Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 32 in window, 67987403 - 67987404, 2 bps 
B D                     Human  tt-
B D                     Chimp  tt-
B D                   Gorilla  tt-
B D                 Orangutan  tt-
B D                    Gibbon  tt-
B D                    Rhesus  tt-
B D       Crab-eating macaque  tt-
B D                    Baboon  tt-
B D              Green monkey  tt-
B D                  Marmoset  tt-
B D           Squirrel monkey  tg-
B D           Chinese hamster  cc-
B D          White rhinoceros  ct-
          Cape elephant shrew  gt-
B D           Tasmanian devil  ttg
B D                     Mouse  ===
B D                       Rat  ===
      Lesser Egyptian jerboa  ===
B D                    Tenrec  ===
B D                  Hedgehog  ---
B D                     Shrew  ===
                Prairie vole  ===
              Golden hamster  ===
             Star-nosed mole  ===
B D                      Pika  ===
B D                    Rabbit  ---
B D                       Dog  ---
B D                     Panda  ---
B D                   Ferret   ---
        David's myotis (bat)  ---
B D                   Manatee  ---
B D                  Microbat  ---
               Big brown bat  ---
B D                       Cow  ===
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
                Killer whale  ===
B D                 Armadillo  ---
B D                    Alpaca  ---
              Bactrian camel  ---
            Black flying-fox  ---
B D                       Cat  ---
B D                  Bushbaby  ---
B D                  Elephant  ---
B D                Guinea pig  ===
            Brush-tailed rat  ---
B D            Naked mole-rat  ---
                  Chinchilla  ---
          Chinese tree shrew  ---
              Pacific walrus  ===
B D                     Horse  ===
B D                  Squirrel  ===
B D                       Pig  ---
                Weddell seal  ===
B D                   Dolphin  ===
B D                    Turkey  ===
B D                   Chicken  ===
B D                Budgerigar  ===
          Tibetan ground jay  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D       Medium ground finch  ===
  D              Mallard duck  ===
B D                   Wallaby  ===
  D    White-throated sparrow  ===
                    Aardvark  ===
            Cape golden mole  ===
B D                   Megabat  ---
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D                   Opossum  ===
B D                  Platypus  ===
B D        American alligator  ===
B D               Zebra finch  ===
  D       Collared flycatcher  ===

Inserts between block 1 and 2 in window
B D         White rhinoceros 1bp
         Cape elephant shrew 1bp

Alignment block 2 of 32 in window, 67987405 - 67987405, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
B D           Chinese hamster  a
B D                Guinea pig  g
B D          White rhinoceros  a
B D           Tasmanian devil  g
B D                     Mouse  =
B D                       Rat  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
         Cape elephant shrew  =
B D                  Hedgehog  -
B D                     Shrew  =
                Prairie vole  =
              Golden hamster  =
             Star-nosed mole  =
B D                      Pika  =
B D                    Rabbit  -
B D                       Dog  -
B D                     Panda  -
B D                   Ferret   -
        David's myotis (bat)  -
B D                   Manatee  -
B D                  Microbat  -
               Big brown bat  -
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
                Killer whale  =
B D                 Armadillo  -
B D                    Alpaca  -
              Bactrian camel  -
            Black flying-fox  -
B D                       Cat  -
B D                  Elephant  -
            Brush-tailed rat  -
B D            Naked mole-rat  -
                  Chinchilla  -
          Chinese tree shrew  -
              Pacific walrus  =
B D                     Horse  =
B D                  Squirrel  =
B D                       Pig  -
                Weddell seal  =
B D                   Dolphin  =
B D                    Turkey  =
B D                   Chicken  =
B D                Budgerigar  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  =
  D              Mallard duck  =
B D                   Wallaby  =
  D    White-throated sparrow  =
                    Aardvark  =
            Cape golden mole  =
B D                   Megabat  -
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                   Opossum  =
B D                  Platypus  =
B D        American alligator  =
B D               Zebra finch  =
  D       Collared flycatcher  =

Alignment block 3 of 32 in window, 67987406 - 67987406, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  g
B D           Chinese hamster  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D          White rhinoceros  a
          Cape elephant shrew  g
B D           Tasmanian devil  a
B D                     Mouse  =
B D                       Rat  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
B D                  Hedgehog  -
B D                     Shrew  =
                Prairie vole  =
              Golden hamster  =
             Star-nosed mole  =
B D                      Pika  =
B D                    Rabbit  -
B D                       Dog  -
B D                     Panda  -
B D                   Ferret   -
        David's myotis (bat)  -
B D                   Manatee  -
B D                  Microbat  -
               Big brown bat  -
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
                Killer whale  =
B D                 Armadillo  -
B D                    Alpaca  -
              Bactrian camel  -
            Black flying-fox  -
B D                       Cat  -
B D                  Elephant  -
B D            Naked mole-rat  -
          Chinese tree shrew  -
              Pacific walrus  =
B D                     Horse  =
B D                  Squirrel  =
B D                       Pig  -
                Weddell seal  =
B D                   Dolphin  =
B D                    Turkey  =
B D                   Chicken  =
B D                Budgerigar  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  =
  D              Mallard duck  =
B D                   Wallaby  =
  D    White-throated sparrow  =
                    Aardvark  =
            Cape golden mole  =
B D                   Megabat  -
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                   Opossum  =
B D                  Platypus  =
B D        American alligator  =
B D               Zebra finch  =
  D       Collared flycatcher  =

Inserts between block 3 and 4 in window
B D         White rhinoceros 1bp

Alignment block 4 of 32 in window, 67987407 - 67987407, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                   Gorilla  -t
B D                 Orangutan  -t
B D                    Gibbon  -t
B D                    Rhesus  -t
B D       Crab-eating macaque  -t
B D                    Baboon  -t
B D              Green monkey  -t
B D                  Marmoset  -t
B D           Squirrel monkey  -t
B D                  Bushbaby  -t
           Chinese tree shrew  -t
B D                  Squirrel  -t
       Lesser Egyptian jerboa  -t
B D           Chinese hamster  -g
B D            Naked mole-rat  -t
B D                Guinea pig  -t
                   Chinchilla  -t
             Brush-tailed rat  -t
B D                       Pig  -t
B D                    Alpaca  -t
               Bactrian camel  -t
B D                       Cat  -t
B D                       Dog  -t
B D                   Ferret   -t
B D                     Panda  -t
               Pacific walrus  -t
             Black flying-fox  -t
B D                   Megabat  -t
                Big brown bat  -t
         David's myotis (bat)  -t
B D                  Microbat  -t
B D                  Elephant  -t
          Cape elephant shrew  -t
B D                   Manatee  -t
                     Aardvark  -t
B D                 Armadillo  -t
B D           Tasmanian devil  g-
B D                     Mouse  ==
B D                       Rat  ==
B D                    Tenrec  ==
B D                  Hedgehog  --
B D                     Shrew  ==
                Prairie vole  ==
              Golden hamster  ==
             Star-nosed mole  ==
B D                      Pika  ==
B D                    Rabbit  --
B D                       Cow  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
                Killer whale  ==
B D          White rhinoceros  ==
B D                     Horse  ==
                Weddell seal  ==
B D                   Dolphin  ==
B D                    Turkey  ==
B D                   Chicken  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
  D              Mallard duck  ==
B D                   Wallaby  ==
  D    White-throated sparrow  ==
            Cape golden mole  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                   Opossum  ==
B D                  Platypus  ==
B D        American alligator  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==

Alignment block 5 of 32 in window, 67987408 - 67987408, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
B D           Chinese hamster  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                      Pika  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
                     Aardvark  t
B D                 Armadillo  t
B D           Tasmanian devil  t
B D                     Mouse  =
B D                       Rat  =
B D                    Tenrec  =
B D                     Shrew  =
                Prairie vole  =
              Golden hamster  =
             Star-nosed mole  =
B D                    Rabbit  -
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
                Killer whale  =
B D                   Dolphin  =
B D                    Turkey  =
B D                   Chicken  =
B D                Budgerigar  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  =
  D              Mallard duck  =
B D                   Wallaby  =
  D    White-throated sparrow  =
            Cape golden mole  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                   Opossum  =
B D                  Platypus  =
B D        American alligator  =
B D               Zebra finch  =
  D       Collared flycatcher  =

Alignment block 6 of 32 in window, 67987409 - 67987409, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
B D           Chinese hamster  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                      Pika  c
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  t
B D                  Elephant  g
          Cape elephant shrew  c
B D                   Manatee  g
                     Aardvark  g
B D                 Armadillo  t
  D  Chinese softshell turtle  t
B D                     Mouse  =
B D                       Rat  =
B D                    Tenrec  =
B D                     Shrew  =
                Prairie vole  =
              Golden hamster  =
             Star-nosed mole  =
B D                    Rabbit  -
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
                Killer whale  =
B D                   Dolphin  =
B D                    Turkey  =
B D                   Chicken  =
B D                Budgerigar  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  =
  D              Mallard duck  =
B D                   Wallaby  =
  D    White-throated sparrow  =
            Cape golden mole  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D           Tasmanian devil  -
B D                   Opossum  =
B D                  Platypus  =
B D        American alligator  =
B D               Zebra finch  =
  D       Collared flycatcher  =

Alignment block 7 of 32 in window, 67987410 - 67987413, 4 bps 
B D                     Human  taa--t
B D                     Chimp  taa--t
B D                   Gorilla  taa--t
B D                 Orangutan  taa--t
B D                    Gibbon  taa--t
B D                    Rhesus  taa--t
B D       Crab-eating macaque  taa--t
B D                    Baboon  taa--t
B D              Green monkey  taa--t
B D                  Marmoset  taa--t
B D           Squirrel monkey  tag--t
B D                  Bushbaby  taa--t
           Chinese tree shrew  taa--a
B D                  Squirrel  taa--g
       Lesser Egyptian jerboa  taa--t
B D           Chinese hamster  tta--t
B D            Naked mole-rat  taa--a
B D                Guinea pig  taa--a
                   Chinchilla  taa--a
             Brush-tailed rat  taa--a
B D                    Rabbit  taa--a
B D                      Pika  tga--a
B D                       Pig  tca--g
B D                    Alpaca  gaa--g
               Bactrian camel  taa--g
B D                     Horse  tta--a
B D          White rhinoceros  tta--a
B D                       Cat  taa--g
B D                       Dog  taa--g
B D                   Ferret   taa--g
B D                     Panda  taa--g
               Pacific walrus  taa--g
                 Weddell seal  taa--g
             Black flying-fox  taa--g
B D                   Megabat  taa--g
                Big brown bat  tag--g
         David's myotis (bat)  tag--g
B D                  Microbat  tag--g
B D                  Hedgehog  taa--a
B D                  Elephant  tag--a
          Cape elephant shrew  taaccc
B D                   Manatee  tag--a
                     Aardvark  tag--a
B D                 Armadillo  taa--a
B D           Tasmanian devil  -aa--c
  D  Chinese softshell turtle  taa--t
B D                     Mouse  ======
B D                       Rat  ======
B D                    Tenrec  ======
B D                     Shrew  ======
                Prairie vole  ======
              Golden hamster  ======
             Star-nosed mole  ======
B D                       Cow  ======
               Domestic goat  ======
B D                     Sheep  ======
            Tibetan antelope  ======
                Killer whale  ======
B D                   Dolphin  ======
B D                    Turkey  ======
B D                   Chicken  ======
B D                Budgerigar  ======
          Tibetan ground jay  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D               Rock pigeon  ======
B D       Medium ground finch  ======
  D              Mallard duck  ======
B D                   Wallaby  ======
  D    White-throated sparrow  ======
            Cape golden mole  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D                   Opossum  ======
B D                  Platypus  ======
B D        American alligator  ======
B D               Zebra finch  ======
  D       Collared flycatcher  ======

Alignment block 8 of 32 in window, 67987414 - 67987417, 4 bps 
B D                     Human  ggtt
B D                     Chimp  agtt
B D                   Gorilla  ggtt
B D                 Orangutan  ggtt
B D                    Gibbon  ggtt
B D                    Rhesus  ggtt
B D       Crab-eating macaque  ggtt
B D                    Baboon  ggtt
B D              Green monkey  ggtt
B D                  Marmoset  agtt
B D           Squirrel monkey  agct
B D                  Bushbaby  ggca
           Chinese tree shrew  agca
B D                  Squirrel  gatg
       Lesser Egyptian jerboa  gatg
B D           Chinese hamster  ggta
B D            Naked mole-rat  gatg
B D                Guinea pig  gatg
                   Chinchilla  gatg
             Brush-tailed rat  gatg
B D                    Rabbit  ggtg
B D                      Pika  ggta
B D                       Pig  ggca
B D                    Alpaca  ggca
               Bactrian camel  ggca
B D                   Dolphin  ggca
                 Killer whale  ggca
B D                     Horse  ggca
B D          White rhinoceros  ggca
B D                       Cat  agca
B D                       Dog  ggca
B D                   Ferret   agca
B D                     Panda  ggca
               Pacific walrus  ggca
                 Weddell seal  gg-a
             Black flying-fox  gaca
B D                   Megabat  gaca
                Big brown bat  gaca
         David's myotis (bat)  gaca
B D                  Microbat  gaca
B D                  Hedgehog  ggca
B D                  Elephant  ggca
          Cape elephant shrew  tgca
B D                   Manatee  ggca
                     Aardvark  ggca
B D                 Armadillo  ggca
B D           Tasmanian devil  --ct
  D  Chinese softshell turtle  ggct
B D                     Mouse  ====
B D                       Rat  ====
B D                    Tenrec  ====
B D                     Shrew  ====
                Prairie vole  ====
              Golden hamster  ====
             Star-nosed mole  ====
B D                       Cow  ====
               Domestic goat  ====
B D                     Sheep  ====
            Tibetan antelope  ====
B D                    Turkey  ====
B D                   Chicken  ====
B D                Budgerigar  ====
          Tibetan ground jay  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D               Rock pigeon  ====
B D       Medium ground finch  ====
  D              Mallard duck  ====
B D                   Wallaby  ====
  D    White-throated sparrow  ====
            Cape golden mole  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D                   Opossum  ====
B D                  Platypus  ====
B D        American alligator  ====
B D               Zebra finch  ====
  D       Collared flycatcher  ====

Inserts between block 8 and 9 in window
B D          Tasmanian devil 2bp

Alignment block 9 of 32 in window, 67987418 - 67987420, 3 bps 
B D                     Human  --agt
B D                     Chimp  --agt
B D                   Gorilla  --agt
B D                 Orangutan  --agt
B D                    Gibbon  --agt
B D                    Rhesus  --agt
B D       Crab-eating macaque  --agt
B D                    Baboon  --agt
B D              Green monkey  --agt
B D                  Marmoset  --aat
B D           Squirrel monkey  --aat
B D                  Bushbaby  --ggt
           Chinese tree shrew  --agc
B D                  Squirrel  --agt
       Lesser Egyptian jerboa  --att
B D           Chinese hamster  --att
B D            Naked mole-rat  --aat
B D                Guinea pig  --aat
                   Chinchilla  --aat
             Brush-tailed rat  --aat
B D                    Rabbit  --agt
B D                      Pika  --agt
B D                       Pig  --agc
B D                    Alpaca  --agc
               Bactrian camel  --agc
B D                   Dolphin  --ggc
                 Killer whale  --ggc
B D                     Horse  --aac
B D          White rhinoceros  --aac
B D                       Cat  --ggc
B D                       Dog  --agc
B D                   Ferret   --agc
B D                     Panda  --agc
               Pacific walrus  --agc
                 Weddell seal  --agc
             Black flying-fox  --agc
B D                   Megabat  --agc
                Big brown bat  --agc
         David's myotis (bat)  --agc
B D                  Microbat  --agc
B D                  Hedgehog  --ag-
B D                  Elephant  --aga
          Cape elephant shrew  --agc
B D                   Manatee  --gga
B D                    Tenrec  --aga
                     Aardvark  --aga
B D                 Armadillo  --agt
B D                   Opossum  --agt
B D           Tasmanian devil  --agt
  D  Chinese softshell turtle  ata--
B D                     Mouse  =====
B D                       Rat  =====
B D                     Shrew  =====
                Prairie vole  =====
              Golden hamster  =====
             Star-nosed mole  =====
B D                       Cow  =====
               Domestic goat  =====
B D                     Sheep  =====
            Tibetan antelope  =====
B D                    Turkey  =====
B D                   Chicken  =====
B D                Budgerigar  =====
          Tibetan ground jay  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D               Rock pigeon  =====
B D       Medium ground finch  =====
  D              Mallard duck  =====
B D                   Wallaby  =====
  D    White-throated sparrow  =====
            Cape golden mole  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D                  Platypus  =====
B D        American alligator  =====
B D               Zebra finch  =====
  D       Collared flycatcher  =====

Inserts between block 9 and 10 in window
         Cape elephant shrew 3bp
B D                  Opossum 1bp
B D          Tasmanian devil 1bp

Alignment block 10 of 32 in window, 67987421 - 67987426, 6 bps 
B D                     Human  acaag---t
B D                     Chimp  acaag---t
B D                   Gorilla  acaag---t
B D                 Orangutan  acaac---t
B D                    Gibbon  acaag---t
B D                    Rhesus  acaag---t
B D       Crab-eating macaque  acaag---t
B D                    Baboon  acaag---t
B D              Green monkey  acaag---t
B D                  Marmoset  acaaa---t
B D           Squirrel monkey  acaat---t
B D                  Bushbaby  acaaa---t
           Chinese tree shrew  ataag---a
B D                  Squirrel  acaga---t
       Lesser Egyptian jerboa  ac-------
B D           Chinese hamster  tcaag---a
B D            Naked mole-rat  gcaag---t
B D                Guinea pig  gcaag---c
                   Chinchilla  gtaag---c
             Brush-tailed rat  gcaag---t
B D                    Rabbit  acaag---t
B D                      Pika  gcagg---t
B D                       Pig  acaag---t
B D                    Alpaca  ccaag---t
               Bactrian camel  ccaag---t
B D                   Dolphin  acaag---t
                 Killer whale  acaag---t
             Tibetan antelope  acaag---t
B D                       Cow  acaag---t
B D                     Sheep  acaag---t
                Domestic goat  acaag---t
B D                     Horse  acaag---t
B D          White rhinoceros  gcaag---t
B D                       Cat  acaag---t
B D                       Dog  acaag---t
B D                   Ferret   acaaa---t
B D                     Panda  acaag---t
               Pacific walrus  acaat---t
                 Weddell seal  acaat---t
             Black flying-fox  tcaac---t
B D                   Megabat  tcaac---t
                Big brown bat  acaag---t
         David's myotis (bat)  acaag---t
B D                  Microbat  acaag---t
B D                  Hedgehog  aagag---t
B D                  Elephant  ataag----
B D                   Manatee  ataag----
B D                    Tenrec  agaaaa---
                     Aardvark  ttaag-a--
B D                 Armadillo  actag--t-
B D                   Opossum  aaaga----
B D           Tasmanian devil  aaaaa----
  D  Chinese softshell turtle  gcaaa---t
B D                     Mouse  =========
B D                       Rat  =========
         Cape elephant shrew  =========
B D                     Shrew  =========
                Prairie vole  =========
              Golden hamster  =========
             Star-nosed mole  =========
B D                    Turkey  =========
B D                   Chicken  =========
B D                Budgerigar  =========
          Tibetan ground jay  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
  D               Rock pigeon  =========
B D       Medium ground finch  =========
  D              Mallard duck  =========
B D                   Wallaby  =========
  D    White-throated sparrow  =========
            Cape golden mole  =========
  D            Painted turtle  =========
  D           Green seaturtle  =========
B D                  Platypus  =========
B D        American alligator  =========
B D               Zebra finch  =========
  D       Collared flycatcher  =========

Inserts between block 10 and 11 in window
B D          Chinese hamster 6bp
B D                      Pig 3bp
B D                   Alpaca 3bp
              Bactrian camel 3bp
B D                  Dolphin 3bp
                Killer whale 3bp
            Tibetan antelope 3bp
B D                      Cow 3bp
B D                    Sheep 3bp
               Domestic goat 3bp
B D                    Horse 3bp
B D         White rhinoceros 3bp
B D                      Cat 3bp
B D                      Dog 3bp
B D                  Ferret  3bp
B D                    Panda 3bp
              Pacific walrus 3bp
                Weddell seal 3bp
            Black flying-fox 3bp
B D                  Megabat 3bp
               Big brown bat 3bp
        David's myotis (bat) 3bp
B D                 Microbat 3bp
B D                 Hedgehog 3bp
B D                 Elephant 3bp
B D                  Manatee 3bp
B D                   Tenrec 3bp
                    Aardvark 3bp
B D                Armadillo 3bp

Alignment block 11 of 32 in window, 67987427 - 67987432, 6 bps 
B D                     Human  -aagaag
B D                     Chimp  -aagaag
B D                   Gorilla  -aagaag
B D                 Orangutan  -aagaag
B D                    Gibbon  -aagaag
B D                    Rhesus  -aagaag
B D       Crab-eating macaque  -aagaag
B D                    Baboon  -aagaag
B D              Green monkey  -aagaag
B D                  Marmoset  -aagaag
B D           Squirrel monkey  -aagaag
B D                  Bushbaby  -aag---
           Chinese tree shrew  -aagaag
B D                  Squirrel  -agg---
       Lesser Egyptian jerboa  ---g---
B D           Chinese hamster  -aga---
B D                     Mouse  -aag---
B D                       Rat  -aag---
B D            Naked mole-rat  -agg---
B D                Guinea pig  -agg---
                   Chinchilla  -agg---
             Brush-tailed rat  -agg---
B D                    Rabbit  -cag---
B D                      Pika  -aag---
B D                       Pig  -aag---
B D                    Alpaca  -aag---
               Bactrian camel  -aag---
B D                   Dolphin  -aag---
                 Killer whale  -aag---
             Tibetan antelope  -aag---
B D                       Cow  -aag---
B D                     Sheep  -aag---
                Domestic goat  -aag---
B D                     Horse  -aag---
B D          White rhinoceros  -aag---
B D                       Cat  -aag---
B D                       Dog  -aag---
B D                   Ferret   -aag---
B D                     Panda  -aaa---
               Pacific walrus  -aag---
                 Weddell seal  -aag---
             Black flying-fox  -aag---
B D                   Megabat  -aag---
                Big brown bat  -aag---
         David's myotis (bat)  -aag---
B D                  Microbat  -aag---
B D                  Hedgehog  -cag---
B D                  Elephant  -aag---
          Cape elephant shrew  -aca---
B D                   Manatee  -aag---
             Cape golden mole  -aag---
B D                    Tenrec  -aca---
                     Aardvark  -aag---
B D                 Armadillo  -aat---
B D                   Opossum  --aa---
B D           Tasmanian devil  --ag---
  D  Chinese softshell turtle  aaaa---
B D                     Shrew  =======
                Prairie vole  =======
              Golden hamster  =======
             Star-nosed mole  =======
B D                    Turkey  =======
B D                   Chicken  =======
B D                Budgerigar  =======
          Tibetan ground jay  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
B D       Medium ground finch  =======
  D              Mallard duck  =======
B D                   Wallaby  =======
  D    White-throated sparrow  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D                  Platypus  =======
B D        American alligator  =======
B D               Zebra finch  =======
  D       Collared flycatcher  =======

Inserts between block 11 and 12 in window
B D                   Rhesus 1bp
B D      Crab-eating macaque 1bp
B D                   Baboon 1bp
B D             Green monkey 1bp
B D                 Squirrel 3bp
B D          Chinese hamster 13bp
B D                    Mouse 3bp
B D                      Rat 3bp
B D           Naked mole-rat 3bp
B D               Guinea pig 3bp
                  Chinchilla 3bp
            Brush-tailed rat 3bp
B D                   Rabbit 3bp
B D                     Pika 3bp
B D                  Opossum 3bp
B D          Tasmanian devil 4bp

Alignment block 12 of 32 in window, 67987433 - 67987439, 7 bps 
B D                     Human  tttttca
B D                     Chimp  tttttca
B D                   Gorilla  tttttca
B D                 Orangutan  tttttca
B D                    Gibbon  tttttca
B D                    Rhesus  tttttta
B D       Crab-eating macaque  tttttta
B D                    Baboon  tttttta
B D              Green monkey  tttttta
B D                  Marmoset  cttttcc
B D           Squirrel monkey  cttttcc
B D                  Bushbaby  ttttcca
           Chinese tree shrew  -tttctg
B D                  Squirrel  ttgttca
       Lesser Egyptian jerboa  ttttcca
                 Prairie vole  tttttca
B D           Chinese hamster  tttttca
               Golden hamster  tttttca
B D                     Mouse  ttttcca
B D                       Rat  tttttca
B D            Naked mole-rat  tttttca
B D                Guinea pig  tttttca
                   Chinchilla  ttttgca
             Brush-tailed rat  tttttca
B D                    Rabbit  ttttctg
B D                      Pika  gtttcag
B D                       Pig  ttttaca
B D                    Alpaca  ttttcca
               Bactrian camel  ttttcca
B D                   Dolphin  ttttcca
                 Killer whale  ttttcca
             Tibetan antelope  ctttcca
B D                       Cow  ttttcca
B D                     Sheep  ttttcca
                Domestic goat  ttttcca
B D                     Horse  ttttccg
B D          White rhinoceros  ttttcct
B D                       Cat  ttttcca
B D                       Dog  ttttcca
B D                   Ferret   ttttcca
B D                     Panda  gtttcca
               Pacific walrus  ttttcca
                 Weddell seal  ttttcca
             Black flying-fox  ttttcca
B D                   Megabat  ttttcca
                Big brown bat  tttttca
         David's myotis (bat)  tttttaa
B D                  Microbat  tttttaa
B D                  Hedgehog  tttt---
B D                  Elephant  -ttttca
          Cape elephant shrew  -tgttcc
B D                   Manatee  -ttttca
             Cape golden mole  -ttttca
B D                    Tenrec  -tttcca
                     Aardvark  -ttctca
B D                 Armadillo  -atttct
B D                   Opossum  -ttttca
B D           Tasmanian devil  tttttca
  D  Chinese softshell turtle  -cttctg
B D                     Shrew  =======
             Star-nosed mole  =======
B D                    Turkey  =======
B D                   Chicken  =======
B D                Budgerigar  =======
          Tibetan ground jay  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
B D       Medium ground finch  =======
  D              Mallard duck  =======
B D                   Wallaby  =======
  D    White-throated sparrow  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D                  Platypus  =======
B D        American alligator  =======
B D               Zebra finch  =======
  D       Collared flycatcher  =======

Inserts between block 12 and 13 in window
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 1bp
B D                Armadillo 1bp
B D                  Opossum 1bp
B D          Tasmanian devil 1bp

Alignment block 13 of 32 in window, 67987440 - 67987442, 3 bps 
B D                     Human  ttt
B D                     Chimp  ttt
B D                   Gorilla  ttt
B D                 Orangutan  ttt
B D                    Gibbon  ttt
B D                    Rhesus  ttt
B D       Crab-eating macaque  ttt
B D                    Baboon  ttt
B D              Green monkey  ttt
B D                  Marmoset  ttt
B D           Squirrel monkey  ttt
B D                  Bushbaby  -tt
           Chinese tree shrew  ttt
B D                  Squirrel  tat
       Lesser Egyptian jerboa  tat
                 Prairie vole  ttt
B D           Chinese hamster  ttt
               Golden hamster  ttt
B D                     Mouse  tat
B D                       Rat  tat
B D            Naked mole-rat  tat
B D                Guinea pig  tat
                   Chinchilla  tat
             Brush-tailed rat  tat
B D                    Rabbit  ttt
B D                      Pika  ctt
B D                       Pig  ttt
B D                    Alpaca  ctt
               Bactrian camel  ctt
B D                   Dolphin  ttt
                 Killer whale  ttt
             Tibetan antelope  ttt
B D                       Cow  ttt
B D                     Sheep  ttt
                Domestic goat  ttt
B D                     Horse  ttt
B D          White rhinoceros  ttt
B D                       Cat  ttt
B D                       Dog  ttt
B D                   Ferret   ttt
B D                     Panda  ttt
               Pacific walrus  ttt
                 Weddell seal  ttt
             Black flying-fox  ttt
B D                   Megabat  ttt
                Big brown bat  ttt
         David's myotis (bat)  ttt
B D                  Microbat  ttt
B D                     Shrew  ttt
              Star-nosed mole  ttt
B D                  Elephant  ttt
          Cape elephant shrew  ttt
B D                   Manatee  ttt
             Cape golden mole  ttt
B D                    Tenrec  ttt
                     Aardvark  ctt
B D                 Armadillo  ttt
B D                   Opossum  tc-
B D           Tasmanian devil  tg-
  D  Chinese softshell turtle  ttt
B D                  Hedgehog  ---
B D                    Turkey  ===
B D                   Chicken  ===
B D                Budgerigar  ===
          Tibetan ground jay  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D       Medium ground finch  ===
  D              Mallard duck  ===
B D                   Wallaby  ===
  D    White-throated sparrow  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D                  Platypus  ===
B D        American alligator  ===
B D               Zebra finch  ===
  D       Collared flycatcher  ===

Inserts between block 13 and 14 in window
         Cape elephant shrew 146bp

Alignment block 14 of 32 in window, 67987443 - 67987450, 8 bps 
B D                     Human  t---aaag-------------------tca
B D                     Chimp  t---aaag-------------------tca
B D                   Gorilla  t---aaag-------------------tca
B D                 Orangutan  t---aaag-------------------tca
B D                    Gibbon  t---aaag-------------------tca
B D                    Rhesus  t---aaag-------------------tca
B D       Crab-eating macaque  t---aaag-------------------tca
B D                    Baboon  t---aaag-------------------tca
B D              Green monkey  t---aaag-------------------tca
B D                  Marmoset  t---taag-------------------tca
B D           Squirrel monkey  t---aaag-------------------tca
B D                  Bushbaby  t---gaag-------------------tca
           Chinese tree shrew  t---gaag-------------------tca
B D                  Squirrel  t---aaag-------------------tca
       Lesser Egyptian jerboa  tt--gaag-------------------tca
                 Prairie vole  c-----ag-------------------tca
B D           Chinese hamster  c-----ag-------------------tca
               Golden hamster  c-----ag-------------------tca
B D                     Mouse  t---gaag-------------------tca
B D                       Rat  t---gaag-------------------tca
B D            Naked mole-rat  t---gaag-------------------cca
B D                Guinea pig  t---gaag-------------------tca
                   Chinchilla  t---gaag-------------------tcc
             Brush-tailed rat  t---aaagtcagaatagaaatatcctttct
B D                    Rabbit  g---gaag-------------------gca
B D                      Pika  g---gaag-------------------cca
B D                       Pig  t---aaaa-------------------tca
B D                    Alpaca  t---gaag-------------------tca
               Bactrian camel  t---gaag-------------------tca
B D                   Dolphin  t---aaaa-------------------tca
                 Killer whale  t---aaaa-------------------tca
             Tibetan antelope  t---aaaa-------------------tcg
B D                       Cow  t---aaaa-------------------tca
B D                     Sheep  t---aaaa-------------------tca
                Domestic goat  t---aaaa-------------------tca
B D                     Horse  t---gaag-------------------tca
B D          White rhinoceros  t---gagg-------------------tca
B D                       Cat  t---gaag-------------------cca
B D                       Dog  t---gaag-------------------cca
B D                   Ferret   t---gaaa-------------------aca
B D                     Panda  t---gaag-------------------tca
               Pacific walrus  t---gaag-------------------cca
                 Weddell seal  t---aaag-------------------cca
             Black flying-fox  t---gaag-------------------tca
B D                   Megabat  t---aaag-------------------tca
                Big brown bat  t---gaag-------------------tca
         David's myotis (bat)  t---gaag-------------------tca
B D                  Microbat  t---gaag-------------------tca
B D                  Hedgehog  ----gaag-------------------tca
B D                     Shrew  t---gaag-------------------tca
              Star-nosed mole  t---gaag-------------------tca
B D                  Elephant  t---gaaa-------------------taa
B D                   Manatee  t---gaaa-------------------tga
             Cape golden mole  t---gaaa-------------------tga
B D                    Tenrec  t---gaag-------------------taa
                     Aardvark  t---gaaa-------------------tga
B D                 Armadillo  t---gaag-------------------gga
B D                   Opossum  a---gaag-------------------tgg
B D           Tasmanian devil  t---aaaa-------------------tga
  D  Chinese softshell turtle  -tagggag-------------------gaa
         Cape elephant shrew  ==============================
B D                    Turkey  ==============================
B D                   Chicken  ==============================
B D                Budgerigar  ==============================
          Tibetan ground jay  ==============================
  D          Peregrine falcon  ==============================
  D              Saker falcon  ==============================
  D               Rock pigeon  ==============================
B D       Medium ground finch  ==============================
  D              Mallard duck  ==============================
B D                   Wallaby  ==============================
  D    White-throated sparrow  ==============================
  D            Painted turtle  ==============================
  D           Green seaturtle  ==============================
B D                  Platypus  ==============================
B D        American alligator  ==============================
B D               Zebra finch  ==============================
  D       Collared flycatcher  ==============================

Alignment block 15 of 32 in window, 67987451 - 67987474, 24 bps 
B D                     Human  gcatc-t----------------gaaaag-----atacatt---gtag-c
B D                     Chimp  gcatc-t----------------gaaaag-----atacatt---gtag-c
B D                   Gorilla  gcatc-t----------------gaaaag-----atacatt---gtag-c
B D                 Orangutan  gcatc-t----------------gaaaag-----atacatt---gtag-c
B D                    Gibbon  gcatc-t----------------gaaaag-----atacgtt---gtag-c
B D                    Rhesus  tcatc-t----------------gaaaag-----atacatt---gtag-c
B D       Crab-eating macaque  tcatc-t----------------gaaaag-----atacatt---gtag-c
B D                    Baboon  tcatc-t----------------gaaaag-----atacatt---gtag-c
B D              Green monkey  ttatc-t----------------gaaaag-----atacatt---gtag-c
B D                  Marmoset  gcatg-t----------------gaaaag-----atacattgtagtag-c
B D           Squirrel monkey  gcatg-t----------------gaaaag-----atacatt---gcag-c
B D                  Bushbaby  gcatc-t----------------gaaga----------------gcat-c
           Chinese tree shrew  gcatc-t----------------gaaaag-----atacgtt---gtag-c
B D                  Squirrel  gcatc-t----------------gagaag-----gtacatt---gtag-c
       Lesser Egyptian jerboa  acatc-t----------------aaaaag-----atacact---gtagcc
                 Prairie vole  acatc-t----------------gaaaag-----ata------------a
B D           Chinese hamster  acatc-t----------------gaaaag-----tta------------a
               Golden hamster  acatc-t----------------gaaaag-----tta------------a
B D                     Mouse  gaatc-t----------------gagagg-----ata------------c
B D                       Rat  gcgtc-t----------------gagagg-----ata------------c
B D            Naked mole-rat  gcatc-g----------------gaaaag-----atacatt---gcag-c
B D                Guinea pig  acata-t----------------gaaaag-----atacatt---gtaa-c
                   Chinchilla  gcatc-g----------------aaaaag-----atacatt---gtag-c
             Brush-tailed rat  gcatctg----------------aaaagg-----atacatt---gtag-c
B D                    Rabbit  gcatt------------------ggaaga-----gagcatt---gtag-c
B D                      Pika  aaccc------------------ggggag-----ctgcgct---atgg-c
B D                       Pig  gcatc-t----------------gaaaat-----atgcatt---gtag-t
B D                    Alpaca  ggatc-t----------------gaaaag-----atgcatt---gtag-c
               Bactrian camel  ggatc-t----------------gaaaag-----atgcatt---gtag-c
B D                   Dolphin  gcatc-t----------------gagaag-----atgcatt---gtag-c
                 Killer whale  gcatc-t----------------gagaag-----atgcatt---gtag-t
             Tibetan antelope  gcatc-t----------------gagaag-----atgcact---gtag-c
B D                       Cow  gcatc-t----------------gagaag-----atgcact---gtag-c
B D                     Sheep  gcatg-t----------------gagaag-----atgcact---gtag-c
                Domestic goat  gcatc-t----------------gagaag-----atgcact---gtag-c
B D                     Horse  gcagc-t----------------ggaaag-----atgcatt---gtag-c
B D          White rhinoceros  gcatc-t----------------ggaaag-----atgcatt---gtag-c
B D                       Cat  gcatc-t----------------g-aaag-----atgtatt---acag-c
B D                       Dog  gcatc-t----------------gaaaag-----ttgcatt----tag-c
B D                   Ferret   gaatc-t----------------gaaaag-----atgcatt---atag-c
B D                     Panda  ggatc-t----------------gaaaag-----atgcatt---atag-c
               Pacific walrus  gcatc-t----------------gaaaag-----acgcatt---atag-c
                 Weddell seal  gcatc-t----------------gaaaaa-----atgcatt---atag-c
             Black flying-fox  gcatctt----------------gaaaag-----gtacatt---gtag-c
B D                   Megabat  gcatctt----------------gaaaag-----gtacatt---gtag-c
                Big brown bat  gcatc-t----------------gaaaag-----------------ag-t
         David's myotis (bat)  gcatc-t----------------gaaaag-----------------ag-c
B D                  Microbat  gcatc-t----------------gaaaag-----------------ag-c
B D                  Hedgehog  tcatc-t----------------gaaaaa-----ttgtgtt---gtag-c
B D                     Shrew  tc--------------------------------atgtatt---ttag-c
              Star-nosed mole  tcctt-t----------------gaaaagatgcactgcacc---gtag-c
B D                  Elephant  gcagc-t----------------gtaaag-----ctgcatt---gtag-c
B D                   Manatee  gcagc-t----------------gaaaag-----atgcatt---gtag-c
             Cape golden mole  acaac-t----------------gaaaag-----aagcatc---atcg-c
B D                    Tenrec  ggagg-t----------------gaaaag-----attcctt---gtag-c
                     Aardvark  gctgc-t----------------gaaaag-----atg-------------
B D                 Armadillo  gcagc---------------------------------------------
B D                   Opossum  gcaga-c-----------------aaaag-----ctac------------
B D           Tasmanian devil  gtaaa-c---------------aaaaaaa-----tttc------------
B D                  Platypus  gcatc-t----------------tagaat-----cttagg----------
  D  Chinese softshell turtle  gctcc-ttgtgaaagtattactagaaaat-----gt--------------
         Cape elephant shrew  ==================================================
B D                    Turkey  ==================================================
B D                   Chicken  ==================================================
B D                Budgerigar  ==================================================
          Tibetan ground jay  ==================================================
  D          Peregrine falcon  ==================================================
  D              Saker falcon  ==================================================
  D               Rock pigeon  ==================================================
B D       Medium ground finch  ==================================================
  D              Mallard duck  ==================================================
B D                   Wallaby  ==================================================
  D    White-throated sparrow  ==================================================
  D            Painted turtle  ==================================================
  D           Green seaturtle  ==================================================
B D        American alligator  ==================================================
B D               Zebra finch  ==================================================
  D       Collared flycatcher  ==================================================

Inserts between block 15 and 16 in window
B D                 Hedgehog 221bp
             Star-nosed mole 1bp

Alignment block 16 of 32 in window, 67987475 - 67987475, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  c
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                      Pika  g
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  a
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                     Shrew  c
              Star-nosed mole  t
B D                  Elephant  c
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  c
B D                   Opossum  t
B D           Tasmanian devil  t
B D                  Platypus  c
  D  Chinese softshell turtle  c
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                 Armadillo  -
B D                    Turkey  =
B D                   Chicken  =
B D                Budgerigar  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  =
  D              Mallard duck  =
B D                   Wallaby  =
  D    White-throated sparrow  =
                    Aardvark  -
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D               Zebra finch  =
  D       Collared flycatcher  =

Inserts between block 16 and 17 in window
B D                 Marmoset 1bp
B D          Squirrel monkey 1bp
          Chinese tree shrew 1bp
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 5bp
B D                   Rabbit 1bp
B D                     Pika 1bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                 Elephant 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
B D                 Platypus 1bp

Alignment block 17 of 32 in window, 67987476 - 67987479, 4 bps 
B D                     Human  -ttt-a
B D                     Chimp  -ttt-a
B D                   Gorilla  -ttt-a
B D                 Orangutan  -ttt-a
B D                    Gibbon  -ttt-a
B D                    Rhesus  -ttt-a
B D       Crab-eating macaque  -ttt-a
B D                    Baboon  -ttt-a
B D              Green monkey  -ttt-a
B D                  Marmoset  -ttt-a
B D           Squirrel monkey  -ttt-a
B D                  Bushbaby  -ttt-a
           Chinese tree shrew  -ttt-a
B D                  Squirrel  -ttt-a
       Lesser Egyptian jerboa  -tta-g
                 Prairie vole  -gtg-g
B D           Chinese hamster  -atg-g
               Golden hamster  -atg-g
B D                     Mouse  -gtg-g
B D                       Rat  -gtg-g
B D            Naked mole-rat  -gtt-a
B D                Guinea pig  -gtt-a
                   Chinchilla  -ttt-a
             Brush-tailed rat  -gtt-a
B D                    Rabbit  -tgg-a
B D                      Pika  -ggg-a
B D                       Pig  -ttt-a
B D                    Alpaca  -tt---
               Bactrian camel  -tt---
B D                   Dolphin  -ttt-a
                 Killer whale  -ttt-a
             Tibetan antelope  -ttt-a
B D                       Cow  -ttt-a
B D                     Sheep  -ttt-a
                Domestic goat  -ttt-a
B D                     Horse  -att-a
B D          White rhinoceros  -ttt-a
B D                       Cat  -ttt-a
B D                       Dog  -ttc--
B D                   Ferret   -ttt-a
B D                     Panda  -ttt-a
               Pacific walrus  -ttt-a
                 Weddell seal  -ttt-a
             Black flying-fox  -ttt-a
B D                   Megabat  -ttt-a
                Big brown bat  -ttt-a
         David's myotis (bat)  -ttt-a
B D                  Microbat  -ttt-a
B D                  Hedgehog  -ttt-a
B D                     Shrew  -ttt-a
              Star-nosed mole  -ttt-a
B D                  Elephant  -ttt-a
B D                   Manatee  -ttt-a
             Cape golden mole  -ttt-a
B D                    Tenrec  -cttga
B D                 Armadillo  -----a
B D                   Opossum  -tta-a
B D           Tasmanian devil  -tta-a
B D                  Platypus  -tta-c
  D  Chinese softshell turtle  atat--
         Cape elephant shrew  ======
B D                    Turkey  ======
B D                   Chicken  ======
B D                Budgerigar  ======
          Tibetan ground jay  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D               Rock pigeon  ======
B D       Medium ground finch  ======
  D              Mallard duck  ======
B D                   Wallaby  ======
  D    White-throated sparrow  ======
                    Aardvark  ------
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D        American alligator  ======
B D               Zebra finch  ======
  D       Collared flycatcher  ======

Inserts between block 17 and 18 in window
  D Chinese softshell turtle 5bp

Alignment block 18 of 32 in window, 67987480 - 67987515, 36 bps 
B D                     Human  gaggctctgatttc-----ctt-g--aagcc-t--gttactta-t------ttg
B D                     Chimp  gaggctctgatttc-----ctt-g--aagcc-t--gttactta-t------ttg
B D                   Gorilla  gaggctctgatttc-----ctt-g--aagcc-t--gttactta-t------ttg
B D                 Orangutan  gaggctctgatttc-----ctt-g--aagcc-t--gttactta-t------ttg
B D                    Gibbon  gaggctctgatttc-----ctt-g--aagcc-t--gttactta-t------ttg
B D                    Rhesus  gagg--ctgatttc-----ctt-g--aagcc-t--gtcactta-t------ttg
B D       Crab-eating macaque  gagg--ctgatttc-----ctt-g--aagcc-t--gtcactta-t------ttg
B D                    Baboon  gagg--ctgatttc-----ctt-g--aagcc-t--gtcactta-t------ttg
B D              Green monkey  gagg--ctgatttc-----ctt-g--aagcc-t--gtcactta-t------ttg
B D                  Marmoset  gaggctctgatttc-----ctt-g--aagtc-t--gctactta-t------ttg
B D           Squirrel monkey  gaggctctgatttc-----ctt-g--aagtc-t--gcaactta-t------ttg
B D                  Bushbaby  gaggctctgatttc-----tct-g--taacc-g--attactta-t------ttg
           Chinese tree shrew  gagactttcatttt-----cct-g--aagct-c--atcaccta-g------ttt
B D                  Squirrel  gaggctctggtttc-----cct-g--cagct-c--atctttta-t------ttg
       Lesser Egyptian jerboa  gggctctggttttc-----ccc-c--aaacc-t--tttacata-t------ttg
                 Prairie vole  gacgccctgatttc-----cct-g--aagccaa--tttacttg-c------tta
B D           Chinese hamster  gaagccctcttttc-----cct-g--aagcc-a--ttcacttg-c------atg
               Golden hamster  gaggccctcatttc-----cct-g--aagcc-a--atcacttg-c------ttg
B D                     Mouse  gaggccctgatttc-----cct-g--aagct-g--ttcccttg-c------ttg
B D                       Rat  gaggccctgatttc-----cct-g--aagtc-a--ttcccttc-c------ttg
B D            Naked mole-rat  caggctctgatttc-----cct-g--aagct-c--atcactta-t------ttg
B D                Guinea pig  caaattctgatttc-----ccc-a--aagcc-c--atcactta-t------ttg
                   Chinchilla  cagactctgatttc-----ccc-a--aagcc-cgggtcactta-t------ctg
             Brush-tailed rat  gaggctctgatttc-----ccc-c--aaacc-c--gtcactta-t------ttg
B D                    Rabbit  gagacgctga-ttt-----cct-g--aagcc-t--cctattta-cagttgtttg
B D                      Pika  gaggctctga-ttc-----ccc-g--gaaca--------------------ttg
B D                       Pig  gaggctctgatttc-----ctg-a--agacc-c--atccatta-t------ttg
B D                    Alpaca  gaggctctgatttc-----cct-a--acacc-c--atcaattatt------ttg
               Bactrian camel  gaggctctgatttc-----cct-a--acacc-c--atcaattatt------ttg
B D                   Dolphin  gaggc--tgatttc-----ccc-c--aaacc-c--atcaatta-t------ttg
                 Killer whale  caggc--tgatttc-----ccc-a--aaacc-c--atcaatta-t------ttg
             Tibetan antelope  gaggctttgatttc-----cccta--aaatt-c--atcagtta-t------ttg
B D                       Cow  gaggctctgatttc-----cccta--aaatt-c--atcagtta-t------ttg
B D                     Sheep  gaggctttgatttc-----cccta--aaatt-c--atcagtta-t------ttg
                Domestic goat  gaggctttgatttc-----cccta--aaatt-c--atcagtta-t------ttg
B D                     Horse  gagactctaatttc-----cct-g--aaacc-t--gtcact---t------atg
B D          White rhinoceros  gtgact--------------ct-g--aaacg-t--atcact---t------gta
B D                       Cat  gaggttctgatttc-----ccc-g--aagcc-c--tttactta-t------ttg
B D                       Dog  gaggttctgatttc-----ccc-g--aaacc-c--attacttc-t------tta
B D                   Ferret   gaggttctgatttc-----ccc-a--gatcc-c--atcacttc-t------tta
B D                     Panda  gaggttctgatttc-----cct-a--aaacc-c--atcacttc-t------tta
               Pacific walrus  gaggttctgatttc-----ccc-a--aaacc-c--atcacttc-t------ata
                 Weddell seal  gaggttctgatttc-----ccc-a--caacc-c--atcacttc-t------tta
             Black flying-fox  gaggctct-atttc-----cct-g--aaaca-c--attactta-t------ttg
B D                   Megabat  gaggctct-atttc-----cat-g--aaaca-c--attactta-t------ttg
                Big brown bat  gaagctc--------------t-g--aaacc-c--attactta-t------ttg
         David's myotis (bat)  gaggctc--------------t-g--aaacc-c--atgactta-t------ttg
B D                  Microbat  gaggctc--------------t-g--aaacc-c--atgactta-t------ttg
B D                  Hedgehog  aaagttctgatttc-----cat-g--aagct-c--atgactta-t------atg
B D                     Shrew  gag--tttgatttt-----tat-g--aaatc-c--at--caca-ta-----ttt
              Star-nosed mole  gatgctctggtttc-----tgg-g--aaacc-c--at--ctca-t------ttg
B D                  Elephant  gaggttctaaattc-----ctg-g--aaacc-c--attactta-t------ttg
B D                   Manatee  gaggttctaacttt-----ccg-g--aaacc-c--atcactta-t------ttg
             Cape golden mole  gaagtcctgacttc-----cct-c--aagcc-c--atcactta-t------atc
B D                    Tenrec  gacgttcagtcttc-----cct-g--aagcc-c--atcacttg-t------ttg
                     Aardvark  ---------acttc-----cct-c--aagcc-c--atcactta-t------ttg
B D                 Armadillo  ------ctgactt------ctt-g--aagct-c--atcgcttg-t------ttg
B D                   Opossum  tatattgtgactcc-----tct-ggtatatt-t--accttctg-a------t--
B D           Tasmanian devil  tatattaagatttt-----cct-gataaatg-t--atctcctg-a------t--
B D                  Platypus  cggaataagacctc-----ccc-a--gcttt-t--gtaccctc-c------att
B D        American alligator  gaggctttgaaaaagtgccttc-t--aaaag-t--attacta------------
  D  Chinese softshell turtle  aacgatttgtataa-----ttt-a--gagag-t--gttggtg------------
         Cape elephant shrew  ======================================================
B D                    Turkey  ======================================================
B D                   Chicken  ======================================================
B D                Budgerigar  ======================================================
          Tibetan ground jay  ======================================================
  D          Peregrine falcon  ======================================================
  D              Saker falcon  ======================================================
  D               Rock pigeon  ======================================================
B D       Medium ground finch  ======================================================
  D              Mallard duck  ======================================================
B D                   Wallaby  ======================================================
  D    White-throated sparrow  ======================================================
  D            Painted turtle  ======================================================
  D           Green seaturtle  ======================================================
B D               Zebra finch  ======================================================
  D       Collared flycatcher  ======================================================

Inserts between block 18 and 19 in window
B D                      Dog 1bp

Alignment block 19 of 32 in window, 67987516 - 67987521, 6 bps 
B D                     Human  -taaagg
B D                     Chimp  -taaagg
B D                   Gorilla  -taaagg
B D                 Orangutan  -taaagg
B D                    Gibbon  -taaagg
B D                    Rhesus  -taaagg
B D       Crab-eating macaque  -taaagg
B D                    Baboon  -taaagg
B D              Green monkey  -taaagg
B D                  Marmoset  -taaagg
B D           Squirrel monkey  -taaagg
B D                  Bushbaby  -taaagg
           Chinese tree shrew  -tgaagg
B D                  Squirrel  -ttaagg
       Lesser Egyptian jerboa  -taaagt
                 Prairie vole  -aaatgg
B D           Chinese hamster  -aaaaag
               Golden hamster  -aaaaag
B D                     Mouse  -g--aag
B D                       Rat  -gaaaag
B D            Naked mole-rat  -taaaga
B D                Guinea pig  -taaagg
                   Chinchilla  -taaagg
             Brush-tailed rat  -taaagg
B D                    Rabbit  -taaagg
B D                      Pika  -tggagg
B D                       Pig  -taaagg
B D                    Alpaca  -taaagg
               Bactrian camel  -taaagg
B D                   Dolphin  -taaatg
                 Killer whale  -taaatg
             Tibetan antelope  -taaaag
B D                       Cow  -taaaag
B D                     Sheep  -taaaag
                Domestic goat  -taaaag
B D                     Horse  -taaagg
B D          White rhinoceros  -taaagg
B D                       Cat  -taaagg
B D                       Dog  -taaagg
B D                   Ferret   -taaagg
B D                     Panda  -taaagg
               Pacific walrus  -taaagg
                 Weddell seal  -tgaagg
             Black flying-fox  -taa---
B D                   Megabat  -taa---
                Big brown bat  -taaagg
         David's myotis (bat)  -taaagg
B D                  Microbat  -taaaga
B D                  Hedgehog  -tgaagg
B D                     Shrew  -ataagt
              Star-nosed mole  -ttaagg
B D                  Elephant  -taaagg
B D                   Manatee  -taaagg
             Cape golden mole  -ttc---
B D                    Tenrec  -tcaagg
                     Aardvark  -caaaga
B D                 Armadillo  -taaagg
B D                   Opossum  -taaagg
B D           Tasmanian devil  -taaaga
B D                   Wallaby  -taaagg
B D                  Platypus  -taaggg
B D        American alligator  -aaaaa-
  D  Chinese softshell turtle  ccaaaa-
         Cape elephant shrew  =======
B D                    Turkey  =======
B D                   Chicken  =======
B D                Budgerigar  =======
          Tibetan ground jay  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
B D       Medium ground finch  =======
  D              Mallard duck  =======
  D    White-throated sparrow  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D               Zebra finch  =======
  D       Collared flycatcher  =======

Alignment block 20 of 32 in window, 67987522 - 67987524, 3 bps 
B D                     Human  tcc--
B D                     Chimp  tcc--
B D                   Gorilla  tcc--
B D                 Orangutan  tcc--
B D                    Gibbon  tcc--
B D                    Rhesus  tcc--
B D       Crab-eating macaque  tcc--
B D                    Baboon  tcc--
B D              Green monkey  tcc--
B D                  Marmoset  tcc--
B D           Squirrel monkey  tcc--
B D                  Bushbaby  tcg--
           Chinese tree shrew  tcc--
B D                  Squirrel  tcc--
       Lesser Egyptian jerboa  tct--
                 Prairie vole  gcc--
B D           Chinese hamster  gcc--
               Golden hamster  gcc--
B D                     Mouse  gct--
B D                       Rat  gcc--
B D            Naked mole-rat  tcc--
B D                Guinea pig  tcc--
                   Chinchilla  tcc--
             Brush-tailed rat  ttc--
B D                    Rabbit  tcc--
B D                      Pika  gct--
B D                       Pig  tcc--
B D                    Alpaca  tcc--
               Bactrian camel  tcc--
B D                   Dolphin  tcc--
                 Killer whale  tcc--
             Tibetan antelope  tcc--
B D                       Cow  tcc--
B D                     Sheep  tcc--
                Domestic goat  tcc--
B D                     Horse  tcc--
B D          White rhinoceros  acc--
B D                       Cat  ttc--
B D                       Dog  tcc--
B D                   Ferret   tcc--
B D                     Panda  tcc--
               Pacific walrus  tcc--
                 Weddell seal  tcc--
                Big brown bat  tcc--
         David's myotis (bat)  tcc--
B D                  Microbat  tcc--
B D                  Hedgehog  tct--
B D                     Shrew  tcc--
              Star-nosed mole  tcc--
B D                  Elephant  tcc--
          Cape elephant shrew  tct--
B D                   Manatee  tcc--
B D                    Tenrec  tcc--
                     Aardvark  ccc--
B D                 Armadillo  tcc--
B D                   Opossum  --t--
B D           Tasmanian devil  --t--
B D                   Wallaby  --t--
B D                  Platypus  tgc--
B D        American alligator  --tga
  D  Chinese softshell turtle  --tgg
            Black flying-fox  -----
B D                    Turkey  =====
B D                   Chicken  =====
B D                Budgerigar  =====
          Tibetan ground jay  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D               Rock pigeon  =====
B D       Medium ground finch  =====
  D              Mallard duck  =====
  D    White-throated sparrow  =====
            Cape golden mole  -----
B D                   Megabat  -----
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D               Zebra finch  =====
  D       Collared flycatcher  =====

Inserts between block 20 and 21 in window
B D                   Tenrec 200bp
B D                  Opossum 2bp
B D          Tasmanian devil 2bp
B D                  Wallaby 2bp

Alignment block 21 of 32 in window, 67987525 - 67987526, 2 bps 
B D                     Human  at
B D                     Chimp  at
B D                   Gorilla  gt
B D                 Orangutan  at
B D                    Gibbon  at
B D                    Rhesus  at
B D       Crab-eating macaque  at
B D                    Baboon  at
B D              Green monkey  at
B D                  Marmoset  at
B D           Squirrel monkey  at
B D                  Bushbaby  ag
           Chinese tree shrew  at
B D                  Squirrel  at
       Lesser Egyptian jerboa  at
                 Prairie vole  ac
B D           Chinese hamster  ac
               Golden hamster  at
B D                     Mouse  ag
B D                       Rat  ag
B D            Naked mole-rat  ac
B D                Guinea pig  at
                   Chinchilla  at
             Brush-tailed rat  ac
B D                    Rabbit  ac
B D                      Pika  gc
B D                       Pig  at
B D                    Alpaca  at
               Bactrian camel  at
B D                   Dolphin  at
                 Killer whale  at
             Tibetan antelope  at
B D                       Cow  at
B D                     Sheep  at
                Domestic goat  at
B D                     Horse  gc
B D          White rhinoceros  at
B D                       Cat  at
B D                       Dog  at
B D                   Ferret   at
B D                     Panda  at
               Pacific walrus  at
                 Weddell seal  at
                Big brown bat  ag
         David's myotis (bat)  ag
B D                  Microbat  ag
B D                  Hedgehog  at
B D                     Shrew  at
              Star-nosed mole  at
B D                  Elephant  at
          Cape elephant shrew  gt
B D                   Manatee  at
             Cape golden mole  at
B D                    Tenrec  at
                     Aardvark  at
B D                 Armadillo  at
B D                   Opossum  at
B D           Tasmanian devil  ac
B D                   Wallaby  at
B D                  Platypus  at
B D        American alligator  ct
  D  Chinese softshell turtle  aa
            Black flying-fox  --
B D                    Turkey  ==
B D                   Chicken  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
  D              Mallard duck  ==
  D    White-throated sparrow  ==
B D                   Megabat  --
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==

Inserts between block 21 and 22 in window
B D       American alligator 2bp

Alignment block 22 of 32 in window, 67987527 - 67987532, 6 bps 
B D                     Human  agtaag
B D                     Chimp  agtaag
B D                   Gorilla  agtaag
B D                 Orangutan  agtcag
B D                    Gibbon  agtaag
B D                    Rhesus  agtaag
B D       Crab-eating macaque  agtaag
B D                    Baboon  agtaag
B D              Green monkey  agtaag
B D                  Marmoset  ggtaag
B D           Squirrel monkey  ggtaag
B D                  Bushbaby  ggtaaa
           Chinese tree shrew  agtaag
B D                  Squirrel  aataaa
       Lesser Egyptian jerboa  aggaag
                 Prairie vole  aatgag
B D           Chinese hamster  aatgag
               Golden hamster  aatgag
B D                     Mouse  cacaag
B D                       Rat  catgag
B D            Naked mole-rat  agcaag
B D                Guinea pig  actaag
                   Chinchilla  agtaag
             Brush-tailed rat  agtaag
B D                    Rabbit  aggaag
B D                      Pika  acgaag
B D                       Pig  agtaag
B D                    Alpaca  agtaag
               Bactrian camel  agtaag
B D                   Dolphin  agtaag
                 Killer whale  agtaag
             Tibetan antelope  a-----
B D                       Cow  a-----
B D                     Sheep  a-----
                Domestic goat  a-----
B D                     Horse  agtaag
B D          White rhinoceros  agtaag
B D                       Cat  agtaag
B D                       Dog  agtaag
B D                   Ferret   agttag
B D                     Panda  agtaag
               Pacific walrus  aataag
                 Weddell seal  aataaa
                Big brown bat  aataag
         David's myotis (bat)  agtaag
B D                  Microbat  agtaag
B D                  Hedgehog  agtaaa
B D                     Shrew  agtaag
              Star-nosed mole  agtaac
B D                  Elephant  gataaa
          Cape elephant shrew  ggggag
B D                   Manatee  agtaaa
             Cape golden mole  atgaag
B D                    Tenrec  agtgag
                     Aardvark  aataag
B D                 Armadillo  actaag
B D                   Opossum  gttaac
B D           Tasmanian devil  attaac
B D                   Wallaby  gtta--
B D                  Platypus  gctaga
B D        American alligator  ggtaat
  D           Green seaturtle  agaaac
  D  Chinese softshell turtle  agaaac
  D    Spiny softshell turtle  agaaac
            Black flying-fox  ------
B D                    Turkey  ======
B D                   Chicken  ======
B D                Budgerigar  ======
          Tibetan ground jay  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D               Rock pigeon  ======
B D       Medium ground finch  ======
  D              Mallard duck  ======
  D    White-throated sparrow  ======
B D                   Megabat  ------
  D            Painted turtle  ======
B D               Zebra finch  ======
  D       Collared flycatcher  ======

Inserts between block 22 and 23 in window
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 355bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                 Hedgehog 1bp
B D                    Shrew 1bp
             Star-nosed mole 1bp
B D                  Opossum 5bp
B D          Tasmanian devil 5bp
B D                  Wallaby 2bp
B D                 Platypus 1bp

Alignment block 23 of 32 in window, 67987533 - 67987533, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  c
B D                      Pika  g
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  g
B D                 Armadillo  t
B D                   Opossum  g
B D           Tasmanian devil  g
B D                   Wallaby  g
B D        American alligator  g
  D           Green seaturtle  a
  D  Chinese softshell turtle  a
  D    Spiny softshell turtle  a
B D                     Mouse  =
B D                       Rat  =
      Lesser Egyptian jerboa  =
B D                  Hedgehog  =
B D                     Shrew  =
                Prairie vole  =
              Golden hamster  =
B D           Chinese hamster  =
             Star-nosed mole  =
B D                    Rabbit  =
B D                       Dog  =
B D                     Panda  =
B D                   Ferret   =
        David's myotis (bat)  =
B D                  Microbat  =
               Big brown bat  =
B D                       Cow  -
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
                Killer whale  =
B D                    Alpaca  =
              Bactrian camel  =
            Black flying-fox  -
B D                       Cat  =
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
              Pacific walrus  =
B D          White rhinoceros  =
B D                     Horse  =
B D                  Squirrel  =
B D                       Pig  =
                Weddell seal  =
B D                   Dolphin  =
B D                    Turkey  =
B D                   Chicken  =
B D                Budgerigar  =
          Tibetan ground jay  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  =
  D              Mallard duck  =
  D    White-throated sparrow  =
B D                   Megabat  -
  D            Painted turtle  =
B D                  Platypus  =
B D               Zebra finch  =
  D       Collared flycatcher  =

Alignment block 24 of 32 in window, 67987534 - 67987541, 8 bps 
B D                     Human  ttgaact-t
B D                     Chimp  ttgaact-t
B D                   Gorilla  ttgaact-t
B D                 Orangutan  ttgaact-t
B D                    Gibbon  ttgaact-t
B D                    Rhesus  ttgaact-t
B D       Crab-eating macaque  ttgaact-t
B D                    Baboon  ttgaact-t
B D              Green monkey  ttgaact-t
B D                  Marmoset  ttgaatt-t
B D           Squirrel monkey  ttgaact-t
B D                  Bushbaby  tcgaact-t
           Chinese tree shrew  ttgaatt-t
B D                  Squirrel  ttgaatt-t
       Lesser Egyptian jerboa  ttaaatt-t
                 Prairie vole  ttacatt-t
B D           Chinese hamster  ttatatt-t
               Golden hamster  ttacatt-t
B D                     Mouse  ttacatt-t
B D                       Rat  ttacatt-t
B D            Naked mole-rat  ttgaatt-t
B D                Guinea pig  ttgaatt-t
                   Chinchilla  ataaatt-t
             Brush-tailed rat  ttgaatt-t
B D                    Rabbit  ttgaatg-t
B D                      Pika  ttgactt-c
B D                       Pig  ttaaatt-t
B D                    Alpaca  ttgaatt-t
               Bactrian camel  ttgaatt-t
B D                   Dolphin  ttgaatt-t
                 Killer whale  ttgaatt-t
B D                     Horse  ttggatt-t
B D          White rhinoceros  ttgaatt-t
B D                       Cat  ttgaatt-t
B D                       Dog  ttgaatt-t
B D                   Ferret   ttgaatt-t
B D                     Panda  ttgaatt-t
               Pacific walrus  ttgaatt-t
                 Weddell seal  ttgaatt-t
                Big brown bat  ttgaatt-t
         David's myotis (bat)  ttgaatt-t
B D                  Microbat  ttgaatt-t
B D                  Hedgehog  ttcaact-t
B D                     Shrew  tggaaat-t
              Star-nosed mole  ttgaagt-t
B D                  Elephant  ttaaact-t
          Cape elephant shrew  aggaatt-t
B D                   Manatee  ttgaact-t
             Cape golden mole  ttgagtt-t
B D                    Tenrec  ttgaact-g
                     Aardvark  ttgaact-t
B D                 Armadillo  ttgaatt-t
B D                   Opossum  ttaagca-t
B D           Tasmanian devil  ttaagca-c
B D                   Wallaby  ttaagca-c
B D                  Platypus  ctgaagc-c
B D        American alligator  atgaattt-
  D           Green seaturtle  ttgaatt--
  D  Chinese softshell turtle  ttgaatt--
  D    Spiny softshell turtle  ttgaatt--
B D                       Cow  ---------
               Domestic goat  ---------
B D                     Sheep  ---------
            Tibetan antelope  ---------
            Black flying-fox  ---------
B D                    Turkey  =========
B D                   Chicken  =========
B D                Budgerigar  =========
          Tibetan ground jay  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
  D               Rock pigeon  =========
B D       Medium ground finch  =========
  D              Mallard duck  =========
  D    White-throated sparrow  =========
B D                   Megabat  ---------
  D            Painted turtle  =========
B D               Zebra finch  =========
  D       Collared flycatcher  =========

Inserts between block 24 and 25 in window
B D                      Pig 10bp
B D                   Alpaca 10bp
              Bactrian camel 10bp
B D                  Dolphin 10bp
                Killer whale 10bp
B D                    Horse 10bp
B D         White rhinoceros 1bp
B D                      Cat 10bp
B D                      Dog 10bp
B D                  Ferret  10bp
B D                    Panda 10bp
              Pacific walrus 10bp
                Weddell seal 10bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                 Hedgehog 10bp
B D                    Shrew 10bp
             Star-nosed mole 303bp

Alignment block 25 of 32 in window, 67987542 - 67987554, 13 bps 
B D                     Human  a----------cta-----------tt-------tggaatt
B D                     Chimp  a----------cta-----------tt-------tggaatt
B D                   Gorilla  a----------cta-----------tt-------tggaatt
B D                 Orangutan  a----------cta-----------ct-------tggaatt
B D                    Gibbon  a-------------------------t-------ttggatt
B D                    Rhesus  a----------tta-----------tt-------tagaatt
B D       Crab-eating macaque  a----------tta-----------tt-------tagaatt
B D                    Baboon  a----------tta-----------tt-------tagaatt
B D              Green monkey  a----------tta-----------tt-------tagaatt
B D                  Marmoset  a----------tta-----------tt-------tagaatt
B D           Squirrel monkey  a----------tta-----------tt-------tagaatt
B D                  Bushbaby  a------------------------tt-------tataata
           Chinese tree shrew  attattcaggatta-----------tt-------taggatc
B D                  Squirrel  a----------tta-ttcaggattatt-------taggatt
       Lesser Egyptian jerboa  a----------tta-tttaaggctatt-------tagattt
                 Prairie vole  a----------tca-tttacgactatt-------taggatt
B D           Chinese hamster  a----------tca-tttatgactact-------t--gttc
               Golden hamster  a----------tca-tttaagactatt-------taggatt
B D                     Mouse  a----------tta-cttaagaccatt-------taggatt
B D                       Rat  a----------tgattttaagattatt-------taggact
B D            Naked mole-rat  a----------tta-ttcaggattatt-------tgagatt
B D                Guinea pig  a----------tta-ttcaggattatt-------taagatt
                   Chinchilla  a----------tta-ttcaggattatt-------taagatt
             Brush-tailed rat  a----------tta-ttcaggattact-------taaga-t
B D                    Rabbit  a----------tta-----------tt-------taggatt
B D                      Pika  a----------ttc-----------tt-------taggatt
B D                       Pig  ---------------------attatt-------tagtatt
B D                    Alpaca  ---------------------atttttaaatctgtagg---
               Bactrian camel  ---------------------atttttaaacctgtagg---
B D                   Dolphin  ---------------------attttt-------taggatt
                 Killer whale  ---------------------attttt-------taggatt
B D                     Horse  ---------------------attatt-------taggatt
B D          White rhinoceros  ----------------------ttatt-------taggatt
B D                       Cat  ---------------------attatt-------taggatt
B D                       Dog  ---------------------attatt-------tagaatt
B D                   Ferret   ---------------------attatt-------taggatt
B D                     Panda  ---------------------attatt-------taggatt
               Pacific walrus  ---------------------attatt-------taggatt
                 Weddell seal  ---------------------attatt-------taggatt
             Black flying-fox  --------------------------t-------tgg----
B D                   Megabat  --------------------------t-------tgg----
                Big brown bat  ----------------------ttatt-------taggat-
         David's myotis (bat)  ----------------------ttatt-------taggat-
B D                  Microbat  ----------------------ttatt-------taggat-
B D                  Hedgehog  ---------------------aacatt-------tatcttt
B D                     Shrew  ---------------------attatt-------tataaat
              Star-nosed mole  ---------------------attatt-------tataatt
B D                  Elephant  ---------------------agtatt-------tgtactt
          Cape elephant shrew  ---------------------aatatt-------ta-----
B D                   Manatee  ---------------------aatgtt-------tataatt
             Cape golden mole  ---------------------aatatt-------tagaatt
B D                    Tenrec  ---------------------aacatt-------tagaatt
                     Aardvark  ---------------------aatgtt-------tagaatt
B D                 Armadillo  ---------------------actatt-------taggatt
B D                   Opossum  ---------------attggagtgaca-------ttggatt
B D           Tasmanian devil  ---------------attggagagaca-------ttgaatt
B D                   Wallaby  ---------------cttgtaaagaca-------ctggatt
B D                  Platypus  --------------aatcagagtggtt-------ctgtctt
B D        American alligator  -------------------------------------aatt
  D           Green seaturtle  --------------------------------------acc
  D  Chinese softshell turtle  --------------------------------------acc
  D    Spiny softshell turtle  --------------------------------------acc
B D                       Cow  -----------------------------------------
               Domestic goat  -----------------------------------------
B D                     Sheep  -----------------------------------------
            Tibetan antelope  -----------------------------------------
B D                    Turkey  =========================================
B D                   Chicken  =========================================
B D                Budgerigar  =========================================
          Tibetan ground jay  =========================================
  D          Peregrine falcon  =========================================
  D              Saker falcon  =========================================
  D               Rock pigeon  =========================================
B D       Medium ground finch  =========================================
  D              Mallard duck  =========================================
  D    White-throated sparrow  =========================================
  D            Painted turtle  =========================================
B D               Zebra finch  =========================================
  D       Collared flycatcher  =========================================

Inserts between block 25 and 26 in window
B D                 Elephant 10bp
B D                  Manatee 10bp
            Cape golden mole 10bp
B D                   Tenrec 10bp
                    Aardvark 1068bp
B D                Armadillo 10bp
B D                 Platypus 1bp

Alignment block 26 of 32 in window, 67987555 - 67987557, 3 bps 
B D                     Human  tta-
B D                     Chimp  tta-
B D                   Gorilla  tta-
B D                 Orangutan  tta-
B D                    Gibbon  tta-
B D                    Rhesus  tta-
B D       Crab-eating macaque  tta-
B D                    Baboon  tta-
B D              Green monkey  tta-
B D                  Marmoset  tta-
B D           Squirrel monkey  tta-
B D                  Bushbaby  taa-
           Chinese tree shrew  tta-
B D                  Squirrel  ttt-
       Lesser Egyptian jerboa  tta-
                 Prairie vole  tta-
B D           Chinese hamster  aga-
               Golden hamster  tta-
B D                     Mouse  tta-
B D                       Rat  tta-
B D            Naked mole-rat  tta-
B D                Guinea pig  tta-
                   Chinchilla  tta-
             Brush-tailed rat  tta-
B D                    Rabbit  tta-
B D                      Pika  tga-
B D                       Pig  ttt-
B D                   Dolphin  ttt-
                 Killer whale  ttt-
B D                     Horse  ttt-
B D          White rhinoceros  ttt-
B D                       Cat  ttt-
B D                       Dog  ttt-
B D                   Ferret   ttt-
B D                     Panda  ttt-
               Pacific walrus  ttc-
                 Weddell seal  ttt-
B D                  Hedgehog  ttt-
B D                     Shrew  ttt-
              Star-nosed mole  ttt-
B D                  Elephant  tta-
          Cape elephant shrew  --a-
B D                   Manatee  tta-
             Cape golden mole  tta-
B D                    Tenrec  atg-
B D                 Armadillo  tta-
B D                   Opossum  tct-
B D           Tasmanian devil  tta-
B D                   Wallaby  tta-
B D                  Platypus  cct-
B D        American alligator  -tag
  D           Green seaturtle  -taa
  D  Chinese softshell turtle  -taa
  D    Spiny softshell turtle  -taa
        David's myotis (bat)  ----
B D                  Microbat  ----
               Big brown bat  ----
B D                       Cow  ----
               Domestic goat  ----
B D                     Sheep  ----
            Tibetan antelope  ----
B D                    Alpaca  ----
              Bactrian camel  ----
            Black flying-fox  ----
B D                    Turkey  ====
B D                   Chicken  ====
B D                Budgerigar  ====
          Tibetan ground jay  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D               Rock pigeon  ====
B D       Medium ground finch  ====
  D              Mallard duck  ====
  D    White-throated sparrow  ====
                    Aardvark  ====
B D                   Megabat  ----
  D            Painted turtle  ====
B D               Zebra finch  ====
  D       Collared flycatcher  ====

Inserts between block 26 and 27 in window
B D       American alligator 17bp
  D          Green seaturtle 2bp
  D Chinese softshell turtle 6bp
  D   Spiny softshell turtle 6bp

Alignment block 27 of 32 in window, 67987558 - 67987588, 31 bps 
B D                     Human  aatt-------ggtag----cttc-a-------------agaact--cttag---aa----g----atc
B D                     Chimp  aatt-------ggtag----cttc-a-------------agaact--cttag---aa----g----atc
B D                   Gorilla  aatt-------ggtag----cttc-a-------------agaact--cttag---aa----g----atc
B D                 Orangutan  aatt-------ggtag----cttc-a-------------agaact--cttag---aa----g----atc
B D                    Gibbon  aatt-------ggtag----cttc-a-------------agaact--cttag---aa----g----atc
B D                    Rhesus  aatt-------ggtag----cttc-a-------------agaact--cttag---aa----g----atc
B D       Crab-eating macaque  aatt-------ggtag----cttc-a-------------agaact--cttag---aa----g----atc
B D                    Baboon  aatt-------ggtag----cttc-a-------------agaact--cttag---aa----g----atc
B D              Green monkey  aatt-------ggtag----cttc-a-------------agaact--cttag---aa----g----atc
B D                  Marmoset  aatt-------ggtag----cttc-a-------------agaatg--cttag---aa----g----atc
B D           Squirrel monkey  aatt-------ggtcg----cttc-a-------------agaatg--cttag---aa----g----atc
B D                  Bushbaby  aatc-------agtaggt--tttc-a-------------gaaact--cttag---aa----c----at-
           Chinese tree shrew  actc-------tgtaaac--tttt-a-------------ggaact--cttag---aa----c----att
B D                  Squirrel  aatc-------tgtaagc--attc-a-------------ggaact--cttaa---aa----catt----
       Lesser Egyptian jerboa  agtc-------tgtgagc--tttc-a-------------ggaaat--cctta---aa----c-------
                 Prairie vole  agtc---------taatt--attc-g-------------gaaacc--cttaa---at----c-------
B D           Chinese hamster  aacc---------tt---------------------------------ttaa---ca----c-------
               Golden hamster  agtc---------tcatt--g---------------------------ttaa---ca----c-------
B D                     Mouse  agtc-------t-tcagt--attt-a-------------ggaacc--cttaa---ag----c-------
B D                       Rat  agtc---------taagt--attt-a-------------gaaacc--ctaaa---ag----c-------
B D            Naked mole-rat  gatt-------tgtaagc--tttc-a-------------ggaact--cttca---a-------------
B D                Guinea pig  aatc-------cataagc--tttc-a-------------ggaact--cttca---a-------------
                   Chinchilla  agtc-------catacgc--tttc-a-------------ggaact--cttca---g-------------
             Brush-tailed rat  aatc-------agtaggc--tttc-a-------------tgcact--cttta---g-------------
B D                    Rabbit  aata-------ggcaagc--tttc-a-------------gaaagt--cttag---aa----c---a---
B D                      Pika  aagt-------ggaaagc--tttc-a-------------ggaagt--tttag---aa----c---a---
B D                       Pig  aaat------caataggc--tttc-a-------------ggaagt--cttag---aacatgc----a--
B D                    Alpaca  ----------------ct--tttc-a-------------cgaagt--cttag---aa----c----a--
               Bactrian camel  ----------------ct--tttc-a-------------cgaagt--cttag---aa----c----a--
B D                   Dolphin  aaat------tggtaggc--tttc-a-------------ggaagt--cttag---aa----c----a--
                 Killer whale  aaat------tggtaggc--tttc-a-------------ggaagt--cttag---aa----c----a--
             Tibetan antelope  ----------------gc--tttc-a-------------ggaagt--cttac---aa----c----c--
B D                       Cow  ----------------gc--tttc-a-------------ggaagt--cttag---aa----c----c--
B D                     Sheep  ----------------gc--tttc-a-------------ggaagt--cttac---aa----c----c--
                Domestic goat  ----------------gc--tttc-a-------------ggaagt--cttac---aa----c----c--
B D                     Horse  aaat------cagtaggc--ttt----------------tgaact--cttag---aa----c----a--
B D          White rhinoceros  aaat------cagtaggc--ttt----------------tgagct--cttag---aa----c----g--
B D                       Cat  aaat------cagtaggc--ttta-t-------------ggaact--cccag---aa----c----a--
B D                       Dog  aaat------cagtaggc--ttta-a-------------ggaact--cccag---aa----c----a--
B D                   Ferret   aaat------cagtagac--ttta-a-------------ggaact--cccag---aa----c----a--
B D                     Panda  aagt------cagtaggc--ttta-a-------------ggaatt--cccag---aa----c----a--
               Pacific walrus  aaat------cagtaggc--ttta-a-------------ggaact--cccag---aa----c----a--
                 Weddell seal  aaat------cagtaggc--ttta-a-------------ggaact--cccag---at----c----a--
             Black flying-fox  -------------taggc--tttc-a-------------ggaatt--cttag---aa----c----a--
B D                   Megabat  -------------taggc--tttc-a-------------ggaatt--cttag---aa----c----a--
                Big brown bat  -------------tagga--tttc-a-------------ggaact--tttag---aa----c----a--
         David's myotis (bat)  -------------tagga--tttc-a-------------gaaact--tttat---ta----c----a--
B D                  Microbat  -------------tagga--tttc-a-------------ggaact--tatat---ta----c----a--
B D                  Hedgehog  ttttttttttttgtaggc--tttc-a-------------ggaatt--cttgg---aa----c----a--
B D                     Shrew  aaat------caatatgt--tctc-a-------------gaaata--cttagcaaaa----c----a--
              Star-nosed mole  aaat------------------tc-a-------------ggagcc--gttag---aa----c----a--
B D                  Elephant  aatc-------tgtaggc--tttc-a-------------ggaact--cttgg---aa----c----a--
          Cape elephant shrew  aact-------t-----c--tttc-a-------------gtaact---ttga---aa----c----a--
B D                   Manatee  aatc-------tgtaggc--tttc-a-------------agaact--cttag---aa----c----g--
             Cape golden mole  aatc-------tgtagtc--tttc-a-------------ggaact---ttag---aa----g----a--
B D                    Tenrec  agtc-------tgcagac--tttc-a-------------taaatt--cttat---aa----c----g--
B D                 Armadillo  aacc-------agtagac--attc-a-------------ggaact--cttag---aa----c----a--
B D                   Opossum  aatt------cactgaat--tctc-a-------------agcattgtctgag---at----t-------
B D           Tasmanian devil  aatt------cagtaagc--ttta-a-------------aattttagctgag---at----t-------
B D                   Wallaby  aatt------cactaagc--ttca-a-------------aacattgtctgag---at----t-------
B D                  Platypus  aatc-------aggacac--ttccaa-------------agatcc--cctgg---aa----t-------
B D        American alligator  aatt-------ggagaattattta-attatctaatgaatagaagt--ctgtg---aa------------
  D           Green seaturtle  aatt-------aacagat--ttca-a-------------agaagt--tttgg---aa----c----c--
  D            Painted turtle  aatt-------aacagat--ttca-a-------------agtagt--cttgg---aa----c----t--
  D  Chinese softshell turtle  -----------aacagat--ttca-a-------------agaagt--cttgt---aa----c----t--
  D    Spiny softshell turtle  -----------aacagat--ttca-a-------------agaagt--cttgt---aa----c----t--
B D                    Turkey  =====================================================================
B D                   Chicken  =====================================================================
B D                Budgerigar  =====================================================================
          Tibetan ground jay  =====================================================================
  D          Peregrine falcon  =====================================================================
  D              Saker falcon  =====================================================================
  D               Rock pigeon  =====================================================================
B D       Medium ground finch  =====================================================================
  D              Mallard duck  =====================================================================
  D    White-throated sparrow  =====================================================================
                    Aardvark  =====================================================================
B D               Zebra finch  =====================================================================
  D       Collared flycatcher  =====================================================================

Inserts between block 27 and 28 in window
B D                    Chimp 2bp
B D                  Gorilla 2bp
B D                Orangutan 1bp
B D                   Gibbon 1bp
B D                   Rhesus 4bp
B D      Crab-eating macaque 6bp
B D                   Baboon 5bp
B D             Green monkey 10bp
B D                 Marmoset 1bp
B D          Squirrel monkey 1bp
B D                 Bushbaby 1bp
          Chinese tree shrew 1bp
B D                 Squirrel 147bp
      Lesser Egyptian jerboa 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp

Alignment block 28 of 32 in window, 67987589 - 67987612, 24 bps 
B D                     Human  tttttttttcctatttt-aatgaag
B D                     Chimp  tttttttttcctatttt-aatgaag
B D                   Gorilla  tttttttttcctatttt-aatgaag
B D                 Orangutan  tttttttttcctatttt-aataaag
B D                    Gibbon  ttattttttcctatttt-aatgaag
B D                    Rhesus  tttttttttcctaattt-aatgaag
B D       Crab-eating macaque  tttttttttcctaattt-aatgaag
B D                    Baboon  tttttctttcctaattt-aatgaag
B D              Green monkey  tttttttttcctaattt-aatgaag
B D                  Marmoset  --ttcgtttcctatttt-aatgaag
B D           Squirrel monkey  --tttgtttcctatttt-aatgaag
B D                  Bushbaby  gttttctttcata------------
           Chinese tree shrew  ---ctttctcctgtttt-gatgaaa
B D                  Squirrel  ttgttttcttctgtttt-gatgaag
       Lesser Egyptian jerboa  gtgtttt-ttttct-----------
                 Prairie vole  ttgtttt-ccctgtttc-agtgagg
B D           Chinese hamster  ttgtttt-tcctctttc-aatgagg
               Golden hamster  ttgtttt-tcttatttc-aatgagg
B D                     Mouse  ctctttt-gcctgtttc-ggtgagg
B D                       Rat  ctgtttt-tcctgcttc-agtgaag
B D            Naked mole-rat  ttcttttctcctgtttc-aatgaaa
B D                Guinea pig  ttgttttctcatgtttc-aatgaag
                   Chinchilla  ttgttttctcatgtttc-attgaag
             Brush-tailed rat  ttgttttcttatgtttc-aatgaag
B D                    Rabbit  ttgttctctcctgcttc-agtggga
B D                      Pika  ttgttctctcctgtttc-aat-gaa
B D                       Pig  tggttttctcttgtact-gatgaat
B D                    Alpaca  ttgtcttctcttatttt-gatgagt
               Bactrian camel  ttgtcttctcttatttt-gatgagt
B D                   Dolphin  tggttttctcttctttt-gataatt
                 Killer whale  tggttttctcttctttt-gataatt
             Tibetan antelope  cagttttctcttgtttt-gatggct
B D                       Cow  cggttttctcttgtttt-gatggct
B D                     Sheep  cagttttctcttgtttt-gatggct
                Domestic goat  cagttttctcttgtttt-gatggct
B D                     Horse  tggttttcttttgttta-gatggag
B D          White rhinoceros  ttgttttctttt------gatgaag
B D                       Cat  ttgttttctctagtttt-gatgaag
B D                       Dog  ttattttctctagtttt-gatgaag
B D                   Ferret   ttattttctccagtttt-gatgaag
B D                     Panda  ttgttttctctagtttt-gttgaag
               Pacific walrus  ttattttctctagtttt-gatgaag
                 Weddell seal  ttattttctctagtttt-gatgaag
             Black flying-fox  ttgttttctcttgttta-gatgaag
B D                   Megabat  ttgttttctcttgttta-gatgaag
                Big brown bat  tcattttctc--gtttt-gatgaag
         David's myotis (bat)  tcattttctcttgtttt-gatgaag
B D                  Microbat  tcattttctcttgtttt-gatgaag
B D                  Hedgehog  gttttttttttttttttaaatgaag
B D                     Shrew  ttgctctcttttt-----gatgaag
              Star-nosed mole  taatttcattttt-----gatgaag
B D                  Elephant  ttgttttctcttgtttt-gttgagg
          Cape elephant shrew  -----tgcccttatttt-gataagg
B D                   Manatee  ttgttttctcttgtttt-gatgagg
             Cape golden mole  ttgttttctcaggtttt-ggtgaag
B D                    Tenrec  ttttttgctt--gtttt-gatgaga
B D                 Armadillo  ttgtttt-----gtttt-aatgagg
B D                   Opossum  tatttcccttttggttt-gatatgg
B D           Tasmanian devil  taattcccttttggttt-catatgg
B D                   Wallaby  tatttcccttttggttt-gatatga
B D                  Platypus  ttatttcctccagggtt-tataaaa
B D        American alligator  atatattctcatg-cat-aatcagt
  D           Green seaturtle  gtttgtcttcttgatag-aataaac
  D            Painted turtle  gtttgtcctcttgatag-aataaat
  D  Chinese softshell turtle  gtttgtcctcttggtac-aataaac
  D    Spiny softshell turtle  gtttgtcctcttggtac-aataaac
B D                    Turkey  =========================
B D                   Chicken  =========================
B D                Budgerigar  =========================
          Tibetan ground jay  =========================
  D          Peregrine falcon  =========================
  D              Saker falcon  =========================
  D               Rock pigeon  =========================
B D       Medium ground finch  =========================
  D              Mallard duck  =========================
  D    White-throated sparrow  =========================
                    Aardvark  =========================
B D               Zebra finch  =========================
  D       Collared flycatcher  =========================

Inserts between block 28 and 29 in window
B D                 Platypus 2bp

Alignment block 29 of 32 in window, 67987613 - 67987626, 14 bps 
B D                     Human  ---------aacatttaatatac
B D                     Chimp  ---------aacatttaatatac
B D                   Gorilla  ---------aacatttaatatac
B D                 Orangutan  ---------aacatttaatatac
B D                    Gibbon  ---------aacatttaatgtac
B D                    Rhesus  ---------aacatttaacatac
B D       Crab-eating macaque  ---------aacatttaacatac
B D                    Baboon  ---------aacatttaacatac
B D              Green monkey  ---------aacatttaacatac
B D                  Marmoset  ---------aacatttaatatac
B D           Squirrel monkey  ---------aacatttaatatac
           Chinese tree shrew  ---------aacat---------
B D                  Squirrel  ---------aatgtttagtacac
       Lesser Egyptian jerboa  -----------gacttaatatat
                 Prairie vole  ----------------aataccc
B D           Chinese hamster  ---------attatttaacaccc
               Golden hamster  ---------attatttaacaccc
B D                     Mouse  ---------aacattcgctaccc
B D                       Rat  ---------aacatttaatacct
B D            Naked mole-rat  ---------aacatttaatatat
B D                Guinea pig  ---------atcatttaatattc
                   Chinchilla  ---------gacatttaatatac
             Brush-tailed rat  ---------aacatttaatatac
B D                    Rabbit  ---------aacatttacaatac
B D                      Pika  ---------aacatttacaatac
B D                       Pig  ---------ggtgtttaatacac
B D                    Alpaca  ---------agcatttaatacac
               Bactrian camel  ---------agcatttaatacac
B D                   Dolphin  ---------aacatttaatatac
                 Killer whale  ---------aacatttaatatac
             Tibetan antelope  ---------gacatttaatatac
B D                       Cow  ---------gacatttaatacat
B D                     Sheep  ---------gacatttaatatac
                Domestic goat  ---------gacatttaatatac
B D                     Horse  ---------aacatttaatatac
B D          White rhinoceros  ---------aacatttaatatac
B D                       Cat  ---------aacatgtaatatac
B D                       Dog  ---------aacatgtaatatcc
B D                   Ferret   ---------aacatgtattatcc
B D                     Panda  ---------aacatgtaatatcc
               Pacific walrus  ---------aacatgtaatatcc
                 Weddell seal  ---------aacatgtaatatcc
             Black flying-fox  ---------aacatttagcatac
B D                   Megabat  ---------aacatttaacatac
                Big brown bat  ---------agcatttaatatac
         David's myotis (bat)  ---------agcatttaatatac
B D                  Microbat  ---------agcatttaatatac
B D                  Hedgehog  ---------agcatttaatatat
B D                     Shrew  ---------aacgttcagtatgt
              Star-nosed mole  ---------atcagttaatatat
B D                  Elephant  ---------aacatttaacgtgc
          Cape elephant shrew  ---------aacatttaacatat
B D                   Manatee  ---------aacatttaacctat
             Cape golden mole  ---------aacatgtaacacgc
B D                    Tenrec  ---------cgcgtgtaacatac
                     Aardvark  ---------agctcttaacatgt
B D                 Armadillo  ---------aacatttgatatac
B D                   Opossum  ---------agattggaatataa
B D           Tasmanian devil  ---------agattggaatataa
B D                   Wallaby  ---------acattggaatataa
B D                  Platypus  ---------agagttgggtac--
B D        American alligator  tctatgataggaagccagtatat
  D           Green seaturtle  accgtcaggggagtccagtataa
  D            Painted turtle  accatcaggagagtccagtataa
  D  Chinese softshell turtle  actatcagg-gagtgcaatataa
  D    Spiny softshell turtle  actatcaca-gagtgcaatataa
B D                  Bushbaby  -----------------------
B D                    Turkey  =======================
B D                   Chicken  =======================
B D                Budgerigar  =======================
          Tibetan ground jay  =======================
  D          Peregrine falcon  =======================
  D              Saker falcon  =======================
  D               Rock pigeon  =======================
B D       Medium ground finch  =======================
  D              Mallard duck  =======================
  D    White-throated sparrow  =======================
B D               Zebra finch  =======================
  D       Collared flycatcher  =======================

Inserts between block 29 and 30 in window
B D                 Platypus 26bp

Alignment block 30 of 32 in window, 67987627 - 67987636, 10 bps 
B D                     Human  aggttt-tctt
B D                     Chimp  aggttt-tctt
B D                   Gorilla  aggttt-tctt
B D                 Orangutan  aggttt-tctt
B D                    Gibbon  aggttt-tctt
B D                    Rhesus  aggttt-tctt
B D       Crab-eating macaque  aggttt-tctt
B D                    Baboon  aggttt-tctt
B D              Green monkey  aggttt-tctt
B D                  Marmoset  aggttt-cctt
B D           Squirrel monkey  aggttt-tctt
           Chinese tree shrew  ---ttt-tctt
B D                  Squirrel  aggttt-tctt
       Lesser Egyptian jerboa  aggttc-tatt
                 Prairie vole  aggttc-tttc
B D           Chinese hamster  aggttc-tttc
               Golden hamster  aggttc-tttt
B D                     Mouse  gggttc-tttg
B D                       Rat  -ggttc-cttg
B D            Naked mole-rat  aggttt-tctt
B D                Guinea pig  aggttt-tctt
                   Chinchilla  aggttt-tctt
             Brush-tailed rat  gggttt-tctt
B D                    Rabbit  agattc-ctta
B D                      Pika  aggttt-ctta
B D                       Pig  tggttt-tctt
B D                    Alpaca  tgattt-tctt
               Bactrian camel  tgattt-tctt
B D                   Dolphin  tggttt-tctt
                 Killer whale  tggttt-tctt
             Tibetan antelope  gggttt-tctt
B D                       Cow  gggttt-tctt
B D                     Sheep  gggttt-tctt
                Domestic goat  gggttt-tctt
B D                     Horse  tggttt-tctt
B D          White rhinoceros  tggttt-tctt
B D                       Cat  tt---------
B D                       Dog  tt---------
B D                   Ferret   tt---------
B D                     Panda  tt---------
               Pacific walrus  tt---------
                 Weddell seal  tt---------
             Black flying-fox  tggttt-tctt
B D                   Megabat  aggttt-tctt
                Big brown bat  tggttt-tctt
         David's myotis (bat)  tggttt-tctt
B D                  Microbat  tggttt-tctt
B D                  Hedgehog  agacct-tctt
B D                     Shrew  aggtttatgtt
              Star-nosed mole  aggttt-tctt
B D                  Elephant  aggttt-tctt
          Cape elephant shrew  tggttt-tctt
B D                   Manatee  aggttt-tctt
             Cape golden mole  aggttt-tctt
B D                    Tenrec  aggttt-tctt
                     Aardvark  aggttt-tctt
B D                 Armadillo  aggttt-tctt
B D                   Opossum  aagttt-acct
B D           Tasmanian devil  aggttt-acat
B D                   Wallaby  aggttt-acat
B D        American alligator  gtgttt-tac-
  D           Green seaturtle  gggttt-tac-
  D            Painted turtle  gggttt-ttc-
  D  Chinese softshell turtle  aag-tt-tag-
  D    Spiny softshell turtle  agg-tt-tag-
B D                  Bushbaby  -----------
B D                    Turkey  ===========
B D                   Chicken  ===========
B D                Budgerigar  ===========
          Tibetan ground jay  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
  D               Rock pigeon  ===========
B D       Medium ground finch  ===========
  D              Mallard duck  ===========
  D    White-throated sparrow  ===========
B D                  Platypus  ===========
B D               Zebra finch  ===========
  D       Collared flycatcher  ===========

Inserts between block 30 and 31 in window
B D                    Panda 222bp
B D                  Opossum 1bp
B D          Tasmanian devil 1bp
B D                  Wallaby 1bp

Alignment block 31 of 32 in window, 67987637 - 67987650, 14 bps 
B D                     Human  ag--tattgactttca
B D                     Chimp  ag--tattgactttca
B D                   Gorilla  ag--tattgactttca
B D                 Orangutan  ag--tattgactttca
B D                    Gibbon  ag--tattgactttca
B D                    Rhesus  ag--tattgactttca
B D       Crab-eating macaque  ag--tattgactttca
B D                    Baboon  ag--tattgactttca
B D              Green monkey  ag--tattgactttca
B D                  Marmoset  ag--tattgactttca
B D           Squirrel monkey  gg--tattgactttca
B D                  Bushbaby  ---------acctgcc
           Chinese tree shrew  ag--tattaactttca
B D                  Squirrel  ag--tattgactttca
       Lesser Egyptian jerboa  tag-ttttgactttcg
                 Prairie vole  cac-tgtggtc-tttg
B D           Chinese hamster  ca--tgttgccttttg
               Golden hamster  cac-tgttgccttttg
B D                     Mouse  ctc-cattgccttttg
B D                       Rat  ctc-tattgccttttg
B D            Naked mole-rat  ag--tattgcctttca
B D                Guinea pig  ag--tattgcctttca
                   Chinchilla  ag--tgtggcctttca
             Brush-tailed rat  ag--ttttgcccttca
B D                    Rabbit  g---tatagactttca
B D                      Pika  c---tagtgactttca
B D                       Pig  ag--tattgacttcca
B D                    Alpaca  ag--tattgacttcta
               Bactrian camel  ag--tattgactttta
B D                   Dolphin  ag--tattgactttca
                 Killer whale  ag--tattgactttca
             Tibetan antelope  ag--tattgacatttg
B D                       Cow  ag--aattgacatttg
B D                     Sheep  ag--tattgacatttg
                Domestic goat  ag--tattgacatttg
B D                     Horse  ag--tattaactttca
B D          White rhinoceros  ag--tattgactttct
B D                       Cat  ag--tattgactttct
B D                       Dog  ag--tattgactttct
B D                   Ferret   ag--tattgactttct
B D                     Panda  ag--tattgactttct
               Pacific walrus  ag--tattgagtttct
                 Weddell seal  ag--tattgagtttct
             Black flying-fox  ag--tattgactttca
B D                   Megabat  ag--tattgactttca
                Big brown bat  ag--tattgactttca
         David's myotis (bat)  ag--tatcgactttca
B D                  Microbat  ag--tattgactttca
B D                  Hedgehog  ag--tataacttttac
B D                     Shrew  ag--attgacttttc-
              Star-nosed mole  ag--taatgcttttca
B D                  Elephant  --tacatcggctttca
          Cape elephant shrew  --cacatcggctttca
B D                   Manatee  --cacatcggctttca
             Cape golden mole  --ctcattgactttca
B D                    Tenrec  --cactctggccttcc
                     Aardvark  --cacgtcagctttcg
B D                 Armadillo  --agcactggctttca
B D                   Opossum  ag--aagctgctaaac
B D           Tasmanian devil  ag--aagctgctaaac
B D                   Wallaby  ag--aagctgctgaac
B D        American alligator  ag--aaggctccttaa
  D           Green seaturtle  ag--taggtcccttaa
  D            Painted turtle  ag--taggtcccttaa
  D  Chinese softshell turtle  ag--taggt-ccttaa
  D    Spiny softshell turtle  ag--taggtcccttaa
B D                    Turkey  ================
B D                   Chicken  ================
B D                Budgerigar  ================
          Tibetan ground jay  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
  D               Rock pigeon  ================
B D       Medium ground finch  ================
  D              Mallard duck  ================
  D    White-throated sparrow  ================
B D                  Platypus  ================
B D               Zebra finch  ================
  D       Collared flycatcher  ================

Inserts between block 31 and 32 in window
B D       American alligator 1bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp
  D   Spiny softshell turtle 1bp

Alignment block 32 of 32 in window, 67987651 - 67987903, 253 bps 
B D                     Human  taagta-ttttct-ggggca-attac-tatct----cagttga--------ttatctctgaaggcctatt
B D                     Chimp  taagta-ttttct-ggggca-gttac-tatct----cagttga--------ttatctctgaaggcctatt
B D                   Gorilla  taagta-ttttct-ggggca-attac-tatct----cagttga--------ttatctctgaaggcctatt
B D                 Orangutan  taagta-ttatct-ggggca-attac-tatct----cagttga--------ttatctctgaaggcctatt
B D                    Gibbon  taagta-ttatct-ggggca-attac-tatct----cagttga--------ttatctctgaaggcctatt
B D                    Rhesus  taagta-ttatct-ggggca-attac-tatct----cagttga--------ttatctctgaaggcctatt
B D       Crab-eating macaque  taagta-ttatct-ggggca-attac-tatct----cagttga--------ttatctctgaaggcctatt
B D                    Baboon  taagta-ttatct-ggggca-attac-tatct----cagttga--------ttatctctgaaggcctatt
B D              Green monkey  tatgta-ttatct-ggggca-attac-tatct----cagttga--------ttatctctgaaggcctatt
B D                  Marmoset  taagta-ttatctgggggca-attac-tgtct----cagttga----ttatttatctctgaaggcctatt
B D           Squirrel monkey  taagta-ttatctgggggca-ataac-tgtct----cagttga----ttatttatctctgaaggcctatt
B D                  Bushbaby  ctggta-tcatct-gtgccc-gttat-taatc----tattata-------tttgtctcagaaga--tatt
           Chinese tree shrew  taactg-tcatct-ggtata-gtta----tct----cagttta----ttatttctctctgaaggtctatt
B D                  Squirrel  taactg-tcatct-ggg----gtggt-tatct----cagttga----ttttttatttctgaaggcctatt
       Lesser Egyptian jerboa  taactg-tcatgt-gggagcagttct-tatct----ccattga----ttatttatctctgaagcctattc
                 Prairie vole  cagcta-ccatct-gggaagagttct-tttcc----cagttg------------tccccaaagttctgtt
B D           Chinese hamster  cagcca-ccatcc-aggaagagttct-tttct----tagttgt----atatttctctctgaa-----gtt
               Golden hamster  cagcca-ccatct-gggaagagttct-tttct----cagttga----gtatttctctctgaa-----att
B D                     Mouse  cagcca-tcatct-gggaagtcttct-tatct----cacgtga----acgtctctctctgaagttctgtt
B D                       Rat  cagccc-tcatct-gggaagccttct-tatct----catgtga----gcatttctctc--aggttctgtt
B D            Naked mole-rat  taagta-ccatct-gggcag-----t-tatct----cagttga----tcattcatctctgaaggcctgtt
B D                Guinea pig  taagta-ccatct-gggcag-----t-tatct----gagttga----tta----cctctgaaggcctatt
                   Chinchilla  taagta-ccatct-gggcag-----t-tgtct----cggttga----ttatttgtctctgaaggcctgtt
             Brush-tailed rat  taagta-ccatct-ggccag-----t-tatct----cagttgg----ttatttatcccagaaggcctatt
B D                    Rabbit  taactg-tcatct-gaggcg-ggtac-tatcc----cagctga----ttatttatctctgacggcctatt
B D                      Pika  t-actg-tcatct-gaggca-gctgt-tatct----ccgctga----ttatttatctctgaaggcctctt
B D                       Pig  taactatttgtct-ggggca-attat-tatct----cagttga----ttatttatctctgaaggcctatt
B D                    Alpaca  taacta-tcgccc-agggcc-attat-tattt----catttga----ttgtttatctctgaaggcctatt
               Bactrian camel  taacta-tcgtcc-agggcc-attat-tattt----catttga----ttgtttatctctgaaggcctatt
B D                   Dolphin  taacta-tcatct-ggggca-attat-tgtct----cagttga----ttatttatctctgaaggcctctt
                 Killer whale  taacta-tcatct-ggggca-attat-tgtct----cagttga----ttatttatctctgaaggcctctt
             Tibetan antelope  taacta-tcatct-agaaca-attac-tgtct----tggttga--------ttatctctgaaagcatctt
B D                       Cow  tagcta-tcgtct-ggaata-attat-tgtct----tggttga--------ttatctctgaaagcgtatt
B D                     Sheep  taacta-tcatct-ggaaca-attat-tgtct----tggttga--------ttatctctgaaaccgtatt
                Domestic goat  taacta-tcatct-ggaata-attat-tgtct----tggttgg--------ttatctctgaaatcgtatt
B D                     Horse  taactg-tcgtct-ggggca-attat-tatct----cagttga----ttatttatctctgcggccctatt
B D          White rhinoceros  taacta-tcctct-ggggca-attat-tttct----cagttga----ttatttatctctacaggcctatt
B D                       Cat  taactc-ttgtct-gggtca-attat-tatat----cagttga----ttctttatctctgaaggcccatt
B D                       Dog  taactc-ttgtct-tggcca-attat-tatct----ctgttga----ttctttatctctgaagacttatt
B D                   Ferret   taactc-ttgtct-gggcca-attat-tatct----cagtaga----ttctttatctctgaaggcttact
B D                     Panda  taactc-ttgtct-gggcca-attat-tatct---ccagttga----ttctttatctctgaaggcttagt
               Pacific walrus  taactc-ttgtct-gggt-a-attac-tagct----cagttga----ttctttatctctgaaggcttatt
                 Weddell seal  taactc-ttgtct-gggtca-attac-tatct----cagttga----ttctttatctctgaaggcttatt
             Black flying-fox  taactc-atct-g-ggggca-gttat-tatct----cagttga----ttatttatctctgagggcctatt
B D                   Megabat  taactc-atct-g-ggggca-gttat-tatct----cagttga----ttatttatctctgagggcttatt
                Big brown bat  tagctc-atct-g-gaggca-gttat-tattc----cagttga----ttatttatctctgaaggcctagt
         David's myotis (bat)  gagctc-attt-g-gaagcg-gctat-tatcc----caggtga----ttacttatctctgaaggtcta-t
B D                  Microbat  tagctc-attt-g-gaggca-gttat-tatcc----caggtga----ttacttatctctgaaggcctagt
B D                  Hedgehog  ta-----tcatct-gggaca-attat-tattt----cagtcga----ttatttattgctgaagatgtatt
B D                     Shrew  ------------------ca-gctat-catctgggacagatga----gtatttatctcttaaagc-----
              Star-nosed mole  t--------aact-gagata-attat-tatct----cagttga----ttagttatctctgaagacctctt
B D                  Elephant  taacta-ttg-------------tat-tatct----cagctgattatttatttatctctgtaggcctgtt
          Cape elephant shrew  taacta-tct-------------tat-tatct----cagcaga----ttatttctctctgaaggcctg--
B D                   Manatee  gaacta-ttg-------------tat-tatct----cagctga----ttatttatctcaaaaggcctgtt
             Cape golden mole  taacta-tgg-------------cat-aatct----tagttga----ttatttatctctgaaggcctagt
B D                    Tenrec  ttacag-ttg-------------tat-tatct----cagatgg----gtatttatctctgagggcctatt
                     Aardvark  tta-ta-tca-------------tat-tatct----ctgctgg---------------------cctatt
B D                 Armadillo  taacta-tcatct-ggggca-attat-tattt----cagttga----taatttatctctgaatgcctatt
B D                   Opossum  taacta-ctgtct-ggggca-gttttaaatct----catttga----ttatttatttcagagagccaata
B D           Tasmanian devil  taacta-ctgtct-agagca-attttatattt----catttga----ttatttatttcagagggccaata
B D                   Wallaby  taacta-ctgtct-ggggtg-gttttatattt----catttga----ttatttattttggggagccaatg
B D                  Platypus  caactg-tcgtct-ggggct-acctc-tctgt----cagatga----aaatttctctctgaggcccaagt
B D        American alligator  tagcta-ctgtct-gaaacg-att---tatcg----tgtatga----ctgtttatctgtgagcaaaaaat
  D           Green seaturtle  taacta-ctgtct-ggaaca-att---tatct----tgtatga----ttatttaccttggagcaccaagt
  D            Painted turtle  tagcta-ctgtct-ggaaca-att---tatct----tgtatga----ttatttacctcgacacaccaagt
  D  Chinese softshell turtle  tagtta-ttctct-ggaaca-att---taact----tgtacg-------atttacatctgagcatcaagt
  D    Spiny softshell turtle  tagtta-ttctct-ggaaca-att---taact----tgtacg-------atttacatctgagcatcaagt
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
  D              Mallard duck  ======================================================================
  D    White-throated sparrow  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================

                        Human  ttaactctaca----------ttta--tctg------------------aacttaac-----tgaataac
                        Chimp  ttaactctaca----------ttta--tctg------------------aacttaac-----tgaataac
                      Gorilla  ttaactctaca----------ttta--tctg------------------aacttaac-----tgaataac
                    Orangutan  ttaactctaca----------ttta--tctg------------------aacttaac-----tgaataac
                       Gibbon  ttaactctata----------ttta--tctg------------------aacttaac-----tgaataac
                       Rhesus  ttaactctaca----------ttta--tctg------------------aacttaac-----tgaataac
          Crab-eating macaque  ttaactctaca----------ttta--tctg------------------aacttaac-----tgaataac
                       Baboon  ttaactctaca----------ttta--tctg------------------aacttaac-----tgaataac
                 Green monkey  ttaactctaca----------ttta--tctg------------------aacttaac-----tgaataac
                     Marmoset  ttaactctaca----------ttta--tctg------------------aacttaac-----tgaataac
              Squirrel monkey  ttaactctaca----------ttta--tctg------------------aacttaac-----tgaataac
                     Bushbaby  ttaactctaca----------ttta--tctg------------------aactt-gc-----agaatagc
           Chinese tree shrew  ctaactctaca----------ttta--tctg------------------aactt-ac-----tgaataac
                     Squirrel  ctaactctaca----------ttta--tctg------------------aactt-ac-----tgaagaac
       Lesser Egyptian jerboa  ctaactctgca----------ctta--tctc------------------t-ctt-ac------cagtaac
                 Prairie vole  ctaactgtaca----------ttca--tctc------------------ttctt-acagagagagctagc
              Chinese hamster  ctaactgaacg----------ccca--tctc------------------tactt-at--ggatagctaac
               Golden hamster  ctaactgtacg----------tcca--tctc------------------tactt-at--gtagaactaac
                        Mouse  ctgatgctctg----------tcct--tctc------------------tactt-ac-----tggggaac
                          Rat  ctgacgctcta----------tcct--tctc------------------tactt-ac-----tggagaac
               Naked mole-rat  ctaactg--ca----------ttta--tcta------------------tactt-ac-----agaataac
                   Guinea pig  cgcactg--ca----------ttta--ccta------------------tactt-ac-----tgactaac
                   Chinchilla  ctaactg--ca----------ttta--tctg------------------tactt-ac-----tgaatagc
             Brush-tailed rat  atggtgg--ca----------ttta--tctg------------------tagtt-ac-----tgagtaac
                       Rabbit  ctgaagctaca----------ttta--tctg------------------gacta-gc-----tgaataac
                         Pika  ctaaaactaca----------ttta--tctg------------------cactg-ac-----ggaatagc
                          Pig  ctaactctaca----------ttta--tctg------------------aactt-ac-----cgaataac
                       Alpaca  ctaactctaca----------ttta--tctg------------------aactt-ac-----tacgtaac
               Bactrian camel  ctaactctaca----------ttta--tctg------------------aactt-ac-----tacataac
                      Dolphin  ctaactctaca----------ttta--tctg------------------aactt-ac-----tgaataac
                 Killer whale  ctaactctaca----------ttta--tctg------------------aactt-ac-----tgaataac
             Tibetan antelope  ctaactctaca----------ttta--tctg------------------aactt-ac-----tgaataac
                          Cow  ctaactctaca----------ttta--tctg------------------aaatt-ac-----tgaataac
                        Sheep  ctaactctaca----------ttta--tctg------------------aactt-ac-----tgaataac
                Domestic goat  ctaactctaca----------ttta--actg------------------aactt-ac-----tgaataac
                        Horse  cgaa--ctaca----------ttta--tctg------------------aactt-ac-----tgaataac
             White rhinoceros  ctaactctaca----------ttta--tctg------------------aactt-ac-----tgaataac
                          Cat  ctaactgtaca----------tgta--tctg------------------aacttaac-----tgaataac
                          Dog  ccaactctgca----------ttta--tctc------------------aactt-ac-----tgaatcac
                      Ferret   ctaa--ctgca----------ttta--tctg------------------aactt-ac-----tgaatcac
                        Panda  ctaactctgca----------ttta--tctg------------------aactt-ac-----tgaatcac
               Pacific walrus  ctaactctgca----------ttta--tctg------------------aactt-ac-----tgaatcac
                 Weddell seal  ctaactctgca----------ttta--tctg------------------aactt-ac-----tgaatcac
             Black flying-fox  ctaattctaca----------ttta--tctg------------------aactc-ac-----tgaataac
                      Megabat  ctaattctaca----------ttta--tctg------------------aactc-ac-----tgaataac
                Big brown bat  ctaactctaca----------tttg--tctg------------------agctt-ag-----taaatagc
         David's myotis (bat)  ctaactccaca----------ttta--tctg------------------agctt-ac-----tgaatagc
                     Microbat  ctaactctaca----------ttta--tctg------------------agctt-ac-----tgaatagc
                     Hedgehog  ttaactctgca----------ttta--tctg------------------aactg-ac-----tgaatcac
                        Shrew  ctaactctcca----------ttta--tctg------------------aactt-ac-----tgaataac
              Star-nosed mole  ctaactttcca----------ttta--tctg------------------aactt-ac-----tgaatcac
                     Elephant  ttaactttacg----------ttta--tctg------------------aactt-ac-----tgagtaac
          Cape elephant shrew  ctaactc--ca----------ttta--tctg------------------aactt-ac-----tgggtaac
                      Manatee  ctaactttaca----------ttta--tctg------------------aactt-ac-----tgagtaac
             Cape golden mole  ctaagtctacg----------ttta--tctggattaactgagtaactccgatta-ac-----tgagtaac
                       Tenrec  ctaactctatg----------ctta--tctg------------------aattt-ag-----ggaataac
                     Aardvark  ctaactttata----------ttta--tctg------------------aactt-ac-----tgcataac
                    Armadillo  ctaactctaca----------ttta--tctg------------------aactt-ag-----tgaataac
                      Opossum  ctaactctaca----------ttta--tcca------------------aactc-ag-----tggataag
              Tasmanian devil  ctaattctaca----------ttta--tcca------------------aactt-aa-----tggataag
                      Wallaby  ctaactctaca----------ttca--tcca------------------aactt-ag-----tgtagaag
                     Platypus  ctaactctacg----------ttta--tcta------------------aactt-at-----cggctcac
           American alligator  taccctcctcatgatgttccctttaatccta------------------aacc-----------cagagc
              Green seaturtle  tagaatccacatcacagtcccttta--ttta------------------aacct-aa-----aacaaaac
               Painted turtle  tagaatccacatcatggttccttta--ttta------------------aacct-aa-----aacaaaac
     Chinese softshell turtle  tagaatccacatcatggccccttta--ctta------------------aatgt-aa-----aacaaaac
       Spiny softshell turtle  tagaatccacctcatggccccttta--ttta------------------aatgt-aa-----aacaaaac
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                 Mallard duck  ======================================================================
       White-throated sparrow  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================

                        Human  tcctcattactcagcacatattttagtgaagagattctt--agga-------gtaa--------------
                        Chimp  tcctcattactcagcacatattttagtgaagagattctt--agga-------gtaa--------------
                      Gorilla  ttctcattactcagcacatattttagtgaagagattctt--agga-------gtaa--------------
                    Orangutan  tcctcattactcagcacatattttagtgaagagattctt--agga-------gtaa--------------
                       Gibbon  tcctcattactcagcacatattttagtgaagagattctt--agga-------gtaa--------------
                       Rhesus  tcctcattactcagcacatattttagtgaagagattctt--agga-------gtaa--------------
          Crab-eating macaque  tcctcattactcagcacatattttagtgaagagattctt--agga-------gtaa--------------
                       Baboon  tcctcattactcagcacatattttagtgaagagattctt--agga-------gtaa--------------
                 Green monkey  tcctcgttactcagcacatattttagtgaagagattctt--agga-------gtaa--------------
                     Marmoset  tcctcattagtcagcacatattttagtgaagaggttctt--agga-------gtaa--------------
              Squirrel monkey  tcctcattagtcagcacatattttagtgaagaggttctt--agga-------gtaa--------------
                     Bushbaby  tcctcattactcagcacatactttagtgaagagattctt--gaga-------gtac--------------
           Chinese tree shrew  tcctcattactcagcacatacttcagtgaagagattctg--agga-------gtaa--------------
                     Squirrel  tcctcattactcagcacatacttttgtgaagagattctt--agga-------gtaa--------------
       Lesser Egyptian jerboa  tcctcattactcagcacatactttagtggagagattctt--agga-------gtaa--------------
                 Prairie vole  tcctcagtactcagcacatacctcagc--agag--tctg--agga-------gtag--------------
              Chinese hamster  tcttcattcctcagcacacacttgagcagagag--tcta--aggg-------gtag--------------
               Golden hamster  tcttcattactcagcacatacttgagc--agag--tctg--aggg-------gtag--------------
                        Mouse  tcctcatcactcagcacatgtgtcaggccagag--tcag--agga-------gtag--------------
                          Rat  tcctcattactcagcacatacttcagtggagag--tccg--aggacattccgagag--------------
               Naked mole-rat  tcctcattactcagcacatg-tttagtgaagagattct-----ga-------gtaa--------------
                   Guinea pig  tcctcattagtcagcacatgctttagtgaagagattctg--agga-------gtaa--------------
                   Chinchilla  tcctcattactcagcacacgctttagtgaagagattctg--agga-------gtaa--------------
             Brush-tailed rat  tcctcattactcagcgcacgctttagtgaagagattctg--agga-------gtaa--------------
                       Rabbit  tcctcattactcagcacatacttcagtgaagagattcct--ggga-------gtaa--------------
                         Pika  tcctcattactcagcacatacttcagcgcagagattcct--agg--------gtaa--------------
                          Pig  tcctcattactcagcacatactttagtgaagatattctt--agga-------gtaa--------------
                       Alpaca  tcctcattactcagcacatagtttagtgaagatattctt--agga-------gtaa--------------
               Bactrian camel  tcctcattactcagcacatactttagtgaagatattctt--agga-------gtaa--------------
                      Dolphin  tcctcattactcagcacatactttagtgaagatattctt--agga-------gtaa--------------
                 Killer whale  tcctcattactcagcacatactttagtgaagatattctt--agga-------gtaa--------------
             Tibetan antelope  tcctcgttactcagcacatactttagtgaagatattctt--agga-------gtag--------------
                          Cow  tcctcgttactcagcacatacttcagtgaagatattctt--agga-------gtag--------------
                        Sheep  tcctcgttactcagcacatactttagtgaagatattctt--agga-------gtag--------------
                Domestic goat  tcctcgttactcagcacatactttagtgaagatattctt--agga-------gtag--------------
                        Horse  tcctcgttactcagcacatactttagtgaagatattctt--agga-------gtaa--------------
             White rhinoceros  tcctcattactcagcacatactttagtgaagatattctt--ggga-------gtaa--------------
                          Cat  tcctcattactcagcacatactttagtgaagatattctt--agga-------gtaa--------------
                          Dog  tcctcgttactcagcacatactttactggagatattcttagagga-------gtaa--------------
                      Ferret   tcctcgttactcagcacatactttagtggagatattcttagagga-------gtaa--------------
                        Panda  tcctcattattcagcacatactttagtggagatattcttagagga-------gtaa--------------
               Pacific walrus  tcctcgttactcagcacatacttcagtagagatattcttagagga-------gtaa--------------
                 Weddell seal  tcttcgttactcagcacatactttagtagagatattcttagagga-------gtaa--------------
             Black flying-fox  tgcacattactcagcacatactttagtgaagatacactt--agga-------gtaa--------------
                      Megabat  tgcacattactcagcacatactttagtgaagatacactt--agga-------gtaa--------------
                Big brown bat  tccacattactcagcacacactgccttgaagatactctg--agga-------gtaa--------------
         David's myotis (bat)  tccacattgctcagcacacactgccgtgaggatactctt--agga-------gtaa--------------
                     Microbat  tccacattactcagcacacactgccgtgaagatactctt--agga-------gtaa--------------
                     Hedgehog  tc--cattagtcagcacatacttcagtgaagatattctt--agga-------gtaa--------------
                        Shrew  tcctcattactcagcacatactttagtgaaaatattctt--agga-------gtaa--------------
              Star-nosed mole  tactcattactcagcacatactttagtgaggatattctt--agga-------gtaa--------------
                     Elephant  tcctcattactcagcacatacttcagtgaagatattctt--agga-------gtaa--------------
          Cape elephant shrew  tcctcattactcagcacatgctttcctgaagatattctt--agga-------ataa--------------
                      Manatee  tcctcattacttagcacgtactttagtgaagatattctt--agga-------gtaa--------------
             Cape golden mole  tcctcgttactcagcacatactttgctgaagatactctt--agga-------gtaa--------------
                       Tenrec  tcctcattactcagcacatacttcagtgaagatattctt--agga-------gtaa--------------
                     Aardvark  tcctcattactcagcacatacttcagtgcagatattc-t--agga-------gtaa--------------
                    Armadillo  tcctcattactcagcatatactttagtgaagatattctt--agga-------gtaa--------------
                      Opossum  tc----ttacacagcacatactttagtaaagacattttt--ggga-------gtaa--------------
              Tasmanian devil  tc----ttactcagcatatactttagtaaagatatt-tt--ggga-------gtaa--------------
                      Wallaby  tc----ttactcagcacatactttcgtaaagacattctt--ggga-------gtaa--------------
                     Platypus  tc----ttactcagcacatatttttgggaggatattctc--ggga-------gcag--------------
           American alligator  tattgcttactcagcacatactttagtcgaggcattctt--ggga-------gtaa--------------
              Green seaturtle  ttttgcttactcagcacatactttagtgaagactttgtt--agga-------gtaaaaagaaaaggagta
               Painted turtle  ttttgcttactcagcacatattttagggaagactttgtt--agga-------gtaa--------------
     Chinese softshell turtle  ttttgcttactcagcacatattttagtgaagattttgtt--aaga-------ttaa--------------
       Spiny softshell turtle  ttttgcttattcagcacatattttagtgaagattttgtt--aaga-------ttaa--------------
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                 Mallard duck  ======================================================================
       White-throated sparrow  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================

                        Human  ----cggc-----------------------------------------------------------tga
                        Chimp  ----cggc-----------------------------------------------------------tga
                      Gorilla  ----cagc-----------------------------------------------------------tga
                    Orangutan  ----cggc-----------------------------------------------------------tga
                       Gibbon  ----cggc-----------------------------------------------------------tga
                       Rhesus  ----cggc-----------------------------------------------------------tga
          Crab-eating macaque  ----cggc-----------------------------------------------------------tga
                       Baboon  ----cggc-----------------------------------------------------------tga
                 Green monkey  ----cggc-----------------------------------------------------------tga
                     Marmoset  ----cggc-----------------------------------------------------------tga
              Squirrel monkey  ----aggc-----------------------------------------------------------tga
                     Bushbaby  ----cggc-----------------------------------------------------------cga
           Chinese tree shrew  ----cggc-----------------------------------------------------------tga
                     Squirrel  ----tggc-----------------------------------------------------------tga
       Lesser Egyptian jerboa  ----cggc-----------------------------------------------------------tga
                 Prairie vole  ----cggc-----------------------------------------------------------tga
              Chinese hamster  ----cagc-----------------------------------------------------------cga
               Golden hamster  ----cagc-----------------------------------------------------------cga
                        Mouse  ----cggc-----------------------------------------------------------tga
                          Rat  --tccggc-----------------------------------------------------------tga
               Naked mole-rat  ----cggc-----------------------------------------------------------tga
                   Guinea pig  ----cagc-----------------------------------------------------------tga
                   Chinchilla  ----cggc-----------------------------------------------------------tga
             Brush-tailed rat  ----cggc-----------------------------------------------------------tga
                       Rabbit  ----cggc-----------------------------------------------------------tga
                         Pika  ----cggc-----------------------------------------------------------taa
                          Pig  ----cggc-----------------------------------------------------------tga
                       Alpaca  ----cggc-----------------------------------------------------------tga
               Bactrian camel  ----cggc-----------------------------------------------------------tga
                      Dolphin  ----cggc-----------------------------------------------------------tga
                 Killer whale  ----cggc-----------------------------------------------------------tga
             Tibetan antelope  ----cggc-----------------------------------------------------------tga
                          Cow  ----tggc-----------------------------------------------------------tga
                        Sheep  ----cggc-----------------------------------------------------------tga
                Domestic goat  ----cggc-----------------------------------------------------------tga
                        Horse  ----tggc-----------------------------------------------------------tga
             White rhinoceros  ----cggc-----------------------------------------------------------tga
                          Cat  ----cggc-----------------------------------------------------------tga
                          Dog  ----cggc-----------------------------------------------------------tga
                      Ferret   ----cggc-----------------------------------------------------------tga
                        Panda  ----cggc-----------------------------------------------------------tga
               Pacific walrus  ----cggc-----------------------------------------------------------tga
                 Weddell seal  ----cggc-----------------------------------------------------------tga
             Black flying-fox  ----cggc-----------------------------------------------------------tga
                      Megabat  ----cggc-----------------------------------------------------------tga
                Big brown bat  ----cggc-----------------------------------------------------------tga
         David's myotis (bat)  ----cggc-----------------------------------------------------------tga
                     Microbat  ----cggc-----------------------------------------------------------tga
                     Hedgehog  ----cggc-----------------------------------------------------------tga
                        Shrew  ----cggc-----------------------------------------------------------tga
              Star-nosed mole  ----cggc-----------------------------------------------------------tga
                     Elephant  ----cggc-----------------------------------------------------------tga
          Cape elephant shrew  ----cggc-----------------------------------------------------------tga
                      Manatee  ----cagc-----------------------------------------------------------tga
             Cape golden mole  ----tggc-----------------------------------------------------------tat
                       Tenrec  ----gggc-----------------------------------------------------------tga
                     Aardvark  ----tggc-----------------------------------------------------------tga
                    Armadillo  ----cggc-----------------------------------------------------------tga
                      Opossum  ----cgga-----------------------------------------------------------tga
              Tasmanian devil  ----catt-----------------------------------------------------------tga
                      Wallaby  ----cggc-----------------------------------------------------------tga
                     Platypus  ----c-gc-----------------------------------------------------------tga
           American alligator  ----tggc-----------------------------------------------------------tga
              Green seaturtle  cttgtggccccttagagactaaccaatttatttgagcataagctttcgtgagctacagctcacttcatga
               Painted turtle  ----tggc-----------------------------------------------------------tga
     Chinese softshell turtle  ----tgga-----------------------------------------------------------tga
       Spiny softshell turtle  ----tgga-----------------------------------------------------------tga
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                 Mallard duck  ======================================================================
       White-throated sparrow  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================

                        Human  cattcaccatattgtgg-tttgtctg-tgtgta----tgttcctgtg---gataacttggcaatcgcttc
                        Chimp  cattcaccatattgtgg-tttgtctg-tgtgta----tgttcctgtg---gataacttggcaatcgcttc
                      Gorilla  cattcaccatattgtgg-tttgtctg-tgtgta----tgttcctgtg---gataacttggcaatcgcttc
                    Orangutan  cattcaccatattgtgg-tttgtctg-tgtgta----tgttcctgtg---gataacttggcaatcgcttc
                       Gibbon  cattcaccatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcaatcgcttc
                       Rhesus  cattcaccatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcaatcgcttc
          Crab-eating macaque  cattcaccatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcaatcgcttc
                       Baboon  cattcaccatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcaatcgcttc
                 Green monkey  cattcaccatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcaatcgcttc
                     Marmoset  cattcaccatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcaatctcttc
              Squirrel monkey  cattcaccatattgtgg-tttgtctg-tgtgta----tgtgtctgtg---gataacttggcaatcgcttc
                     Bushbaby  cgttctccatactgtgg-tttttctg-tgtgtg----tgcgcctgtg---gataacttggcaatctcttc
           Chinese tree shrew  cattctccatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcaatcacttc
                     Squirrel  cattctccatattgtgg-tttgtctgttgtgta----tgtgcctgtg---gataacttggcaatcactcc
       Lesser Egyptian jerboa  cattctccatattgtgg-tttgt-tg-tgtgta----tgcgcctgtg---gataacttggcaatcacttc
                 Prairie vole  cattctccatattgtgg-tttgtctg-tgtgca----tgtgcctgtg---gagaacttggcaatcatctc
              Chinese hamster  cattctccatactgtgg-tttgtctg-tgtgca----tgtgcctgtg---gagaacttggcaatcgtttc
               Golden hamster  cattctccatattgtgg-tttgtctg-tgtgca----tgtgcctgta---gagaacttggcaatcgtttc
                        Mouse  cattctccatattgtgg-tttgtctg-tgtgca----tatgcctgtg---gataacttggcaatagcttc
                          Rat  cattctccatattgtgg-tttgtctg-tgtgca----tatgcctgtg---gataacttggcaatagcctc
               Naked mole-rat  cattctctatattgtgg-tttgtctg-tatgta----tgtgcctgtg---gataacttggcaatctcttc
                   Guinea pig  cattctccatactgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcagtcttttc
                   Chinchilla  cgttctccataccgtgg-tctgtctg-cgtgta----tgtgcctgtg---gataactcggcaacctcttc
             Brush-tailed rat  catcctccgtactgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcagtctcttc
                       Rabbit  cattctccatattgtggttttgtctg-tgtgta----tgtgcctgtg---gataacttggcaaccacttc
                         Pika  cattctccatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcaatcgcttc
                          Pig  cattctccatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcaatcacttc
                       Alpaca  cattctccatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcaatcacttc
               Bactrian camel  cattctccatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataactcggcagtcacttc
                      Dolphin  ccttctccatattgtgg-ttcgtctg-tgtgta----tgtgcctgtg---cataacttggcagccgcttc
                 Killer whale  ccttctccatattgtgg-ttcgtctg-tgtgta----tgtgcctgtg---cataacttggcagccgcttc
             Tibetan antelope  cattctccatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcaatcacttc
                          Cow  cattctccatattgtgg-tttgtctg-tgtgtt----tgtgcctgtg---gataacttggcaatcacttc
                        Sheep  cattcttcatattgtgg-tttgtctg-tgtgtg----tgtgcctgtg---gataacttggcaatcacttc
                Domestic goat  cattctccatattgtgg-tttgtctg-tgtgtg----tgtgcctgtg---gataacttggcaatcacttc
                        Horse  cattctccatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcaatcacttc
             White rhinoceros  cattctccatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcaatcgcttc
                          Cat  cattctccatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcagttgcttc
                          Dog  cattctccatattgtgg-tttgtctg-tgtcta----tgttcctgtg---gataacttggcaatcacttc
                      Ferret   cattttccatattgtgg-tttgtctg-tgtgta----tatgcctgtg---gataacttggcaatcgcttc
                        Panda  cattctccatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcagttgcttc
               Pacific walrus  cattctccatattgtgg-tttgtctc-tgtgta----tgtgcctgtg---gataacttggcaatcgcttt
                 Weddell seal  cattctccatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcaatcgcttt
             Black flying-fox  cattctccatattgtgg-tttgtctc-tgtgta----tgtgcctgtg---gataacttggcaatcgcttc
                      Megabat  cattctccatattgtgg-tttgtctc-tgtgta----tgtgcctgtg---gataacttggcaatcgcttc
                Big brown bat  cattctccatactgtgg-tttgtctc-tgtgta----tgtgcctgtg---gataacttggcaatcgcttc
         David's myotis (bat)  cagtctccatactgtgg-ttcgtctc-agtgta----tgtgcctgtg---gataacttggcagtcgcttc
                     Microbat  cattctccatactgtgg-tttgtctc-tgtgta----tgtgcctgtg---gataacttggcaatcgcttc
                     Hedgehog  cattctccatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcaatcgtttc
                        Shrew  cattctccatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---gataacttggcaatcgtttc
              Star-nosed mole  cattctccatattgtgg-ttagtctg-tgtgca----tgtgcctgtg---gataacttggcaatcacttc
                     Elephant  cattctctacactgtgg-tttgt-----gcgta----tgtgcctgtg---aataacttggcaatcatttc
          Cape elephant shrew  cattctctatattgtgg-tttgcctg-agtgta----tgtgcctgtg---aataacttggcaattgcttc
                      Manatee  cattctcaatactgtgg-tttgtgtc-ttcgta----tgtgcctgtg---aataacttggcaattgtttc
             Cape golden mole  cattctctgtattgtgg-tttgtctg-tgtata----tgtgtctgtg---aataacttggcaatcacttc
                       Tenrec  cattctctatagtgagg-gttgtctg-tgtgga----tgtgcctgtgaataataacttggcaattgcggc
                     Aardvark  cattctctatattgtgg-tttgtctg-tgtgta----tgtgcctgtg---aataacttggcaatagtttc
                    Armadillo  cgttctccatattgtgg-tttgtctg-tgtgta----tgtgcttgtg---gataacttggcaatcgtttc
                      Opossum  cattttccatattgtgg-ttc-tgca-tctgta----tgcacatgtg---tataacttggcagttgcatc
              Tasmanian devil  cattttccatattgtgg-ttc-tgca-tctcta----tgcccatgtg---tgtaacttggcaattgcatt
                      Wallaby  cattttccatattgtgg-ttc-tcca-tctgta----tgcacatgtg---tataacttggcagttgcatc
                     Platypus  cattctccatattgtgg-ttt---tg-tgtgta----aacgcatgcg---gataacttggcaatttcccc
           American alligator  cattctctgtgttgtgg-ttt---ca-tgtgtgtgcatgtgtgtttt---aataacttggcaattgcata
              Green seaturtle  tattctccacagtgtgg-tat---tg-tgcgtg----tgtgtctttg---aataacttggcaattatatt
               Painted turtle  cattctccacagtgtgg-tat---tg-tgcgtg----tgtgtgtttg---aataacttggcaattatatt
     Chinese softshell turtle  cattctgcacagtgtgg-tat---tt-t--atg----tgtgtatttg---aataacttggtaattatatt
       Spiny softshell turtle  cattctccacagtgttg-tat---tt-t--atg----tgtctatttg---aataacttggtaattatatt
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
          Medium ground finch  ======================================================================
                 Mallard duck  ======================================================================
       White-throated sparrow  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================

                        Human  ctcagcgaaa-taac-agcc-agtgtggttcagccaaagtttagaggaataa
                        Chimp  ctcagcgaaa-taac-agcc-agtgtggttcagccaaagtttagaggaataa
                      Gorilla  ctcagcgaaa-taac-agcc-aatgtggttcagccaaagtttagaggaataa
                    Orangutan  ctcagcaaaa-taac-agcc-agtgtggttcagccaaagtttagaggaataa
                       Gibbon  ctcagcgaaa-taac-agcc-agtgtggttcagccaaagtttagaggaataa
                       Rhesus  ctcagtgaaa-taac-agcc-agtgtggttcagccaaagtttagaggaataa
          Crab-eating macaque  ctcagtgaaa-taac-agcc-agtgtggttcagccaaagtttagaggaataa
                       Baboon  ctcagtgaaa-taac-agcc-ggtgtggttcagccaaagtttagaggaataa
                 Green monkey  ctcagtgaaa-taac-agcc-agtgtggttcagccaaagtttagaggaataa
                     Marmoset  ctcagcgaaa-taac-agcc-agtgtggttcagccaaagtttagaggaataa
              Squirrel monkey  ctcagtgaaa-taac-agcc-agtgtggttcagccaaagtttagaggaataa
                     Bushbaby  ctcagtgaaa-taac-agcc-agtgtggttcagccaaagtttagaggaatga
           Chinese tree shrew  ctcagctaaa-taac-agcc-agggtggttcagccaaagtttagaggaatga
                     Squirrel  ctcagcaaaa-tacc-agcc-agtgtggttcagccaaagtttaaaggaataa
       Lesser Egyptian jerboa  ctcagtgaaa-taac-agcc-agagtggttcagccaaagttgagaggaataa
                 Prairie vole  cccagtgaag-taac-agcc-agtgcggttcagccaaagtttagaggaataa
              Chinese hamster  cccggtgaag-taac-agcc-agtgtggttcagccaaagtttagaggaataa
               Golden hamster  cgcagtgaag-taac-agcc-agtgtggttcagccaaagtttagaggaataa
                        Mouse  c-cagtgaac-taac-agcc-agtgcagttcagccaaaggttagagcaataa
                          Rat  c-cagtgaag-taac-agcc-agtgcagttcagccaaaggttagaggaataa
               Naked mole-rat  ctcagcaaag-taac-agct-agtgtggttcagccaaagtttagaggaataa
                   Guinea pig  ctcagcaaag-taac-agcc-agtgtagttcagccaaagtttagaggaataa
                   Chinchilla  cccagcaaag-taac-agcc-agtgtggttcagccaaagtctagaggaatga
             Brush-tailed rat  ctcagcaagc-taac-agcc-agtgtgggtcagctaaagtttagggggataa
                       Rabbit  t------------gc-agcc-agtgtggttcagccaaagtttagaggaatat
                         Pika  c------------cc-agcc-ggtatggttcagccaaagtttagaggaataa
                          Pig  ctc-gcaaaa-taac-agtc-agcgtggttcagccaaagtttagaggagtga
                       Alpaca  ctcggtgaaa-taac-agtc-agtgtggttcagccaaagtttagaggaatga
               Bactrian camel  ctcggtgaaa-taac-agtc-agtgtggttcagccaaagtttagaggaatga
                      Dolphin  ctcagagaaa-taac-agtc-agtgtggttcagccaaagtttagaggagtga
                 Killer whale  ctcagagaaa-taac-agtc-agtgtggttcagccaaagtttagaggagtga
             Tibetan antelope  ctcagtaaaa-taac-agtc-agtgtggttcagccaaagtttagaggagtga
                          Cow  ctcagtaaaa-taac-agtc-agtgtggttcagccaaagtttagaggagtga
                        Sheep  ctcagtaaaa-taac-agtc-agtgtggttcagccaaagtttagaggagtga
                Domestic goat  ctcagtaaaa-taac-agtc-agtgtggttcagccaaagtttagaggagtga
                        Horse  ctcagcgaaa-taac-agtc-agtgtggttcagccaaagtttagaggaatgg
             White rhinoceros  ctcagtgaaa-tagc-agtc-agtgtggttcagccaaagtttagcggcatga
                          Cat  ctcggcaaaa-taac-agtc-agtgtggttcagccaaagtttagaggaatga
                          Dog  cccagcgaag-taacaagtc-agtgtggttcagccaaagtttagcggagtga
                      Ferret   ccctgcgaagttaac-agtc-agtgtggttcagccaaagtttagaggagtga
                        Panda  cccagcgaag-taac-agtc-agtgtggttcagccaaagtttagaggaataa
               Pacific walrus  cccagcgaag-taac-agtc-agtgtggttcagccaaagtttagaggagtga
                 Weddell seal  cgcagcgaag-taac-agtc-a-tgtggttcagccaaagtttagaggagtga
             Black flying-fox  cttagcgaaa-taac-agtc-aatgtggttcagccaaagtttagaagaatga
                      Megabat  cttagcgaaa-taac-agtc-aatgtggttcagccaaagtttagaagaatga
                Big brown bat  ctcagtgaaa-taac-agtc-agtatggttcagccaaagtttaaaggaataa
         David's myotis (bat)  ctcagtgaaa-taac-agtc-agtgtggttcagccaaagtttaaaggaataa
                     Microbat  ctcagtgaaa-taac-agtc-agtgtggttcagccaaagtttaaaggaataa
                     Hedgehog  ctcagagaaa-taat-agtc-agtgtggttcagccaaagtttagaggattga
                        Shrew  ctaagagaaa-taac-agtc-agtgtggttcagccaaagtttagaggaacga
              Star-nosed mole  ctgagggaaa-taac-agtc-ggtgtggttcagccaaagtttagaggaa-ga
                     Elephant  ctcagtgaaa-taac-agcc-agtgtggttcagccaaagtttagagtaatga
          Cape elephant shrew  ctcagtgaaa-taac-agcc-agggtggttcagccaaagtttagaggggtga
                      Manatee  ctcagtgaaa-taac-agcc-agtgtggttcagccaaagtttagaggaatga
             Cape golden mole  ctcagcaaaa-taac-accc-agtgtggttcagccaaagtttagaggaatga
                       Tenrec  ctcagcaaaa-taac-agcc-agtgtggttcagccaaagtttagaggaatga
                     Aardvark  ctcaacgaag-taac-agcc-agtgtggttcagccaaagtttataggaatga
                    Armadillo  ctcagcaaaa-taac-agtc-agtgtagttcagccaaagtttagtggaatga
                      Opossum  cttagtgaaa-taac-atgt-agtatagttcagccaaagtttataggaatga
              Tasmanian devil  cttagtgaaa-taac-cttt-agtgtggttcagccaaagtttataggaatga
                      Wallaby  cttagtgaaa-taag-aatt-attgtggttcagccaaagtttataggaataa
                     Platypus  ctccgtgaaa-taac-attc-agggaagttcagccaaagtttagagggatga
           American alligator  ctgtgtgaaa-taat-gtttagggttagttcagccaaagtttatataaatgg
              Green seaturtle  ctgtgtgaaa-taac-gttaaggggtagttcagccaaagtttat-tcaatgg
               Painted turtle  ctgtatgaaa-taat-gttcaggggtagttcagccaaagtttat-tcaatgg
     Chinese softshell turtle  ctgtgtgaaa-taat-gttt-ggggtacttcagccaaagtttat-tcaatgg
       Spiny softshell turtle  ctgtgtgaaa-taat-gttt-ggggtacttcagccaaagtttat-tcaatgg
                       Turkey  ====================================================
                      Chicken  ====================================================
                   Budgerigar  ====================================================
           Tibetan ground jay  ====================================================
             Peregrine falcon  ====================================================
                 Saker falcon  ====================================================
                  Rock pigeon  ====================================================
          Medium ground finch  ====================================================
                 Mallard duck  ====================================================
       White-throated sparrow  ====================================================
                  Zebra finch  ====================================================
          Collared flycatcher  ====================================================

View table schema

Go to Conservation track controls

Data last updated: 2015-05-06

Downloads for data in this track are available:

Description

This track shows multiple alignments of 100 vertebrate species and measurements of evolutionary conservation using two methods (phastCons and phyloP) from the PHAST package, for all species. The multiple alignments were generated using multiz and other tools in the UCSC/Penn State Bioinformatics comparative genomics alignment pipeline. Conserved elements identified by phastCons are also displayed in this track. PHAST/Multiz are built from chains ("alignable") and nets ("syntenic"), see the documentation of the Chain/Net tracks for a description of the complete alignment process.

PhastCons is a hidden Markov model-based method that estimates the probability that each nucleotide belongs to a conserved element, based on the multiple alignment. It considers not just each individual alignment column, but also its flanking columns. By contrast, phyloP separately measures conservation at individual columns, ignoring the effects of their neighbors. As a consequence, the phyloP plots have a less smooth appearance than the phastCons plots, with more "texture" at individual sites. The two methods have different strengths and weaknesses. PhastCons is sensitive to "runs" of conserved sites, and is therefore effective for picking out conserved elements. PhyloP, on the other hand, is more appropriate for evaluating signatures of selection at particular nucleotides or classes of nucleotides (e.g., third codon positions, or first positions of miRNA target sites).

Another important difference is that phyloP can measure acceleration (faster evolution than expected under neutral drift) as well as conservation (slower than expected evolution). In the phyloP plots, sites predicted to be conserved are assigned positive scores (and shown in blue), while sites predicted to be fast-evolving are assigned negative scores (and shown in red). The absolute values of the scores represent -log p-values under a null hypothesis of neutral evolution. The phastCons scores, by contrast, represent probabilities of negative selection and range between 0 and 1.

Both phastCons and phyloP treat alignment gaps and unaligned nucleotides as missing data, and both were run with the same parameters.

See also: lastz parameters and other details and chain minimum score and gap parameters used in these alignments.

UCSC has repeatmasked and aligned all genome assemblies, and provides all the sequences for download. For genome assemblies not available in the genome browser, there are alternative assembly hub genome browsers. Missing sequence in any assembly is highlighted in the track display by regions of yellow when zoomed out and by Ns when displayed at base level (see Gap Annotation, below).

Primate subset
OrganismSpeciesRelease dateUCSC versionAlignment type
BaboonPapio hamadryasMar 2012Baylor Panu_2.0/papAnu2Reciprocal best net
BushbabyOtolemur garnettiiMar 2011Broad/otoGar3Syntenic net
ChimpPan troglodytesFeb 2011CSAC 2.1.4/panTro4Syntenic net
Crab-eating macaqueMacaca fascicularisJun 2013Macaca_fascicularis_5.0/macFas5Syntenic net
GibbonNomascus leucogenysOct 2012GGSC Nleu3.0/nomLeu3Syntenic net
GorillaGorilla gorilla gorillaMay 2011gorGor3.1/gorGor3Reciprocal best net
Green monkeyChlorocebus sabaeusMar 2014Chlorocebus_sabeus 1.1/chlSab2Syntenic net
HumanHomo sapiensDec 2013GRCh38/hg38reference species
MarmosetCallithrix jacchusMar 2009WUGSC 3.2/calJac3Syntenic net
OrangutanPongo pygmaeus abeliiJuly 2007WUGSC 2.0.2/ponAbe2Reciprocal best net
RhesusMacaca mulattaOct 2010BGI CR_1.0/rheMac3Syntenic net
Squirrel monkeySaimiri boliviensisOct 2011Broad/saiBol1Syntenic net
Euarchontoglires subset
Brush-tailed ratOctodon degusApr 2012OctDeg1.0/octDeg1Syntenic net
ChinchillaChinchilla lanigeraMay 2012 ChiLan1.0/chiLan1Syntenic net
Chinese hamsterCricetulus griseusJul 2013C_griseus_v1.0/criGri1Syntenic net
Chinese tree shrewTupaia chinensisJan 2013TupChi_1.0/tupChi1Syntenic net
Golden hamsterMesocricetus auratusMar 2013MesAur1.0/mesAur1Syntenic net
Guinea pigCavia porcellusFeb 2008Broad/cavPor3Syntenic net
Lesser Egyptian jerboaJaculus jaculusMay 2012JacJac1.0/jacJac1Syntenic net
MouseMus musculusDec 2011GRCm38/mm10Syntenic net
Naked mole-ratHeterocephalus glaberJan 2012Broad HetGla_female_1.0/hetGla2Syntenic net
PikaOchotona princepsMay 2012OchPri3.0/ochPri3Syntenic net
Prairie voleMicrotus ochrogasterOct 2012MicOch1.0/micOch1Syntenic net
RabbitOryctolagus cuniculusApr 2009Broad/oryCun2Syntenic net
RatRattus norvegicusJul 2014RGSC 6.0/rn6Syntenic net
SquirrelSpermophilus tridecemlineatusNov 2011Broad/speTri2Syntenic net
Laurasiatheria subset
AlpacaVicugna pacosMar 2013Vicugna_pacos-2.0.1/vicPac2Syntenic net
Bactrian camelCamelus ferusDec 2011CB1/camFer1Syntenic net
Big brown batEptesicus fuscusJul 2012EptFus1.0/eptFus1Syntenic net
Black flying-foxPteropus alectoAug 2012ASM32557v1/pteAle1Syntenic net
CatFelis catusNov 2014ICGSC Felis_catus 8.0/felCat8Syntenic net
CowBos taurusJun 2014Bos_taurus_UMD_3.1.1/bosTau8Syntenic net
David's myotis batMyotis davidiiAug 2012ASM32734v1/myoDav1Syntenic net
DogCanis lupus familiarisSep 2011Broad CanFam3.1/canFam3Syntenic net
DolphinTursiops truncatusOct 2011Baylor Ttru_1.4/turTru2Reciprocal best net
Domestic goatCapra hircusMay 2012CHIR_1.0/capHir1Syntenic net
Ferret Mustela putorius furoApr 2011MusPutFur1.0/musFur1Syntenic net
HedgehogErinaceus europaeusMay 2012EriEur2.0/eriEur2Syntenic net
HorseEquus caballusSep 2007EquCab3.0/equCab3Syntenic net
Killer whaleOrcinus orcaJan 2013Oorc_1.1/orcOrc1Syntenic net
MegabatPteropus vampyrusJul 2008Broad/pteVam1Reciprocal best net
MicrobatMyotis lucifugusJul 2010Broad Institute Myoluc2.0/myoLuc2Syntenic net
Pacific walrusOdobenus rosmarus divergensJan 2013Oros_1.0/odoRosDiv1Syntenic net
PandaAiluropoda melanoleucaDec 2009BGI-Shenzhen 1.0/ailMel1Syntenic net
PigSus scrofaAug 2011SGSC Sscrofa10.2/susScr3Syntenic net
SheepOvis ariesAug 2012ISGC Oar_v3.1/oviAri3Syntenic net
ShrewSorex araneusAug 2008Broad/sorAra2Syntenic net
Star-nosed moleCondylura cristataMar 2012ConCri1.0/conCri1Syntenic net
Tibetan antelopePantholops hodgsoniiMay 2013PHO1.0/panHod1Syntenic net
Weddell sealLeptonychotes weddelliiMar 2013LepWed1.0/lepWed1Reciprocal best net
White rhinocerosCeratotherium simumMay 2012CerSimSim1.0/cerSim1Syntenic net
Afrotheria subset
AardvarkOrycteropus afer aferMay 2012OryAfe1.0/oryAfe1Syntenic net
Cape elephant shrewElephantulus edwardiiAug 2012EleEdw1.0/eleEdw1Syntenic net
Cape golden moleChrysochloris asiaticaAug 2012ChrAsi1.0/chrAsi1Syntenic net
ElephantLoxodonta africanaJul 2009Broad/loxAfr3Syntenic net
ManateeTrichechus manatus latirostrisOct 2011Broad v1.0/triMan1Syntenic net
TenrecEchinops telfairiNov 2012Broad/echTel2Syntenic net
Mammal subset
ArmadilloDasypus novemcinctusDec 2011Baylor/dasNov3Syntenic net
OpossumMonodelphis domesticaOct 2006Broad/monDom5Net
PlatypusOrnithorhynchus anatinusMar 2007WUGSC 5.0.1/ornAna1Reciprocal best net
Tasmanian devilSarcophilus harrisiiFeb 2011WTSI Devil_ref v7.0/sarHar1Net
WallabyMacropus eugeniiSep 2009TWGS Meug_1.1/macEug2Reciprocal best net
Aves subset
BudgerigarMelopsittacus undulatusSep 2011WUSTL v6.3/melUnd1Net
ChickenGallus gallusNov 2011ICGSC Gallus_gallus-4.0/galGal4Net
Collared flycatcherFicedula albicollisJun 2013FicAlb1.5/ficAlb2Net
Mallard duckAnas platyrhynchosApr 2013BGI_duck_1.0/anaPla1Net
Medium ground finchGeospiza fortisApr 2012GeoFor_1.0/geoFor1Net
ParrotAmazona vittataJan 2013AV1/amaVit1Net
Peregrine falconFalco peregrinusFeb 2013F_peregrinus_v1.0/falPer1Net
Rock pigeonColumba liviaFeb 2013Cliv_1.0/colLiv1Net
Saker falconFalco cherrugFeb 2013F_cherrug_v1.0/falChe1Net
Scarlet macawAra macaoJun 2013SMACv1.1/araMac1Net
Tibetan ground jayPseudopodoces humilisJan 2013PseHum1.0/pseHum1Net
TurkeyMeleagris gallopavoDec 2009TGC Turkey_2.01/melGal1Net
White-throated sparrowZonotrichia albicollisApr 2013ASM38545v1/zonAlb1Net
Zebra finchTaeniopygia guttataFeb 2013WashU taeGut324/taeGut2Net
Sarcopterygii subset
American alligatorAlligator mississippiensisAug 2012allMis0.2/allMis1Net
Chinese softshell turtlePelodiscus sinensisOct 2011PelSin_1.0/pelSin1Net
CoelacanthLatimeria chalumnaeAug 2011Broad/latCha1Net
Green seaturtleChelonia mydasMar 2013CheMyd_1.0/cheMyd1Net
LizardAnolis carolinensisMay 2010Broad AnoCar2.0/anoCar2Net
Painted turtleChrysemys picta belliiMar 2014v3.0.3/chrPic2Net
Spiny softshell turtleApalone spiniferaMay 2013ASM38561v1/apaSpi1Net
X. tropicalisXenopus tropicalisSep 2012JGI 7.0/xenTro7Net
Fish subset
Atlantic codGadus morhuaMay 2010Genofisk GadMor_May2010/gadMor1Net
Burton's mouthbreederHaplochromis burtoniOct 2011AstBur1.0/hapBur1Net
FuguTakifugu rubripesOct 2011FUGU5/fr3Net
LampreyPetromyzon marinusSep 2010WUGSC 7.0/petMar2Net
MedakaOryzias latipesOct 2005NIG/UT MEDAKA1/oryLat2Net
Mexican tetra (cavefish)Astyanax mexicanusApr 2013Astyanax_mexicanus-1.0.2/astMex1Net
Nile tilapiaOreochromis niloticusJan 2011Broad oreNil1.1/oreNil2Net
Princess of BurundiNeolamprologus brichardiMay 2011NeoBri1.0/neoBri1Net
Pundamilia nyerereiPundamilia nyerereiOct 2011PunNye1.0/punNye1Net
Southern platyfishXiphophorus maculatusJan 2012Xiphophorus_maculatus-4.4.2/xipMac1Net
Spotted garLepisosteus oculatusDec 2011LepOcu1/lepOcu1Net
SticklebackGasterosteus aculeatusFeb 2006Broad/gasAcu1Net
TetraodonTetraodon nigroviridisMar 2007Genoscope 8.0/tetNig2Net
Yellowbelly pufferfishTakifugu flavidusMay 2013version 1 of Takifugu flavidus genome/takFla1Net
Zebra mbunaMaylandia zebraMar 2012MetZeb1.1/mayZeb1Net
ZebrafishDanio rerioSep 2014GRCz10/danRer10Net

Table 1. Genome assemblies included in the 100-way Conservation track.

Display Conventions and Configuration

In full and pack display modes, conservation scores are displayed as a wiggle track (histogram) in which the height reflects the size of the score. The conservation wiggles can be configured in a variety of ways to highlight different aspects of the displayed information. Click the Graph configuration help link for an explanation of the configuration options.

Pairwise alignments of each species to the human genome are displayed below the conservation histogram as a grayscale density plot (in pack mode) or as a wiggle (in full mode) that indicates alignment quality. In dense display mode, conservation is shown in grayscale using darker values to indicate higher levels of overall conservation as scored by phastCons.

Checkboxes on the track configuration page allow selection of the species to include in the pairwise display. Note that excluding species from the pairwise display does not alter the the conservation score display.

To view detailed information about the alignments at a specific position, zoom the display in to 30,000 or fewer bases, then click on the alignment.

Gap Annotation

The Display chains between alignments configuration option enables display of gaps between alignment blocks in the pairwise alignments in a manner similar to the Chain track display. The following conventions are used:

  • Single line: No bases in the aligned species. Possibly due to a lineage-specific insertion between the aligned blocks in the human genome or a lineage-specific deletion between the aligned blocks in the aligning species.
  • Double line: Aligning species has one or more unalignable bases in the gap region. Possibly due to excessive evolutionary distance between species or independent indels in the region between the aligned blocks in both species.
  • Pale yellow coloring: Aligning species has Ns in the gap region. Reflects uncertainty in the relationship between the DNA of both species, due to lack of sequence in relevant portions of the aligning species.

Genomic Breaks

Discontinuities in the genomic context (chromosome, scaffold or region) of the aligned DNA in the aligning species are shown as follows:

  • Vertical blue bar: Represents a discontinuity that persists indefinitely on either side, e.g. a large region of DNA on either side of the bar comes from a different chromosome in the aligned species due to a large scale rearrangement.
  • Green square brackets: Enclose shorter alignments consisting of DNA from one genomic context in the aligned species nested inside a larger chain of alignments from a different genomic context. The alignment within the brackets may represent a short misalignment, a lineage-specific insertion of a transposon in the human genome that aligns to a paralogous copy somewhere else in the aligned species, or other similar occurrence.

Base Level

When zoomed-in to the base-level display, the track shows the base composition of each alignment. The numbers and symbols on the Gaps line indicate the lengths of gaps in the human sequence at those alignment positions relative to the longest non-human sequence. If there is sufficient space in the display, the size of the gap is shown. If the space is insufficient and the gap size is a multiple of 3, a "*" is displayed; other gap sizes are indicated by "+".

Codon translation is available in base-level display mode if the displayed region is identified as a coding segment. To display this annotation, select the species for translation from the pull-down menu in the Codon Translation configuration section at the top of the page. Then, select one of the following modes:

  • No codon translation: The gene annotation is not used; the bases are displayed without translation.
  • Use default species reading frames for translation: The annotations from the genome displayed in the Default species to establish reading frame pull-down menu are used to translate all the aligned species present in the alignment.
  • Use reading frames for species if available, otherwise no translation: Codon translation is performed only for those species where the region is annotated as protein coding.
  • Use reading frames for species if available, otherwise use default species: Codon translation is done on those species that are annotated as being protein coding over the aligned region using species-specific annotation; the remaining species are translated using the default species annotation.

Codon translation uses the following gene tracks as the basis for translation:

Gene TrackSpecies
UCSC GenesHuman, Mouse
RefSeq GenesCow, Frog (X. tropicalis)
Ensembl Genes v73Atlantic cod, Bushbaby, Cat, Chicken, Chimp, Coelacanth, Dog, Elephant, Ferret, Fugu, Gorilla, Horse, Lamprey, Lizard, Mallard duck, Marmoset, Medaka, Megabat, Microbat, Orangutan, Panda, Pig, Platypus, Rat, Soft-shell Turtle, Southern platyfish, Squirrel, Tasmanian devil, Tetraodon, Zebrafish
no annotationAardvark, Alpaca, American alligator, Armadillo, Baboon, Bactrian camel, Big brown bat, Black flying-fox, Brush-tailed rat, Budgerigar, Burton's mouthbreeder, Cape elephant shrew, Cape golden mole, Chinchilla, Chinese hamster, Chinese tree shrew, Collared flycatcher, Crab-eating macaque, David's myotis (bat), Dolphin, Domestic goat, Gibbon, Golden hamster, Green monkey, Green seaturtle, Hedgehog, Killer whale, Lesser Egyptian jerboa, Manatee, Medium ground finch, Mexican tetra (cavefish), Naked mole-rat, Nile tilapia, Pacific walrus, Painted turtle, Parrot, Peregrine falcon, Pika, Prairie vole, Princess of Burundi, Pundamilia nyererei, Rhesus, Rock pigeon, Saker falcon, Scarlet Macaw, Sheep, Shrew, Spiny softshell turtle, Spotted gar, Squirrel monkey, Star-nosed mole, Tawny puffer fish, Tenrec, Tibetan antelope, Tibetan ground jay, Wallaby, Weddell seal, White rhinoceros, White-throated sparrow, Zebra Mbuna, Zebra finch
Table 2. Gene tracks used for codon translation.

Methods

Pairwise alignments with the human genome were generated for each species using lastz from repeat-masked genomic sequence. Lineage-specific repeats were removed prior to alignment, then reinserted. Pairwise alignments were then linked into chains using a dynamic programming algorithm that finds maximally scoring chains of gapless subsections of the alignments organized in a kd-tree. The scoring matrix and parameters for pairwise alignment and chaining were tuned for each species based on phylogenetic distance from the reference. High-scoring chains were then placed along the genome, with gaps filled by lower-scoring chains, to produce an alignment net. For more information about the chaining and netting process and parameters for each species, see the description pages for the Chain and Net tracks.

An additional filtering step was introduced in the generation of the 100-way conservation track to reduce the number of paralogs and pseudogenes from the high-quality assemblies and the suspect alignments from the low-quality assemblies: the pairwise alignments of high-quality mammalian sequences (placental and marsupial) were filtered based on synteny; those for 2X mammalian genomes were filtered to retain only alignments of best quality in both the target and query ("reciprocal best").

The resulting best-in-genome pairwise alignments were progressively aligned using multiz/autoMZ, following the tree topology diagrammed above, to produce multiple alignments. The multiple alignments were post-processed to add annotations indicating alignment gaps, genomic breaks, and base quality of the component sequences. The annotated multiple alignments, in MAF format, are available for bulk download. An alignment summary table containing an entry for each alignment block in each species was generated to improve track display performance at large scales. Framing tables were constructed to enable visualization of codons in the multiple alignment display.

Phylogenetic Tree Model

Both phastCons and phyloP are phylogenetic methods that rely on a tree model containing the tree topology, branch lengths representing evolutionary distance at neutrally evolving sites, the background distribution of nucleotides, and a substitution rate matrix. The all-species tree model for this track was generated using the phyloFit program from the PHAST package (REV model, EM algorithm, medium precision) using multiple alignments of 4-fold degenerate sites extracted from the 100-way alignment (msa_view). The 4d sites were derived from the RefSeq (Reviewed+Coding) gene set, filtered to select single-coverage long transcripts.

This same tree model was used in the phyloP calculations; however, the background frequencies were modified to maintain reversibility. The resulting tree model: all species.

PhastCons Conservation

The phastCons program computes conservation scores based on a phylo-HMM, a type of probabilistic model that describes both the process of DNA substitution at each site in a genome and the way this process changes from one site to the next (Felsenstein and Churchill 1996, Yang 1995, Siepel and Haussler 2005). PhastCons uses a two-state phylo-HMM, with a state for conserved regions and a state for non-conserved regions. The value plotted at each site is the posterior probability that the corresponding alignment column was "generated" by the conserved state of the phylo-HMM. These scores reflect the phylogeny (including branch lengths) of the species in question, a continuous-time Markov model of the nucleotide substitution process, and a tendency for conservation levels to be autocorrelated along the genome (i.e., to be similar at adjacent sites). The general reversible (REV) substitution model was used. Unlike many conservation-scoring programs, phastCons does not rely on a sliding window of fixed size; therefore, short highly-conserved regions and long moderately conserved regions can both obtain high scores. More information about phastCons can be found in Siepel et al. 2005.

The phastCons parameters used were: expected-length=45, target-coverage=0.3, rho=0.3.

PhyloP Conservation

The phyloP program supports several different methods for computing p-values of conservation or acceleration, for individual nucleotides or larger elements ( http://compgen.cshl.edu/phast/). Here it was used to produce separate scores at each base (--wig-scores option), considering all branches of the phylogeny rather than a particular subtree or lineage (i.e., the --subtree option was not used). The scores were computed by performing a likelihood ratio test at each alignment column (--method LRT), and scores for both conservation and acceleration were produced (--mode CONACC).

Conserved Elements

The conserved elements were predicted by running phastCons with the --viterbi option. The predicted elements are segments of the alignment that are likely to have been "generated" by the conserved state of the phylo-HMM. Each element is assigned a log-odds score equal to its log probability under the conserved model minus its log probability under the non-conserved model. The "score" field associated with this track contains transformed log-odds scores, taking values between 0 and 1000. (The scores are transformed using a monotonic function of the form a * log(x) + b.) The raw log odds scores are retained in the "name" field and can be seen on the details page or in the browser when the track's display mode is set to "pack" or "full".

Credits

This track was created using the following programs:

  • Alignment tools: lastz (formerly blastz) and multiz by Minmei Hou, Scott Schwartz and Webb Miller of the Penn State Bioinformatics Group
  • Chaining and Netting: axtChain, chainNet by Jim Kent at UCSC
  • Conservation scoring: phastCons, phyloP, phyloFit, tree_doctor, msa_view and other programs in PHAST by Adam Siepel at Cold Spring Harbor Laboratory (original development done at the Haussler lab at UCSC).
  • MAF Annotation tools: mafAddIRows by Brian Raney, UCSC; mafAddQRows by Richard Burhans, Penn State; genePredToMafFrames by Mark Diekhans, UCSC
  • Tree image generator: phyloPng by Galt Barber, UCSC
  • Conservation track display: Kate Rosenbloom, Hiram Clawson (wiggle display), and Brian Raney (gap annotation and codon framing) at UCSC

The phylogenetic tree is based on Murphy et al. (2001) and general consensus in the vertebrate phylogeny community. Thanks to Giacomo Bernardi for help with the fish relationships.

References

Phylo-HMMs, phastCons, and phyloP:

Felsenstein J, Churchill GA. A Hidden Markov Model approach to variation among sites in rate of evolution. Mol Biol Evol. 1996 Jan;13(1):93-104. PMID: 8583911

Pollard KS, Hubisz MJ, Rosenbloom KR, Siepel A. Detection of nonneutral substitution rates on mammalian phylogenies. Genome Res. 2010 Jan;20(1):110-21. PMID: 19858363; PMC: PMC2798823

Siepel A, Bejerano G, Pedersen JS, Hinrichs AS, Hou M, Rosenbloom K, Clawson H, Spieth J, Hillier LW, Richards S, et al. Evolutionarily conserved elements in vertebrate, insect, worm, and yeast genomes. Genome Res. 2005 Aug;15(8):1034-50. PMID: 16024819; PMC: PMC1182216

Siepel A, Haussler D. Phylogenetic Hidden Markov Models. In: Nielsen R, editor. Statistical Methods in Molecular Evolution. New York: Springer; 2005. pp. 325-351.

Yang Z. A space-time process model for the evolution of DNA sequences. Genetics. 1995 Feb;139(2):993-1005. PMID: 7713447; PMC: PMC1206396

Chain/Net:

Kent WJ, Baertsch R, Hinrichs A, Miller W, Haussler D. Evolution's cauldron: duplication, deletion, and rearrangement in the mouse and human genomes. Proc Natl Acad Sci U S A. 2003 Sep 30;100(20):11484-9. PMID: 14500911; PMC: PMC208784

Multiz:

Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, Green ED, et al. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res. 2004 Apr;14(4):708-15. PMID: 15060014; PMC: PMC383317

Lastz (formerly Blastz):

Chiaromonte F, Yap VB, Miller W. Scoring pairwise genomic sequence alignments. Pac Symp Biocomput. 2002:115-26. PMID: 11928468

Harris RS. Improved pairwise alignment of genomic DNA. Ph.D. Thesis. Pennsylvania State University, USA. 2007.

Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W. Human-mouse alignments with BLASTZ. Genome Res. 2003 Jan;13(1):103-7. PMID: 12529312; PMC: PMC430961

Phylogenetic Tree:

Murphy WJ, Eizirik E, O'Brien SJ, Madsen O, Scally M, Douady CJ, Teeling E, Ryder OA, Stanhope MJ, de Jong WW, Springer MS. Resolution of the early placental mammal radiation using Bayesian phylogenetics. Science. 2001 Dec 14;294(5550):2348-51. PMID: 11743200