window
B D                 Squirrel 1bp
                Prairie vole 668bp
B D          Chinese hamster 808bp
              Golden hamster 11bp
B D                      Rat 7bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 2bp
B D                     Pika 2bp
B D                      Pig 5bp
B D                   Alpaca 5bp
              Bactrian camel 5bp
                Killer whale 5bp
            Tibetan antelope 5bp
B D                      Cow 5bp
B D                    Sheep 5bp
               Domestic goat 5bp
B D                    Horse 5bp
B D         White rhinoceros 5bp
B D                      Cat 5bp
B D                      Dog 5bp
B D                  Ferret  5bp
B D                    Panda 5bp
              Pacific walrus 5bp
                Weddell seal 5bp
               Big brown bat 49bp
B D                 Microbat 60bp
B D                    Shrew 5bp
             Star-nosed mole 5bp
B D                 Elephant 7bp
         Cape elephant shrew 1bp
B D                  Manatee 7bp
            Cape golden mole 16bp
                    Aardvark 7bp

Alignment block 19 of 185 in window, 203868435 - 203868435, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  g
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  g
                     Aardvark  a
B D                 Armadillo  t
B D           Tasmanian devil  a
  D    White-throated sparrow  g
B D       Medium ground finch  g
B D               Zebra finch  a
B D                    Turkey  g
              Golden hamster  =
B D                  Hedgehog  -
B D                       Rat  =
B D                     Mouse  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                Budgerigar  =
  D               Rock pigeon  =
  D              Mallard duck  =
  D  Chinese softshell turtle  =
B D                   Chicken  =
B D             X. tropicalis  =
  D            Painted turtle  =
  D       Collared flycatcher  =
B D        American alligator  =
          Tibetan ground jay  =
  D             Scarlet macaw  =
                Prairie vole  =
B D           Chinese hamster  =
B D                   Wallaby  =
B D                  Platypus  =
  D    Spiny softshell turtle  =
  D           Green seaturtle  =
            Black flying-fox  =
B D                   Megabat  =
B D                   Opossum  =
B D                   Dolphin  =

Inserts between block 19 and 20 in window
      Lesser Egyptian jerboa 1bp

Alignment block 20 of 185 in window, 203868436 - 203868449, 14 bps 
B D                     Human  ttgac-ttaag-c------------aaa
B D                     Chimp  ttgac-ttaag-a------------aaa
B D                   Gorilla  ttgac-ttaag-c------------aaa
B D                 Orangutan  tcgac-ttaag-c------------aaa
B D                    Gibbon  ttgac-ataag-c------------aaa
B D                    Rhesus  ttgat-ttaag-c------------aaa
B D       Crab-eating macaque  ttgat-ttaag-c------------aaa
B D                    Baboon  ttgat-ttaag-c------------aaa
B D              Green monkey  ttgat-ttaag-c------------aaa
B D                  Marmoset  tcgactttaag-c------------aaa
B D           Squirrel monkey  ttgactttaaa-c------------aaa
B D                  Bushbaby  ttgac-ttaag-a------------aaa
           Chinese tree shrew  ttgct-ttaagac------------aaa
B D                  Squirrel  tggat-ttagg-c------------aaa
       Lesser Egyptian jerboa  tgacc-taaaa-t------------aa-
               Golden hamster  tagac-taaaa-t------------aag
B D                       Rat  taaat-tcaaa-t------------aaa
B D            Naked mole-rat  ctgat-ttaat-c------------aaa
B D                Guinea pig  ctgat-ttaaa-t------------a--
                   Chinchilla  ttgac-ttaat-t------------aaa
             Brush-tailed rat  ttaat-ttaac-t------------gaa
B D                    Rabbit  ttgat-ttaca-g------------aaa
B D                      Pika  ccaat-ttaca-g------------aaa
B D                       Pig  ttgct-ttaag-c------------aaa
B D                    Alpaca  ttgat-ttaag-a------------aaa
               Bactrian camel  ttgat-ttaag-a------------aaa
                 Killer whale  ctgat-ttagg-c------------aaa
             Tibetan antelope  ttgat-tgaag-c------------aaa
B D                       Cow  ttgat-tgaat-a------------aaa
B D                     Sheep  ttgat-tgaag-c------------aaa
                Domestic goat  ttgat-tgaag-c------------aga
B D                     Horse  tcgat-tcaag-c------------aaa
B D          White rhinoceros  ttgac-ttaag-a------------aaa
B D                       Cat  ttgat-ttaag-c------------aaa
B D                       Dog  ttgat-ttaag-t------------gaa
B D                   Ferret   tggat-ttaag-c------------aaa
B D                     Panda  tgaat-ttaag-c------------gac
               Pacific walrus  tggat-ttaag-t------------gaa
                 Weddell seal  tggat-ttaag-t------------gaa
             Black flying-fox  ------------t------------taa
B D                   Megabat  ------------t------------taa
                Big brown bat  ctaat-tggagta------------aaa
         David's myotis (bat)  ctaat-tggag-a------------aaa
B D                  Microbat  ctaat-tggag-c------------aaa
B D                     Shrew  ttgaa-gtaag-c------------aag
              Star-nosed mole  atgac-ttaag-c------------aaa
B D                  Elephant  ttcac-ttaat-a------------aaa
          Cape elephant shrew  ccaac-ttaat-a------------aaa
B D                   Manatee  tagac-ttaat-a------------aaa
             Cape golden mole  tcaac-tgaat-g------------aaa
B D                    Tenrec  ccaac-ttaat-a------------aaa
                     Aardvark  aaaaa-tcaat-a------------aaa
B D                 Armadillo  tcaat-ttaag-c------------aag
B D           Tasmanian devil  tggat-atact-t------------tat
  D    White-throated sparrow  cttac-taaag-c------------aaa
B D       Medium ground finch  cttac-taaag-c------------aaa
B D               Zebra finch  tggac-tgata-taaaatgagattgaaa
B D                    Turkey  cttat-taaag-c------------aaa
B D                  Hedgehog  ----------------------------
B D                     Mouse  ============================
  D          Peregrine falcon  ============================
  D              Saker falcon  ============================
  D                    Parrot  ============================
B D                Budgerigar  ============================
  D               Rock pigeon  ============================
  D              Mallard duck  ============================
  D  Chinese softshell turtle  ============================
B D                   Chicken  ============================
B D             X. tropicalis  ============================
  D            Painted turtle  ============================
  D       Collared flycatcher  ============================
B D        American alligator  ============================
          Tibetan ground jay  ============================
  D             Scarlet macaw  ============================
                Prairie vole  ============================
B D           Chinese hamster  ============================
B D                   Wallaby  ============================
B D                  Platypus  ============================
  D    Spiny softshell turtle  ============================
  D           Green seaturtle  ============================
B D                   Opossum  ============================
B D                   Dolphin  ============================

Alignment block 21 of 185 in window, 203868450 - 203868497, 48 bps 
B D                     Human  tcctggga-agag----t---ttttttgctatacaattc----------aa-ggt--------tttaagg
B D                     Chimp  tcctggga-agag----t---ttttttgctatacaattc----------aa-ggt--------tttaagg
B D                   Gorilla  tcctggga-agag--------ctttttgctatacaattc----------aa-ggt--------tttaagg
B D                 Orangutan  tcctggga-agag----t---ttctttgctatacaattc----------aa-ggt--------tttaagg
B D                    Gibbon  tcctggga-agag----t---ttctttgctatacaattc----------aa-ggt--------tttaagg
B D                    Rhesus  tcctggga-agag----t---ttctttgccacacaattc----------aa-ggt--------tttaagg
B D       Crab-eating macaque  tcctggga-agag----t---ttctttgccatacaattc----------aa-ggt--------tttaagg
B D                    Baboon  tcctggga-agag----t---ttctttgccatacagttc----------aa-ggt--------tttaagg
B D              Green monkey  tcctggga-agag----t---ttctttgccatacaattc----------aa-ggt--------tttaagg
B D                  Marmoset  tcctggga-agag----t---ttctttgctatacaattc----------aa-ggt--------tttaagg
B D           Squirrel monkey  tcctggga-agag----t---ttctttgctatacaattc----------aa-ggt--------tttaaaa
B D                  Bushbaby  tcatg-----------------cctttcctatacaattc----------ac-ggt--------tctaagg
           Chinese tree shrew  tcatggggtaaag----t---tttcttcctatataattc----------aa-gct--------tttaagg
B D                  Squirrel  ---tcaca-ggaagtgtt---tttttttctatataattc----------aa-agt--------tttaagg
               Golden hamster  ------ta-agaa----t---tttttccccattcacttt----------ac--tt--------tttgaga
B D                       Rat  ------ta-agaa----t---tctttcttcattcacttt----------aa-gtt--------tttgaga
B D            Naked mole-rat  -----ttg-tgga----a---ttcttttctatacaattc----------aa-ggc--------tttgagg
B D                Guinea pig  -------g-tgga----a---ttttttcctatacaattc----------aa-ggc--------gttcaga
                   Chinchilla  -----gta-tgga----a---tttttttccatacaattc----------aa-ggc--------tttgagg
             Brush-tailed rat  -----tta-tgga----a---ttcttttctatacaattc----------aagggc--------tttgagg
B D                    Rabbit  tcatagaa-agag----t---tcctttcctatacagttc----------aa-ggt--------tttaaca
B D                      Pika  tcacagga-agag----t---ttctttcctatacacctc----------aa-agt--------tttgaca
B D                       Pig  --ttgtgg-gaag----t---ttctttcctacccaattc----------ta-ggt--------tttaagg
B D                    Alpaca  --ttatgg-gaag----t---ttctttcctacccaattg----------aa-ggt--------tttaagg
               Bactrian camel  --ttatgg-gaag----t---ttccttcctacccaattg----------aa-ggt--------tttaagg
                 Killer whale  --ttatgg-gaag----t---ttctttcctacccaattc----------aa-ggt--------tttaagg
             Tibetan antelope  --ttatga-gatg----t---ttctttccta-tcaattc----------ga-ggt--------tttaagg
B D                       Cow  --ttatga-gata----t---ttctttctta-tcaa-tc----------aa-ggt--------tttaagg
B D                     Sheep  --ttatga-gatg----t---ttctttccta-tcaattc----------aa-ggt--------tttaagg
                Domestic goat  --ttatga-gatg----t---ttctttccta-tcaattc----------aa-ggt--------tttaagg
B D                     Horse  --tcatga-gaag----t---ttctttcctaccggtttc----------aa-ggt--------tttaagg
B D          White rhinoceros  --tcatgg-gaag----t---ttctttcttacctaattc----------ag-tgt--------tttaagg
B D                       Cat  --acatat-caag----t---ttctttcctacccgattt----------ga-gat--------tttaaga
B D                       Dog  --tcat-t-taag----t---ttctttcctacccaattt----------aa-gat--------tttaaga
B D                   Ferret   --tcatat-taag----c---ttctttcctaccttattt----------aa-gat--------tttaaga
B D                     Panda  --tcatat-aaag----t---ttctttcccacccaattt----------aa-gat--------tttaaga
               Pacific walrus  --tcatat-aaag----t---tcctttcctacccaattt----------aa-gat--------tttaaga
                 Weddell seal  --tcatat-aaag----t---ttctttcctacccaattt----------ac-gat--------tttaaga
             Black flying-fox  --tcatgg-gaag----c---ttctttcctattcgattc----------aa-ggt--------tttacag
B D                   Megabat  --tcatgg-gaag----c---ttctttcctattcgattc----------aa-cgt--------tttacag
                Big brown bat  --tcatgg-aaag----tttcttcttccctgcccaactc----------aa-ggt--------tttaagg
         David's myotis (bat)  --tcatgg-aaag----t---ttcttccctgcccgactc----------aa-ggt--------cttaagg
B D                  Microbat  --tcatgg-aaag----t---ttcttccctgcccgactc----------aa-ggt--------cttaagg
B D                  Hedgehog  -----------------------ctttcatacttaactc----------aa-aactaaaaagtcttaagt
B D                     Shrew  --t---ca-tagg----t---tgctttcctacctaattc----------aa-ggc--------ttcaagg
              Star-nosed mole  --tgagta-gaag----t---ttctt-----cccaattc----------aa-gg---------tttaagg
B D                  Elephant  ccatgtaa-gt-g----t---ttctttcctatccaattc----------aa-gg---------tttaaga
          Cape elephant shrew  taatggaa-ctgg----t---ttatttaccacttaagtc----------aa-ga---------cacaaca
B D                   Manatee  ccatgtga-aagg----t---ttctttcctatccaattc----------aa-gg---------tttaaaa
             Cape golden mole  tcattggc---ag----t---ttctttcttacccaattc----------aa-gg---------tttaaga
B D                    Tenrec  tcatggga-agag----c---ttctctcatttccaattc----------aa-gg---------tctaaga
                     Aardvark  tcatagga-agag--------ttccttcctacccaattc----------aa-gg---------tttaagt
B D                 Armadillo  tcatggga-tgaa----t---ttctttcccatccacttc----------aa-ggt--------tttaaag
B D           Tasmanian devil  ---------------------tcatttaatcactgctct----------ag-agc--------tgcaaaa
  D    White-throated sparrow  ------------------------------agacagtgc----------ca-tcc--------catcatg
B D       Medium ground finch  ------------------------------agacagtgc----------ca-tcc--------cattgca
B D               Zebra finch  ------------------------------aaataatgctgagttttcaca-gct--------tactaaa
B D                    Turkey  ----------------------------------aatgc----------at-tcc--------cattgtg
B D                     Mouse  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
  D             Scarlet macaw  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Platypus  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================
      Lesser Egyptian jerboa  ----------------------------------------------------------------------
B D                   Dolphin  ======================================================================

                        Human  tcctc--------------------------
                        Chimp  tcctc--------------------------
                      Gorilla  tcctc--------------------------
                    Orangutan  tcctc--------------------------
                       Gibbon  tcctc--------------------------
                       Rhesus  tcctc--------------------------
          Crab-eating macaque  tcctc--------------------------
                       Baboon  tcctc--------------------------
                 Green monkey  tcctc--------------------------
                     Marmoset  tcctt--------------------------
              Squirrel monkey  tcctc--------------------------
                     Bushbaby  tcctc--------------------------
           Chinese tree shrew  tcctc--------------------------
                     Squirrel  tcttc--------------------------
               Golden hamster  ctctc--------------------------
                          Rat  cactc--------------------------
               Naked mole-rat  tgtgc--------------------------
                   Guinea pig  catgc--------------------------
                   Chinchilla  agtgc--------------------------
             Brush-tailed rat  tgtag--------------------------
                       Rabbit  tcctc--------------------------
                         Pika  tcctc--------------------------
                          Pig  tcctc--------------------------
                       Alpaca  tcctg--------------------------
               Bactrian camel  tcctg--------------------------
                 Killer whale  tcctc--------------------------
             Tibetan antelope  tcttc--------------------------
                          Cow  tcttc--------------------------
                        Sheep  tcttc--------------------------
                Domestic goat  tcttc--------------------------
                        Horse  ccctt--------------------------
             White rhinoceros  ccctt--------------------------
                          Cat  tcctc--------------------------
                          Dog  tcttc--------------------------
                      Ferret   ccttc--------------------------
                        Panda  ccttc--------------------------
               Pacific walrus  tcttc--------------------------
                 Weddell seal  ttttc--------------------------
             Black flying-fox  tcctc--------------------------
                      Megabat  tcctc--------------------------
                Big brown bat  ccctc--------------------------
         David's myotis (bat)  tcctc--------------------------
                     Microbat  tcctc--------------------------
                     Hedgehog  ttctt--------------------------
                        Shrew  gtctc--------------------------
              Star-nosed mole  ttctc--------------------------
                     Elephant  tcgtc--------------------------
          Cape elephant shrew  tcctc--------------------------
                      Manatee  tcttc--------------------------
             Cape golden mole  tcttt--------------------------
                       Tenrec  tcctc--------------------------
                     Aardvark  tcccc--------------------------
                    Armadillo  tcctc--------------------------
              Tasmanian devil  acacc--------------------------
       White-throated sparrow  -------------------tgtca--tgata
          Medium ground finch  --aaaag-----------ctatca---gtga
                  Zebra finch  gcaaaagacagtgccatcccatcatatgtca
                       Turkey  ttgaggaacagag------------------
                        Mouse  ===============================
             Peregrine falcon  ===============================
                 Saker falcon  ===============================
                       Parrot  ===============================
                   Budgerigar  ===============================
                  Rock pigeon  ===============================
                 Mallard duck  ===============================
     Chinese softshell turtle  ===============================
                      Chicken  ===============================
                X. tropicalis  ===============================
               Painted turtle  ===============================
          Collared flycatcher  ===============================
           American alligator  ===============================
           Tibetan ground jay  ===============================
                Scarlet macaw  ===============================
                 Prairie vole  ===============================
              Chinese hamster  ===============================
                      Wallaby  ===============================
                     Platypus  ===============================
       Spiny softshell turtle  ===============================
              Green seaturtle  ===============================
                      Opossum  ===============================
       Lesser Egyptian jerboa  -------------------------------
                      Dolphin  ===============================

Inserts between block 21 and 22 in window
              Golden hamster 647bp
B D                      Rat 706bp
B D          Tasmanian devil 20bp
B D              Zebra finch 1bp

Alignment block 22 of 185 in window, 203868498 - 203868520, 23 bps 
B D                     Human  ggattcatat----acttt-a-taaatga
B D                     Chimp  ggattcatat----acttt-a-taaatga
B D                   Gorilla  ggattcatat----acttt-a-taaacga
B D                 Orangutan  ggattcatat----acttt-a-taaatga
B D                    Gibbon  ggattcatat----acttt-a-taaacga
B D                    Rhesus  ggattcatat----gcttt-a-taaacga
B D       Crab-eating macaque  ggattcatat----gcttt-a-taaacga
B D                    Baboon  ggattcatat----gcttt-a-taaacga
B D              Green monkey  ggattcatat----gcttt-a-taaacga
B D                  Marmoset  ggattcatac----gcttt-a-taaacga
B D           Squirrel monkey  aaattcatat----gctttaa-taaacga
B D                  Bushbaby  taacttatta----atttt-a-tgaacaa
           Chinese tree shrew  taattaatta----gtttt-a-taaacta
B D                  Squirrel  caattcatta----atttt-a-tacgctg
B D            Naked mole-rat  tcattcatta----attct-a-taaacta
B D                Guinea pig  tcattcatta----attct-g-taaac--
                   Chinchilla  tcattcatta----attct-a-tgaactg
             Brush-tailed rat  tcatttgtta----attct-a-taaacta
B D                    Rabbit  --------taattcatttt-a-taaatga
B D                      Pika  --------ta----atttt-a-tcaatga
B D                       Pig  taattca-------ctttt-a-taaatga
B D                    Alpaca  taattca-------atttt-a-taaatga
               Bactrian camel  taattca-------atttt-a-taaatga
                 Killer whale  tgatcca-------ctttt-a-taaacgg
             Tibetan antelope  tgattca-------ttgtt-a-taaacga
B D                       Cow  tgattca-------ttttt-a-taaacaa
B D                     Sheep  tgattca-------ttttt-a-taaacaa
                Domestic goat  tgattca-------ttttt-a-taaacaa
B D                     Horse  aaattca-------ctttt-a-taaacta
B D          White rhinoceros  tagttca-------ctttt-a-taaacta
B D                       Cat  gagctca-------ctttt-a-taaatga
B D                       Dog  taattca-------ctttt-a-taaatga
B D                   Ferret   --------------acttt-a-taaacga
B D                     Panda  taattca-------ctttt-a-taaacaa
               Pacific walrus  taattca-------ctttt-a-taaacga
                 Weddell seal  taattca-------ctttt-a-taaatga
             Black flying-fox  taattca-------tgtct-a-taaactg
B D                   Megabat  taattca-------tgtct-a-taaactg
                Big brown bat  aaattca-------atttt-a-taaacca
         David's myotis (bat)  aaattca-------atttt-a-taaaccc
B D                  Microbat  aaattca-------atctt-a-taaacca
B D                  Hedgehog  tgattca-------ctttc-c-aaaaccg
B D                     Shrew  taat-----------tttt-a-taaaccc
              Star-nosed mole  taatt---------ctttt-t-taagcta
B D                  Elephant  taattca-------gtttt-a-caaacta
          Cape elephant shrew  taattta-------atttt-a-taaattt
B D                   Manatee  taattca-------gtttt-a-taaacta
             Cape golden mole  taattca-------acttt-a-gaaacta
B D                    Tenrec  taattca-------gtttc-ataaaactg
                     Aardvark  taattta-------ctttt-a-taaacta
B D                 Armadillo  tgaatct-------gtttt-a-taaactt
B D           Tasmanian devil  -accttc-------attta-a-cagatga
  D    White-throated sparrow  gaatatagaa----attgc-a-caaagct
B D       Medium ground finch  gattgtacat----ggtac-a-gtaattt
B D               Zebra finch  gattatagaa----attgc-a-aacaact
B D                    Turkey  ---tacagca----gttgt-a-caaaata
              Golden hamster  =============================
B D                       Rat  =============================
B D                     Mouse  =============================
  D          Peregrine falcon  =============================
  D              Saker falcon  =============================
  D                    Parrot  =============================
B D                Budgerigar  =============================
  D               Rock pigeon  =============================
  D              Mallard duck  =============================
  D  Chinese softshell turtle  =============================
B D                   Chicken  =============================
B D             X. tropicalis  =============================
  D            Painted turtle  =============================
  D       Collared flycatcher  =============================
B D        American alligator  =============================
          Tibetan ground jay  =============================
  D             Scarlet macaw  =============================
                Prairie vole  =============================
B D           Chinese hamster  =============================
B D                   Wallaby  =============================
B D                  Platypus  =============================
  D    Spiny softshell turtle  =============================
  D           Green seaturtle  =============================
B D                   Opossum  =============================
      Lesser Egyptian jerboa  -----------------------------
B D                   Dolphin  =============================

Inserts between block 22 and 23 in window
B D          Tasmanian devil 19bp

Alignment block 23 of 185 in window, 203868521 - 203868553, 33 bps 
B D                     Human  a-ttagccagc-----ttgt----------tt-aa-aatg-----------tag---------ggaaatt
B D                     Chimp  a-ttagccagc-----ttgt----------tt-aa-aatg-----------tag---------ggaaatt
B D                   Gorilla  a-ttagccagc-----ttgt----------tt-aa-aatg-----------tag---------ggaaatt
B D                 Orangutan  a-ttagccagc-----ttgt----------tt-aa-aatg-----------tag---------ggaaatt
B D                    Gibbon  a-ttagccagc-----ttgt----------tt-aa-aatg-----------tag---------ggaaatt
B D                    Rhesus  a-ttagccagc-----ctgt----------tt-aa-aatg-----------tag---------ggaaatc
B D       Crab-eating macaque  a-ttagccagc-----ctgt----------tt-aa-aatg-----------tag---------ggaaatc
B D                    Baboon  a-ttagccagc-----ctgt----------tt-aa-aatg-----------tag---------ggaaatc
B D              Green monkey  a-ttagccagc-----ctgt----------tt-aa-aatg-----------tag---------ggaaatc
B D                  Marmoset  a-ttagccagc-----ttgt----------tt-aa-aatt-----------tag---------ggaaatc
B D           Squirrel monkey  a-ttagccagc-----ttgt----------tt-aa-aatt-----------tag---------ggaaatc
B D                  Bushbaby  a-ttgtccagc-----ttgt----------tt-aa-gatt-----------gaa---------gcaaatc
           Chinese tree shrew  a-ttagcaa---------gt----------tt-aa-aatt-----------taa---------gtaaatt
B D                  Squirrel  a-ttagctaac-----tttt----------tt-aa-aatt-----------taa---------ggaaatt
B D            Naked mole-rat  g-ttggctaac-----ttgt----------tt-aa-aacc-----------tca---------gcaagtc
B D                Guinea pig  ---tagttaac-----ttgt----------tt-aa-aatc-----------tca---------tcaagtc
                   Chinchilla  g-ttagttaac-----ttgt----------at-aa-aatc-----------tca---------gcaagtc
             Brush-tailed rat  g-ttagttaac-----ttgt----------tt-aa-aatc-----------tga---------ataagtc
B D                    Rabbit  a-taagccagc-----ttgc----------tt-aa-aatt-----------taa---------ggaaatc
B D                      Pika  g-taagccagt-----ttgc----------tt-aa-aatt-----------taa---------ggagatc
B D                       Pig  a-ttagcctgc--------t----------tt-aa-aatt------------------------------
B D                    Alpaca  a-ttagtcagc-----ttgt----------tt-ag-aatt-----------tca----------------
               Bactrian camel  a-ttagccagc-----ttat----------tt-ag-aatt-----------tca----------------
B D                   Dolphin  a-tcagcctgc-----ttgt----------tt-aa-cttt------------ca----------------
                 Killer whale  g-ttagcctgc-----ttgt----------ttaaa-cact------------ca----------------
             Tibetan antelope  a-tgagcctgc-----ttgt----------tt-aa-catt-----------gca----------------
B D                       Cow  a-tgagcctgc-----ttgt----------tt-aa-catt-----------gcg----------------
B D                     Sheep  a-tgagcctgc-----ttgt----------tt-aa-cact-----------gca----------------
                Domestic goat  a-tgagcctgc-----ttgt----------tt-aa-catt-----------gca----------------
B D                     Horse  atttagccagc-----ttat----------tt-aa-aatc-----------taagcaaattgt-------
B D          White rhinoceros  a-ttaaccagc-----ttat----------tt-aa-aatt-----------taagaaaatctt-------
B D                       Cat  a-----tcggc-----ttat----------tt-aa-aatg-----------taa----------------
B D                       Dog  a-----tc-gc-----ttgt----------tt-aa-aatt-----------taa----------------
B D                   Ferret   a-----tcagc-----ttgt----------tt-aa-aatt-----------taa----------------
B D                     Panda  a-----tcagc-----ttgt----------tt-aa-aatg-----------tat----------------
               Pacific walrus  a-----tcagc-----ttgt----------tt-ag-aatt-----------taa----------------
                 Weddell seal  a-----tcagc-----ttgt----------tt-aa-aatt-----------taa----------------
             Black flying-fox  a-ttagccagc-----ttgt----------tt-aa-aatt-----------taa----------------
B D                   Megabat  a-ttagccagc-----ttgt----------tt-aa-aatt-----------taa----------------
                Big brown bat  a-ttagccagc-----ttgt----------tt-aa-aagt-----------caa----------------
         David's myotis (bat)  a-ttagccagc-----ttgt----------tt-aa-aatt-----------taa----------------
B D                  Microbat  a-ttagccagc-----ttgt----------tt-aa-aatg-----------taa----------------
B D                  Hedgehog  -tttaacccac-----ttgc----------tt-aacaatt-----------taagcaaatcat-------
B D                     Shrew  -actattaagc-----ttgt----------tt-aa-aatt-----------tgaataaatcat-------
              Star-nosed mole  -aacagacagg-----ttgt----------tt-aa-aatc-----------taagcaaataat-------
B D                  Elephant  a-ctatccaac-----ttgt----------tt-aa-aact-----------taa---------gcaaatc
          Cape elephant shrew  a-ccatccaac-----ttat----------tt-aa-aatg-----------taa---------ataaat-
B D                   Manatee  a-ctatccaac-----ttgt----------tt-aa-gact-----------taa---------gcaaatc
             Cape golden mole  a-ctatcccat-----ttgc----------tt-ag-aaat-----------ag-----------------
B D                    Tenrec  g-ttaatgaat-----catt----------tc-at-aaac-----------aaa---------ggcaatt
                     Aardvark  a-ctccccaac-----ttgt----------tt-aa-aact-----------taa---------gcaaatt
B D                 Armadillo  a-ttagccaac-----ttgt----------tt-aa-aact-----------taa---------gtca---
B D           Tasmanian devil  -gttaaatgac-----ttac----------tc-ag-tattacttgggaagtta-----------------
  D    White-throated sparrow  -gtcagtgagg-----ttgtaaatggtccagt-aa-tttc-----------c------------------
B D       Medium ground finch  -ccccttaagatttttttgcagtctgttcatc-ag-gttt-----------t------------------
B D               Zebra finch  -gtcagtgagg-----ttatacatggtacagt-aa-tctt-----------c------------------
B D                    Turkey  -gcctgtggag-----acatacatggtgtacc-aa-tttc-----------c------------------
              Golden hamster  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
  D             Scarlet macaw  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Platypus  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================
      Lesser Egyptian jerboa  ----------------------------------------------------------------------

                        Human  -g
                        Chimp  -g
                      Gorilla  -g
                    Orangutan  -g
                       Gibbon  -g
                       Rhesus  -a
          Crab-eating macaque  -a
                       Baboon  -a
                 Green monkey  -a
                     Marmoset  -g
              Squirrel monkey  -g
                     Bushbaby  -a
           Chinese tree shrew  -g
                     Squirrel  -t
               Naked mole-rat  -a
                   Guinea pig  -a
                   Chinchilla  -a
             Brush-tailed rat  aa
                       Rabbit  -a
                         Pika  -a
                          Pig  --
                       Alpaca  --
               Bactrian camel  --
                      Dolphin  --
                 Killer whale  --
             Tibetan antelope  --
                          Cow  --
                        Sheep  --
                Domestic goat  --
                        Horse  --
             White rhinoceros  --
                          Cat  --
                          Dog  --
                      Ferret   --
                        Panda  --
               Pacific walrus  --
                 Weddell seal  --
             Black flying-fox  --
                      Megabat  --
                Big brown bat  --
         David's myotis (bat)  --
                     Microbat  --
                     Hedgehog  --
                        Shrew  --
              Star-nosed mole  --
                     Elephant  a-
          Cape elephant shrew  --
                      Manatee  g-
             Cape golden mole  --
                       Tenrec  t-
                     Aardvark  a-
                    Armadillo  --
              Tasmanian devil  --
       White-throated sparrow  --
          Medium ground finch  --
                  Zebra finch  --
                       Turkey  --
               Golden hamster  ==
                          Rat  ==
                        Mouse  ==
             Peregrine falcon  ==
                 Saker falcon  ==
                       Parrot  ==
                   Budgerigar  ==
                  Rock pigeon  ==
                 Mallard duck  ==
     Chinese softshell turtle  ==
                      Chicken  ==
                X. tropicalis  ==
               Painted turtle  ==
          Collared flycatcher  ==
           American alligator  ==
           Tibetan ground jay  ==
                Scarlet macaw  ==
                 Prairie vole  ==
              Chinese hamster  ==
                      Wallaby  ==
                     Platypus  ==
       Spiny softshell turtle  ==
              Green seaturtle  ==
                      Opossum  ==
       Lesser Egyptian jerboa  --

Inserts between block 23 and 24 in window
B D                 Elephant 40bp
         Cape elephant shrew 10bp
B D                  Manatee 40bp
            Cape golden mole 26bp
B D                   Tenrec 45bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 24 of 185 in window, 203868554 - 203868554, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                      Pika  t
B D           Tasmanian devil  t
  D    White-throated sparrow  c
B D       Medium ground finch  g
B D               Zebra finch  c
B D                    Turkey  c
             Star-nosed mole  -
              Golden hamster  =
B D                  Hedgehog  -
B D                       Rat  =
B D                     Shrew  -
B D                     Mouse  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                Budgerigar  =
  D               Rock pigeon  =
  D              Mallard duck  =
  D  Chinese softshell turtle  =
B D                   Chicken  =
B D             X. tropicalis  =
  D            Painted turtle  =
  D       Collared flycatcher  =
B D        American alligator  =
          Tibetan ground jay  =
  D             Scarlet macaw  =
                Prairie vole  =
         Cape elephant shrew  =
B D           Chinese hamster  =
B D                     Panda  -
               Domestic goat  -
B D                     Sheep  -
B D                   Wallaby  =
B D                  Platypus  =
  D    Spiny softshell turtle  =
  D           Green seaturtle  =
B D                       Cow  -
            Tibetan antelope  -
B D                  Microbat  -
        David's myotis (bat)  -
               Big brown bat  -
            Black flying-fox  -
B D                   Megabat  -
B D                       Pig  -
B D                   Opossum  =
              Pacific walrus  -
B D                   Ferret   -
              Bactrian camel  -
B D                    Alpaca  -
B D                       Dog  -
      Lesser Egyptian jerboa  -
B D                    Tenrec  =
B D                 Armadillo  =
B D                       Cat  -
                    Aardvark  =
B D                  Elephant  =
B D                     Horse  -
                Weddell seal  -
B D          White rhinoceros  -
B D                   Manatee  =
                Killer whale  -
B D                   Dolphin  -
            Cape golden mole  =

Alignment block 25 of 185 in window, 203868555 - 203868564, 10 bps 
B D                     Human  gggaagaatg
B D                     Chimp  gggaagaatg
B D                   Gorilla  gggaagaatg
B D                 Orangutan  gggaagaatg
B D                    Gibbon  gggaagaatg
B D                    Rhesus  gggaagaatg
B D       Crab-eating macaque  gggaagaatg
B D                    Baboon  gggaagaatg
B D              Green monkey  gggaagaatg
B D                  Marmoset  gggaagaatg
B D           Squirrel monkey  gggaagaatg
B D                  Bushbaby  gggaagaatg
           Chinese tree shrew  gagaag-aca
B D                  Squirrel  gggaagaatg
       Lesser Egyptian jerboa  gagaggtaca
B D            Naked mole-rat  gggaagaatg
B D                Guinea pig  aggaagaacg
                   Chinchilla  gggaagaat-
             Brush-tailed rat  gggaagaatg
B D                    Rabbit  gctataaaca
B D                      Pika  gacatgaaca
B D                       Pig  ---------c
B D                    Alpaca  ---------g
               Bactrian camel  ---------g
B D                   Dolphin  ---------g
                 Killer whale  ---------g
             Tibetan antelope  ---------g
B D                       Cow  ---------g
B D                     Sheep  ---------g
                Domestic goat  ---------g
B D                     Horse  gggaagaatg
B D          White rhinoceros  gggaagaatg
B D                       Cat  ---------g
B D                       Dog  ---------g
B D                   Ferret   ---------a
B D                     Panda  ---------g
               Pacific walrus  ---------g
                 Weddell seal  ---------g
             Black flying-fox  ---------g
B D                   Megabat  ---------g
                Big brown bat  ---------g
         David's myotis (bat)  ---------g
B D                  Microbat  ---------g
B D                  Hedgehog  gggaagaa--
B D                     Shrew  -agaagaata
              Star-nosed mole  gggaagaatg
B D                  Elephant  gggaagagct
          Cape elephant shrew  -----aactt
B D                   Manatee  gagaa-----
                     Aardvark  gagaagaact
B D                 Armadillo  aagaagaatt
B D           Tasmanian devil  -atctgaatt
  D    White-throated sparrow  cttaagattt
B D       Medium ground finch  ttatgtgctg
B D               Zebra finch  cttaagattt
B D                    Turkey  cttaagattt
              Golden hamster  ==========
B D                       Rat  ==========
B D                     Mouse  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
  D                    Parrot  ==========
B D                Budgerigar  ==========
  D               Rock pigeon  ==========
  D              Mallard duck  ==========
  D  Chinese softshell turtle  ==========
B D                   Chicken  ==========
B D             X. tropicalis  ==========
  D            Painted turtle  ==========
  D       Collared flycatcher  ==========
B D        American alligator  ==========
          Tibetan ground jay  ==========
  D             Scarlet macaw  ==========
                Prairie vole  ==========
B D           Chinese hamster  ==========
B D                   Wallaby  ==========
B D                  Platypus  ==========
  D    Spiny softshell turtle  ==========
  D           Green seaturtle  ==========
B D                   Opossum  ==========
B D                    Tenrec  ==========
            Cape golden mole  ==========

Inserts between block 25 and 26 in window
B D           Naked mole-rat 118bp

Alignment block 26 of 185 in window, 203868565 - 203868572, 8 bps 
B D                     Human  cct-----tcttt-
B D                     Chimp  cct-----tcttt-
B D                   Gorilla  cct-----tcttt-
B D                 Orangutan  cct-----tcttt-
B D                    Gibbon  cct-----tcttt-
B D                    Rhesus  cct-----tcttt-
B D       Crab-eating macaque  cct-----tcttt-
B D                    Baboon  cct-----tcttt-
B D              Green monkey  cct-----tcttt-
B D                  Marmoset  gct-----tcttt-
B D           Squirrel monkey  gct-----tcttt-
B D                  Bushbaby  ctt-----tattt-
           Chinese tree shrew  cct-----tctga-
B D                  Squirrel  cct-----tcatt-
       Lesser Egyptian jerboa  cct-----ttctt-
B D            Naked mole-rat  cct-----tcttt-
B D                Guinea pig  cct-----tcttt-
                   Chinchilla  cct-----ttttt-
             Brush-tailed rat  cct-----tcctc-
B D                    Rabbit  cct-----tttaa-
B D                      Pika  cct-----tttaa-
B D                       Pig  ctt-----tcttt-
B D                    Alpaca  cct-----tcttt-
               Bactrian camel  cct-----tcttt-
B D                   Dolphin  cat-----tcttt-
                 Killer whale  cat-----tcttt-
             Tibetan antelope  cct-----tcttt-
B D                       Cow  cct-----tcttt-
B D                     Sheep  cct-----tcttt-
                Domestic goat  cct-----tcttt-
B D                     Horse  cct-----ttttt-
B D          White rhinoceros  cct-----ttttt-
B D                       Cat  cct-----tcttt-
B D                       Dog  cct-----tcttt-
B D                   Ferret   cct-----tcttt-
B D                     Panda  cct-----tctct-
               Pacific walrus  cct-----tcttt-
                 Weddell seal  cct-----tcttt-
             Black flying-fox  cct-----tcttt-
B D                   Megabat  cct-----tcttt-
                Big brown bat  cct-----tcttt-
         David's myotis (bat)  cct-----ta----
B D                  Microbat  cct-----tcttt-
B D                  Hedgehog  -at-----tcttt-
B D                     Shrew  tta-----tattt-
              Star-nosed mole  cct-----tcttt-
B D                  Elephant  cc------tcttt-
          Cape elephant shrew  ac------ttttt-
B D                   Manatee  ---------ccct-
                     Aardvark  cc------tcttt-
B D                 Armadillo  cct-----tcttt-
B D           Tasmanian devil  -ct-----gctcc-
  D    White-throated sparrow  -tt-----ttttct
B D       Medium ground finch  -tt-----acatta
B D               Zebra finch  -tt-------tttt
B D                    Turkey  -gtgaagatttttt
              Golden hamster  ==============
B D                       Rat  ==============
B D                     Mouse  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
  D                    Parrot  ==============
B D                Budgerigar  ==============
  D               Rock pigeon  ==============
  D              Mallard duck  ==============
  D  Chinese softshell turtle  ==============
B D                   Chicken  ==============
B D             X. tropicalis  ==============
  D            Painted turtle  ==============
  D       Collared flycatcher  ==============
B D        American alligator  ==============
          Tibetan ground jay  ==============
  D             Scarlet macaw  ==============
                Prairie vole  ==============
B D           Chinese hamster  ==============
B D                   Wallaby  ==============
B D                  Platypus  ==============
  D    Spiny softshell turtle  ==============
  D           Green seaturtle  ==============
B D                   Opossum  ==============
B D                    Tenrec  ==============
            Cape golden mole  ==============

Inserts between block 26 and 27 in window
B D         White rhinoceros 264bp

Alignment block 27 of 185 in window, 203868573 - 203868594, 22 bps 
B D                     Human  --actt-aattca--aggtttta-aggt
B D                     Chimp  --actt-aattca--aggtttta-aggt
B D                   Gorilla  --actt-aattca--aggtttta-aggt
B D                 Orangutan  --actt-aattca--aggtttta-agtt
B D                    Gibbon  --acct-aattca--aggtttta-aggt
B D                    Rhesus  --actt-aattca--aggtttta-aggt
B D       Crab-eating macaque  --actt-aattca--aggtttta-aggt
B D                    Baboon  --actt-aattca--aggtttta-aggt
B D              Green monkey  --actt-aattca--aggtttta-aggt
B D                  Marmoset  --actc-aattca--agatttta-aggt
B D           Squirrel monkey  --agtc-aattca--agatttta-aggt
B D                  Bushbaby  --actc-aattca--aggtttga-a--t
           Chinese tree shrew  --gttc-gattca--aggtttta-aggt
B D                  Squirrel  --attc-aattca--aggtccta-aagc
       Lesser Egyptian jerboa  --actc-agttca--aggtttta-aagt
B D            Naked mole-rat  --attc-cattca--aagtttta-agct
B D                Guinea pig  --attc-cattca--aggtttta-aatt
                   Chinchilla  --attc-cattca--aggtttta-aact
             Brush-tailed rat  --attc-ctttca--agatttta-aact
B D                    Rabbit  --agct-aattca--aggttctg-aagg
B D                      Pika  --attt-aattca--aggttttg-aagg
B D                       Pig  --actc-aattca--aggtttta-agtt
B D                    Alpaca  --actc-aatcca--aa--tttt-aagt
               Bactrian camel  --actc-aatcca--ga--tttt-aagt
B D                   Dolphin  --actc-aatgca--gggtttta-gggt
                 Killer whale  --actc-aatgca--gggtttta-gggt
             Tibetan antelope  --actc-aatgca--aggttttc-agat
B D                       Cow  --actc-aatgca--aggtttta-agat
B D                     Sheep  --actc-aatgca--aggtttta-agat
                Domestic goat  --actc-aatgca--aggtttta-agat
B D                     Horse  --attc-aattca--atgcttta-aggt
B D          White rhinoceros  --cctc-aattca--atgtttta-aggt
B D                       Cat  --actc-aattca--aagtctta-aggt
B D                       Dog  --accc-ggttca--aagtttta-aggt
B D                   Ferret   --actc-aattca--aagtttta-aggt
B D                     Panda  --actc-aattca--aagtttta-aggt
               Pacific walrus  --actc-aattca--aagtttta-aggt
                 Weddell seal  --actc-aggtca--gagtttta-aggt
             Black flying-fox  --actc-aattca--aggtttta-agcc
B D                   Megabat  --actc-agtc----acgtttt--agcc
                Big brown bat  --actc-tagtca--agattttg-aggt
         David's myotis (bat)  --acttttattca--ggatttta-aggt
B D                  Microbat  --actcttattca--ggatttta-aggt
B D                  Hedgehog  --gctc-aataca--aggtttta-----
B D                     Shrew  --actc-aatcca--aggtttta-----
              Star-nosed mole  --atgc-aattca--aagttttaaaggt
B D                  Elephant  --gctt-gattca--aagtttta-aggt
          Cape elephant shrew  --tctc-aatacc--aagcatta-tgat
B D                   Manatee  --actc-aattca--aagtttta-aggt
             Cape golden mole  -----t-aatttg--aagttgca-aagt
                     Aardvark  --aatc-agttaa--aggtttta-aggt
B D                 Armadillo  --actc-aattca--atgtctta-aggt
B D           Tasmanian devil  --tcta-aattca--gaga---a-aggc
  D    White-throated sparrow  gcagtc-tgttcatcaggctttg-taat
B D       Medium ground finch  gc-----------ttggggtata-tg--
B D               Zebra finch  atagtc-tgctcatcaggctttg-ttgt
B D                    Turkey  gcagta-tgttcatcaggctttg-ccgt
              Golden hamster  ============================
B D                       Rat  ============================
B D                     Mouse  ============================
  D          Peregrine falcon  ============================
  D              Saker falcon  ============================
  D                    Parrot  ============================
B D                Budgerigar  ============================
  D               Rock pigeon  ============================
  D              Mallard duck  ============================
  D  Chinese softshell turtle  ============================
B D                   Chicken  ============================
B D             X. tropicalis  ============================
  D            Painted turtle  ============================
  D       Collared flycatcher  ============================
B D        American alligator  ============================
          Tibetan ground jay  ============================
  D             Scarlet macaw  ============================
                Prairie vole  ============================
B D           Chinese hamster  ============================
B D                   Wallaby  ============================
B D                  Platypus  ============================
  D    Spiny softshell turtle  ============================
  D           Green seaturtle  ============================
B D                   Opossum  ============================
B D                    Tenrec  ============================

Inserts between block 27 and 28 in window
          Chinese tree shrew 311bp
  D   White-throated sparrow 12bp
B D              Zebra finch 12bp
B D                   Turkey 14bp

Alignment block 28 of 185 in window, 203868595 - 203868616, 22 bps 
B D                     Human  tc---t-ctt----------aatcaattc----tactagc----------
B D                     Chimp  tc---t-c------------aatcaattc----tacaagc----------
B D                   Gorilla  tc---t-ctt----------aatcaattc----tacaagc----------
B D                 Orangutan  tc---t-ctt----------aatcaattc----tacaagc----------
B D                    Gibbon  tc---t-ctt----------aatcaattc----tacaagt----------
B D                    Rhesus  tc---t-ctt----------aatcaattc----tacaagc----------
B D       Crab-eating macaque  tc---t-ctt----------aatcaattc----tacaagc----------
B D                    Baboon  tc---t-ctt----------aatcaattc----tacaaac----------
B D              Green monkey  tc---t-ctt----------aatcaattc----tacaagc----------
B D                  Marmoset  tc---t-ctt----------aatcaattc----tacaaac----------
B D           Squirrel monkey  tt---t-ctt----------aatcatttc----tacaaac----------
B D                  Bushbaby  tc---tgctt----------aataaattc----tataaat----------
B D                  Squirrel  ag---a-tcc----------tgttgattt----tattaac----------
       Lesser Egyptian jerboa  cc---t-ctt----------aatcaattc----tgtaaac----------
B D            Naked mole-rat  cc---t-c--------------ttaatcc----tataaac----------
B D                Guinea pig  ca---t-t--------------ttaatcc----tatatac----------
                   Chinchilla  cc---t-c--------------ttaatcc----tatacac----------
             Brush-tailed rat  cc---t-t--------------ttaatcc----tttagac----------
B D                    Rabbit  ac---c-c--------------ttaatcagttctaaaagc----------
B D                      Pika  ac---t-c--------------ttaatta-----aaaaat----------
B D                       Pig  gc---t-ttt----------aatcacctc----tacaaac----------
B D                    Alpaca  cc---t-ctt----------aatgaactc----tgtaacc----------
               Bactrian camel  cc---t-ctt----------aatgaactc----tgtaacc----------
B D                   Dolphin  cc---t-ctt----------aatcaactc----ta---------------
                 Killer whale  cc---t-ctt----------aatcaactc----ta---------------
             Tibetan antelope  cc---a-ctg----------agtcaactg----tataaac----------
B D                       Cow  cc---a-ctt----------agtcaactc----tataaac----------
B D                     Sheep  cc---a-ctg----------agtcaactg----tataaac----------
                Domestic goat  cc---a-ctg----------agtcaactg----tataaac----------
B D                     Horse  ct---t-ctt----------aataaattc----tatatag----------
B D          White rhinoceros  ct---t-ctt----------aatcaattc----tatatac----------
B D                       Cat  ct---t-c------------agtcaattc----tataaac----------
B D                       Dog  cc---t-c------------agtcaattc----tataaaa----------
B D                   Ferret   cc---t-c------------agtcaattc----tataaac----------
B D                     Panda  cc---t-c------------ggtcaattc----tataaac----------
               Pacific walrus  ac---t-c------------agtcaattc----tataaac----------
                 Weddell seal  ac---t-c------------agtcaattc----tataaac----------
             Black flying-fox  cc---t-ctt----------aatcaattc----tataaac----------
B D                   Megabat  cc---t-ctt----------a--tcattc----tataaac----------
                Big brown bat  cc---t-ctt----------aatcaactc----tgtaaac----------
         David's myotis (bat)  cc---t-ctg----------aatcaactc----tgtaaac----------
B D                  Microbat  cc---t-ctg----------aatcaactc----tgtaaac----------
B D                  Hedgehog  aa---t-ttc----------tcttacttt----tataaac----------
B D                     Shrew  -------ttc----------tattcattc----tataact----------
              Star-nosed mole  ca---t-ctt----------aatcaattt----tataatt----------
B D                  Elephant  tc---t-gtt----------tatcaagtc----tataaac----------
          Cape elephant shrew  ---------------------------cc----tacaaat----------
B D                   Manatee  cc---t-gtt----------actcaattc----tataaac----------
             Cape golden mole  -------------------------------------aac----------
                     Aardvark  cc---t-att----------agctaattc----tattaac----------
B D                 Armadillo  cctctt-att----------aatcaattc----tataaac----------
B D           Tasmanian devil  tc---t-tttcaccatcatctgttattgc----tgttagc----------
  D    White-throated sparrow  -----------------------tagctt----gggaaatatattgttgc
B D       Medium ground finch  -------------------------------------------ttgttgc
B D               Zebra finch  -----------------------tagctt----ggggtatatattgttgc
B D                    Turkey  -----------------------tagctt----agaacatacatc-ttgc
              Golden hamster  ==================================================
B D                       Rat  ==================================================
B D                     Mouse  ==================================================
  D          Peregrine falcon  ==================================================
  D              Saker falcon  ==================================================
  D                    Parrot  ==================================================
B D                Budgerigar  ==================================================
  D               Rock pigeon  ==================================================
  D              Mallard duck  ==================================================
  D  Chinese softshell turtle  ==================================================
B D                   Chicken  ==================================================
B D             X. tropicalis  ==================================================
  D            Painted turtle  ==================================================
  D       Collared flycatcher  ==================================================
B D        American alligator  ==================================================
          Tibetan ground jay  ==================================================
  D             Scarlet macaw  ==================================================
                Prairie vole  ==================================================
B D           Chinese hamster  ==================================================
B D                   Wallaby  ==================================================
B D                  Platypus  ==================================================
  D    Spiny softshell turtle  ==================================================
  D           Green seaturtle  ==================================================
          Chinese tree shrew  ==================================================
B D                   Opossum  ==================================================
B D                    Tenrec  ==================================================

Inserts between block 28 and 29 in window
B D          Squirrel monkey 8bp
B D                  Megabat 135bp
B D          Tasmanian devil 2bp

Alignment block 29 of 185 in window, 203868617 - 203868627, 11 bps 
B D                     Human  taattagc-------------------caa
B D                     Chimp  taattagc-------------------caa
B D                   Gorilla  taattagc-------------------caa
B D                 Orangutan  taattagc-------------------caa
B D                    Gibbon  taattagc-------------------caa
B D                    Rhesus  taattagc-------------------caa
B D       Crab-eating macaque  taattagc-------------------caa
B D                    Baboon  taattagc-------------------caa
B D              Green monkey  taattagc-------------------caa
B D                  Marmoset  caattagt-------------------caa
B D           Squirrel monkey  caattagt-------------------caa
B D                  Bushbaby  tagctagc-------------------taa
B D                  Squirrel  cagttagc-------------------caa
       Lesser Egyptian jerboa  ttgttagc-------------------taa
B D            Naked mole-rat  tagttagc-------------------taa
B D                Guinea pig  tagtttgt-------------------caa
                   Chinchilla  tagttagc-------------------caa
             Brush-tailed rat  tagttagctggtgcatgcctgtaatctcag
B D                    Rabbit  aagttagc-------------------caa
B D                      Pika  gagttatc-------------------cac
B D                       Pig  taattagc-------------------taa
B D                    Alpaca  tagttagc-------------------taa
               Bactrian camel  tagttagt-------------------taa
B D                   Dolphin  tagttagc-------------------taa
                 Killer whale  tagttagc-------------------taa
             Tibetan antelope  tagttagctag----------------taa
B D                       Cow  tagttagctag----------------taa
B D                     Sheep  tagttagctag----------------taa
                Domestic goat  tagttagctag----------------taa
B D                     Horse  tagttagt-------------------taa
B D          White rhinoceros  tagttagc-------------------taa
B D                       Cat  tagttagc-------------------taa
B D                       Dog  tagttggc-------------------taa
B D                   Ferret   tagttagt-------------------taa
B D                     Panda  taattagc-------------------taa
               Pacific walrus  tagttagc-------------------taa
                 Weddell seal  tagttagc-------------------taa
             Black flying-fox  tagttagc-------------------taa
B D                   Megabat  tagttagc-------------------taa
                Big brown bat  tacttagc-------------------taa
         David's myotis (bat)  tatttagc-------------------taa
B D                  Microbat  tatttagc-------------------taa
B D                  Hedgehog  caattagc-------------------taa
B D                     Shrew  taactagc-------------------tga
              Star-nosed mole  taattaac-------------------taa
B D                  Elephant  tagttaac-------------------caa
          Cape elephant shrew  aagttaaa-------------------gaa
B D                   Manatee  tagttaac-------------------gaa
             Cape golden mole  aagagg------------------------
                     Aardvark  tacctaat-------------------gaa
B D                 Armadillo  tggttagc-------------------caa
B D           Tasmanian devil  caaatggc-------------------caa
  D    White-throated sparrow  tgtgtata-------------------ctg
B D       Medium ground finch  tgtgtata-------------------cta
B D                    Turkey  ----tatc-------------------cag
              Golden hamster  ==============================
B D                       Rat  ==============================
B D                     Mouse  ==============================
  D          Peregrine falcon  ==============================
  D              Saker falcon  ==============================
  D                    Parrot  ==============================
B D                Budgerigar  ==============================
  D               Rock pigeon  ==============================
  D              Mallard duck  ==============================
  D  Chinese softshell turtle  ==============================
B D                   Chicken  ==============================
B D             X. tropicalis  ==============================
  D            Painted turtle  ==============================
B D               Zebra finch  ------------------------------
  D       Collared flycatcher  ==============================
B D        American alligator  ==============================
          Tibetan ground jay  ==============================
  D             Scarlet macaw  ==============================
                Prairie vole  ==============================
B D           Chinese hamster  ==============================
B D                   Wallaby  ==============================
B D                  Platypus  ==============================
  D    Spiny softshell turtle  ==============================
  D           Green seaturtle  ==============================
          Chinese tree shrew  ==============================
B D                   Opossum  ==============================
B D                    Tenrec  ==============================

Inserts between block 29 and 30 in window
            Cape golden mole 4bp

Alignment block 30 of 185 in window, 203868628 - 203868633, 6 bps 
B D                     Human  t-------tat-tt
B D                     Chimp  t-------tat-tt
B D                   Gorilla  t-------tat-tt
B D                 Orangutan  t-------tat-tt
B D                    Gibbon  t-------tat-tt
B D                    Rhesus  t-------tat-at
B D       Crab-eating macaque  t-------tat-at
B D                    Baboon  t-------tat-at
B D              Green monkey  t-------tat-tt
B D                  Marmoset  t-------tat-tt
B D           Squirrel monkey  t-------tat-tt
B D                  Bushbaby  t-------tgt-tt
           Chinese tree shrew  t-------tgt-tt
B D                  Squirrel  t-------tat-tt
       Lesser Egyptian jerboa  t-------ttc-tt
B D            Naked mole-rat  t-------tat-ta
B D                Guinea pig  c-------tat-tt
                   Chinchilla  t-------tat-tt
             Brush-tailed rat  c-------tct-tg
B D                    Rabbit  t-------tat-tt
B D                      Pika  t-------tat-tc
B D                       Pig  t-------tat-tt
B D                    Alpaca  t-------tat-tt
               Bactrian camel  t-------tat-tt
B D                   Dolphin  t-------tat-tt
                 Killer whale  t-------tat-tt
             Tibetan antelope  t-------tat-tt
B D                       Cow  t-------tat-tt
B D                     Sheep  t-------tat-tt
                Domestic goat  t-------tat-tt
B D                     Horse  t-------tat-cg
B D          White rhinoceros  t-------tat-tt
B D                       Cat  t-------tat-tt
B D                       Dog  t-------tac-tt
B D                   Ferret   t-------tacttt
B D                     Panda  t-------tac-tt
               Pacific walrus  t-------tac-tt
                 Weddell seal  t-------tac-tt
             Black flying-fox  t-------tac-tt
B D                   Megabat  t-------tac-tt
                Big brown bat  c-------t-----
         David's myotis (bat)  t-------t-----
B D                  Microbat  t-------t-----
B D                  Hedgehog  t-------tgt-tt
B D                     Shrew  tta-----tat-tt
              Star-nosed mole  t-------tat-tt
B D                  Elephant  t-------tac-tt
          Cape elephant shrew  t-------tac-tc
B D                   Manatee  t-------tac-tt
                     Aardvark  t-------gac-tt
B D                 Armadillo  t-------ttt-tt
B D           Tasmanian devil  --gtacagtgc-tc
  D    White-throated sparrow  t-------ggc-tt
B D       Medium ground finch  t-------ggc-tt
B D                    Turkey  t-------gac-tt
              Golden hamster  ==============
B D                       Rat  ==============
B D                     Mouse  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
  D                    Parrot  ==============
B D                Budgerigar  ==============
  D               Rock pigeon  ==============
  D              Mallard duck  ==============
  D  Chinese softshell turtle  ==============
B D                   Chicken  ==============
B D             X. tropicalis  ==============
  D            Painted turtle  ==============
B D               Zebra finch  --------------
  D       Collared flycatcher  ==============
B D        American alligator  ==============
          Tibetan ground jay  ==============
  D             Scarlet macaw  ==============
                Prairie vole  ==============
B D           Chinese hamster  ==============
B D                   Wallaby  ==============
B D                  Platypus  ==============
  D    Spiny softshell turtle  ==============
  D           Green seaturtle  ==============
B D                   Opossum  ==============
B D                    Tenrec  ==============
            Cape golden mole  ==============

Inserts between block 30 and 31 in window
B D          Squirrel monkey 1bp
B D                 Bushbaby 1bp
B D                 Squirrel 31bp
      Lesser Egyptian jerboa 1015bp
B D                   Rabbit 1bp
B D                     Pika 1bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                 Hedgehog 1bp
B D                    Shrew 1bp
             Star-nosed mole 1bp
B D                 Elephant 38bp
         Cape elephant shrew 183bp
B D                  Manatee 38bp
                    Aardvark 35bp
B D                Armadillo 5bp
B D          Tasmanian devil 1bp

Alignment block 31 of 185 in window, 203868634 - 203868639, 6 bps 
B D                     Human  aaaaat-
B D                     Chimp  aaaaat-
B D                   Gorilla  aaaaat-
B D                 Orangutan  aaaaat-
B D                    Gibbon  aaaaat-
B D                    Rhesus  aaaaat-
B D       Crab-eating macaque  aaaaat-
B D                    Baboon  aaaaat-
B D              Green monkey  aaaaat-
B D                  Marmoset  aaaaac-
B D           Squirrel monkey  aaaaac-
B D                  Bushbaby  aaaagt-
           Chinese tree shrew  aaaatg-
B D                  Squirrel  ataaat-
               Golden hamster  aagaat-
B D            Naked mole-rat  agaaaa-
B D                Guinea pig  aaaaaa-
                   Chinchilla  aaaaaa-
             Brush-tailed rat  agaggc-
B D                    Rabbit  taaaat-
B D                      Pika  gaaaat-
B D                       Pig  aaaaa--
B D                    Alpaca  taaaa--
               Bactrian camel  taaaa--
B D                   Dolphin  aaaaa--
                 Killer whale  aaaaa--
             Tibetan antelope  taaaa--
B D                       Cow  taaaa--
B D                     Sheep  taaaa--
                Domestic goat  taaaa--
B D                     Horse  aaaaa--
B D          White rhinoceros  aaaaa--
B D                       Cat  aaaaa--
B D                       Dog  aaaag--
B D                   Ferret   aaaaa--
B D                     Panda  aaaaa--
               Pacific walrus  aaaaa--
                 Weddell seal  aaaaa--
             Black flying-fox  aaaaa--
B D                   Megabat  aaaaa--
                Big brown bat  aaaaa--
         David's myotis (bat)  aagaa--
B