Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 444 in window, 155802878 - 155803022, 145 bps 
B D                     Human  tagtataaac-atagcattca-------tttt--agtcctctgc-aagaga--------c---at--ttt
B D                     Chimp  tagtataaac-atagcattca-------tttt--agtcctctgc-aagaga--------c---at--ttt
B D                   Gorilla  tagtataaac-atagcattca-------tttt--agtcctctgc-aagaga--------c---at--ttt
B D                 Orangutan  tagtataaac-atagcattca-------tttt--agtgctctgc-aagaga--------c---at--ttt
B D                    Gibbon  tagtataaac-atagcattca-------tttt--agtgctctgc-aagaga--------c---at--ttt
B D                    Rhesus  tagtataaac-atagcattca-------gttt--ggtgctctgc-aagata--------c---at--ttt
B D       Crab-eating macaque  tagtataaac-atagcattca-------gttt--ggtgctctgc-aagaga--------c---at--ttt
B D                    Baboon  tagtataaac-atagcattca-------gttt--agtgctctgc-aagaga--------c---at--ttt
B D              Green monkey  tagtataaac-atagcattca-------gttt--agtgctctgc-aagaga--------c---at--ttt
B D                  Marmoset  tagtataaat-gcagcattca-------tttt--agtgctctgc-aagaga--------c---at--tct
B D           Squirrel monkey  tagtaaaaat-gcagcattca-------tttt--agtgctctgc-aagaga--------c---at--tct
B D                  Bushbaby  tgctataaac-atggcattta-------tttt--agcgctctgc-aagaga--------c---at--ttt
           Chinese tree shrew  tgccatgaca-g--gcacttg-------ctcc--ggtggtctgc-gagggt--------g---gt--tcc
B D                  Squirrel  tagtagaaataatagcattca-------tttt--aatactctgt-aaaaga--------c---at---tt
       Lesser Egyptian jerboa  cagtataaac-acagcgttta-------tttc--agtgctctac-aaaaga--------c---gt--ctt
                 Prairie vole  cagtataaac-acagcattca-------tttt--tgtgctccgc-caaaga--------c---at--ttt
B D           Chinese hamster  gagtataaac-acagcattca-------tttt--tgtgctcagc-caaaga--------c---at--ttt
               Golden hamster  gagtataaac-acagcattca-------tttt--tgtgctcagc-caaaga--------c---at--ttt
B D                     Mouse  tagtataaac-acagcattcattttttttttt--tttactcagc-caaagaccttttttt---tt--ttt
B D                       Rat  tcgtataaac-acagcattca-------tttt--tgtactcagg-caaaga------gat---tt--ttt
B D            Naked mole-rat  cagtataaac---agcgctca-------gctg--agtgcctggg-aagaga--------c---at--gct
B D                Guinea pig  cagtataaac-gcagcgttca-------tttg--agtgctcagc-aagaga--------c---at--tct
                   Chinchilla  tagtgtaaac-gtagccttca-------tccg--agtgcccagc-aagaga--------c---at--tct
             Brush-tailed rat  tcgtataaac-ggagctggca-------ccgg--agtg-ctggc-aagaga--------c---at--tcc
B D                    Rabbit  taatataaac-atggcattca-------tt----agtgctctgcaaaaaga--------c---at--ttt
B D                      Pika  tggtataaac-atggcattca-------tt----ggtgccctgc-aaaagc--------c---at--ttt
B D                       Pig  gaatataatc-agagcatttg-------tttc--tgtgctatgc-aagaga--------c---at--tct
B D                    Alpaca  taacataaac-atagcactgg-------cttc--ggtgctctgc-gaaaga--------c---gt--ttt
               Bactrian camel  taacgtaaac-atagcactgg-------cttc--ggtgctctgc-gagaga--------c---gt--ttt
B D                   Dolphin  taatataaac-atggcattcg-------tgtc--gttggtctgc-aagcga--------c---at--ttt
                 Killer whale  taatataaac-atggcattcg-------tgtc--attggtctgc-aagcaa--------c---at--ttt
             Tibetan antelope  taatataaat-gtagcatttg-------tttc--agtgctctgc-cagaga--------t---at--ttc
B D                       Cow  taacataaac-gtagcatttg-------tttc--agtgccctgc-cagaga--------t---at--ttt
B D                     Sheep  taatataaat-gtaacatttg-------tttc--agtgctctgc-cagaga--------t---at--ttt
                Domestic goat  taatataaat-gtagcatttg-------tttc--agtgctctgc-cagaga--------t---at--ttt
B D                     Horse  taatataaac-acagcattct-------tttt--agtggtctgc-aagaga--------c---at--ttt
B D          White rhinoceros  caatataaat-acagcattct-------tttt--agtgctctgc-aagaga--------c---at--ttt
B D                       Cat  tcatgtaaac-acagcatttg-------tttt--agtgctctgt-cggaga--------c---at--ttt
B D                       Dog  taatataaac-atagtattca-------tttt--agtgctctgc-aggaga--------c---ag--ttt
B D                   Ferret   taacataaat-ttaacatttg-------ttgt--a-tgctctgc-aggaga--------c---at--ttt
B D                     Panda  taatgtaaac-atgacattcg-------ttgt--agtgctctgc-agggga--------c---aa--ttt
               Pacific walrus  taatataaac-ataaaattcg-------ttgt--agtgctctgc-aggaga--------c---at--ttt
                 Weddell seal  taatataaac-gtaacattcg-------ttgt--agcgctctgc-aggaga--------c---at--ttt
             Black flying-fox  taatataagc-atagcattca-------tttt--tgtgctctac-atgaga------------at--tct
B D                   Megabat  taatataagc-atagcattcg-------tttt--tgtgctctac-ttgaga------------at--tct
                Big brown bat  cgatataaac-atagcattcg-------tttt--cgtgccctgt-acgaga--------c---at--tgt
         David's myotis (bat)  ggatataaac-gtagtactcg-------tttt--cgtgctccgg-atgaga--------c---at--ttt
B D                  Microbat  ggatataaac-gtagcattcg-------cttt--cgtgctctgg-acgaga--------c---at--ttt
B D                  Hedgehog  gagtgtaaac-agcacatggt-------ttgt--agtgttcttc-aagaga--------t---ct--cct
B D                     Shrew  tagtttaaat-atctcattgg-------tttt--aatgccatgg-aagaga--------cttttt--tct
              Star-nosed mole  tggtgtaaac-atggccttgg-------tctctgcacgcggtgc-aggaga--------c---ag--gct
B D                  Elephant  tagtataaat-atagcgtttg-------cctt--agtgccctgc-aagaga--------c---at--ttt
          Cape elephant shrew  tagtataaac-acaccattct-------gttt--agttctgtgc-aagagg--------c---ct--ttt
B D                   Manatee  tcgtataaat-acagcatttg-------gttt--agagctctgc-aagaga--------c---at--ttt
             Cape golden mole  tagtataaat-gcaacatttg-------cttc--cgtgctcttc-aagaaa--------c---at--ttt
B D                    Tenrec  aagtataaac----acatttt-------attt--agtgctctgc-aagaga--------t---at--ttt
                     Aardvark  tagtataaac-atagcatttc-------cttt--agtgctctgc-aattga--------c---gt--tgt
B D                 Armadillo  tggcataaac-atagcattca-------tttt--aatgctctgc-gagaga--------c---ag--ttt
B D                   Opossum  tgagataaac-acagcatcca-------tcct--ggagaattca-caaaga--------c---at--ttt
B D           Tasmanian devil  tggaataaac-acaacatcca-------tttt--ggaaatatca-tgaagg--------c---at--ttt
B D                   Wallaby  tggaataaac-acagcatcca-------ttct--ggagaattca-caaagg--------c---at--ttt
B D                  Platypus  caatagaggc-a-agtatcca-------actt--ggtgggtcgg-ggaaac--------c---attatcc
  D               Rock pigeon  tgctttaagt----------t-------tttc--agtcatatac-ctgggt--------c----t--ttt
  D             Scarlet macaw  tgctttaaat----------t-------tttc--agtcatatac-ctgagc--------c----t--cct
B D              Atlantic cod  taaaacaaac-gcagc-ctca-------cctc--tctgagttgc--agcga--------c---ct--ctc
         Pundamilia nyererei  ======================================================================
B D                   Lamprey  ======================================================================
         Princess of Burundi  ======================================================================
      Yellowbelly pufferfish  ======================================================================
                 Spotted gar  ======================================================================
B D                      Fugu  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D              Nile tilapia  ======================================================================
B D               Stickleback  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
B D                 Tetraodon  ======================================================================
       Burton's mouthbreeder  ======================================================================
          Southern platyfish  ======================================================================
B D        American alligator  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
B D               Zebra finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                    Turkey  ======================================================================
          Tibetan ground jay  ======================================================================
  D    White-throated sparrow  ======================================================================
  D           Green seaturtle  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================

                        Human  ta-ctg-aga-------tata------taaatgctttgt-ac--agtaaagaa--------gtcatgaag
                        Chimp  ta-ctg-aga-------ttta------taaatgctttgt-ac--agtaaagaa--------gtcatggag
                      Gorilla  ta-ctg-aga-------tata------taaatgctttgt-ac--agtaaagaa--------gtcatggag
                    Orangutan  ta-ctg-aga-------tata------taaatgctttgt-ac--agtaaagaa--------gtcatggag
                       Gibbon  ta-ctg-aga-------tata------taaatgctttgt-ac--agtaaagaa--------gtcatggag
                       Rhesus  ta-ctg-aga-------tata------t-----------------------aa--------gtcatggag
          Crab-eating macaque  ta-ctg-aga-------tata------t-----------------------aa--------gtcatggag
                       Baboon  ta-ctg-aga-------tata------t-----------------------aa--------gtcatggag
                 Green monkey  ta-ctg-aga-------tata------t-----------------------aa--------gtcatggag
                     Marmoset  tc-ctgaaaa-------aata------taaatgctttgt-ac--agtaaggaa--------atcatggag
              Squirrel monkey  ta-ctg-aaa-------aata------taaatgctttgt-cc--agtaaagaa--------atcatggag
                     Bushbaby  ta-ctg-aaa-------taca------taaatgctttgc-ac--agtaaagaa--------gtcctaggg
           Chinese tree shrew  c--ctg-tgg---------ca------taagtgctttgc-ac--cgtgcggag------ccgtctttgc-
                     Squirrel  ttactg-aat-------tata------taaatgccttgc-at--tgtaaagaa--------gtcagggag
       Lesser Egyptian jerboa  ttaccg-aaa-------tata------taaatgttttgc-ac--tgtgaggaa--------acgatgggt
                 Prairie vole  ttccta-aaa-------taca------taaatgctttgt-gc--tatgaagaa--------gtcatgggg
              Chinese hamster  ttccta-aaa-------taca------taaatgctttgc-ac--tgtgaagta--------gtcatggag
               Golden hamster  ttccta-aaa-------taca------taaatgctttgc-ac--tgtgaagta--------gtcatggag
                        Mouse  ttccta-aaa-------taca------taaatgctttgc-ac--tgtgaagaa--------tccatggag
                          Rat  ttccta-aaa-------taca------taaatgctttgc-ac--tgtgaagaa--------gctgtggac
               Naked mole-rat  tt-ctg-aaa-------ttca------taaatgttttgc-ac--tgtagagaa--------gtcatggag
                   Guinea pig  tt-ctg-aaa-------aggg------taaatattttac-ac--tg-aaagaa--------gtcgtggca
                   Chinchilla  tt-ctg-aaa-------tgtg------taaatatttggc-cc--tg-aaagaa--------gtcctggag
             Brush-tailed rat  tt-ctg-aaa-------tgca------taaatattttgc-aa--tg-aaagaa--------gttgtggag
                       Rabbit  ta-gta-aaa-------tgta------taaatgctgtgt-ac--catcaagaa--------gtcacagaa
                         Pika  ta-ttg-aaa-------tgta------tagatgctgtgc-ac--aggaaagaa--------ggtgtggga
                          Pig  ta-ctg-aaa-------tgta------gaaaggatttgc-tc--agtgaagga--------gtcatagag
                       Alpaca  ta-ctg-aaa-------tcta------taaatgatttgg-ac--ggtaaagaa--------gttggggag
               Bactrian camel  ta-ctg-aaa-------tcta------taaatgatttgg-ac--ggtaaagaa--------gtcggggag
                      Dolphin  ta-ctg-aaa-------ggta------aaagtgatttgc-ac--agtaaagaa--------gccatggag
                 Killer whale  ta-ctg-aaa-------ggta------aaagtgatttgc-ac--agtaaagaa--------gccatggag
             Tibetan antelope  ta-ctg-aaa-------ggta------taaatgatttgc-ac--agtagataa--------gtcagggag
                          Cow  ta-ctg-aaa-------ggta------taaatgttttgc-ac--cgtagagaa--------gtcatggag
                        Sheep  ta-ctg-aaa-------ggta------taaatgatttgc-ac--agtagagaa--------gtcagggag
                Domestic goat  ta-ctg-aaa-------ggta------taaatgatttgc-ac--agtagagaa--------gtcagggag
                        Horse  ta-ctg-aaa-------tata------taaatgctttgc-ac--agtaaagaa--------gtcacggag
             White rhinoceros  ta-ctg-aaa-------tatg------taaatgctttgc-ac--agtaaagaa--------gtcacagag
                          Cat  ta-ctg-aaa-------taca------taaatgctttgc-at--agtaaagaa--------gtcttagag
                          Dog  ta-ccg-aaa-------tata------taaatgctttgc-at--agtaaa-aa--------gtcagagag
                      Ferret   ta-ctg-aaa-------tata------taaatgcttagc-at--gggaaagaa--------gttggagac
                        Panda  ta-ctg-aaa-------gata------taaatgctttgcaat--aggaaagaa--------gtcggagag
               Pacific walrus  ta-ctg-aaa-------tata------taaatgctttgc-at--aggaaagaa--------gtcggagag
                 Weddell seal  ta-ctg-aaa-------taga------taaatgctttgc-ct--aggaaagaa--------gtcggagag
             Black flying-fox  ta-ctg-aaa-------taca------taaatgttttgc-ac--ggtaaagaa--------gtcatgcag
                      Megabat  ta-ctg-aaa-------taca------taaatgttttgc-ac--ggtaaagaa--------gtcatgcag
                Big brown bat  tg-ctg-aaa-------tgtatactagtaaatgctttgt-ac--ggtaaagaa--------gtcctggag
         David's myotis (bat)  tg-ctg-aaa-------tgta------taaatgttttat-ac--gggaaagaa--------gtcctggag
                     Microbat  tg-ctg-aaa-------tgta------taaatgttttat-ac--gggaaagaa--------gtcctggag
                     Hedgehog  ta-ctg-aaa-------tata------tggatgccttgc-tc--aataaagag--------gtcagacag
                        Shrew  ta-cca-agt-------cata------tagattctttg------tgtggtgac--------attaca-ag
              Star-nosed mole  ga-ccg-ga---------ata------tagggaggttgg-cc--tgggcagga--------gtcacg-gg
                     Elephant  ac-ctc-aca-------taca------tcaa-----tgc-ac--agtaaaaaa--------gtcatagag
          Cape elephant shrew  ta-ctc-acg-------taca------taaa-----tgc-a---aattaaaaa--------gtgatgggg
                      Manatee  ta-ctc-acg-------taca------taaa------gc-ac--agtaaaaaa--------gtcacggag
             Cape golden mole  ta-ctc-aca-------tacg------taaa-----tgc-ac--agtaaaaat--------gtcat-aag
                       Tenrec  ta-ttc-tca-------ttca------taaa-----tttgac--agtaaaaaa--------gtcatggat
                     Aardvark  ----tc-aca-------ttca------taaa-----cgc-cc--agtaaacaa--------gtcatggag
                    Armadillo  ta-ctc-aac-------tata------taaatgctttgc-ac--agcaaagaa--------gtcttgaag
                      Opossum  ta-ctc--------------a-----------gcttttc-tc--actaagaga--------gccccagag
              Tasmanian devil  ta-ctc--------------a-----------gcttttc-tc--actaagaga--------gccccagag
                      Wallaby  ta-ctt--------------a-----------gcatttc-tc--accaagaga--------gccccagaa
                     Platypus  ta-cca-att-------aaca------aaacacattatc-tc--agaaagaaa--------gccacagag
                  Rock pigeon  gg-ttg-taa----------a------tgatttggttat-tc--aatgtgaatttcattcattcattagg
                Scarlet macaw  gg-ttg-taaattataactta------ttattcggcaat-tcatagtgtgaat--------ttcattagg
                 Atlantic cod  ca-cca-gca---------ca------agaatggctttt-at--ag---------------tctctgcag
          Pundamilia nyererei  ======================================================================
                      Lamprey  ======================================================================
          Princess of Burundi  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                  Spotted gar  ======================================================================
                         Fugu  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                 Nile tilapia  ======================================================================
                  Stickleback  ======================================================================
                  Zebra mbuna  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
                    Tetraodon  ======================================================================
        Burton's mouthbreeder  ======================================================================
           Southern platyfish  ======================================================================
           American alligator  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
                  Zebra finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
          Collared flycatcher  ======================================================================
                       Turkey  ======================================================================
           Tibetan ground jay  ======================================================================
       White-throated sparrow  ======================================================================
              Green seaturtle  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
       Spiny softshell turtle  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================

                        Human  ---catgag-a-a----------g-g-actcagattt---gcgtt------tagataa-catcaacttga
                        Chimp  ---catgag-a-a----------g-g-actcagattt---gcgtt------tagataa-catcaacttga
                      Gorilla  ---catgag-a-a----------g-g-actcagattt---gcgtt------tagataa-catcaacttga
                    Orangutan  ---catgag-a-a----------g-g-actcagattt---gcatt------tagataa-catcaacttga
                       Gibbon  ---catgag-a-a----------g-g-actcagattt---gcgtt------tagataa-catcaacttga
                       Rhesus  ---cgtgag-a-a----------g-g-acttagattt---gtgtt------tagataa-catcaacttga
          Crab-eating macaque  ---cgtgag-a-a----------g-g-acttagattt---gtgtt------tagataa-catcaacttga
                       Baboon  ---cgtgag-a-a----------g-g-acttagattt---gcgtt------tagataa-catcaacttga
                 Green monkey  ---cgtgag-a-g----------g-g-acttagattt---gcgtt------tagataa-catcaacttga
                     Marmoset  ---catgag-a-agggtgttgg-g-g-gctcagattt---gcgtt------tagataa-catcaacttga
              Squirrel monkey  ---catgaa-a-agggcgttgg-g-g-acgcagattt---gtgtt------tagataa-catcaacttga
                     Bushbaby  ---catgag-a-tgagtcctgg-g-g-gctgagattt--cgcttt------tagatag-catcaactc--
           Chinese tree shrew  -----tgaa-g-g---ccctgg-a-g-actcag---t---gtgct------tccagtg-c-------tga
                     Squirrel  ---ctttag-acaggaccttg--g-g-gctcagattt---gcttt------tagataa-tatcaattt--
       Lesser Egyptian jerboa  ---tttggg-a-agagttctg--g-g-actcagatct---acttt------tagataa-tatcaactt--
                 Prairie vole  ---cttggg-a-agggt-ttg--g-g-gctcaggttt---acttt------cagatac-catcaactt--
              Chinese hamster  ---cttgag-a-agggtcctg--g-a-cctcaggttt---acttt------tagatac-catcaactt--
               Golden hamster  ---cttgag-a-agggtcctg--g-a-cctcaggttt---acttt------tagatac-catcaactt--
                        Mouse  ---cttgag-a-agggtcctg--g-g-cctcaggttt---acttt------tagatac-catcaactt--
                          Rat  ---cttgag-a-agggtcttg--g-g-cctcaggttt---ac-tt------tagatac-catcgactt--
               Naked mole-rat  ---cttgag-a-agggtcctg--g-g-actcaggttt---gcttt------tagataa-tatcagcat--
                   Guinea pig  ---cttggg-a-agggtcctg--g-g-tctctggttt---ggttt------tagataa-catcagcgt--
                   Chinchilla  ---ctcagg-a-agggccctg--g-g-actcaggttt---gactt------tagataa-catcaccat--
             Brush-tailed rat  ---ctcggg-a-agtgtcctg--g-g-acgcaggttt---ggttt------tagataa-catcaatgt--
                       Rabbit  aaggaggag-g-agggcactg--gca-acccaaattt---acttt------cagataa-catcggctt--
                         Pika  ---gtggag-g-aaggtactg--g-a-acccagattt---actct------cagataa-caccaactc--
                          Pig  ---catgag-a-agggcgctgg-g-c-actcagatct---acttt------tcaaaaa-catcaactt--
                       Alpaca  ---cctgag-g-aaggtcccgg-g-g-actcagacct---gcttt------catgtag-catcagctt--
               Bactrian camel  ---cctgag-g-agggtcctgg-g-g-actcagacct---gcttt------cacgtag-catcagctt--
                      Dolphin  ---cataag-a-ag-------g-g-g-actcagacct---gcttc------tagataa-catcagctt--
                 Killer whale  ---cataag-a-ag-------g-g-g-actcagacct---gcttc------tagataa-catcagctt--
             Tibetan antelope  ---catagg-a-ggggtgccag-g-g-actcagacct---gcttt------tagataa-catcaactg--
                          Cow  ---catagg-a-ggggtgccag-g-g-actcagacct---gcttt------tagataa-catcaactg--
                        Sheep  ---catagg-a-gggatgccag-g-g-actcagacct---gcttt------tagataa-catcaactg--
                Domestic goat  ---catagg-a-ggggtgccag-g-g-actcagacct---gcttt------tagataa-catcaactg--
                        Horse  ---catgag-a-aggggtactg-g-g-actcagactt---gattt------tagataa-cttcaactt--
             White rhinoceros  ---catgag-a-aggagtgctg-g-g-actccaatgt---gcttt------tagataa-catcaactt--
                          Cat  ---catgag-a-agcggactgg-g-g-actcgggttt---gcttt------tagatta-caccgacct--
                          Dog  ---catgag-a-agggtgctgg-g-g-actcagattt---gcttt------tagataa-cactgactt--
                      Ferret   ---caggag-a-agggtactgg-g-g-actcagatct---gcttt------tagataa-cacggactt--
                        Panda  ---catgaa-a-agggtactgg-g-g-actcaaattt---gcttt------cagataa-caccggcct--
               Pacific walrus  ---caggag-a-agggtactgg-g-g-actctgattt---gcttt------tagataa-cactgactt--
                 Weddell seal  ---caggag-a-agggaactgg-g-g-actctgatct---gcttt------tagataa-cactgactt--
             Black flying-fox  ---catggg-a-aat----------------------------tt------tagataa-cgt-aactt--
                      Megabat  ---catggg-a-aat----------------------------tt------tagataa-cgt-aactt--
                Big brown bat  ---cgtgag-g-cgtgtgctgc-a-a-g---------------tt------tagacag-catcaacct--
         David's myotis (bat)  ---catgag-a-agtgtgctgg-a-a-g---------------tt------tagacag-caccaacct--
                     Microbat  ---catgag-a-agtgtgctgg-a-a-g---------------tt------tagacag-caccaacct--
                     Hedgehog  ---catgag-a-agggtactga-a-aaactcacattt---gcctg------tagataa-cctcattg---
                        Shrew  ---c---ag-a-aggggacaat-g-a----cagattt---gcttg------taggtga-ttccaacc---
              Star-nosed mole  ---cctgag-a-agggtaccag-g-g--ctcagactc---gcttt------taggtaa-cttcactta--
                     Elephant  ---cctgag-a-aggatcctgg-g-g-actcagagtt---gccgt------cagatag-catcaactt--
          Cape elephant shrew  ---cgcaag-a-agggccctag-g-g-ac---------------t------cagatag-catcatcct--
                      Manatee  ---catgag-c-agggtcctgg-g-g--ctcggattt---gccgt------cagatag-catcaactt--
             Cape golden mole  ---catgaa-a-gggatcttgg-g-c-attcagattt---gcctt------cagataa-catcagctt--
                       Tenrec  ---cgtggg-a-aaggtcctgg-g---actcacattt---gcctt------cagataa-catcaactt--
                     Aardvark  ---catgagaa-agggtcctgg-g-g-actcagattt---gcctt------caggtaa-tatcgactt--
                    Armadillo  ---catgaa-a-agggtactgg-g-g-actcagactt---gcctt------aaggtaa-catcagctt--
                      Opossum  ---cagggg-aggggatgatagaa-g-gctcacattt---gcctt------cagataa-catcagctt--
              Tasmanian devil  ---cagagg-agggggtgatagaa-t-gctcatattt---gcctt------cagatat-catcagttt--
                      Wallaby  ---cagggg-a-gggatgataaaa-g-gctcatattt---gcctt------tagataa-catcagctt--
                     Platypus  ---ctggta-g-acataacaga-g-g-gctcatcttt---gtccc------caaatgt-tatcaactc--
                  Rock pigeon  ---actgag-a-tgt--------a-g-ttgcagatgc---ggctgtagcagtagatag--atagagag--
                Scarlet macaw  ---aatgag-g-tgt--------a-g-ttgcagatgc---agctg--gtagcaggtag--ataggtag--
                 Atlantic cod  ---c--gag-g-c----------a-g-atttacactcgaggcttt------cagacaagaatgcacttta
          Pundamilia nyererei  ======================================================================
                      Lamprey  ======================================================================
          Princess of Burundi  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                  Spotted gar  ======================================================================
                         Fugu  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                 Nile tilapia  ======================================================================
                  Stickleback  ======================================================================
                  Zebra mbuna  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
                    Tetraodon  ======================================================================
        Burton's mouthbreeder  ======================================================================
           Southern platyfish  ======================================================================
           American alligator  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
                  Zebra finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
          Collared flycatcher  ======================================================================
                       Turkey  ======================================================================
           Tibetan ground jay  ======================================================================
       White-throated sparrow  ======================================================================
              Green seaturtle  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
       Spiny softshell turtle  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================

                        Human  agaagataaac-----a
                        Chimp  agaagataaac-----a
                      Gorilla  agaagataaac-----a
                    Orangutan  agaagataaac-----a
                       Gibbon  agaagataaac-----a
                       Rhesus  agaagataaac-----a
          Crab-eating macaque  agaagataaac-----a
                       Baboon  agaagataaac-----a
                 Green monkey  agaagataaac-----a
                     Marmoset  aggagataaac-----a
              Squirrel monkey  agaagataaac-----a
                     Bushbaby  -agagataaac-----a
           Chinese tree shrew  ggggaggaggc-----g
                     Squirrel  -gaagataaac-----a
       Lesser Egyptian jerboa  -gaagataaac-----a
                 Prairie vole  -caagctaaac-----a
              Chinese hamster  -gaagataaac-----a
               Golden hamster  -gaagataaac-----a
                        Mouse  -gaagataaac-----a
                          Rat  -gaagataaac-----a
               Naked mole-rat  -gaagataaac-----a
                   Guinea pig  -gaagataaac-----a
                   Chinchilla  -gaagataaac-----a
             Brush-tailed rat  -gaagataaac-----a
                       Rabbit  -gaagataaac-----a
                         Pika  -gaagataaac-----a
                          Pig  -gaagataaac-----a
                       Alpaca  -gaagacaaac-----a
               Bactrian camel  -gaagacaaac-----a
                      Dolphin  -gaagggaaac-----g
                 Killer whale  -gaagggaaac-----g
             Tibetan antelope  -gaa-ataaac-----a
                          Cow  -gaa-ataaac-----a
                        Sheep  -gaa-ataaac-----a
                Domestic goat  -gaa-ataaac-----a
                        Horse  -gaagataaac-----a
             White rhinoceros  -gaagataaac-----a
                          Cat  -gaagataaac-----a
                          Dog  -gaagataaac-----a
                      Ferret   -gaagataaac-----a
                        Panda  -gaagataaac-----a
               Pacific walrus  -gaagataaac-----a
                 Weddell seal  -gaagataaac-----a
             Black flying-fox  -gaagataaac-----a
                      Megabat  -gaagataaac-----a
                Big brown bat  -gaagataagc-----a
         David's myotis (bat)  -gaagataaat-----g
                     Microbat  -gaagataaac-----a
                     Hedgehog  -gaaggaggac-----a
                        Shrew  -taaattaaac-----a
              Star-nosed mole  -gaagataaat-----a
                     Elephant  -gaagataaac-----a
          Cape elephant shrew  -gaagataaat-----a
                      Manatee  -gaagataaac-----a
             Cape golden mole  -gaagataaaa-----c
                       Tenrec  -gaagataaac-----a
                     Aardvark  -gaagataaat-----a
                    Armadillo  -gaaggtaaac-----a
                      Opossum  -gagcataaat-----a
              Tasmanian devil  -gagcataaat-----a
                      Wallaby  -gagcataaat-----a
                     Platypus  -atgaataacc-----a
                  Rock pigeon  -atatatagatatccca
                Scarlet macaw  -aggaagagat-----a
                 Atlantic cod  agaagctaaac-----a
          Pundamilia nyererei  =================
                      Lamprey  =================
          Princess of Burundi  =================
       Yellowbelly pufferfish  =================
                  Spotted gar  =================
                         Fugu  =================
     Mexican tetra (cavefish)  =================
                 Nile tilapia  =================
                  Stickleback  =================
                  Zebra mbuna  =================
                    Zebrafish  =================
                       Medaka  =================
                    Tetraodon  =================
        Burton's mouthbreeder  =================
           Southern platyfish  =================
           American alligator  =================
                      Chicken  =================
                 Mallard duck  =================
                       Parrot  =================
                   Budgerigar  =================
                  Zebra finch  =================
             Peregrine falcon  =================
                 Saker falcon  =================
          Medium ground finch  =================
                       Lizard  =================
          Collared flycatcher  =================
                       Turkey  =================
           Tibetan ground jay  =================
       White-throated sparrow  =================
              Green seaturtle  =================
                   Coelacanth  =================
                X. tropicalis  =================
       Spiny softshell turtle  =================
     Chinese softshell turtle  =================
               Painted turtle  =================

Inserts between block 1 and 2 in window
B D             Atlantic cod 1097bp

Alignment block 2 of 444 in window, 155803023 - 155803047, 25 bps 
B D                     Human  --tttataa---ggcgtttttg--ccctttgt
B D                     Chimp  --tttataa---ggcgtttttg--ccctttgt
B D                   Gorilla  --tttataa---ggcgtttttg--ccctttgt
B D                 Orangutan  --cttataa---ggcgtttttg--ccctttgt
B D                    Gibbon  --tttataa---tgcgtttttg--ccctttgt
B D                    Rhesus  --tttataa---ggtgttttta--tcctttgt
B D       Crab-eating macaque  --tttataa---ggtgttttta--ccctttgt
B D                    Baboon  --tttataa---ggtgttttta--ccctttgt
B D              Green monkey  --tttataa---agcgttttta--ccctttgt
B D                  Marmoset  --tttgtaa---ggcattcatg--ccctttgt
B D           Squirrel monkey  --tttataa---ggcattcatg--ccctttgt
B D                  Bushbaby  --tttagaa---ggcatttctg--ctctttgt
           Chinese tree shrew  --ctc--aa---ggc--ttctg--ccc-ttgc
B D                  Squirrel  --tttattc---ggtgtttctg--cccttatt
       Lesser Egyptian jerboa  --tttacaa---agcattcctg--ccctttat
                 Prairie vole  --tttacaa---gacatctctg--ccctttgt
B D           Chinese hamster  --tttacaa---gacatctctg--ccctttgt
               Golden hamster  --tttacaa---gacatctctg--ccctttgt
B D                     Mouse  --tttacaa---gacatctctg--ccctttgt
B D                       Rat  --tttacaa---gacatctctg--ccctttgt
B D            Naked mole-rat  --tttataa---ggcatttctg--tcttttgt
B D                Guinea pig  --tttgtaa---ggcatctctg--tcctttgt
                   Chinchilla  --tttacaa---ggcattgctg--ccctttgt
             Brush-tailed rat  --tttataa---ggcagctctg--tcctttgt
B D                    Rabbit  --tttataa---gatatttctg--ccctttgt
B D                      Pika  --tttataa---gttcttaac---ccctttgt
B D                       Pig  --ttaataa---ggcatctctg--cactttgt
B D                    Alpaca  --gttctaa---ggcctctctg--ccctttgt
               Bactrian camel  --gttctaa---ggcctctctg--ccctttgt
B D                   Dolphin  --tttataa---ggcatttctg--cccttggt
                 Killer whale  --tttataa---ggcatttctg--cccttggt
             Tibetan antelope  --ttcataa---ggcatttctg--cccatggt
B D                       Cow  --gtcataa---ggcatttctg--cccatggt
B D                     Sheep  --ttcataa---ggcatttctg--cccatggt
                Domestic goat  --ttcataa---ggcatttctg--cccatggt
B D                     Horse  --tttatat---ggcatttctg--ccctttgt
B D          White rhinoceros  --tttataa---ggcatttctg--ccctttgt
B D                       Cat  --tttataa---ggcatttatg--cgctttgt
B D                       Dog  --tttataa---ggcatttctg--ctctttgt
B D                   Ferret   --tttataa---gatatttctg--ctctttgt
B D                     Panda  --tttataa---ggcagttctg--ctctttgt
               Pacific walrus  --tttataa---ggcatttctg--ctctttgt
                 Weddell seal  --tttataa---ggcatttctg--ccctttgt
             Black flying-fox  --tttataa---ggcatttcga--cccgaggt
B D                   Megabat  --tttataa---ggcatttcga--cccgaggt
                Big brown bat  --ttcatgc---ggcatttctg--cccttggt
         David's myotis (bat)  --ttcatgc---ggcatttctg--cccttggt
B D                  Microbat  --ttcatgc---ggcatttctg--cccttggt
B D                  Hedgehog  tgtctatag---gacatgcctg--ctacgtgt
B D                     Shrew  --tttatag---ggcatttatg--ccctttgt
              Star-nosed mole  --tttatag---gacatttctg--tcctttgt
B D                  Elephant  --tttataa---ggcatttctg--ccctt--t
          Cape elephant shrew  --tttataa---gcagtttctg--tcctttgt
B D                   Manatee  --tttataa---ggcatttctg--cccttt-t
             Cape golden mole  --tgtatat---ggcattt-tg--tcctctgc
B D                    Tenrec  --tgtataa---ggaatttctg--tcctttgt
                     Aardvark  --ctcataa---ggcatttctg--ccctttgt
B D                 Armadillo  --attacaa---ggcattgttg--cc-----t
B D                   Opossum  --ttt---t---tgtattcctg--tactctat
B D           Tasmanian devil  --tttataa---tgtgttcctg--tgcagtat
B D                   Wallaby  --tttacaa---tatattcctg--tgctctat
B D                  Platypus  --tttattg---ttcttctaagtctccttatt
  D               Rock pigeon  --tatacatgtacatgtgtatg--cttgtat-
  D             Scarlet macaw  --tgtacat---cgtgtatgta--cctgtgt-
B D              Atlantic cod  ================================
         Pundamilia nyererei  ================================
B D                   Lamprey  ================================
         Princess of Burundi  ================================
      Yellowbelly pufferfish  ================================
                 Spotted gar  ================================
B D                      Fugu  ================================
    Mexican tetra (cavefish)  ================================
B D              Nile tilapia  ================================
B D               Stickleback  ================================
                 Zebra mbuna  ================================
B D                 Zebrafish  ================================
B D                    Medaka  ================================
B D                 Tetraodon  ================================
       Burton's mouthbreeder  ================================
          Southern platyfish  ================================
B D        American alligator  ================================
B D                   Chicken  ================================
  D              Mallard duck  ================================
  D                    Parrot  ================================
B D                Budgerigar  ================================
B D               Zebra finch  ================================
  D          Peregrine falcon  ================================
  D              Saker falcon  ================================
B D       Medium ground finch  ================================
B D                    Lizard  ================================
  D       Collared flycatcher  ================================
B D                    Turkey  ================================
          Tibetan ground jay  ================================
  D    White-throated sparrow  ================================
  D           Green seaturtle  ================================
B D                Coelacanth  ================================
B D             X. tropicalis  ================================
  D    Spiny softshell turtle  ================================
  D  Chinese softshell turtle  ================================
  D            Painted turtle  ================================

Inserts between block 2 and 3 in window
  D              Rock pigeon 1bp
  D            Scarlet macaw 16bp

Alignment block 3 of 444 in window, 155803048 - 155803178, 131 bps 
B D                     Human  ttcattt-agaaataaa-tataat-attgg-aaaaaa-g-aag--------tcagtgg-aa--tattgc-
B D                     Chimp  ttcattt-agaaataaa-tataat-attgg-aaaaaa-g-aag--------tcagtgg-aa--tattgc-
B D                   Gorilla  ttcattt-agaaataaa-tataat-attgg-aaaaaa-g-aag--------tcagtgg-aa--tattgc-
B D                 Orangutan  ttcattt-agaaataaa-tataat-attgg-aaaaaa-g-aag--------tcagtgg-aa--tagtgc-
B D                    Gibbon  ttcattt-agaaataaa-tataat-attgg-aaaaaa-g-aag--------tcagtgg-aa--tattgc-
B D                    Rhesus  ttcattt-agaaataaa-tataat-attgg-aaaaaa-g-aag--------tcagtgg-aa--tattgc-
B D       Crab-eating macaque  ttcattt-agaaataaa-tataat-attgg-aaaaaa-g-aag--------tcagtgg-aa--tatcgc-
B D                    Baboon  ttcattt-agaaataaa-tataat-attgg-aaaaaa-g-aag--------tcagtgg-aa--tattgc-
B D              Green monkey  ttcattt-agaaataaa-tataat-attgg-aaaaaa-g-aag--------tcagtgg-aa--tattgc-
B D                  Marmoset  ttcattt-aaaaataaa-tatagt-attgg-aaaa-----aag--------tcagtgg-aa--tattgc-
B D           Squirrel monkey  ttcattt-aaaaataaa-tctaat-attgg-aaaaaa-g-aag--------tcagtgg-aa--tattgc-
B D                  Bushbaby  ttcaatt-agaaacaaa-tataat-attgg-aaaaat-g-aag--------tcagcgg-aa--tattgc-
           Chinese tree shrew  ctcactg-aggaacgca-tgtgc------g-tggagc-g-aag--------ccg--gg-ag--cgttgc-
B D                  Squirrel  ttcaact-aaaaacaaa-taaaat-actgg-aaaaat-gaaag--------tcagtgg-aa--tagtgc-
       Lesser Egyptian jerboa  ttcaagt-ggaaacaaa-cataat-attggaaaaaat-g-aac--------ctagtgg-aa--tattgc-
                 Prairie vole  tttaagt-agaaacaaa-tataat-atcgg-aaaaat-g-aag--------tcagtgg-aa--tgttgct
B D           Chinese hamster  tttaagt-agaaacaaa-tataat-attgg-aaaaat-g-aag--------tcagtgg-aa--tattgc-
               Golden hamster  tttaagt-agaaacaaa-tataat-attgg-aaaaac-g-aag--------tcagtgg-aa--tattgc-
B D                     Mouse  tttaagt-agaaacaaa-tataat-attgg-aaaaat-g-aag--------tcagtgg-aa--tattgc-
B D                       Rat  tttaagt-agaaacaaa-tataat-attgg-aagaat-g-aag--------tcagtgg-aa--tattgc-
B D            Naked mole-rat  ttcaagt-gaaaacaaa-tataat-aatgg-aaaaat-g-aag--------ccagtgg-ag--tattgc-
B D                Guinea pig  ttcaagt-agaaacaaa-tataat-aatgg-aaaagt-g-aag--------ccagtgg-aa--tattgc-
                   Chinchilla  ttcaggg-agaaaccaa-tgcaat-aatgg-aaaagt-g-aag--------tgagtgg-aa--tattgc-
             Brush-tailed rat  ttcaagt-agaagcaaa-tataat-aatgg-aaaagt-a-aag--------ccagtgg-aa--tattgc-
B D                    Rabbit  ttcaag-----ggcaaa-tataataactgg-aaaaat-g-aag--------tcagtgg-aa--tattgc-
B D                      Pika  tacaagt-agaagcaaa-tataat-actgg-aaaaat-g-agg--------tcagcggaaa--tattgc-
B D                       Pig  ttcaatt-aaaaacaaa------t-attgg-agaaat-g-atg--------tcagtga-aa--tattgc-
B D                    Alpaca  ttcaatt-agaaacaaa-tataat-cttgg-aaaaat-g-aag--------tcagtgg-aa--tatagc-
               Bactrian camel  ttcaatt-ggaaacaaa-tatgat-cttgg-aaaaat-g-aag--------tcagtgg-aa--tattgc-
B D                   Dolphin  ttcagtt-agtaacaaa-tataat-attgg-aaaaat-g-cag--------tcagtgg-aa--tattgc-
                 Killer whale  ttcagtt-agtaacaaa-tataat-attgg-aaaaat-g-cag--------tcagtgg-aa--tattgc-
             Tibetan antelope  ttcggtt-agaaaagaattataac-attga-aaaaat-g-aag--------tcagtgg-aa--tattgc-
B D                       Cow  ttcagtt-agaaaaaaattataac-attga-aaaaat-g-aag--------tccgtgg-aa--tattgc-
B D                     Sheep  ttcggtt-agaaaagaattaaaac-attga-aaaaag-g-aag--------tcagtgg-aa--tattgc-
                Domestic goat  ttcggtt-agaaaagaattaaaac-attga-aaaaat-g-agg--------tcagtgg-aa--tattgc-
B D                     Horse  ttcagtt-agaaacaaa-tataat-attgg-aaaaat-g-aag--------tcagtgg-aa--tattgc-
B D          White rhinoceros  ttcagtt-agaaacaaa-tataat-attgg-aaaaat-g-aag--------tcggtgg-aa--tattgc-
B D                       Cat  ttcaatt-aaaaacaaa-tataat-attggaaaaaat-g-aag--------ccagggg-at--tattgc-
B D                       Dog  ttcaattaaaaaacaaa-tattac-attgg-aaaaat-g-gag--------tcagagc-at--tcttgc-
B D                   Ferret   ttcaatt-gaaaacaaa-tataat-tttga-aaaaat-g-aag--------tcaggac-at--tattgc-
B D                     Panda  ttcaatt-aaaaacaag-tatagt-attag-aaaaat-g-aag--------ac--ggg-at--tattcc-
               Pacific walrus  ttcaatt-aaaaacaac-tataat-attgg-aaaact-g-aag--------tcagggg-at--tcttgc-
                 Weddell seal  ttcaatt-aaaaacagc-gataat-attgg-aaaact-g-aag--------tcagggg-attatattgc-
             Black flying-fox  ttcaatg-agaaacaaa-tttaat-attgg-aaaaat-g-aag--------taat----------ttgc-
B D                   Megabat  ttcaatg-agaaacaaa-tttaat-attgg-aaaaat-g-aag--------tcat----------ttgc-
                Big brown bat  ttcaatg-agaagcaat-gataat-attgg-aaaaat-g-aag--------tcagtgg-aa--tattgc-
         David's myotis (bat)  ttcaatg-agaagcaat-gataat-attgg-aaaaat-g-aag--------tcagtgg-aa--tattgc-
B D                  Microbat  ttcaatg-agaagcaat-gataat-attgg-aaaaat-g-aag--------tcagtgg-aa--tattgc-
B D                  Hedgehog  ttcaat----------------------------------------------------------------
B D                     Shrew  ttcagtc-agaaacaag-tagtgt-atgag-aaaatt-a-aaa--------tgggtga-tt--tagtgc-
              Star-nosed mole  ttcaatt-agcaacaag-tatcct-attgg-aaaaat-g-aag--------tcagtgg-aa--tattgc-
B D                  Elephant  ttcatt--agaagcaaa-tacagt-att--------t-g-aag--------tcagcgg--a--tattgc-
          Cape elephant shrew  ttcatta-aaaaatgaa-tatgtt-attgg-aaaaat-g-aag--------tcagtgg-aa--tactgt-
B D                   Manatee  ttcatt--agaaacaaa-tatatt-att--------t-g-aag--------tcagtga-aa--tattgc-
             Cape golden mole  ttcaat--aaaagcaaa-tatatt-attgg-aaaaat-g-aag--------tcaatga-ac--cattgc-
B D                    Tenrec  ttcatt--agaaacaaa-tgtatt-cctgc-ggaaaa-t-aat--------tcagtgg-aa--tattac-
                     Aardvark  ttcatt--agaaacaaa-tatatt-att-g-aaaaat-g-aag--------tcagtgg-aa--tattgc-
B D                 Armadillo  tccagtg-ggaaacaaa-tataat-attgg-aaaagt-c-agg--------tcagtgg-ac--tattac-
B D                   Opossum  tacgact-agaaacaaa-tataat-gttgg-aaaaaatt-aag--------tcagccg-ga--tctttc-
B D           Tasmanian devil  tacaact-ggaaacaaa-tacaat-gttgg-aaaaaa-t-aag--------tcagctg-aa--tctttc-
B D                   Wallaby  tacaact-ggaaacaaa-tataat-gctgg-aaaaaatt-aag--------tcagccg-aa--tctttc-
B D                  Platypus  tccagtg-aataaaata-tctacc-tcaga-aatact-g-aag--------tctactc-aa--taaggc-
  D               Rock pigeon  ------------------tttata-tgtgg-gagatt-c-atgcttagcttttactgg-aa--gtcgat-
B D              Atlantic cod  ======================================================================
         Pundamilia nyererei  ======================================================================
B D                   Lamprey  ======================================================================
         Princess of Burundi  ======================================================================
      Yellowbelly pufferfish  ======================================================================
                 Spotted gar  ======================================================================
B D                      Fugu  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D              Nile tilapia  ======================================================================
B D               Stickleback  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
B D                 Tetraodon  ======================================================================
       Burton's mouthbreeder  ======================================================================
          Southern platyfish  ======================================================================
B D        American alligator  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
B D               Zebra finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                    Turkey  ======================================================================
          Tibetan ground jay  ======================================================================
  D    White-throated sparrow  ======================================================================
  D           Green seaturtle  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================

                        Human  tacata-------------aaggc-aagaatgttaagt-aaacca--------t--ctctagatatctgg
                        Chimp  tacata-------------aaggc-aagaatgttaagt-aaacca--------t--ccctagatatctgg
                      Gorilla  tacata-------------aaggc-aagaatgttaagt-aaacca--------t--ccctagatatctgg
                    Orangutan  tacata-------------aaggc-aagaatgttaagt-aaacca--------t--ccctaggtatctgg
                       Gibbon  tacata-------------aaggc-aagaatgttaagt-aaacca--------t--ccctaggtatctgg
                       Rhesus  tgcata-------------aaggc-aagaatgttaagt-aaacca--------t--ccctaggtatctgg
          Crab-eating macaque  tgcata-------------aaggc-aagaatgttaagt-aaacca--------t--ccctaggtatctgg
                       Baboon  tgcata-------------aaggc-aagaatgttaagt-aaacca--------t--ccctaggtatctgg
                 Green monkey  tgcata-------------aaggc-aagaatgttaagt-aaacca--------t--ccctaggtatctgg
                     Marmoset  tacata-------------aacac-aagaatgttaact-aaacca--------t--ccctaggtgtctgg
              Squirrel monkey  tacata-------------aacgc-aagaatgtcaact-aaacca--------t--ccctaggtatctag
                     Bushbaby  ttcata-------------aaggc-aagaatggtaact-aaacca--------t--cccgagacatctgg
           Chinese tree shrew  ttcata-------------aaggc-gggggtgc------------------------------------a
                     Squirrel  ttcata-------------aaggc-aagaatgttaact-aaacca--------t--ctctaggcatccag
       Lesser Egyptian jerboa  tttata-------------aaggc-aagaatgttcact-aaacca--------t--cttttggtatccag
                 Prairie vole  tttata-------------aaggc-aagaacgtt-cct--ggctg--------t--cgctaggctcccgg
              Chinese hamster  tttata-------------aaggc-aagaatgtt-act--gactg--------t--gtctaggctcctgg
               Golden hamster  tttata-------------aaggc-aagaatgtt-act--caccg--------t--gtctaggctcccgg
                        Mouse  tttata-------------aaggc-aagaatgtt-act--gagtg--------t--ctctaggctcctgg
                          Rat  tttata-------------aaggc-aagaatgtt-act--gactg--------t--ctctaggctcctgg
               Naked mole-rat  tttata-------------aagcc-aagaatgttaact--aaacc--------a--cctccagccaccag
                   Guinea pig  tttata-------------aaggc-aagaatgttaact--aaacc--------a--cttctggccaccag
                   Chinchilla  tttata-------------aaggc-aggaatgcgaacc--agaccaacgcccgc--cccccggccactgg
             Brush-tailed rat  tttata-------------aaggc-aagagtgctaagt--aga----------c--cctccggtcaccag
                       Rabbit  ttcgta-------------aaggc-aagaatgttagct-aaacca--------t--ccctaagcaactgg
                         Pika  ttcata-------------gcggtaaagaagtttagct-gaacca--------t--ccct---------t
                          Pig  ttcata-------------aaggc-aagaatgggagct-caacca--------c--ccccagacatctgg
                       Alpaca  ctcata-------------aaggc-aatagggcacgct-gcaaca--------c--ccccaggcatctgg
               Bactrian camel  ctcata-------------aaggc-aagagtgcctgct-gcaaca--------c--ccccaggcatctgg
                      Dolphin  ttcgta-------------aaggc-aagaatgtgaact-aaacca--------c--ccccaggcatctgg
                 Killer whale  ttcgta-------------aaggc-aagaatgtgaact-aaacca--------c--ctccaggcatctgg
             Tibetan antelope  ttagta-------------aaggc-aagaatgtgaact-aaaccg--------t--ccccaggcatctgg
                          Cow  ttagta-------------aaggc-aagaatgtgaact-aaacca--------t--ccccaggcatctgg
                        Sheep  ttagta-------------aaggc-aagaatgtgatctaaaacca--------t--ccccaggcatctgg
                Domestic goat  ttagta-------------aaggc-aagaatgtgatctaaaaccg--------t--ccccaggcatctgg
                        Horse  ttcata-------------------aagaatgttaact-aaacca--------t--cagcaggcatctgg
             White rhinoceros  ttcata-------------------gagaatgttaact-aaacca--------t--caccaggcatctgc
                          Cat  ttcata-------------aaagc-gagaatgttaacc-agacca--------t--ctccaggcatctgg
                          Dog  ttcata-------------aaagc-aagaatgttaact-acacca--------t--ctccaggcatctgg
                      Ferret   ttcata-------------aaagt-aaggatgttagcc-aaacca--------t--ctccaggcatctgg
                        Panda  ttcatt-------------aaag--aagaacattaact-aagcca--------t--ctccaggcttctgg
               Pacific walrus  ttcata-------------aaagc-aagaatgtgaact-aaacca--------t--ctccaggcatctgg
                 Weddell seal  ttcata-------------aaagc-aagaatgttaact-aaacca--------t--ctccaggcatctgg
             Black flying-fox  ttgtta-------------aggga-aagaatgttaatt-aaacca--------t--ccccaggcatctgg
                      Megabat  ttgtta-------------aggga-aagaatgttaact-aaacca--------t--ccccaggcatctgg
                Big brown bat  ttcgta-------------aagga-aagaatgttaact-acacca--------t--ccacgggcatctgg
         David's myotis (bat)  tttgta-------------aagga-aagcatgttaact-aaacca--------t--ccactggcatctga
                     Microbat  tttgta-------------aagga-aagaatgttaact-aaacca--------t--ccacaggcatctgg
                     Hedgehog  ----------------------------------------------------------------------
                        Shrew  ttcatc-------------aaggc-aggcatgtttagg-agacta--------c--tcccaggcacctgg
              Star-nosed mole  ttcgta-------------aagcc-aagaatgttaact-aaacca--------c---ctcaggcatctgg
                     Elephant  ttcata-------------aaggc-aaaaatgttaact-aaacca--------t--ccctaggcatctgg
          Cape elephant shrew  ttctta-------------aagtc-aagaatgtcaact-aaacca--------t--ccctagacatctgg
                      Manatee  ttcata-------------aaggc-aagaatgtgagct-aaacca--------t--ccctaggcatctgg
             Cape golden mole  tttata-------------aaggg-aagaatgttaggt-aaacct--------t--tcctagg-------
                       Tenrec  ttcata-------------aaggc-aagaatg-cagct-aaacct--------c--ccctaggcatccga
                     Aardvark  ttcata-------------aaggc-aagaatgttaact-aaacca--------t--tcttaggcatctgg
                    Armadillo  ttcata-------------aagag-aagaattttagct-gaaccg--------t--cttcaggcatctga
                      Opossum  tccata-------------aagtc-aggaatgttaacc-aaagaa--------t--tctcagacctttgg
              Tasmanian devil  tccata-------------aagtc-aggaaagttaacc-agatca--------t--ccccagacctttag
                      Wallaby  tccata-------------aagtc-agaaaagttaacc-aaatca--------t--ccccagacttttgg
                     Platypus  -------------------------tagaccgttaacc-aaatca--------t--ttctccactcttgc
                  Rock pigeon  tttacatccagtaccaagtgaatc-aaggatgtgagtc-aaaacg--------tagtgctcagtttctac
                 Atlantic cod  ======================================================================
          Pundamilia nyererei  ======================================================================
                      Lamprey  ======================================================================
          Princess of Burundi  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                  Spotted gar  ======================================================================
                         Fugu  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                 Nile tilapia  ======================================================================
                  Stickleback  ======================================================================
                  Zebra mbuna  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
                    Tetraodon  ======================================================================
        Burton's mouthbreeder  ======================================================================
           Southern platyfish  ======================================================================
           American alligator  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                Scarlet macaw  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
                  Zebra finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
          Collared flycatcher  ======================================================================
                       Turkey  ======================================================================
           Tibetan ground jay  ======================================================================
       White-throated sparrow  ======================================================================
              Green seaturtle  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
       Spiny softshell turtle  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================

                        Human  ggtaat----ataact--acacaaggactatt---ta-ttttat
                        Chimp  ggtaat----ataact--acacaaggactatt---ta-ttttat
                      Gorilla  ggtaat----ataact--acacaaggactatt---ta-tgttat
                    Orangutan  ggtaat----ataact--acacaaggactatt---ta-ttttat
                       Gibbon  ggtaat----ataact--acacaaggactatt---ta-ttttat
                       Rhesus  ggtaat----ataact--acacaaagactatt---ta-ttttat
          Crab-eating macaque  ggtaat----ataact--acacaaagactatt---ta-ttttat
                       Baboon  ggtaat----ataact--acacaaagactatt---ta-ttttat
                 Green monkey  ggtaat----ataact--acacaaagactatt---ta-ttttat
                     Marmoset  ggtagt----ataatt--acacaaggactatt---ta-ttttat
              Squirrel monkey  ggtaat----ataatt--atgcaaggactgtt---ta-ttttat
                     Bushbaby  tctaat----ataatt--ccaccaggactatt---ta-tcttat
           Chinese tree shrew  gtcact----gcaact-----cgagggctacg---tg-ctctag
                     Squirrel  ggtaat----ataagt--tcacaaggactatt---ta-ttttat
       Lesser Egyptian jerboa  agtaat----ataact--tccctggaactatt---ta-ctgtgt
                 Prairie vole  gacaat----agaact--ccacacggactagt---ta-ctccat
              Chinese hamster  ggtaat----ataact--tcacaaagactatt---ta-ttttgt
               Golden hamster  ggtaat----ataact--gcatgaagactatt---ta-ttttgt
                        Mouse  ggtact----gtgact--tcataagaaccatt---ta-tcttgt
                          Rat  ggtaat----ataact--tcataagaactatt---ta-ttttgt
               Naked mole-rat  ggcaat----acagct--tcatgaggacaatt---tg-ttttat
                   Guinea pig  agcgat----acagtt--tcacagggactgtt---ta-ttgcga
                   Chinchilla  ggtgat----accatt--tcacaggggctgtt---tc-ttgcaa
             Brush-tailed rat  cgtgac----gcagtt--tcgcagggactatt---ta-ttgtga
                       Rabbit  ggtact----ataact--cca---ggactatt---tg-ttttac
                         Pika  ggcact----ataacc--ctacagggactatt---tg-ttttgt
                          Pig  agtaat----ataagt-tccacaaggaccatt---ta-tgttat
                       Alpaca  aagcat----gtgagc-gccacggggcgtatt---ta-tttcat
               Bactrian camel  aggcat----gtgagc-gccgcggggcgtatt---ta-tttcat
                      Dolphin  agtcat----agaagt-gtcacaaggactatt---ta-ttttat
                 Killer whale  agtcat----agaagt-gtcacaaggactatt---ta-ttttat
             Tibetan antelope  agtcat----agcagt-accccagggactatt---tatttttat
                          Cow  agtcat----agcagt-gccacagggactatt---tatttttat
                        Sheep  agtcat----agcagt-gccccagggactatt---tatttttat
                Domestic goat  agtcat----agcagt-gccccagggactatt---tatttttat
                        Horse  aataat----ataagt-gccagaaagactattttcta-ttttat
             White rhinoceros  agtaat----ataagt-gccagaaagactatt---ta-ttttac
                          Cat  agtaat----aggagt-gccacaaggactatt---ta-ttttat
                          Dog  agtaac----aggcgt-gccgcaaggacta---------tttat
                      Ferret   agtaat----aggagt-gccacaaagactatg---ga-ttttat
                        Panda  agtaat----aggagt-gccacaaagactatt---ta-ttttat
               Pacific walrus  agcaat----aggagt-gccacaaaaactatc---ta-ttttag
                 Weddell seal  agtaat----aggagt-gccacaaaaactgtc---ta-ttttag
             Black flying-fox  agtaat----ataagt-gccacaagaactatt---ta-ttttat
                      Megabat  agtaat----ataagt-gccacaagaactatt---ta-ttttat
                Big brown bat  agtaat----ataagt-gccacgagaactatt---ta-ttttat
         David's myotis (bat)  agtcat----ataagt-gccttgagaactatt---ta-ttttat
                     Microbat  agtcat----ataagt-gccatgagaactatt---ta-ttttat
                     Hedgehog  ---aat----atatat----acatgtacatgt---ta-ttttgt
                        Shrew  ag-gat----agaagt-gccacaggtactatt---ta-ttttgt
              Star-nosed mole  agtaat----ataagt-gccccaggaactatt---ta-ttttat
                     Elephant  gataat----ataagc-tctacaagaactatt---ta-ttttat
          Cape elephant shrew  gataat----ataagc-tctagagggactatt---ta-ttttat
                      Manatee  ggtaat----gtaagc-tctacaaggactatc---ta-tttga-
             Cape golden mole  ---cat----gtagga-tctacaagaactact---ta-ttttac
                       Tenrec  ggtcat----aaaaga-gctacaaagactatt---ta-ttttat
                     Aardvark  aataat----ataagc-tccacaaagactatt---ta-ttttat
                    Armadillo  ggtaat----ataagcatctagaaggactatt---ta-ttttac
                      Opossum  tttaat----gtaagc-tcttcaaaaactgtt---ta-ctttac
              Tasmanian devil  tataat----gtaaac-tcttcaaaaattgtt---ta-ttttac
                      Wallaby  tataat----gtaagc-tcttcaaagactgtt---ta-ttttac
                     Platypus  aacacg----atcagc-acctctgaca-tatt---tg-ctgcat
                  Rock pigeon  agaaattcagaagacc-ccaaaagaaagcgtc---ca-gttcac
                 Atlantic cod  ============================================
          Pundamilia nyererei  ============================================
                      Lamprey  ============================================
          Princess of Burundi  ============================================
       Yellowbelly pufferfish  ============================================
                  Spotted gar  ============================================
                         Fugu  ============================================
     Mexican tetra (cavefish)  ============================================
                 Nile tilapia  ============================================
                  Stickleback  ============================================
                  Zebra mbuna  ============================================
                    Zebrafish  ============================================
                       Medaka  ============================================
                    Tetraodon  ============================================
        Burton's mouthbreeder  ============================================
           Southern platyfish  ============================================
           American alligator  ============================================
                      Chicken  ============================================
                 Mallard duck  ============================================
                Scarlet macaw  ============================================
                       Parrot  ============================================
                   Budgerigar  ============================================
                  Zebra finch  ============================================
             Peregrine falcon  ============================================
                 Saker falcon  ============================================
          Medium ground finch  ============================================
                       Lizard  ============================================
          Collared flycatcher  ============================================
                       Turkey  ============================================
           Tibetan ground jay  ============================================
       White-throated sparrow  ============================================
              Green seaturtle  ============================================
                   Coelacanth  ============================================
                X. tropicalis  ============================================
       Spiny softshell turtle  ============================================
     Chinese softshell turtle  ============================================
               Painted turtle  ============================================

Inserts between block 3 and 4 in window
B D                 Platypus 4bp

Alignment block 4 of 444 in window, 155803179 - 155803217, 39 bps 
B D                     Human  ------agtc-at-tttctga---ggt----acactc--tagcatgtgg-tgagcac
B D                     Chimp  ------agtc-at-tttctga---ggt----acactc--tagcatgtag-tgagcac
B D                   Gorilla  ------agtc-at-tttctga---ggt----acactc--tagcatgtgg-tgagcac
B D                 Orangutan  ------agtc-at-tttctga---ggt----acactg--tagcatgtgg-tgagcac
B D                    Gibbon  ------agtc-at-tttctga---ggt----acactg--tagcatgtgg-tgagcac
B D                    Rhesus  ------agtc-at-tttctga---ggt----acactg--tagcatgtgg-tgagcac
B D       Crab-eating macaque  ------agtc-at-tttctga---ggt----acactg--tagcatgtgg-tgagcac
B D                    Baboon  ------agtc-at-tttctga---ggt----acactg--tagcatgtgg-tgagcac
B D              Green monkey  ------agtc-at-tttctga---ggt----acactg--tagcatgtgg-tgagcac
B D                  Marmoset  ------agtc-gt-tttctga---ggt----acgctg--tagcaggtgg-tgagcac
B D           Squirrel monkey  ------agtc-gt-tttctga---ggt----acgctg--tagcaggtgg-tgagcac
B D                  Bushbaby  ------agtc-gt-tttctga---ggt----acagtg--cagcacttgg-tgagcgc
           Chinese tree shrew  ------gctc------tctgg---ggc----tca--g--aggcatgcgg-ggcgcat
B D                  Squirrel  ------agtc-at-tttctga---ggc----acaata--tagcacttgt-tgagcat
       Lesser Egyptian jerboa  ------ggtc-at-tttctaa---gac----acaatg--tagcacttgg-tcagtgt
                 Prairie vole  ------gatt-ct-tt--tga---ggc----acagtg--ctacacttgg-tgagcac
B D           Chinese hamster  ------ggtt-ct-tt-ctga---gcc----acaatg--tttcacttgg-tgagcac
               Golden hamster  ------ggtt-cc-tt-ctga---gcc----acagtt--cttcagttgg-tgagagc
B D                     Mouse  ------ggtt-ct-tttctga---gcc----atagtg--ctacacttgg-tgagcac
B D                       Rat  ------ggtt-ct-tttccga---ggc----acagcg--ctacacttgg-tgagcac
B D            Naked mole-rat  ------agtc-at-tttctga---gac----gcaatg--tagcatttgg-tgagcat
B D                Guinea pig  ------agtc-at-tttctga---gac----acagtg--taacacttgg-tgagcat
                   Chinchilla  ------agac-at-tttctga---g------acaggg--tggcacttgg-tgagcat
             Brush-tailed rat  ------agtt-ag-tttc-ga---g------acagtg--tgggccttgg-tgagcac
B D                    Rabbit  ------agtg-gg--ttttga---ggt----acaatg--taacacttgg-tgtgcac
B D                      Pika  ------agtt-ggcttcttga---ggt----ccaatg--tagcacttag-ggagtac
B D                       Pig  ------agtc-at-tttctga---ggt----acaatg--taacacttgg-tgagcac
B D                    Alpaca  ------agac-ct-cttctga---gct----ccagtg--tcacatttgg-tgagcac
               Bactrian camel  ------agac-ct-cttctga---gct----ccagtg--tcacacttgg-tgagcac
B D                   Dolphin  ------agtc-tt-tttccga---gga----acagtg--taacacttgg-tgagcac
                 Killer whale  ------agtc-tt-tttccga---gga----acagtg--taacacttgg-tgagcac
             Tibetan antelope  ------ggcc-a--ttcctga---gga----acaatg--taacacggta-tgagcac
B D                       Cow  ------ggcc-at-ttcctga---gga----acaatg--taacacggtg-tgagcac
B D                     Sheep  ------ggcc-a--ttcctga---gga----acaatg--taacacggtg-tgagcac
                Domestic goat  ------ggcc-a--ttcctga---gga----acagtg--taacacggtg-tgagcac
B D                     Horse  ------agtc-gt-tttctgg---ggt----acaatg--taacacttgg-tgagcac
B D          White rhinoceros  ------agtc-gt-tttctga---ggt----acaaca--taagacttgg-ggagcac
B D                       Cat  ------agtg-gt-tttctga---ggt----acagtg--tgacattttg-tgagcac
B D                       Dog  ------agtg-gt-cttctga---gat----acaata--taatgctttg-tgagcac
B D                   Ferret   ------agtg-gt-tttctga---ggt----acaatg--taacgctttg-tgagcac
B D                     Panda  ------agtg-gt-tttctga---ggt----acaatg--taacattttg-tgagcac
               Pacific walrus  ------agtg-gt-tttctga---agt----acactg--gaacactttg-tgagcac
                 Weddell seal  ------agtg-gt-tttctga---ggt----acactg--gaacactttg-tgagcac
             Black flying-fox  ------ggtt-gt-tttctgg---ggt----acaatg--taacaattgattgagcac
B D                   Megabat  ------ggtt-gt-tttctgg---ggt----acaatg--taacaattgg-tgagcat
                Big brown bat  ------agtc-gt-tttctga---gct----tcagtg--taacagttgg-tgagcaa
         David's myotis (bat)  ------agtt-gt-tctctga---gct----ttagtg--taacacttgg-tgagcaa
B D                  Microbat  ------agtc-gt-tttctga---gct----ttagtg--taacacttgg-tgagcaa
B D                     Shrew  ------a--t-tc-cttcgaa---atg----acagtg--taacacttgg-tgagaac
              Star-nosed mole  ------agtt-gt-tttccca---gga----atactg--taacacttgg-tgagcac
B D                  Elephant  ------agtc-tt-tctgtga---ggt----acagtg--tcacacttgg-tgagcac
          Cape elephant shrew  ------cgtc-gt-attctga---gat----acagtg--cagcacttgg-tgaacct
B D                   Manatee  -------gtc-tt-tttctga---ggt----gcagtg--tatctcttgg-tgaacac
             Cape golden mole  ------agtc-tt-cctctaa---ggt----gcaatg--cagcacttga-tgagcac
B D                    Tenrec  ------agtc-tt-tttctga---aat----atagta--tagcacttgg-tgagcac
                     Aardvark  ------agtcttt-tttctga---ggt----aca-tt--tagcacttgg-tgagtac
B D                 Armadillo  ------agtc-tt-tttgtaa---ggt----acagtg--tagcatttgg-tgagcac
B D                   Opossum  -------atg-at-ctgtttg---ggtttacaaagct--tagcacctgg-tggccac
B D           Tasmanian devil  -------gtg-at-ctattta---ggtttacaaagct--tagcacctgg-tggcaac
B D                   Wallaby  -------atg-tt-ccgtttg---ggtttacaaagct--cagcacctgg-tggccac
B D                  Platypus  ---------t-ct-gttctgc---tgt----aaaacactcagtatttca-tgagcac
  D               Rock pigeon  accatcagtg-tc-attttaatttgtt----acattg-ttggcatatga-tcagttc
B D                  Hedgehog  ---------------------------------------------------------
B D              Atlantic cod  =========================================================
         Pundamilia nyererei  =========================================================
B D                   Lamprey  =========================================================
         Princess of Burundi  =========================================================
      Yellowbelly pufferfish  =========================================================
                 Spotted gar  =========================================================
B D                      Fugu  =========================================================
    Mexican tetra (cavefish)  =========================================================
B D              Nile tilapia  =========================================================
B D               Stickleback  =========================================================
                 Zebra mbuna  =========================================================
B D                 Zebrafish  =========================================================
B D                    Medaka  =========================================================
B D                 Tetraodon  =========================================================
       Burton's mouthbreeder  =========================================================
          Southern platyfish  =========================================================
B D        American alligator  =========================================================
B D                   Chicken  =========================================================
  D              Mallard duck  =========================================================
  D             Scarlet macaw  =========================================================
  D                    Parrot  =========================================================
B D                Budgerigar  =========================================================
B D               Zebra finch  =========================================================
  D          Peregrine falcon  =========================================================
  D              Saker falcon  =========================================================
B D       Medium ground finch  =========================================================
B D                    Lizard  =========================================================
  D       Collared flycatcher  =========================================================
B D                    Turkey  =========================================================
          Tibetan ground jay  =========================================================
  D    White-throated sparrow  =========================================================
  D           Green seaturtle  =========================================================
B D                Coelacanth  =========================================================
B D             X. tropicalis  =========================================================
  D    Spiny softshell turtle  =========================================================
  D  Chinese softshell turtle  =========================================================
  D            Painted turtle  =========================================================

Inserts between block 4 and 5 in window
B D                    Mouse 824bp

Alignment block 5 of 444 in window, 155803218 - 155803222, 5 bps 
B D                     Human  atc-------------------------------------------------------------------
B D                     Chimp  atc-------------------------------------------------------------------
B D                   Gorilla  atc-------------------------------------------------------------------
B D                 Orangutan  atc-------------------------------------------------------------------
B D                    Gibbon  atc-------------------------------------------------------------------
B D                    Rhesus  atc-------------------------------------------------------------------
B D       Crab-eating macaque  atc-------------------------------------------------------------------
B D                    Baboon  atc-------------------------------------------------------------------
B D              Green monkey  atcataaaaataaatgattgacagagcgagactccgtctcaaaaaaaaaataataaaaaaataaaacaaa
B D                  Marmoset  acc-------------------------------------------------------------------
B D           Squirrel monkey  atc-------------------------------------------------------------------
B D                  Bushbaby  atc-------------------------------------------------------------------
           Chinese tree shrew  gtc-------------------------------------------------------------------
B D                  Squirrel  atc-------------------------------------------------------------------
       Lesser Egyptian jerboa  att-------------------------------------------------------------------
                 Prairie vole  atc-------------------------------------------------------------------
B D           Chinese hamster  atc-------------------------------------------------------------------
               Golden hamster  atc-------------------------------------------------------------------
B D                       Rat  atc-------------------------------------------------------------------
B D            Naked mole-rat  ----------------------------------------------------------------------
B D                Guinea pig  atc-------------------------------------------------------------------
                   Chinchilla  atc-------------------------------------------------------------------
             Brush-tailed rat  atc-------------------------------------------------------------------
B D                    Rabbit  ata-------------------------------------------------------------------
B D                      Pika  ata-------------------------------------------------------------------
B D                       Pig  atc-------------------------------------------------------------------
B D                    Alpaca  atc-------------------------------------------------------------------
               Bactrian camel  atc-------------------------------------------------------------------
B D                   Dolphin  atc-------------------------------------------------------------------
                 Killer whale  atc-------------------------------------------------------------------
             Tibetan antelope  atc-------------------------------------------------------------------
B D                       Cow  atc-------------------------------------------------------------------
B D                     Sheep  atc-------------------------------------------------------------------
                Domestic goat  atc-------------------------------------------------------------------
B D                     Horse  atc-------------------------------------------------------------------
B D          White rhinoceros  atc-------------------------------------------------------------------
B D                       Cat  atc-------------------------------------------------------------------
B D                       Dog  atc-------------------------------------------------------------------
B D                   Ferret   att-------------------------------------------------------------------
B D                     Panda  atc-------------------------------------------------------------------
               Pacific walrus  atc-------------------------------------------------------------------
                 Weddell seal  atc-------------------------------------------------------------------
             Black flying-fox  gtc-------------------------------------------------------------------
B D                   Megabat  gtc-------------------------------------------------------------------
                Big brown bat  atc-------------------------------------------------------------------
         David's myotis (bat)  gtc-------------------------------------------------------------------
B D                  Microbat  atc-------------------------------------------------------------------
B D                     Shrew  ctc-------------------------------------------------------------------
              Star-nosed mole  atc-------------------------------------------------------------------
B D                  Elephant  atc-------------------------------------------------------------------
          Cape elephant shrew  atc-------------------------------------------------------------------
B D                   Manatee  atc-------------------------------------------------------------------
             Cape golden mole  atc-------------------------------------------------------------------
B D                    Tenrec  atc-------------------------------------------------------------------
                     Aardvark  atc-------------------------------------------------------------------
B D                 Armadillo  atc-------------------------------------------------------------------
B D                   Opossum  att-------------------------------------------------------------------
B D           Tasmanian devil  atc-------------------------------------------------------------------
B D                   Wallaby  atc-------------------------------------------------------------------
B D                  Platypus  ac--------------------------------------------------------------------
  D               Rock pigeon  -tc-------------------------------------------------------------------
B D                  Hedgehog  ----------------------------------------------------------------------
B D                     Mouse  ======================================================================
B D              Atlantic cod  ======================================================================
         Pundamilia nyererei  ======================================================================
B D                   Lamprey  ======================================================================
         Princess of Burundi  ======================================================================
      Yellowbelly pufferfish  ======================================================================
                 Spotted gar  ======================================================================
B D                      Fugu  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D              Nile tilapia  ======================================================================
B D               Stickleback  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
B D                 Tetraodon  ======================================================================
       Burton's mouthbreeder  ======================================================================
          Southern platyfish  ======================================================================
B D        American alligator  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
B D               Zebra finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                    Turkey  ======================================================================
          Tibetan ground jay  ======================================================================
  D    White-throated sparrow  ======================================================================
  D           Green seaturtle  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================

                        Human  at-
                        Chimp  at-
                      Gorilla  at-
                    Orangutan  at-
                       Gibbon  at-
                       Rhesus  at-
          Crab-eating macaque  at-
                       Baboon  at-
                 Green monkey  at-
                     Marmoset  gt-
              Squirrel monkey  at-
                     Bushbaby  at-
           Chinese tree shrew  ag-
                     Squirrel  at-
       Lesser Egyptian jerboa  at-
                 Prairie vole  ac-
              Chinese hamster  ac-
               Golden hamster  ac-
                          Rat  at-
               Naked mole-rat  gt-
                   Guinea pig  at-
                   Chinchilla  at-
             Brush-tailed rat  at-
                       Rabbit  at-
                         Pika  at-
                          Pig  at-
                       Alpaca  at-
               Bactrian camel  at-
                      Dolphin  at-
                 Killer whale  at-
             Tibetan antelope  at-
                          Cow  at-
                        Sheep  at-
                Domestic goat  at-
                        Horse  at-
             White rhinoceros  at-
                          Cat  at-
                          Dog  a--
                      Ferret   ---
                        Panda  a--
               Pacific walrus  a--
                 Weddell seal  a--
             Black flying-fox  at-
                      Megabat  at-
                Big brown bat  at-
         David's myotis (bat)  at-
                     Microbat  at-
                        Shrew  at-
              Star-nosed mole  at-
                     Elephant  at-
          Cape elephant shrew  gt-
                      Manatee  at-
             Cape golden mole  at-
                       Tenrec  at-
                     Aardvark  at-
                    Armadillo  at-
                      Opossum  at-
              Tasmanian devil  at-
                      Wallaby  at-
                     Platypus  ---
                  Rock pigeon  ctc
                     Hedgehog  ---
                        Mouse  ===
                 Atlantic cod  ===
          Pundamilia nyererei  ===
                      Lamprey  ===
          Princess of Burundi  ===
       Yellowbelly pufferfish  ===
                  Spotted gar  ===
                         Fugu  ===
     Mexican tetra (cavefish)  ===
                 Nile tilapia  ===
                  Stickleback  ===
                  Zebra mbuna  ===
                    Zebrafish  ===
                       Medaka  ===
                    Tetraodon  ===
        Burton's mouthbreeder  ===
           Southern platyfish  ===
           American alligator  ===
                      Chicken  ===
                 Mallard duck  ===
                Scarlet macaw  ===
                       Parrot  ===
                   Budgerigar  ===
                  Zebra finch  ===
             Peregrine falcon  ===
                 Saker falcon  ===
          Medium ground finch  ===
                       Lizard  ===
          Collared flycatcher  ===
                       Turkey  ===
           Tibetan ground jay  ===
       White-throated sparrow  ===
              Green seaturtle  ===
                   Coelacanth  ===
                X. tropicalis  ===
       Spiny softshell turtle  ===
     Chinese softshell turtle  ===
               Painted turtle  ===

Inserts between block 5 and 6 in window
B D                    Sheep 144bp
B D                  Opossum 1bp
B D          Tasmanian devil 1bp
B D                  Wallaby 1bp
B D                 Platypus 1bp

Alignment block 6 of 444 in window, 155803223 - 155803223, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                       Rat  a
B D            Naked mole-rat  g
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  g
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  a
  D               Rock pigeon  a
B D                  Hedgehog  -
B D                     Mouse  =
B D              Atlantic cod  =
         Pundamilia nyererei  =
B D                   Lamprey  =
         Princess of Burundi  =
      Yellowbelly pufferfish  =
                 Spotted gar  =
B D                      Fugu  =
    Mexican tetra (cavefish)  =
B D              Nile tilapia  =
B D               Stickleback  =
                 Zebra mbuna  =
B D                 Zebrafish  =
B D                    Medaka  =
B D                 Tetraodon  =
       Burton's mouthbreeder  =
          Southern platyfish  =
B D        American alligator  =
B D                   Chicken  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
B D               Zebra finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                  Platypus  =
B D       Medium ground finch  =
B D                    Lizard  =
  D       Collared flycatcher  =
B D           Tasmanian devil  =
B D                   Wallaby  =
B D                    Turkey  =
          Tibetan ground jay  =
  D    White-throated sparrow  =
  D           Green seaturtle  =
B D                Coelacanth  =
B D             X. tropicalis  =
B D                   Opossum  =
  D    Spiny softshell turtle  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =

Inserts between block 6 and 7 in window
                Prairie vole 900bp
B D          Chinese hamster 1016bp
              Golden hamster 947bp

Alignment block 7 of 444 in window, 155803224 - 155803234, 11 bps 
B D                     Human  caaaca-aatga---
B D                     Chimp  aaaaca-aatga---
B D                   Gorilla  aaaaca-aatga---
B D                 Orangutan  aaaata-aatga---
B D                    Gibbon  aaaata-aatga---
B D                    Rhesus  gaaata-aatga---
B D       Crab-eating macaque  aaaata-aatga---
B D                    Baboon  aaaata-aatga---
B D              Green monkey  aaaata-aatga---
B D                  Marmoset  aaaata-aatgc---
B D           Squirrel monkey  aaaata-aatgc---
B D                  Bushbaby  aaaata-aatgg---
           Chinese tree shrew  aggac--actgg---
B D                  Squirrel  agaata-aatgg---
       Lesser Egyptian jerboa  ----ta-aacag---
B D                       Rat  -----a-cagaa---
B D            Naked mole-rat  agaatc-a-tga---
B D                Guinea pig  aaaatc-agtgg---
                   Chinchilla  gaaatc-agtgg---
             Brush-tailed rat  aaagtc-agcag---
B D                    Rabbit  aaaata-aatg----
B D                      Pika  aaacga-aatgg---
B D                       Pig  aaaata-aatgg---
B D                    Alpaca  taaata-aacgg---
               Bactrian camel  taaata-aacgg---
B D                   Dolphin  aaaatc-agtgg---
                 Killer whale  aaaatc-agtgg---
             Tibetan antelope  aaaata-aatgg---
B D                       Cow  aagata-aatgg---
B D                     Sheep  taaata-aatgg---
                Domestic goat  aaaata-aatgg---
B D                     Horse  aaaata-aatgg---
B D          White rhinoceros  aaagta-aaagg---
B D                       Cat  aatgta-aatgg---
B D                       Dog  aatata-aatgg---
B D                   Ferret   aacata-aatgg---
B D                     Panda  aatata-aatgg---
               Pacific walrus  aacata-aatgg---
                 Weddell seal  aatata-aatgg---
             Black flying-fox  aaaatg-aatgg---
B D                   Megabat  aaaatg-aatgg---
                Big brown bat  caaata-agtgg---
         David's myotis (bat)  aaaata-aatgg---
B D                  Microbat  aaaata-aatgg---
B D                     Shrew  taagta-aatgg---
              Star-nosed mole  aaaata-aatgg---
B D                  Elephant  aacgta-aatga---
          Cape elephant shrew  aaaata-aatga---
B D                   Manatee  aaagta-aatga---
             Cape golden mole  aaaatt-aataa---
B D                    Tenrec  aaaagtaaatga---
                     Aardvark  aaaata-aatga---
B D                 Armadillo  aaaata-aatga---
B D                   Opossum  aaaaaa-aaaga---
B D           Tasmanian devil  taaaaa--atga---
B D                   Wallaby  tcaaaa-tatga---
B D                  Platypus  aaaatt-cat-----
  D               Rock pigeon  ataaca-agcagaga
B D                  Hedgehog  ---------------
              Golden hamster  ===============
B D           Chinese hamster  ===============
B D                     Mouse  ===============
                Prairie vole  ===============
B D              Atlantic cod  ===============
         Pundamilia nyererei  ===============
B D                   Lamprey  ===============
         Princess of Burundi  ===============
      Yellowbelly pufferfish  ===============
                 Spotted gar  ===============
B D                      Fugu  ===============
    Mexican tetra (cavefish)  ===============
B D              Nile tilapia  ===============
B D               Stickleback  ===============
                 Zebra mbuna  ===============
B D                 Zebrafish  ===============
B D                    Medaka  ===============
B D                 Tetraodon  ===============
       Burton's mouthbreeder  ===============
          Southern platyfish  ===============
B D        American alligator  ===============
B D                   Chicken  ===============
  D              Mallard duck  ===============
  D             Scarlet macaw  ===============
  D                    Parrot  ===============
B D                Budgerigar  ===============
B D               Zebra finch  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
B D       Medium ground finch  ===============
B D                    Lizard  ===============
  D       Collared flycatcher  ===============
B D                    Turkey  ===============
          Tibetan ground jay  ===============
  D    White-throated sparrow  ===============
  D           Green seaturtle  ===============
B D                Coelacanth  ===============
B D             X. tropicalis  ===============
  D    Spiny softshell turtle  ===============
  D  Chinese softshell turtle  ===============
  D            Painted turtle  ===============

Alignment block 8 of 444 in window, 155803235 - 155803235, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  g
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                      Pika  g
B D                       Pig  t
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                     Shrew  t
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  g
                     Aardvark  t
B D                 Armadillo  t
B D                   Opossum  t
B D           Tasmanian devil  t
B D                   Wallaby  c
B D                  Hedgehog  -
B D                    Rabbit  -
              Golden hamster  =
B D           Chinese hamster  =
B D                     Mouse  =
                Prairie vole  =
B D              Atlantic cod  =
         Pundamilia nyererei  =
B D                   Lamprey  =
         Princess of Burundi  =
      Yellowbelly pufferfish  =
                 Spotted gar  =
B D                      Fugu  =
    Mexican tetra (cavefish)  =
B D              Nile tilapia  =
B D               Stickleback  =
                 Zebra mbuna  =
B D                 Zebrafish  =
B D                    Medaka  =
B D                 Tetraodon  =
       Burton's mouthbreeder  =
          Southern platyfish  =
B D        American alligator  =
B D                   Chicken  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
B D               Zebra finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  -
B D                  Platypus  -
B D       Medium ground finch  =
B D                    Lizard  =
  D       Collared flycatcher  =
B D                    Turkey  =
          Tibetan ground jay  =
  D    White-throated sparrow  =
  D           Green seaturtle  =
B D                Coelacanth  =
B D             X. tropicalis  =
  D    Spiny softshell turtle  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =

Inserts between block 8 and 9 in window
      Lesser Egyptian jerboa 4bp
B D                      Rat 698bp

Alignment block 9 of 444 in window, 155803236 - 155803254, 19 bps 
B D                     Human  --taatgaccgtgataaatca
B D                     Chimp  --taatgaccgtgataaatca
B D                   Gorilla  --taatgaccgtgataaatca
B D                 Orangutan  --taatgaccgtgataaatca
B D                    Gibbon  --taatgaccgtgataaatca
B D                    Rhesus  --taatgaccatgataaatca
B D       Crab-eating macaque  --taatgaccatgataaatca
B D                    Baboon  --taatgaccatgataaatca
B D              Green monkey  --taatgaccatgataaatca
B D                  Marmoset  --taatgaccgtgataaatca
B D           Squirrel monkey  --taatgaccatgataaatca
B D                  Bushbaby  --tcatgaccaggataaatca
           Chinese tree shrew  --tactgccc---------ca
B D                  Squirrel  --taaggaccatgataaatca
       Lesser Egyptian jerboa  --gggtagccatgataaatct
B D            Naked mole-rat  --taatggccttgataaacca
B D                Guinea pig  --taatggccatgataaatca
                   Chinchilla  --tagaggccaggataaatct
             Brush-tailed rat  --tagtgggcaggatggatca
B D                    Rabbit  ------------gatggagca
B D                      Pika  --taattagagtgatggagcc
B D                       Pig  --taatgaccaggataaatca
B D                    Alpaca  --taatgaccaggataaatca
               Bactrian camel  --taatgaccaggataaatca
B D                   Dolphin  --taatgaccaggataaatca
                 Killer whale  --taatgaccaggataaatca
             Tibetan antelope  --taatgaccaggatgaacca
B D                       Cow  --taatgacctggatgaacca
B D                     Sheep  --taatgaccagtatgaacca
                Domestic goat  --taatgaccagaatgaacca
B D                     Horse  --taatgaccatgataaatca
B D          White rhinoceros  --taatgatcacgataaatca
B D                       Cat  --tattgaacatgataaacca
B D                       Dog  --taatgagcatgacaaatca
B D                   Ferret   --taatgaacatgataaatca
B D                     Panda  --taataagcatgat-aatta
               Pacific walrus  --taatgaacatgataaatca
                 Weddell seal  --taatgaacgtgataaatca
             Black flying-fox  --taatgaccatgaaaaatca
B D                   Megabat  --taatgaccatgaaaaatca
                Big brown bat  --taaggaccgtgataaatca
         David's myotis (bat)  --taaggaccaggataaatca
B D                  Microbat  --taaggaccaggataaatca
B D                     Shrew  --tgataactgagatgaatca
              Star-nosed mole  --taatggctatgataaatca
B D                  Elephant  --taatgaccctgataaatca
          Cape elephant shrew  --tagtgactgttataaatct
B D                   Manatee  --taatgaccgttatacatca
             Cape golden mole  --tagcggcca----------
B D                    Tenrec  --taatgaccatgataaatca
                     Aardvark  --taattactatgataaatca
B D                 Armadillo  --taatgaccatgataaacca
B D                   Opossum  --taatgacagtgataaacca
B D           Tasmanian devil  --taatgactg--atgaatca
B D                   Wallaby  --taatgacaaccataaatca
B D                  Platypus  tattgttattgatgtaaacca
B D                  Hedgehog  ---------------------
              Golden hamster  =====================
B D           Chinese hamster  =====================
B D                     Mouse  =====================
B D                       Rat  =====================
                Prairie vole  =====================
B D              Atlantic cod  =====================
         Pundamilia nyererei  =====================
B D                   Lamprey  =====================
         Princess of Burundi  =====================
      Yellowbelly pufferfish  =====================
                 Spotted gar  =====================
B D                      Fugu  =====================
    Mexican tetra (cavefish)  =====================
B D              Nile tilapia  =====================
B D               Stickleback  =====================
                 Zebra mbuna  =====================
B D                 Zebrafish  =====================
B D                    Medaka  =====================
B D                 Tetraodon  =====================
       Burton's mouthbreeder  =====================
          Southern platyfish  =====================
B D        American alligator  =====================
B D                   Chicken  =====================
  D              Mallard duck  =====================
  D             Scarlet macaw  =====================
  D                    Parrot  =====================
B D                Budgerigar  =====================
B D               Zebra finch  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
  D               Rock pigeon  ---------------------
B D       Medium ground finch  =====================
B D                    Lizard  =====================
  D       Collared flycatcher  =====================
B D                    Turkey  =====================
          Tibetan ground jay  =====================
  D    White-throated sparrow  =====================
  D           Green seaturtle  =====================
B D                Coelacanth  =====================
B D             X. tropicalis  =====================
  D    Spiny softshell turtle  =====================
  D  Chinese softshell turtle  =====================
  D            Painted turtle  =====================

Inserts between block 9 and 10 in window
B D                  Opossum 574bp
B D          Tasmanian devil 2481bp
B D                  Wallaby 4bp

Alignment block 10 of 444 in window, 155803255 - 155803262, 8 bps 
B D                     Human  --------ctgaactt
B D                     Chimp  --------ctgaactt
B D                   Gorilla  --------ctgaactt
B D                 Orangutan  --------ctgaactt
B D                    Gibbon  --------ctgaactt
B D                    Rhesus  --------ctgaactt
B D       Crab-eating macaque  --------ctgaactt
B D                    Baboon  --------ctgaactt
B D              Green monkey  --------ctgaactt
B D                  Marmoset  --------ctgaactt
B D           Squirrel monkey  --------ctgaactt
B D                  Bushbaby  --------ctggac-t
           Chinese tree shrew  --------tggatgcc
B D                  Squirrel  --------ttgaactt
       Lesser Egyptian jerboa  --------gtgaactc
B D            Naked mole-rat  --------ctgaactg
B D                Guinea pig  --------ctgaacct
                   Chinchilla  --------ctgaactt
             Brush-tailed rat  --------ctgaactg
B D                    Rabbit  --------ccaaagtt
B D                      Pika  --------ccaaagtc
B D                       Pig  --------ctgaactt
B D                    Alpaca  --------ctgaactt
               Bactrian camel  --------ctgaactt
B D                   Dolphin  --------ctgaactg
                 Killer whale  --------ctgaactg
             Tibetan antelope  --------ctgaactt
B D                       Cow  --------ctgaactt
B D                     Sheep  --------ctgaactt
                Domestic goat  --------ctgaactt
B D                     Horse  --------ctgagctt
B D          White rhinoceros  --------ctgagctt
B D                       Cat  --------ttggacgt
B D                       Dog  --------ctggactt
B D                   Ferret   --------ctgggctt
B D                     Panda  --------cttggctt
               Pacific walrus  --------ctgggctt
                 Weddell seal  --------ctgggctt
             Black flying-fox  --------ttgaactt
B D                   Megabat  --------ttgaactt
                Big brown bat  --------ttgaactt
         David's myotis (bat)  --------ttgaactt
B D                  Microbat  --------ttgaactt
B D                     Shrew  --------tt--ctct
              Star-nosed mole  --------ccagtttt
B D                  Elephant  --------ctgaactt
          Cape elephant shrew  --------ctgaactt
B D                   Manatee  --------ctgaactt
             Cape golden mole  ---------tgaactc
B D                    Tenrec  --------ttgaacat
                     Aardvark  --------ctgaattt
B D                 Armadillo  --------ctgaacaa
B D                   Wallaby  --------ctaaactt
B D                  Platypus  agccttttgtaaacta
B D                  Hedgehog  ----------------
              Golden hamster  ================
B D           Chinese hamster  ================
B D                     Mouse  ================
B D                       Rat  ================
                Prairie vole  ================
B D              Atlantic cod  ================
         Pundamilia nyererei  ================
B D                   Lamprey  ================
         Princess of Burundi  ================
      Yellowbelly pufferfish  ================
                 Spotted gar  ================
B D                      Fugu  ================
    Mexican tetra (cavefish)  ================
B D              Nile tilapia  ================
B D               Stickleback  ================
                 Zebra mbuna  ================
B D                 Zebrafish  ================
B D                    Medaka  ================
B D                 Tetraodon  ================
       Burton's mouthbreeder  ================
          Southern platyfish  ================
B D        American alligator  ================
B D                   Chicken  ================
  D              Mallard duck  ================
  D             Scarlet macaw  ================
  D                    Parrot  ================
B D                Budgerigar  ================
B D               Zebra finch  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
  D               Rock pigeon  ----------------
B D       Medium ground finch  ================
B D                    Lizard  ================
  D       Collared flycatcher  ================
B D           Tasmanian devil  ================
B D                    Turkey  ================
          Tibetan ground jay  ================
  D    White-throated sparrow  ================
  D           Green seaturtle  ================
B D                Coelacanth  ================
B D             X. tropicalis  ================
B D                   Opossum  ================
  D    Spiny softshell turtle  ================
  D  Chinese softshell turtle  ================
  D            Painted turtle  ================

Alignment block 11 of 444 in window, 155803263 - 155803272, 10 bps 
B D                     Human  gaaatggtg-----g
B D                     Chimp  gaaatggtg-----g
B D                   Gorilla  gaaatggtg-----g
B D                 Orangutan  gaaatggtg-----g
B D                    Gibbon  caattggtg-----g
B D                    Rhesus  caaatggtg-----g
B D       Crab-eating macaque  caaatggtg-----g
B D                    Baboon  caaatggtg-----g
B D              Green monkey  caaatggtg-----g
B D                  Marmoset  ccaatggtg-----g
B D           Squirrel monkey  caaatggtg-----g
B D                  Bushbaby  caagtcatg-----g
           Chinese tree shrew  caagggcag-----g
B D                  Squirrel  caggtggagcaggag
       Lesser Egyptian jerboa  caactggtg-----a
B D            Naked mole-rat  caggctgtg-----g
B D                Guinea pig  caggccgtg-----g
                   Chinchilla  caagctgtg-----c
             Brush-tailed rat  caggccgtg-----g
B D                    Rabbit  ccggcaatg-----g
B D                      Pika  caggcaatg-----g
B D                       Pig  caggcagtg-----g
B D                    Alpaca  caggcagtg-----g
               Bactrian camel  caggcagtg-----c
B D                   Dolphin  ggggcagtg-----g
                 Killer whale  ggggcagtg-----g
             Tibetan antelope  agggaagtg-----g
B D                       Cow  agggaagtg-----g
B D                     Sheep  agggaagtg-----g
                Domestic goat  agggaagtg-----g
B D                     Horse  caggcggtg-----g
B D          White rhinoceros  caggcggtg-----g
B D                       Cat  tgggcagtg-----g
B D                       Dog  tgggcagtg-----g
B D                   Ferret   tgggtagtg-----g
B D                     Panda  tgggcagtg-----g
               Pacific walrus  tgggcagtg-----g
                 Weddell seal  tgggcagta-----g
             Black flying-fox  caggcagtg-----g
B D                   Megabat  caggcagtg-----g
                Big brown bat  caggcagtg-----g
         David's myotis (bat)  caggcagtg-----g
B D                  Microbat  caggcagtg-----g
B D                     Shrew  catg-----------
              Star-nosed mole  caagcagtg-----c
B D                  Elephant  cagacagtg-----g
          Cape elephant shrew  catacagtg-----g
B D                   Manatee  cagacagtg-----g
             Cape golden mole  cagacagtg-----g
B D                    Tenrec  aagacagtg-----g
                     Aardvark  aagatgatg-----g
B D                 Armadillo  taggcagca-----a
B D                  Platypus  aggattgtt-----g
B D                  Hedgehog  ---------------
              Golden hamster  ===============
B D           Chinese hamster  ===============
B D                     Mouse  ===============
B D                       Rat  ===============
                Prairie vole  ===============
B D              Atlantic cod  ===============
         Pundamilia nyererei  ===============
B D                   Lamprey  ===============
         Princess of Burundi  ===============
      Yellowbelly pufferfish  ===============
                 Spotted gar  ===============
B D                      Fugu  ===============
    Mexican tetra (cavefish)  ===============
B D              Nile tilapia  ===============
B D               Stickleback  ===============
                 Zebra mbuna  ===============
B D                 Zebrafish  ===============
B D                    Medaka  ===============
B D                 Tetraodon  ===============
       Burton's mouthbreeder  ===============
          Southern platyfish  ===============
B D        American alligator  ===============
B D                   Chicken  ===============
  D              Mallard duck  ===============
  D             Scarlet macaw  ===============
  D                    Parrot  ===============
B D                Budgerigar  ===============
B D               Zebra finch  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
  D               Rock pigeon  ---------------
B D       Medium ground finch  ===============
B D                    Lizard  ===============
  D       Collared flycatcher  ===============
B D           Tasmanian devil  ===============
B D                   Wallaby  ===============
B D                    Turkey  ===============
          Tibetan ground jay  ===============
  D    White-throated sparrow  ===============
  D           Green seaturtle  ===============
B D                Coelacanth  ===============
B D             X. tropicalis  ===============
B D                   Opossum  ===============
  D    Spiny softshell turtle  ===============
  D  Chinese softshell turtle  ===============
  D            Painted turtle  ===============

Alignment block 12 of 444 in window, 155803273 - 155803273, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  t
B D                      Pika  t
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  c
B D                       Cow  t
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  t
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
              Star-nosed mole  c
B D                  Elephant  t
          Cape elephant shrew  c
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  c
B D                  Platypus  c
                  Spotted gar  c
B D                  Hedgehog  -
B D                     Shrew  -
              Golden hamster  =
B D           Chinese hamster  =
B D                     Mouse  =
B D                       Rat  =
                Prairie vole  =
B D              Atlantic cod  =
         Pundamilia nyererei  =
B D                   Lamprey  =
         Princess of Burundi  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
    Mexican tetra (cavefish)  =
B D              Nile tilapia  =
B D               Stickleback  =
                 Zebra mbuna  =
B D                 Zebrafish  =
B D                    Medaka  =
B D                 Tetraodon  =
       Burton's mouthbreeder  =
          Southern platyfish  =
B D        American alligator  =
B D                   Chicken  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
B D               Zebra finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  -
B D       Medium ground finch  =
B D                    Lizard  =
  D       Collared flycatcher  =
B D           Tasmanian devil  =
B D                   Wallaby  =
B D                    Turkey  =
          Tibetan ground jay  =
  D    White-throated sparrow  =
  D           Green seaturtle  =
B D                Coelacanth  =
B D             X. tropicalis  =
B D                   Opossum  =
  D    Spiny softshell turtle  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =

Inserts between block 12 and 13 in window
          Chinese tree shrew 2bp

Alignment block 13 of 444 in window, 155803274 - 155803302, 29 bps 
B D                     Human  tctccatg-ccgt------------caag-ccatcactg-----------------tttt
B D                     Chimp  tctccatg-ctgt------------caag-ccatcactg-----------------tttt
B D                   Gorilla  tctccatg-ccat------------caag-ccatcactg-----------------tttt
B D                 Orangutan  tctccatg-ccat------------taag-ccatcactg-----------------tttt
B D                    Gibbon  tctccatg-cctt------------caag-ccatcactg-----------------tttt
B D                    Rhesus  tctccatg-ccat------------caag-ccattgctg-----------------tttt
B D       Crab-eating macaque  tctccatg-ccat------------caag-ccattgctg-----------------tttt
B D                    Baboon  tctccatg-ccat------------caag-ccattgctg-----------------tttt
B D              Green monkey  tctccatg-ccat------------caag-ccatcgctg-----------------tttt
B D                  Marmoset  tctctgtg-ccat------------caaa-ccattaccg-----------------tttt
B D           Squirrel monkey  tctctgtg-ccat------------caaa-ccatcactg-----------------tttt
B D                  Bushbaby  tct-tgta-ccat------------caaa-ccatcactg-----------------tttt
           Chinese tree shrew  gccctgtg-ccct------gtgccctgtg-ctgctgctg-----------------ttta
B D                  Squirrel  act-tatg-ccat-----------caaaa-tgactcata-----------------tttc
       Lesser Egyptian jerboa  act-tggg-tcat------------agaa-ccattgttg-----------------tttt
B D            Naked mole-rat  tct-tctg-cctt------------caaa-ccatcccaa-----------------tctt
B D                Guinea pig  tct-tgtg-cctt------------caac-ctgtcatta-----------------tttt
                   Chinchilla  ctt-tgtg-cctt------------caaa-ctgtcatta-----------------tttt
             Brush-tailed rat  ctt-tggg-cctt------------caaa-ccatcgtca-----------------tttt
B D                    Rabbit  tct-tgtg-ccat------------caaa-ccgtcactag----------------tctc
B D                      Pika  tct---tg-ccat------------gaaa-ccatacctgt----------------gttc
B D                       Pig  tct-ttagtccat------------caga-ccatcacta-----------------tttt
B D                    Alpaca  tct-tggaccctt------------caaa-ccatccctg-----------------tttt
               Bactrian camel  tct-tgggccctt------------caaa-ccatccctg-----------------tttt
B D                   Dolphin  gct-ttggcccat------------ccaa-ccatcagtg-----------------tttt
                 Killer whale  gct-ttggcccat------------ccaa-ccatcagtg-----------------tttt
             Tibetan antelope  gct-tgggcccat------------caaa-ccatcactg-----------------tttt
B D                       Cow  gct-ttggcccat------------caaa-ccatcactg-----------------tttt
B D                     Sheep  gct-tgggcccat------------caaa-ccatcactg-----------------tttt
                Domestic goat  gct-tgggcccat------------caaa-ccatcactg-----------------tttt
B D                     Horse  tct-tgtg-ccat------------caaa-ctatcactg-----------------tttt
B D          White rhinoceros  tgt-tgta-ccat------------caaa-ccgtcactg-----------------tttt
B D                       Cat  tct-tgtg-tcat-------------aaa-ccatcatta-----------------tttt
B D                       Dog  tct-tgtg-ccgt-------------aaa-tcatcatta-----------------tttt
B D                   Ferret   cct-tgtg-ccat-------------aaa-ccatcatta-----------------tttt
B D                     Panda  tct-tgtg-ctgt-------------aa----atcatta-----------------tttt
               Pacific walrus  tct-cgtg-ccgt-------------aac-ccatcatta-----------------tttt
                 Weddell seal  tct-tgtg-ctgt-------------aac-tcatcataa-----------------tttt
             Black flying-fox  tct-tgtg-ccat------------caaa-atatcactg-----------------tttt
B D                   Megabat  tct-tgtg-ccat------------caaa-atatcactg-----------------tttt
                Big brown bat  tct-tgtg-ccat------------taaa-ctctcactg-----------------cttg
         David's myotis (bat)  tct-tgtg-ctat------------taaa-ctctcactg-----------------cttg
B D                  Microbat  tct-tgtg-ctgt------------taaa-ctctcactg-----------------cttg
B D                     Shrew  ---------ttat------------caaa-ccatcactg-----------------tctt
              Star-nosed mole  t--------ctat------------caag-ccatcactt-----------------tttt
B D                  Elephant  tct-tgtg-ccat------------caag-ccatcactg-----------------tttt
          Cape elephant shrew  tct-tgtg-tcat------------taaa-ctattaata-----------------tttt
B D                   Manatee  tct-tgtg-ctgt------------caaa-ccatcactg-----------------ttta
             Cape golden mole  ttt-tgta-tcat------------caaa-ctgtcagtg-----------------tttc
B D                    Tenrec  cct-tata-cca---------------------tcagtg-----------------tttt
                     Aardvark  ttt-tgta-ccat------------caaa-gcatagctt-----------------tttt
B D                 Armadillo  cct-tatg-ccat------------caaa-ccatcactg-----------------tttt
B D           Tasmanian devil  tct-gaat-tctt------------caaattcattgctt-----------------ctca
B D                  Platypus  ----tagg-cagta--actgatagaccac-ccaacattgtgatttccttctcctgcttcc
                  Spotted gar  -------------tccgctagatggcagt-ttaatacca-----------------cttt
B D                  Hedgehog  ------------------------------------------------------------
              Golden hamster  ============================================================
B D           Chinese hamster  ============================================================
B D                     Mouse  ============================================================
B D                       Rat  ============================================================
                Prairie vole  ============================================================
B D              Atlantic cod  ============================================================
         Pundamilia nyererei  ============================================================
B D                   Lamprey  ============================================================
         Princess of Burundi  ============================================================
      Yellowbelly pufferfish  ============================================================
B D                      Fugu  ============================================================
    Mexican tetra (cavefish)  ============================================================
B D              Nile tilapia  ============================================================
B D               Stickleback  ============================================================
                 Zebra mbuna  ============================================================
B D                 Zebrafish  ============================================================
B D                    Medaka  ============================================================
B D                 Tetraodon  ============================================================
       Burton's mouthbreeder  ============================================================
          Southern platyfish  ============================================================
B D        American alligator  ============================================================
B D                   Chicken  ============================================================
  D              Mallard duck  ============================================================
  D             Scarlet macaw  ============================================================
  D                    Parrot  ============================================================
B D                Budgerigar  ============================================================
B D               Zebra finch  ============================================================
  D          Peregrine falcon  ============================================================
  D              Saker falcon  ============================================================
  D               Rock pigeon  ------------------------------------------------------------
B D       Medium ground finch  ============================================================
B D                    Lizard  ============================================================
  D       Collared flycatcher  ============================================================
B D                   Wallaby  ============================================================
B D                    Turkey  ============================================================
          Tibetan ground jay  ============================================================
  D    White-throated sparrow  ============================================================
  D           Green seaturtle  ============================================================
B D                Coelacanth  ============================================================
B D             X. tropicalis  ============================================================
B D                   Opossum  ============================================================
  D    Spiny softshell turtle  ============================================================
  D  Chinese softshell turtle  ============================================================
  D            Painted turtle  ============================================================

Alignment block 14 of 444 in window, 155803303 - 155803312, 10 bps 
B D                     Human  agg--ta---------------gaaa-t
B D                     Chimp  agg--ta---------------gaaa-t
B D                   Gorilla  agg--ta---------------gaaa-t
B D                 Orangutan  agg--ta---------------gaaa-t
B D                    Gibbon  agg--ga---------------gaaa-t
B D                    Rhesus  agg--ga---------------gaaa-t
B D       Crab-eating macaque  agg--ga---------------gaaa-t
B D                    Baboon  agg--ga---------------gaaa-t
B D              Green monkey  agg--ga---------------gaaa-t
B D                  Marmoset  agg--ga---------------gaaa-t
B D           Squirrel monkey  agg--ga---------------gaaatt
B D                  Bushbaby  aag--gg---------------caag-t
           Chinese tree shrew  ggg--ga---------------gtaa-g
B D                  Squirrel  agg--ga---------------gaaa-t
       Lesser Egyptian jerboa  atg--gg---------------aaaa-t
B D            Naked mole-rat  gta--at---------------aaaa-t
B D                Guinea pig  agg--at---------------aaaa-t
                   Chinchilla  agg--gc---------------aaaa-t
             Brush-tailed rat  ggg--gt---------------aaag-t
B D                    Rabbit  agg--gt---------------aaag-a
B D                      Pika  agc--ag---------------aaaa-a
B D                       Pig  agg--ag---------------gaaa-t
B D                    Alpaca  aag--gg---------------gaaa-t
               Bactrian camel  agg--gg---------------gaaa-t
B D                   Dolphin  aag--gg---------------gaaa-t
                 Killer whale  aag--gg---------------gaaa-t
             Tibetan antelope  aag--gg---------------gaaa-t
B D                       Cow  gag--gg---------------ggaa-t
B D                     Sheep  aag--gg---------------gaaa-t
                Domestic goat  aag--gg---------------gaaa-t
B D                     Horse  aag--gg---------------gaaa-t
B D          White rhinoceros  agg--gg---------------gaaa-t
B D                       Cat  agg--ga---------------gata-c
B D                       Dog  agg--ga---------------gatt-t
B D                   Ferret   agg--ga---------------gtta-a
B D                     Panda  agg--ga---------------gata-t
               Pacific walrus  agg--ga---------------atta-t
                 Weddell seal  agg--ga---------------gtta-t
             Black flying-fox  att--gt---------------gaaa-t
B D                   Megabat  att--gt---------------gaaa-t
                Big brown bat  ggt--gtgtttgcgggggaggggaaa-t
         David's myotis (bat)  ggt--atgattgtgggggagagggaa-t
B D                  Microbat  ggt--atgtttgtgggggagagggaa-t
B D                     Shrew  aag------------------agaaa-t
              Star-nosed mole  aag------------------ggaaa-t
B D                  Elephant  agggaag---------------gaaa-t
          Cape elephant shrew  ttaaagg---------------agga-a
B D                   Manatee  aggggag---------------gaaa-t
             Cape golden mole  accagat---------------aaga-a
B D                    Tenrec  agggggt---------------agag-a
                     Aardvark  tggggag---------------gggg-t
B D                 Armadillo  agagggg---------------aaat-c
B D           Tasmanian devil  agg--ta---------------aaaa-a
B D                  Platypus  acg--ga---------------aata-t
  D                    Parrot  agg--ta---------------gaga-g
                  Spotted gar  -----------------actcaggaa-t
B D                  Hedgehog  ----------------------------
              Golden hamster  ============================
B D           Chinese hamster  ============================
B D                     Mouse  ============================
B D                       Rat  ============================
                Prairie vole  ============================
B D              Atlantic cod  ============================
         Pundamilia nyererei  ============================
B D                   Lamprey  ============================
         Princess of Burundi  ============================
      Yellowbelly pufferfish  ============================
B D                      Fugu  ============================
    Mexican tetra (cavefish)  ============================
B D              Nile tilapia  ============================
B D               Stickleback  ============================
                 Zebra mbuna  ============================
B D                 Zebrafish  ============================
B D                    Medaka  ============================
B D                 Tetraodon  ============================
       Burton's mouthbreeder  ============================
          Southern platyfish  ============================
B D        American alligator  ============================
B D                   Chicken  ============================
  D              Mallard duck  ============================
  D             Scarlet macaw  ============================
B D                Budgerigar  ============================
B D               Zebra finch  ============================
  D          Peregrine falcon  ============================
  D              Saker falcon  ============================
  D               Rock pigeon  ----------------------------
B D       Medium ground finch  ============================
B D                    Lizard  ============================
  D       Collared flycatcher  ============================
B D                   Wallaby  ============================
B D                    Turkey  ============================
          Tibetan ground jay  ============================
  D    White-throated sparrow  ============================
  D           Green seaturtle  ============================
B D                Coelacanth  ============================
B D             X. tropicalis  ============================
B D                   Opossum  ============================
  D    Spiny softshell turtle  ============================
  D  Chinese softshell turtle  ============================
  D            Painted turtle  ============================

Inserts between block 14 and 15 in window
B D                 Marmoset 3bp
B D          Squirrel monkey 3bp
B D                 Bushbaby 7bp
B D                      Pig 3bp
B D                   Alpaca 3bp
              Bactrian camel 3bp
B D                  Dolphin 3bp
                Killer whale 3bp
            Tibetan antelope 3bp
B D                      Cow 3bp
B D                    Sheep 3bp
               Domestic goat 3bp
B D                    Horse 3bp
B D         White rhinoceros 3bp
B D                      Cat 2bp
B D                      Dog 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
            Black flying-fox 3bp
B D                  Megabat 3bp
               Big brown bat 3bp
        David's myotis (bat) 3bp
B D                 Microbat 3bp
B D                    Shrew 3bp
             Star-nosed mole 3bp
B D                 Elephant 2bp
         Cape elephant shrew 2bp
B D                  Manatee 1bp
            Cape golden mole 12bp
B D                   Tenrec 12bp
                    Aardvark 10bp
B D                Armadillo 2bp
B D                 Platypus 3bp

Alignment block 15 of 444 in window, 155803313 - 155803340, 28 bps 
B D                     Human  ---------gtaaa-aaat----tattcttctgaattataaa
B D                     Chimp  ---------gtaaa-aaat----tattcttctgaattataaa
B D                   Gorilla  ---------gtaaa-aaat----tattcttctgaattataaa
B D                 Orangutan  ---------gtaaa-aaat----ta---ttctgaattataaa
B D                    Gibbon  ---------gtaaa-aaat----tattcttctgaattataaa
B D                    Rhesus  ---------gtaaa-aaat----tattcttctgaattataag
B D       Crab-eating macaque  ---------gtaaa-aaat----tattcttctgaattataag
B D                    Baboon  ---------gtaaa-aaat----tattcttctgaattataag
B D              Green monkey  ---------gtaaa-aaat----tattcttctgaattataag
B D                  Marmoset  ---------gtaaa-aaat----gattattctgaattattag
B D           Squirrel monkey  ---------gtaaa-aaat----tattcttctgaattattag
B D                  Bushbaby  ---------agaaa-aaat----tattctactgaattgttgg
           Chinese tree shrew  ---------gaaac-aggc-------cctgcccagtcgtgag
B D                  Squirrel  ----------aaaa-taatacattattctactgaattagaag
       Lesser Egyptian jerboa  ----------acag-aaattatatactctactgagttataaa
B D            Naked mole-rat  ----------tggg-t-ag----ttatttattccact-----
B D                Guinea pig  ----------tagc-taac----ttatctactgcatctc--g
                   Chinchilla  ----------cggg-tcat----ttatttcctgcattatgag
             Brush-tailed rat  ----------cagg-tgat----ttctctacagcatcatgag
B D                    Rabbit  ----------caat-acat----tattttagtgacttataag
B D                      Pika  ----------gaat-actt----cgttttaatgcctaataag
B D                       Pig  ---------gtaat-aaat----tgtcctactggattataag
B D                    Alpaca  ---------gtcat-aaat----tgttctactggattggaag
               Bactrian camel  ---------atcat-aaat----tgttctactggattggaag
B D                   Dolphin  ---------gtagt-aaat----tgttctactgggtagtaag
                 Killer whale  ---------gtagt-aaat----tgttctactgggtagtaag
             Tibetan antelope  ---------gtcgt-aaat----tattctgctgggtcataag
B D                       Cow  ---------gtcat-aaat----tattcttctgggtcctaag
B D                     Sheep  ---------gtcgt-aaat----tattctgctgggtcataag
                Domestic goat  ---------gtcgt-aaat----tattctgctgggtcataag
B D                     Horse  ---------gtaat-aaat----tgttctactaaattataag
B D          White rhinoceros  ---------gtaat-aaat----tgttctactaaattataag
B D                       Cat  ---------gtaat-aaat----tgttctagtgaattataag
B D                       Dog  ---------ataat-caat----tgttctattgaatgataag
B D                   Ferret   ---------gcaat-taat----tgtcc-attgaattgtaag
B D                     Panda  ---------gtaat-tatt----tgtcccattgaattatgag
               Pacific walrus  ---------gtaat-taaa----tgtcctattgaattgtaag
                 Weddell seal  ---------gtaat-taaa----tgtcctattgaattgtaag
             Black flying-fox  ---------gcaataatat----cgttctgctgaattataag
B D                   Megabat  ---------gcaataacat----cgttctgctgaattataag
                Big brown bat  ---------gcaat-acgt----tgttttactgaattataag
         David's myotis (bat)  ---------gcaat-acat----tgttttactgaattataag
B D                  Microbat  ---------gcaat-acat----tgttttactgaattataag
B D                     Shrew  ---------cttat-aagt----tattcttctgactcatgag
              Star-nosed mole  ---------gtaat-aaat----tgttctgctgaattatgag
B D                  Elephant  ---------gcaa--aaac----tattctactgggttataaa
          Cape elephant shrew  ---------gtaat-aaaa----tgttctactggatagtaaa
B D                   Manatee  ---------gtaat-aaac----cattctcctggattataaa
             Cape golden mole  ---------gtaac-agaa----cattccactggattacaaa
B D                    Tenrec  ---------gtaat-aaag----tattttattggattataac
                     Aardvark  ---------gtaat-aaaa----taatctaccgtattataaa
B D                 Armadillo  ---------gaaat-aact----tattctactgaattataag
B D           Tasmanian devil  -----------aaa-aaag----ttttatactaaa--gccag
B D                  Platypus  ---------gattt-agat----ttagattct---ttaca--
  D                    Parrot  ---------gtaga-ga------------tacgtacgtcgta
  D            Painted turtle  ---------gtgaa-gaac----tcttatttggaactttgca
                  Spotted gar  gcagaattcctaaa-acac----cttaatgccgaactttaag
B D                  Hedgehog  ------------------------------------------
              Golden hamster  ==========================================
B D           Chinese hamster  ==========================================
B D                     Mouse  ==========================================
B D                       Rat  ==========================================
                Prairie vole  ==========================================
B D              Atlantic cod  ==========================================
         Pundamilia nyererei  ==========================================
B D                   Lamprey  ==========================================
         Princess of Burundi  ==========================================
      Yellowbelly pufferfish  ==========================================
B D                      Fugu  ==========================================
    Mexican tetra (cavefish)  ==========================================
B D              Nile tilapia  ==========================================
B D               Stickleback  ==========================================
                 Zebra mbuna  ==========================================
B D                 Zebrafish  ==========================================
B D                    Medaka  ==========================================
B D                 Tetraodon  ==========================================
       Burton's mouthbreeder  ==========================================
          Southern platyfish  ==========================================
B D        American alligator  ==========================================
B D                   Chicken  ==========================================
  D              Mallard duck  ==========================================
  D             Scarlet macaw  ==========================================
B D                Budgerigar  ==========================================
B D               Zebra finch  ==========================================
  D          Peregrine falcon  ==========================================
  D              Saker falcon  ==========================================
  D               Rock pigeon  ------------------------------------------
B D       Medium ground finch  ==========================================
B D                    Lizard  ==========================================
  D       Collared flycatcher  ==========================================
B D                   Wallaby  ==========================================
B D                    Turkey  ==========================================
          Tibetan ground jay  ==========================================
  D    White-throated sparrow  ==========================================
  D           Green seaturtle  ==========================================
B D                Coelacanth  ==========================================
B D             X. tropicalis  ==========================================
B D                   Opossum  ==========================================
  D    Spiny softshell turtle  ==========================================
  D  Chinese softshell turtle  ==========================================

Inserts between block 15 and 16 in window
B D                 Elephant 238bp
         Cape elephant shrew 413bp
B D                  Manatee 157bp
            Cape golden mole 9bp
B D                   Tenrec 9bp
                    Aardvark 168bp
B D          Tasmanian devil 6bp
  D                   Parrot 2bp
  D           Painted turtle 2bp

Alignment block 16 of 444 in window, 155803341 - 155803348, 8 bps 
B D                     Human  gt------tatctg--
B D                     Chimp  gt------tatctg--
B D                   Gorilla  gt------tatctg--
B D                 Orangutan  gt------gatctg--
B D                    Gibbon  gt------gatctg--
B D                    Rhesus  gt------gatctg--
B D       Crab-eating macaque  gt------gatctg--
B D                    Baboon  gt------gatctg--
B D              Green monkey  gt------gatctg--
B D                  Marmoset  ata-----gatctg--
B D           Squirrel monkey  ata-----gatctg--
B D                  Bushbaby  g-------actccg--
           Chinese tree shrew  gg------gctt----
B D                  Squirrel  gg------gatctc--
       Lesser Egyptian jerboa  gg------gatatc--
B D                Guinea pig  ga------gatctc--
                   Chinchilla  gg------gatccc--
             Brush-tailed rat  ag------gatcgc--
B D                    Rabbit  tg------gagcag--
B D                      Pika  gg------aatcag--
B D                       Pig  gg------tatttg--
B D                    Alpaca  gg------tatctg--
               Bactrian camel  gg------tatctg--
B D                   Dolphin  ca------tatctg--
                 Killer whale  ca------tatctg--
             Tibetan antelope  ga------tgtcta--
B D                       Cow  ga------tgtcta--
B D                     Sheep  ga------tgtcta--
                Domestic goat  ga------tgtcta--
B D                     Horse  gg------tataca--
B D          White rhinoceros  ga------tatctg--
B D                       Cat  cg------tatctg--
B D                       Dog  gg------tatctg--
B D                   Ferret   gg------tatttg--
B D                     Panda  ag------tgtctg--
               Pacific walrus  -g------tatctg--
                 Weddell seal  -g------tatctg--
             Black flying-fox  gg------catctg--
B D                   Megabat  gg------catctg--
                Big brown bat  gt------tatctg--
         David's myotis (bat)  gg------tatctg--
B D                  Microbat  gg------tatctg--
B D                     Shrew  gg------tatctg--
              Star-nosed mole  ag------tgtctg--
B D           Tasmanian devil  --catttctaatga--
B D                  Platypus  -------gactttt--
  D                    Parrot  ----------tgta--
  D            Painted turtle  ----------ttga--
                  Spotted gar  ------aatatcagtt
B D                  Hedgehog  ----------------
B D                    Tenrec  ================
         Cape elephant shrew  ================
              Golden hamster  ================
B D           Chinese hamster  ================
B D                     Mouse  ================
B D                       Rat  ================
                Prairie vole  ================
B D                 Armadillo  ----------------
B D                   Manatee  ================
B D            Naked mole-rat  ----------------
B D                  Elephant  ================
B D              Atlantic cod  ================
         Pundamilia nyererei  ================
B D                   Lamprey  ================
         Princess of Burundi  ================
      Yellowbelly pufferfish  ================
B D                      Fugu  ================
    Mexican tetra (cavefish)  ================
B D              Nile tilapia  ================
B D               Stickleback  ================
                 Zebra mbuna  ================
B D                 Zebrafish  ================
B D                    Medaka  ================
B D                 Tetraodon  ================
       Burton's mouthbreeder  ================
          Southern platyfish  ================
B D        American alligator  ================
B D                   Chicken  ================
  D              Mallard duck  ================
  D             Scarlet macaw  ================
B D                Budgerigar  ================
B D               Zebra finch  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
  D               Rock pigeon  ----------------
B D       Medium ground finch  ================
B D                    Lizard  ================
  D       Collared flycatcher  ================
B D                   Wallaby  ================
B D                    Turkey  ================
          Tibetan ground jay  ================
  D    White-throated sparrow  ================
  D           Green seaturtle  ================
B D                Coelacanth  ================
B D             X. tropicalis  ================
B D                   Opossum  ================
  D    Spiny softshell turtle  ================
  D  Chinese softshell turtle  ================
                    Aardvark  ================
            Cape golden mole  ================

Inserts between block 16 and 17 in window
  D                   Parrot 23bp
  D           Painted turtle 23bp

Alignment block 17 of 444 in window, 155803349 - 155803371, 23 bps 
B D                     Human  aggtgaga----------------aattaatt--------------gctt-act
B D                     Chimp  aggtgaga----------------aattaatt--------------gctt-act
B D                   Gorilla  aggtgaga----------------aattaatt--------------gctt-act
B D                 Orangutan  aggtgaga----------------aattaatt--------------gctt-act
B D                    Gibbon  aggtgaga----------------aattaata--------------gctt-act
B D                    Rhesus  aggtgaga----------------aattaatt--------------gctt-act
B D       Crab-eating macaque  aggtgaga----------------aattaatt--------------gctt-act
B D                    Baboon  aggtgaga----------------aattaatt--------------gctt-act
B D              Green monkey  aggtgaga----------------aattaatt--------------gctt-act
B D                  Marmoset  agttgaga----------------atttaatt--------------gttt-act
B D           Squirrel monkey  agttgaga----------------atttaatt--------------gctt-act
B D                  Bushbaby  aggtgaga----------------aactcctt--------------gctt-gct
           Chinese tree shrew  -ggtggga----------------cac-aagt--------------gctc-acg
B D                  Squirrel  aggtggga----------------aactaatt--------------gctt-act
       Lesser Egyptian jerboa  agat-gga----------------aactaatt--------------gctt-tgg
B D            Naked mole-rat  -ggtggga----------------aactaatt--------------gctt-act
B D                Guinea pig  aggtggga----------------aactaact--------------gctt-act
                   Chinchilla  aggtggga----------------aactaatt--------------gctt-act
             Brush-tailed rat  aagt-gga----------------aagtaatt--------------gctt-act
B D                    Rabbit  aggtaggtcgg-------------aactattt--------------gctt-cct
B D                      Pika  agagaggtaggcaggtaggtaggaaaccagct--------------gctt-cct
B D                       Pig  agttgaga----------------aaataga---------------actt-act
B D                    Alpaca  aggtgaga----------------aaccagg---------------gctt-cct
               Bactrian camel  aggtgaga----------------aaccagg---------------gctt-cct
B D                   Dolphin  agctgaga----------------aaccggg---------------acttaact
                 Killer whale  agctgaga----------------aaccggg---------------acttaact
             Tibetan antelope  aggtgaga----------------aactagg---------------actt-act
B D                       Cow  aggcgaga----------------aactagg---------------actt-act
B D                     Sheep  aggtgaga----------------aactagg---------------actt-act
                Domestic goat  aggtgaga----------------aactagg---------------actt-act
B D                     Horse  aggtgaga----------------aaccagg---------------actt-cct
B D          White rhinoceros  aggtgaga----------------aaccagg---------------actt-aga
B D                       Cat  agatgaga----------------aatcagg---------------aatt-act
B D                       Dog  aggtgaga----------------aaccagg---------------cgtt-act
B D                   Ferret   gggtgaga----------------aacccgg---------------aatt-act
B D                     Panda  gggtggga----------------aaccagg---------------aatt-act
               Pacific walrus  gggtgaga----------------aaccagg---------------aatt-att
                 Weddell seal  gggcgaga----------------aaccagg---------------aatt-att
             Black flying-fox  aggtaaga----------------actcaga---------------attt-aca
B D                   Megabat  aggtaaga----------------actcaga---------------attt-aca
                Big brown bat  aggtgcaa----------------caccagg---------------actt-aca
         David's myotis (bat)  aagtgcaa----------------aagcagg---------------actt-aca
B D                  Microbat  aggtgcaa----------------aatcagg---------------acttaaca
B D                  Hedgehog  --------------------------taaaa---------------atg-----
B D                     Shrew  gggaaaga----------------agtgaga---------------attt-att
              Star-nosed mole  -----aaa----------------agttagg---------------atct-cca
B D                   Manatee  ----------------------------------------------atcg-act
             Cape golden mole  ----------------------------------------------gatg-gcg
B D                    Tenrec  ----------------------------------------------ggca-gca
                     Aardvark  -------------------------gttgct-atgtatgagtcagaattg-act
B D                 Armadillo  ------------------------gaaaactgaggtgggaatctaggcct-acg
B D           Tasmanian devil  aggcacca----------------gaatggt---------------attt-ct-
B D                  Platypus  cagtgaca----------------gtttgcg-----------------------
B D                Budgerigar  atgtgtga----------------ggttcatt--------------gctg-gct
  D                    Parrot  atgtgtaa----------------ggttcatt--------------ccta-gct
  D             Scarlet macaw  atgtgtaa----------------ggttcatt--------------ccta-gct
  D            Painted turtle  ataagtac------------------tttttt--------------ggta-aat
                  Spotted gar  taattcta----------------atttgggt--------------gctg-aca
         Cape elephant shrew  ======================================================
              Golden hamster  ======================================================
B D           Chinese hamster  ======================================================
B D                     Mouse  ======================================================
B D                       Rat  ======================================================
                Prairie vole  ======================================================
B D                  Elephant  ======================================================
B D              Atlantic cod  ======================================================
         Pundamilia nyererei  ======================================================
B D                   Lamprey  ======================================================
         Princess of Burundi  ======================================================
      Yellowbelly pufferfish  ======================================================
B D                      Fugu  ======================================================
    Mexican tetra (cavefish)  ======================================================
B D              Nile tilapia  ======================================================
B D               Stickleback  ======================================================
                 Zebra mbuna  ======================================================
B D                 Zebrafish  ======================================================
B D                    Medaka  ======================================================
B D                 Tetraodon  ======================================================
       Burton's mouthbreeder  ======================================================
          Southern platyfish  ======================================================
B D        American alligator  ======================================================
B D                   Chicken  ======================================================
  D              Mallard duck  ======================================================
B D               Zebra finch  ======================================================
  D          Peregrine falcon  ======================================================
  D              Saker falcon  ======================================================
  D               Rock pigeon  ------------------------------------------------------
B D       Medium ground finch  ======================================================
B D                    Lizard  ======================================================
  D       Collared flycatcher  ======================================================
B D                   Wallaby  ======================================================
B D                    Turkey  ======================================================
          Tibetan ground jay  ======================================================
  D    White-throated sparrow  ======================================================
  D           Green seaturtle  ======================================================
B D                Coelacanth  ======================================================
B D             X. tropicalis  ======================================================
B D                   Opossum  ======================================================
  D    Spiny softshell turtle  ======================================================
  D  Chinese softshell turtle  ======================================================

Inserts between block 17 and 18 in window
B D                  Manatee 30bp
            Cape golden mole 23bp
B D                   Tenrec 11bp
                    Aardvark 63bp
B D          Tasmanian devil 1bp
B D               Budgerigar 2bp
  D                   Parrot 2bp
  D            Scarlet macaw 2bp
  D           Painted turtle 2bp

Alignment block 18 of 444 in window, 155803372 - 155803375, 4 bps 
B D                     Human  aaag
B D                     Chimp  aaag
B D                   Gorilla  aaag
B D                 Orangutan  aaag
B D                    Gibbon  aaag
B D                    Rhesus  aaag
B D       Crab-eating macaque  aaag
B D                    Baboon  aaag
B D              Green monkey  aaag
B D                  Marmoset  gaaa
B D           Squirrel monkey  aaag
B D                  Bushbaby  agag
           Chinese tree shrew  agag
B D                  Squirrel  agag
       Lesser Egyptian jerboa  agaa
B D            Naked mole-rat  aggg
                   Chinchilla  agag
             Brush-tailed rat  agag
B D                    Rabbit  ggag
B D                      Pika  ggag
B D                       Pig  agag
B D                    Alpaca  ggag
               Bactrian camel  ggag
B D                   Dolphin  agag
                 Killer whale  agag
             Tibetan antelope  aaaa
B D                       Cow  agaa
B D                     Sheep  aaaa
                Domestic goat  aaaa
B D                     Horse  agag
B D          White rhinoceros  agac
B D                       Cat  aggg
B D                       Dog  aggg
B D                   Ferret   aggg
B D                     Panda  aagg
               Pacific walrus  aggg
                 Weddell seal  aggg
             Black flying-fox  aaag
B D                   Megabat  aaag
                Big brown bat  agag
         David's myotis (bat)  agag
B D                  Microbat  agag
B D                     Shrew  agag
              Star-nosed mole  gaag
B D                  Elephant  agaa
          Cape elephant shrew  agaa
B D                   Manatee  ggaa
             Cape golden mole  --aa
B D                    Tenrec  --aa
                     Aardvark  agag
B D                 Armadillo  --aa
B D           Tasmanian devil  gaa-
B D                  Platypus  -aa-
B D                Budgerigar  -tcc
  D                    Parrot  -taa
  D             Scarlet macaw  -taa
B D        American alligator  ---a
  D            Painted turtle  -agg
                  Spotted gar  atat
B D                  Hedgehog  ----
              Golden hamster  ====
B D           Chinese hamster  ====
B D                     Mouse  ====
B D                       Rat  ====
                Prairie vole  ====
B D                Guinea pig  ----
B D              Atlantic cod  ====
         Pundamilia nyererei  ====
B D                   Lamprey  ====
         Princess of Burundi  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
    Mexican tetra (cavefish)  ====
B D              Nile tilapia  ====
B D               Stickleback  ====
                 Zebra mbuna  ====
B D                 Zebrafish  ====
B D                    Medaka  ====
B D                 Tetraodon  ====
       Burton's mouthbreeder  ====
          Southern platyfish  ====
B D                   Chicken  ====
  D              Mallard duck  ====
B D               Zebra finch  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D               Rock pigeon  ----
B D       Medium ground finch  ====
B D                    Lizard  ====
  D       Collared flycatcher  ====
B D                   Wallaby  ====
B D                    Turkey  ====
          Tibetan ground jay  ====
  D    White-throated sparrow  ====
  D           Green seaturtle  ====
B D                Coelacanth  ====
B D             X. tropicalis  ====
B D                   Opossum  ====
  D    Spiny softshell turtle  ====
  D  Chinese softshell turtle  ====

Inserts between block 18 and 19 in window
B D                 Bushbaby 2bp
B D                   Rabbit 1bp
B D                     Pika 1bp
B D               Budgerigar 1bp
  D                   Parrot 1bp
  D            Scarlet macaw 1bp
B D       American alligator 1bp
  D           Painted turtle 1bp

Alignment block 19 of 444 in window, 155803376 - 155803383, 8 bps 
B D                     Human  gaaa----------aata
B D                     Chimp  gaaa----------aata
B D                   Gorilla  gaaa----------aata
B D                 Orangutan  gaaa----------aata
B D                    Gibbon  gaaa----------aata
B D                    Rhesus  caaa----------aata
B D       Crab-eating macaque  caaa----------aata
B D                    Baboon  caaa----------aata
B D              Green monkey  caaa----------aata
B D                  Marmoset  gaaa----------ag-a
B D           Squirrel monkey  gaaa----------ag-a
B D                  Bushbaby  gaaa----------aaca
           Chinese tree shrew  gg---------------g
B D                  Squirrel  gaaa----------ctaa
       Lesser Egyptian jerboa  gaaa----------gttc
B D            Naked mole-rat  gaaa----------agta
B D                Guinea pig  --------------aata
                   Chinchilla  ggaa----------aata
             Brush-tailed rat  gaaa----------acta
B D                    Rabbit  aaaa----------aata
B D                      Pika  taaa----------aata
B D                       Pig  gaaa----------aata
B D                    Alpaca  gaga----------agta
               Bactrian camel  gaga----------agta
B D                   Dolphin  gaaa----------aata
                 Killer whale  gaaa----------aata
             Tibetan antelope  gaaa----------aaca
B D                       Cow  gaaa----------acta
B D                     Sheep  gaaa----------aata
                Domestic goat  gaaa----------aata
B D                     Horse  gaaa----------agta
B D          White rhinoceros  gaaa----------aatc
B D                       Cat  ggga----------aata
B D                       Dog  agaa----------aata
B D                   Ferret   agag----------aata
B D                     Panda  agag----------aata
               Pacific walrus  agaa----------aata
                 Weddell seal  aaag----------aata
             Black flying-fox  gaaa----------aata
B D                   Megabat  gaaa----------aata
                Big brown bat  gaaa----------aata
         David's myotis (bat)  gaaa----------aata
B D                  Microbat  gaaa----------aata
B D                     Shrew  gaa---------------
              Star-nosed mole  gaa---------------
B D                  Elephant  gaaa----------aata
          Cape elephant shrew  gaaa----------agca
B D                   Manatee  gaca----------aata
             Cape golden mole  ctga----------aatt
B D                    Tenrec  gaaa----------aaca
                     Aardvark  gaaa----------aata
B D                 Armadillo  agaa----------aaca
B D                   Opossum  aaaa----------a---
B D           Tasmanian devil  gaaa----------a---
B D                  Platypus  gaat----------gata
B D                Budgerigar  -aga----------aatc
  D                    Parrot  -aga----------aatc
  D             Scarlet macaw  -aga----------aatc
B D        American alligator  -agg----------aatc
  D            Painted turtle  -agaataagctgctaatc
                  Spotted gar  ttaa----------aaca
B D                  Hedgehog  ------------------
              Golden hamster  ==================
B D           Chinese hamster  ==================
B D                     Mouse  ==================
B D                       Rat  ==================
                Prairie vole  ==================
B D              Atlantic cod  ==================
         Pundamilia nyererei  ==================
B D                   Lamprey  ==================
         Princess of Burundi  ==================
      Yellowbelly pufferfish  ==================
B D                      Fugu  ==================
    Mexican tetra (cavefish)  ==================
B D              Nile tilapia  ==================
B D               Stickleback  ==================
                 Zebra mbuna  ==================
B D                 Zebrafish  ==================
B D                    Medaka  ==================
B D                 Tetraodon  ==================
       Burton's mouthbreeder  ==================
          Southern platyfish  ==================
B D                   Chicken  ==================
  D              Mallard duck  ==================
B D               Zebra finch  ==================
  D          Peregrine falcon  ==================
  D              Saker falcon  ==================
  D               Rock pigeon  ------------------
B D       Medium ground finch  ==================
B D                    Lizard  ==================
  D       Collared flycatcher  ==================
B D                   Wallaby  ==================
B D                    Turkey  ==================
          Tibetan ground jay  ==================
  D    White-throated sparrow  ==================
  D           Green seaturtle  ==================
B D                Coelacanth  ==================
B D             X. tropicalis  ==================
  D    Spiny softshell turtle  ==================
  D  Chinese softshell turtle  ==================

Inserts between block 19 and 20 in window
            Cape golden mole 2bp
B D                   Tenrec 386bp
B D                  Opossum 2bp
B D          Tasmanian devil 2bp
B D                 Platypus 1bp
B D               Budgerigar 1bp
  D                   Parrot 1bp
  D            Scarlet macaw 1bp
B D       American alligator 1bp
  D           Painted turtle 1bp

Alignment block 20 of 444 in window, 155803384 - 155803389, 6 bps 
B D                     Human  attcta
B D                     Chimp  attcta
B D                   Gorilla  attcta
B D                 Orangutan  attc--
B D                    Gibbon  attcta
B D                    Rhesus  attcta
B D       Crab-eating macaque  attcta
B D                    Baboon  attcta
B D              Green monkey  attcta
B D                  Marmoset  attcta
B D           Squirrel monkey  attcta
B D                  Bushbaby  attcag
           Chinese tree shrew  cttctg
B D                  Squirrel  ttgt--
       Lesser Egyptian jerboa  atgg--
B D            Naked mole-rat  attctg
B D                Guinea pig  attc--
                   Chinchilla  attc--
             Brush-tailed rat  aatc--
B D                    Rabbit  attcgg
B D                      Pika  gtttta
B D                       Pig  a---tg
B D                    Alpaca  atgctg
               Bactrian camel  atgctg
B D                   Dolphin  a-----
                 Killer whale  a-----
             Tibetan antelope  atactg
B D                       Cow  atattg
B D                     Sheep  atactg
                Domestic goat  acgctg
B D                     Horse  atac--
B D          White rhinoceros  atgctg
B D                       Cat  atgctg
B D                       Dog  atgctg
B D                   Ferret   atgctg
B D                     Panda  atgctg
               Pacific walrus  atgctt
                 Weddell seal  atgctg
             Black flying-fox  atgccg
B D                   Megabat  atgccg
                Big brown bat  atgctg
         David's myotis (bat)  atgctc
B D                  Microbat  atgctg
B D                     Shrew  -tgcca
B D                  Elephant  atgctc
          Cape elephant shrew  atgctt
B D                   Manatee  atgccc
             Cape golden mole  atccca
B D                    Tenrec  atgctc
                     Aardvark  atgctt
B D                 Armadillo  atgctg
B D                   Opossum  atca--
B D           Tasmanian devil  atca--
B D                  Platypus  atgtg-
B D                Budgerigar  attttt
  D                    Parrot  attttt
  D             Scarlet macaw  attttt
B D        American alligator  aca---
                  Spotted gar  atgaaa
             Star-nosed mole  ------
B D                  Hedgehog  ------
              Golden hamster  ======
B D           Chinese hamster  ======
B D                     Mouse  ======
B D                       Rat  ======
                Prairie vole  ======
B D              Atlantic cod  ======
         Pundamilia nyererei  ======
B D                   Lamprey  ======
         Princess of Burundi  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
    Mexican tetra (cavefish)  ======
B D              Nile tilapia  ======
B D               Stickleback  ======
                 Zebra mbuna  ======
B D                 Zebrafish  ======
B D                    Medaka  ======
B D                 Tetraodon  ======
       Burton's mouthbreeder  ======
          Southern platyfish  ======
B D                   Chicken  ======
  D              Mallard duck  ======
B D               Zebra finch  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D               Rock pigeon  ------
B D       Medium ground finch  ======
B D                    Lizard  ======
  D       Collared flycatcher  ======
B D                   Wallaby  ======
B D                    Turkey  ======
          Tibetan ground jay  ======
  D    White-throated sparrow  ======
  D           Green seaturtle  ======
B D                Coelacanth  ======
B D             X. tropicalis  ======
  D    Spiny softshell turtle  ======
  D  Chinese softshell turtle  ======
  D            Painted turtle  ======

Inserts between block 20 and 21 in window
            Cape golden mole 890bp
B D                  Opossum 12bp
B D          Tasmanian devil 12bp

Alignment block 21 of 444 in window, 155803390 - 155803408, 19 bps 
B D                     Human  t-g------t-------ctgtacctgc-ccgtca
B D                     Chimp  t-g------t-------ctgtacctgc-ccatca
B D                   Gorilla  t-g------t-------ctgtacctgc-ccatca
B D                 Orangutan  t-g------t-------ctgtacccgc-ccatca
B D                    Gibbon  t-g------t-------ctgtacctgc-ccatca
B D                    Rhesus  t-a------t-------ctgtacctgc-ccatca
B D       Crab-eating macaque  t-a------t-------ctgtacctgc-ccatca
B D                    Baboon  t-g------t-------ctgtacctgc-ccatca
B D              Green monkey  t-g------t-------ctgtacctgc-ccatca
B D                  Marmoset  t-g------t-------ctgtacctac-ccatca
B D           Squirrel monkey  t-g------t-------ctgtacctgc-tcatca
B D                  Bushbaby  t-g------t-------ctgtacctgt-ctacag
           Chinese tree shrew  --g------t-------ctgagcc-gc-ctgtac
B D                  Squirrel  t-tc-----t-------ctgctcat---tc----
       Lesser Egyptian jerboa  t-g------t-------gtgcttgt---ttataa
B D            Naked mole-rat  t-g------t-------ctataggtga-ttgtaa
B D                Guinea pig  c-a------t-------ctgcacatgg-ccataa
                   Chinchilla  c-g------t-------gtgcatgtgg-ccgtag
             Brush-tailed rat  a-g------t-------ctgcatgtgg-ccataa
B D                    Rabbit  t-g------t-------ctgcatatac-ctctaa
B D                      Pika  t-g------t-------ct-ctcccgc-ctgcaa
B D                       Pig  t-g------t-------ctgtacctgc-ctgtca
B D                    Alpaca  t-g------t-------ctgcatctgc-ctgtaa
               Bactrian camel  c-g------t-------ctgcacctgc-ctgtaa
B D                   Dolphin  ------------------------tgc-ctgtaa
                 Killer whale  ------------------------tgc-ctgtaa
             Tibetan antelope  t-gt-----t-------ctgtccctgc-ctgtaa
B D                       Cow  t-gt-----t-------ctgtccctgc-ctgtaa
B D                     Sheep  t-gt-----t-------ctgtccctgc-ctgtaa
                Domestic goat  t-gt-----t-------ctgtccctgc-ctgtaa
B D                     Horse  t-g------t-------ctatacctgc-ttgccg
B D          White rhinoceros  t-g------t-------ctgtacctgc-ctgtga
B D                       Cat  t-g------t-------ccatgcctgg-ctgtaa
B D                       Dog  t-g------t-------ctgtacctgc-ctgtaa
B D                   Ferret   t-g------t-------ctggacctgc-ctgtaa
B D                     Panda  t-g------t-------ctatacctgc-ctgtaa
               Pacific walrus  g-g------t-------ctgtacctgc-ctgtaa
                 Weddell seal  t-g------t-------ctgtacctgc-ctgtaa
             Black flying-fox  t-g------t-------ctgtacttgc-ctgtaa
B D                   Megabat  t-g------t-------ctgtacttgc-ctgtaa
                Big brown bat  t-g------g-------ctactcctgc-ctgtca
         David's myotis (bat)  t-g------t-------ctacacctgc-ctgtaa
B D                  Microbat  t-g------t-------ctacacctgc-ctggaa
B D                  Hedgehog  -------------------------------caa
B D                     Shrew  a-g-------------------------ctgtat
              Star-nosed mole  -------------------------------aat
B D                  Elephant  ---ca----a-------ctttacctgc-ctgtaa
          Cape elephant shrew  ---ca----t-------gtttacttgc-ccatat
B D                   Manatee  ---ca----t-------cttcacctgc-ctgtcg
             Cape golden mole  ---cc----t-------ctttagctga-ctataa
B D                    Tenrec  ---ca----t-------cttaatctgc-ctataa
                     Aardvark  ---ca----t-------ctttatctgc-ctgtaa
B D                 Armadillo  ---aa----t-------ctttacctgc-caggaa
B D                   Opossum  t-a------c-------ctgtaacagcaacgtaa
B D           Tasmanian devil  tca------t-------ctatatcagtacaataa
B D                  Platypus  ---cc----t-------ctattcctgc-ccatca
B D                Budgerigar  ---------tgtcttgtttgtaccaag-tga---
  D                    Parrot  ---------tgtc----ttgtaccaag-tga---
  D             Scarlet macaw  ---------tgtc----ctgtacccag-tga---
B D        American alligator  -----------------ctgtacacac-aca---
                  Spotted gar  ----tgtttt-------ctgcttttcc-ctct--
              Golden hamster  ==================================
B D           Chinese hamster  ==================================
B D                     Mouse  ==================================
B D                       Rat  ==================================
                Prairie vole  ==================================
B D              Atlantic cod  ==================================
         Pundamilia nyererei  ==================================
B D                   Lamprey  ==================================
         Princess of Burundi  ==================================
      Yellowbelly pufferfish  ==================================
B D                      Fugu  ==================================
    Mexican tetra (cavefish)  ==================================
B D              Nile tilapia  ==================================
B D               Stickleback  ==================================
                 Zebra mbuna  ==================================
B D                 Zebrafish  ==================================
B D                    Medaka  ==================================
B D                 Tetraodon  ==================================
       Burton's mouthbreeder  ==================================
          Southern platyfish  ==================================
B D                   Chicken  ==================================
  D              Mallard duck  ==================================
B D               Zebra finch  ==================================
  D          Peregrine falcon  ==================================
  D              Saker falcon  ==================================
  D               Rock pigeon  ----------------------------------
B D       Medium ground finch  ==================================
B D                    Lizard  ==================================
  D       Collared flycatcher  ==================================
B D                   Wallaby  ==================================
B D                    Turkey  ==================================
          Tibetan ground jay  ==================================
  D    White-throated sparrow  ==================================
  D           Green seaturtle  ==================================
B D                Coelacanth  ==================================
B D             X. tropicalis  ==================================
  D    Spiny softshell turtle  ==================================
  D  Chinese softshell turtle  ==================================
  D            Painted turtle  ==================================

Inserts between block 21 and 22 in window
B D               Budgerigar 12bp
  D                   Parrot 12bp
  D            Scarlet macaw 12bp
B D       American alligator 13bp

Alignment block 22 of 444 in window, 155803409 - 155803410, 2 bps 
B D                     Human  ---------tc-------
B D                     Chimp  ---------tc-------
B D                   Gorilla  ---------tc-------
B D                 Orangutan  ---------tc-------
B D                    Gibbon  ---------tc-------
B D                    Rhesus  ---------tc-------
B D       Crab-eating macaque  ---------tc-------
B D                    Baboon  ---------tc-------
B D              Green monkey  ---------tc-------
B D                  Marmoset  ---------tc-------
B D           Squirrel monkey  ---------tt-------
B D                  Bushbaby  ---------tc-------
           Chinese tree shrew  ---------gc-------
       Lesser Egyptian jerboa  ---------tg-------
B D            Naked mole-rat  ---------tc-------
B D                Guinea pig  ---------gc-------
             Brush-tailed rat  ---------tc-------
B D                    Rabbit  ---------tc-------
B D                      Pika  ---------tc-------
B D                       Pig  ---------gc-------
B D                    Alpaca  ---------tc-------
               Bactrian camel  ---------tc-------
B D                   Dolphin  ---------cc-------
                 Killer whale  ---------tc-------
             Tibetan antelope  ---------tc-------
B D                       Cow  ---------tc-------
B D                     Sheep  ---------tc-------
                Domestic goat  ---------tc-------
B D                     Horse  ---------tc-------
B D          White rhinoceros  ---------tc-------
B D                       Cat  ---------tc-------
B D                       Dog  ---------tc-------
B D                   Ferret   ---------tc-------
B D                     Panda  ---------tt-------
               Pacific walrus  ---------tc-------
                 Weddell seal  ---------tc-------
             Black flying-fox  ---------tc-------
B D                   Megabat  ---------tc-------
                Big brown bat  ---------tc-------
         David's myotis (bat)  ---------tc-------
B D                  Microbat  ---------tc-------
B D                  Hedgehog  ---------tc-------
B D                     Shrew  ---------ca-------
              Star-nosed mole  ---------cc-------
B D                  Elephant  ---------tc-------
          Cape elephant shrew  ---------tc-------
B D                   Manatee  ---------tc-------
             Cape golden mole  ---------ta-------
B D                    Tenrec  ---------tc-------
                     Aardvark  ---------tc-------
B D                 Armadillo  ---------tc-------
B D                  Platypus  ---------ct-------
  D              Saker falcon  ---------tc-------
  D          Peregrine falcon  ---------tc-------
B D                Budgerigar  ---------tc-------
  D                    Parrot  ---------tc-------
  D             Scarlet macaw  ---------tc-------
B D        American alligator  ---------tg-------
                  Spotted gar  tgggaaaagttgggggaa
              Golden hamster  ==================
B D           Chinese hamster  ==================
B D                     Mouse  ==================
B D                       Rat  ==================
                Prairie vole  ==================
                  Chinchilla  ------------------
B D                  Squirrel  ------------------
B D              Atlantic cod  ==================
         Pundamilia nyererei  ==================
B D                   Lamprey  ==================
         Princess of Burundi  ==================
      Yellowbelly pufferfish  ==================
B D                      Fugu  ==================
    Mexican tetra (cavefish)  ==================
B D              Nile tilapia  ==================
B D               Stickleback  ==================
                 Zebra mbuna  ==================
B D                 Zebrafish  ==================
B D                    Medaka  ==================
B D                 Tetraodon  ==================
       Burton's mouthbreeder  ==================
          Southern platyfish  ==================
B D                   Chicken  ==================
  D              Mallard duck  ==================
B D               Zebra finch  ==================
  D               Rock pigeon  ------------------
B D       Medium ground finch  ==================
B D                    Lizard  ==================
  D       Collared flycatcher  ==================
B D           Tasmanian devil  ------------------
B D                   Wallaby  ==================
B D                    Turkey  ==================
          Tibetan ground jay  ==================
  D    White-throated sparrow  ==================
  D           Green seaturtle  ==================
B D                Coelacanth  ==================
B D             X. tropicalis  ==================
B D                   Opossum  ------------------
  D    Spiny softshell turtle  ==================
  D  Chinese softshell turtle  ==================
  D            Painted turtle  ==================

Inserts between block 22 and 23 in window
                 Spotted gar 1bp

Alignment block 23 of 444 in window, 155803411 - 155803411, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
       Lesser Egyptian jerboa  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  a
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  c
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  g
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
B D                     Shrew  c
              Star-nosed mole  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  g
             Cape golden mole  a
B D                    Tenrec  c
                     Aardvark  a
B D                 Armadillo  a
B D                  Platypus  a
  D              Saker falcon  a
  D          Peregrine falcon  a
B D                Budgerigar  a
  D                    Parrot  a
  D             Scarlet macaw  a
B D        American alligator  a
B D               Stickleback  a
                  Spotted gar  a
              Golden hamster  =
B D           Chinese hamster  =
B D                     Mouse  =
B D                       Rat  =
                Prairie vole  =
B D                  Squirrel  -
B D              Atlantic cod  =
         Pundamilia nyererei  =
B D                   Lamprey  =
         Princess of Burundi  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
    Mexican tetra (cavefish)  =
B D              Nile tilapia  =
                 Zebra mbuna  =
B D                 Zebrafish  =
B D                    Medaka  =
B D                 Tetraodon  =
       Burton's mouthbreeder  =
          Southern platyfish  =
B D                   Chicken  =
  D              Mallard duck  =
B D               Zebra finch  =
  D               Rock pigeon  -
B D       Medium ground finch  =
B D                    Lizard  =
  D       Collared flycatcher  =
B D           Tasmanian devil  -
B D                   Wallaby  =
B D                    Turkey  =
          Tibetan ground jay  =
  D    White-throated sparrow  =
  D           Green seaturtle  =
B D                Coelacanth  =
B D             X. tropicalis  =
B D                   Opossum  -
  D    Spiny softshell turtle  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =

Inserts between block 23 and 24 in window
B D               Budgerigar 3bp
  D                   Parrot 3bp
  D            Scarlet macaw 3bp
B D       American alligator 3bp

Alignment block 24 of 444 in window, 155803412 - 155803413, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D                    Baboon  aa
B D              Green monkey  aa
B D                  Marmoset  aa
B D           Squirrel monkey  aa
B D                  Bushbaby  aa
           Chinese tree shrew  gg
B D                  Squirrel  at
       Lesser Egyptian jerboa  aa
B D                     Mouse  aa
B D            Naked mole-rat  aa
B D                Guinea pig  aa
                   Chinchilla  ca
             Brush-tailed rat  ca
B D                    Rabbit  aa
B D                      Pika  aa
B D                       Pig  aa
B D                    Alpaca  ag
               Bactrian camel  ag
B D                     Horse  aa
B D          White rhinoceros  aa
B D                       Cat  aa
B D                       Dog  aa
B D                   Ferret   aa
B D                     Panda  aa
               Pacific walrus  aa
                 Weddell seal  aa
             Black flying-fox  aa
B D                   Megabat  aa
                Big brown bat  aa
         David's myotis (bat)  aa
B D                  Microbat  aa
B D                  Hedgehog  at
B D                     Shrew  at
              Star-nosed mole  aa
B D                  Elephant  aa
          Cape elephant shrew  aa
B D                   Manatee  aa
             Cape golden mole  aa
B D                    Tenrec  aa
                     Aardvark  aa
B D                 Armadillo  aa
B D                   Opossum  at
B D           Tasmanian devil  at
B D                  Platypus  aa
  D              Saker falcon  ca
  D          Peregrine falcon  ca
B D                Budgerigar  ca
  D                    Parrot  ca
  D             Scarlet macaw  ca
B D        American alligator  cc
B D               Stickleback  ga
                  Spotted gar  aa
B D                     Sheep  --
               Domestic goat  --
              Golden hamster  ==
B D           Chinese hamster  ==
B D                       Rat  ==
                Prairie vole  ==
B D                       Cow  --
                Killer whale  --
            Tibetan antelope  --
B D              Atlantic cod  ==
         Pundamilia nyererei  ==
B D                   Lamprey  ==
         Princess of Burundi  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
    Mexican tetra (cavefish)  ==
B D              Nile tilapia  ==
                 Zebra mbuna  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
B D                 Tetraodon  ==
       Burton's mouthbreeder  ==
          Southern platyfish  ==
B D                   Chicken  ==
  D              Mallard duck  ==
B D               Zebra finch  ==
  D               Rock pigeon  --
B D       Medium ground finch  ==
B D                    Lizard  ==
  D       Collared flycatcher  ==
B D                   Wallaby  ==
B D                    Turkey  ==
          Tibetan ground jay  ==
  D    White-throated sparrow  ==
  D           Green seaturtle  ==
B D                Coelacanth  ==
B D             X. tropicalis  ==
  D    Spiny softshell turtle  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
B D                   Dolphin  --

Inserts between block 24 and 25 in window
B D                 Platypus 641bp

Alignment block 25 of 444 in window, 155803414 - 155803418, 5 bps 
B D                     Human  gaccc
B D                     Chimp  gatcc
B D                   Gorilla  gaccc
B D                 Orangutan  gaccc
B D                    Gibbon  gaccc
B D                    Rhesus  gaccc
B D       Crab-eating macaque  gaccc
B D                    Baboon  gaccc
B D              Green monkey  gaccc
B D                  Marmoset  gacct
B D           Squirrel monkey  gaccc
B D                  Bushbaby  aaccc
           Chinese tree shrew  a---c
B D                  Squirrel  aactc
       Lesser Egyptian jerboa  gatgt
B D                     Mouse  gaccc
B D            Naked mole-rat  gaccc
B D                Guinea pig  ggccc
                   Chinchilla  gacac
             Brush-tailed rat  gactc
B D                    Rabbit  gaccc
B D                      Pika  gatcc
B D                       Pig  gacat
B D                    Alpaca  gatct
               Bactrian camel  gatct
B D                   Dolphin  gactc
                 Killer whale  gactc
             Tibetan antelope  gactt
B D                       Cow  gactt
B D                     Sheep  gactt
                Domestic goat  gactt
B D                     Horse  gacct
B D          White rhinoceros  gacct
B D                       Cat  gacct
B D                       Dog  gacct
B D                   Ferret   gacct
B D                     Panda  gacct
               Pacific walrus  gacct
                 Weddell seal  gacct
             Black flying-fox  g----
B D                   Megabat  g----
                Big brown bat  gacct
         David's myotis (bat)  gacct
B D                  Microbat  gacct
B D                  Hedgehog  gttcc
B D                     Shrew  aggcc
              Star-nosed mole  gggcc
B D                  Elephant  gatcc
          Cape elephant shrew  gaccc
B D                   Manatee  gatcc
             Cape golden mole  aactc
B D                    Tenrec  gactc
                     Aardvark  gactc
B D                 Armadillo  gaccc
B D                   Opossum  gat--
B D           Tasmanian devil  aat--
  D              Saker falcon  cactc
  D          Peregrine falcon  cactc
B D                Budgerigar  caatc
  D                    Parrot  caatc
  D             Scarlet macaw  caatc
B D        American alligator  cagaa
B D               Stickleback  ggccc
                  Spotted gar  ag---
              Golden hamster  =====
B D           Chinese hamster  =====
B D                       Rat  =====
                Prairie vole  =====
B D              Atlantic cod  =====
         Pundamilia nyererei  =====
B D                   Lamprey  =====
         Princess of Burundi  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
    Mexican tetra (cavefish)  =====
B D              Nile tilapia  =====
                 Zebra mbuna  =====
B D                 Zebrafish  =====
B D                    Medaka  =====
B D                 Tetraodon  =====
       Burton's mouthbreeder  =====
          Southern platyfish  =====
B D                   Chicken  =====
  D              Mallard duck  =====
B D               Zebra finch  =====
  D               Rock pigeon  -----
B D                  Platypus  =====
B D       Medium ground finch  =====
B D                    Lizard  =====
  D       Collared flycatcher  =====
B D                   Wallaby  =====
B D                    Turkey  =====
          Tibetan ground jay  =====
  D    White-throated sparrow  =====
  D           Green seaturtle  =====
B D                Coelacanth  =====
B D             X. tropicalis  =====
  D    Spiny softshell turtle  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====

Inserts between block 25 and 26 in window
B D                  Opossum 1bp
B D          Tasmanian devil 1bp

Alignment block 26 of 444 in window, 155803419 - 155803435, 17 bps 
B D                     Human  ca-----agtgtccatc-------atgtg-------
B D                     Chimp  ca-----agtgtccgtc-------atgtg-------
B D                   Gorilla  ca-----attgtccatc-------atgtg-------
B D                 Orangutan  ca-----agtgtccatc---------ttg-------
B D                    Gibbon  ca-----agtgtctgtc-------atgtg-------
B D                    Rhesus  ca-----agtgtctgtc-------atgtg-------
B D       Crab-eating macaque  ca-----agtgtctgtc-------atgtg-------
B D                    Baboon  ca-----agtgtctgtc-------atgtg-------
B D              Green monkey  ca-----agtgtctgtc-------atgtg-------
B D                  Marmoset  ca-----agtgcctgtc-------atgtg-------
B D           Squirrel monkey  ca-----agtgcctatc-------atgtg-------
B D                  Bushbaby  ca-----agtgc----c-------atgtg-------
           Chinese tree shrew  ca-----tgtgc--------------gtg-------
B D                  Squirrel  ca-----agtac----c-------aagtg-------
       Lesser Egyptian jerboa  ta-----agtac----c-------aagct-------
               Golden hamster  aa-----gggcc----c-------atact-------
B D                     Mouse  aa-----gctgc----c-------ggaaa-------
B D            Naked mole-rat  tt-----agtgc----c-------atgtg-------
B D                Guinea pig  tt-----actgc----a-------aagtg-------
                   Chinchilla  tt-----agtgc----c-------aactg-------
             Brush-tailed rat  tc-----ggtgc----c-------aggta-------
B D                    Rabbit  ca-----agtgc----t-------actga-------
B D                      Pika  ta-----catgc----t-------aatgc-------
B D                       Pig  ca-----tgtac----c-------aggtg-------
B D                    Alpaca  cg-----agtgc----c-------aggtg-------
               Bactrian camel  cg-----agtgc----c-------aggtg-------
B D                   Dolphin  ca-----agtgc----c-------agatg-------
                 Killer whale  ca-----agtgc----c-------agatg-------
             Tibetan antelope  ca-----agtgc----c-------aggtg-------
B D                       Cow  ca-----agtgc----c-------agttg-------
B D                     Sheep  ca-----agtgc----c-------aggtg-------
                Domestic goat  ca-----agtgc----c-------aggtg-------
B D                     Horse  ca-----agtgc----c-------atgtg-------
B D          White rhinoceros  ca-----agtgc---------------tt-------
B D                       Cat  ca-----agtgc----t---------gtg-------
B D                       Dog  ca-----agtgc----c-------atgtg-------
B D                   Ferret   ca-----agtgc----c-------atgtg-------
B D                     Panda  ca-----agtgc----c-------atgtg-------
               Pacific walrus  ca-----agtgc----c-------a-gtg-------
                 Weddell seal  ca-----agtgc----c-------a-gtg-------
             Black flying-fox  ---------tgc----c-------atgtg-------
B D                   Megabat  ---------tgc----c-------atgtg-------
                Big brown bat  ca-----aatgc----c-------atgtg-------
         David's myotis (bat)  ca-----gatgc----c-------atgtg-------
B D                  Microbat  ca-----aatgc----c-------atgtg-------
B D                  Hedgehog  ca-----agtca----c-------atggc-------
B D                     Shrew  tataaccagaga----t-------aggtg-------
              Star-nosed mole  tg-----agtgc----c-------aggtg-------
B D                  Elephant  cg-----ggtgc----t-------gtgtg-------
          Cape elephant shrew  ca-----gct---------------tgtg-------
B D                   Manatee  ca-----ggtgc----t-------gtgtg-------
             Cape golden mole  ca-----ggtgc----t-------gtgtg-------
B D                    Tenrec  ca-----agtgc----t-------gcatg-------
                     Aardvark  ca-----ggtgc----t-------atatg-------
B D                 Armadillo  ct-----aggg-----------------a-------
B D                   Opossum  ct-----tctgg----t-------atgtg-------
B D           Tasmanian devil  ct-----tccaa----t-------acatg-------
  D              Saker falcon  -----acagtgt----c-------------------
  D          Peregrine falcon  -----acagtgt----c-------------------
B D                Budgerigar  -----acagtgt----c-------------------
  D                    Parrot  -----acagtgt----c-------------------
  D             Scarlet macaw  -----acagtgt----c-------------------
B D        American alligator  -----aaagtga----ttcaggtg------------
  D            Painted turtle  -----tcagtag------------------------
B D               Stickleback  ca-----aatgt----c-------ttaaagc--tga
                  Spotted gar  -a-----attat----g-------gtgcagcatgaa
B D           Chinese hamster  ====================================
B D                       Rat  ====================================
                Prairie vole  ====================================
B D              Atlantic cod  ====================================
         Pundamilia nyererei  ====================================
B D                   Lamprey  ====================================
         Princess of Burundi  ====================================
      Yellowbelly pufferfish  ====================================
B D                      Fugu  ====================================
    Mexican tetra (cavefish)  ====================================
B D              Nile tilapia  ====================================
                 Zebra mbuna  ====================================
B D                 Zebrafish  ====================================
B D                    Medaka  ====================================
B D                 Tetraodon  ====================================
       Burton's mouthbreeder  ====================================
          Southern platyfish  ====================================
B D                   Chicken  ====================================
  D              Mallard duck  ====================================
B D               Zebra finch  ====================================
  D               Rock pigeon  ------------------------------------
B D                  Platypus  ====================================
B D       Medium ground finch  ====================================
B D                    Lizard  ====================================
  D       Collared flycatcher  ====================================
B D                   Wallaby  ====================================
B D                    Turkey  ====================================
          Tibetan ground jay  ====================================
  D    White-throated sparrow  ====================================
  D           Green seaturtle  ====================================
B D                Coelacanth  ====================================
B D             X. tropicalis  ====================================
  D    Spiny softshell turtle  ====================================
  D  Chinese softshell turtle  ====================================

Inserts between block 26 and 27 in window
              Golden hamster 3bp
B D                    Mouse 4bp
B D                   Rabbit 1bp
B D                     Pika 1bp

Alignment block 27 of 444 in window, 155803436 - 155803438, 3 bps 
B D                     Human  tgt
B D                     Chimp  tgt
B D                   Gorilla  tgt
B D                 Orangutan  tgt
B D                    Gibbon  tgt
B D                    Rhesus  tgt
B D       Crab-eating macaque  tgt
B D                    Baboon  tgt
B D              Green monkey  tgt
B D                  Marmoset  tgt
B D           Squirrel monkey  tgt
B D                  Bushbaby  tgt
           Chinese tree shrew  cgc
B D                  Squirrel  cat
       Lesser Egyptian jerboa  tgt
B D           Chinese hamster  tgt
               Golden hamster  --t
B D                     Mouse  tgt
B D            Naked mole-rat  tgt
B D                Guinea pig  ggt
                   Chinchilla  tgt
             Brush-tailed rat  tgg
B D                    Rabbit  tgt
B D                      Pika  tgt
B D                       Pig  tgt
B D                    Alpaca  tg-
               Bactrian camel  tg-
B D                   Dolphin  tgt
                 Killer whale  tgt
             Tibetan antelope  tgt
B D                       Cow  tgt
B D                     Sheep  tgt
                Domestic goat  tgt
B D                     Horse  tgt
B D          White rhinoceros  tgt
B D                       Cat  tgc
B D                       Dog  tgt
B D                   Ferret   tgt
B D                     Panda  tgt
               Pacific walrus  tgt
                 Weddell seal  tgt
             Black flying-fox  tgt
B D                   Megabat  tgt
                Big brown bat  tgt
         David's myotis (bat)  tgt
B D                  Microbat  tgt
B D                  Hedgehog  tgg
B D                     Shrew  ttg
              Star-nosed mole  tgt
B D                  Elephant  tgt
          Cape elephant shrew  tat
B D                   Manatee  tgt
             Cape golden mole  tgt
B D                    Tenrec  tgt
                     Aardvark  tgt
B D                 Armadillo  tgt
B D                   Opossum  tga
B D           Tasmanian devil  tga
B D                   Chicken  tat
B D        American alligator  --t
B D               Stickleback  tgt
                  Spotted gar  tga
B D                       Rat  ===
                Prairie vole  ===
B D              Atlantic cod  ===
         Pundamilia nyererei  ===
B D                   Lamprey  ===
         Princess of Burundi  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
    Mexican tetra (cavefish)  ===
B D              Nile tilapia  ===
                 Zebra mbuna  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
B D                 Tetraodon  ===
       Burton's mouthbreeder  ===
          Southern platyfish  ===
  D              Mallard duck  ===
  D             Scarlet macaw  ---
  D                    Parrot  ---
B D                Budgerigar  ---
B D               Zebra finch  ===
  D          Peregrine falcon  ---
  D              Saker falcon  ---
  D               Rock pigeon  ---
B D                  Platypus  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D       Collared flycatcher  ===
B D                   Wallaby  ===
B D                    Turkey  ===
          Tibetan ground jay  ===
  D    White-throated sparrow  ===
  D           Green seaturtle  ===
B D                Coelacanth  ===
B D             X. tropicalis  ===
  D    Spiny softshell turtle  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ---

Alignment block 28 of 444 in window, 155803439 - 155803445, 7 bps 
B D                     Human  aa----att--a---t
B D                     Chimp  aa----att--a---t
B D                   Gorilla  aa----att--a---t
B D                 Orangutan  aa----att--g---t
B D                    Gibbon  aa----att--a---t
B D                    Rhesus  aa----att--a---t
B D       Crab-eating macaque  aa----att--a---t
B D                    Baboon  aa----att--a---t
B D              Green monkey  aa----att--a---t
B D                  Marmoset  aa----att--a---t
B D           Squirrel monkey  aa----att--a---t
B D                  Bushbaby  aa----att--a---c
           Chinese tree shrew  ca----gtt--c---c
B D                  Squirrel  aa----att--c---c
       Lesser Egyptian jerboa  ca----ggt--c---t
B D           Chinese hamster  ca----act--c---c
               Golden hamster  ca----att--c---c
B D                     Mouse  aa----att--a---c
B D                       Rat  aa----att--attcc
B D            Naked mole-rat  aa----att--t---c
B D                Guinea pig  aa----att--c---c
                   Chinchilla  aa----att--c---c
             Brush-tailed rat  aa----att--c---c
B D                    Rabbit  aa----atc--c----
B D                      Pika  ca----acc--c---t
B D                       Pig  ac----att--t---t
B D                    Alpaca  aa----att--t---c
               Bactrian camel  aa----att--t---c
B D                   Dolphin  ac----att--t---c
                 Killer whale  ac----att--t---c
             Tibetan antelope  ac----att--t---t
B D                       Cow  ac----att--t---t
B D                     Sheep  ac----att--t---t
                Domestic goat  ac----att--t---t
B D                     Horse  aa----att--t---c
B D          White rhinoceros  aa----att--t---c
B D                       Cat  aa----gtt--t---c
B D                       Dog  aa----att--t---c
B D                   Ferret   aa----atc--t---g
B D                     Panda  aa----att--t---c
               Pacific walrus  aa----att--t---g
                 Weddell seal  aa----att--t---g
             Black flying-fox  aa----att--t---c
B D                   Megabat  aa----att--t---c
                Big brown bat  aa----att--t---c
         David's myotis (bat)  ac----att--t---c