Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 21 in window, 157589226 - 157589322, 97 bps 
B D                     Human  gtcctctaactgacctttccc-----------aaaatcgaatcct---gtctaaaagc-tgta---acct
B D                     Chimp  gtcctctaaatgacctttccc-----------aaaatcgaatcct---gtctaaaagc-tgta---acct
B D                   Gorilla  gtcctctaactgacctttccc-----------aaaatcgaatcct---gtctaaaagc-tgta---acct
B D                 Orangutan  gtcctctgactgacctttccc-----------aaaattgaatcct---gtctaaaagc-tgta---acct
B D                    Gibbon  gtcctctaactgacctttccc-----------aaaatcgaatccc---gtctaaaagc-tgta---acct
B D                    Rhesus  gtcctctatctgacctttccc-----------caaatcgaatcct---gtctaaaagc-tgaa---acct
B D       Crab-eating macaque  gtcctctatctgacctttccc-----------caaatcgaatcct---gtctaaaagc-tgaa---acct
B D                    Baboon  gtcctctatctgacctttccc-----------caaatcgaatcct---gtctaaaagc-tgaa---acct
B D              Green monkey  gtcctctatctgacctttccc-----------aaaatcgaatcct---gtctaaaagc-tgaa---acct
B D                  Marmoset  gtcctctaactgacctttccc-----------aaaatccaatcct---gtctagaagc-tgaa---acct
B D           Squirrel monkey  gtcctctaactgacctttccc-----------aaaatcgaatcct---gtctagaagc-tgaa---acct
B D                  Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  gtcctccaagtgacctttccc------------aaatcgaattctta-gtctacaagc-tgta---acat
B D                  Squirrel  gtcctctcactgaccttcccc------------aaatcaagtcctggtttctaaaagc-cgta---acct
       Lesser Egyptian jerboa  gtcctccaaatgaccttactc-----------aaaatcaagtcctga-gtctaagagc-tgta---acac
                 Prairie vole  gccctctagctgaccttttcc------------aaatcaagtcctga-gtctgaaagt-tgta---accc
B D           Chinese hamster  gtcctctagttgacctttccc------------aaatcaagtcctaa-gtctgaaagc-tgta---accc
               Golden hamster  gtcctctagctgacctttccc------------aaatcaagtcctga-gtctgaaagc-tgta---accc
B D                     Mouse  gtcctctaactgacctttccc------------aaatcaagtcctca-gtctgaaa-c-tgta---acct
B D                       Rat  gtcctttaaatgacctttccc------------aaatcaagtcctta-gtctgaaagc-tgta---accc
B D            Naked mole-rat  gtcctctaactgaccttttcc-----------aaaatcaagtcccaa-gtctataagc-tgta---acct
B D                Guinea pig  gtcctccaactgaccttttcc-----------aaaatcaagtcctta-gtctaaaagc-tgta---actt
                   Chinchilla  gtcctctaactgacctttccc-----------aaaatcaagttccga-gtctaaaagc-tgta---accc
             Brush-tailed rat  gtcctctaattgacctttccc-----------aaaatcaagttctga-gtctaaaagc-tgta---acct
B D                    Rabbit  gtcctctaactgacctttccc-----------aaaatcgaatcctga-gtctaaaagc-tgta---acct
B D                      Pika  gtcctccaactgacccttccc-----------aaaatcgaatcctgt-gtctaaaagc-tgta---acct
B D                       Pig  gtcctccaggtgacctttccc-----------aaaatcgaatcctga-gtctaaaagc-tgta---acct
B D                    Alpaca  gtcctccaaatgacctttccc-----------aaagtcgaatcctga-gtctaaaagc-tgta---acct
               Bactrian camel  gtcctctaaatgacctttccc-----------aaagttgaatcctga-gtctaaaagc-tgta---acct
B D                   Dolphin  gtcctccaactgacctttccc-----------aaaatcgaatcctga-gtcgaaaagc-tgta---acct
                 Killer whale  gtcctccaactgacctttccc-----------aaaatcgaatcctga-gtcgaaaagc-tgta---a-ct
             Tibetan antelope  gtcctccagctgaccttttcc-----------aaaatcgaatccgga-gtctaaaagc-tgta---acct
B D                       Cow  gtcctccagctgaccttttcc-----------aaaatcgaatcccga-gtctaaaagc-tgta---acct
B D                     Sheep  gtcctccagctgaccttttcc-----------aaagtcgaatccgga-gtctaaaagc-tgta---acct
                Domestic goat  gtcctccagctgaccttttcc-----------aaagtcaaatccgga-gtctaaaagc-tgta---acct
B D                     Horse  gtcctccaactgacctttccc-----------caaatcgaatcctga-gtctaaaagc-tgta---acct
B D          White rhinoceros  gtcctccaactgacctttccc-----------aaaatcgaatcttga-gtctaaaagc-tgta---acct
B D                       Cat  gtcctccaaatgacctttccc-----------aaaatcaaatcctga-atctgaaagc-tgta---acct
B D                       Dog  gtcctccaaacgacctttccc-----------caaatccaatcccca-gcccaagagc-tgta---acct
B D                   Ferret   gtcctcccaatgacctttacc-----------aaaatcgaatgctga-atctaaaagc-tgta---acct
B D                     Panda  gtcctcccaatgacctttccc-----------aaaatcgaatcctga-atctaaaagc-tgta---acct
               Pacific walrus  gtcctcccaatgtcctttccc-----------aaaatcgaatcctga-atctaaaagc-tgta---acct
                 Weddell seal  gtcctcccagtgacc-ttccc-----------aaaatcaaatcctga-atctaaaagc-tgta---acct
             Black flying-fox  gtcctccagctgacctttgcc-----------aaaatggaatcctga-gtctgaaagc-tgta---acct
B D                   Megabat  gtcctccagctgacctttccc-----------aaaatggaatcctga-gtctaaaagc-tgta---acct
                Big brown bat  gtcctccaattgaccttcccc-----------caaacggaatcctgc-gtctaaaagc-tgta---acct
         David's myotis (bat)  gtcctccaactgaccttcccc-----------caaatggaatcctgc-gtctaaaagc-tgta---acct
B D                  Microbat  gtcctccaactgaccttcccc-----------caaatggaatcctgc-gtctaaaagc-tgta---acct
B D                  Hedgehog  gtcctccaactgaactcccccctcaaggaaaaaaaaaagaatcccga-gacagaaagt-tgta---attg
              Star-nosed mole  gtcctccaaatgacctttccc-----------aaaatcaaatcctga-gactaaaagc-tgta---acct
B D                  Elephant  gctccccaggtgacctttccc-----------caaatcgaatcctga-gtctaaaagc-cgta---acct
          Cape elephant shrew  gtcccccgaatgacctttccc-----------aaaatcgaatcctga-gtctaaaagc-tgta---acct
B D                   Manatee  gtcccccagctgacctttccc-----------aaaattgagtcctga-gtctcaaagc-gata---actt
             Cape golden mole  gtcccccaactgacctttccc-----------aaaatcgagtcctga-gtctaaaagc-tgta---accc
B D                    Tenrec  gtcccccagctgacctttccc-----------aaaatcgaatcctga-gtctaaaagc-tgta---acct
                     Aardvark  gtcccccaactgacctttccc-----------aaaatcgaatcctgt-gtctgaaagc-tgta---acct
B D                 Armadillo  gtcctccaactgacctttccc-----------aaaatcgaatcctga-gtctaaaagcatgta---acct
B D                   Opossum  gccctgcatttacccttctcc-----------aaaagagaaccacaa-attt--aacc-tgaa---attt
B D           Tasmanian devil  gtccctcactcagccttctcc-----------aagtggag--------------aacc-tgta---atct
B D                   Wallaby  gtccctcacttacccttctcc-----------aaaaggag--------------aacc-tgta---attc
  D              Mallard duck  gactttc--ttttcctctcca-----------cagctggaaacataa-aactgccagtatttatttacca
B D        American alligator  gacattt--ttggccttc----------------actgaaaacataa-aactgccagtatttatttacca
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                  Platypus  ======================================================================
B D                    Lizard  ======================================================================
B D       Medium ground finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Saker falcon  ======================================================================
  D           Green seaturtle  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================

                        Human  aaaa-----ccc-a----gaatcattggccttaaagaagttttcccaag---agaatt
                        Chimp  aaaa-----ccc-a----gaatcattggccttaaagaagttttcccaag---agaatt
                      Gorilla  aaaa-----ccc-a----gaatcattggccttaaagaagttttcccaag---agaatt
                    Orangutan  aaaa-----ccc-a----gaatcattggccttaaagaagttttcccaag---agaatt
                       Gibbon  aaaa-----ccc-a----gaatcactggccttaaagaagttttcccaag---agaatt
                       Rhesus  aaaa-----ccc-a----gaatcattggtcttaaagaggttttcccaag---ataatt
          Crab-eating macaque  aaaa-----ccc-a----gaatcattggtcttaaagaggttttcccaag---ataatt
                       Baboon  aaaa-----ccc-a----gaatcactggtcttaaagaggttttcccaag---ataatt
                 Green monkey  aaaa-----ccc-a----gaatcattggtcttaaagaggttttcccaag---ataatt
                     Marmoset  aaaa-----cct-a----taatcattggccttaaagaagttttcccaag---agaatt
              Squirrel monkey  aaaa-----cct-a----taatcattggccttaaagaagttttcccaag---agaatt
                     Bushbaby  -------------------aatcattgatcttaaagaagtttccctggg---agaatt
           Chinese tree shrew  aaaa-----ccc-c----caatcactggccttaaagaagtttcccagag---agaatt
                     Squirrel  -aaa-----ccc-c----aaatcacc-----------agtttccccgag---agaatg
       Lesser Egyptian jerboa  aaaa-----ccc-c----aaatcactggccttagagaagtttccctgag---agaatt
                 Prairie vole  aaaa-----ccc-c----aaatcactggccttcgagaagtttccctgag---agaatc
              Chinese hamster  aaaa-----ccc-c----aaatcactggccttcgagaagtttccctgag---agaatc
               Golden hamster  aaaa-----ccc-c----aaatcactggccttcgagaagtttccctgag---agaatc
                        Mouse  aaaa-----ccc-c----aaatcactggccttagagaagtttccctgag---agaatc
                          Rat  aaaa-----ccc-c----aaatcactggccttagagaagtttccctgag---agaatc
               Naked mole-rat  aaaa-----ccc-a----aaatcattggccttaaagaaatttccttgag---agaatt
                   Guinea pig  aaaa-----ccc-a----aaatcattggccttaaagaaatttccttgag---agaatt
                   Chinchilla  aaaa-----ctc-a----aaatcattggccttaaagaaatttccttgag---agaatt
             Brush-tailed rat  aaaa-----ccc-a----aaatcaatggacttaaagaaatttccttgag---agaatt
                       Rabbit  aaaa-----cct-c----aaatcattggccttaaagaagtttccctgag---agaatt
                         Pika  aaaa-----cct-c----aaatcattggccttaacgaaatctccctgag---agaatt
                          Pig  aaaa-----cccaa----aaatcactggccttaaggaagttttcctgag---agaatt
                       Alpaca  aaaa-----ccc-a----aaatcattggccttaaagaaatttccctgag---agaatt
               Bactrian camel  aaaa-----ccc-a----aaatcattggccttaaagaaatttccctgag---agaatt
                      Dolphin  aaaa-----ccc-c----aaatcattggccttaaagaagtttccctgag---agaatt
                 Killer whale  aaaa-----ccc-c----aaatcattggccttaaagaagtttccctgag---agaatt
             Tibetan antelope  aaaa-----ccc-a----aaatcattggccttaaagaagcttccctgag---agaatt
                          Cow  aaaa-----ccc-a----aaatcattggccttaaagaagtttccctgag---agaatt
                        Sheep  aaaa-----ccc-c----aaatcattggccttaaagaagcttccctgag---agaatt
                Domestic goat  aaaa-----ccc-a----aaatcattggccttaaagaagcttccctgag---agaatt
                        Horse  aaaa-----ccc-a----aaatcactggccttaaggaaatttccctgag---agaatt
             White rhinoceros  aaaa-----ccc-c----aagtcattggccttaaagaagtttccttgagagaagaatt
                          Cat  aaaa-----ccc-c----caatca-tggccttaaaaaagtttcccggag---agaatt
                          Dog  aaaa-----ccc-c----caatca-tggccttaaagaagttccccagag---agaatc
                      Ferret   aaaa-----ccc-c----caatca-tggccttaaagaagtttcccagag---agaacg
                        Panda  aaaa-----ccc-c----caatca-tggccttaaagaagtttcccagag---agaatt
               Pacific walrus  aaaa-----ccc-c----caatca-tggccttaaagaagtttcccagag---agaatt
                 Weddell seal  aaaa-----ccc-c----caatca-tggccttaaagaagtttcccagag---agaatt
             Black flying-fox  aaaa-----ccc------aaatca-tggccttaaagaagtctccccgag---agaatt
                      Megabat  aaaa-----ccc------aaatca-tggccttaaagaagtctccccgag---agaatt
                Big brown bat  aaaa-----ccc------aaatca-tggccttaaagaagtttccctgag---agtatt
         David's myotis (bat)  aaaa-----ccc------aaatca-tggccttaaagaagtttccctgag---agaatt
                     Microbat  aaaa-----ccc------aaatca-tggccttaaagaagtttccctgag---agaatt
                     Hedgehog  aaaa-----ctc-c----aaatcactggcctgaaagaactttccctgag---agaatt
              Star-nosed mole  aaaa-----ccc-c----aaatcattggccttaaggaagtttccctgag---agaaat
                     Elephant  aaaa-----c---a----aaatcattggccttaaagaaggttccctgag---agaatt
          Cape elephant shrew  aaaa-----cct-a----aaatcattggtcttaaggacatttccctgag---agaatt
                      Manatee  aaaa-----cct-c----aaatcgttggtcttaaagaagattccctgag---agaatt
             Cape golden mole  aaaa-----cat-aaaatcaatcattgaccttaaagaggttttcctgag---agaatt
                       Tenrec  aaaa-----cct-g----caatcattggccttgaagaagtttccctgag---agaatt
                     Aardvark  gaaa-----cct-a----aaatcattggccttaaagaagtctccctgag---agaatt
                    Armadillo  aaaa-----cc-------cagtcattggccttgaagaagtttcacagag---agaatt
                      Opossum  caaa-----cat-c----aaatgatctgccccaaagaatctgtccttga---aaaaga
              Tasmanian devil  aaat-----cag-c----aaattatctgtcctgaggaatccgtccttga---aaaaga
                      Wallaby  aaac-----cat-c----gaattatttctcctaaagaatctgtccttga---aacaga
                 Mallard duck  aaaaaaaaccct-a----gaatt--tgatcttgatgacccttac--------------
           American alligator  aaaa-----ccc-a----gaatt--tgatcctgatgaccttgac--------------
                   Coelacanth  ==========================================================
                X. tropicalis  ==========================================================
                  Rock pigeon  ==========================================================
       White-throated sparrow  ==========================================================
       Spiny softshell turtle  ==========================================================
               Painted turtle  ==========================================================
                     Platypus  ==========================================================
                       Lizard  ==========================================================
          Medium ground finch  ==========================================================
          Collared flycatcher  ==========================================================
     Chinese softshell turtle  ==========================================================
                 Saker falcon  ==========================================================
              Green seaturtle  ==========================================================
                   Budgerigar  ==========================================================
                       Turkey  ==========================================================
                      Chicken  ==========================================================
             Peregrine falcon  ==========================================================

Alignment block 2 of 21 in window, 157589323 - 157589429, 107 bps 
B D                     Human  agacca--ttcc-tttttcat---------tt----ctaaatgtatgtgcctcatgcatgcattc-agga
B D                     Chimp  agacca--ttcc-tttttcat---------tt----ctaaatgtatgtgcctcatgcatgcattc-agga
B D                   Gorilla  agacca--ttcc-tttttcat---------tt----ctaaatgtatgtgcctcatgcatgcattc-agga
B D                 Orangutan  agacca--ttcc-tttttcat---------tt----ctaaatgtatgtgcctcatgcatgcattc-agga
B D                    Gibbon  agacca--ttcc-tttttcat---------tt----ctaaatgtatgtgcctcatgcatgcattc-agga
B D                    Rhesus  aggcca--ttcc-tttttcat---------tt----ctaaatgtatgtgccttatgcctgcattc-agga
B D       Crab-eating macaque  aggcca--ttcc-tttttcat---------tt----ctaaatgtatgtgccttatgcctgcattc-agga
B D                    Baboon  agacca--ttcc-tttttcat---------tt----ctaaatgtatgtgccttatgcctgcattc-agga
B D              Green monkey  agacca--ttcc-tttttcat---------tt----ctaaatgtgtgtgccttatgcctgcattc-agga
B D                  Marmoset  agacca--ttcc-tttttcat---------tt----ctaaatggatgtgcttcatgcatgcattc-agga
B D           Squirrel monkey  agacca--ttct-tttttcat---------tt----ctaaatgtatgtgcttcatgcatgcattc-agga
B D                  Bushbaby  aggccg--ttcc-tttttcat---------tt----ctaaatatatgcgccttgttcgtgcattc-agga
           Chinese tree shrew  aggcca--ttcc-tttttcat---------tt----ctaaatgtatgtgtctcgtgcatgcattc-agga
B D                  Squirrel  agg-ccgttgct--tttgcat---------tt----taaggtcagtgtctctctcttgagccttc-agga
       Lesser Egyptian jerboa  aag-ca--ttcc-tttttcat---------tt----ccaagcgtatgtgtcttatgcgtgccttc-agga
                 Prairie vole  aag-ca--ttcc--ttttctt---------tt----ccaagtgcatgtgtctccggcatgccttc-agga
B D           Chinese hamster  aag-ca--ttcc--ttttctt---------tt----ccaactgcatgtgtctcctgcatgccttc-agga
               Golden hamster  aag-ca--ttcc--ttttctt---------tt----ccaactgcatgtgtctcctgcatgccttc-agga
B D                     Mouse  aag-ca--ttcc--ttttctt---------tt----ccaagtgcatgtgtctcctgcatgccttc-agga
B D                       Rat  aag-ca--ttcc--ttttctt---------tt----ccaagtgcatgtgtctcctgcatgccttc-agga
B D            Naked mole-rat  agg-ca--ttcc-tttttcat---------tt----tcaagtgcatatgtctcgtgcatgctttc-agga
B D                Guinea pig  agg-ca--ttcc-tttttcat---------tt----tcaagtgcatgtgtcttgtgcatgctttc-agga
                   Chinchilla  agg-ca--ttcc-tttttcat---------tt----tcaagtgcacgtgtctcgtgcatgctttc-agga
             Brush-tailed rat  agg-ca--ttcc-tttttcat---------tt----ttaagcgcatgtgtctcacgcatgcttgc-agga
B D                    Rabbit  aggcca--ttct-gttttcat---------tt----ctaaatgtatgtgcctcatgcatgcattc-agga
B D                      Pika  aggccg--ttcc-attttcct---------tt----gtaaatgtgtgtgcctcgtgcatgcattc-agga
B D                       Pig  aggcca--ttccttttttcat---------tt----ctaagtgcatgtgccttgcgcatgcattc-agaa
B D                    Alpaca  aagcca--ttcc-tttttcat---------tt----ctaaatgcatgtgcctcttgtatgcattc-agaa
               Bactrian camel  aagcca--ttcc-tttttcac---------tt----ctaaatgcatgtgcctcttgtatgcattc-agaa
B D                   Dolphin  aggcca--ttcc-tttttgat---------tt----ctaaatgcatgtgccttgtgtaagcattc-agaa
                 Killer whale  aggcca--ttcc-tttttgat---------tt----ctaaatgcatgtgccttgtgcatgcattc-agaa
             Tibetan antelope  aggcca--ttcc-tttttcat---------tt----ctaaatgcatgtgcctcgtgcacacattc-ggaa
B D                       Cow  aggcca--ttcc-tttttcat---------tt----ctaaacgcatgtgcctcgtgcacacattc-agaa
B D                     Sheep  aggcca--ttcc-tttttcat---------tt----ctaaatgcatgtgcctcgtgcacacattc-ggaa
                Domestic goat  aggcca--ttcc-tttttcat---------tt----ctaaatgcatgtgcctcgtgcacacattc-ggaa
B D                     Horse  aggcca--ttcc-tttttcat---------tg----ctaaatgtatgtgccccgtgcatgcattc-agaa
B D          White rhinoceros  aggcaa--ttcc-tttttcat---------tt----ctaaatgtatgtgccccgtgcatgcattc-agaa
B D                       Cat  aggcca--ttcc-tttttcat---------tt----ctaaacatatgggcctcatgcctgcattc-agaa
B D                       Dog  aggcca--cacc-cctctcat---------ct----ctaaacatatgggcctcctgcccgcatcc-agac
B D                   Ferret   aggcca--ttcc-tttttcat---------tt----ctaaacatatgggcctcatgcatgcattc-agaa
B D                     Panda  gggcca--ttcc-tttttcat---------tt----ctaaacatatgggcctcatgcatgcattc-agaa
               Pacific walrus  aggcca--ttcc-tttttcat---------tt----ctaaacatatgggcctcatgcacgcattc-agaa
                 Weddell seal  aggcca--ttcc-tttttcat---------tt----ctaaacatatgggcctcatgcatgcattc-agaa
             Black flying-fox  aggcag--tccc-ttttcatt----------t----ctaaatgtatgtgtctcgtgcttgggttc-agaa
B D                   Megabat  aggcag--tccc-ttttcatt----------t----ctaaatgtatgtgtctcgtgcttgggttc-agaa
                Big brown bat  agacca--ttcc-tttttttt---gtttgttt----ctaaatgtatgtgcctcgtgcgtgcattc-agaa
         David's myotis (bat)  agacca--ttcc-tttttttt---gtttgttt----ctaaatgtatgtgcctcgtgcgtgcattc-agaa
B D                  Microbat  agacta--ttcc-ttttttttttgttttgttt----ctaaatgtatgtgcctcgtgcgtgcattc-agaa
B D                  Hedgehog  ggacca--ttcc-cctttcat---------tc----ctaagtgcatatgtctcacgcaggcattc-agaa
              Star-nosed mole  gaacca--ttcc-tttttcat---------tt----ctggatgcatgtgtctcatgcatgtgttc-agaa
B D                  Elephant  agacca--tgcc-gtgctcac---------tt----ctaa----atgcgcctcctgcgtgggttc-cggc
          Cape elephant shrew  gggcca--ttcc-tccttcat---------ttagaaatga----atgtgcctcatgcctgagctc-agga
B D                   Manatee  agacca--ttcc-ttcttcac---------tt----ctaa----atgtgcctcgcgcatgagttc-acga
             Cape golden mole  agacca--ttcc-atcttcgt---------tt----ctaaatgcatgtgcctcatgcataagttc-aaga
B D                    Tenrec  agacca--ttcc-ttcttcat---------tt----ctaagtgtacgtacctcctgcgcgagttc-agga
                     Aardvark  aggcca--ttct-tccttcat---------tt----ctaaatgtatgtgcctcatgcatgagttc-agga
B D                 Armadillo  aggcca--ttcc-tttttcat---------tt----ctaaatgtttgtgccttgtgcatgagttc-agga
B D                   Opossum  tgcctg--ttcc-cattgcct---------ct----gtcaatgtctttaccagctgccta-attc-agga
B D           Tasmanian devil  tgacag--ttcc-cattgttt---------tt----gtcaatatccccgccagctgctta-agtc-agga
B D                   Wallaby  tgacag--ttcc-cattg-ct---------tt----gtcaatatctttgccagctgctta-attc-agga
  D              Mallard duck  agtaca--ttat-gtgcatat---------ta----gcagatgtctctctgtgatg---tactcaaa--a
B D        American alligator  agtaca--ttac-ttgcatat---------tt----gaacatgtctttccatgatgttctactaaaagga
  D           Green seaturtle  agtaca--ctac-ttgaatat---------tt----gtacatgcccttccatcatgtattcctaagagga
  D            Painted turtle  agtaca--ctac-ttgcatat---------tt----gtacatgcccttccatcatgtattcctaagagga
  D  Chinese softshell turtle  agaaca--ctac-ttgcatat---------tt----gtacattcccttccatgatgtattcctctgagga
  D    Spiny softshell turtle  agaaca--ctac-ttgcatat---------tt----gtacattcccttccatgatgtattcctctgagga
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                  Platypus  ======================================================================
B D                    Lizard  ======================================================================
B D       Medium ground finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================

                        Human  agtgtggtatccttggcctcaagcc---------------------tc-cctgaattt-taggatacgtg
                        Chimp  agtgtggtatccttggcctcaagcc---------------------tc-cctgaattt-taggatacgtg
                      Gorilla  agtgtggtatccttggccttaagcc---------------------tc-cctgaattt-taggatacgtg
                    Orangutan  agtgtggtatccttggcctcaagcc---------------------tc-cctgaattt-taggatacgtg
                       Gibbon  agtgtggtatccttggcctcaagcc---------------------tc-cctgaattt-taggatacgtg
                       Rhesus  agtatggtatccttggcctcaagcc---------------------tc-cctgaattt-taggatatgtg
          Crab-eating macaque  agtatggtatccttggcctcaagcc---------------------tc-cctgaattt-taggatatgtg
                       Baboon  agtgtggtatccttggcctcaagcc---------------------tc-cctgaattt-taggatatgtg
                 Green monkey  agtgtggtatccttggcctcaaacc---------------------tc-cctgaattt-taggatatgtg
                     Marmoset  agtacggtatccttggcctcaagcc---------------------tc-cctgaattt-taggatatgtg
              Squirrel monkey  agtatggtatccttggcctcaagcc---------------------tc-cctgaattt-taggatacgtg
                     Bushbaby  agtgtggtatccttggcctgaagcc---------------------tc-cctgaattt-tgggatacatg
           Chinese tree shrew  agtgtgatatccttggcctcaagcc---------------------tc-tctaaa-tt-tgggatatgtg
                     Squirrel  agtg-agtatccttggcctcaagcc---------------------tc-cttgaatct-tgagatacgtg
       Lesser Egyptian jerboa  agtgtggtatccttggcctccagcc---------------------tc-cctgaatct-tgggctacgtg
                 Prairie vole  agtgtggtatccttggccccgagcc---------------------tt-cctaaattt-ggggatacacg
              Chinese hamster  agtgtggtatccttggccccgagcc---------------------tt-cctaaattt-ggggatacgtg
               Golden hamster  agtgtggtatccttggccccgagcc---------------------tt-cctaaattt-ggggatacatg
                        Mouse  agtgtggtatccttggccccaagcc---------------------tt-cctaaattt-ggggatatgtg
                          Rat  agtgtggtatccttggccccaagcc---------------------tt-ccttttttt-ggggatacgtg
               Naked mole-rat  agtatggtatccttggcttcaagcc---------------------tc-cctgaattt-tgggatatgtg
                   Guinea pig  agtgtggtatccttggcctcaagcc---------------------tc-cctgaattt-agggatatgtg
                   Chinchilla  agtatagcatccttggcctcaagcc---------------------tc-cctgaattt-tgggatatgtg
             Brush-tailed rat  agtgtggtatccttggcctcgagcc---------------------tc-cctgaattt-tgggatatgtg
                       Rabbit  agtggggtgtccttggcctcctgcc---------------------tc-cccgagttt-cgggatgggtg
                         Pika  agtgtggtgtctttggcctcccgcc---------------------tc-cccaagttt-gtggatgggcg
                          Pig  agtctggtatccttggcctcaagcc---------------------tc-cctgagttt-caggatgcatg
                       Alpaca  agtgtggtatccttggcctcaagcc---------------------tctcttgagtct-tgggatgcgtg
               Bactrian camel  agtgtggtatccttggcctcaagcc---------------------tctcttgagttt-tgggatgcgtg
                      Dolphin  actgtggtatcattggcctcaagcc---------------------tc-cctgagttt-caggatgcgtg
                 Killer whale  actgtggtatcgttggcctcaagcc---------------------tc-cctgagttt-caggatgcgtg
             Tibetan antelope  agtgtggtatccttggcctcaaccc---------------------tc-cgtgagttt-caggatgcgtg
                          Cow  agtgtggtatccttggcctcaaccc---------------------tg-cgtgagttt-caggatgcgtg
                        Sheep  agtgtggtatccttggcctcaaccc---------------------tc-tgtgagttt-caggatgcgtg
                Domestic goat  agtgtggtatccttggcctcaaccc---------------------tt-catgagttt-caggatgcatg
                        Horse  agtctggtatccttggcctcaagcc---------------------tc-ttggaattt-tgggatgcttg
             White rhinoceros  agtgtgctatccttggcctcaagcc---------------------tc-ctggaattt-tgggatgcgtg
                          Cat  agtatggtatccttggcctcaagcc---------------------tc-cctgaatgt-tgggatgcgtg
                          Dog  agcgcggtgtccttggcctccagcc---------------------tc-cc-ggattc-cggggtgcctg
                      Ferret   cgtgtggtatccttggcctcaagcc---------------------tc-cccgaattt-tgggatgcgtg
                        Panda  agtgtggtatccttggcctcaagcc---------------------tc-tctgaattt-cgggatacgcg
               Pacific walrus  actgtggtatccttggcctcaagcc---------------------tc-cctgaattt-tgggatgcgtg
                 Weddell seal  actgtggta-ccttggcctcaagcc---------------------tc-cctgaattt-tgggatgtgtg
             Black flying-fox  agtgtgatatccgtggcttcaagac---------------------tc-cctgaattt-ggggatctgtg
                      Megabat  agtgtgatatccgtggcttcaagac---------------------tc-cctgaattt-ggggatctgtg
                Big brown bat  agcgtggtatccttggcctcaagcc---------------------tc-cctgaatttgggggatgtgtg
         David's myotis (bat)  agcgtggtatccttggcctcaagcc---------------------tc-cctgaatttgggggatgtgtg
                     Microbat  agcgtggtatccttggcctcaagcc---------------------tc-cctgaatttgggggatgtgtg
                     Hedgehog  agcatgggatctttggcctccaacc---------------------tc-ccctaattc-tgggatgtgtg
              Star-nosed mole  agcatggtacccttggcctccaacc---------------------tc-cctgaattc-tgggatgtgtg
                     Elephant  tgggcgatgcccgtggcctctagcc---------------------tc-cctgagttt-cagaatatgtg
          Cape elephant shrew  agtgcggtatccttggccccaagcc---------------------tc-cctgaatct-cagaata-gtg
                      Manatee  agtgtggtacccctggtctctagcc---------------------tc-cctaaattt-cagaatatgtg
             Cape golden mole  agtgtggtatccttggcctcaagcc---------------------tc--ctgaattt-cagtatatgtg
                       Tenrec  agtgtcgtgtccttggcccccagcc---------------------tc-tccggattt-cagagtacgtg
                     Aardvark  agtgtggtatccttggcctcaagcc---------------------tc-cctgaattt-cagaatacgtg
                    Armadillo  agtgtggtgtctttggcctcaagcc---------------------tc-cctgaattt-caggatatgtg
                      Opossum  cccttgttctcattggccttcagtc---------------------at--ctaaattt-c----------
              Tasmanian devil  ctctcattctcattggacgacagac---------------------tt--ctaaattt-cagtatctgtc
                      Wallaby  ctcttgttctcattggactacagac---------------------tt--ctaaattt-cagtatctgtc
                 Mallard duck  acttctacg---ttggccacaaacc-tctcccctctgcgagcccagcc-ccggaattg-cagtgccagtg
           American alligator  acttttata---ttggacacaacccatatcccc------agctcc-cc-cctggatta-caaagccaacg
              Green seaturtle  actccgata---ttggccacaaact---------------------gc-ccagagtcg-caatgcttgtg
               Painted turtle  actctgata---ttggccacaaact---------------------gc-ccagaatcg-caatgcttgtg
     Chinese softshell turtle  actctgata---ttggccacaaact---------------------gc-ccagaatca-caatgcctatg
       Spiny softshell turtle  actctgata---ttggccacaaact---------------------gc-ccagaatca-caatgcctatg
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
                     Platypus  ======================================================================
                       Lizard  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
                 Saker falcon  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
             Peregrine falcon  ======================================================================

                        Human  tataagc---
                        Chimp  tataagc---
                      Gorilla  tataagc---
                    Orangutan  tataagc---
                       Gibbon  tataagc---
                       Rhesus  tataagc---
          Crab-eating macaque  tataagc---
                       Baboon  tataagc---
                 Green monkey  tataagc---
                     Marmoset  tataagc---
              Squirrel monkey  tatgagc---
                     Bushbaby  tataagc---
           Chinese tree shrew  tataagc---
                     Squirrel  tataagc---
       Lesser Egyptian jerboa  tataagc---
                 Prairie vole  tataagc---
              Chinese hamster  tataagc---
               Golden hamster  tataagc---
                        Mouse  tataagc---
                          Rat  tataagc---
               Naked mole-rat  tataagc---
                   Guinea pig  tataagc---
                   Chinchilla  tataagc---
             Brush-tailed rat  tataagc---
                       Rabbit  tataagc---
                         Pika  tataggc---
                          Pig  gataagc---
                       Alpaca  gataagc---
               Bactrian camel  gataagc---
                      Dolphin  gataagc---
                 Killer whale  gataagc---
             Tibetan antelope  gataagc---
                          Cow  gataagc---
                        Sheep  gataagc---
                Domestic goat  gataagc---
                        Horse  gggaagc---
             White rhinoceros  gagaagc---
                          Cat  gataagc---
                          Dog  ggtaagc---
                      Ferret   gataagc---
                        Panda  gagaagc---
               Pacific walrus  gataagc---
                 Weddell seal  gataagc---
             Black flying-fox  gctaagc---
                      Megabat  gctaagc---
                Big brown bat  gctaaac---
         David's myotis (bat)  gctaagc---
                     Microbat  gctaagc---
                     Hedgehog  gataagc---
              Star-nosed mole  gataagc---
                     Elephant  tacaagt---
          Cape elephant shrew  tctaagt---
                      Manatee  tacaagc---
             Cape golden mole  tacaagc---
                       Tenrec  tataagc---
                     Aardvark  tataagc---
                    Armadillo  aataagc---
                      Opossum  ----------
              Tasmanian devil  tataagc---
                      Wallaby  tataagc---
                 Mallard duck  tgcacatgac
           American alligator  tgcacatgac
              Green seaturtle  tgcacatgac
               Painted turtle  tgcacatgac
     Chinese softshell turtle  tgcacatgac
       Spiny softshell turtle  tgcacatgac
                   Coelacanth  ==========
                X. tropicalis  ==========
                  Rock pigeon  ==========
       White-throated sparrow  ==========
                     Platypus  ==========
                       Lizard  ==========
          Medium ground finch  ==========
          Collared flycatcher  ==========
                 Saker falcon  ==========
                   Budgerigar  ==========
                       Turkey  ==========
                      Chicken  ==========
             Peregrine falcon  ==========

Alignment block 3 of 21 in window, 157589430 - 157589551, 122 bps 
B D                     Human  aataatctctctgttccaactt-gattggagcctgaatccaatctctcctgaaattag--tttcaaatcc
B D                     Chimp  aataatctctctgttccaactt-gattggagcctgaatccaatctctcctgaaattag--tttcaaatcc
B D                   Gorilla  aataatctctctgttccaactt-gattggagcctgaatccaatctctcctgaaattag--tttcaaatcc
B D                 Orangutan  aataatctctctgttccaactt-gattggagcctgaatccaatctctcctgaaattag--tttcaaatcc
B D                    Gibbon  aataatctctctgttccaactt-gattggagcctgaatccaatctctcctgaaattag--tttcaaatcc
B D                    Rhesus  aataatctctctgttccaactt-gattggagcctgaatccaatctttcctgaaattag--tttcaaatcc
B D       Crab-eating macaque  aataatctctctgttccaactt-gattggagcctgaatccaatctttcctgaaattag--tttcaaatcc
B D                    Baboon  aataatctctctgttccaactt-gattggagcctgaatccaatctctcctgaaattag--tttcaaatcc
B D              Green monkey  aataatctctctgttccaactt-gattggagcctgaatccaatctctcctgaaattag--tttcaaatcc
B D                  Marmoset  aataatctctctgttccaactt-gattggagcctgaatccaatctctcctgaaattag--ttttaaatcc
B D           Squirrel monkey  aataatctctctgttccaactt-gattggagcctgaatccaatctcttctgaaattag--tttcaaatcc
B D                  Bushbaby  aatgatctctcagttctaactt-gattggagcctgaacctaatctcacccgaaattag-ttttcaagtcc
           Chinese tree shrew  aataatctctcagttccaaa-t-gattggagcctgaacccaatctcaccctaaattag-ttttcaaatcc
B D                  Squirrel  cataatctcccagttccaactt-gattggagcctgaacccaatcttacc-aaaattag-ttttcaaatcc
       Lesser Egyptian jerboa  aatgatctctcagttccaactt-gattggagactgaactcaatctcacc-aaaattag-tttccaaatcc
                 Prairie vole  aatgatctctgagttccaactt-gattggagcttgaacccaatctcacc-aaaattag-ttttcaaatcc
B D           Chinese hamster  aatgatctctgagttccaactt-gattggagcttgaacccaatctcacc-aaaattag-ttttcaaatcc
               Golden hamster  aatgatctctgagttccaactt-gattggagcttgaacccaatctcacc-aaaattag-ttttcaaatcc
B D                     Mouse  aatgatctccgagttccaactt-gattggagcttgaacccaatctcacc-aaaattag-ttttcaaatcc
B D                       Rat  aatgatctccgagttccaactt-gattggagcttgaacccaatctcacc-aaaattag-ttttcaaatcc
B D            Naked mole-rat  aataatctctcagttctaactt-gattggagcctgaaccccatcttact-gaaattag-ttttcaaatct
B D                Guinea pig  aataatctctcagttctaactt-gattgcagcctgaaccccatctcact-gaaattag-ttttcaaatct
                   Chinchilla  aataatctctccgttctaactt-gattggagcctgaaccccatctcact-aaaattag-ttttcaaatct
             Brush-tailed rat  aataatctctcagttataactt-gattggagtctgaaccccatctcact-aaaattag-ttttcaaattt
B D                    Rabbit  aataatctctcagttccaactt-gattggagtctgaacccaatctcacc-gaaattag-ttttcaaatcc
B D                      Pika  aataatctctcagatccaactt-gattggagtctgaacccaatctcacc-gaaattag-ttttcaaatcc
B D                       Pig  aataatctctcagttccaactt-gattggagcctgaacccaatctcacccgaaattag-ttttcaaatcc
B D                    Alpaca  aataatctctcagctccaactt-gattggagcctgaacccaacctcacccaaaattag-ttttcaagtcc
               Bactrian camel  aatagtctctcagctccaactt-gattggagcctgaacccaacctcacccaaaattag-ttttcaagtcc
B D                   Dolphin  aataatctctcagttccaactt-gattggagcctgaacccaatctcacccgaaattag-ttttcaaatcc
                 Killer whale  aataatctctcagttccaactt-gattggagcctgaacccaatctcacccgaaattag-ttttcaaatcc
             Tibetan antelope  aataatctctcagttccaactt-gattggagcctgaacccaatctcacccgaaattag-ttttcaaatcc
B D                       Cow  aataatctctcagttccaactt-gattggagcctgaacccaatctcacccgaaattag-ttttcaaatcc
B D                     Sheep  aataatctctcagttccaactt-gattggagcctgaacccaatctcacccgaaattag-ttttcaaatcc
                Domestic goat  aataatctctcagttccaactt-gattggagcctgaacccaatctcacccgaaattag-ttttcaaatcc
B D                     Horse  aataatctcttagttccaactt-gattggagcctgaaccaaatctgacccaaaattag-ttttcaaatcc
B D          White rhinoceros  aataatctctctgttccaactt-gattggagcctgaacccaatctgacccaaaattag-ttttcaaatcc
B D                       Cat  aataatctctcagttccaactt-gattggagcctgaactcaatctcacctgaaattag-ttttcaaatcc
B D                       Dog  agcaatctctcagttccgacct-gatgggagcctgaactcaatctcacctgaaattgg-ttttcaaatcc
B D                   Ferret   aataatctcttggttccaactt-gattggagcctgaactcaatatcacctgaaattag-ttttcaaatcc
B D                     Panda  aataatctctcggttccaactt-gattggagcctgaactcaatctcacctgaaattag-ttttcaaatcc
               Pacific walrus  aataatctctcggttccaactt-gactggagcctgaactcaatctcacctgagattag-ttttcaaatcc
                 Weddell seal  aataatctctcggttccaactt-gactggagcctgaactcaatctcacctgaaattag-ttttcaaatcc
             Black flying-fox  aataatctctcaattccaactt-gattggagcctgaacccggtctcacccgaaattag-ttttcaaattc
B D                   Megabat  aataatctctcaattccaactt-gattggagcctgaacccggtctcacccgaaattag-ttttcaaattc
                Big brown bat  agtaatctctcagctccaacta-gattggagcctgagcccagtctcactcaaaattag-ttttcaaatcc
         David's myotis (bat)  aataatctctcagctccaactt-gattggagcctgagcccagtctcactcgaaattag-ttttcaaatcc
B D                  Microbat  aataatctctcagctccaactt-gattggagcctgagcccagtctcactcgaaattag-ttttcaaatcc
B D                  Hedgehog  aataatctctcagttcccactt-gattggagcctgaacccaatctcaccagaaattagtttttcaaatcc
              Star-nosed mole  aataatctctcagttccaagtt-gattggagcctgaacccaatctcacccgaaattag-ttttcaaatac
B D                  Elephant  aataatctcacggctctaattt-gattggggcctgaactcaatctcacccgaaattag-ttttcaaatcc
          Cape elephant shrew  aataatctctccattctgattt-gattggagcctgaaccctatctcacccaaaattag-ttttcaaatcc
B D                   Manatee  aataatctcgcagttttagttt-gattggggcctgcacccaatctcacccaaaattag-tttccaaatac
             Cape golden mole  aataatctctcaattctaaatt-gattgcagcctgaactcaatctcacctaaaattag-ttttcaaatcc
B D                    Tenrec  aataatctctctgctcgaactt-gattggagcctgaacccaacctcacctgaaattag-ttttcaaatcc
                     Aardvark  aataatctctc---tctaactt-gattgcagcctgaacccaatctcacccaaaattag-ttttcaaatcc
B D                 Armadillo  aataatctcttagttccaactt-gattggagcctgaacccagtctcacccaaaattgg-ttttcacatcc
B D                   Opossum  -----------------------------agactgaatctaatctcactagaaattag--tctcaaattc
B D           Tasmanian devil  aggaagctcccagttcagactt-gattagagactgaatctaatctcaccagaaattag-ttctcaaactc
B D                   Wallaby  agtaatcttccagttcagactt-gattagagactgaatctaatctcaccagaaattag-ttctcaaactc
B D                  Platypus  agtcatctcgcaggtctgacttcgtttgaagtctgaatccaatctcaccagaaattaa-tctcaaaatcc
  D              Mallard duck  attcatttctctgctccctctt-gattggagtctgaatccaatcttgct----aatag-tcttccagttc
B D        American alligator  tttcatttctcagttctgactt-gattggagcctgaatccaatcttact----aatag-ttctccaagtc
  D           Green seaturtle  attcatttttcagttctgattt-gattagagtctgattccaatc---ct----agtag-tcctccagttc
  D            Painted turtle  attcatttctcagttttgactt-gattagagtctgaatccaatcctact----agtag-tcctccagttc
  D  Chinese softshell turtle  attcatttctcagttttgactt-gattagagtctgaatccaatcctact----attag-tcctccagttc
  D    Spiny softshell turtle  attcatttctcagttttgactt-gattagagtctgaatccagtcctact----attag-tcctccagttc
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                    Lizard  ======================================================================
B D       Medium ground finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D              Saker falcon  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D          Peregrine falcon  ======================================================================

                        Human  aaattcaattaaaaacagatgtttccaa---------gtaaactgaaaa--------aagtc--t-----
                        Chimp  aaattcaattaaaaacagatgtttccaa---------gtaaactgaaaa--------aagtg--t-----
                      Gorilla  aaattcaattaaaaacagatgtttccaa---------gtagactgaaaa--------aagtc--t-----
                    Orangutan  aaattcaattaaaaacagatgtttccaa---------gtagactgaaaa--------aagtc--t-----
                       Gibbon  aaattcaattaaaaacagatgtttccaa---------gtagactgaaaa--------aagtc--t-----
                       Rhesus  aaattcaattaaaaacagatgtttccaa---------gtagactgaaaa--------aaggc--t-----
          Crab-eating macaque  aaattcaattaaaaacagatgttttcaa---------gtagactgaaaa--------aaggc--t-----
                       Baboon  aaattcaattaaaaacagatgtttccaa---------gtagactgaaaa--------aaggc--t-----
                 Green monkey  aaattcaattaaaaacagatgtttccaa---------gtagactgaaaa--------aaggc--t-----
                     Marmoset  aaattcaattaaaaacagatgtttccaa---------gtagactgaaaa--------aaggc--t-----
              Squirrel monkey  aaattcaattaaaaacagatgtttccca---------gtagactgaaaa--------aaggc--t-----
                     Bushbaby  aaattcaattaaaaacagatgtttccaa---------gtagactg-aaa--------aaggc--t-----
           Chinese tree shrew  aaattcaattaaaaacagatgtttccaa---------ctagatcg-aaa--------agggc--t-----
                     Squirrel  aaattcaattaaaaacagatgtttccaa---------gcagactgaaaa--------gga-c--t-----
       Lesser Egyptian jerboa  aaattgaattaaaaacagatgtttccaa---------gcagactgaaaatggctgtgaa-----c-----
                 Prairie vole  aaattcaattaaaaacagatgtttccaa---------gtagactgaaaa--------aaa-t--t-----
              Chinese hamster  aaattcaattaaaaacagatgtttccaa---------ctagactgaaaa--------aa-----t-----
               Golden hamster  aaattcaattaaaaacagatgtttccaa---------ctagactgaaaa--------aa-----t-----
                        Mouse  aaattcaattaaaaacagatgtttccaa---------gtagactgaaaa--------aa-----a-----
                          Rat  aaattcaattaaaaacagatgtttccaa---------gtagactgaaaa--------aa-----a-----
               Naked mole-rat  atattcaattaaaaacagatgtttccaa---------gcagactgaaaa--------tgg-c--t-----
                   Guinea pig  aaattcaattaaaaacagatgtttccaa---------gcagactgaaaa--------tgg-c--t-----
                   Chinchilla  aaattcaattaaaaacagatgtttccaa---------gcagaccgaaaa--------tgg-c--t-----
             Brush-tailed rat  aaattcaattaaaaacagatgtttccaa---------gcagactgaaaa--------tgg-c--t-----
                       Rabbit  aaattcaattaaaaacagatgtttccaa---------gtagactgaaaa--------agg-c--t-----
                         Pika  aaattcaattaaaaccagatgtttccaa---------gtagactg--aa--------agg-c--t-----
                          Pig  aaatgcaattaaaaacagatgtttccaa---------gcagactgaaaa--------aga-t--t-----
                       Alpaca  aaatgcaattaaaaacagatgtttccaa---------gcagactgaaaa--------agg-t--t-----
               Bactrian camel  aaatgcaattaaaaacagatgtttccaa---------gcagactgaaaa--------agg-t--t-----
                      Dolphin  aaatgcaattaaaaacagatgtttccaa---------tcagactgaaag--------at-----t-----
                 Killer whale  aaatgcaattaaaaacagatgtttccaa---------tcagactgaaag--------at-----t-----
             Tibetan antelope  aaatgcaattaaaaacagatgtttccaa---------gtagactgaaaa--------atg-c--t-----
                          Cow  aaatgcaattaaaaacagatgtttccaa---------gcagactgaaaa--------agg-c--t-----
                        Sheep  aaatgcaattaaaaacagatgtttccaa---------gtagactgaaaa--------acg-c--t-----
                Domestic goat  aaatgcaattaaaaacagatgtttccaa---------gtagactgaaaa--------acg-c--t-----
                        Horse  aaatgcaattaaaaacagatgtttctat---------gtagactgaaaa--------aga-c--t-----
             White rhinoceros  gaatgcaattaaaaacagatgtttccaa---------gtagactgaaaa--------aga-c--t-----
                          Cat  aaatacaattaaaaacagatgtttccaa---------atagactgaaaa--------agg-t--t-----
                          Dog  agatgcaattagaaacagatgtttccaa---------acagactgaaaa--------agg-t--t-----
                      Ferret   aaatgcaattaaaaacaggtgtttccaa---------atagactgaaaa--------agg-t--t-----
                        Panda  aaatgcaattaaaaacagatgtttccaa---------atagacggaaaa--------agg-t--t-----
               Pacific walrus  aaatgcaattaaaaacagatgttcccaa---------atagactgaaaa--------aag-t--t-----
                 Weddell seal  aaatgcaattaaaaacagatgtttccaa---------atagactgaaaa--------aag-t--t-----
             Black flying-fox  aaacacaattaaaaacagatgtttccaa---------gtagactgaaaa--------ggg-c--t-----
                      Megabat  aaacacaattaaaaacagatgtttccaa---------gtagactgaaaa--------ggg-c--t-----
                Big brown bat  aaatgcaattaaaaacagatgtctccaa---------gaagactgaaca--------agg-c--t-----
         David's myotis (bat)  gaaggcaattaaaaacagatgtctccaa---------gtagactgagaa--------agg-c--t-----
                     Microbat  aaaggcaattaaaaacagatgtctccaa---------gtagactgagaa--------agg-c--t-----
                     Hedgehog  aaatacaattaaaaacagatgtttccaa---------gtagacagaaaa--------tgg-t--cacgag
              Star-nosed mole  aaatacaattaaaaacagatgtttccaa---------gtcgactgaaag--------agc-t--t-----
                     Elephant  acattcgattaaaaacagatgtttctag-------------acgtaaag--------agg-c--t-----
          Cape elephant shrew  acactcaattaaaaacagatgtttctaa-------------acttaaag--------aga-c--t-----
                      Manatee  acattcaattaaaaacagatgtttctag-------------acttaaag--------agg-c--t-----
             Cape golden mole  acattcaattaaaaacagatgtttc-----------------tttaaag--------atg-c--t-----
                       Tenrec  accttcaattaaaaacagatgtttccaa-------------acttaaat--------agg-c--t-----
                     Aardvark  acattcaattaaaaacagatgtttctaa-------------acttgaag--------agg-c--t-----
                    Armadillo  taatttgattaaaaacagatgtttccaa---------ggagacttaacg--------agg-c--t-----
                      Opossum  aaattctattgaaaacagatggctctgg---------gcaaacttggag--------agt-c--t-----
              Tasmanian devil  aaattcgattgaaaacagatgtctccag---------gcagtcttggag--------agg-c--t-----
                      Wallaby  aaattcgattgaaaacagatgtctccag---------gcagacttggag--------agt-c--t-----
                     Platypus  aaattcaatgaaaaacagatgctttcaa---------gcaaactagaaa--------catcc--a-----
                 Mallard duck  aaattatattggaagcagatgctcccaaatcaggttggggagcttatag--------aaa----t-----
           American alligator  aaattatattaaaagcagatgcttccaaaccaggttggggagcttatag--------aaa----t-----
              Green seaturtle  aaattatattgaaaacatatgcttccagcgtggcttggggaatttgaag--------aaa-cttt-----
               Painted turtle  aaattatattgaaaacagatgcttccaacctggcttggggaattcgaag--------aaa-cttt-----
     Chinese softshell turtle  aaactgtattgaaaacagatgcttccaacttggtttggggaacttaaag--------aaa-c--t-----
       Spiny softshell turtle  aaactgtattgaaaacagatgcttccagcttggtttggggaacctaaag--------aaa-c--t-----
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
                       Lizard  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
                 Saker falcon  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
             Peregrine falcon  ======================================================================

                        Human  ------------------at-------------------------------------------aaagaaa
                        Chimp  ------------------at-------------------------------------------aaagaaa
                      Gorilla  ------------------at-------------------------------------------gaagaaa
                    Orangutan  ------------------at-------------------------------------------aaagaaa
                       Gibbon  ------------------at-------------------------------------------aaagaaa
                       Rhesus  ------------------at-------------------------------------------aaagaaa
          Crab-eating macaque  ------------------at-------------------------------------------aaagaaa
                       Baboon  ------------------at-------------------------------------------aaagaaa
                 Green monkey  ------------------at-------------------------------------------aaagaaa
                     Marmoset  ------------------at--------------------a---------------------aaaaaaaa
              Squirrel monkey  ------------------at-----------------aaaa---------------------aaaaaaaa
                     Bushbaby  ------------------gt-----------------gaaa---------------------aaaaaaaa
           Chinese tree shrew  ------------------gtaaagaaggagaaaaaaaaaag---------------------aaaaggaa
                     Squirrel  ------------------gt--------------------g---------------------ggaaaaaa
       Lesser Egyptian jerboa  ------------------aa--------------------a----------------------acaaaac
                 Prairie vole  ------------------ga--------------------a----------------------aaaaaaa
              Chinese hamster  ------------------tt--------------------a----------------------aaaaaaa
               Golden hamster  ------------------ga--------------------a---------------------gaaaaaaa
                        Mouse  ------------------gt--------------------g---------------------gaaaaaaa
                          Rat  ------------------ag--------------------t---------------------ggaaaaaa
               Naked mole-rat  ------------------gt--------------------g---------------------aaaaaaaa
                   Guinea pig  ------------------gt--------------------g---------------------aaaaaaaa
                   Chinchilla  ------------------gt--------------------g---------------------aaaaaaaa
             Brush-tailed rat  ------------------gt--------------------g---------------------gaaaaaaa
                       Rabbit  ------------------gt--------------------g----------------------------a
                         Pika  ------------------gt--------------------g---------------------aaaaacaa
                          Pig  ------------------gt--------------------g----------------------gaaaaaa
                       Alpaca  ------------------gt--------------------g----------------------aaaaaaa
               Bactrian camel  ------------------gt--------------------g----------------------aaaaaaa
                      Dolphin  ------------------gt--------------------g----------------------aaaaaaa
                 Killer whale  ------------------gt--------------------g----------------------aaaaaaa
             Tibetan antelope  ------------------gt--------------------g----------------------aaaaaac
                          Cow  ------------------gt--------------------g----------------------aaaaaaa
                        Sheep  ------------------gt--------------------g----------------------aaaaaac
                Domestic goat  ------------------gt--------------------g----------------------aaaaaac
                        Horse  ------------------gt--------------------g---------------------aaaaaaaa
             White rhinoceros  ------------------gt--------------------g---------------------aaaaaaaa
                          Cat  ------------------gt--------------------g---------------------gaaaaaaa
                          Dog  ------------------gt--------------------g----------------------gggggaa
                      Ferret   ------------------tt--------------------g------------------gggatgggggg
                        Panda  ------------------gt--------------------gtgtgtg---------tgtgggggggaaga
               Pacific walrus  ------------------gt--------------------gca----------------gggggggaaaa
                 Weddell seal  ------------------gt--------------------gc-------------------ggggaaaaa
             Black flying-fox  ------------------gt--------------------g----------------------aagcaca
                      Megabat  ------------------gt--------------------g----------------------aagcaca
                Big brown bat  ------------------gt--------------------g----------------------aagaaag
         David's myotis (bat)  ------------------gt--------------------g----------------------aagaaaa
                     Microbat  ------------------gt--------------------g----------------------aagaaaa
                     Hedgehog  agagagagagagagagagga--------------------g----------------------aaaaaga
              Star-nosed mole  ------------------gt--------------------g----------------------aaaaaaa
                     Elephant  ------------------gt--------------------gaaaaaa---------------ataaaaaa
          Cape elephant shrew  ------------------gt--------------------gaaagaagaagaagg------gagaaaaaa
                      Manatee  ------------------gt--------------------gagaaaa------------------aaaaa
             Cape golden mole  ------------------at-----------------------------------------gaaaaataa
                       Tenrec  ------------------gt--------------------gagtggggagggggtggggaggaaagacaa
                     Aardvark  ------------------gt--------------------g------------------------aaaaa
                    Armadillo  ------------------gt--------------------ga-----------------------aaaaa
                      Opossum  ------------------gc--------------------t----------------------aaagaaa
              Tasmanian devil  ------------------gc--------------------g----------------------aaagaaa
                      Wallaby  ------------------gc--------------------t----------------------aaagata
                     Platypus  ------------------at--------------------g----------------------atgaaa-
                 Mallard duck  ------------------ct--------------------a------------------gtcaagtatat
           American alligator  ------------------ct--------------------a------------------gtctcatatat
              Green seaturtle  ------------------gt--------------------a------------------atcaagagaaa
               Painted turtle  ------------------gt--------------------a------------------atcaagagaaa
     Chinese softshell turtle  ------------------gt--------------------a------------------atcagtagaaa
       Spiny softshell turtle  ------------------gt--------------------a------------------atcagtagaaa
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
                       Lizard  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
                 Saker falcon  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
             Peregrine falcon  ======================================================================

Inserts between block 3 and 4 in window
B D          Tasmanian devil 26bp

Alignment block 4 of 21 in window, 157589552 - 157589573, 22 bps 
B D                     Human  ag-----------g---------------ca--ggc--tcactgccttgaga
B D                     Chimp  ag-----------g---------------ca--ggc--tcactgccttgaga
B D                   Gorilla  ag-----------g---------------ca--ggc--tcactgccttgaga
B D                 Orangutan  ag-----------a---------------ca--gac--tcactgccttgaga
B D                    Gibbon  ag-----------g---------------ca--ggc--tcactgccttgaga
B D                    Rhesus  ag-----------g---------------ca--ggc--tcactgccttggga
B D       Crab-eating macaque  ag-----------g---------------ca--ggc--tcactgccttggga
B D                    Baboon  ag-----------g---------------ca--ggc--tcactgccttggga
B D              Green monkey  ag-----------g---------------ca--ggc--tcactgccttggga
B D                  Marmoset  ag-----------g---------------ca--ggc--tcactgccttgaga
B D           Squirrel monkey  aa-----------g---------------ca--ggc--tcactgccttgaga
B D                  Bushbaby  aa-----------a---------------ca--ggc--tcattgccttgcga
           Chinese tree shrew  aa-----------a---------------tg--ggc--tcagtgccttgaga
B D                  Squirrel  a------------------------aaatca--gac--tcgccgccttgaga
       Lesser Egyptian jerboa  at-----------a----------catatca--ggc--tcactgccttgaga
                 Prairie vole  at-----------g----------tatctca--gtc--tcaccgcctccaga
B D           Chinese hamster  at-----------g----------tatctca--gcc--tcactgcctccaga
               Golden hamster  aa-----------g----------tatctca--gcc--tcgctgcctccaga
B D                     Mouse  at-----------g----------tatctca--ggc--gtactgcctcgaga
B D                       Rat  at-----------g----------gatctca--ggc--tcagtgcctggaga
B D            Naked mole-rat  aa-----------a--------------tca--gac--ccagtaccccgaga
B D                Guinea pig  aa-----------a-------aaaagaatca--gac--ccagtaccttgaga
                   Chinchilla  aa-----------a-------aaaggaatca--gac--ccagtacctcgaga
             Brush-tailed rat  aa-----------a-----------gaatca--gag--ctagtacctggaga
B D                    Rabbit  aa-----------a----------aaaatca--ggc--tcactgccttgaga
B D                      Pika  aa-----------a----------aaagtca--ggc--gcactgccttgaga
B D                       Pig  ac-----------acacatacacaaaaacca--ggt--tcattg-ctttaga
B D                    Alpaca  --------------------------------------------cctttaga
               Bactrian camel  --------------------------------------------cctttaga
B D                   Dolphin  aa-----------t---------------ca--ggt--tcactgcctttaca
                 Killer whale  aa-----------t---------------ca--ggt--tcactgcctttaca
             Tibetan antelope  ca-----------g---------------ca--ggt--ttactgcctttaga
B D                       Cow  aa-----------a------------aatca--ggt--tcactgcctttaga
B D                     Sheep  ca-----------g---------------ca--ggt--ttactgcctttaga
                Domestic goat  ca-----------g---------------ca--ggt--ttactgcccttaga
B D                     Horse  aa-----------t---------------ca--ggg--tcactgcctttaga
B D          White rhinoceros  aa-----------t---------------ca--gggt-tcactgcctttaga
B D                       Cat  aa-----------t---------------ca--ggt--tcactgcctttagg
B D                       Dog  aa-----------t---------------ca--ggt--tcactgcctttagg
B D                   Ferret   aa-----------t---------------ca--ggt--tcacagcctttagg
B D                     Panda  aa-----------t---------------ca--ggt--tcactgcctttagg
               Pacific walrus  aa-----------t---------------ca--ggt--tcactgcctttagg
                 Weddell seal  aa-----------t---------------ca--ggt--tcactgcctttagg
             Black flying-fox  aa-----------t---------------ca--agt--tcactgcctttaga
B D                   Megabat  aa-----------t---------------ca--agt--tcactgcctttaga
                Big brown bat  aa-----------t---------------ca--ggt--tcactgcttgtaga
         David's myotis (bat)  aa-----------t---------------ca--ggt--tcactccttttaga
B D                  Microbat  aa-----------t---------------ca--ggt--tcactccttttaga
B D                  Hedgehog  aa-----------g-------aaaacaggca--agc--ccactacttgagga
              Star-nosed mole  a---------------------------------------actgtctttaga
B D                  Elephant  aa-----------t---------------ca--ggc--tcactgccttgaga
          Cape elephant shrew  agcccaaaccacct---------------ct--gac--tcagagcctggaga
B D                   Manatee  aa-----------t---------------ca--ggc--tcactgccttaagc
             Cape golden mole  aa-----------t---------------ca--ggc--acactgccttgaga
B D                    Tenrec  ag-----------g---------------ca--ggc--acattgcctggaga
                     Aardvark  aa-----------c---------------catggac--tcactgccttgaga
B D                 Armadillo  aa-----------t---------------ta--ggt--tcactgctttgaga
B D                   Opossum  ------------------------------------catggcttcccacaa-
B D                   Wallaby  ------------------------------------tatcattttccaaaa-
B D                  Platypus  --------------------------attta--gcc--tcaaggaatgtaga
  D              Mallard duck  ---------------agt----------------------------------
B D        American alligator  ---------------agt----------------------------------
  D           Green seaturtle  ---------------aggagaaacaaaagca--gac--ctcctgccttgaga
  D            Painted turtle  ---------------aggagaaacaaaagca--gac--ctcctgccttgaga
  D  Chinese softshell turtle  ---------------aggagaaataaaagca--gat--cccctgcctagaga
  D    Spiny softshell turtle  ---------------aggagaaataaaagca--gat--cccctgccttgaga
B D                Coelacanth  ====================================================
B D             X. tropicalis  ====================================================
B D           Tasmanian devil  ====================================================
  D               Rock pigeon  ====================================================
  D    White-throated sparrow  ====================================================
B D                    Lizard  ====================================================
B D       Medium ground finch  ====================================================
  D       Collared flycatcher  ====================================================
  D              Saker falcon  ====================================================
B D                Budgerigar  ====================================================
B D                    Turkey  ====================================================
B D                   Chicken  ====================================================
  D          Peregrine falcon  ====================================================

Inserts between block 4 and 5 in window
B D                  Opossum 12bp
B D                  Wallaby 12bp
  D           Painted turtle 3472bp

Alignment block 5 of 21 in window, 157589574 - 157589575, 2 bps 
B D                     Human  -at
B D                     Chimp  -at
B D                   Gorilla  -at
B D                 Orangutan  -at
B D                    Gibbon  -at
B D                    Rhesus  -at
B D       Crab-eating macaque  -at
B D                    Baboon  -at
B D              Green monkey  -at
B D                  Marmoset  -at
B D           Squirrel monkey  -at
B D                  Bushbaby  -at
           Chinese tree shrew  -at
B D                  Squirrel  -a-
       Lesser Egyptian jerboa  -at
                 Prairie vole  -ac
B D           Chinese hamster  -ac
               Golden hamster  -ac
B D                     Mouse  -ac
B D                       Rat  -ac
B D            Naked mole-rat  -at
B D                Guinea pig  -at
                   Chinchilla  -at
             Brush-tailed rat  -at
B D                    Rabbit  -at
B D                      Pika  -at
B D                       Pig  -at
B D                    Alpaca  -at
               Bactrian camel  -at
B D                   Dolphin  -at
                 Killer whale  -at
             Tibetan antelope  -at
B D                       Cow  -at
B D                     Sheep  -at
                Domestic goat  -at
B D                     Horse  -at
B D          White rhinoceros  -at
B D                       Cat  -at
B D                       Dog  -at
B D                   Ferret   -at
B D                     Panda  -at
               Pacific walrus  -at
                 Weddell seal  -at
             Black flying-fox  -ac
B D                   Megabat  -ac
                Big brown bat  -gt
         David's myotis (bat)  -at
B D                  Microbat  -at
B D                  Hedgehog  -at
              Star-nosed mole  -gt
B D                  Elephant  -at
          Cape elephant shrew  -at
B D                   Manatee  -at
             Cape golden mole  -at
B D                    Tenrec  -at
                     Aardvark  -at
B D                 Armadillo  -at
  D              Mallard duck  -g-
B D        American alligator  -a-
  D           Green seaturtle  ag-
  D  Chinese softshell turtle  ag-
  D    Spiny softshell turtle  ag-
B D                Coelacanth  ===
B D             X. tropicalis  ===
B D           Tasmanian devil  ===
  D               Rock pigeon  ===
  D    White-throated sparrow  ===
  D            Painted turtle  ===
B D                  Platypus  ---
B D                    Lizard  ===
B D       Medium ground finch  ===
  D       Collared flycatcher  ===
  D              Saker falcon  ===
B D                Budgerigar  ===
B D                    Turkey  ===
B D                   Chicken  ===
B D                   Wallaby  ===
B D                   Opossum  ===
  D          Peregrine falcon  ===

Alignment block 6 of 21 in window, 157589576 - 157589576, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                      Pika  t
B D                       Pig  c
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  c
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  g
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D                   Opossum  t
B D           Tasmanian devil  c
B D                   Wallaby  t
  D              Mallard duck  t
B D        American alligator  c
  D           Green seaturtle  t
  D  Chinese softshell turtle  t
  D    Spiny softshell turtle  t
B D                Coelacanth  =
B D             X. tropicalis  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D            Painted turtle  =
B D                  Platypus  -
B D                    Lizard  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D              Saker falcon  =
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  =
  D          Peregrine falcon  =
B D                  Squirrel  -

Inserts between block 6 and 7 in window
  D             Mallard duck 1bp
B D       American alligator 1bp
  D          Green seaturtle 3372bp
  D Chinese softshell turtle 4135bp

Alignment block 7 of 21 in window, 157589577 - 157589604, 28 bps 
B D                     Human  ggttg--aattctcta-ggtactt-----ataatca
B D                     Chimp  ggttg--aattctcta-ggtattt-----ataatca
B D                   Gorilla  ggttg--aattctcta-ggtattt-----ataatca
B D                 Orangutan  ggttg--aattctcta-ggtattt-----ataatca
B D                    Gibbon  ggttg--aattctcta-ggtattt-----ataatca
B D                    Rhesus  ggttg--aattctcta-ggtattt-----ataatca
B D       Crab-eating macaque  ggttg--aattctcta-ggtattt-----ataatca
B D                    Baboon  ggttg--aattctcta-ggtattt-----ataatca
B D              Green monkey  ggttg--aattctcta-ggtattt-----ataatca
B D                  Marmoset  ggttg--aattctcta-ggtattt-----ataatca
B D           Squirrel monkey  ggttg--agttctcta-ggtattt-----ataatca
B D                  Bushbaby  gcttg--aattctcta-ggtattt-----gtaatca
           Chinese tree shrew  ggtgg--aattctctg-gctattt-----gtaatca
B D                  Squirrel  --ttg--aattctcta-ggtattt-----gtaatca
       Lesser Egyptian jerboa  ggctg--aatcctgta-ggtattt-----gtaatca
                 Prairie vole  ggttg--aattctcta-ggtattt-----gtaatca
B D           Chinese hamster  ggttg--aattctcta-ggtattt-----gtaatca
               Golden hamster  ggttg--aattctcta-ggtattt-----gtaatca
B D                     Mouse  ggtga--aattctcta-ggtattt-----gtaatca
B D                       Rat  ggttg--aattctcta-ggtattt-----gtaatca
B D            Naked mole-rat  gtttg--aattctcta-gatatttttttggtaacca
B D                Guinea pig  gttta--agttctcta-ggtatttttttggtaacaa
                   Chinchilla  ttttg--acttctcta-agtattttttggg---ata
             Brush-tailed rat  gtttg--agttgtcta-ggtattttgggggtaacaa
B D                    Rabbit  ggttg--aattctcta-ggtattt-----gtaatca
B D                      Pika  ggttg--aactctcta-ggtattt-----ataatca
B D                       Pig  agatg--actattctatggttttt-----gtaatca
B D                    Alpaca  gggtg--aatatgcta-ggtattt-----gtaatca
               Bactrian camel  gggtg--aatatgctt-ggtattt-----gtaatca
B D                   Dolphin  agttg--aatattcta-ggtattt-----gtaatca
                 Killer whale  agttg--aatattcta-ggtattt-----gtaatca
             Tibetan antelope  agttg--actattcta-ggtattt-----gtaatca
B D                       Cow  agttg--actattcta-ggtattt-----gtaatca
B D                     Sheep  agttg--actattcta-ggtattt-----gtaatca
                Domestic goat  agttg--actattcta-ggtattt-----gtaatca
B D                     Horse  ggttg--cattttcca-ggtctct-----gtgatca
B D          White rhinoceros  ggttg--cattttcta-ggtacct-----gtaatga
B D                       Cat  ggttg--aatttttca-ggtattt-----ataatca
B D                       Dog  ggttg--aatttctca-ggtcttt-----gtaatca
B D                   Ferret   ggttg--agtttttca-ggttttt-----gtaatca
B D                     Panda  ggttg--attttctca-ggtattt-----gaaatca
               Pacific walrus  ggttg--aatttttca-ggtattt-----gtaatca
                 Weddell seal  ggttg--aatttttca-ggtattt-----gtaatca
             Black flying-fox  gcttg--aatcttcta-ggtatct-----gtaatca
B D                   Megabat  gcttg--aatcttcta-ggtatct-----gtaatca
                Big brown bat  ggttg--cattttcta-ggtattt-----gcaatca
         David's myotis (bat)  ggttg--aattttcta-ggtattg-----gcaatca
B D                  Microbat  ggttg--aattttcta-ggtattt-----gcaatca
B D                  Hedgehog  agttg--cattttcta-ggtattt-----gtaatca
              Star-nosed mole  tgttg--cattttcta-ggtattt-----gcaatca
B D                  Elephant  ggttg--aattctcta-ggtattt-----gtcatca
          Cape elephant shrew  aattg--aattctcta-ggtatct-----gccgaca
B D                   Manatee  ggttg--aattctcta-ggtattt-----gtcatcg
             Cape golden mole  ggttg--gattctcta-ggtattt-----gtcatta
B D                    Tenrec  ggttg--gattcccca-ggtattg-----gtcatca
                     Aardvark  acttg--aattctcca-ggtattt-----gtcatca
B D                 Armadillo  ggttg--aattctcta-cgtattg-----gtaatca
B D                   Opossum  aattg--aaatcttta-aatattt-----gtaatta
B D           Tasmanian devil  ggtag--aaacctcta-agtattt-----gtaatca
B D                   Wallaby  cactg--aaacttcta-agtatat-----gtaatca
B D                  Platypus  ------------------gtattt-----gtaatca
  D              Mallard duck  agttgaaaatgtatga-agtattt-----gtaatca
B D        American alligator  ggttg-aaatgtataa-agtattt-----gtaatca
B D                Coelacanth  ====================================
B D             X. tropicalis  ====================================
  D               Rock pigeon  ====================================
  D    White-throated sparrow  ====================================
  D            Painted turtle  ====================================
B D                    Lizard  ====================================
B D       Medium ground finch  ====================================
  D       Collared flycatcher  ====================================
  D  Chinese softshell turtle  ====================================
  D              Saker falcon  ====================================
  D           Green seaturtle  ====================================
B D                Budgerigar  ====================================
B D                    Turkey  ====================================
B D                   Chicken  ====================================
  D          Peregrine falcon  ====================================

Inserts between block 7 and 8 in window
B D          Tasmanian devil 3bp
B D                  Wallaby 3743bp

Alignment block 8 of 21 in window, 157589605 - 157589624, 20 bps 
B D                     Human  ta--ag--gaagag-a------g---aaat-ca-ga
B D                     Chimp  ta--ag--gaagag-a------g---aagt-ca-ga
B D                   Gorilla  ta--ag--gaagac-a------g---aaat-ca-ga
B D                 Orangutan  ta--ag--gaagag-a------g---aaat-ca-ga
B D                    Gibbon  ta--ag--gaagag-a------g---aaat-ca-ga
B D                    Rhesus  ta--ag--gaagag-a------g---aaat-ca-ga
B D       Crab-eating macaque  ta--ag--gaagag-a------g---aaat-ca-ga
B D                    Baboon  ta--ag--gaagag-a------g---aaat-ca-ga
B D              Green monkey  ta--ag--gaagag-a------g---aaat-ca-ga
B D                  Marmoset  ca--ag--gaagag-a------g---aaat-ca-ga
B D           Squirrel monkey  ca--ag--gaagag-a------g---aaat-ca-ga
B D                  Bushbaby  ca--ag--gcagaa-a------g---aagt-aa-ga
           Chinese tree shrew  ac--ag--gaaggc-a------g---aaat-aa-ga
B D                  Squirrel  ac--ag--gaagg-------------aagt-aa-tg
       Lesser Egyptian jerboa  ac--ag--gaaggg-a------t---aaat-aa-g-
                 Prairie vole  ac--ac--agatgg-a------g---aagt-aa-gg
B D           Chinese hamster  ac--ac--aaatgg-a------g---aaat-aa-gg
               Golden hamster  ac--ac--acatgg-a------g---aaat-aa-gg
B D                     Mouse  ac--ac--aaatgg-a------ga--aaat-aa-ag
B D                       Rat  ac--ac--ggatgg-a------g---aaac-aa-ag
B D            Naked mole-rat  ac--ag--gaaagg-a------g---aaat-aa-ga
B D                Guinea pig  ac--ag--gaaagg-a------g---aaat-aa-ga
                   Chinchilla  ac--ag--gaaagg-a------g---aaag-aa-ga
             Brush-tailed rat  ac--ag--gaaagg-a------g---aaaa-aa-ga
B D                    Rabbit  ac--ag--gaaggg-a------g---aaat-aa-ga
B D                      Pika  ac--ag--gaaggg-a------g---aaat-ta-ga
B D                       Pig  ac--ag--aaaaag-a------gaag----------
B D                    Alpaca  ct--ag--gaaggg-a------gaagaaat-aa-ga
               Bactrian camel  ct--ag--gaaggg-a------gaagaaat-aa-ga
B D                   Dolphin  at--gg--gaaggg-a------gaagaaat----aa
                 Killer whale  at--gg--gaaggg-a------gaagaaat----aa
             Tibetan antelope  at--at--gaaggg-a------ggagaaat----ga
B D                       Cow  at--at--gaaggg-c------ggagaaat----ga
B D                     Sheep  ac--at--gaaggg-a------ggagaaat----aa
                Domestic goat  at--at--gaaggg-a------ggagaaat----ga
B D                     Horse  ac--a---gaaggg-a------gaagaaac-aa-ga
B D          White rhinoceros  ac--ag--gaagag-a------gaacaaat-aa-ga
B D                       Cat  ac--ag--gaaggg-a------ggagaaat-aagga
B D                       Dog  at--ag--gaaggg-a------ggagaaat-aa-ga
B D                   Ferret   ac--ag--gaaggg-a------ggggaaag-aa-ga
B D                     Panda  ac--ag--gaaggg-a------ggggaaat-aa-ga
               Pacific walrus  ac--ag--gaaggg-a------ggcaaaat-aa-ga
                 Weddell seal  ac--ag--gaaggg-a------ggcaaaat-aa-ga
             Black flying-fox  ac--ag--gaaaggtt------gaagaact-aa-ga
B D                   Megabat  ac--ag--gaaagttt------gaagaact-aa-gg
                Big brown bat  ac--ag--gaagga-a------gaagaaag-aa-ga
         David's myotis (bat)  ac--ag--gaaggg-a------gaagaaag-aa-ga
B D                  Microbat  ac--ag--gaaggg-a------gaagaaag-aa-ga
B D                  Hedgehog  ac--ag--gaaggg-agcaaagggaggga-----ga
              Star-nosed mole  ac--ag--gaagag-a------gaagatc-----ga
B D                  Elephant  ac-agg--aagggg-a------a---a----ta-gg
          Cape elephant shrew  gc--tg--aagggg-a------g---a----ga-tt
B D                   Manatee  acggga--aaaggg-a------a---a----ta-ga
             Cape golden mole  gc--ag--gaaggg-a------c---a----ca-ga
B D                    Tenrec  ac--ag--gaagag-a------g---agat-aa-gg
                     Aardvark  ac--at--gaaggg-a------g---aaataaa-ga
B D                 Armadillo  ac--ag--gaaggg-a------g---aaataaa-ga
B D                   Opossum  -----gctgaaggg-t------g---aaat-aa-ag
B D           Tasmanian devil  --------caagag-t------g---aaag-aa-ag
B D                  Platypus  cc--ag--gaagga-c----------aaat--a-aa
  D              Mallard duck  ag--ag--aaaa---c------a---aaag-ca-ga
B D        American alligator  ag--ag--aacagg-g------a---aaaa-ca-aa
B D                Coelacanth  ====================================
B D             X. tropicalis  ====================================
  D               Rock pigeon  ====================================
  D    White-throated sparrow  ====================================
  D            Painted turtle  ====================================
B D                    Lizard  ====================================
B D       Medium ground finch  ====================================
  D       Collared flycatcher  ====================================
  D  Chinese softshell turtle  ====================================
  D              Saker falcon  ====================================
  D           Green seaturtle  ====================================
B D                Budgerigar  ====================================
B D                    Turkey  ====================================
B D                   Chicken  ====================================
B D                   Wallaby  ====================================
  D          Peregrine falcon  ====================================

Inserts between block 8 and 9 in window
  D             Mallard duck 3238bp
B D       American alligator 1bp

Alignment block 9 of 21 in window, 157589625 - 157589632, 8 bps 
B D                     Human  g--ttgctcc
B D                     Chimp  g--ttgctcc
B D                   Gorilla  g--ttgctcc
B D                 Orangutan  g--ttgttac
B D                    Gibbon  g--ttcttct
B D                    Rhesus  g--ctgttcc
B D       Crab-eating macaque  g--ctgttcc
B D                    Baboon  g--ctgttcc
B D              Green monkey  g--ttgttcc
B D                  Marmoset  g--ttgttcc
B D           Squirrel monkey  g--ttgttcc
B D                  Bushbaby  g--tctttcc
           Chinese tree shrew  g--ttgttcc
B D                  Squirrel  t--gtcctgc
       Lesser Egyptian jerboa  ---ttgtttc
                 Prairie vole  c--atgttcc
B D           Chinese hamster  c--atgttcc
               Golden hamster  c--gtgttcc
B D                     Mouse  c--tagttcc
B D                       Rat  c--tcgttcc
B D            Naked mole-rat  c--ttgcatc
B D                Guinea pig  g--ttgtatc
                   Chinchilla  c--ttatgtc
             Brush-tailed rat  c--ttgtgtc
B D                    Rabbit  -----gttcc
B D                      Pika  -----gttcc
B D                       Pig  ------tttc
B D                    Alpaca  g--ttgttcc
               Bactrian camel  g--ttgttcc
B D                   Dolphin  g--ttgtttc
                 Killer whale  g--ttgtttc
             Tibetan antelope  g--ttgcttc
B D                       Cow  g--ttgcttc
B D                     Sheep  g--ttgcttc
                Domestic goat  g--ttacttc
B D                     Horse  g--ttgttcc
B D          White rhinoceros  g--ttgtttc
B D                       Cat  g--ttgttct
B D                       Dog  g--ctgttgt
B D                   Ferret   a--ctgtttt
B D                     Panda  g--ttgttct
               Pacific walrus  g--ttgttct
                 Weddell seal  g--ttgttct
             Black flying-fox  g--ttgttcc
B D                   Megabat  g--ttgttcc
                Big brown bat  g--ttgttcc
         David's myotis (bat)  g--ttgttcc
B D                  Microbat  g--ttgttcc
B D                  Hedgehog  g--tagttcc
              Star-nosed mole  g--ttgttct
B D                  Elephant  g--tcattcc
          Cape elephant shrew  g--ctgcgcc
B D                   Manatee  gactcgctcc
             Cape golden mole  g--ttgctcc
B D                    Tenrec  g--gcggccc
                     Aardvark  g--tcactcc
B D                 Armadillo  a--ttgcttc
B D                   Opossum  t--tggatc-
B D           Tasmanian devil  t--tggacc-
B D                  Platypus  g--ttggacc
B D        American alligator  g--cag----
B D                Coelacanth  ==========
B D             X. tropicalis  ==========
  D               Rock pigeon  ==========
  D    White-throated sparrow  ==========
  D            Painted turtle  ==========
B D                    Lizard  ==========
B D       Medium ground finch  ==========
  D       Collared flycatcher  ==========
  D  Chinese softshell turtle  ==========
  D              Saker falcon  ==========
  D           Green seaturtle  ==========
  D              Mallard duck  ==========
B D                Budgerigar  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
B D                   Wallaby  ==========
  D          Peregrine falcon  ==========

Inserts between block 9 and 10 in window
B D                  Opossum 237bp
B D          Tasmanian devil 10bp
B D                 Platypus 1860bp

Alignment block 10 of 21 in window, 157589633 - 157589642, 10 bps 
B D                     Human  gga--ga--gttag
B D                     Chimp  gga--ga--gttag
B D                   Gorilla  gga--ga--gttag
B D                 Orangutan  gga--ga--attag
B D                    Gibbon  gga--ga--gttag
B D                    Rhesus  gga--ga--gttag
B D       Crab-eating macaque  gga--ga--gttag
B D                    Baboon  gga--ga--gttag
B D              Green monkey  gga--ga--gttag
B D                  Marmoset  -ga--ga--gtttg
B D           Squirrel monkey  gga--ga--atttg
B D                  Bushbaby  aga--ga--gtttg
           Chinese tree shrew  -ca--gc--cttgg
B D                  Squirrel  -ca--ga--gtctg
       Lesser Egyptian jerboa  -cc--ga--gctgg
                 Prairie vole  -ca--ga--gtttg
B D           Chinese hamster  -ca--ga--gtttg
               Golden hamster  -ca--gg--gtttg
B D                     Mouse  -ca--ga--acttg
B D                       Rat  -ca--ga--gtttg
B D            Naked mole-rat  -ca--aagagtttg
B D                Guinea pig  -ca--aagagtttg
                   Chinchilla  -ca--aagcatttg
             Brush-tailed rat  -ta--aa--aagtg
B D                    Rabbit  -ca--gaaagttgg
B D                      Pika  -ca--gaaagttgg
B D                       Pig  -tagagg--gtttt
B D                    Alpaca  -cagaaa--actct
               Bactrian camel  -cggaaa--accct
B D                   Dolphin  -cagaga--gttcg
                 Killer whale  -cagaga--gttcg
             Tibetan antelope  -cacaga--attca
B D                       Cow  -cacaga--gttca
B D                     Sheep  -cacaga--attca
                Domestic goat  -caccga--attca
B D                     Horse  -cagagg--gtttt
B D          White rhinoceros  -cagaga--gtttg
B D                       Cat  -caggga--gcttg
B D                       Dog  -ca--ga--gtttg
B D                   Ferret   -catggg--gtttg
B D                     Panda  -caggga--ctttg
               Pacific walrus  -caggga--atttg
                 Weddell seal  -caggga--gtttg
             Black flying-fox  -cg--ga--gtttg
B D                   Megabat  -cg--ga--gtttg
                Big brown bat  -cg--gg--gtttg
         David's myotis (bat)  -ca--ga--gtttg
B D                  Microbat  -cg--ga--gttcg
B D                  Hedgehog  -ct--ga--gctcc
              Star-nosed mole  -ca--ga--attta
B D                  Elephant  -caaagt--gtttg
          Cape elephant shrew  -cctcag--agttg
B D                   Manatee  -ggcaga--gtttg
             Cape golden mole  -caaaga------g
B D                    Tenrec  -caaagg--gtttg
                     Aardvark  -caaaga--gttcg
B D                 Armadillo  -taagga--gtttg
B D           Tasmanian devil  gag--ga--at---
B D        American alligator  ac------------
B D                Coelacanth  ==============
B D             X. tropicalis  ==============
  D               Rock pigeon  ==============
  D    White-throated sparrow  ==============
  D            Painted turtle  ==============
B D                  Platypus  ==============
B D                    Lizard  ==============
B D       Medium ground finch  ==============
  D       Collared flycatcher  ==============
  D  Chinese softshell turtle  ==============
  D              Saker falcon  ==============
  D           Green seaturtle  ==============
  D              Mallard duck  ==============
B D                Budgerigar  ==============
B D                    Turkey  ==============
B D                   Chicken  ==============
B D                   Wallaby  ==============
B D                   Opossum  ==============
  D          Peregrine falcon  ==============

Inserts between block 10 and 11 in window
B D                      Pig 4bp
B D                   Alpaca 4bp
              Bactrian camel 4bp
B D                  Dolphin 4bp
                Killer whale 4bp
            Tibetan antelope 4bp
B D                      Cow 4bp
B D                    Sheep 4bp
               Domestic goat 4bp
B D                    Horse 7bp
B D         White rhinoceros 7bp
B D                      Cat 56bp
B D                      Dog 1070bp
B D                  Ferret  3bp
B D                    Panda 10bp
              Pacific walrus 10bp
                Weddell seal 10bp
            Black flying-fox 4bp
B D                  Megabat 4bp
               Big brown bat 8bp
        David's myotis (bat) 4bp
B D                 Microbat 4bp

Alignment block 11 of 21 in window, 157589643 - 157589644, 2 bps 
B D                     Human  ct
B D                     Chimp  ct
B D                   Gorilla  ct
B D                 Orangutan  ct
B D                    Gibbon  ct
B D                    Rhesus  ct
B D       Crab-eating macaque  ct
B D                    Baboon  ct
B D              Green monkey  ct
B D                  Marmoset  ct
B D           Squirrel monkey  ct
B D                  Bushbaby  ct
           Chinese tree shrew  cc
B D                  Squirrel  cg
       Lesser Egyptian jerboa  ct
                 Prairie vole  cc
B D           Chinese hamster  cc
               Golden hamster  cc
B D                     Mouse  cc
B D                       Rat  cc
B D            Naked mole-rat  ct
B D                Guinea pig  ct
                   Chinchilla  ct
             Brush-tailed rat  ct
B D                    Rabbit  ct
B D                      Pika  ct
B D                       Pig  tc
B D                    Alpaca  tc
               Bactrian camel  tc
B D                   Dolphin  tc
                 Killer whale  tc
             Tibetan antelope  cc
B D                       Cow  cc
B D                     Sheep  cc
                Domestic goat  cc
B D                     Horse  tt
B D          White rhinoceros  tt
B D                       Cat  tc
B D                       Dog  cc
B D                   Ferret   tc
B D                     Panda  tt
               Pacific walrus  tc
                 Weddell seal  tt
             Black flying-fox  tt
B D                   Megabat  tt
                Big brown bat  tt
         David's myotis (bat)  tt
B D                  Microbat  tt
B D                  Elephant  ct
          Cape elephant shrew  ct
B D                   Manatee  ct
             Cape golden mole  ct
B D                    Tenrec  ct
                     Aardvark  ct
B D                 Armadillo  cg
B D           Tasmanian devil  ct
B D        American alligator  ct
             Star-nosed mole  --
B D                  Hedgehog  --
B D                Coelacanth  ==
B D             X. tropicalis  ==
  D               Rock pigeon  ==
  D    White-throated sparrow  ==
  D            Painted turtle  ==
B D                  Platypus  ==
B D                    Lizard  ==
B D       Medium ground finch  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
  D              Saker falcon  ==
  D           Green seaturtle  ==
  D              Mallard duck  ==
B D                Budgerigar  ==
B D                    Turkey  ==
B D                   Chicken  ==
B D                   Wallaby  ==
B D                   Opossum  ==
  D          Peregrine falcon  ==

Inserts between block 11 and 12 in window
B D                 Bushbaby 4bp
          Chinese tree shrew 4bp
B D          Tasmanian devil 2956bp

Alignment block 12 of 21 in window, 157589645 - 157589651, 7 bps 
B D                     Human  -cttcct-t
B D                     Chimp  -cttcct-t
B D                   Gorilla  -cttcct-t
B D                 Orangutan  -cttcct-c
B D                    Gibbon  -cttcct-t
B D                    Rhesus  -cttcct-t
B D       Crab-eating macaque  -cttcct-t
B D                    Baboon  -cttcct-t
B D              Green monkey  -cttcct-t
B D                  Marmoset  -cttcct-t
B D           Squirrel monkey  -cttcct-t
B D                  Bushbaby  -cttcct-t
           Chinese tree shrew  -cttccc-t
B D                  Squirrel  -cctccg-t
       Lesser Egyptian jerboa  -cttcct-t
                 Prairie vole  -cttcct-c
B D           Chinese hamster  -cttcct-t
               Golden hamster  -cttcct-t
B D                     Mouse  -cttgc--t
B D                       Rat  -cttcct-t
B D            Naked mole-rat  -cttcct-t
B D                Guinea pig  -cttcct-t
                   Chinchilla  -cttcct-t
             Brush-tailed rat  -cttgct-t
B D                    Rabbit  -cttcct-t
B D                      Pika  -cttcct-t
B D                       Pig  -ctttct-t
B D                    Alpaca  -cttcctcc
               Bactrian camel  -cttcctcc
B D                   Dolphin  -tttcct-t
                 Killer whale  -tttcct-t
             Tibetan antelope  -tttcct-t
B D                       Cow  -tttcct-t
B D                     Sheep  -tttcct-t
                Domestic goat  -tttcct-t
B D                     Horse  -ccttcc-t
B D          White rhinoceros  -ccttcc-t
B D                       Cat  -cttcct-t
B D                       Dog  -ctccct-c
B D                   Ferret   -cttcct-t
B D                     Panda  -cttccg-t
               Pacific walrus  -ccgcct-t
                 Weddell seal  -cttcct-t
             Black flying-fox  -ttccct-t
B D                   Megabat  -ttccct-t
                Big brown bat  -cttcct-t
         David's myotis (bat)  -cttcct-t
B D                  Microbat  -cttcct-t
B D                  Elephant  -cttt-c-t
          Cape elephant shrew  -cttcat-t
B D                   Manatee  -cttc-t-t
             Cape golden mole  -cttcct-t
B D                    Tenrec  -ctctgc-t
                     Aardvark  -gttttt-t
B D                 Armadillo  -cttcct-t
B D        American alligator  cctgcct--
             Star-nosed mole  ---------
B D                  Hedgehog  ---------
B D                Coelacanth  =========
B D             X. tropicalis  =========
B D           Tasmanian devil  =========
  D               Rock pigeon  =========
  D    White-throated sparrow  =========
  D            Painted turtle  =========
B D                  Platypus  =========
B D                    Lizard  =========
B D       Medium ground finch  =========
  D       Collared flycatcher  =========
  D  Chinese softshell turtle  =========
  D              Saker falcon  =========
  D           Green seaturtle  =========
  D              Mallard duck  =========
B D                Budgerigar  =========
B D                    Turkey  =========
B D                   Chicken  =========
B D                   Wallaby  =========
B D                   Opossum  =========
  D          Peregrine falcon  =========

Inserts between block 12 and 13 in window
B D                 Squirrel 4bp
      Lesser Egyptian jerboa 4bp
                Prairie vole 4bp
B D          Chinese hamster 4bp
              Golden hamster 4bp
B D                    Mouse 4bp
B D                      Rat 4bp
B D           Naked mole-rat 4bp
B D               Guinea pig 4bp
                  Chinchilla 4bp
            Brush-tailed rat 4bp
B D                   Rabbit 4bp
B D                     Pika 4bp
B D                 Elephant 4bp
         Cape elephant shrew 4bp
B D                  Manatee 4bp
            Cape golden mole 4bp
B D                   Tenrec 4bp
                    Aardvark 4bp
B D                Armadillo 4bp

Alignment block 13 of 21 in window, 157589652 - 157589686, 35 bps 
B D                     Human  tca------ca---------ctgag----ccat--ccaagtgc----tc-ggaaacagt-------gt
B D                     Chimp  tca------ca---------ctgag----ccat--ccaagtgc----tc-ggaaacagt-------gt
B D                   Gorilla  tca------ca---------ctgag----ccat--ccaagtgc----tt-ggaaacagt-------gt
B D                 Orangutan  tca------ca---------ctgag----ctat--ccaagtgc----tc-ggaaacagt-------gt
B D                    Gibbon  tca------ca---------ctgag----ccat--ccaagtgc----tc-ggaaacagt-------gt
B D                    Rhesus  tca------ca---------ctggg----tcat--ccaagtgc----tc-agaaacagt-------gt
B D       Crab-eating macaque  tca------ca---------ctggg----tcat--ccaagtgc----tc-agaaacagt-------gt
B D                    Baboon  tca------ca---------ctggg----tcat--ccaagtgc----tc-agaa--agt-------gt
B D              Green monkey  tca------ca---------ctggg----tcat--ccaagtgc----tc-agaaacagt-------gt
B D                  Marmoset  tca------ca---------cagag----tcat--cc-ggtgc----tc-agaaacagt-------gt
B D           Squirrel monkey  tca------ca---------ctgag----tcat--cc-ggtgc----tt-ggaaacagt-------gc
B D                  Bushbaby  cca------ca---------ctgag----ctct--ccaagtgc----tt-ggagtcagt-------gt
           Chinese tree shrew  cca------ca---------ctgag----ctct--gaaagaac----tt-ggaatcagt-------gt
B D                  Squirrel  cca------cc---------ctgagcacccacc--ctgggaac----t---------gg-------gt
       Lesser Egyptian jerboa  cca------ca---------ctga-----gtct--ccgagggt----tt-ccagtcagt-------gt
                 Prairie vole  cca------ca---------ccga-----cact--tggagagc----tt-cgaggcagt-------ct
B D           Chinese hamster  cca------ca---------ccga-----cact--tggagagc----tt-cgagtcagt-------gt
               Golden hamster  cca------ca---------ccga-----cact--tggagagc----tt-cgagtcagt-------gt
B D                     Mouse  cca------ca---------ccga-----cact--ctgagagc----tt-caagtcact-------gt
B D                       Rat  cca------ca---------ccaa-----cact--ttcggagc----tt-cgagtcact-------gt
B D            Naked mole-rat  cca------ta---------ctgag--------------gtgc----tt-ggagtcagt-------gt
B D                Guinea pig  ctg------ta---------ccgag----tgct--ccaagtgc----ct-ggaggcttt-------gt
                   Chinchilla  cct------tc---------ctgag----cacc--ccaactgc----ct-ggagtcagt-------gt
             Brush-tailed rat  ccc------tc---------ctcag----catt--tcaagtgt----tt-ggagtcagt-------at
B D                    Rabbit  cca------cgcggggctctccgg-----ctct--ccgagtgc----tc-ggaatccat-------at
B D                      Pika  cca------ca----------gaa-----ttct--ctgagtgc----tc-agattcctt-------at
B D                       Pig  cca------cc---------ctcag----ccct--gcaagggc----tg-agaattagt-------ta
B D                    Alpaca  cca------ca---------tgggg----ccct--ccgagggc----tc-agaatcagt-------ac
               Bactrian camel  cca------ca---------cggag----ccct--ccgagggc----tc-agaatcagt-------ac
B D                   Dolphin  cca------ca---------ctgag----ccct--ccaagggc----tc-agaatcagt-------ac
                 Killer whale  cca------ca---------ctgag----ccct--ccaagggc----tc-agaatcagt-------ac
             Tibetan antelope  cca------ca---------atgag----ccct--ccaaaggc----tc-ggcatcagt-------ac
B D                       Cow  cca------ca---------atgag----ccct--ccaaaggc----tc-ggcatcagt-------ac
B D                     Sheep  cca------ca---------atgag----ccct--ccaaaggc----tc-agcatcagt-------ac
                Domestic goat  cca------ca---------atgag----ccct--ccaaaggc----tc-ggcatcagt-------ac
B D                     Horse  cca------cg---------ctgaa----ccct--gtgagcgc----tc-agagtcagt-------gc
B D          White rhinoceros  cca------ca---------gcgag----ccct--ccgagtgc----tc-cgaatccat-------ac
B D                       Cat  ccatccttcta---------ctgaa----ccct--ccgagtgc----tc-agaaccagt-------gc
B D                       Dog  cca------ca---------ctgaa----ccct--ccaagtgc----tc-agacccagtgcctttcgc
B D                   Ferret   cca------ta---------ctgaa----ccat--ccaagtgc----tc-ggaaccaat-------gc
B D                     Panda  ccc------ta---------cttaa----ccct--ccaagtgc----tt-agaaccggt-------gt
               Pacific walrus  cca------ta---------ctgaa----ccct--ccaagtgc----tc-agaaccagt-------gc
                 Weddell seal  cca------ta---------ctgaa----ccct--ccaagtgc----tc-agaaccaat-------gc
             Black flying-fox  aca------cc---------cagag----ctct--ccaaatat----tc-cgaacatgg-------gc
B D                   Megabat  aca------cc---------cagag----ctct--ccaaatat----tc-ggaacatgg-------gc
                Big brown bat  cta------ca---------ttgag----ccct--ccaagtgc----tcactcccgtgg---------
         David's myotis (bat)  cta------ca---------ttgaa----ccct--tcaactgc----tcactgccctgg---------
B D                  Microbat  cta------ca---------ttgag----ccct--ccaactgc----tcactcccatgg---------
B D                  Hedgehog  --------------------ctggg----ccct--gtg-gtgt----tt-ggcatcagt-------gc
              Star-nosed mole  --------------------ttctt----tcct--cca-ctgt----gc-agaatccga-------gc
B D                  Elephant  cca------ca---------ctgag----ctttctaccagtgc----cc-tgagtcagg-------gt
          Cape elephant shrew  cca------ca---------ctggg----ctgcctacaagggt----ct-gaatttagg-------tc
B D                   Manatee  cca------ca---------ctgag----ctctcgaccagtgt----tc-caagccagt-------gt
             Cape golden mole  cca------ca---------ttgag----cta---acaagtactctgtc-tgaatcagt-------gt
B D                    Tenrec  cca------tg---------ctggg----c-----------------tc-tgaatcagt-------gt
                     Aardvark  tca------ct---------ctgag----ctctc----agtgtct--tt-ggaatcagt-------gt
B D                 Armadillo  ccc------tg---------ctgaa----atct--atatgtgc----tc-tgagacagt-------gt
B D                   Opossum  tca------ta---------cagtg----tcct--ccataaac----ta-agaagca-----------
B D        American alligator  ---------tg---------agaag----ccct--taaggta-----tg-gaaatgaat-------gt
B D                Coelacanth  ====================================================================
B D             X. tropicalis  ====================================================================
B D           Tasmanian devil  ====================================================================
  D               Rock pigeon  ====================================================================
  D    White-throated sparrow  ====================================================================
  D            Painted turtle  ====================================================================
B D                  Platypus  ====================================================================
B D                    Lizard  ====================================================================
B D       Medium ground finch  ====================================================================
  D       Collared flycatcher  ====================================================================
  D  Chinese softshell turtle  ====================================================================
  D              Saker falcon  ====================================================================
  D           Green seaturtle  ====================================================================
  D              Mallard duck  ====================================================================
B D                Budgerigar  ====================================================================
B D                    Turkey  ====================================================================
B D                   Chicken  ====================================================================
B D                   Wallaby  ====================================================================
  D          Peregrine falcon  ====================================================================

Inserts between block 13 and 14 in window
            Cape golden mole 233bp
B D                   Tenrec 16bp

Alignment block 14 of 21 in window, 157589687 - 157589700, 14 bps 
B D                     Human  cttttaaggaggtg----
B D                     Chimp  cttttaaggaggtg----
B D                   Gorilla  cttttaaggaggtg----
B D                 Orangutan  cttttaaggaggtg----
B D                    Gibbon  cttttaaggaggtg----
B D                    Rhesus  cttttaaggaggtg----
B D       Crab-eating macaque  cttttaaggaggtg----
B D                    Baboon  cttttaaggaggtg----
B D              Green monkey  cttttaaggaggtg----
B D                  Marmoset  tctttaaggaggtg----
B D           Squirrel monkey  cctttaaggaggtg----
B D                  Bushbaby  cttttaaggaggtg----
           Chinese tree shrew  cttatagggaggtg----
B D                  Squirrel  ctcttggggggtgc----
       Lesser Egyptian jerboa  ctcctaaaaaggca----
                 Prairie vole  -ttttaagaaggtg----
B D           Chinese hamster  cttttaagaaggtg----
               Golden hamster  cttttaagaaggtg----
B D                     Mouse  cttttaagaaggtg----
B D                       Rat  cttttaagaaggtg----
B D            Naked mole-rat  ct-ttaaggaggtg----
B D                Guinea pig  ct-ttaaggaggtg----
                   Chinchilla  ct-ttaaggaggtg----
             Brush-tailed rat  ct-ttaaggagttg----
B D                    Rabbit  cttttatggaggtg----
B D                      Pika  cttttg------------
B D                       Pig  tcttttaagaggtg----
B D                    Alpaca  ctgttgaagaggtg----
               Bactrian camel  ctgttgaagaggtg----
B D                   Dolphin  attttgaagaggtg----
                 Killer whale  attttgaagaggtg----
             Tibetan antelope  cttttgaagaggtg----
B D                       Cow  cttttgaagaggtg----
B D                     Sheep  cttttgaagaggtg----
                Domestic goat  cttttgaagaggtg----
B D                     Horse  ctctcaaggaggtg----
B D          White rhinoceros  ctttcgaggaggtg----
B D                       Cat  cttttgagaaaatg----
B D                       Dog  ctttcgagtagccc----
B D                   Ferret   cttttgaggacatg----
B D                     Panda  cttttgaagagatg----
               Pacific walrus  cttttgaggagatg----
                 Weddell seal  cttttgaggagatg----
             Black flying-fox  cttttgaggacgtg----
B D                   Megabat  cttttgaggatgtg----
                Big brown bat  cttctgaggaggtg----
         David's myotis (bat)  tttctgaggaggtg----
B D                  Microbat  cttctgaggaggtg----
B D                  Hedgehog  ctttccaggaggtg----
              Star-nosed mole  attttgaggaagtc----
B D                  Elephant  cttctggggaagta----
          Cape elephant shrew  ttttttgggagaag----
B D                   Manatee  cttttggggaggtg----
B D                    Tenrec  ttccttggggagtg----
                     Aardvark  cttttgaggaagta----
B D                 Armadillo  gttttggggaggta----
B D                   Opossum  ---tcagactgatg----
B D        American alligator  --tttccaaaggcagctt
B D                Coelacanth  ==================
B D             X. tropicalis  ==================
B D           Tasmanian devil  ==================
  D               Rock pigeon  ==================
  D    White-throated sparrow  ==================
  D            Painted turtle  ==================
B D                  Platypus  ==================
B D                    Lizard  ==================
B D       Medium ground finch  ==================
  D       Collared flycatcher  ==================
  D  Chinese softshell turtle  ==================
  D              Saker falcon  ==================
  D           Green seaturtle  ==================
  D              Mallard duck  ==================
B D                Budgerigar  ==================
B D                    Turkey  ==================
B D                   Chicken  ==================
B D                   Wallaby  ==================
  D          Peregrine falcon  ==================
            Cape golden mole  ==================

Alignment block 15 of 21 in window, 157589701 - 157589702, 2 bps 
B D                     Human  tg
B D                     Chimp  tg
B D                   Gorilla  tg
B D                 Orangutan  tg
B D                    Gibbon  tg
B D                    Rhesus  tg
B D       Crab-eating macaque  tg
B D                    Baboon  tg
B D              Green monkey  tg
B D                  Marmoset  tg
B D           Squirrel monkey  tg
B D                  Bushbaby  tc
           Chinese tree shrew  tg
B D                  Squirrel  ag
       Lesser Egyptian jerboa  tg
                 Prairie vole  ag
B D           Chinese hamster  ag
               Golden hamster  ag
B D                     Mouse  ag
B D                       Rat  ag
B D            Naked mole-rat  tg
B D                Guinea pig  tg
                   Chinchilla  tg
             Brush-tailed rat  tg
B D                    Rabbit  tg
B D                       Pig  ta
B D                    Alpaca  tg
               Bactrian camel  tg
B D                   Dolphin  ta
                 Killer whale  ta
             Tibetan antelope  tg
B D                       Cow  tg
B D                     Sheep  tg
                Domestic goat  tg
B D                     Horse  tg
B D          White rhinoceros  tg
B D                       Cat  ta
B D                       Dog  tg
B D                   Ferret   cg
B D                     Panda  tg
               Pacific walrus  tg
                 Weddell seal  tg
             Black flying-fox  tg
B D                   Megabat  tg
                Big brown bat  gc
         David's myotis (bat)  gg
B D                  Microbat  gg
B D                  Hedgehog  tg
              Star-nosed mole  aa
B D                  Elephant  tg
          Cape elephant shrew  tg
B D                   Manatee  tg
             Cape golden mole  ta
B D                    Tenrec  tg
                     Aardvark  tg
B D                 Armadillo  tg
B D                   Opossum  tg
B D        American alligator  ca
B D                Coelacanth  ==
B D             X. tropicalis  ==
B D                      Pika  --
B D           Tasmanian devil  ==
  D               Rock pigeon  ==
  D    White-throated sparrow  ==
  D            Painted turtle  ==
B D                  Platypus  ==
B D                    Lizard  ==
B D       Medium ground finch  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
  D              Saker falcon  ==
  D           Green seaturtle  ==
  D              Mallard duck  ==
B D                Budgerigar  ==
B D                    Turkey  ==
B D                   Chicken  ==
B D                   Wallaby  ==
  D          Peregrine falcon  ==

Inserts between block 15 and 16 in window
B D                   Tenrec 191bp

Alignment block 16 of 21 in window, 157589703 - 157589705, 3 bps 
B D                     Human  tt---a
B D                     Chimp  tt---a
B D                   Gorilla  tt---a
B D                 Orangutan  tt---a
B D                    Gibbon  ttatga
B D                    Rhesus  ttatga
B D       Crab-eating macaque  ttatga
B D                    Baboon  ttatga
B D              Green monkey  ttatga
B D                  Marmoset  ttatga
B D           Squirrel monkey  ttatga
B D                  Bushbaby  ttatga
           Chinese tree shrew  ttgtga
B D                  Squirrel  tctgaa
       Lesser Egyptian jerboa  tcatgg
                 Prairie vole  ccatga
B D           Chinese hamster  ccatga
               Golden hamster  ccatga
B D                     Mouse  tcatga
B D                       Rat  tcatga
B D            Naked mole-rat  ctgtga
B D                Guinea pig  ttatga
                   Chinchilla  ccatga
             Brush-tailed rat  ctatga
B D                    Rabbit  gtaaga
B D                       Pig  tcatga
B D                    Alpaca  ttatga
               Bactrian camel  ttatga
B D                   Dolphin  tgatga
                 Killer whale  tgatga
             Tibetan antelope  ttatga
B D                       Cow  ttatga
B D                     Sheep  ttatga
                Domestic goat  ttatga
B D                     Horse  ttagga
B D          White rhinoceros  ttatga
B D                       Cat  ttatga
B D                       Dog  ttacaa
B D                   Ferret   ttatga
B D                     Panda  ttatga
               Pacific walrus  ttatga
                 Weddell seal  ttatga
             Black flying-fox  ttataa
B D                   Megabat  ttataa
                Big brown bat  ttatga
         David's myotis (bat)  ttatga
B D                  Microbat  ttatga
B D                  Hedgehog  tggtga
              Star-nosed mole  tgatga
B D                  Elephant  tta---
          Cape elephant shrew  tta---
B D                   Manatee  tta---
             Cape golden mole  taa---
B D                    Tenrec  tga---
                     Aardvark  tta---
B D                 Armadillo  tta---
B D                   Opossum  ---tag
B D        American alligator  tta---
B D                Coelacanth  ======
B D             X. tropicalis  ======
B D                      Pika  ------
B D           Tasmanian devil  ======
  D               Rock pigeon  ======
  D    White-throated sparrow  ======
  D            Painted turtle  ======
B D                  Platypus  ======
B D                    Lizard  ======
B D       Medium ground finch  ======
  D       Collared flycatcher  ======
  D  Chinese softshell turtle  ======
  D              Saker falcon  ======
  D           Green seaturtle  ======
  D              Mallard duck  ======
B D                Budgerigar  ======
B D                    Turkey  ======
B D                   Chicken  ======
B D                   Wallaby  ======
  D          Peregrine falcon  ======

Inserts between block 16 and 17 in window
B D                  Manatee 207bp
                    Aardvark 223bp

Alignment block 17 of 21 in window, 157589706 - 157589706, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
       Lesser Egyptian jerboa  c
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  t
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  a
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D        American alligator  t
B D                Coelacanth  =
B D             X. tropicalis  =
B D                      Pika  -
B D           Tasmanian devil  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D            Painted turtle  =
B D                  Platypus  =
B D                    Lizard  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D              Saker falcon  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  =
B D                   Wallaby  =
B D                   Opossum  -
  D          Peregrine falcon  =
B D                  Squirrel  -

Inserts between block 17 and 18 in window
B D                 Elephant 221bp
         Cape elephant shrew 1094bp
B D                Armadillo 3bp

Alignment block 18 of 21 in window, 157589707 - 157589707, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  g
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  t
              Star-nosed mole  t
B D                  Elephant  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D        American alligator  t
B D                Coelacanth  =
B D             X. tropicalis  =
B D                      Pika  -
B D           Tasmanian devil  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D            Painted turtle  =
B D                  Platypus  =
B D                    Lizard  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D              Saker falcon  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  =
B D                   Wallaby  =
B D                   Opossum  -
  D          Peregrine falcon  =
         Cape elephant shrew  =
B D                  Squirrel  -

Inserts between block 18 and 19 in window
B D       American alligator 5704bp

Alignment block 19 of 21 in window, 157589708 - 157589786, 79 bps 
B D                     Human  tgccaggctagacttttctacccga-gcca--ctttctgattt-attccaggtcaggacaaatttgaatc
B D                     Chimp  tgccaggctagacttttctacctga-acca--ctttctgattt-attccaggtcaggacaaatttgaatc
B D                   Gorilla  tgccaggctagacttttctacccga-gcca--ctttctgattt-attccaggtcaggacaaatttgaatc
B D                 Orangutan  tactaggctagacttttctacccga-gcca--ctttctgattt-attccacgtcaggacaaatttgaatc
B D                    Gibbon  tgccaggctagacttttctacccga-gcca--ctttctgattt-attccaggtcaggacaaatttgaatc
B D                    Rhesus  tgccaggctggatttttctacctga-gcca--ctttctgattt-attccaggtaaggacaaatttgaatc
B D       Crab-eating macaque  tgccaggctggatttttctacctga-gcca--ctttctgattt-attccaggtaaggacaaatttgaatc
B D                    Baboon  tgccaggctggatttttctacctga-gcca--ctttctgattt-attccaggtaaggacaaatttgaatc
B D              Green monkey  tgccaggctggatttttctacctga-gaca--ctttctgattt-aatccaggtaaggacaaatttgaatc
B D                  Marmoset  tgccacactggacttttctacctga-acca--ctttctgattt-attccaggtcaggacaaatttgagtc
B D           Squirrel monkey  tgccacactagacttttctacctga-gcca--ctttctgattt-atttcaggtcaggacaaatttgaatc
B D                  Bushbaby  tgtcaggctggacttttctgcttga-tcta--ctttctaatat-attccaggtcaaaacaaatttgcatc
           Chinese tree shrew  tgttaggttggac-tttctgcttga-tcca--ctttctaatct-atttcaggtcaagacaaatttgcttc
B D                  Squirrel  ---------aggccttgttgcctca-tcct--atttccaatct-actccaggtcaaggccaatttgcatc
       Lesser Egyptian jerboa  tgccagcctggacttttctgtgtgatttgc--ct---taatcc-attccaggtcaagacaaatttgcatc
                 Prairie vole  tgctggcttgggcttgtctttgtgaccccc--ctttctaatct-attccagatcaagacaaatttgcatc
B D           Chinese hamster  tgctggctttggcttttctttgtga-tccc--ctttctaatct-attccagatcaagacaaatttgcatc
               Golden hamster  tgctggctttggcttttctttgtgattccc--ctttctaatct-attccagatcaagacaaatttgcatc
B D                     Mouse  tgctggccttggcttttctttgtga-tccc--cattctaatct-attccagatcaagacgaatttgcatc
B D                       Rat  tgctggcctcggcttttctttgtga-tccc--cattctaatct-attccagatcaagacgaatttgcatc
B D            Naked mole-rat  tgctaggctgcacttttctgcatga-tcca--ctttctaatct-attccaggtcaagacaaatttgcatc
B D                Guinea pig  tgttaggctggacttttaggcctgc-tcca--ctttctaatct-gttccaggtcaagacaaatttgcatt
                   Chinchilla  tgctaggctgggcttttcgccatga-tgcc--ctctctaatct-actccaggtcaagacacatttgcatc
             Brush-tailed rat  ttctaggctggacttttcggcatga-tcca--cttcctgatct-attccagctcaagacaaatttgcatc
B D                    Rabbit  cgccaggctggact---------gc-tcca--ctttctgatct-ctaccaggtcaagacaaatttgcatc
B D                      Pika  ----aggctggacttttgggccagg-tcca--catgctgagct-ataccaggtcaagacaaatttgcatc
B D                       Pig  tgccaggctgggtttttctg-ctga-tcca--ctttctaatct-attccaggtcaagacaaatttgcatc
B D                    Alpaca  tgccaggctggactttcctgcctga-tcca--ctttctaatct-attccaggtcaagacaaatttgcatc
               Bactrian camel  tgccaggctggacgttcctgcctga-tcca--ctttctaatct-attccaggtcaagacaaatttgcatc
B D                   Dolphin  tgccaggctggacttttctgcctga-tcca--ctttctaatct-attccaggtccagacagataagcatc
                 Killer whale  tgccaggctggacttttctgcctga-tcca--ctttctaatct-attccaggtccagacagataagcatc
             Tibetan antelope  tgccagtctgagctttcctgcctga-tcca--ctttctaatct-attccaggtcaagacaaatttgcatt
B D                       Cow  tgccaggctgagctttcctgcctga-tcca--ctttctaatct-attccaggtcaagaaaaatttgcatt
B D                     Sheep  tgccaggctgagctttcctgcctga-tcca--ctttctaatct-attccaggttaagacaaatttgcatt
                Domestic goat  tgccaggctgagctttcctgcctga-tcca--ctttctaatct-attccaggtcaagacaaatttgcatt
B D                     Horse  tgccaggctgggctgttctgcctga-tcca--ctttctaatct-cttcccggtcaggacaaatatgcatc
B D          White rhinoceros  tgccaggctggactgtcctgtctga-tcca--ctttctaatct-gttctcagtcaggacaaatttgcatc
B D                       Cat  tgtcagtccggacttttctgcccaa-tcca--catcctaatct-attccaggtcaaaacaaatttgcatc
B D                       Dog  tgcccggctggactttcctgcctga-cccc--cttcctaatct-agtctagctaaagacaattttgcatc
B D                   Ferret   tgctgggctggacttttctgcccca-tcct--cttcctaatct-attctagctcaaggcaaatttacatc
B D                     Panda  tgcctggctagactttcctgcctga-tcca--cttcctaagct-attccagctcaagacaaatttgcatc
               Pacific walrus  tgcccagctgggcttttctgcctga-tcca--tttcctaatct-gttctagctcaagacaaattggcatc
                 Weddell seal  tgcccagctggacttttctgcctga-tcca--cttcctaatct-gttctagctcaagacaaatttgcatc
             Black flying-fox  tgtcaggctggacttttctgcctga-tttg--ctttctaatct-attccaggtcaagacaaacttatgtt
B D                   Megabat  tgtcaggctggacttttctgcttga-tttg--ctttctaatct-attccaggtcaagacaaacttatgtt
                Big brown bat  tgccaggcaggacttttctgcctat-ttca--ctttctaatct-actccaggtcaagacaaactggcatc
         David's myotis (bat)  tgccgggcaggatattactgcctct-ttca--cgttctaatct-actccaggtcaagacaaactggcatc
B D                  Microbat  tgccgggcaggacttttctgcctct-ttca--ctttctaatct-actccaggtcaagacaaactggcatc
B D                  Hedgehog  tgcaaggctgaatttttctgcctgg-cctg--ctttctaacct-attccaggtccagacaaatttgcatt
              Star-nosed mole  taccaggctgaaccttgctgtctgg-gtca--tgttctcttct-attctaggtcaaggaatatttgtatc
B D                  Elephant  ctccaggctgggcttttctgcctga-tcca--ctctctagtct-gatccagggcaaaattactttgcatc
B D                   Manatee  ttccagtctggactgttctgtctaa-tcca--ctctctagtct-attccagggcaaaattaatttgcatc
             Cape golden mole  tgtcaggctagatttttctgtctga-gtca----ctctaatct-gttccaagactaaattaattttcatc
B D                    Tenrec  tgccaggctcgccttttctgtctga-cccatgctctctcatctccccccagggcaaagtgaaattgcatc
                     Aardvark  tgccaggagggacttttctgtttga-taca--ccttctaat-t-attccaggacaaaattaatttgcctc
B D                 Armadillo  tgctaggctagacttttctgcctga-tcca--ctttctcatct-attctaggttaagacaaatatgcatc
B D                   Opossum  ----ggctttgatttt----------ttta--atttcaagttt-cttctaggttaagaaaaatgtgaatc
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D           Tasmanian devil  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
  D            Painted turtle  ======================================================================
B D                  Platypus  ======================================================================
B D                    Lizard  ======================================================================
B D       Medium ground finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Saker falcon  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================
  D          Peregrine falcon  ======================================================================
         Cape elephant shrew  ======================================================================

                        Human  --ttgggttaggca-c
                        Chimp  --ttgggttaggca-c
                      Gorilla  --ttgggttaggca-c
                    Orangutan  --ttgggttaggca-c
                       Gibbon  --ttgggttaggca-c
                       Rhesus  --ttgggttaggca-c
          Crab-eating macaque  --ttgggttaggca-c
                       Baboon  --ttgggttaggca-c
                 Green monkey  --ttgggttaggca-c
                     Marmoset  --ttgggttagaca-c
              Squirrel monkey  --ttgggttagaca-c
                     Bushbaby  --tcgagttaggca-c
           Chinese tree shrew  --ttgggttaggca-c
                     Squirrel  --ttgggtgaggca-c
       Lesser Egyptian jerboa  --ctgtgttaggca-c
                 Prairie vole  --ttgggttaggca-c
              Chinese hamster  --ttgggttcggca-c
               Golden hamster  --tcgagttaggca-c
                        Mouse  --ttgagctaggca-c
                          Rat  --ctgggctaggca-c
               Naked mole-rat  --ttgtgctaggcatg
                   Guinea pig  --ttgggctaggca-a
                   Chinchilla  --ttgggctcggca-a
             Brush-tailed rat  --ttgggctacgc--a
                       Rabbit  --ttgggttaggca-c
                         Pika  --ttgggttaggca-c
                          Pig  --ttgagttag-ca-c
                       Alpaca  --ttgagcgaggca-c
               Bactrian camel  --ttgagcgaggca-c
                      Dolphin  --ttgagttaggca-c
                 Killer whale  --ttgagttaggca-c
             Tibetan antelope  --gtgagttagaca-c
                          Cow  --gtgagttagaca-c
                        Sheep  --gtgagttagaca-c
                Domestic goat  --gtgagttagaca-c
                        Horse  --ttgggttaggcc-c
             White rhinoceros  --tcaggttaggca-c
                          Cat  --ttatgttaggca-c
                          Dog  --ttatgtgaggca-c
                      Ferret   --ttatgttaggca-c
                        Panda  --ttatgttaggca-c
               Pacific walrus  --ctatgttaggca-c
                 Weddell seal  --tgatgttaggca-c
             Black flying-fox  --ttgggttaggca-c
                      Megabat  --ttgggttaggca-c
                Big brown bat  --ccatgttagcca-c
         David's myotis (bat)  --tcctgtgagcca-c
                     Microbat  --tcctgttagcca-c
                     Hedgehog  --gtgtgttaagca-c
              Star-nosed mole  --tcattctagaca-c
                     Elephant  --ttggactaggca-t
                      Manatee  --ttgggctaggca-c
             Cape golden mole  --ttgatctaggta-c
                       Tenrec  --ttgggctgggca-c
                     Aardvark  --ttaggctaggca-c
                    Armadillo  --ttggtttaggca-c
                      Opossum  ttttaggataaaca-g
                   Coelacanth  ================
                X. tropicalis  ================
              Tasmanian devil  ================
                  Rock pigeon  ================
       White-throated sparrow  ================
               Painted turtle  ================
                     Platypus  ================
                       Lizard  ================
          Medium ground finch  ================
          Collared flycatcher  ================
     Chinese softshell turtle  ================
                 Saker falcon  ================
              Green seaturtle  ================
                 Mallard duck  ================
                   Budgerigar  ================
                       Turkey  ================
                      Chicken  ================
                      Wallaby  ================
           American alligator  ================
             Peregrine falcon  ================
          Cape elephant shrew  ================

Alignment block 20 of 21 in window, 157589787 - 157589875, 89 bps 
B D                     Human  ttaataattcttattgctga-gaattaatttct-acatacagcagaagggacaca-t-----------aa
B D                     Chimp  ttaataattcttattgctga-gaattaatttct-acatacagcagaagggacaca-t-----------aa
B D                   Gorilla  ttaataattcttattgctga-g----aatttct-acatacagcagaagggacac--t-----------aa
B D                 Orangutan  ttaataattcttattgctga-gaattaatttct-acatacagcagaagggacaca-t-----------aa
B D                    Gibbon  ttaataattcttattgctga-gaattaatttct-acatacagcagaagggacaca-t-----------aa
B D                    Rhesus  ttaataattcttattgctga-gaattaatttct-acatacagcagaagggacacatt-----------aa
B D       Crab-eating macaque  ttaataattcttattgctga-gaattaatttct-acatacagcagaagggacacatt-----------aa
B D                    Baboon  ttaataattcttattgctga-gaattaatttct-acatacagcagaagggacacatt-----------aa
B D              Green monkey  ttaataattcttattgctga-gaattaatttct-acatatagcagaagggacacatt-----------aa
B D                  Marmoset  ttaataattcttattgctga-gaattaatttct-ccatacagcagaagggac--ata-----------ga
B D           Squirrel monkey  ttaataattcttattgctga-gaattaattttt-ccatacagcagaagggacatata-----------aa
B D                  Bushbaby  ctcataatgcttattgccaa-gaattaatttct-acatacagcagaagggacaca-t-----------ta
           Chinese tree shrew  ttaataagtgttattaccat-gaattaatttcc-ccttctagcagaagggacatgtt-----------aa
B D                  Squirrel  gtagtaattcttatggctga-gaattaatttct-acacacagcggaaggaacccat------------aa
       Lesser Egyptian jerboa  gtaataatccttattgctga-aaattagttcct-gtgcacagcggaaagggcacat-------------a
                 Prairie vole  ataataattcttattgcaga-gaattagttctt-acatccagcggaaaggccacat-------------a
B D           Chinese hamster  ataataactcttattgccga-gaattagttctt-acatccagcggaaaggacacat-------------a
               Golden hamster  ataataactcttattgccga-gaattagttctt-acatccagcggaaagcacacat-------------a
B D                     Mouse  gtaataattcttattgctga-gaattagttctt-acatgtagcggaaagggcacat-------------a
B D                       Rat  gtaataattcttattgctgc-gaattagttctt-acattcagcggaaagggcacat-------------a
B D            Naked mole-rat  gaaataattcttattgctga-gacttcatttct-acacccagaggaaggaaaacat-------------a
B D                Guinea pig  gtaataattcttattgctga-gccttctcttct-acacccacaggaaggaaagcat-------------a
                   Chinchilla  gtaataattcttattgctga-accttcatttct-gcacccagaggaaggaaaacat-------------a
             Brush-tailed rat  gtaataattcttattgctga-gccttcatttct-gcacccagaggaaggaaaacat--------------
B D                    Rabbit  ttaataattcttgttgctca-gaatcggtttct-acctacagcagaagggacacatt-----------aa
B D                      Pika  ttcataa---------------------tttct-acctatagcagaagggacacatt-----------aa
B D                       Pig  ttcatatttcttattgctga-gaatgaatttct-accaataaaagaagggacacat-------------a
B D                    Alpaca  ttcataattcttattgctga-gaatgaagttct-accaataaaagcagggacacat-------------a
               Bactrian camel  ttcataattcttattgctga-gaatgaagttct-accaataaaagcagggacacat-------------a
B D                   Dolphin  ttcataattcttattgctga-gaatgaatttct-accaataaaagtagggacacat-------------a
                 Killer whale  ttcataattcttattgctga-gaatgaatttct-accaataaaagtagggacacat-------------a
             Tibetan antelope  ttcataattcttattgctga-gaatgaatttct-accaataaaagtagggacacat-------------a
B D                       Cow  ttcataattcttattgctga-gaatgaatttct-accaataaaagtagggacacat-------------a
B D                     Sheep  ttcataattcttattgctga-gaatgaatttct-accaataaaagtagggacacat-------------a
                Domestic goat  ttcataattcttattgctga-gaatgaatttct-accaataaaagtagggacacat-------------a
B D                     Horse  ctaataattcttattgctga-gacttaattgct-accaataaaggaaagaacacat------------ga
B D          White rhinoceros  ttaataattcttattgctga-gaactaattgct-accaataaaggaagggacacat------------ga
B D                       Cat  ttaataattcttattactga-gaattaatgtct-acatatagaggaaggggcacat------------aa
B D                       Dog  ttaacaattcttattgctgagggatgaatttct-acgtacagaggaagggacacat------------aa
B D                   Ferret   ttaataattctcattgagaa-gaatgactttct-acgtatagaggaagggacacat------------aa
B D                     Panda  ttaataattctcattgctga-ggatgaatttct-acatacagaggaagggacacat------------aa
               Pacific walrus  ttaataattctcattgctga-gaatgaatttct-acatatagaggaagggacacat------------aa
                 Weddell seal  ttaataatactcattgctga-gaatgaatttct-gcacatagaggaagggacacat------------aa
             Black flying-fox  ttaataattcttattactga-gaattaatttct-acatatagagaaaggg----ct------------at
B D                   Megabat  ttaataattcttattactga-gaattaatttct-acatatagagaaaggg----ct------------ac
                Big brown bat  ttaacagttctgatggctga-gaattaatttct-gcatgtaggaagaaca----ca------------ta
         David's myotis (bat)  ttaaccattcttatggctga-gaattaatttct-gcatgtaggaagaaca----ca------------ta
B D                  Microbat  ttaaccattcttatggctga-gaattaatttct-gcatggagggagaaca----ca------------ta
B D                  Hedgehog  ttaataattcttattgctaa-gaattaacttct-acacggaaaggaagagacacat-------------a
              Star-nosed mole  ttaataattcttattgc--------taatttct-acatctatgggaagagacatgg-------------a
B D                  Elephant  ttagtgatgcttattactga-gggttaatttcc-acacatagaagaagggacccat------------aa
          Cape elephant shrew  ttaaaaatacttattactga-gaattaat----------------gagaaatacat------------aa
B D                   Manatee  ttaatgactcttattactgg-gaatgaatttct-atatatagggaaagggacacat------------aa
             Cape golden mole  ttaacaactct-atggctga-gaagtaatttct-acatgtagagaacaggacacattttaa-------aa
B D                    Tenrec  ttaataattctcatgcctga-gaatcagtttcc-acctagagaggg-agggaacattaaaaccaaaccaa
                     Aardvark  ttaataactcttattactga-gaattaatttct-ataaatagaggaaagggcacat------------aa
B D                 Armadillo  gcaataactcttgttgctgg-ggattaatttctaacatagagaagaagggacacat------------aa
B D                   Opossum  taaatagttc-----------taacttatttct-gcata-aggatgaatgatagat--------------
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D           Tasmanian devil  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
  D            Painted turtle  ======================================================================
B D                  Platypus  ======================================================================
B D                    Lizard  ======================================================================
B D       Medium ground finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Saker falcon  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================
  D          Peregrine falcon  ======================================================================

                        Human  aaaa--------------------------------------gaa------ctta-------ttttc---
                        Chimp  aaaa--------------------------------------gaa------ctta-------ttttc---
                      Gorilla  aaaa--------------------------------------gaa------ctta-------ttttc---
                    Orangutan  aaaa--------------------------------------gaa------ctta-------ttttc---
                       Gibbon  aaaa--------------------------------------taa------ctta-------ttttc---
                       Rhesus  aaaa--------------------------------------taa------ctta-------ttttc---
          Crab-eating macaque  aaaa--------------------------------------taa------ctta-------ttttc---
                       Baboon  aaaa--------------------------------------taa------ctta-------ttttc---
                 Green monkey  aaaa--------------------------------------taa------ctta-------ttttc---
                     Marmoset  aaaa--------------------------------------taa------ctta-------gtttc---
              Squirrel monkey  aaaa--------------------------------------taa------ctta-------gtttc---
                     Bushbaby  agaa--------------------------------------taa------cttg-------ttatc---
           Chinese tree shrew  aaaa--------------------------------------aaaaaaagtcttg-------ctatc---
                     Squirrel  aaaa--------------------------------------taa------ctgg-------ttatc---
       Lesser Egyptian jerboa  aaaa--------------------------------------taa------cttg-------ttatc---
                 Prairie vole  aaaa--------------------------------------taa------cttg-------ttatcg-a
              Chinese hamster  aaaa--------------------------------------taa------cttg-------ttatcg--
               Golden hamster  aaaa--------------------------------------taa------cttg-------ttatcg--
                        Mouse  aaaa--------------------------------------taa------cttg-------ttatcg--
                          Rat  aaaa--------------------------------------taa------cttg-------ttatcgaa
               Naked mole-rat  aaaa--------------------------------------taa------cttg-------ttatc---
                   Guinea pig  aaaa--------------------------------------taa------cttg-------ttatc---
                   Chinchilla  aaaa--------------------------------------taa------cttg-------ttatc---
             Brush-tailed rat  aaaa--------------------------------------tac------tttg-------ttatc---
                       Rabbit  aaaa--------------------------------------tac------ctcg-------ttatt---
                         Pika  gaaa--------------------------------------tag------cttg-------ttatt---
                          Pig  aaaa--------------------------------------taa------cttc-------ttact---
                       Alpaca  aaaa--------------------------------------taa------cttg-------ttact---
               Bactrian camel  aaaa--------------------------------------taa------cttg-------ttact---
                      Dolphin  aaaa--------------------------------------taa------cttg-------tttct---
                 Killer whale  aaaa--------------------------------------taa------cttg-------tttct---
             Tibetan antelope  aaaa--------------------------------------taa------cttg-------ttact---
                          Cow  aaaa--------------------------------------taa------cttg-------ttact---
                        Sheep  aaaa--------------------------------------taa------cttg-------ttact---
                Domestic goat  aaaa--------------------------------------taa------cttg-------ttact---
                        Horse  aaaa--------------------------------------taa------cttg-------ttctc---
             White rhinoceros  aaaa--------------------------------------tca------cttg-------ttatc---
                          Cat  aaaa--------------------------------------taa------attg-------ttacc---
                          Dog  aaaa--------------------------------------taa------attg-------ttatc---
                      Ferret   aaaa--------------------------------------taa------gctg-------ctatc---
                        Panda  aaaa--------------------------------------taa------actg-------ttatc---
               Pacific walrus  aaaa--------------------------------------taa------attg-------ttatc---
                 Weddell seal  aaaa--------------------------------------taa------attg-------ttatc---
             Black flying-fox  aaga--------------------------------------aaa------cttg-------ttatt---
                      Megabat  aaga--------------------------------------aaa------cttg-------ttatt---
                Big brown bat  aaaa--------------------------------------taa------cttg-------ttatt---
         David's myotis (bat)  aaaa--------------------------------------taa------cttg-------ttatg---
                     Microbat  aaaa--------------------------------------taa------cttg-------ttatt---
                     Hedgehog  aaaa--------------------------------------taa------ctgg-------ttagc---
              Star-nosed mole  aaaa--------------------------------------ttg------cttacttttacttatt---
                     Elephant  aaaa-------------------------------------ggaa------cttt-------t---c---
          Cape elephant shrew  aaaa--------------------------------------gaa------ttca-------t---c---
                      Manatee  aaagaacttctcccaaagtaaggagcaccctggcgttgggtggaa------cttc-------t---c---
             Cape golden mole  agag------------------------------------------------------------------
                       Tenrec  acag--------------------------------------------------------------c---
                     Aardvark  aaga----------------------------------------a------cttc-------t---c---
                    Armadillo  aaaa-----------------------------------ttaaaa------cttg-------tta-t---
                      Opossum  -gta--------------------------------------taa------tttt-------ttttg---
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
              Tasmanian devil  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
                     Platypus  ======================================================================
                       Lizard  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================
             Peregrine falcon  ======================================================================

                        Human  -t------agaagtactggcata-t
                        Chimp  -t------agaagtactggcata-t
                      Gorilla  -t------agaaatactggcata-t
                    Orangutan  -t------agaagtactggcata-t
                       Gibbon  -t------agaagtactgacata-t
                       Rhesus  -t------agaagtactggcata-t
          Crab-eating macaque  -t------agaagtactggcata-t
                       Baboon  -t------agaagtactggcata-t
                 Green monkey  -t------agaagtactggcata-t
                     Marmoset  -t------acaagtactggcata-t
              Squirrel monkey  -g------tcaagtactggcata-t
                     Bushbaby  -c------aaaagtactagaata-t
           Chinese tree shrew  -c------aaaagaactggaata-t
                     Squirrel  -a------aaaagtagtggaata-g
       Lesser Egyptian jerboa  -a------aaaagtaatggaata-t
                 Prairie vole  aa------aaaagtaatggaata-t
              Chinese hamster  -a------aaaagtaatggaata-t
               Golden hamster  -a------gaaagtaatggaata-t
                        Mouse  -a------aaaaggaatggaata-t
                          Rat  aa------aaaagtaatggaata-t
               Naked mole-rat  -a------aaaagtaatggaata-t
                   Guinea pig  -a------aaaagcaatggaata-t
                   Chinchilla  -a------aaaagtaatggaata-t
             Brush-tailed rat  -a------aaaagtaatggaata-t
                       Rabbit  -a------aaaagtaatggaata-t
                         Pika  -a------aacggtaatgggata-t
                          Pig  -c------aaaagtactagaata-t
                       Alpaca  -c------aaaagtactagaata-t
               Bactrian camel  -c------aaaagtactagaata-t
                      Dolphin  -t------aaaagtactagaata-t
                 Killer whale  -t------aaaagtactagaata-t
             Tibetan antelope  -c------aaaagtactagaatg-t
                          Cow  -c------aaaagtactagaata-t
                        Sheep  -c------aaaagtattagaata-t
                Domestic goat  -c------aaaagtactagaata-t
                        Horse  -c-------aaagtactaggata-t
             White rhinoceros  -c------aaaagtactagaaca-t
                          Cat  -c------caaagtactagaata-t
                          Dog  -c------caaagtaggagaata-t
                      Ferret   -c------caaagtagaagaata-t
                        Panda  -c------caaagtaggagaata-t
               Pacific walrus  -c------caaagtaagagaata-t
                 Weddell seal  -c------caaagtaggagaata-t
             Black flying-fox  -c------aaaagtactagaata-t
                      Megabat  -c------aaaagtactagaata-t
                Big brown bat  -c------aaaagtactagaaca-t
         David's myotis (bat)  -c------aaaagtactagaaca-t
                     Microbat  -c------aaaagtactagaaca-t
                     Hedgehog  -t------aaacatactagcata-t
              Star-nosed mole  -tttttacaaataatctagagta-t
                     Elephant  -c------cggagtactggaaca-t
          Cape elephant shrew  -t------caaagtcctggacta-g
                      Manatee  -c------caaagta--agaata-g
             Cape golden mole  ---------agagaaatggaata-t
                       Tenrec  -c------caaagtcctggaata-c
                     Aardvark  -c------caacgtattggaatatt
                    Armadillo  -c------caa--------aata-t
                      Opossum  -t------atgaattttggaata-t
                   Coelacanth  =========================
                X. tropicalis  =========================
              Tasmanian devil  =========================
                  Rock pigeon  =========================
       White-throated sparrow  =========================
               Painted turtle  =========================
                     Platypus  =========================
                       Lizard  =========================
          Medium ground finch  =========================
          Collared flycatcher  =========================
     Chinese softshell turtle  =========================
                 Saker falcon  =========================
              Green seaturtle  =========================
                 Mallard duck  =========================
                   Budgerigar  =========================
                       Turkey  =========================
                      Chicken  =========================
                      Wallaby  =========================
           American alligator  =========================
             Peregrine falcon  =========================

Inserts between block 20 and 21 in window
B D                  Opossum 5934bp

Alignment block 21 of 21 in window, 157589876 - 157590363, 488 bps 
B D                     Human  cagggattcttgcacggaaagtttcatttagcacattttt-aaaaactcc-ttctaaagttagcctgatg
B D                     Chimp  cacggattcttgcacggaaagtttcatttagcacattttt-aaaaactcc-ttctaaagttagcctgatg
B D                   Gorilla  cagggattcttgcacggaaagtttcatttagcacattttt-aaaaactcc-ttctaaagttagcctgatg
B D                 Orangutan  cagggattcttgcacagaaagtttcatttggcacattttt-aaaaactcc-ttctaaagttagcctaatg
B D                    Gibbon  cagggattcttgcacagaaagtttcatttagcacattttt-aaaaactcc-ttctaaagttagcctaatg
B D                    Rhesus  cagggattcttgcacagaaagtttcatttagcacattttttaaaaactcc-ttctaaagttagcctaatg
B D       Crab-eating macaque  cagggattcttgcacagaaagtttcatttagcacatttttaaaaaactcc-ttctaaagttagcctaatg
B D                    Baboon  cagggattcttgcacagaaagtttcatttagcacatttttaaaaaactcc-ttctaaagttagcctaatg
B D              Green monkey  cagggattcttgcacagaaagtttcatttagcacattttttaaaaactcc-ttctaaagttagcctaatg
B D                  Marmoset  cagggattcttgcacagaaagtttcatttagcacatttta-aaaaactcc-ttctaaagttagccaaatg
B D           Squirrel monkey  ca-ggattcttgcacagaaagtttcatttagcacatttta-aaaaacacc-ttctaaagttagcctaatg
B D                  Bushbaby  taaggatgttttaacagaaactttcacccagcacattctt-tgaatctcc-ttttaaaattggcctaatg
           Chinese tree shrew  tataaattattgcccagaaagtttcagttagcacatcttt-aaaaactcc-ttctaaagctagtgtaatg
B D                  Squirrel  taagagtgcctgaatgtaaagtttcctttagcacattctc-taaaggtcc-ttctgcagagagtcgaatg
       Lesser Egyptian jerboa  taaggatttttgcacataaaatttcatttagcacattctt-taaaacttc-tcctaaagctaacgtaatg
                 Prairie vole  taaagattcttgcacataaagttttgtttagcacattcct-cggaactgctttctaaagctactctaatg
B D           Chinese hamster  taaagattcttgcacataaagttttgtttagcacattcct-caaaactgc-ttctaaagctagcctaatg
               Golden hamster  taaagattcttgcacataaagttttgtttagcacattcct-caaaactgc-ttctaaagctagcctaatg
B D                     Mouse  taaagattctttcacataaagttttgtttagcacattcct-caaaactgc-ttctaaagctagcctaatg
B D                       Rat  taaagattcttgcacataaagttttgtttagcacattcct-cagaactgc-ttctaaagagggcctaatg
B D            Naked mole-rat  taaggattcttgcacataaagtttcatttagcaaattctt-taaaactcc-atctaaatctagcttaatg
B D                Guinea pig  taaggattcctgcgtataaagtttcatttagcacattctt-taaaacttc-ttctaaagctagcctaatg
                   Chinchilla  taaggattcctgcccataaagtttcatttagcacattctt-taaaactcc-ttctaaagctagcctaatg
             Brush-tailed rat  taagtattactgtacataaagtttcatttagcacattctt-tagaattcc-ttctaaagctagcctaatg
B D                    Rabbit  taagaattcctacacagaaagttccagttagcacattctt-taaggctcc-ttctaaagctaccctaatg
B D                      Pika  taagaattcctacacagaaagttccagttagcacattctt-taaggctcc-ttctaaagctaccctaatg
B D                       Pig  taaagattcttagacagaaagtttcatttagcacatgctt-taaaactcc-ttctaaagctaccctaatg
B D                    Alpaca  taaagattcttagacagaaagtttcatttagcacatgctt-taaaactcc-ttctaaagctagcctaatg
               Bactrian camel  taaagattcttagacagaaagtttcatttagcacatgctt-taaaactcc-ttctaaagctagcctaatg
B D                   Dolphin  taaatattcttagacagaaagtttcatttagcacatgctt-taaaattcc-ttctagagctagcctaacg
                 Killer whale  taaatattcttagacagaaagtttcatttagcacatgctt-taaaattcc-ttctagagctagcctaacg
             Tibetan antelope  taaagattcttagacagaaagtttcatttagcacatactt-taaaattcc-ttctaaagctagcctaatg
B D                       Cow  taaagattcttagacagaaagtttcatttagcacatactt-taaaattcc-ttctaaagctagcctaatg
B D                     Sheep  taaagattcttagacagaaagtttcatttagcacatactt-taaaattcc-ttctaaagctagcctaatg
                Domestic goat  taaagattcttagacagaaagtttcatttagcacatactt-taaaattcc-ttctaaagctagcctaatg
B D                     Horse  taaagactcttacacagaaagtttcatttagcacatgctt-tcaaactcc----taaagctagcatagtg
B D          White rhinoceros  taaagacacttacacagaaagtttcatttagcatatgctt-tcaaactct----taaagctagcctagtg
B D                       Cat  taaagattattgtccagaaagtttcatttcacgcatgcca-taaaactcc-ttctaaagctagcctaatg
B D                       Dog  taaagattcctgcccagaaagtttcatttaacacatgcta-taaaactcc-ctctaaagctggcctaatg
B D                   Ferret   taaagattcttgcccagaaagtttcatttaacacatgtta-taaaactcc-ttctaaagctagcctaatg
B D                     Panda  taaagatccttgcccagaaagtttcatttaacacatgcta-taaaactcc-ttctaaagctagcctaatg
               Pacific walrus  taaagattcttgcccagaaagtttcatttaacacatgcta-taaaactcc-ttataaagctagcctaatg
                 Weddell seal  taaagattcttgcctaggaagtttcatttaacacatgcta-taaaactcc-ttatgaagctagcctaatg
             Black flying-fox  taaagattcttg-acagaaagtttcatttagcacatgctt-taaaattcc-ttctaaagctagcctaata
B D                   Megabat  taaagattcttg-acagaaagtttcatttagcacatgctt-taaaattcc-ttctaaagctagcctaata
                Big brown bat  tacaaattcttgcacacgcagtttcacttagcacatgctt-taaatctcc-t---aaagctagcctaatg
         David's myotis (bat)  tacaaattcttgcacatgcagtttcatttagcacatgctt-taaaactcc-t---aaagctagcctaatg
B D                  Microbat  tacaaattcttgcacatgcagtttcatttagcacacgctt-taaaactcc-t--aaaagctagcctaacg
B D                  Hedgehog  taaagatcattgcacagagagtttcatatagcacgttctt-tacaactct-ttcaaaagctcacctaacg
              Star-nosed mole  taaagatttttgaata-aaagtttcactt--cacattctt-taaaactcc-tgctaaagctagcctaatg
B D                  Elephant  caaggattcttgcatggagagtttcatttagcacattccg-taaaagccc-ttttaaagctagcctaatg
          Cape elephant shrew  taaggacttttgcatggaaagtttcattcagcacattcct-taaaagccc-ttctaaagcgagcctaatg
B D                   Manatee  taaggattcttgcaaggaaa-tttcgtttcacacattcc--taaaagccc-ttttaaagctagcctaagg
             Cape golden mole  taaagattcgtattcagagagtttcatttagcacattcct-taaaagtct-ttct-aagctagcttaatg
B D                    Tenrec  tgaaggtttgtgcacagaaagtttcatttagcacattcct-taaaagcgc-ttctaaagagagcctaatg
                     Aardvark  taatgattcttgcacgaaaagtttcatttagcacattcct-taaaagctc-tcctaaagctagcctaatg
B D                 Armadillo  taaggat------------agttt---------cattctt-taaaagc-c-ttttaaagctagcctaacc
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D           Tasmanian devil  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
  D            Painted turtle  ======================================================================
B D                  Platypus  ======================================================================
B D                    Lizard  ======================================================================
B D       Medium ground finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Saker falcon  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
  D          Peregrine falcon  ======================================================================

                        Human  gcaattcagaaa--acatta-gtgagttttggaagg--------tt---ttt----ttt-------cc--
                        Chimp  gcaattcagaaa--acatta-gtgagttttggaagg------tttt---ttt----ttt-------cc--
                      Gorilla  gcaattcagaaa--acatta-gtgagttttggaagg-------ttt---ttt----ttt-------cc--
                    Orangutan  gcaattcagaaa--acatta-gtgagttttggaagg-------ttt---ttt----ttc-------cc--
                       Gibbon  gcaattcagaaa--acatta-gtgagttttggaagg--------tt---ttt----ttt-------cc--
                       Rhesus  gcaattcagaaa--acatta-gtgagttttggaacg---tttttat---ttt----ttt-------cc--
          Crab-eating macaque  gcaattcagaaa--acatta-gtgagttttggaacg---tttttat---ttt----ttt-------cc--
                       Baboon  gcaattcagaaa--acatta-gtgagttttggaacg---tttttat---ttt----ttt-------cc--
                 Green monkey  gcaattcagaaa--acatta-gtgagttttggaaca---tttttat---ttt----ttt-------cc--
                     Marmoset  gcaattcagaaa--acatta-gtgagttttggaatt-------ctc---ccc----gcc-------cc--
              Squirrel monkey  gcaattcagaaa--acatta-gtgaattttggaagt-------ttt---att----ttc-------ct--
                     Bushbaby  ataattcagaaa--atatca-gtgaactttggaagg-------ttc---ttc----accccccca-cc--
           Chinese tree shrew  gcaactcaagaa--atattt-gtgagttttggaagt---ttttttt---ttt----ccc-------tc--
                     Squirrel  gcaactcaggaa--acatga-gtgagtttcggaagg-------ttg---ttt--------------tc--
       Lesser Egyptian jerboa  gcaatccaggaa--acatta-gtgagttttgggagg-------ttt---ttt----tttttttttaac--
                 Prairie vole  gcaattcaggaa--acatta-ctgagtttgggaact-------ttt---tc---------------cc--
              Chinese hamster  gcaattcaggaa--acatta-ctgagtttgggaac--------ttt---tc---------------cc--
               Golden hamster  gcaattcaggaa--acatta-ctgagtttgggaac--------tcc---cc---------------cc--
                        Mouse  gcgattcaggaa--acatta-gggagtttgggaact-------ttt---tct----c---------cc--
                          Rat  gcagctcaggaa--acatta-gtgagtttgggaact-------ttt---tct--------------cc--
               Naked mole-rat  gaaattcaggaa--acatta-gtgagttttggaaga-------ttt---ttt----t---------ct--
                   Guinea pig  gaaattcaggaa--acatta-ctgcgttttggaagg-------ttt---ttt----cc--------gt--
                   Chinchilla  gaaattcaggaa--acatta-gtgagttttggaggg-------ttt---ttt----tc--------ct--
             Brush-tailed rat  ggtattcaggaa--acatta-gtgagttttggaatg-------ttt---ttt----t---------ct--
                       Rabbit  gcaattcaggaa--acatta-gtgagttttggaagg-------gtt---ttc--------------cc--
                         Pika  gctattcaggaa--acatta-gtgagttttggaagg-------ttt---ctt--------------cccc
                          Pig  gcaattcaggaa--acatta-gtgagttttggaagg-------ttt---ttt---------------c--
                       Alpaca  gcaattcaggaa--acatta-gtgagttttagaagg--------tt---ccc----c---------cc--
               Bactrian camel  gcaattcaggaa--acattaggtgagttttagaagg---------c---ccc----c---------cc--
                      Dolphin  gcaattcaggga--acatta-gtgagcttggggagg-------ttt---ttt---------------c--
                 Killer whale  gcaattcaggga--acatta-gtgagcttggggagg-------ttt---ttt---------------c--
             Tibetan antelope  gcaattcaggaa--acatta-gtgagttttggaagg-------ttt---ttt----t---------cc--
                          Cow  gcaattcaggaa--acatta-gtgagttttggaagg-------ttt---ttt----t---------cc--
                        Sheep  gcaattcaggaa--acatta-gtgagttttggaagg-------ttt---ttt----t---------cc--
                Domestic goat  gcaattcgggaa--acatta-gtgagttttggaagg-------ttt---ttt----t---------cc--
                        Horse  ggaattcaagaa--acgtta-gtgagttttggaagg--------tt---ttg----t---------tc--
             White rhinoceros  gcaattcaggaa--acatta-gtgagttttggaagg-------ctt---ttt----t---------tc--
                          Cat  gaaattcaggaa--acatta-gtgagttttggaagg-------ttt---tct----t---------cc--
                          Dog  gcaatccaggac--acatta-gtgggtttgggaagg-------tcc-ctccc----c---------cc--
                      Ferret   gcaattcaggaa--acatta-gtgagttttggaagg-------ttttttttt----c---------cc--
                        Panda  gcaattcaggaa--acatta-gtgagtttgggaagg-------ttt--tttt----t---------cc--
               Pacific walrus  gcaattcaggaa--acatta-gtgagttttggaagg-------tttatcctc----c---------cc--
                 Weddell seal  gcaattcaggaa--acatta-gtgagttttggaagg-------ttt---ttt----c---------cc--
             Black flying-fox  gtaattcaggaa--acatta-ctgttttt---------------------------t---------tc--
                      Megabat  gtaattcaggaa--acatta-ctgttttt---------------------------t---------tc--
                Big brown bat  gcgattcaggaa--acatta-gtaagttt-ggaagg-------ttttttttttccac---------cc--
         David's myotis (bat)  gtgattcaggacttacatta-gtaagttt-ggaagg-------ttc----------c---------cc--
                     Microbat  gcgattcaggacttacatta-gtaagttt-ggaagg-------tcc----------c---------cccc
                     Hedgehog  gcaattcaggaa--acatta-gtgagcgttggaaag-------gtt----tt----t---------gt--
              Star-nosed mole  gcaattcaggaa--acattt-gttacttttggaaga-------ttt----tt----t---------gc--
                     Elephant  gcaattcagaaa--ac--aa-atgagttttggaagt----tttttt---ttt----t---------tc--
          Cape elephant shrew  gtaattcagaaa--ac--aa-atgtatttgaggag------agttc---ccc----c---------ac--
                      Manatee  gcaattcagaaa--acataa-atgagttttggaag--------att---gtt----t---------tc--
             Cape golden mole  gcaattcaaaat--gcataa-atgagtttgggaaggtttttacccc---cac----c---------cc--
                       Tenrec  gcaattcaacaa--acataa-atgagtttgggaagg----cgccct---ggc----c---------aa--
                     Aardvark  gcaattcagaaa--acataa-atgagttttggaa------tttttt---ttt----t---------tt--
                    Armadillo  aaaagtcaggaa--acatta-ataagttttagatgg---------g---ttt----c---------cc--
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
              Tasmanian devil  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
                     Platypus  ======================================================================
                       Lizard  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
             Peregrine falcon  ======================================================================

                        Human  ----------cccatt-gaaatcaaaaccc----cattaaggaatgcacggtgggaagagggagaagaaa
                        Chimp  ----------cccatt-gaaatcaaaaccc----cattaaggaatgcacagtgggaagagggagaagaaa
                      Gorilla  ----------cccatt-gaaatcaaaaccc----cattaaggaatgcacagtgggaagagggagaagaaa
                    Orangutan  ----------tccatt-gaaatccaaaccc----cattaaggaatgcatggtgggaagagggagaagaaa
                       Gibbon  ----------cccatt-gaaatcaaaaccc----ctttaaggaatgcgtggtgggaagagggagaggaaa
                       Rhesus  ----------cccatt-gaaatcaaaaccc----cattaaggaatgcatggtgggaagagagagaagaaa
          Crab-eating macaque  ----------cccatt-gaaatcaaaaccc----cattaaggaatgcatggtgggaagagagagaagaaa
                       Baboon  ----------cccatt-gaaatcaaaaccc----cattaaggaatgcatggtgggaagagagagaagaaa
                 Green monkey  ----------cccatt-gaaatcaaaaccc----cattaaggaatgcatggtgggaagagagagaagaaa
                     Marmoset  ----------cacatt-taaatcaaaaccc----cattaaggaatgcatagtgggaagagggagaagaaa
              Squirrel monkey  ----------ctcatt-gaaatcaaaaccc----cattaaggaatgcatagtgggaagaaggagaagaaa
                     Bushbaby  ----------cccact-gaaatcaaaaccc----cgttaaagaatgcgtggcaggaacagggaggaggaa
           Chinese tree shrew  ----------ccaatc-taaatcaagaacc----cattaaagaatgcctggtgggaagagggaagagaaa
                     Squirrel  ----------cccatt-gagatcaaaaccaaacgcattaaagaatgcgt-ttggagattaaggggagaga
       Lesser Egyptian jerboa  ----------cccatt-gaaatcaaaaccc----tattaaagaatgaatggtggg-agagggaagaaaaa
                 Prairie vole  ----------cccatt-aaaatcaaaaccc----cattaaagaatgaatggtgggaagagagaggagaaa
              Chinese hamster  ----------cccatt-aaaatcaaaaccc----cattaaagaatgaatggtgggaagagggaggagaaa
               Golden hamster  ----------cccatc-aaaatcaaaaccc----cattaaagaatgaatggtgggaagagggaggagaca
                        Mouse  ----------cccatt-aaaatcaaaaccc----cattaaagagtgcatggtgggaagaaggaggggaaa
                          Rat  ----------cccatt-aaaatcaaaaccc----cattaaagaatgaatggtgggaagaaggaggggaaa
               Naked mole-rat  ----------cccatt-gaaatcaaaaccc----cgttaaagaatgtatgatgggaagaaggaggagaag
                   Guinea pig  ----------cccatt-gaaatcaaaatcc----tgttaaagaatgtatgatgggaagaaggaagagaag
                   Chinchilla  ----------ctcatt-gaaatcaaaatcc----tgttaaagaacgtatgatgggaaga---aggagcag
             Brush-tailed rat  ----------cccatt-gaaatcaaaatcc----tgttgagaaatgtatgatgggaagagggaggagaag
                       Rabbit  ----------ctcatt-gaaaccaaaaccc----cattacagaacacgtagtgagaag----aaggttct
                         Pika  ccccccccgtcccact-gaaatcaaaaccc----cattacagaacacatagtgggaag----agggttct
                          Pig  ----------cccatt-ga-atcaaaaccc----cattaaagtatgcatagtggggaaaaggaggagaaa
                       Alpaca  ----------tccatt-ga-atcaaaaccc----cattaaagtaagcataggggggaaaaggaggaaaaa
               Bactrian camel  ----------cccatt-ga-atcaaaaccc----cattaaagtaagcataggggggaaaaggaggaaaaa
                      Dolphin  ----------cccact-ga-atcaaaaccc----cattaacgtttgcatagtggggaaaaggaggagaaa
                 Killer whale  ----------cccact-ga-atcaaaaccc----cattaacgtttgcatagtggggaaaaggaggagaaa
             Tibetan antelope  ----------cccatt-ga-atcaaaaccc----cattaaagaaggcatagtggggaaaagg-ggagaaa
                          Cow  ----------cccggt-ga-atcaaaaccc----cattaaagtatgcatagtggggaaaagg-ggagaaa
                        Sheep  ----------cccgtt-ga-atcaaaaccc----cattaaagaatgcatagtgggaaaaagg-ggagaaa
                Domestic goat  ----------cccgtt-ga-atcaaaaccc----cattaaagaatgcatagtgggaaaaagg-ggagaaa
                        Horse  ----------cccgtt-ga-atcaaaaccc----cattaaattgtgcatggtggg-gaggggaggagaaa
             White rhinoceros  ----------cccgtt-ga-atcaaaaccc----aattaaatcgtgcatggtagg-gaagggaggagaaa
                          Cat  ----------cccatt-ga-atcagaaccc----cattaaagtatgcatggtggggaaagggaggagaga
                          Dog  ----------cccatt-ga-atcaaaaccc----cattaaagtctgcatgctggg-aaagagaggagaaa
                      Ferret   ----------cccatt-ga-atcaataccc----cattaaaatatgcatggtgggaaaagggaggagaaa
                        Panda  ----------cccatt-ga-atcaaaaccc----cattaaagtatgcatggtggggaaagggaggagaaa
               Pacific walrus  ----------cccact-ga-atcaaaaccc----cattaaagtatgcatggtggggaaagggaggagaaa
                 Weddell seal  ----------cccatt-ga-atcaaaaccc----cattaaagtatgcatggtggggaaagggaggagaaa
             Black flying-fox  ----------cccatt-ga-attaaatccc----tattaaagtttgcatggttaggaaagggtgagggga
                      Megabat  ----------cccatt-ga-attaaatccc----tattaaagttcgcatggttaggaaagggtgagggga
                Big brown bat  ----------cccatt-aa-attaaatccc----catt-aagtatgcatggttgaaaaa-ggggatgaaa
         David's myotis (bat)  ----------cccatt-ga-attaaatctc----catt-aagtatgcatggttgaaaaagggggatgaaa
                     Microbat  ca--------cccatt-ga-attaaatccc----catt-aagtatgcatgattgaaaaagggggatgaaa
                     Hedgehog  ----------cccact-ga-attgaaactc----cattaaagtatgcattgtggggaaag----------
              Star-nosed mole  ----------cccttt-ga-atcaaaactc----cgctaaactatgcatggtgaggaagggg-ggaggca
                     Elephant  ----------tctcct-ga-atcaaaaccc----tattaaagcacgcatggtgaagagcagga---gaaa
          Cape elephant shrew  ----------ctcttt-ga-atcaaaaccc----tattaaagcatacatggcggagagcaagaggtgaaa
                      Manatee  ----------ccccct-ga-atc---------------aaagtgtgcctggcggatagcagggggagaaa
             Cape golden mole  ----------cacccc-aa-atcgaactct----cattaaagtgtgcatggtatagaacaggagaagcaa
                       Tenrec  ----------caacccgaa-atcaaaatcc----cattacagcacgctcggtggagaacaggaagagaaa
                     Aardvark  ----------tttcct-aa-accaaaaccc----cattaaagcatgcatggtggagagcaggaggagaaa
                    Armadillo  ----------tccatt-gg-atcaaaaccc----cattaaagcatggatgctggggggagggagaagaaa
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
              Tasmanian devil  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
                     Platypus  ======================================================================
                       Lizard  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
             Peregrine falcon  ======================================================================

                        Human  gcttacttgtagacaaataata---------------------------cccatgaactt--taatgcat
                        Chimp  gcttacttgtagacaaataata---------------------------cccatgaactt--taatgcat
                      Gorilla  gcttacttgtagacaaataata---------------------------cccatgaactt--taatgcat
                    Orangutan  gcttacttgtagacaaataata---------------------------cccatgaactt--taatgcat
                       Gibbon  gcttacttgtagacaaatagta---------------------------cccatgaactt--taatgcat
                       Rhesus  gcttacttgtagacaaatagta---------------------------cccatgaactt--taatacat
          Crab-eating macaque  gcttacttgtagacaaatagta---------------------------cccatgaactt--taatacat
                       Baboon  gcttacttgtagacaaatagta---------------------------cccatgaactt--taatacat
                 Green monkey  gcttacttgtagacaaatcgta---------------------------cccatgaactt--taatacat
                     Marmoset  gcttacttgtagacaaatagta---------------------------cccacgaactt--taatgcat
              Squirrel monkey  gcttacttgtagacaaatagta---------------------------cccatgaactt--taatgcat
                     Bushbaby  acttacttgtggacaaatagta---------------------------cccatgaactt--caatgcat
           Chinese tree shrew  gctcgcttgtggacagacagta---------------------------cccatgaactt--taatgcat
                     Squirrel  gcttgcttgtggacaaacagta---------------------------cccgtgaactt--taatgcat
       Lesser Egyptian jerboa  gcttacttgtggacaaacagta---------------------------tctatgaactt--cagtctat
                 Prairie vole  ----gcttgtggacaaatagta-----------------------------cgcgaacct--cggtgcat
              Chinese hamster  gcttgcttgtggacaaatagta----------------------------ccatgaacct--cggtgcat
               Golden hamster  gcttgcttgtggacaaatagta----------------------------ccatgaacct--cggtgcat
                        Mouse  gcttacttgtggacaaatagta----------------------------cggtgaacct---ggtacat
                          Rat  gcttacttgtggacaaatattg----------------------------ccgcgaacct---ggtgcat
               Naked mole-rat  gctcacttgtggacagatagta---------------------------ctcatgaactt--taatgcat
                   Guinea pig  gctcgcttgtggacagatagta---------------------------cccatgaactt--taatgcat
                   Chinchilla  gctcga-tgtggacagatagga---------------------------cccatgaactt--taatgcat
             Brush-tailed rat  gctcgc-tgtggacagatagtg---------------------------cccatgaactt--taatgcat
                       Rabbit  cctgacttgtggacacatagta---------------------------cccatgaactt--taatgcat
                         Pika  cctcacttgtggacacatagta---------------------------cccatgaactt--taatgcat
                          Pig  gcttacttgtggacaaatagta---------------------------cccatgaactt--taatgcat
                       Alpaca  gcttacttgtggacaaatagta---------------------------cccatgaactt--taatgcat
               Bactrian camel  gcttacttgtggacaaatagta---------------------------cccatgaactt--taatgcat
                      Dolphin  gcttacttgtggacaaatagta---------------------------tccatgaactt--taatgcat
                 Killer whale  gcttacttgtggacaaatagta---------------------------tccatgaactt--taatgcat
             Tibetan antelope  gcttgcttgtggacaaatagta---------------------------cccatgaactt--taatgcat
                          Cow  gcttacttgtggacaaatagta---------------------------cccatgaactt--taatgcat
                        Sheep  gcttacttgtggacaaatagta---------------------------cccatgaactt--taatgcat
                Domestic goat  gcttacttgtggacaaatagta---------------------------cccatgaactt--taatgcat
                        Horse  gcttacttgtggacaaatagta---------------------------cccatgaactc--gaatgcat
             White rhinoceros  gcttacttgtggacaaatagta---------------------------cccatgaactt--gaatgcat
                          Cat  gctcacttgtggacaaatagtc---------------------------cccatgaactt--taatgcgt
                          Dog  gctcacttgtggacaaatagta---------------------------cccatgaactt--taatgcat
                      Ferret   gctcacttgtggacaaacagta---------------------------cccatgaactt--taatgcgc
                        Panda  gctcacttgtggacaaatagta---------------------------cccatgaactt--taatgcgt
               Pacific walrus  gctcacttgtggacaaatagta---------------------------cccatgaactt--taatgcgt
                 Weddell seal  gctcacttgtggacaaatagta---------------------------cccatgaactt--taatgcgt
             Black flying-fox  gcttacttgtggacaaatagta---------------------------cccatgaactt--taatgcat
                      Megabat  gcttacttgtggacaaatagta---------------------------cccatgaactt--taatgcat
                Big brown bat  gcttacttgtggacaaatagta---------------------------tccatgaactt--taatacat
         David's myotis (bat)  gcttacttgtggacaaatagta---------------------------tccatgaactt--taatacat
                     Microbat  gcttacttgtggacaaatagta---------------------------tccatgaactt--taatacat
                     Hedgehog  -ctgacttgtggacaaacagta---------------------------tccctaaactt--gagtgcat
              Star-nosed mole  acttacttgtggacaaatagta---------------------------cccctgaactt--gagtgcac
                     Elephant  gcttgcttgtggacagacagta---------------------------cccatgaactttctaatacgt
          Cape elephant shrew  gcttgcttgtggacaaacagaactttagtatattaaaaatacttactacctcatgaactt--taatacat
                      Manatee  gcttgcttgtggacagatagta---------------------------cccatgaactttttaatacgt
             Cape golden mole  gcttgcttgtggacaaatagta---------------------------cccatgaactt--tagtgcat
                       Tenrec  gcttgtttgtggacaaatagtg---------------------------ctcatgaac-t--tggtgcac
                     Aardvark  gcttgcttgtggacaaagagtgtg-------------------------cctgtgaactt--taatatat
                    Armadillo  gtttacttgtggacaaatagta---------------------------tccatgaactt--taatacat
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
              Tasmanian devil  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
                     Platypus  ======================================================================
                       Lizard  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
             Peregrine falcon  ======================================================================

                        Human  taaaatggattcataag-tttttcaaagatgagaaacatgtgtccaattattgtaagattcaccactcct
                        Chimp  taaaatggattcataag-tttttcaaagatgagaaacatgtgtccaattattgtgagattcaccactcct
                      Gorilla  taaaatggattcataag-tttttcaaagatgagaaacatgtgtccaattattgtgagattcaccactcct
                    Orangutan  taaaatggattcataag-tttttcaaagatgagaaacatgtgtccaattattgtgagattcaccactcct
                       Gibbon  taaaatggattcataag-tttttcaaagatgagaaacatgtgtccaattattgtgagattcaccactcct
                       Rhesus  taaaatggattcataag-tttttcaaagatgagaaacatgtgtccaattattgtgagattcaccactcct
          Crab-eating macaque  taaaatggattcataag-tttttcaaagatgagaaacatgtgtccaattattgtgagattcaccactcct
                       Baboon  taaaatggattcataag-tttttcaaagatgagaaacatgtgtccaattattgtgagattcgccactcct
                 Green monkey  tcaaatggattcataag-tttttcaaagatgggaaacatgtgtccaattattgtgagattcgccactcct
                     Marmoset  taaaatggattcataag-ttcttcaaagatgagaaacatgtgtccaattattgtgagattcaccactcct
              Squirrel monkey  taaaatggtttcataag-ttcttcaaagatgagaaacatgtgtccaattattgtgagattcaccactcct
                     Bushbaby  taaagtggattcataag-ttcttcgaagatgaaaaacatgtgtccaattattgtgagattcaccactcct
           Chinese tree shrew  taaaatggattcataag-ttcttcaaagatgaaaaccatgtgtcaaattattgtgagagtcatcactcct
                     Squirrel  taaaatcgatgcaaaca-tcctttgaggatgaaaaacacgtgtcccatca--ttaagattcctcgctgct
       Lesser Egyptian jerboa  taaaatggatgcatgag-gtcttcgaagatgaaaaccatgtgtccacttg-tctgagagtcaccactcca
                 Prairie vole  taaaatgaacgcatgag-gtcttcggagatgaaaaccatgtgtccaattactgtgagcctcgctgcccct
              Chinese hamster  taaaatgaatgcatgag-gtcttcgaagatgaaaaccatgtgtccaattactgtgagcttcgctgcccct
               Golden hamster  taaaatgaatgcatgag-gtcttcgaagatgaaaaccatgtgtccaattactgtgagcttcgctgcccct
                        Mouse  taaaatgaatgcatgag-gtcttcgaagatgaaaaccatgtggccaattactgtgagcttccctggccct
                          Rat  taaaatgaatgcatgag-gtcttcgaagatgaaaaccatgtggccaattactgtgagcttcact-gcccc
               Naked mole-rat  taaaatggatgcataagtttttttgaagatgagaaacatatgtccaattattatgagatgcactgctcct
                   Guinea pig  taaaatggatgcataag-ttcttcgaagatgagaaacatatgtccaattattgtgagattcaccgctcct
                   Chinchilla  taaaatggatgcataag-ttcttcgaagatgagaaacatatgtccaattactgtgagattctccgctcct
             Brush-tailed rat  taaaatggatgcataag-ttcttcgaagatgagaaacatatgtccaattattgtgagattcaccgctcct
                       Rabbit  tgaaatggattcatacg-tttttcaaagatgaaaaacatgtgtccaattattgtgagattcaccactcct
                         Pika  tgaaatggattcatacg-ttctttggagatgaaaaacatgtgtccaattattgtgagattcaccactcct
                          Pig  taaaatggattcataag-ttcttcttagatgaaaaacatgtgtccaattattgttagattcaccactcct
                       Alpaca  taaaatggattcataag-ttcttctaagatgaaaaacatgtgtccaattattgtgagattcaccactcct
               Bactrian camel  taaaatggattcataag-ttcttctaagatgaaaaacatgtgtccaattattgtgagattcaccactcct
                      Dolphin  taaaatggattcataag-ttcttctaagatgaaaaacatgtgtccaattattgtgagattcaccactcct
                 Killer whale  taaaatggattcataag-ttcttctaagatgaaaaacacgtgtccaattatcgtaagattcaccactcct
             Tibetan antelope  taaaatggattcataag-ttcttctaagatgaaaaacatgtgtccaattactgtgagattcaccactcct
                          Cow  taaaatggattcataag-ttcttctaagatgaaaaacatgtgtccaattactgtgagattcaccactcct
                        Sheep  taaaatggattcataag-ttcttttaagatgaaaaacatgtgtccaattactgtgagattcaccactcct
                Domestic goat  taaaatggattcataac-ttcttctaagatgaaaaacatgtgtccaattactgtgagattcaccactcct
                        Horse  taaaatggattcataag-ttcctgtaagatgagaaacatgtgtccaattactgtgagattctccactccc
             White rhinoceros  taaaatggattcataag-ttcttctaagatgagaaacatgtgtccaattactgtgagattcaccactcct
                          Cat  taaaatggactcataag-ttctcctcagatgaaaaacatgtgtccaattattgtgagattcaccactccc
                          Dog  taaaatggattcataag-ttcttctaagatgaaaaccatgtgtccaattattgtgagattcaccacccct
                      Ferret   taaaatggattcataag-ttcttctaagatgaaaaacatgtgtcctattactgtgagattcaccactcct
                        Panda  taaaatggattcataag-ttcttctaagatgaaaaacatgtgtccaattattgtgagattcaccactcct
               Pacific walrus  taaaatggattcataag-ttcttctaagatgaaaaacatgtgtccagttattgtgagattcaccacgcct
                 Weddell seal  taaaatggattcataag-ttcttctaagatgaaaaacatgtgtccagttattgtgagattcaccacgcct
             Black flying-fox  taaaatggattcatacg-ttcttctaagatgaaaaacatatgtcccattactatgagattcaccattcct
                      Megabat  taaaatggattcatacg-ttcttctaagatgaaaaacatatgtcccattactatgagattcaccattcct
                Big brown bat  taaaatggattcataag-ttcttctgagatgaaaaacatgtgtccaattatggtgagattcaccattcct
         David's myotis (bat)  taaaatggattcttaag-ttcttctgagatgaaaaacatgtgtccaattatggtgagattcaccattcct
                     Microbat  taaaatggattcttaag-ttcttctgagatgaaaaacatgtgtccaattatggtgagattcaccattcct
                     Hedgehog  taagatggattcataag-ttcttttaagatgaaaaacatgtgtccaattactgtgagattcaccactcct
              Star-nosed mole  taaaatggattcgtaag-ttcttctaagatgaaaaacatgtggccaattattgtgagattcgccactcct
                     Elephant  taaaatggacccatgag----ttctcagatgaaaaacacgtgtccagttgttgtcagagtcactgctcat
          Cape elephant shrew  taaaatggagccctaag-ttcttctcagatgaaaaccatgtgtctagttattgtgagattcaccactcct
                      Manatee  taaaaaggatgtgtggg-ttcttctaagatgaaaatcccatgtccaactgttgtgagattcagcgctgtt
             Cape golden mole  t-aaatggactcctaag-ttcttctaaaatgaaaaccatgtgtctagttattgtgagattctccactcct
                       Tenrec  tgaaatagattcatcct-ttccactcagatgaaaaacacgtgtcctgttactgtgagtctctacactcct
                     Aardvark  taaaatggactcagaag-ttcttctaagatgaaaaacatgtgtccagttgtagtgagattcaccactcct
                    Armadillo  taaaatggattcataag-ttcatataagatgaaaaacatgtgtccaattattgtgagattcaccattcct
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
              Tasmanian devil  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
                     Platypus  ======================================================================
                       Lizard  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
             Peregrine falcon  ======================================================================

                        Human  tacaaattcagagcagacagtcctcatctcct-tgtcttaaagtgcataggtctattttcagaataa---
                        Chimp  tacaaattcagagcagacagtcctcatctcct-tgtcttaaagtgcataggtctattttcagaataa---
                      Gorilla  tacaagttcagagcagacagtcctcatctcct-tgtcttaaagtgcataggtctattttcagaataa---
                    Orangutan  tacaagttcagagcagacagtcctcatctcct-tgtcttaaagtgcataggtctattttcagaataa---
                       Gibbon  tacaagttcagagcagacaatcctcatctcct-tgtcttaaagtgcataggtctattttcagaataa---
                       Rhesus  tacaagttcagagcagacagtcctcatctccc-tgtcttaaagtgcacatgtctattttcagaataa---
          Crab-eating macaque  tacaagttcagagcagacagtcctcatctccc-tgtcttaaagtgcacatgtctattttcagaataa---
                       Baboon  tacaagttcagagcagacagtcctcatctccc-tgtcttaaagtgcacatgtctattttcagaataa---
                 Green monkey  tacaagttcagagcagacagtcctcatctccc-tgtcttaaagtgcacatgtctattttcagaataa---
                     Marmoset  tacaagttcagagcagacagtcctcatctcct-tgtcttaaagtgcatatgtctattttcagaataa---
              Squirrel monkey  tacaagttcagagcaggcagtcctcacctcct-tgtcttaaagtgcatatgtctattttcagaataa---
                     Bushbaby  tacaagttcagagcagacagtcctcatctccc-tgtcttaaaatgaggatgtctattttcagaataa---
           Chinese tree shrew  tacaagttcagagcagatagtgctcatctcct-tgtcttaaaatgaatatgtctattttcagaataa---
                     Squirrel  tacaagctcagcccagacggtcttcatctccc-tgcctaaaaatggggatgcctgttttcagagtaa---
       Lesser Egyptian jerboa  cctcagttcagagcagacag---tcatttcct-tgtcttaaaatgagtatgtctatgttcagaataa---
                 Prairie vole  gatgagatgagggcggacagtcctcagctcac-tgtcttaaaatgagcatgtctattttcagaataa---
              Chinese hamster  gatgagatgagggcagacagtcctcatcttag-tgtcttaaaatgagcatgtctattttcagaataa---
               Golden hamster  gacgagatgagggcagacagtcctcatcttag-tgtcttaaaatgagcgtgtctattttcagaataa---
                        Mouse  gatgagttgagggcagacagtcctcatctcag-tgtctcaaaatgagcatgtctattttcagaataattt
                          Rat  gatgagttgagggcagacagtcctcatctcag-tgtcttaaaatgagcatgtctattttcagaataa---
               Naked mole-rat  tacaagttcagagcagacagtcctcatctcct-tgtcttaaaatgagtatgtctcttttcagaataa---
                   Guinea pig  tacaagttcagagcagacagtcttcatctcct-tgtcttaaaatgagtgtgtctcttttcagaataa---
                   Chinchilla  tacaagttcagagcagacagtcctcatctcct-tgtcttaaaatgagtatgtctcttttcagaataa---
             Brush-tailed rat  tacaagttcagagcagacagtcctcatctcct-tgtcttaaaatgagtatgtctctttgcagaataa---
                       Rabbit  tacaagttcagcacaggcagccctcatctcct-tgtcttaaaatgagtgtgcctattttcagaataa---
                         Pika  cacaaattcagtgcaggcagccctcacctcct-tgtcttgaaatgagtatgcctattttcagaataa---
                          Pig  tacaagttcggagcagacagtcctcatctcct-tgtcttaaaatgaggatgtctattttgagaataa---
                       Alpaca  tacaagttcagagcagacagtcctcatctcct-tgtcttaaaatgagtatgtctattttcagaataa---
               Bactrian camel  tacaagttcagagcagacagtcctcatctcct-tgtcttaaaatgagtatgtctattttcagactaa---
                      Dolphin  tacaagttcagagcagagagtcctcatctcct-tgtcttaaattgagtatgtctattttcagaataa---
                 Killer whale  tacaagttcagagcagagagtcctcatctcct-tgtcttaaattgagtatgtctattttcagaataa---
             Tibetan antelope  tacaagttcagaacagacagtcctcatctcct-tgtcttaaaatgagtatgtctattttcagaataa---
                          Cow  tacaagttcagagcagacaatcctcatctcct-tgtcttaaaatgagtatgtctattttcagaataa---
                        Sheep  tataagttcagaacagacagtcctcatctcct-tgtcttaaaatgagtatgtctattttcagaataa---
                Domestic goat  tacaagttcagaacagacagtcctcatctcct-tgtcttaaaatgagtatgtctattttcagaataa---
                        Horse  tacaagttcagagcagacaggcctcatctcct-tgtctcaaagcgagtatgtctattttcagaataa---
             White rhinoceros  tacaagttcagagcagacagtcctcatctcct-tgtttcaaaatgagtgtgtctattttcagagtaa---
                          Cat  tacaagttcagaacagaccatcctcatgtcct-gcttctaaaatgagtacgtctattttcagaataa---
                          Dog  tacaagttcggaacagaccatcctcctgtccc-gcttctaaaatgagtacgtctattttcagaataa---
                      Ferret   tacaagttcggaacagaccatcctcatgtcct-agttctcaaatgagtgtgtctattttcagaataa---
                        Panda  tacaagttcggaacagaccatcctcatgtcct-ggttctaaaatgagtatgtctattttcagaataa---
               Pacific walrus  tacaagttcggaacagaccatcctcatgtcct-ggttctaaaatgagtatgtctattctcagaataa---
                 Weddell seal  tacaagttcggaacagaccatcctcatgtcct-ggttctaaaatgagtatgtctattttcagaataa---
             Black flying-fox  tacaagttcagaacagacagtcctcatgtcct-tgtcttaaaatgagtatgtctattttcagaataa---
                      Megabat  tacaagttcagaacagacagtcctcatgtcct-tgtcttaaaatgagtatgtctattttcagaataa---
                Big brown bat  tacaagttcagaacagacagtcctcatctcct-tgtcttaaaatgagtatgtctattttcagaataa---
         David's myotis (bat)  tacaagttcagaacagacagtcctcatctcct-tgtcttaaaatgagtatgtctattttcagaataa---
                     Microbat  tacaagttcagaacagacagtcctcatctcct-tgtcttaaaatgagtatgtctattttcagaataa---
                     Hedgehog  tacaagttcagaaaggatggtcctcatctcctctgtcttaaaatgagtatgtctgctttcagaataa---
              Star-nosed mole  tacaagttcagagaggacagtcctcatctcct-tgtctaaaaatgagtatgtctattttcagaataa---
                     Elephant  t-caagtccacagcagaccgtccctgtcacct-tgtcttcaaacgagtgtgtctattatcagaataa---
          Cape elephant shrew  tacaagttcagagcaggcggccctcatctcct-tgtctttaaatgagtgtgtctcgtttcagaataa---
                      Manatee  t-gcacttcacagcagacagtcctcgtctcct-tgtcttaaaatgagagcgtctattatcagaataa---
             Cape golden mole  cacaagttcagagcagacggtcctcatctcct-tgtcttaaaatgagtatgtctagtttcaaaataa---
                       Tenrec  cacaagttcagagcagacggacttcatcccct-tgtcttaaaat-agtgtgtctagcttcagaataa---
                     Aardvark  cacaagttcagagcagatgatcctcatctcct-tgtcttaagatgagtatgtctattttcagaataa---
                    Armadillo  tataagttcagagcagattgtcctcatctcct-tgtcttaaaatgagcatgtctattttcagaatac---
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
              Tasmanian devil  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
                     Platypus  ======================================================================
                       Lizard  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
             Peregrine falcon  ======================================================================

                        Human  ----ttttt-agcat----taagtctgggcc---accatttga--tttttaatc----tcctctttt-at
                        Chimp  ----ttttt-agcat----taagtctgggcc---accatttga--tttttaatc----tcctctttt-at
                      Gorilla  ----ttttt-agcat----taagtctgggcc---accatttga--tttttaatc----tcctctttt-at
                    Orangutan  ----ttttt-agcat----taagtctgggcc---accatttga--tttttaatc----tcctctttt-at
                       Gibbon  ----ttttt-aacat----taagtctgggcc---accatttga--tttttaatc----tcctcttgt-at
                       Rhesus  ----ttttt-agcat----taagtctgggcc---accatttga--tttttaatc----tcctctttt-at
          Crab-eating macaque  ----ttttt-agcat----taagtctgggcc---accatttga--tttttaatc----tcctctttt-at
                       Baboon  ----ttttt-agcat----taagtctggacc---accatttga--tttttaatc----tcctctttt-at
                 Green monkey  ----gtttt-agcat----taagtctgggcc---accatttga--tttttaatc----tcctctttt-at
                     Marmoset  ----ttttt-agcat----taagtctgggcc---accatttga--tttttaatc----tcctctttt-at
              Squirrel monkey  ----ttttt-agcat----taagtctgggcc---accatttga--tttttaatc----tcctctttt-at
                     Bushbaby  ----tttttaagcat----taagtctggtcc---accatttga--tttttaatc----tcctctttt-at
           Chinese tree shrew  ----ttttt-agcat----taagtctggtcc---agcatttga--tttttaatc----tcttctttt-at
                     Squirrel  ----ttttt-aacat----taaatcaggtcc---agcatttga--tttctaatc----tcctctttt-at
       Lesser Egyptian jerboa  ----ttttt-cacattaagtaagtctggtcc---atcatttga--tttttaatc----tgttttc---at
                 Prairie vole  --ttttttt-tacat----taagtctggtcc---atcatttga--tttttaatctttttttttttcatat
              Chinese hamster  --ttttttt-tacat----taagtctggtcc---atcatttga--tttttaatc----tttttttcatat
               Golden hamster  --ttttttt-tacat----taagtctggtcc---atcatttga--tttttaatc-ttttttttttcatat
                        Mouse  ttttttttt-tgcat----tacgtctggccc---atcatttga--gttttaatc----tttttttca-at
                          Rat  --ttttttt-tgcat----taagtctggccc---gtcatttga--gttttaatc----tttttttcatat
               Naked mole-rat  ----tgtta-aacat----taagtctggtccaccaccatttta--tttttcatc----ttctctttt-at
                   Guinea pig  ----tgtta-aacat----taagtctggtccaccaccatttta--tttttaatc----ttctctttt-at
                   Chinchilla  ----tgtta-aacat----taagtctggtccaccaccatttta--tttttaatc----ttctctttt-at
             Brush-tailed rat  ----tgtta-aacat----taagtctagtccactaccatttta--tttttaatc----ttctctttt-at
                       Rabbit  ----ttttt-aacat----gaagtctggtcc---accacttga--tttttaatc----tcctctttt-at
                         Pika  ----ttttt-aacat----taagtctagtcc---accatttga--tttttaatc----tcctctttt-at
                          Pig  ----ttttc-agctt----gaagcctggtcc---actatttga--tttttaatc----tcctctttt-at
                       Alpaca  ----ttttc-agcat----gaagcctggttc---accatttga--tttttaatc----tcctctttt-at
               Bactrian camel  ----ttttc-agcat----gaagcctggtcc---accatttga--tttttaatc----tcctctttt-at
                      Dolphin  ----ttttc-agcat----gaagcctggtcc---accatttga--tttttaatc----tcctctttt-at
                 Killer whale  ----ttttc-agcgt----gaagcctggtcc---accatttga--tttttaatc----tcctctttt-at
             Tibetan antelope  ----ttttc-agcat----gaagcctggtcc---accatttga--tttttaatc----tcttctttt-at
                          Cow  ----ttttc-agcat----gaagcctggtcc---accatttga--tttttaatc----tcttctttt-at
                        Sheep  ----ttttc-agcat----gaagtctggtcc---accatttga--tttttaatc----tcttctttt-at
                Domestic goat  ----ttttc-agcat----gaagcctggtcc---accatttga--tttttaatc----tcttctttt-at
                        Horse  ----ctttc-agcat----ggagtctggtcc---accatttga--tttttaatc----tcttctttt-at
             White rhinoceros  ----ttttc-agcat----gaagtctggtcc---accatttga--tttttaatc----tcctctttt-at
                          Cat  ----ttttc-agcat----taagtctggtcc---accatttga--tttttaatc----tcctctttt-at
                          Dog  ----ttttc-agcgt----tcggtctggtcc---accatttga--tttttaatc----tcctctttt-at
                      Ferret   ----ttttc-agcat----taagtctggtcc---accatttga-ttttttagtc----tcctctttt-at
                        Panda  ----ttttc-ggcat----ttagtctggtcc---accatttgc--tttttaatc----tcctctttt-at
               Pacific walrus  ----ttttc-agcat----tgagtctggtcc---accatttga--tttttaatc----tcctctttt-at
                 Weddell seal  ----ttttc-agcat----taggtctggtcc---accatttga--tttttaatc----tcctctttt-at
             Black flying-fox  ----ttttc-agcat----taagtctggtcc---accatttgc--cttttaatc----tcctctttt-at
                      Megabat  ----ttttc-agcat----taagtctggtcc---accatttgc--cttttaatc----tcctctttt-at
                Big brown bat  ----gtttc-agcat----taagtctggtcc---actatttga--tttttaatc----tcctctttt-at
         David's myotis (bat)  ----gtttc-agcat----taagtctggccc---actatttga--tttttaatc----tcctctttt-at
                     Microbat  ----gtttc-agcat----taagtctggtcc---actatttga--tttttaatc----tcctctttt-at
                     Hedgehog  ----ttttc-aatat----taagtctggtcc---accatttgatttttttaatc----tcctctttt-at
              Star-nosed mole  ----ttttc-agcat----taagtctggtcc---accatttga--tttttaatc----tcctctttt-at
                     Elephant  ----tgttt-agtat----tgagttcagccc---acca-ttga--tctgtaat-------ctctttt-at
          Cape elephant shrew  ----ttttt-agcat----taagttcactcc---agca-tcaa--tttgtaatc----tcctctttt-at
                      Manatee  ----tttcg-agcat----tgagttcagtcc---acca-ctga--tctgtaatc----tcctctttt-at
             Cape golden mole  ----ttttt-agcat----taagtgcagtcc---acca-ttga--tttgtaatc----tcctctttt-at
                       Tenrec  ----ttttt-tgcgt----tcggttcagtcc---accg-ctga--tttgtaatc----tcctctttc-at
                     Aardvark  ----ttttt-agc-t----taagtacagtcc---acca-ttga--tttgtaat-------ctctttt-at
                    Armadillo  ----ttttt-agcat----taagtttggtcc---accatttga--tttttaatc----tcctctttt-at
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
              Tasmanian devil  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
                     Platypus  ======================================================================
                       Lizard  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
             Peregrine falcon  ======================================================================

                        Human  ccctgg-aatcttgcattcctggtgtacttca-----------tc----------------t--------
                        Chimp  ccctgg-aatcttgcattcctggtgtacttca-----------tc----------------t--------
                      Gorilla  ccctgg-aatcttgcattcctggtgtacttca-----------tc----------------t--------
                    Orangutan  ccctgg-aatcttgcattcctggtgtacttca-----------tc----------------t--------
                       Gibbon  ccctgg-aatcttgcattcctggtgtacttca-----------tc----------------t--------
                       Rhesus  ccctgg-aatcttgcattcctggtgtacttca-----------tc----------------t--------
          Crab-eating macaque  ccctgg-aatcttgcattcctggtgtacttca-----------tc----------------t--------
                       Baboon  ccctgg-aatcttgcattcctggtgtacttca-----------tc----------------t--------
                 Green monkey  ccctgg-aatcttgcattcctggtgtacttca-----------tc----------------t--------
                     Marmoset  ccctgg-aatcttgcattcctggtgtacttca-----------tc----------------t--------
              Squirrel monkey  ccttgg-aatcttgcattcctggtgtacttca-----------tc----------------t--------
                     Bushbaby  ccctgg-aatcttgcattcctggtgtacctca-----------tc----------------t--------
           Chinese tree shrew  ccttgg-aatcttgcattcctggtgtacttca-----------tc----------------t--------
                     Squirrel  -cctgg-aatcttgcattcctgggacacttca-----------ct----------------ttt------
       Lesser Egyptian jerboa  ccctgg-aatcttacattctt--catcctttt-----------tg----------------gggggatgt
                 Prairie vole  ccctggaactcttaccttcttggtatccttcg-----------ac----------------tta------
              Chinese hamster  ccctgg-actcttacattcttggtatccttca-----------tc----------------tta------
               Golden hamster  ccctgg-actcttacattcttggtatccttca-----------tc----------------ttacg-tgt
                        Mouse  ccccag-actattacattctcggtacccttca-----------tc----------------gtgtg-tgt
                          Rat  ccccag-actcttacgttcttggtacccttca-----------tc-------------------------
               Naked mole-rat  ccccag-aatcttgcattcctggtacacttca-----------tc----------------cttt-----
                   Guinea pig  ccccag-aatcttgcattcctggtatacttca-----------tc----------------ccccttt--
                   Chinchilla  ccccag-aatcttgcattcctcatatacttca--------------------------------------
             Brush-tailed rat  ccccag-aatcttgcattactgatacacttca-----------tc----------------ttcttcttc
                       Rabbit  ccctgg-aatcttgcattcctggtgcacttca-----------tc-------------------------
                         Pika  ccctgg-aatcttgcattcctggtgcacttca-----------tc-------------------------
                          Pig  ccctgg-aatcttgcattcctggtgcacttcatcttttttttttt----------------t--------
                       Alpaca  ccttgg-aatcttgcattcctggtgcacttcatc---------tc----------------t--------
               Bactrian camel  ccttgg-aatcttgcattcctggtgcacttcatc---------tc----------------t--------
                      Dolphin  ccctgg-aatcttgcattcctgatgcacttca-----------tc----------------t--------
                 Killer whale  ccctgg-aatcttgcattcctgatgcacttca-----------tc----------------t--------
             Tibetan antelope  ccctgg-aatcttgcattcctggtacacttca-----------tc----------------t--------
                          Cow  ccctgg-aatcttgcattcctggtacacttca-----------tc----------------t--------
                        Sheep  ccctgg-aatcttgcattcctggtacacttca-----------tc----------------t--------
                Domestic goat  ccctgg-aatcttgcattcctggtacacttca-----------tc----------------t--------
                        Horse  ccctgg-aattttgcattcctgatgcatttca-----------tc----------------t--------
             White rhinoceros  ccctgg-aatcttgcattcctgatgcatttca-----------tc----------------t--------
                          Cat  ccctag-aatcttgcattcctggtgcacttca-----------tc----------------c--------
                          Dog  ccctgg-aatctcgcattcctggtgcacttca-----------tc----------------t--------
                      Ferret   ccctgg-aatctcgcatttctggtgcacttca-----------tc----------------t--------
                        Panda  ccctgg-aatcttgcattcctggtgcacttca-----------tc----------------t--------
               Pacific walrus  ccctga-aatcttgcattcctggtgcacttca-----------tc----------------t--------
                 Weddell seal  ccctgg-aatcttgcattcctggtgcacttca-----------tc----------------t--------
             Black flying-fox  ccctgg-aatcttgcgttcctggtacacttta-----------tc---------------tt--------
                      Megabat  ccctgg-aatcttgcgttcctggtacacttta-----------tc----------------t--------
                Big brown bat  ccctgg-aatcttgcattcctggtgcacttta-----------tc----------------t--------
         David's myotis (bat)  ccctgg-aatcttgcattcctggtacacttta-----------tc----------------t--------
                     Microbat  ccctgg-actcttgcattcctggtgcacttta-----------tc----------------t--------
                     Hedgehog  ccctgg-aatcttgcattcctagtgcacttc-------------c----------------t--------
              Star-nosed mole  ccctgg-aatcttgcattcctggggcacttca-----------tc----------------t--------
                     Elephant  ccctgg-aatcttgcatccctggtgcacttcg-----------tc---------tttttttt--------
          Cape elephant shrew  ccctgg-aatcttgcatccctggtgcacttca-----------tc----------------t--------
                      Manatee  ccctgg-aatcttgcattgctggtgcacttca-----------tcttttttttttttttttt--------
             Cape golden mole  ccctgg-aatcttgcattcctggagtgcttca-----------tc---------------tt--------
                       Tenrec  ccccgg-aatcttgcattcctggtgcacttca-----------tc---------------tt--------
                     Aardvark  ccctgg-aatcttgcattcctagtgcacttca-----------tc----------------t--------
                    Armadillo  ccctgg-aatcttgcatttctggtgcacttca-----------tc---------------tt--------
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
              Tasmanian devil  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
                     Platypus  ======================================================================
                       Lizard  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
             Peregrine falcon  ======================================================================

                        Human  ---------------------------t-------------ttt---t------------gtgtgtaata
                        Chimp  ---------------------------t-------------ttt---t------------gtgtgtaata
                      Gorilla  ---------------------------t-------------ttt---t------------gtgtgtaata
                    Orangutan  ---------------------------t-------------ttt---t------------gtgtgtaata
                       Gibbon  ---------------------------t-------------ttt---t------------gtgtgtaata
                       Rhesus  ---------------------------t-------------ttt---t------------gtgcgtaata
          Crab-eating macaque  ---------------------------t-------------ttt---t------------gtgcgtaata
                       Baboon  ---------------------------t-------------ttt---t------------gtgagtaata
                 Green monkey  ---------------------------t-------------ttt---t------------gtgcgtaata
                     Marmoset  ---------------------------t-------------ttt---t------------gtgtgtaata
              Squirrel monkey  ---------------------------t-------------ttt---t------------gtgtgtaata
                     Bushbaby  ---------------------------t-------------ttt---t------------gtgtgtaata
           Chinese tree shrew  ---------------------------t-------------tttttgt------------gtgtggaata
                     Squirrel  -----------------ttttttttttt-------------tcc---t------------gtgtggaata
       Lesser Egyptian jerboa  gtgtctgtgtgtgtgtgtgtgtgtgtgt-------------gtg---t------------gtgtataatc
                 Prairie vole  ---------------------------t-------------gtg---t------------gtgtggaatg
              Chinese hamster  -------------------------tgt-------------gtg---t------------gtgtagaatg
               Golden hamster  gt--------------------gtgtgt-------------gtg---t------------gtgtagaatg
                        Mouse  gtgtgtgtgtgtgtgtgtgtgtgtgtgt-------------gtg---t------------gtgtagaatg
                          Rat  ----------------------ttgtgc-------------gtg---c------------acgcagaatg
               Naked mole-rat  --------------------tttttcct-------------ttt---g------------gtgtagaata
                   Guinea pig  --------------------tttttttt-------------ttt---t------------ttgtagaata
                   Chinchilla  --------------------cccttttt-------------ttt---g------------gtgtagaata
             Brush-tailed rat  ttttttctttcttt---cttcctttttt-------------ttt---g------------gtgtagaata
                       Rabbit  ---------------------------t-------------ttt---t------------gtgtggaata
                         Pika  ---------------------------t-------------ttt---t------------gtgtggaata
                          Pig  ---------------------------t------------tttg---t------------atgtggaata
                       Alpaca  ---------------------------t------------tttg---t------------gtgtggaata
               Bactrian camel  ---------------------------t------------tttg---t------------gtgtggaata
                      Dolphin  ---------------------------t------------tttg---t------------gtgtggaata
                 Killer whale  ---------------------------t------------tttg---t------------gtgtggaata
             Tibetan antelope  ---------------------------t------------tttg---t------------gtgtggaata
                          Cow  ---------------------------t------------tttg---t------------gtgcagaata
                        Sheep  ---------------------------t------------tttg---t------------gtgtggaata
                Domestic goat  ---------------------------t------------tttg---t------------gtgtggaata
                        Horse  ---------------------------t-------------ttt---t------------gtgtggaata
             White rhinoceros  ---------------------------t-------------ttt---t------------gtatggaata
                          Cat  ---------------------------c-------------ttt---t------------gtgtggaata
                          Dog  ---------------------------c-------------ttt---t------------gtgtggaata
                      Ferret   ---------------------------c-------------ttt---t------------gtgcggaata
                        Panda  ---------------------------c-------------ttt---t------------gtgcggaata
               Pacific walrus  ---------------------------c-------------ttt---t------------gtgtggaata
                 Weddell seal  ---------------------------c-------------ttt---t------------gtgcggaata
             Black flying-fox  ---------------------------t------------tttt---c------------gtgtggaata
                      Megabat  ---------------------------t------------tttt---c------------gtgtggaata
                Big brown bat  ---------------------------ttgtgtgtgtgtgtgtg---t------------gtgtggaata
         David's myotis (bat)  ---------------------------t--tgtgtgtgcatgtg---t------------gtgtggaata
                     Microbat  ---------------------------t--tgtgtgtgcgtgtg---t------------gtgtggaata
                     Hedgehog  ---------------------------t-------------ggg---taggggggagggggtgcagaata
              Star-nosed mole  ---------------------------t-------------ttt---t------------gtgtagaata
                     Elephant  ---------------------------t-------------ttt---t------------gaatggagta
          Cape elephant shrew  ---------------------------t-------------ttc---t------------gggtggaatt
                      Manatee  ---------------------------c-------------ttt---t------------gcatggagta
             Cape golden mole  ---------------------------t-------------ttg---c------------gtgtggaata
                       Tenrec  ---------------------------g-------------gtg---c------------gtgcggaata
                     Aardvark  ---------------------------t-------------ttt---t------------gtgtggaata
                    Armadillo  ---------------------------t-------------ttt---t------------gtatggaata
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
              Tasmanian devil  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
                     Platypus  ======================================================================
                       Lizard  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
             Peregrine falcon  ======================================================================

                        Human  atatccttcagaaatctttgatgcatcagtgaatt-aaaa---g-a-aaaag
                        Chimp  atatccttcagaaatctttgatgcatcagtgaatt-aaaa---g-a-aaaa-
                      Gorilla  atatccttcagaaatctttgatgcatcagtgaatt-aaaa---g-a-aaa--
                    Orangutan  atatccttcagaaatctttgatgcatcagtgaatg-aaaa---g-a-aaaa-
                       Gibbon  atatccttcagaaatctttgatgcatcagtgaatt-aaaa---g-a-aaaa-
                       Rhesus  atatccttcagaaatctttgatgcatcagtgaatt-aaaa---g-a-aaaa-
          Crab-eating macaque  atatccttcagaaatctttgatgcatcagtgaatt-aaaa---g-a-aaaa-
                       Baboon  atatccttcagaaatctttgatgcatcagtgaatt-aaaa---g-a-aaaa-
                 Green monkey  atatccttcagaaatctttgatgcatcagtgaatt-aaaa---g---aaaa-
                     Marmoset  atatccttcagaaatctttgatgcgtcagtgaatt-aaaa---g-a-aaaa-
              Squirrel monkey  atatccttcagaaatctttgatgcatcagtgaatt-aaaa---g---aaaa-
                     Bushbaby  atatccttcagaaatctttgatgcatcagtgaatt-aaaa---g-a-aaaa-
           Chinese tree shrew  atacccttcagaaatctttgatgcatcggtgaatt-aaaa---g-a-aaaa-
                     Squirrel  atatacttccgaaatctttgatgcaccggtgaatt-aaaa---c-gaaaaa-
       Lesser Egyptian jerboa  acatcctacagagatctc-tatgcatcagtgaatt-aaag--------aaa-
                 Prairie vole  ataccctttggagatcttggatgcatctgtgaatt-aaag---g-gaaaaa-
              Chinese hamster  atacccttcagagatcttggatgcatctgtgaatt-aaag---g-g--aaa-
               Golden hamster  atacccttcagagatcttggatgcatctgtgaatt-aaag---g-g--aaa-
                        Mouse  atacccttcagagatcttggatgcatctgtgaatt-aaag--ag-a--aaa-
                          Rat  atactcttcagagatcttggacgcatctgtgaatt-aaag---g-g--aaa-
               Naked mole-rat  atatccttcagaaatctttgatgcatcagtgaatt-aaaa---g-a--aaa-
                   Guinea pig  atatccttcagaaatctttgatgcatcagtgaatt-aaaa---g-a--aaa-
                   Chinchilla  atatccttcagaaatctttgatgcatcagtgaatt-aaaa---g-g--aaa-
             Brush-tailed rat  atatccttcagaaatctttgatgcatcagtgaatt-aaaa---g-a--aaa-
                       Rabbit  atatccttcagaaatctttgatgcatcggtgaatt-aaaa---g-gaaaaa-
                         Pika  atatccttcagaaatctttgatgcaccggtgaatt-aaaa---a-g-aaaa-
                          Pig  atatccttcagaaatctttgatgcattggtgaatt-aaaa---g-a--aaa-
                       Alpaca  atgtccttcagaaatctttgatgcattggtgaattaaaaa---g-a--aaa-
               Bactrian camel  atgtccttcagaaatctttgatgcattggtgaattaaaaa---g-a--aaa-
                      Dolphin  atatctttcagaaaactttgatgcattggtgaatt-aaaa---g-a--aaa-
                 Killer whale  atatctttcagaaaactttgatgcattggtaaatt-aaaa---g-a--aaa-
             Tibetan antelope  atatccttcaaaaatctttgattcattggtgaatt-aaaa---g-a--aaa-
                          Cow  atatccttcaaaaatctttgatgcattggtgaatt-aaaa---g-a--aaa-
                        Sheep  atatccttcaaaaatctttgatgcattggtgaatt-aaaa---g-a--aaa-
                Domestic goat  atatccttcaaaaatctttgatgcattggtgaatt-aaaa---g-a--aaa-
                        Horse  atatccttcagaaatctttgatgcattggtgaatt-aaaa---g-a--aaa-
             White rhinoceros  atatccttcagaaatctttgatgcattggtgaata-aaaa---g-a--aaa-
                          Cat  atatccttcagaaatctttgatgcattggtgaatt-aaaa---g-a--aaa-
                          Dog  atatccttcagaaatctttgatgcattggtgaatt-aaaa---gga--aaa-
                      Ferret   atatccttcagaaatctttgatgcattggtgaatt-aaaa---g-a--aaa-
                        Panda  atatccttcagaaatctttgatgcattggtgaatt-aaaa---g----aaa-
               Pacific walrus  atatccttcagaaatctttgatgcattggtgaatt-aaaa---g-a--aaa-
                 Weddell seal  atatccttcagaaatctttgatgcattggtgaatt-aaaa---gaa--aaa-
             Black flying-fox  atatccctcagaaatctttgatgcattggtgaatt-aaaa---g-a--aaa-
                      Megabat  atatccctcagaaatctttgatgcattggtgaatt-aaaa---g-a--aaa-
                Big brown bat  atatccctcagaaatctttgatgcattggtgaatt-aaaa---g-g--aaa-
         David's myotis (bat)  atatccctcagaaatctttgatgcattggtgaatt-aaaa---g-g--aaa-
                     Microbat  atatccctcagaaatctttgatgcattggtgaatt-aaaa---g-g--aaa-
                     Hedgehog  atatccttcaggaatctttgatgcattggtgaatt-aaga---g-a--aaa-
              Star-nosed mole  atatctttcagaaatctttgatgcattggtgaatt-aaaa---gaa--aaa-
                     Elephant  atatcctttagaaatctttgatgcagcagtgaatt-agaa---g-a--aaa-
          Cape elephant shrew  atatccttcagaaatctttgatgcagcggtgaatt-agaa-agg-g--aaa-
                      Manatee  atatcctccagaaatc--tgatgcagtggtgaatt-agaa---g-a--aaa-
             Cape golden mole  atctccttcagaaatctttgatgcagtggtgaatt-aaga-gaa-a--aaa-
                       Tenrec  acatccttcagaaatctttgatgcagc--tgaatt-agaa-ggg-g--aaa-
                     Aardvark  atatccttcaggaatctttgatgcagcagtgaatt-agaa---g-a--aaa-
                    Armadillo  atatccttcagaaacctttgatgcattggtgaatt-aaaaagaa-a--aaa-
                   Coelacanth  ====================================================
                X. tropicalis  ====================================================
              Tasmanian devil  ====================================================
                  Rock pigeon  ====================================================
       White-throated sparrow  ====================================================
               Painted turtle  ====================================================
                     Platypus  ====================================================
                       Lizard  ====================================================
          Medium ground finch  ====================================================
          Collared flycatcher  ====================================================
     Chinese softshell turtle  ====================================================
                 Saker falcon  ====================================================
              Green seaturtle  ====================================================
                 Mallard duck  ====================================================
                   Budgerigar  ====================================================
                       Turkey  ====================================================
                      Chicken  ====================================================
                      Wallaby  ====================================================
           American alligator  ====================================================
                      Opossum  ====================================================
             Peregrine falcon  ====================================================

View table schema

Go to Conservation track controls

Data last updated: 2015-05-06

Downloads for data in this track are available:

Description

This track shows multiple alignments of 100 vertebrate species and measurements of evolutionary conservation using two methods (phastCons and phyloP) from the PHAST package, for all species. The multiple alignments were generated using multiz and other tools in the UCSC/Penn State Bioinformatics comparative genomics alignment pipeline. Conserved elements identified by phastCons are also displayed in this track. PHAST/Multiz are built from chains ("alignable") and nets ("syntenic"), see the documentation of the Chain/Net tracks for a description of the complete alignment process.

PhastCons is a hidden Markov model-based method that estimates the probability that each nucleotide belongs to a conserved element, based on the multiple alignment. It considers not just each individual alignment column, but also its flanking columns. By contrast, phyloP separately measures conservation at individual columns, ignoring the effects of their neighbors. As a consequence, the phyloP plots have a less smooth appearance than the phastCons plots, with more "texture" at individual sites. The two methods have different strengths and weaknesses. PhastCons is sensitive to "runs" of conserved sites, and is therefore effective for picking out conserved elements. PhyloP, on the other hand, is more appropriate for evaluating signatures of selection at particular nucleotides or classes of nucleotides (e.g., third codon positions, or first positions of miRNA target sites).

Another important difference is that phyloP can measure acceleration (faster evolution than expected under neutral drift) as well as conservation (slower than expected evolution). In the phyloP plots, sites predicted to be conserved are assigned positive scores (and shown in blue), while sites predicted to be fast-evolving are assigned negative scores (and shown in red). The absolute values of the scores represent -log p-values under a null hypothesis of neutral evolution. The phastCons scores, by contrast, represent probabilities of negative selection and range between 0 and 1.

Both phastCons and phyloP treat alignment gaps and unaligned nucleotides as missing data, and both were run with the same parameters.

See also: lastz parameters and other details and chain minimum score and gap parameters used in these alignments.

UCSC has repeatmasked and aligned all genome assemblies, and provides all the sequences for download. For genome assemblies not available in the genome browser, there are alternative assembly hub genome browsers. Missing sequence in any assembly is highlighted in the track display by regions of yellow when zoomed out and by Ns when displayed at base level (see Gap Annotation, below).

Primate subset
OrganismSpeciesRelease dateUCSC versionAlignment type
BaboonPapio hamadryasMar 2012Baylor Panu_2.0/papAnu2Reciprocal best net
BushbabyOtolemur garnettiiMar 2011Broad/otoGar3Syntenic net
ChimpPan troglodytesFeb 2011CSAC 2.1.4/panTro4Syntenic net
Crab-eating macaqueMacaca fascicularisJun 2013Macaca_fascicularis_5.0/macFas5Syntenic net
GibbonNomascus leucogenysOct 2012GGSC Nleu3.0/nomLeu3Syntenic net
GorillaGorilla gorilla gorillaMay 2011gorGor3.1/gorGor3Reciprocal best net
Green monkeyChlorocebus sabaeusMar 2014Chlorocebus_sabeus 1.1/chlSab2Syntenic net
HumanHomo sapiensDec 2013GRCh38/hg38reference species
MarmosetCallithrix jacchusMar 2009WUGSC 3.2/calJac3Syntenic net
OrangutanPongo pygmaeus abeliiJuly 2007WUGSC 2.0.2/ponAbe2Reciprocal best net
RhesusMacaca mulattaOct 2010BGI CR_1.0/rheMac3Syntenic net
Squirrel monkeySaimiri boliviensisOct 2011Broad/saiBol1Syntenic net
Euarchontoglires subset
Brush-tailed ratOctodon degusApr 2012OctDeg1.0/octDeg1Syntenic net
ChinchillaChinchilla lanigeraMay 2012 ChiLan1.0/chiLan1Syntenic net
Chinese hamsterCricetulus griseusJul 2013C_griseus_v1.0/criGri1Syntenic net
Chinese tree shrewTupaia chinensisJan 2013TupChi_1.0/tupChi1Syntenic net
Golden hamsterMesocricetus auratusMar 2013MesAur1.0/mesAur1Syntenic net
Guinea pigCavia porcellusFeb 2008Broad/cavPor3Syntenic net
Lesser Egyptian jerboaJaculus jaculusMay 2012JacJac1.0/jacJac1Syntenic net
MouseMus musculusDec 2011GRCm38/mm10Syntenic net
Naked mole-ratHeterocephalus glaberJan 2012Broad HetGla_female_1.0/hetGla2Syntenic net
PikaOchotona princepsMay 2012OchPri3.0/ochPri3Syntenic net
Prairie voleMicrotus ochrogasterOct 2012MicOch1.0/micOch1Syntenic net
RabbitOryctolagus cuniculusApr 2009Broad/oryCun2Syntenic net
RatRattus norvegicusJul 2014RGSC 6.0/rn6Syntenic net
SquirrelSpermophilus tridecemlineatusNov 2011Broad/speTri2Syntenic net
Laurasiatheria subset
AlpacaVicugna pacosMar 2013Vicugna_pacos-2.0.1/vicPac2Syntenic net
Bactrian camelCamelus ferusDec 2011CB1/camFer1Syntenic net
Big brown batEptesicus fuscusJul 2012EptFus1.0/eptFus1Syntenic net
Black flying-foxPteropus alectoAug 2012ASM32557v1/pteAle1Syntenic net
CatFelis catusNov 2014ICGSC Felis_catus 8.0/felCat8Syntenic net
CowBos taurusJun 2014Bos_taurus_UMD_3.1.1/bosTau8Syntenic net
David's myotis batMyotis davidiiAug 2012ASM32734v1/myoDav1Syntenic net
DogCanis lupus familiarisSep 2011Broad CanFam3.1/canFam3Syntenic net
DolphinTursiops truncatusOct 2011Baylor Ttru_1.4/turTru2Reciprocal best net
Domestic goatCapra hircusMay 2012CHIR_1.0/capHir1Syntenic net
Ferret Mustela putorius furoApr 2011MusPutFur1.0/musFur1Syntenic net
HedgehogErinaceus europaeusMay 2012EriEur2.0/eriEur2Syntenic net
HorseEquus caballusSep 2007EquCab3.0/equCab3Syntenic net
Killer whaleOrcinus orcaJan 2013Oorc_1.1/orcOrc1Syntenic net
MegabatPteropus vampyrusJul 2008Broad/pteVam1Reciprocal best net
MicrobatMyotis lucifugusJul 2010Broad Institute Myoluc2.0/myoLuc2Syntenic net
Pacific walrusOdobenus rosmarus divergensJan 2013Oros_1.0/odoRosDiv1Syntenic net
PandaAiluropoda melanoleucaDec 2009BGI-Shenzhen 1.0/ailMel1Syntenic net
PigSus scrofaAug 2011SGSC Sscrofa10.2/susScr3Syntenic net
SheepOvis ariesAug 2012ISGC Oar_v3.1/oviAri3Syntenic net
ShrewSorex araneusAug 2008Broad/sorAra2Syntenic net
Star-nosed moleCondylura cristataMar 2012ConCri1.0/conCri1Syntenic net
Tibetan antelopePantholops hodgsoniiMay 2013PHO1.0/panHod1Syntenic net
Weddell sealLeptonychotes weddelliiMar 2013LepWed1.0/lepWed1Reciprocal best net
White rhinocerosCeratotherium simumMay 2012CerSimSim1.0/cerSim1Syntenic net
Afrotheria subset
AardvarkOrycteropus afer aferMay 2012OryAfe1.0/oryAfe1Syntenic net
Cape elephant shrewElephantulus edwardiiAug 2012EleEdw1.0/eleEdw1Syntenic net
Cape golden moleChrysochloris asiaticaAug 2012ChrAsi1.0/chrAsi1Syntenic net
ElephantLoxodonta africanaJul 2009Broad/loxAfr3Syntenic net
ManateeTrichechus manatus latirostrisOct 2011Broad v1.0/triMan1Syntenic net
TenrecEchinops telfairiNov 2012Broad/echTel2Syntenic net
Mammal subset
ArmadilloDasypus novemcinctusDec 2011Baylor/dasNov3Syntenic net
OpossumMonodelphis domesticaOct 2006Broad/monDom5Net
PlatypusOrnithorhynchus anatinusMar 2007WUGSC 5.0.1/ornAna1Reciprocal best net
Tasmanian devilSarcophilus harrisiiFeb 2011WTSI Devil_ref v7.0/sarHar1Net
WallabyMacropus eugeniiSep 2009TWGS Meug_1.1/macEug2Reciprocal best net
Aves subset
BudgerigarMelopsittacus undulatusSep 2011WUSTL v6.3/melUnd1Net
ChickenGallus gallusNov 2011ICGSC Gallus_gallus-4.0/galGal4Net
Collared flycatcherFicedula albicollisJun 2013FicAlb1.5/ficAlb2Net
Mallard duckAnas platyrhynchosApr 2013BGI_duck_1.0/anaPla1Net
Medium ground finchGeospiza fortisApr 2012GeoFor_1.0/geoFor1Net
ParrotAmazona vittataJan 2013AV1/amaVit1Net
Peregrine falconFalco peregrinusFeb 2013F_peregrinus_v1.0/falPer1Net
Rock pigeonColumba liviaFeb 2013Cliv_1.0/colLiv1Net
Saker falconFalco cherrugFeb 2013F_cherrug_v1.0/falChe1Net
Scarlet macawAra macaoJun 2013SMACv1.1/araMac1Net
Tibetan ground jayPseudopodoces humilisJan 2013PseHum1.0/pseHum1Net
TurkeyMeleagris gallopavoDec 2009TGC Turkey_2.01/melGal1Net
White-throated sparrowZonotrichia albicollisApr 2013ASM38545v1/zonAlb1Net
Zebra finchTaeniopygia guttataFeb 2013WashU taeGut324/taeGut2Net
Sarcopterygii subset
American alligatorAlligator mississippiensisAug 2012allMis0.2/allMis1Net
Chinese softshell turtlePelodiscus sinensisOct 2011PelSin_1.0/pelSin1Net
CoelacanthLatimeria chalumnaeAug 2011Broad/latCha1Net
Green seaturtleChelonia mydasMar 2013CheMyd_1.0/cheMyd1Net
LizardAnolis carolinensisMay 2010Broad AnoCar2.0/anoCar2Net
Painted turtleChrysemys picta belliiMar 2014v3.0.3/chrPic2Net
Spiny softshell turtleApalone spiniferaMay 2013ASM38561v1/apaSpi1Net
X. tropicalisXenopus tropicalisSep 2012JGI 7.0/xenTro7Net
Fish subset
Atlantic codGadus morhuaMay 2010Genofisk GadMor_May2010/gadMor1Net
Burton's mouthbreederHaplochromis burtoniOct 2011AstBur1.0/hapBur1Net
FuguTakifugu rubripesOct 2011FUGU5/fr3Net
LampreyPetromyzon marinusSep 2010WUGSC 7.0/petMar2Net
MedakaOryzias latipesOct 2005NIG/UT MEDAKA1/oryLat2Net
Mexican tetra (cavefish)Astyanax mexicanusApr 2013Astyanax_mexicanus-1.0.2/astMex1Net
Nile tilapiaOreochromis niloticusJan 2011Broad oreNil1.1/oreNil2Net
Princess of BurundiNeolamprologus brichardiMay 2011NeoBri1.0/neoBri1Net
Pundamilia nyerereiPundamilia nyerereiOct 2011PunNye1.0/punNye1Net
Southern platyfishXiphophorus maculatusJan 2012Xiphophorus_maculatus-4.4.2/xipMac1Net
Spotted garLepisosteus oculatusDec 2011LepOcu1/lepOcu1Net
SticklebackGasterosteus aculeatusFeb 2006Broad/gasAcu1Net
TetraodonTetraodon nigroviridisMar 2007Genoscope 8.0/tetNig2Net
Yellowbelly pufferfishTakifugu flavidusMay 2013version 1 of Takifugu flavidus genome/takFla1Net
Zebra mbunaMaylandia zebraMar 2012MetZeb1.1/mayZeb1Net
ZebrafishDanio rerioSep 2014GRCz10/danRer10Net

Table 1. Genome assemblies included in the 100-way Conservation track.

Display Conventions and Configuration

In full and pack display modes, conservation scores are displayed as a wiggle track (histogram) in which the height reflects the size of the score. The conservation wiggles can be configured in a variety of ways to highlight different aspects of the displayed information. Click the Graph configuration help link for an explanation of the configuration options.

Pairwise alignments of each species to the human genome are displayed below the conservation histogram as a grayscale density plot (in pack mode) or as a wiggle (in full mode) that indicates alignment quality. In dense display mode, conservation is shown in grayscale using darker values to indicate higher levels of overall conservation as scored by phastCons.

Checkboxes on the track configuration page allow selection of the species to include in the pairwise display. Note that excluding species from the pairwise display does not alter the the conservation score display.

To view detailed information about the alignments at a specific position, zoom the display in to 30,000 or fewer bases, then click on the alignment.

Gap Annotation

The Display chains between alignments configuration option enables display of gaps between alignment blocks in the pairwise alignments in a manner similar to the Chain track display. The following conventions are used:

  • Single line: No bases in the aligned species. Possibly due to a lineage-specific insertion between the aligned blocks in the human genome or a lineage-specific deletion between the aligned blocks in the aligning species.
  • Double line: Aligning species has one or more unalignable bases in the gap region. Possibly due to excessive evolutionary distance between species or independent indels in the region between the aligned blocks in both species.
  • Pale yellow coloring: Aligning species has Ns in the gap region. Reflects uncertainty in the relationship between the DNA of both species, due to lack of sequence in relevant portions of the aligning species.

Genomic Breaks

Discontinuities in the genomic context (chromosome, scaffold or region) of the aligned DNA in the aligning species are shown as follows:

  • Vertical blue bar: Represents a discontinuity that persists indefinitely on either side, e.g. a large region of DNA on either side of the bar comes from a different chromosome in the aligned species due to a large scale rearrangement.
  • Green square brackets: Enclose shorter alignments consisting of DNA from one genomic context in the aligned species nested inside a larger chain of alignments from a different genomic context. The alignment within the brackets may represent a short misalignment, a lineage-specific insertion of a transposon in the human genome that aligns to a paralogous copy somewhere else in the aligned species, or other similar occurrence.

Base Level

When zoomed-in to the base-level display, the track shows the base composition of each alignment. The numbers and symbols on the Gaps line indicate the lengths of gaps in the human sequence at those alignment positions relative to the longest non-human sequence. If there is sufficient space in the display, the size of the gap is shown. If the space is insufficient and the gap size is a multiple of 3, a "*" is displayed; other gap sizes are indicated by "+".

Codon translation is available in base-level display mode if the displayed region is identified as a coding segment. To display this annotation, select the species for translation from the pull-down menu in the Codon Translation configuration section at the top of the page. Then, select one of the following modes:

  • No codon translation: The gene annotation is not used; the bases are displayed without translation.
  • Use default species reading frames for translation: The annotations from the genome displayed in the Default species to establish reading frame pull-down menu are used to translate all the aligned species present in the alignment.
  • Use reading frames for species if available, otherwise no translation: Codon translation is performed only for those species where the region is annotated as protein coding.
  • Use reading frames for species if available, otherwise use default species: Codon translation is done on those species that are annotated as being protein coding over the aligned region using species-specific annotation; the remaining species are translated using the default species annotation.

Codon translation uses the following gene tracks as the basis for translation:

Gene TrackSpecies
UCSC GenesHuman, Mouse
RefSeq GenesCow, Frog (X. tropicalis)
Ensembl Genes v73Atlantic cod, Bushbaby, Cat, Chicken, Chimp, Coelacanth, Dog, Elephant, Ferret, Fugu, Gorilla, Horse, Lamprey, Lizard, Mallard duck, Marmoset, Medaka, Megabat, Microbat, Orangutan, Panda, Pig, Platypus, Rat, Soft-shell Turtle, Southern platyfish, Squirrel, Tasmanian devil, Tetraodon, Zebrafish
no annotationAardvark, Alpaca, American alligator, Armadillo, Baboon, Bactrian camel, Big brown bat, Black flying-fox, Brush-tailed rat, Budgerigar, Burton's mouthbreeder, Cape elephant shrew, Cape golden mole, Chinchilla, Chinese hamster, Chinese tree shrew, Collared flycatcher, Crab-eating macaque, David's myotis (bat), Dolphin, Domestic goat, Gibbon, Golden hamster, Green monkey, Green seaturtle, Hedgehog, Killer whale, Lesser Egyptian jerboa, Manatee, Medium ground finch, Mexican tetra (cavefish), Naked mole-rat, Nile tilapia, Pacific walrus, Painted turtle, Parrot, Peregrine falcon, Pika, Prairie vole, Princess of Burundi, Pundamilia nyererei, Rhesus, Rock pigeon, Saker falcon, Scarlet Macaw, Sheep, Shrew, Spiny softshell turtle, Spotted gar, Squirrel monkey, Star-nosed mole, Tawny puffer fish, Tenrec, Tibetan antelope, Tibetan ground jay, Wallaby, Weddell seal, White rhinoceros, White-throated sparrow, Zebra Mbuna, Zebra finch
Table 2. Gene tracks used for codon translation.

Methods

Pairwise alignments with the human genome were generated for each species using lastz from repeat-masked genomic sequence. Lineage-specific repeats were removed prior to alignment, then reinserted. Pairwise alignments were then linked into chains using a dynamic programming algorithm that finds maximally scoring chains of gapless subsections of the alignments organized in a kd-tree. The scoring matrix and parameters for pairwise alignment and chaining were tuned for each species based on phylogenetic distance from the reference. High-scoring chains were then placed along the genome, with gaps filled by lower-scoring chains, to produce an alignment net. For more information about the chaining and netting process and parameters for each species, see the description pages for the Chain and Net tracks.

An additional filtering step was introduced in the generation of the 100-way conservation track to reduce the number of paralogs and pseudogenes from the high-quality assemblies and the suspect alignments from the low-quality assemblies: the pairwise alignments of high-quality mammalian sequences (placental and marsupial) were filtered based on synteny; those for 2X mammalian genomes were filtered to retain only alignments of best quality in both the target and query ("reciprocal best").

The resulting best-in-genome pairwise alignments were progressively aligned using multiz/autoMZ, following the tree topology diagrammed above, to produce multiple alignments. The multiple alignments were post-processed to add annotations indicating alignment gaps, genomic breaks, and base quality of the component sequences. The annotated multiple alignments, in MAF format, are available for bulk download. An alignment summary table containing an entry for each alignment block in each species was generated to improve track display performance at large scales. Framing tables were constructed to enable visualization of codons in the multiple alignment display.

Phylogenetic Tree Model

Both phastCons and phyloP are phylogenetic methods that rely on a tree model containing the tree topology, branch lengths representing evolutionary distance at neutrally evolving sites, the background distribution of nucleotides, and a substitution rate matrix. The all-species tree model for this track was generated using the phyloFit program from the PHAST package (REV model, EM algorithm, medium precision) using multiple alignments of 4-fold degenerate sites extracted from the 100-way alignment (msa_view). The 4d sites were derived from the RefSeq (Reviewed+Coding) gene set, filtered to select single-coverage long transcripts.

This same tree model was used in the phyloP calculations; however, the background frequencies were modified to maintain reversibility. The resulting tree model: all species.

PhastCons Conservation

The phastCons program computes conservation scores based on a phylo-HMM, a type of probabilistic model that describes both the process of DNA substitution at each site in a genome and the way this process changes from one site to the next (Felsenstein and Churchill 1996, Yang 1995, Siepel and Haussler 2005). PhastCons uses a two-state phylo-HMM, with a state for conserved regions and a state for non-conserved regions. The value plotted at each site is the posterior probability that the corresponding alignment column was "generated" by the conserved state of the phylo-HMM. These scores reflect the phylogeny (including branch lengths) of the species in question, a continuous-time Markov model of the nucleotide substitution process, and a tendency for conservation levels to be autocorrelated along the genome (i.e., to be similar at adjacent sites). The general reversible (REV) substitution model was used. Unlike many conservation-scoring programs, phastCons does not rely on a sliding window of fixed size; therefore, short highly-conserved regions and long moderately conserved regions can both obtain high scores. More information about phastCons can be found in Siepel et al. 2005.

The phastCons parameters used were: expected-length=45, target-coverage=0.3, rho=0.3.

PhyloP Conservation

The phyloP program supports several different methods for computing p-values of conservation or acceleration, for individual nucleotides or larger elements ( http://compgen.cshl.edu/phast/). Here it was used to produce separate scores at each base (--wig-scores option), considering all branches of the phylogeny rather than a particular subtree or lineage (i.e., the --subtree option was not used). The scores were computed by performing a likelihood ratio test at each alignment column (--method LRT), and scores for both conservation and acceleration were produced (--mode CONACC).

Conserved Elements

The conserved elements were predicted by running phastCons with the --viterbi option. The predicted elements are segments of the alignment that are likely to have been "generated" by the conserved state of the phylo-HMM. Each element is assigned a log-odds score equal to its log probability under the conserved model minus its log probability under the non-conserved model. The "score" field associated with this track contains transformed log-odds scores, taking values between 0 and 1000. (The scores are transformed using a monotonic function of the form a * log(x) + b.) The raw log odds scores are retained in the "name" field and can be seen on the details page or in the browser when the track's display mode is set to "pack" or "full".

Credits

This track was created using the following programs:

  • Alignment tools: lastz (formerly blastz) and multiz by Minmei Hou, Scott Schwartz and Webb Miller of the Penn State Bioinformatics Group
  • Chaining and Netting: axtChain, chainNet by Jim Kent at UCSC
  • Conservation scoring: phastCons, phyloP, phyloFit, tree_doctor, msa_view and other programs in PHAST by Adam Siepel at Cold Spring Harbor Laboratory (original development done at the Haussler lab at UCSC).
  • MAF Annotation tools: mafAddIRows by Brian Raney, UCSC; mafAddQRows by Richard Burhans, Penn State; genePredToMafFrames by Mark Diekhans, UCSC
  • Tree image generator: phyloPng by Galt Barber, UCSC
  • Conservation track display: Kate Rosenbloom, Hiram Clawson (wiggle display), and Brian Raney (gap annotation and codon framing) at UCSC

The phylogenetic tree is based on Murphy et al. (2001) and general consensus in the vertebrate phylogeny community. Thanks to Giacomo Bernardi for help with the fish relationships.

References

Phylo-HMMs, phastCons, and phyloP:

Felsenstein J, Churchill GA. A Hidden Markov Model approach to variation among sites in rate of evolution. Mol Biol Evol. 1996 Jan;13(1):93-104. PMID: 8583911

Pollard KS, Hubisz MJ, Rosenbloom KR, Siepel A. Detection of nonneutral substitution rates on mammalian phylogenies. Genome Res. 2010 Jan;20(1):110-21. PMID: 19858363; PMC: PMC2798823

Siepel A, Bejerano G, Pedersen JS, Hinrichs AS, Hou M, Rosenbloom K, Clawson H, Spieth J, Hillier LW, Richards S, et al. Evolutionarily conserved elements in vertebrate, insect, worm, and yeast genomes. Genome Res. 2005 Aug;15(8):1034-50. PMID: 16024819; PMC: PMC1182216

Siepel A, Haussler D. Phylogenetic Hidden Markov Models. In: Nielsen R, editor. Statistical Methods in Molecular Evolution. New York: Springer; 2005. pp. 325-351.

Yang Z. A space-time process model for the evolution of DNA sequences. Genetics. 1995 Feb;139(2):993-1005. PMID: 7713447; PMC: PMC1206396

Chain/Net:

Kent WJ, Baertsch R, Hinrichs A, Miller W, Haussler D. Evolution's cauldron: duplication, deletion, and rearrangement in the mouse and human genomes. Proc Natl Acad Sci U S A. 2003 Sep 30;100(20):11484-9. PMID: 14500911; PMC: PMC208784

Multiz:

Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, Green ED, et al. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res. 2004 Apr;14(4):708-15. PMID: 15060014; PMC: PMC383317

Lastz (formerly Blastz):

Chiaromonte F, Yap VB, Miller W. Scoring pairwise genomic sequence alignments. Pac Symp Biocomput. 2002:115-26. PMID: 11928468

Harris RS. Improved pairwise alignment of genomic DNA. Ph.D. Thesis. Pennsylvania State University, USA. 2007.

Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W. Human-mouse alignments with BLASTZ. Genome Res. 2003 Jan;13(1):103-7. PMID: 12529312; PMC: PMC430961

Phylogenetic Tree:

Murphy WJ, Eizirik E, O'Brien SJ, Madsen O, Scally M, Douady CJ, Teeling E, Ryder OA, Stanhope MJ, de Jong WW, Springer MS. Resolution of the early placental mammal radiation using Bayesian phylogenetics. Science. 2001 Dec 14;294(5550):2348-51. PMID: 11743200