Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 34 in window, 67912270 - 67912285, 16 bps 
B D                     Human  ggaaaggtcttag--t--tt
B D                     Chimp  ggaaaggtcttag--t--tt
B D                   Gorilla  ggaaaggtcttag--c--tt
B D                 Orangutan  agaaaggtcttag--c--tt
B D                    Gibbon  agaaaggtcttag--c--tt
B D                    Rhesus  agaaaggtcttag--c--tt
B D       Crab-eating macaque  agaaaggtcttag--c--tt
B D                    Baboon  agaaaggtcttag--c--tt
B D              Green monkey  agaaaggtcttag--c--tt
B D                  Marmoset  agaaaggtcttag--c--tt
B D           Squirrel monkey  agaaaggtcttag--c--tt
                 Prairie vole  ---------------c----
B D           Chinese hamster  ---------------c----
               Golden hamster  ---------------a----
B D                     Mouse  ---------------t----
B D                       Rat  ---------------c----
B D            Naked mole-rat  agaaaggtcttaggtc----
B D                Guinea pig  agaaacgtcttag--t----
                   Chinchilla  agaaaggtcttaa--t----
             Brush-tailed rat  agaaaggtcatag--t----
B D                    Rabbit  agaaagatcttag--ctc--
B D                    Alpaca  aaaaaggtcttag--c--tc
               Bactrian camel  agaaaggtcttag--c--tc
B D                   Dolphin  agaaagttgctag--c--tc
                 Killer whale  agaaagttgctag--c--tc
             Tibetan antelope  agaaaggtcttag--c--tc
B D                       Cow  agaaaggtcttag--c--tc
B D                     Sheep  agaaaggtcttag--c--tc
                Domestic goat  agaaaggtcttag--c--tc
B D                     Horse  agaaagttcttag--c--tc
B D          White rhinoceros  agaaagttcttac--c--tt
B D                       Cat  aaaaaagtcttag--c--tg
B D                       Dog  agaaaagtattag--c--tg
B D                   Ferret   agaaaggtcttag--c--tg
B D                     Panda  aaaaagttcttag--c--tg
               Pacific walrus  agaaaggtcttag--c--tg
                 Weddell seal  agaaaggtcttag--c--tg
             Black flying-fox  agaaaggtattat--c--tc
B D                   Megabat  agaaaggtattat--c--tc
                Big brown bat  agaaagac-ttag--c--tc
         David's myotis (bat)  agaaagac-ttag--c--tc
B D                  Microbat  agaaagac-ttag--c--tc
B D                     Shrew  agtaagatcttag--c--tc
              Star-nosed mole  --taaaacgaata--c--tt
B D                  Elephant  tgaaaagtcttat--c--tc
          Cape elephant shrew  agagagatcttac--c--tt
B D                   Manatee  agaaaagtcttat--c--tc
B D                    Tenrec  agaaaagtctt---------
                     Aardvark  agaagagtcttat--c--tg
B D                 Armadillo  agaaagatcttag--c--ta
      Lesser Egyptian jerboa  ====================
B D                  Hedgehog  ====================
B D                      Pika  ====================
B D                  Bushbaby  ====================
          Chinese tree shrew  ====================
B D                  Squirrel  ====================
B D                       Pig  ====================
B D                    Turkey  ====================
B D                   Chicken  ====================
  D             Scarlet macaw  ====================
B D                Budgerigar  ====================
          Tibetan ground jay  ====================
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
  D               Rock pigeon  ====================
B D       Medium ground finch  ====================
  D              Mallard duck  ====================
  D                    Parrot  ====================
  D    White-throated sparrow  ====================
            Cape golden mole  ====================
  D    Spiny softshell turtle  ====================
  D  Chinese softshell turtle  ====================
  D            Painted turtle  ====================
  D           Green seaturtle  ====================
B D           Tasmanian devil  ====================
B D                   Opossum  ====================
B D        American alligator  ====================
B D               Zebra finch  ====================
  D       Collared flycatcher  ====================

Alignment block 2 of 34 in window, 67912286 - 67912304, 19 bps 
B D                     Human  t--aaa---agcagtctttttaaa-
B D                     Chimp  t--aaa---agcagtccttttaaa-
B D                   Gorilla  t--aaa---agcagtcatttaaaa-
B D                 Orangutan  t--aaa---agcagtccttttaaa-
B D                    Gibbon  t--aaa---agcagtccttttaaa-
B D                    Rhesus  t--aaa---agcagtccttttaaa-
B D       Crab-eating macaque  t--aaa---agcagtccttttaaa-
B D                    Baboon  t--aaa---agcagtccttttaaa-
B D              Green monkey  t--aaa---agcagtccttttaaa-
B D                  Marmoset  t--aaa---agcagtccttttaaa-
B D           Squirrel monkey  t--aaa---agcagtccttttaaa-
                 Prairie vole  t--gaa---ggcaatactttt-aa-
B D           Chinese hamster  t--gaa---ggcaatacttttaaa-
               Golden hamster  t--gaa---tgcaatacttttaaa-
B D                     Mouse  t--aaa---ggcaatacttgtaaa-
B D                       Rat  a--cta---ggcaatac-tgtaaa-
B D            Naked mole-rat  t--aaa---agcagtacttttaaa-
B D                Guinea pig  t--aaa---accagtacttagaaa-
                   Chinchilla  t--aaa---agcagtacttttgga-
             Brush-tailed rat  t--aaa---agcaacacttttaaa-
B D                    Rabbit  t--aac---agcaggac-tttaaa-
B D                      Pika  t--aac---agcagtac-tttata-
B D                    Alpaca  t--aaa---aggagtatctttaat-
               Bactrian camel  t--aaa---aggagtatctttaat-
B D                   Dolphin  t--aaa---aggagtacttttaat-
                 Killer whale  t--aaa---aggagtacttttaat-
             Tibetan antelope  t--gaa---aggagtacttttaat-
B D                       Cow  t--gaa---aggagtacttttaat-
B D                     Sheep  t--gaa---aggagtacttttaat-
                Domestic goat  t--gaa---aggagtacttttaat-
B D                     Horse  t--aaa---aggagtacttttaag-
B D          White rhinoceros  t--aaa---aggagaacttttaag-
B D                       Cat  t--aaa---aggagtacttttaag-
B D                       Dog  t---aa---aagagtactttaaag-
B D                   Ferret   t---aa---aggaatacttttaag-
B D                     Panda  t--gaa---aggagtacttataag-
               Pacific walrus  t--gaa---aggagtacttttaag-
                 Weddell seal  t--gaa---aggagtacttttaag-
             Black flying-fox  t--gaa---aggagtact--taag-
B D                   Megabat  t--gaa---aggagtact--taag-
                Big brown bat  t--aaa---aggagcgcttttaag-
         David's myotis (bat)  t--aaa---aggagtgctcttaag-
B D                  Microbat  t--aaa---aggagtgctcctaag-
B D                     Shrew  ttgtag---gaaaatactttcaag-
              Star-nosed mole  tttgga---taacatttttttaaa-
B D                  Elephant  t--aaacagagtagtactttgtaaa
          Cape elephant shrew  t--taacgaaggagcactttgtaaa
B D                   Manatee  t--aaacagaggagtacttcgtaaa
B D                    Tenrec  -------tgtggaatgcttcagaaa
                     Aardvark  t--aaacagaaaagtactttgtaaa
B D                 Armadillo  t--aaa---aggaatactttgtaaa
      Lesser Egyptian jerboa  =========================
B D                  Hedgehog  =========================
B D                  Bushbaby  =========================
          Chinese tree shrew  =========================
B D                  Squirrel  =========================
B D                       Pig  =========================
B D                    Turkey  =========================
B D                   Chicken  =========================
  D             Scarlet macaw  =========================
B D                Budgerigar  =========================
          Tibetan ground jay  =========================
  D          Peregrine falcon  =========================
  D              Saker falcon  =========================
  D               Rock pigeon  =========================
B D       Medium ground finch  =========================
  D              Mallard duck  =========================
  D                    Parrot  =========================
  D    White-throated sparrow  =========================
            Cape golden mole  =========================
  D    Spiny softshell turtle  =========================
  D  Chinese softshell turtle  =========================
  D            Painted turtle  =========================
  D           Green seaturtle  =========================
B D           Tasmanian devil  =========================
B D                   Opossum  =========================
B D        American alligator  =========================
B D               Zebra finch  =========================
  D       Collared flycatcher  =========================

Inserts between block 2 and 3 in window
             Star-nosed mole 5250bp

Alignment block 3 of 34 in window, 67912305 - 67912310, 6 bps 
B D                     Human  ggaaat
B D                     Chimp  ggaaat
B D                   Gorilla  ggaaat
B D                 Orangutan  ggaaat
B D                    Gibbon  ggaaat
B D                    Rhesus  ggaaat
B D       Crab-eating macaque  ggaaat
B D                    Baboon  ggaaat
B D              Green monkey  ggaaat
B D                  Marmoset  ggaaat
B D           Squirrel monkey  ggaaat
                 Prairie vole  gaatgt
B D           Chinese hamster  gcatgt
               Golden hamster  gcatgt
B D                     Mouse  gaacgg
B D                       Rat  gaatgt
B D            Naked mole-rat  gtaaaa
B D                Guinea pig  gtaagt
                   Chinchilla  gtgaat
             Brush-tailed rat  gtaaat
B D                    Rabbit  gaaagt
B D                      Pika  gaaagt
B D                    Alpaca  ggaaat
               Bactrian camel  ggaaat
B D                   Dolphin  ggtaat
                 Killer whale  ggtaat
             Tibetan antelope  ggaaat
B D                       Cow  ggaaat
B D                     Sheep  ggaaat
                Domestic goat  ggaaat
B D                     Horse  ggaaat
B D          White rhinoceros  ggaaat
B D                       Cat  ggaaat
B D                       Dog  caaaat
B D                   Ferret   ggaacc
B D                     Panda  ggaact
               Pacific walrus  ggaact
                 Weddell seal  ggaact
             Black flying-fox  ggaaat
B D                   Megabat  ggaaat
                Big brown bat  ggaatt
         David's myotis (bat)  gg-aat
B D                  Microbat  ggaaat
B D                     Shrew  ggaaat
B D                  Elephant  ggaaat
          Cape elephant shrew  ggaaat
B D                   Manatee  ggaaat
B D                    Tenrec  ggaaat
                     Aardvark  gggaat
B D                 Armadillo  ggaagt
      Lesser Egyptian jerboa  ======
B D                  Hedgehog  ======
             Star-nosed mole  ======
B D                  Bushbaby  ======
          Chinese tree shrew  ======
B D                  Squirrel  ======
B D                       Pig  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D             Scarlet macaw  ======
B D                Budgerigar  ======
          Tibetan ground jay  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D               Rock pigeon  ======
B D       Medium ground finch  ======
  D              Mallard duck  ======
  D                    Parrot  ======
  D    White-throated sparrow  ======
            Cape golden mole  ======
  D    Spiny softshell turtle  ======
  D  Chinese softshell turtle  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D           Tasmanian devil  ======
B D                   Opossum  ======
B D        American alligator  ======
B D               Zebra finch  ======
  D       Collared flycatcher  ======

Inserts between block 3 and 4 in window
B D                   Tenrec 13bp

Alignment block 4 of 34 in window, 67912311 - 67912314, 4 bps 
B D                     Human  gtag
B D                     Chimp  ataa
B D                   Gorilla  gtaa
B D                 Orangutan  gtaa
B D                    Gibbon  gtaa
B D                    Rhesus  g-aa
B D       Crab-eating macaque  gtaa
B D                    Baboon  gtaa
B D              Green monkey  gtaa
B D                  Marmoset  gtaa
B D           Squirrel monkey  gtag
                 Prairie vole  atgg
B D           Chinese hamster  gtga
               Golden hamster  gtga
B D                     Mouse  gaga
B D                       Rat  gtga
B D            Naked mole-rat  gcaa
B D                Guinea pig  gcaa
                   Chinchilla  gcaa
             Brush-tailed rat  acaa
B D                    Rabbit  gaaa
B D                      Pika  gcaa
B D                    Alpaca  acca
               Bactrian camel  acca
B D                   Dolphin  acca
                 Killer whale  acca
             Tibetan antelope  gcca
B D                       Cow  gcca
B D                     Sheep  gcca
                Domestic goat  gcca
B D                     Horse  gcag
B D          White rhinoceros  gcaa
B D                       Cat  gcaa
B D                       Dog  gcaa
B D                   Ferret   acaa
B D                     Panda  ggga
               Pacific walrus  gcaa
                 Weddell seal  gcaa
             Black flying-fox  gcaa
B D                   Megabat  gcaa
                Big brown bat  gcaa
         David's myotis (bat)  gcaa
B D                  Microbat  gcaa
B D                     Shrew  gcaa
B D                  Elephant  gcaa
          Cape elephant shrew  agaa
B D                   Manatee  acaa
                     Aardvark  acaa
B D                 Armadillo  gcaa
      Lesser Egyptian jerboa  ====
B D                    Tenrec  ====
B D                  Hedgehog  ====
             Star-nosed mole  ====
B D                  Bushbaby  ====
          Chinese tree shrew  ====
B D                  Squirrel  ====
B D                       Pig  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
          Tibetan ground jay  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D               Rock pigeon  ====
B D       Medium ground finch  ====
  D              Mallard duck  ====
  D                    Parrot  ====
  D    White-throated sparrow  ====
            Cape golden mole  ====
  D    Spiny softshell turtle  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D           Tasmanian devil  ====
B D                   Opossum  ====
B D        American alligator  ====
B D               Zebra finch  ====
  D       Collared flycatcher  ====

Inserts between block 4 and 5 in window
            Brush-tailed rat 103bp

Alignment block 5 of 34 in window, 67912315 - 67912324, 10 bps 
B D                     Human  ctat-------------------------------------gctcat
B D                     Chimp  ctat-------------------------------------gctcat
B D                   Gorilla  ctgt-------------------------------------gctcat
B D                 Orangutan  ctat-------------------------------------gctgat
B D                    Gibbon  ctat-------------------------------------gctgat
B D                    Rhesus  ctat-------------------------------------gctgat
B D       Crab-eating macaque  ctat-------------------------------------gctgat
B D                    Baboon  ctat-------------------------------------gctgat
B D              Green monkey  ctat-------------------------------------gctgat
B D                  Marmoset  ctat-------------------------------------gctgat
B D           Squirrel monkey  ctat-------------------------------------gctaa-
                 Prairie vole  ccgt-------------------------------------gttggt
B D           Chinese hamster  gtat-------------------------------------gttcat
               Golden hamster  ctat-------------------------------------gttgat
B D                     Mouse  ctct-------------------------------------gccgat
B D                       Rat  cact-------------------------------------gcccat
B D            Naked mole-rat  ctgt-------------------------------------gcggat
B D                Guinea pig  ctgt-------------------------------------gctgat
                   Chinchilla  cggt-------------------------------------gctgat
             Brush-tailed rat  ctgt-------------------------------------actgat
B D                    Rabbit  ctatgggggccggtgttgtggtgcagtgggttaactccctggcctgc
B D                      Pika  ctgt-------------------------------------gcttgc
B D                    Alpaca  ctat-------------------------------------gccgat
               Bactrian camel  ctat-------------------------------------gccgat
B D                   Dolphin  ctat-------------------------------------gccaat
                 Killer whale  ctat-------------------------------------gccaat
             Tibetan antelope  gtat-------------------------------------gccaat
B D                       Cow  gtat-------------------------------------gccaat
B D                     Sheep  gtat-------------------------------------gccaat
                Domestic goat  gtat-------------------------------------gccaat
B D                     Horse  ttat-------------------------------------gctgat
B D          White rhinoceros  ctat-------------------------------------gctgat
B D                       Cat  ctat-------------------------------------gctgat
B D                       Dog  ctat-------------------------------------gctgat
B D                   Ferret   ctat-------------------------------------gctgat
B D                     Panda  ctat-------------------------------------gctgat
               Pacific walrus  ctat-------------------------------------gctgat
                 Weddell seal  ctat-------------------------------------gctgat
             Black flying-fox  ctat-------------------------------------gctgat
B D                   Megabat  ctat-------------------------------------gctgat
                Big brown bat  ctat-------------------------------------gctgat
         David's myotis (bat)  ctat-------------------------------------gctgat
B D                  Microbat  ctct-------------------------------------gctgat
B D                     Shrew  ctct-------------------------------------actga-
B D                  Elephant  cagt-------------------------------------gctgac
          Cape elephant shrew  tagt-------------------------------------gtagat
B D                   Manatee  cagt-------------------------------------gccgat
                     Aardvark  tggt-------------------------------------gctgat
B D                 Armadillo  ctat-------------------------------------gccgat
      Lesser Egyptian jerboa  ===============================================
B D                    Tenrec  ===============================================
B D                  Hedgehog  ===============================================
             Star-nosed mole  ===============================================
B D                  Bushbaby  ===============================================
          Chinese tree shrew  ===============================================
B D                  Squirrel  ===============================================
B D                       Pig  ===============================================
B D                    Turkey  ===============================================
B D                   Chicken  ===============================================
  D             Scarlet macaw  ===============================================
B D                Budgerigar  ===============================================
          Tibetan ground jay  ===============================================
  D          Peregrine falcon  ===============================================
  D              Saker falcon  ===============================================
  D               Rock pigeon  ===============================================
B D       Medium ground finch  ===============================================
  D              Mallard duck  ===============================================
  D                    Parrot  ===============================================
  D    White-throated sparrow  ===============================================
            Cape golden mole  ===============================================
  D    Spiny softshell turtle  ===============================================
  D  Chinese softshell turtle  ===============================================
  D            Painted turtle  ===============================================
  D           Green seaturtle  ===============================================
B D           Tasmanian devil  ===============================================
B D                   Opossum  ===============================================
B D        American alligator  ===============================================
B D               Zebra finch  ===============================================
  D       Collared flycatcher  ===============================================

Inserts between block 5 and 6 in window
B D                   Rabbit 181bp

Alignment block 6 of 34 in window, 67912325 - 67912347, 23 bps 
B D                     Human  tga----ttttgtt--att---gttgtccttt
B D                     Chimp  tga----ttttgtt--att---gttgtccttt
B D                   Gorilla  tga----ttttgtt--att---gttatccttt
B D                 Orangutan  tga----tttcgtt--att---gttatccttt
B D                    Gibbon  tga----tttcgtt--att---gttatccttt
B D                    Rhesus  tga----ttttgtt--att---gttatccttt
B D       Crab-eating macaque  tga----ttttgtt--att---gttatccttt
B D                    Baboon  tga----ttttgtt--att---gttatccttt
B D              Green monkey  tga----ttttgtt--att---gttatccttt
B D                  Marmoset  tgatttttttttttaaatt---attatccttt
B D           Squirrel monkey  -------ttttttt--att---gttatccttt
                 Prairie vole  tgat---ttttatt--ctt---gta-tgtgct
B D           Chinese hamster  tgag---ttttatt--ctt---gcactttgct
               Golden hamster  tgag---tttt---------------------
B D                     Mouse  tgat---ttttatt--ctt---gtaatttgct
B D                       Rat  agat---ttttatt--c-t---gtaatattct
B D            Naked mole-rat  tga----ttctctc--ctt---gttattcttt
B D                Guinea pig  tga----tttcatc--ctt---gctattcttt
                   Chinchilla  tga----ttttatc--ctt---gttattcttt
             Brush-tailed rat  taa----ttttatc--ctt---gttattcttt
B D                    Rabbit  tgt----ttttatt--ctt---gttatccttt
B D                      Pika  ----------tggt--ttt---gttacacttt
B D                    Alpaca  tga----ttttgtt--act---gttatttgct
               Bactrian camel  tga----ttttgtt--att---gttatttgct
B D                   Dolphin  tga----ttttatt--att---gttcttggct
                 Killer whale  tga----ttttact--att---gttcttggct
             Tibetan antelope  taa----ttttatt--att---gctatttgct
B D                       Cow  tga----ttttatt--att---gctatttgct
B D                     Sheep  tga----ttttatt--att---gctatttgct
                Domestic goat  tga----ttttatt--att---gctatttgct
B D                     Horse  tga----------t--att---attatttgtt
B D          White rhinoceros  aga----tt---tt--gtt---actatttgtt
B D                       Cat  tga----ttttatt--att---gttacttatg
B D                       Dog  tga----ttctatt--ctt---gttacttgtt
B D                   Ferret   tga----ttatatt--att---gttac---tt
B D                     Panda  tga----ttatatt--att---gttacttgtt
               Pacific walrus  tga----ttatatt--gtt---gttacttgtt
                 Weddell seal  tga----ttatatt--gtt---gtcacttgtt
             Black flying-fox  tga----ttttatt--att---gttatttgtt
B D                   Megabat  tga----ttttatt--att---gttatttgtt
                Big brown bat  tgat---ttttatt--att---gttatttgtt
         David's myotis (bat)  tgat---ttttgtc--att---gttatttgtt
B D                  Microbat  tgat---ttttatc--att---gttatttgtt
B D                     Shrew  --a---------------------tatttgca
B D                  Elephant  tga----ttttatt--gtt---ggtatctttt
          Cape elephant shrew  tga----tttattt--gctctgtttatcgtct
B D                   Manatee  tga----ttttatt--gtt---gttgtctttt
                     Aardvark  tgg----ttttatt--gtt---gttttcattt
B D                 Armadillo  tga----ttttatt--att---gttatctgtt
      Lesser Egyptian jerboa  ================================
B D                    Tenrec  ================================
B D                  Hedgehog  ================================
             Star-nosed mole  ================================
B D                  Bushbaby  ================================
          Chinese tree shrew  ================================
B D                  Squirrel  ================================
B D                       Pig  ================================
B D                    Turkey  ================================
B D                   Chicken  ================================
  D             Scarlet macaw  ================================
B D                Budgerigar  ================================
          Tibetan ground jay  ================================
  D          Peregrine falcon  ================================
  D              Saker falcon  ================================
  D               Rock pigeon  ================================
B D       Medium ground finch  ================================
  D              Mallard duck  ================================
  D                    Parrot  ================================
  D    White-throated sparrow  ================================
            Cape golden mole  ================================
  D    Spiny softshell turtle  ================================
  D  Chinese softshell turtle  ================================
  D            Painted turtle  ================================
  D           Green seaturtle  ================================
B D           Tasmanian devil  ================================
B D                   Opossum  ================================
B D        American alligator  ================================
B D               Zebra finch  ================================
  D       Collared flycatcher  ================================

Inserts between block 6 and 7 in window
B D                 Elephant 2229bp
B D                  Manatee 875bp
                    Aardvark 1785bp

Alignment block 7 of 34 in window, 67912348 - 67912361, 14 bps 
B D                     Human  -gagttt-ttatggta
B D                     Chimp  -gagttt-ttatggta
B D                   Gorilla  -gagttt-ttatgata
B D                 Orangutan  -gagttg-ttatggta
B D                    Gibbon  -gagttt-ttatggta
B D                    Rhesus  -gagtgt-ttactgta
B D       Crab-eating macaque  -gagtgt-ttactgta
B D                    Baboon  -gagtgt-ttactgta
B D              Green monkey  -gagtgt-ttactgta
B D                  Marmoset  -gagttt-ttactgtg
B D           Squirrel monkey  -gagttt-ttactgtg
                 Prairie vole  -ag---t-ttcctgtg
B D           Chinese hamster  -agt--t-ttcctgtg
B D                     Mouse  -agt--t-ttcctgtg
B D                       Rat  -ggt--t-tagctgcg
B D            Naked mole-rat  -gagtgt-ttaccatg
B D                Guinea pig  -gactgt-ttaccatg
                   Chinchilla  -gagcat-tcccaatg
             Brush-tailed rat  -gagtgt-ttactata
B D                    Rabbit  -gagttt-ttaccatg
B D                      Pika  -gaactt-ttactgcg
B D                    Alpaca  -gagttt-ttagtatg
               Bactrian camel  -gagttt-ttagtatg
B D                   Dolphin  -gagttt-ttactg--
                 Killer whale  -gagttt-ttactg--
             Tibetan antelope  -gagttt-ttagtgta
B D                       Cow  -gagttt-ttactgtg
B D                     Sheep  -gagttt-ttagtgtg
                Domestic goat  -gagttt-ttagtgtg
B D                     Horse  -gagttt-ttactatg
B D          White rhinoceros  -gagctt-ttactatg
B D                       Cat  -gag-tt-ttactgtg
B D                       Dog  -gag-tt-ttacttag
B D                   Ferret   -gag-tt-ttacctag
B D                     Panda  -gag-tt-ttacttag
               Pacific walrus  -gag-tt-ttacttcg
                 Weddell seal  -gag-tt-ttacttcg
             Black flying-fox  -gagttt-ttactatg
B D                   Megabat  -gagttt-ttactatg
                Big brown bat  -gagttt-ttagtatg
         David's myotis (bat)  -gagttt-ttagtatg
B D                  Microbat  -gagttt-ttagtatg
B D                     Shrew  -g---tt-ttagtatg
          Cape elephant shrew  tgattttagtgtta--
B D                 Armadillo  -gatttt-ttacta--
      Lesser Egyptian jerboa  ================
B D                    Tenrec  ================
B D                  Hedgehog  ================
              Golden hamster  ----------------
             Star-nosed mole  ================
B D                   Manatee  ================
B D                  Bushbaby  ================
B D                  Elephant  ================
          Chinese tree shrew  ================
B D                  Squirrel  ================
B D                       Pig  ================
B D                    Turkey  ================
B D                   Chicken  ================
  D             Scarlet macaw  ================
B D                Budgerigar  ================
          Tibetan ground jay  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
  D               Rock pigeon  ================
B D       Medium ground finch  ================
  D              Mallard duck  ================
  D                    Parrot  ================
  D    White-throated sparrow  ================
                    Aardvark  ================
            Cape golden mole  ================
  D    Spiny softshell turtle  ================
  D  Chinese softshell turtle  ================
  D            Painted turtle  ================
  D           Green seaturtle  ================
B D           Tasmanian devil  ================
B D                   Opossum  ================
B D        American alligator  ================
B D               Zebra finch  ================
  D       Collared flycatcher  ================

Inserts between block 7 and 8 in window
         Cape elephant shrew 2bp
B D                Armadillo 2bp

Alignment block 8 of 34 in window, 67912362 - 67912394, 33 bps 
B D                     Human  cactaggcatta--------------------------------tgct---------------aggta-t
B D                     Chimp  cactaggcatta--------------------------------tgct---------------aggta-t
B D                   Gorilla  cactaggcatta--------------------------------tgct---------------aggtact
B D                 Orangutan  cactaggcatta--------------------------------tgct---------------aggtacc
B D                    Gibbon  cactaggcatta--------------------------------tgct---------------aggtact
B D                    Rhesus  tgctaggcatta--------------------------------tgct---------------aggtaat
B D       Crab-eating macaque  tgctaggcatta--------------------------------tgct---------------aggtaat
B D                    Baboon  tgctaggcatta--------------------------------tgct---------------aggtaat
B D              Green monkey  tgctaggcatta--------------------------------tgct---------------aggtaat
B D                  Marmoset  cactaggcatta--------------------------------tgct---------------agatact
B D           Squirrel monkey  cactaggcatta--------------------------------tgct---------------agatact
                 Prairie vole  tgttaggcttta--------------------------------tggt---------------agagact
B D           Chinese hamster  tgctaggcttca--------------------------------tgat---------------agaggct
               Golden hamster  --ctaggcttta--------------------------------tggt---------------agagact
B D                     Mouse  tgctagactttt--------------------------------ccat---------------ggaggct
B D                       Rat  tgctaggcttta--------------------------------tggt---------------ggaggct
B D            Naked mole-rat  catttggcatta--------------------------------tgct---------------aagtaca
B D                Guinea pig  catttggcatta--------------------------------tggt---------------aattaca
                   Chinchilla  catttggcctta--------------------------------tgat---------------aagtaca
             Brush-tailed rat  catttggcatta--------------------------------tggt----------------atcaca
B D                    Rabbit  tgtgagggatta--------------------------------cact---------------aggtact
B D                      Pika  tttggtggatta--------------------------------tgct---------------aggtact
B D                    Alpaca  tgttaggcatta--------------------------------tgtt---------------acttatg
               Bactrian camel  tgttaggcatta--------------------------------tgtt---------------acttatg
B D                   Dolphin  tgttaggcatta--------------------------------tgtt---------------agttact
                 Killer whale  tgttaggcatta--------------------------------tgtt---------------agttact
             Tibetan antelope  tgttaggcatta--------------------------------tgct---------------agttact
B D                       Cow  tgttaggcatta--------------------------------tgct---------------agttact
B D                     Sheep  tgttagccatta--------------------------------tgct---------------agttact
                Domestic goat  tgttaggcatta--------------------------------tgct---------------agttact
B D                     Horse  tgctagacattatgctagttttatatttatgctagttactagtatgctagtaacttatcatacagttact
B D          White rhinoceros  tgctaggcattat-------------------------------tgct---------------agttact
B D                       Cat  tgctaggcatta--------------------------------tgct---------------aattcct
B D                       Dog  tgcttggcatta--------------------------------tgct---------------aattact
B D                   Ferret   tgctaggtatta--------------------------------tgct---------------aattact
B D                     Panda  tgctaggcatta--------------------------------tgct---------------aattaca
               Pacific walrus  tgctaggcatta--------------------------------tgct---------------aattaca
                 Weddell seal  tgctaggcatta--------------------------------tgct---------------aattaca
             Black flying-fox  tgctaggtatta--------------------------------tgct---------------agttact
B D                   Megabat  tgctaggtatta--------------------------------tgct---------------agttact
                Big brown bat  tgttaggcatta--------------------------------tgct---------------aattact
         David's myotis (bat)  tgctaggcatta--------------------------------tgct---------------aattact
B D                  Microbat  tgctaggcatta--------------------------------tgct---------------aattact
B D                     Shrew  tggtaggccttg--------------------------------ttct---------------tattact
B D                 Armadillo  tgctaggcatta--------------------------------tgat---------------agctact
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
             Star-nosed mole  ======================================================================
B D                   Manatee  ======================================================================
B D                  Bushbaby  ======================================================================
B D                  Elephant  ======================================================================
          Chinese tree shrew  ======================================================================
B D                  Squirrel  ======================================================================
B D                       Pig  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
  D              Mallard duck  ======================================================================
  D                    Parrot  ======================================================================
  D    White-throated sparrow  ======================================================================
                    Aardvark  ======================================================================
            Cape golden mole  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================

                        Human  atga-a-aatat-g
                        Chimp  atga-a-aatat-g
                      Gorilla  atga-a-aatat-g
                    Orangutan  atga-a-catat-g
                       Gibbon  atga-g-catat-g
                       Rhesus  atga-a-aatat-g
          Crab-eating macaque  atga-a-aatat-g
                       Baboon  atga-a-aatat-g
                 Green monkey  atga-a-aatat-g
                     Marmoset  atga-a-aatat-a
              Squirrel monkey  gtga-a-aatat-g
                 Prairie vole  gtca-a-aatga-a
              Chinese hamster  gtca-a-aatga-a
               Golden hamster  gtca-a-aatga-a
                        Mouse  gtga-a-aatga-a
                          Rat  gtaaga-aatga-a
               Naked mole-rat  gtga-a-aattt-a
                   Guinea pig  atga-a-aattt-a
                   Chinchilla  atga-a-aattt-a
             Brush-tailed rat  atga-a-aattt-a
                       Rabbit  atga-c-agttt-c
                         Pika  ---------tct-t
                       Alpaca  atga-a-aattt-a
               Bactrian camel  atga-a-aattt-a
                      Dolphin  atga-a-aattt-c
                 Killer whale  atga-a-aattt-c
             Tibetan antelope  atga-a-aattt-a
                          Cow  atga-g-cattt-a
                        Sheep  atga-a-aattt-a
                Domestic goat  atga-a-aattt-a
                        Horse  atga-a-aattt-c
             White rhinoceros  atga-a-aattt-a
                          Cat  atga-a-aattt-a
                          Dog  atga-a-aattt-a
                      Ferret   agga-a-aattt-a
                        Panda  atga-a-aattt-a
               Pacific walrus  gtga-a-aattt-a
                 Weddell seal  atga-a-aattt-a
             Black flying-fox  atga-a-aattt-a
                      Megabat  atga-a-aattt-a
                Big brown bat  ctga-g-aatttaa
         David's myotis (bat)  ctga-a-aattt-a
                     Microbat  ctga-a-aattt-a
                        Shrew  acga-a-aatat-a
                    Armadillo  atga-ataattt-a
       Lesser Egyptian jerboa  ==============
                       Tenrec  ==============
          Cape elephant shrew  ==============
                     Hedgehog  ==============
              Star-nosed mole  ==============
                      Manatee  ==============
                     Bushbaby  ==============
                     Elephant  ==============
           Chinese tree shrew  ==============
                     Squirrel  ==============
                          Pig  ==============
                       Turkey  ==============
                      Chicken  ==============
                Scarlet macaw  ==============
                   Budgerigar  ==============
           Tibetan ground jay  ==============
             Peregrine falcon  ==============
                 Saker falcon  ==============
                  Rock pigeon  ==============
          Medium ground finch  ==============
                 Mallard duck  ==============
                       Parrot  ==============
       White-throated sparrow  ==============
                     Aardvark  ==============
             Cape golden mole  ==============
       Spiny softshell turtle  ==============
     Chinese softshell turtle  ==============
               Painted turtle  ==============
              Green seaturtle  ==============
              Tasmanian devil  ==============
                      Opossum  ==============
           American alligator  ==============
                  Zebra finch  ==============
          Collared flycatcher  ==============

Alignment block 9 of 34 in window, 67912395 - 67912399, 5 bps 
B D                     Human  tctct
B D                     Chimp  tctct
B D                   Gorilla  tctct
B D                 Orangutan  tctct
B D                    Gibbon  tctct
B D                    Rhesus  tctct
B D       Crab-eating macaque  tctct
B D                    Baboon  tctct
B D              Green monkey  tctct
B D                  Marmoset  tctct
B D           Squirrel monkey  tctct
       Lesser Egyptian jerboa  tttct
                 Prairie vole  gctct
B D           Chinese hamster  gctct
               Golden hamster  gttct
B D                     Mouse  gctct
B D                       Rat  gctgt
B D            Naked mole-rat  --gac
B D                Guinea pig  --tct
                   Chinchilla  --tct
             Brush-tailed rat  --tct
B D                    Rabbit  tcttg
B D                      Pika  tcttt
B D                    Alpaca  tctgt
               Bactrian camel  tctgt
B D                   Dolphin  tctct
                 Killer whale  tctct
             Tibetan antelope  tctct
B D                       Cow  tctct
B D                     Sheep  tctct
                Domestic goat  tctct
B D                     Horse  tctct
B D          White rhinoceros  tctct
B D                       Cat  tctct
B D                       Dog  tctct
B D                   Ferret   tctct
B D                     Panda  tctct
               Pacific walrus  tctct
                 Weddell seal  tctct
             Black flying-fox  tctcg
B D                   Megabat  tctcg
                Big brown bat  tctct
         David's myotis (bat)  tttct
B D                  Microbat  tctct
B D                     Shrew  ctttt
B D                 Armadillo  ttcct
B D                    Tenrec  =====
         Cape elephant shrew  =====
B D                  Hedgehog  =====
             Star-nosed mole  =====
B D                   Manatee  =====
B D                  Bushbaby  =====
B D                  Elephant  =====
          Chinese tree shrew  =====
B D                  Squirrel  =====
B D                       Pig  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D             Scarlet macaw  =====
B D                Budgerigar  =====
          Tibetan ground jay  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D               Rock pigeon  =====
B D       Medium ground finch  =====
  D              Mallard duck  =====
  D                    Parrot  =====
  D    White-throated sparrow  =====
                    Aardvark  =====
            Cape golden mole  =====
  D    Spiny softshell turtle  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D           Tasmanian devil  =====
B D                   Opossum  =====
B D        American alligator  =====
B D               Zebra finch  =====
  D       Collared flycatcher  =====

Inserts between block 9 and 10 in window
B D                   Alpaca 34bp
              Bactrian camel 34bp
B D                  Dolphin 34bp
                Killer whale 34bp
            Tibetan antelope 36bp
B D                      Cow 36bp
B D                    Sheep 36bp
               Domestic goat 36bp
B D                    Horse 34bp
B D         White rhinoceros 34bp
B D                      Cat 33bp
B D                      Dog 34bp
B D                  Ferret  34bp
B D                    Panda 34bp
              Pacific walrus 34bp
                Weddell seal 34bp
            Black flying-fox 22bp
B D                  Megabat 22bp
               Big brown bat 22bp
        David's myotis (bat) 22bp
B D                 Microbat 22bp
B D                    Shrew 2991bp

Alignment block 10 of 34 in window, 67912400 - 67912421, 22 bps 
B D                     Human  --------------------------------------------------------------aatc--cc
B D                     Chimp  --------------------------------------------------------------aatc--cc
B D                   Gorilla  --------------------------------------------------------------aatc--cc
B D                 Orangutan  --------------------------------------------------------------aatc--cc
B D                    Gibbon  --------------------------------------------------------------aatc--cc
B D                    Rhesus  --------------------------------------------------------------aatc--cc
B D       Crab-eating macaque  --------------------------------------------------------------aatc--cc
B D                    Baboon  --------------------------------------------------------------aatc--cc
B D              Green monkey  --------------------------------------------------------------aatc--cc
B D                  Marmoset  --------------------------------------------------------------aatc--ct
B D           Squirrel monkey  --------------------------------------------------------------aatc--ct
       Lesser Egyptian jerboa  --------------------------------------------------------------aatc--ta
                 Prairie vole  --------------------------------------------------------------tctg--tc
B D           Chinese hamster  --------------------------------------------------------------actg--cc
               Golden hamster  --------------------------------------------------------------actg--ct
B D                     Mouse  --------------------------------------------------------------cctg--cc
B D                       Rat  --------------------------------------------------------------actg--tc
B D            Naked mole-rat  --------------------------------------------------------------ataa--t-
B D                Guinea pig  --------------------------------------------------------------ctaatctc
                   Chinchilla  --------------------------------------------------------------ctag--tc
             Brush-tailed rat  --------------------------------------------------------------ctga--tc
B D                    Rabbit  --------------------------------------------------------------agtt--cc
B D                      Pika  --------------------------------------------------------------aacc--ct
B D                    Alpaca  --------------------------------------------------------------tatc--cc
               Bactrian camel  --------------------------------------------------------------tatc--cc
B D                   Dolphin  --------------------------------------------------------------tatc--cg
                 Killer whale  --------------------------------------------------------------tatc--cg
             Tibetan antelope  --------------------------------------------------------------tatt--tc
B D                       Cow  --------------------------------------------------------------tatt--tc
B D                     Sheep  --------------------------------------------------------------tatt--tc
                Domestic goat  --------------------------------------------------------------tatt--tc
B D                     Horse  --------------------------------------------------------------tatc--cc
B D          White rhinoceros  --------------------------------------------------------------tatc--tc
B D                       Cat  --------------------------------------------------------------tatc--cc
B D                       Dog  --------------------------------------------------------------tatc--cc
B D                   Ferret   --------------------------------------------------------------tatc--cc
B D                     Panda  --------------------------------------------------------------tatc--ct
               Pacific walrus  --------------------------------------------------------------tatc--cc
                 Weddell seal  --------------------------------------------------------------tatc--cc
             Black flying-fox  --------------------------------------------------------------aatc--ct
B D                   Megabat  --------------------------------------------------------------aatc--ct
                Big brown bat  --------------------------------------------------------------tatc--cc
         David's myotis (bat)  --------------------------------------------------------------tatc--cc
B D                  Microbat  --------------------------------------------------------------tatc--cc
B D                 Armadillo  aattcttttcagaattacccagaattttaattttcagagttactctaaaaagtagatcatttattc--cc
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
             Star-nosed mole  ======================================================================
B D                   Manatee  ======================================================================
B D                  Bushbaby  ======================================================================
B D                  Elephant  ======================================================================
          Chinese tree shrew  ======================================================================
B D                  Squirrel  ======================================================================
B D                       Pig  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
  D              Mallard duck  ======================================================================
  D                    Parrot  ======================================================================
  D    White-throated sparrow  ======================================================================
                    Aardvark  ======================================================================
            Cape golden mole  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================

                        Human  tgttttagacatgata
                        Chimp  tgttttagacatgata
                      Gorilla  tgttttagacatgata
                    Orangutan  tgttttagacatgata
                       Gibbon  tgttttagacatgata
                       Rhesus  tgttttagacatgata
          Crab-eating macaque  tgttttagacatgata
                       Baboon  tgttttagacatgata
                 Green monkey  tgttttagacatgata
                     Marmoset  tattttagacgggata
              Squirrel monkey  tattttagacgtgata
       Lesser Egyptian jerboa  cattgcagacatgata
                 Prairie vole  cattttagacatggta
              Chinese hamster  cattttagacatgata
               Golden hamster  catcttagacatgata
                        Mouse  cacgttagacgagata
                          Rat  catttgagatgtgata
               Naked mole-rat  ---------------a
                   Guinea pig  cattttagacataata
                   Chinchilla  cattttagac-----a
             Brush-tailed rat  cattttagac-----a
                       Rabbit  cattttagacataata
                         Pika  cgttttgtttgtgaca
                       Alpaca  cattttggacacaata
               Bactrian camel  cattttggacacaata
                      Dolphin  cattttagac------
                 Killer whale  cattttagacatgata
             Tibetan antelope  cattttagacatgata
                          Cow  cattttagacatgata
                        Sheep  cattttagacatgata
                Domestic goat  cattttagacatgata
                        Horse  cattttagtcttgata
             White rhinoceros  cattttagtcatgata
                          Cat  tattttagacatgata
                          Dog  tattttagacatgata
                      Ferret   tattttagacttgata
                        Panda  tatcttagacatgata
               Pacific walrus  tattttagacatgata
                 Weddell seal  tattttagacatgata
             Black flying-fox  cattttagacatgata
                      Megabat  cattttagacatgata
                Big brown bat  cattttagacacgata
         David's myotis (bat)  cattttagacacaata
                     Microbat  cattttagacacgata
                    Armadillo  cattttagatgtgata
                       Tenrec  ================
          Cape elephant shrew  ================
                     Hedgehog  ================
                        Shrew  ================
              Star-nosed mole  ================
                      Manatee  ================
                     Bushbaby  ================
                     Elephant  ================
           Chinese tree shrew  ================
                     Squirrel  ================
                          Pig  ================
                       Turkey  ================
                      Chicken  ================
                Scarlet macaw  ================
                   Budgerigar  ================
           Tibetan ground jay  ================
             Peregrine falcon  ================
                 Saker falcon  ================
                  Rock pigeon  ================
          Medium ground finch  ================
                 Mallard duck  ================
                       Parrot  ================
       White-throated sparrow  ================
                     Aardvark  ================
             Cape golden mole  ================
       Spiny softshell turtle  ================
     Chinese softshell turtle  ================
               Painted turtle  ================
              Green seaturtle  ================
              Tasmanian devil  ================
                      Opossum  ================
           American alligator  ================
                  Zebra finch  ================
          Collared flycatcher  ================

Inserts between block 10 and 11 in window
B D                     Pika 3746bp

Alignment block 11 of 34 in window, 67912422 - 67912440, 19 bps 
B D                     Human  acattgaggctagagagat
B D                     Chimp  acattgaggctagagagat
B D                   Gorilla  acattgaggctagagagat
B D                 Orangutan  acattgaggctagagagat
B D                    Gibbon  acattgaggctagagagat
B D                    Rhesus  acattgaggctagagagat
B D       Crab-eating macaque  acattgaggctagagagat
B D                    Baboon  acattgaggctagagagat
B D              Green monkey  acattgaggctagagagat
B D                  Marmoset  acattgaggctagagagat
B D           Squirrel monkey  acattgaggctagagagat
       Lesser Egyptian jerboa  aaattaa---ttgacagat
                 Prairie vole  aaattgaggctagggagat
B D           Chinese hamster  aaattgaggccaggaagat
               Golden hamster  aaattgacatcaggaagat
B D                     Mouse  aaattgagactgggaagat
B D                       Rat  aaattgaggctagggaggt
B D            Naked mole-rat  aaattgaagctagagagat
B D                Guinea pig  aagttgaagcta--gagat
                   Chinchilla  aaattgaagctagagagat
             Brush-tailed rat  aaaat---------tagat
B D                    Rabbit  aaattaaggctggagatat
B D                    Alpaca  aaattgaggctagagagat
               Bactrian camel  aaattgaggctagagagat
B D                   Dolphin  -aattgaggctagagggag
                 Killer whale  aaattgaggctagagggag
             Tibetan antelope  aaattg------gagagat
B D                       Cow  aaattggggctagagagat
B D                     Sheep  aaattggggctagagagat
                Domestic goat  aaattggggctagagagat
B D                     Horse  aaattgaggcaagagaggt
B D          White rhinoceros  aaattgaggctagagagat
B D                       Cat  aaactgagtctagagagat
B D                       Dog  aaattgagtccagagagat
B D                   Ferret   taattgagtctagagagat
B D                     Panda  aaattgaatccagagagat
               Pacific walrus  acattgagtctagagagat
                 Weddell seal  acattgagtctagagagat
             Black flying-fox  aaattgaggatagagag--
B D                   Megabat  aaattgaggatagagag--
                Big brown bat  aaattgaggctagaaaggt
         David's myotis (bat)  aaattgaggctagaaaggt
B D                  Microbat  aaattgaagctagaaaggt
B D                 Armadillo  aaattgaggctagagagat
B D                    Tenrec  ===================
         Cape elephant shrew  ===================
B D                  Hedgehog  ===================
B D                     Shrew  ===================
             Star-nosed mole  ===================
B D                      Pika  ===================
B D                   Manatee  ===================
B D                  Bushbaby  ===================
B D                  Elephant  ===================
          Chinese tree shrew  ===================
B D                  Squirrel  ===================
B D                       Pig  ===================
B D                    Turkey  ===================
B D                   Chicken  ===================
  D             Scarlet macaw  ===================
B D                Budgerigar  ===================
          Tibetan ground jay  ===================
  D          Peregrine falcon  ===================
  D              Saker falcon  ===================
  D               Rock pigeon  ===================
B D       Medium ground finch  ===================
  D              Mallard duck  ===================
  D                    Parrot  ===================
  D    White-throated sparrow  ===================
                    Aardvark  ===================
            Cape golden mole  ===================
  D    Spiny softshell turtle  ===================
  D  Chinese softshell turtle  ===================
  D            Painted turtle  ===================
  D           Green seaturtle  ===================
B D           Tasmanian devil  ===================
B D                   Opossum  ===================
B D        American alligator  ===================
B D               Zebra finch  ===================
  D       Collared flycatcher  ===================

Inserts between block 11 and 12 in window
B D          Chinese hamster 8610bp

Alignment block 12 of 34 in window, 67912441 - 67912448, 8 bps 
B D                     Human  tatgtaac
B D                     Chimp  tatgtaac
B D                   Gorilla  tatgtaac
B D                 Orangutan  tatgtaac
B D                    Gibbon  tatgtaac
B D                    Rhesus  tatgtaac
B D       Crab-eating macaque  tatgtaac
B D                    Baboon  tatgtaac
B D              Green monkey  tatgtaac
B D                  Marmoset  tatgtaac
B D           Squirrel monkey  tatgtaac
       Lesser Egyptian jerboa  taagtaac
                 Prairie vole  gaagtaac
               Golden hamster  gcagtaac
B D                     Mouse  gaagtaac
B D                       Rat  gaa-taac
B D            Naked mole-rat  tgtttaac
B D                Guinea pig  taaataa-
                   Chinchilla  taagtaac
             Brush-tailed rat  taagtaac
B D                    Rabbit  -gaataac
B D                    Alpaca  tacataac
               Bactrian camel  tacgtaac
B D                   Dolphin  taagtaac
                 Killer whale  taagtaac
             Tibetan antelope  ttagta--
B D                       Cow  tcatta--
B D                     Sheep  tcagta--
                Domestic goat  tcagta--
B D                     Horse  taagtaag
B D          White rhinoceros  taagtaac
B D                       Cat  taagtaac
B D                       Dog  taagtgac
B D                   Ferret   tagatatc
B D                     Panda  taagtagc
               Pacific walrus  taagtagc
                 Weddell seal  taagtagc
             Black flying-fox  taagtaat
B D                   Megabat  taagtaat
                Big brown bat  taaataat
         David's myotis (bat)  taaataat
B D                  Microbat  taaataat
B D                 Armadillo  taagtaat
B D                    Tenrec  ========
         Cape elephant shrew  ========
B D                  Hedgehog  ========
B D                     Shrew  ========
B D           Chinese hamster  ========
             Star-nosed mole  ========
B D                      Pika  ========
B D                   Manatee  ========
B D                  Bushbaby  ========
B D                  Elephant  ========
          Chinese tree shrew  ========
B D                  Squirrel  ========
B D                       Pig  ========
B D                    Turkey  ========
B D                   Chicken  ========
  D             Scarlet macaw  ========
B D                Budgerigar  ========
          Tibetan ground jay  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D               Rock pigeon  ========
B D       Medium ground finch  ========
  D              Mallard duck  ========
  D                    Parrot  ========
  D    White-throated sparrow  ========
                    Aardvark  ========
            Cape golden mole  ========
  D    Spiny softshell turtle  ========
  D  Chinese softshell turtle  ========
  D            Painted turtle  ========
  D           Green seaturtle  ========
B D           Tasmanian devil  ========
B D                   Opossum  ========
B D        American alligator  ========
B D               Zebra finch  ========
  D       Collared flycatcher  ========

Inserts between block 12 and 13 in window
              Golden hamster 14746bp

Alignment block 13 of 34 in window, 67912449 - 67912456, 8 bps 
B D                     Human  atgcagaa
B D                     Chimp  atgcagaa
B D                   Gorilla  atgcagaa
B D                 Orangutan  atgcagaa
B D                    Gibbon  atgcagaa
B D                    Rhesus  atgcagaa
B D       Crab-eating macaque  atgcagaa
B D                    Baboon  atgcagaa
B D              Green monkey  atgcagaa
B D                  Marmoset  atgcaaaa
B D           Squirrel monkey  atccagag
       Lesser Egyptian jerboa  --acaaag
                 Prairie vole  --tcagaa
B D                     Mouse  --acagaa
B D                       Rat  --acagaa
B D            Naked mole-rat  -accag-a
B D                Guinea pig  -cccagga
                   Chinchilla  -cccagaa
             Brush-tailed rat  -cccagga
B D                    Rabbit  -------a
B D                    Alpaca  actcctaa
               Bactrian camel  actcctaa
B D                   Dolphin  actcccaa
                 Killer whale  actcccaa
             Tibetan antelope  actcccaa
B D                       Cow  actcccaa
B D                     Sheep  actcccaa
                Domestic goat  actcccaa
B D                     Horse  actaccaa
B D          White rhinoceros  acttccaa
B D                       Cat  acttccaa
B D                       Dog  acttctaa
B D                   Ferret   acttctaa
B D                     Panda  acttctaa
               Pacific walrus  acttctaa
                 Weddell seal  acttctaa
             Black flying-fox  actcccag
B D                   Megabat  actcccag
                Big brown bat  actcccaa
         David's myotis (bat)  actcccca
B D                  Microbat  actcccaa
B D                 Armadillo  atgcccaa
B D                    Tenrec  ========
         Cape elephant shrew  ========
B D                  Hedgehog  ========
B D                     Shrew  ========
              Golden hamster  ========
B D           Chinese hamster  ========
             Star-nosed mole  ========
B D                      Pika  ========
B D                   Manatee  ========
B D                  Bushbaby  ========
B D                  Elephant  ========
          Chinese tree shrew  ========
B D                  Squirrel  ========
B D                       Pig  ========
B D                    Turkey  ========
B D                   Chicken  ========
  D             Scarlet macaw  ========
B D                Budgerigar  ========
          Tibetan ground jay  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D               Rock pigeon  ========
B D       Medium ground finch  ========
  D              Mallard duck  ========
  D                    Parrot  ========
  D    White-throated sparrow  ========
                    Aardvark  ========
            Cape golden mole  ========
  D    Spiny softshell turtle  ========
  D  Chinese softshell turtle  ========
  D            Painted turtle  ========
  D           Green seaturtle  ========
B D           Tasmanian devil  ========
B D                   Opossum  ========
B D        American alligator  ========
B D               Zebra finch  ========
  D       Collared flycatcher  ========

Inserts between block 13 and 14 in window
      Lesser Egyptian jerboa 2bp
B D                    Mouse 3339bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 2bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp

Alignment block 14 of 34 in window, 67912457 - 67912460, 4 bps 
B D                     Human  -aatt
B D                     Chimp  -aatt
B D                   Gorilla  -aatt
B D                 Orangutan  -aatt
B D                    Gibbon  -aatt
B D                    Rhesus  -aatt
B D       Crab-eating macaque  -aatt
B D                    Baboon  -aatt
B D              Green monkey  -aatt
B D                  Marmoset  -aatt
B D           Squirrel monkey  -aatt
       Lesser Egyptian jerboa  -aat-
                 Prairie vole  ---t-
B D                       Rat  ---t-
B D            Naked mole-rat  -aat-
B D                Guinea pig  -aat-
                   Chinchilla  -aat-
             Brush-tailed rat  -aat-
B D                    Alpaca  -att-
               Bactrian camel  -att-
B D                   Dolphin  -atc-
                 Killer whale  -atc-
             Tibetan antelope  -atc-
B D                       Cow  -atc-
B D                     Sheep  -atc-
                Domestic goat  -atc-
B D                     Horse  -atc-
B D          White rhinoceros  -atc-
B D                       Cat  -atc-
B D                       Dog  -atc-
B D                   Ferret   -agc-
B D                     Panda  -agc-
               Pacific walrus  -agc-
                 Weddell seal  -agc-
             Black flying-fox  -att-
B D                   Megabat  -att-
                Big brown bat  -acc-
         David's myotis (bat)  -acc-
B D                  Microbat  -acc-
B D                 Armadillo  gatc-
B D                     Mouse  =====
B D                    Tenrec  =====
         Cape elephant shrew  =====
B D                  Hedgehog  =====
B D                     Shrew  =====
              Golden hamster  =====
B D           Chinese hamster  =====
             Star-nosed mole  =====
B D                      Pika  =====
B D                    Rabbit  =====
B D                   Manatee  =====
B D                  Bushbaby  =====
B D                  Elephant  =====
          Chinese tree shrew  =====
B D                  Squirrel  =====
B D                       Pig  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D             Scarlet macaw  =====
B D                Budgerigar  =====
          Tibetan ground jay  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D               Rock pigeon  =====
B D       Medium ground finch  =====
  D              Mallard duck  =====
  D                    Parrot  =====
  D    White-throated sparrow  =====
                    Aardvark  =====
            Cape golden mole  =====
  D    Spiny softshell turtle  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D           Tasmanian devil  =====
B D                   Opossum  =====
B D        American alligator  =====
B D               Zebra finch  =====
  D       Collared flycatcher  =====

Inserts between block 14 and 15 in window
      Lesser Egyptian jerboa 1bp
                Prairie vole 2bp
B D                      Rat 11470bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp

Alignment block 15 of 34 in window, 67912461 - 67912517, 57 bps 
B D                     Human  gtata---gttatatgaacccac-------ggctggtgctccc-aaaactcattcatccccttgagga
B D                     Chimp  gtata---gttatatgaacccat-------ggcgggtgctccc-aaaactcattcatccccttgagga
B D                   Gorilla  gtata---gttatatgaacccat-------ggctggtgctccc-aaaactcaatcatccccttgagga
B D                 Orangutan  gtata---gttatacgaacccat-------ggctgctgctccc-aaaactcattcatcaccttgagga
B D                    Gibbon  gtata---gttatacgaacccat-------ggctggtgctccc-aaaactcattcatccccttgagga
B D                    Rhesus  gtata---gttataagaacccat-------ggctggtgctccc-aaagctcattcatccccttgagga
B D       Crab-eating macaque  gtata---gttataagaacccat-------ggctggtgctccc-aaagctcattcatccccttgagga
B D                    Baboon  gtata---gttataagaacccat-------ggctggtgctccc-aaagctcattcatccccttgagga
B D              Green monkey  gtata---gttataagaacccat-------gggtggtgctccc-aaagctcattcatctgcttgagga
B D                  Marmoset  ttaca---attataggaacccac--------gctggtgttcac-caagcttaatcatccccttgagga
B D           Squirrel monkey  ttata---attataggaacccat-------ggctggtgttcac-aaagcttattcatccccttgagga
       Lesser Egyptian jerboa  ataca---gt--taggaaccctg-------ggctggtgctcca-aaagcctattcagctcctcaagga
                 Prairie vole  -cctg---gt--cagggacctag-------aacctaaacacc--ccagctccttcagctcctcggggg
B D            Naked mole-rat  ttata---gt--taggaattcag-------ga-tggtactccc-caacctcattcaggtcttcgagga
B D                Guinea pig  atgta---gt--tagaaattcag-------tg-tcgtgctccc-cacagtcattcaggtctcaaaaga
                   Chinchilla  atata---gt--taggaatttgg-------ga-tggtgctccc-caagctcattcaggtctctgagga
             Brush-tailed rat  atgta---gt--taggaattc-a-------aa-ttgtgttcccacaagcttattcatg--actgagga
B D                    Rabbit  ------------taagaacccag-------ga---gtggttct-----gtcatttagcccctcaagga
B D                    Alpaca  gtata---gtt---atagcccag-------gactagtgctccc--aggctcattcaggccttcacgga
               Bactrian camel  gtata---gtt---acagcccag-------gactggtgctccc--aagctcattcaggccctcacgga
B D                   Dolphin  atata---gtt---agagcccag-------gactggtgcaccc--aagctcattcaggtcctcaagga
                 Killer whale  atata---gtt---agagcccag-------gactggtgcaccc--aagctcattcgggtcctcaagga
             Tibetan antelope  atatatatgtt---agagcccat-------gagtggtataccc--aagctcattcaggccctcaagga
B D                       Cow  atatatatgtt---agagcctat-------gactggtatggag--aaggcaat---ggcacccca---
B D                     Sheep  atatatatgtt---agagcccat-------gagtggtataccc--aagctcattcaggccctcaagga
                Domestic goat  atatatatgtt---agagcccat-------gagtggtataccc--aagctcattcaggccctcaagga
B D                     Horse  atata---gtt---tgagcccag-------gactggtgctccc--aagcccactcaggccctcaagga
B D          White rhinoceros  atata---gtt---agagcccgg-------gactggtgcttcc--aagctcactcaggccctcaagga
B D                       Cat  atact---gtt---tgagcccag-------gactggcactccc--aggcacactcaggcactcgggga
B D                       Dog  ataca---gtt--aagagtccagaactggtaactggtactcct--aagctcattcaggcactcaagtg
B D                   Ferret   ataca---gtt---attgtccag-------gactggtactccc--aagctcattcaggcattcaagga
B D                     Panda  ataca---gtt---ggagtccag-------gactgacattccc--aagctcattcaggcactcaagga
               Pacific walrus  ataca---gtt--aagagtccag-------gactggtactccc--aagctcattcaggcactcaagga
                 Weddell seal  ataca---gtt---agagtccag-------gactggtactccc--aagctcattcaggcactcaagga
             Black flying-fox  gtata---gtt---agagcccag-------gactggtgctccc--aggcacagttaggccctcaagga
B D                   Megabat  gtata---gtt---agagcccag-------gactggtgctccc--aggcacagttaggccctcaagga
                Big brown bat  atgtc---gtt---ggg-cccag-------gactggtgctcct--gagcccacacaggcccttaagga
         David's myotis (bat)  atgta---gtt---gga-cccag-------gattggtgctcct--gagcccacacaggcccttaagga
B D                  Microbat  atgta---gtt---gga-cccag-------gactggtgctcct--gagcccacacaggcccataagga
B D                 Armadillo  --ata---gtt--aagaacccag-------aactggtactccc--aaacaaattcaggcccttaa---
B D                     Mouse  ====================================================================
B D                       Rat  ====================================================================
B D                    Tenrec  ====================================================================
         Cape elephant shrew  ====================================================================
B D                  Hedgehog  ====================================================================
B D                     Shrew  ====================================================================
              Golden hamster  ====================================================================
B D           Chinese hamster  ====================================================================
             Star-nosed mole  ====================================================================
B D                      Pika  ====================================================================
B D                   Manatee  ====================================================================
B D                  Bushbaby  ====================================================================
B D                  Elephant  ====================================================================
          Chinese tree shrew  ====================================================================
B D                  Squirrel  ====================================================================
B D                       Pig  ====================================================================
B D                    Turkey  ====================================================================
B D                   Chicken  ====================================================================
  D             Scarlet macaw  ====================================================================
B D                Budgerigar  ====================================================================
          Tibetan ground jay  ====================================================================
  D          Peregrine falcon  ====================================================================
  D              Saker falcon  ====================================================================
  D               Rock pigeon  ====================================================================
B D       Medium ground finch  ====================================================================
  D              Mallard duck  ====================================================================
  D                    Parrot  ====================================================================
  D    White-throated sparrow  ====================================================================
                    Aardvark  ====================================================================
            Cape golden mole  ====================================================================
  D    Spiny softshell turtle  ====================================================================
  D  Chinese softshell turtle  ====================================================================
  D            Painted turtle  ====================================================================
  D           Green seaturtle  ====================================================================
B D           Tasmanian devil  ====================================================================
B D                   Opossum  ====================================================================
B D        American alligator  ====================================================================
B D               Zebra finch  ====================================================================
  D       Collared flycatcher  ====================================================================

Inserts between block 15 and 16 in window
                Prairie vole 135bp

Alignment block 16 of 34 in window, 67912518 - 67912540, 23 bps 
B D                     Human  g-ttcagattctactgatt-gggag
B D                     Chimp  g-ttcagattctactgatt-gggag
B D                   Gorilla  g-ttcagattctactgact-gggag
B D                 Orangutan  g-ttcagattctactgatt-gggag
B D                    Gibbon  g-ttcagattttactgatt-gggag
B D                    Rhesus  g-ttcagattctactgact-gggag
B D       Crab-eating macaque  g-ttcagattctactgact-gggag
B D                    Baboon  g-ttcagattctactgact-gggag
B D              Green monkey  g-ttcagattctactgact-gggag
B D                  Marmoset  c-ttcagattctagtgatt-aggag
B D           Squirrel monkey  c-ttcagattctgctgatt-gggag
       Lesser Egyptian jerboa  --------ctt---taggt-gagaa
B D            Naked mole-rat  g-tttaaattt---tgagt-ggaat
B D                Guinea pig  gttttaaattt---tgggt-ggaat
                   Chinchilla  g-tttaaattt---tgggc-agaat
             Brush-tailed rat  g-tttaaattt---tgggt-ggaat
B D                    Rabbit  -gtttaagtttcactgagt-ggaag
B D                    Alpaca  g-tttaatttctactgaat-gggag
               Bactrian camel  g-tttaatttctactgaat-gggag
B D                   Dolphin  gttttgatttctactgagt-gggag
                 Killer whale  g-tttgatctctactgagt-gggag
             Tibetan antelope  gttttaatttttactgaat-gggag
B D                       Cow  --ctccagtactcttgcct-gggaa
B D                     Sheep  gttttaatttctactgaat-gggag
                Domestic goat  gttttaatttctactgaat-gggag
B D                     Horse  g-tttaaattctgctgagt-gggag
B D          White rhinoceros  g-tttaaattctactgagt-gggag
B D                       Cat  g-tttaatttctactgagt-gggag
B D                       Dog  g-tttaatttctactgagt-gggag
B D                   Ferret   g-tttaatttctacttagt-gggag
B D                     Panda  a-gttaatttctactgagtggggag
               Pacific walrus  g-tgtaatttctactgagt-gggaa
                 Weddell seal  g-tgtaatttctactgagt-gggag
             Black flying-fox  g-tttagtttctgctgatt-gggaa
B D                   Megabat  g-tttagtttctgctgatt-gggaa
                Big brown bat  g-cttcctctctactgaat-gggag
         David's myotis (bat)  g-cttcctctctactgaat-gggag
B D                  Microbat  g-----ctctctactgaat-gggac
B D                 Armadillo  --------ttcttctagga-gggag
B D                     Mouse  =========================
B D                       Rat  =========================
B D                    Tenrec  =========================
         Cape elephant shrew  =========================
B D                  Hedgehog  =========================
B D                     Shrew  =========================
                Prairie vole  =========================
              Golden hamster  =========================
B D           Chinese hamster  =========================
             Star-nosed mole  =========================
B D                      Pika  =========================
B D                   Manatee  =========================
B D                  Bushbaby  =========================
B D                  Elephant  =========================
          Chinese tree shrew  =========================
B D                  Squirrel  =========================
B D                       Pig  =========================
B D                    Turkey  =========================
B D                   Chicken  =========================
  D             Scarlet macaw  =========================
B D                Budgerigar  =========================
          Tibetan ground jay  =========================
  D          Peregrine falcon  =========================
  D              Saker falcon  =========================
  D               Rock pigeon  =========================
B D       Medium ground finch  =========================
  D              Mallard duck  =========================
  D                    Parrot  =========================
  D    White-throated sparrow  =========================
                    Aardvark  =========================
            Cape golden mole  =========================
  D    Spiny softshell turtle  =========================
  D  Chinese softshell turtle  =========================
  D            Painted turtle  =========================
  D           Green seaturtle  =========================
B D           Tasmanian devil  =========================
B D                   Opossum  =========================
B D        American alligator  =========================
B D               Zebra finch  =========================
  D       Collared flycatcher  =========================

Inserts between block 16 and 17 in window
B D                    Horse 8bp
B D         White rhinoceros 8bp
B D                      Cat 8bp
B D                      Dog 8bp
B D                  Ferret  217bp
B D                    Panda 8bp
              Pacific walrus 8bp
                Weddell seal 8bp
            Black flying-fox 8bp
B D                  Megabat 8bp
               Big brown bat 8bp
        David's myotis (bat) 8bp
B D                 Microbat 8bp

Alignment block 17 of 34 in window, 67912541 - 67912541, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
       Lesser Egyptian jerboa  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  t
B D                       Cow  a
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  a
B D          White rhinoceros  g
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                 Armadillo  a
B D                     Mouse  =
B D                       Rat  =
B D                    Tenrec  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
                Prairie vole  =
              Golden hamster  =
B D           Chinese hamster  =
             Star-nosed mole  =
B D                      Pika  =
B D                   Manatee  =
B D                  Bushbaby  =
B D                  Elephant  =
          Chinese tree shrew  =
B D                  Squirrel  =
B D                       Pig  =
B D                    Turkey  =
B D                   Chicken  =
  D             Scarlet macaw  =
B D                Budgerigar  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  =
  D              Mallard duck  =
  D                    Parrot  =
  D    White-throated sparrow  =
                    Aardvark  =
            Cape golden mole  =
  D    Spiny softshell turtle  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D           Tasmanian devil  =
B D                   Opossum  =
B D        American alligator  =
B D               Zebra finch  =
  D       Collared flycatcher  =

Inserts between block 17 and 18 in window
      Lesser Egyptian jerboa 8bp
B D           Naked mole-rat 8bp
B D               Guinea pig 8bp
                  Chinchilla 8bp
            Brush-tailed rat 8bp
B D                   Rabbit 8bp
B D                   Alpaca 8bp
              Bactrian camel 8bp
B D                  Dolphin 8bp
                Killer whale 8bp
            Tibetan antelope 8bp
B D                      Cow 454bp
B D                    Sheep 8bp
               Domestic goat 8bp

Alignment block 18 of 34 in window, 67912542 - 67912652, 111 bps 
B D                     Human  --------gaaagagctcactgtaatagaatgcaaa------------------atgtagtaaaaatttt
B D                     Chimp  --------gaaagagctcactgtaatagaatgcaaa------------------atgtagtaaaaatttt
B D                   Gorilla  --------gaaagagctcactgtaatagaatgcaaa------------------atgtagtaaaaatttt
B D                 Orangutan  --------gaaagagctcactataatagaatgcaaa------------------a-gtagtaaaaatttt
B D                    Gibbon  --------gaaagagctcactgtaatagaatgcaaa------------------atgtagtaaaaatttt
B D                    Rhesus  --------gaaagagctcactgtaatagaatgcaaa------------------atgt----aaaatttt
B D       Crab-eating macaque  --------gaaagagctcactgtaatagaatgcaaa------------------atgt----aaaatttt
B D                    Baboon  --------gaaagagctcactgtaatagaatgcaaa------------------atgtagtaaaaatttt
B D              Green monkey  --------gaaagagctcactgtaatagaatacaaa------------------atgtagtaaaaatttt
B D                  Marmoset  --------gaaatagctcactgtaatagagtgcaaa------------------atgtattaacaaattt
B D           Squirrel monkey  --------gaaacagctcactgtaatagagtgcaaa------------------atgtattaaaaatttt
       Lesser Egyptian jerboa  --------taactagctcattgcaatatagtgcaag------------------gtaaagaaaaaaattg
B D            Naked mole-rat  --------tgaacagctcact---------tgcaaa------------------atggag-aagaattta
B D                Guinea pig  --------tagacagcgcact---------cgcaaa------------------atggag-aagaattta
                   Chinchilla  --------taaacagc--------------------------------------atgg----agaactta
             Brush-tailed rat  --------taaaccgctcatt---------cacaaa------------------atgg----agaattta
B D                    Rabbit  --------taaacggttcattgtaa-----tatcct------------------gtgg------------
B D                    Alpaca  --------taaacatcacattgtaatacactgagag------------------atgaggtaaaatttta
               Bactrian camel  --------taaatagcacactgtaatacactgagag------------------atgaggtaagatttta
B D                   Dolphin  --------taaacagtacactgtaatacaatgagag------------------ataaagtaacattttt
                 Killer whale  --------taaacagtacactgtaatacaatgagag------------------ataaagtaacattttt
             Tibetan antelope  --------caaacagtgcactgtaataaaatgagag------------------ataaagtaaaatttta
B D                     Sheep  --------caaacggtgcactgtaataaaatgagag------------------ataaagtaaaatttta
                Domestic goat  --------caaacggtgcactgtaataaaatgagag------------------ataaagtaaaatttta
B D                     Horse  --------taaaaagctcactgtatttcaatgagag------------------atgaagtaaaattt--
B D          White rhinoceros  --------taaacagctcactgtcatacaatgcgag------------------atgaagtaaaattt--
B D                       Cat  --------taaacagctctctgtaatataatgcagg------------------atgaagtaaaatttt-
B D                       Dog  --------taaacaactcactgtaatataatgcaag------------------atgaagtaaaatttt-
B D                   Ferret   --------aaaacagctcactgtaatataatgcagg------------------atgaggtaaaatttt-
B D                     Panda  --------taaacatctcactgtaatataatgcatg------------------atgaagtaaaatttt-
               Pacific walrus  --------taaacagctcactg-aatataatgcagt------------------atgaagtaaaatttt-
                 Weddell seal  --------taaacagctcactg-aatataatgcagg------------------atgaagtaaaatttt-
             Black flying-fox  --------taaacagcttactataatataatgtgag------------------atgaagtaaaatta--
B D                   Megabat  --------taaacagcttactataatataatgtgag------------------atgaagtaaaatta--
                Big brown bat  --------taaacagctcct----gtacaatgtgagatgaagtaaaatttaaaaatgaagtaaaattt--
         David's myotis (bat)  --------taaacagttcct----gcacaatgtgag------------------atgaagtaaaattt--
B D                  Microbat  --------taaacagctcct----gtacaatgtgag------------------atgaagtaaaattt--
B D                 Armadillo  taggcatgtaaacagctcaatataatataatacaaa------------------a---------------
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
                Prairie vole  ======================================================================
              Golden hamster  ======================================================================
B D           Chinese hamster  ======================================================================
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
B D                   Manatee  ======================================================================
B D                       Cow  ======================================================================
B D                  Bushbaby  ======================================================================
B D                  Elephant  ======================================================================
          Chinese tree shrew  ======================================================================
B D                  Squirrel  ======================================================================
B D                       Pig  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
  D              Mallard duck  ======================================================================
  D                    Parrot  ======================================================================
  D    White-throated sparrow  ======================================================================
                    Aardvark  ======================================================================
            Cape golden mole  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================

                        Human  aaa-tgaagtaaatt-gtaaaagtagagataca-aaca--atttagtgagaacacagaggaagaagggat
                        Chimp  aaa-tgaaataaatt-gtaaaagtagagataca-aaca--atttagtgagaacacagaggaagaagggat
                      Gorilla  aaa-tgaagtaaatt-gtaaaagtagagataca-aaca--atttaatgagaacacagaggaagaagggat
                    Orangutan  aaa-tgaagtaaatt-ctaaaagtaaagataca-aaca--atttagtgagaacacagcggaagaagggat
                       Gibbon  aaa-tgaagtaaatt-gtaaaagtagagataca-aaca--atttagtgagaacacagaggaagaagggat
                       Rhesus  aaa-tgaagtaaatt-gtaaaagtagatataca-aaca--atttagtgagaacacagaggaagaagggat
          Crab-eating macaque  aaa-tgaagtaaatt-gtaaaagtagatataca-aaca--atttagtgagaacacagaggaagaagggat
                       Baboon  aaa-tgaagtaaatt-gtaaaagtagagatata-aaca--atttagtgagaacacagaggaagaagggat
                 Green monkey  aaa-tgaagtaaatt-gtaaaagtagagataca-aaca--atttagtgagaacacagaggaagaagggat
                     Marmoset  aaa-tgaattaaaat-g-aaaaatagagatgca-aaca--atttagtgagaacacagaggaggaagggat
              Squirrel monkey  aaa-tgaattaaaat-gtgaaagtagatatgca-aaca--atttagtgagaacacagaggaagaagggat
       Lesser Egyptian jerboa  aaagggaagcaaaat-ttaaagatataaatata-a------tttagtgagagcatagaggaaaaagggat
               Naked mole-rat  aaagtgaagtaaaaa-ttttgaaaggctatgca-a------tttagtgagaacatagaggatgaagtgat
                   Guinea pig  aaagtggggtaaaaa-ttttaaatagctataca-a------tgtagtgagaacatagaggaagaagtgat
                   Chinchilla  aaagtgaagtaaaa--ttttaaaacgctgtgca-a------tttagtgagaacatattggaagacgtgat
             Brush-tailed rat  aaagtgaaataaaaattttaaaaaagctatgca-a------cttaataaggccataaaggaagaagtgat
                       Rabbit  --attgaagtaagat-ttaaaaatagagataca-g-------acagtgaaagcatagaagaagggatga-
                       Alpaca  aaa-tgaagtaaaat-gtaaaactagagataca-agtaacatttagtgagtgtgtagaggaagaagggat
               Bactrian camel  aaa-tgaagtaaaat-ttaaaactagagataca-agtaacatttagtgagtgcgtagaggaagaggggat
                      Dolphin  aaa-tgaagaaaaat-ttaaagatagagataca-aat----------------gtagaggaagaggggat
                 Killer whale  aaa-tgaagaagaat-ttaaagatagagataca-aat----------------gtagaggaagagggg--
             Tibetan antelope  aaa-taaagtaaaat-ctaaagataga-ataca-aataacatttaatgaaagagtagaggaagagggaat
                        Sheep  aaa-taaagtaaaat-ctaaagataga-ataca-gataacatttagtgaaagagtagaggaagagggaat
                Domestic goat  aaa-taaagtaaaat-ctaaagataga-ataca-gataacatttaatgaaagagtagaggaagagggaat
                        Horse  ------------------aaaaataaagataca-aacaacatttactgagagcatagatgaagaagggat
             White rhinoceros  ------------------aaaaat--agataca-aacaacatttactgagagcagaaagtaaaaggggat
                          Cat  aag-tgaagta-agt-ttaaaaatggagataaa-aacaacatttagtgaaagcatagagtaagaggggat
                          Dog  aag-tgaagta-agt-taaaaaatagagataag-aacaacatttcgtgagagcatagaggagggggaggt
                      Ferret   aag-tgaagta-aat-ttaaaaatagagattaaaaacaacatttggtgagagcataaaagaaggagggat
                        Panda  gag-tgaagta-agt-ttaaaaatagagataaa-aacaacacttagtgagtgcatagaagaaggggggat
               Pacific walrus  aag-tgaggta-agt-ttaaaagtagagataaa----aacatttagtgagagcatagaagaagggggaat
                 Weddell seal  aag-tgaagta-agt-ttaaaaatagagataaa----aacatttagtgagagcatagaagaagggggaat
             Black flying-fox  ------------------aaaaatagagaacca-aacagcatttcatgagagcatagaggaagaggaaat
                      Megabat  ------------------aaaaatagagaacca-aacagcatttcatgagagcatagaggaagaggaaat
                Big brown bat  ------------------aaaaatggagataca-aaaggcatttagtgagaacatagagaaagagggaat
         David's myotis (bat)  ------------------aaaaatagagataca-gatggcatttagc--aaacatagaggaagagggaat
                     Microbat  ------------------aaaaatagagataca-gatggcatttagt--gaacatagaggaagagggaat
                    Armadillo  ----tgaagtaaaat-ttaaaaatag--ataca-aacaatacttaatgagaacatagtggaagaaggaat
                        Mouse  ======================================================================
                          Rat  ======================================================================
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                 Prairie vole  ======================================================================
               Golden hamster  ======================================================================
              Chinese hamster  ======================================================================
              Star-nosed mole  ======================================================================
                         Pika  ======================================================================
                      Manatee  ======================================================================
                          Cow  ======================================================================
                     Bushbaby  ======================================================================
                     Elephant  ======================================================================
           Chinese tree shrew  ======================================================================
                     Squirrel  ======================================================================
                          Pig  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                 Mallard duck  ======================================================================
                       Parrot  ======================================================================
       White-throated sparrow  ======================================================================
                     Aardvark  ======================================================================
             Cape golden mole  ======================================================================
       Spiny softshell turtle  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================

                        Human  ta
                        Chimp  ta
                      Gorilla  ta
                    Orangutan  ta
                       Gibbon  ta
                       Rhesus  ta
          Crab-eating macaque  ta
                       Baboon  ta
                 Green monkey  ta
                     Marmoset  ta
              Squirrel monkey  ta
       Lesser Egyptian jerboa  tc
               Naked mole-rat  ta
                   Guinea pig  ta
                   Chinchilla  ga
             Brush-tailed rat  ta
                       Rabbit  --
                       Alpaca  ta
               Bactrian camel  ta
                      Dolphin  ta
                 Killer whale  --
             Tibetan antelope  ta
                        Sheep  ta
                Domestic goat  ta
                        Horse  ta
             White rhinoceros  ta
                          Cat  ta
                          Dog  ta
                      Ferret   ta
                        Panda  ta
               Pacific walrus  ta
                 Weddell seal  ta
             Black flying-fox  ta
                      Megabat  ta
                Big brown bat  ta
         David's myotis (bat)  ta
                     Microbat  ta
                    Armadillo  ta
                        Mouse  ==
                          Rat  ==
                       Tenrec  ==
          Cape elephant shrew  ==
                     Hedgehog  ==
                        Shrew  ==
                 Prairie vole  ==
               Golden hamster  ==
              Chinese hamster  ==
              Star-nosed mole  ==
                         Pika  ==
                      Manatee  ==
                          Cow  ==
                     Bushbaby  ==
                     Elephant  ==
           Chinese tree shrew  ==
                     Squirrel  ==
                          Pig  ==
                       Turkey  ==
                      Chicken  ==
                Scarlet macaw  ==
                   Budgerigar  ==
           Tibetan ground jay  ==
             Peregrine falcon  ==
                 Saker falcon  ==
                  Rock pigeon  ==
          Medium ground finch  ==
                 Mallard duck  ==
                       Parrot  ==
       White-throated sparrow  ==
                     Aardvark  ==
             Cape golden mole  ==
       Spiny softshell turtle  ==
     Chinese softshell turtle  ==
               Painted turtle  ==
              Green seaturtle  ==
              Tasmanian devil  ==
                      Opossum  ==
           American alligator  ==
                  Zebra finch  ==
          Collared flycatcher  ==

Alignment block 19 of 34 in window, 67912653 - 67912696, 44 bps 
B D                     Human  actgtga--ttag-----------------gagga-tca-gg---aaaacataatttatcttctctcc
B D                     Chimp  attgtga--ttag-----------------gagga-tca-gg---aaaacataatttatcttctctcc
B D                   Gorilla  attataa--ttag-----------------gagga-tca-gg---aaaacataatttatcttctctcc
B D                 Orangutan  attatga--ttag-----------------gagga-tca-gg---aaaaaataatttatcttccctcc
B D                    Gibbon  attgtga--ttag-----------------gagga-tca-gg---aaaaaataatttatcttccctcc
B D                    Rhesus  attgtg---ttag-----------------gagga-tcg-gg---aaaaaataatttatcttccctcc
B D       Crab-eating macaque  attgtga--ttag-----------------gagga-tcg-gg---aaaaaataatttatcttccctcc
B D                    Baboon  attgtga--ttag-----------------gagga-tcg-gg-a-aaaaaataatttatcttccctcc
B D              Green monkey  attgtga--ttag-----------------gagga-tcg-ggga-aaaaaataatttatcttcccttc
B D                  Marmoset  attctga--cttg-----------------cagga-tca-gg----aaaaataatttatcttttctcc
B D           Squirrel monkey  attctga--ctag-----------------gagga-tca-gg---aaaaaataatttatctttttttc
       Lesser Egyptian jerboa  attctga--tcag-----------------gaga------tt-a-aagggaaaactcactttctccc-
                 Prairie vole  actttgatgtctg-----------------gagat-ttt-tt-a-aaaaatatagtctttttttttt-
B D            Naked mole-rat  attagga--tggaacatagaaggatgaagtgagaa-tca-at-t-aaaaaatcattcattttccttc-
B D                Guinea pig  attctga--ccaa-----------------gagaa-tca-at-g-aaaaaa--aatcatttttcttt-
                   Chinchilla  attctga--ccaa-----------------gagaa-tca-at-t-aaaaaatcattcatttcccttc-
             Brush-tailed rat  attctga--ccaa-----------------aagaa-tga-at-taaaaaaatcatttgtttctcttc-
B D                    Rabbit  gttctga--aaag-----------------gggat-cag-ga-c-aaacaa--attaatattct----
B D                    Alpaca  attctaa--tcag-----------------gaaga-tca-ga---aaaaaataattcatcttccttct
               Bactrian camel  attctaa--tcag-----------------gaaga-tca-ga---aaaaaataattcatcttccttct
B D                   Dolphin  attctaa--tccg-----------------gaaga-gcatga---aaaaggtagttcatcttccttcc
                 Killer whale  attctaa--tccg-----------------gaaga-gcatga---aaaaggtaattcatcttccttcc
             Tibetan antelope  attctag--tcca-----------------gaaga-tctgga---aaaaaataattcatcttccttcc
B D                     Sheep  attctag--tcca-----------------gaaga-tcagga---aaaaaataattcatcttccttcc
                Domestic goat  attctag--tcca-----------------gaaga-tcagga---aaaaaataattcatcttccttcc
B D                     Horse  attctga--ccag-----------------gaaga-tca-gg---aaaaaataattcagctttcctac
B D          White rhinoceros  attctga--ccag-----------------gaagc-tca-gg---aaaaaataattcatctttcctcc
B D                       Cat  attctgt--tgag-----------------gaagattta-gg---aacaaataatacatcttccttcc
B D                       Dog  attctgt--ctag-----------------gacga-tta-ag---aacaaataattcatcttccttct
B D                   Ferret   attctgg--ccag-----------------gaaga-tta-gg---aacaaataattcatttacactct
B D                     Panda  attctgt--ccag-----------------gaaga-tta-gg---aacaaataattcgttttctctc-
               Pacific walrus  attctgt--ccgg-----------------gaaga-ttg-gg----acaaataattcgctttccctct
                 Weddell seal  attctgt--ccag-----------------gaaga-ttg-gg---aacaaataattcattttccctct
             Black flying-fox  attctga--ccag-----------------gaaga-tcg-gg---aaaaaataattaatctttcttcc
B D                   Megabat  attctga--ccag-----------------gaaga-tcg-gg---aaaaaataattaatctttcttcc
                Big brown bat  attctga--ccag-----------------gaaga-tca-gg---aaaaaataatttatctctcttct
         David's myotis (bat)  attctga--ccag-----------------gaaga-tga-gg---aaaaaataatttatcccccttct
B D                  Microbat  attctga--ccag-----------------gaaga-tga-gg---aaaaaataatttatctcccttct
B D                 Armadillo  attctga--ccag-----------------gagga-tca-gg---aaaatatagttcaccttccctcc
B D                     Mouse  ====================================================================
B D                       Rat  ====================================================================
B D                    Tenrec  ====================================================================
         Cape elephant shrew  ====================================================================
B D                  Hedgehog  ====================================================================
B D                     Shrew  ====================================================================
              Golden hamster  ====================================================================
B D           Chinese hamster  ====================================================================
             Star-nosed mole  ====================================================================
B D                      Pika  ====================================================================
B D                   Manatee  ====================================================================
B D                       Cow  ====================================================================
B D                  Bushbaby  ====================================================================
B D                  Elephant  ====================================================================
          Chinese tree shrew  ====================================================================
B D                  Squirrel  ====================================================================
B D                       Pig  ====================================================================
B D                    Turkey  ====================================================================
B D                   Chicken  ====================================================================
  D             Scarlet macaw  ====================================================================
B D                Budgerigar  ====================================================================
          Tibetan ground jay  ====================================================================
  D          Peregrine falcon  ====================================================================
  D              Saker falcon  ====================================================================
  D               Rock pigeon  ====================================================================
B D       Medium ground finch  ====================================================================
  D              Mallard duck  ====================================================================
  D                    Parrot  ====================================================================
  D    White-throated sparrow  ====================================================================
                    Aardvark  ====================================================================
            Cape golden mole  ====================================================================
  D    Spiny softshell turtle  ====================================================================
  D  Chinese softshell turtle  ====================================================================
  D            Painted turtle  ====================================================================
  D           Green seaturtle  ====================================================================
B D           Tasmanian devil  ====================================================================
B D                   Opossum  ====================================================================
B D        American alligator  ====================================================================
B D               Zebra finch  ====================================================================
  D       Collared flycatcher  ====================================================================

Alignment block 20 of 34 in window, 67912697 - 67912703, 7 bps 
B D                     Human  tacttct
B D                     Chimp  tacttct
B D                   Gorilla  tacttct
B D                 Orangutan  tacttct
B D                    Gibbon  tacttct
B D                    Rhesus  tacttct
B D       Crab-eating macaque  tacttct
B D                    Baboon  tacttct
B D              Green monkey  tacttct
B D                  Marmoset  tacttct
       Lesser Egyptian jerboa  tcctact
                 Prairie vole  tacattt
B D            Naked mole-rat  tactcct
B D                Guinea pig  tactcct
                   Chinchilla  tattcc-
             Brush-tailed rat  tactcct
B D                    Alpaca  tgtttcc
               Bactrian camel  tgtttcc
B D                   Dolphin  tatttct
                 Killer whale  tatttct
             Tibetan antelope  catttct
B D                     Sheep  catttct
                Domestic goat  catttct
B D                     Horse  tatttct
B D          White rhinoceros  tatttct
B D                       Cat  tatttct
B D                       Dog  tatttct
B D                   Ferret   tatttct
B D                     Panda  tacttct
               Pacific walrus  tatttct
                 Weddell seal  tatttct
             Black flying-fox  tatttct
B D                   Megabat  tatttct
                Big brown bat  tatttct
         David's myotis (bat)  tatttct
B D                  Microbat  tatttct
B D                 Armadillo  tactttt
B D                     Mouse  =======
B D                       Rat  =======
B D                    Tenrec  =======
         Cape elephant shrew  =======
B D                  Hedgehog  =======
B D                     Shrew  =======
              Golden hamster  =======
B D           Chinese hamster  =======
             Star-nosed mole  =======
B D                      Pika  =======
B D                    Rabbit  -------
B D           Squirrel monkey  -------
B D                   Manatee  =======
B D                       Cow  =======
B D                  Bushbaby  =======
B D                  Elephant  =======
          Chinese tree shrew  =======
B D                  Squirrel  =======
B D                       Pig  =======
B D                    Turkey  =======
B D                   Chicken  =======
  D             Scarlet macaw  =======
B D                Budgerigar  =======
          Tibetan ground jay  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
B D       Medium ground finch  =======
  D              Mallard duck  =======
  D                    Parrot  =======
  D    White-throated sparrow  =======
                    Aardvark  =======
            Cape golden mole  =======
  D    Spiny softshell turtle  =======
  D  Chinese softshell turtle  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D           Tasmanian devil  =======
B D                   Opossum  =======
B D        American alligator  =======
B D               Zebra finch  =======
  D       Collared flycatcher  =======

Inserts between block 20 and 21 in window
B D                    Horse 23bp

Alignment block 21 of 34 in window, 67912704 - 67912705, 2 bps 
B D                     Human  ct
B D                     Chimp  ct
B D                   Gorilla  ct
B D                 Orangutan  gt
B D                    Gibbon  tt
B D                    Rhesus  ct
B D       Crab-eating macaque  ct
B D                    Baboon  ct
B D              Green monkey  ct
B D                  Marmoset  ct
       Lesser Egyptian jerboa  tt
                 Prairie vole  tt
B D            Naked mole-rat  ct
B D                Guinea pig  ct
                   Chinchilla  aa
             Brush-tailed rat  ct
B D                    Alpaca  ct
               Bactrian camel  ct
B D                   Dolphin  tt
                 Killer whale  tt
             Tibetan antelope  ct
B D                     Sheep  ct
                Domestic goat  ct
B D          White rhinoceros  ct
B D                       Cat  ct
B D                       Dog  ct
B D                   Ferret   ct
B D                     Panda  ct
               Pacific walrus  ct
                 Weddell seal  ct
             Black flying-fox  ct
B D                   Megabat  ct
                Big brown bat  at
         David's myotis (bat)  at
B D                  Microbat  at
B D                 Armadillo  ct
B D                     Mouse  ==
B D                       Rat  ==
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
              Golden hamster  ==
B D           Chinese hamster  ==
             Star-nosed mole  ==
B D                      Pika  ==
B D                    Rabbit  --
B D           Squirrel monkey  --
B D                   Manatee  ==
B D                       Cow  ==
B D                  Bushbaby  ==
B D                  Elephant  ==
          Chinese tree shrew  ==
B D                     Horse  ==
B D                  Squirrel  ==
B D                       Pig  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
  D              Mallard duck  ==
  D                    Parrot  ==
  D    White-throated sparrow  ==
                    Aardvark  ==
            Cape golden mole  ==
  D    Spiny softshell turtle  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
B D        American alligator  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==

Alignment block 22 of 34 in window, 67912706 - 67912706, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                     Sheep  a
                Domestic goat  a
B D          White rhinoceros  t
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                 Armadillo  a
B D                     Mouse  =
B D                       Rat  =
B D                    Tenrec  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
              Golden hamster  =
B D           Chinese hamster  =
             Star-nosed mole  =
B D                      Pika  =
B D                    Rabbit  -
B D           Squirrel monkey  -
B D                   Manatee  =
B D                       Cow  =
            Black flying-fox  -
B D                  Bushbaby  =
B D                  Elephant  =
          Chinese tree shrew  =
B D                     Horse  =
B D                  Squirrel  =
B D                       Pig  =
B D                    Turkey  =
B D                   Chicken  =
  D             Scarlet macaw  =
B D                Budgerigar  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  =
  D              Mallard duck  =
  D                    Parrot  =
  D    White-throated sparrow  =
                    Aardvark  =
            Cape golden mole  =
B D                   Megabat  -
  D    Spiny softshell turtle  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D           Tasmanian devil  =
B D                   Opossum  =
B D        American alligator  =
B D               Zebra finch  =
  D       Collared flycatcher  =

Inserts between block 22 and 23 in window
B D                  Ferret  9bp

Alignment block 23 of 34 in window, 67912707 - 67912707, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
       Lesser Egyptian jerboa  g
                 Prairie vole  t
B D            Naked mole-rat  t
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                     Sheep  g
                Domestic goat  g
B D          White rhinoceros  a
B D                 Armadillo  g
B D                     Mouse  =
B D                       Rat  =
B D                    Tenrec  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
              Golden hamster  =
B D           Chinese hamster  =
             Star-nosed mole  =
B D                      Pika  =
B D                    Rabbit  -
B D                       Dog  -
B D                     Panda  -
B D                   Ferret   =
B D           Squirrel monkey  -
        David's myotis (bat)  -
B D                   Manatee  =
B D                  Microbat  -
               Big brown bat  -
B D                       Cow  =
            Black flying-fox  -
B D                       Cat  -
B D                  Bushbaby  =
B D                  Elephant  =
          Chinese tree shrew  =
              Pacific walrus  -
B D                     Horse  =
B D                  Squirrel  =
B D                       Pig  =
                Weddell seal  -
B D                    Turkey  =
B D                   Chicken  =
  D             Scarlet macaw  =
B D                Budgerigar  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  =
  D              Mallard duck  =
  D                    Parrot  =
  D    White-throated sparrow  =
                    Aardvark  =
            Cape golden mole  =
B D                   Megabat  -
  D    Spiny softshell turtle  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D           Tasmanian devil  =
B D                   Opossum  =
B D        American alligator  =
B D               Zebra finch  =
  D       Collared flycatcher  =

Inserts between block 23 and 24 in window
B D           Naked mole-rat 6bp
B D                   Alpaca 54bp
              Bactrian camel 54bp

Alignment block 24 of 34 in window, 67912708 - 67912709, 2 bps 
B D                     Human  gt-
B D                     Chimp  gt-
B D                   Gorilla  gt-
B D                 Orangutan  gt-
B D                    Gibbon  gt-
B D                    Rhesus  gg-
B D       Crab-eating macaque  gg-
B D                    Baboon  gg-
B D              Green monkey  gg-
B D                  Marmoset  gt-
       Lesser Egyptian jerboa  tt-
                 Prairie vole  tt-
B D                Guinea pig  tt-
                   Chinchilla  ta-
             Brush-tailed rat  tt-
B D                   Dolphin  -t-
                 Killer whale  -t-
             Tibetan antelope  -t-
B D                     Sheep  -t-
                Domestic goat  -t-
B D          White rhinoceros  at-
B D                       Cat  gt-
B D                       Dog  gt-
B D                     Panda  gt-
               Pacific walrus  gt-
                 Weddell seal  gt-
                Big brown bat  gt-
         David's myotis (bat)  gt-
B D                  Microbat  gt-
B D                 Armadillo  -tt
B D                     Mouse  ===
B D                       Rat  ===
B D                    Tenrec  ===
         Cape elephant shrew  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
              Golden hamster  ===
B D           Chinese hamster  ===
             Star-nosed mole  ===
B D                      Pika  ===
B D                    Rabbit  ---
B D                   Ferret   ===
B D           Squirrel monkey  ---
B D                   Manatee  ===
B D                       Cow  ===
B D                    Alpaca  ===
              Bactrian camel  ===
            Black flying-fox  ---
B D                  Bushbaby  ===
B D                  Elephant  ===
B D            Naked mole-rat  ===
          Chinese tree shrew  ===
B D                     Horse  ===
B D                  Squirrel  ===
B D                       Pig  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
          Tibetan ground jay  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D       Medium ground finch  ===
  D              Mallard duck  ===
  D                    Parrot  ===
  D    White-throated sparrow  ===
                    Aardvark  ===
            Cape golden mole  ===
B D                   Megabat  ---
  D    Spiny softshell turtle  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D           Tasmanian devil  ===
B D                   Opossum  ===
B D        American alligator  ===
B D               Zebra finch  ===
  D       Collared flycatcher  ===

Inserts between block 24 and 25 in window
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                      Cat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp

Alignment block 25 of 34 in window, 67912710 - 67912712, 3 bps 
B D                     Human  ttt
B D                     Chimp  ttt
B D                   Gorilla  ttt
B D                 Orangutan  ttt
B D                    Gibbon  ttt
B D                    Rhesus  ttt
B D       Crab-eating macaque  ttt
B D                    Baboon  -gt
B D              Green monkey  -gt
B D                  Marmoset  ttt
       Lesser Egyptian jerboa  cct
                 Prairie vole  att
B D                Guinea pig  ttt
                   Chinchilla  gt-
             Brush-tailed rat  ttt
B D                   Dolphin  -cc
                 Killer whale  -cc
             Tibetan antelope  -cc
B D                     Sheep  -cc
                Domestic goat  -cc
B D                       Dog  tcc
B D                     Panda  tcc
               Pacific walrus  tcc
                 Weddell seal  tcc
                Big brown bat  -cc
         David's myotis (bat)  -cc
B D                  Microbat  -cc
B D                 Armadillo  ttt
B D                     Mouse  ===
B D                       Rat  ===
B D                    Tenrec  ===
         Cape elephant shrew  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
              Golden hamster  ===
B D           Chinese hamster  ===
             Star-nosed mole  ===
B D                      Pika  ===
B D                    Rabbit  ---
B D                   Ferret   ===
B D           Squirrel monkey  ---
B D                   Manatee  ===
B D                       Cow  ===
B D                    Alpaca  ===
              Bactrian camel  ===
            Black flying-fox  ---
B D                       Cat  ===
B D                  Bushbaby  ===
B D                  Elephant  ===
B D            Naked mole-rat  ===
          Chinese tree shrew  ===
B D          White rhinoceros  ---
B D                     Horse  ===
B D                  Squirrel  ===
B D                       Pig  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
          Tibetan ground jay  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D       Medium ground finch  ===
  D              Mallard duck  ===
  D                    Parrot  ===
  D    White-throated sparrow  ===
                    Aardvark  ===
            Cape golden mole  ===
B D                   Megabat  ---
  D    Spiny softshell turtle  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D           Tasmanian devil  ===
B D                   Opossum  ===
B D        American alligator  ===
B D               Zebra finch  ===
  D       Collared flycatcher  ===

Inserts between block 25 and 26 in window
      Lesser Egyptian jerboa 7bp
                Prairie vole 4bp
B D               Guinea pig 6bp
            Brush-tailed rat 181bp

Alignment block 26 of 34 in window, 67912713 - 67912713, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  c
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D            Naked mole-rat  t
B D                Guinea pig  c
                   Chinchilla  c
B D                    Rabbit  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                     Sheep  t
                Domestic goat  t
B D                       Dog  t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                 Armadillo  t
B D                     Mouse  =
B D                       Rat  =
B D                    Tenrec  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
              Golden hamster  =
B D           Chinese hamster  =
             Star-nosed mole  =
B D                      Pika  =
B D                   Ferret   =
B D           Squirrel monkey  -
B D                   Manatee  =
B D                       Cow  =
B D                    Alpaca  =
              Bactrian camel  =
            Black flying-fox  -
B D                       Cat  =
B D                  Bushbaby  =
B D                  Elephant  =
            Brush-tailed rat  =
          Chinese tree shrew  =
B D          White rhinoceros  -
B D                     Horse  =
B D                  Squirrel  =
B D                       Pig  =
B D                    Turkey  =
B D                   Chicken  =
  D             Scarlet macaw  =
B D                Budgerigar  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  =
  D              Mallard duck  =
  D                    Parrot  =
  D    White-throated sparrow  =
                    Aardvark  =
            Cape golden mole  =
B D                   Megabat  -
  D    Spiny softshell turtle  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D           Tasmanian devil  =
B D                   Opossum  =
B D        American alligator  =
B D               Zebra finch  =
  D       Collared flycatcher  =

Inserts between block 26 and 27 in window
B D                  Dolphin 4bp
                Killer whale 3bp
            Tibetan antelope 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                      Dog 388bp
B D                    Panda 4bp
              Pacific walrus 27bp
                Weddell seal 3bp
               Big brown bat 3bp
        David's myotis (bat) 3bp
B D                 Microbat 3bp

Alignment block 27 of 34 in window, 67912714 - 67912714, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  a
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
B D                    Rabbit  t
B D                 Armadillo  t
B D                     Mouse  =
B D                       Rat  =
B D                    Tenrec  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
              Golden hamster  =
B D           Chinese hamster  =
             Star-nosed mole  =
B D                      Pika  =
B D                       Dog  =
B D                     Panda  =
B D                   Ferret   =
B D           Squirrel monkey  -
        David's myotis (bat)  =
B D                   Manatee  =
B D                  Microbat  =
               Big brown bat  =
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
                Killer whale  =
B D                    Alpaca  =
              Bactrian camel  =
            Black flying-fox  -
B D                       Cat  =
B D                  Bushbaby  =
B D                  Elephant  =
            Brush-tailed rat  =
          Chinese tree shrew  =
              Pacific walrus  =
B D          White rhinoceros  -
B D                     Horse  =
B D                  Squirrel  =
B D                       Pig  =
                Weddell seal  =
B D                   Dolphin  =
B D                    Turkey  =
B D                   Chicken  =
  D             Scarlet macaw  =
B D                Budgerigar  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  =
  D              Mallard duck  =
  D                    Parrot  =
  D    White-throated sparrow  =
                    Aardvark  =
            Cape golden mole  =
B D                   Megabat  -
  D    Spiny softshell turtle  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D           Tasmanian devil  =
B D                   Opossum  =
B D        American alligator  =
B D               Zebra finch  =
  D       Collared flycatcher  =

Inserts between block 27 and 28 in window
B D                Armadillo 234bp

Alignment block 28 of 34 in window, 67912715 - 67912716, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  tt
B D                    Rhesus  tt
B D       Crab-eating macaque  tt
B D                    Baboon  tt
B D              Green monkey  tt
B D                  Marmoset  cc
       Lesser Egyptian jerboa  tg
                 Prairie vole  ta
B D            Naked mole-rat  tt
B D                Guinea pig  tt
                   Chinchilla  tt
B D                    Rabbit  ct
                 Killer whale  t-
                 Weddell seal  t-
                Big brown bat  t-
         David's myotis (bat)  t-
B D                  Microbat  t-
B D                     Mouse  ==
B D                       Rat  ==
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
              Golden hamster  ==
B D           Chinese hamster  ==
             Star-nosed mole  ==
B D                      Pika  ==
B D                       Dog  ==
B D                     Panda  ==
B D                   Ferret   ==
B D           Squirrel monkey  --
B D                   Manatee  ==
B D                       Cow  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
B D                 Armadillo  ==
B D                    Alpaca  ==
              Bactrian camel  ==
            Black flying-fox  --
B D                       Cat  ==
B D                  Bushbaby  ==
B D                  Elephant  ==
            Brush-tailed rat  ==
          Chinese tree shrew  ==
              Pacific walrus  ==
B D          White rhinoceros  --
B D                     Horse  ==
B D                  Squirrel  ==
B D                       Pig  ==
B D                   Dolphin  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
  D              Mallard duck  ==
  D                    Parrot  ==
  D    White-throated sparrow  ==
                    Aardvark  ==
            Cape golden mole  ==
B D                   Megabat  --
  D    Spiny softshell turtle  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
B D        American alligator  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==

Inserts between block 28 and 29 in window
                Killer whale 415bp
               Big brown bat 17bp
        David's myotis (bat) 17bp
B D                 Microbat 486bp

Alignment block 29 of 34 in window, 67912717 - 67912717, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                   Gorilla  -t
B D                 Orangutan  -g
B D                    Gibbon  -t
B D                    Rhesus  -t
B D       Crab-eating macaque  -t
B D                    Baboon  -c
B D              Green monkey  -c
B D                  Marmoset  -t
       Lesser Egyptian jerboa  -t
                 Prairie vole  -t
B D            Naked mole-rat  -t
B D                Guinea pig  -t
                   Chinchilla  -t
B D                    Rabbit  -t
                 Weddell seal  a-
B D                     Mouse  ==
B D                       Rat  ==
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
              Golden hamster  ==
B D           Chinese hamster  ==
             Star-nosed mole  ==
B D                      Pika  ==
B D                       Dog  ==
B D                     Panda  ==
B D                   Ferret   ==
B D           Squirrel monkey  --
        David's myotis (bat)  ==
B D                   Manatee  ==
B D                  Microbat  ==
               Big brown bat  ==
B D                       Cow  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
                Killer whale  ==
B D                 Armadillo  ==
B D                    Alpaca  ==
              Bactrian camel  ==
            Black flying-fox  --
B D                       Cat  ==
B D                  Bushbaby  ==
B D                  Elephant  ==
            Brush-tailed rat  ==
          Chinese tree shrew  ==
              Pacific walrus  ==
B D          White rhinoceros  --
B D                     Horse  ==
B D                  Squirrel  ==
B D                       Pig  ==
B D                   Dolphin  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
  D              Mallard duck  ==
  D                    Parrot  ==
  D    White-throated sparrow  ==
                    Aardvark  ==
            Cape golden mole  ==
B D                   Megabat  --
  D    Spiny softshell turtle  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
B D        American alligator  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==

Alignment block 30 of 34 in window, 67912718 - 67912718, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                   Gorilla  -t
B D                 Orangutan  -t
B D                    Gibbon  -t
B D                    Rhesus  -t
B D       Crab-eating macaque  -t
B D                    Baboon  -t
B D              Green monkey  -t
       Lesser Egyptian jerboa  -c
                 Prairie vole  -t
B D            Naked mole-rat  -t
B D                Guinea pig  -c
                   Chinchilla  -c
B D                    Rabbit  -t
                 Weddell seal  g-
B D                     Mouse  ==
B D                       Rat  ==
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
              Golden hamster  ==
B D           Chinese hamster  ==
             Star-nosed mole  ==
B D                      Pika  ==
B D                       Dog  ==
B D                     Panda  ==
B D                   Ferret   ==
B D           Squirrel monkey  --
        David's myotis (bat)  ==
B D                   Manatee  ==
B D                  Microbat  ==
               Big brown bat  ==
B D                       Cow  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
                Killer whale  ==
B D                 Armadillo  ==
B D                    Alpaca  ==
              Bactrian camel  ==
            Black flying-fox  --
B D                  Marmoset  --
B D                       Cat  ==
B D                  Bushbaby  ==
B D                  Elephant  ==
            Brush-tailed rat  ==
          Chinese tree shrew  ==
              Pacific walrus  ==
B D          White rhinoceros  --
B D                     Horse  ==
B D                  Squirrel  ==
B D                       Pig  ==
B D                   Dolphin  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
  D              Mallard duck  ==
  D                    Parrot  ==
  D    White-throated sparrow  ==
                    Aardvark  ==
            Cape golden mole  ==
B D                   Megabat  --
  D    Spiny softshell turtle  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
B D        American alligator  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==

Alignment block 31 of 34 in window, 67912719 - 67912738, 20 bps 
B D                     Human  tttt----------------tgagatg--ga-gtctcac
B D                     Chimp  tttt-----------------gagatg--ga-gtctcac
B D                   Gorilla  t--------------------gagatg--gaggtctcgc
B D                 Orangutan  ttttgtttttgtttttgttttgagatg--ga-gtcttgc
B D                    Gibbon  ttt------------------gagatg--ga-gtctcac
B D                    Rhesus  t--------------------gagatg--ga-gtctcgc
B D       Crab-eating macaque  t--------------------gagatg--ga-gtctcgc
B D                    Baboon  t--------------------gagatg--ga-gtctcgc
B D              Green monkey  t--------------------gagatg--ga-gtctcac
       Lesser Egyptian jerboa  ------------------------ctgattt-ttctcat
                 Prairie vole  ------------------------tta--tg-tgcacat
B D            Naked mole-rat  ------------------------atttcta-ttcttat
B D                Guinea pig  ------------------------ctgattt-ctctcat
                   Chinchilla  -----------------------------tt-ctctcat
                 Weddell seal  ----------------ctccttaggac--tt-ctctcgt
B D                     Mouse  =======================================
B D                       Rat  =======================================
B D                    Tenrec  =======================================
         Cape elephant shrew  =======================================
B D                  Hedgehog  =======================================
B D                     Shrew  =======================================
              Golden hamster  =======================================
B D           Chinese hamster  =======================================
             Star-nosed mole  =======================================
B D                      Pika  =======================================
B D                    Rabbit  ---------------------------------------
B D                       Dog  =======================================
B D                     Panda  =======================================
B D                   Ferret   =======================================
B D           Squirrel monkey  ---------------------------------------
        David's myotis (bat)  =======================================
B D                   Manatee  =======================================
B D                  Microbat  =======================================
               Big brown bat  =======================================
B D                       Cow  =======================================
               Domestic goat  =======================================
B D                     Sheep  =======================================
            Tibetan antelope  =======================================
                Killer whale  =======================================
B D                 Armadillo  =======================================
B D                    Alpaca  =======================================
              Bactrian camel  =======================================
            Black flying-fox  ---------------------------------------
B D                  Marmoset  ---------------------------------------
B D                       Cat  =======================================
B D                  Bushbaby  =======================================
B D                  Elephant  =======================================
            Brush-tailed rat  =======================================
          Chinese tree shrew  =======================================
              Pacific walrus  =======================================
B D          White rhinoceros  ---------------------------------------
B D                     Horse  =======================================
B D                  Squirrel  =======================================
B D                       Pig  =======================================
B D                   Dolphin  =======================================
B D                    Turkey  =======================================
B D                   Chicken  =======================================
  D             Scarlet macaw  =======================================
B D                Budgerigar  =======================================
          Tibetan ground jay  =======================================
  D          Peregrine falcon  =======================================
  D              Saker falcon  =======================================
  D               Rock pigeon  =======================================
B D       Medium ground finch  =======================================
  D              Mallard duck  =======================================
  D                    Parrot  =======================================
  D    White-throated sparrow  =======================================
                    Aardvark  =======================================
            Cape golden mole  =======================================
B D                   Megabat  ---------------------------------------
  D    Spiny softshell turtle  =======================================
  D  Chinese softshell turtle  =======================================
  D            Painted turtle  =======================================
  D           Green seaturtle  =======================================
B D           Tasmanian devil  =======================================
B D                   Opossum  =======================================
B D        American alligator  =======================================
B D               Zebra finch  =======================================
  D       Collared flycatcher  =======================================

Alignment block 32 of 34 in window, 67912739 - 67912741, 3 bps 
B D                     Human  tct
B D                     Chimp  tct
B D                   Gorilla  tct
B D                 Orangutan  tct
B D                    Gibbon  tct
B D                    Rhesus  tct
B D       Crab-eating macaque  tct
B D                    Baboon  tct
B D              Green monkey  tct
       Lesser Egyptian jerboa  tcc
                 Prairie vole  ttg
B D            Naked mole-rat  ttt
B D                Guinea pig  tct
                   Chinchilla  tct
B D                     Mouse  ===
B D                       Rat  ===
B D                    Tenrec  ===
         Cape elephant shrew  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
              Golden hamster  ===
B D           Chinese hamster  ===
             Star-nosed mole  ===
B D                      Pika  ===
B D                    Rabbit  ---
B D                       Dog  ===
B D                     Panda  ===
B D                   Ferret   ===
B D           Squirrel monkey  ---
        David's myotis (bat)  ===
B D                   Manatee  ===
B D                  Microbat  ===
               Big brown bat  ===
B D                       Cow  ===
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
                Killer whale  ===
B D                 Armadillo  ===
B D                    Alpaca  ===
              Bactrian camel  ===
            Black flying-fox  ---
B D                  Marmoset  ---
B D                       Cat  ===
B D                  Bushbaby  ===
B D                  Elephant  ===
            Brush-tailed rat  ===
          Chinese tree shrew  ===
              Pacific walrus  ===
B D          White rhinoceros  ---
B D                     Horse  ===
B D                  Squirrel  ===
B D                       Pig  ===
                Weddell seal  ---
B D                   Dolphin  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
          Tibetan ground jay  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D       Medium ground finch  ===
  D              Mallard duck  ===
  D                    Parrot  ===
  D    White-throated sparrow  ===
                    Aardvark  ===
            Cape golden mole  ===
B D                   Megabat  ---
  D    Spiny softshell turtle  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D           Tasmanian devil  ===
B D                   Opossum  ===
B D        American alligator  ===
B D               Zebra finch  ===
  D       Collared flycatcher  ===

Inserts between block 32 and 33 in window
B D           Naked mole-rat 73bp

Alignment block 33 of 34 in window, 67912742 - 67912744, 3 bps 
B D                     Human  gtt
B D                     Chimp  gtt
B D                   Gorilla  gtt
B D                 Orangutan  gtt
B D                    Gibbon  gtt
B D                    Rhesus  gtt
B D       Crab-eating macaque  gtt
B D                    Baboon  gtt
B D              Green monkey  gtt
       Lesser Egyptian jerboa  -tt
                 Prairie vole  -tc
B D                Guinea pig  -tt
                   Chinchilla  -tt
B D                     Mouse  ===
B D                       Rat  ===
B D                    Tenrec  ===
         Cape elephant shrew  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
              Golden hamster  ===
B D           Chinese hamster  ===
             Star-nosed mole  ===
B D                      Pika  ===
B D                    Rabbit  ---
B D                       Dog  ===
B D                     Panda  ===
B D                   Ferret   ===
B D           Squirrel monkey  ---
        David's myotis (bat)  ===
B D                   Manatee  ===
B D                  Microbat  ===
               Big brown bat  ===
B D                       Cow  ===
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
                Killer whale  ===
B D                 Armadillo  ===
B D                    Alpaca  ===
              Bactrian camel  ===
            Black flying-fox  ---
B D                  Marmoset  ---
B D                       Cat  ===
B D                  Bushbaby  ===
B D                  Elephant  ===
            Brush-tailed rat  ===
B D            Naked mole-rat  ===
          Chinese tree shrew  ===
              Pacific walrus  ===
B D          White rhinoceros  ---
B D                     Horse  ===
B D                  Squirrel  ===
B D                       Pig  ===
                Weddell seal  ---
B D                   Dolphin  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
          Tibetan ground jay  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D       Medium ground finch  ===
  D              Mallard duck  ===
  D                    Parrot  ===
  D    White-throated sparrow  ===
                    Aardvark  ===
            Cape golden mole  ===
B D                   Megabat  ---
  D    Spiny softshell turtle  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D           Tasmanian devil  ===
B D                   Opossum  ===
B D        American alligator  ===
B D               Zebra finch  ===
  D       Collared flycatcher  ===

Inserts between block 33 and 34 in window
      Lesser Egyptian jerboa 267bp
                Prairie vole 3bp
B D               Guinea pig 96bp
                  Chinchilla 93bp

Alignment block 34 of 34 in window, 67912745 - 67912770, 26 bps 
B D                     Human  gcccaggctagagtgcagtggcgcga
B D                     Chimp  gcccaggctagagtgcagtggcgcga
B D                   Gorilla  gcccaggctagagtgcagtggcgcga
B D                 Orangutan  gcccaggctagagtgcagtggcgcga
B D                    Gibbon  gcccaggctagaatgcagtggcgcaa
B D                    Rhesus  gcccaggctagagtgcagtggcgtga
B D       Crab-eating macaque  gcccaggctagagtgcagtggcgtga
B D                    Baboon  gcccaggctagagtgcagtggcgtga
B D              Green monkey  gcccaggctagagtgcagtggcatga
                 Prairie vole  gaggatgtcaga-ttccctggaacaa
B D                     Mouse  ==========================
B D                       Rat  ==========================
      Lesser Egyptian jerboa  ==========================
B D                    Tenrec  ==========================
         Cape elephant shrew  ==========================
B D                  Hedgehog  ==========================
B D                     Shrew  ==========================
              Golden hamster  ==========================
B D           Chinese hamster  ==========================
             Star-nosed mole  ==========================
B D                      Pika  ==========================
B D                    Rabbit  --------------------------
B D                       Dog  ==========================
B D                     Panda  ==========================
B D                   Ferret   ==========================
B D           Squirrel monkey  --------------------------
        David's myotis (bat)  ==========================
B D                   Manatee  ==========================
B D                  Microbat  ==========================
               Big brown bat  ==========================
B D                       Cow  ==========================
               Domestic goat  ==========================
B D                     Sheep  ==========================
            Tibetan antelope  ==========================
                Killer whale  ==========================
B D                 Armadillo  ==========================
B D                    Alpaca  ==========================
              Bactrian camel  ==========================
            Black flying-fox  --------------------------
B D                  Marmoset  --------------------------
B D                       Cat  ==========================
B D                  Bushbaby  ==========================
B D                  Elephant  ==========================
B D                Guinea pig  ==========================
            Brush-tailed rat  ==========================
B D            Naked mole-rat  ==========================
                  Chinchilla  ==========================
          Chinese tree shrew  ==========================
              Pacific walrus  ==========================
B D          White rhinoceros  --------------------------
B D                     Horse  ==========================
B D                  Squirrel  ==========================
B D                       Pig  ==========================
                Weddell seal  --------------------------
B D                   Dolphin  ==========================
B D                    Turkey  ==========================
B D                   Chicken  ==========================
  D             Scarlet macaw  ==========================
B D                Budgerigar  ==========================
          Tibetan ground jay  ==========================
  D          Peregrine falcon  ==========================
  D              Saker falcon  ==========================
  D               Rock pigeon  ==========================
B D       Medium ground finch  ==========================
  D              Mallard duck  ==========================
  D                    Parrot  ==========================
  D    White-throated sparrow  ==========================
                    Aardvark  ==========================
            Cape golden mole  ==========================
B D                   Megabat  --------------------------
  D    Spiny softshell turtle  ==========================
  D  Chinese softshell turtle  ==========================
  D            Painted turtle  ==========================
  D           Green seaturtle  ==========================
B D           Tasmanian devil  ==========================
B D                   Opossum  ==========================
B D        American alligator  ==========================
B D               Zebra finch  ==========================
  D       Collared flycatcher  ==========================

View table schema

Go to Conservation track controls

Data last updated: 2015-05-06

Downloads for data in this track are available:

Description

This track shows multiple alignments of 100 vertebrate species and measurements of evolutionary conservation using two methods (phastCons and phyloP) from the PHAST package, for all species. The multiple alignments were generated using multiz and other tools in the UCSC/Penn State Bioinformatics comparative genomics alignment pipeline. Conserved elements identified by phastCons are also displayed in this track. PHAST/Multiz are built from chains ("alignable") and nets ("syntenic"), see the documentation of the Chain/Net tracks for a description of the complete alignment process.

PhastCons is a hidden Markov model-based method that estimates the probability that each nucleotide belongs to a conserved element, based on the multiple alignment. It considers not just each individual alignment column, but also its flanking columns. By contrast, phyloP separately measures conservation at individual columns, ignoring the effects of their neighbors. As a consequence, the phyloP plots have a less smooth appearance than the phastCons plots, with more "texture" at individual sites. The two methods have different strengths and weaknesses. PhastCons is sensitive to "runs" of conserved sites, and is therefore effective for picking out conserved elements. PhyloP, on the other hand, is more appropriate for evaluating signatures of selection at particular nucleotides or classes of nucleotides (e.g., third codon positions, or first positions of miRNA target sites).

Another important difference is that phyloP can measure acceleration (faster evolution than expected under neutral drift) as well as conservation (slower than expected evolution). In the phyloP plots, sites predicted to be conserved are assigned positive scores (and shown in blue), while sites predicted to be fast-evolving are assigned negative scores (and shown in red). The absolute values of the scores represent -log p-values under a null hypothesis of neutral evolution. The phastCons scores, by contrast, represent probabilities of negative selection and range between 0 and 1.

Both phastCons and phyloP treat alignment gaps and unaligned nucleotides as missing data, and both were run with the same parameters.

See also: lastz parameters and other details and chain minimum score and gap parameters used in these alignments.

UCSC has repeatmasked and aligned all genome assemblies, and provides all the sequences for download. For genome assemblies not available in the genome browser, there are alternative assembly hub genome browsers. Missing sequence in any assembly is highlighted in the track display by regions of yellow when zoomed out and by Ns when displayed at base level (see Gap Annotation, below).

Primate subset
OrganismSpeciesRelease dateUCSC versionAlignment type
BaboonPapio hamadryasMar 2012Baylor Panu_2.0/papAnu2Reciprocal best net
BushbabyOtolemur garnettiiMar 2011Broad/otoGar3Syntenic net
ChimpPan troglodytesFeb 2011CSAC 2.1.4/panTro4Syntenic net
Crab-eating macaqueMacaca fascicularisJun 2013Macaca_fascicularis_5.0/macFas5Syntenic net
GibbonNomascus leucogenysOct 2012GGSC Nleu3.0/nomLeu3Syntenic net
GorillaGorilla gorilla gorillaMay 2011gorGor3.1/gorGor3Reciprocal best net
Green monkeyChlorocebus sabaeusMar 2014Chlorocebus_sabeus 1.1/chlSab2Syntenic net
HumanHomo sapiensDec 2013GRCh38/hg38reference species
MarmosetCallithrix jacchusMar 2009WUGSC 3.2/calJac3Syntenic net
OrangutanPongo pygmaeus abeliiJuly 2007WUGSC 2.0.2/ponAbe2Reciprocal best net
RhesusMacaca mulattaOct 2010BGI CR_1.0/rheMac3Syntenic net
Squirrel monkeySaimiri boliviensisOct 2011Broad/saiBol1Syntenic net
Euarchontoglires subset
Brush-tailed ratOctodon degusApr 2012OctDeg1.0/octDeg1Syntenic net
ChinchillaChinchilla lanigeraMay 2012 ChiLan1.0/chiLan1Syntenic net
Chinese hamsterCricetulus griseusJul 2013C_griseus_v1.0/criGri1Syntenic net
Chinese tree shrewTupaia chinensisJan 2013TupChi_1.0/tupChi1Syntenic net
Golden hamsterMesocricetus auratusMar 2013MesAur1.0/mesAur1Syntenic net
Guinea pigCavia porcellusFeb 2008Broad/cavPor3Syntenic net
Lesser Egyptian jerboaJaculus jaculusMay 2012JacJac1.0/jacJac1Syntenic net
MouseMus musculusDec 2011GRCm38/mm10Syntenic net
Naked mole-ratHeterocephalus glaberJan 2012Broad HetGla_female_1.0/hetGla2Syntenic net
PikaOchotona princepsMay 2012OchPri3.0/ochPri3Syntenic net
Prairie voleMicrotus ochrogasterOct 2012MicOch1.0/micOch1Syntenic net
RabbitOryctolagus cuniculusApr 2009Broad/oryCun2Syntenic net
RatRattus norvegicusJul 2014RGSC 6.0/rn6Syntenic net
SquirrelSpermophilus tridecemlineatusNov 2011Broad/speTri2Syntenic net
Laurasiatheria subset
AlpacaVicugna pacosMar 2013Vicugna_pacos-2.0.1/vicPac2Syntenic net
Bactrian camelCamelus ferusDec 2011CB1/camFer1Syntenic net
Big brown batEptesicus fuscusJul 2012EptFus1.0/eptFus1Syntenic net
Black flying-foxPteropus alectoAug 2012ASM32557v1/pteAle1Syntenic net
CatFelis catusNov 2014ICGSC Felis_catus 8.0/felCat8Syntenic net
CowBos taurusJun 2014Bos_taurus_UMD_3.1.1/bosTau8Syntenic net
David's myotis batMyotis davidiiAug 2012ASM32734v1/myoDav1Syntenic net
DogCanis lupus familiarisSep 2011Broad CanFam3.1/canFam3Syntenic net
DolphinTursiops truncatusOct 2011Baylor Ttru_1.4/turTru2Reciprocal best net
Domestic goatCapra hircusMay 2012CHIR_1.0/capHir1Syntenic net
Ferret Mustela putorius furoApr 2011MusPutFur1.0/musFur1Syntenic net
HedgehogErinaceus europaeusMay 2012EriEur2.0/eriEur2Syntenic net
HorseEquus caballusSep 2007EquCab3.0/equCab3Syntenic net
Killer whaleOrcinus orcaJan 2013Oorc_1.1/orcOrc1Syntenic net
MegabatPteropus vampyrusJul 2008Broad/pteVam1Reciprocal best net
MicrobatMyotis lucifugusJul 2010Broad Institute Myoluc2.0/myoLuc2Syntenic net
Pacific walrusOdobenus rosmarus divergensJan 2013Oros_1.0/odoRosDiv1Syntenic net
PandaAiluropoda melanoleucaDec 2009BGI-Shenzhen 1.0/ailMel1Syntenic net
PigSus scrofaAug 2011SGSC Sscrofa10.2/susScr3Syntenic net
SheepOvis ariesAug 2012ISGC Oar_v3.1/oviAri3Syntenic net
ShrewSorex araneusAug 2008Broad/sorAra2Syntenic net
Star-nosed moleCondylura cristataMar 2012ConCri1.0/conCri1Syntenic net
Tibetan antelopePantholops hodgsoniiMay 2013PHO1.0/panHod1Syntenic net
Weddell sealLeptonychotes weddelliiMar 2013LepWed1.0/lepWed1Reciprocal best net
White rhinocerosCeratotherium simumMay 2012CerSimSim1.0/cerSim1Syntenic net
Afrotheria subset
AardvarkOrycteropus afer aferMay 2012OryAfe1.0/oryAfe1Syntenic net
Cape elephant shrewElephantulus edwardiiAug 2012EleEdw1.0/eleEdw1Syntenic net
Cape golden moleChrysochloris asiaticaAug 2012ChrAsi1.0/chrAsi1Syntenic net
ElephantLoxodonta africanaJul 2009Broad/loxAfr3Syntenic net
ManateeTrichechus manatus latirostrisOct 2011Broad v1.0/triMan1Syntenic net
TenrecEchinops telfairiNov 2012Broad/echTel2Syntenic net
Mammal subset
ArmadilloDasypus novemcinctusDec 2011Baylor/dasNov3Syntenic net
OpossumMonodelphis domesticaOct 2006Broad/monDom5Net
PlatypusOrnithorhynchus anatinusMar 2007WUGSC 5.0.1/ornAna1Reciprocal best net
Tasmanian devilSarcophilus harrisiiFeb 2011WTSI Devil_ref v7.0/sarHar1Net
WallabyMacropus eugeniiSep 2009TWGS Meug_1.1/macEug2Reciprocal best net
Aves subset
BudgerigarMelopsittacus undulatusSep 2011WUSTL v6.3/melUnd1Net
ChickenGallus gallusNov 2011ICGSC Gallus_gallus-4.0/galGal4Net
Collared flycatcherFicedula albicollisJun 2013FicAlb1.5/ficAlb2Net
Mallard duckAnas platyrhynchosApr 2013BGI_duck_1.0/anaPla1Net
Medium ground finchGeospiza fortisApr 2012GeoFor_1.0/geoFor1Net
ParrotAmazona vittataJan 2013AV1/amaVit1Net
Peregrine falconFalco peregrinusFeb 2013F_peregrinus_v1.0/falPer1Net
Rock pigeonColumba liviaFeb 2013Cliv_1.0/colLiv1Net
Saker falconFalco cherrugFeb 2013F_cherrug_v1.0/falChe1Net
Scarlet macawAra macaoJun 2013SMACv1.1/araMac1Net
Tibetan ground jayPseudopodoces humilisJan 2013PseHum1.0/pseHum1Net
TurkeyMeleagris gallopavoDec 2009TGC Turkey_2.01/melGal1Net
White-throated sparrowZonotrichia albicollisApr 2013ASM38545v1/zonAlb1Net
Zebra finchTaeniopygia guttataFeb 2013WashU taeGut324/taeGut2Net
Sarcopterygii subset
American alligatorAlligator mississippiensisAug 2012allMis0.2/allMis1Net
Chinese softshell turtlePelodiscus sinensisOct 2011PelSin_1.0/pelSin1Net
CoelacanthLatimeria chalumnaeAug 2011Broad/latCha1Net
Green seaturtleChelonia mydasMar 2013CheMyd_1.0/cheMyd1Net
LizardAnolis carolinensisMay 2010Broad AnoCar2.0/anoCar2Net
Painted turtleChrysemys picta belliiMar 2014v3.0.3/chrPic2Net
Spiny softshell turtleApalone spiniferaMay 2013ASM38561v1/apaSpi1Net
X. tropicalisXenopus tropicalisSep 2012JGI 7.0/xenTro7Net
Fish subset
Atlantic codGadus morhuaMay 2010Genofisk GadMor_May2010/gadMor1Net
Burton's mouthbreederHaplochromis burtoniOct 2011AstBur1.0/hapBur1Net
FuguTakifugu rubripesOct 2011FUGU5/fr3Net
LampreyPetromyzon marinusSep 2010WUGSC 7.0/petMar2Net
MedakaOryzias latipesOct 2005NIG/UT MEDAKA1/oryLat2Net
Mexican tetra (cavefish)Astyanax mexicanusApr 2013Astyanax_mexicanus-1.0.2/astMex1Net
Nile tilapiaOreochromis niloticusJan 2011Broad oreNil1.1/oreNil2Net
Princess of BurundiNeolamprologus brichardiMay 2011NeoBri1.0/neoBri1Net
Pundamilia nyerereiPundamilia nyerereiOct 2011PunNye1.0/punNye1Net
Southern platyfishXiphophorus maculatusJan 2012Xiphophorus_maculatus-4.4.2/xipMac1Net
Spotted garLepisosteus oculatusDec 2011LepOcu1/lepOcu1Net
SticklebackGasterosteus aculeatusFeb 2006Broad/gasAcu1Net
TetraodonTetraodon nigroviridisMar 2007Genoscope 8.0/tetNig2Net
Yellowbelly pufferfishTakifugu flavidusMay 2013version 1 of Takifugu flavidus genome/takFla1Net
Zebra mbunaMaylandia zebraMar 2012MetZeb1.1/mayZeb1Net
ZebrafishDanio rerioSep 2014GRCz10/danRer10Net

Table 1. Genome assemblies included in the 100-way Conservation track.

Display Conventions and Configuration

In full and pack display modes, conservation scores are displayed as a wiggle track (histogram) in which the height reflects the size of the score. The conservation wiggles can be configured in a variety of ways to highlight different aspects of the displayed information. Click the Graph configuration help link for an explanation of the configuration options.

Pairwise alignments of each species to the human genome are displayed below the conservation histogram as a grayscale density plot (in pack mode) or as a wiggle (in full mode) that indicates alignment quality. In dense display mode, conservation is shown in grayscale using darker values to indicate higher levels of overall conservation as scored by phastCons.

Checkboxes on the track configuration page allow selection of the species to include in the pairwise display. Note that excluding species from the pairwise display does not alter the the conservation score display.

To view detailed information about the alignments at a specific position, zoom the display in to 30,000 or fewer bases, then click on the alignment.

Gap Annotation

The Display chains between alignments configuration option enables display of gaps between alignment blocks in the pairwise alignments in a manner similar to the Chain track display. The following conventions are used:

  • Single line: No bases in the aligned species. Possibly due to a lineage-specific insertion between the aligned blocks in the human genome or a lineage-specific deletion between the aligned blocks in the aligning species.
  • Double line: Aligning species has one or more unalignable bases in the gap region. Possibly due to excessive evolutionary distance between species or independent indels in the region between the aligned blocks in both species.
  • Pale yellow coloring: Aligning species has Ns in the gap region. Reflects uncertainty in the relationship between the DNA of both species, due to lack of sequence in relevant portions of the aligning species.

Genomic Breaks

Discontinuities in the genomic context (chromosome, scaffold or region) of the aligned DNA in the aligning species are shown as follows:

  • Vertical blue bar: Represents a discontinuity that persists indefinitely on either side, e.g. a large region of DNA on either side of the bar comes from a different chromosome in the aligned species due to a large scale rearrangement.
  • Green square brackets: Enclose shorter alignments consisting of DNA from one genomic context in the aligned species nested inside a larger chain of alignments from a different genomic context. The alignment within the brackets may represent a short misalignment, a lineage-specific insertion of a transposon in the human genome that aligns to a paralogous copy somewhere else in the aligned species, or other similar occurrence.

Base Level

When zoomed-in to the base-level display, the track shows the base composition of each alignment. The numbers and symbols on the Gaps line indicate the lengths of gaps in the human sequence at those alignment positions relative to the longest non-human sequence. If there is sufficient space in the display, the size of the gap is shown. If the space is insufficient and the gap size is a multiple of 3, a "*" is displayed; other gap sizes are indicated by "+".

Codon translation is available in base-level display mode if the displayed region is identified as a coding segment. To display this annotation, select the species for translation from the pull-down menu in the Codon Translation configuration section at the top of the page. Then, select one of the following modes:

  • No codon translation: The gene annotation is not used; the bases are displayed without translation.
  • Use default species reading frames for translation: The annotations from the genome displayed in the Default species to establish reading frame pull-down menu are used to translate all the aligned species present in the alignment.
  • Use reading frames for species if available, otherwise no translation: Codon translation is performed only for those species where the region is annotated as protein coding.
  • Use reading frames for species if available, otherwise use default species: Codon translation is done on those species that are annotated as being protein coding over the aligned region using species-specific annotation; the remaining species are translated using the default species annotation.

Codon translation uses the following gene tracks as the basis for translation:

Gene TrackSpecies
UCSC GenesHuman, Mouse
RefSeq GenesCow, Frog (X. tropicalis)
Ensembl Genes v73Atlantic cod, Bushbaby, Cat, Chicken, Chimp, Coelacanth, Dog, Elephant, Ferret, Fugu, Gorilla, Horse, Lamprey, Lizard, Mallard duck, Marmoset, Medaka, Megabat, Microbat, Orangutan, Panda, Pig, Platypus, Rat, Soft-shell Turtle, Southern platyfish, Squirrel, Tasmanian devil, Tetraodon, Zebrafish
no annotationAardvark, Alpaca, American alligator, Armadillo, Baboon, Bactrian camel, Big brown bat, Black flying-fox, Brush-tailed rat, Budgerigar, Burton's mouthbreeder, Cape elephant shrew, Cape golden mole, Chinchilla, Chinese hamster, Chinese tree shrew, Collared flycatcher, Crab-eating macaque, David's myotis (bat), Dolphin, Domestic goat, Gibbon, Golden hamster, Green monkey, Green seaturtle, Hedgehog, Killer whale, Lesser Egyptian jerboa, Manatee, Medium ground finch, Mexican tetra (cavefish), Naked mole-rat, Nile tilapia, Pacific walrus, Painted turtle, Parrot, Peregrine falcon, Pika, Prairie vole, Princess of Burundi, Pundamilia nyererei, Rhesus, Rock pigeon, Saker falcon, Scarlet Macaw, Sheep, Shrew, Spiny softshell turtle, Spotted gar, Squirrel monkey, Star-nosed mole, Tawny puffer fish, Tenrec, Tibetan antelope, Tibetan ground jay, Wallaby, Weddell seal, White rhinoceros, White-throated sparrow, Zebra Mbuna, Zebra finch
Table 2. Gene tracks used for codon translation.

Methods

Pairwise alignments with the human genome were generated for each species using lastz from repeat-masked genomic sequence. Lineage-specific repeats were removed prior to alignment, then reinserted. Pairwise alignments were then linked into chains using a dynamic programming algorithm that finds maximally scoring chains of gapless subsections of the alignments organized in a kd-tree. The scoring matrix and parameters for pairwise alignment and chaining were tuned for each species based on phylogenetic distance from the reference. High-scoring chains were then placed along the genome, with gaps filled by lower-scoring chains, to produce an alignment net. For more information about the chaining and netting process and parameters for each species, see the description pages for the Chain and Net tracks.

An additional filtering step was introduced in the generation of the 100-way conservation track to reduce the number of paralogs and pseudogenes from the high-quality assemblies and the suspect alignments from the low-quality assemblies: the pairwise alignments of high-quality mammalian sequences (placental and marsupial) were filtered based on synteny; those for 2X mammalian genomes were filtered to retain only alignments of best quality in both the target and query ("reciprocal best").

The resulting best-in-genome pairwise alignments were progressively aligned using multiz/autoMZ, following the tree topology diagrammed above, to produce multiple alignments. The multiple alignments were post-processed to add annotations indicating alignment gaps, genomic breaks, and base quality of the component sequences. The annotated multiple alignments, in MAF format, are available for bulk download. An alignment summary table containing an entry for each alignment block in each species was generated to improve track display performance at large scales. Framing tables were constructed to enable visualization of codons in the multiple alignment display.

Phylogenetic Tree Model

Both phastCons and phyloP are phylogenetic methods that rely on a tree model containing the tree topology, branch lengths representing evolutionary distance at neutrally evolving sites, the background distribution of nucleotides, and a substitution rate matrix. The all-species tree model for this track was generated using the phyloFit program from the PHAST package (REV model, EM algorithm, medium precision) using multiple alignments of 4-fold degenerate sites extracted from the 100-way alignment (msa_view). The 4d sites were derived from the RefSeq (Reviewed+Coding) gene set, filtered to select single-coverage long transcripts.

This same tree model was used in the phyloP calculations; however, the background frequencies were modified to maintain reversibility. The resulting tree model: all species.

PhastCons Conservation

The phastCons program computes conservation scores based on a phylo-HMM, a type of probabilistic model that describes both the process of DNA substitution at each site in a genome and the way this process changes from one site to the next (Felsenstein and Churchill 1996, Yang 1995, Siepel and Haussler 2005). PhastCons uses a two-state phylo-HMM, with a state for conserved regions and a state for non-conserved regions. The value plotted at each site is the posterior probability that the corresponding alignment column was "generated" by the conserved state of the phylo-HMM. These scores reflect the phylogeny (including branch lengths) of the species in question, a continuous-time Markov model of the nucleotide substitution process, and a tendency for conservation levels to be autocorrelated along the genome (i.e., to be similar at adjacent sites). The general reversible (REV) substitution model was used. Unlike many conservation-scoring programs, phastCons does not rely on a sliding window of fixed size; therefore, short highly-conserved regions and long moderately conserved regions can both obtain high scores. More information about phastCons can be found in Siepel et al. 2005.

The phastCons parameters used were: expected-length=45, target-coverage=0.3, rho=0.3.

PhyloP Conservation

The phyloP program supports several different methods for computing p-values of conservation or acceleration, for individual nucleotides or larger elements ( http://compgen.cshl.edu/phast/). Here it was used to produce separate scores at each base (--wig-scores option), considering all branches of the phylogeny rather than a particular subtree or lineage (i.e., the --subtree option was not used). The scores were computed by performing a likelihood ratio test at each alignment column (--method LRT), and scores for both conservation and acceleration were produced (--mode CONACC).

Conserved Elements

The conserved elements were predicted by running phastCons with the --viterbi option. The predicted elements are segments of the alignment that are likely to have been "generated" by the conserved state of the phylo-HMM. Each element is assigned a log-odds score equal to its log probability under the conserved model minus its log probability under the non-conserved model. The "score" field associated with this track contains transformed log-odds scores, taking values between 0 and 1000. (The scores are transformed using a monotonic function of the form a * log(x) + b.) The raw log odds scores are retained in the "name" field and can be seen on the details page or in the browser when the track's display mode is set to "pack" or "full".

Credits

This track was created using the following programs:

  • Alignment tools: lastz (formerly blastz) and multiz by Minmei Hou, Scott Schwartz and Webb Miller of the Penn State Bioinformatics Group
  • Chaining and Netting: axtChain, chainNet by Jim Kent at UCSC
  • Conservation scoring: phastCons, phyloP, phyloFit, tree_doctor, msa_view and other programs in PHAST by Adam Siepel at Cold Spring Harbor Laboratory (original development done at the Haussler lab at UCSC).
  • MAF Annotation tools: mafAddIRows by Brian Raney, UCSC; mafAddQRows by Richard Burhans, Penn State; genePredToMafFrames by Mark Diekhans, UCSC
  • Tree image generator: phyloPng by Galt Barber, UCSC
  • Conservation track display: Kate Rosenbloom, Hiram Clawson (wiggle display), and Brian Raney (gap annotation and codon framing) at UCSC

The phylogenetic tree is based on Murphy et al. (2001) and general consensus in the vertebrate phylogeny community. Thanks to Giacomo Bernardi for help with the fish relationships.

References

Phylo-HMMs, phastCons, and phyloP:

Felsenstein J, Churchill GA. A Hidden Markov Model approach to variation among sites in rate of evolution. Mol Biol Evol. 1996 Jan;13(1):93-104. PMID: 8583911

Pollard KS, Hubisz MJ, Rosenbloom KR, Siepel A. Detection of nonneutral substitution rates on mammalian phylogenies. Genome Res. 2010 Jan;20(1):110-21. PMID: 19858363; PMC: PMC2798823

Siepel A, Bejerano G, Pedersen JS, Hinrichs AS, Hou M, Rosenbloom K, Clawson H, Spieth J, Hillier LW, Richards S, et al. Evolutionarily conserved elements in vertebrate, insect, worm, and yeast genomes. Genome Res. 2005 Aug;15(8):1034-50. PMID: 16024819; PMC: PMC1182216

Siepel A, Haussler D. Phylogenetic Hidden Markov Models. In: Nielsen R, editor. Statistical Methods in Molecular Evolution. New York: Springer; 2005. pp. 325-351.

Yang Z. A space-time process model for the evolution of DNA sequences. Genetics. 1995 Feb;139(2):993-1005. PMID: 7713447; PMC: PMC1206396

Chain/Net:

Kent WJ, Baertsch R, Hinrichs A, Miller W, Haussler D. Evolution's cauldron: duplication, deletion, and rearrangement in the mouse and human genomes. Proc Natl Acad Sci U S A. 2003 Sep 30;100(20):11484-9. PMID: 14500911; PMC: PMC208784

Multiz:

Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, Green ED, et al. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res. 2004 Apr;14(4):708-15. PMID: 15060014; PMC: PMC383317

Lastz (formerly Blastz):

Chiaromonte F, Yap VB, Miller W. Scoring pairwise genomic sequence alignments. Pac Symp Biocomput. 2002:115-26. PMID: 11928468

Harris RS. Improved pairwise alignment of genomic DNA. Ph.D. Thesis. Pennsylvania State University, USA. 2007.

Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W. Human-mouse alignments with BLASTZ. Genome Res. 2003 Jan;13(1):103-7. PMID: 12529312; PMC: PMC430961

Phylogenetic Tree:

Murphy WJ, Eizirik E, O'Brien SJ, Madsen O, Scally M, Douady CJ, Teeling E, Ryder OA, Stanhope MJ, de Jong WW, Springer MS. Resolution of the early placental mammal radiation using Bayesian phylogenetics. Science. 2001 Dec 14;294(5550):2348-51. PMID: 11743200