Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 343 in window, 56079857 - 56079875, 19 bps 
B D                     Human  attc-attacccttccctgg
B D                     Chimp  attc-attacccttccctgg
B D                   Gorilla  attc-attacccttccctgg
B D                 Orangutan  attc-attacccttccctgg
B D                    Gibbon  attc-attacccttccttgg
B D                    Rhesus  attc-attacccttccctgg
B D       Crab-eating macaque  attc-attacccttccctgg
B D                    Baboon  attc-attacccttccctgg
B D              Green monkey  attc-attacccttccctgg
B D                  Marmoset  attc-attacccttccctgg
B D           Squirrel monkey  agcc-attacccttccctgg
B D                  Bushbaby  attc-gttacctttccttgg
           Chinese tree shrew  attc-attacctttccccgg
       Lesser Egyptian jerboa  cttc-gctacctcgtcccgg
                 Prairie vole  attc-actaccttgccccgg
B D           Chinese hamster  atcc-actacctttccccgg
               Golden hamster  attc-actacctttccccgg
B D                     Mouse  attc-actacctttcccccg
B D                       Rat  agtc-actacctttccccgg
B D            Naked mole-rat  attc-actacctttcccggc
B D                Guinea pig  attc-aatacctttcccggg
             Brush-tailed rat  attc-agtacctatccc-gg
B D                    Rabbit  attc-attacctttcccctt
B D                      Pika  agtc-attacctttccccga
B D                       Pig  --cc-attacctttctcctc
B D                    Alpaca  --cc-attacctttctcct-
               Bactrian camel  --cc-attacctttctcct-
B D                   Dolphin  --cc-attacctttctcctt
                 Killer whale  --cc-attacctttctcctt
             Tibetan antelope  --cc-attacctttctcctc
B D                       Cow  --cc-attacctttctcctc
B D                     Sheep  --cc-attacctttctcctc
                Domestic goat  --cc-attacctttctcctc
B D                     Horse  --cc-attaccttactcctt
B D          White rhinoceros  --cc-attacctttctcctt
B D                       Cat  --cc-atcacctttcccctt
B D                       Dog  --cc-agcacctttccccgt
B D                   Ferret   --ac-agtaccttttccctt
B D                     Panda  --cc-agtaccttttccctt
               Pacific walrus  --cc-actaccttttccctt
                 Weddell seal  --cc-agtaccttttccctt
             Black flying-fox  --cc-attaccttacctctt
B D                   Megabat  --cc-attaccttacctctt
                Big brown bat  --cc-attacctgacccctc
         David's myotis (bat)  --cc-attacctta-ccctc
B D                  Microbat  --cc-attacctta-ccctc
B D                  Hedgehog  --tc-tttacctttcccttc
B D                     Shrew  --cc-attacctttcccctc
B D                  Elephant  --cc-attacctttccgggg
          Cape elephant shrew  --cc-attacctttccctgg
B D                   Manatee  --cctattacctttcccgag
             Cape golden mole  --cc-attacctttcccagg
                     Aardvark  --cc-attacctttcc-aga
B D                 Armadillo  --gc-attacctttcccagg
B D                   Opossum  --------------------
B D           Tasmanian devil  --------------------
B D                   Wallaby  --------------------
B D              Atlantic cod  ====================
B D               Stickleback  ====================
          Southern platyfish  ====================
      Yellowbelly pufferfish  ====================
B D                      Fugu  ====================
B D                 Tetraodon  ====================
B D                   Chicken  ====================
  D              Mallard duck  ====================
          Tibetan ground jay  ====================
B D                    Medaka  ====================
         Pundamilia nyererei  ====================
                 Zebra mbuna  ====================
       Burton's mouthbreeder  ====================
         Princess of Burundi  ====================
B D              Nile tilapia  ====================
B D             X. tropicalis  ====================
  D            Painted turtle  ====================
  D           Green seaturtle  ====================
B D        American alligator  ====================
                  Chinchilla  ====================
  D               Rock pigeon  ====================
  D       Collared flycatcher  ====================
B D       Medium ground finch  ====================
B D                    Lizard  ====================
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
B D                  Platypus  ====================
  D  Chinese softshell turtle  ====================
             Star-nosed mole  NNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ====================

Inserts between block 1 and 2 in window
      Lesser Egyptian jerboa 222bp
B D                      Pig 7bp
B D                   Alpaca 7bp
              Bactrian camel 7bp
B D                  Dolphin 7bp
                Killer whale 7bp
            Tibetan antelope 7bp
B D                      Cow 7bp
B D                    Sheep 7bp
               Domestic goat 7bp
B D                    Horse 7bp
B D         White rhinoceros 7bp
B D                      Cat 7bp
B D                      Dog 7bp
B D                  Ferret  7bp
B D                    Panda 7bp
              Pacific walrus 7bp
                Weddell seal 7bp
            Black flying-fox 7bp
B D                  Megabat 7bp
               Big brown bat 7bp
        David's myotis (bat) 7bp
B D                 Microbat 7bp
B D                 Hedgehog 7bp
B D                    Shrew 7bp
B D                  Opossum 5bp
B D          Tasmanian devil 10bp
B D                  Wallaby 10bp

Alignment block 2 of 343 in window, 56079876 - 56079891, 16 bps 
B D                     Human  a-tctgggggc---tttcgg
B D                     Chimp  a-tctgggggc---tttcgg
B D                   Gorilla  a-tctgggggc---ttttgg
B D                 Orangutan  a-tctgggggc---ttttgg
B D                    Gibbon  a-tctgggggc---ttttgg
B D                    Rhesus  a-tctgggggc---ttttgg
B D       Crab-eating macaque  a-tctgggggc---ttttgg
B D                    Baboon  a-tctgggggc---ttttgg
B D              Green monkey  a-tctgggggc---ttttgg
B D                  Marmoset  a-tctgggggca--ttttgg
B D           Squirrel monkey  a-tctgggggcc--ttttgg
B D                  Bushbaby  a-gttaggggc---ttttgg
           Chinese tree shrew  a-tttgccagc---acttgg
                 Prairie vole  --cctggggac---ttctga
B D           Chinese hamster  --cccggggac---atttgg
               Golden hamster  --cccggggac---attcgg
B D                     Mouse  --cctggggac---gtttgg
B D                       Rat  --cctggggtc---gtttgg
B D            Naked mole-rat  g-tc-gggagc---gtttgg
B D                Guinea pig  g-tcggggggc---acttgg
             Brush-tailed rat  g-tctaggggc---gcttgg
B D                    Rabbit  a-ttcgagggt---ctttcg
B D                      Pika  a-ttcgggggt---ctcggg
B D                       Pig  a-tttgggggc---ggctgg
B D                    Alpaca  attttgggggc---gtttgg
               Bactrian camel  attttgggggc---gtttgg
B D                   Dolphin  a-tttgggggc---gtttgg
                 Killer whale  a-tttgggggc---gtttgg
             Tibetan antelope  a-tttgggggc---gttcgg
B D                       Cow  a-tttgggggc---gttcgg
B D                     Sheep  a-tttgggggc---gttcgg
                Domestic goat  a-tttgggggc---gttcgg
B D                     Horse  a-ttt-ggggc---gtttgg
B D          White rhinoceros  a-ttt-ggggc---gtttgg
B D                       Cat  a-tttgggggc---gtttgg
B D                       Dog  g-ct--agggc---gtctgc
B D                   Ferret   a-tttgggggc---gtttgg
B D                     Panda  a-tttgggggc---gtttgg
               Pacific walrus  a-tttgggggc---gtttgg
                 Weddell seal  a-tttgggggc---gtttgg
             Black flying-fox  a-tttgggggc---gtttgg
B D                   Megabat  a-tttgggggc---gtttgg
                Big brown bat  t-tttgggggt---gtttgg
         David's myotis (bat)  a-tttgggggt---gttggg
B D                  Microbat  a-tttgggggt---gttggg
B D                  Hedgehog  a-tttgg-------------
B D                     Shrew  a-tttgg-------------
B D                  Elephant  a-tttgggggg---cttctg
          Cape elephant shrew  a-tttggaggg---gttttg
B D                   Manatee  a-tttgggggg---gctttg
             Cape golden mole  a-tgtggggat---atttgg
                     Aardvark  c-tttggggga---cttttg
B D                 Armadillo  t-tttgggggt----tcttg
B D                   Opossum  g-tgtgggggcagtctttgg
B D           Tasmanian devil  g-tgtttggggtttcttagg
B D                   Wallaby  g-tgtgggggcagtcttagg
B D              Atlantic cod  ====================
B D               Stickleback  ====================
          Southern platyfish  ====================
      Yellowbelly pufferfish  ====================
B D                      Fugu  ====================
B D                 Tetraodon  ====================
B D                   Chicken  ====================
  D              Mallard duck  ====================
          Tibetan ground jay  ====================
B D                    Medaka  ====================
         Pundamilia nyererei  ====================
                 Zebra mbuna  ====================
       Burton's mouthbreeder  ====================
         Princess of Burundi  ====================
B D              Nile tilapia  ====================
B D             X. tropicalis  ====================
  D            Painted turtle  ====================
  D           Green seaturtle  ====================
B D        American alligator  ====================
                  Chinchilla  ====================
      Lesser Egyptian jerboa  ====================
  D               Rock pigeon  ====================
  D       Collared flycatcher  ====================
B D       Medium ground finch  ====================
B D                    Lizard  ====================
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
B D                  Platypus  ====================
  D  Chinese softshell turtle  ====================
             Star-nosed mole  NNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ====================

Inserts between block 2 and 3 in window
B D                 Hedgehog 11bp
B D                    Shrew 399bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 3 of 343 in window, 56079892 - 56079996, 105 bps 
B D                     Human  a-atctcg--acc--tcc----ccttggcctatctcctgcag-------aaa-aat--t-agg-gtgagc
B D                     Chimp  a-atctcg--acc--tcc----ccttggcctatctcctgcag-------aaa-aat--t-agg-gtgagc
B D                   Gorilla  a-atctcg--acc--tcc----ccttggcctatctcctgcag-------aaa-aat--t-agg-gtgagc
B D                 Orangutan  a-atctcg--acc--tcc----ccttggcctatctcctgcag-------aaa-aat--t-agg-gtgagc
B D                    Gibbon  a-atctcg--act--tcc----ccttggcctatctcctgcag-------aaa-aat--t-agg-gtgagc
B D                    Rhesus  a-atcttg--acc--tcc----ccttggctcagctcctgcag-------aaa-aat--t-agg-gtgagc
B D       Crab-eating macaque  a-atcttg--acc--tcc----ccttggcccagctcctgcag-------aaa-aat--t-agg-gtgagc
B D                    Baboon  a-atcttg--acc--tcc----ccttggcccagctcctgcag-------aaa-aat--t-agg-gtgagc
B D              Green monkey  a-atcttg--acc--tcc----ccttggcccagctcctgcag-------aaa-aat--t-agg-gtgagc
B D                  Marmoset  a-atctcg--acc--tcc----ccttggcccagctcccgtag-------aaa-aat--t-agg-gcgagc
B D           Squirrel monkey  a-atctcg--acc--tcc----ccttggcccagctcctgcag-------aaa-aat--t-agg-gcgagc
B D                  Bushbaby  a-atctgg--atg--tcc----ccttaaagcagctcccgaag-------aat-aat--t-ctg-gcgaga
           Chinese tree shrew  a-atcctg--acc--tcc----cctcagcacagctctgggag-------gga-aac--t-agg-gagaga
                 Prairie vole  a-ttcttg--atc--tcc----tcttagc-catctccggggg-------aaattgc--t-aga-gggaga
B D           Chinese hamster  g-ttcttg--atg--tct----tcttagc-catctccggggg-------aaattgc--t-aga-gtgaga
               Golden hamster  a-ttcttg--atc--tct----tcttaac-catctccggggg-------aaattgc--t-aga-ctgaga
B D                     Mouse  a-atcttg--atc--tcc----tcttaac-catctccggggg-------aaattgc--t-gga-gtgaga
B D                       Rat  a-atcttg--atc--tcc----tctgaac-catctccggagg-------gaattgc--t-gga-gtaaga
B D            Naked mole-rat  t-gtctcg--ctc--tcc----gctccccgcggctcccggga-------aaa--gc--g-ggc-gcgagc
B D                Guinea pig  a-gtccag--cgc--tcg----gctctctgaggctcccgggg-------aaa-cgc--g-ggc-gtgagc
             Brush-tailed rat  a-gtccag--ctc--tcc----gctccccgcggctcccgggg-------aaa-cgc--g-ggctgtgggc
B D                    Rabbit  a-atcttg--gcc--tcc----actgagcccggctcctgagg-------aga-agt--t-cgg-gccgga
B D                      Pika  a-gtctcg--gcc--tcg----gtataacccagctccccaagataaaaaaaa-aat--t-aaa-gcggga
B D                       Pig  a-atcttg--gcc--tct----ccttagtccagctcctggag-------aaa-aat--t-agg-gtgaga
B D                    Alpaca  g-atcttg--gcc--tcc----gcttagtccaactcctggag-------gaa-aat--t-agg-gtgaga
               Bactrian camel  g-atcttg--gcc--tca----gcttagtccaactcctggag-------aaa-aat--t-agg-gtgaga
B D                   Dolphin  a-atcttg--gcc--tcc----ccttacttcaactcccggag-------aaa-aat--t-agg-gcgaga
                 Killer whale  a-atcttg--gcc--tcc----ccttacttcagctcccggag-------aaa-aat--t-agg-gcgaga
             Tibetan antelope  a-atcttg--g---------------------actccgggag-------aat-aat--t-agg-gcgaga
B D                       Cow  a-atcttg--g---------------------actccgggag-------aat-aat--t-agg-gcgaga
B D                     Sheep  a-atcttg--g---------------------actccgggag-------aat-aat--t-agg-gcgaga
                Domestic goat  a-atcttg--g---------------------actccgggag-------aat-aat--t-agg-gcgaga
B D                     Horse  a-atcctg--acc--tcc----ccctagtccagctcctgaag-------aca-aat--t-agt-gtgaga
B D          White rhinoceros  a-atcttt--acg--ttc----ccttagtccagctcctgaag-------a-a-aat--t-agg-gggaga
B D                       Cat  a-atctcgccccc--ccc----ccttagtccagctcccgaag-------aaa-aat--t-agg-gtgaga
B D                       Dog  a-gtcccg--gcc--gcc----cctcggcccggcccccg--g-------gaa-ggt--c-cgg-gcgcga
B D                   Ferret   a-atcttg--gcc--tcc----ccttagtccagctcccgaag-------aga-aat--t-agg-gcgaga
B D                     Panda  a-atcctg--gcc--tcc----ccttagtccagctcccgtag-------aaa-agt--t-gcg-gtgaga
               Pacific walrus  a-atcttg--gcc--tcc----ccttagtccagctcccgaag-------aaa-aat--t-agg-gtgaga
                 Weddell seal  a-atcttg--gcc--tcc----ccttagtccagctcccgaag-------aaa-acc--t-agg-gtgagg
             Black flying-fox  a-atctgg--acc--tca----ctt-agtccagctcccgaag-------aaa-aat--t-------gaga
B D                   Megabat  a-atctgg--acc--tca----ctt-agtccagctcccgaag-------aaa-aat--t-------gaga
                Big brown bat  a-accttg--gcc--ccg----cttcagtccaactcccgaag-------aaa-ggg--tcggg-gtgaga
         David's myotis (bat)  a-atcttg--acc--cct----cttgagtcctactcccgtag-------gac-aat--tcggg-acgaga
B D                  Microbat  a-atcttg--acc--cct----cttgagtcctactcccgaag-------gac-cat--tcggg-acgaga
B D                  Hedgehog  g-atcttg--ttttgtcc----ctttagtttagctcctgaag-------aaa-agt--g-agg-gtgaca
B D                  Elephant  a-atcttg--acc--tccgccttcgtagcccagctccggaag-------gaa-agt--t-aga-gtgaga
          Cape elephant shrew  a---tctg--acc--ttc----tctcgggccagggccagaag-------caa-ggt--t-agg-gtgaga
B D                   Manatee  gaatcttg--ata--tcctccttcttagcccagctccggaag-------gaa-agt--t-agg-gcgaga
             Cape golden mole  a-atcttg--acc--ttc----ccttagcccagctctggaag-------gaa-agt--t-agg-atgaga
                     Aardvark  a-atcttg--aca--tct----ttttagcccagctccagaaa-------gaa-agt--t-agg-gtgaga
B D                 Armadillo  a-ctcttg--ccc--tct----cc---------------aag-------aag-aat--t-agg-gggaga
B D                   Opossum  -------------aattt----tctgcccccctctcctacga-------gaa-aac--g-agg-gtgagc
B D           Tasmanian devil  -------------aattt----tctgcacccctctcccccga-------gaa-aag--g-agg-gtga--
B D                   Wallaby  -------------gattt----tctgcacccttctcctccgg-------gaa-aaaatg-aga-gtgatc
B D                     Shrew  ======================================================================
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
                  Chinchilla  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Platypus  ======================================================================
  D  Chinese softshell turtle  ======================================================================
             Star-nosed mole  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ======================================================================

                        Human  -c--cca--tcctcg--at-----ctgctccg-ccaagttgcggg---------------accgcgg---
                        Chimp  -c--cca--tcctcg--at-----ctgctccg-ccaagttgcggg---------------accgcgg---
                      Gorilla  -c--cca--tcctcg--at-----ctgctccg-ccaagttgcggg---------------accgcgg---
                    Orangutan  -c--cca--tcctcg--at-----ctgctccg-ccaagttgcggg---------------accgcgg---
                       Gibbon  -c--cca--tcctcg--at-----ctgctccg-ccaagttgcggg---------------accgcgg---
                       Rhesus  -c--cca--tcttcg--at-----ctgctccg-ccaagttgcggg---------------accgcgg---
          Crab-eating macaque  -c--cca--tcttcg--at-----ctgccccg-ccaagttgcggg---------------accgcgg---
                       Baboon  -c--cca--tcttcg--at-----ctgctccg-ccaagttgcggg---------------accgcgg---
                 Green monkey  -c--cca--tcctcg--at-----ctgctccg-ccaagttgcggg---------------accgcgg---
                     Marmoset  -c--cca--tcctcg--at-----ctgctccg-ccaagttgcggg---------------gccgcag---
              Squirrel monkey  -c--cca--tcctcg--gt-----cttctccg-ccaagttgcggg---------------accgcgg---
                     Bushbaby  -c--cca--tcccgg--gt-----ctgccggg-ccaggttgcggg---------------cccgcgg---
           Chinese tree shrew  -c--cca--tc-tca--ct-----ctgcctgg-cggagctgcggg---------------gcagtgg---
                 Prairie vole  -c--ccc--tccttg--ac-----cctcttgg-ccaagctgcggg---------------ctggcgg---
              Chinese hamster  -c--ccc--tccttg--ac-----cctcttgg-ccaagctgcggg---------------ctggcgg---
               Golden hamster  -c--ccc--tccttg--ac-----cctcttgg-ccgagctgcggg---------------ctggcgg---
                        Mouse  -c--ccc--tccttg--ac-----cctcttgg-ccaagctgtggg---------------ctggcgg---
                          Rat  -c--ccc--tccttg--ac-----cctcttgg-ccaggctgcggg---------------ctggcgg---
               Naked mole-rat  -c--ccc--tcccga--gccgggtctggtcgg-ccacgccgcggg-------------------------
                   Guinea pig  -c--cac--tcctgg--ac-----ccgttcgg-ctacgctgtggg-------------------------
             Brush-tailed rat  tc--cac--tccctg--g------tcgcccgg-ccacgctgcggg-------------------------
                       Rabbit  -c--ccccagcctcg--ac-----ctgctccg-cggggcggtggg----------------gcgtga---
                         Pika  -g--ccc--gcctct--ac-----cggcttcg-aggggctgcgga----------------ccggga---
                          Pig  -c--cca--tccgcg--at-----ctgcgtggccccagttgcccg---------------gcactgg---
                       Alpaca  -c--ccg--tgcggg--ct-----ctgcgtag-ccaagttgcagg---------------gcactcg---
               Bactrian camel  -c--cca--tgcggg--ct-----ctgcgtag-ccaagctgcagg---------------gcactcg---
                      Dolphin  -c--ccg--tcctgg--at-----ctgcgcgg-ccaagttgccgg---------------gcactgg---
                 Killer whale  -c--ccg--tcccgg--at-----ctgcgcgg-ccaagttgccgg---------------gcactgg---
             Tibetan antelope  -g--ccg--tttagg--at-----ctgcgcgg-ccaagcggccgg---------------ccact-g---
                          Cow  -g--cag--tttagg--at-----ctgcgcgg-ccaaactgccgg---------------gcact-g---
                        Sheep  -g--ccg--tttagg--at-----ctgcgcgg-ccaagctgccgg---------------ccact-g---
                Domestic goat  -g--ccg--tttagg--at-----ctgcgcgg-ccaagctgccgg---------------ccact-g---
                        Horse  -c--cca--tcccgg--ct-----cagc-tgggccaag-cgcggg---------------gcagtgg---
             White rhinoceros  -c--cca--tcctgg--at-----ctgc-tgggccaagtcgcggg---------------gcagtgg---
                          Cat  -c--cca--tgctcg--at-----gtgcgtggc-caagcggacaa---------------acactgg---
                          Dog  -c--ccc--ggctcg--gc-----tcgcgtggcccg----------------------------------
                      Ferret   -c--cca--tgcccg--at-----gtgcgtggctctcgtggaccc---------------gcactag---
                        Panda  -c--ccg--tgctcg--ct-----gtgcgtggcccaagcgggcac---------------gcactgc---
               Pacific walrus  -c--cga--tgctcg--at-----gtgcgtggcccaagtggacac---------------gcactgg---
                 Weddell seal  -c--cga--cgctcg--at-----gtgcgtggccccaacggacac---------------gcactgg---
             Black flying-fox  -c--tca--ttctcg--at-----tcgcttggccca------------------------gctgcgg---
                      Megabat  -c--tca--ttctcg--at-----tcgcttggccca------------------------gctgcgg---
                Big brown bat  -c--cc---ccctcg--ac-----ccgtccggccca------------------------gccgcga---
         David's myotis (bat)  -c--cc---tcctcg--ac-----cagtttggccca------------------------gccgcga---
                     Microbat  -c--cc---tcctcg--ac-----ccgtttggccca------------------------gccgcga---
                     Hedgehog  -c--ccg--gcggcg--ct-----ctgc-tgg----------------------------gccccga---
                     Elephant  -c--ccc--ttcttc--gt-----ctgcttgg-cgaagaagaggg--------------agtcccggagt
          Cape elephant shrew  -catccc--ttatgctgat-----cggcttgg-ctgagaagaggg--------------ggtctcggagt
                      Manatee  -c--ccc--ttcgtg--gt-----ctgcttgg-cgaagaagcggg--------------agtcccggagt
             Cape golden mole  -t--tcc--ttctcc--gt-----tggcttgg-cgaagaa--------------------gtcccggaat
                     Aardvark  -c--ctc--ttctcg--gt-----aggctagg-ctaagaagaggg--------------agtcccggagt
                    Armadillo  -c--cca--tcctcg--gt-----ctgctagg-ccaagaagaggg--------------agtcccgg-gc
                      Opossum  -c--cca--ctgttg--ct-----ctgattgg-ccgggacaagggggttcccacagtctggccaatg---
              Tasmanian devil  --------------g--ct-----ctgattgg-ctggaacaagagggtccccaaagactggctaatg---
                      Wallaby  -c--cct--ccttta--ct-----ctgattgg-ccgaagcaggag--------cagactggccaatg---
                        Shrew  ======================================================================
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Chinchilla  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================
              Star-nosed mole  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Squirrel  ======================================================================

                        Human  --------ggcgt---------ggc--acg-----ctc----------g--gg-----
                        Chimp  --------ggcgt---------ggc--acg-----ctc----------g--gg-----
                      Gorilla  --------ggcgt---------ggc--acg-----ctc----------g--gg-----
                    Orangutan  --------ggcgt---------ggc--acg-----ctg----------g--gg-----
                       Gibbon  --------ggcgt---------ggc--acg-----ctc----------g--gg-----
                       Rhesus  --------ggcgt---------ggc--gcg-----ctc----------g--gg-----
          Crab-eating macaque  --------ggcgt---------ggc--gcg-----ctc----------g--gg-----
                       Baboon  --------ggcgt---------ggc--gcg-----ctc----------g--gg-----
                 Green monkey  --------ggcgt---------ggc--gcg-----ctc----------g--gg-----
                     Marmoset  --------ggcgt----ggcgcggc--gcg-----ctc----------t--gg-----
              Squirrel monkey  --------ggcgt----ggcgcggc--gcg-----ctc----------g--gg-----
                     Bushbaby  --------ggcgt---------gg----cg-----ctc----------g--ag-----
           Chinese tree shrew  --------ggcgt----gg---ggc--gcg-----ctc----------g--gg-----
                 Prairie vole  ----------------------ggc--gct-----ctc----------t--gg-----
              Chinese hamster  ----------------------ggc--gcg-----cgg----------c--gg-----
               Golden hamster  ----------------------ggc--gcg-----ctc----------t--gg-----
                        Mouse  ----------------------ggc--acg-----ct-----------t--gg-----
                          Rat  ----------------------agc--acc-----tt-----------t--gg-----
               Naked mole-rat  -----------------------gc--acg-----ctc----------c--gg-----
                   Guinea pig  -----------------------gt--gcg-----ctt----------c--gg-----
             Brush-tailed rat  ---------------------------acg-----ctc----------c--gg-----
                       Rabbit  ----------------------ggc--gc------ctc----------g--gg-----
                         Pika  ----------------------ggc--gc------ccc----------g--gg-----
                          Pig  --------agctt----gg---ggc--gcg-----ctc----------g--gg-----
                       Alpaca  --------ggcgt----gg---ggc--gcg-----ctc----------g--gg-----
               Bactrian camel  --------ggcgt----gg---ggc--gcg-----ctc----------g--gg-----
                      Dolphin  --------ggcgt----gg---ggc--gcg-----ctc----------g--gg-----
                 Killer whale  --------ggcgt----gg---ggc--gcg-----ctc----------g--gg-----
             Tibetan antelope  --------ggcgt----gg---ggc--gcg-----cta------gctcg--gg-----
                          Cow  --------ggcgt----gg---ggc--gcg-----cta------gctcg--gg-----
                        Sheep  --------ggcgt----gg---ggc--gcg-----ctagctcggggtgg--gg-----
                Domestic goat  --------ggcgt----gg---ggc--gcg-----cta-----ggcgcg--gg-----
                        Horse  --------ggcgt-----g---ggc--gcg-------c----------g--gg-----
             White rhinoceros  --------ggcgt----gg---ggc--gcg-------c----------g--gg-----
                          Cat  --------ggcgt----gg---ggc--gcg-----ctc----------g--gg-----
                          Dog  -----------------gg---gac--gag-----ccc--------------------
                      Ferret   --------cgcct----gg---ggt--gcg-----ctc----------g--gg-----
                        Panda  --------ggcgt----gg---ggc--gcg-----ctc----------g--cc-----
               Pacific walrus  --------ggcgt----gg---ggc--gcg-----ctc----------g--gg-----
                 Weddell seal  --------ggcgt----gg---ggc--gcg-----ctc----------g--gg-----
             Black flying-fox  --------ggcac----cg---agc--gtg-------g----------gttgc-----
                      Megabat  --------ggcac----cg---agc--gtg-------g----------gttgc-----
                Big brown bat  --------ggcgg----tg---ggc--gtg-------g----------g--gc-----
         David's myotis (bat)  --------ggcag----gg---ggc--gcg-------g----------g--gc-----
                     Microbat  --------ggcag----gg---ggc--gcg-------g----------g--gc-----
                     Hedgehog  --------ggcgt----gg---ggc--gcggggagctg----------g--gg-----
                     Elephant  tgccga--ggtgt----gg---ggc--gcg-----ctc----------g--gg-----
          Cape elephant shrew  tgcgcg--ggagtcggagg---cgc--gct-----ctc----------g--gg-----
                      Manatee  tgccag--ggcgt----gg---ggc--gcg-----ctc----------g--ga-----
             Cape golden mole  tgcctg--cgcgc----cg---gga--gcg-----ctc----------t--gg-----
                     Aardvark  tgccagttgctgt----gg---ggctggca-----ttc----------g--ga-----
                    Armadillo  cggccg--agcgc----ag---g-----------------------------------
                      Opossum  --------agctc----ag---ggc--ccg-----cgt----------a--ag--ggg
              Tasmanian devil  --------aactc----gg---gac--ccg-----cgt----------a--agg-ggg
                      Wallaby  --------aactc----gg---ggc--ccg-----cgt----------a--aggtggg
                        Shrew  ==========================================================
                 Atlantic cod  ==========================================================
                  Stickleback  ==========================================================
           Southern platyfish  ==========================================================
       Yellowbelly pufferfish  ==========================================================
                         Fugu  ==========================================================
                    Tetraodon  ==========================================================
                      Chicken  ==========================================================
                 Mallard duck  ==========================================================
           Tibetan ground jay  ==========================================================
                       Medaka  ==========================================================
          Pundamilia nyererei  ==========================================================
                  Zebra mbuna  ==========================================================
        Burton's mouthbreeder  ==========================================================
          Princess of Burundi  ==========================================================
                 Nile tilapia  ==========================================================
                X. tropicalis  ==========================================================
               Painted turtle  ==========================================================
              Green seaturtle  ==========================================================
           American alligator  ==========================================================
                   Chinchilla  ==========================================================
       Lesser Egyptian jerboa  ==========================================================
                  Rock pigeon  ==========================================================
          Collared flycatcher  ==========================================================
          Medium ground finch  ==========================================================
                       Lizard  ==========================================================
             Peregrine falcon  ==========================================================
                 Saker falcon  ==========================================================
                     Platypus  ==========================================================
     Chinese softshell turtle  ==========================================================
              Star-nosed mole  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Squirrel  ==========================================================

Inserts between block 3 and 4 in window
B D                 Elephant 4bp
         Cape elephant shrew 4bp
B D                  Manatee 4bp
            Cape golden mole 3bp
B D                Armadillo 12bp

Alignment block 4 of 343 in window, 56079997 - 56080004, 8 bps 
B D                     Human  gcaggcgg
B D                     Chimp  gcaggcgg
B D                   Gorilla  gcaggcgg
B D                 Orangutan  gcaggcgg
B D                    Gibbon  gcaggcgg
B D                    Rhesus  gcgggcag
B D       Crab-eating macaque  gcgggcag
B D                    Baboon  gcgggcag
B D              Green monkey  gcgggcag
B D                  Marmoset  gcgggcgg
B D           Squirrel monkey  gctggcgg
B D                  Bushbaby  gagggccg
           Chinese tree shrew  ccctgctg
                 Prairie vole  gcggttgt
B D           Chinese hamster  gcgggtgt
               Golden hamster  gcgggtgt
B D                     Mouse  gcgggtgt
B D                       Rat  gcgggtgt
B D            Naked mole-rat  gcaggcgg
B D                Guinea pig  gcaagcgg
             Brush-tailed rat  gagggcgg
B D                    Rabbit  gcgcgcgg
B D                      Pika  gcgcgcg-
B D                       Pig  gcgggccg
B D                    Alpaca  gcgggccg
               Bactrian camel  gcgggccg
B D                   Dolphin  gcgggccg
                 Killer whale  gcgggccg
             Tibetan antelope  gcgggccg
B D                       Cow  gcgggccg
B D                     Sheep  gggggccg
                Domestic goat  gcgggccg
B D                     Horse  gcgggccg
B D          White rhinoceros  gcgggccg
B D                       Cat  gcgggcag
B D                   Ferret   gcgggcgg
B D                     Panda  gcggccag
               Pacific walrus  gcgggcag
                 Weddell seal  gcggccag
             Black flying-fox  gctggcgg
B D                   Megabat  gctggcgg
                Big brown bat  gcaggcgg
         David's myotis (bat)  gcaggcgg
B D                  Microbat  gcaggcgg
B D                  Hedgehog  gcgcgc--
B D                  Elephant  gcaatcag
          Cape elephant shrew  gcagtcgg
B D                   Manatee  ccagtcag
             Cape golden mole  tcagtcag
B D                    Tenrec  gcagtcag
                     Aardvark  gcag--ag
B D                 Armadillo  cctcgcgg
B D                   Opossum  gtgggcgg
B D           Tasmanian devil  gagggttg
B D                   Wallaby  gcgggcgg
B D                     Shrew  ========
B D              Atlantic cod  ========
B D               Stickleback  ========
          Southern platyfish  ========
      Yellowbelly pufferfish  ========
B D                      Fugu  ========
B D                 Tetraodon  ========
B D                   Chicken  ========
  D              Mallard duck  ========
          Tibetan ground jay  ========
B D                    Medaka  ========
         Pundamilia nyererei  ========
                 Zebra mbuna  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D              Nile tilapia  ========
B D             X. tropicalis  ========
  D            Painted turtle  ========
  D           Green seaturtle  ========
B D        American alligator  ========
                  Chinchilla  ========
      Lesser Egyptian jerboa  ========
  D               Rock pigeon  ========
  D       Collared flycatcher  ========
B D       Medium ground finch  ========
B D                    Lizard  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
B D                  Platypus  ========
  D  Chinese softshell turtle  ========
             Star-nosed mole  NNNNNNNN
B D                  Squirrel  ========
B D                       Dog  --------

Inserts between block 4 and 5 in window
            Black flying-fox 6bp
B D                  Megabat 6bp
               Big brown bat 6bp
        David's myotis (bat) 227bp
B D                 Microbat 6bp

Alignment block 5 of 343 in window, 56080005 - 56080006, 2 bps 
B D                     Human  tc
B D                     Chimp  tc
B D                   Gorilla  tc
B D                 Orangutan  tc
B D                    Gibbon  tc
B D                    Rhesus  tc
B D       Crab-eating macaque  tc
B D                    Baboon  tc
B D              Green monkey  tc
B D                  Marmoset  tc
B D           Squirrel monkey  tc
B D                  Bushbaby  tc
           Chinese tree shrew  tc
                 Prairie vole  cc
B D           Chinese hamster  cc
               Golden hamster  cc
B D                     Mouse  ct
B D                       Rat  cc
B D            Naked mole-rat  cg
B D                Guinea pig  cg
             Brush-tailed rat  tg
B D                    Rabbit  cg
B D                       Pig  -c
B D                    Alpaca  -c
               Bactrian camel  -c
B D                   Dolphin  -c
                 Killer whale  -c
             Tibetan antelope  -c
B D                       Cow  -c
B D                     Sheep  -c
                Domestic goat  -c
B D                     Horse  tc
B D          White rhinoceros  tc
B D                       Cat  cc
B D                   Ferret   tc
B D                     Panda  tc
               Pacific walrus  tc
                 Weddell seal  tg
B D                  Hedgehog  t-
B D                  Elephant  tc
          Cape elephant shrew  tt
B D                   Manatee  tc
             Cape golden mole  cc
B D                    Tenrec  tc
                     Aardvark  tc
B D                 Armadillo  cc
B D                   Opossum  tg
B D           Tasmanian devil  tg
B D                   Wallaby  tg
B D                      Pika  --
B D                     Shrew  ==
B D              Atlantic cod  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                 Tetraodon  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
B D             X. tropicalis  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
                  Chinchilla  ==
      Lesser Egyptian jerboa  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D                  Platypus  ==
B D                   Megabat  ==
  D  Chinese softshell turtle  ==
             Star-nosed mole  NN
            Black flying-fox  ==
B D                  Squirrel  ==
        David's myotis (bat)  ==
               Big brown bat  ==
B D                  Microbat  ==
B D                       Dog  --

Inserts between block 5 and 6 in window
B D                  Opossum 9bp
B D          Tasmanian devil 33bp
B D                  Wallaby 33bp

Alignment block 6 of 343 in window, 56080007 - 56080034, 28 bps 
B D                     Human  cgaggctcc----gcaatccc-tactccagcct
B D                     Chimp  cgaggctcc----gcaatccc-tactccagcct
B D                   Gorilla  cgaggctcc----gcaatccc-tactccagcct
B D                 Orangutan  cgaggctcc----gcaatccc-tactccagcct
B D                    Gibbon  cgaggctcc----gcaatccc-tactccagcct
B D                    Rhesus  cgaggctcc----gcaatccc-tactccagcct
B D       Crab-eating macaque  cgaggctcc----gcaatccc-tactccagcct
B D                    Baboon  cgaggctcc----gcaatccc-tactccagcct
B D              Green monkey  cgaggctcc----gcaatccc-tactccagcct
B D                  Marmoset  agaggctcc----gcaatccc-tactccagcct
B D           Squirrel monkey  agaggctcc----gcaatccc-tactccagcct
B D                  Bushbaby  ccggctact----gcaatcac-cactc--ggcc
           Chinese tree shrew  ccgggcttc---ggcaattcc-tgctccagcct
                 Prairie vole  caggctgccagcaaccatcgc-gactccagcct
B D           Chinese hamster  caggctgca------------------------
               Golden hamster  caggctgca---accctcggc-gactccagcct
B D                     Mouse  cgggctaca----accatcag-gactccagcct
B D                       Rat  cgggctaca----accatcag-gacttcagcct
B D            Naked mole-rat  cgaggctcc----gcacgccc-cgctccaaacg
B D                Guinea pig  cgaggctcc----gcacgccc-cgctctagccg
             Brush-tailed rat  cggggctcc----gcacgccc-tgctccagcgg
B D                    Rabbit  ccagcctcc---cgcaacccc-ggccgcagccc
B D                       Pig  cgaggctcc---agcaatcgc-tactccagcct
B D                    Alpaca  ccaggctcc---agcaatccc-gactccagcct
               Bactrian camel  ccaggctcc---agcaatccc-gactccggcct
B D                   Dolphin  agaggctcc---agcaatcgc-tactccagcct
                 Killer whale  agaggctcc---agcaatcgc-tactccagcct
             Tibetan antelope  cgaagctcc---ggcaatcgc-tactccagcct
B D                       Cow  cgaagctcc---ggcaatctc-tactccagcct
B D                     Sheep  cgaagctcc---ggcaatcgc-tactccagcct
                Domestic goat  cgaagctcc---ggcaatcgc-tactccagcct
B D          White rhinoceros  ggaggcggc---ggcaatccc-tat-ccagcct
B D                       Cat  ggaggctcc---agccagctc-cacgccagcct
B D                       Dog  --cggctgc---agc------------------
B D                   Ferret   cgcggctcc---agccttttc-cacgccggcct
B D                     Panda  ggcggctcc---agccagctc-cacgccagcct
               Pacific walrus  ggcagctcc---cgcagtctc-cacgccagcct
                 Weddell seal  cgcggctcc---agccgtctc-cacgccagcct
             Black flying-fox  -gaggctcc---cgcagtccc-cactccagcct
B D                   Megabat  -gaggctcc---cgcagtccc-cactccagcct
                Big brown bat  --aggctcc---cgcagcccg-cgctccagccc
B D                  Microbat  --aggctcc---cgcagccct-cgctccagcct
B D                  Hedgehog  cggggctcc---g--------------------
B D                  Elephant  ggagactcc---agcaaactc---ctccagccc
          Cape elephant shrew  gcaaactcc---tgcaaactc-tgctccagccc
B D                   Manatee  ggaggctcc---agcaaactc---ctgcagccc
             Cape golden mole  cgaggctcc---agcatcctc-tcccccggacc
B D                    Tenrec  cgaggcgcc---a-caaactc-tcccc------
                     Aardvark  ggagactcc---agcaaactc-tgctccagccc
B D                 Armadillo  cgcggcagc---agcaaaccc-gactcccgccc
B D                   Opossum  tgagactcg---ggcgaaatcgaacttcaaccc
B D           Tasmanian devil  tgagttttg---ggtaaaat--aacttgaagcc
B D                   Wallaby  tgagatttg---gtcaaaattgaacttgatgcc
B D                      Pika  ---------------------------------
B D                     Shrew  =================================
B D              Atlantic cod  =================================
B D               Stickleback  =================================
          Southern platyfish  =================================
      Yellowbelly pufferfish  =================================
B D                      Fugu  =================================
B D                 Tetraodon  =================================
B D                   Chicken  =================================
  D              Mallard duck  =================================
          Tibetan ground jay  =================================
B D                    Medaka  =================================
         Pundamilia nyererei  =================================
                 Zebra mbuna  =================================
       Burton's mouthbreeder  =================================
         Princess of Burundi  =================================
B D              Nile tilapia  =================================
B D             X. tropicalis  =================================
  D            Painted turtle  =================================
  D           Green seaturtle  =================================
B D        American alligator  =================================
                  Chinchilla  =================================
      Lesser Egyptian jerboa  =================================
  D               Rock pigeon  =================================
  D       Collared flycatcher  =================================
B D       Medium ground finch  =================================
B D                    Lizard  =================================
  D          Peregrine falcon  =================================
  D              Saker falcon  =================================
B D                  Platypus  =================================
  D  Chinese softshell turtle  =================================
             Star-nosed mole  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  =================================
        David's myotis (bat)  =================================

Alignment block 7 of 343 in window, 56080035 - 56080059, 25 bps 
B D                     Human  cgcgcgg-gagggggcgcggccgtga
B D                     Chimp  cgcgcgg-gagggggcgcggccgtga
B D                   Gorilla  cgagcgg-gagggggcgcggccgtga
B D                 Orangutan  cgcgcgg-gagggggcgcggccgtga
B D                    Gibbon  cgcgcgg-gagggggcgcggccgtga
B D                    Rhesus  cgcgcgg-gagggggcgcggccgtga
B D       Crab-eating macaque  cgcgcgg-gagggggcgcggccgtga
B D                    Baboon  cgcgcgg-gagggggcgcggccgtga
B D              Green monkey  cgcgcgg-gagggggcgcggccgtga
B D                  Marmoset  cgcgcgg-gagggggcgcggccgtga
B D           Squirrel monkey  cgcgcgg-gagggggcgcggccgtga
B D                  Bushbaby  cgcgcgg---aggggcgcggccgtga
           Chinese tree shrew  cgcgcgg-gagggggcgcggccgtga
                 Prairie vole  cgcacag-gagggggcgcggccgtga
B D           Chinese hamster  --------------gcgcggccgtga
               Golden hamster  cgcacgg-gagggggcgcggccgtga
B D                     Mouse  cgcacgg-gagggggcgcggccgtga
B D                       Rat  cgcacgg-gagggggcgcggccgtga
B D            Naked mole-rat  cgcacgc-gagggggcgcggccgtga
B D                Guinea pig  cgcacgc-gagggggcgcggccgtga
             Brush-tailed rat  cgcacgc-gagggggcgcggccgtga
B D                    Rabbit  cgcgcgg-gagggggcgcggccgtga
B D                      Pika  ---gctg-gagggggcgcggctgtga
B D                       Pig  agcgccc-gagggggcgcggccgtga
B D                    Alpaca  cgcgccc-gagggggcgcggccgtga
B D                   Dolphin  cgcgccc-gagggggcgcggccgaga
                 Killer whale  cgcgccc-gagggggcgcggccgaga
             Tibetan antelope  cgcgccc-gagggggcgcggccgaga
B D                       Cow  cgcgccc-gagggggcgcggccgaga
B D                     Sheep  cgcgccc-gagggggcgcggccgaga
                Domestic goat  cgcgccc-gagggggcgcggccgaga
B D          White rhinoceros  cgcgccg-gagggggcgcggccgtga
B D                       Cat  cgcgccg-gagggggcgcggccgtga
B D                       Dog  -------------------gccg---
B D                   Ferret   cgcgccg-gagggggcgcggccgtga
B D                     Panda  cgcgccg-gagtgggcgcggccgtga
               Pacific walrus  cgcgccg-gagggggcgcggccgtga
                 Weddell seal  cgtgccg-gagggggcgcggccgtga
             Black flying-fox  cgcgccc-gcgggggcgcggctgtga
B D                   Megabat  cgcgccc-gcgggggcgcggctgtga
                Big brown bat  cgcgccc-gcgggggcgcggccgtga
B D                  Microbat  cgcgccc-gcgggggcgcggccgtga
B D                  Hedgehog  ---gccg-gagggcgcgcggccgtga
B D                  Elephant  ggctcga-aagggggcgcggccgtga
          Cape elephant shrew  -gcacgg-aagggggcgcggccgtga
B D                   Manatee  cgcgcgg-aagggggcgcggccgtga
             Cape golden mole  cgcgcag-aagggggcgcggccgtga
B D                    Tenrec  ----gag-aagggggcgcggctgtga
                     Aardvark  agcgcggaaagggggcgcggccgtga
B D                 Armadillo  ggcgcgg-gagggggcgcggccgtga
B D                   Opossum  tgcgaaa-gtcagag-gcgctgccag
B D           Tasmanian devil  tactaaa-tgagtaggacactgcccg
B D                   Wallaby  tactaaa-gcaggagagctgcggtga
B D                     Shrew  ==========================
B D              Atlantic cod  ==========================
B D               Stickleback  ==========================
          Southern platyfish  ==========================
      Yellowbelly pufferfish  ==========================
B D                      Fugu  ==========================
B D                 Tetraodon  ==========================
B D                   Chicken  ==========================
  D              Mallard duck  ==========================
          Tibetan ground jay  ==========================
B D                    Medaka  ==========================
         Pundamilia nyererei  ==========================
                 Zebra mbuna  ==========================
       Burton's mouthbreeder  ==========================
         Princess of Burundi  ==========================
B D              Nile tilapia  ==========================
B D             X. tropicalis  ==========================
  D            Painted turtle  ==========================
  D           Green seaturtle  ==========================
B D        American alligator  ==========================
                  Chinchilla  ==========================
      Lesser Egyptian jerboa  ==========================
  D               Rock pigeon  ==========================
  D       Collared flycatcher  ==========================
B D       Medium ground finch  ==========================
B D                    Lizard  ==========================
  D          Peregrine falcon  ==========================
  D              Saker falcon  ==========================
B D                  Platypus  ==========================
  D  Chinese softshell turtle  ==========================
             Star-nosed mole  NNNNNNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  NNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ==========================
        David's myotis (bat)  ==========================

Alignment block 8 of 343 in window, 56080060 - 56080084, 25 bps 
B D                     Human  ct--ca--cccccttccct----ctgcgttcct
B D                     Chimp  ct--ca--cccccttccct----ctgcgttcct
B D                   Gorilla  ct--ca--cccccttccct----ctgcgttcct
B D                 Orangutan  ct--ca--cccccttccct----ctgcgttcct
B D                    Gibbon  ct--ca--cccccttccct----ctgcgttcct
B D                    Rhesus  ct--ca--cccccttccct----ctgcgttcct
B D       Crab-eating macaque  ct--ca--cccccttccct----ctgcgttcct
B D                    Baboon  ct--ca--cccccttccct----ctgcgttcct
B D              Green monkey  ct--ca--cccccttccct----ctgggttcct
B D                  Marmoset  ct--ca--cccccttccct----ctgcgttcct
B D           Squirrel monkey  ct--ca--cccccttccct----ctgcgttcct
B D                  Bushbaby  ct--ca---cccctgcctc----ctgcgt---t
           Chinese tree shrew  ct--ca--cccccttccct----cggcgt---t
                 Prairie vole  ctcaca--cccccttcccc----cttcact---
B D           Chinese hamster  ctcaca--cccccttcccc----cttc------
               Golden hamster  ctcaca--cccccttcccc----cttt------
B D                     Mouse  ct--ca--cccctttcccc----cttcact---
B D                       Rat  ct--ca--cccccttcccc----cttcgct---
B D            Naked mole-rat  ct--ca--cccccttcccctgctct--------
B D                Guinea pig  ct--ca--cccccttctcctgagct--------
             Brush-tailed rat  ct--ca--cccccttctgctgagct--------
B D                    Rabbit  ct--ca--cccggctc-----------------
B D                      Pika  ct--ca--gccagctccccagc-ct--------
B D                       Pig  ct--ca--ccccctcccc-----ctgcgctccc
B D                    Alpaca  ct--ca--ccccctccc----------------
B D                   Dolphin  tt--ca--ccccctccc----------------
                 Killer whale  tt--ca--ccccctccc----------------
             Tibetan antelope  ct--ca--ccccctcccc-----ctgcgctccg
B D                       Cow  ct--ca--ccccctcccc-----ctgcgctccg
B D                     Sheep  ct--ca--ccccctcccc-----ctgcgctccg
                Domestic goat  ct--ca--ccccctcccc-----ctgcgctccg
B D          White rhinoceros  ct--ca--ccccctcccc-----ctgc-ctccc
B D                       Cat  ct--ca--ccccctcccc-----ctgcgctccc
B D                       Dog  --------cccccctccc-----ctgc------
B D                   Ferret   gt--ca--ccccctcccc-----ctgcgctccc
B D                     Panda  ct--ca--cc----cccc-----ctgcgctccc
               Pacific walrus  ct--ca--ccccctcccc-----ctgcgctccc
                 Weddell seal  ct--ca--ccccctcccc-----ctgcgctccc
             Black flying-fox  ct--ca--ccccctcctc-----ctgcactctc
B D                   Megabat  ct--ca--ccccctcctc-----ctgcactctc
                Big brown bat  ct--ca--ccccctcccc-----ccgcgctccc
B D                  Microbat  ct--ca--ccccctcccc-----ctgcgctccc
B D                  Hedgehog  ct--ca--ccccctcccc-----ctgcgctcgc
B D                  Elephant  ct--ca--ccccctcccct----gcgcg-----
          Cape elephant shrew  ct--caccccccctcccct----ccgca-----
B D                   Manatee  ct--ca--ccccctccccg----gcacg-----
             Cape golden mole  ct--ca---cccctccccc----gagcg-----
B D                    Tenrec  ct--ca---cccctcccct----gcgca-----
                     Aardvark  ct--ca--ccccctcccct----gcacg-----
B D                 Armadillo  ct--ca-cccccctccccc----gtgcg-----
B D                   Opossum  cg--ct--agcgagtccgg----gagcggccgt
B D           Tasmanian devil  ct--at--agctagtccta----gagctgccgt
B D                   Wallaby  ct--ca--ccccactcccc----gctcctgcat
  D       Collared flycatcher  cc--cc--ccccccccccc----cccccccccc
B D                     Shrew  =================================
B D              Atlantic cod  =================================
B D               Stickleback  =================================
          Southern platyfish  =================================
      Yellowbelly pufferfish  =================================
B D                      Fugu  =================================
B D                 Tetraodon  =================================
B D                   Chicken  =================================
  D              Mallard duck  =================================
          Tibetan ground jay  =================================
B D                    Medaka  =================================
         Pundamilia nyererei  =================================
                 Zebra mbuna  =================================
       Burton's mouthbreeder  =================================
         Princess of Burundi  =================================
B D              Nile tilapia  =================================
B D             X. tropicalis  =================================
  D            Painted turtle  =================================
  D           Green seaturtle  =================================
B D        American alligator  =================================
                  Chinchilla  =================================
      Lesser Egyptian jerboa  =================================
  D               Rock pigeon  =================================
B D       Medium ground finch  =================================
B D                    Lizard  =================================
  D          Peregrine falcon  =================================
  D              Saker falcon  =================================
B D                  Platypus  =================================
  D  Chinese softshell turtle  =================================
             Star-nosed mole  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  =================================
        David's myotis (bat)  =================================

Inserts between block 8 and 9 in window
                Prairie vole 4bp
B D          Chinese hamster 4bp
              Golden hamster 4bp
B D                    Mouse 4bp
B D                      Rat 1bp

Alignment block 9 of 343 in window, 56080085 - 56080136, 52 bps 
B D                     Human  ------ccctc--------cctctctct----ctctctct--------c------aca---cacacacac
B D                     Chimp  ------ccctc--------cctctctct----ctctctc----------------aca---cacacatac
B D                   Gorilla  ------ccctc--------cctctctct----ctctctct--------c------aca---cacacacac
B D                 Orangutan  ------ccctc--------cctctctct----ctctctctcacacacac------aca---cacacacac
B D                    Gibbon  ------ccctc--------cctctctct----ctctctca--------c------aca---cacacacac
B D                    Rhesus  ------ccctc--------cctctctct----ca--------------c------aca---cacacacac
B D       Crab-eating macaque  ------ccctc--------cctctctct----ca--------------c------aca---cacacacac
B D                    Baboon  ------ccctc--------cctctctct----ca--------------c------aca---cacacacac
B D              Green monkey  ------ccctc--------cctctctct----ca--------------c------aca---cacacacac
B D                  Marmoset  ------ccct---------cctctctct----ctctcacaca------c------aca---cacacacac
B D           Squirrel monkey  ------ccct---------cctctctct----ct--------------c------aca---cacacacac
B D                  Bushbaby  ------ccctc--------cctccgtct----ct--------------c------aca---ggcacacac
           Chinese tree shrew  ------ccctc--------cctctctcc----ctct------------t------aca---gacacacac
       Lesser Egyptian jerboa  ------ccctc--------cctccctccacctcg--------------c------cca---gacgtac-g
                 Prairie vole  ------ccttc--------cctccctcc----tt--------------c------cca---gacag---a
B D           Chinese hamster  ------ccctc--------cgtccctcc----tt--------------c------cca---gacagac-a
               Golden hamster  ------ccctc--------cctccctcc----tt--------------c------cca---gacagac-a
B D                     Mouse  ------ccctccctcccttcctccctcc----ct--------------c------cca---gacagac-a
B D                       Rat  -------------------cgtccctcc----ct--------------c------cca---gacagac-a
B D            Naked mole-rat  -------------------cctccctct---tct--------------c------cca---gacgtac-a
B D                Guinea pig  ----------c--------cctccctct---cag--------------c------cc----gacgtac-a
             Brush-tailed rat  ----------c--------cctccctct---gct--------------c------cca---gacgtac-a
B D                    Rabbit  --------------------------------------------------------------ccgtgctc
B D                      Pika  ---------cc--------ctcccctcc----cg--------------c------cca---gccgcactc
B D                       Pig  ---------tc--------cttcgctcc----ct--------------c------gca---gac-tacac
B D                    Alpaca  ----------c--------ctgcgctcc----ct--------------c------cca---gac-tacac
B D                   Dolphin  ----------c--------ctgcgctcc----ct--------------t------gca---gac-tacac
                 Killer whale  ----------c--------ctgcgctcc----ct--------------t------gca---gac-tacac
             Tibetan antelope  ---------tc--------ctgcgctcc----ct--------------c------gca---gac-tccac
B D                       Cow  ---------tc--------ctgcgctcc----ct--------------c------gca---gac-tccac
B D                     Sheep  ---------tc--------ctgcgctcc----ct--------------c------gca---gac-tccac
                Domestic goat  ---------tc--------ctgcgctcc----ct--------------c------gca---gac-tccac
B D          White rhinoceros  ---------tc--------ctccgcgct----cg----------------------ca---gacacaca-
B D                       Cat  ---------tc--------cttcgccct----ct--------------c------aca---gacatacac
B D                       Dog  --------------------------------------------------------cc---ggcgggc--
B D                   Ferret   ---------tc--------cttcgccct----ct----------------------ca---gacatacac
B D                     Panda  ---------tc--------cttcgccct----ct--------------c------aca---gacatacac
               Pacific walrus  ---------tc--------cttcgccct----ct--------------c------aca---gacgtacac
                 Weddell seal  ---------tc--------cttcgccct----ct--------------c------aca---gacgtacac
             Black flying-fox  ---------t----------------------------------------------ca---gacacacac
B D                   Megabat  ---------t----------------------------------------------ca---gacacacac
                Big brown bat  ---------tc--------ctt--ccct----cg----------------------ca---gacacacac
B D                  Microbat  ---------tc--------ctt--ccct----cg----------------------ca---gacacacac
B D                  Hedgehog  ---------tc--------ctgcgctcg----ct--------------a------gca---gac-ttcac
B D                  Elephant  ------ccctc-------cctccctcct----ct--------------c------aca---gacacacac
          Cape elephant shrew  ------ccctc----------------------------------------------------------c
B D                   Manatee  ------ctctc-------cctccctccc----ct--------------c------aca---ggcacacac
             Cape golden mole  ------ctctccctcccttcttccctcc----ct--------------c------tgcttaaacgcacac
B D                    Tenrec  ------ccctc-------tcctccgccc----ct--------------c------tcc---aacacacac
                     Aardvark  ------ccctc-------tctccctccc----ct--------------c------aca---gacacacac
B D                 Armadillo  ------ccctc--------cctcctgct----ct--------------c------cca---gacacacac
B D                   Opossum  ----------------------gactca----cc--------------ccactcccca---cacacgtac
B D           Tasmanian devil  ----------------------gattca----ct--------------c-------ca---cacatgtat
B D                   Wallaby  ----------------------gcatcc----ct--------------c------------------ttt
  D       Collared flycatcher  ccccccccccc--------ccccccccc----cc--------------c------ccc---ccccccccc
B D                     Shrew  ======================================================================
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
                  Chinchilla  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Platypus  ======================================================================
  D  Chinese softshell turtle  ======================================================================
             Star-nosed mole  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ======================================================================
        David's myotis (bat)  ======================================================================

                        Human  ccct-cccctgcca-tccc
                        Chimp  ccct-cccctgcca-tccc
                      Gorilla  ccct-cccctgcca-tccc
                    Orangutan  ccct-cccctgcca-accc
                       Gibbon  ccct-cccctgcca-tccc
                       Rhesus  ccct-cccctgcca-tcct
          Crab-eating macaque  ccct-cccctgcca-tcct
                       Baboon  ccctccccctgcca-tccc
                 Green monkey  ccct-cccctgcca-tccc
                     Marmoset  ccct-cccctgcca-tccc
              Squirrel monkey  ccct-cccctgccg-tccc
                     Bushbaby  ccct-cccctgccc-tccc
           Chinese tree shrew  ccct-cccctgcca-tccc
       Lesser Egyptian jerboa  ccct-cccctgcca-gccc
                 Prairie vole  gcct-cccctgcag-tccc
              Chinese hamster  ccct-cctctgccg-tccc
               Golden hamster  ccct-cccctgccg-tccc
                        Mouse  ccct-cccctgccg-tccc
                          Rat  ccct-cccctgccg-cccc
               Naked mole-rat  ctct-cccctgcca-tccc
                   Guinea pig  ccct-gctctgcca-cccc
             Brush-tailed rat  ccct-cctctgccg-tccc
                       Rabbit  ccct-cccctgcca-tccc
                         Pika  ccct-cccctgcca-tccc
                          Pig  ccct-cccctgcta-tccc
                       Alpaca  ccct-cccctgcca-tccc
                      Dolphin  ccct-cccctgcca-tccc
                 Killer whale  ccct-cccctgcca-tccc
             Tibetan antelope  tcct-cccctgcca-tccc
                          Cow  tcct-cccctgcca-tccc
                        Sheep  tcct-cccctgcca-tccc
                Domestic goat  tcct-cccctgcca-tccc
             White rhinoceros  ccct-cccctgcca-tccc
                          Cat  ccct-cccctacta-tccc
                          Dog  ---------------cccc
                      Ferret   ccct-cccctgcta-tccc
                        Panda  ccct-cccctgcca-tccc
               Pacific walrus  ccct-cccctgcta-tccc
                 Weddell seal  ccct-cccctgcta-tccc
             Black flying-fox  ccct-cccctgcca-tccc
                      Megabat  ccct-cccctgcca-tccc
                Big brown bat  ccct-cccct-cca-tccc
                     Microbat  ccct-cccctgcca-tccc
                     Hedgehog  ccct--ccctgcca-tccc
                     Elephant  ccct-cctctgcca-cc--
          Cape elephant shrew  ccct-tctcagcca-cc--
                      Manatee  ccct-cctctgcga-cc--
             Cape golden mole  ccct-cccctgcca-cc--
                       Tenrec  ccct-cctctgcca-cc--
                     Aardvark  ccct------gcta-cc--
                    Armadillo  ccct-tccctcccatcc--
                      Opossum  gcac-ccccttcct-tctc
              Tasmanian devil  gcat-tcccttctt-tcct
                      Wallaby  ccct-tcttctcta-gcct
          Collared flycatcher  cccc-ccccccccc-cccc
                        Shrew  ===================
                 Atlantic cod  ===================
                  Stickleback  ===================
           Southern platyfish  ===================
       Yellowbelly pufferfish  ===================
                         Fugu  ===================
                    Tetraodon  ===================
                      Chicken  ===================
                 Mallard duck  ===================
           Tibetan ground jay  ===================
                       Medaka  ===================
          Pundamilia nyererei  ===================
                  Zebra mbuna  ===================
        Burton's mouthbreeder  ===================
          Princess of Burundi  ===================
                 Nile tilapia  ===================
                X. tropicalis  ===================
               Painted turtle  ===================
              Green seaturtle  ===================
           American alligator  ===================
                   Chinchilla  ===================
                  Rock pigeon  ===================
          Medium ground finch  ===================
                       Lizard  ===================
             Peregrine falcon  ===================
                 Saker falcon  ===================
                     Platypus  ===================
     Chinese softshell turtle  ===================
              Star-nosed mole  NNNNNNNNNNNNNNNNNNN
               Bactrian camel  NNNNNNNNNNNNNNNNNNN
                        Horse  NNNNNNNNNNNNNNNNNNN
                     Squirrel  ===================
         David's myotis (bat)  ===================

Inserts between block 9 and 10 in window
B D                  Opossum 10bp
B D          Tasmanian devil 7bp
B D                  Wallaby 10bp

Alignment block 10 of 343 in window, 56080137 - 56080143, 7 bps 
B D                     Human  --tcc-----ccg------g
B D                     Chimp  --tcc-----ccg------g
B D                   Gorilla  --tcc-----ccg------g
B D                 Orangutan  --gcc-----cca------g
B D                    Gibbon  --gcc-----ccg------g
B D                    Rhesus  --gcc-----ccg------g
B D       Crab-eating macaque  --gcc-----ccg------g
B D                    Baboon  --gcc-----ccg------g
B D              Green monkey  --gcc-----ccg------g
B D                  Marmoset  --gcc-----cctgactccg
B D           Squirrel monkey  --gcc-----ccg------g
B D                  Bushbaby  --gcc-----ccg------g
           Chinese tree shrew  --gcc-----ccg------g
       Lesser Egyptian jerboa  --gct-----cct------g
                 Prairie vole  --gct-----ccg------g
B D           Chinese hamster  --gct-----cgg------g
               Golden hamster  --gct-----ccg------g
B D                     Mouse  --gct-----ccg------g
B D                       Rat  --gct-----ccg------g
B D            Naked mole-rat  --gct-----ctg------g
B D                Guinea pig  --gct-----cca------g
             Brush-tailed rat  --gct-----cca------g
B D                    Rabbit  --gcc-----cag------g
B D                      Pika  --gcc-----cag------g
B D                       Pig  --gcc-----ccg------g
B D                    Alpaca  --gcc-----ccg------g
B D                   Dolphin  --gcc-----cca------a
                 Killer whale  --gcc-----cca------a
             Tibetan antelope  --gcc-----ccg-------
B D                       Cow  --gcc-----ccg-------
B D                     Sheep  --gcc-----ccg-------
B D          White rhinoceros  --gcc-----ccg------g
B D                       Cat  --gcc-----ccg------g
B D                       Dog  --gcc-----ccg------g
B D                   Ferret   --gcc-----ccg------g
B D                     Panda  --gcc-----ccg------g
               Pacific walrus  --gcc-----ccg------g
                 Weddell seal  --gcc-----ccg------g
             Black flying-fox  --gcc-----ccg------g
B D                   Megabat  --gcc-----ccg------g
                Big brown bat  --gcc-----ccg------g
B D                  Microbat  --gcc-----ccg------g
B D                  Hedgehog  --gcc-----ccg------g
B D                  Elephant  --cgc-----cag------g
          Cape elephant shrew  --ggc-----cag------g
B D                   Manatee  --cgc-----cag------g
             Cape golden mole  --cgc-----cag------g
B D                    Tenrec  --cgc-----ctc------c
                     Aardvark  --cgc-----cag------g
B D                 Armadillo  --cgcccctgccg------g
B D                   Opossum  --ttc-----tctggtcctg
B D           Tasmanian devil  --tcc-----cct-----ca
B D                   Wallaby  --tct-----ac--------
  D       Collared flycatcher  ccccc-----cc--------
B D                     Shrew  ====================
B D              Atlantic cod  ====================
B D               Stickleback  ====================
          Southern platyfish  ====================
      Yellowbelly pufferfish  ====================
B D                      Fugu  ====================
B D                 Tetraodon  ====================
B D                   Chicken  ====================
  D              Mallard duck  ====================
          Tibetan ground jay  ====================
B D                    Medaka  ====================
         Pundamilia nyererei  ====================
                 Zebra mbuna  ====================
       Burton's mouthbreeder  ====================
         Princess of Burundi  ====================
B D              Nile tilapia  ====================
B D             X. tropicalis  ====================
  D            Painted turtle  ====================
  D           Green seaturtle  ====================
B D        American alligator  ====================
                  Chinchilla  ====================
  D               Rock pigeon  ====================
B D       Medium ground finch  ====================
B D                    Lizard  ====================
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
B D                  Platypus  ====================
  D  Chinese softshell turtle  ====================
               Domestic goat  --------------------
             Star-nosed mole  NNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNN
B D                     Horse  NNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ====================
        David's myotis (bat)  ====================

Alignment block 11 of 343 in window, 56080144 - 56080213, 70 bps 
B D                     Human  actccggctccg------gctccgat------tgcaat-----tt-g----caa-cct----ccgct---
B D                     Chimp  actccggctccg------------at------tgcaat-----tt-g----caa-cct----ccgct---
B D                   Gorilla  actctggctccg------gctccgat------tgcaat-----tt-g----caa-cct----ccgct---
B D                 Orangutan  actccggctccg------gctccgat------tgcaat-----tt-g----caa-cct----ccgct---
B D                    Gibbon  actccggctccg------gctccgat------tgcaat-----tt-g----caa-cct----ccgct---
B D                    Rhesus  actccggctccggctccggctccgat------tgcagt-----tt-g----caa-cct----ccgct---
B D       Crab-eating macaque  actccggctccggctccggctccgat------tgcagt-----tt-g----caa-cct----ccgct---
B D                    Baboon  actccggctccggctccggctccgat------tgcagt-----tt-g----caa-cct----ccgct---
B D              Green monkey  actccggctccggctccggctccgat------tgcagt-----tt-g----caa-cct----ccgct---
B D                  Marmoset  actccggctccg------gctccgat------tgcaat-----tc-g----taa-act----ccgcc---
B D           Squirrel monkey  actccggctccg------gctccgat------tgcaat-----tt-g----taa-act----ccgct---
B D                  Bushbaby  actccggctcca------gctccggt------tgcagt-----tt-------------------------
           Chinese tree shrew  gctccggctccg------gctccggg------tgcaac-----tt-g----caa-cct----ccgc----
       Lesser Egyptian jerboa  actccgactccg------gctccggt------tgccgt-----ct-g----caa-cct----ccgct---
                 Prairie vole  actcggactccg------gctcctct------tgccgt-----cc-g----caa-cct----ccgct---
B D           Chinese hamster  actccgactccg------gctcctgc------tgcagt-----tt-g----caa-tct----ccgat---
               Golden hamster  actccgactccg------gctcctgt------tgcagt-----tt-g----cag-cct----ccggt---
B D                     Mouse  actccgactacg------gctccggt------tgcagt-----tt-g----caa-cct----ccgct---
B D                       Rat  actctgactccg------gctccagt------tgcagt-----tt-g----caa-cct----ccgct---
B D            Naked mole-rat  actctggctccg------gctccggttccgctcgcaat-----tt-g----taa-cct----ctgtg---
B D                Guinea pig  actccggctccg------gc------------cgcaga-----gt-g----caa--ct----ccgag---
             Brush-tailed rat  actccggctccg------gc------------cgcagt-----gt-g----cag-cct----ccctg---
B D                    Rabbit  actcgggctcca------gcgcccgc------ctcagt-----ct-g----caa-ccg----ccgcc---
B D                      Pika  actcaggctcca------gcacccgc------cgtagt-----ct-a----caa-cct----ccgcc---
B D                       Pig  actccggctccg------gctccggt------tgcaat-----tc-g----caa-cct----cctct---
B D                    Alpaca  actccggctccg------gctccggt------tgcagt-----tt-g----caa-cct----cttct---
B D                   Dolphin  actccggctccg------gctccggt------tgcagt-----tt-g----caa-cct----cctct---
                 Killer whale  actccggctccg------gctccggt------tgcagt-----tt-g----caa-cct----cctct---
             Tibetan antelope  -----gactccg------gctccggt------tgcact-----tc-g----cag-cct----cctct---
B D                       Cow  -----gactccg------gctccggt------tgcact-----tc-g----cag-cct----cctct---
B D                     Sheep  -----gactccg------gccccggt------tgcact-----tc-g----cag-cct----cctct---
B D          White rhinoceros  actctggctccg------gctccggt------tgcagt-----gt-g----taa-cct----cctct---
B D                       Cat  actctggctccg------gctcctat------tgcagt-----tt-g----caa-cct----cctct---
B D                       Dog  --------cccg------gctccgat------tgcgct-----cc-g----cag-cct----cc-cc---
B D                   Ferret   actctggctccg------gctccgat------tgcagt-----tt-g----caa-tct----tctct---
B D                     Panda  actctggctccg------gctccgat------tgcagt-----tt-g----caa-cgt----cctct---
               Pacific walrus  actctggctccg------gctcggat------tgcagt-----ct-g----caa-cct----cctct---
                 Weddell seal  actctggctccg------gctccgat------tgcagt-----ct-g----caa-cct----cctct---
             Black flying-fox  actctggctccg------gctccggt------tgcagt-----tt-g----caa-cct----cgtct---
B D                   Megabat  actctggctccg------gctccggt------tgcagt-----tt-g----caa-cct----cgtct---
                Big brown bat  gctccggctccg------gctccggt------tgcact-----tt-g----cca--ct----cctct---
B D                  Microbat  actctggctccg------gctccggt------tgcact-----tt-g----caa--ct----cctct---
B D                  Hedgehog  actctggctcgg------gctccagt------tgcagt-----tt-g----caa-act----cccct---
B D                  Elephant  actccggctccg------gctcgggt------ggtaat-----tt-g--------ctg----ccgcc---
          Cape elephant shrew  actccgactccc------gac-------------taat-----tt-g--------ctc----ctgcc---
B D                   Manatee  actccggctccg------gctcgggc------ggtaat-----tt-a--------ctg----ccgcc---
             Cape golden mole  actctggctccg------g------t------ggtaat-----ct-g--------ctg----ccgcc---
B D                    Tenrec  actccggatccg------g------t------ggtaat-----ct-g--------ctg----ccgcc---
                     Aardvark  actctggctctg------g------t------ggtaat-----tt-g--------ctg----ccgccgtt
B D                 Armadillo  gctctggctcca------g------t------tgcaat-----tt-g----caaactt----ctgcc---
B D                   Opossum  gctccagctcga------gatcctgg------aacacttggtgttgg----cta-cctggccagccc---
B D           Tasmanian devil  gctccaactcta------aatcctgt------aatatttcgtgtt-t----cta-cctggacaaact---
B D                   Wallaby  -------------------atcctgt------aacatctcgt-tt-g----tta-cctggacaggct---
B D                  Platypus  attccaactccg------gcttgtgt------tgc-ct-----tt-g----caa-act-----tgcc---
  D       Collared flycatcher  -ccccccccccc------gtccccgc------tgtccc-----ct-ggcgccag-cag----cggct---
B D                     Shrew  ======================================================================
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
                  Chinchilla  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
               Domestic goat  ----------------------------------------------------------------------
             Star-nosed mole  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ======================================================================
        David's myotis (bat)  ======================================================================

                        Human  g---------ccgt------------c---------gc--cgcagcagcca-cc-aattcgcc-a
                        Chimp  g---------ccgc------------c---------gc--cgcagcagcca-cc-aattcgcc-a
                      Gorilla  g---------ccgc------------c---------gc--cgcagcagcca-cc-aattcgcc-a
                    Orangutan  g---------ccgc------------c---------gc--cgcagcagcca-cc-agttcgcc-t
                       Gibbon  g---------ccgc------------c---------gc--cgcagcagcca-cc-aattcgcc-t
                       Rhesus  g-------------------------c---------gc--cgcagcagcca-cc-aattcgcc-t
          Crab-eating macaque  g-------------------------c---------gc--cgcagcagcca-cc-aattcgcc-t
                       Baboon  g-------------------------c---------gc--cgcagcagcca-cc-aattcgcc-t
                 Green monkey  g-------------------------c---------gc--tgcagcagcca-cc-aattcgcc-t
                     Marmoset  g---------ctgc------------cgccgccgcagc--cgcagccgcca-cc-agttcgct-g
              Squirrel monkey  g---------ccgc------------c---------gc--cgcagccgcca-cc-agtgcgct-g
                     Bushbaby  --------------------------t---------gt--aaccgccgcca-cc-aattcgca-g
           Chinese tree shrew  --------------------------c---------gc--c------------------------
       Lesser Egyptian jerboa  g---------cggc------------c---------ac--tg------ctg-cc-agtccgct-g
                 Prairie vole  g---------ccgc------------c---------gc--tg----cacta-cc-tattcgct-g
              Chinese hamster  ----------------------------------------tgccgccacca-cc-tatgcgccgg
               Golden hamster  g---------ccgc------------c---------gc--tgcctccacca-cc-tatgcgccgg
                        Mouse  g---------ccgc------------c---------gc--gg------cca-cc-taatcgct-g
                          Rat  g---------cggc------------c---------gc--ag------cta-cc-tattcgct-g
               Naked mole-rat  g---------ccgc------------t---------gt--cg---ccgcct-cc-cattcgcg-g
                   Guinea pig  g---------ccac------------c---------gt--tg---ccgcct-cc-cactcgcg-g
             Brush-tailed rat  g---------ctgt------------c---------gt--cg---ccgcct-cc-cattcgcg-g
                       Rabbit  g---------ccgc------------c---------gc--cg----------cc-cgctcgcc-g
                         Pika  g---------ccgc------------c---------ac--ca--------------gctcgct-g
                          Pig  g---------ctgc------------c---------gc--ta----------cc-aagtcgct-g
                       Alpaca  g---------ccgc------------c---------gc--ta----------cc-aagtcgct-g
                      Dolphin  g---------ccg-------------c---------gc--ta----------cc-aagtctcc-g
                 Killer whale  g---------ccgc------------c---------gc--ta----------cg-aagtctcc-g
             Tibetan antelope  g---------ccgc------------c---------gc--ta----------ccggggtcgct-g
                          Cow  g---------ccgc------------c---------gc--ta----------cc-gggtcgct-g
                        Sheep  g---------ccgc------------c---------gc--ta----------ccggggtcgct-g
             White rhinoceros  g---------ccgc------------c---------gc--ta----------cc-aattcgct-g
                          Cat  g---------ccgc------------c---------gc--tg----------ct-aagtcgcc-g
                          Dog  g---------ccgc------------c---------gc--tg----------cc-g-gtcgct-g
                      Ferret   g---------ccgc------------c---------gc--ta----------cc-aagtcact-g
                        Panda  g---------ccgc------------c---------gc--tc----------cc-gagtcgct-g
               Pacific walrus  g---------ccgc------------c---------gc--ta----------cc-aagtcgct-g
                 Weddell seal  g---------ccgc------------c---------gc--ta----------cc-aagtcgct-g
             Black flying-fox  g---------ccgc------------g---------cc--ta----------cc-aattcgcc-g
                      Megabat  g---------ccgc------------g---------cc--ta----------cc-aattcgcc-g
                Big brown bat  g---------ccgc------------c---------gc--tg----------cc-agtccgcc-g
                     Microbat  g---------ccgc------------c---------gc--tg----------cc-agcccgcc-g
                     Hedgehog  g---------ccgc------------c---------gcctca----------cc-cattcgct-g
                     Elephant  g---------ccgc------------c---------ac--ta----------tc-acttcgct-g
          Cape elephant shrew  g---------tccc------------c---------ac--ca----------cc-acttcgct-g
                      Manatee  g---------ccgccgccgccgctggc---------ac--ca----------cc-acttcgct-g
             Cape golden mole  g---------ccac------------t---------ac--ca----------ac-atttggct-g
                       Tenrec  g---------ccgc------------t---------g---ca----------ac-ttctgtcg-g
                     Aardvark  g---------ccgc------------c---------gc--cg----------cc-acttcgct-g
                    Armadillo  g---------ccgc------------c---------gc--ca----------cc-aattcgct-g
                      Opossum  gccgccgccgccgc------------c---------gc--cg----------cc-tcctcccc-t
              Tasmanian devil  g------------c------------c---------tc--tg----------cc-tccccctt-t
                      Wallaby  g---------cgac------------c---------tc--cg----------cc-tcctccct-t
                     Platypus  g---------ccac------------c---------tc--caaggcctccaccc-catcc-----
          Collared flycatcher  g---------tcac------------c---------cc--tg----------cc-ggctcggc-a
                        Shrew  =================================================================
                 Atlantic cod  =================================================================
                  Stickleback  =================================================================
           Southern platyfish  =================================================================
       Yellowbelly pufferfish  =================================================================
                         Fugu  =================================================================
                    Tetraodon  =================================================================
                      Chicken  =================================================================
                 Mallard duck  =================================================================
           Tibetan ground jay  =================================================================
                       Medaka  =================================================================
          Pundamilia nyererei  =================================================================
                  Zebra mbuna  =================================================================
        Burton's mouthbreeder  =================================================================
          Princess of Burundi  =================================================================
                 Nile tilapia  =================================================================
                X. tropicalis  =================================================================
               Painted turtle  =================================================================
              Green seaturtle  =================================================================
           American alligator  =================================================================
                   Chinchilla  =================================================================
                  Rock pigeon  =================================================================
          Medium ground finch  =================================================================
                       Lizard  =================================================================
             Peregrine falcon  =================================================================
                 Saker falcon  =================================================================
     Chinese softshell turtle  =================================================================
                Domestic goat  -----------------------------------------------------------------
              Star-nosed mole  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Horse  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Squirrel  =================================================================
         David's myotis (bat)  =================================================================

Inserts between block 11 and 12 in window
B D                  Opossum 1bp
B D          Tasmanian devil 1bp
B D                  Wallaby 1bp

Alignment block 12 of 343 in window, 56080214 - 56080277, 64 bps 
B D                     Human  gcggttca-------------------------------ggt--gg-ct---cttgcctcgatg---tcc
B D                     Chimp  gcggttca-------------------------------ggt--gg-ct---cttgcctcgatg---tcc
B D                   Gorilla  gcggttca-------------------------------ggt--gg-ct---cttgcctcgatg---tcc
B D                 Orangutan  gcggttca-------------------------------ggt--gc-ct---cttgcctcgatg---tcc
B D                    Gibbon  gcggttca-------------------------------ggt--gg-ct---cttgcctcgatg---tcc
B D                    Rhesus  gcggttca-------------------------------ggt--gg-ct---cttgcctggatg---tcc
B D       Crab-eating macaque  gcggttca-------------------------------ggt--gg-ct---cttgcctggatg---tcc
B D                    Baboon  gcggttca-------------------------------ggt--gg-ct---cttgcctggatg---tcc
B D              Green monkey  gcggttca-------------------------------ggt--gg-ct---cttgcctggatg---tcc
B D                  Marmoset  gcggctca-------------------------------ggt--ga-ct---ctcgcctcgatg---tcc
B D           Squirrel monkey  gcggctca-------------------------------ggt--gg-ct---ctcgcctcgatg---tcc
B D                  Bushbaby  gcggctca-------------------------------ggt--gg-ct---cccgcttcgatg---tcc
           Chinese tree shrew  ------cannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn--gg-ct---atcatttcgatg---tcc
       Lesser Egyptian jerboa  gtggctca-------------------------------ggt--gg-ct--agtcgcttcgatg---tcc
                 Prairie vole  gctgctca-------------------------------ggt--gg-ct---gtcgcttcgatg---tcc
B D           Chinese hamster  gctgctca-------------------------------ggt--gg-ct---gtcgcttcgatg---tcc
               Golden hamster  gctgccca-------------------------------ggt--gg-ct---gtcgcttcgatg---tcc
B D                     Mouse  gctgttca-------------------------------ggt--gg-ct---gtcgcctggatgtcctcc
B D                       Rat  gctgttca-------------------------------ggt--gg-ct---ttcgcttcgatgtcctcc
B D            Naked mole-rat  gcggctaa-------------------------------ggt--gg-cc---gtcgcttcgatg---tcc
B D                Guinea pig  gcggctca-------------------------------ggt--gg-ct---atggcttcaatg---tcc
                   Chinchilla  gccgccca-------------------------------ggt--gg-cc---gtcgcttcgatg---ccc
             Brush-tailed rat  gcggctca-------------------------------ggt--gg-ct---gtcgcttcgatg---ccc
B D                    Rabbit  gcggctca-------------------------------ggt--gg-tt---ctcgcttccatg---tcc
B D                      Pika  gcggctca-------------------------------ggt--gg-ac---cccgcttccatg---tcc
B D                       Pig  gtggctca-------------------------------ggt--gg-ct---c-cgcttcgatg---tcc
B D                    Alpaca  gtggctca-------------------------------ggt--gg-ct---c-cgcttcgatg---tcc
B D                   Dolphin  gcggctca-------------------------------ggt--gg-ct---c-cgcttagatg---tcc
                 Killer whale  gcggctca-------------------------------ggt--gg-ct---c-cgcttagatg---tcc
             Tibetan antelope  gcggctca-------------------------------ggt--gg-ct---c-cgcttcgatg---tcc
B D                       Cow  gcggctca-------------------------------ggt--gg-ct---t-cgcttcgatg---tcc
B D                     Sheep  gcggctca-------------------------------ggt--gg-ct---c-cgcttcgatg---tcc
B D          White rhinoceros  gcggctca-------------------------------ggt--gg-ct---c-cgcttcgatg---tcc
B D                       Cat  gcggctca-------------------------------ggt--gg-ct---c-cgcttcgatg---tcc
B D                       Dog  gcggctca-------------------------------ggt--gg-cc---c-cgctcggatg---tcc
B D                   Ferret   gcggttca-------------------------------ggt--gg-ct---c-cgcttcgatg---tcc
B D                     Panda  gcggctca-------------------------------ggt--gg-ct---c-cgcttcgatg---tcc
               Pacific walrus  gcggctca-------------------------------ggt--gg-ct---c-cgcttcgatg---tcc
                 Weddell seal  gcggctca-------------------------------ggt--gg-ct---c-cgcttcgatg---tcc
             Black flying-fox  ggggctca-------------------------------ggt--gg-ct---c-cgcttggatg---tct
B D                   Megabat  ggggctca-------------------------------ggt--gg-ct---c-cgcttggatg---tct
                Big brown bat  ggaactca-------------------------------ggt--gg-ct-----ggtttcgatg---tct
B D                  Microbat  ggaactca-------------------------------ggt--gg-ct-----ggtttcgatg---tct
B D                  Hedgehog  gcggctca-------------------------------ggt--gg-ct---c-cgcttcgatg---tcc
B D                  Elephant  gcggctca-------------------------------ggt--gg-ct---cctgcctcgatg---tcc
          Cape elephant shrew  gcggctca-------------------------------ggt--gg-tt---cagtcttcgatg---tcc
B D                   Manatee  gcggctca-------------------------------ggt--gg-ct---cccgcttcgatg---tcc
             Cape golden mole  gcggctca-------------------------------ggt--gg-ct---cccgcttcgatg---tct
B D                    Tenrec  --ggctca-------------------------------ggt--gacct---ccggcttcgatg---ccc
                     Aardvark  gcggctca-------------------------------ggt--gg-ct---cccgcttcgatg---tcc
B D                 Armadillo  gcggctca-------------------------------ggt--gg-cc---cccgcttggatg---tcc
B D                   Opossum  cgagctca-------------------------------ggt--gg-cttgcccagtcctgatg---tct
B D           Tasmanian devil  ggagttta-------------------------------ggtctta-ttttcttagtcttaatc---tct
B D                   Wallaby  gccgctcc-------------------------------ggc-------------------ggc---tct
B D                  Platypus  --acctca-------------------------------gga--gg-cc---gtcgaacccctg---tgc
  D       Collared flycatcher  -------------------------------------------------------gcgcgctcg---tcc
B D                     Shrew  ======================================================================
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
               Domestic goat  ----------------------------------------------------------------------
             Star-nosed mole  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ======================================================================
        David's myotis (bat)  ======================================================================

                        Human  tagccta-gggg----c--------------c-ccc----g-ggccgg--acttgg--ctggg
                        Chimp  tagccta-gggg----c--------------c-ccc----g-ggccgg--acttgg--ctggg
                      Gorilla  tagccta-gggg----c--------------c-ccc----g-ggccgg--actcgg--ctggg
                    Orangutan  tagtcta-gggg----c--------------c-ccc----g-ggccgg--actctg--ctggg
                       Gibbon  tagtcta-gggg----c--------------c-ccc----g-ggccgg--actcgg--ctggg
                       Rhesus  tagtcta-gggg----c--------------c-ccc----g-ggccgg--actcgg--ctggg
          Crab-eating macaque  tagtcta-gggg----c--------------c-ccc----g-ggccgg--actcgg--ctggg
                       Baboon  tagtcta-gggg----c--------------c-ccc----g-ggccgg--actcgg--ctggg
                 Green monkey  tagtcta-gggg----c--------------c-ccc----g-ggccgg--actcgg--cgggc
                     Marmoset  tagtctc-ggga----c--------------c-ccc----g-ggccgg--actggg--ctggg
              Squirrel monkey  tagccta-ggga----c--------------c-ccc----g-ggccgg--actggg--ctggg
                     Bushbaby  tagtcca-gggg----c--------------c-ccc----g-ggccgg--actcgg--ctggg
           Chinese tree shrew  tagtcca-ggag----c--------------c-ctc----g-ggccgg--acgcgg--c-gag
       Lesser Egyptian jerboa  tagacca-gggggccct--------------c-ccc----g-ggccgg--actcga--ctggg
                 Prairie vole  taatcca-gggg----c--------------c-ccc----g-ggccag--actcgg--ctggg
              Chinese hamster  taaccca-gggg----c--------------c-ccc----g-ggccag--actcgg--ctggg
               Golden hamster  taaccca-gggg----c--------------c-ccc----g-ggccag--actcgc--ctggg
                        Mouse  taatctt-gggg----g--------------c-ccc----g-ggccag--actcgg--ctggg
                          Rat  taatctt-gggg----c--------------c-ccc----g-ggccag--actcgg--caggg
               Naked mole-rat  tagtcca-gggg----t--------------c-ccc----g-ggccgg--gctcgg--ctggg
                   Guinea pig  tagt-cc-acgg----t--------------c-ccccgccg-ggccgg--actcgg--ctggg
                   Chinchilla  tagt-cc-gggg----c--------------c-ccc------ggccgg--actcgg--ctggg
             Brush-tailed rat  tagtccc-gggg----c--------------c-ccc----g-ggccgg--actcgg--ctggg
                       Rabbit  tagtgca-gggg----c--------------c-ccc----g-ggccgg--actcgg--ctggg
                         Pika  tagtgcaggggg----c--------------c-ccc----g-ggccgg--actcgg--ctggg
                          Pig  tagtcca-gggg----c-t------------c-ccc----c-ggccgg--attggg--ctggg
                       Alpaca  tagttcc-gggg----c-c------------c-ctc----c-ggccgg--attggg--ctggg
                      Dolphin  tagtcca-gggc----cgc------------c-ccc----c-ggccgg--attggg--ctggg
                 Killer whale  tagtcca-ggga----cgc------------c-ccc----c-ggccgg--attggg--ctggg
             Tibetan antelope  tagtcca-gggc----c-c------------t-tcc----c-ggccgg--cttggg--ctggg
                          Cow  tagtcca-gggc----c-c------------t-tcc----c-ggccgg--cttggg--ctggg
                        Sheep  tagtcca-gggc----c-c------------t-tcc----c-ggccgg--cttggg--ctggg
             White rhinoceros  tagtcca-gggg----c-c------------c-ccc----g-ggccgg--attcgg--ctggg
                          Cat  tagtcca-gcac----c-cccccaccccca-c-ccc----g-ggccgg--attcgg--cgggg
                          Dog  tagtcgg-ggc--------------------c-ccc----g-ggacgg--atcccg--cgggg
                      Ferret   tagtcca-gccc----c-cccaccccacgccg-ccc----g-ggctgg--attcgg--cgggg
                        Panda  tagtcca-gggg----g-c------------c-ccc----g-ggccgg--attcgg--cgggg
               Pacific walrus  tagtcca-gcgc----c-ccccgtccccccgc-ccc----g-ggccgg--attcgg--cgggg
                 Weddell seal  tagtcca-gcgc----c-ccccgtccccccgc-ccc----g-ggccgg--attcgg--cgggg
             Black flying-fox  tagtcca-agg----------------tcccc-ccc----g-ggccga--atacgg--ctggg
                      Megabat  tagtcca-agg---------------cccccc-ccc----g-ggccga--atacgg--ctggg
                Big brown bat  tagtccc-ggg-------------------gc-ccc----g-ggccg---atccgg--ccgcg
                     Microbat  tagtccc-ggg-------------------gcgccc----g-ggccg---actcgg--ctgcg
                     Hedgehog  tagtcca-gggg----c-c------------c-cca----g-ggccgg--gttcgg--ctggg
                     Elephant  tagtcca-gggg----c--------------c-ccc----ggggccgg--acttgg--ctggg
          Cape elephant shrew  tagtccc-aggg----c--------------c-ccc----g-------------gg--ctggg
                      Manatee  tagtcca-gggg----c--------------c-ccc----g-ggccga--actcgg--ctggg
             Cape golden mole  cagtcca-gggg----c--------------c-ccc----g-ggccgg--attcgc--ctggg
                       Tenrec  tagtcca---gg----c--------------c-ccg----g-ggccgg--accccg--ctggg
                     Aardvark  tagccca-gggg----c--------------c-ccc----g-ggccgg--actcgg--ctggg
                    Armadillo  tagtcca-gggg----c--------------c-ccc----cgggccgg--gctcgg--ctggg
                      Opossum  tagcccc-ggag----c--------------c-cca----g-cccggg--cccgggcccccgg
              Tasmanian devil  taacctc-agag-------------------c-ccg----t-cctcgg--ccccaa--ctcag
                      Wallaby  ----ccc-agag----c--------------c-ccg----g-cctgggccccccaa--cccag
                     Platypus  tagtccc-aaac----c--------------t-gat---------------------------
          Collared flycatcher  cgggcac-ggct----c--------------c-ccc----c-agcccc--ctgtgc--ctctg
                        Shrew  ===============================================================
                 Atlantic cod  ===============================================================
                  Stickleback  ===============================================================
           Southern platyfish  ===============================================================
       Yellowbelly pufferfish  ===============================================================
                         Fugu  ===============================================================
                    Tetraodon  ===============================================================
                      Chicken  ===============================================================
                 Mallard duck  ===============================================================
           Tibetan ground jay  ===============================================================
                       Medaka  ===============================================================
          Pundamilia nyererei  ===============================================================
                  Zebra mbuna  ===============================================================
        Burton's mouthbreeder  ===============================================================
          Princess of Burundi  ===============================================================
                 Nile tilapia  ===============================================================
                X. tropicalis  ===============================================================
               Painted turtle  ===============================================================
              Green seaturtle  ===============================================================
           American alligator  ===============================================================
                  Rock pigeon  ===============================================================
          Medium ground finch  ===============================================================
                       Lizard  ===============================================================
             Peregrine falcon  ===============================================================
                 Saker falcon  ===============================================================
     Chinese softshell turtle  ===============================================================
                Domestic goat  ---------------------------------------------------------------
              Star-nosed mole  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Horse  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Squirrel  ===============================================================
         David's myotis (bat)  ===============================================================

Alignment block 13 of 343 in window, 56080278 - 56080280, 3 bps 
B D                     Human  ctc-
B D                     Chimp  ctc-
B D                   Gorilla  ctc-
B D                 Orangutan  ctc-
B D                    Gibbon  ctc-
B D                    Rhesus  ctc-
B D       Crab-eating macaque  ctc-
B D                    Baboon  ctc-
B D              Green monkey  ctc-
B D                  Marmoset  ctc-
B D           Squirrel monkey  ctc-
B D                  Bushbaby  ctc-
           Chinese tree shrew  ctc-
       Lesser Egyptian jerboa  ctc-
                 Prairie vole  ctc-
B D           Chinese hamster  ctc-
               Golden hamster  ctc-
B D                     Mouse  ctc-
B D                       Rat  ctc-
B D            Naked mole-rat  ctc-
B D                Guinea pig  ctc-
                   Chinchilla  ctc-
             Brush-tailed rat  ctc-
B D                    Rabbit  ctc-
B D                      Pika  ctc-
B D                       Pig  ctc-
B D                    Alpaca  ctc-
B D                   Dolphin  ctc-
                 Killer whale  ctc-
             Tibetan antelope  ttc-
B D                       Cow  ctc-
B D                     Sheep  ttc-
B D          White rhinoceros  ctc-
B D                       Cat  ctg-
B D                       Dog  cct-
B D                   Ferret   ccg-
B D                     Panda  ctg-
               Pacific walrus  ctg-
                 Weddell seal  ctg-
             Black flying-fox  ctc-
B D                   Megabat  ctc-
                Big brown bat  cgg-
B D                  Microbat  ctg-
B D                  Hedgehog  cgc-
B D                     Shrew  ccc-
B D                  Elephant  ctc-
          Cape elephant shrew  ctc-
B D                   Manatee  ctc-
             Cape golden mole  ctc-
B D                    Tenrec  cgc-
                     Aardvark  ctc-
B D                 Armadillo  ctc-
B D                   Opossum  cgc-
B D           Tasmanian devil  cat-
B D                   Wallaby  cat-
  D       Collared flycatcher  -cca
B D              Atlantic cod  ====
B D               Stickleback  ====
          Southern platyfish  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D                 Tetraodon  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D                    Medaka  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
B D             X. tropicalis  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
  D               Rock pigeon  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
B D                  Platypus  ----
  D  Chinese softshell turtle  ====
               Domestic goat  ----
             Star-nosed mole  NNNN
              Bactrian camel  NNNN
B D                     Horse  NNNN
B D                  Squirrel  ====
        David's myotis (bat)  ====

Alignment block 14 of 343 in window, 56080281 - 56080294, 14 bps 
B D                     Human  ccttcaccctctg----c
B D                     Chimp  ccttcaccctctg----c
B D                   Gorilla  ccttcaccctctg----c
B D                 Orangutan  ccttcaccctctg----c
B D                    Gibbon  ccttcaccctctg----c
B D                    Rhesus  ccttcaccctccg----c
B D       Crab-eating macaque  ccttcaccctccg----c
B D                    Baboon  ccttcaccctccg----c
B D              Green monkey  ccttcaccgtccg----c
B D                  Marmoset  ccttcaccctccg---cc
B D           Squirrel monkey  ccttcaccctccg---tc
B D                  Bushbaby  ccttctccctcct---tt
           Chinese tree shrew  ccttcactctcctcggct
       Lesser Egyptian jerboa  cctgcaacccccg---cc
                 Prairie vole  ccttcaccctccc---tt
B D           Chinese hamster  ccttcaccctccg---ct
               Golden hamster  ccttcaccctccg---ct
B D                     Mouse  ccttcaccctcca---ct
B D                       Rat  ccttcaccatccg---ct
B D            Naked mole-rat  ccttcaccttctg---ct
B D                Guinea pig  ccttcacctcccg---ct
                   Chinchilla  cgcgcacctcccg---cc
             Brush-tailed rat  ccttcaccttcgg---ct
B D                    Rabbit  ccttcaccctccg---ct
B D                      Pika  ccttcactctcgg---ct
B D                       Pig  ccctcacccgccg---c-
B D                    Alpaca  ccctcaccctcgg---c-
B D                   Dolphin  ccctcactctccg---c-
                 Killer whale  ccctcactctccg---c-
             Tibetan antelope  ccctcaccctccg---c-
B D                       Cow  ccctcaccctacg---c-
B D                     Sheep  ccctcaccctccg---c-
B D          White rhinoceros  ccctcaccctccg---c-
B D                       Cat  ccttcaccctctg---c-
B D                       Dog  ccgccg-cctccg---c-
B D                   Ferret   ccttcaccctccg---c-
B D                     Panda  -------gctccg---c-
               Pacific walrus  ccttcaccctccg---c-
                 Weddell seal  ccttcaccctccg---c-
             Black flying-fox  cgctcaccctccg---c-
B D                   Megabat  cgctcaccctccg---c-
                Big brown bat  cgctccccgtcgg---c-
B D                  Microbat  cgcgccccctgcg---c-
B D                  Hedgehog  ctctcacctcccg---c-
B D                     Shrew  cctgcgccccgcg---c-
              Star-nosed mole  cccgcgcctc-cc---c-
B D                  Elephant  ccctcaccctccg---c-
          Cape elephant shrew  ccctcaccctcta---c-
B D                   Manatee  ccctcaccctccc---c-
             Cape golden mole  ctctcaccctccg---c-
B D                    Tenrec  ccctcggcctcgc---c-
                     Aardvark  ccctcaccctcct---c-
B D                 Armadillo  ccctcactctcct---c-
B D                   Opossum  ---gca------------
B D           Tasmanian devil  ---cca------------
B D                   Wallaby  ---cca------------
B D                  Platypus  cccagaccccagt-----
  D       Collared flycatcher  ccgccacccgcag---c-
B D              Atlantic cod  ==================
B D               Stickleback  ==================
          Southern platyfish  ==================
      Yellowbelly pufferfish  ==================
B D                      Fugu  ==================
B D                 Tetraodon  ==================
B D                   Chicken  ==================
  D              Mallard duck  ==================
          Tibetan ground jay  ==================
B D                    Medaka  ==================
         Pundamilia nyererei  ==================
                 Zebra mbuna  ==================
       Burton's mouthbreeder  ==================
         Princess of Burundi  ==================
B D              Nile tilapia  ==================
B D             X. tropicalis  ==================
  D            Painted turtle  ==================
  D           Green seaturtle  ==================
B D        American alligator  ==================
  D               Rock pigeon  ==================
B D       Medium ground finch  ==================
B D                    Lizard  ==================
  D          Peregrine falcon  ==================
  D              Saker falcon  ==================
  D  Chinese softshell turtle  ==================
               Domestic goat  ------------------
              Bactrian camel  NNNNNNNNNNNNNNNNNN
B D                     Horse  NNNNNNNNNNNNNNNNNN
B D                  Squirrel  ==================
        David's myotis (bat)  ==================

Inserts between block 14 and 15 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 2bp
B D                 Microbat 2bp
B D                 Hedgehog 1bp
B D                    Shrew 1bp
             Star-nosed mole 1bp
B D                 Elephant 2bp
         Cape elephant shrew 2bp
B D                  Manatee 2bp
            Cape golden mole 2bp
B D                   Tenrec 2bp
                    Aardvark 2bp
B D                Armadillo 2bp

Alignment block 15 of 343 in window, 56080295 - 56080296, 2 bps 
B D                     Human  --gg
B D                     Chimp  --gg
B D                   Gorilla  --gg
B D                 Orangutan  --gg
B D                    Gibbon  --gg
B D                    Rhesus  --gg
B D       Crab-eating macaque  --gg
B D                    Baboon  --gg
B D              Green monkey  --gg
B D                  Marmoset  --gc
B D           Squirrel monkey  --gc
B D                  Bushbaby  --gg
           Chinese tree shrew  --gg
       Lesser Egyptian jerboa  --gg
B D           Chinese hamster  --gc
               Golden hamster  --gg
B D                     Mouse  --gt
B D                       Rat  --gg
B D            Naked mole-rat  --gg
B D                Guinea pig  --gg
                   Chinchilla  --gg
             Brush-tailed rat  --gc
B D                    Rabbit  --gg
B D                      Pika  --gc
B D                       Pig  --g-
B D                    Alpaca  --g-
               Bactrian camel  --g-
B D                   Dolphin  --g-
                 Killer whale  --g-
             Tibetan antelope  --g-
B D                       Cow  --g-
B D                     Sheep  --g-
B D          White rhinoceros  --g-
B D                       Cat  --g-
B D                       Dog  --g-
B D                   Ferret   --g-
B D                     Panda  --g-
               Pacific walrus  --g-
                 Weddell seal  --g-
             Black flying-fox  --g-
B D                   Megabat  --g-
                Big brown bat  --g-
B D                  Microbat  --g-
B D                  Hedgehog  --g-
B D                     Shrew  --g-
              Star-nosed mole  --g-
B D                  Elephant  --g-
          Cape elephant shrew  --g-
B D                   Manatee  --g-
             Cape golden mole  --g-
B D                    Tenrec  --g-
                     Aardvark  --g-
B D                 Armadillo  --g-
B D                   Opossum  ---g
B D           Tasmanian devil  ---g
B D                   Wallaby  ---g
B D                  Platypus  ---g
  D       Collared flycatcher  ct--
B D              Atlantic cod  ====
B D               Stickleback  ====
          Southern platyfish  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D                 Tetraodon  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D                    Medaka  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
B D             X. tropicalis  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
  D               Rock pigeon  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
                Prairie vole  ----
  D  Chinese softshell turtle  ====
               Domestic goat  ----
B D                     Horse  NNNN
B D                  Squirrel  ====
        David's myotis (bat)  ====

Inserts between block 15 and 16 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
B D                 Microbat 1bp
B D                 Hedgehog 1bp
B D                    Shrew 1bp
             Star-nosed mole 1bp
B D                  Opossum 1bp
B D          Tasmanian devil 1bp
B D                  Wallaby 1bp
B D                 Platypus 1bp

Alignment block 16 of 343 in window, 56080297 - 56080383, 87 bps 
B D                     Human  agtcatgagggcgaacgacgctctgcaggtgctgggcttgcttttcagcctggcccggggctccgaggtg
B D                     Chimp  agtcatgagggcgaacgacgctctgcaggtgctgggcttgcttttcagcctggcccggggctccgaggtg
B D                   Gorilla  agtcatgagggcgaacgacgctctgcaggtgctgggcttgcttttcagcctggcccagggctccgaggtg
B D                 Orangutan  agtcatgagggcgaacgacgctctgcaggtgctgggcttgcttttcagcctggcccggggctccgaggtg
B D                    Gibbon  agtcatgagggcgaacgacgctctgcaggtgctgggcttgcttttcagcctggcccggggctccgaggtg
B D                    Rhesus  agtcatgagggcgaacggcgctctgcaggtgctgggcttgcttttcaacctggcccggggctccgaggtg
B D       Crab-eating macaque  agtcatgagggcgaacggcgctctgcaggtgctgggcttgcttttcaacctggcccggggctccgaggtg
B D                    Baboon  agtcatgagggcgaacggcgctctgcaggtgctgggcttgcttttcaacctggcccggggctccgaggtg
B D              Green monkey  agtcatgagggcgaacggcgctctgcaggtgctgggcttgcttttcaacctggcccggggctccgaggtg
B D                  Marmoset  agtcatgagggcgaacggcgctctgcaggtgctgggcttgcttttcagcctgacccggggctcagaggtg
B D           Squirrel monkey  agtcatgagggcgaacggcgctctgcaggtgctgggcttgcttttcagcctggcccggggctcagaggtg
B D                  Bushbaby  agtcatgagggcgaatggggctctgcaggtgctgggcttgcttctcagcctggcccggggctccgaggtg
           Chinese tree shrew  agacatgaggacgagcaccgctctgcaggtgctgggcttcctcctcggcctggcccggggctccgaggtg
       Lesser Egyptian jerboa  agtcatgagggccaaccgggctctgcaggtgctgggcttccttctcagcctggcccgcggctccgaggtg
                 Prairie vole  caccatgaaggc------gactctgcaggtgctgggcttccttctcagcctggcccggggttccgagatg
B D           Chinese hamster  aatcatgagggcgattgggactctgcaggtgctgggcttccttctcagcctgacccggggttccgagatg
               Golden hamster  aatcatgagggcgattgggactctgcaggtgctgggcttccttctcagcctggcccggggttccgagatg
B D                     Mouse  aatcatgagtgcgattgggactctgcaggtgctgggtttccttctcagcctggcccggggttccgagatg
B D                       Rat  aatcatgagggcgactgggactctgcaggtgctgtgcttccttctcagcctggcccggggttccgagatg
B D            Naked mole-rat  agtcatgagggcgaatggggctctgcaggtgctgggcttccttctcagcctggcccggggctccgaggtt
B D                Guinea pig  agtcatgagggccagtggggctctgcaggtgctgggcttccttctcagcctggcccggggctcggaggtg
                   Chinchilla  agtcatgagggccggcggggctctgcaggtgctgggcttcctcctgagcctggcccggggctccgaggtg
             Brush-tailed rat  agtcatgagggcgaaaggggctctgcaggtgctaggcttccttctgagcctggcccggggctccgaggtg
B D                    Rabbit  agtcatgcggggaagccgggctctgcaggtgctgggtgtcctgctcagcctggcccggggctccgaggtg
B D                      Pika  aatcatgcgggccagctcggctctgcaggtgctgggcgtccttctcagtctggcccggggctcggacgtg
B D                       Pig  agtcatgagggcgaaccgggctctgcaggtgctgggcttcctcctcagcctggcccggggctccgaggtg
B D                    Alpaca  agtcatgagggtgaacgcggctctgcaggtgttgggcttcctcctcagtctggcccggggctccgaggtg
               Bactrian camel  agtcatgagggtgaacgcggctctgcaggtgttgggcttcctcctcagtctggcccggggctccgaggtg
B D                   Dolphin  agtcatgagagcgaacggggctctgcaggtgctgggcttcctcctcagcctggcccggggctccgaggtg
                 Killer whale  agtcatgagagcgaacggggctctgcaggtgctgggcttcctcctcagcctggcccggggctccgaggtg
             Tibetan antelope  agtcatgaaggtgaaccgggctctgcaggtgctgggtttcctcctcagcctggcccggggctccgaggtg
B D                       Cow  agtcatgagggtgaaccgggctctgcaggtgctgggtttcctcctcagcctggcccggggctccgaggtg
B D                     Sheep  agtcatgaaggtgaaccgggctctgcaggtgctgggtttcctcctcagcctggcccggggctgcg-----
                Domestic goat  agtcatgaaggtgaaccgggctctgcaggtgctgggtttcctcctcagcctggcccggggctccgaggtg
B D          White rhinoceros  cgtcatgagggcgaaccgggctctgcaggtgctgggcttccttctcagcctggcccggggctccgaggtg
B D                       Cat  agtcatgagggcgaatggggctctgcaggtgctgggcttctttctcagcttggcccggggctccgaggtg
B D                       Dog  cctcatgagggcgacagcgccgctgcaggtgctgggcttcctgctcagcttggtccgcgcctcctacgtg
B D                   Ferret   agtcatgagggtgaatgcggctctgcaggtgctgggctttcttctcaacctggcccagggctccgacgtg
B D                     Panda  agccatgagggcgaaggcggctctgcaggtgctgggcttccttctcaacctggcccggggctccgaggtg
               Pacific walrus  agtcatgagggcaaaagcggctctgcaggtgctgggcttccttctcaacctggcccggggctccgaggtg
                 Weddell seal  agtcatgagggcgaacgcggctctgcaggtgctgggcttccttctcaacctggcccggggctccgaggtg
             Black flying-fox  agttatgagggcgaacggggctctacaggtgctgggcttccttctcagcctggcccggggctccgaggtg
B D                   Megabat  agttatgagggcgaacggggctctacaggtgctgggcttccttctcagcctggcccggggctccgaggtg
                Big brown bat  agtcatgagggcgacccgggctctgcaggtgctgggcttcctcctcagcctggcccggggctccgaggtg
B D                  Microbat  agtcatgagggcgcagcgggctctgcaggtgctgggcttcctcctcagcctggcccggggctccgaggtg
B D                  Hedgehog  agtcatgaaggcttgcggggctctgcaggtgctggccttctttctcagcttggcccggggctccgaggtg
B D                     Shrew  agtcatgaaggcggccccagcgctgcaggtgctgggcttgctcctcagcctggcccggggctccgaggtg
              Star-nosed mole  cgtcatgaaggcgaccccggctctgcaggtgctgggcttgctgctcagcctggcccggggctccgaggtg
B D                  Elephant  agtcatgagggcgaacggggctctgcaggtgctgggcttccttctcagcctggcccggggctccgaggtg
          Cape elephant shrew  agttatgaaggcgaacggggctctgcaggtgctgggtttgcttcttagcctggcccggggctccgaggtg
B D                   Manatee  agtcatgagggcgaaaggggctctgcaggtgctgagcttgcttctcagcctggcccaaggctctgaggtg
             Cape golden mole  agtcatgagggcgaacccggctctgcaggtgctgggcttgcttctcagcctggcccggggctccgaagtg
B D                    Tenrec  agtcatgagggcccgcggggcgctgcaggtgctgggcttgcttctcagcctggcccggggctccgaggtg
                     Aardvark  agtcatgagggcaaatggggctctgcaggtgctgggcttgcttctcagcctggcccggggctccgaagtg
B D                 Armadillo  agccatgagggccaaggcggctctgcaggtgctaggcttctttcttagcctggcccggggctcagaggtg
B D                   Opossum  agccatgagggggttcctcgcgctgcaggcattgggctggttcctcaacctggccagcagttcggaggtg
B D           Tasmanian devil  agtgatgaagggattactg---------gtattgggctggctcctccacctggttgggggctcggagttg
B D                   Wallaby  agcgatgaaggggttacgggcgctgcccgtattgggttggctcctccaccaggccaggggctcgaagatg
B D                  Platypus  agccatgaaggaggcaggggagctataggtgctggactgggtgctgagcctggcccagggctctgagttg
  D       Collared flycatcher  --------------------tcccctgggcgcagggccagc------gccgggcccggcgccgctgcctg
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                     Horse  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ======================================================================
        David's myotis (bat)  ======================================================================

                        Human  ggcaact--ctcaggca-gg----
                        Chimp  ggcaact--ctcaggca-gg----
                      Gorilla  ggcaact--ctcaggca-gg----
                    Orangutan  ggcaact--ctcaggca-gg----
                       Gibbon  ggcaact--ctcaggca-gg----
                       Rhesus  ggcaact--ctcaggca-gg----
          Crab-eating macaque  ggcaact--ctcaggca-gg----
                       Baboon  ggcaact--ctcaggca-gg----
                 Green monkey  ggcaact--ctcaggca-gg----
                     Marmoset  ggcaact--ctcaggca-gg----
              Squirrel monkey  ggcaact--ctcaggca-gg----
                     Bushbaby  ggcaact--cacaggca-gg----
           Chinese tree shrew  ggcagct--cgcaggca-gg----
       Lesser Egyptian jerboa  ggcaact--ctcaggca-gg----
                 Prairie vole  ggcaact--ctcaggca-gg----
              Chinese hamster  ggcaact--ctcaggca-gg----
               Golden hamster  ggcaact--ctcaggca-gg----
                        Mouse  ggcaact--ctcaggca-gg----
                          Rat  ggcaact--ctcaggca-gg----
               Naked mole-rat  ggcaact--cgcaggca-gg----
                   Guinea pig  ggcaact--cgcaggca-gg----
                   Chinchilla  ggcagct--cgcaggca-gg----
             Brush-tailed rat  ggcaact--cgcaggca-gg----
                       Rabbit  ggcaact--cgcaggca-gg----
                         Pika  ggcaact--cgcaggca-gg----
                          Pig  ggcaact--ctcaggca-gg----
                       Alpaca  ggcaact--cgcaggca-gg----
               Bactrian camel  ggcaact--cgcaggca-gg----
                      Dolphin  ggcaact--cgcaggca-gg----
                 Killer whale  ggcaact--cgcaggca-gg----
             Tibetan antelope  ggcaatt--cgcaggca-gg----
                          Cow  ggcaact--cgcaggca-gg----
                        Sheep  -----ta--tgcctgcgcga----
                Domestic goat  ggcaatt--cgcaggca-gg----
             White rhinoceros  ggcaact--cgcaggca-gg----
                          Cat  ggcaact--cgcaggca-gg----
                          Dog  ggcaact--cccaggca-gg----
                      Ferret   ggcaact--ctcaggca-gg----
                        Panda  ggcaact--cccaggca-gg----
               Pacific walrus  ggcaact--cccaggca-gg----
                 Weddell seal  ggcaact--cccaggca-gg----
             Black flying-fox  ggcaact--cgcaggca-gg----
                      Megabat  ggcaact--cgcaggca-gg----
                Big brown bat  ggcacct--cgcaggca-gg----
                     Microbat  ggcaact--cgcagtca-gg----
                     Hedgehog  ggcaact--cgcaggca-gg----
                        Shrew  ggcacct--cgcaggca-gg----
              Star-nosed mole  ggcacct--cgcaggca-gg----
                     Elephant  ggcagct--cgcaggca-gg----
          Cape elephant shrew  ggcaact--cgcagaca-gg----
                      Manatee  ggcaact--cgcaggca-gg----
             Cape golden mole  ggcaatt--cgcaggca-gg----
                       Tenrec  ggcagct--cgcaggca-gg----
                     Aardvark  ggcaact--cgcagaca-gg----
                    Armadillo  ggcaact--cgcaggca-gg----
                      Opossum  ggcagct--cacaggca-gg----
              Tasmanian devil  ggcagct--tccaggga-gg----
                      Wallaby  ggtacct--cgcaagca-gg----
                     Platypus  ggcagtt--agtttgca-gg----
          Collared flycatcher  cggggctgctgcagcca-ggcccg
                 Atlantic cod  ========================
                  Stickleback  ========================
           Southern platyfish  ========================
       Yellowbelly pufferfish  ========================
                         Fugu  ========================
                    Tetraodon  ========================
                      Chicken  ========================
                 Mallard duck  ========================
           Tibetan ground jay  ========================
                       Medaka  ========================
          Pundamilia nyererei  ========================
                  Zebra mbuna  ========================
        Burton's mouthbreeder  ========================
          Princess of Burundi  ========================
                 Nile tilapia  ========================
                X. tropicalis  ========================
               Painted turtle  ========================
              Green seaturtle  ========================
           American alligator  ========================
                  Rock pigeon  ========================
          Medium ground finch  ========================
                       Lizard  ========================
             Peregrine falcon  ========================
                 Saker falcon  ========================
     Chinese softshell turtle  ========================
                        Horse  NNNNNNNNNNNNNNNNNNNNNNNN
                     Squirrel  ========================
         David's myotis (bat)  ========================

Alignment block 17 of 343 in window, 56080384 - 56080419, 36 bps 
B D                     Human  taagt-----------------ggc-------g--c-gagagca-------ccggcg--ggctcggcac-
B D                     Chimp  taagt-----------------ggc-------g--c-gagagca-------ccggcg--ggctcggcac-
B D                   Gorilla  taagt-----------------ggc-------g--c-gagagca-------ccggcg--ggctcagcac-
B D                 Orangutan  taagt-----------------ggc-------g--c-gagagca-------ccggcg--ggctcggcaa-
B D                    Gibbon  taagt-----------------gac-------g--c-gagagca-------ccggcg--ggctcagcac-
B D                    Rhesus  taagt-----------------ggc-------g--c-gagagca-------ctggcg--ggctcggcac-
B D       Crab-eating macaque  taagt-----------------ggc-------g--c-gagagca-------ctggcg--ggctcggcac-
B D                    Baboon  taagt-----------------ggc-------g--c-gagagca-------ctggcg--ggctcggcac-
B D              Green monkey  taagt-----------------ggc-------g--c-gagagca-------ctggcg--ggctcggcac-
B D                  Marmoset  taagc-----------------ggc-------g--c-gggaaca-------ccggcg--ggctccgcac-
B D           Squirrel monkey  taagc-----------------ggc-------g--c-gggagca-------ccggcg--ggctccgcac-
B D                  Bushbaby  taagc-----------------ggc-------g--c-gggagc--------caagcg--ggctgggacc-
           Chinese tree shrew  taagt-----------------ggc-------g--c-gggagca-------caggca--ggtttgcagc-
       Lesser Egyptian jerboa  taag--------------------c-------g--c-gggagcc-------ccagc----ggctggaac-
                 Prairie vole  taagc-----------------cgc-------g--cggggagca-------ccagca---ggctggaag-
B D           Chinese hamster  taagc-----------------ggc-------g--cggggagcc-------tcagcc---ggctggaag-
               Golden hamster  taagc-----------------ccc-------g--cggggagcc-------ccagca---ggctggaag-
B D                     Mouse  taagc-----------------cgc-------g--c-gggagcc-------ccagca---ggctggaag-
B D                       Rat  taagc-----------------cgc-------g--c-gggagcc-------ccagaa---gtctggaag-
B D            Naked mole-rat  taagt-----------------ggc-------g--c-gggggcg-------cccgct---ggctgggac-
B D                Guinea pig  taagt-----------------ggt-------a--c-gggggcg-------cccgct---gcccgggac-
                   Chinchilla  taagc-----------------ggcgctggcgc--c-ggcgg------------------gccgggacc-
             Brush-tailed rat  taagt-----------------ggc-------t--c-gggga------------------gcccgaagt-
B D                    Rabbit  taagc-----------------ggc-------g--c-cgcagcg-------ccagcc--ggctcgggtc-
B D                      Pika  taagt-----------------taa-------g--c-ggtcgcggagggcaccaaca--cggtcgggac-
B D                       Pig  taagc-----------------ggc-------g--c-gggagca-------ccggca--ggctcggaac-
B D                    Alpaca  taagc-----------------ggc-------g--c-gggagca-------caggca--ggctcggaac-
               Bactrian camel  taagc-----------------ggc-------g--c-gggagca-------caggc----------aac-
B D                   Dolphin  taagc-----------------ggt-------g--c-gggagca-------ccggca--ggctcggaac-
                 Killer whale  taagc-----------------ggt-------g--c-gggagca-------ccgaca--ggctcggaac-
             Tibetan antelope  taagc-----------------ggc-------g--c-gggagca-------caggcg--ggctccgaac-
B D                       Cow  taagc-----------------ggc-------g--c-gggagca-------ctggcg--ggctccgaac-
B D                     Sheep  tgtgc-----------------ggc-------g--g-ggaagca-------tgggcg--ggcgccgaac-
                Domestic goat  taagc-----------------ggc-------g--c-gggagca-------caggcg--ggctccgaac-
B D          White rhinoceros  taagc-----------------ggc-------g--c-gggagca-------cgggca--g-ctcggacc-
B D                       Cat  taagt-----------------ggc-------a--c-gagggca-------cccgca--gcctcggaac-
B D                       Dog  taagc-----------------ggc-------g--c-gggcgcc-------tggg---------ggggg-
B D                   Ferret   taagc-----------------cgc-------g--c-gggagca-------gcgacc--gtctcggaaa-
B D                     Panda  taagc-----------------ggc-------g--c-gggagca-------ccggcc--gtctcgggat-
               Pacific walrus  taagc-----------------ggc-------g--c-gggatca-------ccggcc--gtctcggaac-
                 Weddell seal  taagc-----------------ggc-------g--c-gggatca-------ccggcc--gtctcggaac-
             Black flying-fox  taagc-----------------ggc-------g--c-gggagca-------ccaaca--agctgggaac-
B D                   Megabat  taagc-----------------ggc-------g--c-gggagca-------ccaaca--agctgggaac-
                Big brown bat  taagc-----------------ggc-------g--c-gggagcg-------tccgca--ggctcggacc-
B D                  Microbat  taagc-----------------ggc-------g--c-gggagca-------tccgaa--ggctcggacc-
B D                  Hedgehog  taagt-----------------gct-------g--c-gggacca-------ccgact--gactccaaac-
B D                     Shrew  taaga-----------------ggc-------g--c-ggagagc-------acggcc-agactcggacc-
              Star-nosed mole  taagt-----------------ggc-------g--c-gggagcc-------ccgacg-ggg---ggacc-
B D                  Elephant  taagc-----------------ggc-------g--g-ggaagca-------ctggcc--aactcggaac-
          Cape elephant shrew  taagc-----------------tgt-------g-cc-gggagca-------tcaacc--tactgggaac-
B D                   Manatee  taagt-----------------ggc-------g--c-gggagca-------ccggcc--aactcggaac-
             Cape golden mole  taagc-----------------ggc-------g--c-gggagca-------tcagcc--aactcagagc-
B D                    Tenrec  taagc-----------ggcgcgggc-------g--c-gggcgcg-------gcagcc--acctc-gctc-
                     Aardvark  taagc-----------------ggc-------g--c-gggagca-------ccagcc--agctcgaaac-
B D                 Armadillo  taagc-----------------ggc-------g--c-ccgcgcc-------ccggca--ggctcggcag-
B D                   Opossum  taagt-----------------ggg-------ggct-gcgggac-------aggggaagagctgggcgct
B D           Tasmanian devil  taagt-----------------ggc-------ggat-gggagag-------aaagga--agctgggagct
B D                   Wallaby  taagtaggttttgggagctagggga-------ggct-gcggaac-------agggga--aactgggtact
B D                  Platypus  aaggc-----------------gac-------g--c-ggggg-a-------ccgccg--ggcctgc----
  D       Collared flycatcher  -----------------tccaggga-------g--c-agcgggg-------ccagcc--tgcgccgtgt-
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                     Horse  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ======================================================================
        David's myotis (bat)  ======================================================================

                        Human  -ctg--
                        Chimp  -ctg--
                      Gorilla  -ctg--
                    Orangutan  -ctg--
                       Gibbon  -ctg--
                       Rhesus  -ctg--
          Crab-eating macaque  -ctg--
                       Baboon  -ctg--
                 Green monkey  -ctg--
                     Marmoset  -ctg--
              Squirrel monkey  -ctg--
                     Bushbaby  -ctg--
           Chinese tree shrew  -ctg--
       Lesser Egyptian jerboa  -ctg--
                 Prairie vole  -cgg--
              Chinese hamster  -cgg--
               Golden hamster  -cgg--
                        Mouse  -ctg--
                          Rat  -ctg--
               Naked mole-rat  -ctg--
                   Guinea pig  -cgg--
                   Chinchilla  -cgg--
             Brush-tailed rat  -cgg--
                       Rabbit  -ctg--
                         Pika  -ctg--
                          Pig  -tcg--
                       Alpaca  -ccg--
               Bactrian camel  -ccg--
                      Dolphin  -ctg--
                 Killer whale  -ctg--
             Tibetan antelope  -ccg--
                          Cow  -ccg--
                        Sheep  -ccg--
                Domestic goat  -ccg--
             White rhinoceros  -ctg--
                          Cat  -ccg--
                          Dog  -ggg--
                      Ferret   -ctg--
                        Panda  -ccg--
               Pacific walrus  -ctg--
                 Weddell seal  -ctg--
             Black flying-fox  -gtg--
                      Megabat  -gtg--
                Big brown bat  -cgg--
                     Microbat  -ctg--
                     Hedgehog  -ccg--
                        Shrew  -gcc--
              Star-nosed mole  -ccg--
                     Elephant  -c----
          Cape elephant shrew  -ccg--
                      Manatee  -c-g--
             Cape golden mole  -c-c--
                       Tenrec  -c-g--
                     Aardvark  -ccg--
                    Armadillo  -ctg--
                      Opossum  gctg--
              Tasmanian devil  gctg--
                      Wallaby  actg--
                     Platypus  ------
          Collared flycatcher  -cccca
                 Atlantic cod  ======
                  Stickleback  ======
           Southern platyfish  ======
       Yellowbelly pufferfish  ======
                         Fugu  ======
                    Tetraodon  ======
                      Chicken  ======
                 Mallard duck  ======
           Tibetan ground jay  ======
                       Medaka  ======
          Pundamilia nyererei  ======
                  Zebra mbuna  ======
        Burton's mouthbreeder  ======
          Princess of Burundi  ======
                 Nile tilapia  ======
                X. tropicalis  ======
               Painted turtle  ======
              Green seaturtle  ======
           American alligator  ======
                  Rock pigeon  ======
          Medium ground finch  ======
                       Lizard  ======
             Peregrine falcon  ======
                 Saker falcon  ======
     Chinese softshell turtle  ======
                        Horse  NNNNNN
                     Squirrel  ======
         David's myotis (bat)  ======

Inserts between block 17 and 18 in window
            Brush-tailed rat 4bp

Alignment block 18 of 343 in window, 56080420 - 56080473, 54 bps 
B D                     Human  g----gag---------c--cgg---a-----a--ccca--gtg-----cgcgcag--------------
B D                     Chimp  g----gag---------c--cgg---a-----a--ccca--gtg-----cgcgcag--------------
B D                   Gorilla  g----gag---------c--cgg---a-----a--ccca--gtg-----cgcgcag--------------
B D                 Orangutan  g----gag---------c--ccg---a-----a--ccca--gtg-----cgcgcag--------------
B D                    Gibbon  g----gag---------c--cgg---a-----a--ccca--gtg-----cgcgcag--------------
B D                    Rhesus  g----gag---------c--cgg---a-----a--ccca--gtg-----cgcgaag--------------
B D       Crab-eating macaque  g----gag---------c--cgg---a-----a--ccca--gtg-----cgcgaag--------------
B D                    Baboon  g----gag---------c--cgg---a-----a--ccca--gtg-----cgcgcag--------------
B D              Green monkey  g----gag---------c--cgg---a-----a--ccca--gtg-----cgcgcag--------------
B D                  Marmoset  g----gag---------c--ccg---a-----a--ccca--gtg-----cgcgcag--------------
B D           Squirrel monkey  g----gag---------c--ccg---a-----a--ccca--gtg-----cgcgcag--------------
B D                  Bushbaby  g----gag---------c--ccg---a-----g--ccgc--g-g-----cgcgcag--------------
           Chinese tree shrew  g----gag---------c--ccc---a-----c--ccca--gtg-----cgcgcca--------------
       Lesser Egyptian jerboa  g----gag---------c--------a-----c--ccga--gcg-----cgcgcag--------------
                 Prairie vole  a----gag---------c--gcg---a-----c--ctga--ggg-----cgcacag--------------
B D           Chinese hamster  agagcgag---------c--gcg---a-----c--ctga--gcg-----cgcgcag--------------
               Golden hamster  agagcgag---------c--gcg---a-----c--ttga--gcg-----cgcgcag--------------
B D                     Mouse  g----ggg---------c--gca---a-----t--ctga--gcg-----ctcgcag--------------
B D                       Rat  g----gag---------cgtgtg---a-----c--ctga--acg-----ctcgcag--------------
B D            Naked mole-rat  g----agg---------c--------g-----g--acgc--cag-----cgcgcgg--------------
B D                Guinea pig  g----ggg---------c--------a-----g--acag--cag-----cacactg--------------
                   Chinchilla  g----gga---------c----------------------------------------------------
             Brush-tailed rat  g----gga---------c----------------------------------------------------
B D                    Rabbit  g----gaa---------c--ccc---a-----a--ccgagggag-----tgcgtgg--------------
B D                      Pika  a----gaacacccctacc--ctc---a-----a--ccgactgag-----tgcacgg--------------
B D                       Pig  g----gat---------c--ccg---a-----g--cgga--gcg-----cgcgggg--------------
B D                    Alpaca  g----gat---------c--ccg---a-----a--ccga--gtg-----cgcgggg--------------
               Bactrian camel  g----gat---------c--ccg---a-----a--ccga--gtg-----cgcgggg--------------
B D                   Dolphin  g----gat---------t--ccg---a-----g--acaa--att-----cgcgggg--------------
                 Killer whale  g----gat---------t--ccg---a-----g--acaa--att-----cgcgggg--------------
             Tibetan antelope  g----gat---------t--ccg---a-----g--ccgg--att-----cgtgggg--------------
B D                       Cow  g----gat---------t--ccg---a-----g--ccgg--att-----cgtgggg--------------
B D                     Sheep  g----gat---------t--ccg---a-----g--ccgg--att-----cgtgggg--------------
B D          White rhinoceros  g----gg----------t--ccg---a-----a--ccga--ggg-----cgcggag--------------
B D                       Cat  g----ga----------c--ccg---a-----a--ccga--gtg-----cgccgaa--------------
B D                       Dog  g----ggg---------c--ccg---g---------cgg--ggg-----cgggggg--------------
B D                   Ferret   g----gat---------c--cct---a-----a--ccca--gtg-----cgcggaa--------------
B D                     Panda  g----gat---------c--ccg---a-----a--ccga--gag-----cgcggaa--------------
               Pacific walrus  g----gat---------c--ccg---a-----a--ccga--gtg-----cgcggaa--------------
                 Weddell seal  g----gat---------c--ccg---a-----a--ccga--gtg-----cgcggaa--------------
             Black flying-fox  g----gac---------c--ccg---a-----a--ccga--gtg-----cgcggag--------------
B D                   Megabat  g----gac---------c--ccg---a-----a--ccga--gtg-----cgcggag--------------
                Big brown bat  g----ggc---------c--cccccga-----g--ccca--gtg-----cgcggag--------------
B D                  Microbat  g----ggc---------c--ccc---g-----a--ccca--gtg-----cgccgag--------------
B D                  Hedgehog  g----gat---------c--ctg---a-----g--ccag--gtg-----cgcagat--------------
B D                     Shrew  g----ggt---------c--ggg---g-----g--tggc--gag-----cgct-----------------
              Star-nosed mole  g----ggc---------t--gtg---c-----g--cggc--gtg-----ggcg-----------------
B D                  Elephant  g----gga---------t--ccg---a-----a--cc----gtg-----cgcggag--------------
          Cape elephant shrew  g----gag---------g--ccg---a-----a--ct----atg-----tg-ggcg--------------
B D                   Manatee  g----gag---------c--ccg---a-----a--cc----gag-----cgcggag--------------
             Cape golden mole  g----gga---------c--cca---g-----a--cc----gcg-----cgcggag--------------
B D                    Tenrec  g----gga---------g--ccg---ga----a--cc----gcg-----cgcgcag--------------
                     Aardvark  c----gaa---------c--cgg---a-----a--cc----gtg-----cgcagag--------------
B D                 Armadillo  g----gag---------c--ccc---a-----gcccc----gag-----cacggag--------------
B D                   Opossum  ---------------------------ggagcc--ccga--gag-----cagggcggggaaccgggcttc
B D           Tasmanian devil  ---------------------------gcacca--ccga--gcg-----ctgggaggagcaggggtctgc
B D                   Wallaby  ---------------------------ggagca--ctga--gca-----cggggag--------------
B D                  Platypus  g----gcg---------c--ccg---g-----a--cgga--gag-----ggggaga--------------
  D       Collared flycatcher  g----ctg---------c--cct---g-----a--ccga--ggggccgccacggggcaccacc-------
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ======================================================================
        David's myotis (bat)  ======================================================================

                        Human  -----cctc--g--ga------g-ggt---atg---g----gcacggt-------ctc-aggcg
                        Chimp  -----cctc--g--ga------g-ggc---atg---g----gcacggt-------ctc-aggcg
                      Gorilla  -----cctc--g--ga------g-ggc---atg---g----gcacggt-------ctc-aggcg
                    Orangutan  -----cctc--g--ga------g-ggc---atg---g----gcacggt-------ctc-aggcg
                       Gibbon  -----cctc--g--ga------g-ggc---atg---g----gtagggt-------ctc-aggcg
                       Rhesus  -----cctc--t--ga------g-ggc---atg---g----gcagggt-------ctc-aggcg
          Crab-eating macaque  -----cctc--t--ga------g-ggc---atg---g----gcagggt-------ctc-aggcg
                       Baboon  -----cctc--t--ga------g-ggc---atg---g----gcagggt-------ctc-aggcg
                 Green monkey  -----cctc--t--ga------g-ggc---atg---g----gcagggt-------ctc-aggcg
                     Marmoset  -----tctc--c--gg------g-ggc---agg---a----gcagggt-------ccc-aggcg
              Squirrel monkey  -----tctc--g--ga------g-ggc---agg---g----gcagggt-------ccc-aggcg
                     Bushbaby  -----tccc--t--ga------g-ggc---agg---a----gcagggt-------gtc-gggca
           Chinese tree shrew  -----tccc--t--ga------a-agc---a-g---g----acggagt-------ctc-aggag
       Lesser Egyptian jerboa  -----actc--t--ga------g-ctg----gg---t----tacgggg-------ttc------
                 Prairie vole  -----accc--t--gg------g-caa---ggg---g----gttcggg-------ttc-tgcc-
              Chinese hamster  -----accc--t--gg------g-caa----gg---g----gttcggg-------ttc-tggc-
               Golden hamster  -----accc--t--gg------a-caa----gg---g----gttcggg-------ttc-tgac-
                        Mouse  -----accc--t--gg------g-caa----gg---a----gtttggg-------ttc-tgac-
                          Rat  -----accc--t--gg------g-caa----gg---a----gttcggg-------cac-tgac-
               Naked mole-rat  -----accc--t--ga------g-ca-----gg---a----ccagggc-------ctc-aggc-
                   Guinea pig  -----a--------ga------g-cc-----tg---a----gcaggg---------cc-aggc-
                   Chinchilla  --------------------------------------------------------cc-gga--
             Brush-tailed rat  --------------------------------------------------------tc-agac-
                       Rabbit  -----tccc--t--ga------g-gcg----cg---g----gcagggt-------ctc-tggcg
                         Pika  -----tccc--c--aa--------------------------cagggt----acacct-tggcc
                          Pig  -----tccg--g--ga------g-ggc---agg---g----gcaggaa-------ccc-gggct
                       Alpaca  -----tccg--g--ga------g-ggc---agg---g----gcaggag-------ctt-gggcg
               Bactrian camel  -----tccg--g--ga------g-ggc---agg---g----gcaggag-------ctt-gggcg
                      Dolphin  -----tgcc--g--ga------g-gcc---agg---g----gcaggag-------ctc-gggct
                 Killer whale  -----tgcc--g--ga------g-gcc---agg---g----gcaggag-------ctc-gggct
             Tibetan antelope  -----tgcc--g--ga------g-gcc---agc---g----gcaggag-------ctt-gggct
                          Cow  -----tgcc--g--ga------g-gcc---agt---g----gcaggag-------ctt-gggct
                        Sheep  -----tgcc--g--ga------g-gcc---agc---g----ccaggag-------ctt-gggct
             White rhinoceros  -----ccct--g--ga------g-------------g----gcagggg-------ctc-ccgca
                          Cat  -----ttct--g--ga------g-------------g----gcagggg-cagcggctg-gggcg
                          Dog  -----ccct--g--gg------a---c---caccccg----gcggggc------------gctg
                      Ferret   -----tcct--g--ga------g-------------g----gcagggggcaggagctg-gggcg
                        Panda  -----tcct--g--ga------a-------------g----gcagggg----------------
               Pacific walrus  -----tcct--g--ga------a-------------g----gcaggag-------ctg-gggcg
                 Weddell seal  -----tcct--g--ga------g-------------g----gcaggag-------ctg-gggcg
             Black flying-fox  -----tcct--g--ga------g---c---agc---g----tcaggag-------atc-cggcg
                      Megabat  -----tcct--g--ga------g---c---agc---g----tcaggag-------atc-cggcg
                Big brown bat  -----tcct--g--gg------g---c---agc---g------ag-------------------
                     Microbat  -----tcct--a--gg------g---c---agc---g------agg-----------c-cgggg
                     Hedgehog  -----gccc--g--gg------c--------gg---g----ctggggc----------------
                        Shrew  -------cg--g--ggtcctgcg--------gg---g----ccgggag-------ct-------
              Star-nosed mole  -------ct--g--gg------g--------gg---gcgccccggggg----------------
                     Elephant  -----ccac--t--ga------g-ggtgtgagg---c----gccgagt-------ctc-gcaca
          Cape elephant shrew  -----tccc--taaaa------g-ggtgtgagg---c----tccgggg-------ctcggtgca
                      Manatee  -----ccac--t--ga------g-ggtgcgacg---t----gccgagt-------ttc-agaca
             Cape golden mole  -----tccc--t--gg------g-ggtacgagg---c----accgagt-------ctc-agttg
                       Tenrec  -----ccgc--c---g------g-ggtgcgagg---c----gcccagt-------ctc------
                     Aardvark  -----ccct--t--ga------g-ggtgtgagg---c----acagagt-------cgc-aaacc
                    Armadillo  -----cccc--t--ga------c-ggc---agg---g----gcagggt-------ctc-aggcg
                      Opossum  gctatgctctgg--ga------g-----------------------------------------
              Tasmanian devil  ga---gccc--g--ga------g-----------------------------------------
                      Wallaby  ----------------------------------------------------------------
                     Platypus  -----actc--g--gc------ccggg---acg---g----ccgcggt-------ttc-gggcg
          Collared flycatcher  -----tccc--t--ga------c-t---------------------------------------
                 Atlantic cod  ================================================================
                  Stickleback  ================================================================
           Southern platyfish  ================================================================
       Yellowbelly pufferfish  ================================================================
                         Fugu  ================================================================
                    Tetraodon  ================================================================
                      Chicken  ================================================================
                 Mallard duck  ================================================================
           Tibetan ground jay  ================================================================
                       Medaka  ================================================================
          Pundamilia nyererei  ================================================================
                  Zebra mbuna  ================================================================
        Burton's mouthbreeder  ================================================================
          Princess of Burundi  ================================================================
                 Nile tilapia  ================================================================
                X. tropicalis  ================================================================
               Painted turtle  ================================================================
              Green seaturtle  ================================================================
           American alligator  ================================================================
                  Rock pigeon  ================================================================
          Medium ground finch  ================================================================
                       Lizard  ================================================================
             Peregrine falcon  ================================================================
                 Saker falcon  ================================================================
     Chinese softshell turtle  ================================================================
                Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Horse  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Squirrel  ================================================================
         David's myotis (bat)  ================================================================

Inserts between block 18 and 19 in window
B D          Tasmanian devil 33322bp

Alignment block 19 of 343 in window, 56080474 - 56080555, 82 bps 
B D                     Human  gcgcgg-gg-tt-----------------g-tggg--tgc-t------g--cccc--c----ggtttgcc
B D                     Chimp  gcgcgg-gg-tt-----------------g-tggg--tgc-t------g--cccc--c----ggtttgcg
B D                   Gorilla  gcgcgg-gg-tt-----------------g-tggg--tgc-t------g--cccc--c----ggtttgcc
B D                 Orangutan  gcgcgg-gg-ga-----------------g-tggg--tgc-t------g--cccc--c----ggtttgcc
B D                    Gibbon  gcgcgg-gg-gt-----------------g-tggg--tgc-t------g--cccc--c----ggtttgcc
B D                    Rhesus  gcgcgg-gg-gt-----------------g-tggg--tgc-t------g--cccc--c-----gtacgcc
B D       Crab-eating macaque  gcgcgg-gg-gt-----------------g-tggg--tgc-t------g--cccc--c-----gtacgcc
B D                    Baboon  gcgcgg-gg-gt-----------------g-tggg--tgc-t------g--cccc--c-----gtacgcc
B D              Green monkey  gcgcgg-gg-gt-----------------g-tggg--tgc-t------g--cccc--c-----gtacgcc
B D                  Marmoset  gcgcgg-gg--t-----------------g-tggg--tgc-t------g--cccc--g----ggtccgcc
B D           Squirrel monkey  gcgcgg-gg--t-----------------g-tggg--tgc-t------g--cgcc--g----ggtccgcc
B D                  Bushbaby  gtgtgg-gacgt-----------------g-gagg--tgc-t------g--gccc--cg---ggtccgct
           Chinese tree shrew  gagtgg-gg-ct-----------------g-gggg--tgc-t------g--acca--cg---ggtccgtt
       Lesser Egyptian jerboa  -------------------------------gggc--tgc-g------a--ctcc--t----gagctgtt
                 Prairie vole  ccgctg-aa-ct-----------------gggggg--tgc-g------a--cccc--g----agtctact
B D           Chinese hamster  gcgctc-aa-ct-----------------gcgggg--tgc-g------a--cccc--g----agtctacc
               Golden hamster  gcgctc-aa-cg-----------------g-gggt--tgc-g------a--cccc--g----agtctacc
B D                     Mouse  gctttg-aa-ct-----------------gggggg--tgc-g------g--taca--g----ggtctgct
B D                       Rat  tctttg-aa-ctggggagtgtgtgtgggggggggg--tgc-g------a--cacc--g----ggtctgct
B D            Naked mole-rat  ttgcgg-ga-tt-----------------c-aggc--tac-g------a--ccct--c----ggtgggct
B D                Guinea pig  tttcag-gg-ct-----------------g-gggc--tat-g------a--cccc--a----gggcgaca
                   Chinchilla  --gcgg-gg----------------------------agc-g------c---------------gcggc-
             Brush-tailed rat  ttgcag-gg-tt-----------------a-gggc--tgc-g------c--cccc--c----gggcggca
B D                    Rabbit  gtgcgg-gg-cc-------------------gggg--tgc-t------g--actctgg----gatctgct
B D                      Pika  gtgcgg-gg-cc-------------------gggt--tac-t------c--ccca---------------
B D                       Pig  gtgcta-gg-ct-------------------gggg--tacgg------a--gccc--c----ggtccgct
B D                    Alpaca  gtgtga-gc-ct-----------------g-gggg--tgctg------a--gccc--a----agcccgct
               Bactrian camel  gtgtga-gc-ct-----------------g-gggg--tgctg------a--gccc--a----agcccgct
B D                   Dolphin  gtgcga-gg-ct-----------------g-gggg--tgcgg------a--gccc--c----ggcgcgct
                 Killer whale  gtgcga-gg-ct-----------------g-gggg--tgcgg------a--gccc--c----ggcgcgct
             Tibetan antelope  gcgcga-gg-ct-------------------gggg--tgtga------a--gccc--c----cgccggct
B D                       Cow  gcgcga-ag-ct-------------------gggg--cgcga------a--gccc--c----cgccggct
B D                     Sheep  gcgcga-gg-ct-------------------gggg--tgtga------a--gccc--c----cgccggct
B D          White rhinoceros  gtgtgacgc-tc-------------------gggg--tgctg------a--ccct--g----ggtccgct
B D                       Cat  gggcga-gg-ct-------------------ggggggtgccc------a--cccc--g----ggtccgct
B D                       Dog  cggcgg-gc-tc-------------------gggg-ctcccg------acccccc--a----cttctgat
B D                   Ferret   gtgcga-gg-tt-------------------ggga--tgccg------a--ccct--g----ggtccgct
B D                     Panda  ------------------------------------------------------c--g----gctccgct
               Pacific walrus  gggcga-gg-tt-------------------gggg--tgccg------a---ccc--g----ggtccgct
                 Weddell seal  gggcga-gg-tt-------------------gggg--tgccg------a---ccc--g----ggtccgct
             Black flying-fox  gcgcga-gg-ct-----------------a-gggg--tgctg------a--cccc--g----gatctgct
B D                   Megabat  gcgcga-gg-ct-------------------gggg--tgctg------a--cccc--g----gatctgct
                Big brown bat  ----gg-t-----------------------gggg--tgctg------g--ccc---g----gctccgct
B D                  Microbat  gggtgg-g-----------------------gggg--ggctg------g--ccct-gg----gggcccct
B D                  Hedgehog  -agacg-cg-cc-------------------gcgc--agt-g------a--gact--g----gaagtgct
B D                     Shrew  -agcta-gg-gc-------------------gggg--cgc-g------g-----t--g----ggactgca
              Star-nosed mole  --gtga-gg-cc-------------------gact--ccc-a------g--cccc--g----ggaccacc
B D                  Elephant  gtgcga-gg-ct-----------------g-aggc--ttctg------a--cccc--g----actccgcg
          Cape elephant shrew  gtg-----------------------------ggg--tgctg------a--cccc--c----ggtcccca
B D                   Manatee  gtgcga-gg-ct-----------------g-gggg--tgctg------a--cccc--g----agtccgcg
             Cape golden mole  gtgcta-----t-----------------g-ggaa--tgctg------a--tccc--g----ggtccgcg
B D                    Tenrec  -----------------------------------------------------------------ccgc-
                     Aardvark  atgtgc-----t-----------------g-gggt--tgctg------a--cccc--g----ggtctgcg
B D                 Armadillo  gcgcga-gg-cc-----------------g-ggag--tgttg------a--cccc--a----gggtcgcg
B D                   Opossum  ---------------------------------------ccg------a--ggac--t----tgcgagtc
B D           Tasmanian devil  ----------------------------------g--agccgggggtcg--gggt--t----ggtgtatc
B D                   Wallaby  ----------------------------------g--agccg------g--gatt--t----ggtgagcc
B D                  Platypus  ----------------------------------------------------------gagggggacggg
  D       Collared flycatcher  ---------------------------------------------------------------gcccgcc
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Horse  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ======================================================================
        David's myotis (bat)  ======================================================================

                        Human  a--g--gacca--cct-----------------------gg---------------------gag-----
                        Chimp  a--g--gacca--cct-----------------------gg---------------------gag-----
                      Gorilla  a--g--gacca--cct-----------------------gg---------------------gag-----
                    Orangutan  a--g--ggcca--cct-----------------------gg---------------------gag-----
                       Gibbon  a--g--gacca--cct-----------------------gg---------------------gag-----
                       Rhesus  ---g--gacca--cct-----------------------gg---------------------gag-----
          Crab-eating macaque  ---g--gacca--cct-----------------------gg---------------------gag-----
                       Baboon  g--g--gacca--cct-----------------------gg---------------------gag-----
                 Green monkey  g--g--gacca--cct-----------------------gg---------------------gag-----
                     Marmoset  g--g--gacca--cct-----------------------gg---------------------gaa-----
              Squirrel monkey  g--g--gacca--cct-----------------------gg---------------------gag-----
                     Bushbaby  g--c--gacca--cct-----------------------ga---------------------gag-----
           Chinese tree shrew  g--g--gacca--cct-----------------------gg---------------------gag-----
       Lesser Egyptian jerboa  g--g--gacca--cct-----------------------ga---------------------gga-----
                 Prairie vole  g--g--aacaa--gca-----------------------aa---------------------gag-----
              Chinese hamster  g--g--gacca--cct-----------------------tg---------------------gag-----
               Golden hamster  c--g--aacca--cct-----------------------ag---------------------gag-----
                        Mouse  c--g--gacca--cca-----------------------ag---------------------gag-----
                          Rat  c--g--cacca--cca-----------------------ag---------------------gag-----
               Naked mole-rat  g--g--gggct--ca------------------------gg---------------------gag-----
                   Guinea pig  g--g--ggcta--cc------------------------gg---------------------gag-----
                   Chinchilla  g--g--ggcca--cc------------------------gg---------------------gag-----
             Brush-tailed rat  g--g--ggtca--cc------------------------gg---------------------gag-----
                       Rabbit  g--g--gatcc--ccg-----------------------ggg-----------------gaaaga-----
                         Pika  ---------cc--ccg-----------------------gg---------------------aga-----
                          Pig  g--g--gacccctcct-----------------------gg---------------------gcg-----
                       Alpaca  g--c--gaccc--ccc-----------------------gg---------------------gtg-----
               Bactrian camel  g--c--gaccc--ccc-----------------------gg---------------------gtg-----
                      Dolphin  g--g--ggccc--cct-----------------------gg---------------------gcg-----
                 Killer whale  g--g--ggccc--cct-----------------------gg---------------------gcg-----
             Tibetan antelope  g--g--gaccc--cct-----------------------gg---------------------gcc-----
                          Cow  g--g--gaccc--cct-----------------------gg---------------------gct-----
                        Sheep  g--g--gaccc--cct-----------------------gg---------------------gcc-----
             White rhinoceros  g--g--gacca--cct-----------------------gg---------------------gcg-----
                          Cat  g--g--gacca--cct-----------------------ag---------------------gcg-----
                          Dog  c--t--g--cg--tcg-----------------------gg---------------------gtg-----
                      Ferret   g--g--gacca--cct-----------------------ag---------------------gca-----
                        Panda  g--g--ggcca--cct-----------------------ag---------------------gca-----
               Pacific walrus  g--g--gacca--cct-----------------------ag---------------------gca-----
                 Weddell seal  g--g--gacca--cct-----------------------ag---------------------gca-----
             Black flying-fox  g--g--gacca--cct-----------------------gg---------------------gcg-----
                      Megabat  g--g--gacca--cct-----------------------gg---------------------gcg-----
                Big brown bat  g--g--ggccg--ccc-----------------------gg---------------------gtg-----
                     Microbat  g--g--ggcca--ctg-----------------------gg---------------------aag-----
                     Hedgehog  g--gctggctc--ccctca-------------------ttc---------------------act-----
                        Shrew  g--g--gactg--ccc-----------------------------------------------cc-----
              Star-nosed mole  t--g--ggcta-----------------------------------------------------------
                     Elephant  g--g--tatca--cct-----------------------gg---------------------gag-----
          Cape elephant shrew  g--a--gacca--gctg----------------------gg---------------------gag-----
                      Manatee  g--g--gatca--cct-----------------------gg---------------------gag-----
             Cape golden mole  g--g--gacca--cct-----------------------ga---------------------gag-----
                       Tenrec  ----------------------------------------------------------------------
                     Aardvark  g--a--gacca--cct-----------------------gg---------------------gag-----
                    Armadillo  g--g--gacca--tct-----------------------gg---------------------gag-----
                      Opossum  t--g--gg--a--ctc----------------------gga---------------------ggg-----
              Tasmanian devil  c--g--ggcaa--cct------------------------------------------------g-----
                      Wallaby  g--g--gggaa--tcttcggcttgcgagcccagggatgggg---------------------ggg-----
                     Platypus  g--a--ggtcg--acc-----------------------ggacgtgagagctgagggacggcgag-----
          Collared flycatcher  gctg--ggcca--cca-----------------------gt---------------------ggcaacaa
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Chinese softshell turtle  ======================================================================
                Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Horse  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Squirrel  ======================================================================
         David's myotis (bat)  ======================================================================

                        Human  --ag-gggcggtc---------a----------gg---ctcg-----------------g--------gt
                        Chimp  --ag-gggcggtc---------a----------gg---ctcg-----------------g--------gt
                      Gorilla  --ag-gggcggtc---------a----------gg---ctcg-----------------g--------gt
                    Orangutan  --ag-gggcggtc---------a----------gg---ctcg-----------------g--------gt
                       Gibbon  --ag-gggcggtc---------a----------gg---ctcg-----------------g--------gt
                       Rhesus  --tg-gggcgatc---------a----------gg---ctcg-----------------g--------gt
          Crab-eating macaque  --tg-gggcgatc---------a----------gg---ctcg-----------------g--------ct
                       Baboon  --tg-gggcgatc---------a----------gg---ctcg-----------------g--------gt
                 Green monkey  --tg-gggcgatc---------a----------gg---ctcg-----------------g--------gt
                     Marmoset  --tg-gggcggtc---------g----------gg---ctcg-----------------g--------gt
              Squirrel monkey  --tg-gggcggtc---------g----------gg---ctcg-----------------g--------gt
                     Bushbaby  --a--gggcggtc---------a----------gg---ctcg-----------------a--------gt
           Chinese tree shrew  --ggcgggcagcc---------a----------gg---cttg-----------------g--------gt
       Lesser Egyptian jerboa  --gg-gaccc-tt----ctttct----------gg---ctag--------------------------gt
                 Prairie vole  --gg-gacca-tg---------t----------gg---ctcg--------------------------gt
              Chinese hamster  --gg-gagcg-tg---------t----------gg---cttg--------------------------at
               Golden hamster  --gg-gaccg-cg---------a----------gg---ctct--------------------------gt
                        Mouse  --gg-gaccg-tg---------t----------gc---ctca--------------------------gt
                          Rat  --gg-ggccg-tg---------t----------gc---ctcg--------------------------gt
               Naked mole-rat  --ag-tagcg-tc---------a----------gg---ctcg-----------------g--------gt
                   Guinea pig  --gg-gagcg-tc---------g----------gg---cttg-----------------a--------gt
                   Chinchilla  --gg-gagcg-tc---------a----------gg---ctcg-----------------c--------gt
             Brush-tailed rat  --gg-gagcg-tt---------a----------gg---ctcg-----------------g--------gt
                       Rabbit  --gg-gcccg-cc---------g----------gg---ctcg-----------------g--------gt
                         Pika  --ga-agccg-cc---------------------------cg-----------------g--------gt
                          Pig  --gg-gaacg-tc---------a----------gg---atcg-----------------g--------gt
                       Alpaca  --gg-ggcca-tc---------a----------gg---ctcg-----------------g--------gt
               Bactrian camel  --gg-gacca-tc---------a----------gg---ctcggggtctcgggcgggggcg--------gt
                      Dolphin  --ga-gaccg-tc---------a----------gg---atca-----------------g--------gt
                 Killer whale  --ga-gaccg-tc---------a----------gg---atca-----------------g--------gt
             Tibetan antelope  -cgg-gaccg-tc---------a----------gg---atgg-----------------g--------gt
                          Cow  -cgg-gaccg-tc---------a----------gg---atgg-----------------g--------gt
                        Sheep  -cgg-gaccg-tc---------a----------gg---atgg-----------------g--------gt
             White rhinoceros  --gg-cactg-cc---------a----------cg---ctgg-----------------g--------gc
                          Cat  --ga-gaccg-tc---------a----------gg---ctcg-----------------g--------gt
                          Dog  --gg-gcccc-cc---------g----------ggacacccc-----------------g--------ct
                      Ferret   --gg-gaccg-tc---------a----------gc---ttcg-----------------g--------gt
                        Panda  --gg-gaccg-tc---------a----------gg---ttcg-----------------g--------gt
               Pacific walrus  --gg-aaccg-tc---------a----------gg----tcg-----------------g--------gt
                 Weddell seal  --gg-aaccg-tc---------a----------gg----tcg-----------------g--------gt
             Black flying-fox  --gg-gaccg-tc---------a----------gg---ctcg-----------------g--------gt
                      Megabat  --gg-gaccg-tc---------a----------gg---ctcg-----------------g--------gt
                Big brown bat  --gg-gaccg-cc---------a----------gg---ctcg-----------------g--------g-
                     Microbat  --gg-gatcgacc---------a----------ag---ctcg-----------------g--------t-
                     Hedgehog  --gg-gggta-cc---------t----------gg---gcga-----------------a--------gg
                        Shrew  --gg-ggtcc-cc---------g----------gg---gtcc-----------------t--------cc
              Star-nosed mole  --gg-tgttg-cc---------gtcgtgcgtttgg---gttt-----------------c--------gg
                     Elephant  --gg-gacgg-tc---------a----------gg---tttg-----------------gtggcttgggt
          Cape elephant shrew  --ag-gaggg-tc---------a----------ga---ctca-----------------gaggctgaagt
                      Manatee  --gg-gacgg-tc---------g----------gg---ctcg-----------------gagtctcggat
             Cape golden mole  --gg-aacga-tc---------a----------gc---ctca-----------------g--------gt
                       Tenrec  ------------c---------a----------ga---cttg-----------------g--------gt
                     Aardvark  --gg-ggcgg-tc---------a----------gg---ctca-----------------g--------at
                    Armadillo  --ga-gacgg-cc---------g----------gc---tcca-----------------gaggttcgggg
                      Opossum  --gt-cagtg-cctgcagcccca----------gt---cctg-----------------g--------cc
              Tasmanian devil  --gg-agacg-cc---------------------g---ctcg-----------------t--------ct
                      Wallaby  --gg-cggtg-cctgaagcctca----------ag---cctg-----------------t--------ct
                     Platypus  --ga-ggacggcg---------a----------gg---ttcg-----------------g--------tc
          Collared flycatcher  ccag-caccc-ca---------g----------gg---ctca-----------------gggacaggagt
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Chinese softshell turtle  ======================================================================
                Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Horse  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Squirrel  ======================================================================
         David's myotis (bat)  ======================================================================

                        Human  t--atcgg--cgtgg-t---cc-----
                        Chimp  t--atcgg--cgtgg-t---cc-----
                      Gorilla  t--atcgg--cgtgg-t---cc-----
                    Orangutan  t--atcgg--tgtgg-t---cc-----
                       Gibbon  t--atcgg--cgtgg-t---cc-----
                       Rhesus  t--atcgg--cgtgg-t---cc-----
          Crab-eating macaque  t--atcgg--cgtgg-t---cc-----
                       Baboon  t--atcgg--cgtgg-t---cc-----
                 Green monkey  t--atcgg--cgtgg-t---cc-----
                     Marmoset  t--atcgg--cgtgg-t---cc-----
              Squirrel monkey  t--atcgg--cgtgg-t---cc-----
                     Bushbaby  t--ct-gg--ggtgg-t---cc-----
           Chinese tree shrew  t--ctcgg--agtgg-g---gc-----
       Lesser Egyptian jerboa  a--cacga--tgtga-g---tc-----
                 Prairie vole  t--ctcag--agtgg-g---ct-----
              Chinese hamster  t--ctcgg--agtgg-g---ct-----
               Golden hamster  t--ctccg--agtgg-g---ct-----
                        Mouse  t--cttgg--agtgg-g---ct-----
                          Rat  t--cttgg--agtggag---ct-----
               Naked mole-rat  t--ctcgg--agtg--g---tc-----
                   Guinea pig  t--cttgg--cgtg--g---tc-----
                   Chinchilla  c--ctcgg--cgcg--g---tc-----
             Brush-tailed rat  t--cttgg--cgtg--a---tc-----
                       Rabbit  t--ctcgg--cgtga-t---cc-----
                         Pika  t--ctcgg--cgtga-t---tc-----
                          Pig  t--ctcgg--cgtgg-t---cc-----
                       Alpaca  t--ct----------------c-----
               Bactrian camel  t--ct----------------c-----
                      Dolphin  t--ctcgg--cgtgg-t---cc-----
                 Killer whale  t--ctcgg--cgtgg-t---cc-----
             Tibetan antelope  t--ctcgg--cgtgg-t---cc-----
                          Cow  t--ctcgg--cgtgg-t---cc-----
                        Sheep  t--ctcgg--cgtgg-t---cc-----
             White rhinoceros  t--ctcgg--cgtgg-t---cc-----
                          Cat  t--ctcgg--cgtgg-t---cc-----
                          Dog  c--ccctg--ggcgc-t---gc-----
                      Ferret   t--ctcgg--cgcgg-t---cc-----
                        Panda  t--ctcgg--cgcgg-t---cc-----
               Pacific walrus  t--ctcgg--cgcga-t---cc-----
                 Weddell seal  t--ctcgg--cgcgg-t---cc-----
             Black flying-fox  t--ttcgg--cgtgg-t---tc-----
                      Megabat  t--ttcgg--cgtgg-t---tc-----
                Big brown bat  ---ttcag--ggtgg-t---cc-----
                     Microbat  ---taccg--gatgg-t----c-----
                     Hedgehog  tggtaagg--cgcgg-gtactt-----
                        Shrew  tcgccgtc--cctgc-g---tc-----
              Star-nosed mole  tcgctctc--cgggt-g---cg-----
                     Elephant  t--ctcgg--cgtgg-t---cc-----
          Cape elephant shrew  t--ctagg--catgg-t---ca-----
                      Manatee  t--ctcgg--cgtgg-t---ct-----
             Cape golden mole  t--cccgg--cctgg-t---tt-----
                       Tenrec  ----cagg--ccagg-c---c------
                     Aardvark  t--gtcgg--cttgg-t---ta-----
                    Armadillo  t--ctcgg--cgtgg-t---cg-----
                      Opossum  c--ctcgg--actca-c---ta-----
              Tasmanian devil  c--gtcgg--ggcgg-c---cc-----
                      Wallaby  t--ctcag--agtgg-c---cc-----
                     Platypus  c--gtccg--cggga-t---ct-----
          Collared flycatcher  t--ccagggcaatgg-c---actgact
                 Atlantic cod  ===========================
                  Stickleback  ===========================
           Southern platyfish  ===========================
       Yellowbelly pufferfish  ===========================
                         Fugu  ===========================
                    Tetraodon  ===========================
                      Chicken  ===========================
                 Mallard duck  ===========================
           Tibetan ground jay  ===========================
                       Medaka  ===========================
          Pundamilia nyererei  ===========================
                  Zebra mbuna  ===========================
        Burton's mouthbreeder  ===========================
          Princess of Burundi  ===========================
                 Nile tilapia  ===========================
                X. tropicalis  ===========================
               Painted turtle  ===========================
              Green seaturtle  ===========================
           American alligator  ===========================
                  Rock pigeon  ===========================
          Medium ground finch  ===========================
                       Lizard  ===========================
             Peregrine falcon  ===========================
                 Saker falcon  ===========================
     Chinese softshell turtle  ===========================
                Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Horse  NNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Squirrel  ===========================
         David's myotis (bat)  ===========================

Inserts between block 19 and 20 in window
B D                      Rat 6bp
B D                  Opossum 12bp
B D          Tasmanian devil 19bp
B D                  Wallaby 35487bp

Alignment block 20 of 343 in window, 56080556 - 56080563, 8 bps 
B D                     Human  g----gccgagg
B D                     Chimp  g----gccgagg
B D                   Gorilla  g----gccgagg
B D                 Orangutan  g----gccgagg
B D                    Gibbon  g----gccgagg
B D                    Rhesus  g----gccgagg
B D       Crab-eating macaque  g----gccgagg
B D                    Baboon  g----gccgagg
B D              Green monkey  g----gccgagg
B D                  Marmoset  g----gccgagg
B D           Squirrel monkey  g----gccgacg
B D                  Bushbaby  c----ggcggga
           Chinese tree shrew  g----ggcgagg
       Lesser Egyptian jerboa  a----ggcaggg
                 Prairie vole  g----gacaggg
B D           Chinese hamster  g----ggcaggg
               Golden hamster  g----ggcaggg
B D                     Mouse  g----gtcaggg
B D                       Rat  g----ggctggg
B D            Naked mole-rat  g----ggcaggg
B D                Guinea pig  g----ggcaggg
                   Chinchilla  c----ggcaggg
             Brush-tailed rat  c----agcaggg
B D                    Rabbit  c----ggcggga
B D                      Pika  t--------aag
B D                       Pig  g----ggcgggg
B D                    Alpaca  g----ggcaggg
               Bactrian camel  g----ggcgggg
B D                   Dolphin  g----ggcgggg
                 Killer whale  g----ggcgggg
             Tibetan antelope  g----gacgggg
B D                       Cow  g----ggcgggg
B D                     Sheep  g----ggcgggg
B D          White rhinoceros  g----ggcggtg
B D                       Cat  g----ggcgggg
B D                       Dog  g----ggcgggc
B D                   Ferret   g----ggcgggg
B D                     Panda  g----ggcgggg
               Pacific walrus  g----ggcgggg
                 Weddell seal  g----ggcgggg
             Black flying-fox  t----ggcgggg
B D                   Megabat  t----ggcgggg
                Big brown bat  t----tgtgggg
B D                  Microbat  t----tgcgggg
B D                  Hedgehog  g----ggcgagg
B D                     Shrew  g----gggtgga
              Star-nosed mole  a----ggggggc
B D                  Elephant  g----gtcaggg
          Cape elephant shrew  gtgacgccgata
B D                   Manatee  g----gtcagcg
             Cape golden mole  g----gtttagg
                     Aardvark  a----gtcaggg
B D                 Armadillo  c----ggcgggc
B D                   Opossum  -----tgctgg-
B D           Tasmanian devil  -----ggccgg-
B D                   Wallaby  -----ggctgg-
B D                  Platypus  g----gccgag-
  D       Collared flycatcher  -catcccca---
B D              Atlantic cod  ============
B D               Stickleback  ============
          Southern platyfish  ============
      Yellowbelly pufferfish  ============
B D                      Fugu  ============
B D                 Tetraodon  ============
B D                   Chicken  ============
  D              Mallard duck  ============
          Tibetan ground jay  ============
B D                    Medaka  ============
         Pundamilia nyererei  ============
                 Zebra mbuna  ============
       Burton's mouthbreeder  ============
         Princess of Burundi  ============
B D              Nile tilapia  ============
B D             X. tropicalis  ============
  D            Painted turtle  ============
  D           Green seaturtle  ============
B D        American alligator  ============
  D               Rock pigeon  ============
B D       Medium ground finch  ============
B D                    Lizard  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
B D                    Tenrec  ------------
  D  Chinese softshell turtle  ============
               Domestic goat  NNNNNNNNNNNN
B D                     Horse  NNNNNNNNNNNN
B D                  Squirrel  ============
        David's myotis (bat)  ============

Inserts between block 20 and 21 in window
B D                 Hedgehog 4bp
B D                    Shrew 7bp
             Star-nosed mole 4bp

Alignment block 21 of 343 in window, 56080564 - 56080566, 3 bps 
B D                     Human  gcg
B D                     Chimp  gcg
B D                   Gorilla  gcg
B D                 Orangutan  gcg
B D                    Gibbon  gcg
B D                    Rhesus  gcg
B D       Crab-eating macaque  gcg
B D                    Baboon  gcg
B D              Green monkey  gcg
B D                  Marmoset  gcg
B D           Squirrel monkey  gcg
B D                  Bushbaby  at-
           Chinese tree shrew  acc
       Lesser Egyptian jerboa  act
                 Prairie vole  acc
B D           Chinese hamster  act
               Golden hamster  act
B D                     Mouse  act
B D                       Rat  act
B D            Naked mole-rat  tct
B D                Guinea pig  ac-
                   Chinchilla  act
             Brush-tailed rat  act
B D                    Rabbit  acg
B D                      Pika  acg
B D                       Pig  aga
B D                    Alpaca  acg
               Bactrian camel  acg
B D                   Dolphin  acg
                 Killer whale  acg
             Tibetan antelope  acg
B D                       Cow  acg
B D                     Sheep  acg
                Domestic goat  gcg
B D          White rhinoceros  acg
B D                       Cat  tcg
B D                       Dog  tcg
B D                   Ferret   tcg
B D                     Panda  tcg
               Pacific walrus  tcg
                 Weddell seal  tcg
             Black flying-fox  acg
B D                   Megabat  acg
                Big brown bat  gcg
B D                  Microbat  gcg
B D                  Hedgehog  acg
B D                     Shrew  acc
              Star-nosed mole  acg
B D                  Elephant  acc
          Cape elephant shrew  aaa
B D                   Manatee  gcc
             Cape golden mole  a-g
B D                    Tenrec  --g
                     Aardvark  aag
B D                 Armadillo  gca
B D                   Opossum  ac-
B D           Tasmanian devil  acc
B D                   Wallaby  acg
  D       Collared flycatcher  gcc
B D              Atlantic cod  ===
B D               Stickleback  ===
          Southern platyfish  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                 Tetraodon  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D                    Medaka  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
B D             X. tropicalis  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D               Rock pigeon  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
B D                  Platypus  ---
  D  Chinese softshell turtle  ===
B D                     Horse  NNN
B D                  Squirrel  ===
        David's myotis (bat)  ===

Inserts between block 21 and 22 in window
               Domestic goat 1bp

Alignment block 22 of 343 in window, 56080567 - 56080618, 52 bps 
B D                     Human  gcattccggg------------------ac--cc---tca-cgc--c-------a-------cc------
B D                     Chimp  gcattccggg------------------ac--cc---tca-cgc--c-------a-------cc------
B D                   Gorilla  gcattccggg------------------ac--cc---tca-cgc--c-------a-------cc------
B D                 Orangutan  gcattcctgg------------------ac--cc---tca-cgc--c-------c-------cc------
B D                    Gibbon  gcattcctgg------------------ac--cc---tca-cgc--t-------c-------cc------
B D                    Rhesus  gcattcttgg------------------ac--cc---tca-cgc--c---------------cc------
B D       Crab-eating macaque  gcattcttgg------------------ac--cc---tca-cgc--c---------------cc------
B D                    Baboon  gcattcctgg------------------ac--cc---tca-cgc--c---------------cc------
B D              Green monkey  gcattcctgg------------------ac--cc---tca-cgc--c---------------cc------
B D                  Marmoset  gcattcctgg------------------ac--cc---tca-agc--c-------c-------cg------
B D           Squirrel monkey  gcattcctgg------------------aa--cc---tca-cga--c-------c-------cg------
B D                  Bushbaby  gcattcctgg------------------ac--gt----------------------------cc------
           Chinese tree shrew  acattcctgg------------------gc--cc-------cac--t---------------cc------
       Lesser Egyptian jerboa  gcgttcttga------------------at--gc---cca---c--c---------------ct------
                 Prairie vole  gcattcctgg------------------at--gc---cta---c--t---------------ct------
B D           Chinese hamster  gcattcctgg------------------at--gccttctc---c--c---------------ct------
               Golden hamster  gcattcctgg------------------at--gc---cta---c--c---------------ct------
B D                     Mouse  gcattcctgt------------------at--gc---cta---c--c---------------ct------
B D                       Rat  gcattcctgg------------------at--gc---cta---c--c---------------ct------
B D            Naked mole-rat  gcatttctga------------------gc--gc---ccg---c--c---------------c-------
B D                Guinea pig  acattcctgg------------------ac--gc---acg---c--c-----------------------
                   Chinchilla  gcactccggg------------------ac--gc---cca---c--c-----------------------
             Brush-tailed rat  gaattcctgg------------------ac--ac---tcg---c--c---------------a-------
B D                    Rabbit  gcattcctgg------------------ag--cc---ctg--gc--c---------------cc------
B D                      Pika  gcattcttgg------------------ag--cc---cca--gc--c---------------cc------
B D                       Pig  ggattcctgc------------------accacc---accttcc--cctgggcac-------ct------
B D                    Alpaca  ggattcctgg------------------accacc---acc---t--ccccacccc-------ag------
               Bactrian camel  ggattcctgg------------------accacc---atc---t--ccccacccc-------gg------
B D                   Dolphin  ggattcccga------------------accact---accttgc--cccggccac-------ct------
                 Killer whale  ggattcccga------------------accact---accttgc--cccggccac-------ct------
             Tibetan antelope  cgattccggg------------------ac--ct---gcc---c--cccggccac-------tg------
B D                       Cow  cgattctggg------------------ac--ct---gcc---c--cccggccac-------cg------
B D                     Sheep  cgattcaggg------------------ac--ct---gct---c--cccggccac-------cg------
                Domestic goat  cgtcccaggc------------------cc--ct---gcc---c--ctcggccac-------cg------
B D          White rhinoceros  gcattcctgg-----------------------a---cca---c--caccacctc-------ct------
B D                       Cat  ggattcctgaaccaccaccaccaccaccac--ca---cca---c--caccacccc-------ca------
B D                       Dog  gcgctcccga-----------------------------------------cccc-------cc------
B D                   Ferret   gaattcctga----------------------ca---tcc---c--ccccacccc-------cc------
B D                     Panda  ggatgcctga-------------------t--ca---ccc---c--ccccccccc-------cc------
               Pacific walrus  ggattcctga-------------------c--ca---ccc---t--ccccgcccc-------cc------
                 Weddell seal  ggattcctga-------------------c--ca---ccc---t--ccccgcccc-------cc------
             Black flying-fox  ggattcctgg------------------ac--ca---ccc--------------c-------ct------
B D                   Megabat  ggattcctgg------------------ac--ca---ccc--------------c-------ct------
                Big brown bat  -cgttcctgc------------------ac--ca---ccc---g--cgcccacac-------ca------
         David's myotis (bat)  gcgttcctgc------------------ac--ca---ccc---g--cgcccccac-------ca------
B D                  Microbat  -cgttcctgc------------------ac--ca---ccc---g--cgcggccac-------ca------
B D                  Hedgehog  gcattccggg------------------ac--ca---gca------ggtcgcctt-------tc------
B D                     Shrew  tccccc--cc------------------ac--cc---tca---c--cctcacccc-------ct------
              Star-nosed mole  cgccccggcc------------------ac--ac---aca---cttcatcgcctc-------cc------
B D                  Elephant  ggcttcctgg------------------gc--cc---cct---t--------------------------
          Cape elephant shrew  agactttcag------------------gc--cc---tct---t--------------------------
B D                   Manatee  ggcttcctgg------------------gc--cc---cct---t--------------------------
             Cape golden mole  ggctcgttgg------------------tc--cc---cct---t--------------------------
B D                    Tenrec  ggcgtgctgg------------------cc--cc---tct---t--------------------------
                     Aardvark  ggcttcatga------------------tc--cc---cct---t--------------------------
B D                 Armadillo  ggatacgcgg------------------ac--ca---gtc---c--------------------------
B D                   Opossum  ----ccctcc------------------ac--cc---c-----c--gcccgcccg-------cctagtga
B D           Tasmanian devil  ---tcccccc------------------aa--cc---ctc-cac--cccctctcg-------ccttctga
B D                   Wallaby  ---tcccccc------------------aa--cc---ctc-cac--tcccgcccg-------ccttctga
B D                  Platypus  --------------------------------------------------------------cg------
  D       Collared flycatcher  tcatccactg------------------cc--cc---att-cgc--caccatgcctagatgaca------
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                     Horse  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ======================================================================

                        Human  ---c------------------------------tt-ctc-----c--agagcgtc--gccgaccc---t
                        Chimp  ---c------------------------------tt-ccc-----c--agagcgtc--gccgaccc---t
                      Gorilla  ---c------------------------------tt-ccc-----c--agagcgtc--gccgaccc---t
                    Orangutan  ---c------------------------------tt-ccc-----c--agagagtc--gccgaccc---t
                       Gibbon  ---c------------------------------tt-ccc-----c--agagcgtc--gccgaccc---t
                       Rhesus  ---c------------------------------tt-ccc-----c--agagcgtc--gtcgaccc---t
          Crab-eating macaque  ---c------------------------------tt-ccc-----c--agagcgtc--gtcgaccc---t
                       Baboon  ---c------------------------------tt-ccc-----c--agagcgtc--gtcgaccc---t
                 Green monkey  ---c------------------------------tt-ccc-----c--agagcgtc--gtcgaccc---t
                     Marmoset  ---c------------------------------tt-ccc-----c--agagcgtc--gccgaccc---t
              Squirrel monkey  ---c------------------------------tt-ccc-----c--agagcgtc--gccgaccc---t
                     Bushbaby  ---t------------------------------cc-acc-----c--aacgcgcc--gccgaccc---t
           Chinese tree shrew  ---c------------------------------tt-ccc-----c--aaagcgtc--gcagaccc---t
       Lesser Egyptian jerboa  ---c------------------------------tt-ccc-----c--ggggtgtt--gcagaccc---t
                 Prairie vole  ---t------------------------------ct-ccc-----c--agggcgtc--ggggaccc---t
              Chinese hamster  ---t------------------------------ctcccc-----c--ggggcgtc--gctgaccc---t
               Golden hamster  ---t------------------------------ctcccc-----c--ggggcatc--gctgaccc---t
                        Mouse  ---t------------------------------at-tcc-----c--agggcgtc--gccgaccc---t
                          Rat  ---t------------------------------ct-tcc-----c--agggcgtc--gctgaccc---t
               Naked mole-rat  ---c------------------------------tt-tcc-----c--agggagtc--gcagaccc---c
                   Guinea pig  ---c------------------------------cc-tta-----c--agagcctc--gctgaccc---c
                   Chinchilla  ---c------------------------------ct-tcc-----c--agggcgtc--gctgaccc---c
             Brush-tailed rat  ---c------------------------------ct-ccc-----c--aggtcgtc--gctgaccc---c
                       Rabbit  ---a------------------------------tt-ccc-----c--agggcgtc--gc-gaccc---c
                         Pika  ---a------------------------------ct-ccc-----c--agggtgtc--gc-gaccc---t
                          Pig  ---c------------------------------ct-ccc-----t--ggcccgtc--gcggaccc---t
                       Alpaca  ---c------------------------------ag-cct-----a--ccc------------cgc---t
               Bactrian camel  ---c------------------------------cg-cct-----a--ccc------------ctc---t
                      Dolphin  ---c------------------------------ct-ccc-----t--gccgtgtc--gcggaccc---t
                 Killer whale  ---c------------------------------ct-ccc-----t--gccgtgtc--gcggaccc---t
             Tibetan antelope  ---c------------------------------ct-cct-----g--ggcgcctc--gcagaccc---t
                          Cow  ---c------------------------------ct-cct-----g--ggcgcatc--gcagaccc---t
                        Sheep  ---c------------------------------ct-cct-----g--ggcgcctc--gcagaccc---t
                Domestic goat  ---c------------------------------ct-cct-----g--ggcgcctc--gcagaccc---t
             White rhinoceros  ---c------------------------------ct-ccc-----c--agcgcgtc--gctgaccc---t
                          Cat  ---cacacacac-----------------actcgct-cag-----c--agcgcgtc--gccgaccc---t
                          Dog  ---a------------------------------------------------------------ct---t
                      Ferret   ---aacacacacacacacatacacacaccccactct-ccc-----g--agcgcgtc--gccggcct---t
                        Panda  ---cccgcacaca----------------caaccct-ccg-----c--agcgcgtc--cccggcct---t
               Pacific walrus  ---c-------------------------caaccct-cgg-----c--agcgcgtc--gccggcct---t
                 Weddell seal  ---c-------------------------caaccct-cgg-----c--agcgcgtc--gccggcct---t
             Black flying-fox  ---c------------------------------ct-ccc-----c--agtgcgtc--gccgaccg---c
                      Megabat  ---c------------------------------ct-ccc-----c--agtgcgtc--gtcgaccg---c
                Big brown bat  ---c------------------------------ct-ccc-----c--ggtgcgtc--gccgaccc---c
         David's myotis (bat)  ---c------------------------------ct-ccc-----c--agcgcgtc--gccgactc---c
                     Microbat  ---c------------------------------ct-ccc-----c--agcgcgtc--gccgactc---c
                     Hedgehog  ---t---------------------------------------------------------aatct---c
                        Shrew  ---t------------------------------ct-ccc-----t--agcgcatc--gccgaccc---t
              Star-nosed mole  ---c--------------------------agcgct-ccc-----c--ggcgcgtg--gcggaccc---c
                     Elephant  ----------------------------------ct-ccc-----t--agcgcgcc--aacgaccc---t
          Cape elephant shrew  ----------------------------------tt-cac-----c--agctcccc--acagaccctagt
                      Manatee  ----------------------------------ct-ccc-----c--agtgcgcc--gccgaccc---t
             Cape golden mole  ----------------------------------ct-cgc-----a-gagaaatta--gcaaaccc---t
                       Tenrec  ----------------------------------ct-ccc-----ctgtgcgtccc--gccgaccc---g
                     Aardvark  ----------------------------------ct-ccc-----g----cgcgtc--gcgtaccc---t
                    Armadillo  ----------------------------------ct-c----------agcgcgtc--gc-gaccc---t
                      Opossum  gaat------------------------------cc-tat-----c--ggagaagc--gcctgctg---c
              Tasmanian devil  gcat------------------------------tt-tcc-----c--ggggaagc--gaccgccg---c
                      Wallaby  ggat------------------------------cc-tcc-----t--ggggaagc--gattgctt---t
                     Platypus  ---c------------------------------ct-cccgtgcgc--ggagcgccgggccgaccg---c
          Collared flycatcher  ---c------------------------------ca-ccc-----c--agtttttg--ggtgacag---t
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Chinese softshell turtle  ======================================================================
                        Horse  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Squirrel  ======================================================================

                        Human  ctaa
                        Chimp  ctaa
                      Gorilla  ctaa
                    Orangutan  ctaa
                       Gibbon  ctaa
                       Rhesus  ctaa
          Crab-eating macaque  ctaa
                       Baboon  ctaa
                 Green monkey  ctaa
                     Marmoset  ttaa
              Squirrel monkey  ctaa
                     Bushbaby  ttaa
           Chinese tree shrew  ctga
       Lesser Egyptian jerboa  ctat
                 Prairie vole  ctga
              Chinese hamster  ctga
               Golden hamster  ctgg
                        Mouse  ctaa
                          Rat  ctaa
               Naked mole-rat  ctaa
                   Guinea pig  ctaa
                   Chinchilla  ccag
             Brush-tailed rat  ctaa
                       Rabbit  ctaa
                         Pika  ctac
                          Pig  ctga
                       Alpaca  ctga
               Bactrian camel  ctga
                      Dolphin  ctga
                 Killer whale  ctga
             Tibetan antelope  caga
                          Cow  caga
                        Sheep  caga
                Domestic goat  caga
             White rhinoceros  cgaa
                          Cat  ctaa
                          Dog  ctga
                      Ferret   ctaa
                        Panda  ctaa
               Pacific walrus  ctaa
                 Weddell seal  ctaa
             Black flying-fox  ctaa
                      Megabat  ctaa
                Big brown bat  ttcg
         David's myotis (bat)  tgaa
                     Microbat  ttaa
                     Hedgehog  caac
                        Shrew  cgct
              Star-nosed mole  cact
                     Elephant  ctaa
          Cape elephant shrew  ctca
                      Manatee  ctaa
             Cape golden mole  ttaa
                       Tenrec  caga
                     Aardvark  ctaa
                    Armadillo  ctgg
                      Opossum  c---
              Tasmanian devil  c---
                      Wallaby  c---
                     Platypus  ccgg
          Collared flycatcher  cca-
                 Atlantic cod  ====
                  Stickleback  ====
           Southern platyfish  ====
       Yellowbelly pufferfish  ====
                         Fugu  ====
                    Tetraodon  ====
                      Chicken  ====
                 Mallard duck  ====
           Tibetan ground jay  ====
                       Medaka  ====
          Pundamilia nyererei  ====
                  Zebra mbuna  ====
        Burton's mouthbreeder  ====
          Princess of Burundi  ====
                 Nile tilapia  ====
                X. tropicalis  ====
               Painted turtle  ====
              Green seaturtle  ====
           American alligator  ====
                  Rock pigeon  ====
          Medium ground finch  ====
                       Lizard  ====
             Peregrine falcon  ====
                 Saker falcon  ====
     Chinese softshell turtle  ====
                        Horse  NNNN
                     Squirrel  ====

Alignment block 23 of 343 in window, 56080619 - 56080673, 55 bps 
B D                     Human  ttgg--tc---tcccca------------gaagagg-----ctgaggccgaaac---------------a
B D                     Chimp  ttgg--tc---tcccca------------gaaaagg-----ctgaggccgaaac---------------a
B D                   Gorilla  ttgg--tc---tcccca------------gaagagg-----ctgaggccgaaac---------------a
B D                 Orangutan  ttgg--tc---tcccca------------gaagagg-----ctga-gccgaaac---------------a
B D                    Gibbon  atgg--tc---tcccca------------gaagagg-----ctgaggccgaaac---------------a
B D                    Rhesus  ttgg--tc---tcccca------------aaagagg-----ctgaggccgcaac---------------a
B D       Crab-eating macaque  ttgg--tc---tcccca------------aaagagg-----ctgaggccgcaac---------------a
B D                    Baboon  ttgg--tc---tcccca------------aaagagg-----ctgaggccgcaac---------------a
B D              Green monkey  ttgg--tc---tcccca------------aaagagg-----ctgaggccgaaac---------------a
B D                  Marmoset  ttgg--tc---tcccca------------gaagatg-----ctgaggctgaaac---------------a
B D           Squirrel monkey  ttgg--tc---tcccca------------gaagatg-----ctgaggccgaaac---------------a
B D                  Bushbaby  ttgg--tc---tctcct-----------------------------cccgacac--------------aa
           Chinese tree shrew  ttgc--tg---tcccct------------gataagg-----ctgatgccgaaac---------------a
       Lesser Egyptian jerboa  ttgg--tc---tgccct------------gattagg-----ttgatacctggac---------------c
                 Prairie vole  ttgc--tct--ttttct------------gatcagg-----ttgatg--taaac---------------a
B D           Chinese hamster  ttgg--tgt--ttttct------------gatcagg-----ttgatg--tggac---------------a
               Golden hamster  ttgg--tgt--ttttct------------gatcagg-----ttgata--cggac---------------a
B D                     Mouse  ttgg--ttt--tattct------------gatctgg-----ttggtg-ccgaac---------------a
B D                       Rat  ttgg--tct--tattct------------gatttgg-----ttaatg-aagaac---------------a
B D            Naked mole-rat  ttgg--tt---tccgct------------ggtgagg-----ttgagg-----------------------
B D                Guinea pig  ttag--tc---tccgct------------gtttaaa-----ttgctg-----------------------
                   Chinchilla  --gg--tc---tccgcg------------ggtgagg-----ctgagg-----------------------
             Brush-tailed rat  ttgg--cc---tccact------------ggagagg-----ttgagg-----------------------
B D                    Rabbit  ttga--tc---tttgct------------ggagaag----attgatgcccaaac---------------a
B D                      Pika  ttgggctc---tcttct------------gtaggag------tggtgcccacag---------------g
B D                       Pig  tttg--tc---tctcgg------------gataggg-----ctgatgcgcaaac----------------
B D                    Alpaca  tttg--tc---tctttg------------gataggg-----ctgatgcttaaac----------------
               Bactrian camel  tttg--tc---tcttcg------------gataggg-----ctgatgcttaaac----------------
B D                   Dolphin  tttg--tc---tctccg------------gataggg-----ctgatgccgaaac----------------
                 Killer whale  tttg--tc---tctccg------------gataggg-----ctgatgccgaaac----------------
             Tibetan antelope  tttg--tc---tctcc------------------gg-----cggatgctgaaac----------------
B D                       Cow  tttg--tc---tctcc------------------gg-----cggatgctgaaac----------------
B D                     Sheep  tttg--tc---tctcc------------------gg-----cggatgcttaaac----------------
                Domestic goat  tttg--tc---tctcc------------------gg-----cggatgctgaaac----------------
B D                     Horse  ttgt--cc---tctctg------------gacagag-----ctgatgccgaaac----------------
B D          White rhinoceros  tttg--tc---tctccg------------gataggg-----ctggtgcccaaac----------------
B D                       Cat  ttca--tc---tctctc------------ggtgggg-----ctgatgccgaaac----------------
B D                       Dog  tctg--cg---tcggg-------------gtggggg-----cc--ccccgggac----------------
B D                   Ferret   tttg--tc---tctctcgggcggggatggggggtgg-----ctgacgccgagac----------------
B D                     Panda  tttg--tc---tctctc------------ttgggga-----ctgatgccgagac----------------
               Pacific walrus  tttg--tc---tctctc------------gaggggg-----ctgacgccgagac----------------
                 Weddell seal  tttgtctc---tctctc------------ggggggg-----ctgacgccgagac----------------
             Black flying-fox  tttt--tc---tctctc------------gatagga-----ctgatgctgaaac----------------
B D                   Megabat  tttt--tc---tctctc------------gataaga-----ctgatgctgaaac----------------
                Big brown bat  tgtg--tt---ccttac------------ggcaggg-----ctggtgccgaaac----------------
         David's myotis (bat)  tctg--tt---ccttac------------gacaggg-----ctgatgccgaaac----------------
B D                  Microbat  tctg--tt---ccttag------------cacaggg-----ctgatgccgaaac----------------
B D                  Hedgehog  -tta--cc---tccctg------------cataggg-----ctgata------c----------------
B D                     Shrew  -tta--atttgtcccgg------------gttgggg-----cgggtg------c----------------
              Star-nosed mole  -tcg--cccc-tctcga---------------gggg-----cttggg------c----------------
B D                  Elephant  -ttc--gt---tcccat------------gatggta-----ctgacggcgaaac---------------a
          Cape elephant shrew  -ctc--tt---ttctcc------------tatggaa-----ctgacg-----------------------
B D                   Manatee  -ttt--gt---tctcct------------gatggta-----ctgacgccgaaat---------------a
             Cape golden mole  -gtt--gt---gtccct------------gttgg-g-----ttgacgccgaaac---------------a
B D                    Tenrec  -ccc--ct---tcccct------------gctgg------------------------------------
                     Aardvark  -ttc--ga---tccctt------------ggcggta-----ctgacgctgaaac---------------t
B D                 Armadillo  -ttc--gt---tccccg------------gctg--------------ccgacac---------------a
B D                   Opossum  -tca--gt---tccccg------------ctcggat-----ttcgaggcactgc--------------aa
B D           Tasmanian devil  -tca--gt---ttcccg------------atccgat-----ttcgag--atggc--------------aa
B D                   Wallaby  -tca--gt---tcccca------------atctggt----------------------------------
B D                  Platypus  ---------------------------gagaggacg-----gcggggccgagacggatccctgccctcga
  D       Collared flycatcher  --gg--tc---actctg------------gaaagggccaaactgggccaggaag---------------a
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                  Squirrel  ======================================================================

                        Human  gtag-ttcacac-tt----ct------gaggggc
                        Chimp  gtag-ttcacac-tt----ct------gaggggc
                      Gorilla  gtag-ttcacac-tt----ct------gaggggc
                    Orangutan  gtag-ttcacac-tt----ct------gcggggc
                       Gibbon  gtag-ttcacac-tt----ct------gaggggc
                       Rhesus  gtag-ttcacac-tt----ct------gagggac
          Crab-eating macaque  gtag-ttcacac-tt----ct------gagggac
                       Baboon  gtag-ttcacac-tt----ct------gagggac
                 Green monkey  gtag-ttcacac-tt----ct------gagggac
                     Marmoset  gtag-ttcacac-tt----ct------aaggggc
              Squirrel monkey  gtag-ttcacac-tt----ct------aaggggc
                     Bushbaby  gcag-ttcgcac-ct----ct------gagggg-
           Chinese tree shrew  gtag-ttcacac-tt----gt------gaggggc
       Lesser Egyptian jerboa  ctag-ttcacac-ct----ct------gaggggt
                 Prairie vole  gtag-ttc-------------------tgagagc
              Chinese hamster  gca---tc-------------------tgagggc
               Golden hamster  gtag-ttc-------------------ggagagc
                        Mouse  gtag-ttcaca--------ct------tgagagt
                          Rat  gtagattcaca--------ct------tgagagc
               Naked mole-rat  -------------------------------gac
                   Guinea pig  -------------------------------agc
                   Chinchilla  -------------------------------gac
             Brush-tailed rat  -------------------------------gac
                       Rabbit  gtag-ttcacac-tt----ct------gaggggc
                         Pika  ggag-ctctcgc-tg----ct------gaggggc
                          Pig  ---a-ttcacac-tt----ct------gagggac
                       Alpaca  --ag-ttcacac-tt----at------gaggggc
               Bactrian camel  --ag-ttcacac-tt----at------gaggggc
                      Dolphin  --ag-ttcacac-tt----ct------gaggggc
                 Killer whale  --ag-ttcacac-tt----ct------gaggggc
             Tibetan antelope  --ca-ttcacac-tt----ct------ga-ggac
                          Cow  --ca-ttcacac-tt----ct------gagggac
                        Sheep  --ca-ttcacac-tt----ct------ga-ggac
                Domestic goat  --ca-ttcacac-tt----ct------ga-ggac
                        Horse  --ag-ctcacac-tttccgaa------gggagct
             White rhinoceros  --ag-ttcacac-tt----at------gaggggc
                          Cat  --ag-atcacac-tt----ct------gagggtc
                          Dog  --ac-cccgctc-cc----ct------ggggagc
                      Ferret   --ag-gtcacac-tt----cc------gagggac
                        Panda  --ag-atcacac-tt----cc------gaggggc
               Pacific walrus  --ag-atcacac-tt----cc------gaggggc
                 Weddell seal  --ag-atcacgc-tt----cc------gaggggc
             Black flying-fox  --ag-ttcac---tt----cttgctgggggggtc
                      Megabat  --ag-ttcac-t-tt----cttgctgggggggg-
                Big brown bat  --cg-tgcacac-tt----ct-----gggggggc
         David's myotis (bat)  --ag-tgcaccc-tt----ct------ggggggc
                     Microbat  --ag-tgcaccc-tt----ct------ggggggc
                     Hedgehog  --aa-ttcacac-ta-----t------gggagtt
                        Shrew  --gg-gctgcat-tt----ct------gagggac
              Star-nosed mole  --ag-ctcacac-ct-------------aggagc
                     Elephant  gtag-ttcacac-tt----ct------gagggac
          Cape elephant shrew  --------ccac-tt----tg------aaggggt
                      Manatee  gtag-ttcacac-tt----ct------gaggcgc
             Cape golden mole  gtag-ttcacac-tt----ct------gaggggc
                       Tenrec  -------------tg----ct------gctgtgc
                     Aardvark  gtag-ttcacac-tt----ct------gagggac
                    Armadillo  gtag-ttcacgt-t------c------gaggggc
                      Opossum  ggaa-gctaggcatt----ct------gggggcc
              Tasmanian devil  gaag-cccaggcatt----ct------gggggaa
                      Wallaby  ggaa-cccaggcatt----ct------gggggtc
                     Platypus  ggag-tccgtgg-ac----cg------gagggag
          Collared flycatcher  gctg-ctcaccc-ac----ct------ctggcac
                 Atlantic cod  ==================================
                  Stickleback  ==================================
           Southern platyfish  ==================================
       Yellowbelly pufferfish  ==================================
                         Fugu  ==================================
                    Tetraodon  ==================================
                      Chicken  ==================================
                 Mallard duck  ==================================
           Tibetan ground jay  ==================================
                       Medaka  ==================================
          Pundamilia nyererei  ==================================
                  Zebra mbuna  ==================================
        Burton's mouthbreeder  ==================================
          Princess of Burundi  ==================================
                 Nile tilapia  ==================================
                X. tropicalis  ==================================
               Painted turtle  ==================================
              Green seaturtle  ==================================
           American alligator  ==================================
                  Rock pigeon  ==================================
          Medium ground finch  ==================================
                       Lizard  ==================================
             Peregrine falcon  ==================================
                 Saker falcon  ==================================
     Chinese softshell turtle  ==================================
                     Squirrel  ==================================

Inserts between block 23 and 24 in window
B D                  Megabat 108bp
  D      Collared flycatcher 139bp

Alignment block 24 of 343 in window, 56080674 - 56080687, 14 bps 
B D                     Human  cc----t---gcag------------gga--ggg-------g
B D                     Chimp  cc----t---gcag------------gga--gcg-------g
B D                   Gorilla  cc----t---gcagggagcggagcacgga--gcg-------g
B D                 Orangutan  cc----t---gcag------------gga--acg-------g
B D                    Gibbon  cc----t---gcag------------gga--gcg-------g
B D                    Rhesus  cc----t---gcag------------gga--gcg-------g
B D       Crab-eating macaque  cc----t---gcag------------gga--gcg-------g
B D                    Baboon  cc----t---gcag------------gga--gcg-------g
B D              Green monkey  cc----t---gcag------------gga--gcg-------g
B D                  Marmoset  cc----t---gcag------------gga--gcg-------g
B D           Squirrel monkey  cc----t---gcag------------gga--gcg-------g
B D                  Bushbaby  cc----t---gcag------------gga--gca-------g
           Chinese tree shrew  cc----t---gca-------------gga--gtg-------g
       Lesser Egyptian jerboa  cc----t---gcag------------gga--gcg-------g
                 Prairie vole  c-----t---gcag------------aga--ggg------ag
B D           Chinese hamster  ct----t---gcag------------aga--ggg------cg
               Golden hamster  ct----t---acag------------aga--ggg------cg
B D                     Mouse  ct----t---ggga------------gga--ggg------tg
B D                       Rat  ct----t---ggga------------gga--ggg------cg
B D            Naked mole-rat  ct----t---tcag------------gga--gcg------ga
                   Chinchilla  ct----t---gcag------------gga--gcg------gg
             Brush-tailed rat  ct----t---gctg------------gca--tc---------
B D                    Rabbit  gc----t---gctg------------gga--gc-------gg
B D                      Pika  gc----a---actg------------gga--gcgaggcaggg
B D                       Pig  cc----t---gcag------------gaa--ggg-------g
B D                    Alpaca  cc----t---gcag------------gga--ggg-------g
               Bactrian camel  cc----t---gcag------------cga--ggg-------g
B D                   Dolphin  cc----t---gcag------------gga--ggg-------g
                 Killer whale  cc----t---gcag------------gga--gag-------g
             Tibetan antelope  cc----t---gcag------------gga--cgg-------g
B D                       Cow  cc----t---gcag------------gga--tgg-------g
B D                     Sheep  cc----t---acag------------gga--cgg-------g
                Domestic goat  cc----t---gcag------------gga--cgg-------g
B D                     Horse  tc----t---gcag------------ggaagggg-------a
B D          White rhinoceros  cc----t---gccg------------gga--gag-------g
B D                       Cat  cc----t---gtag------------gga--ggg-------g
B D                       Dog  cc----t---gtgg------------gga--cgg-------c
B D                   Ferret   tc----t---gtag------------gga--ggg-------g
B D                     Panda  cc----t---atag------------gga--ggg-------g
               Pacific walrus  cc----t---gtgg------------gga--ggg-------g
                 Weddell seal  cctacat---gtag------------gga--ggg-------g
             Black flying-fox  cc----t---gcag------------gga--ggg-------g
                Big brown bat  cc----t---gccg------------gga--ggg-------g
         David's myotis (bat)  cc----t---gcgg------------gga--ggg-------g
B D                  Microbat  cc----t---gcgg------------gga--ggg-------g
B D                  Hedgehog  at----t---gcgt------------gtg--ggg-------g
B D                     Shrew  cc----t---gcag------------gcg--tca-------g
              Star-nosed mole  tg----t---gc---------------cg--cga-------g
B D                  Elephant  cc----t----cag------------gga--gag-------g
          Cape elephant shrew  gc----t---gcaa------------aaa--gag-------g
B D                   Manatee  cc----t---gcag------------gga--ggg-------g
             Cape golden mole  cc----t---gaag------------gga--ggg-------g
B D                    Tenrec  cc----c---gctg------------gga--gag-------g
                     Aardvark  c-----------------------------------------
B D                 Armadillo  tc----t--ggcag------------gga--gag-------g
B D                   Opossum  cc----a---gttt------------ggg--gag-------g
B D           Tasmanian devil  cc----c---a-tt------------gta--gag-------a
B D                   Wallaby  cc----a---attt------------gta--gag-------a
B D                  Platypus  cc----gttagcgg------------gga--ggg-------a
B D                Guinea pig  ------------------------------------------
B D              Atlantic cod  ==========================================
B D               Stickleback  ==========================================
          Southern platyfish  ==========================================
      Yellowbelly pufferfish  ==========================================
B D                      Fugu  ==========================================
B D                 Tetraodon  ==========================================
B D                   Chicken  ==========================================
  D              Mallard duck  ==========================================
          Tibetan ground jay  ==========================================
B D                    Medaka  ==========================================
         Pundamilia nyererei  ==========================================
                 Zebra mbuna  ==========================================
       Burton's mouthbreeder  ==========================================
         Princess of Burundi  ==========================================
B D              Nile tilapia  ==========================================
B D             X. tropicalis  ==========================================
  D            Painted turtle  ==========================================
  D           Green seaturtle  ==========================================
B D        American alligator  ==========================================
  D               Rock pigeon  ==========================================
  D       Collared flycatcher  ==========================================
B D       Medium ground finch  ==========================================
B D                    Lizard  ==========================================
  D          Peregrine falcon  ==========================================
  D              Saker falcon  ==========================================
B D                   Megabat  ==========================================
  D  Chinese softshell turtle  ==========================================
B D                  Squirrel  ==========================================

Inserts between block 24 and 25 in window
B D                  Opossum 9bp
B D          Tasmanian devil 3bp
B D                  Wallaby 3bp

Alignment block 25 of 343 in window, 56080688 - 56080745, 58 bps 
B D                     Human  agcagggaa---ct-tca-----ttc-tgtaa---------------------------ac---ag----
B D                     Chimp  agcagggag---ct-tca-----ttc-tgtaa---------------------------ac---ag----
B D                   Gorilla  agcagggag---ct-tca-----ttc-tgtaa---------------------------ac---ag----
B D                 Orangutan  agcaggaac---cc-tca-----ttc-tgtaa---------------------------ac---ag----
B D                    Gibbon  agcaaggac---ct-tca-----ttc-tgtaa---------------------------ac---ag----
B D                    Rhesus  ggcagggac---ct-taa-----ttc-tataa---------------------------ac---ag----
B D       Crab-eating macaque  ggcagggac---ct-taa-----ttc-tataa---------------------------ac---ag----
B D                    Baboon  agcagggac---ct-taa-----ttc-tataa---------------------------ac---ag----
B D              Green monkey  agcagggac---ct-taa-----ttc-tataa---------------------------ac---ag----
B D                  Marmoset  atcggagac---ct-tta-----ttc-tgtaa---------------------------ac---ag----
B D           Squirrel monkey  agcggggac---ct-tca-----ttc-tgtaa---------------------------ac---ag----
B D                  Bushbaby  agcgaggat---ct---------ttc-tgtga---------------------------ac---gg----
           Chinese tree shrew  aaccgggac---ct-cca-----ttc-tgtaa---------------------------acgcgag----
       Lesser Egyptian jerboa  ggcaggggc---ct---------ttc-tgtaa---------------------------ct---gt----
                 Prairie vole  agtagggac---cc---------ttc-tgtaa---------------------------ac---ct----
B D           Chinese hamster  ggcagggac---cc---------ttc-tgcaa---------------------------ac---cc----
               Golden hamster  ggcagggac---cc---------ttc-tgtaa---------------------------ac---cc----
B D                     Mouse  ggcagggac---cc---------ttc-tgtaa---------------------------ac---gt----
B D                       Rat  ggcagggac---cc---------ttc-tgtaa---------------------------ac---gt----
B D            Naked mole-rat  gc-ggggac---ct-agg-----ttt-tgtat---------------------------ac---ac----
B D                Guinea pig  ---ggggac---gt-agg-----ttt-tgt----------------------------------------
                   Chinchilla  agtggggac---cc-agg-----ttt-cgggt---------------------------gc---g-----
             Brush-tailed rat  ---ggagac---tt-agg-----ttt-tgtat---------------------------tc---g-----
B D                    Rabbit  ggctgggac---ct-ccg-----ctc-tgcag---------------------------gc---gt----
B D                      Pika  ggcggagac---ct-ctg-----ttt-tgcag---------------------------at---gt----
B D                       Pig  agctaggac---cc-cca-----ttc-tgtaa---------------------------ac---gtgag-
B D                    Alpaca  agctgggac---ct-cca-----ttc-tgtaa---------------------------at---gtgag-
               Bactrian camel  agctgggac---ct-cca-----ttc-tgtaa---------------------------at---gtgag-
B D                   Dolphin  agctgggac---ct-cca-----ttc-tgtaa---------------------------ac---gtgag-
                 Killer whale  agctgggac---ct-cca-----ttc-tgtaa---------------------------ac---gtgag-
             Tibetan antelope  aactaggac---ct-cca-----ttc-tgtaa---------------------------ac---gtgag-
B D                       Cow  aactaggac---ct-cca-----ttc-tgtaa---------------------------ac---gtgag-
B D                     Sheep  aactaggac---ct-cca-----ttc-tgtaa---------------------------ac---gtgag-
                Domestic goat  agctaggac---ct-cca-----ttc-tgtaa---------------------------ac---gtgag-
B D                     Horse  agatgggac---ct-cccgt---tcc-tgtta---------------------------ac---gtgag-
B D          White rhinoceros  agctgggac---ct-cca-----ttc-tgcaa---------------------------ac---ttgag-
B D                       Cat  agctgggac---ct-ccg-----ttc-tgtaa---------------------------ac---gt----
B D                       Dog  -cgtggggc---ct-cgg-----ctc-cgcaa---------------------------ac---gtgcg-
B D                   Ferret   agctgtgac---ct-cc------ttc-tgtaa---------------------------ac---gtgag-
B D                     Panda  agctgggac---ct-ccg-----ttc-tgtaa---------------------------ac---gtgag-
               Pacific walrus  -cctgggac---ct-ccg-----ttc-tgtaa---------------------------ac---gtgag-
                 Weddell seal  -gctgggac---ct-ccg-----ttc-tgtaa---------------------------ac---gtgag-
             Black flying-fox  agctgggac---cg-cca-----ttc-ggtaa---------------------------at---gt----
                Big brown bat  agctgagac---tt-cca-----ttcttgtaa---------------------------ac---gt----
         David's myotis (bat)  cgccgagac---cc-tcg-----ttcttgtaa---------------------------ac---gt----
B D                  Microbat  cgccgagac---cc-tcg-----ttcttgtaa---------------------------ac---gt----
B D                  Hedgehog  aactgggac---cc-cccccccattc-tgtac---------------------------tc---atgag-
B D                     Shrew  agctgggac---ct-ccc-----gtc-cgcag---------------------------cc---gtggga
              Star-nosed mole  ggcctggac---ct-ccg-----ttc-tgc----------------------------------------
B D                  Elephant  agccggaac---ct-cca-----ttc-cgtaa---------------------------ga---gtaag-
          Cape elephant shrew  agttgggag---ct--ca-----ctc-tataa---------------------------ac---agcgg-
B D                   Manatee  agccgagac---ct-cca-----ttc-tgtaa---------------------------gc---gtgag-
             Cape golden mole  aacctggac---ct-cca-----ttc-tgtaa---------------------------gc---ttggg-
B D                    Tenrec  agcccggac---cc-cca-----atc-tgaga---------------------------gc---gggag-
                     Aardvark  -----------------------------------------------------------------tgag-
B D                 Armadillo  ggccgggtc---ccccca-----ccc-cctcactagtgcacggagggcactagagaaccgc---gcgag-
B D                   Opossum  ggcaggtta---tt-ttg-----ttt-tcttt---------------------------tc---ccaag-
B D           Tasmanian devil  tataagatgaagtt-ttg-----ttt-tattt---------------------------tc---tgga--
B D                   Wallaby  tgta--------tt-gtg-----tta-tattt---------------------------tc---tcgag-
B D                  Platypus  ----------------------------------------------------------------------
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Megabat  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                  Squirrel  ======================================================================

                        Human  ------gag--gtgc---tt-gga--------gg-t----------------------g-ggggc-ctt-
                        Chimp  ------gag--gtgc---tt-gga--------gg-t----------------------g-ggggc-ctt-
                      Gorilla  ------gag--gtgc---tt-gga--------ga-t----------------------g-ggggc-ctt-
                    Orangutan  ------gag--gtgc---tt-gga--------gg-t----------------------g-ggggc-ctt-
                       Gibbon  ------gag--gtgc---tt-gga--------gg-t----------------------g-ggggc-ctt-
                       Rhesus  ------gag--gtgc---tt-gga--------gg-t----------------------g-ggggc-ctt-
          Crab-eating macaque  ------gag--gtgc---tt-gga--------gg-t----------------------g-ggggc-ctt-
                       Baboon  ------gag--gtgc---tt-gga--------gg-t----------------------g-ggggc-ctt-
                 Green monkey  ------gag--gtgc---tt-gga--------gg-t----------------------g-ggggc-cct-
                     Marmoset  ------gag--gtgc---tt-gga--------gg-t----------------------g-gggac-ctt-
              Squirrel monkey  ------gag--gtgc---tt-gga--------gg-t----------------------g-gggac-cct-
                     Bushbaby  ------gag--atga---tt-gga--------ag-t----------------------g-gggat-ctc-
           Chinese tree shrew  ------gaa--acgg---tt-gga--------gg-t----------------------g-gggat-ctt-
       Lesser Egyptian jerboa  ------gag--gagctgata-gga--------ag-t----------------------g-gagaatctt-
                 Prairie vole  ------gag--aagc---------------------------------------------------ctt-
              Chinese hamster  ------gag--gagc---------------------------------------------------ctt-
               Golden hamster  ------gag--gagc---------------------------------------------------ctt-
                        Mouse  ------aag--gagc---------------------------------------------------ctt-
                          Rat  ------aag--gagc---------------------------------------------------ctt-
               Naked mole-rat  ------gag--gagcttgag-gga--------gg-t----------------------g-gggat-ctt-
                   Guinea pig  ------gag--gaggttgag-gga--------gg-t----------------------g-gggac-ctt-
                   Chinchilla  ------ggg--gagcttgcg-gga--------gg-c----------------------g-gggat-ctg-
             Brush-tailed rat  ------ggg--gagt------------------g-t----------------------g-gggat-ctt-
                       Rabbit  ------gtg--gacatggct-gga--------gg-t----------------------g-gggat-ccc-
                         Pika  ------atggagacccacct-gga--------ag-t----------------------g-ggggt-cct-
                          Pig  ------ggc--ctga---tt-gga--------gg-t----------------------g-gagat-ctt-
                       Alpaca  ------ggg--atga---tt-gga--------gg-t----------------------g-gagat-ctt-
               Bactrian camel  ------ggg--atga---tt-gga--------gg-t----------------------g-gagat-ctt-
                      Dolphin  ------ggg--atga---tt-gga--------gg-t----------------------g-gagat-ctt-
                 Killer whale  ------ggg--atga---tt-gga--------gg-t----------------------g-gagat-ctt-
             Tibetan antelope  ------ggg--gtga---tt-gga--------gt-t----------------------g-gagaa-cac-
                          Cow  ------ggg--gtga---tt-gga--------gg-t----------------------g-gagat-ctt-
                        Sheep  ------ggg--gtga---tt-gga--------gg-t----------------------g-gagaa-cac-
                Domestic goat  ------ggg--gtga---tt-gga--------gg-t----------------------g-gagaa-cac-
                        Horse  ------gag--atga--ttt-gga--------gg-t----------------------g-gagat-ctt-
             White rhinoceros  ------gag--gtga---tt-gga--------gg-t----------------------g-gagag-ctt-
                          Cat  ------gag--atga---tg-ggt--------ga-t----------------------t-taggt-ctt-
                          Dog  ------gcg--gcag---tg-agg--------gg-g----------------------gtgaggt-ccc-
                      Ferret   ------gag--atga---tc-gga--------gg-t----------------------g-gaggt-ctt-
                        Panda  ------gag--atga---tc-gga--------gg-t----------------------g-gaggt-ctt-
               Pacific walrus  ------gag--atga---tc-gga--------gg-t----------------------g-gaggt-ctt-
                 Weddell seal  ------gag--atga---tc-gga--------gg-t----------------------g-gaggt-ctt-
             Black flying-fox  ------gag--atga---cg-gga--------gg-t----------------------g-gagat-ctt-
                Big brown bat  ------gag--gcgg---tg-aga--------gg-t----------------------g-gaaat-tgt-
         David's myotis (bat)  ------gag--gtgg---tt-gga--------gg-t----------------------g-gtgat-tct-
                     Microbat  ------gag--gtgg---tt-gga--------gg-t----------------------g-gtgat-ttt-
                     Hedgehog  ------gag--atga---tt-gga--------tg-t----------------------g-gagta-ctt-
                        Shrew  tgattgggg--atga---tc-gag----------------------------------g-caggt-ctc-
              Star-nosed mole  -gaactgag--atgc---gc-gca----------------------------------g-ggggg-cgc-
                     Elephant  ------gag--atga---tt-gga--------gg-t----------------------a-gagat-cttc
          Cape elephant shrew  ------aag--atag---tt-gga--------gg-t----------------------g-gagat-ctt-
                      Manatee  ------gag--atgg---tt-gcg--------gg-t----------------------a-gagat-ctt-
             Cape golden mole  ------gaa------------gga--------gg-t----------------------g-gagct-cgt-
                       Tenrec  ------gag--gggc---tttgga--------gg-t----------------------g-gagat-cgtg
                     Aardvark  ------gat--aagg---ct-gga--------gg-t----------------------g-gagat-ctt-
                    Armadillo  ------gag--atag---tt-gga--------gg-t----------------------g-gagat-ctg-
                      Opossum  ------agg--ccag---tc-cga--------attt----------------------g-gag-------
              Tasmanian devil  ------aag--cgaa---tc-aga--------atct----------------------g-gag-------
                      Wallaby  ------aag--tgaa---tc-aga--------at-t----------------------g-gag-------
                     Platypus  --agacgag--acgt---tc-gggacgggtcggg-tctggggcgctgctcctcctccgg-ggggc-ctt-
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Megabat  ======================================================================
     Chinese softshell turtle  ======================================================================
                     Squirrel  ======================================================================

                        Human  ggc-gggaa-
                        Chimp  ggc-gg-aa-
                      Gorilla  ggc-gg-aa-
                    Orangutan  ggc-gg-aa-
                       Gibbon  ggc-gg-aa-
                       Rhesus  ggc-gg-aa-
          Crab-eating macaque  ggc-gg-aa-
                       Baboon  ggc-gg-aa-
                 Green monkey  ggc-gg-aa-
                     Marmoset  ggc-gg-aa-
              Squirrel monkey  ggc-gg-aa-
                     Bushbaby  ggc-gg-aa-
           Chinese tree shrew  ggc-cg-ca-
       Lesser Egyptian jerboa  aac-ag-aa-
                 Prairie vole  gac-tt-ga-
              Chinese hamster  gacttg-aa-
               Golden hamster  ggc-tg-aa-
                        Mouse  ggcttgaaa-
                          Rat  gacttg-aa-
               Naked mole-rat  ggc-gg-aa-
                   Guinea pig  ggc-gg-aa-
                   Chinchilla  ggc-gg-at-
             Brush-tailed rat  ggc-gg-aa-
                       Rabbit  ggc-ag-ga-
                         Pika  ggc-tg-aa-
                          Pig  gga-gg-ga-
                       Alpaca  gga-gg-aa-
               Bactrian camel  gga-gg-aa-
                      Dolphin  gga-aa-ga-
                 Killer whale  gga-aa-ga-
             Tibetan antelope  gga-gg-aa-
                          Cow  gga-gg-aa-
                        Sheep  gga-gg-aa-
                Domestic goat  gga-gg-aa-
                        Horse  tgc-tg-gt-
             White rhinoceros  ggc-tg-a--
                          Cat  gga-ga-aa-
                          Dog  gga-g-----
                      Ferret   gga-ga----
                        Panda  gga-ga----
               Pacific walrus  aga-g-----
                 Weddell seal  ggc-g-----
             Black flying-fox  g---------
                Big brown bat  g---------
         David's myotis (bat)  g---------
                     Microbat  g---------
                     Hedgehog  ----------
                        Shrew  ggg-ag-gg-
              Star-nosed mole  agg-gg-gg-
                     Elephant  ggg-gg-gg-
          Cape elephant shrew  ggc-gg-ga-
                      Manatee  -gg-gg-gg-
             Cape golden mole  gcg-gg-ag-
                       Tenrec  gcg-gg-ag-
                     Aardvark  ggc-gg-ga-
                    Armadillo  ggt-gg-ga-
                      Opossum  ----------
              Tasmanian devil  ----------
                      Wallaby  ----------
                     Platypus  ccc-gg-atc
                 Atlantic cod  ==========
                  Stickleback  ==========
           Southern platyfish  ==========
       Yellowbelly pufferfish  ==========
                         Fugu  ==========
                    Tetraodon  ==========
                      Chicken  ==========
                 Mallard duck  ==========
           Tibetan ground jay  ==========
                       Medaka  ==========
          Pundamilia nyererei  ==========
                  Zebra mbuna  ==========
        Burton's mouthbreeder  ==========
          Princess of Burundi  ==========
                 Nile tilapia  ==========
                X. tropicalis  ==========
               Painted turtle  ==========
              Green seaturtle  ==========
           American alligator  ==========
                  Rock pigeon  ==========
          Collared flycatcher  ==========
          Medium ground finch  ==========
                       Lizard  ==========
             Peregrine falcon  ==========
                 Saker falcon  ==========
                      Megabat  ==========
     Chinese softshell turtle  ==========
                     Squirrel  ==========

Inserts between block 25 and 26 in window
          Chinese tree shrew 10bp
B D                   Rabbit 1bp
B D                     Pika 1bp
B D                      Pig 16bp
B D                   Alpaca 12bp
              Bactrian camel 12bp
B D                  Dolphin 17bp
                Killer whale 17bp
            Tibetan antelope 17bp
B D                      Cow 17bp
B D                    Sheep 17bp
               Domestic goat 17bp
B D                    Horse 15bp
B D         White rhinoceros 10bp
B D                      Cat 11bp
B D                      Dog 5bp
B D                  Ferret  10bp
B D                    Panda 10bp
              Pacific walrus 13bp
                Weddell seal 10bp
            Black flying-fox 10bp
               Big brown bat 10bp
        David's myotis (bat) 10bp
B D                 Microbat 10bp
B D                 Hedgehog 11bp
B D                    Shrew 11bp
             Star-nosed mole 17bp
B D                 Elephant 5bp
         Cape elephant shrew 5bp
B D                  Manatee 5bp
            Cape golden mole 5bp
B D                   Tenrec 5bp
                    Aardvark 5bp
B D                Armadillo 5bp

Alignment block 26 of 343 in window, 56080746 - 56080790, 45 bps 
B D                     Human  gg-g-----------------t-ctcggtt----------------------------------------
B D                     Chimp  gg-g-----------------t-ctcggtt----------------------------------------
B D                   Gorilla  gg-g-----------------t-ctcggtt----------------------------------------
B D                 Orangutan  gg-g-----------------t-ctcggtt----------------------------------------
B D                    Gibbon  gg-g-----------------t-ctcggtt----------------------------------------
B D                    Rhesus  gg-g-----------------t-ctcggtt----------------------------------------
B D       Crab-eating macaque  gg-g-----------------t-ctcggtt----------------------------------------
B D                    Baboon  gg-g-----------------t-ctcggtt----------------------------------------
B D              Green monkey  gg-g-----------------t-ctcggtt----------------------------------------
B D                  Marmoset  gg-g-----------------t-ctcggtt----------------------------------------
B D           Squirrel monkey  gg-g-----------------t-ctcggtt----------------------------------------
B D                  Bushbaby  gg-g-----------------t-ctc--------------------------------------------
           Chinese tree shrew  ga-t-----------------t-cttgctt----------------------------------------
B D                  Squirrel  gg-g-----------------c-cccagct----------------------------------------
       Lesser Egyptian jerboa  ag-a-----------------t-ctcagct----------------------------------------
                 Prairie vole  gg-g-----------------t-ctccgtt----------------------------------------
B D           Chinese hamster  gg-g-----------------t-ctcggtt----------------------------------------
               Golden hamster  gg-g-----------------t-ctctgtt----------------------------------------
B D                     Mouse  gg-g-----------------t-ctccgtt----------------------------------------
B D                       Rat  gg-g-----------------t-ctcagtt----------------------------------------
B D            Naked mole-rat  gg-g-----------------g-ctcactt----------------------------------------
B D                Guinea pig  gg-t-----------------g-ctcactg----------------------------------------
                   Chinchilla  gg-------------------g-cgcactg----------------------------------------
             Brush-tailed rat  gg-------------------g-ctcacta----------------------------------------
B D                    Rabbit  -a-g-----------------g-ctcag-g----------------------------------------
B D                      Pika  -g-g-----------------g-ttca-------------------------------------------
B D                       Pig  gg-g-----------------t-ctcggtt----------------------------------------
B D                    Alpaca  ga-g-----------------t-ctcggtt----------------------------------------
               Bactrian camel  ga-g-----------------t-ctcggtt----------------------------------------
B D                   Dolphin  gg-g----------------tt-ctcggtt----------------------------------------
                 Killer whale  gg-g----------------tt-ctcggtt----------------------------------------
             Tibetan antelope  gc-g-----------------t-ctcggtt----------------------------------------
B D                       Cow  gg-g-----------------t-ctcggtt----------------------------------------
B D                     Sheep  gc-a-----------------t-ctcggtt----------------------------------------
                Domestic goat  gc-g-----------------t-ctcggtt----------------------------------------
B D                     Horse  gg-g----------------ct-ctcagtt----------------------------------------
B D          White rhinoceros  gg-g-----------------t-ctcagtt----------------------------------------
B D                       Cat  at-g-----------------t-ctcagtt----------------------------------------
B D                       Dog  gg-g-----------------t-cccggcc----------------------------------------
B D                   Ferret   gt-g-----------------t-ctc--------------------------------------------
B D                     Panda  gg-g-----------------ctctcagtc----------------------------------------
               Pacific walrus  gg-g-----------------g-ctcagtt----------------------------------------
                 Weddell seal  gg-g-----------------c-ctcagtt----------------------------------------
             Black flying-fox  ggtg-----------------t-ctcagtt----------------------------------------
                Big brown bat  gg-g-----------------t-ct--gtt----------------------------------------
         David's myotis (bat)  gg-g-----------------t-ct--gtt----------------------------------------
B D                  Microbat  gg-g-----------------t-ct--gtt----------------------------------------
B D                  Hedgehog  gg-a-----------------c-ctcaatt----------------------------------------
B D                     Shrew  gg-t-----------------t-ctctgtt----------------------------------------
              Star-nosed mole  ga-g-----------------c-ctcagtt----------------------------------------
B D                  Elephant  ga-g------------------------------------------------------------------
          Cape elephant shrew  ga-gaagggttgtgttggaggt-ctcaata----------------------------------------
B D                   Manatee  ga-g-----------------t-ctcggca----------------------------------------
             Cape golden mole  ta-g-------------------ccccctactcactcc--------------------------------
B D                    Tenrec  gg-t---------cttgagagc-ccccctactcgcctccctactcacccacttccaccccccggcacttc
                     Aardvark  gg-g-----------------t-ctcgtta----------------------------------------
B D                 Armadillo  c--------------------t-ctcagtt----------------------------------------
B D                   Opossum  ---------------------c-ctcattt----------------------------------------
B D           Tasmanian devil  --------------------tc-ttaacct----------------------------------------
B D                   Wallaby  ---------------------c-ctaactt----------------------------------------
B D                  Platypus  -----------------gagcc-ctccctt----------------------------------------
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Megabat  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  -------tg-------ct-cgcca-------ac-----------cccc-tgc---------------ccc
                        Chimp  -------tg-------ct-cgcca-------ac-----------cccc-tgc---------------ccc
                      Gorilla  -------tg-------ct-cgcca-------ac-----------cccc-tgc---------------ccc
                    Orangutan  -------tg-------ct-cgtca-------ac-----------cccc-tgc---------------ccc
                       Gibbon  -------tg-------ct-cgccacctgctcgc-----------cacc-tgc---------------ccc
                       Rhesus  -------tg-------ct-cgcca-------gc-----------ttcc-tgc---------------ccg
          Crab-eating macaque  -------tg-------ct-cgcca-------gc-----------ttcc-tgc---------------ccg
                       Baboon  -------tg-------ct-cgcca-------gc-----------ctcc-tgc---------------ccg
                 Green monkey  -------tg-------ct-cgcca-------gc-----------ctcc-tgc---------------ccc
                     Marmoset  -------tg-------ct-ctcca-------gc-----------ctcc-tac---------------ccc
              Squirrel monkey  -------tg-------ct-ctcca-------gc-----------ctcc-tac---------------ccc
                     Bushbaby  -------tg-------ct-cccca-------gc------------tcc-tgt---------------ccc
           Chinese tree shrew  -------tg-------ct-aacca-------gc-----------cccc-tgc---------------ccc
                     Squirrel  -------tg-------at-ttctg-------gca----------cccc-tgg---------------ctc
       Lesser Egyptian jerboa  -------tg-------cc-ctcca-------gc-----------ccca-tgg----------------cc
                 Prairie vole  -------tg-------ct-ctgcg-------gt-----------tccg-tgg---------------ccc
              Chinese hamster  -------tg-------ct-ctctg-------gc-----------tccc-tgg---------------tcc
               Golden hamster  -------tg-------ca-ctccg-------gc-----------tccc-tgg---------------tct
                        Mouse  -------tg-------ct-ctcag-------gt-----------tccc-tgg---------------ccc
                          Rat  -------tg-------tt-ctcag-------gt-----------tccc-tgg---------------ccc
               Naked mole-rat  -------tg-------c---------------------------cccc-tga---------------ccc
                   Guinea pig  -------ta-------t---------------------------cccc-tga---------------acc
                   Chinchilla  -------ta-------c---------------------------cctc-gga---------------ccc
             Brush-tailed rat  -------tc-------c---------------------------cctc-tga---------------ccc
                       Rabbit  -------tg-------c---------------------------tccc-cag---------------ccc
                         Pika  --------a-------c---------------------------tccc-gcc---------------cca
                          Pig  -------tg-------ca-c-cca-------tc-----------ctcc-tgc---------------ccc
                       Alpaca  -------tg-------ct-ccccc-------ac-----------ctcc-tgc---------------ccc
               Bactrian camel  -------tg-------ct-ctccc-------ac-----------ctcc-tgc---------------ctc
                      Dolphin  -------tg-------tt-c-cca-------ac-----------ctcc-tgc---------------ccc
                 Killer whale  -------tg-------tt-c-cca-------ac-----------ctcc-tgc---------------ccc
             Tibetan antelope  -------ta-------ct-c-cag-------ac-----------ctctttgg---------------ccc
                          Cow  -------tg-------ct-c-tag-------ac-----------gtccttgg---------------ccc
                        Sheep  -------ta-------ct-c-cag-------ac-----------ctctttgg---------------ccc
                Domestic goat  -------ta-------ct-c-cag-------ac-----------ctctttgg---------------ccc
                        Horse  -------tg-------ctccccca-------at-----------cctc-tgt---------------ttc
             White rhinoceros  -------tg-------cg-cccca-------at-----------gccc-tgc---------------tcc
                          Cat  -------tg-------tt-cccca-------ac-----------cgcg-------------------tcc
                          Dog  -------tg-------tg-agccc-------ac-----------cccc-------------------tcc
                      Ferret   -------tg-------tt-cccca-------gc-----------ccca-------------------tcc
                        Panda  -------tg-------tt-cccca-------ac-----------ccca-------------------tcc
               Pacific walrus  -------ta-------tt-tccca-------ag-----------acca-------------------tcc
                 Weddell seal  -------ca-------tt-cccca-------ag-----------ccca-------------------tcc
             Black flying-fox  -------tg-------ct-cccca-------ac-----------ccct-tgc---tctgt-------ccc
                Big brown bat  -------tg-------cg-ccccg-------gc-----------cccc-ggc---ccccg-------gcc
         David's myotis (bat)  -------tg-------ct-ccccg-------ac-----------ctcc-tgc---cccca-------ccc
                     Microbat  -------tg-------ct-ccccg-------ac-----------ctcc-tgc---cccca-------ccc
                     Hedgehog  -------tgccacaaccc-ccccc-------gc-----------cccc-ctg---cctccaccttcaccc
                        Shrew  -------ta-------cc-cccca-------gc-----------cccc-ct-------------------
              Star-nosed mole  -------tg-------ct-cccca-------gc-----------cccc-ccc---ccccc-------ccc
                     Elephant  -----------------t-ctcta-------cc-----------cccc-ag-------------------
          Cape elephant shrew  -------ga-------cc-ctcta-------cc-----------cccc-ag-------------------
                      Manatee  -------gc--------c-cccta-------cc-----------cccc-ag-------------------
             Cape golden mole  -------tc-------ac-ctcca-------cccgcacccccaccccc-ag-------------------
                       Tenrec  caccccacc-------cc-ctcca-------cctatccccccagcccc-cg-------------------
                     Aardvark  -------g---------c-cccta-------cccttccccccc-tccc-ag-------------------
                    Armadillo  -------tg-------ct-ctcca-------gccccttccc---cccg-gg-------------------
                      Opossum  -------c--------tt-tccca-------gg-----------cccg-tct----cctagt-----tct
              Tasmanian devil  -------ct-------tt-tccca-------gt-----------tccg-tct---cccgggt-----tcc
                      Wallaby  -------ct-------tt-tccca-------gt-----------cccg-tct---ccctggt-----tcc
                     Platypus  -------tc-------cc-tcctc-------cc-----------ctcc-ccgtggccccttctcccgccc
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Megabat  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  cc------------accc--------g------cgcc-ga
                        Chimp  cc------------accc-------cg------cgcc-ga
                      Gorilla  cc------------accc-------cg------cgcc-ga
                    Orangutan  cc------------cgcc-------cg------cgcc-ta
                       Gibbon  tc------------accc-------cg------cgcc-gt
                       Rhesus  cc------------accc-------cg------cacc-ga
          Crab-eating macaque  cc------------accc-------cg------cacc-ga
                       Baboon  cc------------agcc-------cg------cacc-ga
                 Green monkey  cc------------accc-------cg------cacc-ga
                     Marmoset  ct------------acct-------cg------cacc-ga
              Squirrel monkey  ct------------acct-------cg------cacc-ga
                     Bushbaby  cc------------accc-------ga------cacctgg
           Chinese tree shrew  cc------------attt-------cg------ccccagg
                     Squirrel  tc------------accc-------ca-----ccctg-gg
       Lesser Egyptian jerboa  cc------------atcc-------ca-----ctcca-ag
                 Prairie vole  cc------------accc-------ca-----cccca-gg
              Chinese hamster  cc------------accc-------ca-cccgcccca-gg
               Golden hamster  cc------------accc-------caccccacccca-gg
                        Mouse  cc------------accc-------ca-----ttcca-gg
                          Rat  cc------------accc-------ca-----tccca-gg
               Naked mole-rat  cc------------accc-------ca------cccaggg
                   Guinea pig  cc------------actc-------ta------ctca-gg
                   Chinchilla  cc------------tctc-------ca------ccca-gc
             Brush-tailed rat  cct-----------tctc-------ca------cccg-gg
                       Rabbit  cc------------ggcccccaccgcg-----ccccg-gg
                         Pika  cc------------tgcc-------cg-----ccgag-gg
                          Pig  ctcctgccccctcctgc-----------------------
                       Alpaca  cc------------ggg-----------------------
               Bactrian camel  ct------------ggg-----------------------
                      Dolphin  ca------------ggg-----------------------
                 Killer whale  ca------------ggg-----------------------
             Tibetan antelope  ct------------ggg-----------------------
                          Cow  ct------------ggg-----------------------
                        Sheep  ct------------ggg-----------------------
                Domestic goat  ct------------ggg-----------------------
                        Horse  cc------------cgg-----------------------
             White rhinoceros  cc------------ctg-----------------------
                          Cat  cg------------ggg-----------------------
                          Dog  ct------------cgg-----------------------
                      Ferret   ct------------cgg-----------------------
                        Panda  ct------------cgg-----------------------
               Pacific walrus  ct------------tgg-----------------------
                 Weddell seal  ct------------cgg-----------------------
             Black flying-fox  cc------------caa-----------------------
                Big brown bat  cc------------agg-----------------------
         David's myotis (bat)  cc------------agg-----------------------
                     Microbat  cc------------agg-----------------------
                     Hedgehog  cg------------gg------------------------
                        Shrew  --------------gg------------------------
              Star-nosed mole  cg------------gg------------------------
                     Elephant  ----------------------------------------
          Cape elephant shrew  ----------------------------------------
                      Manatee  ----------------------------------------
             Cape golden mole  ----------------------------------------
                       Tenrec  ----------------------------------------
                     Aardvark  ----------------------------------------
                    Armadillo  ----------------------------------------
                      Opossum  cc------------agg-----------------------
              Tasmanian devil  cc------------agg-----------------------
                      Wallaby  cc------------cgg-----------------------
                     Platypus  t---------------------------------------
                 Atlantic cod  ========================================