Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1053 in window, 87259404 - 87259424, 21 bps 
B D                     Human  tat--------------------------------------------aag----------acacct---c
B D                     Chimp  tat--------------------------------------------aag----------acacct---c
B D                   Gorilla  tat--------------------------------------------aag----------acacct---c
B D                 Orangutan  tat--------------------------------------------gag----------acagct---c
B D                    Gibbon  tgt--------------------------------------------aag----------acacct---c
B D                    Rhesus  tat--------------------------------------------aag----------acacct---c
B D       Crab-eating macaque  tat--------------------------------------------aag----------acacct---c
B D                    Baboon  tat--------------------------------------------aag----------acacct---c
B D              Green monkey  tat--------------------------------------------aag----------acacc-----
B D                  Marmoset  tat--------------------------------------------aag----------acacct---c
B D           Squirrel monkey  tat----------------------------------------------g----------acacct---c
B D                  Bushbaby  tct--------------------------------------------aag----------acactt---t
           Chinese tree shrew  tttaagatacctacaacccttgctatagggcaagtaccaccatgcccaag----------atacct---c
B D                  Squirrel  tct--------------------------------------------aag----------acatct---c
       Lesser Egyptian jerboa  tct--------------------------------------------aag----------tcacct---c
                 Prairie vole  tct--------------------------------------------tgg----------tcacct---c
B D           Chinese hamster  tct--------------------------------------------tag----------tcacct---c
B D                     Mouse  tct--------------------------------------------tagttgcctctcatcacct---c
B D                       Rat  tct--------------------------------------------tagttgtctctagtcacct---c
B D            Naked mole-rat  tct--------------------------------------------aag----------acatct---c
B D                Guinea pig  tct--------------------------------------------aaa----------acacct---g
                   Chinchilla  tct--------------------------------------------aag----------acacct---c
             Brush-tailed rat  tct--------------------------------------------aag----------acaact---c
B D                    Rabbit  tct--------------------------------------------aag----------gaacctatat
B D                      Pika  ---------------------------------------------------------------------t
B D                       Pig  tct--------------------------------------------aag----------gcaccc---c
B D                    Alpaca  tct--------------------------------------------aag----------gcacct---c
               Bactrian camel  tct--------------------------------------------aag----------gcacct---c
B D                   Dolphin  -----------------------------------------------------------------t---g
                 Killer whale  tca--------------------------------------------aag----------gcccct---g
             Tibetan antelope  tct--------------------------------------------aag----------gcacct---c
B D                       Cow  tct--------------------------------------------a----------------------
B D                     Sheep  tct--------------------------------------------aag----------gcacct---c
                Domestic goat  tct--------------------------------------------aag----------gcacct---c
B D                     Horse  tct--------------------------------------------aag----------gtacct---c
B D          White rhinoceros  tcg--------------------------------------------aag----------gtacct---c
B D                       Cat  tct--------------------------------------------aac----------gcacct---c
B D                       Dog  tca--------------------------------------------aag----------gcacat---c
B D                   Ferret   tca--------------------------------------------gag----------gcacct---c
B D                     Panda  tca--------------------------------------------aag----------gcacct---c
               Pacific walrus  tca--------------------------------------------aag----------gcacct---c
                 Weddell seal  tca--------------------------------------------aag----------acacct---c
             Black flying-fox  tct--------------------------------------------aag----------gcacct---c
B D                   Megabat  tct--------------------------------------------aag----------gcacct---c
                Big brown bat  tct--------------------------------------------aag----------gcacct---c
         David's myotis (bat)  tct--------------------------------------------aag----------gcacct---c
B D                  Microbat  tct--------------------------------------------aag----------gcacct---c
B D                  Hedgehog  tct--------------------------------------------cag----------gcactt---c
B D                     Shrew  ctt--------------------------------------------aag----------gcactc---a
              Star-nosed mole  tcc--------------------------------------------aag----------atgcct---c
B D                  Elephant  ttc--------------------------------------------ag-----------gcacct---c
          Cape elephant shrew  ttc--------------------------------------------ta-----------gcattt---a
B D                   Manatee  ttc--------------------------------------------ag-----------gcacct---c
             Cape golden mole  ttc--------------------------------------------aa-----------gaaaat----
B D                    Tenrec  tgc--------------------------------------------aa-----------gcacct---c
                     Aardvark  ttc--------------------------------------------aa-----------gcatca---c
B D                 Armadillo  tct--------------------------------------------aag----------gcatct---c
B D                   Opossum  ----------------------------------------------------------------------
B D           Tasmanian devil  ----------------------------------------------------------------------
B D              Nile tilapia  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
                 Spotted gar  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                      Fugu  ======================================================================
B D                Coelacanth  ======================================================================
          Southern platyfish  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Medaka  ======================================================================
B D                 Zebrafish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
  D                    Parrot  ======================================================================
  D            Painted turtle  ======================================================================
B D                  Platypus  ======================================================================
B D                    Lizard  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Saker falcon  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================
  D          Peregrine falcon  ======================================================================
              Golden hamster  ======================================================================

                        Human  ca--gc--tc-tt
                        Chimp  ca--gc--tc-t-
                      Gorilla  ca--gc--tc-t-
                    Orangutan  ca--gc--tc-t-
                       Gibbon  ca--gc--tc-t-
                       Rhesus  tg--gc--tc-t-
          Crab-eating macaque  tg--gc--tc-t-
                       Baboon  cg--gc--tc-t-
                 Green monkey  -a--gc--tc-t-
                     Marmoset  cg--gc--tc-t-
              Squirrel monkey  ca--gc--tc-t-
                     Bushbaby  ca--gc--tt-tt
           Chinese tree shrew  ca--gc--cc-tt
                     Squirrel  tgctga--tc---
       Lesser Egyptian jerboa  ta--gt--tc-ta
                 Prairie vole  ag--tc--t----
              Chinese hamster  tg--gc--tc---
                        Mouse  tg--ga--tc---
                          Rat  tg--ga--tt---
               Naked mole-rat  tg--gc--cc-tg
                   Guinea pig  tg--acctcc-tg
                   Chinchilla  c------------
             Brush-tailed rat  tg--gc--cc-tg
                       Rabbit  tg--gc--cc-tc
                         Pika  tg--a--------
                          Pig  ta--gt--tc-tt
                       Alpaca  tg--gt--tc-at
               Bactrian camel  tg--gt--tc-at
                      Dolphin  tg--gt--tc-tt
                 Killer whale  tg--gt--tc-tt
             Tibetan antelope  tg--gt--tc-tt
                          Cow  -------------
                        Sheep  tg--gt--tc-tt
                Domestic goat  tg--gt--tc-tt
                        Horse  tg--gc--tc-tt
             White rhinoceros  tg--gc--tc-tt
                          Cat  ca--gc--tc-tt
                          Dog  tt--gc--tc-tt
                      Ferret   tg--cc--tc-tt
                        Panda  ta--gc--tc-tt
               Pacific walrus  tg--gc--tc-tt
                 Weddell seal  tg--gc--tc-tt
             Black flying-fox  tg--gc--tc-tt
                      Megabat  tg--gc--tc-tt
                Big brown bat  tg--gc--tc-tt
         David's myotis (bat)  tg--gc--tc-tt
                     Microbat  tg--gc--tc-tt
                     Hedgehog  tg--gt--tc-tt
                        Shrew  ag--gc--tc-tt
              Star-nosed mole  tg--gc--tt-tt
                     Elephant  tg--gc--tc-tg
          Cape elephant shrew  -g--ac--tc-tt
                      Manatee  tg--gc--tc-tt
             Cape golden mole  tg--gc--tc-tt
                       Tenrec  tg--gc--tt-tt
                     Aardvark  tg--cc--tc-tg
                    Armadillo  tg--gg--tcttt
                      Opossum  -------------
              Tasmanian devil  -------------
                 Nile tilapia  =============
                  Zebra mbuna  =============
                    Tetraodon  =============
                  Stickleback  =============
                  Spotted gar  =============
          Pundamilia nyererei  =============
        Burton's mouthbreeder  =============
          Princess of Burundi  =============
                         Fugu  =============
                   Coelacanth  =============
           Southern platyfish  =============
                 Atlantic cod  =============
                       Medaka  =============
                    Zebrafish  =============
     Mexican tetra (cavefish)  =============
       Yellowbelly pufferfish  =============
                X. tropicalis  =============
                  Rock pigeon  =============
       White-throated sparrow  =============
                       Parrot  =============
               Painted turtle  =============
                     Platypus  =============
                       Lizard  =============
                  Zebra finch  =============
          Medium ground finch  =============
          Collared flycatcher  =============
     Chinese softshell turtle  =============
                 Saker falcon  =============
              Green seaturtle  =============
                 Mallard duck  =============
                   Budgerigar  =============
                       Turkey  =============
                      Chicken  =============
           Tibetan ground jay  =============
                      Wallaby  =============
           American alligator  =============
             Peregrine falcon  =============
               Golden hamster  =============

Inserts between block 1 and 2 in window
B D                  Opossum 5bp

Alignment block 2 of 1053 in window, 87259425 - 87259446, 22 bps 
B D                     Human  aagttcaaaa------ctt--tta--gttc------------ag
B D                     Chimp  aagttcaaaa------ctt--tta--gttc------------ag
B D                   Gorilla  aagttcaaaa------ctt--tta--gttc------------ag
B D                 Orangutan  aagttcaaaa------ctt--tta--gttc------------ag
B D                    Gibbon  aagttcaaaa------ctt--tta--gttc------------ag
B D                    Rhesus  aagttcaaaa------c----tta--gttc------------ag
B D       Crab-eating macaque  aagttcaaaa------ctt--tta--gttc------------ag
B D                    Baboon  aagttcaaaa------ctt--tta--gttc------------ag
B D              Green monkey  aagtttaaaa------ctt--tta--gttc------------ag
B D                  Marmoset  aagttcaaaa------ctt--tta--attc------------ag
B D           Squirrel monkey  aagttcaaaa------ctt--cta--gttc------------ag
B D                  Bushbaby  aagtttaaaa------cat--tta--gtt---------------
           Chinese tree shrew  aagctcaaaa------ctt--tta--gtt---------------
B D                  Squirrel  ----agcaga------a----cca--attc------------at
       Lesser Egyptian jerboa  aaatttaaaa------c----ttttaatcc------------aa
                 Prairie vole  ----ttcaaa------c----ttt--actc------------aa
B D           Chinese hamster  ----ttcaaa------c----ctt--actc------------aa
B D                     Mouse  ----ttcaaa------c----ctt--actc------------aa
B D                       Rat  ----gtcaaa------c----ctt--actccaaaacaaaacaaa
B D            Naked mole-rat  aagttcaaaa------ctt--tta--atcc------------aa
B D                Guinea pig  gagttcaaaa------c-t--tta--atcc------------aa
                   Chinchilla  aagttcaaaa------ctt--tta--acac------------aa
             Brush-tailed rat  gagttcaaaa------c----tta--gtgc------------aa
B D                    Rabbit  aagttcaaaa------ctt--tca--gttc------------aa
B D                      Pika  -----caaaa------ctt--tca--cttc------------aa
B D                       Pig  aaatgcaaaa------ctg--tta--gttc------------aa
B D                    Alpaca  aagtgcaaaa------ctt--tta--gttc------------ag
               Bactrian camel  aagtgcaaaa------ctt--tta--gttc------------ag
B D                   Dolphin  aagtgcaaaa------ctt--tta--gttc------------ag
                 Killer whale  aagtgcaaaa------ctt--tta--gttc------------ag
             Tibetan antelope  aagtgcaaaa------ctt--tta--gttc------------aa
B D                       Cow  ---------a------ctt--tta--gttc------------aa
B D                     Sheep  aagtgcaaca------ctt--tta--gttc------------aa
                Domestic goat  aagtgcaaaa------ctt--tta--gttc------------aa
B D                     Horse  aagtgcaaaa------gtt--tta--gttc------------aa
B D          White rhinoceros  aagtgcaaaa------ctt--tta--gttc------------aa
B D                       Cat  aagtgcaaac------aat--tta--gttc------------aa
B D                       Dog  aagtgcaaac------tat--tta--gttc------------ca
B D                   Ferret   aggtgcaaac------tat--tca--gttc------------aa
B D                     Panda  atgtgcaaac--caactat--tta--gttc------------aa
               Pacific walrus  aagtgcaaacaaaaactat--taa--gttc------------aa
                 Weddell seal  aagtgcaaacaaaaactat--taa--gttc------------aa
             Black flying-fox  atgtgcaaaa------cgt--tga--cttt------------a-
B D                   Megabat  atgtgcaaaa------cgt--tga--cttt------------a-
                Big brown bat  aagtgc-aaa------act--tga--gttg------------aa
         David's myotis (bat)  aagtgcaaaa------act--tga--gttc------------aa
B D                  Microbat  aagtgcaaaa------act--tga--gttc------------aa
B D                  Hedgehog  aaattctaaa------ctt--tca--gttt------------aa
B D                     Shrew  aaatttaata------c----ata--gttc------------aa
              Star-nosed mole  aaattcaaaa------cta--tta--gttc------------aa
B D                  Elephant  aaattccaaa------catagcta--gttc------------ta
          Cape elephant shrew  aa-----aaa------ctttgata----tc------------ag
B D                   Manatee  aaattaaaaa------ctttgtta--gttc------------aa
             Cape golden mole  tagttc-aaa------ctttatta--attc------------aa
B D                    Tenrec  catttc-aaa------cttcattt--attc------------ca
                     Aardvark  aagtgcaaaa------cattgtta--attc------------ag
B D                 Armadillo  aagttcaaag------ctt---tt--agtt------------aa
B D                   Opossum  aagtgcagaa------att--ttg--atat------------aa
B D           Tasmanian devil  ---tcaaaat------att--ttg--attc------------aa
B D                   Wallaby  aagtacaaaa------att--ttg--attc------------aa
B D              Nile tilapia  ============================================
                 Zebra mbuna  ============================================
B D                 Tetraodon  ============================================
B D               Stickleback  ============================================
                 Spotted gar  ============================================
         Pundamilia nyererei  ============================================
       Burton's mouthbreeder  ============================================
         Princess of Burundi  ============================================
B D                      Fugu  ============================================
B D                Coelacanth  ============================================
          Southern platyfish  ============================================
B D              Atlantic cod  ============================================
B D                    Medaka  ============================================
B D                 Zebrafish  ============================================
    Mexican tetra (cavefish)  ============================================
      Yellowbelly pufferfish  ============================================
B D             X. tropicalis  ============================================
  D               Rock pigeon  ============================================
  D    White-throated sparrow  ============================================
  D                    Parrot  ============================================
  D            Painted turtle  ============================================
B D                  Platypus  ============================================
B D                    Lizard  ============================================
B D               Zebra finch  ============================================
B D       Medium ground finch  ============================================
  D       Collared flycatcher  ============================================
  D  Chinese softshell turtle  ============================================
  D              Saker falcon  ============================================
  D           Green seaturtle  ============================================
  D              Mallard duck  ============================================
B D                Budgerigar  ============================================
B D                    Turkey  ============================================
B D                   Chicken  ============================================
          Tibetan ground jay  ============================================
B D        American alligator  ============================================
  D          Peregrine falcon  ============================================
              Golden hamster  ============================================

Inserts between block 2 and 3 in window
B D                  Dolphin 363bp
                Killer whale 352bp

Alignment block 3 of 1053 in window, 87259447 - 87259454, 8 bps 
B D                     Human  acaaatta
B D                     Chimp  acaaacta
B D                   Gorilla  acaaacta
B D                 Orangutan  acaaacta
B D                    Gibbon  acaaacta
B D                    Rhesus  acaaacta
B D       Crab-eating macaque  acaaacta
B D                    Baboon  acaaacta
B D              Green monkey  acaaacta
B D                  Marmoset  acaaacta
B D           Squirrel monkey  acaaacta
B D                  Bushbaby  -caaacta
           Chinese tree shrew  -caaacaa
B D                  Squirrel  ta------
       Lesser Egyptian jerboa  acaagca-
                 Prairie vole  aaaatctt
B D           Chinese hamster  aaaatctt
B D                     Mouse  aaaagaaa
B D                       Rat  acaaaaca
B D            Naked mole-rat  gcaaactg
B D                Guinea pig  gcgaactt
                   Chinchilla  gcaaacta
             Brush-tailed rat  gcaaactg
B D                    Rabbit  acta----
B D                      Pika  acta----
B D                       Pig  acgaacta
B D                    Alpaca  aaaaacta
               Bactrian camel  aaaaacta
B D                   Dolphin  acaaacta
                 Killer whale  acaaacta
             Tibetan antelope  acaaacta
B D                       Cow  acaaacta
B D                     Sheep  acaaacta
                Domestic goat  acaaacta
B D                     Horse  acaaacca
B D          White rhinoceros  acaaac--
B D                       Cat  acaaacta
B D                       Dog  acaaacta
B D                   Ferret   ac----tg
B D                     Panda  acaaaata
               Pacific walrus  acaaacta
                 Weddell seal  acaaacta
B D                   Megabat  ---aacta
                Big brown bat  gccaacca
         David's myotis (bat)  gccaatca
B D                  Microbat  gccaacca
B D                  Hedgehog  gtaaact-
B D                     Shrew  agaaaata
              Star-nosed mole  gcaaacta
B D                  Elephant  agaagctg
          Cape elephant shrew  aaaaactg
B D                   Manatee  agaagctg
             Cape golden mole  agaagcta
B D                    Tenrec  cgaagctc
                     Aardvark  agaaacta
B D                 Armadillo  acaaacaa
B D                   Opossum  agaaagtg
B D           Tasmanian devil  a----ctg
B D                   Wallaby  ataagctg
B D              Nile tilapia  ========
                 Zebra mbuna  ========
B D                 Tetraodon  ========
B D               Stickleback  ========
                 Spotted gar  ========
         Pundamilia nyererei  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D                      Fugu  ========
B D                Coelacanth  ========
          Southern platyfish  ========
B D              Atlantic cod  ========
B D                    Medaka  ========
B D                 Zebrafish  ========
    Mexican tetra (cavefish)  ========
      Yellowbelly pufferfish  ========
B D             X. tropicalis  ========
  D               Rock pigeon  ========
  D    White-throated sparrow  ========
  D                    Parrot  ========
  D            Painted turtle  ========
B D                  Platypus  ========
B D                    Lizard  ========
            Black flying-fox  --------
B D               Zebra finch  ========
B D       Medium ground finch  ========
  D       Collared flycatcher  ========
  D  Chinese softshell turtle  ========
  D              Saker falcon  ========
  D           Green seaturtle  ========
  D              Mallard duck  ========
B D                Budgerigar  ========
B D                    Turkey  ========
B D                   Chicken  ========
          Tibetan ground jay  ========
B D        American alligator  ========
  D          Peregrine falcon  ========
              Golden hamster  ========

Inserts between block 3 and 4 in window
      Lesser Egyptian jerboa 17bp
                Prairie vole 16bp
B D          Chinese hamster 165bp
B D                    Mouse 19bp
B D                      Rat 108bp

Alignment block 4 of 1053 in window, 87259455 - 87259518, 64 bps 
B D                     Human  g-tagagttggtag---------------a-aagc------------agaac---att------------
B D                     Chimp  g-tagagttggtag---------------a-aagc------------agaac---att------------
B D                   Gorilla  g-tagagttggtag---------------a-aagc------------agaac---att------------
B D                 Orangutan  g-tagagctggtag---------------a-aagc------------agaac---att------------
B D                    Gibbon  g-tagagttggtag---------------a-aagc------------agacc---att------------
B D                    Rhesus  g-tagagttggtag---------------a-aagc------------agaac---att------------
B D       Crab-eating macaque  g-tagagttggtag---------------a-aagc------------agaac---att------------
B D                    Baboon  g-tagagttggtag---------------a-aagc------------agaac---att------------
B D              Green monkey  g-tagagttggtag---------------a-aagt------------agaac---att------------
B D                  Marmoset  g-tagagatggcag---------------t-aagc------------agaac---att------------
B D           Squirrel monkey  g-tagagttggcag---------------t-aagc------------agaac---att------------
B D                  Bushbaby  t-tagaggtggtgg---------------t-aagc------------agaaa---att------------
           Chinese tree shrew  t-tagagctggtga---------------t-aagc------------ccaaa---ttt------------
B D                  Squirrel  ----------------------------------a------------tcaat---gtt------------
       Lesser Egyptian jerboa  ----------------------------------t------------tgaac---gtt------------
                 Prairie vole  ----------------------------------c------------ctaat---ata------------
B D           Chinese hamster  ----------------------------------t------------ctaac---ccaagttgtctggga
B D                     Mouse  ----------------------------------c------------taaat---ata------------
B D                       Rat  t-gtgctccatttt---------------c-aggc------------caagt---gtc------------
B D            Naked mole-rat  t-tagggctagtga---------------t-aggc------------agaat---act------------
B D                Guinea pig  c-tagggctgctga---------------t-gggc------------agaac---ata------------
                   Chinchilla  t-tagagttaatga---------------t-aggc------------agaac---att------------
             Brush-tailed rat  t-tagggatagtga---------------t-aggc------------acagc---ttt------------
B D                    Rabbit  ----tcagagttgt---------------t-aagt------------ggaat---att------------
B D                      Pika  ----acagaactgg---------------t-aggc------------agaat---gtt------------
B D                       Pig  t-tagagctgatgg---------------t-aacc------------agaac---att------------
B D                    Alpaca  t-tagagatgat-g---------------c-aagc------------aggat---gtc------------
               Bactrian camel  t-tagagatgat-g---------------c-aagc------------aggat---gtc------------
B D                   Dolphin  t-tagagctgatgg---------------t-aagc------------aggac---atc------------
                 Killer whale  t-tagagctgatgg---------------t-aagc------------aggac---atc------------
             Tibetan antelope  t-taacattgatgg---------------c-aagc------------agggc---atc------------
B D                       Cow  t-taaagctgatgg---------------c-aagc------------aggac---atc------------
B D                     Sheep  t-taaaattgatgg---------------c-aagc------------agggc---atc------------
                Domestic goat  t-taaaattgatgg---------------c-aagc------------agggc---atc------------
B D                     Horse  t-tagagctgatga---------------t-aagt------------aggac---cct------------
B D          White rhinoceros  -----agctgatgg---------------t-aagc------------aggac---act------------
B D                       Cat  t-tagtgctgatgg---------------t-aaac------------aggac---att------------
B D                       Dog  t-tatagctgatgg---------------c-aagc------------aggat---gtc------------
B D                   Ferret   t-tagagctgatgg---------------t-aagc------------aggat---att------------
B D                     Panda  t-tagaactgaggg---------------t-aagc------------aggac---a--------------
               Pacific walrus  t-tagagctgatag---------------t-aagc------------aggac---att------------
                 Weddell seal  t-cagagctgatag---------------t-aagc------------aggac---att------------
             Black flying-fox  -----aacttatgg---------------t-aagc------------aggac---att------------
B D                   Megabat  t-tagaacttatgg---------------t-aagc------------aggac---att------------
                Big brown bat  t-taaagctgatga---------------taaagc------------aggac---att------------
         David's myotis (bat)  t-taaagctgatga---------------t-aagc------------aggac---att------------
B D                  Microbat  t-taaagctgatga---------------t-aagc------------aggac---att------------
B D                  Hedgehog  ---tcagctaatgg---------------t-gtgc------------aggac---act------------
B D                     Shrew  t-catagttgatgg---------------t-gagctgtcattaactgatggt---aac------------
              Star-nosed mole  t-tacagtgggagg---------------a-aagc------------aagat---agt------------
B D                  Elephant  t-tagagttgatgg---------------c-aagc------------aggac---agc------------
          Cape elephant shrew  taaagagttgatggtcaataaattttccat-acac------------aagac---acg------------
B D                   Manatee  t-tagagttgatgg---------------t-aaac------------gggac---agt------------
             Cape golden mole  t-tagagttggtga---------------a-tgaa------------tattctaagtg------------
B D                    Tenrec  t-tggggtttatga---------------g-aagc------------cgctc---gtg------------
                     Aardvark  t-tagtgttgatgg---------------t-aagc------------aggac---att------------
B D                 Armadillo  t-tagaactaatga---------------t-aagc------------agcac---att------------
B D                   Opossum  t-aagaatggacca---------------c-agaa------------atgtg---acc------------
B D           Tasmanian devil  t-aagaattgataa---------------t-agaa------------gtgta---act------------
B D                   Wallaby  t-aagaattgataa---------------t-agaa------------gtgta---act------------
B D              Nile tilapia  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
                 Spotted gar  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                      Fugu  ======================================================================
B D                Coelacanth  ======================================================================
          Southern platyfish  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Medaka  ======================================================================
B D                 Zebrafish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
  D                    Parrot  ======================================================================
  D            Painted turtle  ======================================================================
B D                  Platypus  ======================================================================
B D                    Lizard  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Saker falcon  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D        American alligator  ======================================================================
  D          Peregrine falcon  ======================================================================
              Golden hamster  ======================================================================

                        Human  ----gg----t------t-a--a-----------------------t-ttttg-----------------
                        Chimp  ----gg----t------t-a--a-----------------------t-ttttg-----------------
                      Gorilla  ----gg----t------t-a--a-----------------------t-ttttg-----------------
                    Orangutan  ----ggttaat------t-a--a-----------------------t-ttttg-----------------
                       Gibbon  ----gg----t------t-a--a-----------------------t-ttttg-----------------
                       Rhesus  ----ggctaat------t-a--a-----------------------t-tttcg-----------------
          Crab-eating macaque  ----ggctaat------t-a--a-----------------------t-tttcg-----------------
                       Baboon  ----ggctaat------t-a--a-----------------------t-tttcg-----------------
                 Green monkey  ----ggctaat------t-a--a-----------------------t-ttttg-----------------
                     Marmoset  ----gg----------------------------------------------------------------
              Squirrel monkey  ----gg----------------------------------------------------------------
                     Bushbaby  ----ggttaat------g-a--a-----------------------t-tttct-----------------
           Chinese tree shrew  ----agtcaat------g-a--a-----------------------t-tttct-----------------
                     Squirrel  ----aa----t------g-a--a-----------------------t-cttct-----------------
       Lesser Egyptian jerboa  ----gg----t------t-aaaaaa---------------------t-tttgt-----------------
                 Prairie vole  ----aa----c------c-a--atata------------ctt----t-ttcat-----------------
              Chinese hamster  aaacaa----c------a-a--atgtt------------ctt----a-accaccgagccagctctccagg
                        Mouse  ----aa----t------c-aatatatt------------ctt----t-tttgt-----------------
                          Rat  ----aa----tggaaccc-aggagact------------ccttggat-ttcct-----------------
               Naked mole-rat  ----ga----t------t-a--acaaa-------------------t-tttct-----------------
                   Guinea pig  ----aa----t------g-a--at-------------------------ttct-----------------
                   Chinchilla  ----ga----t------t-a--atgag-------------------a-gttct-----------------
             Brush-tailed rat  ----ca----t------t-g--atgca-------------------t-tttct-----------------
                       Rabbit  ----gg----c------t-a--gctta-------------------t-tttat-----------------
                         Pika  ----aa----c------t-c--acacc-------------------t-tttct-----------------
                          Pig  ----gg----t------t-a--aagaa-------------------t-tttct-----------------
                       Alpaca  ----ag----t------t-a--aggac-------------------t-tttct-----------------
               Bactrian camel  ----ag----t------t-a--aggac-------------------t-tttct-----------------
                      Dolphin  ----ag----t------t-a--aggaa-------------------t-tttct-----------------
                 Killer whale  ----ag----t------t-a--aggaa-------------------t-tttct-----------------
             Tibetan antelope  ----ag----g------t-a--aggaa-------------------t-tttct-----------------
                          Cow  ----ag----g------t-a--aggaa-------------------t-tttct-----------------
                        Sheep  ----ag----g------t-a--aggaa-------------------t-tttct-----------------
                Domestic goat  ----ag----g------t-a--aggaa-------------------t-tttct-----------------
                        Horse  ----gg----t------g-a--aggaa-------------------t-tttct-----------------
             White rhinoceros  ----gg----t------t-a--aggaa-------------------t-ttttt-----------------
                          Cat  ----gg----t------c-a----caa-------------------t-tttct-----------------
                          Dog  ----gg----t------taa--atcag-------------------t-tttct-----------------
                      Ferret   ----gg----t------t-a--atcaa-------------------t-tttct-----------------
                        Panda  ----------t------t-a--atcaa-------------------t-tttct-----------------
               Pacific walrus  ----gg----t------t-a--atcaa-------------------t-tttct-----------------
                 Weddell seal  ----gg----t------t-a--atcaa-------------------t-tttct-----------------
             Black flying-fox  ----gg----t------g-a--------------------------------------------------
                      Megabat  ----gg----t------g-a--------------------------------------------------
                Big brown bat  ----gg----c------t-a--aggaa-------------------t-catct-----------------
         David's myotis (bat)  ----gg----c------t-a--aggaa-------------------t-tatct-----------------
                     Microbat  ----gg----c------t-a--aggaa-------------------t-tatct-----------------
                     Hedgehog  -------------------a------a-------------------t-tacta-----------------
                        Shrew  ----ga----t------t-a------a-------------------t-tttct-----------------
              Star-nosed mole  ----g--------------a------a-------------------t-cttct-----------------
                     Elephant  ----gg----t------t-g--atgaa-------------------t-tgtct-----------------
          Cape elephant shrew  ----ag----t------t-------aa-------------------t-tttct-----------------
                      Manatee  ----gg----t------a-a--atgaa-------------------t-tttct-----------------
             Cape golden mole  ----ga----t------c-t--attta-------------------tattttt-----------------
                       Tenrec  ----gg----t------c-c--gtgga-------------------tctttct-----------------
                     Aardvark  ----ga----t------t-a--atgaa-------------------t-tttgt-----------------
                    Armadillo  ----gg----t------t-a--ataag-------------------t-tttct-----------------
                      Opossum  ----aa----c------a-c--cccaa-----------------gtt-acaga-----------------
              Tasmanian devil  ----ga----c------g-c--tataaaggttttttgaggttttttt-tgttt-----------------
                      Wallaby  ----aa----c------a-t--cctag-------------------t-taaat-----------------
                 Nile tilapia  ======================================================================
                  Zebra mbuna  ======================================================================
                    Tetraodon  ======================================================================
                  Stickleback  ======================================================================
                  Spotted gar  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                         Fugu  ======================================================================
                   Coelacanth  ======================================================================
           Southern platyfish  ======================================================================
                 Atlantic cod  ======================================================================
                       Medaka  ======================================================================
                    Zebrafish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                X. tropicalis  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
                       Parrot  ======================================================================
               Painted turtle  ======================================================================
                     Platypus  ======================================================================
                       Lizard  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
           Tibetan ground jay  ======================================================================
           American alligator  ======================================================================
             Peregrine falcon  ======================================================================
               Golden hamster  ======================================================================

                        Human  ------------------aa-----------------ttg------gatattt-----------------
                        Chimp  ------------------aa-----------------ttg------gatattt-----------------
                      Gorilla  ------------------aa-----------------ttg------gatattt-----------------
                    Orangutan  ------------------aa-----------------ttg------gatattt-----------------
                       Gibbon  ------------------aa-----------------ttg------gatattt-----------------
                       Rhesus  ------------------aa-----------------ttg------gatattt-----------------
          Crab-eating macaque  ------------------aa-----------------ttg------gctattt-----------------
                       Baboon  ------------------aa-----------------ttg------gatattt-----------------
                 Green monkey  ------------------aa-----------------ttg------gatattt-----------------
                     Marmoset  -----------------------------------------------atattt-----------------
              Squirrel monkey  -----------------------------------------------atattt-----------------
                     Bushbaby  ------------------aa-----------------ttg-----aaacttcc-----------------
           Chinese tree shrew  ------------------aa-----------------ttg------gatattt-----------------
                     Squirrel  ------------------aa-----------------ctg------gctcttc-----------------
       Lesser Egyptian jerboa  ------------------at-----------------ttg------tttcttc-----------------
                 Prairie vole  ------------ttttagat-----------------tta------tttttat-----------------
              Chinese hamster  catgtcaatacattctcaac-----------------ttg------tactttc-----------------
                        Mouse  ------------ttatagat-----------------tca------tttattt---tgtttcattttatt
                          Rat  ------------ctggaaatagtgtgacagacagttgtga------gctgtataggtgatggaacccaca
               Naked mole-rat  ------------------aa-----------------ttg------gattttc-----------------
                   Guinea pig  ------------------ga-----------------tcg------gctcttc-----------------
                   Chinchilla  ------------------aa-----------------tcg------aatc-ta-----------------
             Brush-tailed rat  ------------------ag-----------------ttg------gatcatc-----------------
                       Rabbit  ------------------aa-----------------tta------ggtagtc-----------------
                         Pika  ------------------aa-----------------aca------tatattc-----------------
                          Pig  ------------------aa-----------------taa------gatcctc-----------------
                       Alpaca  ------------------gg-----------------ttg------gatcctc-----------------
               Bactrian camel  ------------------ga-----------------ttg------gatcctc-----------------
                      Dolphin  ------------------aa-----------------ttg------gatcttc-----------------
                 Killer whale  ------------------aa-----------------ttg------gatcttc-----------------
             Tibetan antelope  ------------------aa-----------------ttg------gatcttc-----------------
                          Cow  ------------------aa-----------------ttg------gatcttc-----------------
                        Sheep  ------------------aa-----------------ttg------gatcttc-----------------
                Domestic goat  ------------------aa-----------------ttg------gatcttc-----------------
                        Horse  ------------------aa-----------------ttg------gatcttc-----------------
             White rhinoceros  ------------------aa-----------------ttg------gatcttc-----------------
                          Cat  ------------------aa-----------------ttg------tattttc-----------------
                          Dog  ------------------ga-----------------ttg------tatcttc-----------------
                      Ferret   ------------------aa-----------------ttg------tatcttc-----------------
                        Panda  ------------------aa-----------------ttg------t--cttc-----------------
               Pacific walrus  ------------------aa-----------------ttg------ttccttc-----------------
                 Weddell seal  ------------------aa-----------------ttg------ttctttc-----------------
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
                Big brown bat  ------------------aa-----------------ttg------gattttc-----------------
         David's myotis (bat)  ------------------aa-----------------ttg------gattttc-----------------
                     Microbat  ------------------aa-----------------ttg------gattttc-----------------
                     Hedgehog  ------------------aa-----------------tt------------tt-----------------
                        Shrew  ------------------aa-----------------ttg------gatcctt-----------------
              Star-nosed mole  ------------------ag-----------------ctg------ggtattt-----------------
                     Elephant  ------------------aa-----------------gtg------catcttc-----------------
          Cape elephant shrew  ------------------aa-----------------aac------tattttc-----------------
                      Manatee  ------------------aa-----------------ggg------cattttc-----------------
             Cape golden mole  ------------------------------------------------tt--------------------
                       Tenrec  ------------------ga-----------------gcg------catc--------------------
                     Aardvark  ------------------aa-----------------gtt------caccttc-----------------
                    Armadillo  ------------------aa-----------------ctg------gaccttc-----------------
                      Opossum  ------------------at-----------------ttgctcatcactcttt-----------------
              Tasmanian devil  ------------------gt-----------------ttgtttatcactcttc-----------------
                      Wallaby  ------------------gt-----------------ttctttatcactcttc-----------------
                 Nile tilapia  ======================================================================
                  Zebra mbuna  ======================================================================
                    Tetraodon  ======================================================================
                  Stickleback  ======================================================================
                  Spotted gar  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                         Fugu  ======================================================================
                   Coelacanth  ======================================================================
           Southern platyfish  ======================================================================
                 Atlantic cod  ======================================================================
                       Medaka  ======================================================================
                    Zebrafish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                X. tropicalis  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
                       Parrot  ======================================================================
               Painted turtle  ======================================================================
                     Platypus  ======================================================================
                       Lizard  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
           Tibetan ground jay  ======================================================================
           American alligator  ======================================================================
             Peregrine falcon  ======================================================================
               Golden hamster  ======================================================================

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                 Green monkey  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  ----------------------------------------------------------------------
              Chinese hamster  ----------------------------------------------------------------------
                        Mouse  ttatgggtaggagtg--------ttttgcctac----atgtatatctgtgca--------------ccac
                          Rat  tcctctggaagagcaacagatgctcttaaccactgagacatctctctggccaagtcaatagattatcaac
               Naked mole-rat  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                       Rabbit  ----------------------------------------------------------------------
                         Pika  ----------------------------------------------------------------------
                          Pig  ----------------------------------------------------------------------
                       Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
                      Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
                          Cow  ----------------------------------------------------------------------
                        Sheep  ----------------------------------------------------------------------
                Domestic goat  ----------------------------------------------------------------------
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                          Cat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
                        Panda  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                     Microbat  ----------------------------------------------------------------------
                     Hedgehog  ----------------------------------------------------------------------
                        Shrew  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
          Cape elephant shrew  ----------------------------------------------------------------------
                      Manatee  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
                       Tenrec  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
                    Armadillo  ----------------------------------------------------------------------
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ----------------------------------------------------------------------
                      Wallaby  ----------------------------------------------------------------------
                 Nile tilapia  ======================================================================
                  Zebra mbuna  ======================================================================
                    Tetraodon  ======================================================================
                  Stickleback  ======================================================================
                  Spotted gar  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                         Fugu  ======================================================================
                   Coelacanth  ======================================================================
           Southern platyfish  ======================================================================
                 Atlantic cod  ======================================================================
                       Medaka  ======================================================================
                    Zebrafish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                X. tropicalis  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
                       Parrot  ======================================================================
               Painted turtle  ======================================================================
                     Platypus  ======================================================================
                       Lizard  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
           Tibetan ground jay  ======================================================================
           American alligator  ======================================================================
             Peregrine falcon  ======================================================================
               Golden hamster  ======================================================================

                        Human  ------c----tggtg-atgtgct-------t
                        Chimp  ------c----tggtg-atgtgct-------t
                      Gorilla  ------c----tggtg-atgtgct-------t
                    Orangutan  ------c----tggtg-atgtgct-------t
                       Gibbon  ------c----tggcg-atgtgct-------t
                       Rhesus  ------c----tggcg-atgtgct-------t
          Crab-eating macaque  ------c----tggtg-atgtgct-------t
                       Baboon  ------c----tggcg-atgtgct-------t
                 Green monkey  ------c----tggcg-atgtgct-------t
                     Marmoset  ------c----ttgca-atgtgct-------t
              Squirrel monkey  ------c----ttgca-atgtgct-------t
                     Bushbaby  ------c----tggtg-aaatcct-------t
           Chinese tree shrew  ------ct---tggtg-ata---t-------t
                     Squirrel  ------cc---tgatc-atattcc-------t
       Lesser Egyptian jerboa  ------cc---tgttt-gtagtcc-----ttg
                 Prairie vole  ------ca---tatat-aaagctc--------
              Chinese hamster  ------ca---tggtt-aatattc------ta
                        Mouse  ttg---ca---tggct-agtactgatggaggt
                          Rat  ttgagcca---tccct-ggt--taatagtcgg
               Naked mole-rat  ------ct---tggtc-aaattcc-------t
                   Guinea pig  ------cc---aggtt-ttattct-------t
                   Chinchilla  ------cc---ttgtg-acattcc-------t
             Brush-tailed rat  ------cc---tggtt-atattcc-------c
                       Rabbit  ------t------------------------t
                         Pika  ------t------------------------t
                          Pig  ------tc---tggtg-atgttct-------t
                       Alpaca  ------tc---tgatg-atattct-------t
               Bactrian camel  ------tc---tggtg-atattct-------t
                      Dolphin  ------tc---tggtg-atactct-------t
                 Killer whale  ------tc---tggtg-atactct-------t
             Tibetan antelope  ------tc---tactg-atattct-------t
                          Cow  ------tc---tggtg-atattct-------t
                        Sheep  ------tc---tactg-atattct-------t
                Domestic goat  ------tc---tactg-atattct-------t
                        Horse  ------tc---tggtg-atatttg-------t
             White rhinoceros  ------tg---tggtg-atattct-------t
                          Cat  ------ta---tggtg-atattct-------t
                          Dog  ------ta---cagtg-atattct-------t
                      Ferret   ------cg---ttgtg-atattct-------t
                        Panda  ------ta---ttgtg-atattct-------t
               Pacific walrus  ------ta---ttgtg-atattct-------t
                 Weddell seal  ------ta---ttgtg-atattct-------t
             Black flying-fox  -------------------------------t
                      Megabat  -------------------------------t
                Big brown bat  ------tc---tggtg-atattct-------t
         David's myotis (bat)  ------tc---tgatg-atattct-------t
                     Microbat  ------tc---tggtg-atattct-------t
                     Hedgehog  ------ac---tgatagagatact--------
                        Shrew  ------gc---tggcagatatgtt-------t
              Star-nosed mole  ------tc---tggta-acagact--------
                     Elephant  ------cc---tggag-aaactct-------t
          Cape elephant shrew  ------tc---tagag-acaccct-------t
                      Manatee  ------cc---tggag-gtgtgtg-------t
             Cape golden mole  --------------------------------
                       Tenrec  --------------------------------
                     Aardvark  ------tc---tggag-ataccct-------t
                    Armadillo  ------tc---tggtg-atattct-------t
                      Opossum  ------cctgttg--g-aaagtct-------t
              Tasmanian devil  ------cctgttggtg-acagcct-------t
                      Wallaby  ------cttattggtg-acagcct-------t
                 Nile tilapia  ================================
                  Zebra mbuna  ================================
                    Tetraodon  ================================
                  Stickleback  ================================
                  Spotted gar  ================================
          Pundamilia nyererei  ================================
        Burton's mouthbreeder  ================================
          Princess of Burundi  ================================
                         Fugu  ================================
                   Coelacanth  ================================
           Southern platyfish  ================================
                 Atlantic cod  ================================
                       Medaka  ================================
                    Zebrafish  ================================
     Mexican tetra (cavefish)  ================================
       Yellowbelly pufferfish  ================================
                X. tropicalis  ================================
                  Rock pigeon  ================================
       White-throated sparrow  ================================
                       Parrot  ================================
               Painted turtle  ================================
                     Platypus  ================================
                       Lizard  ================================
                  Zebra finch  ================================
          Medium ground finch  ================================
          Collared flycatcher  ================================
     Chinese softshell turtle  ================================
                 Saker falcon  ================================
              Green seaturtle  ================================
                 Mallard duck  ================================
                   Budgerigar  ================================
                       Turkey  ================================
                      Chicken  ================================
           Tibetan ground jay  ================================
           American alligator  ================================
             Peregrine falcon  ================================
               Golden hamster  ================================

Inserts between block 4 and 5 in window
B D                  Manatee 202bp

Alignment block 5 of 1053 in window, 87259519 - 87259546, 28 bps 
B D                     Human  tacatatgtgtcatta-ct-gacttaca--tg
B D                     Chimp  tacatatgtgtcatta-ct-gacttaca--tg
B D                   Gorilla  tacatatgtgtcatta-ct-gacttaca--tg
B D                 Orangutan  tacatatgtgtcatta-ct-gacttaaa--tg
B D                    Gibbon  tacatatgtgtcgtta-ct-cacttaaa--tg
B D                    Rhesus  tacatatgtgtcatta-ct-gacttaaa--tg
B D       Crab-eating macaque  tacatatgtgtcatta-ct-gacttaaa--tg
B D                    Baboon  tacatatgtgtcatta-ct-gacttaaa--tg
B D              Green monkey  tacatatgtgtcatta-ct-gacttaaa--tg
B D                  Marmoset  taaattagtgtcatta-ct-gacttaaa--ta
B D           Squirrel monkey  taaat--gt-tcatta-tg-gacttaaa--ta
B D                  Bushbaby  taaatatgtgacatta-ct-aactaaaa--ta
           Chinese tree shrew  taagtatacagtatga-ct-ggctgaac--ta
B D                  Squirrel  tacatata-----tta-ccaattaaaaa--tt
       Lesser Egyptian jerboa  aacatacatggcattg-ctggtttaaaa--ga
                 Prairie vole  ---atatatgagcttt-tt-gccca-------
B D           Chinese hamster  taaatatttgtcctta-ct-ttttaaaa--aa
B D                     Mouse  taaaaattaa--------------aaaa--ca
B D                       Rat  taaatatttgtcctta-ct-gattaaaa--tt
B D            Naked mole-rat  taggtatattaaatta-ct-gattaaaa--ga
B D                Guinea pig  taagtacattacatca-ct-ggttaaaa--g-
                   Chinchilla  taattacattaaatta-ct-gattaaag--t-
             Brush-tailed rat  taattat-----gtta-ct-gattaaag----
B D                    Rabbit  taaatatgtgacatca-ct-cgccatga--gg
B D                      Pika  caattgtgttacgtca-ct-----gaaa--gg
B D                       Pig  ----tatgtgacatta-tt-gactggaa--ta
B D                    Alpaca  ----tatgtgacatta-ct-gcctgaaa--ca
               Bactrian camel  ----tatgtgacatta-ct-gcctgaaa--ca
B D                   Dolphin  ----tatgtgacatta-ct-gactaaaa--ta
                 Killer whale  ----tatgtgacatta-ct-gactaaaa--ta
             Tibetan antelope  ----tatgtgacagaa-ct-gactaaaa--ta
B D                       Cow  ----tatgggacat-a-ct-gactaaaa--ta
B D                     Sheep  ----tatgtgacagaa-ct-ggctaaaa--ta
                Domestic goat  ----tatgtgacagaa-ct-gactaaaa--ta
B D                     Horse  taactaggtgacgtta-gt-gactgaaa--ta
B D          White rhinoceros  taactatgtgacatta-gt-aactgaaa--tg
B D                       Cat  ----tatttagcatta--t-gactgaaa--ta
B D                       Dog  ----tatttggcatta--t-caatgaaa--tg
B D                   Ferret   ----tacttggcattg--t-gactgaaa--tg
B D                     Panda  ----tatatggcatta--t-gactgaaa--tg
               Pacific walrus  ----tatttggcatta--t-gactgaaa--ta
                 Weddell seal  ----tatttggcatta--t-gactgaaa--tg
             Black flying-fox  taactatgcgatatta-ct-gactaaaa--tg
B D                   Megabat  taactatgcgatatta-ct-gactaaaa--tg
                Big brown bat  taactatgtgacatta-ct---ctgaat--aa
         David's myotis (bat)  taactacttgacatta-ct---ctgaaa--ca
B D                  Microbat  taactacgtgacatta-cc---ctgaaa--ca
B D                  Hedgehog  ---------------------aaaaaaa--aa
B D                     Shrew  gaactctgtggcatta-tt-gactgaaa--ta
              Star-nosed mole  --accttgtgacatta-ct-gactgaaa--ga
B D                  Elephant  ------------------------gaac--tc
          Cape elephant shrew  ------------------------tatctgta
             Cape golden mole  -------------------------tac--ta
B D                    Tenrec  -------------------------ttc--cc
                     Aardvark  ------------------------taac--tg
B D                 Armadillo  ------------------------taac--ta
B D                   Opossum  ----------tcattgtct-ctctgatc--cc
B D           Tasmanian devil  ----------tcattatct-atctcata--cc
B D                   Wallaby  ----------tcataattt-atctgata--cc
B D              Nile tilapia  ================================
                 Zebra mbuna  ================================
B D                 Tetraodon  ================================
B D               Stickleback  ================================
                 Spotted gar  ================================
         Pundamilia nyererei  ================================
       Burton's mouthbreeder  ================================
         Princess of Burundi  ================================
B D                      Fugu  ================================
B D                Coelacanth  ================================
          Southern platyfish  ================================
B D              Atlantic cod  ================================
B D                    Medaka  ================================
B D                 Zebrafish  ================================
    Mexican tetra (cavefish)  ================================
      Yellowbelly pufferfish  ================================
B D             X. tropicalis  ================================
  D               Rock pigeon  ================================
  D    White-throated sparrow  ================================
  D                    Parrot  ================================
  D            Painted turtle  ================================
B D                  Platypus  ================================
B D                    Lizard  ================================
B D               Zebra finch  ================================
B D       Medium ground finch  ================================
  D       Collared flycatcher  ================================
  D  Chinese softshell turtle  ================================
  D              Saker falcon  ================================
  D           Green seaturtle  ================================
  D              Mallard duck  ================================
B D                Budgerigar  ================================
B D                    Turkey  ================================
B D                   Chicken  ================================
          Tibetan ground jay  ================================
B D        American alligator  ================================
  D          Peregrine falcon  ================================
              Golden hamster  ================================
B D                   Manatee  ================================

Alignment block 6 of 1053 in window, 87259547 - 87259566, 20 bps 
B D                     Human  tt-----------------a-a---------------aaa-gctaa-----------------------t
B D                     Chimp  tt-----------------a-a---------------aaa-gctaa-----------------------t
B D                   Gorilla  tt-----------------a-a---------------aaa-gctaa-----------------------t
B D                 Orangutan  tt-----------------aca---------------aaa-gctaa-----------------------t
B D                    Gibbon  tt-----------------a-a---------------aaa-gctaa-----------------------t
B D                    Rhesus  tt-----------------a-a---------------aaa-actaa-----------------------t
B D       Crab-eating macaque  tt-----------------a-a---------------aaa-actaa-----------------------t
B D                    Baboon  tt-----------------a-a---------------aaa-gctaa-----------------------t
B D              Green monkey  tt-----------------a-a---------------aaa-gctaa-----------------------t
B D                  Marmoset  tt-----------------a-a---------------aaa-cctaa-----------------------t
B D           Squirrel monkey  tt-----------------a-a---------------aaa-gctaa-----------------------t
B D                  Bushbaby  at-----------------a-a---------------aaa-gctca-----------------------t
           Chinese tree shrew  tt-----------------g-a---------------aaa-actaa-----------------------t
B D                  Squirrel  ac-----------------a-a---------------ag---ctaa-----------------------t
       Lesser Egyptian jerboa  gt-----------------a-t---------------aaa-gctaa-----------------------t
                 Prairie vole  ------------------------------------------catg-----------------------t
B D           Chinese hamster  tt-----------------a-a---------------aaa-taaaa-----------------------t
B D                     Mouse  gc-----------------a-a---------------ca---acaa-----------------------t
B D                       Rat  ta-----------------a-a---------------ga---acaa-----------------------t
B D            Naked mole-rat  tt-----------------a-a---------------aaa-tctga-----------------------t
B D                Guinea pig  ---------------------------------------a-tttag-----------------------a
                   Chinchilla  ---------------------------------------g-tttta-----------------------a
             Brush-tailed rat  ------------------------------------------gtta-----------------------a
B D                    Rabbit  ct-----------------a-a---------------cat-gctaa-----------------------t
B D                      Pika  cc-----------------a-a---------------cgt-gctaaaaacaaacaaaacagcaactacca
B D                       Pig  tt-----------------a-a---------------aaa-gcaaa-----------------------t
B D                    Alpaca  -------------------a-a---------------aaa-gcaga-----------------------t
               Bactrian camel  -------------------a-a---------------aaa-gcaga-----------------------t
B D                   Dolphin  tt-----------------a-a---------------aaa-gcaaa-----------------------t
                 Killer whale  tt-----------------a-a---------------aaa-gcaaa-----------------------t
             Tibetan antelope  tt-----------------a-a---------------aaa-gcaga-----------------------t
B D                       Cow  tt-----------------a-a---------------aaa-gcaga-----------------------t
B D                     Sheep  tt-----------------a-a---------------aaa-gcaga-----------------------t
                Domestic goat  tt-----------------a-a---------------aaa-gcaga-----------------------t
B D                     Horse  tt-----------------a-a---------------aaa-gctaa-----------------------t
B D          White rhinoceros  tt-----------------a-a---------------aaa-gctaa-----------------------t
B D                       Cat  tt-----------------a-a---------------aaa-gctaa-----------------------t
B D                       Dog  tt-----------------a-a---------------aaa-gctaa-----------------------t
B D                   Ferret   tt-----------------a-a---------------aaa-gctaa-----------------------t
B D                     Panda  tt-----------------a-a---------------aaa-gctaa-----------------------t
               Pacific walrus  tt-----------------a-a---------------aaa-gctaa-----------------------t
                 Weddell seal  tt-----------------a-a---------------aaa-gctaa-----------------------t
             Black flying-fox  tt-----------------a-a---------------aaa-gctaa-----------------------c
B D                   Megabat  tt-----------------a-a---------------aaa-gctaa-----------------------c
                Big brown bat  at------------------------------------ta-gctaa-----------------------c
         David's myotis (bat)  tt-------------------a---------------aaa-gctaa-----------------------c
B D                  Microbat  gt-----------------a-a---------------aaa-gctaa-----------------------c
B D                  Hedgehog  aaa----------------a-a---------------aaa-gctga-----------------------c
B D                     Shrew  ttt----------------a-a---------------gaa-gctag-----------------------t
              Star-nosed mole  ttg----------------a-a---------------tag-ac---------------------------
B D                  Elephant  tg-----------------a-c---------------gtg-attca-----------------------t
          Cape elephant shrew  tg-----------------a-t---------------agg-gtcca-----------------------g
             Cape golden mole  tgt-----------aaaaaa-t---------------atg-agcca-----------------------t
B D                    Tenrec  tgg-----------agagag-tctttagctacgtgcaata-atcca-----------------------c
                     Aardvark  tg-----------------t-c---------------atgtgttca-----------------------t
B D                 Armadillo  tgggatattgccaaaacatt-t---------------atgagctaa-----------------------t
B D                   Opossum  ct-----------------g-a---------------aag-cttag-----------------------a
B D           Tasmanian devil  tc-----------------a-g---------------aaa-cttag-----------------------a
B D                   Wallaby  tc-----------------a-g---------------aag-cttag-----------------------a
B D                Coelacanth  ----------------------------------tttaaa-ccttg-----------------------t
B D              Nile tilapia  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
                 Spotted gar  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                      Fugu  ======================================================================
          Southern platyfish  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Medaka  ======================================================================
B D                 Zebrafish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
  D                    Parrot  ======================================================================
  D            Painted turtle  ======================================================================
B D                  Platypus  ======================================================================
B D                    Lizard  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Saker falcon  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D        American alligator  ======================================================================
  D          Peregrine falcon  ======================================================================
              Golden hamster  ======================================================================
B D                   Manatee  ======================================================================

                        Human  at--------------acatg-
                        Chimp  aa--------------acatg-
                      Gorilla  aa--------------acatg-
                    Orangutan  aa--------------acatg-
                       Gibbon  aa--------------acatg-
                       Rhesus  ac--------------acata-
          Crab-eating macaque  ac--------------acata-
                       Baboon  ac--------------acatc-
                 Green monkey  ac--------------acata-
                     Marmoset  aa--------------a-aag-
              Squirrel monkey  ------------------aag-
                     Bushbaby  ------------------agg-
           Chinese tree shrew  aa--------------acaag-
                     Squirrel  aa--------------tctgt-
       Lesser Egyptian jerboa  at--------------actgc-
                 Prairie vole  at--------------atttg-
              Chinese hamster  aa--------------attgg-
                        Mouse  ga--------------attgc-
                          Rat  aa--------------attga-
               Naked mole-rat  aa--------------actgc-
                   Guinea pig  ag--------------tctac-
                   Chinchilla  aa--------------atggc-
             Brush-tailed rat  aa--------------attac-
                       Rabbit  ga--------------agagg-
                         Pika  aa--------------aaagg-
                          Pig  at--------------acaac-
                       Alpaca  tt--------------atagc-
               Bactrian camel  tt--------------atagc-
                      Dolphin  ac--------------acagc-
                 Killer whale  ac--------------acagc-
             Tibetan antelope  at--------------tcagc-
                          Cow  at--------------acagc-
                        Sheep  at--------------acagc-
                Domestic goat  at--------------acagc-
                        Horse  at--------------acagc-
             White rhinoceros  at--------------acagc-
                          Cat  aa--------------acagc-
                          Dog  aa--------------acagc-
                      Ferret   aa--------------acagc-
                        Panda  aa--------------acagc-
               Pacific walrus  aa--------------acagc-
                 Weddell seal  aa--------------acagc-
             Black flying-fox  at--------------acatc-
                      Megabat  at--------------acatc-
                Big brown bat  at--------------acagc-
         David's myotis (bat)  at--------------acagt-
                     Microbat  at--------------acagt-
                     Hedgehog  aa--------------aaacc-
                        Shrew  -a--------------aaact-
              Star-nosed mole  ------------------att-
                     Elephant  gt--------------acatg-
          Cape elephant shrew  tg--------------gcatc-
             Cape golden mole  gt--------------------
                       Tenrec  at--------------acttg-
                     Aardvark  gt--------------gcatg-
                    Armadillo  gt--------------gcagt-
                      Opossum  aatggag---------gcaga-
              Tasmanian devil  aataaagataggctaagcaga-
                      Wallaby  aataaagatatgctaagcaga-
                   Coelacanth  tt--------------tccatg
                 Nile tilapia  ======================
                  Zebra mbuna  ======================
                    Tetraodon  ======================
                  Stickleback  ======================
                  Spotted gar  ======================
          Pundamilia nyererei  ======================
        Burton's mouthbreeder  ======================
          Princess of Burundi  ======================
                         Fugu  ======================
           Southern platyfish  ======================
                 Atlantic cod  ======================
                       Medaka  ======================
                    Zebrafish  ======================
     Mexican tetra (cavefish)  ======================
       Yellowbelly pufferfish  ======================
                X. tropicalis  ======================
                  Rock pigeon  ======================
       White-throated sparrow  ======================
                       Parrot  ======================
               Painted turtle  ======================
                     Platypus  ======================
                       Lizard  ======================
                  Zebra finch  ======================
          Medium ground finch  ======================
          Collared flycatcher  ======================
     Chinese softshell turtle  ======================
                 Saker falcon  ======================
              Green seaturtle  ======================
                 Mallard duck  ======================
                   Budgerigar  ======================
                       Turkey  ======================
                      Chicken  ======================
           Tibetan ground jay  ======================
           American alligator  ======================
             Peregrine falcon  ======================
               Golden hamster  ======================
                      Manatee  ======================

Alignment block 7 of 1053 in window, 87259567 - 87259585, 19 bps 
B D                     Human  tt----------------t-------ggaaaagg---aa-ct--t------a----------ta
B D                     Chimp  tt----------------t-------ggaaaagt---aa-ct--t------a----------ta
B D                   Gorilla  tt----------------t-------ggaaaagg---aa-ct--t------a----------ta
B D                 Orangutan  tt----------------t-------ggaaaagg---aa-ct--t------a----------ta
B D                    Gibbon  tt----------------t-------ggaaaagg---aa-cc--t------a----------ta
B D                    Rhesus  tt----------------t-------ggaaaagg---aa-tc--t------a----------ta
B D       Crab-eating macaque  tt----------------t-------ggaaaagg---aa-tc--t------a----------ta
B D                    Baboon  tt----------------t-------ggaaaagg---aa-tc--t------a----------ta
B D              Green monkey  tt----------------t-------ggaaaagg---aa-tc--t------a----------ta
B D                  Marmoset  tt----------------t-------ggaaaagg---aa-cc--t------a----------ta
B D           Squirrel monkey  tt----------------t-------ggaaaagg---aa-cc--t------a----------ta
B D                  Bushbaby  ct----------------t-------ggaaaaga---aa-tt--taaaccaa----------aa
           Chinese tree shrew  ct----------------c-------agaaaagg---aa-tt--t------t----------ta
B D                  Squirrel  ct----------------t-------aataaaagtttca-aa--c------t----------aa
       Lesser Egyptian jerboa  ct----------------t-------agaaaagg---aa-ca--t------a----------aa
                 Prairie vole  tg----------------c-------accacatg---catgc--c------tggtgcccacaga
B D           Chinese hamster  ct----------------t-------agaaaagg---aa-at--t------tgatgct----aa
B D                     Mouse  ct----------------t-------acaaaagg---aa-at--t------g----------ta
B D                       Rat  ct----------------t-------acaaaagg---ta-at--t------t----------ta
B D            Naked mole-rat  ct----------------t-------agaagagg----a-at--t------t----------ta
B D                Guinea pig  ct----------------t-------agaaatgg----a-gt--t------t----------ca
                   Chinchilla  tg----------------t-------agaaaagg----a-at--t------t----------ta
             Brush-tailed rat  ct----------------t-------tagaaggg----a-----t------t----------ta
B D                    Rabbit  ct----------------c-------caaaaagg---aa-ct--t------t----------ta
B D                      Pika  ct----------------c-------tctgcagg---aa-ct--t------t----------ta
B D                       Pig  ct----------------tt------ggaaaaga---ag-cc--t------t----------ta
B D                    Alpaca  ct----------------tt------ggaaaaag---aa-cc--t------t----------ta
               Bactrian camel  ct----------------tt------ggaaaaag---aa-cc--t------t----------ta
B D                   Dolphin  ct----------------tt------ggaaaagg---aa-ac--t------t------------
                 Killer whale  ct----------------tt------ggaaaagg---aa-ac--t------t------------
             Tibetan antelope  ct----------------tt------gcaaaaag---aa-tc--t------t------------
B D                       Cow  ct----------------tt------gggaaaag---aa-tc--t------t----------ta
B D                     Sheep  ct----------------tt------gcaaaaag---aa-------------------------
                Domestic goat  ct----------------tt------gcaaaaag---aa-tc--t------t------------
B D                     Horse  ct----------------tt------gagaaatg---aa-cc--t------t----------ta
B D          White rhinoceros  ct----------------tt------gaagaagg---aa-ac--t------t------------
B D                       Cat  ct----------------tg------ggaaaagg---aa-tc--t------t------------
B D                       Dog  ct----------------tt------ggaaaaga---aa-tc--t------t-----------a
B D                   Ferret   ct----------------tt------ggaaaagg---aa-tc---------------------a
B D                     Panda  ct----------------tt------gagaaaag---aa-tc--t------t------------
               Pacific walrus  ct----------------tt------ggaaaagg---aa-tc--t------t-----------a
                 Weddell seal  ct----------------tt------ggaaaagg---aa-tc--t------t-----------a
             Black flying-fox  ct----------------tt------agaaaagg---aa-cc--t------t----------ta
B D                   Megabat  ct----------------tt------agaaaagg---aa-cc--t------t----------ta
                Big brown bat  ct----------------tt------ggaaaagg---aa-ca--t------t----------ta
         David's myotis (bat)  ct----------------tt------ggaaaagg---aa-ca--t------t----------ta
B D                  Microbat  ct----------------tt------ggaaatgg---aa-ca--t------t----------ta
B D                  Hedgehog  ct----------------tc------agaaaagg---aa-ct--c------t----------ta
B D                     Shrew  ct----------------tt------ggaaaagt---aa-ct--t-------------------
              Star-nosed mole  ct----------------tt------gaaaag--------------------------------
B D                  Elephant  tt--------------------------------------------------------------
          Cape elephant shrew  ct--------------------------------------------------------------
             Cape golden mole  ---gtgtaggaa----------------------------------------------------
B D                    Tenrec  ttggtgt-ggaa----------------------------------------------------
                     Aardvark  ctcg------------------------------------------------------------
B D                 Armadillo  cttgcaaagatacttcta----------------------------------------------
B D                   Opossum  ct----------------gtg-----tgaaaaca---aa-cttat------a----------t-
B D           Tasmanian devil  ct----------------atg-----tgaaaaca---aa-cc--t------t----------t-
B D                   Wallaby  ct----------------gtg-----tgaaaaca---aa-cc--t------g----------t-
  D           Green seaturtle  --------------------ttt-gggtaaagtt---ca-ca--t------t------------
B D                Coelacanth  ---------------------ttaagagaatatg------------------------------
B D              Nile tilapia  ================================================================
                 Zebra mbuna  ================================================================
B D                 Tetraodon  ================================================================
B D               Stickleback  ================================================================
                 Spotted gar  ================================================================
         Pundamilia nyererei  ================================================================
       Burton's mouthbreeder  ================================================================
         Princess of Burundi  ================================================================
B D                      Fugu  ================================================================
          Southern platyfish  ================================================================
B D              Atlantic cod  ================================================================
B D                    Medaka  ================================================================
B D                 Zebrafish  ================================================================
    Mexican tetra (cavefish)  ================================================================
      Yellowbelly pufferfish  ================================================================
B D             X. tropicalis  ================================================================
  D               Rock pigeon  ================================================================
  D    White-throated sparrow  ================================================================
  D                    Parrot  ================================================================
  D            Painted turtle  ================================================================
B D                  Platypus  ================================================================
B D                    Lizard  ================================================================
B D               Zebra finch  ================================================================
B D       Medium ground finch  ================================================================
  D       Collared flycatcher  ================================================================
  D  Chinese softshell turtle  ================================================================
  D              Saker falcon  ================================================================
  D              Mallard duck  ================================================================
B D                Budgerigar  ================================================================
B D                    Turkey  ================================================================
B D                   Chicken  ================================================================
          Tibetan ground jay  ================================================================
B D        American alligator  ================================================================
  D          Peregrine falcon  ================================================================
              Golden hamster  ================================================================
B D                   Manatee  ================================================================

Inserts between block 7 and 8 in window
B D                Armadillo 14bp

Alignment block 8 of 1053 in window, 87259586 - 87259591, 6 bps 
B D                     Human  aacc-ca
B D                     Chimp  aacc-ca
B D                   Gorilla  aacc-ca
B D                 Orangutan  aacc-ca
B D                    Gibbon  aacc-ca
B D                    Rhesus  aact-ca
B D       Crab-eating macaque  aact-ca
B D                    Baboon  aact-ca
B D              Green monkey  aact-ca
B D                  Marmoset  aacc-ca
B D           Squirrel monkey  aacc-ca
B D                  Bushbaby  gacc-ta
           Chinese tree shrew  ggac-ca
B D                  Squirrel  aaca-aa
       Lesser Egyptian jerboa  gacc-ct
                 Prairie vole  gact-ag
B D           Chinese hamster  aact-aa
B D                     Mouse  aact-ac
B D                       Rat  aactcaa
B D            Naked mole-rat  aact-aa
B D                Guinea pig  aact-aa
                   Chinchilla  aact-aa
             Brush-tailed rat  aact-ga
B D                    Rabbit  agtg-aa
B D                      Pika  a----ag
B D                       Pig  aact-aa
B D                    Alpaca  aact-ag
               Bactrian camel  aact-ag
B D                   Dolphin  ---t-aa
                 Killer whale  ---t-aa
             Tibetan antelope  ---t-aa
B D                       Cow  aact-aa
B D                     Sheep  -----aa
                Domestic goat  ---t-aa
B D                     Horse  aact-aa
B D          White rhinoceros  ---t-aa
B D                       Cat  -----ga
B D                       Dog  aact-ag
B D                   Ferret   gact-ag
B D                     Panda  ------a
               Pacific walrus  aact-aa
                 Weddell seal  aact-aa
             Black flying-fox  aact-ag
B D                   Megabat  aact-ag
                Big brown bat  a------
         David's myotis (bat)  a------
B D                  Microbat  a------
B D                  Hedgehog  aagt-aa
B D                     Shrew  ---t-aa
B D                   Manatee  -----aa
B D                   Opossum  ------a
B D           Tasmanian devil  ------t
B D                   Wallaby  ------a
  D           Green seaturtle  aact-ag
B D                Coelacanth  -acc---
             Star-nosed mole  -------
B D              Nile tilapia  =======
                 Zebra mbuna  =======
B D                 Tetraodon  =======
B D               Stickleback  =======
                 Spotted gar  =======
         Pundamilia nyererei  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D                      Fugu  =======
          Southern platyfish  =======
B D              Atlantic cod  =======
B D                    Medaka  =======
B D                 Zebrafish  =======
    Mexican tetra (cavefish)  =======
      Yellowbelly pufferfish  =======
B D             X. tropicalis  =======
  D               Rock pigeon  =======
  D    White-throated sparrow  =======
  D                    Parrot  =======
  D            Painted turtle  =======
B D                  Platypus  =======
B D                    Lizard  =======
B D               Zebra finch  =======
B D       Medium ground finch  =======
  D       Collared flycatcher  =======
  D  Chinese softshell turtle  =======
  D              Saker falcon  =======
  D              Mallard duck  =======
B D                Budgerigar  =======
B D                    Turkey  =======
B D                   Chicken  =======
          Tibetan ground jay  =======
B D        American alligator  =======
B D                    Tenrec  -------
  D          Peregrine falcon  =======
B D                 Armadillo  =======
         Cape elephant shrew  -------
                    Aardvark  -------
            Cape golden mole  -------
              Golden hamster  =======
B D                  Elephant  -------

Inserts between block 8 and 9 in window
          Chinese tree shrew 2013bp
B D                 Squirrel 2bp
      Lesser Egyptian jerboa 2bp
                Prairie vole 2bp
B D          Chinese hamster 2bp
B D                    Mouse 2bp
B D                      Rat 2bp
B D           Naked mole-rat 2bp
B D               Guinea pig 2bp
                  Chinchilla 2bp
            Brush-tailed rat 2bp
B D                   Rabbit 2bp
B D                     Pika 2bp
B D                      Pig 15bp
B D                   Alpaca 14bp
              Bactrian camel 14bp
B D                  Dolphin 8bp
                Killer whale 8bp
            Tibetan antelope 15bp
B D                      Cow 15bp
B D                    Sheep 15bp
               Domestic goat 15bp
B D                    Horse 14bp
B D         White rhinoceros 14bp
B D                      Cat 14bp
B D                      Dog 14bp
B D                  Ferret  13bp
B D                    Panda 14bp
              Pacific walrus 14bp
                Weddell seal 14bp
            Black flying-fox 14bp
B D                  Megabat 14bp
               Big brown bat 14bp
        David's myotis (bat) 14bp
B D                 Microbat 14bp
B D                 Hedgehog 14bp
B D                    Shrew 14bp
B D                  Manatee 36bp

Alignment block 9 of 1053 in window, 87259592 - 87259663, 72 bps 
B D                     Human  tactca-------------------------------------------------------------tat
B D                     Chimp  tactca-------------------------------------------------------------tat
B D                   Gorilla  tactca-------------------------------------------------------------tat
B D                 Orangutan  tactc---------------------------------------------------------------at
B D                    Gibbon  tatgcacactc----------------------------------tatgtttgtgtgtgtgtgtgtgtgt
B D                    Rhesus  tatgcacactc----------------------------------a---------------------tat
B D       Crab-eating macaque  tatgcacactc----------------------------------a---------------------tat
B D                    Baboon  tatgcacactc----------------------------------a---------------------tat
B D              Green monkey  tatgcacactc----------------------------------a---------------------tat
B D                  Marmoset  tacatacactc----------------------------------a---------------------tat
B D           Squirrel monkey  tacatacactg----------------------------------a---------------------tat
B D                  Bushbaby  caagaacactc----------------------------------a---------------------cat
B D                  Squirrel  ------aacat----------------------------------a---------------------ca-
       Lesser Egyptian jerboa  ------aactc----------------------------------a---------------------tgg
                 Prairie vole  ------gagtc----------------------------------a---------------------tg-
B D           Chinese hamster  ------gatac----------------------------------a---------------------tat
B D                     Mouse  ------tattc----------------------------------a---------------------cat
B D                       Rat  ------tattc----------------------------------g---------------------cat
B D            Naked mole-rat  ------gatcc----------------------------------a---------------------tgt
B D                Guinea pig  ------gatcc----------------------------------a---------------------tgt
                   Chinchilla  ------gctcc----------------------------------a---------------------cgt
             Brush-tailed rat  ------gctcc----------------------------------a---------------------ggt
B D                    Rabbit  ------gaacc----------------------------------t---------------------tat
B D                      Pika  ------gagcc----------------------------------a---------------------ttt
B D                       Pig  ------cactc----------------------------------a---------------------tgt
B D                    Alpaca  ------cactc----------------------------------a---------------------tgt
               Bactrian camel  ------cactc----------------------------------a---------------------tgt
B D                   Dolphin  -------tccc---------------------------------------------------------gt
                 Killer whale  -------tccc------ctgt--gtgtgtgtgtgtgt--------g---------------------tgt
             Tibetan antelope  ------tactcctctgtgtgt--gtgtgtgtgtgtgt--------g---------------------tgt
B D                       Cow  ------tactc----------------ctgtgtgtgt--------g---------------------tgt
B D                     Sheep  ------tactc--------------gtgtgtgtgtgt--------g---------------------tgt
                Domestic goat  ------tactcc--------t--gtgtgtgtgtgtgt--------g---------------------tgt
B D                     Horse  ------cactc----------------------------------a---------------------tgt
B D          White rhinoceros  ------cactc----------------------------------a---------------------cgt
B D                       Cat  ------cactc---------c------------------------a---------------------tgt
B D                       Dog  ------cactg---------t--gtatatgt--------------g---------------------tgt
B D                   Ferret   ------cactg---------t--gtgtgtgcgtgtgc--------a---------------------tgt
B D                     Panda  ------cac----------------------------------------------------------tgt
               Pacific walrus  ------cactg---------t--gcatgcgtgcgtgtgtctgtgtg---------------------tgt
                 Weddell seal  ------cactg---------t--gcatgc----------------g---------------------tgt
             Black flying-fox  ------catta--------gtcagtgtgtgtgtgtatatagacaaa---------------------tga
B D                   Megabat  ------catta--------gtcagtgtgtgtgtgtatatagacaaa---------------------tga
                Big brown bat  ------cactt--------gt--gtgtttgtgcatgtgtatgtgtg---------------------tgt
         David's myotis (bat)  ------cactc--------at--gtgtgcatgtatgtgtaggtgtg---------------------t--
B D                  Microbat  ------cagtc--------gt--gtgtgcgtgtatgtgtaggtgtg---------------------tgt
B D                  Hedgehog  ------tactc----------------------------------c---------------------tgt
B D                     Shrew  ------taatc----------------------------------c---------------------tgt
              Star-nosed mole  -------aacc----------------------------------a---------------------tgt
B D                  Elephant  ----------------------------------------------------------------------
          Cape elephant shrew  ----------------------------------------------------------------------
B D                   Manatee  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
B D                    Tenrec  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
B D                 Armadillo  ----------------------------------------------------------------------
B D                   Opossum  ----------------------------------------------------------------------
B D           Tasmanian devil  ----------------------------------------------------------------------
B D                   Wallaby  ----------------------------------------------------------------------
  D           Green seaturtle  ----------------------------------------------------------------------
B D                Coelacanth  ----------------------------------------------------------------------
B D              Nile tilapia  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
                 Spotted gar  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                      Fugu  ======================================================================
          Southern platyfish  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Medaka  ======================================================================
B D                 Zebrafish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
  D                    Parrot  ======================================================================
  D            Painted turtle  ======================================================================
B D                  Platypus  ======================================================================
B D                    Lizard  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Saker falcon  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D        American alligator  ======================================================================
  D          Peregrine falcon  ======================================================================
              Golden hamster  ======================================================================
          Chinese tree shrew  ======================================================================

                        Human  ---------------------------------------------gt-----ctg---------------
                        Chimp  ---------------------------------------------gt-----ctg---------------
                      Gorilla  ---------------------------------------------gt-----ctg---------------
                    Orangutan  ---------------------------------------------gt-----ctg---------------
                       Gibbon  ---------------------------------------------gt-----gtg---------------
                       Rhesus  ---------------------------------------------gt-----cag---------------
          Crab-eating macaque  ---------------------------------------------gt-----cag---------------
                       Baboon  ---------------------------------------------gt-----cag---------------
                 Green monkey  ---------------------------------------------gt-----cag---------------
                     Marmoset  ---------------------------------------------at-----cca---------------
              Squirrel monkey  ---------------------------------------------at-----cca---------------
                     Bushbaby  ---------------------------------------------gt-----ctg---------------
                     Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ---------------------------------------------gt-----ctgtttctacctccaccc
                 Prairie vole  ----------------------------------------------------------------------
              Chinese hamster  ---------------------------------------------at-----------------------
                        Mouse  ---------------------------------------------gt-----gtgct---------ggct
                          Rat  ---------------------------------------------at-----atgat---------ggcc
               Naked mole-rat  ---------------------------------------------gc-----gta---------------
                   Guinea pig  ---------------------------------------------gt-----ata---------------
                   Chinchilla  ---------------------------------------------gc-----ata---------------
             Brush-tailed rat  ---------------------------------------------gc-----atg---------------
                       Rabbit  ---------------------------------------------gt-----ggc---------------
                         Pika  ---------------------------------------------gt-----gtc---------------
                          Pig  ---------------------------------------------at-----gga---------------
                       Alpaca  ---------------------------------------------gt-----atg---------------
               Bactrian camel  ---------------------------------------------gt-----atg---------------
                      Dolphin  ---------------------------------------------gt-----gtg---------------
                 Killer whale  ---------------------------------------------gt-----gtg---------------
             Tibetan antelope  ---------------------------------------------gt-----gtg---------------
                          Cow  ---------------------------------------------gt-----gtg---------------
                        Sheep  ---------------------------------------------gt-----gtg---------------
                Domestic goat  ---------------------------------------------gt-----gtg---------------
                        Horse  ---------------------------------------------gt-----gtg---------------
             White rhinoceros  ---------------------------------------------gt-----gtg---------------
                          Cat  ---------------------------------------------gt-----gcg---------------
                          Dog  ---------------------------------------------gt-----gtg---------------
                      Ferret   ---------------------------------------------gt-----gtg---------------
                        Panda  ---------------------------------------------gt-----gtg---------------
               Pacific walrus  ---------------------------------------------gt-----gtg---------------
                 Weddell seal  ---------------------------------------------gt-----gtg---------------
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
                Big brown bat  gcacgtgtgtgtgcacgtgtgtgtgtgtgtgcatgttgtgtgtgcgt-----gtg---------------
         David's myotis (bat)  ---------------------tttgtgtgt---------------gt-----gtg---------------
                     Microbat  -------tttgtgtgtgtgtgtgtgtgtgt---------------gt-----gtg---------------
                     Hedgehog  ---------------------------------------------gcactgtatg---------------
                        Shrew  ---------------------------------------------gc----tatg---------------
              Star-nosed mole  ---------------------------------------------gc-----------------------
                     Elephant  ----------------------------------------------------------------------
          Cape elephant shrew  ----------------------------------------------------------------------
                      Manatee  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
                       Tenrec  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
                    Armadillo  ----------------------------------------------------------------------
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ----------------------------------------------------------------------
                      Wallaby  ----------------------------------------------------------------------
              Green seaturtle  ----------------------------------------------------------------------
                   Coelacanth  ----------------------------------------------------------------------
                 Nile tilapia  ======================================================================
                  Zebra mbuna  ======================================================================
                    Tetraodon  ======================================================================
                  Stickleback  ======================================================================
                  Spotted gar  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                         Fugu  ======================================================================
           Southern platyfish  ======================================================================
                 Atlantic cod  ======================================================================
                       Medaka  ======================================================================
                    Zebrafish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                X. tropicalis  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
                       Parrot  ======================================================================
               Painted turtle  ======================================================================
                     Platypus  ======================================================================
                       Lizard  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
           Tibetan ground jay  ======================================================================
           American alligator  ======================================================================
             Peregrine falcon  ======================================================================
               Golden hamster  ======================================================================
           Chinese tree shrew  ======================================================================

                        Human  --------------------------c----g------------t----------gtgtgt-------g-
                        Chimp  --------------------------c----g------------t----------gtgtgt-------g-
                      Gorilla  --------------------------c----g------------t----------gtgtgt-------g-
                    Orangutan  --------------------------t----a------------t----------gtgtgt-------g-
                       Gibbon  --------------------------t----g------------t----------gtgtgt-------g-
                       Rhesus  --------------------------t----g------------t----------gtgtgt-------g-
          Crab-eating macaque  --------------------------t----g------------t----------gtgtgt-------g-
                       Baboon  --------------------------t----g------------t----------gtgtgt-------g-
                 Green monkey  --------------------------t----g------------t----------gtgtgt-------g-
                     Marmoset  --------------------------t----g------------t----------gtgtgt-------g-
              Squirrel monkey  --------------------------t----g------------t----------gtgtgt-------g-
                     Bushbaby  --------------------------t----g------------t----------gtgtgt-------g-
                     Squirrel  --------------------aactgat----g------------t----------ctgtat-------g-
       Lesser Egyptian jerboa  tccctccctttgcctctccctcctccc----ccatgcgcttgtgt----------gggtat-------g-
                 Prairie vole  --------------------agccctc----c------------t----------ggaaat-------g-
              Chinese hamster  -----------gctgcccccaccccat----a------------t----------gggtgt-------g-
                        Mouse  tccctccc--agttagcactacctcac----t-------------------------gagt-------g-
                          Rat  tctctccc--agttatccccacctctc----t-------------------------gtgt-------a-
               Naked mole-rat  ----------------------ctcat----g------------t----------ttgtgt-------g-
                   Guinea pig  ----------------------ctcat----g------------t----------ttgtgt-------g-
                   Chinchilla  -----------------------tcat----g------------c----------ttgtg----------
             Brush-tailed rat  -----------------------tcat----g------------t----------ttgtgt-------a-
                       Rabbit  ----------------------ctcat----a---------acct---------------t-------g-
                         Pika  ----------------------tccat----a---------tcct----------gtgtgt-------g-
                          Pig  --------------------------g----g------------t----------gggggt---------
                       Alpaca  --------------------------t----g------------t----------gtgtgt---------
               Bactrian camel  --------------------------t----g------------t----------gtgtgt---------
                      Dolphin  --------------------------t----g------------t----------gtgtat---------
                 Killer whale  --------------------------t----g------------t----------gtgtat---------
             Tibetan antelope  --------------------------t----g------------t----------gtgtgt------ta-
                          Cow  --------------------------t----g------------t----------gtgtgt------ta-
                        Sheep  --------------------------t----g------------t----------gtgtgt------ta-
                Domestic goat  --------------------------t----g------------t----------gtgtgt------ta-
                        Horse  --------------------------t----g------------t-------------------------
             White rhinoceros  --------------------------t----g------------t----------gtgg-----------
                          Cat  --------------------------t----g------------t----------gtagat-------a-
                          Dog  --------------------------t----c------------t----------gtagat-------a-
                      Ferret   --------------------------t----c------------t----------gtagat-------a-
                        Panda  --------------------------t----t------------t----------gtagag-------a-
               Pacific walrus  --------------------------t----c------------t----------gtagat-------a-
                 Weddell seal  --------------------------t----c------------t----------gtagat-------a-
             Black flying-fox  --------------------------------------------------------cagat-------ag
                      Megabat  --------------------------------------------------------cagat-------ag
                Big brown bat  --------------------------t----g------------t----------tcagat-------ag
         David's myotis (bat)  --------------------------t----g------------t----------tcagat-------ag
                     Microbat  --------------------------t----g------------t----------tcagat-------ag
                     Hedgehog  --------------------------ttatgg------------t----------tccagc-------g-
                        Shrew  --------------------------t----g------------t----------ttatgt-------a-
              Star-nosed mole  ---------------------------------------------------------acat-------a-
                     Elephant  ----------------------------------------------------------cgt-------g-
          Cape elephant shrew  ---------------------------------------------------------gtgt-------g-
                      Manatee  --------------------------------------------tgtgtgtgtgtgtgtgt-------g-
             Cape golden mole  -------------------------------------------------------gggtatattactaa-
                       Tenrec  -------------------------------------------------------gcatgt-------g-
                     Aardvark  ----------------------------------------------------------tgt-------g-
                    Armadillo  --------------------------------------------tatgcacgctcatatgg-------g-
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ----------------------------------------------------------------------
                      Wallaby  ----------------------------------------------------------------------
              Green seaturtle  ----------------------------------------------------------------------
                   Coelacanth  ----------------------------------------------------------------------
                 Nile tilapia  ======================================================================
                  Zebra mbuna  ======================================================================
                    Tetraodon  ======================================================================
                  Stickleback  ======================================================================
                  Spotted gar  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                         Fugu  ======================================================================
           Southern platyfish  ======================================================================
                 Atlantic cod  ======================================================================
                       Medaka  ======================================================================
                    Zebrafish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                X. tropicalis  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
                       Parrot  ======================================================================
               Painted turtle  ======================================================================
                     Platypus  ======================================================================
                       Lizard  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
           Tibetan ground jay  ======================================================================
           American alligator  ======================================================================
             Peregrine falcon  ======================================================================
               Golden hamster  ======================================================================
           Chinese tree shrew  ======================================================================

                        Human  -------------a------------------ga--------------------aagag---agcggga-
                        Chimp  -------------a------------------ga--------------------aagag---agcggga-
                      Gorilla  -------------a------------------ga--------------------aagag---agcggga-
                    Orangutan  -------------a------------------ga--------------------aagag---agaggga-
                       Gibbon  -------------t------------------gt--------------------gtaag---agaggga-
                       Rhesus  -------------t------------------gt--------------------gagag---agagaga-
          Crab-eating macaque  -------------t------------------gt--------------------gagag---agagaga-
                       Baboon  -------------t------------------ga--------------------gagag---agagaga-
                 Green monkey  -------------t----------------------------------------aagag---agacaga-
                     Marmoset  -------------t--------------------------------------------------------
              Squirrel monkey  -------------t------------------gt--------------------gtgag---agagaga-
                     Bushbaby  -------------ttgggggggggggggctttgg--------------------gggag---agaagga-
                     Squirrel  --------------------------------tg--------------------tgtgc---agtc----
       Lesser Egyptian jerboa  ----------agtt------------------tg--------------------ggcac---gtgcgtg-
                 Prairie vole  -------------t------------------tgttacaaataat---------tgtgagccagaggca-
              Chinese hamster  -------------t------------------ta--------------------cgtga---agaggag-
                        Mouse  -------------t------------------ta--------------------ggtgc---agaggcg-
                          Rat  -------------t------------------ta--------------------ggtat---aaaggca-
               Naked mole-rat  ------------tc------------------tg--------------------aagat---agagaca-
                   Guinea pig  ------------tc------------------tg--------------------aagac---agagaag-
                   Chinchilla  ------------tt------------------tg--------------------agggt---agggg---
             Brush-tailed rat  ------------tc------------------tg--------------------aaagc---agg-----
                       Rabbit  ------------tc------------------tg--------------------tgagc---agagac--
                         Pika  ------------tg------------------tg--------------------tacag---agagac--
                          Pig  ---ggggagaaaga------------------gg--------------------gagag---atctatt-
                       Alpaca  -----------gga------------------ga--------------------gagag---acactgg-
               Bactrian camel  -----------gga------------------ga--------------------gagag---acactgg-
                      Dolphin  -----aaagagaga------------------gg--------------------gagag---atatatt-
                 Killer whale  -----aaagagaga------------------gg--------------------gagag---atatatt-
             Tibetan antelope  --gggagagataga------------------gg--------------------gaaag---atatagt-
                          Cow  --gggagagataga------------------gg--------------------gaaag---atatagt-
                        Sheep  --gggagagagaga------------------gg--------------------gaaag---atatagt-
                Domestic goat  --gggagagataga------------------gg--------------------gaaag---atatagt-
                        Horse  --------------------------------------------------------------ggagaaa-
             White rhinoceros  --------------------------------------------------------------ggagaga-
                          Cat  --aagagggagtga------------------g-----------------------------aaagact-
                          Dog  --gagcaagaggaa------------------g-----------------------------agagatt-
                      Ferret   --gagccagaggga------------------ga--------------------gagag---aaagaat-
                        Panda  --gagcaagaggga------------------ga--------------------gagag---aaagatt-
               Pacific walrus  --gagcaggaggga------------------ga--------------------gagagat-aaagatt-
                 Weddell seal  --gagcaagaggga------------------ga--------------------g-------aaagatt-
             Black flying-fox  atgatagataggtg------------------ggtgaatggata----------gggag---agagatt-
                      Megabat  atgatagataggtg------------------ggtgaatggata----------gggag---agagatt-
                Big brown bat  atgataaat----------------------------------------------aggg---agagact-
         David's myotis (bat)  atgataaatagata------------------gg--------------------gagag---agagact-
                     Microbat  atgataaatagata------------------gg--------------------gagag---agagact-
                     Hedgehog  --accaagaagagg------------------gg--------------------ag------ggaagtt-
                        Shrew  --gctaaaaaaaga------------------gg--------------------gaactgaggggggtg-
              Star-nosed mole  --tgtgaatagaga------------------gt--------------------aaatt---gggggta-
                     Elephant  -------------t------------------gt--------------------gtagg---tgggtgg-
          Cape elephant shrew  -------------t------------------gt--------------------gtaaa---tg------
                      Manatee  -------------t------------------gt--------------------gtaga---ggggtgga
             Cape golden mole  -------------g------------------at--------------------actag---taggaat-
                       Tenrec  -------------g------------------gt--------------------gcaag---ggggttg-
                     Aardvark  -------------t------------------gt--------------------ttggg---ggggtga-
                    Armadillo  -------------t------------------gt--------------------gtgat---ggggaag-
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ----------------------------------------------------------------------
                      Wallaby  ----------------------------------------------------------------------
              Green seaturtle  --------------------------------------------tg------agtgtat---tgtggat-
                   Coelacanth  ----------------------------------taatgatatgtattcagttagcaaa---aaagagg-
                 Nile tilapia  ======================================================================
                  Zebra mbuna  ======================================================================
                    Tetraodon  ======================================================================
                  Stickleback  ======================================================================
                  Spotted gar  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                         Fugu  ======================================================================
           Southern platyfish  ======================================================================
                 Atlantic cod  ======================================================================
                       Medaka  ======================================================================
                    Zebrafish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                X. tropicalis  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
                       Parrot  ======================================================================
               Painted turtle  ======================================================================
                     Platypus  ======================================================================
                       Lizard  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
           Tibetan ground jay  ======================================================================
           American alligator  ======================================================================
             Peregrine falcon  ======================================================================
               Golden hamster  ======================================================================
           Chinese tree shrew  ======================================================================

                        Human  ---------gag-aca------------------------------gagaga-----------tcat---
                        Chimp  ---------gag-aca------------------------------gagaga-----------tcat---
                      Gorilla  ---------gag-aca------------------------------gagaga-----------tcat---
                    Orangutan  ---------gag-aca------------------------------gagaga-----------tcat---
                       Gibbon  ---------gag-acg------------------------------gagaga-----------tcat---
                       Rhesus  ---------aaacata------------------------------gagaga-----------tcgt---
          Crab-eating macaque  ---------aaacaga------------------------------gagaga-----------tcgt---
                       Baboon  ---------aaacaga------------------------------gagaga-----------tcgt---
                 Green monkey  ---------aaacaga------------------------------gagaga-----------tcgt---
                     Marmoset  ---------gag---a------------------------------gagaga-----------ttgt---
              Squirrel monkey  ---------gag---a------------------------------gagaga-----------tcgt---
                     Bushbaby  ---------gag-aaa------------------------------gagaaa-----------gcat---
                     Squirrel  ---------------------------------------------------------------tcat---
       Lesser Egyptian jerboa  ---------cac-ctg------------------------------ggtgtgtgaaaagagttatgt---
                 Prairie vole  ---------gaa--tg------------------------------gatgaa-----------gtat---
              Chinese hamster  ---------gaa--ta------------------------------gatgag-----------atac---
                        Mouse  ---------gaa-ttg------------------------------gaaggg-----------gtgt---
                          Rat  ---------gaa-ttg------------------------------gaagag-----------gtat---
               Naked mole-rat  ---t------------------------------------------agggaa-----------gttc---
                   Guinea pig  ---tagacggag-ggg------------------------------aaggat-----------gtgc---
                   Chinchilla  --------tggg-gta------------------------------ggggag-----------gtgc---
             Brush-tailed rat  ---------gag-gtg------------------------------ggggag-----------gttc---
                       Rabbit  ---------------------------------------------------------------tcgt---
                         Pika  ---------------------------------------------------------------tcat---
                          Pig  ---------gag-aaaga-------------------------gaaaaatca-----------ttgt---
                       Alpaca  ---------gag-agag----------------------------aaaatca-----------ttgt---
               Bactrian camel  ---------gag-agag----------------------------aaaatca-----------ttgt---
                      Dolphin  ---------gag-agag----------------------------agaatca-----------ctgt---
                 Killer whale  ---------gag-agag----------------------------agaatca-----------ctgt---
             Tibetan antelope  ---------gag-aggga--------------------------cagaatca-----------ttgt---
                          Cow  ---------gaa-aggga--------------------------cagaatca-----------ttgt---
                        Sheep  ---------gag-agaga--------------------------cagaatca-----------ttgt---
                Domestic goat  ---------gag-aggga--------------------------cagaatca-----------ttgt---
                        Horse  ---------gag-aga------------------------------caatca-----------ttgt---
             White rhinoceros  ---------gag-aga------------------------------gaatca-----------ttgt---
                          Cat  ---------ttg-aaa------------------------------gaatta-----------ttgt---
                          Dog  ---------gag-agg------------------------------gaatca-----------ctgt---
                      Ferret   ---------gtg-aga------------------------------ggatca-----------ctgt---
                        Panda  ---------gag-aga------------------------------gaatca-----------ctg----
               Pacific walrus  ---------gag-aga------------------------------gaatca-----------ctgt---
                 Weddell seal  ---------gag-aga------------------------------gaatca-----------ccat---
             Black flying-fox  ---------gag-aaaga----------------------------gaatca-----------ttgt---
                      Megabat  ---------gag-aaaga----------------------------gaatca-----------ttgt---
                Big brown bat  ---------ggg-agaga--------------------------aggagtc--------------gt---
         David's myotis (bat)  ---------ggg-agaga--------------------------aggaatca-----------ttgt---
                     Microbat  ---------ggg-agaga--------------------------aggaatca-----------ttgt---
                     Hedgehog  ---------gag-tg---------------------------------atta-----------tcat---
                        Shrew  ---------ggg-cagataggaggaaaagagaaagacttg---aaagaacca-----------ttgt---
              Star-nosed mole  ---------gag------------------------------------acta-----------tttt---
                     Elephant  --------agaa-aga------------------------------gagaca-----------ttgt---
          Cape elephant shrew  ---------tca-aga------------------------------gagaca-----------ttgt---
                      Manatee  gaaagagaaaca-aga------------------------------gaaaca-----------ttgt---
             Cape golden mole  -------------aaa------------------------------ataatt-----------ttct---
                       Tenrec  -------------aga------------------------------aagaca-----------gact---
                     Aardvark  ----------ag-aaa------------------------------gagaca-----------ttat---
                    Armadillo  ---------gag-tgg------------------------------gggaga-----------atgt---
                      Opossum  --------------------------tactaacaggtctgcacatatgaaca-----------acac---
              Tasmanian devil  --------------------------cactaaaaggtctccatatgtaaata-----------tcac---
                      Wallaby  --------------------------ctctaataggtctccatgtgtgaatg-----------tcat---
              Green seaturtle  ---------gca-aga------------------------------aaggca-----------tggt---
                   Coelacanth  ---------gtgcaaa------------------------------aagtca-----------tcacaag
                 Nile tilapia  ======================================================================
                  Zebra mbuna  ======================================================================
                    Tetraodon  ======================================================================
                  Stickleback  ======================================================================
                  Spotted gar  ======================================================================
          Pundamilia nyererei  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                         Fugu  ======================================================================
           Southern platyfish  ======================================================================
                 Atlantic cod  ======================================================================
                       Medaka  ======================================================================
                    Zebrafish  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                X. tropicalis  ======================================================================
                  Rock pigeon  ======================================================================
       White-throated sparrow  ======================================================================
                       Parrot  ======================================================================
               Painted turtle  ======================================================================
                     Platypus  ======================================================================
                       Lizard  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                 Saker falcon  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
           Tibetan ground jay  ======================================================================
           American alligator  ======================================================================
             Peregrine falcon  ======================================================================
               Golden hamster  ======================================================================
           Chinese tree shrew  ======================================================================

                        Human  ------t---------------tta---------ttactg---t-taat----at
                        Chimp  ------t---------------tta---------ttactg---t-taat----at
                      Gorilla  ------t---------------tta---------ttactg---t-taat----at
                    Orangutan  ------t---------------tta---------tcactg---t-taat----at
                       Gibbon  ------t-----------------------------actg---t-taat----at
                       Rhesus  ------t---------------tta---------ttactg---t-taat----at
          Crab-eating macaque  ------t---------------ttc---------ttactg---t-taat----at
                       Baboon  ------t---------------tta---------ttactg---t-taat----at
                 Green monkey  ------t---------------tta---------ttactg---t-taat----at
                     Marmoset  ------t---------------tta---------ttactg---t-taat----at
              Squirrel monkey  ------t---------------tta---------ttcctg---t-taat----at
                     Bushbaby  ------t---------------tca---------ttgctg---t-ta------gt
                     Squirrel  ------t---------------ttt---------ttctat-----tagt----at
       Lesser Egyptian jerboa  ------t-gagggaggtttatcatt---------tcattg---t-tagt----at
                 Prairie vole  ------t-gggggagg------gtt---------tcctagctgt-tagt----gt
              Chinese hamster  ------tggggggagg------gtt---------tcctagatgt-tagt----gt
                        Mouse  ------t-gtgaggga------ctt---------tcctgg-----tagt----g-
                          Rat  ------t-gtgag---------cat---------tcttgg-----tgat----ga
               Naked mole-rat  ------a-tgcat---------ttt---------ctccag---t-tagt----at
                   Guinea pig  ------t-ctgct---------tct---------ctccat---t-taat----at
                   Chinchilla  ------a-cgggt---------ttt---------ctccat---t-tagt----at
             Brush-tailed rat  ------a-tagg---------------------------t---t-tagt----gt
                       Rabbit  ------t---------------tta---------ttcctg---t-tagc----tt
                         Pika  ------t---------------tta---------ttcctg---t-tgtt----tt
                          Pig  ------t---------------tta---------cttcca---t-tagt------
                       Alpaca  ------t---------------tta---------ttccta---t-tagt------
               Bactrian camel  ------t---------------tta---------ttcctt---t-tagt------
                      Dolphin  ------t---------------tta---------ttccta---t-tagt------
                 Killer whale  ------t---------------tta---------ttccta---t-tagt------
             Tibetan antelope  ------t---------------tta---------atccta---t-tagt------
                          Cow  ------t---------------tga---------atccta---t-tagt------
                        Sheep  ------t---------------tta---------atccta---t-tagt------
                Domestic goat  ------t---------------tta---------atccta---t-tagt------
                        Horse  ------t---------------tta---------ttccta---t-tagt----aa
             White rhinoceros  ------t---------------tta---------ttcgta---t-tagt----at
                          Cat  ------t---------------tta---------ttccta---t-tggt----at
                          Dog  ------t---------------tta---------atcctg---t-tggt----at
                      Ferret   ------t---------------tta---------ttcctg---t-tggt----at
                        Panda  ------t---------------tta---------ttccta---t-tgct----at
               Pacific walrus  ------t---------------tta---------ttccta---t-tggt----at
                 Weddell seal  ------t---------------tta---------ttccta---t-tggt----at
             Black flying-fox  ------t---------------tta---------ttccta---t-ta-t----at
                      Megabat  ------t---------------tta---------ttccta---t-ta-t----at
                Big brown bat  ------t---------------tga---------cttttg---c-tagt----at
         David's myotis (bat)  ------t---------------ttg---------gttctg---c-tagt----at
                     Microbat  ------t---------------tta---------cttcta---c-tagt----at
                     Hedgehog  ------t---------------tt-----------acccc---t-tagt----tt
                        Shrew  ------c---------------tt----------tacctg---t-tggt----tt
              Star-nosed mole  ------a---------------tt------------ccta---t-taat----at
                     Elephant  ------t---------------tta---------ttccta---t-tagt----at
          Cape elephant shrew  ------c---------------tta---------taaata---t-----------
                      Manatee  ------t---------------tta---------ttcctg---t-tagt----at
             Cape golden mole  ------t---------------tcta--------ttccta---t-tagc----at
                       Tenrec  ------t---------------ttt---------tttcta---t-tagt----at
                     Aardvark  ------t---------------ttaa--------gctata---g-tcat----at
                    Armadillo  ------t---------------tta---------ttccta---t-tagt----at
                      Opossum  ------a---------------tga---------attcct---taaaatagacat
              Tasmanian devil  ------a---------------tta---------tt-cca---t-aaatagccat
                      Wallaby  ------a---------------tta---------ttccca---t-aaatagccat
              Green seaturtle  ------a---------------tatgaatagtacttactg---t-gaaa----t-
                   Coelacanth  taaatat---------------tta---------caatca---t-aaat----at
                 Nile tilapia  =======================================================
                  Zebra mbuna  =======================================================
                    Tetraodon  =======================================================
                  Stickleback  =======================================================
                  Spotted gar  =======================================================
          Pundamilia nyererei  =======================================================
        Burton's mouthbreeder  =======================================================
          Princess of Burundi  =======================================================
                         Fugu  =======================================================
           Southern platyfish  =======================================================
                 Atlantic cod  =======================================================
                       Medaka  =======================================================
                    Zebrafish  =======================================================
     Mexican tetra (cavefish)  =======================================================
       Yellowbelly pufferfish  =======================================================
                X. tropicalis  =======================================================
                  Rock pigeon  =======================================================
       White-throated sparrow  =======================================================
                       Parrot  =======================================================
               Painted turtle  =======================================================
                     Platypus  =======================================================
                       Lizard  =======================================================
                  Zebra finch  =======================================================
          Medium ground finch  =======================================================
          Collared flycatcher  =======================================================
     Chinese softshell turtle  =======================================================
                 Saker falcon  =======================================================
                 Mallard duck  =======================================================
                   Budgerigar  =======================================================
                       Turkey  =======================================================
                      Chicken  =======================================================
           Tibetan ground jay  =======================================================
           American alligator  =======================================================
             Peregrine falcon  =======================================================
               Golden hamster  =======================================================
           Chinese tree shrew  =======================================================

Alignment block 10 of 1053 in window, 87259664 - 87259686, 23 bps 
B D                     Human  ----------atttggcttaaa-atag-ataatgt-
B D                     Chimp  ----------atttggcttaaa-atgg-ataatgt-
B D                   Gorilla  ----------atttggcttaaa-atgg-ataatgt-
B D                 Orangutan  ----------atttggcttaaa-atgg-ataatgt-
B D                    Gibbon  ----------atttggcttaaa-atgg-ataatgt-
B D                    Rhesus  ----------atttggcttaaa-atgt-ataatct-
B D       Crab-eating macaque  ----------atttggcttaaa-atgt-ataatct-
B D                    Baboon  ----------atttggcttaaa-atgt-ataatct-
B D              Green monkey  ----------atttggcttaaa-acgt-ataatct-
B D                  Marmoset  ----------attttgcttaaa-atgt-atgatgt-
B D           Squirrel monkey  ----------attttgcttaaa-gtgt-ataatgt-
B D                  Bushbaby  ----------caccggccaaag-atgc-acaatgt-
B D                  Squirrel  ----------cttttgtttaca-atgt-acattgt-
       Lesser Egyptian jerboa  ----------ctttagcttaaa-a-gg-gcagggt-
                 Prairie vole  ----------cttagaattaaa-atga-acac--t-
B D           Chinese hamster  ----------cttaggatgcaa-atga-gcac--t-
B D                     Mouse  ----------ttttggatgaaa-gtga-acgctat-
B D                       Rat  ----------tttaggagtaaa-ggca-atgctat-
B D            Naked mole-rat  ----------ctttggcttaaa-atat-aaa-tct-
B D                Guinea pig  ----------ctttggtttaca-atat-gcaccct-
                   Chinchilla  ----------ctttggcttaaa-atat-ac--tct-
             Brush-tailed rat  ----------c--tggcttaaa-atat-acagtcc-
B D                    Rabbit  ----------ctttggcttaca-atgt-accacgt-
B D                      Pika  ----------ctctggcttaaa-atacaaccgtgt-
B D                       Pig  ----------c--tagcttata-atgt-acagtgt-
B D                    Alpaca  ----------ctttggcttaaa-atgt-acaatgt-
               Bactrian camel  ----------ctttggcttaaa-atgt-acaatgt-
B D                   Dolphin  ----------ctctggcttaaa-aagt-acaacgt-
                 Killer whale  ----------ctctggcttaaa-aagt-acaacgt-
             Tibetan antelope  ----------ttttggcttaaa-atgt-acaatat-
B D                       Cow  ----------ctttggcttaaa-atgt-acaatgt-
B D                     Sheep  ----------ttttggcttaaa-atgt-acaatat-
                Domestic goat  ----------ttttggcttaaa-atgt-acaatat-
B D                     Horse  ----------ctttggcttaaa-acgt-acactgt-
B D          White rhinoceros  ----------ctttggcgtaaa-atgt-accatgt-
B D                       Cat  ----------ctttggcttaaaaatat-acagttt-
B D                       Dog  ----------ctttggcttaaaaatgt-accgttt-
B D                   Ferret   ----------ctttggttgaaacatgc-acagttt-
B D                     Panda  ----------ctttggcttaaaaatgt-acagctt-
               Pacific walrus  ----------ctttggtttaaaaatgt-acagttt-
                 Weddell seal  ----------ctttggtttaaaaatgt-acagttt-
             Black flying-fox  ----------ctttgtgttaaa-atgt-acaatgt-
B D                   Megabat  ----------ctttgtgttaaa-atgt-acaatgt-
                Big brown bat  ----------cttttgcttaaa-atgt-acaatgt-
         David's myotis (bat)  ----------cttttgcttaaa-atat-acaatgt-
B D                  Microbat  ----------ctcttgcttaaa-atat-acaatgt-
B D                  Hedgehog  --------------------aa-atgt-atagtct-
B D                     Shrew  ----------cattagcttaaa-atgt-atcaagt-
              Star-nosed mole  ----------ctttggcttaaa-atgt-a-caatc-
B D                  Elephant  ----------ctttggcttaac-atac-ataatgt-
          Cape elephant shrew  ----------------cccaaa-atgt-ata--gt-
B D                   Manatee  ----------ctttggtttacc-atgc-ataatgt-
             Cape golden mole  ----------ctt--tggcata-atgc-aaaatgt-
B D                    Tenrec  ----------ctttgtgttaaa-atgt-ataatgt-
                     Aardvark  ----------ctttggcttaaa-atgc-ataatat-
B D                 Armadillo  ----------cattcgcttcaa-atgt-atattgt-
B D                   Opossum  ----------ctttagcctaac-atgt-atg-catc
B D           Tasmanian devil  ----------cttttgcctaaa-atgt-at--cat-
B D                   Wallaby  ----------cttttaattaaa-atgt-at--cat-
  D              Saker falcon  ----------atccaactccaa-atat-atgcagt-
  D          Peregrine falcon  ----------atccaactccaa-atat-atgcagt-
  D           Green seaturtle  ----------ttttaacaatca-acta-atgcag--
B D                Coelacanth  aaaagattttttttcaactaag-atta-ccattca-
B D              Nile tilapia  ====================================
                 Zebra mbuna  ====================================
B D                 Tetraodon  ====================================
B D               Stickleback  ====================================
                 Spotted gar  ====================================
         Pundamilia nyererei  ====================================
       Burton's mouthbreeder  ====================================
         Princess of Burundi  ====================================
B D                      Fugu  ====================================
          Southern platyfish  ====================================
B D              Atlantic cod  ====================================
B D                    Medaka  ====================================
B D                 Zebrafish  ====================================
    Mexican tetra (cavefish)  ====================================
      Yellowbelly pufferfish  ====================================
B D             X. tropicalis  ====================================
  D               Rock pigeon  ====================================
  D    White-throated sparrow  ====================================
  D                    Parrot  ====================================
  D            Painted turtle  ====================================
B D                  Platypus  ====================================
B D                    Lizard  ====================================
B D               Zebra finch  ====================================
B D       Medium ground finch  ====================================
  D       Collared flycatcher  ====================================
  D  Chinese softshell turtle  ====================================
  D              Mallard duck  ====================================
B D                Budgerigar  ====================================
B D                    Turkey  ====================================
B D                   Chicken  ====================================
          Tibetan ground jay  ====================================
B D        American alligator  ====================================
              Golden hamster  ====================================
          Chinese tree shrew  ====================================

Alignment block 11 of 1053 in window, 87259687 - 87259700, 14 bps 
B D                     Human  ggcttctgaga----ata
B D                     Chimp  ggcttctgaga----ata
B D                   Gorilla  ggcttctgaga----ata
B D                 Orangutan  ggcttctgaga----ata
B D                    Gibbon  ggcttcagggg----ata
B D                    Rhesus  ggtttctgaga----ata
B D       Crab-eating macaque  ggcttctgaga----ata
B D                    Baboon  ggcttctgaga----ata
B D              Green monkey  ggcttctgaga----ata
B D                  Marmoset  agcttctgaga----ata
B D           Squirrel monkey  agcttccgaga----ata
B D                  Bushbaby  ggcttctgaga----ata
B D                  Squirrel  agcttctgaga----ata
       Lesser Egyptian jerboa  gacttctgaga----aaa
                 Prairie vole  gaattctaaga----aca
B D           Chinese hamster  gaattctaaga----aca
B D                     Mouse  gaattctggga----aca
B D                       Rat  gaattctgaga----aca
B D            Naked mole-rat  ggcttctgaga----ata
B D                Guinea pig  ggcttttcgga----ata
                   Chinchilla  ggcttctgaga----ata
             Brush-tailed rat  agcctctaaga----aca
B D                    Rabbit  gacttctgaga----ata
B D                      Pika  ggcttctgagaacccaca
B D                       Pig  ggcttatgaga----ata
B D                    Alpaca  ggcttcagaga----gta
               Bactrian camel  ggcttcagaga----ata
B D                   Dolphin  ggcttctgaga----ata
                 Killer whale  ggcttctgaga----ata
             Tibetan antelope  gccttctgaga----ata
B D                       Cow  gccttctgaga----ata
B D                     Sheep  gccttctgaga----ata
                Domestic goat  gccttctgaga----ata
B D                     Horse  ggcttctgaga----ata
B D          White rhinoceros  ggcttctgaga----ata
B D                       Cat  ggcttctgaga----a--
B D                       Dog  ggcttctgaaa----aga
B D                   Ferret   ggcttcagaga----ata
B D                     Panda  ggcttctgaga----ata
               Pacific walrus  ggcttctgaga----ata
                 Weddell seal  ggcttctgaga----ata
             Black flying-fox  ggcttctgaga----ata
B D                   Megabat  ggcttctgaga----ata
                Big brown bat  ggcctctgaga----ata
         David's myotis (bat)  ggcctctgaga----ata
B D                  Microbat  ggcctctgaga----ata
B D                  Hedgehog  gaattcggac--------
B D                     Shrew  ggcttctgag--------
              Star-nosed mole  gacttctgaga----ata
B D                  Elephant  ggcttcttaga----a--
          Cape elephant shrew  gacttctgaag----a--
B D                   Manatee  ggcttccgagc----a--
             Cape golden mole  gacttctgagc----ata
B D                    Tenrec  gggttcggagt----ata
                     Aardvark  ggcttctgagc----aga
B D                 Armadillo  agcttctggac----aaa
B D                   Opossum  gtcttttgaac----aaa
B D           Tasmanian devil  gccttatgaac----aaa
B D                   Wallaby  gtcttgtgaaa----ata
  D              Saker falcon  agcatttaa------ttt
  D          Peregrine falcon  agcatttaa------ttt
  D           Green seaturtle  ----attga------ata
B D                Coelacanth  agtttcattga----gtt
B D                    Medaka  ggttccttggt----gcc
B D              Nile tilapia  ==================
                 Zebra mbuna  ==================
B D                 Tetraodon  ==================
B D               Stickleback  ==================
                 Spotted gar  ==================
         Pundamilia nyererei  ==================
       Burton's mouthbreeder  ==================
         Princess of Burundi  ==================
B D                      Fugu  ==================
          Southern platyfish  ==================
B D              Atlantic cod  ==================
B D                 Zebrafish  ==================
    Mexican tetra (cavefish)  ==================
      Yellowbelly pufferfish  ==================
B D             X. tropicalis  ==================
  D               Rock pigeon  ==================
  D    White-throated sparrow  ==================
  D                    Parrot  ==================
  D            Painted turtle  ==================
B D                  Platypus  ==================
B D                    Lizard  ==================
B D               Zebra finch  ==================
B D       Medium ground finch  ==================
  D       Collared flycatcher  ==================
  D  Chinese softshell turtle  ==================
  D              Mallard duck  ==================
B D                Budgerigar  ==================
B D                    Turkey  ==================
B D                   Chicken  ==================
          Tibetan ground jay  ==================
B D        American alligator  ==================
              Golden hamster  ==================
          Chinese tree shrew  ==================

Alignment block 12 of 1053 in window, 87259701 - 87259706, 6 bps 
B D                     Human  atta--tt
B D                     Chimp  atta--tt
B D                   Gorilla  atta--tt
B D                 Orangutan  atta--tt
B D                    Gibbon  atta--tt
B D                    Rhesus  atta--tt
B D       Crab-eating macaque  atta--tt
B D                    Baboon  atta--tt
B D              Green monkey  atta--tt
B D                  Marmoset  atta--tt
B D           Squirrel monkey  atta--tt
B D                  Bushbaby  atta--tt
B D                  Squirrel  atta--tt
       Lesser Egyptian jerboa  atta--aa
                 Prairie vole  atta--a-
B D           Chinese hamster  atta--a-
B D                     Mouse  acta--ga
B D                       Rat  acta--aa
B D            Naked mole-rat  atta--tt
B D                Guinea pig  atta--ct
                   Chinchilla  atta--ct
             Brush-tailed rat  atta--ct
B D                    Rabbit  atta--tt
B D                      Pika  aacc--tt
B D                       Pig  attc----
B D                    Alpaca  attc----
               Bactrian camel  attc----
B D                   Dolphin  attc----
                 Killer whale  attc----
             Tibetan antelope  attc----
B D                       Cow  attc----
B D                     Sheep  attc----
                Domestic goat  attc----
B D                     Horse  atta--tt
B D          White rhinoceros  atta--tt
B D                       Cat  --ta--tt
B D                       Dog  atta--ct
B D                   Ferret   attc--ct
B D                     Panda  atta--tt
               Pacific walrus  atta--tt
                 Weddell seal  atta--tt
             Black flying-fox  atta--tt
B D                   Megabat  atta--tt
                Big brown bat  attttatt
         David's myotis (bat)  attc--tt
B D                  Microbat  attc--tt
B D                  Hedgehog  atta--aa
B D                     Shrew  atta--tt
              Star-nosed mole  agta--tt
B D                  Elephant  --ta--tt
          Cape elephant shrew  --aa--tt
B D                   Manatee  atta--tt
             Cape golden mole  atta--tt
B D                    Tenrec  gctg--tt
                     Aardvark  atta--tt
B D                 Armadillo  atta--tt
B D                   Opossum  aata--tt
B D           Tasmanian devil  aata--tt
B D                   Wallaby  aata--tt
  D              Saker falcon  gtt-----
  D          Peregrine falcon  gtt-----
  D           Green seaturtle  gtt-----
B D                Coelacanth  ctta--tg
B D                    Medaka  gtta--tt
     Mexican tetra (cavefish)  attt--tt
B D              Nile tilapia  ========
                 Zebra mbuna  ========
B D                 Tetraodon  ========
B D               Stickleback  ========
                 Spotted gar  ========
         Pundamilia nyererei  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D                      Fugu  ========
          Southern platyfish  ========
B D              Atlantic cod  ========
B D                 Zebrafish  ========
      Yellowbelly pufferfish  ========
B D             X. tropicalis  ========
  D               Rock pigeon  ========
  D    White-throated sparrow  ========
  D                    Parrot  ========
  D            Painted turtle  ========
B D                  Platypus  ========
B D                    Lizard  ========
B D               Zebra finch  ========
B D       Medium ground finch  ========
  D       Collared flycatcher  ========
  D  Chinese softshell turtle  ========
  D              Mallard duck  ========
B D                Budgerigar  ========
B D                    Turkey  ========
B D                   Chicken  ========
          Tibetan ground jay  ========
B D        American alligator  ========
              Golden hamster  ========
          Chinese tree shrew  ========

Inserts between block 12 and 13 in window
  D             Saker falcon 9bp
  D         Peregrine falcon 9bp
  D          Green seaturtle 26bp
B D               Coelacanth 6bp

Alignment block 13 of 1053 in window, 87259707 - 87259717, 11 bps 
B D                     Human  tt--------------------aagt--------aaata
B D                     Chimp  tt--------------------aagt--------aaata
B D                   Gorilla  tt--------------------aagt--------aaata
B D                 Orangutan  tt--------------------aagt--------aaata
B D                    Gibbon  tt--------------------aagt--------aaata
B D                    Rhesus  tc--------------------aagt--------aaata
B D       Crab-eating macaque  tc--------------------aagt--------aaata
B D                    Baboon  tc--------------------aagt--------aaata
B D              Green monkey  tc--------------------aagt--------aaata
B D                  Marmoset  t---------------------aagt--------aaata
B D           Squirrel monkey  t---------------------aagt--------aaata
B D                  Bushbaby  tt--------------------aagtg-------aaaca
B D                  Squirrel  ttaaa------gaa----aa-------------------
       Lesser Egyptian jerboa  ta-------------------------------------
B D                     Mouse  ta-------------------------------------
B D                       Rat  ta-------------------------------------
B D            Naked mole-rat  tt------------------ta-----------------
B D                Guinea pig  ta------------------ta-----------------
                   Chinchilla  tt------------------ta-----------------
             Brush-tailed rat  tt------------------ta-----------------
B D                    Rabbit  ttaaa------gaa----gata-----------------
B D                      Pika  ttaaa------gaa----ggta-----------------
B D                     Horse  ttaaa------gaa----aat------------------
B D          White rhinoceros  ttaaa------gaa----aat------------------
B D                       Cat  ttaaa------gaa----aat------------------
B D                       Dog  ttaat------gaa----aat------------------
B D                   Ferret   ttaaa------gaa----aat------------------
B D                     Panda  ttaaa------gaa----aat------------------
               Pacific walrus  ttaaa------gaa----aat------------------
                 Weddell seal  ttaaa------gaa----aat------------------
             Black flying-fox  ttaaa------gag----aat------------------
B D                   Megabat  ttaaa------gag----aat------------------
                Big brown bat  ttaaa------gaa----aat------------------
         David's myotis (bat)  ttaaa------taa----aac------------------
B D                  Microbat  ttaaa------taa----aac------------------
B D                  Hedgehog  agaca------gtg----att------------------
B D                     Shrew  tgaaa------ata----att------------------
              Star-nosed mole  tcaag------gga----aat------------------
B D                  Elephant  ttcaa------gac--tcatt------------------
B D                   Manatee  ttcaa------gac--taatt------------------
             Cape golden mole  ttcaa------gac--taatt------------------
B D                    Tenrec  ttcca------gg-------t------------------
                     Aardvark  ttcaa------ggc--taatt------------------
B D                 Armadillo  ttaaa------gaaagtaatc------------------
B D                   Opossum  ttaagt-----gaa-------------------------
B D           Tasmanian devil  ttaagt-----gaa-------------------------
B D                   Wallaby  ttaagt-----gaa-------------------------
  D              Saker falcon  --------------------------ttacattaaaata
  D          Peregrine falcon  --------------------------ttacattaaaata
  D                    Parrot  --------------------------ttaaatatataca
  D           Green seaturtle  --------------------------acaaatacatata
B D                Coelacanth  ttata----------------------------------
B D                    Medaka  -----taaaaagaa-------------------------
     Mexican tetra (cavefish)  -----taaaggaaa-------------------------
B D              Nile tilapia  =======================================
                 Zebra mbuna  =======================================
B D                 Tetraodon  =======================================
B D               Stickleback  =======================================
                 Spotted gar  =======================================
         Pundamilia nyererei  =======================================
       Burton's mouthbreeder  =======================================
         Princess of Burundi  =======================================
B D                      Fugu  =======================================
          Southern platyfish  =======================================
B D              Atlantic cod  =======================================
B D                 Zebrafish  =======================================
      Yellowbelly pufferfish  =======================================
B D             X. tropicalis  =======================================
  D               Rock pigeon  =======================================
  D    White-throated sparrow  =======================================
  D            Painted turtle  =======================================
B D                  Platypus  =======================================
B D                    Lizard  =======================================
B D               Zebra finch  =======================================
B D       Medium ground finch  =======================================
  D       Collared flycatcher  =======================================
  D  Chinese softshell turtle  =======================================
  D              Mallard duck  =======================================
B D                Budgerigar  =======================================
B D                    Turkey  =======================================
B D                   Chicken  =======================================
          Tibetan ground jay  =======================================
B D        American alligator  =======================================
                Prairie vole  ---------------------------------------
               Domestic goat  ---------------------------------------
         Cape elephant shrew  ---------------------------------------
              Golden hamster  =======================================
B D           Chinese hamster  ---------------------------------------
              Bactrian camel  ---------------------------------------
B D                     Sheep  ---------------------------------------
            Tibetan antelope  ---------------------------------------
          Chinese tree shrew  =======================================
B D                    Alpaca  ---------------------------------------
B D                       Cow  ---------------------------------------
                Killer whale  ---------------------------------------
B D                   Dolphin  ---------------------------------------
B D                       Pig  ---------------------------------------

Inserts between block 13 and 14 in window
      Lesser Egyptian jerboa 4bp
B D                    Mouse 596bp
B D                      Rat 2bp
  D             Saker falcon 6bp
  D         Peregrine falcon 6bp
  D                   Parrot 10bp
  D          Green seaturtle 9bp

Alignment block 14 of 1053 in window, 87259718 - 87259754, 37 bps 
B D                     Human  ac-------------atc-----------------------aatata----attt-----------a---
B D                     Chimp  ac-------------atc-----------------------aatata----attt-----------a---
B D                   Gorilla  ac-------------atc-----------------------aatata----attt-----------a---
B D                 Orangutan  ac-------------atc-----------------------aatata----attt-----------a---
B D                    Gibbon  ac-------------atc-----------------------aatata----attt-----------a---
B D                    Rhesus  ac-------------atc-----------------------actata----attt-----------a---
B D       Crab-eating macaque  ac-------------atc-----------------------actata----attt-----------a---
B D                    Baboon  ac-------------atc-----------------------actata----attt-----------a---
B D              Green monkey  ac-------------atc-----------------------actata----attt-----------a---
B D                  Marmoset  cc-------------atc-----------------------aaatta----attt-----------a---
B D           Squirrel monkey  cc-------------atc-----------------------aaaata----attt-----------a---
B D                  Bushbaby  act----t-------acc-----------------------aatata----attt-----------a---
B D                  Squirrel  -----------------t-----------------------aatata----attt-----------a---
       Lesser Egyptian jerboa  ------------------------------------------actca----attt-----------a---
                 Prairie vole  ----------------at-----------------------atctca----gttt-----------a---
B D           Chinese hamster  ----------------at-----------------------atctca----gcat-----------a---
B D                       Rat  ----------------ac-----------------------gtcttg----tttt-----------a---
B D            Naked mole-rat  -------a-------aat-----------------------aatata----attt-----------a---
B D                Guinea pig  -------a-------aat-----------------------aatata----attt-----------g---
                   Chinchilla  -------a-------aat-----------------------aatata----attt-----------a---
             Brush-tailed rat  -------a-------aat-----------------------gatata----attt-----------a---
B D                    Rabbit  --------------------------------------------aca----atac-----------a---
B D                      Pika  --------------------------------------------aga-------------------g---
B D                       Pig  ---------------atc-----------------------aatata----attt-----------a---
B D                    Alpaca  ---------------atc-----------------------aatata----attt-----------a---
               Bactrian camel  ---------------atc-----------------------aatata----attt-----------a---
B D                   Dolphin  ---------------atc-----------------------aatata----attt-----------a---
                 Killer whale  ---------------atc-----------------------aatata----attt-----------a---
             Tibetan antelope  ---------------atc-----------------------aacata----attt-----------a---
B D                       Cow  ---------------atc-----------------------aacata----attt-----------a---
B D                     Sheep  ---------------atc-----------------------aacata----attt-----------a---
                Domestic goat  ---------------acc-----------------------aacata----attt-----------a---
B D                     Horse  -------aa---ttcatc-----------------------aacata----attt-----------a---
B D          White rhinoceros  -------aa---ttcatc-----------------------aatata----attt-----------a---
B D                       Cat  -------aa---gtcacc-----------------------aat-------attt-----------a---
B D                       Dog  -------ag---tttgtc-----------------------aat-------attt-----------a---
B D                   Ferret   -------aa---ttcatc-----------------------aat-------attt-----------a---
B D                     Panda  -------aa---t--gtc-----------------------aac-------attc-----------a---
               Pacific walrus  -------aa---ttcatc-----------------------aat-------attt-----------aaat
                 Weddell seal  -------aa---ttcatc-----------------------aat-------attt-----------a---
             Black flying-fox  -------aa---tttatc-----------------------aatata----actt-----------a---
B D                   Megabat  -------aa---tttatc-----------------------aatata----actt-----------a---
                Big brown bat  -------aa---ttcatc-----------------------aaaata----attt-----------a---
         David's myotis (bat)  -------aa---tttacc-----------------------aaaata----attt-----------a---
B D                  Microbat  -------aa---ttcatc-----------------------aaaata----attt-----------a---
B D                  Hedgehog  ---------------ctta----------------------aataga----gttt-----------a---
B D                     Shrew  ---------------acc-----------------------aataca----attt-----------a---
              Star-nosed mole  ---------------gtc-----------------------aata--------tt-----------a---
B D                  Elephant  --------------catc-----------------------aatata----attt---------------
          Cape elephant shrew  -------------------------------------------tatt----attt---------------
B D                   Manatee  --------------catc-----------------------aagata----actt---------------
             Cape golden mole  --------------catc-----------------------aatgta----attt---------------
B D                    Tenrec  --------------tgtc-----------------------a---ta----attt---------------
                     Aardvark  --------------catc-----------------------aatata----attt---------------
B D                 Armadillo  --------------catc-----------------------cagaca----acttacttctttttc----
B D                   Opossum  --aaacaat---tttaat-----------------------aatcag----tttt-----------c---
B D           Tasmanian devil  --aatatag---ttttat-----------------------aataag----tatt-----------g---
B D                   Wallaby  --aatataa---ttttaa-----------------------aataag----tttt-----------g---
  D              Saker falcon  -------------tccac-----------------------aacatactacatcc-----------a---
  D          Peregrine falcon  -------------tccac-----------------------aacatactacatcc-----------a---
  D                    Parrot  -------------tttcc-----------------------aaccttttacatta-----------a---
  D           Green seaturtle  -------------tttcc-----------------------aatcttttacatta-----------a---
B D                Coelacanth  ------------------acatagttgtcagaaattgctgaaatctc----atct-----------a---
B D                    Medaka  ----agaaa---attttt-----------------------cttgtt----ctct-----------g---
     Mexican tetra (cavefish)  ----attaaacgattttt-----------------------actgca----cctt-----------g---
B D              Nile tilapia  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
                 Spotted gar  ======================================================================
         Pundamilia nyererei  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                      Fugu  ======================================================================
          Southern platyfish  ======================================================================
B D              Atlantic cod  ======================================================================
B D                 Zebrafish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D             X. tropicalis  ======================================================================
  D               Rock pigeon  ======================================================================
  D    White-throated sparrow  ======================================================================
  D            Painted turtle  ======================================================================
B D                  Platypus  ======================================================================
B D                    Lizard  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D        American alligator  ======================================================================
              Golden hamster  ======================================================================
B D                     Mouse  ======================================================================
          Chinese tree shrew  ======================================================================

                        Human  aa----------ttgttgg-----t-ttctt-tttttt
                        Chimp  aa----------ttgttgg-----t-ttctt-tttttt
                      Gorilla  aa----------ttgttgg-----t-ttctt-tttttt
                    Orangutan  aa----------ttgttgg-----t-ttctt-ttttta
                       Gibbon  aa----------ttgttgg-----t-ttctt-ttttta
                       Rhesus  aa----------ttgttgg-----t-ttctt-ttttt-
          Crab-eating macaque  aa----------ttgttgg-----t-ttctt-ttttt-
                       Baboon  aa----------ttgttgg-----t-ttc-t-ttttt-
                 Green monkey  aa----------ttgttgg-----t-ttctt-ttttta
                     Marmoset  aa----------tagctga-----t-ttctt-ttttta
              Squirrel monkey  aa----------tagctga-----t-ttctt-tttt--
                     Bushbaby  aa----------ttgttgg-----a-ttctt-tttaa-
                     Squirrel  aa----------ttgttga-----a-ttcat-------
       Lesser Egyptian jerboa  ac----------tgttta--------------------
                 Prairie vole  ca----------tcactgg-----g-tcctt-------
              Chinese hamster  ag----------tcattga-----g-tcttt-------
                          Rat  aa----------tcattgg-----a-tctaa-------
               Naked mole-rat  aa----------c--ttgg-----a-ttttc-------
                   Guinea pig  aa----------c--ttgga----a-ttttt-------
                   Chinchilla  aa----------c--ttgg-----a-ttttt-------
             Brush-tailed rat  aa----------c--ttgg-----a-ttttt-------
                       Rabbit  aa----------ttgttggatgatg-ttttta------
                         Pika  ag----------ctgctggctgcta-tgctta------
                          Pig  aa----------ttgtat-----------tt-------
                       Alpaca  aa----------ctgtat--------ttttt-------
               Bactrian camel  aa----------ctgtat--------ttttg-------
                      Dolphin  aa----------ttgtatt-----tattttt-------
                 Killer whale  aa----------ttgtatt-----tattttt-------
             Tibetan antelope  aa----------ttgtatt-----tgttttt-------
                          Cow  aa----------ttgtatt-----tattttt-------
                        Sheep  aa----------ttgtatt-----tgttttt-------
                Domestic goat  aa----------ttgtatt-----tgttttt-------
                        Horse  aa----------ttgtatt-------------------
             White rhinoceros  ag----------ttgtatt-------------------
                          Cat  aa----------gtgtatt-----a-atttt-------
                          Dog  aa----------ttgtatt-----c---ttt-------
                      Ferret   ag----------ttgtatt-----c--tctt-------
                        Panda  aa----------ttgtatt-----c-ttttt-------
               Pacific walrus  aa----------ttgtctt-----c---ttt-------
                 Weddell seal  aa----------ttgtctt-----c---ttt-------
             Black flying-fox  aat---------tttatat-----c-------------
                      Megabat  aat---------tttattt-----c-------------
                Big brown bat  aa----------ttgaagt-----t-------------
         David's myotis (bat)  aa----------ttgaagt-----t-------------
                     Microbat  aa----------ttgaagt-----t-------------
                     Hedgehog  aa----------tggtgtg-----c-cttaa-------
                        Shrew  aa----------gcgtggg-----t-tttta-------
              Star-nosed mole  ag----------ttgtgtact---t-tttta-------
                     Elephant  --------------------------------------
          Cape elephant shrew  --------------------------------------
                      Manatee  --------------------------------------
             Cape golden mole  --------------------------------------
                       Tenrec  --------------------------------------
                     Aardvark  --------------------------------------
                    Armadillo  --------------------------------------
                      Opossum  aa----------ttattt--------------------
              Tasmanian devil  aa----------tgattt--------------------
                      Wallaby  aa----------tgcttt--------------------
                 Saker falcon  aagctggctaacttgtaag-------------------
             Peregrine falcon  aagctggctaacttgtaag-------------------
                       Parrot  aatagggc---ctttcaca-------------------
              Green seaturtle  aat-----------------------------------
                   Coelacanth  a-------------------------------------
                       Medaka  ------------ttgatt--------------------
     Mexican tetra (cavefish)  ta----------ttgcga--------------------
                 Nile tilapia  ======================================
                  Zebra mbuna  ======================================
                    Tetraodon  ======================================
                  Stickleback  ======================================
                  Spotted gar  ======================================
          Pundamilia nyererei  ======================================
        Burton's mouthbreeder  ======================================
          Princess of Burundi  ======================================
                         Fugu  ======================================
           Southern platyfish  ======================================
                 Atlantic cod  ======================================
                    Zebrafish  ======================================
       Yellowbelly pufferfish  ======================================
                X. tropicalis  ======================================
                  Rock pigeon  ======================================
       White-throated sparrow  ======================================
               Painted turtle  ======================================
                     Platypus  ======================================
                       Lizard  ======================================
                  Zebra finch  ======================================
          Medium ground finch  ======================================
          Collared flycatcher  ======================================
     Chinese softshell turtle  ======================================
                 Mallard duck  ======================================
                   Budgerigar  ======================================
                       Turkey  ======================================
                      Chicken  ======================================
           Tibetan ground jay  ======================================
           American alligator  ======================================
               Golden hamster  ======================================
                        Mouse  ======================================
           Chinese tree shrew  ======================================

Inserts between block 14 and 15 in window
B D                Orangutan 2bp
B D             Green monkey 1bp
B D                 Squirrel 5bp
      Lesser Egyptian jerboa 8bp
                Prairie vole 3bp
B D                      Rat 20bp
B D               Guinea pig 2bp
                  Chinchilla 2bp
            Brush-tailed rat 2bp
B D                   Rabbit 9bp
B D                     Pika 5bp
B D                      Dog 4bp

Alignment block 15 of 1053 in window, 87259755 - 87259767, 13 bps 
B D                     Human  aaaaaa-----------aagtg----ga------
B D                     Chimp  aaaaaa-----------aagtg----ga------
B D                   Gorilla  -taaaa-----------aagtg----ga------
B D                 Orangutan  aaaaaa-----------aagtg----ga------
B D                    Gibbon  ----aa-----------aaatg----ga------
B D                    Rhesus  -aaaaa-----------aagtg----ga------
B D       Crab-eating macaque  -aaaaa-----------aagtg----ga------
B D                    Baboon  -aaaag-----------aagtg----ga------
B D              Green monkey  aaaaaa-----------aagtg----ga------
B D                  Marmoset  -aaaaa-----------aagtg----aa------
B D           Squirrel monkey  --aaaa-----------aagtg----ga------
B D                  Bushbaby  -aacaa-----------tagta----gt------
           Chinese tree shrew  agaaaa-----------gaacg----aa------
B D                  Squirrel  ----aa-----------aaaac----ac------
       Lesser Egyptian jerboa  -gaagg-----------aaact----gc------
                 Prairie vole  -aaaaa-----------aaact----gc------
B D           Chinese hamster  ---aaa-----------aaact----gc------
B D                     Mouse  -gacaa-----------aaact----gc------
B D                       Rat  -aacaa-----------aaact----gc------
B D            Naked mole-rat  -aataa-----------aaata----gt------
B D                Guinea pig  -aataa-----------aaata----gt------
                   Chinchilla  -aataa-----------aaaca------------
             Brush-tailed rat  -tataa-----------aaata----gt------
B D                    Rabbit  -aagaa-----------aatct----gc------
B D                      Pika  -aaaac-----------atttt----ct------
B D                       Pig  -----t-----------aagta----ga------
B D                    Alpaca  -----a-----------aacta----ga------
               Bactrian camel  -----a-----------aaata----ga------
B D                   Dolphin  -----a-----------aagta----ga------
                 Killer whale  -----a-----------aagta----ga------
             Tibetan antelope  -----a-----------aagta----ga------
B D                       Cow  -----a-----------aagta----ga------
B D                     Sheep  -----a-----------aagta----ga------
                Domestic goat  -----a-----------aagta----ga------
B D                     Horse  -----a-----------aagta----ga------
B D          White rhinoceros  -----a-----------aagta----ga------
B D                       Cat  -----t-----------taa-------a------
B D                       Dog  -----a-----------aaaaa----aa------
B D                   Ferret   -----t-----------taaaa----aa------
B D                     Panda  -----t-----------taaaa----aa------
               Pacific walrus  -----t-----------taaaa----aa------
                 Weddell seal  -----t-----------taaaa----ga------
             Black flying-fox  -----t-----------tagaacatcaa------
B D                   Megabat  -----t-----------tagaacatcaa------
                Big brown bat  -----t-----------tagaatgtaga------
         David's myotis (bat)  -----t-----------aagaatgtaga------
B D                  Microbat  -----t-----------aagaatgtaga------
B D                  Hedgehog  -----a-----------aaaaa----aa------
B D                     Shrew  -----a----------------------------
              Star-nosed mole  -----a-----------aagca----ca------
B D                  Elephant  -----a-----------aagca-----c------
          Cape elephant shrew  -----a-----------aggca-----a------
B D                   Manatee  -----a-----------aagca-----a------
             Cape golden mole  -----a-----------aagca-----a------
B D                    Tenrec  -----a-----------aagca-----a------
                     Aardvark  -----a-----------aagca-----g------
B D                 Armadillo  ----aa-----------aagta----ga------
B D                   Opossum  --------------------ta----ga------
B D           Tasmanian devil  --------------------ta----aa------
B D                   Wallaby  --------------------ta----aa------
  D              Saker falcon  agaaac-----------aagtg----gg------
  D          Peregrine falcon  agaaac-----------aagtg----gg------
  D                    Parrot  acacactgca---tctgaagct----cg------
B D                Coelacanth  aggaaa-----------atatg----ga------
B D                    Medaka  -------aaagtctttcaagtg----aaattaaa
     Mexican tetra (cavefish)  -------aaa-------agacg----gaattgaa
B D              Nile tilapia  ==================================
                 Zebra mbuna  ==================================
B D                 Tetraodon  ==================================
B D               Stickleback  ==================================
                 Spotted gar  ==================================
         Pundamilia nyererei  ==================================
       Burton's mouthbreeder  ==================================
         Princess of Burundi  ==================================
B D                      Fugu  ==================================
          Southern platyfish  ==================================
B D              Atlantic cod  ==================================
B D                 Zebrafish  ==================================
      Yellowbelly pufferfish  ==================================
B D             X. tropicalis  ==================================
  D               Rock pigeon  ==================================
  D    White-throated sparrow  ==================================
  D            Painted turtle  ==================================
B D                  Platypus  ==================================
B D                    Lizard  ==================================
B D               Zebra finch  ==================================
B D       Medium ground finch  ==================================
  D       Collared flycatcher  ==================================
  D  Chinese softshell turtle  ==================================
  D           Green seaturtle  ----------------------------------
  D              Mallard duck  ==================================
B D                Budgerigar  ==================================
B D                    Turkey  ==================================
B D                   Chicken  ==================================
          Tibetan ground jay  ==================================
B D        American alligator  ==================================
              Golden hamster  ==================================

Inserts between block 15 and 16 in window
          Chinese tree shrew 1bp

Alignment block 16 of 1053 in window, 87259768 - 87259780, 13 bps 
B D                     Human  aa-------agtaaagcttc-----
B D                     Chimp  aa-------agtaaagcttc-----
B D                   Gorilla  aa-------agtaaag---c-----
B D                 Orangutan  aa-------agtaaagcttc-----
B D                    Gibbon  aa-------agt-aagcttc-----
B D                    Rhesus  aa-------agcaatgcttc-----
B D       Crab-eating macaque  aa-------agcaatgcttc-----
B D                    Baboon  ac-------agcaaagcttc-----
B D              Green monkey  aa-------agcaaagcttc-----
B D                  Marmoset  aa-------agtaaagcttc-----
B D           Squirrel monkey  aa-------agtaaagcttc-----
B D                  Bushbaby  aa-------agaaaaatttc-----
           Chinese tree shrew  ga-------accaaagtatc-----
B D            Naked mole-rat  gt-------tatac-----------
B D                Guinea pig  gt-------tatac-----------
                   Chinchilla  gt-------tatac-----------
             Brush-tailed rat  gt-------tatac-----------
B D                    Rabbit  a------------------------
B D                      Pika  g------------------------
B D                       Pig  aa-------cgaaaaggctc-----
B D                    Alpaca  aa-------agaataggttc-----
               Bactrian camel  aa-------aggatagattc-----
B D                   Dolphin  aa-------agaaaagcttc-----
                 Killer whale  aa-------agaaaagcttc-----
             Tibetan antelope  ag-------agaaacacttt-----
B D                       Cow  aa-------agaaacacttc-----
B D                     Sheep  ag-------agaaacacttc-----
                Domestic goat  ag-------agaaacacttc-----
B D                     Horse  aa-------agcaagtcttc-----
B D          White rhinoceros  aa-------agaaaagcctc-----
B D                       Cat  gt-------agaaaagtgtc-----
B D                       Dog  gt-------agaaaagcctc-----
B D                   Ferret   gt-------agaaaagcttc-----
B D                     Panda  gt-------agaaaagcttc-----
               Pacific walrus  gt-------aggaaagcttc-----
                 Weddell seal  gt-------aggaaagcttc-----
             Black flying-fox  aa-------agaaaagcttc-----
B D                   Megabat  aa-------agaaaagcttc-----
                Big brown bat  aa-------agaaaagcttc-----
         David's myotis (bat)  aa-------agaaaagcttc-----
B D                  Microbat  aa-------agaaaagcttc-----
B D                  Hedgehog  aaaaaagatagaaaagattc-----
B D                     Shrew  -------------atgcttc-----
              Star-nosed mole  aa-------aggcaagcttc-----
B D                  Elephant  aa-------ggaaaagctac-----
          Cape elephant shrew  aa-------gagaaagcta------
B D                   Manatee  aa-------gggaaagcttc-----
             Cape golden mole  aa-------gggaaagctcc-----
B D                    Tenrec  ag-------gggaaagcttc-----
                     Aardvark  aa-------gggaaagcttc-----
B D                 Armadillo  aa-------ggaaaagcttc-----
B D                   Opossum  ga-------aataaa----t-----
B D           Tasmanian devil  ga-------aataaa----t-----
B D                   Wallaby  gt-------aataaa----t-----
  D              Saker falcon  -------------------t-----
  D          Peregrine falcon  -------------------t-----
  D                    Parrot  -------------------t-----
  D           Green seaturtle  --------------caagcc-----
  D            Painted turtle  ---------aagataaagcc-----
B D                Coelacanth  ----------aactgacttc-----
B D                    Medaka  -a-------aagatcacttttaggt
     Mexican tetra (cavefish)  -a-------accataaagtt----a
B D              Nile tilapia  =========================
                 Zebra mbuna  =========================
B D                 Tetraodon  =========================
B D               Stickleback  =========================
                 Spotted gar  =========================
         Pundamilia nyererei  =========================
       Burton's mouthbreeder  =========================
         Princess of Burundi  =========================
B D                      Fugu  =========================
          Southern platyfish  =========================
B D              Atlantic cod  =========================
B D                 Zebrafish  =========================
      Yellowbelly pufferfish  =========================
B D             X. tropicalis  =========================
  D               Rock pigeon  =========================
  D    White-throated sparrow  =========================
B D                  Platypus  =========================
B D                    Lizard  =========================
B D               Zebra finch  =========================
B D       Medium ground finch  =========================
  D       Collared flycatcher  =========================
  D  Chinese softshell turtle  =========================
  D              Mallard duck  =========================
B D                Budgerigar  =========================
B D                    Turkey  =========================
B D                   Chicken  =========================
          Tibetan ground jay  =========================
B D        American alligator  =========================
                Prairie vole  -------------------------
              Golden hamster  =========================
B D                       Rat  -------------------------
B D           Chinese hamster  -------------------------
      Lesser Egyptian jerboa  -------------------------
B D                     Mouse  -------------------------
B D                  Squirrel  -------------------------

Inserts between block 16 and 17 in window
  D             Saker falcon 3bp
  D         Peregrine falcon 3bp
  D                   Parrot 2bp
  D          Green seaturtle 3bp
  D           Painted turtle 3bp
B D               Coelacanth 11bp

Alignment block 17 of 1053 in window, 87259781 - 87259789, 9 bps 
B D                     Human  tgtaaaa-gc--
B D                     Chimp  tgtaaaa-gc--
B D                   Gorilla  tgtaaaa-gc--
B D                 Orangutan  tgtaaaa-gc--
B D                    Gibbon  tgtaaaa-gc--
B D                    Rhesus  tgtaaaa-gc--
B D       Crab-eating macaque  tgtaaaa-gc--
B D                    Baboon  tgtaaaa-gc--
B D              Green monkey  tgtaaaa-gc--
B D                  Marmoset  tataaaa-gc--
B D           Squirrel monkey  tgtaaaa-gc--
B D                  Bushbaby  tgctaaa-gt--
           Chinese tree shrew  tgcaaaa-gt--
B D                  Squirrel  ---agaa-ct--
       Lesser Egyptian jerboa  ---agga-gc--
                 Prairie vole  ------a-at--
B D           Chinese hamster  ---ctaa-at--
B D                     Mouse  ---agga-gt--
B D                       Rat  ---aggg-gt--
B D            Naked mole-rat  --tagaa-gt--
B D                Guinea pig  --tagaa-gt--
                   Chinchilla  --tagaa-gt--
             Brush-tailed rat  --tagaa-at--
B D                    Rabbit  ---aaaa-gt--
B D                      Pika  ---gaaa-tt--
B D                       Pig  tgcaaaa-gt--
B D                    Alpaca  tacaaaa-gt--
               Bactrian camel  tacaaaa-gt--
B D                   Dolphin  tgcaaaa-gt--
                 Killer whale  tgcaaaa-gt--
             Tibetan antelope  tgcaaaa-at--
B D                       Cow  tgcaaaa-at--
B D                     Sheep  tgcaaac-at--
                Domestic goat  tgcaaac-at--
B D                     Horse  tgcgaaa-gt--
B D          White rhinoceros  tgcaaaa-gt--
B D                       Cat  tgcaaaa-gt--
B D                       Dog  tgcaaaa-gt--
B D                   Ferret   tgtaaaa-gt--
B D                     Panda  tgcaaaa-gt--
               Pacific walrus  tgcaaaa-gt--
                 Weddell seal  tgcaaaa-gt--
             Black flying-fox  tgcaaac-at--
B D                   Megabat  tgcaaac-at--
                Big brown bat  tgcaaa--gt--
         David's myotis (bat)  tgcaaa--gt--
B D                  Microbat  tgcaaa--gt--
B D                  Hedgehog  tgcaaaa-tt--
B D                     Shrew  tcaaaagcat--
              Star-nosed mole  tccaaaa-gt--
B D                  Elephant  cgcaaaaggc--
          Cape elephant shrew  --taaaaagt--
B D                   Manatee  tgcaaaaggc--
             Cape golden mole  tgcaaacagc--
B D                    Tenrec  tgcacaaagc--
                     Aardvark  tgcaaaaagc--
B D                 Armadillo  tgcaaaa-gt--
B D                   Opossum  tagataa-tg--
B D           Tasmanian devil  tggataa-ta--
B D                   Wallaby  tagagaa-ta--
B D                  Platypus  tgcaaaa-gt--
  D              Saker falcon  tgattt------
  D          Peregrine falcon  tgattt------
  D           Green seaturtle  tgaaga------
  D            Painted turtle  tgaaga------
B D                Coelacanth  cac---------
B D                    Medaka  --caaaa-attt
     Mexican tetra (cavefish)  --cataa-cttg
B D              Nile tilapia  ============
                 Zebra mbuna  ============
B D                 Tetraodon  ============
B D               Stickleback  ============
                 Spotted gar  ============
         Pundamilia nyererei  ============
       Burton's mouthbreeder  ============
         Princess of Burundi  ============
B D                      Fugu  ============
          Southern platyfish  ============
B D              Atlantic cod  ============
B D                 Zebrafish  ============
      Yellowbelly pufferfish  ============
B D             X. tropicalis  ============
  D               Rock pigeon  ============
  D    White-throated sparrow  ============
  D                    Parrot  ============
B D                    Lizard  ============
B D               Zebra finch  ============
B D       Medium ground finch  ============
  D       Collared flycatcher  ============
  D  Chinese softshell turtle  ============
  D              Mallard duck  ============
B D                Budgerigar  ============
B D                    Turkey  ============
B D                   Chicken  ============
          Tibetan ground jay  ============
B D        American alligator  ============
              Golden hamster  ============

Inserts between block 17 and 18 in window
B D                 Squirrel 1bp
B D                 Platypus 1bp
  D             Saker falcon 4bp
  D         Peregrine falcon 4bp
  D          Green seaturtle 5bp
  D           Painted turtle 3bp
B D               Coelacanth 6bp

Alignment block 18 of 1053 in window, 87259790 - 87259801, 12 bps 
B D                     Human  --------tattgatat-a--a----a
B D                     Chimp  --------tattgatat-a--a----a
B D                   Gorilla  --------tattgatat-a--a----a
B D                 Orangutan  --------tattgatat-a--a----a
B D                    Gibbon  --------tattgatat-a--a----a
B D                    Rhesus  --------tattgatat-a--a----a
B D       Crab-eating macaque  --------tattgatgt-a--a----a
B D                    Baboon  --------tattgatat-a--a----a
B D              Green monkey  --------tattgatat-a--a----a
B D                  Marmoset  --------tattggtat-a--a----a
B D           Squirrel monkey  --------tattgttgt-a--a----a
B D                  Bushbaby  --------cattgacat-a--a----a
           Chinese tree shrew  --------tattagcat-a--a----a
B D                  Squirrel  --------cataagtat-a--a----a
       Lesser Egyptian jerboa  --------tatagatac-a--------
                 Prairie vole  --------tattgattt-a--a----t
B D           Chinese hamster  --------tactgattt-a--a----t
B D                     Mouse  --------tactgattc-a--a----t
B D                       Rat  --------tgctgattt-a--a----t
B D            Naked mole-rat  --------ttttggtat-a--a----a
B D                Guinea pig  --------tattggtat-g--a----a
                   Chinchilla  --------tatt-gtat-a--a----a
             Brush-tailed rat  --------tgttagtat-a--a----a
B D                    Rabbit  --------tctttgtat-g--a----a
B D                      Pika  --------tatttgtat-g--a----a
B D                       Pig  --------tactgataa-g--a-----
B D                    Alpaca  --------tactgaaatat--t-----
               Bactrian camel  --------tactgatat-t--t-----
B D                   Dolphin  --------tactgatag-g--a-----
                 Killer whale  --------tactgatag-g--a-----
             Tibetan antelope  --------tactgatgt-g--a-----
B D                       Cow  --------tactgatgt-g--a-----
B D                     Sheep  --------tactgatgt-g--a-----
                Domestic goat  --------tactgatgt-g--a-----
B D                     Horse  --------tattgatat-a--a----a
B D          White rhinoceros  --------tattgatat-a--a----a
B D                       Cat  --------tgttgatac-a--a----a
B D                       Dog  --------tactgatataa--a----a
B D                   Ferret   --------tactgatat-a--a----a
B D                     Panda  --------tattgatat-a--a----a
               Pacific walrus  --------tattgatat-a--a----a
                 Weddell seal  --------tattgatat-a--a----a
             Black flying-fox  --------tattgatat-a--a-----
B D                   Megabat  --------tattgatat-a--a-----
                Big brown bat  --------tattgatat-a--g----a
         David's myotis (bat)  --------aactgatat-a--g----a
B D                  Microbat  --------tattgatat-a--g----a
B D                  Hedgehog  --------tactaaaa-----------
B D                     Shrew  --------ttatgaaat-a--a-----
              Star-nosed mole  --------tattgatat-g--a-----
B D                  Elephant  ----------------c-a--c----t
B D                   Manatee  --------tattggtac-a--a----t
             Cape golden mole  --------tatagaggt-a--a----t
B D                    Tenrec  --------tgtcgatat-g--g----t
                     Aardvark  --------tattggtat-a--a----t
B D                 Armadillo  --------tattggtat-a--a----a
B D                   Opossum  --------tattaattt-a--cttccc
B D           Tasmanian devil  --------taataattt-a--ctttcc
B D                   Wallaby  --------taataattt-a--cttt-c
B D                  Platypus  --------tattaattg-a--a----a
  D              Saker falcon  --------tatttattt-a--------
  D          Peregrine falcon  --------tatttattt-a--------
  D              Mallard duck  --------tactgattt-aaa------
  D           Green seaturtle  --------tacagttaa-a--------
  D            Painted turtle  --------tacagttaa-a--------
B D                Coelacanth  --------tacagt-------------
B D                    Medaka  gatga---taatgtttg----------
     Mexican tetra (cavefish)  tataagcccagcatctt----------
B D              Nile tilapia  ===========================
                 Zebra mbuna  ===========================
B D                 Tetraodon  ===========================
B D               Stickleback  ===========================
                 Spotted gar  ===========================
         Pundamilia nyererei  ===========================
       Burton's mouthbreeder  ===========================
         Princess of Burundi  ===========================
B D                      Fugu  ===========================
          Southern platyfish  ===========================
B D              Atlantic cod  ===========================
B D                 Zebrafish  ===========================
      Yellowbelly pufferfish  ===========================
B D             X. tropicalis  ===========================
  D               Rock pigeon  ===========================
  D    White-throated sparrow  ===========================
  D                    Parrot  ===========================
B D                    Lizard  ===========================
B D               Zebra finch  ===========================
B D       Medium ground finch  ===========================
  D       Collared flycatcher  ===========================
  D  Chinese softshell turtle  ===========================
B D                Budgerigar  ===========================
B D                    Turkey  ===========================
B D                   Chicken  ===========================
          Tibetan ground jay  ===========================
B D        American alligator  ===========================
         Cape elephant shrew  ---------------------------
              Golden hamster  ===========================

Inserts between block 18 and 19 in window
  D             Saker falcon 4bp
  D         Peregrine falcon 3bp
  D             Mallard duck 5bp

Alignment block 19 of 1053 in window, 87259802 - 87259803, 2 bps 
B D                     Human  a-----t
B D                     Chimp  a-----t
B D                   Gorilla  a-----t
B D                 Orangutan  a-----t
B D                    Gibbon  a-----t
B D                    Rhesus  a-----t
B D       Crab-eating macaque  a-----t
B D                    Baboon  a-----g
B D              Green monkey  a-----t
B D                  Marmoset  a-----t
B D           Squirrel monkey  a-----t
B D                  Bushbaby  a-----t
           Chinese tree shrew  a-----t
B D                  Squirrel  a-----t
       Lesser Egyptian jerboa  ------t
                 Prairie vole  c-----t
B D           Chinese hamster  c-----t
B D                     Mouse  c-----t
B D                       Rat  c-----t
B D            Naked mole-rat  a-----t
B D                Guinea pig  a-----t
                   Chinchilla  t-----t
             Brush-tailed rat  g-----t
B D                    Rabbit  a-----t
B D                      Pika  a-----t
B D                       Pig  t-----t
B D                     Horse  a-----t
B D          White rhinoceros  a-----t
B D                       Dog  a-----t
B D                   Ferret   a-----t
B D                     Panda  c-----t
               Pacific walrus  a-----t
                 Weddell seal  a-----t
                Big brown bat  a-----t
         David's myotis (bat)  a-----t
B D                  Microbat  a-----t
B D                  Elephant  a-----c
          Cape elephant shrew  ------g
B D                   Manatee  a-----c
             Cape golden mole  t-----c
B D                    Tenrec  a-----c
                     Aardvark  a-----a
B D                 Armadillo  a-----t
B D                   Opossum  a-----t
B D           Tasmanian devil  a-----t
B D                   Wallaby  a-----c
B D                  Platypus  actccct
  D              Mallard duck  -----at
  D           Green seaturtle  -----at
  D            Painted turtle  -----at
B D                Coelacanth  ------t
B D                    Medaka  a-----t
     Mexican tetra (cavefish)  a-----g
             Star-nosed mole  -------
B D                     Shrew  -------
B D              Nile tilapia  =======
                 Zebra mbuna  =======
B D                 Tetraodon  =======
B D               Stickleback  =======
                 Spotted gar  =======
         Pundamilia nyererei  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D                      Fugu  =======
B D                  Hedgehog  -------
          Southern platyfish  =======
B D              Atlantic cod  =======
B D                 Zebrafish  =======
      Yellowbelly pufferfish  =======
B D             X. tropicalis  =======
  D               Rock pigeon  =======
  D    White-throated sparrow  =======
  D                    Parrot  =======
B D                    Lizard  =======
B D                   Megabat  -------
            Black flying-fox  -------
B D               Zebra finch  =======
B D       Medium ground finch  =======
  D       Collared flycatcher  =======
  D  Chinese softshell turtle  =======
  D              Saker falcon  =======
B D                Budgerigar  =======
B D                    Turkey  =======
B D                   Chicken  =======
          Tibetan ground jay  =======
B D        American alligator  =======
               Domestic goat  -------
  D          Peregrine falcon  =======
              Golden hamster  =======
              Bactrian camel  -------
B D                     Sheep  -------
            Tibetan antelope  -------
B D                       Cat  -------
B D                    Alpaca  -------
B D                       Cow  -------
                Killer whale  -------
B D                   Dolphin  -------

Inserts between block 19 and 20 in window
  D          Green seaturtle 2bp
  D           Painted turtle 6bp
B D               Coelacanth 2bp

Alignment block 20 of 1053 in window, 87259804 - 87259804, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  t
           Chinese tree shrew  g
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  t
             Brush-tailed rat  a
B D                    Rabbit  g
B D                      Pika  g
B D                       Pig  t
B D                   Dolphin  t
                 Killer whale  t
B D                     Horse  g
B D          White rhinoceros  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  g
B D                   Opossum  a
B D           Tasmanian devil  a
B D                   Wallaby  a
B D                  Platypus  a
           Tibetan ground jay  a
  D                    Parrot  g
  D              Mallard duck  a
B D                   Chicken  g
  D           Green seaturtle  a
  D            Painted turtle  a
B D                    Medaka  t
     Mexican tetra (cavefish)  a
             Star-nosed mole  -
B D                     Shrew  -
B D              Nile tilapia  =
                 Zebra mbuna  =
B D                 Tetraodon  =
B D               Stickleback  =
                 Spotted gar  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                      Fugu  =
B D                  Hedgehog  -
B D                Coelacanth  =
          Southern platyfish  =
B D              Atlantic cod  =
B D                 Zebrafish  =
      Yellowbelly pufferfish  =
B D             X. tropicalis  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
B D                    Lizard  =
B D                   Megabat  -
            Black flying-fox  -
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D              Saker falcon  =
B D                Budgerigar  =
B D                    Turkey  =
B D        American alligator  =
               Domestic goat  -
  D          Peregrine falcon  =
              Golden hamster  =
              Bactrian camel  -
B D                     Sheep  -
            Tibetan antelope  -
B D                       Cat  -
B D                    Alpaca  -
B D                       Cow  -

Inserts between block 20 and 21 in window
          Tibetan ground jay 3bp
  D                   Parrot 39bp
  D             Mallard duck 5bp
B D                  Chicken 5bp
  D          Green seaturtle 24bp
  D           Painted turtle 24bp

Alignment block 21 of 1053 in window, 87259805 - 87259805, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  c
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  a
B D                      Pika  a
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  c
B D                       Cow  t
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  a
B D                   Opossum  a
B D           Tasmanian devil  a
B D                   Wallaby  a
B D                  Platypus  a
B D                Coelacanth  a
B D                    Medaka  a
     Mexican tetra (cavefish)  a
             Star-nosed mole  -
B D                     Shrew  -
B D              Nile tilapia  =
                 Zebra mbuna  =
B D                 Tetraodon  =
B D               Stickleback  =
                 Spotted gar  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                      Fugu  =
B D                  Hedgehog  -
          Southern platyfish  =
B D              Atlantic cod  =
B D                 Zebrafish  =
      Yellowbelly pufferfish  =
B D             X. tropicalis  =
  D               Rock pigeon  =
  D    White-throated sparrow  =
  D                    Parrot  =
  D            Painted turtle  =
B D                    Lizard  =
B D                   Megabat  -
            Black flying-fox  -
B D               Zebra finch  =
B D       Medium ground finch  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
  D              Saker falcon  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D                Budgerigar  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D        American alligator  =
  D          Peregrine falcon  =
              Golden hamster  =

Inserts between block 21 and 22 in window
B D               Guinea pig 3bp

Alignment block 22 of 1053 in window, 87259806 - 87259825, 20 bps 
B D                     Human  tttt----------aagtcaa--ccaag----taa----t
B D                     Chimp  tttt----------aattcaa--ccaag----taa----t
B D                   Gorilla  tttt----------aagtcaa--ccaag----taa----t
B D                 Orangutan  tttt----------aagtcaa--ccaag----taa----t
B D                    Gibbon  ttct----------aagtcaa--ccaac----taa----t
B D                    Rhesus  tttt----------aagtcaa--ccaag----taa----t
B D       Crab-eating macaque  tttt----------aagtcaa--ccaag----taa----t
B D                    Baboon  tttt----------aagtcaa--ccaag----taa----t
B D              Green monkey  tttt----------aagtcaa--ccaag----taa----t
B D                  Marmoset  cttt----------aagtcaa--ctaagtaattaa----t
B D           Squirrel monkey  tttt----------aagtcaa--ccaagtaattaa----t
B D                  Bushbaby  ttttt--------aaaatcac--ccgag----taa----t
           Chinese tree shrew  ttttt--------gaagccac--ccaaa----taataagt
B D                  Squirrel  -attt--------gaagtcaa--ccacg----tacctaat
       Lesser Egyptian jerboa  -tttg--------gaagctaa--cccaa----caactaac
                 Prairie vole  ---tt--------gaaactaa--tcaag----tgagtaac
B D           Chinese hamster  ttttt--------gaagctaa--tcaag----tgaggaac
B D                     Mouse  ttttt--------aa--------ccaag----tgactaac
B D                       Rat  tttat--------ga----------agc----taagtaac
B D            Naked mole-rat  ttttt---------aattcac--ccaag----taagt--t
B D                Guinea pig  tattt--------taatccag--ccaag----taata--t
                   Chinchilla  ttttt--------aaatccag--ccaag----gaact--t
             Brush-tailed rat  ttttt----------atccag--ctaag----tcact--t
B D                    Rabbit  gtttt--------taagttaa--ccaag----taa----t
B D                      Pika  ctttg--------tatgtcaa--ccacg----taa----t
B D                       Pig  ttttt--------aaagctaa--gcaaa----taactaat
B D                    Alpaca  ttttt--------gaagctaa--ccaaa----taactaa-
               Bactrian camel  ttttt--------gaagctaa--ccaaa----taactaa-
B D                   Dolphin  ttttt--------gaagctaa--ccaaa----aaaggaat
                 Killer whale  ttttt--------gaagctaa--ccaaa----aaaggaat
             Tibetan antelope  gtttt--------gaagctaa--ccaaa----taactaat
B D                       Cow  ttttt--------gaagctaa--ccaaa----taactaat
B D                     Sheep  gtttg--------gaagctaa--ccaaa----taactgat
                Domestic goat  gtttg--------gaagctaa--ccaaa----taactgat
B D                     Horse  gtttt--------gaaggcaa--ccaaa----taactaat
B D          White rhinoceros  ttttt--------gaaggcaa--ccaaa----taactaat
B D                       Cat  ttttt--------gaagccaa--ccaaa----taactaat
B D                       Dog  ttttt--------gaagccag--ccaaa----taactaat
B D                   Ferret   ttttt--------gaagccaa--ccaaa----taactaat
B D                     Panda  ttttt--------gaagccaa--ccaaa----taactaat
               Pacific walrus  ttttt--------gaaaccaa--ccaaa----taactaat
                 Weddell seal  ttttt--------gaaaccaa--ccaaa----taactaat
             Black flying-fox  -tttt--------gaagccaa--acaaa----taactaat
B D                   Megabat  -tttt--------gaagccaa--acaaa----taactaat
                Big brown bat  ttttt--------gaagccaa--ccaaa----taactaat
         David's myotis (bat)  ttttt--------gaagccaa--ccaaa----taacaaat
B D                  Microbat  ttttt--------gaagccaa--ccaaa----taacaaat
B D                  Hedgehog  -gtca--------agtagcaa--atgtc----tacttttg
B D                     Shrew  ttttt--------agagtcag--gcaaa----taattttt
              Star-nosed mole  ttttt--------gaaggcaa--cctta----taactcat
B D                  Elephant  ttttt--------gaagccaa--tcaaa----taatggat
          Cape elephant shrew  ttctt--------ttggccaa--tctac----taat----
B D                   Manatee  ttttt--------gaagccaa--tc-------taacagat
             Cape golden mole  tt-tt--------aaagccaa--tcaaa----taactaat
B D                    Tenrec  tt-tt--------gaagccac--ccaaa----tagctaat
                     Aardvark  ttttt--------gaaatcaa--tcaaa-----aactgat
B D                 Armadillo  tcttt--------gaaactaa--acaga----taattaat
B D                   Opossum  ttatg-ttgggaacaagcaac--ccaaa----tagctact
B D           Tasmanian devil  ttatgtttgggaagaggcaac--tcaaa----tagttgct
B D                   Wallaby  ttctgtttgggaagaggcaac--ccaaa----taactata
B D                  Platypus  tatta--------agaggaac--tcaaa----taa----c
  D              Saker falcon  --ttt--------taatccaa--catag----tatt----
  D          Peregrine falcon  --ttt--------taatccaa--catag----tatt----
           Tibetan ground jay  --ttt--------tttaacag--cacag----tatt----
B D                Budgerigar  ---tt--------ttaaacaa--catag----tctt----
  D                    Parrot  --ttt--------ttaaacaa--catag----tctt----
  D             Scarlet macaw  --ttt--------ttaaacaa--catag----tctt----
  D              Mallard duck  --att--------ttaaacaa--caaat------------
B D                   Chicken  --aag--------ggaatcaa--gtgat------------
  D           Green seaturtle  --gtt--------caaaccga--c--aa----tgct----
  D            Painted turtle  --gtt--------cagactga--caaaa----tact----
  D  Chinese softshell turtle  --ttt--------cagattga--caaaa----tact----
  D    Spiny softshell turtle  --ttt--------cagattga--caaaa----tact----
B D                Coelacanth  ---tc--------gtaacttt--ccctt----ttattgt-
B D                    Medaka  --ctt--------taagtcagacacaaa----c-------
     Mexican tetra (cavefish)  --ctg--------tacct-----gcaat----t-------
B D              Nile tilapia  ========================================
                 Zebra mbuna  ========================================
B D                 Tetraodon  ========================================
B D               Stickleback  ========================================
                 Spotted gar  ========================================
         Pundamilia nyererei  ========================================
       Burton's mouthbreeder  ========================================
         Princess of Burundi  ========================================
B D                      Fugu  ========================================
          Southern platyfish  ========================================
B D              Atlantic cod  ========================================
B D                 Zebrafish  ========================================
      Yellowbelly pufferfish  ========================================
B D             X. tropicalis  ========================================
  D               Rock pigeon  ========================================
  D    White-throated sparrow  ========================================
B D                    Lizard  ========================================
B D               Zebra finch  ========================================
B D       Medium ground finch  ========================================
  D       Collared flycatcher  ========================================
B D                    Turkey  ========================================
B D        American alligator  ========================================
              Golden hamster  ========================================

Inserts between block 22 and 23 in window
B D                  Chicken 7bp

Alignment block 23 of 1053 in window, 87259826 - 87259828, 3 bps 
B D                     Human  ttc
B D                     Chimp  ttc
B D                   Gorilla  ttc
B D                 Orangutan  ttc
B D                    Gibbon  ttc
B D                    Rhesus  ttc
B D       Crab-eating macaque  ttc
B D                    Baboon  ttc
B D              Green monkey  ttc
B D                  Marmoset  ttc
B D           Squirrel monkey  ttc
B D                  Bushbaby  ttg
           Chinese tree shrew  ttc
B D                  Squirrel  ttc
       Lesser Egyptian jerboa  ttc
                 Prairie vole  tcc
B D           Chinese hamster  ttc
B D                     Mouse  ttc
B D                       Rat  ttc
B D            Naked mole-rat  ct-
B D                Guinea pig  ctc
                   Chinchilla  ctt
             Brush-tailed rat  ttc
B D                    Rabbit  ttc
B D                      Pika  ttt
B D                       Pig  ttc
B D                    Alpaca  ttc
               Bactrian camel  ttc
B D                   Dolphin  ttg
                 Killer whale  ttg
             Tibetan antelope  ttc
B D                       Cow  ttc
B D                     Sheep  ttc
                Domestic goat  ttc
B D                     Horse  ttc
B D          White rhinoceros  ttc
B D                       Cat  ttc
B D                       Dog  ttc
B D                   Ferret   ttc
B D                     Panda  ttc
               Pacific walrus  ttc
                 Weddell seal  ttc
             Black flying-fox  ttt
B D                   Megabat  ttt
                Big brown bat  ttc
         David's myotis (bat)  ttc
B D                  Microbat  ttc
B D                  Hedgehog  tt-
B D                     Shrew  tt-
              Star-nosed mole  ttc
B D                  Elephant  ttc
B D                   Manatee  ttc
             Cape golden mole  ttc
B D                    Tenrec  ttc
                     Aardvark  ttc
B D                 Armadillo  ttc
B D                   Opossum  ttc
B D           Tasmanian devil  ttc
B D                   Wallaby  ttc
B D                  Platypus  tta
B D                Coelacanth  tcc
B D                    Medaka  ttc
     Mexican tetra (cavefish)  gtc
B D              Nile tilapia  ===
                 Zebra mbuna  ===
B D                 Tetraodon  ===
B D               Stickleback  ===
                 Spotted gar  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                      Fugu  ===
          Southern platyfish  ===
B D              Atlantic cod  ===
B D                 Zebrafish  ===
      Yellowbelly pufferfish  ===
B D             X. tropicalis  ===
  D               Rock pigeon  ===
  D    White-throated sparrow  ===
  D             Scarlet macaw  ---
  D                    Parrot  ---
  D    Spiny softshell turtle  ---
  D            Painted turtle  ---
B D                    Lizard  ===
B D               Zebra finch  ===
B D       Medium ground finch  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ---
  D              Saker falcon  ---
  D           Green seaturtle  ---
  D              Mallard duck  ---
B D                Budgerigar  ---
B D                    Turkey  ===
B D                   Chicken  ===
          Tibetan ground jay  ---
B D        American alligator  ===
  D          Peregrine falcon  ---
         Cape elephant shrew  ---
              Golden hamster  ===

Alignment block 24 of 1053 in window, 87259829 - 87259848, 20 bps 
B D                     Human  tg------tttttgt-----t--gagga---agaga
B D                     Chimp  tg------tttttgt-----t--gagga---agaga
B D                   Gorilla  tg------tttttgt-----t--gagga---agaga
B D                 Orangutan  tg------tttttgt-----t--gagga---agaga
B D                    Gibbon  tg------tttttgt-----t--gagga---agaga
B D                    Rhesus  tg------tttttct-----t--gagga---agaga
B D       Crab-eating macaque  tg------tttttct-----t--gagga---agaga
B D                    Baboon  tg------tttttct-----t--gagga---agaga
B D              Green monkey  tg------tttttct-----t--gagga---agaga
B D                  Marmoset  tg------tttttgt-----t--gagaa---tgaga
B D           Squirrel monkey  tg------ttttcgt-----t--gagaa---tgaga
B D                  Bushbaby  ta------tttttgt-----t--gagga---acaga
           Chinese tree shrew  tg------gttttgt-----t--gagga---agaga
B D                  Squirrel  ta------tttttgt-----t--gggaa---agaga
       Lesser Egyptian jerboa  -a------atttt-----------gaca---agtga
                 Prairie vole  tg------attttgc-----t--caaaa---actga
B D           Chinese hamster  cg------attttgc-----t--cgcaa---actga
B D                     Mouse  tg------atttttc-----t--tgaaa---actga
B D                       Rat  tg------atttttc-----t--tgaaa---tcaga
B D            Naked mole-rat  --------gtttttc-----t--ggaga---agaaa
B D                Guinea pig  tg------attttgc-----t--gtggg---agaaa
                   Chinchilla  cg------cttttgt-----t--ggaga---agaaa
             Brush-tailed rat  tg------cttttgc-----t--gggaa---atgaa
B D                    Rabbit  tg------ttttttc-----t--ggggaaagaaagg
B D                      Pika  ta------ttattgt-----t--gggga---agagg
B D                       Pig  ta------ttttggc-----t--ggaga---agaga
B D                    Alpaca  ta------ttttggc-----t--ggaga---agaga
               Bactrian camel  ta------ttttggc-----t--agaga---agaga
B D                   Dolphin  ta------ttttggc-----t--ggaga---agaga
                 Killer whale  ta------ttttggc-----t--ggaga---agaga
             Tibetan antelope  ta------ttttggc-----t--ggaga---agaga
B D                       Cow  ta------ttttggc-----t--ggaga---agaga
B D                     Sheep  ta------ctttggc-----t--ggaga---aggga
                Domestic goat  ta------ctttggc-----t--ggaga---agaga
B D                     Horse  ta------tttttgt-----t--ggaga---agaga
B D          White rhinoceros  ta------tttttgt-----t--ggaga---aaaga
B D                       Cat  ta------tttttgt-----t--gggga---agaga
B D                       Dog  tgggggtttttttgt-----t--ggaga---agaga
B D                   Ferret   ta------ttttcgt-----t--gaaga---agaga
B D                     Panda  ta------tttttgt-----t--ggaga---agaga
               Pacific walrus  ta------tttttgt-----t--ggaga---agaga
                 Weddell seal  ta------tttttgt-----t--ggaga---agaga
             Black flying-fox  ta------tttttgt-----t--aaaga---agaga
B D                   Megabat  ta------tttttgt-----t--aaaga---agaga
                Big brown bat  ta------tttgtgt-----t--ggaga---acaga
         David's myotis (bat)  ta------tttgtgt-----t-gggaga---acaga
B D                  Microbat  ta------tttgtgt-----t-gggaga---acaga
B D                  Hedgehog  ----------------------------------ga
B D                     Shrew  ----------------------------------ga
              Star-nosed mole  ta------tttt-----------ggaaa---agaga
B D                  Elephant  ta------tttttgt-----t--gagga---agaga
          Cape elephant shrew  --------ttttggt-----g--gagga---gaggg
B D                   Manatee  ta------tttttgt-----t--ggggg---aaaga
             Cape golden mole  ta------tttttat-----t--tagga---agagt
B D                    Tenrec  ta------tttctgc-----t--gccgg---ggaga
                     Aardvark  ta------tttttgt-----t--aggga---agaga
B D                 Armadillo  ca------ttattgt-----t--gggga---agaga
B D                   Opossum  caa-----attttgg-----t--aggga---aaatg
B D           Tasmanian devil  tag-----attttga-----c--aggga---aaatg
B D                   Wallaby  caa-----attttgg-----c--aggga---aaatg
B D                  Platypus  tg------tccacat-----t--aaagc---aacac
  D              Saker falcon  --------------------t--acagt---a----
  D          Peregrine falcon  --------------------t--acagt---a----
           Tibetan ground jay  --------------------t--acaat---a----
B D                Budgerigar  --------------------t--acagt---a----
  D                    Parrot  --------------------t--acagt---a----
  D             Scarlet macaw  --------------------t--acagt---a----
  D              Mallard duck  ----------------tactt--gaaat---a----
B D                   Chicken  ---------tttttcttcatg--aaaat---a----
B D                    Turkey  ---------ttttgttttttt--taaac---a----
  D           Green seaturtle  -----------------ttaa--aaaaa---a----
  D            Painted turtle  -----------------taaa--aaaaa---a----
  D  Chinese softshell turtle  -----------------ttat--aaaaa---a----
  D    Spiny softshell turtle  -----------------ttataaaaaaa---a----
B D                Coelacanth  tg------gttttgt-----t--ttata---aaga-
B D                    Medaka  --------------------t--tggaa---agata
     Mexican tetra (cavefish)  ---------tgtggt-----t--tcagg---aggta
B D              Nile tilapia  ====================================
                 Zebra mbuna  ====================================
B D                 Tetraodon  ====================================
B D               Stickleback  ====================================
                 Spotted gar  ====================================
         Pundamilia nyererei  ====================================
       Burton's mouthbreeder  ====================================
         Princess of Burundi  ====================================
B D                      Fugu  ====================================
          Southern platyfish  ====================================
B D              Atlantic cod  ====================================
B D                 Zebrafish  ====================================
      Yellowbelly pufferfish  ====================================
B D             X. tropicalis  ====================================
  D               Rock pigeon  ====================================
  D    White-throated sparrow  ====================================
B D                    Lizard  ====================================
B D               Zebra finch  ====================================
B D       Medium ground finch  ====================================
  D       Collared flycatcher  ====================================
B D        American alligator  ====================================
              Golden hamster  ====================================

Inserts between block 24 and 25 in window
  D             Saker falcon 17bp
  D         Peregrine falcon 17bp
          Tibetan ground jay 5bp
B D               Budgerigar 9bp
  D                   Parrot 5bp
  D            Scarlet macaw 5bp
  D             Mallard duck 25bp
B D                  Chicken 10bp
B D                   Turkey 3bp

Alignment block 25 of 1053 in window, 87259849 - 87259850, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D                    Baboon  aa
B D              Green monkey  aa
B D                  Marmoset  aa
B D           Squirrel monkey  aa
B D                  Bushbaby  aa
           Chinese tree shrew  aa
B D                  Squirrel  ac
       Lesser Egyptian jerboa  tg
                 Prairie vole  aa
B D           Chinese hamster  aa
B D                     Mouse  aa
B D                       Rat  aa
B D            Naked mole-rat  aa
B D                Guinea pig  ag
                   Chinchilla  aa
             Brush-tailed rat  aa
B D                    Rabbit  aa
B D                      Pika  ag
B D                       Pig  aa
B D                    Alpaca  aa
               Bactrian camel  aa
B D                   Dolphin  aa
                 Killer whale  aa
             Tibetan antelope  aa
B D                       Cow  aa
B D                     Sheep  aa
                Domestic goat  ag
B D                     Horse  aa
B D          White rhinoceros  aa
B D                       Cat  aa
B D                       Dog  aa
B D                   Ferret   aa
B D                     Panda  aa
               Pacific walrus  aa
                 Weddell seal  aa
             Black flying-fox  aa
B D                   Megabat  aa
                Big brown bat  aa
         David's myotis (bat)  aa
B D                  Microbat  aa
B D                  Hedgehog  ag
B D                     Shrew  at
              Star-nosed mole  aa
B D                  Elephant  ga
          Cape elephant shrew  gg
B D                   Manatee  ga
             Cape golden mole  gg
B D                    Tenrec  ga
                     Aardvark  ga
B D                 Armadillo  ag
B D                   Opossum  aa
B D           Tasmanian devil  aa
B D                   Wallaby  aa
B D                  Platypus  aa
  D              Saker falcon  ag
  D          Peregrine falcon  ag
B D       Medium ground finch  aa
           Tibetan ground jay  aa
B D                Budgerigar  aa
  D                    Parrot  aa
  D             Scarlet macaw  aa
  D           Green seaturtle  aa
  D            Painted turtle  aa
  D  Chinese softshell turtle  aa
  D    Spiny softshell turtle  aa
B D                Coelacanth  at
B D                    Medaka  aa
     Mexican tetra (cavefish)  aa
B D              Nile tilapia  ==
                 Zebra mbuna  ==
B D                 Tetraodon  ==
B D               Stickleback  ==
                 Spotted gar  ==
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                      Fugu  ==
          Southern platyfish  ==
B D              Atlantic cod  ==
B D                 Zebrafish  ==
      Yellowbelly pufferfish  ==
B D             X. tropicalis  ==
  D               Rock pigeon  ==
  D    White-throated sparrow  ==
B D                    Lizard  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==
  D              Mallard duck  ==
B D                    Turkey  ==
B D                   Chicken  ==
B D        American alligator  ==
              Golden hamster  ==

Inserts between block 25 and 26 in window
B D                   Medaka 82bp
    Mexican tetra (cavefish) 1bp

Alignment block 26 of 1053 in window, 87259851 - 87259856, 6 bps 
B D                     Human  gga--at----------------------g
B D                     Chimp  gga--at----------------------g
B D                   Gorilla  gga--at----------------------g
B D                 Orangutan  gga--at----------------------g
B D                    Gibbon  gga--at----------------------g
B D                    Rhesus  gga--at----------------------g
B D       Crab-eating macaque  gga--at----------------------g
B D                    Baboon  gga--at----------------------g
B D              Green monkey  gga--at----------------------g
B D                  Marmoset  gga--at----------------------a
B D           Squirrel monkey  gaa--gt----------------------a
B D                  Bushbaby  gga--at----------------------g
           Chinese tree shrew  gcc--at----------------------g
B D                  Squirrel  aga--at----------------------g
       Lesser Egyptian jerboa  gga--tt----------------------g
                 Prairie vole  ggc--gt----------------------g
B D           Chinese hamster  gga--gt----------------------g
B D                     Mouse  gaa--gt----------------------g
B D                       Rat  gga--at----------------------g
B D            Naked mole-rat  gga--ag-----------------------
B D                Guinea pig  ga----------------------------
                   Chinchilla  ggt--ag----------------------g
             Brush-tailed rat  gga--ag----------------------g
B D                    Rabbit  gga--a-----------------------a
B D                      Pika  gga--at----------------------g
B D                       Pig  aga--at----------------------g
B D                    Alpaca  gga--at----------------------g
               Bactrian camel  gga--at----------------------g
B D                   Dolphin  gga--at----------------------g
                 Killer whale  gga--at----------------------g
             Tibetan antelope  gga--at----------------------g
B D                       Cow  gga--at----------------------g
B D                     Sheep  gga--at----------------------g
                Domestic goat  gga--aa----------------------g
B D                     Horse  gga--at----------------------g
B D          White rhinoceros  aga--at----------------------g
B D                       Cat  gga--aa----------------------g
B D                       Dog  ggg--at----------------------g
B D                   Ferret   gga--at----------------------g
B D                     Panda  gga--at----------------------g
               Pacific walrus  gga--at----------------------g
                 Weddell seal  gga--at----------------------g
             Black flying-fox  gga--ac----------------------a
B D                   Megabat  gga--ac----------------------a
                Big brown bat  aga--at----------------------g
         David's myotis (bat)  aga--at----------------------g
B D                  Microbat  aga--ac----------------------g