Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 52 in window, 38791998 - 38792003, 6 bps 
B D                     Human  ctcttc
B D                     Chimp  ctcttc
B D                   Gorilla  ctcttc
B D                 Orangutan  ctcttc
B D                    Gibbon  ctcttc
B D                    Rhesus  ctcttc
B D       Crab-eating macaque  ctcttc
B D                    Baboon  ctcttc
B D              Green monkey  ctcttc
B D                  Marmoset  ttcttc
B D           Squirrel monkey  ttcttc
B D                  Bushbaby  ctcttt
           Chinese tree shrew  ctcttc
B D                  Squirrel  ctctac
                 Prairie vole  ttcttc
B D           Chinese hamster  ctcttc
               Golden hamster  cttttc
B D                     Mouse  ttctcc
B D                       Rat  ctcttc
B D            Naked mole-rat  ctcttg
                   Chinchilla  ctctct
             Brush-tailed rat  ctctct
B D                    Rabbit  cacttc
B D                      Pika  ctcttc
B D                    Alpaca  ctcctt
               Bactrian camel  ctcctt
B D                   Dolphin  ctcttc
                 Killer whale  ctcttc
             Tibetan antelope  ctcttc
B D                       Cow  ctcttc
B D                     Sheep  ctcttc
                Domestic goat  ctcttc
B D                     Horse  ttgttc
B D          White rhinoceros  ctcttc
B D                       Cat  ------
B D                       Dog  tccttc
B D                   Ferret   ttctt-
B D                     Panda  ttcttc
               Pacific walrus  ttcttc
                 Weddell seal  ttcttc
B D                  Hedgehog  ctcttg
B D                     Shrew  ctcttc
              Star-nosed mole  ttcatc
B D                  Elephant  ctctcc
          Cape elephant shrew  ctctcc
B D                   Manatee  ctcttc
             Cape golden mole  ctcttc
B D                    Tenrec  ctcgtc
                     Aardvark  ctcctc
B D                 Armadillo  ctcttt
      Lesser Egyptian jerboa  ======
B D                Guinea pig  ======
B D                       Pig  ======
B D                Coelacanth  ======
B D                   Megabat  ------
B D             X. tropicalis  ======
                 Spotted gar  ======
          Southern platyfish  ======
B D                      Fugu  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
  D    White-throated sparrow  ======
B D           Tasmanian devil  ======
    Mexican tetra (cavefish)  ======
B D                 Zebrafish  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D        American alligator  ======
B D                Budgerigar  ======
B D                   Opossum  ======
  D               Rock pigeon  ======
  D       Collared flycatcher  ======
B D       Medium ground finch  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D                    Parrot  ======
B D                  Platypus  ======
B D                   Wallaby  ======
  D  Chinese softshell turtle  ======
            Black flying-fox  ------
        David's myotis (bat)  ------
               Big brown bat  ------
B D                  Microbat  ------

Alignment block 2 of 52 in window, 38792004 - 38792069, 66 bps 
B D                     Human  acaacctcttag-gggcaca---tattattgtg--ccatttcataga-----tgggaaaactaaggctc-
B D                     Chimp  acaacctcttag-gggcaca---tattattgtg--ccatttcataga-----tgggaaaactaaggctc-
B D                   Gorilla  acaacctcttag-gggcagg---tattattgtg--ccatttcatagg-----tgggaaaactgaggctc-
B D                 Orangutan  acaacctcttag-gggcagg---tattattgtg--ccatttcataga-----cgggaaaaccgaggctc-
B D                    Gibbon  acaacctcttag-gggcagg---tattattgtg--ccatttcataga-----tgggaaaactgaggctc-
B D                    Rhesus  acaaccacttagtgggcagg---tattattgtg--ccatttcataga-----tgggaaaactgaggctc-
B D       Crab-eating macaque  acaaccacttagtgggcagg---tattattgtg--ccatttcataga-----tgggaaaactgaggct--
B D                    Baboon  acaaccacttagtgggcagg---tattattgtg--ccatttcataga-----taggaaaactgaggctc-
B D              Green monkey  acaaccacttagtgggcagg---tattattgtg--ccatttcataga-----tgggaaaactgaggctc-
B D                  Marmoset  acaacctcctatggggcagg------tattgtg--ccatttcataga-----tgggaaaactgaagctc-
B D           Squirrel monkey  acaacctcctatggggcagg------tattgtg--ccatttcgtaga-----tgggaaaactgaggctc-
B D                  Bushbaby  acaacctcctgtgaggtgga---tattattgtg--ccatttcatagg-----tggg-gaacagaggctc-
           Chinese tree shrew  ataagtttttgtgaagtaag---tattattatg--ccatttcacagg-----cggagaaactgaggctca
B D                  Squirrel  tcaacttcctgtgaggcagg---tcttaccat---ccatttcataga-----cagggaaactgagactc-
                 Prairie vole  atggcctccagtgtggtagg---aattggtgtg--ctatttcacaga-----tgggaaaaccgaggctc-
B D           Chinese hamster  atggcctccagtgtggtagg---aattattata--ctatttcacaga-----tgggaaaactgaggctc-
               Golden hamster  atggcctccagtgtggtagg---aattattata--ctatttcacaga-----tgggaaaactgaggctc-
B D                     Mouse  gtggcctccagtgagatagg---aatcattata--ccatttcataga-----tgggaaaactgaggctc-
B D                       Rat  atggcctccagggcagtaag---aattactata--ccatttcacaga-----taggaaaactgaggctc-
B D            Naked mole-rat  gca--gatatggatagcagc---tattagtgtg--gcatttcataaa-----tagagaaaccgaggctc-
                   Chinchilla  acagtacagtgggtagcagg---tatcagtgtg--ccaggtcgtagactgggcagagaaaccgagactc-
             Brush-tailed rat  acaatgccgtggatagcagg---tgctagtgtg--acatttcatggactagatggagaaacccaggctc-
B D                    Rabbit  tcatcctcctgtgagacaga---tgttattgtg--ccatttcaccga-----tggggaaactgagaaac-
B D                    Alpaca  gcaacctcctgtgagggagg---tatcattgtgc-ccacttcatagt-----tgggaaaactgaggctc-
               Bactrian camel  gcaacctcctgtgagggagg---tatcgttgtgc-ccacttcataga-----tgggaaaactgaggctc-
B D                   Dolphin  acagcctcctgtgaggtcag---tattgttgtcc-ccatttcataga-----tggggaaactgaggctc-
                 Killer whale  acagcctcctgtgaggtcag---tattattgtcc-ccatttcataga-----tggggaaactgaggctc-
             Tibetan antelope  acaacctcctgtgaagttga---tatgtctgtgc-ccatttcataga-----tggggaaactgaggctc-
B D                       Cow  acaacctcctgagaagttga---tatgtctgtgc-ccatttcataga-----tggggaaactgaggctc-
B D                     Sheep  acaacctcctgtgaagttga---tatgtctgtgc-ccatttcataga-----tggggaaactgaggctc-
                Domestic goat  acaacctcctgtgaagttga---tatgtctgtgc-ccatttcataga-----tggggaaactgaggctc-
B D                     Horse  atggcctcctgtgaggtagg---tattattgtgt-ccatttaataga-----cggggaaactgaggctc-
B D          White rhinoceros  atgacctcctgtgaggtagg---tattattgtgc-tcatttcataga-----tggggaaactgaggctc-
B D                       Cat  ------------------------attattgtac-ccatttcacaga-----tgggaaaactgaagcac-
B D                       Dog  acatcctcctctgcaggagc---tatcattgtgc-ccacctcagggg-----tgggaaaactgaagcac-
B D                   Ferret   --atcctcctaggaagtagg---tattattgtac-ccatttcatgga-----tgggaaaactgaagcac-
B D                     Panda  acatcctcctgtgaagcagg---tattattgtac-ccatttcataga-----tgggaaaactgaagcac-
               Pacific walrus  acatcctcctgtgaaatagg---tattattgtac-ccatttcataga-----tgggaaaactgaagcac-
                 Weddell seal  acatcctcctgtgaagtagg---tattattgtac-ccatttcataga-----tgggaaaactgaagcac-
B D                  Hedgehog  acaacttaccctgaggaaga---tattatcatgctccctttcatagg-----tggggagactgaggttc-
B D                     Shrew  actacttcctgtgaaagcca---tgttactgtgc-ccattgtataga-----cagagacactaggactc-
              Star-nosed mole  acaacctc--------------------ctgtgc-ccatctcataga-----agcggagatgaaggttc-
B D                  Elephant  ataaccttctgcaaggtagatattattattgtgc-ccattttataga-----tgaggaaactgaggctc-
          Cape elephant shrew  acagtcctctgtgaggtatg---tattaatgtat-ccattttatagg-----cagggaaactgaggctc-
B D                   Manatee  ataaccttctgtgaggtagg---tgttattgtgc-ccattgtataga-----tggagaaactgagcctc-
             Cape golden mole  atagccttctgtgaggtagg---tattattgttc-ccattttataga-----tggggaaactgagactc-
B D                    Tenrec  atcagcttcggccaagtagc---tgttgttttgc-tcattttatcga-----tgggcaagctggggctc-
                     Aardvark  aaaaccttccatgaggtagg---tattattgtgc-ccattttataga-----tggggaaactgaggttc-
B D                 Armadillo  acaatcttctgtgacat-gg---tattatggtgc-ccatttcataga-----tgggaaaatcgggtctc-
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Guinea pig  ======================================================================
B D                       Pig  ======================================================================
B D                Coelacanth  ======================================================================
B D                   Megabat  ----------------------------------------------------------------------
B D             X. tropicalis  ======================================================================
                 Spotted gar  ======================================================================
          Southern platyfish  ======================================================================
B D                      Fugu  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================
            Black flying-fox  ----------------------------------------------------------------------
        David's myotis (bat)  ----------------------------------------------------------------------
               Big brown bat  ----------------------------------------------------------------------
B D                  Microbat  ----------------------------------------------------------------------

                        Human  ----tgaaaa-------------------------------------------gc
                        Chimp  ----tgaaaa-------------------------------------------gc
                      Gorilla  ----tgaaaa-------------------------------------------gc
                    Orangutan  ----tgaaaa-------------------------------------------gc
                       Gibbon  ----tgaaaa-------------------------------------------gc
                       Rhesus  ----tgaaaa-------------------------------------------gc
          Crab-eating macaque  ---------a-------------------------------------------gc
                       Baboon  ----tgaaaa-------------------------------------------gc
                 Green monkey  ----taaaaa-------------------------------------------gc
                     Marmoset  ----tgaaaa-------------------------------------------gc
              Squirrel monkey  ----tgagaa-------------------------------------------gc
                     Bushbaby  ----tgaaaa-------------------------------------------gc
           Chinese tree shrew  aaaaaaaaaa-------------------------------------------ac
                     Squirrel  ----tgaaat-------------------------------------------gc
                 Prairie vole  ----tgtaat-------------------------------------------ga
              Chinese hamster  ----tgaaat-------------------------------------------gc
               Golden hamster  ----tgaaat-------------------------------------------gc
                        Mouse  ----tgaaat-------------------------------------------gc
                          Rat  ----tgaagt-------------------------------------------gc
               Naked mole-rat  ----tgaaac-------------------------------------------tc
                   Chinchilla  ----tgaaat-------------------------------------------gc
             Brush-tailed rat  ----tgaagt-------------------------------------------gc
                       Rabbit  ----tgaa-t-------------------------------------------gc
                       Alpaca  ----tgaaaa-------------------------------------------gt
               Bactrian camel  ----tgaaaa-------------------------------------------gt
                      Dolphin  ----tgaaaa-------------------------------------------gc
                 Killer whale  ----tgaaaa-------------------------------------------gc
             Tibetan antelope  ----ttttca-------------------------------------------gc
                          Cow  ----ttttca-------------------------------------------gc
                        Sheep  ----ttttca-------------------------------------------gc
                Domestic goat  ----ttttca-------------------------------------------gc
                        Horse  ----tgaaaa-------------------------------------------gc
             White rhinoceros  ----tgaaaa-------------------------------------------gc
                          Cat  ----agaaaa-------------------------------------------gc
                          Dog  ----agaaaa-------------------------------------------gc
                      Ferret   ----ggaaaa-------------------------------------------gc
                        Panda  ----agaaaa-------------------------------------------gc
               Pacific walrus  ----agaaaa-------------------------------------------gc
                 Weddell seal  ----agaaaa-------------------------------------------gg
                     Hedgehog  ----agaaaa-------------------------------------------gc
                        Shrew  ----agaaaagctgaattgccactcccattatgaaggagcctgacacaggactgt
              Star-nosed mole  ----agaaaa-------------------------------------------gt
                     Elephant  ----tgaaaa-------------------------------------------gc
          Cape elephant shrew  ----t--------------------------------------------------
                      Manatee  ----tgaaaa-------------------------------------------gc
             Cape golden mole  ----tgaaaa-------------------------------------------gc
                       Tenrec  ----aggaaa-------------------------------------------gc
                     Aardvark  ----tgaaaa-------------------------------------------gc
                    Armadillo  ----tgaaaa-------------------------------------------gc
       Lesser Egyptian jerboa  =======================================================
                         Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Guinea pig  =======================================================
                          Pig  =======================================================
                   Coelacanth  =======================================================
                      Megabat  -------------------------------------------------------
                X. tropicalis  =======================================================
                  Spotted gar  =======================================================
           Southern platyfish  =======================================================
                         Fugu  =======================================================
                       Turkey  =======================================================
                      Chicken  =======================================================
                 Mallard duck  =======================================================
           Tibetan ground jay  =======================================================
                  Zebra finch  =======================================================
       White-throated sparrow  =======================================================
              Tasmanian devil  =======================================================
     Mexican tetra (cavefish)  =======================================================
                    Zebrafish  =======================================================
          Pundamilia nyererei  =======================================================
                  Zebra mbuna  =======================================================
        Burton's mouthbreeder  =======================================================
          Princess of Burundi  =======================================================
                 Nile tilapia  =======================================================
               Painted turtle  =======================================================
              Green seaturtle  =======================================================
           American alligator  =======================================================
                   Budgerigar  =======================================================
                      Opossum  =======================================================
                  Rock pigeon  =======================================================
          Collared flycatcher  =======================================================
          Medium ground finch  =======================================================
             Peregrine falcon  =======================================================
                 Saker falcon  =======================================================
                       Parrot  =======================================================
                     Platypus  =======================================================
                      Wallaby  =======================================================
     Chinese softshell turtle  =======================================================
             Black flying-fox  -------------------------------------------------------
         David's myotis (bat)  -------------------------------------------------------
                Big brown bat  -------------------------------------------------------
                     Microbat  -------------------------------------------------------

Inserts between block 2 and 3 in window
                    Aardvark 4bp

Alignment block 3 of 52 in window, 38792070 - 38792119, 50 bps 
B D                     Human  agtaactt-------------gcta-gagctcacactgct-------------g------gggattt---
B D                     Chimp  agtaactt-------------gcta-gagctcacactgct-------------g------gggattt---
B D                   Gorilla  agtgactt-------------gcta-gagctcacactgct-------------g------gggattt---
B D                 Orangutan  agtgactt-------------gcta-gagctcacactgct-------------g------gggattt---
B D                    Gibbon  agtgactt-------------gcta-gagctcacatttct-------------g------gggattt---
B D                    Rhesus  agtaactt-------------gcta-gagctcacactgct-------------a------gggattt---
B D       Crab-eating macaque  agtaactt-------------gcta-gagctcacactgct-------------a------gggattt---
B D                    Baboon  agtaactt-------------gcta-gagctcacactgct-------------a------gggattt---
B D              Green monkey  agtaactt-------------gcta-gagctcacactgct-------------a------gggattt---
B D                  Marmoset  agttactt-------------gcta-gagatcatactgcc-------------a------gggagtt---
B D           Squirrel monkey  agtaactt-------------gcca-gagatcacactgcc-------------a------gggagtt---
B D                  Bushbaby  agcagttt-------------gctg-aaggtcacactgct-------------g------gggagtt---
           Chinese tree shrew  agtaattc-------------acca-ga--tcacaccgct-------------a------gggagtt---
B D                  Squirrel  agtaattt-------------gttg-gaaattacactgtt-------------a------gggaatt---
                 Prairie vole  actaatgt-------------gtca-gagaccacac-------------------------ggaatc---
B D           Chinese hamster  gttaattt-------------gtca-gataccacac-------------------------ggaggc---
               Golden hamster  actaattt-------------gtca-gaggcaacac-------------------------agaagc---
B D                     Mouse  aataactt-------------gtca-gaggtcacac-------------------------tgagac---
B D                       Rat  aataactt-------------ttcc-gaggtcacgc-------------------------tgagcc---
B D            Naked mole-rat  agtggttt-------------gttg-gaggtcaccctgct-------------a------gggagtc---
                   Chinchilla  agcagttt-------------atag-gaggtcaccctgct-------------a------gaaagac---
             Brush-tailed rat  agtggttt-------------gttg-gaggtcaccctgcg-------------a------gggagtc---
B D                    Rabbit  agtaatgt-------------gctg-gacatcatactacc-------------a------gggagtc---
B D                    Alpaca  ccttactt-------------gcca-gaaatcacactatt-------------a------gcaagtt---
               Bactrian camel  ccttactt-------------gcca-gaaatcacactatt-------------a------gcgagtt---
B D                   Dolphin  agtgactt-------------gcca-gaaatcacacaatg-------------a------gggagtt---
                 Killer whale  agtgactt-------------gcca-gaaatcacacaatg-------------a------gggagtt---
             Tibetan antelope  agtgattt-------------gcca-gaaatcacactatt-------------a------gggaatt---
B D                       Cow  agtgattt-------------gcca-gaaatcacactatt-------------a------gggaatt---
B D                     Sheep  agtgattt-------------gcca-gaaatcacactatt-------------a------gggaatt---
                Domestic goat  agtgattt-------------gcca-gaaatcacactatt-------------a------gggaatt---
B D                     Horse  agttactt-------------gcca-gagaccactctaag-------------a------gggagtt---
B D          White rhinoceros  agttactt-------------gcca-gagatcaaactatg-------------a------gggagtt---
B D                       Cat  agttacct-------------gcca-gagatcacactatt-------------gtattatggaatgtgtt
B D                       Dog  agttactt-------------gccaggagatcacaccact-------------g------ggaagtt---
B D                   Ferret   agttactt-------------gcca-gagatcacactatt-------------a------ggaagct---
B D                     Panda  actt-ttc-------------gcca-gagatcacgctctt-------------g------ggaagct---
               Pacific walrus  agttactt-------------gcca-gagatcacactgtt-------------g------ggaagtt---
                 Weddell seal  agttattt-------------gcca-gagatcacactgtt-------------g------ggaagtt---
             Black flying-fox  agttactt-------------gcca-gaaatcacactatc-------------g------gggagtt---
B D                   Megabat  agttactt-------------gcca-gaaatcacactatt-------------g------gggagtt---
B D                  Hedgehog  aaatactt-------------gcca-aagctcacactatt-------------g------ggaagtt---
B D                     Shrew  ggacactttgtttgtttgggggcca-gacccaacagtgctccgggcctactcca------ggcaggg---
              Star-nosed mole  ggtcactt-------------gcca-aagatcacactatt-------------g------ggaagtg---
B D                  Elephant  agttgttt-------------gctg-gagatcacattgct-------------a------gggagtt---
          Cape elephant shrew  --------------------------gaggcctcattgct-------------a------gaaaatt---
B D                   Manatee  agttgttt-------------gctg-gagatcacattgct-------------a------gggagtt---
             Cape golden mole  aattgttt-------------gttg-gagatcacattgct-------------a------gagag-t---
B D                    Tenrec  agtcattt-------------ggtg-gagatggcactgct-------------a------gggta-t---
                     Aardvark  agttgtct-------------gctg-gagatcacattgct-------------a------tggggtt---
B D                 Armadillo  agttattt-------------gccc-gagatcacaccgct-------------a------gggagtt---
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Guinea pig  ======================================================================
B D                       Pig  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
                 Spotted gar  ======================================================================
          Southern platyfish  ======================================================================
B D                      Fugu  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================
        David's myotis (bat)  ----------------------------------------------------------------------
               Big brown bat  ----------------------------------------------------------------------
B D                  Microbat  ----------------------------------------------------------------------

                        Human  ----------------------------------------------------------gcaga-------
                        Chimp  ----------------------------------------------------------gcaga-------
                      Gorilla  ----------------------------------------------------------gcaga-------
                    Orangutan  ----------------------------------------------------------gcaga-------
                       Gibbon  ----------------------------------------------------------gcaga-------
                       Rhesus  ----------------------------------------------------------gcaga-------
          Crab-eating macaque  ----------------------------------------------------------gcaga-------
                       Baboon  ----------------------------------------------------------gcaga-------
                 Green monkey  ----------------------------------------------------------gcaga-------
                     Marmoset  ----------------------------------------------------------gcaga-------
              Squirrel monkey  ----------------------------------------------------------gcaga-------
                     Bushbaby  ----------------------------------------------------------gca-a-------
           Chinese tree shrew  ----------------------------------------------------------gcaaa-------
                     Squirrel  ----------------------------------------------------------gctga-------
                 Prairie vole  ----------------------------------------------------------acagc-------
              Chinese hamster  ----------------------------------------------------------gtggg-------
               Golden hamster  ----------------------------------------------------------atgga-------
                        Mouse  ----------------------------------------------------------acaga-------
                          Rat  ----------------------------------------------------------acaga-------
               Naked mole-rat  ----------------------------------------------------------accaa-------
                   Chinchilla  ----------------------------------------------------------acaga-------
             Brush-tailed rat  ----------------------------------------------------------acaga-------
                       Rabbit  ----------------------------------------------------------agaaa-------
                       Alpaca  ----------------------------------------------------------gcaga-------
               Bactrian camel  ----------------------------------------------------------gcaga-------
                      Dolphin  ----------------------------------------------------------gcaga-------
                 Killer whale  ----------------------------------------------------------gcaga-------
             Tibetan antelope  ----------------------------------------------------------acaga-------
                          Cow  ----------------------------------------------------------gcaga-------
                        Sheep  ----------------------------------------------------------acaga-------
                Domestic goat  ----------------------------------------------------------acaga-------
                        Horse  ----------------------------------------------------------ggaga-------
             White rhinoceros  ----------------------------------------------------------gtaga-------
                          Cat  attagttctgtctacctttttttttttttaacgttcatttgtttttgagaaaaagagagggca-------
                          Dog  ----------------------------------------------------------ggaga-------
                      Ferret   ----------------------------------------------------------ggaga-------
                        Panda  ----------------------------------------------------------ggaga-------
               Pacific walrus  ----------------------------------------------------------ggaga-------
                 Weddell seal  ----------------------------------------------------------ggaga-------
             Black flying-fox  ----------------------------------------------------------gcagg-------
                      Megabat  ----------------------------------------------------------gcagg-------
                     Hedgehog  ----------------------------------------------------------gaaga-------
                        Shrew  -----ttcc-------------------------------------------------ggggaccatgtc
              Star-nosed mole  ----------------------------------------------------------gggga-------
                     Elephant  ----------------------------------------------------------gcaga-------
          Cape elephant shrew  ----------------------------------------------------------acaga-------
                      Manatee  ----------------------------------------------------------gcaga-------
             Cape golden mole  ----------------------------------------------------------acaaa-------
                       Tenrec  ----------------------------------------------------------gcgaa-------
                     Aardvark  ----------------------------------------------------------gcaga-------
                    Armadillo  ----------------------------------------------------------gcaga-------
       Lesser Egyptian jerboa  ======================================================================
                         Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Guinea pig  ======================================================================
                          Pig  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                  Spotted gar  ======================================================================
           Southern platyfish  ======================================================================
                         Fugu  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
     Chinese softshell turtle  ======================================================================
         David's myotis (bat)  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ----------------------------------------------------------------------

                        Human  --ggtag-----ga--ttca
                        Chimp  --ggtag-----ga--ttca
                      Gorilla  --ggtag-----ga--ttca
                    Orangutan  --ggtag-----ga--ttca
                       Gibbon  --ggtag-----ga--ttca
                       Rhesus  --ggtag-----ga--ttca
          Crab-eating macaque  --ggtag-----ga--ttca
                       Baboon  --ggtag-----ga--ttca
                 Green monkey  --ggtag-----ga--ttca
                     Marmoset  --ggtaa-----ga--ttca
              Squirrel monkey  --ggtaa-----ga--ttca
                     Bushbaby  --tgtgg-----ga--ttca
           Chinese tree shrew  --ggttg-----ga--ttca
                     Squirrel  --agtga-----g---ttca
                 Prairie vole  --agtgg-----g----tca
              Chinese hamster  --ggtgg-----g---ttca
               Golden hamster  --gatgg-----g---ttca
                        Mouse  --ggtgg-----g---t---
                          Rat  --ggtgg-----g---ttta
               Naked mole-rat  --agtag-----g---ttca
                   Chinchilla  --agtaa-----c---ttcg
             Brush-tailed rat  --agtag-----g---ttca
                       Rabbit  --gatga-----gc--ttcc
                       Alpaca  --ggtgc-----ggactt--
               Bactrian camel  --ggtgt-----ggactt--
                      Dolphin  --cgtgc-----gaaatt--
                 Killer whale  --ggtga-----gaactt--
             Tibetan antelope  --ggtag-----gaagtt--
                          Cow  --gatag-----gaagct--
                        Sheep  --ggtag-----gaagtt--
                Domestic goat  --ggtag-----gaagtt--
                        Horse  --ggtgg-----ga------
             White rhinoceros  --ggtgg-----ga------
                          Cat  --agtgg-----tgagga--
                          Dog  --agtgg-----gaacgt--
                      Ferret   --agtgg-----ggagat--
                        Panda  --agtaa-----gaacaa--
               Pacific walrus  --agtgg-----gaacgt--
                 Weddell seal  --agtgg-----gaatgt--
             Black flying-fox  --ggtgg-----gaactt--
                      Megabat  --ggtgg-----gaactt--
                     Hedgehog  --ggtga-----ggactc--
                        Shrew  gtgctggggaccgaactt--
              Star-nosed mole  --gttga-----gaactt--
                     Elephant  --gg-------------tcc
          Cape elephant shrew  --aatgg-----aa--ctag
                      Manatee  --ggtgg-----aa--ctca
             Cape golden mole  --agtgg-----aa--ttca
                       Tenrec  --ggtgg-----aa--ctcc
                     Aardvark  --gagag-----aa--ctca
                    Armadillo  --ggtgg-----gg--ctcg
       Lesser Egyptian jerboa  ====================
                         Pika  NNNNNNNNNNNNNNNNNNNN
                   Guinea pig  ====================
                          Pig  ====================
                   Coelacanth  ====================
                X. tropicalis  ====================
                  Spotted gar  ====================
           Southern platyfish  ====================
                         Fugu  ====================
                       Turkey  ====================
                      Chicken  ====================
                 Mallard duck  ====================
           Tibetan ground jay  ====================
                  Zebra finch  ====================
       White-throated sparrow  ====================
              Tasmanian devil  ====================
     Mexican tetra (cavefish)  ====================
                    Zebrafish  ====================
          Pundamilia nyererei  ====================
                  Zebra mbuna  ====================
        Burton's mouthbreeder  ====================
          Princess of Burundi  ====================
                 Nile tilapia  ====================
               Painted turtle  ====================
              Green seaturtle  ====================
           American alligator  ====================
                   Budgerigar  ====================
                      Opossum  ====================
                  Rock pigeon  ====================
          Collared flycatcher  ====================
          Medium ground finch  ====================
             Peregrine falcon  ====================
                 Saker falcon  ====================
                       Parrot  ====================
                     Platypus  ====================
                      Wallaby  ====================
     Chinese softshell turtle  ====================
         David's myotis (bat)  --------------------
                Big brown bat  --------------------
                     Microbat  --------------------

Inserts between block 3 and 4 in window
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                      Cat 141bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
B D                 Hedgehog 1bp
B D                    Shrew 51bp
             Star-nosed mole 1bp

Alignment block 4 of 52 in window, 38792120 - 38792126, 7 bps 
B D                     Human  tactcgg
B D                     Chimp  tactcgg
B D                   Gorilla  tactcgg
B D                 Orangutan  tactcgg
B D                    Gibbon  tactcgg
B D                    Rhesus  tactcag
B D       Crab-eating macaque  tactcag
B D                    Baboon  tactcag
B D              Green monkey  tactcag
B D                  Marmoset  tac----
B D           Squirrel monkey  cac----
B D                  Bushbaby  tcctcag
           Chinese tree shrew  cactcag
B D                  Squirrel  tactctg
                 Prairie vole  tactcag
B D           Chinese hamster  tattcag
               Golden hamster  tactaag
B D                       Rat  ttccgag
B D            Naked mole-rat  tgctcag
                   Chinchilla  tgctcag
             Brush-tailed rat  tgctcag
B D                    Rabbit  tctgcag
B D                    Alpaca  tactcag
               Bactrian camel  tactcag
B D                   Dolphin  tactcag
                 Killer whale  tactcag
             Tibetan antelope  cactcag
B D                       Cow  tactcag
B D                     Sheep  cactcag
                Domestic goat  cactcag
B D                       Cat  tacccag
B D                       Dog  tacccag
B D                   Ferret   tccttca
B D                     Panda  tactcag
               Pacific walrus  tactcgg
                 Weddell seal  tactcgg
             Black flying-fox  tacttag
B D                   Megabat  tacttag
B D                  Hedgehog  cactcaa
B D                     Shrew  cccctag
              Star-nosed mole  -catcag
B D                  Elephant  tactcag
          Cape elephant shrew  tactcaa
B D                   Manatee  tactcag
             Cape golden mole  t----ag
B D                    Tenrec  tactcag
                     Aardvark  tactcag
B D                 Armadillo  tactcac
B D                     Mouse  -------
      Lesser Egyptian jerboa  =======
B D                      Pika  NNNNNNN
B D                Guinea pig  =======
B D                       Pig  =======
B D                Coelacanth  =======
B D             X. tropicalis  =======
                 Spotted gar  =======
          Southern platyfish  =======
B D                      Fugu  =======
B D                    Turkey  =======
B D                   Chicken  =======
  D              Mallard duck  =======
          Tibetan ground jay  =======
B D               Zebra finch  =======
  D    White-throated sparrow  =======
B D           Tasmanian devil  =======
    Mexican tetra (cavefish)  =======
B D                 Zebrafish  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D              Nile tilapia  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D        American alligator  =======
B D                Budgerigar  =======
B D                   Opossum  =======
  D               Rock pigeon  =======
  D       Collared flycatcher  =======
B D       Medium ground finch  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D                    Parrot  =======
B D                  Platypus  =======
B D                   Wallaby  =======
  D  Chinese softshell turtle  =======
B D          White rhinoceros  -------
B D                     Horse  -------
        David's myotis (bat)  -------
               Big brown bat  -------
B D                  Microbat  -------

Inserts between block 4 and 5 in window
B D                 Squirrel 105bp

Alignment block 5 of 52 in window, 38792127 - 38792141, 15 bps 
B D                     Human  gtctgtcta-ccttta
B D                     Chimp  gtctgtcta-ccttta
B D                   Gorilla  gtctgtcta-ccttta
B D                 Orangutan  gtctgtcta-ccttta
B D                    Gibbon  gtctgtcta-ccttta
B D                    Rhesus  gtctgtcta-ccttta
B D       Crab-eating macaque  gtctgtcta-ccttta
B D                    Baboon  gtctgtcta-ccttta
B D              Green monkey  gtctgtcta-ccttta
B D                  Marmoset  -tccatcta-tcttta
B D           Squirrel monkey  -tccatcta-tcttta
B D                  Bushbaby  gtctgcctg-ccctta
           Chinese tree shrew  gtctgtc---------
B D                  Squirrel  atatatata-tatata
                 Prairie vole  atctgtgta-ctttta
B D           Chinese hamster  atctgtgtg-ccttta
               Golden hamster  atctgtgtg-ccttta
B D                     Mouse  -tccgtgta-ccttta
B D                       Rat  atctgtgta-ccttta
B D            Naked mole-rat  gtctgttta-tcctta
                   Chinchilla  gtctgtttactccttc
             Brush-tailed rat  gtctgttgacacctca
B D                    Rabbit  ctctggctg-ccttgc
B D                    Alpaca  gtgtgacca-gcttta
               Bactrian camel  gtgtgtcca-gcttta
B D                   Dolphin  gtgtatcca-gattta
                 Killer whale  gtgtatcca-gattta
             Tibetan antelope  ttctgtcca-gcttta
B D                       Cow  ttctgtcca-gcttta
B D                     Sheep  ttctgtcca-gcttta
                Domestic goat  ttctgtcca-gctttc
B D                     Horse  -actgtcca-ccttta
B D          White rhinoceros  -acagtcca-ctttta
B D                       Cat  ttccatcca-ccttcg
B D                       Dog  gttgggcta-ccttta
B D                   Ferret   gtctgtcca-ccttta
B D                     Panda  gtctgtcca-ccttta
               Pacific walrus  gtctgtcca-cctttg
                 Weddell seal  gtctgtcca-cctttg
             Black flying-fox  gtctgttcc-ccttta
B D                   Megabat  gtctgttcc-ccttta
B D                  Hedgehog  gcctgtcta-cctgta
B D                     Shrew  gactgtcca-ccttta
              Star-nosed mole  accagccca-tcttga
B D                  Elephant  acctgtcta-tcttta
          Cape elephant shrew  gcatgtcta-catttg
B D                   Manatee  acctgtcta-tcttta
             Cape golden mole  ggctgtcta-ctttta
B D                    Tenrec  atccgtctc-tcttta
                     Aardvark  gcctatcta-ccttta
B D                 Armadillo  gtctgtctg-cctttg
      Lesser Egyptian jerboa  ================
B D                      Pika  NNNNNNNNNNNNNNNN
B D                Guinea pig  ================
B D                       Pig  ================
B D                Coelacanth  ================
B D             X. tropicalis  ================
                 Spotted gar  ================
          Southern platyfish  ================
B D                      Fugu  ================
B D                    Turkey  ================
B D                   Chicken  ================
  D              Mallard duck  ================
          Tibetan ground jay  ================
B D               Zebra finch  ================
  D    White-throated sparrow  ================
B D           Tasmanian devil  ================
    Mexican tetra (cavefish)  ================
B D                 Zebrafish  ================
         Pundamilia nyererei  ================
                 Zebra mbuna  ================
       Burton's mouthbreeder  ================
         Princess of Burundi  ================
B D              Nile tilapia  ================
  D            Painted turtle  ================
  D           Green seaturtle  ================
B D        American alligator  ================
B D                Budgerigar  ================
B D                   Opossum  ================
  D               Rock pigeon  ================
  D       Collared flycatcher  ================
B D       Medium ground finch  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
  D                    Parrot  ================
B D                  Platypus  ================
B D                   Wallaby  ================
  D  Chinese softshell turtle  ================
        David's myotis (bat)  ----------------
               Big brown bat  ----------------
B D                  Microbat  ----------------

Inserts between block 5 and 6 in window
B D                      Dog 1bp
B D                   Tenrec 69bp

Alignment block 6 of 52 in window, 38792142 - 38792145, 4 bps 
B D                     Human  aagc
B D                     Chimp  aagc
B D                   Gorilla  aagc
B D                 Orangutan  aagc
B D                    Gibbon  aagc
B D                    Rhesus  aagc
B D       Crab-eating macaque  aagc
B D                    Baboon  aagc
B D              Green monkey  aagc
B D                  Marmoset  aagc
B D           Squirrel monkey  aagc
B D                  Bushbaby  aagc
B D                  Squirrel  tata
                 Prairie vole  aatc
B D           Chinese hamster  aagc
               Golden hamster  aagc
B D                     Mouse  aagc
B D                       Rat  aagc
B D            Naked mole-rat  aagc
                   Chinchilla  aagc
             Brush-tailed rat  aagc
B D                    Rabbit  aagc
B D                    Alpaca  aagc
               Bactrian camel  aagc
B D                   Dolphin  aagc
                 Killer whale  aagc
             Tibetan antelope  aagt
B D                       Cow  aagt
B D                     Sheep  aagt
                Domestic goat  aagt
B D                     Horse  aaat
B D          White rhinoceros  aagc
B D                       Cat  aaga
B D                       Dog  gaga
B D                   Ferret   aaga
B D                     Panda  aaga
               Pacific walrus  aaga
                 Weddell seal  aaga
             Black flying-fox  gagc
B D                   Megabat  gagc
B D                  Hedgehog  aaat
B D                     Shrew  aagc
              Star-nosed mole  aggc
B D                  Elephant  aagc
          Cape elephant shrew  aagt
B D                   Manatee  aagc
             Cape golden mole  aagt
                     Aardvark  aagc
B D                 Armadillo  aagc
      Lesser Egyptian jerboa  ====
B D                      Pika  NNNN
B D                Guinea pig  ====
B D                       Pig  ====
B D                Coelacanth  ====
B D             X. tropicalis  ====
                 Spotted gar  ====
          Southern platyfish  ====
B D                      Fugu  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
  D    White-throated sparrow  ====
B D           Tasmanian devil  ====
    Mexican tetra (cavefish)  ====
B D                 Zebrafish  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
B D                Budgerigar  ====
B D                   Opossum  ====
  D               Rock pigeon  ====
  D       Collared flycatcher  ====
B D       Medium ground finch  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
          Chinese tree shrew  ----
B D                  Platypus  ====
B D                   Wallaby  ====
B D                    Tenrec  ====
  D  Chinese softshell turtle  ====
        David's myotis (bat)  ----
               Big brown bat  ----
B D                  Microbat  ----

Inserts between block 6 and 7 in window
            Cape golden mole 96bp

Alignment block 7 of 52 in window, 38792146 - 38792146, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
B D                  Squirrel  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
                   Chinchilla  t
             Brush-tailed rat  a
B D                    Rabbit  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  c
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
B D                  Hedgehog  t
B D                     Shrew  t
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
                     Aardvark  t
B D                 Armadillo  t
      Lesser Egyptian jerboa  =
B D                      Pika  N
B D                Guinea pig  =
B D                       Pig  =
            Cape golden mole  =
B D                Coelacanth  =
B D             X. tropicalis  =
                 Spotted gar  =
          Southern platyfish  =
B D                      Fugu  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
          Chinese tree shrew  -
B D                  Platypus  =
B D                   Wallaby  =
B D                    Tenrec  =
  D  Chinese softshell turtle  =
        David's myotis (bat)  -
               Big brown bat  -
B D                  Microbat  -

Inserts between block 7 and 8 in window
B D                 Elephant 95bp
         Cape elephant shrew 39bp
B D                  Manatee 49bp
                    Aardvark 764bp

Alignment block 8 of 52 in window, 38792147 - 38792153, 7 bps 
B D                     Human  cttccca
B D                     Chimp  cttccca
B D                   Gorilla  cttccca
B D                 Orangutan  cttccca
B D                    Gibbon  cttccca
B D                    Rhesus  gttccca
B D       Crab-eating macaque  cttccca
B D                    Baboon  cttccca
B D              Green monkey  cttccca
B D                  Marmoset  cttccca
B D           Squirrel monkey  cttccca
B D                  Bushbaby  attccca
           Chinese tree shrew  -ctccca
B D                  Squirrel  attccca
                 Prairie vole  cttccca
B D           Chinese hamster  ctttcca
               Golden hamster  ctttcca
B D                     Mouse  ctt-ccg
B D                       Rat  cttccca
B D            Naked mole-rat  tttccca
                   Chinchilla  tttccca
             Brush-tailed rat  tttccca
B D                    Alpaca  cttctca
               Bactrian camel  cttctca
B D                   Dolphin  cttctca
                 Killer whale  cttctca
             Tibetan antelope  cttctca
B D                       Cow  cttctca
B D                     Sheep  cttctca
                Domestic goat  cttctca
B D                     Horse  cttccta
B D          White rhinoceros  cttccta
B D                       Cat  ctttcca
B D                       Dog  cttcccg
B D                   Ferret   gttccca
B D                     Panda  cttccta
               Pacific walrus  cttccca
                 Weddell seal  cttccca
             Black flying-fox  cttccca
B D                   Megabat  ctttcca
B D                  Hedgehog  cttccta
B D                     Shrew  cttcccc
              Star-nosed mole  cttccct
B D                 Armadillo  cttccca
      Lesser Egyptian jerboa  =======
B D                      Pika  NNNNNNN
B D                Guinea pig  =======
B D                       Pig  =======
B D                    Rabbit  -------
            Cape golden mole  =======
                    Aardvark  =======
B D                Coelacanth  =======
B D             X. tropicalis  =======
                 Spotted gar  =======
          Southern platyfish  =======
B D                      Fugu  =======
B D                    Turkey  =======
B D                   Chicken  =======
  D              Mallard duck  =======
          Tibetan ground jay  =======
B D               Zebra finch  =======
  D    White-throated sparrow  =======
B D           Tasmanian devil  =======
    Mexican tetra (cavefish)  =======
B D                 Zebrafish  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D              Nile tilapia  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D        American alligator  =======
B D                Budgerigar  =======
B D                   Opossum  =======
  D               Rock pigeon  =======
  D       Collared flycatcher  =======
B D       Medium ground finch  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D                    Parrot  =======
         Cape elephant shrew  =======
B D                  Platypus  =======
B D                   Wallaby  =======
B D                   Manatee  =======
B D                  Elephant  =======
B D                    Tenrec  =======
  D  Chinese softshell turtle  =======
        David's myotis (bat)  -------
               Big brown bat  -------
B D                  Microbat  -------

Inserts between block 8 and 9 in window
                Prairie vole 3095bp

Alignment block 9 of 52 in window, 38792154 - 38792303, 150 bps 
B D                     Human  atagtt----attcatagt--------ccagactcacccagcctg-gt-------ctcccat-gccc--a
B D                     Chimp  atagtt----attcatagt--------ccagactcacccagcctg-gt-------ctcccat-gccc--a
B D                   Gorilla  atagtt----attcatagt--------ccagactcacccagcctg-gt-------ctcccat-gccc--a
B D                 Orangutan  atagtt----attcatagt--------ccagactcagccagcctg-gt-------ctcccac-gccc--a
B D                    Gibbon  atagtt----attcatagt--------ccagactcacccagcctg-gt-------ctcccat-gccc--a
B D                    Rhesus  atagtt----attcatggt--------ccacagtcacctgacctg-gt-------ctcccat-gccc--a
B D       Crab-eating macaque  atagtt----attcatggt--------ccacactcacctgacctg-gt-------ctcccat-gccc--a
B D                    Baboon  atggtt----attcatggt--------ccacactcacctgacctg-gt-------ctcccat-gccc--a
B D              Green monkey  atagtt----attcatggt--------ccagactcacctggcctg-at-------ctcccat-gccc--a
B D                  Marmoset  atagtt----attcatagt--------ccagactggccccgcctg-gt-------cccctat-tccc--a
B D           Squirrel monkey  atagtt----attcatagt--------ccagactggccccgcctg-gt-------cccctat-tccc--a
B D                  Bushbaby  gtagtt----attcacagt--------ccacactcttcccgcctg-at-------cccacat-gccc--a
           Chinese tree shrew  atagtt----atttatggc--------ccaaactc-----------------------------------
B D                  Squirrel  atagtt----actcatagc--------tcaaat-------------------------------------
B D           Chinese hamster  atggtt----ttttcatat--------ccagacg------------------------------------
               Golden hamster  acgttt----ttttaatat--------ccagatg------------------------------------
B D                     Mouse  atagtt----atttaatgt--------ccagacc------------------------------------
B D                       Rat  atagtt----atttaatgt--------ccagac-------------------------------------
B D            Naked mole-rat  atagtt----cttcaaagt--------ccaaaat------------------------------------
                   Chinchilla  acagtt----ctccaaag----------------------------------------------------
             Brush-tailed rat  gtagtt----cccccagg---------------t------------------------------------
B D                    Rabbit  -tagtccaagctcccacat--------ccatcccc-------------------------gt-gccc--a
B D                    Alpaca  gtggtt----gttggtagt--------ccaat------ccacccc-at-------tccccat-accc--a
               Bactrian camel  gcggtt----gtttgtagt--------ccaat------ccacccc-ac-------tccccat-accc--a
B D                   Dolphin  atggtt----attcgtagt--------ccaatccacccccac-cc-ac-------tccccat-accc--a
                 Killer whale  atggtt----attcgtagt--------ccaatccacccccac-cc-ac-------tccccat-accc--a
             Tibetan antelope  ttggtt----tttcatagt--------ccaatcaatgtccacccc-at-------tccccataaccc--a
B D                       Cow  ttggtt----tttcatagt--------ccaatcaatgcccacctc-ac-------tccccat-tccc--a
B D                     Sheep  ttggtt----tttcatagt--------ccaatcaatgtccacccc-at-------tccccat-accc--a
                Domestic goat  ttggtt----tttcatagt--------ccaatcaatgtccactcc-at-------tccccat-accc--a
B D                     Horse  atagtt----actcatagt--------cccacccaaccccatccc-cc-------tccgcat-gccc--a
B D          White rhinoceros  atagtt----atttatagt--------ccc-cccatccccacccc-ac-------tccccat-gccc--a
B D                       Cat  ctagtt----aatcacagt--------ccc--------ccacctc-ac-------tccccag-a--c--a
B D                       Dog  ctagtt----attcacgttc-------ccc--------ccacctc-ac-------tccccat-gccc--a
B D                   Ferret   ctagtt----actcatagt--------ccc--------ccatgtc-ac-------tccccac-gccc--a
B D                     Panda  ctagtt----actcatagt--------ccc--------ccagctc-cg-------tccccat-gccc--a
               Pacific walrus  ctagtt----actcatagt--------ccc--------ctacctc-ac-------tccccat-gccc--a
                 Weddell seal  ctagtt----actcatagt--------ccc--------ccacctc-at-------tccctgt-g-cc--a
             Black flying-fox  atagtg----attcagagtctaattt-ccc--------ccaccctaac-------tctccat-gccc--a
B D                   Megabat  atagtg----attcagagtctaatttcccc--------ccaccctaac-------tctccat-gccc--a
B D                  Hedgehog  acagtt----attcatagt--------cca--------acctacc-actaccccactcccca-cacctga
B D                     Shrew  acagat----atgc--agc--------ctg--------ttctgcc-at-------ctcccag-gccc--a
              Star-nosed mole  ac---------------gc--------cca--------ccacgc-----------ttcccaa-gacc--a
B D                 Armadillo  atattt----attcgatgc--------ccagcctcgccctgctcc-ac-------cccctgt-ccac--c
                Prairie vole  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Guinea pig  ======================================================================
B D                       Pig  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
                 Spotted gar  ======================================================================
          Southern platyfish  ======================================================================
B D                      Fugu  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D                    Tenrec  ======================================================================
  D  Chinese softshell turtle  ======================================================================
        David's myotis (bat)  ----------------------------------------------------------------------
               Big brown bat  ----------------------------------------------------------------------
B D                  Microbat  ----------------------------------------------------------------------

                        Human  cctccaccatcta-a--tgcctgaatc----cctgctgca-gcatct--atacctagt------------
                        Chimp  cctccaccatcta-a--tgcctgaatc----cctgctgca-gcatct--atacctagt------------
                      Gorilla  cctccaccatcta-a--tgcctgaatc----cctgctgca-gcatct--atacctagt------------
                    Orangutan  cctccaccatcta-a--tgcctgaatc----cctgctgca-gcatct--atacctagt------------
                       Gibbon  cctccaccatcta-a--tgcctgaatc----cctgctgca-gcatct--acacatagt------------
                       Rhesus  cctccaccatcca-a--tgcctgaatc----cctgctgca-gcatct--atacctact------------
          Crab-eating macaque  cctccaccatcca-a--tgcctgaatc----cctgctgca-gcatct--atacctact------------
                       Baboon  cctccaccatcca-a--tgcctgaatc----cctgctgca-gcatct--atacctact------------
                 Green monkey  cctccaccatcca-a--tgcctgaatc----cctgctgca-gcatct--atacctagt------------
                     Marmoset  cctccaccatcta-a--tgcctgaatg----cctgctgca-gcatcc--atacctagt------------
              Squirrel monkey  cctccaccatcta-a--tgcctgaatg----cctgctgca-gcatcc--atacctagt------------
                     Bushbaby  ccctggacatcca-g--tgcctgagt-----cctgctgca-gcatcc--atacctagt------------
           Chinese tree shrew  cccctaccatc------------accc----tcctcttca-ggacct--gtatctg--------------
                     Squirrel  --ccccccacctg-a----tcccatca----tccaatacctgaatcc--ttgctgcagcctccaattcta
              Chinese hamster  --cccctcgcccg-a---ccactatca----cccagtgca-gaatcc--atgcca---------------
               Golden hamster  ---ccttcacccg-a---cccccaaca----cccaacgca-gaatcc--atgctc---------------
                        Mouse  ctcctctcaccca-aagcactccgtca----cccaaagca-gaatct--atgcca---------------
                          Rat  --cccctcacctg-a-----tccatct----cccgaagca-gaatcc--atgcca---------------
               Naked mole-rat  ctccctgcatcca-a--tgtctgaacc----cctgctgtg-gcatcc--acacctcacgac---------
                   Chinchilla  --tcctgcatcca-g--cgtccgagct----cctgccaca-gcatcc--atgcctcatgg----------
             Brush-tailed rat  gttgttgcaccca-c--tgtctgaggc----cctgctgca-acgccc--acacctcgtgac---------
                       Rabbit  cctctgtcaccca-g--tgcctgaatc----ctggctaca-gcaacc--atacctagg------------
                       Alpaca  cccctatcatcca-a--tgcctgaatc----cctactgta-g----------------------------
               Bactrian camel  cccctatcatcca-a--tgcctgaatc----cttactgta-g----------------------------
                      Dolphin  ccaccatcatcca-a--tgcctgaatc----ccttcggtg-gcttcc--acatctagt------------
                 Killer whale  ccaccatcaacca-a--tgcctgaatc----ccttcggtg-gcttcc--acatctagt------------
             Tibetan antelope  cccccatcatcta-a--tgcctgaatc----ccttctgcg-acttccaaatatctagt------------
                          Cow  cccccatcatcta-a--tgcctgaatc----ccttctgtg-acttccaaatatctagt------------
                        Sheep  cccccatcatcta-a--tgcctgaatc----ccttctgcg-acttccaaatatctagc------------
                Domestic goat  cccccatcatcta-a--tgcctgaatc----ccttctgca-acttccaaatatctagt------------
                        Horse  tccccatca-cca-g--tgcctgaatc----ccta-tgca-gcatcc--atatctagt------------
             White rhinoceros  cccccatcattca-a--tgcctgaatc----cctactgca-gcctcc--atatctagt------------
                          Cat  cccccatcatcca-c--tgcctgaatc----tctaccgca-gtgtcc--atatctagt------------
                          Dog  ccc-catcctcca-a--tatccaaatc----cctcctgca-gcatcc--agacctagt------------
                      Ferret   ccctcatccgcca-g--cgtccgaatc----cctcctgca-gcatcc--acgtctagt------------
                        Panda  cccccatcctcca-g--tgtccgaatc----cctcctgca-gcactc--acgtctagt------------
               Pacific walrus  cccccatcctcca-g--tgtctgaatc----cctcctgca-gcatcc--acgtctagg------------
                 Weddell seal  cccccatcctcca-g--tgtccgaatc----cctcctgca-gcatcc--acgtatagg------------
             Black flying-fox  gccccatcatcca-a--tgcctgaatccctacctattgca-gcctcc--atatctagt------------
                      Megabat  gccccatcatcca-a--tgcctgaatc----cctattgca-gcctcc--atatctagt------------
                     Hedgehog  cccctatcatcca-t--tgcctgaatc----ccag-tgca-gcaacc--atgtctagt------------
                        Shrew  ccccctgtatcca-t----cctgaatc----ccag-tgtg-gcaccc--acatccaat------------
              Star-nosed mole  ctctcatcgtccagt----gttgca------cctg-tgag-gcgccc--atccctaga------------
                    Armadillo  ctctcattatcca-a--tgtctgaatc----ccttctgca-gcctcc--acacccagg------------
                 Prairie vole  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                         Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Guinea pig  ======================================================================
                          Pig  ======================================================================
             Cape golden mole  ======================================================================
                     Aardvark  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                  Spotted gar  ======================================================================
           Southern platyfish  ======================================================================
                         Fugu  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
          Cape elephant shrew  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
     Chinese softshell turtle  ======================================================================
         David's myotis (bat)  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ----------------------------------------------------------------------

                        Human  --gacc--atcctgtctctgctcaaacacctacagga---ac-aggg-----gacttattccccactt
                        Chimp  --gacc--atcctgtctctgctcaaacacctacagga---ac-aggg-----gacttattccccactt
                      Gorilla  --gacc--atcctgtctctgctcaaacacctacagga---ac-aggg-----gacttattccccactt
                    Orangutan  --gacc--atcctgtctctgctcaaacacctacagga---ac-agag-----gacttattccccactt
                       Gibbon  --gacc--atcctgtctctgctcaaacacctacagga---ac-aagg-----gacttattccccactt
                       Rhesus  --gacc--atcctgtctctgctcaaacacctacagga---ac-aggg-----gacttattccccactt
          Crab-eating macaque  --gacc--atcctgtctctgctcaaacacctacagga---ac-aggg-----gacttattccccactt
                       Baboon  --gacc--atcctgtctctgctcaaacacctacagga---ac-aggg-----gacttattccccactt
                 Green monkey  --gacc--atcctgtctctgctcaaacacatacagga---ac-aggg-----gacttattccccactt
                     Marmoset  --ggcc--atcctgtctctgctcaaacacctacagga---ac-agga--tatgatgtattccccactt
              Squirrel monkey  --ggcc--atcctgtctctgctcaaacacctacagga---ac-agga--aatgacgtattccccactt
                     Bushbaby  --ggct--atcttccttctgcttacataccttcaggg---ac-aggg-----agctcgtcccctacta
           Chinese tree shrew  -----------------ctactca------------a---ac-gggg-----g---------------
                     Squirrel  gtggcc--atcctacctctgctccaacacctgcaggg---ac-ag-------gggtcactcccttctg
              Chinese hamster  --gacc--attcagccactgctctgacacctgcaggg---ac-agac-agaaggtccagccccaccta
               Golden hamster  --aaccctattcagcctctgctctaacaccttcaggg---ac-agat-agaaggttcaggcccaccta
                        Mouse  --gacc--gttcagcctctgctcgatcacctggaagg---at-agacaagaaggcccagccacaccta
                          Rat  --gacc--attcagcttctgctgtatcacctacaagg---ac-agac-agaaggcccagccacaccca
               Naked mole-rat  --tggc--atcctgcttctgcccctacacccgcagga---ac-aaag-----gacttggttcctcctg
                   Chinchilla  --tggc--gacctgcttcagctcccacacctgcaggg---ac-aagg-----gacttggtccctcctg
             Brush-tailed rat  --tggg--aacctacttctgcttcctcgccagctggg---ac-aagg-----gactcggtccctcctg
                       Rabbit  --aacc--atcctgcctctgctcaaatatctgcagag---ag-agaggtcatggcctgttcccctttt
                       Alpaca  -----c--acccggcctctgcccgaacccctgcagtg---at-agaa-----ggctcactcccttctg
               Bactrian camel  -----c--acccggcctctgctcgaacccctgcagtg---at-agaa-----ggctcactcccttctg
                      Dolphin  --gacc--atcctgcctctgcttgaacacctgcagag---at-gg-g-----ggctcacgcctttctg
                 Killer whale  --gacc--atcctgcctctgcttgaacacctgcagag---atagg-g-----ggctcacgcctttctg
             Tibetan antelope  --ggcc--atcctgcctctgcttgaacacttacagtg---gt-ag-g-----ggcccactcctttatg
                          Cow  --ggcc--atcctgcctctgcttgaacacctgcagtg---gt-agaa-----ggctcactcccttatg
                        Sheep  --ggcc--atcctgcctctgcttgagcacttacagtg---gt-ag-g-----ggcccactccctgatg
                Domestic goat  --ggcc--atcctgcctctgcttgagcacttacagtg---gt-ag-g-----ggcccactcccttatg
                        Horse  --ggcc--atctggcctctgctcaaacacttgctgag---at-cggg-----ggctcacttacttctg
             White rhinoceros  --ggcc--atcctgcctctgctcaaacacctgctggg---at-aggg-----ggctcactcccttcta
                          Cat  --ggcc--ctcctgcctcttctcaaacacctgctggg---at-agag-----ggctcacccccttcca
                          Dog  --ggcc--atcctgcctctgcttaaacagctgctgcg---at-agag-----ggctcgtgcccttccg
                      Ferret   --ggcc--gtcctgccactactcaaacacctgctggg---at-agaa-----ggctcgtgcccttcca
                        Panda  --gccc--atcctgcctctgctcaaacacctgctggg---at-agag-----ggctcgtgcccttcca
               Pacific walrus  --ggct--gtcctgcctctgctcaaacacctgctggg---at-agag-----ggctcatgcccttccg
                 Weddell seal  --ggcc--atcctgcctctgctcaaacacctgctggg---at-agag-----ggcttgtgcccttccg
             Black flying-fox  --ggcc--atc-tgcttttgctcaaacacctggatgg---ag-ag-g-----ggcttactcccttctg
                      Megabat  --ggcc--atc-tgcttttgctcaaacacctggatgg---ag-ag-g-----ggcttactcccttctg
                     Hedgehog  --gacc--atc-aacttctgttcaaacacctacagga---at-ag-g-----ggatcagtcccttgtg
                        Shrew  --ggt---------------ctcctgctgctatagagcccat-gg-g-----ggcttgttcccttctg
              Star-nosed mole  --gg----------------cacaaccatctgcagg----at-ag-g-----ggctcactcctttctg
                    Armadillo  --ggcc--ctcctgcctctgctccaacacctgcaggg---at-gggg---------cactcccttccg
                 Prairie vole  ====================================================================
       Lesser Egyptian jerboa  ====================================================================
                         Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Guinea pig  ====================================================================
                          Pig  ====================================================================
             Cape golden mole  ====================================================================
                     Aardvark  ====================================================================
                   Coelacanth  ====================================================================
                X. tropicalis  ====================================================================
                  Spotted gar  ====================================================================
           Southern platyfish  ====================================================================
                         Fugu  ====================================================================
                       Turkey  ====================================================================
                      Chicken  ====================================================================
                 Mallard duck  ====================================================================
           Tibetan ground jay  ====================================================================
                  Zebra finch  ====================================================================
       White-throated sparrow  ====================================================================
              Tasmanian devil  ====================================================================
     Mexican tetra (cavefish)  ====================================================================
                    Zebrafish  ====================================================================
          Pundamilia nyererei  ====================================================================
                  Zebra mbuna  ====================================================================
        Burton's mouthbreeder  ====================================================================
          Princess of Burundi  ====================================================================
                 Nile tilapia  ====================================================================
               Painted turtle  ====================================================================
              Green seaturtle  ====================================================================
           American alligator  ====================================================================
                   Budgerigar  ====================================================================
                      Opossum  ====================================================================
                  Rock pigeon  ====================================================================
          Collared flycatcher  ====================================================================
          Medium ground finch  ====================================================================
             Peregrine falcon  ====================================================================
                 Saker falcon  ====================================================================
                       Parrot  ====================================================================
          Cape elephant shrew  ====================================================================
                     Platypus  ====================================================================
                      Wallaby  ====================================================================
                      Manatee  ====================================================================
                     Elephant  ====================================================================
                       Tenrec  ====================================================================
     Chinese softshell turtle  ====================================================================
         David's myotis (bat)  --------------------------------------------------------------------
                Big brown bat  --------------------------------------------------------------------
                     Microbat  --------------------------------------------------------------------

Inserts between block 9 and 10 in window
B D                   Rabbit 584bp

Alignment block 10 of 52 in window, 38792304 - 38792330, 27 bps 
B D                     Human  aagcagcttctgtctcccatcagtgcc
B D                     Chimp  aagcagcttctgtctcccatcagtgcc
B D                   Gorilla  aagcagcttctgtctcccatcagtgcc
B D                 Orangutan  aagcagcttctgtctcccatcagtgcc
B D                    Gibbon  aagcagcttctgtctcccatcagtgcc
B D                    Rhesus  atgcaacttctgtctcccatcagtgcc
B D       Crab-eating macaque  atgcaacttctgtctcccatcagtgcc
B D                    Baboon  atgcaacttctgtctcccatcagtgcc
B D              Green monkey  atgcaacttctgtctcccatcagtgcc
B D                  Marmoset  aagcagc-tctgtgtcctatcagtgtt
B D           Squirrel monkey  aagcagc-tctgtgtcctatcagtgtc
B D                  Bushbaby  aggcagcctctgtttttccttggtacc
B D                  Squirrel  aagaaacctctgtctcccatcaacacc
B D           Chinese hamster  cctcagcctcg------tgtcagctcc
               Golden hamster  catcagcctcg------tgtcagctcc
B D                     Mouse  cggcagcctccaccttccaccggctcc
B D                       Rat  cagcagcctcaacctcccactagctcc
B D            Naked mole-rat  aagtagcctctacctcccatcagcac-
                   Chinchilla  aagtagcccctagctcccatcggcac-
             Brush-tailed rat  aaatag-ccctacctcccatcagcac-
B D                    Rabbit  aagcagccctc--ctcctatcagcttc
B D                    Alpaca  aagaagcctctgtcccctaccagcacc
               Bactrian camel  aagaagcctctgtcccctaccagcacc
B D                   Dolphin  aagcagcctccgtcccccatcagcacc
                 Killer whale  aagcagcctccatcccccatcagcacc
             Tibetan antelope  aagcagcctccaacccccatctgctcc
B D                       Cow  aa-cagcccccgacccccatcagctcc
B D                     Sheep  aagcagcctccaacccccatcagctcc
                Domestic goat  aagcagcctccaacccccatcagctcc
B D                     Horse  aggcagcccttgtcccccatcagcacc
B D          White rhinoceros  aagcagcccctgtcacccatcggcacc
B D                       Cat  aagcatcctctgtcccccctccac-ct
B D                       Dog  aggca----------cccaccagcacc
B D                   Ferret   aagcaccctctgtctcccagcagcaac
B D                     Panda  aagcaccctctgtcccccatcatcacc
               Pacific walrus  aagcaccctctgtcccccagcagcagc
                 Weddell seal  aagcaccctctgtcccccagcagcacc
             Black flying-fox  aagcagtccttgtcccccatcagcacc
B D                   Megabat  aagcagtccttgtcccccatcagcacc
B D                  Hedgehog  aagcatcctttgtcactt-tcctcatc
B D                     Shrew  cagtgcc--------------------
              Star-nosed mole  aaacacct-----------------tc
B D                 Armadillo  aagcagcatctgcctcccatcagcacc
                Prairie vole  ===========================
      Lesser Egyptian jerboa  ===========================
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Guinea pig  ===========================
B D                       Pig  ===========================
            Cape golden mole  ===========================
                    Aardvark  ===========================
B D                Coelacanth  ===========================
B D             X. tropicalis  ===========================
                 Spotted gar  ===========================
          Southern platyfish  ===========================
B D                      Fugu  ===========================
B D                    Turkey  ===========================
B D                   Chicken  ===========================
  D              Mallard duck  ===========================
          Tibetan ground jay  ===========================
B D               Zebra finch  ===========================
  D    White-throated sparrow  ===========================
B D           Tasmanian devil  ===========================
    Mexican tetra (cavefish)  ===========================
B D                 Zebrafish  ===========================
         Pundamilia nyererei  ===========================
                 Zebra mbuna  ===========================
       Burton's mouthbreeder  ===========================
         Princess of Burundi  ===========================
B D              Nile tilapia  ===========================
  D            Painted turtle  ===========================
  D           Green seaturtle  ===========================
B D        American alligator  ===========================
B D                Budgerigar  ===========================
B D                   Opossum  ===========================
  D               Rock pigeon  ===========================
  D       Collared flycatcher  ===========================
B D       Medium ground finch  ===========================
  D          Peregrine falcon  ===========================
  D              Saker falcon  ===========================
  D                    Parrot  ===========================
         Cape elephant shrew  ===========================
          Chinese tree shrew  ---------------------------
B D                  Platypus  ===========================
B D                   Wallaby  ===========================
B D                   Manatee  ===========================
B D                  Elephant  ===========================
B D                    Tenrec  ===========================
  D  Chinese softshell turtle  ===========================
        David's myotis (bat)  ---------------------------
               Big brown bat  ---------------------------
B D                  Microbat  ---------------------------

Inserts between block 10 and 11 in window
B D                      Rat 3339bp
B D                Armadillo 5bp

Alignment block 11 of 52 in window, 38792331 - 38792331, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
B D                  Squirrel  c
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  c
B D            Naked mole-rat  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  t
B D                   Megabat  t
B D                  Hedgehog  a
              Star-nosed mole  c
B D                 Armadillo  c
B D                       Rat  =
                Prairie vole  =
      Lesser Egyptian jerboa  =
B D                      Pika  N
B D                     Shrew  -
B D                Guinea pig  =
B D                       Pig  =
            Cape golden mole  =
                    Aardvark  =
B D                Coelacanth  =
B D             X. tropicalis  =
                 Spotted gar  =
          Southern platyfish  =
B D                      Fugu  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
         Cape elephant shrew  =
          Chinese tree shrew  -
B D                  Platypus  =
B D                   Wallaby  =
B D                   Manatee  =
B D                  Elephant  =
B D                    Tenrec  =
  D  Chinese softshell turtle  =
        David's myotis (bat)  -
               Big brown bat  -
B D                  Microbat  -

Inserts between block 11 and 12 in window
B D          Chinese hamster 2303bp
              Golden hamster 774bp

Alignment block 12 of 52 in window, 38792332 - 38792332, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  t
B D                  Squirrel  c
B D                     Mouse  c
B D            Naked mole-rat  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
B D                  Hedgehog  g
              Star-nosed mole  a
B D                 Armadillo  c
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
      Lesser Egyptian jerboa  =
B D                      Pika  N
B D                     Shrew  -
B D                Guinea pig  =
B D                       Pig  =
            Cape golden mole  =
                    Aardvark  =
B D                Coelacanth  =
B D             X. tropicalis  =
                 Spotted gar  =
          Southern platyfish  =
B D                      Fugu  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
         Cape elephant shrew  =
          Chinese tree shrew  -
B D                  Platypus  =
B D                   Wallaby  =
B D                   Manatee  =
B D                  Elephant  =
B D           Chinese hamster  =
B D                    Tenrec  =
  D  Chinese softshell turtle  =
        David's myotis (bat)  -
               Big brown bat  -
B D                  Microbat  -

Inserts between block 12 and 13 in window
B D                    Mouse 3296bp

Alignment block 13 of 52 in window, 38792333 - 38792354, 22 bps 
B D                     Human  taccct-----ttcttacctctc-cact
B D                     Chimp  taccct-----ttcttacctctc-cact
B D                   Gorilla  taccct-----ttcttacctctc-cact
B D                 Orangutan  taccct-----ttcttacctctc-cact
B D                    Gibbon  taccct-----ttcttgcctctc-cact
B D                    Rhesus  taccct-----ttcttatctctc-cact
B D       Crab-eating macaque  taccct-----ttcttatctctc-tact
B D                    Baboon  taccct-----ttcttatctctc-cact
B D              Green monkey  taccct-----ttcttatctctc-cact
B D                  Marmoset  taccct-----ttcttacctctc-catt
B D           Squirrel monkey  taccct-----ttcttacctctc-catt
B D                  Bushbaby  cactct-----ttcttccctctc-cact
B D                  Squirrel  tacccc-----ttcttacctctc-cact
B D            Naked mole-rat  tactct-----tttttgtctctc-cact
                   Chinchilla  tactct-----cttttgtcactt-tctt
             Brush-tailed rat  tactct-----tttttgtctgtg-tgtc
B D                    Rabbit  tacgct-----ttgttgcctccc-catt
B D                    Alpaca  tactct-----ttcctgcctctc-catt
               Bactrian camel  tactct-----ttcctgcctctc-cact
B D                   Dolphin  tactct-----ttcttgcctctc-cact
                 Killer whale  tactct-----ttcttgcctctc-cact
             Tibetan antelope  taccct-----ttcttccctctc-cact
B D                       Cow  taccct-----ttcttccctctc-cact
B D                     Sheep  caccct-----ttcttccctctc-cact
                Domestic goat  taccct-----ttcttccctctc-cact
B D                     Horse  tactct-----ttcttgcctctc-cact
B D          White rhinoceros  tactct-----ttcttgcctgtt-cact
B D                       Cat  catgct-----ttcttgcctctt-cagt
B D                       Dog  catgct-----ttcttccccccctcagt
B D                   Ferret   catgct-----ttcttgcctctc-cagt
B D                     Panda  cacgct-----ttcttgcttctc-cagt
               Pacific walrus  ca-------------------tc-cagt
                 Weddell seal  catgct-----ttcttgaatctc-cagt
             Black flying-fox  tactct-----ttcttgcctctt-cgtt
B D                   Megabat  tactct-----ttcttgcctctt-cgtt
B D                  Hedgehog  cacaccaccactgcttgcctttc-catc
B D                     Shrew  cacact-----tacctgtactgc-aact
              Star-nosed mole  cacactactcattcttgcctctc-cact
B D                 Armadillo  ccctct-----ttctcgactctc-cact
B D                       Rat  ============================
                Prairie vole  ============================
              Golden hamster  ============================
B D                     Mouse  ============================
      Lesser Egyptian jerboa  ============================
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Guinea pig  ============================
B D                       Pig  ============================
            Cape golden mole  ============================
                    Aardvark  ============================
B D                Coelacanth  ============================
B D             X. tropicalis  ============================
                 Spotted gar  ============================
          Southern platyfish  ============================
B D                      Fugu  ============================
B D                    Turkey  ============================
B D                   Chicken  ============================
  D              Mallard duck  ============================
          Tibetan ground jay  ============================
B D               Zebra finch  ============================
  D    White-throated sparrow  ============================
B D           Tasmanian devil  ============================
    Mexican tetra (cavefish)  ============================
B D                 Zebrafish  ============================
         Pundamilia nyererei  ============================
                 Zebra mbuna  ============================
       Burton's mouthbreeder  ============================
         Princess of Burundi  ============================
B D              Nile tilapia  ============================
  D            Painted turtle  ============================
  D           Green seaturtle  ============================
B D        American alligator  ============================
B D                Budgerigar  ============================
B D                   Opossum  ============================
  D               Rock pigeon  ============================
  D       Collared flycatcher  ============================
B D       Medium ground finch  ============================
  D          Peregrine falcon  ============================
  D              Saker falcon  ============================
  D                    Parrot  ============================
         Cape elephant shrew  ============================
          Chinese tree shrew  ----------------------------
B D                  Platypus  ============================
B D                   Wallaby  ============================
B D                   Manatee  ============================
B D                  Elephant  ============================
B D           Chinese hamster  ============================
B D                    Tenrec  ============================
  D  Chinese softshell turtle  ============================
        David's myotis (bat)  ----------------------------
               Big brown bat  ----------------------------
B D                  Microbat  ----------------------------

Inserts between block 13 and 14 in window
            Brush-tailed rat 58bp

Alignment block 14 of 52 in window, 38792355 - 38792403, 49 bps 
B D                     Human  ggagagat----ccggggaaac--ttccact--cc---cac----------t-gaggtaggatgataaga
B D                     Chimp  ggagagag----ccggggaaac--ttccact--cc---cac----------t-gaggtaggatgataaga
B D                   Gorilla  ggagagag----ccggggaaac--ttccact--cc---cac----------t-gaggtaggatgataaga
B D                 Orangutan  ggagagag----ccggggaaac--ttccact--cc---cac----------t-gaggtaggatgacaaga
B D                    Gibbon  ggagagag----ccggggaaat--ttccact--cc---cac----------t-gaggtaggatgataaga
B D                    Rhesus  ggagagag----ctggggaaac--ttccact--cc---cac----------t-gaggcaggatgataaca
B D       Crab-eating macaque  ggagagag----ctggggaaac--ttccact--cc---cac----------t-gaggcaggatgataaca
B D                    Baboon  ggagagag----ctggggaaaa--ttccact--cc---cac----------t-gaggcaggatgataaca
B D              Green monkey  ggagagag----ctggggaaac--tttcact--cc---cac----------t-gaggcaggatgataaga
B D                  Marmoset  ggagacag----ccagggaaat--gtccact--cc---cac----------t-gaggtaggatgataaga
B D           Squirrel monkey  ggagacag----ccagggaaat--ttccact--cc---cac----------t-gaggtaggatggtaaga
B D                  Bushbaby  gggaagaaaaaccagtggaggccatttcatt--cc---tcc----------tggaggtaggatgataaca
           Chinese tree shrew  gggggggg----------------ccccact--ccctgccc----------a-gaggtaggatgataaga
B D                  Squirrel  ggagacag----ccagggagcc--ttctacc--ca---caa----------t-gaggtagaatgttaaaa
B D            Naked mole-rat  -gggacag----tcaaga-gcc--ttccacc--cc---cac----------a-tgggtaggatgatcaaa
                   Chinchilla  -gtctctg----tcaggg-gcc--ttccacc--tc---cac----------t-cgcgtaggatgatca--
B D                    Rabbit  gaggacag----gcagagagct--gtctgct--gc---tac----------a-gaagtaggatgataaaa
B D                    Alpaca  gagaagag----ccaggaagac--ttccact--ct---cac----------t-aaggtagaatgacaaga
               Bactrian camel  gaggagag----ccaggaagac--tttcact--ct---cac----------t-aaggtagaatgacaaga
B D                   Dolphin  gcggagag----ccaggaagac--ttccact--cc---cac----------t-gcggtaggatgataaga
                 Killer whale  gccgagag----ccaggaagac--ttccact--cc---cac----------t-gaggtaggatgataaga
             Tibetan antelope  ggggaaag----ccaggaagac--tttcaca--cc---cac----------t-gaggtagaatgatgaga
B D                       Cow  ggggaaag----ccaggaagac--tttcacg--cc---cac----------t-gaggcagaatgataaga
B D                     Sheep  ggggaaag----ccaggaagac--tttcacg--cc---ccc----------t-gaggtagaatgatgaga
                Domestic goat  ggggaaag----ccaggaagac--tttcacg--ct---cac----------t-gaggtagaatgatgaga
B D                     Horse  ggagagag----ccaggaagcc--ttccacc--cg---cag----------t-gaggtaggctgataaga
B D          White rhinoceros  gg-gagag----ccaggaagcc--ttccagc--cc---cac----------t-gaggtaggatgacaaga
B D                       Cat  ggggagag----ccaggaagcc--atccacccccc---caccccaccctgcc-gaggcaggatgataaga
B D                       Dog  ---gagaa----ccaggaagcc--atccaccc-cc---cac----------g-gaggtaggatgataaga
B D                   Ferret   gcagagag----ccaaggaccc--atccaccc-ca---cac----------t-gaggtaggatgataaga
B D                     Panda  ggggagag----ccaggaagcc--atccaccctca---cac-ctacc---at-gaggtaggatgataaga
               Pacific walrus  ggggagag----ccaggaagcc--atccaccc-ca---cac----------t-gaggtaggatgataaga
                 Weddell seal  ggggagag----ccaggaagcc--atccaccc-ca---cac----------t-gaggtaggatgataaga
             Black flying-fox  ggggagac----ccaggaagcc--ttcca----cc---ctc----------a-gaggtagcatgataaga
B D                   Megabat  ggggagac----ccaggaagcc--ttcca----cc---ctc----------a-gaggtagcatgataaga
B D                  Hedgehog  gtg-----------aagaattc--ttgcacc--tc---ttc----------t-gaggtaggatgataaga
B D                     Shrew  gcagagaa----ccaagaagcc--ttccact--tc---cat----------t-gaggta----gataaga
              Star-nosed mole  gggggaag----ccaagaagcc--tt-cacc--tt---cac----------t-gaagtag---gataaga
B D                 Armadillo  ggtgagag----ccagggagcc--tcccac---cc---ctt----------t-gaggtggtatgataaca
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
              Golden hamster  ======================================================================
B D                     Mouse  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Guinea pig  ======================================================================
B D                       Pig  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
                 Spotted gar  ======================================================================
          Southern platyfish  ======================================================================
B D                      Fugu  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
            Brush-tailed rat  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D           Chinese hamster  ======================================================================
B D                    Tenrec  ======================================================================
  D  Chinese softshell turtle  ======================================================================
        David's myotis (bat)  ----------------------------------------------------------------------
               Big brown bat  ----------------------------------------------------------------------
B D                  Microbat  ----------------------------------------------------------------------

                        Human  g
                        Chimp  g
                      Gorilla  g
                    Orangutan  g
                       Gibbon  g
                       Rhesus  g
          Crab-eating macaque  g
                       Baboon  g
                 Green monkey  g
                     Marmoset  g
              Squirrel monkey  g
                     Bushbaby  t
           Chinese tree shrew  g
                     Squirrel  a
               Naked mole-rat  g
                   Chinchilla  -
                       Rabbit  a
                       Alpaca  g
               Bactrian camel  g
                      Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
                          Cow  g
                        Sheep  g
                Domestic goat  g
                        Horse  g
             White rhinoceros  g
                          Cat  g
                          Dog  g
                      Ferret   g
                        Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
                      Megabat  g
                     Hedgehog  g
                        Shrew  g
              Star-nosed mole  a
                    Armadillo  g
                          Rat  =
                 Prairie vole  =
               Golden hamster  =
                        Mouse  =
       Lesser Egyptian jerboa  =
                         Pika  N
                   Guinea pig  =
                          Pig  =
             Cape golden mole  =
                     Aardvark  =
                   Coelacanth  =
                X. tropicalis  =
                  Spotted gar  =
           Southern platyfish  =
                         Fugu  =
                       Turkey  =
                      Chicken  =
                 Mallard duck  =
           Tibetan ground jay  =
                  Zebra finch  =
       White-throated sparrow  =
              Tasmanian devil  =
     Mexican tetra (cavefish)  =
                    Zebrafish  =
          Pundamilia nyererei  =
                  Zebra mbuna  =
        Burton's mouthbreeder  =
          Princess of Burundi  =
                 Nile tilapia  =
               Painted turtle  =
              Green seaturtle  =
           American alligator  =
                   Budgerigar  =
                      Opossum  =
                  Rock pigeon  =
          Collared flycatcher  =
          Medium ground finch  =
             Peregrine falcon  =
                 Saker falcon  =
                       Parrot  =
             Brush-tailed rat  =
          Cape elephant shrew  =
                     Platypus  =
                      Wallaby  =
                      Manatee  =
                     Elephant  =
              Chinese hamster  =
                       Tenrec  =
     Chinese softshell turtle  =
         David's myotis (bat)  -
                Big brown bat  -
                     Microbat  -

Inserts between block 14 and 15 in window
B D                 Squirrel 3bp
B D           Naked mole-rat 79bp
B D                      Cat 17bp
B D                  Ferret  125bp
                Weddell seal 903bp
B D                 Hedgehog 3bp
B D                    Shrew 948bp
             Star-nosed mole 4bp

Alignment block 15 of 52 in window, 38792404 - 38792409, 6 bps 
B D                     Human  cttaga
B D                     Chimp  ctt---
B D                   Gorilla  ctt---
B D                 Orangutan  ctt---
B D                    Gibbon  ctt---
B D                    Rhesus  ctt---
B D       Crab-eating macaque  ctt---
B D                    Baboon  ctt---
B D              Green monkey  ctt---
B D                  Marmoset  ctt---
B D           Squirrel monkey  ctt---
B D                  Bushbaby  ctt---
B D                       Cat  ctt---
B D                 Armadillo  ---gga
B D                       Rat  ======
                Prairie vole  ======
              Golden hamster  ======
B D                     Mouse  ======
      Lesser Egyptian jerboa  ======
B D                      Pika  NNNNNN
                Weddell seal  ======
B D                  Hedgehog  ======
B D                     Shrew  ======
B D                Guinea pig  ======
B D                       Pig  ======
B D                    Rabbit  ------
            Cape golden mole  ======
                    Aardvark  ======
B D                Coelacanth  ======
B D                   Megabat  ------
B D                   Dolphin  ------
B D             X. tropicalis  ======
                 Spotted gar  ======
          Southern platyfish  ======
B D                      Fugu  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
  D    White-throated sparrow  ======
B D           Tasmanian devil  ======
    Mexican tetra (cavefish)  ======
B D                 Zebrafish  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D        American alligator  ======
B D                Budgerigar  ======
B D                   Opossum  ======
B D            Naked mole-rat  ======
  D               Rock pigeon  ======
  D       Collared flycatcher  ======
B D       Medium ground finch  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D                    Parrot  ======
            Brush-tailed rat  ======
                  Chinchilla  ------
         Cape elephant shrew  ======
          Chinese tree shrew  ------
B D                  Platypus  ======
B D                   Wallaby  ======
B D                   Manatee  ======
B D                  Elephant  ======
B D           Chinese hamster  ======
B D                    Tenrec  ======
  D  Chinese softshell turtle  ======
B D                   Ferret   ======
             Star-nosed mole  ======
               Domestic goat  ------
B D                     Sheep  ------
            Tibetan antelope  ------
              Bactrian camel  ------
B D                    Alpaca  ------
              Pacific walrus  ------
B D                     Panda  ------
                Killer whale  ------
B D                       Dog  ------
            Black flying-fox  ------
B D          White rhinoceros  ------
B D                     Horse  ------
B D                  Squirrel  ======
        David's myotis (bat)  ------
               Big brown bat  ------
B D                  Microbat  ------
B D                       Cow  ------

Inserts between block 15 and 16 in window
B D                      Cat 3bp

Alignment block 16 of 52 in window, 38792410 - 38792413, 4 bps 
B D                     Human  taag
B D                     Chimp  --ag
B D                    Gibbon  --ag
B D                 Armadillo  t---
B D                       Rat  ====
                Prairie vole  ====
              Golden hamster  ====
B D                     Mouse  ====
      Lesser Egyptian jerboa  ====
B D                      Pika  NNNN
B D                   Gorilla  ----
                Weddell seal  ====
B D                  Hedgehog  ====
B D                     Shrew  ====
B D                Guinea pig  ====
B D                    Baboon  ----
B D                       Pig  ====
B D                    Rabbit  ----
            Cape golden mole  ====
                    Aardvark  ====
B D                Coelacanth  ====
B D                   Megabat  ----
B D                   Dolphin  ----
B D              Green monkey  ----
B D       Crab-eating macaque  ----
B D                    Rhesus  ----
B D             X. tropicalis  ====
                 Spotted gar  ====
          Southern platyfish  ====
B D                      Fugu  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
  D    White-throated sparrow  ====
B D           Tasmanian devil  ====
    Mexican tetra (cavefish)  ====
B D                 Zebrafish  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
B D                Budgerigar  ====
B D                   Opossum  ====
B D            Naked mole-rat  ====
  D               Rock pigeon  ====
  D       Collared flycatcher  ====
B D       Medium ground finch  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
            Brush-tailed rat  ====
                  Chinchilla  ----
         Cape elephant shrew  ====
          Chinese tree shrew  ----
B D                  Platypus  ====
B D                   Wallaby  ====
B D                   Manatee  ====
B D                  Elephant  ====
B D           Chinese hamster  ====
B D                    Tenrec  ====
B D                       Cat  ====
B D                  Bushbaby  ----
  D  Chinese softshell turtle  ====
B D                   Ferret   ====
B D                 Orangutan  ----
             Star-nosed mole  ====
               Domestic goat  ----
B D                     Sheep  ----
            Tibetan antelope  ----
              Bactrian camel  ----
B D                    Alpaca  ----
              Pacific walrus  ----
B D                     Panda  ----
                Killer whale  ----
B D                       Dog  ----
            Black flying-fox  ----
B D          White rhinoceros  ----
B D                     Horse  ----
B D                  Squirrel  ====
        David's myotis (bat)  ----
               Big brown bat  ----
B D                  Microbat  ----
B D           Squirrel monkey  ----
B D                  Marmoset  ----
B D                       Cow  ----

Alignment block 17 of 52 in window, 38792414 - 38792417, 4 bps 
B D                     Human  ataa---
B D                     Chimp  gtaa---
B D                   Gorilla  ---a---
B D                 Orangutan  ---a---
B D                    Gibbon  ataa---
B D                    Rhesus  ---a---
B D       Crab-eating macaque  ---a---
B D                    Baboon  ---a---
B D              Green monkey  ---a---
B D                  Marmoset  ---a---
B D           Squirrel monkey  ---a---
B D                  Bushbaby  ---a---
             Cape golden mole  ---atga
B D                       Rat  =======
                Prairie vole  =======
              Golden hamster  =======
B D                     Mouse  =======
      Lesser Egyptian jerboa  =======
B D                      Pika  NNNNNNN
                Weddell seal  =======
B D                  Hedgehog  =======
B D                     Shrew  =======
B D                Guinea pig  =======
B D                       Pig  =======
B D                    Rabbit  -------
                    Aardvark  =======
B D                Coelacanth  =======
B D                   Megabat  -------
B D                   Dolphin  -------
B D             X. tropicalis  =======
                 Spotted gar  =======
          Southern platyfish  =======
B D                      Fugu  =======
B D                    Turkey  =======
B D                   Chicken  =======
  D              Mallard duck  =======
          Tibetan ground jay  =======
B D               Zebra finch  =======
  D    White-throated sparrow  =======
B D           Tasmanian devil  =======
    Mexican tetra (cavefish)  =======
B D                 Zebrafish  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D              Nile tilapia  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D        American alligator  =======
B D                Budgerigar  =======
B D                   Opossum  =======
B D            Naked mole-rat  =======
  D               Rock pigeon  =======
  D       Collared flycatcher  =======
B D       Medium ground finch  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D                    Parrot  =======
            Brush-tailed rat  =======
                  Chinchilla  -------
         Cape elephant shrew  =======
          Chinese tree shrew  -------
B D                  Platypus  =======
B D                   Wallaby  =======
B D                   Manatee  =======
B D                  Elephant  =======
B D           Chinese hamster  =======
B D                    Tenrec  =======
B D                       Cat  =======
  D  Chinese softshell turtle  =======
B D                   Ferret   =======
             Star-nosed mole  =======
               Domestic goat  -------
B D                     Sheep  -------
            Tibetan antelope  -------
              Bactrian camel  -------
B D                    Alpaca  -------
              Pacific walrus  -------
B D                     Panda  -------
                Killer whale  -------
B D                       Dog  -------
            Black flying-fox  -------
B D          White rhinoceros  -------
B D                     Horse  -------
B D                  Squirrel  =======
B D                 Armadillo  -------
        David's myotis (bat)  -------
               Big brown bat  -------
B D                  Microbat  -------
B D                       Cow  -------

Alignment block 18 of 52 in window, 38792418 - 38792420, 3 bps 
B D                     Human  gat
B D                     Chimp  gat
B D                   Gorilla  gat
B D                 Orangutan  gat
B D                    Gibbon  gat
B D                    Rhesus  gat
B D       Crab-eating macaque  gat
B D                    Baboon  gat
B D              Green monkey  gat
B D                  Marmoset  gat
B D           Squirrel monkey  gat
B D                  Bushbaby  gat
B D            Naked mole-rat  --t
             Brush-tailed rat  --t
                 Weddell seal  --c
             Cape golden mole  gtt
B D                       Rat  ===
                Prairie vole  ===
              Golden hamster  ===
B D                     Mouse  ===
      Lesser Egyptian jerboa  ===
B D                      Pika  NNN
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                Guinea pig  ===
B D                       Pig  ===
B D                    Rabbit  ---
                    Aardvark  ===
B D                Coelacanth  ===
B D                   Megabat  ---
B D                   Dolphin  ---
B D             X. tropicalis  ===
                 Spotted gar  ===
          Southern platyfish  ===
B D                      Fugu  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
B D                Budgerigar  ===
B D                   Opossum  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
                  Chinchilla  ---
         Cape elephant shrew  ===
          Chinese tree shrew  ---
B D                  Platypus  ===
B D                   Wallaby  ===
B D                   Manatee  ===
B D                  Elephant  ===
B D           Chinese hamster  ===
B D                    Tenrec  ===
B D                       Cat  ===
  D  Chinese softshell turtle  ===
B D                   Ferret   ===
             Star-nosed mole  ===
               Domestic goat  ---
B D                     Sheep  ---
            Tibetan antelope  ---
              Bactrian camel  ---
B D                    Alpaca  ---
              Pacific walrus  ---
B D                     Panda  ---
                Killer whale  ---
B D                       Dog  ---
            Black flying-fox  ---
B D          White rhinoceros  ---
B D                     Horse  ---
B D                  Squirrel  ===
B D                 Armadillo  ---
        David's myotis (bat)  ---
               Big brown bat  ---
B D                  Microbat  ---
B D                       Cow  ---

Inserts between block 18 and 19 in window
B D                 Bushbaby 285bp
B D           Naked mole-rat 2bp
            Brush-tailed rat 2bp
                Weddell seal 2bp

Alignment block 19 of 52 in window, 38792421 - 38792448, 28 bps 
B D                     Human  aagataaacttagataagagtttagcc----t
B D                     Chimp  aagataaacttaaataagagtttagcc----t
B D                   Gorilla  aagataaacttagataagagtttagcc----t
B D                 Orangutan  aagataaacttagataagagtttagcc----t
B D                    Gibbon  aagataaacttagataagagtttatcc----t
B D                    Rhesus  aagataaacttagataagagtttagcc----t
B D       Crab-eating macaque  aagataaacttagataagagtttagcc----t
B D                    Baboon  aagataaacttagataagagtttagcc----t
B D              Green monkey  aagataaacttagataagagtttagcc----t
B D                  Marmoset  aagataaacatagataagagtttagcc----t
B D           Squirrel monkey  aagataaacatagataagagtttagcc----t
B D                  Bushbaby  aagataagcttaaataagactttagcc----t
           Chinese tree shrew  -----------------gaa---agtc----t
B D                  Squirrel  -----aga-----------------c-----t
B D            Naked mole-rat  aaagcaca-------------aggtcctgagt
                   Chinchilla  aagggaaa-----------------ct----t
             Brush-tailed rat  aagggaag-----------------cctttgt
B D                    Rabbit  ---------------------tcatcc----t
B D                    Alpaca  --------------------ggaagcc----t
               Bactrian camel  --------------------ggaagcc----t
B D                   Dolphin  --------------------ggaagcc----t
                 Killer whale  --------------------gaaagcc----t
             Tibetan antelope  --------------------ggaagcc----t
B D                       Cow  --------------------ggaagcc----t
B D                     Sheep  --------------------ggaaccc----t
                Domestic goat  --------------------ggaagcc----t
B D                     Horse  --------------------agaaggc----t
B D          White rhinoceros  --------------------ggaagcc----t
B D                       Cat  ----------------------aaaaa----t
B D                       Dog  --------------------gaaagtc----c
B D                     Panda  --------------------gaaagtc----t
               Pacific walrus  --------------------gaaagtc----t
                 Weddell seal  ------------aagaataaaaaaaaa----t
             Black flying-fox  --------------------ggaagcc----t
B D                   Megabat  --------------------ggaagcc----t
B D                  Hedgehog  --------------------gaaagcc----t
              Star-nosed mole  --------------------gaggact----t
             Cape golden mole  gggaccaactcaatc-----gattgca----c
B D                 Armadillo  ------------------------gcc----c
B D                       Rat  ================================
                Prairie vole  ================================
              Golden hamster  ================================
B D                     Mouse  ================================
      Lesser Egyptian jerboa  ================================
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Shrew  ================================
B D                Guinea pig  ================================
B D                       Pig  ================================
                    Aardvark  ================================
B D                Coelacanth  ================================
B D             X. tropicalis  ================================
                 Spotted gar  ================================
          Southern platyfish  ================================
B D                      Fugu  ================================
B D                    Turkey  ================================
B D                   Chicken  ================================
  D              Mallard duck  ================================
          Tibetan ground jay  ================================
B D               Zebra finch  ================================
  D    White-throated sparrow  ================================
B D           Tasmanian devil  ================================
    Mexican tetra (cavefish)  ================================
B D                 Zebrafish  ================================
         Pundamilia nyererei  ================================
                 Zebra mbuna  ================================
       Burton's mouthbreeder  ================================
         Princess of Burundi  ================================
B D              Nile tilapia  ================================
  D            Painted turtle  ================================
  D           Green seaturtle  ================================
B D        American alligator  ================================
B D                Budgerigar  ================================
B D                   Opossum  ================================
  D               Rock pigeon  ================================
  D       Collared flycatcher  ================================
B D       Medium ground finch  ================================
  D          Peregrine falcon  ================================
  D              Saker falcon  ================================
  D                    Parrot  ================================
         Cape elephant shrew  ================================
B D                  Platypus  ================================
B D                   Wallaby  ================================
B D                   Manatee  ================================
B D                  Elephant  ================================
B D           Chinese hamster  ================================
B D                    Tenrec  ================================
  D  Chinese softshell turtle  ================================
B D                   Ferret   ================================
        David's myotis (bat)  --------------------------------
               Big brown bat  --------------------------------
B D                  Microbat  --------------------------------

Inserts between block 19 and 20 in window
            Cape golden mole 1bp

Alignment block 20 of 52 in window, 38792449 - 38792451, 3 bps 
B D                     Human  t-------------ag
B D                     Chimp  t-------------ag
B D                   Gorilla  t-------------ag
B D                 Orangutan  t-------------ag
B D                    Gibbon  t-------------ag
B D                    Rhesus  t-------------ag
B D       Crab-eating macaque  t-------------ag
B D                    Baboon  t-------------ag
B D              Green monkey  t-------------ag
B D                  Marmoset  t-------------ag
B D           Squirrel monkey  t-------------ag
B D                  Bushbaby  t-------------gg
           Chinese tree shrew  t-------------tg
B D                  Squirrel  t-------------ag
B D            Naked mole-rat  t-------------tg
                   Chinchilla  c-------------tg
             Brush-tailed rat  t-------------tg
B D                    Rabbit  t-------------ag
B D                    Alpaca  c-------------ag
               Bactrian camel  t-------------ag
B D                   Dolphin  t-------------ag
                 Killer whale  t-------------ag
             Tibetan antelope  c-------------ag
B D                       Cow  c-------------ag
B D                     Sheep  c-------------ag
                Domestic goat  c-------------ag
B D                     Horse  t-------------ag
B D          White rhinoceros  t-------------ag
B D                       Cat  t-------------aa
B D                       Dog  t-------------aa
B D                     Panda  t-------------aa
               Pacific walrus  t-------------aa
                 Weddell seal  taaaaaaaaaaaaaaa
             Black flying-fox  t-------------ag
B D                   Megabat  t-------------ag
B D                  Hedgehog  c-------------ag
              Star-nosed mole  c-------------aa
B D                  Elephant  t-------------aa
             Cape golden mole  t-------------aa
B D                 Armadillo  t-------------ag
  D          Peregrine falcon  t-------------aa
B D                       Rat  ================
                Prairie vole  ================
              Golden hamster  ================
B D                     Mouse  ================
      Lesser Egyptian jerboa  ================
B D                      Pika  NNNNNNNNNNNNNNNN
B D                     Shrew  ================
B D                Guinea pig  ================
B D                       Pig  ================
                    Aardvark  ================
B D                Coelacanth  ================
B D             X. tropicalis  ================
                 Spotted gar  ================
          Southern platyfish  ================
B D                      Fugu  ================
B D                    Turkey  ================
B D                   Chicken  ================
  D              Mallard duck  ================
          Tibetan ground jay  ================
B D               Zebra finch  ================
  D    White-throated sparrow  ================
B D           Tasmanian devil  ================
    Mexican tetra (cavefish)  ================
B D                 Zebrafish  ================
         Pundamilia nyererei  ================
                 Zebra mbuna  ================
       Burton's mouthbreeder  ================
         Princess of Burundi  ================
B D              Nile tilapia  ================
  D            Painted turtle  ================
  D           Green seaturtle  ================
B D        American alligator  ================
B D                Budgerigar  ================
B D                   Opossum  ================
  D               Rock pigeon  ================
  D       Collared flycatcher  ================
B D       Medium ground finch  ================
  D              Saker falcon  ================
  D                    Parrot  ================
         Cape elephant shrew  ================
B D                  Platypus  ================
B D                   Wallaby  ================
B D                   Manatee  ================
B D           Chinese hamster  ================
B D                    Tenrec  ================
  D  Chinese softshell turtle  ================
B D                   Ferret   ================
        David's myotis (bat)  ----------------
               Big brown bat  ----------------
B D                  Microbat  ----------------

Inserts between block 20 and 21 in window
B D                      Cat 120bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp

Alignment block 21 of 52 in window, 38792452 - 38792453, 2 bps 
B D                     Human  ag
B D                     Chimp  ag
B D                   Gorilla  ag
B D                 Orangutan  ag
B D                    Gibbon  ag
B D                    Rhesus  ag
B D       Crab-eating macaque  ag
B D                    Baboon  ag
B D              Green monkey  ag
B D                  Marmoset  ag
B D           Squirrel monkey  ag
B D                  Bushbaby  aa
           Chinese tree shrew  ag
B D                  Squirrel  aa
B D            Naked mole-rat  at
                   Chinchilla  ac
             Brush-tailed rat  ac
B D                    Rabbit  ag
B D                    Alpaca  aa
               Bactrian camel  ag
B D                   Dolphin  ag
                 Killer whale  ag
             Tibetan antelope  ag
B D                       Cow  ag
B D                     Sheep  ag
                Domestic goat  ag
B D                     Horse  cg
B D          White rhinoceros  ag
B D                       Cat  ag
B D                       Dog  ac
B D                   Ferret   a-
B D                     Panda  ac
               Pacific walrus  ac
                 Weddell seal  ac
             Black flying-fox  ag
B D                   Megabat  ag
B D                  Hedgehog  aa
              Star-nosed mole  ga
B D                  Elephant  at
             Cape golden mole  ca
B D                 Armadillo  ag
  D          Peregrine falcon  ag
B D                       Rat  ==
                Prairie vole  ==
              Golden hamster  ==
B D                     Mouse  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  NN
B D                     Shrew  ==
B D                Guinea pig  ==
B D                       Pig  ==
                    Aardvark  ==
B D                Coelacanth  ==
B D             X. tropicalis  ==
                 Spotted gar  ==
          Southern platyfish  ==
B D                      Fugu  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
B D                Budgerigar  ==
B D                   Opossum  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
  D              Saker falcon  ==
  D                    Parrot  ==
         Cape elephant shrew  ==
B D                  Platypus  ==
B D                   Wallaby  ==
B D                   Manatee  ==
B D           Chinese hamster  ==
B D                    Tenrec  ==
  D  Chinese softshell turtle  ==
        David's myotis (bat)  --
               Big brown bat  --
B D                  Microbat  --

Alignment block 22 of 52 in window, 38792454 - 38792464, 11 bps 
B D                     Human  ctagcttc--------------------------------------------------------------
B D                     Chimp  ctggcttc--------------------------------------------------------------
B D                   Gorilla  ctagcttc--------------------------------------------------------------
B D                 Orangutan  ctagcttc--------------------------------------------------------------
B D                    Gibbon  ctagcttc--------------------------------------------------------------
B D                    Rhesus  ctagcttc--------------------------------------------------------------
B D       Crab-eating macaque  ctagcttc--------------------------------------------------------------
B D                    Baboon  ctagcttc--------------------------------------------------------------
B D              Green monkey  ctagcttc--------------------------------------------------------------
B D                  Marmoset  ctagcttc--------------------------------------------------------------
B D           Squirrel monkey  ttagcttc--------------------------------------------------------------
B D                  Bushbaby  gcagctac--------------------------------------------------------------
           Chinese tree shrew  ctggtttc--------------------------------------------------------------
B D                  Squirrel  ccaggttg--------------------------------------------------------------
B D            Naked mole-rat  ccctggta--------------------------------------------------------------
                   Chinchilla  ccagtgtg--------------------------------------------------------------
             Brush-tailed rat  ccagtgtg--------------------------------------------------------------
B D                    Rabbit  ctagcttc--------------------------------------------------------------
B D                    Alpaca  ctagcttc--------------------------------------------------------------
               Bactrian camel  ctagcttc--------------------------------------------------------------
B D                   Dolphin  ctagcttc--------------------------------------------------------------
                 Killer whale  ctagcttc--------------------------------------------------------------
             Tibetan antelope  ctagcttt--------------------------------------------------------------
B D                       Cow  ttagcttt--------------------------------------------------------------
B D                     Sheep  ctagcttt--------------------------------------------------------------
                Domestic goat  ctagcttt--------------------------------------------------------------
B D                     Horse  ctagcttc--------------------------------------------------------------
B D          White rhinoceros  ctagcttc--------------------------------------------------------------
B D                       Cat  cctgcttccgattctgtgtctccctcttctctccatcctcccctgttcacactctgtgtctctgtctctc
B D                       Dog  ctagcttc--------------------------------------------------------------
B D                   Ferret   ----------------------------------------------------------------------
B D                     Panda  ttggtttc--------------------------------------------------------------
               Pacific walrus  ctagcttc--------------------------------------------------------------
                 Weddell seal  ctagtttc--------------------------------------------------------------
             Black flying-fox  ctagcgtc--------------------------------------------------------------
B D                   Megabat  ctagcgtc--------------------------------------------------------------
B D                  Hedgehog  caagcttc--------------------------------------------------------------
              Star-nosed mole  taa-cttc--------------------------------------------------------------
B D                  Elephant  tttgcttc--------------------------------------------------------------
             Cape golden mole  ataacaac--------------------------------------------------------------
                     Aardvark  ctgccatt--------------------------------------------------------------
B D                 Armadillo  ttagcttc--------------------------------------------------------------
  D          Peregrine falcon  ttggcttt--------------------------------------------------------------
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
              Golden hamster  ======================================================================
B D                     Mouse  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Shrew  ======================================================================
B D                Guinea pig  ======================================================================
B D                       Pig  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
                 Spotted gar  ======================================================================
          Southern platyfish  ======================================================================
B D                      Fugu  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Manatee  ======================================================================
B D           Chinese hamster  ======================================================================
B D                    Tenrec  ======================================================================
  D  Chinese softshell turtle  ======================================================================
        David's myotis (bat)  ----------------------------------------------------------------------
               Big brown bat  ----------------------------------------------------------------------
B D                  Microbat  ----------------------------------------------------------------------

                        Human  ----------------t------------tt--
                        Chimp  ----------------t------------tt--
                      Gorilla  ----------------t------------tt--
                    Orangutan  ----------------t------------tt--
                       Gibbon  ----------------t------------tt--
                       Rhesus  ----------------t------------tt--
          Crab-eating macaque  ----------------t------------tt--
                       Baboon  ----------------t------------tt--
                 Green monkey  ----------------t------------tt--
                     Marmoset  ----------------t------------tt--
              Squirrel monkey  ----------------t------------tt--
                     Bushbaby  ----------------t------------aa--
           Chinese tree shrew  ----------------t----------------
                     Squirrel  ----------------tt-aattttttt-----
               Naked mole-rat  ----------------c----------------
                   Chinchilla  ----------------t----------------
             Brush-tailed rat  ----------------t----------------
                       Rabbit  ----------------t-----------t----
                       Alpaca  ----------------t----------------
               Bactrian camel  ----------------t----------------
                      Dolphin  ----------------t----------------
                 Killer whale  ----------------t----------------
             Tibetan antelope  ----------------t----------------
                          Cow  ----------------t----------------
                        Sheep  ----------------t----------------
                Domestic goat  ----------------t----------------
                        Horse  ----------------ta---------------
             White rhinoceros  ----------------ta---------------
                          Cat  aaaaataaataaacatta---------------
                          Dog  ----------------ta---------------
                      Ferret   ----------------ta---------------
                        Panda  ----------------ta---------------
               Pacific walrus  ----------------ta---------------
                 Weddell seal  ----------------ta---------------
             Black flying-fox  ----------------tg---------------
                      Megabat  ----------------tg---------------
                     Hedgehog  ----------------tgg--------------
              Star-nosed mole  ----------------taa--------------
                     Elephant  ----------------t----------------
             Cape golden mole  ----------------c----------------
                     Aardvark  ----------------t----------------
                    Armadillo  ----------------t----------------
             Peregrine falcon  ----------------t--------------tt
                          Rat  =================================
                 Prairie vole  =================================
               Golden hamster  =================================
                        Mouse  =================================
       Lesser Egyptian jerboa  =================================
                         Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Shrew  =================================
                   Guinea pig  =================================
                          Pig  =================================
                   Coelacanth  =================================
                X. tropicalis  =================================
                  Spotted gar  =================================
           Southern platyfish  =================================
                         Fugu  =================================
                       Turkey  =================================
                      Chicken  =================================
                 Mallard duck  =================================
           Tibetan ground jay  =================================
                  Zebra finch  =================================
       White-throated sparrow  =================================
              Tasmanian devil  =================================
     Mexican tetra (cavefish)  =================================
                    Zebrafish  =================================
          Pundamilia nyererei  =================================
                  Zebra mbuna  =================================
        Burton's mouthbreeder  =================================
          Princess of Burundi  =================================
                 Nile tilapia  =================================
               Painted turtle  =================================
              Green seaturtle  =================================
           American alligator  =================================
                   Budgerigar  =================================
                      Opossum  =================================
                  Rock pigeon  =================================
          Collared flycatcher  =================================
          Medium ground finch  =================================
                 Saker falcon  =================================
                       Parrot  =================================
          Cape elephant shrew  =================================
                     Platypus  =================================
                      Wallaby  =================================
                      Manatee  =================================
              Chinese hamster  =================================
                       Tenrec  =================================
     Chinese softshell turtle  =================================
         David's myotis (bat)  ---------------------------------
                Big brown bat  ---------------------------------
                     Microbat  ---------------------------------

Inserts between block 22 and 23 in window
B D                 Squirrel 1bp
B D           Naked mole-rat 4bp
                  Chinchilla 4bp
            Brush-tailed rat 4bp
B D                 Elephant 2bp
            Cape golden mole 2bp
                    Aardvark 2bp
B D                Armadillo 2bp

Alignment block 23 of 52 in window, 38792465 - 38792482, 18 bps 
B D                     Human  aaaaaatgaa---aattag-aa
B D                     Chimp  aaaaaatgaa---aattag-aa
B D                   Gorilla  aaaaaatgaa---aattag-aa
B D                 Orangutan  aaaaaatgaa---aattag-aa
B D                    Gibbon  aaaaaatgaa---aattagaaa
B D                    Rhesus  aaaaaatgaa---aattag-aa
B D       Crab-eating macaque  aaaaaatgaa---aattag-aa
B D                    Baboon  aaaaaatgaa---aattag-aa
B D              Green monkey  aaaaaatgaa---aattag-aa
B D                  Marmoset  aaaaaatgaa---aattag-aa
B D           Squirrel monkey  aaaaaatgaa---aattag-aa
B D                  Bushbaby  aaaaaattaa---aataag---
           Chinese tree shrew  ---aaaacaa---agttag---
B D                  Squirrel  aattagattc---atttaa-t-
       Lesser Egyptian jerboa  -aagagagga---agtgaa-g-
B D            Naked mole-rat  aat-aaataa---aattag-aa
                   Chinchilla  aataaaatac---aattag-aa
             Brush-tailed rat  aataaaaccc---aattag-aa
B D                    Rabbit  aaaaagtaaa---aattag-aa
B D                       Pig  aaaaaattaa---aattag-aa
B D                    Alpaca  aaacaattta---catt----a
               Bactrian camel  aaacaattta---catt----a
B D                   Dolphin  aaaacattaa---aattag-aa
                 Killer whale  aaaacattaa---aattag-aa
             Tibetan antelope  aaaaaattaa---aattag-aa
B D                       Cow  aaaaaattaa---aattag-aa
B D                     Sheep  aaaaacttaa---aattag-aa
                Domestic goat  aaaaaattaa---aattag-aa
B D                     Horse  aaaaaattaa---agttgg-ag
B D          White rhinoceros  aaaaaattaa---aattag-aa
B D                       Cat  aaaaaatgtttttaattaa-cg
B D                       Dog  aaa-------------caa-ca
B D                   Ferret   aaga---------aaaaag-aa
B D                     Panda  aaaa---------acttaa-ca
               Pacific walrus  gaaa---------acttaa-ca
                 Weddell seal  gaaa---------acttaa-ca
             Black flying-fox  aaaaaattac---aattaa-aa
B D                   Megabat  aaaaaattac---aattaa-aa
B D                  Hedgehog  --------aa---aaaaaa-aa
              Star-nosed mole  --------aa---aattaa-ag
B D                  Elephant  -a------------aggaa-aa
             Cape golden mole  -aaaacttag---gaggca-aa
                     Aardvark  -g-----cag---gagaaa-aa
B D                 Armadillo  -aacaattaa---aatgaa-aa
  D          Peregrine falcon  aagagatgaa---aacag----
B D                       Rat  ======================
                Prairie vole  ======================
              Golden hamster  ======================
B D                     Mouse  ======================
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNN
B D                     Shrew  ======================
B D                Guinea pig  ======================
B D                Coelacanth  ======================
B D             X. tropicalis  ======================
                 Spotted gar  ======================
          Southern platyfish  ======================
B D                      Fugu  ======================
B D                    Turkey  ======================
B D                   Chicken  ======================
  D              Mallard duck  ======================
          Tibetan ground jay  ======================
B D               Zebra finch  ======================
  D    White-throated sparrow  ======================
B D           Tasmanian devil  ======================
    Mexican tetra (cavefish)  ======================
B D                 Zebrafish  ======================
         Pundamilia nyererei  ======================
                 Zebra mbuna  ======================
       Burton's mouthbreeder  ======================
         Princess of Burundi  ======================
B D              Nile tilapia  ======================
  D            Painted turtle  ======================
  D           Green seaturtle  ======================
B D        American alligator  ======================
B D                Budgerigar  ======================
B D                   Opossum  ======================
  D               Rock pigeon  ======================
  D       Collared flycatcher  ======================
B D       Medium ground finch  ======================
  D              Saker falcon  ======================
  D                    Parrot  ======================
         Cape elephant shrew  ======================
B D                  Platypus  ======================
B D                   Wallaby  ======================
B D                   Manatee  ======================
B D           Chinese hamster  ======================
B D                    Tenrec  ======================
  D  Chinese softshell turtle  ======================
        David's myotis (bat)  ----------------------
               Big brown bat  ----------------------
B D                  Microbat  ----------------------

Inserts between block 23 and 24 in window
      Lesser Egyptian jerboa 2bp
B D                 Elephant 3bp
            Cape golden mole 6bp
                    Aardvark 6bp
B D                Armadillo 11bp

Alignment block 24 of 52 in window, 38792483 - 38792486, 4 bps 
B D                     Human  aaaa-
B D                     Chimp  aaaa-
B D                   Gorilla  aaaa-
B D                 Orangutan  aaaa-
B D                    Gibbon  aaaa-
B D                    Rhesus  aaaa-
B D       Crab-eating macaque  aaaa-
B D                    Baboon  aaaa-
B D              Green monkey  aaaa-
B D                  Marmoset  agaa-
B D           Squirrel monkey  agaa-
B D                  Bushbaby  --aa-
           Chinese tree shrew  --aa-
B D                  Squirrel  ---c-
       Lesser Egyptian jerboa  aagg-
               Golden hamster  agat-
B D            Naked mole-rat  agat-
                   Chinchilla  agat-
             Brush-tailed rat  agat-
B D                    Rabbit  agaa-
B D                       Pig  acaa-
B D                    Alpaca  acaa-
               Bactrian camel  acaa-
B D                   Dolphin  acag-
                 Killer whale  acag-
             Tibetan antelope  acaa-
B D                       Cow  acaa-
B D                     Sheep  acaa-
                Domestic goat  acaa-
B D                     Horse  gaaa-
B D          White rhinoceros  agaa-
B D                       Cat  agaa-
B D                       Dog  agaa-
B D                   Ferret   agaa-
B D                     Panda  agaa-
               Pacific walrus  agaa-
                 Weddell seal  agaa-
             Black flying-fox  aaaa-
B D                   Megabat  aaaa-
B D                  Hedgehog  aaaa-
              Star-nosed mole  aa---
                     Aardvark  ggga-
  D          Peregrine falcon  -gaat
B D                       Rat  =====
                Prairie vole  =====
B D                     Mouse  =====
B D                      Pika  NNNNN
B D                     Shrew  =====
B D                Guinea pig  =====
            Cape golden mole  =====
B D                Coelacanth  =====
B D             X. tropicalis  =====
                 Spotted gar  =====
          Southern platyfish  =====
B D                      Fugu  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
  D    White-throated sparrow  =====
B D           Tasmanian devil  =====
    Mexican tetra (cavefish)  =====
B D                 Zebrafish  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D              Nile tilapia  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D        American alligator  =====
B D                Budgerigar  =====
B D                   Opossum  =====
  D               Rock pigeon  =====
  D       Collared flycatcher  =====
B D       Medium ground finch  =====
  D              Saker falcon  =====
  D                    Parrot  =====
         Cape elephant shrew  =====
B D                  Platypus  =====
B D                   Wallaby  =====
B D                   Manatee  =====
B D                  Elephant  =====
B D           Chinese hamster  =====
B D                    Tenrec  =====
  D  Chinese softshell turtle  =====
B D                 Armadillo  =====
        David's myotis (bat)  -----
               Big brown bat  -----
B D                  Microbat  -----

Inserts between block 24 and 25 in window
B D                 Hedgehog 968bp

Alignment block 25 of 52 in window, 38792487 - 38792493, 7 bps 
B D                     Human  ttattca-
B D                     Chimp  ttattca-
B D                   Gorilla  ttattca-
B D                 Orangutan  ttattca-
B D                    Gibbon  ttattca-
B D                    Rhesus  ttattca-
B D       Crab-eating macaque  ttattca-
B D                    Baboon  ttattca-
B D              Green monkey  ttattca-
B D                  Marmoset  ttattca-
B D           Squirrel monkey  ttattga-
B D                  Bushbaby  ttattca-
           Chinese tree shrew  tcattta-
B D                  Squirrel  tcatttt-
       Lesser Egyptian jerboa  tcatcca-
               Golden hamster  ttatttg-
B D            Naked mole-rat  tcattca-
                   Chinchilla  tcattca-
             Brush-tailed rat  taattta-
B D                    Rabbit  tcatgcc-
B D                       Pig  tcattcc-
B D                    Alpaca  tcatcta-
               Bactrian camel  tcatcta-
B D                   Dolphin  tctttca-
                 Killer whale  tctttca-
             Tibetan antelope  tcattca-
B D                       Cow  tcactca-
B D                     Sheep  taattca-
                Domestic goat  tcattca-
B D                     Horse  tcattca-
B D          White rhinoceros  taattca-
B D                       Cat  tcattcg-
B D                       Dog  ccattca-
B D                   Ferret   ggaagga-
B D                     Panda  ccattca-
               Pacific walrus  ccattca-
                 Weddell seal  ccattca-
             Black flying-fox  ccattca-
B D                   Megabat  acattca-
              Star-nosed mole  tcattca-
                     Aardvark  ---gtga-
  D          Peregrine falcon  -tctttag
B D                       Rat  ========
                Prairie vole  ========
B D                     Mouse  ========
B D                      Pika  NNNNNNNN
B D                  Hedgehog  ========
B D                     Shrew  ========
B D                Guinea pig  ========
            Cape golden mole  ========
B D                Coelacanth  ========
B D             X. tropicalis  ========
                 Spotted gar  ========
          Southern platyfish  ========
B D                      Fugu  ========
B D                    Turkey  ========
B D                   Chicken  ========
  D              Mallard duck  ========
          Tibetan ground jay  ========
B D               Zebra finch  ========
  D    White-throated sparrow  ========
B D           Tasmanian devil  ========
    Mexican tetra (cavefish)  ========
B D                 Zebrafish  ========
         Pundamilia nyererei  ========
                 Zebra mbuna  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D              Nile tilapia  ========
  D            Painted turtle  ========
  D           Green seaturtle  ========
B D        American alligator  ========
B D                Budgerigar  ========
B D                   Opossum  ========
  D               Rock pigeon  ========
  D       Collared flycatcher  ========
B D       Medium ground finch  ========
  D              Saker falcon  ========
  D                    Parrot  ========
         Cape elephant shrew  ========
B D                  Platypus  ========
B D                   Wallaby  ========
B D                   Manatee  ========
B D                  Elephant  ========
B D           Chinese hamster  ========
B D                    Tenrec  ========
  D  Chinese softshell turtle  ========
B D                 Armadillo  ========
        David's myotis (bat)  --------
               Big brown bat  --------
B D                  Microbat  --------

Inserts between block 25 and 26 in window
                    Aardvark 3bp

Alignment block 26 of 52 in window, 38792494 - 38792506, 13 bps 
B D                     Human  aaagaagaaaaag
B D                     Chimp  aaacaagaaaaag
B D                   Gorilla  aaacaagaaaaag
B D                 Orangutan  aaacaagaaaaag
B D                    Gibbon  aaacaagaaaaag
B D                    Rhesus  aaacaagaaaaag
B D       Crab-eating macaque  aaacaagaaaaag
B D                    Baboon  aaacaagaaaaag
B D              Green monkey  aaacaagaaaaag
B D                  Marmoset  aaacaagaaaaag
B D           Squirrel monkey  aaacaagaaaaag
B D                  Bushbaby  aaacaagaaaaag
           Chinese tree shrew  caaccagaaaaag
B D                  Squirrel  taaa-----aaag
       Lesser Egyptian jerboa  aagc-----aaag
               Golden hamster  aaacaagaaaaag
B D            Naked mole-rat  aaacaaga-aaaa
                   Chinchilla  aa-----------
             Brush-tailed rat  aaacaaga-aaaa
B D                    Rabbit  agacaagaagaag
B D                       Pig  aaacaaaggagaa
B D                    Alpaca  aaacaaagaaaaa
               Bactrian camel  aaacaaagaaaaa
B D                   Dolphin  aaacaaagggaaa
                 Killer whale  aaacaaagggaaa
             Tibetan antelope  aaacaaagaagaa
B D                       Cow  aagcaaagaagaa
B D                     Sheep  aaacaaagaagaa
                Domestic goat  aaacaaagaagaa
B D                     Horse  gtacaaggag-aa
B D          White rhinoceros  acacaaggagaaa
B D                       Cat  atacaggaagaag
B D                       Dog  atacagggggcgg
B D                   Ferret   aggaaggaaagaa
B D                     Panda  ataagggagtggg
               Pacific walrus  aaacaggagaaga
                 Weddell seal  aaacaggagaaga
             Black flying-fox  aaacaatgaaaaa
B D                   Megabat  aaacaatgaaaaa
              Star-nosed mole  aaacaaatcaaaa
B D                  Elephant  ------agagcag
          Cape elephant shrew  aaggaaggagtag
             Cape golden mole  -aaggaaaagcaa
                     Aardvark  -aggaaggaagaa
B D                 Armadillo  ---aaatgtttaa
  D          Peregrine falcon  aaagactgagtag
B D                       Rat  =============
                Prairie vole  =============
B D                     Mouse  =============
B D                      Pika  NNNNNNNNNNNNN
B D                  Hedgehog  =============
B D                     Shrew  =============
B D                Guinea pig  =============
B D                Coelacanth  =============
B D             X. tropicalis  =============
                 Spotted gar  =============
          Southern platyfish  =============
B D                      Fugu  =============
B D                    Turkey  =============
B D                   Chicken  =============
  D              Mallard duck  =============
          Tibetan ground jay  =============
B D               Zebra finch  =============
  D    White-throated sparrow  =============
B D           Tasmanian devil  =============
    Mexican tetra (cavefish)  =============
B D                 Zebrafish  =============
         Pundamilia nyererei  =============
                 Zebra mbuna  =============
       Burton's mouthbreeder  =============
         Princess of Burundi  =============
B D              Nile tilapia  =============
  D            Painted turtle  =============
  D           Green seaturtle  =============
B D        American alligator  =============
B D                Budgerigar  =============
B D                   Opossum  =============
  D               Rock pigeon  =============
  D       Collared flycatcher  =============
B D       Medium ground finch  =============
  D              Saker falcon  =============
  D                    Parrot  =============
B D                  Platypus  =============
B D                   Wallaby  =============
B D                   Manatee  =============
B D           Chinese hamster  =============
B D                    Tenrec  =============
  D  Chinese softshell turtle  =============
        David's myotis (bat)  -------------
               Big brown bat  -------------
B D                  Microbat  -------------

Inserts between block 26 and 27 in window
B D                    Horse 7bp
B D         White rhinoceros 7bp
B D                      Cat 11bp
B D                      Dog 4bp
B D                  Ferret  20bp
B D                    Panda 5bp
              Pacific walrus 20bp
                Weddell seal 18bp
            Black flying-fox 5bp
B D                  Megabat 5bp
             Star-nosed mole 6bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
            Cape golden mole 5bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 27 of 52 in window, 38792507 - 38792513, 7 bps 
B D                     Human  a-----g---aaaaa---------
B D                     Chimp  a-----g---aaaaa---------
B D                   Gorilla  a-----g----aaga---------
B D                 Orangutan  a-----g---aaaaa---------
B D                    Gibbon  a-----g---aaaaa---------
B D                    Rhesus  a-----g----aaac---------
B D       Crab-eating macaque  a-----g----aaac---------
B D                    Baboon  a-----g----aaac---------
B D              Green monkey  a-----g----aaac---------
B D                  Marmoset  a-----g-aaaaaag---------
B D           Squirrel monkey  a-----gaaaaaaaa---------
B D                  Bushbaby  a-----g---aaaaa---------
           Chinese tree shrew  a-----g---aaaaa---------
B D                  Squirrel  a-----c------ag---------
       Lesser Egyptian jerboa  a-----a------ag---------
               Golden hamster  a-----t------ag---------
B D            Naked mole-rat  g-----a------aa---------
                   Chinchilla  ------a------aa---------
             Brush-tailed rat  g-----a------aa---------
B D                    Rabbit  a-----c------ag---------
B D                       Pig  ------a------aa---------
B D                    Alpaca  ------c------ag---------
               Bactrian camel  ------c------ag---------
B D                   Dolphin  ------c------ag---------
                 Killer whale  ------c------ag---------
             Tibetan antelope  ------c------aa---------
B D                       Cow  ------c------aa---------
B D                     Sheep  ------c------aa---------
                Domestic goat  ------c------aa---------
B D                     Horse  c-----c------ag---------
B D          White rhinoceros  a-----c------ag---------
B D                       Cat  a-----c------ag---------
B D                       Dog  a-----c------tg---------
B D                   Ferret   attaaga------ag---------
B D                     Panda  a-----c------ag---------
               Pacific walrus  g-----a------ag---------
                 Weddell seal  a-----c------ag---------
             Black flying-fox  a-----c------ag---------
B D                   Megabat  a-----c------ag---------
              Star-nosed mole  a-----c------aa---------
B D                  Elephant  -------------ag---------
          Cape elephant shrew  -------------ag---------
B D                   Manatee  -------------gg---------
             Cape golden mole  -------------ag---------
                     Aardvark  -------------gg---------
B D                 Armadillo  ------------cag---------
  D          Peregrine falcon  -----------aaaacttagtgag
B D                       Rat  ========================
                Prairie vole  ========================
B D                     Mouse  ========================
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNNNN
B D                  Hedgehog  ========================
B D                     Shrew  ========================
B D                Guinea pig  ========================
B D                Coelacanth  ========================
B D             X. tropicalis  ========================
                 Spotted gar  ========================
          Southern platyfish  ========================
B D                      Fugu  ========================
B D                    Turkey  ========================
B D                   Chicken  ========================
  D              Mallard duck  ========================
          Tibetan ground jay  ========================
B D               Zebra finch  ========================
  D    White-throated sparrow  ========================
B D           Tasmanian devil  ========================
    Mexican tetra (cavefish)  ========================
B D                 Zebrafish  ========================
         Pundamilia nyererei  ========================
                 Zebra mbuna  ========================
       Burton's mouthbreeder  ========================
         Princess of Burundi  ========================
B D              Nile tilapia  ========================
  D            Painted turtle  ========================
  D           Green seaturtle  ========================
B D        American alligator  ========================
B D                Budgerigar  ========================
B D                   Opossum  ========================
  D               Rock pigeon  ========================
  D       Collared flycatcher  ========================
B D       Medium ground finch  ========================
  D              Saker falcon  ========================
  D                    Parrot  ========================
B D                  Platypus  ========================
B D                   Wallaby  ========================
B D           Chinese hamster  ========================
B D                    Tenrec  ========================
  D  Chinese softshell turtle  ========================
        David's myotis (bat)  ------------------------
               Big brown bat  ------------------------
B D                  Microbat  ------------------------

Inserts between block 27 and 28 in window
B D                 Bushbaby 9bp
          Chinese tree shrew 12bp
B D                 Elephant 4bp
         Cape elephant shrew 4bp
B D                  Manatee 4bp
            Cape golden mole 2bp
                    Aardvark 5bp
B D                Armadillo 2bp

Alignment block 28 of 52 in window, 38792514 - 38792534, 21 bps 
B D                     Human  aaaa------------tgcagcaacagccagga
B D                     Chimp  aaaa------------tgcagcaacagccagga
B D                   Gorilla  aaaa------------tgcagcaacagccagga
B D                 Orangutan  aaaa------------tgcagcaacagccagga
B D                    Gibbon  aaaa------------tgcagcaacagccagga
B D                    Rhesus  aaaa------------tccagcaacagccagga
B D       Crab-eating macaque  aaaa------------tccagcaacagccagga
B D                    Baboon  aaaa------------tccagcaacagccagga
B D              Green monkey  aaaa------------tgtagcaacagccagga
B D                  Marmoset  aaaa------------tgcagcaacagccagga
B D           Squirrel monkey  aaaa------------cgcaccaacagccagga
B D                  Bushbaby  aaaa------------tgcagcaacagccacaa
           Chinese tree shrew  aaaa------------tgcagcaacagccagaa
B D                  Squirrel  aaac------------tgtagcaacaatcagga
       Lesser Egyptian jerboa  aaaa------------tgtagcagcaagcagga
               Golden hamster  aaaa------------caaagccagaaacagga
B D            Naked mole-rat  a------------------------aaccagga
                   Chinchilla  aaac------------tgcggtaacaaccaaga
             Brush-tailed rat  atat------------tgcagcaacaaccaaga
B D                    Rabbit  gaaa------------tg---------ccagga
B D                       Pig  aaaaaaaaacggatattatagcaacagccagga
B D                    Alpaca  aaaa------------cacagcaacagccagga
               Bactrian camel  aaaa------------tacagcaacagccagga
B D                   Dolphin  acaa------------tacagcaacagccagga
                 Killer whale  acaa------------tacagcaacagccagga
             Tibetan antelope  a---------------------aacagacaaga
B D                       Cow  a---------------------aacagacaatg
B D                     Sheep  a---------------------aacagacaata
                Domestic goat  a---------------------aacagacaata
B D                     Horse  aaaa------------cacagcaatagccagga
B D          White rhinoceros  aaaa------------tacagtaatagcaagga
B D                       Cat  aaaa------------tccagcaacatccagga
B D                       Dog  aaaa------------tacagcaacatccagga
B D                   Ferret   gaaa------------tacaataagatccagga
B D                     Panda  aaaa------------tacagcaacgcccagga
               Pacific walrus  aaaa------------tacagcaacacccagga
                 Weddell seal  aaaa------------tacagcaacacccagga
             Black flying-fox  aaga------------tacagtcacagccagga
B D                   Megabat  aaga------------tacagtcacagccagga
              Star-nosed mole  caaa------------tacaacaactgtcaggt
B D                  Elephant  aa-----------------atggataatg----
          Cape elephant shrew  agaa------------cacatgaacagcg-gga
B D                   Manatee  agaa------------cacagcaatagcaggga
             Cape golden mole  agaa------------tacaa------------
B D                    Tenrec  agaa------------tataacagtgggg--ga
                     Aardvark  agaa------------cgcaacagctggg---a
B D                 Armadillo  aaaa------------cacagcaactgcc-aaa
  D          Peregrine falcon  ggaa------------taccgatacagtgaaga
B D                       Rat  =================================
                Prairie vole  =================================
B D                     Mouse  =================================
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Hedgehog  =================================
B D                     Shrew  =================================
B D                Guinea pig  =================================
B D                Coelacanth  =================================
B D             X. tropicalis  =================================
                 Spotted gar  =================================
          Southern platyfish  =================================
B D                      Fugu  =================================
B D                    Turkey  =================================
B D                   Chicken  =================================
  D              Mallard duck  =================================
          Tibetan ground jay  =================================
B D               Zebra finch  =================================
  D    White-throated sparrow  =================================
B D           Tasmanian devil  =================================
    Mexican tetra (cavefish)  =================================
B D                 Zebrafish  =================================
         Pundamilia nyererei  =================================
                 Zebra mbuna  =================================
       Burton's mouthbreeder  =================================
         Princess of Burundi  =================================
B D              Nile tilapia  =================================
  D            Painted turtle  =================================
  D           Green seaturtle  =================================
B D        American alligator  =================================
B D                Budgerigar  =================================
B D                   Opossum  =================================
  D               Rock pigeon  =================================
  D       Collared flycatcher  =================================
B D       Medium ground finch  =================================
  D              Saker falcon  =================================
  D                    Parrot  =================================
B D                  Platypus  =================================
B D                   Wallaby  =================================
B D           Chinese hamster  =================================
  D  Chinese softshell turtle  =================================
        David's myotis (bat)  ---------------------------------
               Big brown bat  ---------------------------------
B D                  Microbat  ---------------------------------

Inserts between block 28 and 29 in window
  D         Peregrine falcon 6192bp

Alignment block 29 of 52 in window, 38792535 - 38792551, 17 bps 
B D                     Human  acctagtctgctcccat-
B D                     Chimp  acctagtctgctcccat-
B D                   Gorilla  acctagtctgctcccat-
B D                 Orangutan  atctagtctgctcccat-
B D                    Gibbon  acctagtctgctcccat-
B D                    Rhesus  acctagcctgctcccat-
B D       Crab-eating macaque  acctagtctgctcccat-
B D                    Baboon  acctagcctgctcccat-
B D              Green monkey  acctagcctgctcccat-
B D                  Marmoset  atctagcctgctcccat-
B D           Squirrel monkey  acctagcctgctcccat-
B D                  Bushbaby  atttaacctgctccaaa-
           Chinese tree shrew  acttagcctgagccaag-
B D                  Squirrel  acctagcctgctccaaa-
       Lesser Egyptian jerboa  acctagcctgctccgag-
               Golden hamster  tcctagcctgcttcgac-
B D            Naked mole-rat  acctagcctgctccaaa-
                   Chinchilla  acccagcctgctccaaa-
             Brush-tailed rat  acccagactgctccaaa-
B D                    Rabbit  acccagcctgtcccaag-
B D                       Pig  aactagcctgctccaaa-
B D                    Alpaca  acccagcctgctccaaa-
               Bactrian camel  acccagcctgctccaaa-
B D                   Dolphin  acctagcctgctccaaa-
                 Killer whale  acctagcctgctccaaa-
             Tibetan antelope  ---tagcctgctccaaa-
B D                       Cow  ---cagcctgctccaaa-
B D                     Sheep  ---tagcctgctccaaa-
                Domestic goat  ---tagcctgctccaaa-
B D                     Horse  acccagcctgctccaaa-
B D          White rhinoceros  acccagcctgctccaaa-
B D                       Cat  acctagcctgctccaga-
B D                       Dog  tccttacctgctccaaa-
B D                   Ferret   atccagcctgctccaga-
B D                     Panda  acctagcctgctgcaaa-
               Pacific walrus  acctagcctgctccaaa-
                 Weddell seal  acctagcctgctccaaa-
             Black flying-fox  aattagccagctccaaa-
B D                   Megabat  aattagccagctccaaa-
              Star-nosed mole  accttgccagcgccaaa-
          Cape elephant shrew  acccagtatgcttcaaag
B D                   Manatee  acccagtctgctccaaag
             Cape golden mole  ---cagtctgcttc-aag
B D                    Tenrec  acccagtctgctccaaag
                     Aardvark  acccagtcttcttcaaag
B D                 Armadillo  acccagcttggtccaaat
B D                       Rat  ==================
                Prairie vole  ==================
B D                     Mouse  ==================
B D                      Pika  NNNNNNNNNNNNNNNNNN
B D                  Hedgehog  ==================
B D                     Shrew  ==================
B D                Guinea pig  ==================
B D                Coelacanth  ==================
B D             X. tropicalis  ==================
                 Spotted gar  ==================
          Southern platyfish  ==================
B D                      Fugu  ==================
B D                    Turkey  ==================
B D                   Chicken  ==================
  D              Mallard duck  ==================
          Tibetan ground jay  ==================
B D               Zebra finch  ==================
  D    White-throated sparrow  ==================
B D           Tasmanian devil  ==================
    Mexican tetra (cavefish)  ==================
B D                 Zebrafish  ==================
         Pundamilia nyererei  ==================
                 Zebra mbuna  ==================
       Burton's mouthbreeder  ==================
         Princess of Burundi  ==================
B D              Nile tilapia  ==================
  D            Painted turtle  ==================
  D           Green seaturtle  ==================
B D        American alligator  ==================
B D                Budgerigar  ==================
B D                   Opossum  ==================
  D               Rock pigeon  ==================
  D       Collared flycatcher  ==================
B D       Medium ground finch  ==================
  D          Peregrine falcon  ==================
  D              Saker falcon  ==================
  D                    Parrot  ==================
B D                  Platypus  ==================
B D                   Wallaby  ==================
B D                  Elephant  ------------------
B D           Chinese hamster  ==================
  D  Chinese softshell turtle  ==================
        David's myotis (bat)  ------------------
               Big brown bat  ------------------
B D                  Microbat  ------------------

Inserts between block 29 and 30 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp

Alignment block 30 of 52 in window, 38792552 - 38792571, 20 bps 
B D                     Human  cactcatctatttcactt---at
B D                     Chimp  cactcatctatttcactt---at
B D                   Gorilla  -actcatctatttcactt---ct
B D                 Orangutan  cactcatccatttcactt---ct
B D                    Gibbon  cactcatctatttcactt---ct
B D                    Rhesus  cactcatctatttcactt---ct
B D       Crab-eating macaque  cactcatctatttcactt---ct
B D                    Baboon  cactcatctatttcactt---ct
B D              Green monkey  cactcatctatttcactt---ct
B D                  Marmoset  cactcatctatttcactt---ct
B D           Squirrel monkey  cactcatctatttcactt---ct
B D                  Bushbaby  cactcgtcaattttactt---ct
           Chinese tree shrew  --------------actt---cc
B D                  Squirrel  ---cgttcaatttcactt---ct
       Lesser Egyptian jerboa  g-ctcatcggcgtcagtt---ct
               Golden hamster  a--tcaccaatgccactt---ct
B D            Naked mole-rat  tgctcatccatttcactt---cc
                   Chinchilla  tgctcgtccatttcactt---ct
             Brush-tailed rat  tgcacatccattttattt---ct
B D                    Rabbit  agctcatcaattttattt---t-
B D                       Pig  tactcatcaattaccctg---ca
B D                    Alpaca  tacttgtcgatttccctt---ct
               Bactrian camel  tacttgtcgatttccctt---ct
B D                   Dolphin  aacttgtcaatttccctt---tt
                 Killer whale  aacttgtcaatttccctt---tt
             Tibetan antelope  tactcgtcagttttcctt---tt
B D                       Cow  tactcgtcaattttcctt---tt
B D                     Sheep  tacttgtcagttttcctt---tt
                Domestic goat  ttctcgtcagttttcctt---tt
B D                     Horse  cacttgtcgatttcactt---ct
B D          White rhinoceros  cacttgtcaatttcactt---ct
B D                       Cat  cactcgtcagcttcacac---ct
B D                       Dog  tgctcatcagcttcactcactcc
B D                   Ferret   cgctcatcaacttcgctc---ct
B D                     Panda  cgctcgccaatgtccctt---ct
               Pacific walrus  cgctcgtcaacttcgctc---ct
                 Weddell seal  cactcgtcaactttgttc---ct
             Black flying-fox  cactcatcaatttcactt---ct
B D                   Megabat  cactcatcaatttcactt---ct
B D                  Hedgehog  cacccatcaacttcaact---ct
              Star-nosed mole  gccttgacaattttgctt---ct
          Cape elephant shrew  cactcatcaatttcactt---at
B D                   Manatee  cacccattaatttcactt---ct
             Cape golden mole  cactcattagtttcactt---ct
B D                    Tenrec  cactggacaaggtcactt----t
                     Aardvark  cactcattaattttgctc---ct
B D                 Armadillo  gattcatcgatttcattt---at
B D                       Rat  =======================
                Prairie vole  =======================
B D                     Mouse  =======================
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNNN
B D                     Shrew  =======================
B D                Guinea pig  =======================
B D                Coelacanth  =======================
B D             X. tropicalis  =======================
                 Spotted gar  =======================
          Southern platyfish  =======================
B D                      Fugu  =======================
B D                    Turkey  =======================
B D                   Chicken  =======================
  D              Mallard duck  =======================
          Tibetan ground jay  =======================
B D               Zebra finch  =======================
  D    White-throated sparrow  =======================
B D           Tasmanian devil  =======================
    Mexican tetra (cavefish)  =======================
B D                 Zebrafish  =======================
         Pundamilia nyererei  =======================
                 Zebra mbuna  =======================
       Burton's mouthbreeder  =======================
         Princess of Burundi  =======================
B D              Nile tilapia  =======================
  D            Painted turtle  =======================
  D           Green seaturtle  =======================
B D        American alligator  =======================
B D                Budgerigar  =======================
B D                   Opossum  =======================
  D               Rock pigeon  =======================
  D       Collared flycatcher  =======================
B D       Medium ground finch  =======================
  D          Peregrine falcon  =======================
  D              Saker falcon  =======================
  D                    Parrot  =======================
B D                  Platypus  =======================
B D                   Wallaby  =======================
B D                  Elephant  -----------------------
B D           Chinese hamster  =======================
  D  Chinese softshell turtle  =======================
        David's myotis (bat)  -----------------------
               Big brown bat  -----------------------
B D                  Microbat  -----------------------

Alignment block 31 of 52 in window, 38792572 - 38792573, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  tt
B D                    Rhesus  tt
B D       Crab-eating macaque  tt
B D                    Baboon  tt
B D              Green monkey  tt
B D                  Marmoset  tt
B D           Squirrel monkey  tt
B D                  Bushbaby  tc
           Chinese tree shrew  tg
B D                  Squirrel  tt
       Lesser Egyptian jerboa  tt
               Golden hamster  tc
B D            Naked mole-rat  tt
                   Chinchilla  tt
             Brush-tailed rat  tt
B D                       Pig  tc
B D                    Alpaca  -t
               Bactrian camel  -t
B D                   Dolphin  ct
                 Killer whale  ct
             Tibetan antelope  ct
B D                       Cow  ct
B D                     Sheep  ct
                Domestic goat  ct
B D                     Horse  tt
B D          White rhinoceros  tt
B D                       Cat  tc
B D                       Dog  tt
B D                   Ferret   tc
B D                     Panda  tc
               Pacific walrus  tg
                 Weddell seal  tg
             Black flying-fox  tc
B D                   Megabat  tc
B D                  Hedgehog  tt
              Star-nosed mole  tt
          Cape elephant shrew  tt
B D                   Manatee  tt
             Cape golden mole  tt
B D                    Tenrec  tt
                     Aardvark  tt
B D                 Armadillo  tt
B D                Coelacanth  tt
B D                       Rat  ==
                Prairie vole  ==
B D                     Mouse  ==
B D                      Pika  NN
B D                     Shrew  ==
B D                Guinea pig  ==
B D                    Rabbit  --
B D             X. tropicalis  ==
                 Spotted gar  ==
          Southern platyfish  ==
B D                      Fugu  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D