Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 119 in window, 49663610 - 49663613, 4 bps 
B D                   Human  gaca
B D                   Chimp  gaca
B D                 Gorilla  gaca
B D               Orangutan  gaca
B D                  Gibbon  gaca
B D                  Rhesus  gaca
B D     Crab-eating macaque  gaca
B D            Green monkey  gaca
B D                Marmoset  gaca
B D         Squirrel monkey  gaca
B D                Bushbaby  gaca
         Chinese tree shrew  gaca
B D                Squirrel  gaca
     Lesser Egyptian jerboa  ctcc
B D          Naked mole-rat  tcca
B D              Guinea pig  gaca
                 Chinchilla  gcca
           Brush-tailed rat  gaca
B D                  Rabbit  gaca
B D                    Pika  gaca
B D                  Alpaca  aaca
             Bactrian camel  aaca
           Tibetan antelope  aaca
B D                     Cow  aaca
B D                   Sheep  aaca
              Domestic goat  aaca
B D                   Horse  gaca
B D        White rhinoceros  gaca
B D                     Cat  ----
B D                     Dog  gaca
B D                 Ferret   aaga
             Pacific walrus  aaca
           Black flying-fox  gaca
B D                 Megabat  gacg
              Big brown bat  gaca
       David's myotis (bat)  gaca
B D                Microbat  gaca
            Star-nosed mole  aata
B D                Elephant  gata
B D                 Manatee  gaca
B D                  Tenrec  gaca
B D               Armadillo  gttg
       Cape elephant shrew  ====
B D                   Shrew  ====
B D                   Mouse  ====
              Prairie vole  ====
B D                     Rat  ====
B D         Chinese hamster  ====
            Golden hamster  ====
B D                  Baboon  ====
B D                     Pig  ====
B D                 Dolphin  ====
              Weddell seal  ====
              Killer whale  ====
B D                   Panda  ====
B D                Platypus  ====
B D                 Opossum  ====
B D         Tasmanian devil  ====
          Cape golden mole  ====
                  Aardvark  ====

Inserts between block 1 and 2 in window
B D                    Cat 1bp
B D               Elephant 1bp
B D                Manatee 1bp
B D                 Tenrec 1bp

Alignment block 2 of 119 in window, 49663614 - 49663614, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D                Bushbaby  t
         Chinese tree shrew  c
B D                Squirrel  t
     Lesser Egyptian jerboa  t
B D          Naked mole-rat  t
B D              Guinea pig  c
                 Chinchilla  t
           Brush-tailed rat  t
B D                  Rabbit  t
B D                    Pika  t
B D                  Alpaca  c
             Bactrian camel  c
           Tibetan antelope  t
B D                     Cow  t
B D                   Sheep  t
              Domestic goat  t
B D                   Horse  t
B D        White rhinoceros  t
B D                     Dog  g
B D                 Ferret   g
             Pacific walrus  g
           Black flying-fox  t
B D                 Megabat  t
              Big brown bat  t
       David's myotis (bat)  t
B D                Microbat  t
            Star-nosed mole  t
B D               Armadillo  t
       Cape elephant shrew  =
B D                   Shrew  =
B D                   Mouse  =
              Prairie vole  =
B D                     Rat  =
B D         Chinese hamster  =
            Golden hamster  =
B D                  Tenrec  =
B D                  Baboon  =
B D                     Pig  =
B D                 Dolphin  =
              Weddell seal  =
              Killer whale  =
B D                   Panda  =
B D                 Manatee  =
B D                Elephant  =
B D                     Cat  =
B D                Platypus  =
B D                 Opossum  =
B D         Tasmanian devil  =
          Cape golden mole  =
                  Aardvark  =

Alignment block 3 of 119 in window, 49663615 - 49663617, 3 bps 
B D                   Human  gga
B D                   Chimp  gga
B D                 Gorilla  gga
B D               Orangutan  gga
B D                  Gibbon  cga
B D                  Rhesus  gga
B D     Crab-eating macaque  gga
B D            Green monkey  aga
B D                Marmoset  gaa
B D         Squirrel monkey  gga
B D                Bushbaby  gaa
         Chinese tree shrew  aca
B D                Squirrel  aga
     Lesser Egyptian jerboa  ggt
B D          Naked mole-rat  gta
B D              Guinea pig  gca
                 Chinchilla  gca
           Brush-tailed rat  gca
B D                  Rabbit  aga
B D                    Pika  gaa
B D                  Alpaca  aga
             Bactrian camel  aga
           Tibetan antelope  gga
B D                     Cow  gga
B D                   Sheep  gga
              Domestic goat  gga
B D                   Horse  gga
B D        White rhinoceros  gga
B D                     Dog  gga
B D                 Ferret   gga
             Pacific walrus  gga
           Black flying-fox  gga
B D                 Megabat  gga
              Big brown bat  gga
       David's myotis (bat)  gga
B D                Microbat  gga
            Star-nosed mole  gg-
B D                Elephant  tga
B D                 Manatee  tga
B D                  Tenrec  tga
B D               Armadillo  aga
       Cape elephant shrew  ===
B D                   Shrew  ===
B D                   Mouse  ===
              Prairie vole  ===
B D                     Rat  ===
B D         Chinese hamster  ===
            Golden hamster  ===
B D                  Baboon  ===
B D                     Pig  ===
B D                 Dolphin  ===
              Weddell seal  ===
              Killer whale  ===
B D                   Panda  ===
B D                     Cat  ===
B D                Platypus  ===
B D                 Opossum  ===
B D         Tasmanian devil  ===
          Cape golden mole  ===
                  Aardvark  ===

Inserts between block 3 and 4 in window
B D                 Alpaca 1bp
            Bactrian camel 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Dog 1bp
B D                Ferret  1bp
            Pacific walrus 1bp

Alignment block 4 of 119 in window, 49663618 - 49663618, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  c
B D                  Gibbon  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D            Green monkey  c
B D                Marmoset  t
B D         Squirrel monkey  c
         Chinese tree shrew  c
B D                Squirrel  g
     Lesser Egyptian jerboa  g
B D          Naked mole-rat  g
B D              Guinea pig  g
                 Chinchilla  g
           Brush-tailed rat  g
B D                  Rabbit  a
B D                    Pika  a
           Black flying-fox  a
B D                 Megabat  a
              Big brown bat  g
       David's myotis (bat)  g
B D                Microbat  g
B D                Elephant  g
B D                 Manatee  g
B D                  Tenrec  c
B D               Armadillo  g
           Star-nosed mole  -
       Cape elephant shrew  =
B D                   Shrew  =
B D                   Mouse  =
              Prairie vole  =
B D                     Rat  =
B D         Chinese hamster  =
            Golden hamster  =
B D                  Baboon  =
B D                     Pig  =
B D                 Dolphin  =
              Weddell seal  =
              Killer whale  =
B D                   Panda  =
B D                     Cow  =
             Domestic goat  =
B D                   Sheep  =
          Tibetan antelope  =
B D        White rhinoceros  =
B D                   Horse  =
            Bactrian camel  =
B D                  Alpaca  =
B D                     Dog  =
B D                 Ferret   =
B D                     Cat  =
            Pacific walrus  =
B D                Platypus  =
B D                 Opossum  =
B D         Tasmanian devil  =
          Cape golden mole  =
                  Aardvark  =
B D                Bushbaby  -

Alignment block 5 of 119 in window, 49663619 - 49663619, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
         Chinese tree shrew  a
B D                Squirrel  g
     Lesser Egyptian jerboa  a
B D          Naked mole-rat  a
B D              Guinea pig  a
                 Chinchilla  a
           Brush-tailed rat  a
B D                  Rabbit  a
B D                    Pika  a
B D                  Alpaca  a
             Bactrian camel  a
           Tibetan antelope  a
B D                     Cow  a
B D                   Sheep  a
              Domestic goat  a
B D                   Horse  a
B D        White rhinoceros  a
B D                     Cat  a
B D                     Dog  a
B D                 Ferret   a
             Pacific walrus  a
           Black flying-fox  a
B D                 Megabat  a
              Big brown bat  a
       David's myotis (bat)  a
B D                Microbat  a
B D                Elephant  a
B D                 Manatee  a
B D                  Tenrec  a
B D               Armadillo  g
           Star-nosed mole  -
       Cape elephant shrew  =
B D                   Shrew  =
B D                   Mouse  =
              Prairie vole  =
B D                     Rat  =
B D         Chinese hamster  =
            Golden hamster  =
B D                     Pig  =
B D                 Dolphin  =
              Weddell seal  =
              Killer whale  =
B D                   Panda  =
B D                Platypus  =
B D                 Opossum  =
B D         Tasmanian devil  =
          Cape golden mole  =
                  Aardvark  =
B D                Bushbaby  -

Inserts between block 5 and 6 in window
B D                 Baboon 58bp
        Chinese tree shrew 4bp

Alignment block 6 of 119 in window, 49663620 - 49663665, 46 bps 
B D                   Human  ggaa-c-aaggta--tgat-----------cagagtgtagatgaaa--tatgaagaaattaga
B D                   Chimp  ggaa-c-aaggta--tgat-----------cagagtgtagatgaaa--tgtgaagaaattaga
B D                 Gorilla  ggaa-c-aaggta--tgat-----------cagagtgtagatgaaa--tgtgaagaaattaga
B D               Orangutan  gaaa-c-aaggta--tgat-----------cagagtgtagatgaaa--tgtgaagaaattaga
B D                  Gibbon  ggaa-c-aaggta--tgat-----------cacagtgtagatgaaa--tgtgaagaaattaga
B D                  Rhesus  ggaa-c-aaggta--tgat-----------cagagtgtagatgaaa--tgtgaagaaattgga
B D     Crab-eating macaque  ggaa-c-aaggta--tgat-----------cagagtgtagatgaaa--tgtgaagaaattgga
B D            Green monkey  ggaa-c-aaggta--tgat-----------cagagtgtagatgaaa--tgtgaagaaattgga
B D                Marmoset  ggat-a-aaggtg--cgat-----------cagagtatagatgaaa--tgtggagatgccgga
B D         Squirrel monkey  gaaa-a-aaggtg--tgat-----------cacagtatagttgaaa--tgtggagaaattgga
B D                Bushbaby  agaa-t-gaggtg--tgat-----------tagtgtgtaggtgaaa--tgtgaggaaatttgt
         Chinese tree shrew  agag-c-aaggtg--tcat-----------tagagaataggtaaaatgtgtgaagatatttga
B D                Squirrel  ggaa-a-ttgcca--tgat-----------tcaagtgtaagtgaag--tatgaaggtatttga
     Lesser Egyptian jerboa  ggaa-a--aactg--tgat-----------ttgagtgtaggggaaa--tgtgaa---------
B D          Naked mole-rat  ggaa-a-atagta--ttat-----------taaagtgtagtttaca--tgagaagaaattt--
B D              Guinea pig  gcaa-a-acagta--tgat-----------tcaaatgtagtttaaa--tgagaa-aaattc--
                 Chinchilla  acag-a-acagta--tgat-----------tcaagtgtagttgaaa--tgagaagaaattt--
           Brush-tailed rat  gtaaca-acagtg--tgat-----------ccaagtatagttgaaa--tgaaaagaaattg--
B D                  Rabbit  ggaa-g-aag--g--tgat-------attagagagtgtacatgaag--tatgaagaaatttga
B D                    Pika  ggaa-c-aaggtg--tgatgagagtgattagaaattgtaggtgaaa--taaaaagacatttga
B D                  Alpaca  ggag-c-caggtg--tgat-----------tagagtgtaggtgaaa--tctgaagaaatttaa
             Bactrian camel  ggag-c-caggtg--tgat-----------tagagtgtaggtgaaa--tccgaagaaatttga
           Tibetan antelope  ggaa-c-aaggtg--tgat-----------tagagagtaggtgaga--tgtgaagaaatgtga
B D                     Cow  ggaa-t-aaggtg--tgat-----------tagagagtaggtgaga--tgtgaagaaatttga
B D                   Sheep  ggaa-c-aaggtg--tgat-----------tagggagtaggtgaga--tgtgaagaaatgtgg
              Domestic goat  ggaa-c-aaggtg--tgat-----------tagggagtaggtgaga--tgtgaagaaatgtga
B D                   Horse  ggaa-c-aggttg--tgat-----------cagagtgtaggtgaaa--tgtgaagaaatttga
B D        White rhinoceros  ggaa-t-aaggtg--tgat-----------tagagtgtaggtgaac--tgtgaagaaatttga
B D                     Cat  ggaa-c-aagaga--tgat-----------tcgagcgtaggtcaaa--tgtaaagaaatttga
B D                     Dog  ggaa-c-aaggga--tgat-----------tagaaaataggtgaaa--agtaaagaaatatga
B D                 Ferret   ggaa-c--agaga--ttat-----------tagagcacagggaaaa--tgtaaagaaacttga
             Pacific walrus  ggaa-c-aaggga--tggt-----------tagagtataggtgaaa--tgtaaagaaatttga
           Black flying-fox  ggaa-caaaggct--tgat-----------tagagtgtaggtgaaa--tgagaagaaatttga
B D                 Megabat  ggaa-caaaggct--tgat-----------tagagtgtaggtgaaa--tgagaagaaatttga
              Big brown bat  gaaa-taaaggtg--tgat-----------tagagtgtaggtgaaa--tgtgaaggaatttga
       David's myotis (bat)  gaaa-caaaggtt--ta--------------aaagtgtaggtgaaa--tgtgaaggattttga
B D                Microbat  gaaa-caaaggtt--ta--------------aaagtgtaggtgaaa--tgtgaaggattttga
            Star-nosed mole  -------gaggtc--tgat-----------ttgagtatacctaaaa--tactaatgaatttaa
B D                Elephant  ggaa-c-aaggtgtaggat-----------gaaagtgtaggtaaag--tattaagaaatctta
B D                 Manatee  ggaa-ctaaggtgtagtat-----------taaagtgtaggtaaag--tattaagaaatttga
B D                  Tenrec  ggaa-c-aaggtg--atat-----------tcaagtgtaggtatga--ttttatgaaatttga
B D               Armadillo  ggaa-c-aagatg--tgat-----------tagattgtagatgaaa--tatgaagatagttga
       Cape elephant shrew  ===============================================================
B D                   Shrew  ===============================================================
B D                   Mouse  ===============================================================
              Prairie vole  ===============================================================
B D                     Rat  ===============================================================
B D         Chinese hamster  ===============================================================
            Golden hamster  ===============================================================
B D                  Baboon  ===============================================================
B D                     Pig  ===============================================================
B D                 Dolphin  ===============================================================
              Weddell seal  ===============================================================
              Killer whale  ===============================================================
B D                   Panda  ===============================================================
B D                Platypus  ===============================================================
B D                 Opossum  ===============================================================
B D         Tasmanian devil  ===============================================================
          Cape golden mole  ===============================================================
                  Aardvark  ===============================================================

Alignment block 7 of 119 in window, 49663666 - 49663666, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D            Green monkey  t
B D                Marmoset  g
B D         Squirrel monkey  t
B D                Bushbaby  t
         Chinese tree shrew  t
B D                Squirrel  t
B D                  Rabbit  t
B D                    Pika  t
B D                  Alpaca  t
             Bactrian camel  t
           Tibetan antelope  t
B D                     Cow  t
B D                   Sheep  t
              Domestic goat  t
B D                   Horse  t
B D        White rhinoceros  t
B D                     Cat  t
B D                     Dog  t
B D                 Ferret   t
             Pacific walrus  t
           Black flying-fox  t
B D                 Megabat  t
              Big brown bat  t
       David's myotis (bat)  t
B D                Microbat  t
            Star-nosed mole  c
B D                Elephant  t
B D                 Manatee  t
B D                  Tenrec  t
                   Aardvark  t
B D               Armadillo  t
       Cape elephant shrew  =
B D                   Shrew  =
B D                   Mouse  =
              Prairie vole  =
B D                     Rat  =
B D         Chinese hamster  =
            Golden hamster  =
    Lesser Egyptian jerboa  -
          Brush-tailed rat  -
                Chinchilla  -
B D              Guinea pig  -
B D                  Baboon  =
B D                     Pig  =
B D                 Dolphin  =
              Weddell seal  =
              Killer whale  =
B D                   Panda  =
B D          Naked mole-rat  -
B D                Platypus  =
B D                 Opossum  =
B D         Tasmanian devil  =
B D                 Gorilla  -
          Cape golden mole  =

Inserts between block 7 and 8 in window
                  Aardvark 3168bp

Alignment block 8 of 119 in window, 49663667 - 49663673, 7 bps 
B D                   Human  ag--aaaaa
B D                   Chimp  ag--aaaaa
B D                 Gorilla  ----aaaaa
B D               Orangutan  ag--aaaaa
B D                  Gibbon  ----aaaaa
B D                  Rhesus  ag--aaaaa
B D     Crab-eating macaque  ag--aaaaa
B D            Green monkey  ag--aaaaa
B D                Marmoset  ag--aaaaa
B D         Squirrel monkey  ag---aaaa
B D                Bushbaby  at--aaaaa
         Chinese tree shrew  ag--aaaaa
B D                Squirrel  gag-aaaaa
     Lesser Egyptian jerboa  ----aaaaa
B D          Naked mole-rat  ----gtaaa
B D              Guinea pig  ----ataaa
                 Chinchilla  ----gtaga
           Brush-tailed rat  ----gtaaa
B D                  Rabbit  ----gcaaa
B D                    Pika  ----gaaaa
B D                  Alpaca  ag--aaaga
             Bactrian camel  ag--aaaga
           Tibetan antelope  ag--aaaga
B D                     Cow  ag--aaaga
B D                   Sheep  ag--aaaga
              Domestic goat  ag--aaaga
B D                   Horse  ag--gatga
B D        White rhinoceros  ag--aatga
B D                     Cat  ag--gaaga
B D                     Dog  ag--gaaga
B D                 Ferret   ag--gaaga
             Pacific walrus  ag--gaagg
           Black flying-fox  ag--aaaga
B D                 Megabat  ag--aaaga
              Big brown bat  ag--aaaga
       David's myotis (bat)  ag--aaaga
B D                Microbat  ag--aaaga
            Star-nosed mole  ag--aaaaa
B D                Elephant  --ttaaaaa
B D                 Manatee  --tt-aaaa
B D                  Tenrec  --tttaaaa
B D               Armadillo  ----agaaa
       Cape elephant shrew  =========
B D                   Shrew  =========
B D                   Mouse  =========
              Prairie vole  =========
B D                     Rat  =========
B D         Chinese hamster  =========
            Golden hamster  =========
B D                  Baboon  =========
B D                     Pig  =========
B D                 Dolphin  =========
              Weddell seal  =========
              Killer whale  =========
B D                   Panda  =========
B D                Platypus  =========
B D                 Opossum  =========
B D         Tasmanian devil  =========
          Cape golden mole  =========
                  Aardvark  =========

Alignment block 9 of 119 in window, 49663674 - 49663674, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D                Bushbaby  a
         Chinese tree shrew  t
B D                Squirrel  a
     Lesser Egyptian jerboa  a
B D          Naked mole-rat  a
B D              Guinea pig  a
                 Chinchilla  a
           Brush-tailed rat  a
B D                  Rabbit  a
B D                    Pika  a
B D                   Horse  a
B D        White rhinoceros  a
B D                     Cat  a
B D                     Dog  a
B D                 Ferret   a
             Pacific walrus  a
           Black flying-fox  a
B D                 Megabat  a
              Big brown bat  g
       David's myotis (bat)  g
B D                Microbat  g
            Star-nosed mole  g
B D                Elephant  a
B D                 Manatee  a
B D                  Tenrec  a
B D               Armadillo  a
       Cape elephant shrew  =
B D                   Shrew  =
B D                   Mouse  =
              Prairie vole  =
B D                     Rat  =
B D         Chinese hamster  =
            Golden hamster  =
B D                  Baboon  =
B D                     Pig  =
B D                 Dolphin  =
              Weddell seal  =
              Killer whale  =
B D                   Panda  =
B D                     Cow  -
             Domestic goat  -
B D                   Sheep  -
          Tibetan antelope  -
            Bactrian camel  -
B D                  Alpaca  -
B D                Platypus  =
B D                 Opossum  =
B D         Tasmanian devil  =
          Cape golden mole  =
                  Aardvark  =

Inserts between block 9 and 10 in window
B D                 Rabbit 1bp
B D                  Horse 3bp
B D       White rhinoceros 3bp
B D                    Cat 1bp
B D                    Dog 2bp
B D                Ferret  1bp
            Pacific walrus 1bp
          Black flying-fox 3bp
B D                Megabat 3bp
             Big brown bat 3bp
      David's myotis (bat) 3bp
B D               Microbat 3bp

Alignment block 10 of 119 in window, 49663675 - 49663675, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D                Bushbaby  a
         Chinese tree shrew  g
B D                Squirrel  a
     Lesser Egyptian jerboa  a
B D          Naked mole-rat  a
B D              Guinea pig  a
                 Chinchilla  a
           Brush-tailed rat  a
B D                  Rabbit  a
B D                    Pika  a
B D                     Pig  a
B D                  Alpaca  a
             Bactrian camel  a
           Tibetan antelope  a
B D                     Cow  a
B D                   Sheep  a
              Domestic goat  a
            Star-nosed mole  g
B D                Elephant  a
B D                 Manatee  a
B D                  Tenrec  g
B D               Armadillo  a
       Cape elephant shrew  =
B D                   Shrew  =
B D                   Mouse  =
              Prairie vole  =
B D                     Rat  =
B D         Chinese hamster  =
            Golden hamster  =
          Black flying-fox  =
B D                  Baboon  =
B D                 Dolphin  =
              Weddell seal  =
B D                 Megabat  =
              Killer whale  =
B D                   Panda  =
             Big brown bat  =
B D                Microbat  =
      David's myotis (bat)  =
B D        White rhinoceros  =
B D                   Horse  =
B D                     Dog  =
B D                 Ferret   =
B D                     Cat  =
            Pacific walrus  =
B D                Platypus  =
B D                 Opossum  =
B D         Tasmanian devil  =
          Cape golden mole  =
                  Aardvark  =

Inserts between block 10 and 11 in window
B D                 Rhesus 2bp
B D    Crab-eating macaque 2bp
B D           Green monkey 2bp
B D               Marmoset 2bp
B D        Squirrel monkey 2bp
B D               Bushbaby 1bp
        Chinese tree shrew 1bp
B D               Squirrel 2bp
    Lesser Egyptian jerboa 11bp
B D         Naked mole-rat 2bp
B D             Guinea pig 2bp
                Chinchilla 2bp
          Brush-tailed rat 3bp
B D                 Rabbit 3bp
B D                   Pika 3bp
B D                    Pig 274bp
B D                 Alpaca 3bp
            Bactrian camel 3bp
          Tibetan antelope 3bp
B D                    Cow 3bp
B D                  Sheep 3bp
             Domestic goat 3bp
           Star-nosed mole 2bp

Alignment block 11 of 119 in window, 49663676 - 49663676, 1 bps 
B D                   Human  -a
B D               Orangutan  -a
B D                  Rhesus  -a
B D     Crab-eating macaque  -a
B D                  Baboon  -a
B D            Green monkey  -a
B D                Marmoset  -a
B D         Squirrel monkey  -a
         Chinese tree shrew  -a
B D                Squirrel  -a
     Lesser Egyptian jerboa  -a
B D          Naked mole-rat  -a
B D              Guinea pig  -a
                 Chinchilla  -a
           Brush-tailed rat  -a
B D                  Rabbit  -a
B D                    Pika  -a
B D                  Alpaca  -a
             Bactrian camel  -a
           Tibetan antelope  -a
B D                     Cow  -a
B D                   Sheep  -a
              Domestic goat  -a
B D                   Horse  -a
B D        White rhinoceros  -a
B D                     Cat  -a
B D                     Dog  -a
B D                 Ferret   -a
             Pacific walrus  -a
               Weddell seal  -a
           Black flying-fox  -a
B D                 Megabat  -a
              Big brown bat  -a
       David's myotis (bat)  -a
B D                Microbat  -a
B D                Elephant  t-
B D                 Manatee  t-
B D                  Tenrec  c-
B D               Armadillo  t-
           Star-nosed mole  ==
       Cape elephant shrew  ==
B D                   Shrew  ==
B D                   Mouse  ==
              Prairie vole  ==
B D                     Rat  ==
B D         Chinese hamster  ==
            Golden hamster  ==
B D                     Pig  ==
B D                 Dolphin  ==
              Killer whale  ==
B D                   Panda  ==
B D                Platypus  ==
B D                 Opossum  ==
B D         Tasmanian devil  ==
B D                 Gorilla  --
          Cape golden mole  ==
                  Aardvark  ==
B D                Bushbaby  ==
B D                  Gibbon  --
B D                   Chimp  --

Inserts between block 11 and 12 in window
B D                 Baboon 629bp
B D                 Alpaca 3bp
            Bactrian camel 3bp
          Tibetan antelope 3bp
B D                    Cow 3bp
B D                  Sheep 3bp
             Domestic goat 3bp
B D                  Horse 3bp
B D       White rhinoceros 3bp
B D                    Cat 5bp
B D                    Dog 3bp
B D                Ferret  5bp
            Pacific walrus 4bp
              Weddell seal 1011bp
          Black flying-fox 3bp
B D                Megabat 3bp
             Big brown bat 3bp
      David's myotis (bat) 3bp
B D               Microbat 3bp

Alignment block 12 of 119 in window, 49663677 - 49663679, 3 bps 
B D                   Human  gca
B D                   Chimp  gca
B D                 Gorilla  gca
B D               Orangutan  gca
B D                  Gibbon  gca
B D                  Rhesus  gca
B D     Crab-eating macaque  gca
B D            Green monkey  gca
B D                Marmoset  gca
B D         Squirrel monkey  gca
B D                Bushbaby  aca
         Chinese tree shrew  gtc
B D                Squirrel  tat
     Lesser Egyptian jerboa  tat
B D          Naked mole-rat  gat
B D              Guinea pig  aat
                 Chinchilla  gat
           Brush-tailed rat  gat
B D                  Rabbit  ggc
B D                    Pika  gac
B D                Elephant  aca
B D                 Manatee  ata
B D                  Tenrec  ata
B D               Armadillo  ata
           Star-nosed mole  ===
       Cape elephant shrew  ===
B D                   Shrew  ===
B D                   Mouse  ===
              Prairie vole  ===
B D                     Rat  ===
B D         Chinese hamster  ===
            Golden hamster  ===
          Black flying-fox  ===
B D                  Baboon  ===
B D                     Pig  ===
B D                 Dolphin  ===
              Weddell seal  ===
B D                 Megabat  ===
              Killer whale  ===
B D                   Panda  ===
             Big brown bat  ===
B D                     Cow  ===
             Domestic goat  ===
B D                   Sheep  ===
          Tibetan antelope  ===
B D                Microbat  ===
      David's myotis (bat)  ===
B D        White rhinoceros  ===
B D                   Horse  ===
            Bactrian camel  ===
B D                  Alpaca  ===
B D                     Dog  ===
B D                 Ferret   ===
B D                     Cat  ===
            Pacific walrus  ===
B D                Platypus  ===
B D                 Opossum  ===
B D         Tasmanian devil  ===
          Cape golden mole  ===
                  Aardvark  ===

Inserts between block 12 and 13 in window
    Lesser Egyptian jerboa 3bp
B D               Elephant 227bp
B D                Manatee 2bp
B D                 Tenrec 4bp
B D              Armadillo 4bp

Alignment block 13 of 119 in window, 49663680 - 49663681, 2 bps 
B D                   Human  tt-
B D                   Chimp  tt-
B D                 Gorilla  tt-
B D               Orangutan  tt-
B D                  Gibbon  tt-
B D                  Rhesus  tt-
B D     Crab-eating macaque  tt-
B D            Green monkey  tt-
B D                Marmoset  tt-
B D         Squirrel monkey  tt-
B D                Bushbaby  gc-
         Chinese tree shrew  at-
B D                Squirrel  at-
     Lesser Egyptian jerboa  at-
B D          Naked mole-rat  at-
B D              Guinea pig  at-
                 Chinchilla  at-
           Brush-tailed rat  ac-
B D                  Rabbit  gc-
B D                    Pika  ac-
B D                  Alpaca  tt-
             Bactrian camel  tt-
           Tibetan antelope  tt-
B D                     Cow  tt-
B D                   Sheep  tt-
              Domestic goat  tt-
B D                   Horse  at-
B D        White rhinoceros  at-
B D                     Cat  at-
B D                     Dog  at-
B D                 Ferret   at-
             Pacific walrus  at-
           Black flying-fox  at-
B D                 Megabat  at-
              Big brown bat  at-
       David's myotis (bat)  at-
B D                Microbat  at-
            Star-nosed mole  aa-
B D                Elephant  -tt
B D                 Manatee  -tg
B D                  Tenrec  -tt
                   Aardvark  -tt
B D               Armadillo  -t-
       Cape elephant shrew  ===
B D                   Shrew  ===
B D                   Mouse  ===
              Prairie vole  ===
B D                     Rat  ===
B D         Chinese hamster  ===
            Golden hamster  ===
B D                  Baboon  ===
B D                     Pig  ===
B D                 Dolphin  ===
              Weddell seal  ===
              Killer whale  ===
B D                   Panda  ===
B D                Platypus  ===
B D                 Opossum  ===
B D         Tasmanian devil  ===
          Cape golden mole  ===

Inserts between block 13 and 14 in window
B D               Bushbaby 2bp
                  Aardvark 300bp

Alignment block 14 of 119 in window, 49663682 - 49663682, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D            Green monkey  t
B D                Marmoset  t
B D         Squirrel monkey  t
B D                Bushbaby  t
         Chinese tree shrew  t
B D                Squirrel  t
     Lesser Egyptian jerboa  t
B D          Naked mole-rat  t
B D              Guinea pig  t
                 Chinchilla  t
           Brush-tailed rat  t
B D                  Rabbit  t
B D                    Pika  t
B D                  Alpaca  t
             Bactrian camel  t
           Tibetan antelope  t
B D                     Cow  t
B D                   Sheep  t
              Domestic goat  t
B D                   Horse  t
B D        White rhinoceros  t
B D                     Cat  t
B D                     Dog  t
B D                 Ferret   t
             Pacific walrus  t
           Black flying-fox  t
B D                 Megabat  t
              Big brown bat  t
       David's myotis (bat)  t
B D                Microbat  t
            Star-nosed mole  t
B D                Elephant  t
B D                 Manatee  t
B D                  Tenrec  t
B D               Armadillo  t
       Cape elephant shrew  =
B D                   Shrew  =
B D                   Mouse  =
              Prairie vole  =
B D                     Rat  =
B D         Chinese hamster  =
            Golden hamster  =
B D                  Baboon  =
B D                     Pig  =
B D                 Dolphin  =
              Weddell seal  =
              Killer whale  =
B D                   Panda  =
B D                Platypus  =
B D                 Opossum  =
B D         Tasmanian devil  =
          Cape golden mole  =
                  Aardvark  =

Inserts between block 14 and 15 in window
B D                 Tenrec 221bp

Alignment block 15 of 119 in window, 49663683 - 49663698, 16 bps 
B D                   Human  taagc----taacgaagaag
B D                   Chimp  taagc----taacaaagaag
B D                 Gorilla  taagc----taacgaagaag
B D               Orangutan  taagc----taacgaagaag
B D                  Gibbon  taagc----taacgaagaag
B D                  Rhesus  taagc----taatgaagaag
B D     Crab-eating macaque  taagc----taatgaagaag
B D            Green monkey  taagc----taatgtagaag
B D                Marmoset  taagc----taatgaagaag
B D         Squirrel monkey  taagc----taatgaaaaag
B D                Bushbaby  taagc----taatgaaggaa
         Chinese tree shrew  taagc----taatgtgaaag
B D                Squirrel  taagc----aaatgaagaag
     Lesser Egyptian jerboa  taaac----gaat---gcag
B D          Naked mole-rat  taagcttagaaat-----ac
B D              Guinea pig  taagctcagaaat-----ac
                 Chinchilla  taaacttagaaat-----ac
           Brush-tailed rat  taagattagaaat-----ac
B D                  Rabbit  taagc----aaataaaaaa-
B D                    Pika  taagc----aaatgaaggac
B D                  Alpaca  taagc----taatgaagaag
             Bactrian camel  taagc----taaaaaagaag
           Tibetan antelope  taaac----taac---aaag
B D                     Cow  taaac----taat---gaag
B D                   Sheep  taaac----taat---ggag
              Domestic goat  taaac----taat---gaag
B D                   Horse  taagc----taatgaagaag
B D        White rhinoceros  taagc----taatgaaaaag
B D                     Cat  ggcgc----taatgaagaag
B D                     Dog  aaagc----taatggagaag
B D                 Ferret   aaagc----taatgaaccag
             Pacific walrus  aaagc----taatgaagcag
           Black flying-fox  taagc----taatga---ag
B D                 Megabat  taagc----taatga---ag
              Big brown bat  taagc----taatgaagtag
       David's myotis (bat)  taagc----taatgaagtag
B D                Microbat  tacgc----taatgaagtag
            Star-nosed mole  taagt----taat---gtat
B D                Elephant  taagc----aaatgaagaag
B D                 Manatee  taagc----tcatgaagagg
B D                  Tenrec  taggc----taatgaagaag
B D               Armadillo  tacgc----taaagaggaag
       Cape elephant shrew  ====================
B D                   Shrew  ====================
B D                   Mouse  ====================
              Prairie vole  ====================
B D                     Rat  ====================
B D         Chinese hamster  ====================
            Golden hamster  ====================
B D                  Baboon  ====================
B D                     Pig  ====================
B D                 Dolphin  ====================
              Weddell seal  ====================
              Killer whale  ====================
B D                   Panda  ====================
B D                Platypus  ====================
B D                 Opossum  ====================
B D         Tasmanian devil  ====================
          Cape golden mole  ====================
                  Aardvark  ====================

Inserts between block 15 and 16 in window
B D                Manatee 2283bp

Alignment block 16 of 119 in window, 49663699 - 49663710, 12 bps 
B D                   Human  ttgagagtggag
B D                   Chimp  ttgaaagtggag
B D                 Gorilla  ttgagagtggag
B D               Orangutan  ttgagagtggag
B D                  Gibbon  ttaagagtgggg
B D                  Rhesus  ttaagaatggag
B D     Crab-eating macaque  ttaagaatggag
B D            Green monkey  ttaagagtggag
B D                Marmoset  ttgagagtggag
B D         Squirrel monkey  ttgagagtgtag
B D                Bushbaby  aggagggtggag
         Chinese tree shrew  ttgaaggtggag
B D                Squirrel  ttaaaggt-aga
     Lesser Egyptian jerboa  ttgtagttgagc
B D          Naked mole-rat  ttgaaggcagag
B D              Guinea pig  ttgaagac--ag
                 Chinchilla  ttgaagactgag
           Brush-tailed rat  tt----------
B D                  Rabbit  ttgaaggtagag
B D                    Pika  ttgaagatagag
B D                  Alpaca  ttgaggttagat
             Bactrian camel  ttgaaggtagat
           Tibetan antelope  ttgcggggagat
B D                     Cow  ttgtggggagag
B D                   Sheep  ttgcggggagag
              Domestic goat  ttgcggggagag
B D                   Horse  ttgagggaggag
B D        White rhinoceros  ttgagggtggag
B D                     Cat  tggatggtggag
B D                     Dog  tggagggtggag
B D                 Ferret   tagagggtggag
             Pacific walrus  tggagggtggag
           Black flying-fox  ttgagcgtagag
B D                 Megabat  ttgagcgtagag
              Big brown bat  ttgaatgtgggg
       David's myotis (bat)  ttgaatgtgggg
B D                Microbat  ttgaatgtgggg
            Star-nosed mole  tttagagtggaa
B D                Elephant  ttgagggttgaa
B D                  Tenrec  ttgaagatggaa
B D               Armadillo  ttgaaagaggtg
       Cape elephant shrew  ============
B D                   Shrew  ============
B D                   Mouse  ============
              Prairie vole  ============
B D                     Rat  ============
B D         Chinese hamster  ============
            Golden hamster  ============
B D                  Baboon  ============
B D                     Pig  ============
B D                 Dolphin  ============
              Weddell seal  ============
              Killer whale  ============
B D                   Panda  ============
B D                 Manatee  ============
B D                Platypus  ============
B D                 Opossum  ============
B D         Tasmanian devil  ============
          Cape golden mole  ============
                  Aardvark  ============

Alignment block 17 of 119 in window, 49663711 - 49663739, 29 bps 
B D                   Human  aaataa-atatggcaaatt-----attt------------------------------------------
B D                   Chimp  aaataa-atatggcaaatt-----attt------------------------------------------
B D                 Gorilla  aaataa-atatggcaaatt-----attt------------------------------------------
B D               Orangutan  aaataa-atatggcaaatt-----attt------------------------------------------
B D                  Gibbon  aaataa-atatggcaaatt-----attt------------------------------------------
B D                  Rhesus  aaataa-atatgaaaaatt-----attt------------------------------------------
B D     Crab-eating macaque  aaataa-atatgaaaaatt-----attt------------------------------------------
B D            Green monkey  aaataa-atgtgaaaaatt-----attt------------------------------------------
B D                Marmoset  aaatga-atgtggcaaatt-----attt------------------------------------------
B D         Squirrel monkey  aaacaa-atgcagcaaatt-----attt------------------------------------------
B D                Bushbaby  aaagaa-atgaagtaaatt-----attt------------------------------------------
         Chinese tree shrew  gaagaa-atgaacacaatt-----agtt------------------------------------------
B D                Squirrel  aa-aaa-atgtgacaaa-g-----tatt------------------------------------------
     Lesser Egyptian jerboa  aa-gaa-atgtagcaa--------tttt------------------------------------------
B D          Naked mole-rat  aa-gag-gtgtggcaaatt-----aact------------------------------------------
B D              Guinea pig  aa-aaa-ctgtgtcaaatt-----aact------------------------------------------
                 Chinchilla  aa-aaa-gtgatgcaaatt-----aact------------------------------------------
           Brush-tailed rat  ---------------------------t------------------------------------------
B D                  Rabbit  aaggaa-atgtgacaaatt-----actt------------------------------------------
B D                    Pika  aagaaa-atgtgacaaatt-----actt------------------------------------------
B D                  Alpaca  gaagaa-gtgtggcaaatt-----attt------------------------------------------
             Bactrian camel  gaagaa-gtgcggcaaatt-----attt------------------------------------------
           Tibetan antelope  gaagaa-gagtggcagata-----attt------------------------------------------
B D                     Cow  gaggaa-gagtggcagata-----attt------------------------------------------
B D                   Sheep  gaagaa-gagtggcagata-----attt------------------------------------------
              Domestic goat  gaagaa-gagtggcagata-----attt------------------------------------------
B D                   Horse  gaagaa-atgcggcaaatt-----attt------------------------------------------
B D        White rhinoceros  gaagaa-atgtggcaaatt-----attt------------------------------------------
B D                     Cat  gaagaa-atgtagcagatt-----atacatatatataacatatatatatgttacatatatatgtatatat
B D                     Dog  ggagaa-atgtggcagatt-----gtgt------------------------------------------
B D                 Ferret   gaagag-atgtggcagatt-----atat------------------------------------------
             Pacific walrus  gaagag-atgtggcagatt-----attt------------------------------------------
           Black flying-fox  aaaaaagatgtggcaaatt-----a-gt------------------------------------------
B D                 Megabat  aaaaaagatgtggcaaatt-----a-gt------------------------------------------
              Big brown bat  gaagaa-atgtggcaaagt-----a-gt------------------------------------------
       David's myotis (bat)  gaagaa-atgtggcaaagt-----a-gt------------------------------------------
B D                Microbat  gaagaa-atgtggcaaagt-----a-gt------------------------------------------
B D                   Shrew  -aaata-aatttaaaaaacccataa-tt------------------------------------------
            Star-nosed mole  -gaaaa-atgttgcaaaat-----a-gt------------------------------------------
B D                Elephant  ggagaa-atgtgacaaatt-----a-tt------------------------------------------
B D                  Tenrec  gaagaa-agaggtccacat-----t-tt------------------------------------------
B D               Armadillo  aagaaa-atgggacaattt-----t-tt------------------------------------------
       Cape elephant shrew  ======================================================================
B D                   Mouse  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
B D         Chinese hamster  ======================================================================
            Golden hamster  ======================================================================
B D                  Baboon  ======================================================================
B D                     Pig  ======================================================================
B D                 Dolphin  ======================================================================
              Weddell seal  ======================================================================
              Killer whale  ======================================================================
B D                   Panda  ======================================================================
B D                 Manatee  ======================================================================
B D                Platypus  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================

                      Human  -------------------tctgtat--
                      Chimp  -------------------tctgtac--
                    Gorilla  -------------------tctgtat--
                  Orangutan  -------------------tctgtat--
                     Gibbon  -------------------tctgtat--
                     Rhesus  -------------------tctgtat--
        Crab-eating macaque  -------------------tctgtat--
               Green monkey  -------------------tctgtat--
                   Marmoset  -------------------tctgtgt--
            Squirrel monkey  -------------------tctgtgt--
                   Bushbaby  -------------------ta-atat--
         Chinese tree shrew  -------------------tttatat--
                   Squirrel  -------------------ttaacat--
     Lesser Egyptian jerboa  -------------------tttatat--
             Naked mole-rat  -------------------ttcacat--
                 Guinea pig  -------------------ttcatac--
                 Chinchilla  -------------------ttcacat--
           Brush-tailed rat  -------------------tttgtat--
                     Rabbit  -------------------tttatgt--
                       Pika  -------------------ttaacat--
                     Alpaca  --------------------ttatat--
             Bactrian camel  --------------------ttatat--
           Tibetan antelope  -------------------cttatgt--
                        Cow  -------------------cttatgt--
                      Sheep  -------------------cttatgt--
              Domestic goat  -------------------cttatgt--
                      Horse  -------------------tttacgt--
           White rhinoceros  -------------------tttacat--
                        Cat  atattacaatatatatatacatatat--
                        Dog  -------------------tttacat--
                    Ferret   -------------------tgtacat--
             Pacific walrus  -------------------cttacat--
           Black flying-fox  -------------------tttacat--
                    Megabat  -------------------tttacat--
              Big brown bat  -------------------tttacat--
       David's myotis (bat)  -------------------tttacat--
                   Microbat  -------------------tttacat--
                      Shrew  -------------------ttaatat--
            Star-nosed mole  -------------------ttaacat--
                   Elephant  -------------------tttttgcat
                     Tenrec  -------------------gttttgcat
                  Armadillo  -------------------tgtgtgt--
        Cape elephant shrew  ============================
                      Mouse  ============================
               Prairie vole  ============================
                        Rat  ============================
            Chinese hamster  ============================
             Golden hamster  ============================
                     Baboon  ============================
                        Pig  ============================
                    Dolphin  ============================
               Weddell seal  ============================
               Killer whale  ============================
                      Panda  ============================
                    Manatee  ============================
                   Platypus  ============================
                    Opossum  ============================
            Tasmanian devil  ============================
           Cape golden mole  ============================
                   Aardvark  ============================

Inserts between block 17 and 18 in window
B D              Armadillo 443bp

Alignment block 18 of 119 in window, 49663740 - 49663771, 32 bps 
B D                   Human  gctgtg-gaaatgca-gat--ttt----ttg-ttaa---tttta
B D                   Chimp  gctgtg-gaaatgta-gat--ttt----ttg-ttaa---tttta
B D                 Gorilla  gctgtg-gaaatgta-gat--ttt----ttg-ttaa---tttta
B D               Orangutan  gctgtg-gaaataca-gat--ttt----ttg-ttaa---tttta
B D                  Gibbon  gctgtg-gaaatgca-gat--ttt----ttg-ttaa---tttta
B D                  Rhesus  gctgtg-gaaataca-gat-attt----ttg-ttaa---tttta
B D     Crab-eating macaque  gctgtg-gaaataca-gat-attt----ttg-ttaa---tttta
B D            Green monkey  gctgtg-gaaatgca-gat-tttt----ttg-ttaa---tttta
B D                Marmoset  -ttgtg-gaaatgcagggtttttt----ttc-ttaa---tttta
B D         Squirrel monkey  -ttgtg-gaaataca-gatttttt----ttc-ttaa---tttta
B D                Bushbaby  gtcgtg-gaaataca-gat----t----ttg-ttaa---tttta
         Chinese tree shrew  gctggg-gaaatgta-gat----------tt-ttaa---cttta
B D                Squirrel  attggg-gaaatgaaaaat---tt----ttg-ttga---ttttt
     Lesser Egyptian jerboa  tctgaa-gaaataca-------------------ga---tattt
B D          Naked mole-rat  tctgga-gaaatgga-tat---tt----ttg-ttaa---tttta
B D              Guinea pig  tctggg-aaaatgaa-tat---tt----ttg-ttaa---tttta
                 Chinchilla  tgtggg-gaaatgaa-tat---tt----ttg-ctaa---tttta
           Brush-tailed rat  tctggg-gaaatcaa-tat---tt----tta-ttaatcttttta
B D                  Rabbit  actaga-gaaatgta-gat---ct----ttg-tgtg---ttttg
B D                    Pika  gctgat-gcaatgta-gat---ct----ttt-ttat---ttcta
B D                  Alpaca  gctaagaaaaatgca-gat---at----tttaaaaa---tttta
             Bactrian camel  gctagggaaaatgca-gat---at----tttaaaaa---attta
           Tibetan antelope  gctcag-aaaatgca-gat---at----ttt-aaaa---tttta
B D                     Cow  gctcag-aaaatgca-gat---at----ttt-aaaa---tttta
B D                   Sheep  gctcag-aaaatgca-aat---at----ttt-aaaa---tttta
              Domestic goat  gctcag-aaaatgca-gat---at----ttt-aaaa---tttta
B D                   Horse  gctggg-gaaatgca-gat---tt----tta-aaaa---tttta
B D        White rhinoceros  gctggg-gaaatgca-gat---tt----tta-gaaa---ttctg
B D                     Cat  attgta-catgtaca-tat---at----ata-cac---------
B D                     Dog  gccagg-gaaatgca-gat---tt----aaa-caa---------
B D                 Ferret   gctagg-gaaacaca-gat---tt----aaa-caa---------
             Pacific walrus  gctggg-gaaatgca-gat---tt----aaa-caa---------
           Black flying-fox  gctgtc-gaactgca-gac---ttaaaattt-tta---------
B D                 Megabat  gctgtc-gaactgca-gac---ttaaaattt-tta---------
              Big brown bat  gctgag-gaaatgtg-gac---tt----ttc-ttta---tctta
       David's myotis (bat)  gctggg-gaaatgtg-gac---tt----tcc-ttaa---tctta
B D                Microbat  gctggg-gaaatgtg-gac---tt----ttc-ttaa---tctta
B D                   Shrew  tcttgg-taaatata-taa----c----tat-aaat---tcat-
            Star-nosed mole  gctagg-gaaataca-gaa---tt----taa-aaaa---taata
B D                Elephant  gctgag-ggaatac--agt---tt----ctg-ttaa---tttta
B D                  Tenrec  agtgag-gtggtac--agt---tt----ttg-ttaa---tttta
B D               Armadillo  ggtaca-gaaatgtg-aat---tt----ctg-gtaa---tttta
       Cape elephant shrew  ============================================
B D                   Mouse  ============================================
              Prairie vole  ============================================
B D                     Rat  ============================================
B D         Chinese hamster  ============================================
            Golden hamster  ============================================
B D                  Baboon  ============================================
B D                     Pig  ============================================
B D                 Dolphin  ============================================
              Weddell seal  ============================================
              Killer whale  ============================================
B D                   Panda  ============================================
B D                 Manatee  ============================================
B D                Platypus  ============================================
B D                 Opossum  ============================================
B D         Tasmanian devil  ============================================
          Cape golden mole  ============================================
                  Aardvark  ============================================

Inserts between block 18 and 19 in window
             Big brown bat 19bp
      David's myotis (bat) 235bp
B D                  Shrew 3bp
           Star-nosed mole 4bp

Alignment block 19 of 119 in window, 49663772 - 49663781, 10 bps 
B D                   Human  taa--ttacat-g
B D                   Chimp  taa--ttacat-g
B D                 Gorilla  taa--ttacat-a
B D               Orangutan  taa--ttacat-g
B D                  Gibbon  taa--ttacat-g
B D                  Rhesus  tag--ttatat-g
B D     Crab-eating macaque  tag--ttatat-g
B D            Green monkey  tag--ttatat-g
B D                Marmoset  taa--ttatat-g
B D         Squirrel monkey  taa--ttatat-g
B D                Bushbaby  taa--ttatat-a
         Chinese tree shrew  tat--gtgcac-a
B D                Squirrel  aaattatacat-a
     Lesser Egyptian jerboa  aaa--acacaa-t
B D          Naked mole-rat  taa--ttacat-t
B D              Guinea pig  taa--ttacat-g
                 Chinchilla  taa--ttacat-g
           Brush-tailed rat  taa--ttacat-a
B D                  Rabbit  taa--ttacat-g
B D                    Pika  aaa--ttatgt-g
B D                  Alpaca  taa--ttacat-a
             Bactrian camel  taa--ttacat-a
           Tibetan antelope  taa--ttatgt-a
B D                     Cow  taa--ttgcat-a
B D                   Sheep  gaa--ttatgt-a
              Domestic goat  gaa--ttatgt-a
B D                   Horse  caa--ttgtg---
B D        White rhinoceros  caa--ttaca---
B D                     Cat  -at--atatat-g
B D                     Dog  -aa--ttata---
B D                 Ferret   -aa--ttgta---
             Pacific walrus  -aa--tt------
           Black flying-fox  taa--ctacat-a
B D                 Megabat  taa--ctacat-a
              Big brown bat  taa--ttacat-g
B D                Microbat  cag--ttacta-g
B D                   Shrew  caa--ttatgt-a
            Star-nosed mole  cac--atatgt-a
B D                Elephant  taa--ttatac--
B D                  Tenrec  tat--ttatac--
B D               Armadillo  tta--atatacg-
       Cape elephant shrew  =============
B D                   Mouse  =============
              Prairie vole  =============
B D                     Rat  =============
B D         Chinese hamster  =============
            Golden hamster  =============
B D                  Baboon  =============
B D                     Pig  =============
B D                 Dolphin  =============
              Weddell seal  =============
              Killer whale  =============
B D                   Panda  =============
      David's myotis (bat)  =============
B D                 Manatee  =============
B D                Platypus  =============
B D                 Opossum  =============
B D         Tasmanian devil  =============
          Cape golden mole  =============
                  Aardvark  =============

Inserts between block 19 and 20 in window
        Chinese tree shrew 462bp
B D                 Alpaca 13bp
            Bactrian camel 13bp
B D                  Sheep 1bp
B D       White rhinoceros 5bp
B D                    Cat 21bp
B D                    Dog 4bp
B D                Ferret  4bp
            Pacific walrus 1bp
          Black flying-fox 2bp
B D                Megabat 2bp
B D               Microbat 209bp
B D                  Shrew 2bp
           Star-nosed mole 2bp

Alignment block 20 of 119 in window, 49663782 - 49663784, 3 bps 
B D                   Human  agt
B D                   Chimp  agt
B D                 Gorilla  agt
B D               Orangutan  agt
B D                  Gibbon  agt
B D                  Rhesus  agt
B D     Crab-eating macaque  agt
B D            Green monkey  agt
B D                Marmoset  agt
B D         Squirrel monkey  agc
B D                Bushbaby  tgt
B D                Squirrel  tat
     Lesser Egyptian jerboa  aat
B D          Naked mole-rat  tat
B D              Guinea pig  tgt
                 Chinchilla  tat
           Brush-tailed rat  tac
B D                  Rabbit  cat
B D                    Pika  aac
B D                Elephant  -at
B D                  Tenrec  -at
B D               Armadillo  gat
           Star-nosed mole  ===
       Cape elephant shrew  ===
B D                   Shrew  ===
B D                   Mouse  ===
              Prairie vole  ===
B D                     Rat  ===
B D         Chinese hamster  ===
            Golden hamster  ===
          Black flying-fox  ===
B D                  Baboon  ===
B D                     Pig  ===
B D                 Dolphin  ===
              Weddell seal  ===
B D                 Megabat  ===
              Killer whale  ===
B D                   Panda  ===
             Big brown bat  ---
B D                     Cow  ---
             Domestic goat  ---
B D                   Sheep  ===
          Tibetan antelope  ---
B D                Microbat  ===
      David's myotis (bat)  ===
B D                 Manatee  ===
B D        White rhinoceros  ===
B D                   Horse  ---
            Bactrian camel  ===
B D                  Alpaca  ===
        Chinese tree shrew  ===
B D                     Dog  ===
B D                 Ferret   ===
B D                     Cat  ===
            Pacific walrus  ===
B D                Platypus  ===
B D                 Opossum  ===
B D         Tasmanian devil  ===
          Cape golden mole  ===
                  Aardvark  ===

Inserts between block 20 and 21 in window
B D                   Pika 3954bp

Alignment block 21 of 119 in window, 49663785 - 49663789, 5 bps 
B D                   Human  tttat
B D                   Chimp  tttat
B D                 Gorilla  tttat
B D               Orangutan  tttat
B D                  Gibbon  tttat
B D                  Rhesus  tttat
B D     Crab-eating macaque  tttat
B D            Green monkey  tttat
B D                Marmoset  tttat
B D         Squirrel monkey  tttat
B D                Bushbaby  tttat
B D                Squirrel  tttat
     Lesser Egyptian jerboa  tttat
B D          Naked mole-rat  tttat
B D              Guinea pig  tttat
                 Chinchilla  tttat
           Brush-tailed rat  ttcat
B D                  Rabbit  tctat
B D                    Pika  tttat
B D                  Alpaca  tatat
             Bactrian camel  taaat
           Tibetan antelope  ---at
B D                     Cow  -ttat
B D                   Sheep  tatat
              Domestic goat  ---at
B D                   Horse  --tat
B D        White rhinoceros  --tat
B D                     Cat  --tat
B D                     Dog  --c--
B D                 Ferret   --cat
             Pacific walrus  --tat
           Black flying-fox  --tat
B D                 Megabat  tatat
B D                Microbat  tttat
B D                   Shrew  --tat
            Star-nosed mole  --taa
B D                Elephant  a-tgt
B D                  Tenrec  attgc
B D               Armadillo  attgt
       Cape elephant shrew  =====
B D                   Mouse  =====
              Prairie vole  =====
B D                     Rat  =====
B D         Chinese hamster  =====
            Golden hamster  =====
B D                  Baboon  =====
B D                     Pig  =====
B D                 Dolphin  =====
              Weddell seal  =====
              Killer whale  =====
B D                   Panda  =====
             Big brown bat  -----
      David's myotis (bat)  =====
B D                 Manatee  =====
        Chinese tree shrew  =====
B D                Platypus  =====
B D                 Opossum  =====
B D         Tasmanian devil  =====
          Cape golden mole  =====
                  Aardvark  =====

Inserts between block 21 and 22 in window
B D                 Alpaca 1bp
            Bactrian camel 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 3bp
B D       White rhinoceros 3bp
B D                    Cat 3bp
B D                    Dog 3bp
B D                Ferret  3bp
            Pacific walrus 3bp
          Black flying-fox 1bp
B D                Megabat 1bp
B D               Microbat 15bp
B D                  Shrew 8bp
           Star-nosed mole 16bp

Alignment block 22 of 119 in window, 49663790 - 49663793, 4 bps 
B D                   Human  tac---a
B D                   Chimp  tac---a
B D                 Gorilla  tac---g
B D               Orangutan  tat---g
B D                  Gibbon  tat---g
B D                  Rhesus  tat---g
B D     Crab-eating macaque  tat---g
B D            Green monkey  tat---g
B D                Marmoset  tgt---g
B D         Squirrel monkey  tgt---g
B D                Bushbaby  gat---a
B D                Squirrel  cat---g
     Lesser Egyptian jerboa  -gt---g
B D          Naked mole-rat  tat---a
B D              Guinea pig  tat---a
                 Chinchilla  gat---a
           Brush-tailed rat  tag---g
B D                  Rabbit  tat---a
B D                    Pika  tac---a
B D                  Alpaca  --t---a
             Bactrian camel  --t---a
           Tibetan antelope  --t---a
B D                     Cow  --t---a
B D                   Sheep  --t---a
              Domestic goat  --t---a
B D                   Horse  tat---a
B D        White rhinoceros  tataaaa
B D                     Cat  tac---a
B D                     Dog  tat---t
B D                 Ferret   tat---a
             Pacific walrus  tat---g
           Black flying-fox  tat---a
B D                 Megabat  tat---a
              Big brown bat  --c---a
       David's myotis (bat)  tgc---a
B D                Microbat  tgc---a
B D                Elephant  --t---a
B D                  Tenrec  --t---a
B D               Armadillo  --t---a
           Star-nosed mole  =======
       Cape elephant shrew  =======
B D                   Shrew  =======
B D                   Mouse  =======
              Prairie vole  =======
B D                     Rat  =======
B D         Chinese hamster  =======
            Golden hamster  =======
B D                  Baboon  =======
B D                     Pig  =======
B D                 Dolphin  =======
              Weddell seal  =======
              Killer whale  =======
B D                   Panda  =======
B D                 Manatee  =======
        Chinese tree shrew  =======
B D                Platypus  =======
B D                 Opossum  =======
B D         Tasmanian devil  =======
          Cape golden mole  =======
                  Aardvark  =======

Inserts between block 22 and 23 in window
B D               Squirrel 2bp
    Lesser Egyptian jerboa 2bp
B D         Naked mole-rat 2168bp

Alignment block 23 of 119 in window, 49663794 - 49663796, 3 bps 
B D                   Human  tgt
B D                   Chimp  tgt
B D                 Gorilla  tgt
B D               Orangutan  tgt
B D                  Gibbon  tgt
B D                  Rhesus  tgc
B D     Crab-eating macaque  tgc
B D            Green monkey  tgt
B D                Marmoset  tgt
B D         Squirrel monkey  tgt
B D                Bushbaby  ttt
B D                Squirrel  tgc
     Lesser Egyptian jerboa  tca
B D              Guinea pig  tgt
                 Chinchilla  tat
           Brush-tailed rat  tgt
B D                  Rabbit  tat
B D                    Pika  tat
B D                  Alpaca  tat
             Bactrian camel  tat
           Tibetan antelope  tgt
B D                     Cow  tat
B D                   Sheep  tat
              Domestic goat  tat
B D                   Horse  tat
B D        White rhinoceros  tat
B D                     Cat  tat
B D                     Dog  tat
B D                 Ferret   tat
             Pacific walrus  tat
           Black flying-fox  gtt
B D                 Megabat  gtt
              Big brown bat  tgt
       David's myotis (bat)  tgt
B D                Microbat  tgt
B D                   Shrew  tac
            Star-nosed mole  tat
       Cape elephant shrew  ===
B D                   Mouse  ===
              Prairie vole  ===
B D                     Rat  ===
B D         Chinese hamster  ===
            Golden hamster  ===
B D                  Tenrec  ---
B D                  Baboon  ===
B D                     Pig  ===
B D                 Dolphin  ===
              Weddell seal  ===
              Killer whale  ===
B D                   Panda  ===
B D               Armadillo  ---
B D                 Manatee  ===
B D                Elephant  ---
        Chinese tree shrew  ===
B D          Naked mole-rat  ===
B D                Platypus  ===
B D                 Opossum  ===
B D         Tasmanian devil  ===
          Cape golden mole  ===
                  Aardvark  ===

Inserts between block 23 and 24 in window
B D             Guinea pig 1427bp
                Chinchilla 2380bp
          Brush-tailed rat 5112bp

Alignment block 24 of 119 in window, 49663797 - 49663800, 4 bps 
B D                   Human  gc-ct
B D                   Chimp  gc-ct
B D                 Gorilla  gc-ct
B D               Orangutan  gc-ct
B D                  Gibbon  gc-ct
B D                  Rhesus  gc-tt
B D     Crab-eating macaque  gc-tt
B D            Green monkey  gc-tt
B D                Marmoset  gc-at
B D         Squirrel monkey  gc-at
B D                Bushbaby  ttatt
B D                Squirrel  at-at
     Lesser Egyptian jerboa  tt-at
B D                  Rabbit  ct-ag
B D                    Pika  -t-ag
B D                  Alpaca  ---at
             Bactrian camel  ---at
           Tibetan antelope  ---at
B D                     Cow  ---gt
B D                   Sheep  ---at
              Domestic goat  ---at
B D                   Horse  ---at
B D        White rhinoceros  ----t
B D                     Cat  ---at
B D                     Dog  ---at
B D                 Ferret   ---at
             Pacific walrus  ---at
           Black flying-fox  ---at
B D                 Megabat  ---at
              Big brown bat  ---at
       David's myotis (bat)  ---at
B D                Microbat  ---at
B D                   Shrew  ---at
            Star-nosed mole  ---at
       Cape elephant shrew  =====
B D                   Mouse  =====
              Prairie vole  =====
B D                     Rat  =====
B D         Chinese hamster  =====
            Golden hamster  =====
B D                  Tenrec  -----
          Brush-tailed rat  =====
                Chinchilla  =====
B D              Guinea pig  =====
B D                  Baboon  =====
B D                     Pig  =====
B D                 Dolphin  =====
              Weddell seal  =====
              Killer whale  =====
B D                   Panda  =====
B D               Armadillo  -----
B D                 Manatee  =====
B D                Elephant  -----
        Chinese tree shrew  =====
B D          Naked mole-rat  =====
B D                Platypus  =====
B D                 Opossum  =====
B D         Tasmanian devil  =====
          Cape golden mole  =====
                  Aardvark  =====

Inserts between block 24 and 25 in window
B D                 Alpaca 10bp
            Bactrian camel 8bp
          Tibetan antelope 8bp
B D                    Cow 8bp
B D                  Sheep 8bp
             Domestic goat 8bp
B D                  Horse 6bp
B D       White rhinoceros 7bp
B D                    Cat 162bp
B D                    Dog 3bp
B D                Ferret  9bp
            Pacific walrus 9bp
          Black flying-fox 2bp
B D                Megabat 2bp
             Big brown bat 2bp
      David's myotis (bat) 2bp
B D               Microbat 2bp
B D                  Shrew 8bp
           Star-nosed mole 8bp

Alignment block 25 of 119 in window, 49663801 - 49663815, 15 bps 
B D                   Human  tcatcaagagttaac
B D                   Chimp  tcatcaagagttaac
B D                 Gorilla  tcatcaagagttaac
B D               Orangutan  tcatcaagagttaat
B D                  Gibbon  tcgtcgagagttaac
B D                  Rhesus  atatc-agagttaat
B D     Crab-eating macaque  atatc-agagttaat
B D            Green monkey  atatcaagagttaat
B D                Marmoset  ttatcaagagttaac
B D         Squirrel monkey  ttatcaagagttaac
B D                Bushbaby  ttatcaagagctaac
B D                Squirrel  ttatcaagaggtaat
     Lesser Egyptian jerboa  atctatgggagtaaa
B D                  Rabbit  ttatgcaaaagtaaa
B D                    Pika  ctatcaggagttaaa
B D                  Alpaca  ttgtcaagagataat
             Bactrian camel  ttgtcaagagataat
           Tibetan antelope  ttatcaagaggcaat
B D                     Cow  ttatcaagaggcaat
B D                   Sheep  ttatcaagaggcaat
              Domestic goat  ttatcaagaggcaat
B D                   Horse  ttatcaagtggtaat
B D        White rhinoceros  ttatcaagaggtaat
B D                     Cat  tcaccaacaggcaat
B D                     Dog  ttatggagcaatagt
B D                 Ferret   ttatgaagcagtaat
             Pacific walrus  ttatgaagtggtaat
           Black flying-fox  ttattgagagataag
B D                 Megabat  ttattgagagataag
              Big brown bat  ttattcagagggaaa
       David's myotis (bat)  ctatgaagaggaaaa
B D                Microbat  ttattaagaggaaaa
B D                   Shrew  ctaacaagaggtaat
            Star-nosed mole  ttatgaagaggggat
B D                Elephant  ---ttgaaaagtaac
B D                  Tenrec  ---ttgaaaggtaat
B D               Armadillo  ----tgaaaggtgac
       Cape elephant shrew  ===============
B D                   Mouse  ===============
              Prairie vole  ===============
B D                     Rat  ===============
B D         Chinese hamster  ===============
            Golden hamster  ===============
          Brush-tailed rat  ===============
                Chinchilla  ===============
B D              Guinea pig  ===============
B D                  Baboon  ===============
B D                     Pig  ===============
B D                 Dolphin  ===============
              Weddell seal  ===============
              Killer whale  ===============
B D                   Panda  ===============
B D                 Manatee  ===============
        Chinese tree shrew  ===============
B D          Naked mole-rat  ===============
B D                Platypus  ===============
B D                 Opossum  ===============
B D         Tasmanian devil  ===============
          Cape golden mole  ===============
                  Aardvark  ===============

Alignment block 26 of 119 in window, 49663816 - 49663833, 18 bps 
B D                   Human  atgcatggtttaca-aaat
B D                   Chimp  acacatggtttaca-aaat
B D                 Gorilla  atacgtggtttaca-aaat
B D               Orangutan  atacatggtttaca-aaat
B D                  Gibbon  atacatggtttaca-aaat
B D                  Rhesus  atacatggttgaca-aaat
B D     Crab-eating macaque  atacatggttgaca-aaat
B D            Green monkey  atacacggttgaca-aaat
B D                Marmoset  --acgtggtttaca-aaat
B D         Squirrel monkey  atacatggtttata-aaat
B D                Bushbaby  acacatgatttaca-attt
B D                Squirrel  gcaaatggcttaca-aatt
     Lesser Egyptian jerboa  acacatgttttatg-aagc
                 Chinchilla  acacatttctcata-aaat
B D                  Rabbit  atacacagtttata-aaat
B D                    Pika  atacacagctgaga-acat
B D                  Alpaca  gtacagggtataca-aaat
             Bactrian camel  gtacagggtataca-aaat
           Tibetan antelope  atatgtggcataca-aaat
B D                     Cow  atatgtggcataca-aaat
B D                   Sheep  atatgtggcataca-aaat
              Domestic goat  atatgtggcataca-aaat
B D                   Horse  gtacctggtataca-aaat
B D        White rhinoceros  gtacatggtataca-aaat
B D                     Cat  atacatggtataca-aaat
B D                     Dog  atacatgatatgcc-aaat
B D                 Ferret   atacatggtataca-aaat
             Pacific walrus  atacatggtataca-aaat
           Black flying-fox  gtacatagtataca-aaaa
B D                 Megabat  gtacatagtatata-aaaa
              Big brown bat  gtgcatggtatacg-aaat
       David's myotis (bat)  gtatatggtatacgaaaat
B D                Microbat  gtatatggtatacg-aaat
B D                   Shrew  atatttggcatgcg-aaat
            Star-nosed mole  atacatggtataca-aaat
B D                Elephant  attaatggtttata-aaat
B D                  Tenrec  ttgcacgatttata-aaat
B D               Armadillo  ttacatggtttgca-aaat
       Cape elephant shrew  ===================
B D                   Mouse  ===================
              Prairie vole  ===================
B D                     Rat  ===================
B D         Chinese hamster  ===================
            Golden hamster  ===================
          Brush-tailed rat  ===================
B D              Guinea pig  ===================
B D                  Baboon  ===================
B D                     Pig  ===================
B D                 Dolphin  ===================
              Weddell seal  ===================
              Killer whale  ===================
B D                   Panda  ===================
B D                 Manatee  ===================
        Chinese tree shrew  ===================
B D          Naked mole-rat  ===================
B D                Platypus  ===================
B D                 Opossum  ===================
B D         Tasmanian devil  ===================
          Cape golden mole  ===================
                  Aardvark  ===================

Inserts between block 26 and 27 in window
B D                  Shrew 237bp

Alignment block 27 of 119 in window, 49663834 - 49663859, 26 bps 
B D                   Human  ttaccaattttcaagagg-ttatagta
B D                   Chimp  ttaccaattttcaagagg-ttatagta
B D                 Gorilla  ttaccaattttcaagagg-ttatagta
B D               Orangutan  ttactaattttcaagaga-ttatagta
B D                  Gibbon  ttactaattttcaagaga-ttatagta
B D                  Rhesus  ttactaatttttaaaaga-ttatagta
B D     Crab-eating macaque  ttactaatttttaaaaga-ttatagta
B D            Green monkey  ttactaatttttaaaaga-ttatagta
B D                Marmoset  ttactaattttcaagaga-ttataata
B D         Squirrel monkey  ttactaattttcaagaga-ttataata
B D                Bushbaby  taacttattttcaagatatttaaagta
B D                Squirrel  -tactgattttcaagaca-gtacaata
     Lesser Egyptian jerboa  atatttatttacaggcta-ttatgata
                 Chinchilla  ttactgattttcagaatg-ttacaata
B D                  Rabbit  gtacagtttttcaataca-gtatgata
B D                    Pika  gtacagattttcaagata-atacaaca
B D                  Alpaca  ttactgattttcaag--a-gaataatt
             Bactrian camel  ttactgattttcaag--a-gaataatt
           Tibetan antelope  gtactgacttacaggata-gagtagtt
B D                     Cow  gtactgacttacaggata-gaataatt
B D                   Sheep  gtactgacttacaggata-gagtaatt
              Domestic goat  gtactgacttacaggata-gagtaatt
B D                   Horse  ttactgattttcaagata-gaataatt
B D        White rhinoceros  gtactgattttcaagata-gaataatt
B D                     Cat  gtagtgattttcaagata-gaata--t
B D                     Dog  atactgattttcaagata-gaata--t
B D                 Ferret   gtactgattttcaagata-gaata--t
             Pacific walrus  gtactgattttcaagata-gaaca--t
           Black flying-fox  ttactgattttcaagata-gtgaattt
B D                 Megabat  ttactgattttcaagata-gtgaaatt
              Big brown bat  ttactgattttcaaaata-atatactt
       David's myotis (bat)  ttactgattttcaaaata-gtatactt
B D                Microbat  ttactgattttcaaaata-gtatactt
B D                   Shrew  ttactaattcttaagaga-gaataaat
            Star-nosed mole  ---atatgttttatgaca-aaataatt
B D                Elephant  atactgatattcttaatg-ttataata
B D                  Tenrec  gcactgattttcataatg-ataggata
B D               Armadillo  tcactgcttttcaagata-ttatagta
       Cape elephant shrew  ===========================
B D                   Mouse  ===========================
              Prairie vole  ===========================
B D                     Rat  ===========================
B D         Chinese hamster  ===========================
            Golden hamster  ===========================
          Brush-tailed rat  ===========================
B D              Guinea pig  ===========================
B D                  Baboon  ===========================
B D                     Pig  ===========================
B D                 Dolphin  ===========================
              Weddell seal  ===========================
              Killer whale  ===========================
B D                   Panda  ===========================
B D                 Manatee  ===========================
        Chinese tree shrew  ===========================
B D          Naked mole-rat  ===========================
B D                Platypus  ===========================
B D                 Opossum  ===========================
B D         Tasmanian devil  ===========================
          Cape golden mole  ===========================
                  Aardvark  ===========================

Inserts between block 27 and 28 in window
B D                   Pika 248bp

Alignment block 28 of 119 in window, 49663860 - 49663869, 10 bps 
B D                   Human  aggcat------------acat
B D                   Chimp  aggcat------------acgt
B D                 Gorilla  aggcat------------acat
B D               Orangutan  aggcat------------acat
B D                  Gibbon  aggcat------------acat
B D                  Rhesus  agacat------------acat
B D     Crab-eating macaque  agacat------------acat
B D            Green monkey  agacat------------atgt
B D                Marmoset  agacat------------acat
B D         Squirrel monkey  agacat------------gcat
B D                Bushbaby  aaacat------------agat
B D                Squirrel  aaacat------------acat
     Lesser Egyptian jerboa  aaaactgggaatggcagggcat
                 Chinchilla  aaagat------------caat
B D                  Rabbit  ----at------------acat
B D                  Alpaca  aaacac------------acac
             Bactrian camel  aaacac------------acac
           Tibetan antelope  aaacat------------acat
B D                     Cow  aaacat------------acat
B D                   Sheep  aaacat------------acat
              Domestic goat  aaacat------------acat
B D                   Horse  aaacag------------acat
B D        White rhinoceros  aaacat------------acgt
B D                     Cat  aaactt------------acat
B D                     Dog  aagcat------------acat
B D                 Ferret   aaacat------------acat
             Pacific walrus  aaacat------------acat
           Black flying-fox  aaatat------------aaat
B D                 Megabat  aaatat------------aaat
              Big brown bat  aaacat------------aaat
       David's myotis (bat)  aagcat------------aaat
B D                Microbat  aagcat------------aaat
B D                   Shrew  gtgt------------------
            Star-nosed mole  aaat----------------at
B D                Elephant  agaaat------------ac--
B D                  Tenrec  aataat------------at--
B D               Armadillo  a--aat------------ac--
B D                    Pika  ======================
       Cape elephant shrew  ======================
B D                   Mouse  ======================
              Prairie vole  ======================
B D                     Rat  ======================
B D         Chinese hamster  ======================
            Golden hamster  ======================
          Brush-tailed rat  ======================
B D              Guinea pig  ======================
B D                  Baboon  ======================
B D                     Pig  ======================
B D                 Dolphin  ======================
              Weddell seal  ======================
              Killer whale  ======================
B D                   Panda  ======================
B D                 Manatee  ======================
        Chinese tree shrew  ======================
B D          Naked mole-rat  ======================
B D                Platypus  ======================
B D                 Opossum  ======================
B D         Tasmanian devil  ======================
          Cape golden mole  ======================
                  Aardvark  ======================

Alignment block 29 of 119 in window, 49663870 - 49663879, 10 bps 
B D                   Human  aatcatcatt
B D                   Chimp  aatcgtcatt
B D                 Gorilla  aatcatcatt
B D               Orangutan  aatcatcatt
B D                  Gibbon  aatcatcatt
B D                  Rhesus  aatcatcatt
B D     Crab-eating macaque  aatcatcatt
B D            Green monkey  aatcatcatt
B D                Marmoset  aatcatc---
B D         Squirrel monkey  aatcatc---
B D                Bushbaby  -ctaatcatt
B D                Squirrel  aatcaacatt
     Lesser Egyptian jerboa  aactataatt
                 Chinchilla  aatcacatt-
B D                  Alpaca  actcttc---
             Bactrian camel  actcttc---
           Tibetan antelope  actgttc---
B D                     Cow  actgttc---
B D                   Sheep  actgttc---
              Domestic goat  actgttc---
B D                   Horse  gcttatcatt
B D        White rhinoceros  actcatca--
B D                     Cat  attcatcggt
B D                     Dog  aaccatccat
B D                 Ferret   gctcatcact
             Pacific walrus  actcatcagt
           Black flying-fox  attcatcatt
B D                 Megabat  attcatcatt
              Big brown bat  actcatcatt
       David's myotis (bat)  actcatcatt
B D                Microbat  actcatcatt
B D                   Shrew  -ctcttcatt
            Star-nosed mole  accttctatt
B D                Elephant  --tcctcatt
B D                  Tenrec  --tcataatt
B D               Armadillo  --tcatcttt
B D                    Pika  ==========
       Cape elephant shrew  ==========
B D                   Mouse  ==========
              Prairie vole  ==========
B D                     Rat  ==========
B D         Chinese hamster  ==========
            Golden hamster  ==========
B D                  Rabbit  ----------
          Brush-tailed rat  ==========
B D              Guinea pig  ==========
B D                  Baboon  ==========
B D                     Pig  ==========
B D                 Dolphin  ==========
              Weddell seal  ==========
              Killer whale  ==========
B D                   Panda  ==========
B D                 Manatee  ==========
        Chinese tree shrew  ==========
B D          Naked mole-rat  ==========
B D                Platypus  ==========
B D                 Opossum  ==========
B D         Tasmanian devil  ==========
          Cape golden mole  ==========
                  Aardvark  ==========

Inserts between block 29 and 30 in window
    Lesser Egyptian jerboa 507bp

Alignment block 30 of 119 in window, 49663880 - 49663940, 61 bps 
B D                   Human  aactgttacca---ttgaacctgagtaatcaccataagatc----------tttt-agtgtcattgttta
B D                   Chimp  aactgttacca---ttgaacctgagtaatcaccataagatc----------tttt-agtgtcattgttta
B D                 Gorilla  aactgtgacca---ttgaacctgagtaatcaccataagatc----------tttt-aatgtcactgttta
B D               Orangutan  aactgttacca---ttgaacctgagtaatcaccataagatc----------tttt-agtgtcattgttta
B D                  Gibbon  aactgttacca---ctgaacctgagtaatcaccataagatc----------tttt-agtgtcattgttta
B D                  Rhesus  aactgttacca---ttgaacctgagtaatcaccataagatg----------tttt-agtatcattgttta
B D     Crab-eating macaque  aactgttacca---ttgaacctgagtaatcaccataagatg----------tttt-agtatcattgtttg
B D            Green monkey  aactgttacca---ttgaacctgagtaatcaccataagatg----------tttt-agtatcatggttta
B D                Marmoset  agctgttatca---ccgaacctgagtaatcagcgtaagctgatcattgttcattc-agtgtcattgttta
B D         Squirrel monkey  aactgttatca---ctgaccctgagtaatcagtgtgagctg----------tttc-attgtcactgttta
B D                Bushbaby  ctttgttatta---ttaacactgagtattctgtataaattt----------ttt---gtgtta---ttta
B D                Squirrel  aacctttattatagttaaagcttaggatttagcaccgaatt----------tt-----cagtgtcatgca
                 Chinchilla  aattgttcata---ttaaaggtgagtatttgacataaaatt----------tttc-acccttataattta
B D                  Alpaca  --------ctt---ttaaacctgaatatttgacctgaggtt----------tttc-agtg---tcattta
             Bactrian camel  --------ctt---ttaaacctgaatatttgacctgaggtt----------tttc-agtgtcatcattta
           Tibetan antelope  --------tta---cgaaacttgaatacttggcatgagatt----------tctc-tgtatcatcattta
B D                     Cow  --------tta---tgaaacttgaatactcggcatgagatt----------tctc-agtatcatcattta
B D                   Sheep  --------tta---tgaaacttgaatacttggcatgagatt----------tctc-agtatcatcattta
              Domestic goat  --------tta---tgaaacttgaatacttggcatgagatt----------tctc-agtatcatcattta
B D                   Horse  gactgttactg---ttaaatctgaatattcagcatgcgatt----------tttc-agcatcatcattta
B D        White rhinoceros  -actgttactg---ttaaatctcaatattcagcatacgatt----------tttc-agtatcatcattta
B D                     Cat  aac--ttactg---tgaaatctaaatattcagaatcagatt----------tttc-tgaatcatcgttaa
B D                     Dog  aac--ttttgg---ttaaacccaagtattcagcataagatt----------tttc-tgaatcatcattaa
B D                 Ferret   aac--ttaggg---ttaaacccaaatattcagcctaagatt----------tttc-tgaatcatcattaa
             Pacific walrus  aac--ttaggg---ttaaacccaaatattcagcataagatt----------tttc-tgaatcatccttaa
           Black flying-fox  aactgttattg---ttaaacttgaatatttggcataagatt----------tttc-agt------attta
B D                 Megabat  aactgttattg---ttaaacctgaatatttgacataagatt----------tttc-agt------attta
              Big brown bat  gactg---ttg---ttaaatctgaatacttatcataatatt----------tttc-aatgttataattta
       David's myotis (bat)  aactg---ttg---ttaaatctcaatactt---ataatatt----------tttc-aatgttataattta
B D                Microbat  aactg---ttg---ttaaatatcaatactt---ataatatt----------tttc-aatgttataattta
B D                   Shrew  aactcttactg---ttaaactagaatatttgacacaagctc----------tttc-aga--tgtaac---
            Star-nosed mole  atttgttacta---ttaagtctgcatacttggcataaaatt----------ttca-att--cataattta
B D                Elephant  ----gttactg---ttaatcctgaatatttgacataagatt----------ttttcagtgtcataattta
B D                  Tenrec  ----cttatga---ctaaccctgactgtttcacttaagatc----------tttt-agtgtcttcattta
B D               Armadillo  ----aactttt---tctattctgaatatttgacacaagatt----------tttt-agtgtcaccatttt
B D                    Pika  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Mouse  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
B D         Chinese hamster  ======================================================================
            Golden hamster  ======================================================================
B D                  Rabbit  ----------------------------------------------------------------------
    Lesser Egyptian jerboa  ======================================================================
          Brush-tailed rat  ======================================================================
B D              Guinea pig  ======================================================================
B D                  Baboon  ======================================================================
B D                     Pig  ======================================================================
B D                 Dolphin  ======================================================================
              Weddell seal  ======================================================================
              Killer whale  ======================================================================
B D                   Panda  ======================================================================
B D                 Manatee  ======================================================================
        Chinese tree shrew  ======================================================================
B D          Naked mole-rat  ======================================================================
B D                Platypus  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================

                      Human  tacac
                      Chimp  tacac
                    Gorilla  tacac
                  Orangutan  tacac
                     Gibbon  tacac
                     Rhesus  tacac
        Crab-eating macaque  tacac
               Green monkey  tacac
                   Marmoset  tatac
            Squirrel monkey  tatac
                   Bushbaby  ttcac
                   Squirrel  tt---
                 Chinchilla  ttcac
                     Alpaca  tgcac
             Bactrian camel  tgcac
           Tibetan antelope  cgcac
                        Cow  cgcac
                      Sheep  ctcac
              Domestic goat  cgcac
                      Horse  tgcac
           White rhinoceros  tgcac
                        Cat  tgtac
                        Dog  tgcac
                    Ferret   tgcac
             Pacific walrus  tgcac
           Black flying-fox  tgcac
                    Megabat  tgcac
              Big brown bat  agcat
       David's myotis (bat)  agcat
                   Microbat  agcat
                      Shrew  -----
            Star-nosed mole  ttcac
                   Elephant  cacac
                     Tenrec  tgcac
                  Armadillo  ctcac
                       Pika  =====
        Cape elephant shrew  =====
                      Mouse  =====
               Prairie vole  =====
                        Rat  =====
            Chinese hamster  =====
             Golden hamster  =====
                     Rabbit  -----
     Lesser Egyptian jerboa  =====
           Brush-tailed rat  =====
                 Guinea pig  =====
                     Baboon  =====
                        Pig  =====
                    Dolphin  =====
               Weddell seal  =====
               Killer whale  =====
                      Panda  =====
                    Manatee  =====
         Chinese tree shrew  =====
             Naked mole-rat  =====
                   Platypus  =====
                    Opossum  =====
            Tasmanian devil  =====
           Cape golden mole  =====
                   Aardvark  =====

Inserts between block 30 and 31 in window
B D               Elephant 6bp
B D                 Tenrec 6bp
B D              Armadillo 7bp

Alignment block 31 of 119 in window, 49663941 - 49663951, 11 bps 
B D                   Human  atcagtgatta-------
B D                   Chimp  attagtgatta-------
B D                 Gorilla  attagtgatta-------
B D               Orangutan  attagtgatta-------
B D                  Gibbon  agtggtgatta-------
B D                  Rhesus  attagtgatta-------
B D     Crab-eating macaque  attagtgatta-------
B D            Green monkey  attagtgatta-------
B D                Marmoset  attagtgatga-------
B D         Squirrel monkey  gttagtgacga-------
B D                Bushbaby  agttatgacca-------
B D                Squirrel  agtagatatca-------
                 Chinchilla  aagaggaatca-------
B D                  Alpaca  agcagtgatca-------
             Bactrian camel  agcagtgatca-------
           Tibetan antelope  agcagtgatca-------
B D                     Cow  agcagtgatca-------
B D                   Sheep  agcagtgatca-------
              Domestic goat  agcagtgatca-------
B D                   Horse  agcagtgatca-------
B D        White rhinoceros  agcagcgatca-------
B D                     Cat  agcagcaatca-------
B D                     Dog  cacggtgatca-------
B D                 Ferret   agatataatca-------
             Pacific walrus  agcagtgatca-------
           Black flying-fox  agcaatgatc--------
B D                 Megabat  agcaacgatc--------
              Big brown bat  ggcagtgatca-------
       David's myotis (bat)  ggcagtgatca-------
B D                Microbat  ggcagtgatca-------
B D                   Shrew  ----------a-------
            Star-nosed mole  atcagcgacaa-------
B D                Elephant  -------atcatta----
B D                  Tenrec  -------gtcatta----
                   Aardvark  -------gtcagtggttc
B D               Armadillo  -------atca-------
B D                    Pika  ==================
       Cape elephant shrew  ==================
B D                   Mouse  ==================
              Prairie vole  ==================
B D                     Rat  ==================
B D         Chinese hamster  ==================
            Golden hamster  ==================
B D                  Rabbit  ------------------
    Lesser Egyptian jerboa  ==================
          Brush-tailed rat  ==================
B D              Guinea pig  ==================
B D                  Baboon  ==================
B D                     Pig  ==================
B D                 Dolphin  ==================
              Weddell seal  ==================
              Killer whale  ==================
B D                   Panda  ==================
B D                 Manatee  ==================
        Chinese tree shrew  ==================
B D          Naked mole-rat  ==================
B D                Platypus  ==================
B D                 Opossum  ==================
B D         Tasmanian devil  ==================
          Cape golden mole  ==================

Inserts between block 31 and 32 in window
B D               Elephant 29bp
B D                 Tenrec 120bp
B D              Armadillo 1bp

Alignment block 32 of 119 in window, 49663952 - 49663952, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D            Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D                Bushbaby  a
B D                Squirrel  a
                 Chinchilla  a
B D                  Alpaca  a
             Bactrian camel  a
           Tibetan antelope  a
B D                     Cow  g
B D                   Sheep  a
              Domestic goat  g
B D                   Horse  a
B D        White rhinoceros  a
B D                     Cat  g
B D                     Dog  a
B D                 Ferret   a
             Pacific walrus  g
              Big brown bat  a
       David's myotis (bat)  a
B D                Microbat  a
B D                   Shrew  t
            Star-nosed mole  a
B D                Elephant  a
B D                  Tenrec  a
                   Aardvark  a
B D                    Pika  =
       Cape elephant shrew  =
B D                   Mouse  =
              Prairie vole  =
B D                     Rat  =
B D         Chinese hamster  =
            Golden hamster  =
B D                  Rabbit  -
          Black flying-fox  -
    Lesser Egyptian jerboa  =
          Brush-tailed rat  =
B D              Guinea pig  =
B D                  Baboon  =
B D                     Pig  =
B D                 Dolphin  =
              Weddell seal  =
B D                 Megabat  -
              Killer whale  =
B D                   Panda  =
B D               Armadillo  =
B D                 Manatee  =
        Chinese tree shrew  =
B D          Naked mole-rat  =
B D                Platypus  =
B D                 Opossum  =
B D         Tasmanian devil  =
          Cape golden mole  =

Inserts between block 32 and 33 in window
B D               Elephant 172bp
B D                 Tenrec 54bp
                  Aardvark 727bp

Alignment block 33 of 119 in window, 49663953 - 49663967, 15 bps 
B D                   Human  tg-------------------------------------------------------t------------
B D                   Chimp  tg-------------------------------------------------------t------------
B D                 Gorilla  tg-------------------------------------------------------t------------
B D               Orangutan  tg-------------------------------------------------------t------------
B D                  Gibbon  tg-------------------------------------------------------t------------
B D                  Rhesus  tg-------------------------------------------------------t------------
B D     Crab-eating macaque  tg-------------------------------------------------------t------------
B D            Green monkey  tg-------------------------------------------------------t------------
B D                Marmoset  tg-------------------------------------------------------t------------
B D         Squirrel monkey  tg-------------------------------------------------------t------------
B D                Bushbaby  gg-------------------------------------------------------c------------
B D                Squirrel  ca-------------------------------------------------------t------------
                 Chinchilla  -g-------------------------------------------------------t------------
B D                  Alpaca  tg-------------------------------------------------------c------------
             Bactrian camel  tg-------------------------------------------------------c------------
           Tibetan antelope  tgtagtggggtggccaaaaagttcgtttaggttttcccggtaagctcttaacagcaac------------
B D                     Cow  tgcattggggtggccaaaaagttcgttcaggtt------------------------tttctggtaagat
B D                   Sheep  tgtattggggtggccaaaaagttcattcaggtt------------------------ttcccggtaagat
              Domestic goat  tgtattggggtggccaaaaagttcgttcaggtt------------------------tttctggtaagct
B D                   Horse  tg--------------------------------------------------------------------
B D        White rhinoceros  tg-------------------------------------------------------t------------
B D                     Cat  tg-------------------------------------------------------t------------
B D                     Dog  tg-------------------------------------------------------t------------
B D                 Ferret   tc-------------------------------------------------------t------------
             Pacific walrus  ta-------------------------------------------------------t------------
           Black flying-fox  ----------------------------------------------------------------------
B D                 Megabat  ----------------------------------------------------------------------
              Big brown bat  cg-------------------------------------------------------t------------
       David's myotis (bat)  cc-------------------------------------------------------t------------
B D                Microbat  ca-------------------------------------------------------t------------
B D                   Shrew  tt-------------------------------------------------------c------------
            Star-nosed mole  tt-------------------------------------------------------c------------
B D                Elephant  ----------------------------------------------------------------------
B D                  Tenrec  ----------------------------------------------------------------------
B D               Armadillo  ----------------------------------------------------------------------
B D                    Pika  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Mouse  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
B D         Chinese hamster  ======================================================================
            Golden hamster  ======================================================================
B D                  Rabbit  ----------------------------------------------------------------------
    Lesser Egyptian jerboa  ======================================================================
          Brush-tailed rat  ======================================================================
B D              Guinea pig  ======================================================================
B D                  Baboon  ======================================================================
B D                     Pig  ======================================================================
B D                 Dolphin  ======================================================================
              Weddell seal  ======================================================================
              Killer whale  ======================================================================
B D                   Panda  ======================================================================
B D                 Manatee  ======================================================================
        Chinese tree shrew  ======================================================================
B D          Naked mole-rat  ======================================================================
B D                Platypus  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================

                      Human  ---------------------------------------atgactct-aaaa
                      Chimp  ---------------------------------------atgactct-aaaa
                    Gorilla  ---------------------------------------atgactct-aaaa
                  Orangutan  ---------------------------------------atgactct-aaaa
                     Gibbon  ---------------------------------------atgactct-aaaa
                     Rhesus  ---------------------------------------atgactat-aaga
        Crab-eating macaque  ---------------------------------------atgactat-aaga
               Green monkey  ---------------------------------------ataactct-aaga
                   Marmoset  ---------------------------------------atgactct-aaaa
            Squirrel monkey  ---------------------------------------atgactct-aaaa
                   Bushbaby  ---------------------------------------acaatttt-aaaa
                   Squirrel  ---------------------------------------acaaatat-aaaa
                 Chinchilla  ---------------------------------------agaagtcc-aaag
                     Alpaca  ---------------------------------------acaactct-aaaa
             Bactrian camel  ---------------------------------------acaactct-gaaa
           Tibetan antelope  ------------ccaaatgaactttttggccaacccaatacaactgt-aaaa
                        Cow  cttaacagcaacccaaatgaacgttttggccaacccaataccactgt-aaaa
                      Sheep  cttaacagcaacccaaatcaactttttggccaacccaatacaacggt-aaaa
              Domestic goat  cttaacagcaacccaaatgaactttttggccaacccaatacaacggtaaaaa
                      Horse  -------------------------------------------------aag
           White rhinoceros  ---------------------------------------atgaccct-aaaa
                        Cat  ---------------------------------------gca-------aaa
                        Dog  ---------------------------------------aca-------aaa
                    Ferret   ---------------------------------------aca-------aaa
             Pacific walrus  ---------------------------------------aca-------aaa
           Black flying-fox  ---------------------------------------acaactct-aaaa
                    Megabat  ---------------------------------------acaactct-aaaa
              Big brown bat  ---------------------------------------acaactat-aaaa
       David's myotis (bat)  ---------------------------------------acaactat-aaaa
                   Microbat  ---------------------------------------acaactat-aaaa
                      Shrew  ----------------------------------------------t-aaaa
            Star-nosed mole  ----------------------------------------------c-aaaa
                   Elephant  ------------------------------------tgggcaactct-aaag
                     Tenrec  ------------------------------------ttggcaacttg-gaag
                  Armadillo  ------------------------------------tttataggtat-aaaa
                       Pika  ====================================================
        Cape elephant shrew  ====================================================
                      Mouse  ====================================================
               Prairie vole  ====================================================
                        Rat  ====================================================
            Chinese hamster  ====================================================
             Golden hamster  ====================================================
                     Rabbit  ----------------------------------------------------
     Lesser Egyptian jerboa  ====================================================
           Brush-tailed rat  ====================================================
                 Guinea pig  ====================================================
                     Baboon  ====================================================
                        Pig  ====================================================
                    Dolphin  ====================================================
               Weddell seal  ====================================================
               Killer whale  ====================================================
                      Panda  ====================================================
                    Manatee  ====================================================
         Chinese tree shrew  ====================================================
             Naked mole-rat  ====================================================
                   Platypus  ====================================================
                    Opossum  ====================================================
            Tasmanian devil  ====================================================
           Cape golden mole  ====================================================
                   Aardvark  ====================================================

Alignment block 34 of 119 in window, 49663968 - 49663971, 4 bps 
B D                   Human  c------------------a-ta
B D                   Chimp  c------------------a-ta
B D                 Gorilla  c------------------a-ta
B D               Orangutan  c------------------a-ta
B D                  Gibbon  c------------------a-ta
B D                  Rhesus  c------------------a-ta
B D     Crab-eating macaque  c------------------a-ta
B D            Green monkey  t------------------a-ta
B D                Marmoset  c------------------a-ta
B D         Squirrel monkey  c------------------a-ta
B D                Bushbaby  c------------------a-ta
B D                Squirrel  c------------------a-ta
                 Chinchilla  c------------------atag
           Brush-tailed rat  c------------------a-ag
B D                  Alpaca  c------------------a-ta
             Bactrian camel  c------------------a-ta
           Tibetan antelope  c------------------a-ta
B D                     Cow  c------------------a-ta
B D                   Sheep  c------------------a-tg
              Domestic goat  c------------------a-ta
B D                   Horse  c------------------a-ta
B D        White rhinoceros  t------------------g-ta
B D                     Cat  c------------------a-ta
B D                     Dog  tgttaagttgtacaaaatgt-ta
B D                 Ferret   c------------------c-ta
             Pacific walrus  c------------------a-ta
           Black flying-fox  c------------------a-ta
B D                 Megabat  c------------------a-ta
              Big brown bat  c------------------a-ta
       David's myotis (bat)  c------------------a-tt
B D                Microbat  t------------------a-tt
B D                   Shrew  c------------------a-tg
            Star-nosed mole  c------------------a-ta
B D                Elephant  c------------------a-ta
B D                  Tenrec  t------------------a-aa
B D               Armadillo  c------------------a-ta
B D                    Pika  =======================
       Cape elephant shrew  =======================
B D                   Mouse  =======================
              Prairie vole  =======================
B D                     Rat  =======================
B D         Chinese hamster  =======================
            Golden hamster  =======================
B D                  Rabbit  -----------------------
    Lesser Egyptian jerboa  =======================
B D              Guinea pig  =======================
B D                  Baboon  =======================
B D                     Pig  =======================
B D                 Dolphin  =======================
              Weddell seal  =======================
              Killer whale  =======================
B D                   Panda  =======================
B D                 Manatee  =======================
        Chinese tree shrew  =======================
B D          Naked mole-rat  =======================
B D                Platypus  =======================
B D                 Opossum  =======================
B D         Tasmanian devil  =======================
          Cape golden mole  =======================
                  Aardvark  =======================

Alignment block 35 of 119 in window, 49663972 - 49663983, 12 bps 
B D                   Human  agctgaactgtt
B D                   Chimp  agctgaactgtt
B D                 Gorilla  agctgaactgtt
B D               Orangutan  agctaaactgtt
B D                  Gibbon  agctgaactgtt
B D                  Rhesus  agctgaactgtt
B D     Crab-eating macaque  agctgaactgtt
B D            Green monkey  agctggactgtt
B D                Marmoset  agctgcagtgtt
B D                Bushbaby  attcacagtgtt
B D                Squirrel  aattgcactttt
                 Chinchilla  agttgctttttt
           Brush-tailed rat  agttgcaatttt
B D                  Alpaca  agttgctcagtt
             Bactrian camel  aattgctcagtt
           Tibetan antelope  tgctgcgttgtt
B D                     Cow  tgctgcgttgtt
B D                   Sheep  tgctgcgttgtt
              Domestic goat  tgctgcattgtt
B D                   Horse  aattgcactgtt
B D        White rhinoceros  agttgcagtgtt
B D                     Cat  aggtgaactgtt
B D                     Dog  agttgtaacatt
B D                 Ferret   ggttgaaccatt
             Pacific walrus  agttgaaccatt
           Black flying-fox  ag----------
B D                 Megabat  ag----------
              Big brown bat  agtagcactgtt
       David's myotis (bat)  agtagcactgtt
B D                Microbat  agtagcactgtt
B D                   Shrew  agttgtactgct
            Star-nosed mole  cattttactatt
B D                Elephant  agttgcatggtt
B D                  Tenrec  aattgaataatt
B D               Armadillo  aatcacactgtt
B D                    Pika  ============
       Cape elephant shrew  ============
B D                   Mouse  ============
              Prairie vole  ============
B D                     Rat  ============
B D         Chinese hamster  ============
            Golden hamster  ============
B D                  Rabbit  ------------
    Lesser Egyptian jerboa  ============
B D              Guinea pig  ============
B D                  Baboon  ============
B D                     Pig  ============
B D                 Dolphin  ============
              Weddell seal  ============
              Killer whale  ============
B D         Squirrel monkey  ------------
B D                   Panda  ============
B D                 Manatee  ============
        Chinese tree shrew  ============
B D          Naked mole-rat  ============
B D                Platypus  ============
B D                 Opossum  ============
B D         Tasmanian devil  ============
          Cape golden mole  ============
                  Aardvark  ============

Inserts between block 35 and 36 in window
B D       White rhinoceros 287bp

Alignment block 36 of 119 in window, 49663984 - 49663985, 2 bps 
B D                   Human  tg
B D                   Chimp  tg
B D                 Gorilla  tg
B D               Orangutan  gg
B D                  Gibbon  tg
B D                  Rhesus  tg
B D     Crab-eating macaque  tg
B D            Green monkey  tg
B D                Marmoset  tg
B D                Bushbaby  ca
B D                Squirrel  ca
                 Chinchilla  ca
           Brush-tailed rat  ca
B D                  Alpaca  ca
             Bactrian camel  ca
           Tibetan antelope  ca
B D                     Cow  ca
B D                   Sheep  ca
              Domestic goat  ca
B D                   Horse  ca
B D        White rhinoceros  ca
B D                     Cat  ca
B D                     Dog  ca
B D                 Ferret   ca
             Pacific walrus  ga
              Big brown bat  ag
       David's myotis (bat)  ca
B D                Microbat  ca
B D                   Shrew  ca
B D                Elephant  ca
B D                  Tenrec  ca
B D               Armadillo  ca
           Star-nosed mole  --
B D                    Pika  ==
       Cape elephant shrew  ==
B D                   Mouse  ==
              Prairie vole  ==
B D                     Rat  ==
B D         Chinese hamster  ==
            Golden hamster  ==
B D                  Rabbit  --
          Black flying-fox  --
    Lesser Egyptian jerboa  ==
B D              Guinea pig  ==
B D                  Baboon  ==
B D                     Pig  ==
B D                 Dolphin  ==
              Weddell seal  ==
B D                 Megabat  --
              Killer whale  ==
B D         Squirrel monkey  --
B D                   Panda  ==
B D                 Manatee  ==
        Chinese tree shrew  ==
B D          Naked mole-rat  ==
B D                Platypus  ==
B D                 Opossum  ==
B D         Tasmanian devil  ==
          Cape golden mole  ==
                  Aardvark  ==

Alignment block 37 of 119 in window, 49663986 - 49663996, 11 bps 
B D                   Human  aaata-ttttat
B D                   Chimp  aaata-ttttat
B D                 Gorilla  aaata-ttttat
B D               Orangutan  aaata-ttttat
B D                  Gibbon  aaata-ttttat
B D                  Rhesus  aaata-ttttat
B D     Crab-eating macaque  aaata-ttttat
B D            Green monkey  aaata-ttttat
B D                Marmoset  aaata-ttttgt
B D                Bushbaby  acata-tttt-t
B D                Squirrel  aaata-ttttgc
                 Chinchilla  aaatc-ttttat
           Brush-tailed rat  aagtt-gcctgt
B D                  Alpaca  aagta-ttttgg
             Bactrian camel  aagta-ttttgg
               Killer whale  aaata-ttttgt
           Tibetan antelope  aaact-ttttgt
B D                     Cow  aaact-tttttt
B D                   Sheep  aaact-ttttgt
              Domestic goat  aaact-ttttgt
B D                   Horse  caata-ttttgt
B D        White rhinoceros  aaata-ttttgt
B D                     Cat  aacta-ttttgt
B D                     Dog  aagta-ttttgt
B D                 Ferret   aagtg-ttttgt
             Pacific walrus  aagta-ttttgt
              Big brown bat  aaata-ttttgt
       David's myotis (bat)  aaata-ttttgt
B D                Microbat  aaata-ttttgt
B D                   Shrew  aaata-tgtcat
            Star-nosed mole  -aata-tattat
B D                Elephant  gaatatttttaa
B D                  Tenrec  gaata-ctttgt
B D               Armadillo  gaata-ttttgg
B D                    Pika  ============
       Cape elephant shrew  ============
B D                   Mouse  ============
              Prairie vole  ============
B D                     Rat  ============
B D         Chinese hamster  ============
            Golden hamster  ============
B D                  Rabbit  ------------
          Black flying-fox  ------------
    Lesser Egyptian jerboa  ============
B D              Guinea pig  ============
B D                  Baboon  ============
B D                     Pig  ============
B D                 Dolphin  ============
              Weddell seal  ============
B D                 Megabat  ------------
B D         Squirrel monkey  ------------
B D                   Panda  ============
B D                 Manatee  ============
        Chinese tree shrew  ============
B D          Naked mole-rat  ============
B D                Platypus  ============
B D                 Opossum  ============
B D         Tasmanian devil  ============
          Cape golden mole  ============
                  Aardvark  ============

Inserts between block 37 and 38 in window
B D                  Shrew 351bp
           Star-nosed mole 2bp

Alignment block 38 of 119 in window, 49663997 - 49664003, 7 bps 
B D                   Human  gtagcag
B D                   Chimp  gtagcag
B D                 Gorilla  gtagcag
B D               Orangutan  gtagcag
B D                  Gibbon  gtagcag
B D                  Rhesus  ttagcag
B D     Crab-eating macaque  ttagcag
B D            Green monkey  ttagcag
B D                Marmoset  gtagcag
B D                Bushbaby  gtagcag
B D                Squirrel  atagcat
                 Chinchilla  atcaaaa
           Brush-tailed rat  gtggaaa
B D                  Alpaca  gtagcag
             Bactrian camel  atagcag
               Killer whale  tgagccg
           Tibetan antelope  agagcta
B D                     Cow  aaagcta
B D                   Sheep  agagcta
              Domestic goat  agagcta
B D                   Horse  atagcag
B D        White rhinoceros  atagcag
B D                     Cat  atggcag
B D                     Dog  atggcac
B D                 Ferret   atggcac
             Pacific walrus  atggcgg
              Big brown bat  agagcag
       David's myotis (bat)  agagcag
B D                Microbat  agagcag
            Star-nosed mole  atgtcag
B D                Elephant  atagcag
B D                  Tenrec  atagcag
B D               Armadillo  atagctg
B D                    Pika  =======
       Cape elephant shrew  =======
B D                   Shrew  =======
B D                   Mouse  =======
              Prairie vole  =======
B D                     Rat  =======
B D         Chinese hamster  =======
            Golden hamster  =======
B D                  Rabbit  -------
          Black flying-fox  -------
    Lesser Egyptian jerboa  =======
B D              Guinea pig  =======
B D                  Baboon  =======
B D                     Pig  =======
B D                 Dolphin  =======
              Weddell seal  =======
B D                 Megabat  -------
B D         Squirrel monkey  -------
B D                   Panda  =======
B D                 Manatee  =======
        Chinese tree shrew  =======
B D          Naked mole-rat  =======
B D                Platypus  =======
B D                 Opossum  =======
B D         Tasmanian devil  =======
          Cape golden mole  =======
                  Aardvark  =======

Inserts between block 38 and 39 in window
B D                 Alpaca 1bp
            Bactrian camel 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                Ferret  13bp
            Pacific walrus 701bp
             Big brown bat 1bp
      David's myotis (bat) 1bp
B D               Microbat 1bp
           Star-nosed mole 1bp

Alignment block 39 of 119 in window, 49664004 - 49664013, 10 bps 
B D                   Human  attgaaaaga
B D                   Chimp  attgaaaaga
B D                 Gorilla  attgaaaaga
B D               Orangutan  attgaaaaga
B D                  Gibbon  attgaaaaga
B D                  Rhesus  attgaaaaga
B D     Crab-eating macaque  attgaaaaga
B D            Green monkey  attgaaaaga
B D                Marmoset  attgaaaaga
B D                Bushbaby  attggaaaaa
B D                Squirrel  attaaaaagg
                 Chinchilla  gtt-aaaaag
           Brush-tailed rat  gtt-aaaagg
B D                  Alpaca  ttttaaaag-
             Bactrian camel  ttttaaaag-
               Killer whale  tttttaaag-
           Tibetan antelope  tttttaaag-
B D                     Cow  tttttaaag-
B D                   Sheep  tttttaaag-
              Domestic goat  tttttaaag-
B D                   Horse  ttttaaaag-
B D        White rhinoceros  ttttaaagg-
B D                     Cat  ttttaaaaa-
B D                     Dog  ttgtaaaag-
B D                 Ferret   ttttaaaag-
              Big brown bat  tttaaaatg-
       David's myotis (bat)  tttaaaatg-
B D                Microbat  tttaaaatt-
            Star-nosed mole  ttacagaa--
B D                Elephant  actaaaaga-
B D                  Tenrec  attaataga-
B D               Armadillo  actaaaaag-
B D                    Pika  ==========
       Cape elephant shrew  ==========
B D                   Shrew  ==========
B D                   Mouse  ==========
              Prairie vole  ==========
B D                     Rat  ==========
B D         Chinese hamster  ==========
            Golden hamster  ==========
B D                  Rabbit  ----------
          Black flying-fox  ----------
    Lesser Egyptian jerboa  ==========
B D              Guinea pig  ==========
B D                  Baboon  ==========
B D                     Pig  ==========
B D                 Dolphin  ==========
              Weddell seal  ==========
B D                 Megabat  ----------
B D         Squirrel monkey  ----------
B D                   Panda  ==========
B D                 Manatee  ==========
        Chinese tree shrew  ==========
B D          Naked mole-rat  ==========
            Pacific walrus  ==========
B D                Platypus  ==========
B D                 Opossum  ==========
B D         Tasmanian devil  ==========
          Cape golden mole  ==========
                  Aardvark  ==========

Inserts between block 39 and 40 in window
B D                 Alpaca 1bp
            Bactrian camel 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                    Cat 3bp
B D                Ferret  190bp
             Big brown bat 1bp
      David's myotis (bat) 1bp
B D               Microbat 1bp

Alignment block 40 of 119 in window, 49664014 - 49664021, 8 bps 
B D                   Human  attgtccc
B D                   Chimp  attgtccc
B D                 Gorilla  attgtccc
B D               Orangutan  attgtccc
B D                  Gibbon  attgtcct
B D                  Rhesus  attgcctc
B D     Crab-eating macaque  attgcctc
B D            Green monkey  attgcctc
B D                Marmoset  attgtctt
B D                Bushbaby  attttctc
B D                Squirrel  gttttctc
                 Chinchilla  gatttatg
           Brush-tailed rat  cttttatc
B D                  Alpaca  -ttttctc
             Bactrian camel  -ttttctt
               Killer whale  tttttctc
           Tibetan antelope  cttttcac
B D                     Cow  cttttcac
B D                   Sheep  cttttcac
              Domestic goat  cttttcac
B D                   Horse  a-tttctc
B D        White rhinoceros  accttctc
B D                     Cat  tttttctc
B D                     Dog  atcttctc
B D                 Ferret   attttctc
           Black flying-fox  attgtctc
B D                 Megabat  attgtctc
              Big brown bat  ttttcctc
       David's myotis (bat)  tttgtctc
B D                Microbat  tttgtctc
            Star-nosed mole  attatcta
B D                Elephant  attttctc
B D                  Tenrec  ctttt-tc
B D               Armadillo  atttggtc
B D                    Pika  ========
       Cape elephant shrew  ========
B D                   Shrew  ========
B D                   Mouse  ========
              Prairie vole  ========
B D                     Rat  ========
B D         Chinese hamster  ========
            Golden hamster  ========
B D                  Rabbit  --------
    Lesser Egyptian jerboa  ========
B D              Guinea pig  ========
B D                  Baboon  ========
B D                     Pig  ========
B D                 Dolphin  ========
              Weddell seal  ========
B D         Squirrel monkey  --------
B D                   Panda  ========
B D                 Manatee  ========
        Chinese tree shrew  ========
B D          Naked mole-rat  ========
            Pacific walrus  ========
B D                Platypus  ========
B D                 Opossum  ========
B D         Tasmanian devil  ========
          Cape golden mole  ========
                  Aardvark  ========

Inserts between block 40 and 41 in window
B D                    Cat 3bp
           Star-nosed mole 2bp

Alignment block 41 of 119 in window, 49664022 - 49664031, 10 bps 
B D                   Human  cgct-cttttt
B D                   Chimp  agct-cttttt
B D                 Gorilla  cgct-cttttt
B D               Orangutan  cgct-cttttt
B D                  Gibbon  cact-ctattt
B D                  Rhesus  cgct-cttttt
B D     Crab-eating macaque  cgct-cttttt
B D            Green monkey  ctct-cttttt
B D                Marmoset  catt-cttttt
B D                Bushbaby  catc-cttttt
B D                Squirrel  catc-cttttt
                 Chinchilla  tatc-attttg
           Brush-tailed rat  tata-attttg
B D                  Alpaca  tatcttttcct
             Bactrian camel  taccttttcct
               Killer whale  catc-cctcct
           Tibetan antelope  catc----ctt
B D                     Cow  catc-cttctt
B D                   Sheep  catc-cttctt
              Domestic goat  catc-cttctt
B D                   Horse  catc-ctttcc
B D        White rhinoceros  catc-cttccc
B D                     Cat  cacc-ctatct
B D                     Dog  catc-ctgtca
B D                 Ferret   catc-ctgtct
             Pacific walrus  catc-ctgtct
               Weddell seal  catc-ctgtct
           Black flying-fox  catc-ttttct
B D                 Megabat  catc-ttttct
              Big brown bat  catc-ttttct
       David's myotis (bat)  catc-ttttct
B D                Microbat  catc-ttttct
            Star-nosed mole  catc-ctgtt-
B D                Elephant  catg-ctttat
B D                  Tenrec  tatg-cttaaa
B D               Armadillo  cata-ctttgt
B D                    Pika  ===========
       Cape elephant shrew  ===========
B D                   Shrew  ===========
B D                   Mouse  ===========
              Prairie vole  ===========
B D                     Rat  ===========
B D         Chinese hamster  ===========
            Golden hamster  ===========
B D                  Rabbit  -----------
    Lesser Egyptian jerboa  ===========
B D              Guinea pig  ===========
B D                  Baboon  ===========
B D                     Pig  ===========
B D                 Dolphin  ===========
B D         Squirrel monkey  -----------
B D                   Panda  ===========
B D                 Manatee  ===========
        Chinese tree shrew  ===========
B D          Naked mole-rat  ===========
B D                Platypus  ===========
B D                 Opossum  ===========
B D         Tasmanian devil  ===========
          Cape golden mole  ===========
                  Aardvark  ===========

Inserts between block 41 and 42 in window
              Weddell seal 262bp

Alignment block 42 of 119 in window, 49664032 - 49664058, 27 bps 
B D                   Human  actcttgaagaatgataatagtaaac-t
B D                   Chimp  attcttgaagaatgataacagtaaac-t
B D                 Gorilla  attcttgaagaatgataatagtaaac-t
B D               Orangutan  attcttgaagaatgataatagtaaac-t
B D                  Gibbon  attcttgaagaatgataatagtaaac-t
B D                  Rhesus  attcttgaagaatgataatagtaaac-a
B D     Crab-eating macaque  attcttgaagaatgataatagtaaac-a
B D            Green monkey  attcttgaagaatgataatagtaaat-t
B D                Marmoset  attcttgaagaatgataatagtaacc-t
B D                Bushbaby  atgcttcataaatgataacatcgtat-t
B D                Squirrel  gtttttgaagaatgataatactttac-a
                 Chinchilla  atttttgaagaatgacaatattatac-c
           Brush-tailed rat  atttttgaagaatgacaatattatac-c
B D                  Alpaca  attcttgaacaatcataattttgcat-c
             Bactrian camel  attcttcaacaatcataattttgcat-c
               Killer whale  attcttcaaaaattatgatattgcac-c
           Tibetan antelope  attcttgaagactcatgatattgtac-t
B D                     Cow  attcttgaagactcatgatattatac-t
B D                   Sheep  attcttgaagactcatgatattgtac-t
              Domestic goat  attcttgaagactcatgatattgtac-t
B D                   Horse  attcttgaagagtcataatattgccc-c
B D        White rhinoceros  atgcttgaagaatcataatattgtac-c
B D                     Cat  attctttaa-aatcataacactacac-c
B D                     Dog  cctctttaagaatcccaacattgcac-a
B D                 Ferret   attctttaagaatcccggcattgcat-a
             Pacific walrus  attctttaagaatcccaacattgcac-a
           Black flying-fox  agtcttagaaaatcatagtattgtac-a
B D                 Megabat  agtcttagaaaatcatagtattgtac-a
              Big brown bat  attcttaaaggatcataa---tgtat-c
       David's myotis (bat)  attcttaaaggatcataatgttgtat-c
B D                Microbat  attcttaaaggatcataatgttgtat-c
            Star-nosed mole  -----ttgaagatcctaatattgtat-c
B D                Elephant  attcttgcaga-tcatgattctgcac--
B D                  Tenrec  ttttttttaca-tcattgtattaccct-
B D               Armadillo  attcttgaaga-tcaaaataaggcac--
B D                    Pika  ============================
       Cape elephant shrew  ============================
B D                   Shrew  ============================
B D                   Mouse  ============================
              Prairie vole  ============================
B D                     Rat  ============================
B D         Chinese hamster  ============================
            Golden hamster  ============================
B D                  Rabbit  ----------------------------
    Lesser Egyptian jerboa  ============================
B D              Guinea pig  ============================
B D                  Baboon  ============================
B D                     Pig  ============================
B D                 Dolphin  ============================
              Weddell seal  ============================
B D         Squirrel monkey  ----------------------------
B D                   Panda  ============================
B D                 Manatee  ============================
        Chinese tree shrew  ============================
B D          Naked mole-rat  ============================
B D                Platypus  ============================
B D                 Opossum  ============================
B D         Tasmanian devil  ============================
          Cape golden mole  ============================
                  Aardvark  ============================

Alignment block 43 of 119 in window, 49664059 - 49664156, 98 bps 
B D                   Human  cctt-ctggttctgtaa--ctgaacaagttactcatcttatc-tt-tgcttttgattg-tgtgtgtatac
B D                   Chimp  cctt-ctggttctgtaa--ctgaacaagttactcaccttatc-tt-tgcttttgattg-tgtgtgcatac
B D                 Gorilla  cctt-ctggttctgtaa--ctgaacaagttactcaccttatc-tt-tgcttttgattg-tgtgtgtatac
B D               Orangutan  cctt-ctggttctgtaa--gtgaacaagttactcaccttatc-tt-tgcttttgattc-tgtgtgtatac
B D                  Gibbon  cctt-ctggttctgtaa--cttaacaagttgcccaccttgtc-tt-tgcttttgattg-tgtgtttatac
B D                  Rhesus  cctt-ctggttgtgtaa--ctgaacaagttactcaccttctc-tt-tgtttttgatta-tgtgtgtatac
B D     Crab-eating macaque  cctt-ctggttgtgtaa--ctgaacaagttactcaccttctc-tt-tgtttttgatta-tgtgtgtatac
B D            Green monkey  cctt-ctggttctgtaa--ctgaacaagttactcaccttctc-tt-tgtttttgatta-tgtctgtatac
B D                Marmoset  cctt-ctggttgtgtaa--ctgaacaagttactcaccttatt-tt-tgcttttgatta-tgtttgtatac
B D                Bushbaby  tctt-ctggtt-tatta--ctgaaaaagttac----cttgtc-tt-tacttttgtttt-tatttgtataa
         Chinese tree shrew  cctt-ttggttctctaa--ctgcg-gagttac----cttatc-ttacgtttttgttta-tatctgtttaa
B D                Squirrel  cctt-ttggttgtgcaa--ccaga-aagtgacttaccttatc-tt-agcttttgtgta-tatctctataa
                 Chinchilla  catt-ctggttttgttc--ctggacacattacttaaag-----at-acctgctatttc-tgtctgtataa
           Brush-tailed rat  catt-gtgattgtgtta--ctgagcacatgacttacag-----at-ttctactatttc-catctgtatac
B D                  Alpaca  cctg-g-------------ctgaacaaga---------tacc-tt-agctttagttta-catctgtaaga
             Bactrian camel  cctg-g-------------ctgaacaaga---------tgcc-tt-agctttagttta-catctgtaaga
               Killer whale  cctt-gtggctatgtcc--ctgaacaagttct----cttatc-tt-agctttcgttta-catctgtagga
           Tibetan antelope  tgtc-atggttacgtcc--ctgaacaaggacc----cttagc-tt-agccttagttta-catgtatatga
B D                     Cow  cgtc-atggttacatcc--ctgaacaagggcc----cttatc-tt-agctttagttta-catgtgtatga
B D                   Sheep  tgtc-atggttacatcc--ctgaacaagggcc----cttagc-tt-agctttagttta-catgtgtatga
              Domestic goat  tgtc-atggttacatcc--ctgagcaagggcc----cttagc-tt-agctttagttta-catgtgtatga
B D                   Horse  cctg-atagttgtgtta--ctgaacaagttac----cctatc-tt-agctttagttta-catctgtatga
B D        White rhinoceros  tctt-gtggtggtgtta--ctgaacaagttac----cttatc-tt-agctttagttta-tatctgtataa
B D                     Cat  cctt-gtagttgtgtta--ctgatcaagttac----catgtc-tt-agtctccattta-tatctgtgtaa
B D                     Dog  tcttcatagttgtgtta--ctgaacaagttac----cttatc-tt-aaccttaattta-tatctgtgtaa
B D                 Ferret   tcttcataggtatgtta--ttgaacaagttac----cttatc-tt-agcctgaattta-tatctgtgtaa
             Pacific walrus  tcttcacagttgtgtta--ttgaacaagttac----cttatc-tt-agcttgaattta-tcttagtttat
           Black flying-fox  tctt-gtagatgtataa--ctgaa-----caa----gttacc-tt-agcttcagttta-tatctgtgcaa
B D                 Megabat  tctt-gtagatgtgtaa--ctgaa-----caa----gttacc-tt-agcttcagttta-tatctgtgcaa
              Big brown bat  cctt-gtggttgtgcaa--ctgaat--attac----cttatc-tt-agctttagttta-tatctgt--aa
       David's myotis (bat)  cctt-gtggttgggcaa--ccaaag--gttac----cttatc-tt-agctttagttta-tatctgt--aa
B D                Microbat  cctt-gtggttgtgcaa--ccaaat--gttac----cttatc-tt-agctttagttta-tatctgt--aa
            Star-nosed mole  cctg--------tagag--ctgaacaattact----gttgctatt-aacttttgtttt-tgcctatataa
B D                Elephant  -ccc-tttggtgtataatttttaacaagttactcatcttctc-tt-agctttagttta-tatctgt--aa
B D                  Tenrec  -cct-tttggtgtgtgaatttgagattgttactcatcttctc-tt-aaattcag-cta-tctttag--ga
B D               Armadillo  -act-ttggttgtataactttgaacaaataactcttgttctc-tt-agctttattttattatct------
B D                    Pika  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Shrew  ======================================================================
B D                   Mouse  ======================================================================
              Prairie vole  ======================================================================
B D                     Rat  ======================================================================
B D         Chinese hamster  ======================================================================
            Golden hamster  ======================================================================
B D                  Rabbit  ----------------------------------------------------------------------
    Lesser Egyptian jerboa  ======================================================================
B D              Guinea pig  ======================================================================
B D                  Baboon  ======================================================================
B D                     Pig  ======================================================================
B D                 Dolphin  ======================================================================
              Weddell seal  ======================================================================
B D         Squirrel monkey  ----------------------------------------------------------------------
B D                   Panda  ======================================================================
B D                 Manatee  ======================================================================
B D          Naked mole-rat  ======================================================================
B D                Platypus  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================

                      Human  aaacaat---ac-a--------aaattacttgcttgttggc-tttgt
                      Chimp  aaacaat---ac-a--------aaatcacttgcttgttggc-tttgt
                    Gorilla  aaacaat---ac-a--------aaattacttgcttgttggc-tttgt
                  Orangutan  aaacaat---ac-a--------aaattacttgcttgttggc-tttgt
                     Gibbon  aaacaat---at-a--------aaattacgtgcttgttggc-tttgt
                     Rhesus  aaacaat---ac-a--------aaattacttgcttgttggc-tttgt
        Crab-eating macaque  aaacaat---ac-a--------aaattacttgcttgttggc-tttgt
               Green monkey  aaacaat---ac-a--------aaatgacttgcttgttggc-tttgt
                   Marmoset  taacaat---ac-a--------aaatgacttgcttgttggc-tttgt
                   Bushbaby  aaactat---a--a--------aaataacttgctcattggc-ttttt
         Chinese tree shrew  aaacaac---ac-a--------aaattatttgcttgtt-gc-atttt
                   Squirrel  aaaacat---ac-a--------aagttactttattgttgac-ttatt
                 Chinchilla  aaacagt---gc-a--------aagtcactagcatttgggc-ttttt
           Brush-tailed rat  aaacagg---tc-c--------aaggtac-agcttgtggactttttt
                     Alpaca  aaacaat---ac-a--------aacttgcttgttagttggc-ttttt
             Bactrian camel  aaacaac---ac-a--------aaattgtttgttagttggc-ttttt
               Killer whale  aaacaat---ac-a--------aagttgcttgtttgctggc-ttttt
           Tibetan antelope  aggcaat---at-a--------aaattactttcttgtagac-----t
                        Cow  aggcaat---at-a--------aaattactttcttgtagac-----t
                      Sheep  aggcaat---at-a--------aaattactttcttgtagac-----t
              Domestic goat  aggcaat---at-a--------aaattactttcttgtagac-----t
                      Horse  aaacaat---ac-c--------aaatc-cttgtttgttggc-tgttt
           White rhinoceros  aaacaat---ac-a--------aaattgcttgtttgaaggc-ttttt
                        Cat  aagcagt---at-a--------cagttgcttacttgttgac-ttctt
                        Dog  aagaaac---ac-a--------tgattgcttatttgttgac-ttttt
                    Ferret   aaacaat---ac-a--------ctgttgcttatttgttgac--tttt
             Pacific walrus  atttatc---tt-agtttatatcagttgcctatttgttgac-ttttt
           Black flying-fox  gaacaat---ac-a--------aagttacttgcctattggc--tttt
                    Megabat  gaacaat---ac-a--------aagttacttgcctattggc--tttt
              Big brown bat  aaatgat---ac-a--------aaatcacttgctggttgtc--tttt
       David's myotis (bat)  aaatgac---ac-a--------aaattacttgcgggttggc--tctt
                   Microbat  aaatgac---ac----------aaattacttgctggttggc--tctt
            Star-nosed mole  aaacagc---at-g--------taattagttgcttattggc-tttgt
                   Elephant  aaacact---acta--------aaattacttgtttattacc-ttttt
                     Tenrec  aaacaacaaaactg--------aaatt-cttgcttattgca-tttta
                  Armadillo  ----------tctt--------aaaatacttgcttcttgc--tttgt
                       Pika  ===============================================
        Cape elephant shrew  ===============================================
                      Shrew  ===============================================
                      Mouse  ===============================================
               Prairie vole  ===============================================
                        Rat  ===============================================
            Chinese hamster  ===============================================
             Golden hamster  ===============================================
                     Rabbit  -----------------------------------------------
     Lesser Egyptian jerboa  ===============================================
                 Guinea pig  ===============================================
                     Baboon  ===============================================
                        Pig  ===============================================
                    Dolphin  ===============================================
               Weddell seal  ===============================================
            Squirrel monkey  -----------------------------------------------
                      Panda  ===============================================
                    Manatee  ===============================================
             Naked mole-rat  ===============================================
                   Platypus  ===============================================
                    Opossum  ===============================================
            Tasmanian devil  ===============================================
           Cape golden mole  ===============================================
                   Aardvark  ===============================================

Inserts between block 43 and 44 in window
B D                 Alpaca 1bp
            Bactrian camel 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                Ferret  1bp
            Pacific walrus 1bp
          Black flying-fox 1bp
B D                Megabat 1bp
             Big brown bat 1bp
      David's myotis (bat) 1bp
B D               Microbat 1bp
           Star-nosed mole 1bp

Alignment block 44 of 119 in window, 49664157 - 49664157, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D            Green monkey  a
B D                Marmoset  a
B D                Bushbaby  t
         Chinese tree shrew  g
B D                Squirrel  a
B D                     Pig  a
B D                  Alpaca  g
             Bactrian camel  g
               Killer whale  g
           Tibetan antelope  a
B D                     Cow  a
B D                   Sheep  a
              Domestic goat  a
B D                   Horse  g
B D        White rhinoceros  g
B D                     Cat  g
B D                     Dog  g
B D                 Ferret   a
             Pacific walrus  a
           Black flying-fox  g
B D                 Megabat  g
              Big brown bat  g
       David's myotis (bat)  g
B D                Microbat  g
            Star-nosed mole  a
B D                Elephant  t
B D                  Tenrec  a
B D               Armadillo  a
B D                    Pika  =
       Cape elephant shrew  =
B D                   Shrew  =
B D                   Mouse  =
              Prairie vole  =
B D                     Rat  =
B D         Chinese hamster  =
            Golden hamster  =
B D                  Rabbit  -
    Lesser Egyptian jerboa  =
          Brush-tailed rat  -
                Chinchilla  -
B D              Guinea pig  =
B D                  Baboon  =
B D                 Dolphin  =
              Weddell seal  =
B D         Squirrel monkey  -
B D                   Panda  =
B D                 Manatee  =
B D          Naked mole-rat  =
B D                Platypus  =
B D                 Opossum  =
B D         Tasmanian devil  =
          Cape golden mole  =
                  Aardvark  =

Inserts between block 44 and 45 in window
B D                    Pig 121bp

Alignment block 45 of 119 in window, 49664158 - 49664168, 11 bps 
B D                   Human  ttac-cacta---tt
B D                   Chimp  ttac-cacta---tt
B D                 Gorilla  ttac-cacta---tt
B D               Orangutan  ttac-cacta---tt
B D                  Gibbon  ttac-cacta---tt
B D                  Rhesus  ttac-catta---tt
B D     Crab-eating macaque  ttac-catta---tt
B D            Green monkey  ttac-catta---tt
B D                Marmoset  ttac-cattg---tt
B D                Bushbaby  aaacttggta---tg
         Chinese tree shrew  ttat-tgtca---tt
B D                Squirrel  caat-tgttg---tt
                 Chinchilla  --gt-tactg---tt
           Brush-tailed rat  --gt-tgatg---tt
B D                  Alpaca  ttac-tgctg---tt
             Bactrian camel  ttac-tgctg---tt
               Killer whale  ttac-tattg---tt
           Tibetan antelope  ttac-tgttg---tt
B D                     Cow  ttac-tgttg---tt
B D                   Sheep  ttac-tgttg---tt
              Domestic goat  ttac-tgttg---tt
B D                   Horse  ---t-tattg---tt
B D        White rhinoceros  ---t-tattg---tt
B D                     Cat  -------------tt
B D                     Dog  ---t-tgtcatcatt
B D                 Ferret   ---t-tgttgtcatt
             Pacific walrus  ---t-tgttgtcatt
           Black flying-fox  ---t---ttg---tt
B D                 Megabat  ---t---ttg---tt
              Big brown bat  ---t-tgttg---tt
       David's myotis (bat)  ---t-tgtta---tt
B D                Microbat  ---t-tgttg---tt
            Star-nosed mole  ttat-tgttg---tt
B D                Elephant  --------tg---tg
B D                  Tenrec  --------aa---ta
B D               Armadillo  --------tg---tg
B D                    Pika  ===============
       Cape elephant shrew  ===============
B D                   Shrew  ===============
B D                   Mouse  ===============
              Prairie vole  ===============
B D                     Rat  ===============
B D         Chinese hamster  ===============
            Golden hamster  ===============
B D                  Rabbit  ---------------
    Lesser Egyptian jerboa  ===============
B D              Guinea pig  ===============
B D                  Baboon  ===============
B D                     Pig  ===============
B D                 Dolphin  ===============
              Weddell seal  ===============
B D         Squirrel monkey  ---------------
B D                   Panda  ===============
B D                 Manatee  ===============
B D          Naked mole-rat  ===============
B D                Platypus  ===============
B D                 Opossum  ===============
B D         Tasmanian devil  ===============
          Cape golden mole  ===============
                  Aardvark  ===============

Inserts between block 45 and 46 in window
             Big brown bat 34bp
      David's myotis (bat) 16bp
B D               Microbat 225bp

Alignment block 46 of 119 in window, 49664169 - 49664172, 4 bps 
B D                   Human  aatg
B D                   Chimp  aatg
B D                 Gorilla  aatg
B D               Orangutan  aatg
B D                  Gibbon  aatg
B D                  Rhesus  gatg
B D     Crab-eating macaque  gatg
B D            Green monkey  gatg
B D                Marmoset  actg
B D                Bushbaby  aata
         Chinese tree shrew  acta
B D                Squirrel  aata
                 Chinchilla  aata
           Brush-tailed rat  aata
B D                  Alpaca  gtta
             Bactrian camel  gtta
               Killer whale  gttg
           Tibetan antelope  gtta
B D                     Cow  gtta
B D                   Sheep  gtta
              Domestic goat  g---
B D                   Horse  gttc
B D        White rhinoceros  gttg
B D                     Cat  gttg
B D                     Dog  gttg
B D                 Ferret   gttg
             Pacific walrus  gttg
           Black flying-fox  cgtt
B D                 Megabat  cgtt
              Big brown bat  agtg
       David's myotis (bat)  agtg
            Star-nosed mole  ---a
B D                Elephant  aatg
B D                  Tenrec  gata
B D               Armadillo  tgtg
B D                    Pika  ====
       Cape elephant shrew  ====
B D                   Shrew  ====
B D                   Mouse  ====
              Prairie vole  ====
B D                     Rat  ====
B D         Chinese hamster  ====
            Golden hamster  ====
B D                  Rabbit  ----
    Lesser Egyptian jerboa  ====
B D              Guinea pig  ====
B D                  Baboon  ====
B D                     Pig  ====
B D                 Dolphin  ====
              Weddell seal  ====
B D         Squirrel monkey  ----
B D                   Panda  ====
B D                Microbat  ====
B D                 Manatee  ====
B D          Naked mole-rat  ====
B D                Platypus  ====
B D                 Opossum  ====
B D         Tasmanian devil  ====
          Cape golden mole  ====
                  Aardvark  ====

Inserts between block 46 and 47 in window
B D                 Alpaca 5bp
            Bactrian camel 5bp
              Killer whale 5bp
          Tibetan antelope 314bp
B D                    Cow 313bp
B D                  Sheep 314bp
             Domestic goat 5bp
           Star-nosed mole 2bp

Alignment block 47 of 119 in window, 49664173 - 49664176, 4 bps 
B D                   Human  ccaa-
B D                   Chimp  ccag-
B D                 Gorilla  ccaa-
B D               Orangutan  ccaa-
B D                  Gibbon  ccaa-
B D                  Rhesus  ccca-
B D     Crab-eating macaque  ccca-
B D            Green monkey  ccca-
B D                Marmoset  ccca-
B D                Bushbaby  taaa-
         Chinese tree shrew  taca-
B D                Squirrel  taca-
                 Chinchilla  taca-
           Brush-tailed rat  taca-
B D                   Horse  -tta-
B D        White rhinoceros  -tta-
B D                     Cat  -tta-
B D                     Dog  -tta-
B D                 Ferret   -tta-
             Pacific walrus  -tta-
           Black flying-fox  -tta-
B D                 Megabat  -tta-
              Big brown bat  -tgg-
       David's myotis (bat)  -tta-
B D                Elephant  tacaa
B D                  Tenrec  cacaa
B D               Armadillo  tgtga
           Star-nosed mole  =====
B D                    Pika  =====
       Cape elephant shrew  =====
B D                   Shrew  =====
B D                   Mouse  =====
              Prairie vole  =====
B D                     Rat  =====
B D         Chinese hamster  =====
            Golden hamster  =====
B D                  Rabbit  -----
    Lesser Egyptian jerboa  =====
B D              Guinea pig  =====
B D                  Baboon  =====
B D                     Pig  =====
B D                 Dolphin  =====
              Weddell seal  =====
              Killer whale  =====
B D         Squirrel monkey  -----
B D                   Panda  =====
B D                     Cow  =====
             Domestic goat  =====
B D                   Sheep  =====
          Tibetan antelope  =====
B D                Microbat  =====
B D                 Manatee  =====
            Bactrian camel  =====
B D                  Alpaca  =====
B D          Naked mole-rat  =====
B D                Platypus  =====
B D                 Opossum  =====
B D         Tasmanian devil  =====
          Cape golden mole  =====
                  Aardvark  =====

Inserts between block 47 and 48 in window
B D                 Rhesus 3bp
B D    Crab-eating macaque 4bp
B D           Green monkey 18bp
B D               Bushbaby 1bp
        Chinese tree shrew 1bp
B D               Squirrel 1bp
                Chinchilla 1bp
          Brush-tailed rat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                Ferret  1bp
            Pacific walrus 1bp
          Black flying-fox 5bp
B D                Megabat 5bp
             Big brown bat 178bp
      David's myotis (bat) 9bp

Alignment block 48 of 119 in window, 49664177 - 49664181, 5 bps 
B D                   Human  tgg-----gg----
B D                   Chimp  agg-----gg----
B D                 Gorilla  tgg-----gg----
B D               Orangutan  tgg-----gg----
B D                  Gibbon  tgg-----gg----
B D                  Rhesus  cgg-----gg----
B D     Crab-eating macaque  cgg-----gg----
B D                Marmoset  --g-----cg----
B D                Bushbaby  tga-----gt----
         Chinese tree shrew  tga-----gc----
B D                Squirrel  tgagatga------
                 Chinchilla  tga-----------
           Brush-tailed rat  tga-----------
B D                   Horse  t-------------
B D        White rhinoceros  t-------------
B D                     Cat  t-------------
B D                     Dog  c-------------
B D                 Ferret   t-------------
             Pacific walrus  t-------------
B D                Elephant  ---------t----
B D                  Tenrec  ---------tgaaa
B D               Armadillo  ---------gagag
           Star-nosed mole  ==============
B D                    Pika  ==============
       Cape elephant shrew  ==============
B D                   Shrew  ==============
B D                   Mouse  ==============
              Prairie vole  ==============
B D                     Rat  ==============
B D         Chinese hamster  ==============
            Golden hamster  ==============
B D                  Rabbit  --------------
          Black flying-fox  ==============
    Lesser Egyptian jerboa  ==============
B D              Guinea pig  ==============
B D                  Baboon  ==============
B D                     Pig  ==============
B D                 Dolphin  ==============
              Weddell seal  ==============
B D                 Megabat  ==============
              Killer whale  ==============
B D         Squirrel monkey  --------------
B D                   Panda  ==============
             Big brown bat  ==============
B D                     Cow  ==============
             Domestic goat  ==============
B D                   Sheep  ==============
          Tibetan antelope  ==============
B D                Microbat  ==============
      David's myotis (bat)  ==============
B D                 Manatee  ==============
            Bactrian camel  ==============
B D                  Alpaca  ==============
B D          Naked mole-rat  ==============
B D                Platypus  ==============
B D                 Opossum  ==============
B D         Tasmanian devil  ==============
          Cape golden mole  ==============
                  Aardvark  ==============
B D            Green monkey  ==============

Inserts between block 48 and 49 in window
                Chinchilla 2bp
B D              Armadillo 10bp

Alignment block 49 of 119 in window, 49664182 - 49664184, 3 bps 
B D                   Human  gaa
B D                   Chimp  aaa
B D               Orangutan  gaa
B D                  Rhesus  g--
B D     Crab-eating macaque  ggc
B D                Marmoset  gaa
B D                Bushbaby  taa
         Chinese tree shrew  ta-
B D                Elephant  gaa
        Cape elephant shrew  gga
B D               Armadillo  gag
           Star-nosed mole  ===
B D                    Pika  ===
B D                   Shrew  ===
B D                   Mouse  ===
              Prairie vole  ===
B D                     Rat  ===
B D         Chinese hamster  ===
            Golden hamster  ===