Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 38 in window, 131766710 - 131766731, 22 bps 
B D                     Human  a---------tatgtgt-----------------------------------------------------
B D                     Chimp  a---------tatgtgt-----------------------------------------------------
B D                   Gorilla  a---------tatgtgt-----------------------------------------------------
B D                 Orangutan  a---------tatgtgt-----------------------------------------------------
B D                    Gibbon  a---------tatgtgt-----------------------------------------------------
B D                    Rhesus  a---------tatgtgt-----------------------------------------------------
B D       Crab-eating macaque  a---------tatgtgt-----------------------------------------------------
B D                    Baboon  a---------tatgtgt-----------------------------------------------------
B D              Green monkey  a---------tatgtgt-----------------------------------------------------
B D                  Marmoset  a---------tatgtgt-----------------------------------------------------
B D           Squirrel monkey  a---------tatgtgt-----------------------------------------------------
B D                  Bushbaby  a---------tatgtga-----------------------------------------------------
           Chinese tree shrew  a---------tgtgtgt-----------------------------------------------------
B D                  Squirrel  a---------tatgtgt-----------------------------------------------------
       Lesser Egyptian jerboa  g---------tgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgt-----------------------
                 Prairie vole  g---------tgcgtctgcat-------------------------------------------------
B D           Chinese hamster  g---------tgtgtgctcat-------------------------------------------------
               Golden hamster  g---------tgtgtgcccat-------------------------------------------------
B D                     Mouse  g---------tgtgtgtgtgtgtgtgtgtgtgtgtgt---------------------------------
B D                       Rat  g---------tgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgcccccatgtgcaggcaggcatgcc
B D            Naked mole-rat  a---------taagtgt-----------------------------------------------------
B D                Guinea pig  a---------taagcat-----------------------------------------------------
                   Chinchilla  a---------taagtat-----------------------------------------------------
             Brush-tailed rat  a---------taagtgt-----------------------------------------------------
B D                    Rabbit  a---------tatatgtgtgtgtgtgtgtgtgtgtgt---------------------------------
B D                      Pika  g---------tatgtatgtgtgtatgtatgtgtg------------------------------------
B D                       Pig  a-------tctatgtgt-----------------------------------------------------
B D                    Alpaca  a-------tctatgtgt-----------------------------------------------------
               Bactrian camel  a-------tctatgtgt-----------------------------------------------------
B D                   Dolphin  c-------tctatgtgt-----------------------------------------------------
                 Killer whale  c-------tctatgtgt-----------------------------------------------------
             Tibetan antelope  a-------tctctgtgt-----------------------------------------------------
B D                       Cow  a-------tctctgtgt-----------------------------------------------------
B D                     Sheep  a-------tctctgtgt-----------------------------------------------------
                Domestic goat  a-------tctctgtgt-----------------------------------------------------
B D                     Horse  a-----------tgtgt-----------------------------------------------------
B D          White rhinoceros  a-------tatgtgtgt-----------------------------------------------------
B D                       Cat  g---------catgtgt-----------------------------------------------------
B D                       Dog  g---------tgtgagt-----------------------------------------------------
B D                   Ferret   a---------tgtgtgt-----------------------------------------------------
B D                     Panda  a---------tgcgtgt-----------------------------------------------------
               Pacific walrus  a---------ggtgtgt-----------------------------------------------------
                 Weddell seal  a---------ggtgtgt-----------------------------------------------------
             Black flying-fox  a---------tctatat-----------------------------------------------------
B D                   Megabat  a---------tctatat-----------------------------------------------------
                Big brown bat  a---------tctgtg------------------------------------------------------
         David's myotis (bat)  a---------tctatg------------------------------------------------------
B D                  Microbat  a---------tctgtg------------------------------------------------------
B D                  Hedgehog  ac-----atgtgtatgt-----------------------------------------------------
              Star-nosed mole  ag-----atatgtgtgt-----------------------------------------------------
B D                  Elephant  atatacggtatatgtgt-----------------------------------------------------
          Cape elephant shrew  -------gtgtgtgtgt-----------------------------------------------------
B D                   Manatee  atatacagtgtatgtgt-----------------------------------------------------
             Cape golden mole  a---------tgtgtgt-----------------------------------------------------
B D                    Tenrec  a-------------tgt-----------------------------------------------------
                     Aardvark  gtgt---gtgtgcgcat-----------------------------------------------------
B D                 Armadillo  atgt---atatgcgtgt-----------------------------------------------------
B D                   Opossum  a---------cacatat-----------------------------------------------------
B D           Tasmanian devil  a---------tacatat-----------------------------------------------------
B D                   Wallaby  g---------tatagat-----------------------------------------------------
B D                  Platypus  t---------tctgggg-----------------------------------------------------
B D                     Shrew  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D        American alligator  ======================================================================

                        Human  -------------------------------g-----att--ttaaaa-atat
                        Chimp  -------------------------------g-----att--ttaaaa-atat
                      Gorilla  -------------------------------g-----att--ttaaaa-atat
                    Orangutan  -------------------------------g-----att--ttaaaa-atat
                       Gibbon  -------------------------------g-----att--ttaaaa-atat
                       Rhesus  -------------------------------g-----att--ttaaaa-atat
          Crab-eating macaque  -------------------------------g-----att--ttaaaa-atat
                       Baboon  -------------------------------g-----att--ttaaaa-atat
                 Green monkey  -------------------------------g-----att--ttaaaa-atat
                     Marmoset  -------------------------------g-----att--ttaaaa-atat
              Squirrel monkey  -------------------------------g-----att--ttaaaa-atat
                     Bushbaby  -------------------------------g-----att--ttaaaa-attt
           Chinese tree shrew  -------------------------------g-----att--ttaaaa-atgt
                     Squirrel  -------------------------------g-----att--ttaaaa-atct
       Lesser Egyptian jerboa  -------------------------------a-----att--ttaaaa-atat
                 Prairie vole  -------------------------------c-----act--ttatga-ctgt
              Chinese hamster  -------------------------------g-----att--ttaaga-atat
               Golden hamster  -------------------------------g-----att--ttaaga-atat
                        Mouse  -------------------------------g-----att--ttaata---at
                          Rat  agcatgtgtgtgaatatgcttgtgcatgtgcg-----att--tttata-atat
               Naked mole-rat  -------------------------------g-----att--tttaaa-atac
                   Guinea pig  -------------------------------g-----att--ttaaaa-atat
                   Chinchilla  -------------------------------g-----att--ttaaaa-atat
             Brush-tailed rat  -------------------------------g-----att--ttaaaa-atat
                       Rabbit  -------------------------------g-----att--ttaaaa-a-at
                         Pika  -------------------------------g-----ttt--taaaaa-a-at
                          Pig  -------------------------------g-----atc--ttaaaatatat
                       Alpaca  -------------------------------g-----atc--ttaaaa-at--
               Bactrian camel  -------------------------------g-----atc--ttaaaa-at--
                      Dolphin  -------------------------------g-----atc--ttaaaa-gtat
                 Killer whale  -------------------------------g-----atc--ttaaaa-gtat
             Tibetan antelope  -------------------------------a-----atc--ttaaaa-atat
                          Cow  -------------------------------a-----atc-ttaaaaa-atgt
                        Sheep  -------------------------------a-----atc--taaaaa-atgt
                Domestic goat  -------------------------------a-----atc--ttaaaa-atgt
                        Horse  -------------------------------g-----atc--ttaaaa-atat
             White rhinoceros  -------------------------------g-----atc--tt-aaa-atat
                          Cat  -------------------------------g-----atc--ttaaaa-atat
                          Dog  -------------------------------g-----atc--ttaaaa-atat
                      Ferret   -------------------------------g-----atc--ttaaaa-atac
                        Panda  -------------------------------g-----agc--ttaaaa-atat
               Pacific walrus  -------------------------------g-----atc--ttaaaa-atat
                 Weddell seal  -------------------------------g-----atc--ttaaaa-atat
             Black flying-fox  -------------------------------a----tatc--tgaaaa-ttat
                      Megabat  -------------------------------a----tatc--tgaaaa-ttat
                Big brown bat  -------------------------------------atc--tcaaaa-atgt
         David's myotis (bat)  -------------------------------------atc--ttaaaa-atgt
                     Microbat  -------------------------------------atc--ttaaaa-atgt
                     Hedgehog  -------------------------------g-----ctg--ttacaaaatgt
              Star-nosed mole  -------------------------------g-----ata-------------
                     Elephant  -------------------------------g-----aac--tt-aaa-atat
          Cape elephant shrew  -------------------------------g-----aac--ttaaaa-ataa
                      Manatee  -------------------------------g-----agc--ttaaaa-ctat
             Cape golden mole  -------------------------------g-----aac--ttaaaa-atat
                       Tenrec  -------------------------------g-----aac--ttaaaa-atat
                     Aardvark  -------------------------------g-----aac--tt---a-atat
                    Armadillo  -------------------------------g-----atc--ttaaaa-atac
                      Opossum  -------------------------------t-----ttc--ttccaa-atta
              Tasmanian devil  -------------------------------t-----ttc--ttaaaa-atta
                      Wallaby  -------------------------------tgggggctc--ttaaaa-atca
                     Platypus  -------------------------------c-----accattcagaa-atag
                        Shrew  =====================================================
                X. tropicalis  =====================================================
                       Lizard  =====================================================
     Chinese softshell turtle  =====================================================
               Painted turtle  =====================================================
              Green seaturtle  =====================================================
                       Turkey  =====================================================
                      Chicken  =====================================================
                 Mallard duck  =====================================================
                       Parrot  =====================================================
                   Budgerigar  =====================================================
           Tibetan ground jay  =====================================================
                  Zebra finch  =====================================================
          Medium ground finch  =====================================================
       White-throated sparrow  =====================================================
          Collared flycatcher  =====================================================
             Peregrine falcon  =====================================================
                 Saker falcon  =====================================================
                  Rock pigeon  =====================================================
           American alligator  =====================================================

Inserts between block 1 and 2 in window
B D                      Cat 238bp
B D                  Wallaby 4bp

Alignment block 2 of 38 in window, 131766732 - 131766834, 103 bps 
B D                     Human  ---------------------aaatgaca-tt-atttatagcaaggcgttc--tctct--ccttt-----
B D                     Chimp  ---------------------aaatgaca-tt-atttatagcaaggcgttc--tctct--ccttt-----
B D                   Gorilla  ---------------------aaatgaca-tt-atttatagcaaggcgttc--tctct--ccttt-----
B D                 Orangutan  ---------------------aaatgaca-tt-atttatagcaaggcgttc--tctct--ccttt-----
B D                    Gibbon  ---------------------aaatgaca-tt-atttatagcaaggcgttc--tctcc--ccttt-----
B D                    Rhesus  ---------------------aaatgaca-tt-atttatagcaaggcgttc--gctct--ccttt-----
B D       Crab-eating macaque  ---------------------aaatgaca-tt-atttatagcaaggcgttc--gctct--ccttt-----
B D                    Baboon  ---------------------aaatgaca-tt-atttatagcaaggcgttc--gctct--ccttt-----
B D              Green monkey  ---------------------aaatgaca-tt-atttatagcaaggcgctc--gctct--ccttt-----
B D                  Marmoset  ---------------------aaatgaca-tt-atttatagcaaggcgttc--tctct--ccttt-----
B D           Squirrel monkey  ---------------------aaatgaca-tt-atttatagcaaggcgttc--tctct--ccttt-----
B D                  Bushbaby  ---------------------aaatgaca-tc-gtttatagcaaggcattc--ctttt--ccttg-----
           Chinese tree shrew  ---------------------aagtgaca-tt-atttatagcaatgcagt-----------cttt-----
B D                  Squirrel  ---------------------aagtgaca-tt-atttatagcaacgtgttc--tttct--ccttt-----
       Lesser Egyptian jerboa  ---------------------aagtgaaa-tt-atttatagcaatgcattc--ttttg--ccttt-----
                 Prairie vole  ---------------------aagtgaca-tc-atttctcacaatgcattt--gttct--cctgt-----
B D           Chinese hamster  ---------------------aagtgaga-tc-atttatagcaatgccttc--attct--ccttt-----
               Golden hamster  ---------------------aagtgaca-tc-atttatagcaaggccttc--attct--ccttt-----
B D                     Mouse  ---------------------gggtaaca-tt-atttatagtaatgtgtcc--attct--ccttt-----
B D                       Rat  ---------------------gaataaca-tt-atttatagtgatgtgttc--attct--ctttt-----
B D            Naked mole-rat  ---------------------aactgaca-tt-atttatagtaatgtgttc--cttct--cctta-----
B D                Guinea pig  ---------------------aagtgaca-tt-atttatagtaatgcgttc--cctct--ccttt-----
                   Chinchilla  ---------------------aagtgaca-tt-atttatagtaatgcgtgc--cttct--ccttt-----
             Brush-tailed rat  ---------------------aagtgtca-tt-atttatagtaaggcgctc--cttct--cctct-----
B D                    Rabbit  ---------------------aagtgacg-tt-atttatagcaatgccttc--tttct--cctct-----
B D                      Pika  ---------------------aagcaaca-tt-atttatagcgatgcattc--tttct--ccttt-----
B D                       Pig  ---------------------aagtgaca-tt-atttatatcaatgcgttc--tttct--cctct-----
B D                    Alpaca  -----------------------gtgaca-tt-atttatagcgatgcgttctttctct--ccttt-----
               Bactrian camel  -----------------------gtgaca-ct-attcatagcgatgcgttctttctct--ccttt-----
B D                   Dolphin  ---------------------aagtgaca-tt-atttatagcaatgtggtc--tttct--ccttt-----
                 Killer whale  ---------------------aagtgaca-tt-atttatagcaatgtggtc--tttct--ccttt-----
             Tibetan antelope  -----------------------gtgtcg-tt-atttatagtaacgcgttc--cctct--ccttt-----
B D                       Cow  -----------------------gtattg-tt-atttatagtaatgcgttc--tttct--ccttt-----
B D                     Sheep  -----------------------gtgtcg-tt-atttatagtaacgcgttc--tctct--ccttt-----
                Domestic goat  -----------------------gtgtcg-tt-atttatagtaacgcgttc--tctct--ccttt-----
B D                     Horse  ---------------------aagtgacg-tt-atttatagcaatgcgttc--tttct--ccttt-----
B D          White rhinoceros  ---------------------aagtgaca-tt-atttatagcaatgcgttc--tttct--ccttt-----
B D                       Cat  ---------------------atgttatg-tt-atttaaagcaatgtggtc--tttct--ccttt-----
B D                       Dog  ---------------------aagttaca-tt-atttgtaacaatgtgctc--ttttt--ccttt-----
B D                   Ferret   ---------------------aagttgc--tt-atgtatagcag------c--tttct--ccttt-----
B D                     Panda  ---------------------aagttac--tt-acatagagcaatgtggtc--tttct--ccttt-----
               Pacific walrus  -----------------------gttcc--tt-atgtataacaatgaggtc--tttct--ccttt-----
                 Weddell seal  -----------------------gttac--tt-atgtatagcgttgaggtc--tttct--ccttt-----
             Black flying-fox  ---------------------aagtgaca-tt-atttatagcaatgtgttc--tttct--cattt-----
B D                   Megabat  ---------------------aagtgaca-tt-atttatagcaatgtgttc--tttct--cattt-----
                Big brown bat  ---------------------aagtgaca-tt-atttatagcaatgcgttc--ctttt--ccttt-----
         David's myotis (bat)  ---------------------aagtgaca-tt-atttatagcaatgcgctc--tttta--acttt-----
B D                  Microbat  ---------------------aagtgaca-tt-atttatagcaatgcgctc--ttttt--ccttt-----
B D                  Hedgehog  ---------------------gaatgattttt-atttatagcaccgcatcc--tttct--ctttc-----
              Star-nosed mole  ------------------------------tt-atttataacagcata------ttct--ccttc-----
B D                  Elephant  ---------------------aactgaca-gt-atttatagcaatgcattc--ttctt--tcttt-----
          Cape elephant shrew  ---------------------aactgaca-tt-attaatagcaatgcattc--tt-tt--tcctt-----
B D                   Manatee  ---------------------aactgaca-tt-atttatagcaatgcattc--ttttt--tcttt-----
             Cape golden mole  ---------------------aactgaca-tt-atttttatcgatgcgttc--ttttttctctct-----
B D                    Tenrec  ---------------------aactgctg-tt-atttataccaatgcattc--ttttt--tctct-----
                     Aardvark  ---------------------aactgaca-tt-atttttagcaatgctttc--tttttt-tcttt-----
B D                 Armadillo  ---------------------aagtg-----------------gtgcattc--tttgt------------
B D                   Opossum  ---------------------aaatgaca-ttaatatataacgatccattc--tttcc--tctctgcatt
B D           Tasmanian devil  ---------------------aaatgaca-tt-atatataacaattcattc--tttcc--tctctttatt
B D                   Wallaby  ---------------------aaatgata-tt--tttccaacaatccattc--tttcc--tctctgcatt
B D                  Platypus  aaaccttctaaagaccatttgaaatgata-tt-atttacaaaaatccattc--ttttc--tctttgcctt
B D                     Shrew  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D        American alligator  ======================================================================

                        Human  ------ccactgacgattttccttttcaatcag-attctcttcattcttacacatc----ccatttgagt
                        Chimp  ------ccactgacgattttccttttcaatcag-attctcttcattcttacacatc----ccatttgagt
                      Gorilla  ------ccactgacgattttccttttcaatcag-attctcttcattcttacacatc----ccatttgagt
                    Orangutan  ------ccactgacgattttccttttcaatcag-attctcttcattcttacacatc----ccatttgagt
                       Gibbon  ------ccactgatgattttccttttcaatcag-attctcttcattcttacacatc----ccatttgagt
                       Rhesus  ------ccactgacgattttccttttcaatcag-attctcttcattcttacacatc----ccatttgagt
          Crab-eating macaque  ------ccactgacgattttccttttcaatcag-attctcttcattcttacacatc----ccatttgagt
                       Baboon  ------ccactgacaattttccttttcaatcag-attctcttcattcttacacatc----ccatttgagt
                 Green monkey  ------ccactgacgattttccttttcaatcag-attctcttcattctcacacatc----ccatttgagt
                     Marmoset  ------ccactgacgattttccttttcaatcag-attcttttcatt-ttacacatc----ccatttgagt
              Squirrel monkey  ------ccactgacgattttccttttcaatcag-attctcttcatt-ttacacatc----ccatttgagt
                     Bushbaby  ------ccactgcctacttcctgttcccattag-attctcctcgttcttacacagc----ccactttagt
           Chinese tree shrew  ------ccactgatcattttcttttgcaatcaa-actatctccattctcacgga-c----ccattttagt
                     Squirrel  ------ctac-aactgtttttcttttcaatcag-actctcttcattcttagacatc----ccattttagt
       Lesser Egyptian jerboa  ------ccactgactatttttcttttcagtcag-actctcctcattctcaca-atc----ccattttagt
                 Prairie vole  ------ccactgaagctgtatcttc--aatcat-accctcttcattcttacacgctgtggacacgttagt
              Chinese hamster  ------tgactggctttttcttttc--aatcag-actctcttcattcttgcacatc----ccactctagt
               Golden hamster  ------ccactggctttttcttttc--aatcag-actctcttcattcttacacatc----ccactctagt
                        Mouse  ------ccactgaccatttttcttttcaatcag-atgctctttattcttaca-atc----ctattttagc
                          Rat  ------ccaccaaccttttatcttct-aatcag-actctcttcattcttacacatc----ccattt----
               Naked mole-rat  ------ccactgactatttttcttttcaatcag-actctcttcactcttacacatc----ccattttagc
                   Guinea pig  -------cactgactatttttcttttcaatcag-actgtcttcactcttacacatc----ccattttagt
                   Chinchilla  ------ccacta----tttttcttttcaatcag-actctcttcactcttacatatc----ccattttagt
             Brush-tailed rat  ------ccactgcctctttttcttttcaatcag-actctcttcactcttacacgtc----ccattttagt
                       Rabbit  ------ccactgactattttccttttcaatcag---tctcttcattcttacacgtc----tcatttgagt
                         Pika  ------tcactgactatttttcttttcaatcag-accctcttcattcttacatgtc----ccatttgagt
                          Pig  ------cc----g--gttttcctcttcaatcag-acactttttattcttacacatc----acatttcagt
                       Alpaca  ------cc----actattttccttttcaatcag-acactttttattcttacgcatc----acacttccgt
               Bactrian camel  ------cc----actgttttccttttcgatcag-acgcgttttattcttaagcatc----acatttccgt
                      Dolphin  ------cc----actattttccttttcaatcag-acac--tttattcttacccacc----acatttcagt
                 Killer whale  ------gc----actattttccttttcaatcag-acac--tttattcttacccacc----acatttcagt
             Tibetan antelope  ------cc----actattttccttttcaattag-acactttttactcttacacatc----acatttcagt
                          Cow  ------cc----actattttccttttcaatcag-acactttttactcctacccatc----acatttcagt
                        Sheep  ------cc----actattttccttttcaatcag-acac--ttgactcttacacatc----acatttcagt
                Domestic goat  ------cc----actattttccttttcaatcag-acactttttactcttacacatc----acatttcagt
                        Horse  ------ccactgactattttcgttttcaatcag-acgctgttccttcttacacatc----acatttcact
             White rhinoceros  ------ccactgactattttccttttcaatcag-gcacttttcattcttacacatc----acatttcagt
                          Cat  ------ccattgactattttccttttcaatcac-atgcttttcattcctatacatc----acatttcagt
                          Dog  ------ccattgactcttttccttttctatcag-atgcttttcatttctacacatc----acatttcagg
                      Ferret   ------ccattaactatttcctttttcagtcagaatgctttccattcctacac-tc----acatttcagt
                        Panda  ------ccattgactattttccttttcagtcag-atgc-tttaattcctacacatc----acatttcagt
               Pacific walrus  ------ccattgactattttccttttcagtcag-atgcttttcattcccacacatc----acatttcagt
                 Weddell seal  ------ccattgactattttccttttcagtccg-atgcttttcattcgtacacgtc----acatttcagt
             Black flying-fox  ------cc----actgtttttcttttcaatcag-atgcttttcattttcacacatc----acatttcaat
                      Megabat  ------cc----actgtttttcttttcaatcag-atgcttttcattttcacacatc----acatttcaat
                Big brown bat  ------cc----actattttccttttaaagcag-atgctattcatccttacgcatc----acatttcagt
         David's myotis (bat)  ------cc----actattttccttttaaagcag-atgctattcatccttacgcatc----acatttcagt
                     Microbat  ------cc----actattttccttttaaagcag-atgctattcatccttacgcatc----acatttcagt
                     Hedgehog  ------ccact-atttccctttttttcactcag-acacgttttattcttacacatc----atatttcagt
              Star-nosed mole  ------ccactgactgtttttcctttcaatcag-atgcttttcattcttatacatc----acagctcagc
                     Elephant  ------ccacagactattttcctactcaatcag-tctcttttca-ttttacgcatc----acat------
          Cape elephant shrew  ------ccacagactattttcctattcaatcag-tctcttttcatttttacacacc----acat------
                      Manatee  ------ccacagactattttcctattcaatcag-tcgcttttcattttcacacagc----acat------
             Cape golden mole  ------ccacaggcaattttcctattcaatcag-tttcttttcatttctacatttc----acac------
                       Tenrec  ------ccataggcaattttcctattcaatcag-tctcttttcattactacacatc----aaat------
                     Aardvark  ------ccacagactattttcctattcaatcat-tatc--ttcatttttacacatc----acat------
                    Armadillo  --------actgacgcttttccttttctataag-aatcttttcatttttatgcctc----acattccact
                      Opossum  actggtccattgaccattttccttttcagtcaa-actctattcattcttatacatc----atgttttggt
              Tasmanian devil  attgcttcattggtcagtttccttttcaatcaa-atggtgttcattcttgcatatc----atgtttt-gt
                      Wallaby  accgctctattgaccgttttccttttcaatcag-attctattcatgtttatacatt----ggattctagt
                     Platypus  accaatctgttgacagttttcctttttagtctg-attctgtttatt-ttacataag----acaattaaga
                        Shrew  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
           American alligator  ======================================================================

                        Human  cactgc
                        Chimp  cactgc
                      Gorilla  cactgc
                    Orangutan  cactgc
                       Gibbon  cactgc
                       Rhesus  cactgc
          Crab-eating macaque  cactgc
                       Baboon  cactgc
                 Green monkey  cactgc
                     Marmoset  cactgc
              Squirrel monkey  cactgc
                     Bushbaby  ccctgc
           Chinese tree shrew  cactgc
                     Squirrel  cactgc
       Lesser Egyptian jerboa  cactgc
                 Prairie vole  ccctgg
              Chinese hamster  cactgc
               Golden hamster  cactgc
                        Mouse  cacagc
                          Rat  ------
               Naked mole-rat  tcctgc
                   Guinea pig  tcctgc
                   Chinchilla  ttctgc
             Brush-tailed rat  tcctgc
                       Rabbit  cattgc
                         Pika  cactgc
                          Pig  cactgc
                       Alpaca  cactgc
               Bactrian camel  cactgc
                      Dolphin  cgctgc
                 Killer whale  cgctgc
             Tibetan antelope  catagc
                          Cow  cacagc
                        Sheep  cacagc
                Domestic goat  cacagc
                        Horse  cactgc
             White rhinoceros  cactgc
                          Cat  cactgc
                          Dog  cacagc
                      Ferret   cactgc
                        Panda  cactgc
               Pacific walrus  cactgc
                 Weddell seal  cactgc
             Black flying-fox  cactgc
                      Megabat  cactgc
                Big brown bat  cactg-
         David's myotis (bat)  cactg-
                     Microbat  cactg-
                     Hedgehog  cactgt
              Star-nosed mole  catcgc
                     Elephant  -gcagt
          Cape elephant shrew  -gcagt
                      Manatee  -gctgt
             Cape golden mole  -gcagt
                       Tenrec  -gcagt
                     Aardvark  -gtagc
                    Armadillo  cactgt
                      Opossum  ccctgc
              Tasmanian devil  tcctgc
                      Wallaby  cactgc
                     Platypus  -ggtgc
                        Shrew  ======
                X. tropicalis  ======
                       Lizard  ======
     Chinese softshell turtle  ======
               Painted turtle  ======
              Green seaturtle  ======
                       Turkey  ======
                      Chicken  ======
                 Mallard duck  ======
                       Parrot  ======
                   Budgerigar  ======
           Tibetan ground jay  ======
                  Zebra finch  ======
          Medium ground finch  ======
       White-throated sparrow  ======
          Collared flycatcher  ======
             Peregrine falcon  ======
                 Saker falcon  ======
                  Rock pigeon  ======
           American alligator  ======

Inserts between block 2 and 3 in window
B D                  Opossum 1bp
B D          Tasmanian devil 1bp

Alignment block 3 of 38 in window, 131766835 - 131766977, 143 bps 
B D                     Human  --ca-cgtgagtaacggggcccgtaaatattc----agccacag--c-c-tc-ttgatccc-ttt-----
B D                     Chimp  --ca-cgtgagtaacggggcccgtaaatattc----agccacag--c-c-tc-ttgatccc-ttt-----
B D                   Gorilla  --ca-cgtgagtaatggggcccgtaaatattc----agccacag--c-c-tc-ttgatccc-ttt-----
B D                 Orangutan  --ca-tgtgagtaacggggcccataaatattc----agccccag--c-c-tc-ttgatccc-ttt-----
B D                    Gibbon  --ca-cgtgagtaacggggcccataaatattc----agcctcag--c-c-tc-ttgatccc-ttt-----
B D                    Rhesus  --ca-cgtgagtaacggggcccataaatattc----agccccag--c-c-tc-ttgatccc-ttt-----
B D       Crab-eating macaque  --ca-cgtgagtaacggggcccataaatattc----agccccag--c-c-tc-ttgatccc-ttt-----
B D                    Baboon  --ca-cgtgagtaacggggcccataaatattc----agccccag--c-c-tc-ttgatccc-ttt-----
B D              Green monkey  --ca-cgtgagtaacggggcccgtgaatattc----agccccag--c-c-tc-ttgatccc-ttt-----
B D                  Marmoset  --ca-cgtgaataacggggcccataaatattc----aggcccag--c-c-tc-ttgatccc-tct-----
B D           Squirrel monkey  --ca-cgtgaataacggggcccataaatattc----aggcccag--c-c-tc-ttgatccc-tct-----
B D                  Bushbaby  --cc-catgagtaacggagcacataaatattc----agatccag--t-catc-tttgtccc-ttt-----
           Chinese tree shrew  --ca-catgaataactgggcaggtgcatactc----agatccac--ctc-tc-tttgtccc-ttt-----
B D                  Squirrel  --cg-cttgaataacagggcacataaatattc----agatctag--ccc-tc-tttgtccc-ctt-----
       Lesser Egyptian jerboa  --ca-catgaataacagggtgcataaatattc----agatctag--tcc-tc-tttgtccc-att-----
                 Prairie vole  --tg-catgaataacagggcacatcaatattc----agatctag--cct-cc-tttgtccc-ttt-----
B D           Chinese hamster  --ca-catgaataacagggcacataaatattc----agatctag--c----c-tttgtccc-ttt-----
               Golden hamster  --ca-catgaataacagggcacataaatattc----agatctag--cct-tc-tttgtccc-ttt-----
B D                     Mouse  --ca-catagat-gcagggcatataagtattc----atatctag--cct-atgttttcccc-cct-----
B D                       Rat  -------tagat-ggagggcacataagtattc----agatctac--cct-ac-tttgtcct-cct-----
B D            Naked mole-rat  --ca-catgaataacagggcacataaatattc----agattgaa--ccc-tc-attgtccc-ttt-----
B D                Guinea pig  --ca-tgtgcataacagggcacataaatattc----agctctaa--ccc-gc-attgtccc-ctt-----
                   Chinchilla  --tg-catgaataacagggcacataaatattc----agatctaa--ccc-tc-attgtccc-ctt-----
             Brush-tailed rat  --ct-catggataacagggcccataaatattc----aggtctaa--ccc-tc-attgtccc-ctt-----
B D                    Rabbit  --cg-catgaggaacagggcacataaatattc----agaccccg--g-c-ac-tttgtccc-ctc-----
B D                      Pika  --ct-catgaagagcagggcacataaatattc----agacacag--a-t-gc-tttgtccg-ctc-----
B D                       Pig  --ca-cataaataagagggagcataagtattc----agacccgg--c-cctc-tttgtcat-ctt-----
B D                    Alpaca  --cg-cgtgagtaacagggagcataaatattc----cgatccag--c-cttc-tttgtccc-ctc-----
               Bactrian camel  --cg-cgtgagtaacggggggcatacatattc----cgatccag--c-c--c-tctgtccc-ctt-----
B D                   Dolphin  --cg-cgtggataacagggagcataagtattc----acatctgg--c-c-tc-cttgtccc-ctt-----
                 Killer whale  --cg-catggataacagggagcataagtattc----acatctgg--c-c-tc-cttgtccc-ctt-----
             Tibetan antelope  --ca-catgaataacagggaacataaatattc----agacccag--c-c-tc-cttgtccc-cttgtccc
B D                       Cow  --ca-catgaataacagggagcataaatattc----agacctgg--c-c-tc-cttgtccc-ctt-----
B D                     Sheep  --ca-catgaatgacagggaacgtaaatattc----agacccag--c-c-tc-cttgtccc-ctt-----
                Domestic goat  --ca-catgaatgacagggaacataaatactc----agacccag--c-c-tc-cttgtccc-ctt-----
B D                     Horse  --ca-catgaataacagagagtataaatattc----agatccag-gc-c-tc-tgcgtccc-ttt-----
B D          White rhinoceros  --ca-catgaataacagagagcataaatattc----agatccaa-gt-c-tc-tttgtccc-ttt-----
B D                       Cat  --ca-catga--aacatggagcataaatattc----agatacag-cc-c-tt-tttatcat-ctt-----
B D                       Dog  --ca-catgaataacaggaagcataaatattc----agatccagccc-c-tc-tttgtccc-att-----
B D                   Ferret   --ca-catgaaaaacagggagcattaatattc----agatccag-cc-c-cc-tctctccc-ctt-----
B D                     Panda  --ca-catgaataacagggggcatcaatattc----agatccag-tc-c-tc-tttgtccc-ctt-----
               Pacific walrus  --ca-cctgaatagcagggagcataaatattc----agatccag-cc-c-tc-tttgtccc-ctt-----
                 Weddell seal  --ca-cctgaataacagggaacataaatattc----agatccag-cc-c-tc-tttgtccc-ctt-----
             Black flying-fox  --ca-catgaataacagggagcataaatattc----agatctag-cc-c-tc-tttgtctt-ctt-----
B D                   Megabat  --ca-catgaataacagggagcataaatattc----agatctag-cc-c-tc-tttgtctt-ctt-----
                Big brown bat  --ca-catgagtaacggggagcggagatattc----agatccag--c-c-tc-tctgtctc-ctt-----
         David's myotis (bat)  --ca-catgaataacggggagcggagatattc----agacccag--c-c-tc-tccgtctc-ctt-----
B D                  Microbat  --ca-catgagtaacggggagcggagatattc----agacccag--a-c-tc-tctgtctc-ctt-----
B D                  Hedgehog  --ct-cagaaataacag-cagcataaatattc----agatcttg-cc-c-tc-tgtgctgc-cac-----
              Star-nosed mole  --ca-tgggaagagttg-gagcataaatattc----agatccag-cc-t-tc-t-tgtcct-cgt-----
B D                  Elephant  --ca-c-tgaataacaggcggcacaaatactcacaaatattcag-cc-c-tt-tttatcctcttt-----
          Cape elephant shrew  --ca-c-tgaatgacaaggag----------cacaaatattcct-tt-c-tt-tttatcctcttt-----
B D                   Manatee  --ga-c-tgaataacaggcggcacaaatactcacagatagtccc-tc-c-tt-cttatcctcttt-----
             Cape golden mole  --ca-c-tgagtaac--ggagcacagatattcacaaatattcag-tc-a-gt-tttatcct-ttt-----
B D                    Tenrec  --ca-c-tgaataacagggagcacaattattcacaaacattcag-tc-a-tt-tttatcct-ttt-----
                     Aardvark  --ca-c-tgaataagggagagcacaaatagtcacaaatattcag-------------tcctcttt-----
B D                 Armadillo  --catt-tgaataatgtggagcatcaatattc----atagccag-cc-a-ac-tttgtccctttc-----
B D                   Opossum  --aa-catgaatgac--tgaaaacaatttttc----atgtttaa--a-c-tt-ctt-tcct-ttc-----
B D           Tasmanian devil  --aa-catgaa------taagaataactattt----gtgttcaa--a-c-tt-c---tcct-ttc-----
B D                  Platypus  taca-taagagtaattgtgaccctaaatgttt--------------t-t-ct-cttctcct-tcc-----
B D                     Shrew  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================

                        Human  -------cttaat-ccca---tttttctcctc-acttc-acc-t----tcactagg----atatttcccg
                        Chimp  -------cttaat-ccca---tttttctcctc-acttc-acc-t----tcactagg----atatttcccg
                      Gorilla  -------cttaat-ccca---tttttctcctc-acttc-acc-t----tcactagg----atatttcccg
                    Orangutan  -------cttaat-tcca---tttttcttctc-acttc-acc-t----tcactagg----atatttcctg
                       Gibbon  -------cttaat-ccca---tttttcttctc-acttc-acc-t----tcactagg----atatttcccg
                       Rhesus  -------cttaat-ccca---tttttcttctc-acttc-acc-t----tcactagg----atatttcccg
          Crab-eating macaque  -------cttaat-ccca---tttttcttctc-acttc-acc-t----tcactagg----atatttcccg
                       Baboon  -------cttaat-ccca---tttttcttctc-acttc-acc-t----tcactagg----atatttcccg
                 Green monkey  -------cttaat-ccca---tttttcttctc-acttc-acc-t----tcactagg----atatttcccg
                     Marmoset  -------cctaat-ccca---tttttcttctg-acttc-acc-t----tcactaga----atatttcccg
              Squirrel monkey  -------cctaat-ccca---tttttcttctg-acttc-acc-t----tcactaga----atatttcccg
                     Bushbaby  -------cctgtt-ccca---tttttcttctc-acttcaact-t----ttgtaagg----atagttcttt
           Chinese tree shrew  -------ctaata-acca---ttttt---ctc-acttc-acc-t----tc--------------------
                     Squirrel  -------tcaaattccca----tttttctttc-atttc-acc-t----tcataaag----atattcctct
       Lesser Egyptian jerboa  -------tctagttccca----ttttt-------gttc-act-t----ttatggaa----atattccttt
                 Prairie vole  -------tcaaattccca----tttttccttc-cactc-acc-t----tcatgagg----atatttcttc
              Chinese hamster  -------ttgaattccca---ttttttctttc-cactc-atc-t----tcgtgagg----atattccttc
               Golden hamster  -------tcgaattccca----tttttctttc-cactc-acc-t----tcatgagg----atatttctct
                        Mouse  -------tttaatttcca----ttcttatttc-cattt-acc-t----tcagggag----atatttcct-
                          Rat  -------tttaattcccg----tttttctttc-cattt-gct-t----tcaggagg----atatttttt-
               Naked mole-rat  -------tctaattccca---ttttttctttc-atttc-acc-t----tcatgagg----atatccctct
                   Guinea pig  -------tctaatcccca---ttttttctttc-atttc-acc-t----tcatgagg----atattcctcg
                   Chinchilla  -------tctaattccca---atttttctttc-atttc-acc-t----tcatgaggatatatattcctct
             Brush-tailed rat  -------tcgcattccca---ttttttctttc-atttt-acc-t----tcatgagg----atattcctct
                       Rabbit  -------tctaatcccca---tttttcttctc-atttc-acc-t----tcgtgagg----atattcctc-
                         Pika  -------cataattccta---cttttcttctc-ttttc-acc-t----tcatgaag----atattcctt-
                          Pig  -------tctaattccta---tttttcttctc-gcttc-acc-t----tcataagc----atattcccct
                       Alpaca  -------tcta-ttccca---tttttcttctc-tcttc-acc-t----tcatgaag----atgtctctct
               Bactrian camel  -------tcta-gtccca---ttttccttctc-tcttc-acc-t----tcatgaag----atgtctctct
                      Dolphin  -------tctaattccca---tttttcttcta-agttc-atc-t----tcaggagg----atgttcctct
                 Killer whale  -------tctagttccca---gttttcttcta-agttc-atc-t----tcaggagg----atgttcctct
             Tibetan antelope  cttgtcccctaattccca---tttttcttctt-acttc-acc-t----tcatgagg----atattcctct
                          Cow  -------cctaattccca---tttttcttctt-acttc-acc-t----tcatgagg----atattcctct
                        Sheep  -------cctaattccca---tttttcttctt-acttc-acc-t----tcatgagg----atattcctct
                Domestic goat  -------cctaattccca---tttttcttctt-acttc-acc-t----tcatgagg----atattcctct
                        Horse  -------tctaattccca---tttttcttctc-acttc-acc-t----tcatgagg----atattcctct
             White rhinoceros  -------tctaattccca---tttttcttctc-acttc-acc-t----tcataagg----atattcctct
                          Cat  -------tctaattccca---tttctctgtcc-aattc-ccc-aattccccaaggg----atattccttt
                          Dog  -------tctaattcttt--ttttttcccctc-aattc-acc-t----tcatgggg----atattcctct
                      Ferret   -------cctcattcaca-tttttttttcctc-aattc-accaa----tcatgggg----atattcctct
                        Panda  -------cctcatccccactttttttttcctc-aattc-act-g----tcatggga----atattactct
               Pacific walrus  -------cttcattccca---tttttttcctc-aactc-acc-a----tcatgggg----atattcctct
                 Weddell seal  -------cttcatttcca---ttttttttctc-aattc-acc-a----tcatgggg----atattcctct
             Black flying-fox  -------tctaattccca---tttttcttctt-acttc-atc-t----ttatgagg----atattcctct
                      Megabat  -------tctaattccca---tttttcttctt-acttc-atc-t----ttatgagg----atattcctct
                Big brown bat  -------tctagtgccca---tttttcttctc-ccttc-acc-t----tcctgagg----atattcctct
         David's myotis (bat)  -------tctaatcccca---tttttcttctc-ccttc-acc-t----tcatgggg----atattcctct
                     Microbat  -------tctaatcccca---tttttcttctc-ccttc-acc-t----tcatgagg----gtattcctct
                     Hedgehog  -------tctaattcctg---atttgcttctt-acttc-acc-t----tcatacga----gtatctcctg
              Star-nosed mole  -------tcttattctca---cctttcttctc-acttt-acc-t----tcatgtgg----ccatttctct
                     Elephant  -------tccagttgcca---tttttcttctc-acttc-gcc-t----tcatgagg----gcattcttct
          Cape elephant shrew  -------tccagttctca---gttttgtcct---ttgc-acc-t----ttgtgaga----gcattctttt
                      Manatee  -------tccaattctca---tttttcttctc-acttc-ccc-t----gtacgagg----gcattcttct
             Cape golden mole  -------ttaaattctca---ttttttttctt--tttc-acc-t----ccatgaaa----acattcttct
                       Tenrec  -------ccaagccccct---tttttgcttctcactta-gct-t----tcaggggg----acattctact
                     Aardvark  -------tccaattccca---tttttcttctc-acttc-acc-t----tcatgagg----gcattcattt
                    Armadillo  -------tctaattccca---tttttcttctc-acttc-acc-t----ttgtgagg----atattcttct
                      Opossum  -------tctatgttaca---ttttattttta-attcc-ctc-t----cttaagga----ttttttctc-
              Tasmanian devil  -------tctattttgca---tcttatttcta-atttc-ctc-t----tctggaga----ctttttttcc
                     Platypus  -------ctttctcccca---ttcttttcttt-gtgtc-ccc-tg---taatgagg----aattttgtat
                        Shrew  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                      Wallaby  ======================================================================
           American alligator  ======================================================================

                        Human  tc--------c-----tttttt--cccagtggct---ttgttaccacaacca------tatcttttt
                        Chimp  tc--------c-----tttttt--cccagtggct---ttgttaccacaacca------tatcttttt
                      Gorilla  tc--------c-----tttttt--cccagtggct---ttgttaccacaacta------tatcttttt
                    Orangutan  tc--------c-----tttttt--cccagtggct---ttgttaccacaatcg------tatcatttt
                       Gibbon  tc--------c-----tttttt--cccagtggct---ttgttaccacaaccg------tatcttttt
                       Rhesus  tc--------c------ttttt--cccagtggct---ttgttaccacaacca------tatcttttt
          Crab-eating macaque  tc--------c------ttttt--cccagtggct---ttgttaccacaacca------tatcttttt
                       Baboon  tc--------c------ttttt--cccagtggct---ttgttaccacaacca------tatcttttt
                 Green monkey  tc--------c------ttttt--ccccgtggct---ttgttaccacaacca------tatcttttt
                     Marmoset  tc--------c-------tttt--cccagtggct---ttgttaccacaatcg------tatcttttt
              Squirrel monkey  tc--------c-------tttt--cccaggtgct---ttgttaccacagtca------tatc-tttt
                     Bushbaby  tt--------c-------ttcc--ccccatctct---ttgttaccatgaccc------tatcttttt
           Chinese tree shrew  ---------------------t--ctcagtaagtaaagtgttaccattgcct------caccgtctt
                     Squirrel  gc--------c--------ttt--ctcagtaact---ttgttaccataacgc------tagcttctt
       Lesser Egyptian jerboa  aa--------c------ttttt--ctctttaact---ttgttaccataactt------tttcttctt
                 Prairie vole  ac--------c------ctttt--atctgtcact---ttgtttctagcgctc------tgtcttctt
              Chinese hamster  ac--------c------ttttt--atctttaac-----tacttctagcactc------gctcttctt
               Golden hamster  ac--------c------tgttt--atctttaact---ttgtttctagcact--------gtcttctt
                        Mouse  ----------c------ctttt--ttctttaact---tagattttatcactc------tgtcttctt
                          Rat  ----------c------ctttt--atctttaaca---ttgtttctatcactc------tgtcttctt
               Naked mole-rat  gc--------c------ttttt--ctcagtaact---ttgttgtcataactc------tatcttctt
                   Guinea pig  gc--------c------ttttt--ctcagtaaat---ttgttaccacaactc------tatcttttt
                   Chinchilla  gt--------c------ttttt--ttcagtaact---ttgttatcataactc------ta---tctt
             Brush-tailed rat  a---------c------ctttt--ctcgataact---ttgttatcataactc------tatcttctt
                       Rabbit  -------------------------tctgtggct---ttgtttccacaacct------tatctcctt
                         Pika  -------------------------tctgcagct---ttgtttccataacct------tatctcctt
                          Pig  cc--------c------ttttt--cccaatggtt---ctgttaccatgactc------tctcttctt
                       Alpaca  cc--------c------tgtct--cccaaagtct---ttgttaccgtaactc------taccttctt
               Bactrian camel  ct--------c------tgtct--cccaaaggct---ttgttaccataactc------taccttctt
                      Dolphin  cc--------c------ctttt--cccagtggct---ttgctaccataactc------tatcttctt
                 Killer whale  cc--------c------ttttt--cccagtggct---ttgctgccataactc------tatcttctt
             Tibetan antelope  cc--------c------tctgt--cccaatgtct---ttgttaccataactt------tatcttctt
                          Cow  cc--------a------tctgt--cccgatgtct---ttgttaccataactt------tatcttctt
                        Sheep  cc--------t------tctgt--cccgatgtct---ttgttaccataactt------tatattctt
                Domestic goat  cc--------c------tctgt--cccgatgtct---ttgttaccataactt------tatcttctt
                        Horse  cc--------c------ttttt--cccagtagct---ttgtcaccataactc------catcttctt
             White rhinoceros  cc--------c------ttttc--cccagtggct---ttgttgacataactc------tatcttctt
                          Cat  -c--------c------ctttt--tccagtggct---ttgttaccattacac------tgtcttcct
                          Dog  cc--------t------ttttttccccagtggat---ttgttacaataacct------tgtcttcca
                      Ferret   cc--------c------ttttt--cccagtggat------ttaccataacac------tgttttcct
                        Panda  cc--------c------ttttt--cccagtggat---ttgttaccataaccc------tgtcttcct
               Pacific walrus  -c--------c------ttttt--cccagtggat---ttgttaccataacct------catcttcct
                 Weddell seal  -c--------t------ttttt--cccagtggat---ttgttaccataacct------catcttcct
             Black flying-fox  gc--------c------ttttc--cccagtggct---ttgttaccataactc------tatcttctt
                      Megabat  gc--------c------ttttc--cccagtggct---ttgttatcgtaactc------tatcttctt
                Big brown bat  cc--------c------ctttc--tccagtggct---ttgttaccataactc------tgtcttctt
         David's myotis (bat)  cc--------c------tttac--cccagtggct---ttgttaccataactc------tatcttctt
                     Microbat  cc--------c------ttttt--cccagtggct---ttgttaccatagctc------tatcttctt
                     Hedgehog  tcccttatctc------cttct--ccctgtggtt---ttggtatcacaactc----tacatacttcc
              Star-nosed mole  tc--------c------cattc--cccagtgcca---ttattactacaattc------aatagtcca
                     Elephant  cc--------c------tctct--cccagtggct---tcgttaccataatcc------tatcttctt
          Cape elephant shrew  tg--------c------tttct--ccaagtggat---tttttaatataatcc------tgatatctt
                      Manatee  gc--------c------tttct--cccagtggcg---ttgttaccatgatcc------tatcttctt
             Cape golden mole  t-----------------ttat--cctaatgact---ttgtttc------ct------tatcttctt
                       Tenrec  tc--------c-------tctt--tccagtggtt---ttgtcaccacaatca------catcttctt
                     Aardvark  ct--------c------tttca--cctagtagct---ttgttaccttaatcc------tattttctt
                    Armadillo  cc--------tttttgtttttg--cccggtggct---ttgt--ccatcgccc------tatcttccc
                      Opossum  -----------------ttttt--ctcaataact---t--------tgaatc------ca-------
              Tasmanian devil  ct--------t----ttttctc--ttcaatgtcc---ttcat-tcataactc------ca-------
                     Platypus  ct--------c------cttat--at-----gcc---ttgattctatagttgactaagaattttatt
                        Shrew  ===================================================================
                X. tropicalis  ===================================================================
                       Lizard  ===================================================================
     Chinese softshell turtle  ===================================================================
               Painted turtle  ===================================================================
              Green seaturtle  ===================================================================
                       Turkey  ===================================================================
                      Chicken  ===================================================================
                 Mallard duck  ===================================================================
                       Parrot  ===================================================================
                   Budgerigar  ===================================================================
           Tibetan ground jay  ===================================================================
                  Zebra finch  ===================================================================
          Medium ground finch  ===================================================================
       White-throated sparrow  ===================================================================
          Collared flycatcher  ===================================================================
             Peregrine falcon  ===================================================================
                 Saker falcon  ===================================================================
                  Rock pigeon  ===================================================================
                      Wallaby  ===================================================================
           American alligator  ===================================================================

Inserts between block 3 and 4 in window
        David's myotis (bat) 71bp
B D                 Microbat 67bp

Alignment block 4 of 38 in window, 131766978 - 131766999, 22 bps 
B D                     Human  tg-----cttt---gt-----------------------------ct-tag---------cgcct----a
B D                     Chimp  tg-----cttt---gt-----------------------------ct-tag---------ctcct----a
B D                   Gorilla  tg-----cttt---gt-----------------------------ct-tag---------ctcct----a
B D                 Orangutan  tg-----cttt---gt-----------------------------ct-tag---------ctcct----a
B D                    Gibbon  tg-----cttt---gt-----------------------------ct-tag---------ctctt----a
B D                    Rhesus  tg-----cttt---gt-----------------------------ct-tag---------ctcct----a
B D       Crab-eating macaque  tg-----cttt---gt-----------------------------ct-tag---------ctcct----a
B D                    Baboon  tg-----cttt---gt-----------------------------ct-tag---------ctcct----a
B D              Green monkey  tg-----cttt---gt-----------------------------ct-tag---------ctcct----a
B D                  Marmoset  tg-----cctt---gt-----------------------------ct-ttg---------ctcct----g
B D           Squirrel monkey  tg-----cctt---at-----------------------------ct-ttg---------ctcct----g
B D                  Bushbaby  agagagtcttt---gttgggagtaaagtgttaaatctggaaaaggct-tagaagagaaatatcct----a
           Chinese tree shrew  ca------gtg---gt-----------------------------ct-gtg---------cccct----g
B D                  Squirrel  tt------ata---gt-----------------------------ct-ttg---------cttcatttct
       Lesser Egyptian jerboa  ta------aga---gc-----------------------------ct-tta---------cctca----t
                 Prairie vole  tg------g----------------------------------------------------ctga----t
B D           Chinese hamster  tg------gta---gt-----------------------------ct-ttg---------actga----t
               Golden hamster  ag------gtg---gt-----------------------------ct-ttg---------actga----t
B D                     Mouse  tg------ata---gt-----------------------------ct-ttg---------gctga----t
B D                       Rat  tg------aca---gt-----------------------------ct-ttg---------gctga----t
B D            Naked mole-rat  ta------ata---gg-----------------------------ct-ttg---------cctaa----t
B D                Guinea pig  ta------gta---gt-----------------------------ct-ttg---------cctca----t
                   Chinchilla  ta------ata---gt-----------------------------ct-ttg---------cctca----t
             Brush-tailed rat  ta------gta---gt-----------------------------ct-ttg------------------g
B D                    Rabbit  aa------ata---at-----------------------------ct-ttg---------ctcct----a
B D                      Pika  aa------ata---at-----------------------------ct-ttg---------cctct----a
B D                       Pig  ------cagta---gg-----------------------------ca-tca---------ccctt----g
B D                    Alpaca  ------taata---at-----------------------------c----a---------cgttt----g
               Bactrian camel  ------taata---at-----------------------------c----a---------cattt----g
B D                   Dolphin  ------caatt---gt-----------------------------ca-tca---------tcctt----g
                 Killer whale  ------caatt---gt-----------------------------ca-tca---------ccctt----g
             Tibetan antelope  ------cgaaa---gt-----------------------------c------------------------
B D                       Cow  ------caaaa---gt-----------------------------c------------------------
B D                     Sheep  ------caaaa---gt-----------------------------c------------------------
                Domestic goat  ------caaaa---gt-----------------------------c------------------------
B D                     Horse  ------caata---gt-----------------------------ca-tca---------ctctt----a
B D          White rhinoceros  -------aata---gt-----------------------------ca-tca---------cttct----a
B D                       Cat  ------caata---gt-----------------------------ca-tca---------cccat----a
B D                       Dog  ------caata---tt-----------------------------ca-tca---------accct-----
B D                   Ferret   ------caata---gt-----------------------------ca-t-----------cccct-----
B D                     Panda  ------caata---gt-----------------------------ca-tca---------cccct-----
               Pacific walrus  ------caata---gt-----------------------------ca-tca---------cccct-----
                 Weddell seal  ------caata---gt-----------------------------ca-tca---------cccct-----
             Black flying-fox  ------caata---gt-----------------------------ca-tca---------cccct----a
B D                   Megabat  ------caata---gt-----------------------------ca-tca---------cccct----a
                Big brown bat  ------cagta---gt-----------------------------ca-tca---------cccct----a
B D                  Hedgehog  ------aatta-ttgt-----------------------------cattca---------cagta----c
              Star-nosed mole  ------tatta---gt-----------------------------ca-cca---------cctct----c
B D                  Elephant  ------taaca---gc-----------------------------ca-gtg---------ccttt----a
          Cape elephant shrew  ------taaca---tc--------------------------------acc---------cctta----a
B D                   Manatee  ------taacg---gc-----------------------------ca-ttg---------ccttt----c
             Cape golden mole  ------taaca---ac-----------------------------ca-t---------------------
B D                    Tenrec  ------taaca---ga-----------------------------ca-ttg---------tcctt----a
                     Aardvark  ------taatg---gc-----------------------------ca-ttg---------ctctt----a
B D                 Armadillo  ------taacaagggt-----------------------------ca-tta---------tctct----a
B D                   Opossum  ----------------------------------------------------------------------
B D           Tasmanian devil  ----------------------------------------------------------------------
B D                  Platypus  -----ccattt---at-----------------------------ct-tta---------ttc-------
B D                     Shrew  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================

                        Human  ------tt-t
                        Chimp  ------tt-t
                      Gorilla  ------tt-t
                    Orangutan  ------tt-t
                       Gibbon  ------tt-t
                       Rhesus  ------tt-t
          Crab-eating macaque  ------tt-t
                       Baboon  ------tt-t
                 Green monkey  ------tg-t
                     Marmoset  tttttttt-t
              Squirrel monkey  gtttgttt-t
                     Bushbaby  ------ttgc
           Chinese tree shrew  ------tt-t
                     Squirrel  ------tt-t
       Lesser Egyptian jerboa  ------tt-t
                 Prairie vole  ------tt-t
              Chinese hamster  ------tt-t
               Golden hamster  ------tt-t
                        Mouse  ------tt-c
                          Rat  ------tt-t
               Naked mole-rat  ------tt-t
                   Guinea pig  ------tt-t
                   Chinchilla  ------tt-t
             Brush-tailed rat  ------tt-t
                       Rabbit  ------tt-t
                         Pika  ------tt-t
                          Pig  ------tt-t
                       Alpaca  ------tt-t
               Bactrian camel  ------tt-t
                      Dolphin  ------at-t
                 Killer whale  ------at-t
             Tibetan antelope  ------at-t
                          Cow  ------at-t
                        Sheep  ------at-t
                Domestic goat  ------at-t
                        Horse  ------tt-t
             White rhinoceros  ------tt-t
                          Cat  ------tt-t
                          Dog  ----------
                      Ferret   -------t-t
                        Panda  -------t-t
               Pacific walrus  -------t-t
                 Weddell seal  -------t-g
             Black flying-fox  ------tt-t
                      Megabat  ------tt-t
                Big brown bat  ------tt-t
                     Hedgehog  ------ta-t
              Star-nosed mole  ------ta-t
                     Elephant  ------tt-t
          Cape elephant shrew  ------tt-a
                      Manatee  ------tt-t
             Cape golden mole  ------tt-t
                       Tenrec  ------tt-t
                     Aardvark  ------tt-t
                    Armadillo  ------tt-t
                      Opossum  -tctgctt-t
              Tasmanian devil  -tttgctt-t
                     Platypus  ----------
                        Shrew  ==========
                     Microbat  ==========
         David's myotis (bat)  ==========
                X. tropicalis  ==========
                       Lizard  ==========
     Chinese softshell turtle  ==========
               Painted turtle  ==========
              Green seaturtle  ==========
                       Turkey  ==========
                      Chicken  ==========
                 Mallard duck  ==========
                       Parrot  ==========
                   Budgerigar  ==========
           Tibetan ground jay  ==========
                  Zebra finch  ==========
          Medium ground finch  ==========
       White-throated sparrow  ==========
          Collared flycatcher  ==========
             Peregrine falcon  ==========
                 Saker falcon  ==========
                  Rock pigeon  ==========
                      Wallaby  ==========
           American alligator  ==========

Inserts between block 4 and 5 in window
          Chinese tree shrew 1bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1051bp
B D                 Hedgehog 2bp
             Star-nosed mole 2bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 1bp
B D                Armadillo 1bp
B D                  Opossum 11bp
B D          Tasmanian devil 11bp

Alignment block 5 of 38 in window, 131767000 - 131767017, 18 bps 
B D                     Human  tttaa---tgtt--------------taaatta--tt
B D                     Chimp  tttaa---tgtt--------------taaatta--tt
B D                   Gorilla  tttaa---tgtt--------------taaatta--tt
B D                 Orangutan  tttaa---tgtt--------------tacattg--tt
B D                    Gibbon  tttaa---tgtt--------------taaatta--tt
B D                    Rhesus  tttaa---tgtt--------------taaatta--tt
B D       Crab-eating macaque  tttaa---tgtt--------------taaatta--tt
B D                    Baboon  tttaa---tgtt--------------taaatta--tt
B D              Green monkey  tttaa---tgtt--------------tatatta--tt
B D                  Marmoset  tttta---agtt--------------taaatta--tt
B D           Squirrel monkey  tttaa---tgtt--------------taaatta--tt
B D                  Bushbaby  tttta---tttt--------------taaatta--gt
           Chinese tree shrew  tttta---tttc--------------taaattg--tt
B D                  Squirrel  ----a---tttt--------------taaatta--tt
       Lesser Egyptian jerboa  ----t---cttc--------------taaatca--tt
                 Prairie vole  ----g--ttttt--------------aaaatca--ct
B D           Chinese hamster  ----g---tttt--------------aaaatca--ct
               Golden hamster  ----g---tttt--------------aaaatca--ct
B D                     Mouse  ----a---tctt--------------aaaacta--tt
B D                       Rat  ----a---tctt--------------aaaatta--tt
B D            Naked mole-rat  ----a---tttt--------------taaataa--tt
B D                Guinea pig  ----a---tttt--------------taaatga--tt
                   Chinchilla  ----a---tttt--------------taaatga--tt
             Brush-tailed rat  ----a---tttt--------------taaagga--ct
B D                    Rabbit  tttta---cttt--------------taaatta--tt
B D                      Pika  --------ctct--------------taaatta--tt
B D                       Pig  tttta---tgtt--------------tatatta--tt
B D                    Alpaca  tttta---tttc--------------taaatta--tc
               Bactrian camel  ttttg---tttc--------------taaatta--tc
B D                   Dolphin  tttta---gttt--------------tatatta--gt
                 Killer whale  tttta---gttt--------------tatatta--gt
             Tibetan antelope  tttta---tttt--------------tctatta--tt
B D                       Cow  tttta---tttt--------------tctgtta--tt
B D                     Sheep  tttta---tttt--------------tctatta--tt
                Domestic goat  tttta---tttt--------------tctatta--tt
B D                     Horse  tttta---tttt--------------taaatta--tt
B D          White rhinoceros  tttta---tttt--------------taaatta--tt
B D                       Cat  tttta---tttt--------------taaatta--ct
B D                       Dog  attta---tttt--------------caaatta--tt
B D                   Ferret   ttcta---tttt--------------taaatta--tt
B D                     Panda  tttta---tttt--------------taaatta--tt
               Pacific walrus  tttta---tttt--------------ttaatta--tt
                 Weddell seal  tttta---tttt--------------ttaatta--tt
             Black flying-fox  tctta---cttt--------------taaatca--tt
B D                   Megabat  tctta---cttt--------------taaatta--tt
B D                  Hedgehog  -gtta----------------------aaacta--tc
              Star-nosed mole  -ttta--ttttt--------------taaatta--tt
B D                  Elephant  ttttt---tttt---------------tagtta--tt
          Cape elephant shrew  tttca---tttt---------------taatta--ct
B D                   Manatee  tttta---tttt--------------gtagtta--tt
             Cape golden mole  cttta---aaacaaaataaaacaaatttagtta--tt
B D                    Tenrec  tttta---tgcc--------------ttagata--aa
                     Aardvark  tttta---tgtt--------------ttagtta--tt
B D                 Armadillo  tttt----------------------gtaatta--tt
B D                   Opossum  -ttca---ttta--------------aaaaacaattt
B D           Tasmanian devil  -tttaatgtttt--------------ttttttaatgt
B D                  Platypus  tcaaa---tatt--------------catttta--gt
B D                     Shrew  =====================================
               Big brown bat  =====================================
B D                  Microbat  =====================================
        David's myotis (bat)  =====================================
B D             X. tropicalis  =====================================
B D                    Lizard  =====================================
  D  Chinese softshell turtle  =====================================
  D            Painted turtle  =====================================
  D           Green seaturtle  =====================================
B D                    Turkey  =====================================
B D                   Chicken  =====================================
  D              Mallard duck  =====================================
  D                    Parrot  =====================================
B D                Budgerigar  =====================================
          Tibetan ground jay  =====================================
B D               Zebra finch  =====================================
B D       Medium ground finch  =====================================
  D    White-throated sparrow  =====================================
  D       Collared flycatcher  =====================================
  D          Peregrine falcon  =====================================
  D              Saker falcon  =====================================
  D               Rock pigeon  =====================================
B D                   Wallaby  =====================================
B D        American alligator  =====================================

Alignment block 6 of 38 in window, 131767018 - 131767027, 10 bps 
B D                     Human  cac--------taa--tata
B D                     Chimp  cac--------taa--tata
B D                   Gorilla  cac--------taa--tata
B D                 Orangutan  cac--------taa--tata
B D                    Gibbon  cac--------taa--tata
B D                    Rhesus  cacttggttattca--tata
B D       Crab-eating macaque  cacttggttattca--tata
B D                    Baboon  cacttggttattca--tata
B D              Green monkey  cac--------taa--taga
B D                  Marmoset  cac--------tga--tata
B D           Squirrel monkey  cac--------taa--tata
B D                  Bushbaby  cac--------tta--tgtc
           Chinese tree shrew  cac-----------------
B D                  Squirrel  cac--------gaa--tctg
       Lesser Egyptian jerboa  cac--------tgg--tatg
                 Prairie vole  cac--------tag--tata
B D           Chinese hamster  cac--------tag--aatg
               Golden hamster  cac--------tag--catg
B D                     Mouse  cac--------tag--catg
B D                       Rat  cac--------tcg--cgtg
B D            Naked mole-rat  tgc--------gaa--tatg
B D                Guinea pig  tgc--------taa--catg
                   Chinchilla  tgc--------taa--cacg
             Brush-tailed rat  tgc--------tac--cacg
B D                    Rabbit  cac--------taa--tgcg
B D                      Pika  cat--------taa--cgca
B D                       Pig  cac--------tga--tgtg
B D                    Alpaca  cac--------tga--tggg
               Bactrian camel  cac--------tga--tggg
B D                   Dolphin  cac--------tga--tggg
                 Killer whale  cac--------tga--tggg
             Tibetan antelope  cac--------tga--tgtg
B D                       Cow  cac--------tga--tgtg
B D                     Sheep  cac--------tga--tgtg
                Domestic goat  cac--------tga--tatg
B D                     Horse  cac--------taa--tgtg
B D          White rhinoceros  cac--------taa--tgtg
B D                       Cat  aac--------taa--tgtg
B D                       Dog  aac--------taa--tgtg
B D                   Ferret   tac--------taa--tgtg
B D                     Panda  aac--------taa--tgta
               Pacific walrus  aac--------taa--tgtg
                 Weddell seal  aac--------gaa--tgtg
             Black flying-fox  cac--------taa--tgtg
B D                   Megabat  cac--------taa--tgtg
B D                  Hedgehog  cag--------gaa--tgtg
              Star-nosed mole  cac--------caa--tagg
B D                  Elephant  tag--------tac--catg
          Cape elephant shrew  tta--------acc--tgtg
B D                   Manatee  caa--------tcc--tgtg
             Cape golden mole  caa--------tac--tgtg
B D                    Tenrec  caa--------tat--tgtg
                     Aardvark  taa--------tac--tgca
B D                 Armadillo  ca-----------c--tgtt
B D                   Opossum  ctc--------taa--taca
B D           Tasmanian devil  ctc--------caaactgca
B D                     Shrew  ====================
               Big brown bat  ====================
B D                  Microbat  ====================
        David's myotis (bat)  ====================
B D             X. tropicalis  ====================
B D                    Lizard  ====================
  D  Chinese softshell turtle  ====================
  D            Painted turtle  ====================
  D           Green seaturtle  ====================
B D                    Turkey  ====================
B D                   Chicken  ====================
  D              Mallard duck  ====================
  D                    Parrot  ====================
B D                Budgerigar  ====================
          Tibetan ground jay  ====================
B D               Zebra finch  ====================
B D       Medium ground finch  ====================
  D    White-throated sparrow  ====================
  D       Collared flycatcher  ====================
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
  D               Rock pigeon  ====================
B D                  Platypus  ====================
B D                   Wallaby  ====================
B D        American alligator  ====================

Inserts between block 6 and 7 in window
B D                  Opossum 3100bp
B D          Tasmanian devil 8bp

Alignment block 7 of 38 in window, 131767028 - 131767031, 4 bps 
B D                     Human  acca
B D                     Chimp  acca
B D                   Gorilla  acca
B D                 Orangutan  agca
B D                    Gibbon  g-ca
B D                    Rhesus  acca
B D       Crab-eating macaque  acca
B D                    Baboon  acca
B D              Green monkey  acca
B D                  Marmoset  acca
B D           Squirrel monkey  acca
B D                  Bushbaby  acca
           Chinese tree shrew  --ca
B D                  Squirrel  atca
       Lesser Egyptian jerboa  atta
                 Prairie vole  atca
B D           Chinese hamster  atca
               Golden hamster  gtca
B D                     Mouse  acca
B D                       Rat  gcca
B D            Naked mole-rat  atca
B D                Guinea pig  atca
                   Chinchilla  atca
             Brush-tailed rat  atca
B D                    Rabbit  acca
B D                      Pika  acca
B D                       Pig  acca
B D                    Alpaca  gccg
               Bactrian camel  gccg
B D                   Dolphin  atcg
                 Killer whale  atcg
             Tibetan antelope  accg
B D                       Cow  acgg
B D                     Sheep  accg
                Domestic goat  accg
B D                     Horse  acca
B D          White rhinoceros  acca
B D                       Cat  atta
B D                       Dog  atta
B D                   Ferret   atta
B D                     Panda  atta
               Pacific walrus  atta
                 Weddell seal  atta
             Black flying-fox  acta
B D                   Megabat  acta
B D                  Hedgehog  atca
              Star-nosed mole  acca
B D                  Elephant  gcca
          Cape elephant shrew  acca
B D                   Manatee  acca
             Cape golden mole  acca
B D                    Tenrec  gc--
                     Aardvark  aaca
B D                 Armadillo  atca
B D           Tasmanian devil  ccca
B D                     Shrew  ====
               Big brown bat  ====
B D                  Microbat  ====
        David's myotis (bat)  ====
B D             X. tropicalis  ====
B D                    Lizard  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
  D                    Parrot  ====
B D                Budgerigar  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
  D       Collared flycatcher  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D               Rock pigeon  ====
B D                  Platypus  ====
B D                   Wallaby  ====
B D        American alligator  ====
B D                   Opossum  ====

Alignment block 8 of 38 in window, 131767032 - 131767084, 53 bps 
B D                     Human  ag-ta-aat-gt--c----agtt--aaatattt------------cagtcatct-ctctgtgtgtgtctg
B D                     Chimp  ag-ta-aat-gt--c----agtt--aactattt------------cagtcatct-ctctgtgtgtgtctg
B D                   Gorilla  ag-ta-aat-gt--c----agtt--aactattt------------cagtcatct-ctctgtgtgtgtctg
B D                 Orangutan  ag-ta-aat-gt--c----agtt--aactattt------------cagtcatct-ctctgtgtgtgtctg
B D                    Gibbon  ag-ta-aat-gt--c----agtt--aactattt------------cagtcatct-ctctgtgtgtgtctg
B D                    Rhesus  ag-ga-aaa-gt--c----agtt--aagtattt------------cagtcatct-ctctgtgtgtgtctg
B D       Crab-eating macaque  ag-ga-aaa-gt--c----agtt--aagtattt------------cagtcatct-ctctgtgtgtgtctg
B D                    Baboon  ag-ga-aaa-gt--c----agtt--aagtattt------------cagtcatct-ctctgtgtgtgtctg
B D              Green monkey  ag-ga-aaa-gt--c----agtt--aagtattt------------cagtcatct-ctctgtgtgtgtctg
B D                  Marmoset  ag-ta-aat-gt--c----agtt--aactattt------------cagtcctct-ctctgtgtgtgtctg
B D           Squirrel monkey  ag-ta-aat-gt--c----agtt--aactattt------------cagtcatct-ctctctgtgtgtctg
B D                  Bushbaby  ag-tg-aaa-at--c----aggt--aacgatcc------------aggtcagct-ttccagatgtgtttg
           Chinese tree shrew  agcca-aaa-at--c----agtc--agctactc------------aagccatct-ctct--atgtgtctt
B D                  Squirrel  ag-ta-gaa-gt--c----agtt--aactattc------------aagtcatct-ctctgtatgtgtttc
       Lesser Egyptian jerboa  ag-ca-gga-at--c----agtc--tactcctc------------aagccatgt-ctctgcc-attc-cc
                 Prairie vole  ag-ca-gaa-ca--c----tgta--aaccatcgcctctctgtaaaacatcgcct-cactgca-atgcttt
B D           Chinese hamster  ag-ta-gag-aa--c----tgta--agccattt------------acatcacct-ttctacg-atgcttt
               Golden hamster  at-ca-gaa-aa--c------ta--aaccattt------------acatcatct-ttctaca-atgcttt
B D                     Mouse  ag-ca-gta-aa--c----agta--gaccttgt------------ataacatct-ctttaca-acatttt
B D                       Rat  ag-ca-gta-aa--c----aata--aactttgt------------actccatct-ctttaca-attcttt
B D            Naked mole-rat  ag-ta-gaa-at--c----agtg--aactactc------------aagttatgg-ctctgta---tgttt
B D                Guinea pig  ag-ta-gaa-at--c----agtg--aacagttt------------gagttactg-ctctgtg---tgttt
                   Chinchilla  ag-ta-gaa-at--c----agta--aactattc------------aagttactg-ctctgta---tgttt
             Brush-tailed rat  ag-tg-gaa-a--------------------tc------------aagctactg-ctctgtg---tattt
B D                    Rabbit  ag-ag-gca-gg--c----agct--agctatgc------------gagtcatct-ttctgcacggggttt
B D                      Pika  ag-ag-aca-at--c----------agctattc------------aagtcgtct-ttctgtacgtgattt
B D                       Pig  ag-aa-ggagat--c----actt--agctagttt-----------atgtcatct-ctctgtatgtgtttt
B D                    Alpaca  ag-aa-gga-at--c----a------attcattt-----------gtgtcatct-ctctgtgtgtgtttt
               Bactrian camel  ag-aa-gga-at--c----a------attcgttt-----------gtgtcgcct-ctctgtatgtgtttt
B D                   Dolphin  ag-aa-gga-at--c----actt--cattagttc-----------gtgtca--t-ctctg----tgtttt
                 Killer whale  ag-aa-gga-gt--c----actt--cattagttc-----------gtgtca--t-ctctg----tgtttt
             Tibetan antelope  ag-at-gga-at--c----actt--aattagttt-----------atatca--t-ctctgta--tgtttt
B D                       Cow  ag-at-gga-at--c----cctt--aatt-gttt-----------atggcatct-ctctgta--tgtttt
B D                     Sheep  ag-at-gga-at--c----actt--aattagttt-----------atatca--t-ctctgta--tgtttt
                Domestic goat  ag-at-gga-at--c----actt--aattagtgt-----------atatca--t-ctctgta--tgtttt
B D                     Horse  ag-ta-gga-at--c----actt--agctatttt-----------atgtcatct-ctctgcatatgtttt
B D          White rhinoceros  gg-ta-gga-at--c----attt--aactatttc-----------atgtcatct-ctctgcatatatttt
B D                       Cat  ag-tt-aga-at--t----actt-----tattgt-----------gtgtcatca-ctctatatgtatttt
B D                       Dog  ac-ta-gaa-atcac----act------------------------------------tgtatgtatttt
B D                   Ferret   aa-ta-gaa-at--c----act------------------------------------ggtatgtgtttt
B D                     Panda  ag-ta-gaa-at--c----act------------------------------------tgtatgtatttt
               Pacific walrus  ag-ta-gaa-at--c----act------------------------------------tgtatgta-ttt
                 Weddell seal  ag-ta-gaa-at--c----act------------------------------------tgtatgta-ttt
             Black flying-fox  ag-ta-aga-at--c----actt--gattattgt-----------atgtcctct-ctctgtatgtgtttt
B D                   Megabat  ag-ta-aga-at--c----actt--gattattgt-----------atgtcctct-ctctgtatgtgtttt
B D                  Hedgehog  ag-ta-gga-at--t----gctt--aattatttt-----------atgtcatca-ctgtgtgtgtgtgtg
              Star-nosed mole  ag-ta-ggg-gc--c----actt--aactatctt-----------atgtcattt-ccctgtgtgtatttc
B D                  Elephant  ag-cc-aga-at--cacttactt--aaatatttc-----------aaggccttt-ctctgtatgtgttct
          Cape elephant shrew  ag-tt-aaa-gt--c-----ctt--gaatatttt-----------gaagcacct-c----tgtgtgtttt
B D                   Manatee  ag-cc-aga-at--cgctcgctt--aaatatttc-----------aaggcctct-ctctgtatatatttt
             Cape golden mole  ag-tc-aaa-at--cacttactt--aaatatttc-----------aagatatct-c--tctgtatgtttt
B D                    Tenrec  --------------aactta-tt--aaatttccc-----------aagagactt-c--tgcatttgtttt
                     Aardvark  gt-tt-gga-at--agtgtactt--aaatatctc-----------actgcatct-ttctttatgtgtttt
B D                 Armadillo  ag-taggga-at--cactgattt--aaatattcc-----------aagtcctct-c--tgcatgtgtttt
B D                   Opossum  ---ac-cca-tt--t----tcttaatatttttcc-----------aatttatgtgttccctattttctgg
B D           Tasmanian devil  ---aa-caa-ag--t----gctt--tgctatttc-----------agtcctccttctcctaatttgatag
B D                     Shrew  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================

                        Human  -----------cttttgt
                        Chimp  -----------cttttgt
                      Gorilla  -----------cttttgt
                    Orangutan  -----------cttttgt
                       Gibbon  -----------cttttgt
                       Rhesus  -----------cttttgt
          Crab-eating macaque  -----------cttttgt
                       Baboon  -----------cttttgt
                 Green monkey  -----------cttttgt
                     Marmoset  -----------cttttgt
              Squirrel monkey  -----------cttttgt
                     Bushbaby  -----------cttctgt
           Chinese tree shrew  -----------ctttcaa
                     Squirrel  -----------cttttgt
       Lesser Egyptian jerboa  -----------cttttgt
                 Prairie vole  -----------cttttat
              Chinese hamster  -----------cctttgt
               Golden hamster  -----------cttgtgc
                        Mouse  -----------cttttgt
                          Rat  -----------cttttgt
               Naked mole-rat  -----------cttttgt
                   Guinea pig  -----------cttctgt
                   Chinchilla  -----------cttttgt
             Brush-tailed rat  -----------cttttgt
                       Rabbit  -----------cttttgt
                         Pika  -----------cttttgt
                          Pig  -----------cttttac
                       Alpaca  -----------cttctac
               Bactrian camel  -----------cttttac
                      Dolphin  -----------cttttat
                 Killer whale  -----------cttttat
             Tibetan antelope  -----------cttttac
                          Cow  -----------cttttac
                        Sheep  -----------cttttac
                Domestic goat  -----------cttttac
                        Horse  -----------cttttgt
             White rhinoceros  -----------cttttgt
                          Cat  -----------attttgt
                          Dog  -----------cttttgt
                      Ferret   -----------cttttct
                        Panda  -----------cttttgg
               Pacific walrus  -----------cttttgt
                 Weddell seal  -----------cttttgt
             Black flying-fox  -----------cttttgt
                      Megabat  -----------cttttgt
                     Hedgehog  -----------tgtgtgt
              Star-nosed mole  -----------tgttgg-
                     Elephant  -----------cttttgt
          Cape elephant shrew  -----------ctttcca
                      Manatee  -----------cttttgc
             Cape golden mole  -----------cttttat
                       Tenrec  -----------cttctgt
                     Aardvark  -----------cttttgt
                    Armadillo  -----------cttttat
                      Opossum  catttccactttttttg-
              Tasmanian devil  -----------tttttg-
                        Shrew  ==================
                Big brown bat  ==================
                     Microbat  ==================
         David's myotis (bat)  ==================
                X. tropicalis  ==================
                       Lizard  ==================
     Chinese softshell turtle  ==================
               Painted turtle  ==================
              Green seaturtle  ==================
                       Turkey  ==================
                      Chicken  ==================
                 Mallard duck  ==================
                       Parrot  ==================
                   Budgerigar  ==================
           Tibetan ground jay  ==================
                  Zebra finch  ==================
          Medium ground finch  ==================
       White-throated sparrow  ==================
          Collared flycatcher  ==================
             Peregrine falcon  ==================
                 Saker falcon  ==================
                  Rock pigeon  ==================
                     Platypus  ==================
                      Wallaby  ==================
           American alligator  ==================

Inserts between block 8 and 9 in window
B D                 Hedgehog 2964bp

Alignment block 9 of 38 in window, 131767085 - 131767106, 22 bps 
B D                     Human  accta-gaac-t------ctgga----c--aaggca
B D                     Chimp  accta-gaac-t------ctgga----c--aaggca
B D                   Gorilla  accta-gaac-t------ctgga----c--aaggca
B D                 Orangutan  accta-gaactt------cggga----c--aaggca
B D                    Gibbon  accta-gaactt------ctgga----c--aaggca
B D                    Rhesus  accta-gaac-t------ctgga----c--taggca
B D       Crab-eating macaque  accta-gaac-t------ctgga----c--aaggca
B D                    Baboon  accta-gaac-t------ctgga----c--aaggca
B D              Green monkey  accta-gaac-t------ctgga----c--aaggca
B D                  Marmoset  gccta-ggaa-a------ctgga----c--aaggc-
B D           Squirrel monkey  accta-gaac-c------ctgga----c--aaggc-
B D                  Bushbaby  actca-gagc-t------atgag----c--aagat-
           Chinese tree shrew  accca-gaac-t------gtgga----c--aaggc-
B D                  Squirrel  atcca-gaac-t------atgaa----c--aaggt-
       Lesser Egyptian jerboa  atcta-gaga-t------ataag----t--aaagc-
                 Prairie vole  accc--gaac-t------gtggg----t--aaagg-
B D           Chinese hamster  atcca-gaac-t------atgag----ttaaagag-
               Golden hamster  atcca-gaac-t------atgag----c--aggag-
B D                     Mouse  gtcca-gaat---------tgag----t--aagat-
B D                       Rat  gccca-gaat---------tgag----t--aagat-
B D            Naked mole-rat  acctgggaac-t------atgga----c--aagac-
B D                Guinea pig  acctgggaac-c------atgga----c--acagc-
                   Chinchilla  aacgaggaag-t------atgga----c--acgac-
             Brush-tailed rat  acctgggagc-t------acagg----c--aggac-
B D                    Rabbit  acctg-gacc-tgcgggcatggg----c--gtggt-
B D                      Pika  acctg-ggac-tgtggacatggg----c--gtggc-
B D                       Pig  atccg-gaac-t------gtgag----c--aagga-
B D                    Alpaca  atctt-caac-a------atggg----c--aggg--
               Bactrian camel  gtctt-gaac-a------atggg----c--aggg--
B D                   Dolphin  agcca-gaactt------gtagg----c--aagga-
                 Killer whale  agcca-gaactt------gtagg----c--aagga-
             Tibetan antelope  atcca-gaac-t------atagg----t--aagga-
B D                       Cow  atcca-gacc-t------atagg----t--aagga-
B D                     Sheep  atcca-gaac-t------acagg----t--aagga-
                Domestic goat  atcca-gaac-t------atagg----t--aagga-
B D                     Horse  gcgca-caac-t------acagg----g--acggt-
B D          White rhinoceros  atgca-gaac-t------acggg----c--aaggc-
B D                       Cat  gctga-gaac-t------ataag----c--aaggc-
B D                       Dog  gctgg-gaac-t------acagg----c--aaggc-
B D                   Ferret   gctga-gagc-t------acagg----c--aaggc-
B D                     Panda  gctgg-gaac-t------acagg----c--aaggc-
               Pacific walrus  gctgg-gaac-t------acagc----c--aaggc-
                 Weddell seal  gctgg-aaac-t------acagc----c--aaggc-
             Black flying-fox  accta-gaat-t------atggg----t--aagat-
B D                   Megabat  accta-gaat-t------atggg----t--aagat-
              Star-nosed mole  tctct-gagc-t------ataga----g--aaaac-
B D                  Elephant  gccta-aaac-t------atgag----c--aaggt-
          Cape elephant shrew  acctc-caac-t------atgag----t--gaggc-
B D                   Manatee  gccta-aaac-t------atgag----c--gaggt-
             Cape golden mole  accta-aaac-t------atgaa----t--aatgt-
B D                    Tenrec  gcctg-aagc-t------ctcag----g--gaggt-
                     Aardvark  gccta-aaac-t------atgag----c--aaggt-
B D                 Armadillo  gccca-gaat-t------ttgga----t--gaagc-
B D                   Opossum  accat-tact-t------ctagaatctc--a-----
B D           Tasmanian devil  acgat-tacc-t------ctaa-----c--a-----
B D                  Hedgehog  ====================================
B D                     Shrew  ====================================
               Big brown bat  ====================================
B D                  Microbat  ====================================
        David's myotis (bat)  ====================================
B D             X. tropicalis  ====================================
B D                    Lizard  ====================================
  D  Chinese softshell turtle  ====================================
  D            Painted turtle  ====================================
  D           Green seaturtle  ====================================
B D                    Turkey  ====================================
B D                   Chicken  ====================================
  D              Mallard duck  ====================================
  D                    Parrot  ====================================
B D                Budgerigar  ====================================
          Tibetan ground jay  ====================================
B D               Zebra finch  ====================================
B D       Medium ground finch  ====================================
  D    White-throated sparrow  ====================================
  D       Collared flycatcher  ====================================
  D          Peregrine falcon  ====================================
  D              Saker falcon  ====================================
  D               Rock pigeon  ====================================
B D                  Platypus  ====================================
B D                   Wallaby  ====================================
B D        American alligator  ====================================

Inserts between block 9 and 10 in window
B D                      Pig 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
             Star-nosed mole 1bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 10 of 38 in window, 131767107 - 131767112, 6 bps 
B D                     Human  gtaag-t----
B D                     Chimp  ataag-t----
B D                   Gorilla  gtaag-t----
B D                 Orangutan  gtaag-t----
B D                    Gibbon  gtaag-c----
B D                    Rhesus  gtaag-t----
B D       Crab-eating macaque  gtaag-t----
B D                    Baboon  gtaag-t----
B D              Green monkey  gtgag-t----
B D                  Marmoset  ---ag-t----
B D           Squirrel monkey  ---ag-t----
B D                  Bushbaby  ---gg-c----
B D                  Squirrel  ---aa-t----
       Lesser Egyptian jerboa  ---ag-t----
B D           Chinese hamster  ---ag-t----
               Golden hamster  ---ag-t----
B D                     Mouse  ---ag-t----
B D                       Rat  ---gg-t----
B D            Naked mole-rat  ---ag-t----
B D                Guinea pig  ---ag-t----
                   Chinchilla  ---ag-t----
             Brush-tailed rat  ---ag-t----
B D                    Rabbit  ---agtt----
B D                      Pika  ---gg-t----
B D                       Pig  ----a-t----
B D                    Alpaca  ----a-t----
               Bactrian camel  ----a-t----
B D                   Dolphin  ----a-t----
                 Killer whale  ----a-t----
             Tibetan antelope  ----a-t----
B D                       Cow  ----a-t----
B D                     Sheep  ----a-t----
                Domestic goat  ----a-t----
B D                     Horse  ----a-t----
B D          White rhinoceros  ----a-t----
B D                       Cat  ----a-t----
B D                       Dog  ----g-t----
B D                   Ferret   ----g-t----
B D                     Panda  ----g-t----
               Pacific walrus  ----g-t----
                 Weddell seal  ----g-t----
             Black flying-fox  ----a-c----
B D                   Megabat  ----a-c----
B D                  Elephant  ----a-t----
          Cape elephant shrew  ----g-t----
B D                   Manatee  ----a-t----
             Cape golden mole  ----c-t----
B D                    Tenrec  ----g-t----
                     Aardvark  ----t-t----
B D                 Armadillo  ----g-t----
B D                   Opossum  ----g-taaca
B D           Tasmanian devil  ----g-tgcaa
             Star-nosed mole  ===========
B D                  Hedgehog  ===========
B D                     Shrew  ===========
                Prairie vole  -----------
               Big brown bat  ===========
B D                  Microbat  ===========
        David's myotis (bat)  ===========
          Chinese tree shrew  -----------
B D             X. tropicalis  ===========
B D                    Lizard  ===========
  D  Chinese softshell turtle  ===========
  D            Painted turtle  ===========
  D           Green seaturtle  ===========
B D                    Turkey  ===========
B D                   Chicken  ===========
  D              Mallard duck  ===========
  D                    Parrot  ===========
B D                Budgerigar  ===========
          Tibetan ground jay  ===========
B D               Zebra finch  ===========
B D       Medium ground finch  ===========
  D    White-throated sparrow  ===========
  D       Collared flycatcher  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
  D               Rock pigeon  ===========
B D                  Platypus  ===========
B D                   Wallaby  ===========
B D        American alligator  ===========

Inserts between block 10 and 11 in window
B D                 Elephant 4bp
         Cape elephant shrew 4bp
B D                  Manatee 4bp
            Cape golden mole 4bp
B D                   Tenrec 452bp
                    Aardvark 4bp

Alignment block 11 of 38 in window, 131767113 - 131767116, 4 bps 
B D                     Human  aagt------------
B D                     Chimp  aagt------------
B D                   Gorilla  aagt------------
B D                 Orangutan  aagt------------
B D                    Gibbon  aagt------------
B D                    Rhesus  aagt------------
B D       Crab-eating macaque  aagt------------
B D                    Baboon  aagt------------
B D              Green monkey  aagt------------
B D                  Marmoset  cagt------------
B D           Squirrel monkey  cagt------------
B D                  Bushbaby  gact------------
           Chinese tree shrew  -agt------------
B D                  Squirrel  aagt------------
B D           Chinese hamster  gatt------------
               Golden hamster  gagt------------
B D                     Mouse  aggt------------
B D                       Rat  aagt------------
B D            Naked mole-rat  aaat------------
B D                Guinea pig  aaac------------
                   Chinchilla  aaat------------
             Brush-tailed rat  aagt------------
B D                    Rabbit  gagt------------
B D                      Pika  aagt------------
B D                       Pig  aaac------------
B D                    Alpaca  gaat------------
               Bactrian camel  gaat------------
B D                   Dolphin  aact------------
                 Killer whale  aact------------
             Tibetan antelope  aaaa------------
B D                       Cow  aaat------------
B D                     Sheep  aaat------------
                Domestic goat  aaat------------
B D                     Horse  aaag------------
B D          White rhinoceros  taat------------
B D                       Cat  aaat------------
B D                       Dog  aaat------------
B D                   Ferret   aaat------------
B D                     Panda  aaat------------
               Pacific walrus  aagt------------
                 Weddell seal  aaat------------
             Black flying-fox  -aat------------
B D                   Megabat  -aat------------
B D                 Armadillo  aaat------------
B D                   Opossum  -aa-----------gg
B D           Tasmanian devil  -aatattccagggcag
             Star-nosed mole  ================
         Cape elephant shrew  ================
B D                  Hedgehog  ================
B D                     Shrew  ================
                Prairie vole  ----------------
      Lesser Egyptian jerboa  ----------------
B D                    Tenrec  ================
               Big brown bat  ================
B D                  Microbat  ================
        David's myotis (bat)  ================
B D                   Manatee  ================
B D                  Elephant  ================
B D             X. tropicalis  ================
B D                    Lizard  ================
  D  Chinese softshell turtle  ================
  D            Painted turtle  ================
  D           Green seaturtle  ================
B D                    Turkey  ================
B D                   Chicken  ================
  D              Mallard duck  ================
  D                    Parrot  ================
B D                Budgerigar  ================
          Tibetan ground jay  ================
B D               Zebra finch  ================
B D       Medium ground finch  ================
  D    White-throated sparrow  ================
  D       Collared flycatcher  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
  D               Rock pigeon  ================
B D                  Platypus  ================
B D                   Wallaby  ================
B D        American alligator  ================
            Cape golden mole  ================
                    Aardvark  ================

Inserts between block 11 and 12 in window
B D                  Opossum 3bp
B D          Tasmanian devil 1741bp

Alignment block 12 of 38 in window, 131767117 - 131767135, 19 bps 
B D                     Human  ctcatgtaaggatcaac-ag
B D                     Chimp  c--atgtaaggatcaac-ag
B D                   Gorilla  ctcatgtaaggaccaac-ag
B D                 Orangutan  ctcatgtaaggatcaac-ag
B D                    Gibbon  ctcatgtaaggatcaac-ag
B D                    Rhesus  ctcatgtaaggatcaac-aa
B D       Crab-eating macaque  ctcatgtaaggatcaac-aa
B D                    Baboon  ctcatgtaaggatcaac-aa
B D              Green monkey  ctcacgtaaggatctac-aa
B D                  Marmoset  ctcacataagggtcaac-aa
B D           Squirrel monkey  ctcatgaaagggtcagc-aa
B D                  Bushbaby  attatctaagggttagc-aa
           Chinese tree shrew  ttcatg-ggggcttatc-ca
B D                  Squirrel  attatgtaaaggttaacaag
       Lesser Egyptian jerboa  atcatgtaaagatcaac-ag
                 Prairie vole  ccagggtgaaggccaat-ag
B D           Chinese hamster  acagtgtgaagactgat-ag
               Golden hamster  atagtgtgaagactaat-ag
B D                     Mouse  cccatgggaagcctcat-ag
B D                       Rat  cccatgggaaggctcct-ag
B D            Naked mole-rat  atcatgtaatggttagc-aa
B D                Guinea pig  ctcacttaaagtcgaac-ag
                   Chinchilla  atcatttaaatgttaac-ga
             Brush-tailed rat  gtcgcgtaaa-gctacc-ag
B D                    Rabbit  ctcatagaagggttggg-gc
B D                      Pika  cccatggaaggtttatc-gc
B D                       Pig  atcacataagggttaag-ga
B D                    Alpaca  atcacacaaggactaat-aa
               Bactrian camel  atcacacaaggactaat-aa
B D                   Dolphin  atcacataagggttaat-aa
                 Killer whale  atcacataagggttaat-aa
             Tibetan antelope  gtcacataaaggttaat-aa
B D                       Cow  gtcacataaaggttaat-aa
B D                     Sheep  gtcacataaaggttaat-aa
                Domestic goat  gtcacataaaggttaat-aa
B D                     Horse  attatggaagggtcaac-ag
B D          White rhinoceros  accatggaagtgtcaac-aa
B D                       Cat  atcatgtaagggttaac-aa
B D                       Dog  cacatgtaagggttaac-aa
B D                   Ferret   aatatgcaagggttaac-aa
B D                     Panda  agtatgtaagggtaaaa-aa
               Pacific walrus  aatatgtaaggattagc-aa
                 Weddell seal  aatatgtaagggttaac-aa
             Black flying-fox  attatataagggttaat-aa
B D                   Megabat  attatataagggttaat-aa
B D                  Elephant  accctataaatgt-atc-aa
          Cape elephant shrew  atcctgtatgtgt-atc-aa
B D                   Manatee  atcccgtaagggt-atc-ag
             Cape golden mole  atcttgtaagcgt-atc-ag
                     Aardvark  atcctgaaaagat-atc-aa
B D                 Armadillo  ttcaggccaaatt-aac-aa
B D                   Opossum  tttttttaagggacagc-ta
             Star-nosed mole  ====================
B D                  Hedgehog  ====================
B D                     Shrew  ====================
B D                    Tenrec  ====================
               Big brown bat  ====================
B D                  Microbat  ====================
        David's myotis (bat)  ====================
B D             X. tropicalis  ====================
B D                    Lizard  ====================
  D  Chinese softshell turtle  ====================
  D            Painted turtle  ====================
  D           Green seaturtle  ====================
B D                    Turkey  ====================
B D                   Chicken  ====================
  D              Mallard duck  ====================
  D                    Parrot  ====================
B D                Budgerigar  ====================
          Tibetan ground jay  ====================
B D               Zebra finch  ====================
B D       Medium ground finch  ====================
  D    White-throated sparrow  ====================
  D       Collared flycatcher  ====================
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
  D               Rock pigeon  ====================
B D                  Platypus  ====================
B D                   Wallaby  ====================
B D        American alligator  ====================
B D           Tasmanian devil  ====================

Inserts between block 12 and 13 in window
B D                 Squirrel 17bp
      Lesser Egyptian jerboa 15bp
                Prairie vole 15bp
B D          Chinese hamster 15bp
              Golden hamster 15bp
B D                    Mouse 12bp
B D                      Rat 15bp
            Brush-tailed rat 584bp
B D                     Pika 1bp

Alignment block 13 of 38 in window, 131767136 - 131767148, 13 bps 
B D                     Human  ttcaggct------c----------------------------cag---a
B D                     Chimp  ttcaggct------c----------------------------cag---a
B D                   Gorilla  ttcaggct------c----------------------------cag---a
B D                 Orangutan  ttcaggct------c----------------------------cag---a
B D                    Gibbon  ttcaggct------c----------------------------cag---a
B D                    Rhesus  ttcaggct------c----------------------------cag---a
B D       Crab-eating macaque  ttcaggct------c----------------------------cag---a
B D                    Baboon  ttcaggct------c----------------------------cag---a
B D              Green monkey  ttcaggct------c----------------------------cag---a
B D                  Marmoset  ttcaggct------c----------------------------cag---a
B D           Squirrel monkey  ttcaggct------c----------------------------cag---a
B D                  Bushbaby  tccagcct------ctggaatcagttggcctgggttcctatctcag---c
           Chinese tree shrew  ttcaggct------ctgggattggtcagcctggaccctatct-cag---c
B D                  Squirrel  -------a------t----------------------------tgg---g
       Lesser Egyptian jerboa  -------c------c----------------------------tag---a
                 Prairie vole  -------c------c----------------------------tgg---a
B D           Chinese hamster  -------c------c----------------------------tgg---a
               Golden hamster  -------t------c----------------------------tgg---a
B D                     Mouse  -------------------------------------------------a
B D                       Rat  -------a------c----------------------------tggaaga
B D            Naked mole-rat  --taggct------c----------------------------cag---a
B D                Guinea pig  --ta-gct------c----------------------------cag---a
                   Chinchilla  --tacgct------t----------------------------cag---a
B D                    Rabbit  -------t------c----------------------------cag---g
B D                      Pika  -------t------t----------------------------tag---g
B D                       Pig  ttcaagatgtgttaa----------------------------cag---a
B D                    Alpaca  ttcagtcc------c----------------------------ctg---a
               Bactrian camel  ttcagtcc------c----------------------------ctg---a
B D                   Dolphin  ctcaagct------c----------------------------cga---a
                 Killer whale  ctcaagct------c----------------------------cga---a
             Tibetan antelope  ttcaagct------c----------------------------cag---a
B D                       Cow  ttcaagct------c----------------------------cag---a
B D                     Sheep  ttcaagct------c----------------------------cag---a
                Domestic goat  ttcaagct------c----------------------------cag---a
B D                     Horse  tccagagt------c----------------------------cag---a
B D          White rhinoceros  ttcagagt------c----------------------------cag---a
B D                       Cat  ttcaacgt------c----------------------------cag---a
B D                       Dog  ttcaagtt------c----------------------------cag---g
B D                   Ferret   ttcaaact------c----------------------------tag---a
B D                     Panda  ttcaagct------c----------------------------cag---a
               Pacific walrus  ttcaagct------c----------------------------cag---a
                 Weddell seal  ttcaggct------c----------------------------cag---a
             Black flying-fox  ttcagact------c----------------------------cag---a
B D                   Megabat  ttcagact------c----------------------------cag---a
B D                  Elephant  ttcaagct------c----------------------------tag---a
          Cape elephant shrew  ttcaagcc------c----------------------------tac---a
B D                   Manatee  ttcaagct------c----------------------------tgg---a
             Cape golden mole  ttcaagtt------c----------------------------cag---a
                     Aardvark  ttaaagct------c----------------------------tag---a
B D                 Armadillo  ttcggtct------a----------------------------cag---a
B D                   Opossum  ccctgttt------t----------------------------tac---c
             Star-nosed mole  ==================================================
B D                  Hedgehog  ==================================================
B D                     Shrew  ==================================================
B D                    Tenrec  ==================================================
            Brush-tailed rat  ==================================================
               Big brown bat  ==================================================
B D                  Microbat  ==================================================
        David's myotis (bat)  ==================================================
B D             X. tropicalis  ==================================================
B D                    Lizard  ==================================================
  D  Chinese softshell turtle  ==================================================
  D            Painted turtle  ==================================================
  D           Green seaturtle  ==================================================
B D                    Turkey  ==================================================
B D                   Chicken  ==================================================
  D              Mallard duck  ==================================================
  D                    Parrot  ==================================================
B D                Budgerigar  ==================================================
          Tibetan ground jay  ==================================================
B D               Zebra finch  ==================================================
B D       Medium ground finch  ==================================================
  D    White-throated sparrow  ==================================================
  D       Collared flycatcher  ==================================================
  D          Peregrine falcon  ==================================================
  D              Saker falcon  ==================================================
  D               Rock pigeon  ==================================================
B D                  Platypus  ==================================================
B D                   Wallaby  ==================================================
B D        American alligator  ==================================================
B D           Tasmanian devil  ==================================================

Inserts between block 13 and 14 in window
B D                 Elephant 35bp
         Cape elephant shrew 35bp
B D                  Manatee 336bp
            Cape golden mole 2196bp
                    Aardvark 35bp
B D                Armadillo 30bp

Alignment block 14 of 38 in window, 131767149 - 131767151, 3 bps 
B D                     Human  ttc
B D                     Chimp  ttc
B D                   Gorilla  ttc
B D                 Orangutan  ttc
B D                    Gibbon  ttc
B D                    Rhesus  ttc
B D       Crab-eating macaque  ttc
B D                    Baboon  ttc
B D              Green monkey  ttc
B D                  Marmoset  ttc
B D           Squirrel monkey  ttc
B D                  Bushbaby  ttc
           Chinese tree shrew  ttt
B D                  Squirrel  ttg
       Lesser Egyptian jerboa  ttc
                 Prairie vole  ttc
B D           Chinese hamster  tcc
               Golden hamster  ttt
B D                     Mouse  ttc
B D                       Rat  ttc
B D            Naked mole-rat  atc
B D                Guinea pig  atc
                   Chinchilla  atc
B D                    Rabbit  gtc
B D                      Pika  atc
B D                       Pig  atc
B D                    Alpaca  gtc
               Bactrian camel  gtc
B D                   Dolphin  atc
                 Killer whale  atc
             Tibetan antelope  atc
B D                       Cow  atc
B D                     Sheep  atc
                Domestic goat  atc
B D                     Horse  atc
B D          White rhinoceros  atc
B D                       Cat  atc
B D                       Dog  atc
B D                   Ferret   atc
B D                     Panda  atc
               Pacific walrus  atc
                 Weddell seal  atc
             Black flying-fox  atc
B D                   Megabat  atc
B D                  Elephant  cta
          Cape elephant shrew  agc
                     Aardvark  gaa
B D                 Armadillo  ttc
B D                   Opossum  tgc
             Star-nosed mole  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                    Tenrec  ===
            Brush-tailed rat  ===
               Big brown bat  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
B D                   Manatee  ===
B D             X. tropicalis  ===
B D                    Lizard  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
  D                    Parrot  ===
B D                Budgerigar  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
  D       Collared flycatcher  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D                  Platypus  ===
B D                   Wallaby  ===
B D        American alligator  ===
B D           Tasmanian devil  ===
            Cape golden mole  ===

Inserts between block 14 and 15 in window
B D                 Squirrel 13bp
      Lesser Egyptian jerboa 13bp
                Prairie vole 13bp
B D          Chinese hamster 13bp
              Golden hamster 13bp
B D                    Mouse 13bp
B D                      Rat 13bp
B D           Naked mole-rat 603bp
B D               Guinea pig 570bp
                  Chinchilla 618bp
B D                   Rabbit 6bp
B D                     Pika 6bp
B D                      Pig 6bp
B D                   Alpaca 6bp
              Bactrian camel 6bp
B D                  Dolphin 6bp
                Killer whale 6bp
            Tibetan antelope 6bp
B D                      Cow 6bp
B D                    Sheep 6bp
               Domestic goat 6bp
B D                    Horse 23bp
B D         White rhinoceros 7bp
B D                      Cat 7bp
B D                      Dog 7bp
B D                  Ferret  7bp
B D                    Panda 7bp
              Pacific walrus 7bp
                Weddell seal 7bp
            Black flying-fox 7bp
B D                  Megabat 7bp

Alignment block 15 of 38 in window, 131767152 - 131767166, 15 bps 
B D                     Human  ccgatttactaaa--tt----
B D                     Chimp  ccgatttactaaa--tt----
B D                   Gorilla  ccgatttactaaa--tt----
B D                 Orangutan  ccgatttactaaa--tt----
B D                    Gibbon  ccgatttactaaa--tt----
B D                    Rhesus  ctgatttactaaa--tt----
B D       Crab-eating macaque  ctgatttactaaa--tt----
B D                    Baboon  ctgatttactaaa--tt----
B D              Green monkey  ctgatttactaaatttt----
B D                  Marmoset  ctgatttactgaa--tt----
B D           Squirrel monkey  ctgatttactgaa--tt----
B D                  Bushbaby  ctggtatactaag--ct----
           Chinese tree shrew  ttgattcactagg--tg----
B D                  Squirrel  ctgatttacttag--tg----
       Lesser Egyptian jerboa  ctgggttactaag--tg----
                 Prairie vole  ctagtttgctgag--tg----
B D           Chinese hamster  ct-gtttgctgag--ta----
               Golden hamster  ct-gtttgctgag--ta----
B D                     Mouse  tg-gtttgctgaa--ta----
B D                       Rat  tg-gtttgctgaa--ta----
B D                    Rabbit  atgacttactagg--ca----
B D                      Pika  ctgatttactaag--ca----
B D                       Pig  ctggactcctaag--at----
B D                    Alpaca  ctgggctcctagc--ct----
               Bactrian camel  ctgggctcctagc--ct----
B D                   Dolphin  ccaggctcctagt--ct----
                 Killer whale  ccaggctcctagt--ct----
             Tibetan antelope  ttgaactcctaat--ct----
B D                       Cow  ttgagctcctaat--ct----
B D                     Sheep  ttgagctcctaat--ct----
                Domestic goat  ttgagctcctaat--tt----
B D          White rhinoceros  ctgggctcc--at--ct----
B D                       Cat  ctgggctcctaat--ct----
B D                       Dog  ctgggttcctaat--ct----
B D                   Ferret   ctgggctcctaat--ct----
B D                     Panda  ctgggctcctaat--ct----
               Pacific walrus  ctgggctcctaat--ct----
                 Weddell seal  ct-ggctcctaat--ct----
             Black flying-fox  ctggactcctaat--ct----
B D                   Megabat  ctggactcctaat--ct----
B D                  Elephant  cttatttactaag--tg----
          Cape elephant shrew  cttatttactcaa--tg----
                     Aardvark  tttatttactaag--tg----
B D                 Armadillo  cctatttacgaaa--tt----
B D                   Opossum  ----cctataaag--tatatc
             Star-nosed mole  =====================
B D                  Hedgehog  =====================
B D                     Shrew  =====================
B D                    Tenrec  =====================
            Brush-tailed rat  =====================
                  Chinchilla  =====================
B D                Guinea pig  =====================
               Big brown bat  =====================
B D                  Microbat  =====================
        David's myotis (bat)  =====================
B D                   Manatee  =====================
B D                     Horse  =====================
B D            Naked mole-rat  =====================
B D             X. tropicalis  =====================
B D                    Lizard  =====================
  D  Chinese softshell turtle  =====================
  D            Painted turtle  =====================
  D           Green seaturtle  =====================
B D                    Turkey  =====================
B D                   Chicken  =====================
  D              Mallard duck  =====================
  D                    Parrot  =====================
B D                Budgerigar  =====================
          Tibetan ground jay  =====================
B D               Zebra finch  =====================
B D       Medium ground finch  =====================
  D    White-throated sparrow  =====================
  D       Collared flycatcher  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
  D               Rock pigeon  =====================
B D                  Platypus  =====================
B D                   Wallaby  =====================
B D        American alligator  =====================
B D           Tasmanian devil  =====================
            Cape golden mole  =====================

Inserts between block 15 and 16 in window
B D                      Pig 3bp
B D                   Alpaca 3bp
              Bactrian camel 3bp
B D                  Dolphin 3bp
                Killer whale 3bp
            Tibetan antelope 3bp
B D                      Cow 3bp
B D                    Sheep 3bp
               Domestic goat 3bp
B D         White rhinoceros 4bp
B D                      Cat 3bp
B D                      Dog 3bp
B D                  Ferret  3bp
B D                    Panda 3bp
              Pacific walrus 3bp
                Weddell seal 3bp
            Black flying-fox 3bp
B D                  Megabat 3bp

Alignment block 16 of 38 in window, 131767167 - 131767170, 4 bps 
B D                     Human  ctca
B D                     Chimp  ctca
B D                   Gorilla  ctca
B D                 Orangutan  ctca
B D                    Gibbon  ctca
B D                    Rhesus  ctca
B D       Crab-eating macaque  ctca
B D                    Baboon  ctca
B D              Green monkey  ctca
B D                  Marmoset  ccca
B D           Squirrel monkey  ccca
B D                  Bushbaby  ttct
           Chinese tree shrew  ctca
B D                  Squirrel  ccc-
       Lesser Egyptian jerboa  cct-
                 Prairie vole  ccc-
B D           Chinese hamster  ccc-
               Golden hamster  cct-
B D                     Mouse  ccc-
B D                       Rat  ccc-
B D                    Rabbit  --c-
B D                      Pika  ccc-
B D                       Pig  gtca
B D                    Alpaca  gtca
               Bactrian camel  gtca
B D                   Dolphin  gtca
                 Killer whale  gtca
             Tibetan antelope  gtca
B D                       Cow  gtca
B D                     Sheep  gtca
                Domestic goat  gtca
B D                     Horse  ctca
B D          White rhinoceros  -tca
B D                       Cat  ttca
B D                       Dog  ttca
B D                   Ferret   ttca
B D                     Panda  ttca
               Pacific walrus  ttca
                 Weddell seal  ttca
             Black flying-fox  ctca
B D                   Megabat  ctca
B D                  Elephant  cctg
          Cape elephant shrew  cctg
                     Aardvark  cctg
B D                 Armadillo  tcca
B D                   Opossum  ttca
             Star-nosed mole  ====
B D                  Hedgehog  ====
B D                     Shrew  ====
B D                    Tenrec  ====
            Brush-tailed rat  ====
                  Chinchilla  ====
B D                Guinea pig  ====
               Big brown bat  ====
B D                  Microbat  ====
        David's myotis (bat)  ====
B D                   Manatee  ====
B D            Naked mole-rat  ====
B D             X. tropicalis  ====
B D                    Lizard  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
  D                    Parrot  ====
B D                Budgerigar  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
  D       Collared flycatcher  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D               Rock pigeon  ====
B D                  Platypus  ====
B D                   Wallaby  ====
B D        American alligator  ====
B D           Tasmanian devil  ====
            Cape golden mole  ====

Alignment block 17 of 38 in window, 131767171 - 131767181, 11 bps 
B D                     Human  aag---acaaatta
B D                     Chimp  aag---acaaatta
B D                   Gorilla  aag---acaaatta
B D                 Orangutan  aag---ataaatta
B D                    Gibbon  aag---acaaatta
B D                    Rhesus  aag---ataaatta
B D       Crab-eating macaque  aag---ataaatta
B D                    Baboon  aag---ataaatta
B D              Green monkey  aag---ataaatta
B D                  Marmoset  aag---acaaatta
B D           Squirrel monkey  aag---acaaatta
B D                  Bushbaby  aag---acaaattc
           Chinese tree shrew  cag---gcaaatta
B D                  Squirrel  aag---gcaaacgg
       Lesser Egyptian jerboa  aag---ataagata
                 Prairie vole  aaa---acaaacta
B D           Chinese hamster  aag---acaaatta
               Golden hamster  agg---acaaatta
B D                     Mouse  aag---acagatta
B D                       Rat  aag---acagatta
B D                    Rabbit  aga---ggacagt-
B D                      Pika  agatttggagagtg
B D                       Pig  aga---gcaactca
B D                    Alpaca  gag---gcaaatta
               Bactrian camel  gag---gcaaatta
B D                   Dolphin  aag---gca----c
                 Killer whale  aag---gca----c
             Tibetan antelope  agg---gcaagcta
B D                       Cow  agg---gcaagcta
B D                     Sheep  agg---gcaagcta
                Domestic goat  agg---gcaagcta
B D                     Horse  gga---gcaa----
B D          White rhinoceros  aga---gtgaatta
B D                       Cat  aag---gcaaattg
B D                       Dog  agg---acaaatta
B D                   Ferret   agg---gtaaatta
B D                     Panda  agg---gcaaatta
               Pacific walrus  agg---gcagatta
                 Weddell seal  agg---gcaaatta
             Black flying-fox  agg---acaaattt
B D                   Megabat  agg---acaaattt
B D                  Elephant  agg---gcaaatta
          Cape elephant shrew  aga---gtaaagca
                     Aardvark  agg---acaaatta
B D                 Armadillo  gga---gcaaagtt
             Star-nosed mole  ==============
B D                  Hedgehog  ==============
B D                     Shrew  ==============
B D                    Tenrec  ==============
            Brush-tailed rat  ==============
                  Chinchilla  ==============
B D                Guinea pig  ==============
               Big brown bat  ==============
B D                  Microbat  ==============
        David's myotis (bat)  ==============
B D                   Manatee  ==============
B D            Naked mole-rat  ==============
B D             X. tropicalis  ==============
B D                    Lizard  ==============
  D  Chinese softshell turtle  ==============
  D            Painted turtle  ==============
  D           Green seaturtle  ==============
B D                    Turkey  ==============
B D                   Chicken  ==============
  D              Mallard duck  ==============
  D                    Parrot  ==============
B D                Budgerigar  ==============
          Tibetan ground jay  ==============
B D               Zebra finch  ==============
B D       Medium ground finch  ==============
  D    White-throated sparrow  ==============
  D       Collared flycatcher  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
  D               Rock pigeon  ==============
B D                  Platypus  ==============
B D                   Wallaby  ==============
B D        American alligator  ==============
B D                   Opossum  ==============
B D           Tasmanian devil  ==============
            Cape golden mole  ==============

Inserts between block 17 and 18 in window
B D                 Elephant 464bp
         Cape elephant shrew 6bp
                    Aardvark 6bp
B D                Armadillo 6bp

Alignment block 18 of 38 in window, 131767182 - 131767211, 30 bps 
B D                     Human  c-tta----------acc-----------aaatat-----g----gtttc--------------------
B D                     Chimp  c-tta----------acc-----------aaatat-----g----gtttc--------------------
B D                   Gorilla  c-tta----------acc-----------aaatat-----g----gtttc--------------------
B D                 Orangutan  c-tta----------atc-----------aaatat-----g----gtttc--------------------
B D                    Gibbon  c-tta----------acc-----------aaatat-----g----gtttc--------------------
B D                    Rhesus  c-tta----------acc-----------aaatat-----g----gttca--------------------
B D       Crab-eating macaque  c-tta----------acc-----------aaatat-----g----gttca--------------------
B D                    Baboon  c-tta----------acc-----------aaatat-----g----gttca--------------------
B D              Green monkey  c-tta----------acc-----------aaatat-----g----gttca--------------------
B D                  Marmoset  c-tta----------ac-----------------------------------------------------
B D           Squirrel monkey  c-tta----------ac-----------------------------------------------------
B D                  Bushbaby  c-tta----------acc-ttt-----ttgggttt-----g----gttct--------------------
           Chinese tree shrew  t-tta----------acc-ttt-----tggggact-----g----accct--------------------
B D                  Squirrel  c-tta----------act----------------cttttaa----gtcca--------------------
       Lesser Egyptian jerboa  c-t-------------------------------------------------------------------
                 Prairie vole  c-tta----------gct----------------t-----g----gttcc--------------------
B D           Chinese hamster  c-tta----------att----------------t-----g----gtttt--------------------
               Golden hamster  c-tta----------gct----------------t-----g----gttcc--------------------
B D                     Mouse  c-tca----------acc----------------t-----g----gttct--------------------
B D                       Rat  c-tca----------acc----------------t-----g----attct--------------------
B D                    Rabbit  -------------gcact----------------t-----g----gttcc--------------------
B D                      Pika  c-ttatccatttggcact----------------t-----g----gttcc--------------------
B D                       Pig  c-ttc----------atgtttt-----cggacctc-----a----gttcc--------------------
B D                    Alpaca  c-tta----------acatttt-----tggacctc-----g----gttcc--------------------
               Bactrian camel  c-tta----------acatttt-----tggacctc-----a----gttcc--------------------
B D                   Dolphin  c-ata----------acatttt-----tggacctt-----g----gttcc--------------------
                 Killer whale  c-tta----------acagttt-----tggacctt-----g----gttcc--------------------
             Tibetan antelope  c-gtg----------aca-ttt-----tggacctc-----t----gttcc--------------------
B D                       Cow  c-atg----------aca-ttt-----tgaacctc-----g----gttcc--------------------
B D                     Sheep  c-atg----------aca-ttt-----tggacctc-----g----gtttcttcttctccgttcaggtcaa
                Domestic goat  c-gtg----------aca-ttt-----tggacctc-----g----gttcc--------------------
B D                     Horse  ----a----------act-ttt-----gggacctc-----a----gtttc--------------------
B D          White rhinoceros  cctga----------act-ttc-----tgggcctc-----a----gagtc--------------------
B D                       Cat  c-tta----------act-ttt---taggggtctt-----g----gttcc--------------------
B D                       Dog  cttta----------act-ttt---gggagtcctt-----g----gtgcc--------------------
B D                   Ferret   c-tta----------cct-ttt---gggggacctt-----g----gttcc--------------------
B D                     Panda  c-tta----------cct-tttg--gggggaactt-----g----gtccc--------------------
               Pacific walrus  c-tta----------cct-ttt---gggggacttt-----g----gtccc--------------------
                 Weddell seal  c-tta----------cct-ttt---gggggacttt-----g----gtccc--------------------
             Black flying-fox  c-tta----------aca-ttt-----tggactgc-----t----gtccc--------------------
B D                   Megabat  c-tta----------aca-ttt-----tggactgc-----t----gtccc--------------------
          Cape elephant shrew  ----------------------ctttttgagcctt-----agtacgtacc--------------------
                     Aardvark  ----------------------ctttttggacctt-----g----gtccc--------------------
B D                 Armadillo  ----------------------ttttttgggtcgt-----c----cttcc--------------------
             Star-nosed mole  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                    Tenrec  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
B D                Guinea pig  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D            Naked mole-rat  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================
            Cape golden mole  ======================================================================

                        Human  -------------------------------ttcaaatccaa
                        Chimp  -------------------------------ttcaaatccaa
                      Gorilla  -------------------------------ttcaaatccaa
                    Orangutan  -------------------------------ttcaaatccaa
                       Gibbon  -------------------------------ttcaaatccaa
                       Rhesus  -------------------------------ttcaaatccaa
          Crab-eating macaque  -------------------------------ttcaaatccaa
                       Baboon  -------------------------------ttcaaatccaa
                 Green monkey  -------------------------------ttcaaattcaa
                     Marmoset  ---------------------------------caactgcaa
              Squirrel monkey  ---------------------------------cgactccaa
                     Bushbaby  -------------------------------ttcatcttcaa
           Chinese tree shrew  -------------------------------ttca-------
                     Squirrel  -------------------------------ttttcttcac-
       Lesser Egyptian jerboa  -------------------------------------ccaa-
                 Prairie vole  -------------------------------tttaccccaa-
              Chinese hamster  -------------------------------tttactccag-
               Golden hamster  -------------------------------tttactccag-
                        Mouse  -------------------------------tttattcaaa-
                          Rat  -------------------------------tctactcaaa-
                       Rabbit  -------------------------------tgtatctccc-
                         Pika  -------------------------------tgcatctgca-
                          Pig  -------------------------------ttcatctccag
                       Alpaca  -------------------------------ctcatcaccat
               Bactrian camel  -------------------------------ctcatcgccat
                      Dolphin  -------------------------------ttcttctccta
                 Killer whale  -------------------------------ttcttctccta
             Tibetan antelope  -------------------------------ttcttctccaa
                          Cow  -------------------------------ttcttctccaa
                        Sheep  gggcaagctacatgacattttgggcctcggtttcttctccaa
                Domestic goat  -------------------------------ttcttctccaa
                        Horse  -------------------------------ttcatctccaa
             White rhinoceros  -------------------------------ttcatctccaa
                          Cat  -------------------------------atcatctccaa
                          Dog  -------------------------------ttcatcgccaa
                      Ferret   -------------------------------ttcacctccaa
                        Panda  --------------------------------tcatctccaa
               Pacific walrus  -------------------------------ttcatctccaa
                 Weddell seal  -------------------------------ttcatctccaa
             Black flying-fox  -------------------------------ttcat---caa
                      Megabat  -------------------------------ttcat---caa
          Cape elephant shrew  -------------------------------ttcacctccaa
                     Aardvark  -------------------------------ttcatctccaa
                    Armadillo  -------------------------------ttcttttccaa
              Star-nosed mole  ==========================================
                     Hedgehog  ==========================================
                        Shrew  ==========================================
                       Tenrec  ==========================================
             Brush-tailed rat  ==========================================
                   Chinchilla  ==========================================
                   Guinea pig  ==========================================
                Big brown bat  ==========================================
                     Microbat  ==========================================
         David's myotis (bat)  ==========================================
                      Manatee  ==========================================
                     Elephant  ==========================================
               Naked mole-rat  ==========================================
                X. tropicalis  ==========================================
                       Lizard  ==========================================
     Chinese softshell turtle  ==========================================
               Painted turtle  ==========================================
              Green seaturtle  ==========================================
                       Turkey  ==========================================
                      Chicken  ==========================================
                 Mallard duck  ==========================================
                       Parrot  ==========================================
                   Budgerigar  ==========================================
           Tibetan ground jay  ==========================================
                  Zebra finch  ==========================================
          Medium ground finch  ==========================================
       White-throated sparrow  ==========================================
          Collared flycatcher  ==========================================
             Peregrine falcon  ==========================================
                 Saker falcon  ==========================================
                  Rock pigeon  ==========================================
                     Platypus  ==========================================
                      Wallaby  ==========================================
           American alligator  ==========================================
                      Opossum  ==========================================
              Tasmanian devil  ==========================================
             Cape golden mole  ==========================================

Inserts between block 18 and 19 in window
B D                 Squirrel 7bp
      Lesser Egyptian jerboa 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                    Mouse 2265bp
B D                      Rat 1450bp
B D                   Rabbit 2bp

Alignment block 19 of 38 in window, 131767212 - 131767212, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
          Cape elephant shrew  a
                     Aardvark  g
B D                 Armadillo  g
             Star-nosed mole  =
B D                      Pika  -
B D                  Hedgehog  =
B D                     Shrew  =
B D                     Mouse  =
                Prairie vole  =
B D                       Rat  =
B D           Chinese hamster  =
              Golden hamster  =
B D                    Rabbit  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
            Brush-tailed rat  =
                  Chinchilla  =
B D                Guinea pig  =
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                   Manatee  =
B D                  Elephant  =
B D                  Squirrel  =
          Chinese tree shrew  -
B D            Naked mole-rat  =
B D             X. tropicalis  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
  D                    Parrot  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                  Platypus  =
B D                   Wallaby  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
            Cape golden mole  =

Alignment block 20 of 38 in window, 131767213 - 131767258, 46 bps 
B D                     Human  aag-agttaaacaatcttacctca--taggattgttgtaagaattaaac
B D                     Chimp  aag-agttcaacaatcttacctca--tgggattgttgtaagaattaaac
B D                   Gorilla  aag-agttcaacaatcttacctca--taggattgttgtaagaattaaac
B D                 Orangutan  aag-agttcaacaatcttacctca--taggattgttgtaagaattaaac
B D                    Gibbon  aag-atttcaacaatcttacctca--taggattgttgtaagaattaaac
B D                    Rhesus  agg-aattcaacaatcttacctca--taggattgttgtaagaattaaac
B D       Crab-eating macaque  agg-aattcaacaatcttacctca--taggattgttgtaagaattaaac
B D                    Baboon  aag-agttcaacaatcttacctca--taggattgttgtaagaattaaac
B D              Green monkey  aag-agttcaacaatcttacctca--taggattgttgtaagaattaaac
B D                  Marmoset  aag-agttcaaccatctt-cctca--caggattgttgtaagaattaaac
B D           Squirrel monkey  gag-agttcaaccatctt-cctca--tgggattgttgtaagaattaaac
B D                  Bushbaby  --g-agttcaactat-tgaactct--tgggattgttgtaggactcaaac
           Chinese tree shrew  -------tcgccaatcttccctca--tgggattgtttttaagattaaac
B D                  Squirrel  gac-agttcaaaagtcttaattta--tgggattgttgtaagaaataaac
       Lesser Egyptian jerboa  gag-ggttaaatgatcttacctca--taggattgttttaagtatttaac
                 Prairie vole  gag-aatccaatggtcttacctca--tagg--tattttgga-attgaac
B D           Chinese hamster  gag-aatttagtgatcttacctca--taggattgttttgaa-actgaac
               Golden hamster  gag-aattcagtgatcttaccaaa--taggattgatttgaa-actgagc
B D                    Rabbit  aac-acttcaacaatcttatctca--cagaactataataaggattacac
B D                      Pika  gag-aattcagcaacc--atctcc--tagaattagtgtaagaattgtac
B D                       Pig  g-----ttcagcaatcctac----ctcatgatgatggtaagagtta-ac
B D                    Alpaca  ggg-tattcaacaatcttacctcactcacgatgattgtacaacttagac
               Bactrian camel  ggg-tattcaacaatcttacctcactcacgatgattgtacaacttagac
B D                   Dolphin  gag-agttcaaccatcttacctcactcacaaaggttttaaggattaaac
                 Killer whale  gag-agttcaaccatcttacctcactcacaaaggttttaaggattaaac
             Tibetan antelope  g-------------tcttatctcactcacgcaggctgtgagagttacgc
B D                       Cow  g-------------tcttacctcactcacaaaggctatgagagttacac
B D                     Sheep  g-------------tcttacctcactcacgaaggctgtgagagttacgc
                Domestic goat  g-------------tcttacctcactcacgaaggctgtgagagttacgc
B D                     Horse  gag-agttcaacaatctcttctcc--tggggtcgttgtaagaattaaac
B D          White rhinoceros  gag-agttcaacaatctctcctca--tggggtggttgtaagaattaaac
B D                       Cat  aag-tgttcaacaatctgacctca--tgagcttgttgtaagaattaaac
B D                       Dog  g---------------------------agattgttgtaagaattaaac
B D                   Ferret   ggg-aattcaataatctgacctca--cgggattattgtaagaaataaat
B D                     Panda  ggg-agttcaacaatctgacctga--taggattgttgtaagaattaaac
               Pacific walrus  ggg-agttcaacaatctgacttca--taggattgttgtaagaattaaac
                 Weddell seal  ggg-agttcaa-aacctgatttca--taggattgttgtaagaattaaac
             Black flying-fox  agg-agttcaacaatcttacctca--tggaatagttgtaagaattaaac
B D                   Megabat  agg-agttcaacaatcttacctca--tggaatagttgtaagaattaaac
          Cape elephant shrew  -ag-agtttaatgactttttctta--tagggtatttgtaggactataat
                     Aardvark  -aa-agtttaataatcttgcctct--tgggattgttgtaagaatgaaaa
B D                 Armadillo  -gatagctcaacaatcttacctca--tgggattattgtaagacttcagc
             Star-nosed mole  =================================================
B D                  Hedgehog  =================================================
B D                     Shrew  =================================================
B D                     Mouse  =================================================
B D                       Rat  =================================================
B D                    Tenrec  =================================================
            Brush-tailed rat  =================================================
                  Chinchilla  =================================================
B D                Guinea pig  =================================================
               Big brown bat  =================================================
B D                  Microbat  =================================================
        David's myotis (bat)  =================================================
B D                   Manatee  =================================================
B D                  Elephant  =================================================
B D            Naked mole-rat  =================================================
B D             X. tropicalis  =================================================
B D                    Lizard  =================================================
  D  Chinese softshell turtle  =================================================
  D            Painted turtle  =================================================
  D           Green seaturtle  =================================================
B D                    Turkey  =================================================
B D                   Chicken  =================================================
  D              Mallard duck  =================================================
  D                    Parrot  =================================================
B D                Budgerigar  =================================================
          Tibetan ground jay  =================================================
B D               Zebra finch  =================================================
B D       Medium ground finch  =================================================
  D    White-throated sparrow  =================================================
  D       Collared flycatcher  =================================================
  D          Peregrine falcon  =================================================
  D              Saker falcon  =================================================
  D               Rock pigeon  =================================================
B D                  Platypus  =================================================
B D                   Wallaby  =================================================
B D        American alligator  =================================================
B D                   Opossum  =================================================
B D           Tasmanian devil  =================================================
            Cape golden mole  =================================================

Alignment block 21 of 38 in window, 131767259 - 131767261, 3 bps 
B D                     Human  aag
B D                     Chimp  aag
B D                   Gorilla  aag
B D                 Orangutan  aag
B D                    Gibbon  aag
B D                    Rhesus  aag
B D       Crab-eating macaque  aag
B D                    Baboon  aag
B D              Green monkey  aag
B D                  Marmoset  aag
B D           Squirrel monkey  aag
           Chinese tree shrew  -aa
B D                  Squirrel  aag
       Lesser Egyptian jerboa  agt
                 Prairie vole  acg
B D           Chinese hamster  aag
               Golden hamster  aag
B D                    Rabbit  aag
B D                      Pika  aag
B D                       Pig  aag
B D                    Alpaca  agg
               Bactrian camel  agg
B D                   Dolphin  aag
                 Killer whale  aag
             Tibetan antelope  aag
B D                       Cow  aag
B D                     Sheep  aag
                Domestic goat  aag
B D                     Horse  aag
B D          White rhinoceros  aag
B D                       Cat  aag
B D                       Dog  aaa
B D                   Ferret   aag
B D                     Panda  aag
               Pacific walrus  aag
                 Weddell seal  aag
             Black flying-fox  aag
B D                   Megabat  aag
          Cape elephant shrew  gag
                     Aardvark  aag
B D                 Armadillo  aag
             Star-nosed mole  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                     Mouse  ===
B D                       Rat  ===
B D                    Tenrec  ===
            Brush-tailed rat  ===
                  Chinchilla  ===
B D                Guinea pig  ===
               Big brown bat  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
B D                   Manatee  ===
B D                  Elephant  ===
B D            Naked mole-rat  ===
B D             X. tropicalis  ===
B D                    Lizard  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
  D                    Parrot  ===
B D                Budgerigar  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
  D       Collared flycatcher  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D                  Platypus  ===
B D                   Wallaby  ===
B D        American alligator  ===
B D                   Opossum  ===
B D           Tasmanian devil  ===
            Cape golden mole  ===
B D                  Bushbaby  ---

Alignment block 22 of 38 in window, 131767262 - 131767267, 6 bps 
B D                     Human  aatatc
B D                     Chimp  aatatc
B D                   Gorilla  aatatc
B D                 Orangutan  aatacc
B D                    Gibbon  aatatc
B D                    Rhesus  aatatc
B D       Crab-eating macaque  aatatc
B D                    Baboon  aatatc
B D              Green monkey  aatatc
B D                  Marmoset  aaaatc
B D           Squirrel monkey  aaaatc
           Chinese tree shrew  ggtgac
B D                  Squirrel  ataatg
       Lesser Egyptian jerboa  ataatc
                 Prairie vole  gtaatc
B D           Chinese hamster  ataatc
               Golden hamster  ataatc
B D                    Rabbit  atattc
B D                      Pika  aaatgg
B D                       Pig  gccacc
B D                    Alpaca  acgatg
               Bactrian camel  acgatg
B D                   Dolphin  gcaatc
                 Killer whale  gcaatc
             Tibetan antelope  gcgatc
B D                       Cow  gcgatc
B D                     Sheep  gcgatc
                Domestic goat  gcgatc
B D                     Horse  ataatc
B D          White rhinoceros  ataatc
B D                       Cat  gtaatc
B D                       Dog  gtaatc
B D                   Ferret   gtcagg
B D                     Panda  gtaatc
               Pacific walrus  gtaatc
                 Weddell seal  gtaatc
          Cape elephant shrew  ataatc
                     Aardvark  ataatc
B D                 Armadillo  ataatc
             Star-nosed mole  ======
B D                  Hedgehog  ======
B D                     Shrew  ======
B D                     Mouse  ======
B D                       Rat  ======
            Black flying-fox  ------
B D                    Tenrec  ======
            Brush-tailed rat  ======
                  Chinchilla  ======
B D                Guinea pig  ======
B D                   Megabat  ------
               Big brown bat  ======
B D                  Microbat  ======
        David's myotis (bat)  ======
B D                   Manatee  ======
B D                  Elephant  ======
B D            Naked mole-rat  ======
B D             X. tropicalis  ======
B D                    Lizard  ======
  D  Chinese softshell turtle  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
  D                    Parrot  ======
B D                Budgerigar  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
B D       Medium ground finch  ======
  D    White-throated sparrow  ======
  D       Collared flycatcher  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D               Rock pigeon  ======
B D                  Platypus  ======
B D                   Wallaby  ======
B D        American alligator  ======
B D                   Opossum  ======
B D           Tasmanian devil  ======
            Cape golden mole  ======
B D                  Bushbaby  ------

Alignment block 23 of 38 in window, 131767268 - 131767268, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  c
               Golden hamster  c
B D                    Rabbit  c
B D                      Pika  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  c
B D          White rhinoceros  c
B D                       Dog  c
                 Weddell seal  c
          Cape elephant shrew  t
                     Aardvark  c
B D                 Armadillo  c
             Star-nosed mole  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                     Mouse  =
B D                       Rat  =
            Black flying-fox  -
B D                    Tenrec  =
            Brush-tailed rat  =
                  Chinchilla  =
B D                Guinea pig  =
B D                   Megabat  -
B D                     Panda  -
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                   Manatee  =
B D                  Elephant  =
B D            Naked mole-rat  =
B D                   Ferret   -
B D                       Cat  -
              Pacific walrus  -
B D             X. tropicalis  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
  D                    Parrot  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                  Platypus  =
B D                   Wallaby  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
            Cape golden mole  =
B D                  Bushbaby  -

Inserts between block 23 and 24 in window
B D                      Dog 3bp

Alignment block 24 of 38 in window, 131767269 - 131767269, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                    Rabbit  c
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  g
B D                     Horse  a
B D          White rhinoceros  a
B D                   Ferret   g
                 Weddell seal  a
          Cape elephant shrew  g
                     Aardvark  a
B D                 Armadillo  a
             Star-nosed mole  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                     Mouse  =
B D                       Rat  =
            Black flying-fox  -
B D                    Tenrec  =
            Brush-tailed rat  =
                  Chinchilla  =
B D                Guinea pig  =
B D                   Megabat  -
B D                     Panda  -
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                   Manatee  =
B D                  Elephant  =
B D            Naked mole-rat  =
B D                       Dog  =
B D                       Cat  -
              Pacific walrus  -
B D             X. tropicalis  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
  D                    Parrot  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                  Platypus  =
B D                   Wallaby  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
            Cape golden mole  =
B D                  Bushbaby  -

Inserts between block 24 and 25 in window
B D                  Ferret  1bp
                Weddell seal 76bp

Alignment block 25 of 38 in window, 131767270 - 131767270, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  c
               Golden hamster  t
B D                    Rabbit  t
B D                      Pika  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  g
B D                     Horse  t
B D          White rhinoceros  t
B D                   Ferret   c
          Cape elephant shrew  t
                     Aardvark  t
B D                 Armadillo  t
             Star-nosed mole  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                     Mouse  =
B D                       Rat  =
            Black flying-fox  -
B D                    Tenrec  =
            Brush-tailed rat  =
                  Chinchilla  =
B D                Guinea pig  =
                Weddell seal  =
B D                   Megabat  -
B D                     Panda  -
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                   Manatee  =
B D                  Elephant  =
B D            Naked mole-rat  =
B D                       Dog  =
B D                       Cat  -
              Pacific walrus  -
B D             X. tropicalis  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
  D                    Parrot  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                  Platypus  =
B D                   Wallaby  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
            Cape golden mole  =
B D                  Bushbaby  -

Inserts between block 25 and 26 in window
B D                      Pig 2bp
B D                   Alpaca 876bp
              Bactrian camel 878bp

Alignment block 26 of 38 in window, 131767271 - 131767271, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
           Chinese tree shrew  g
       Lesser Egyptian jerboa  t
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                    Rabbit  g
B D                      Pika  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                   Ferret   g
          Cape elephant shrew  g
B D                 Armadillo  g
             Star-nosed mole  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                     Mouse  =
B D                       Rat  =
            Black flying-fox  -
B D                    Tenrec  =
            Brush-tailed rat  =
                  Chinchilla  =
B D                Guinea pig  =
B D                       Pig  =
B D                   Dolphin  -
                Weddell seal  =
B D                   Megabat  -
                Killer whale  -
B D                     Panda  -
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                   Manatee  =
B D                  Elephant  =
B D          White rhinoceros  -
B D                     Horse  -
              Bactrian camel  =
B D                    Alpaca  =
B D                  Squirrel  -
B D            Naked mole-rat  =
B D                       Dog  =
B D                       Cat  -
              Pacific walrus  -
B D             X. tropicalis  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
  D                    Parrot  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                  Platypus  =
B D                   Wallaby  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
            Cape golden mole  =
                    Aardvark  -
B D                  Bushbaby  -

Inserts between block 26 and 27 in window
                Prairie vole 1341bp
B D          Chinese hamster 1354bp
         Cape elephant shrew 1475bp

Alignment block 27 of 38 in window, 131767272 - 131767272, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  a
           Chinese tree shrew  t
B D                    Rabbit  t
B D                      Pika  t
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                   Ferret   c
B D                 Armadillo  c
             Star-nosed mole  =
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                     Mouse  =
                Prairie vole  =
B D                       Rat  =
B D           Chinese hamster  =
              Golden hamster  -
            Black flying-fox  -
      Lesser Egyptian jerboa  -
B D                    Tenrec  =
            Brush-tailed rat  =
                  Chinchilla  =
B D                Guinea pig  =
B D                       Pig  =
B D                   Dolphin  -
                Weddell seal  =
B D                   Megabat  -
                Killer whale  -
B D                     Panda  -
               Big brown bat  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                   Manatee  =
B D                  Elephant  =
B D          White rhinoceros  -
B D                     Horse  -
              Bactrian camel  =
B D                    Alpaca  =
B D                  Squirrel  -
B D            Naked mole-rat  =
B D                       Dog  =
B D                       Cat  -
              Pacific walrus  -
B D             X. tropicalis  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
  D                    Parrot  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                  Platypus  =
B D                   Wallaby  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
            Cape golden mole  =
                    Aardvark  -
B D                  Bushbaby  -

Inserts between block 27 and 28 in window
            Tibetan antelope 47bp
B D                      Cow 47bp

Alignment block 28 of 38 in window, 131767273 - 131767275, 3 bps 
B D                     Human  ttt
B D                     Chimp  ttt
B D                   Gorilla  ttt
B D                 Orangutan  att
B D                    Gibbon  att
B D                    Rhesus  att
B D       Crab-eating macaque  att
B D                    Baboon  att
B D              Green monkey  att
B D                  Marmoset  att
B D           Squirrel monkey  gtt
           Chinese tree shrew  gtt
B D                    Rabbit  gtt
B D                      Pika  ttt
B D                   Ferret   --c
             Star-nosed mole  ===
         Cape elephant shrew  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                     Mouse  ===
                Prairie vole  ===
B D                       Rat  ===
B D           Chinese hamster  ===
              Golden hamster  ---
            Black flying-fox  ---
      Lesser Egyptian jerboa  ---
B D                    Tenrec  ===
            Brush-tailed rat  ===
                  Chinchilla  ===
B D                Guinea pig  ===
B D                       Pig  ===
B D                   Dolphin  ---
                Weddell seal  ===
B D                   Megabat  ---
                Killer whale  ---
B D                     Panda  ---
               Big brown bat  ===
B D                       Cow  ===
               Domestic goat  ---
B D                     Sheep  ---
            Tibetan antelope  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
B D                 Armadillo  ---
B D                   Manatee  ===
B D                  Elephant  ===
B D          White rhinoceros  ---
B D                     Horse  ---
              Bactrian camel  ===
B D                    Alpaca  ===
B D                  Squirrel  ---
B D            Naked mole-rat  ===
B D                       Dog  ===
B D                       Cat  ---
              Pacific walrus  ---
B D             X. tropicalis  ===
B D                    Lizard  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
  D                    Parrot  ===
B D                Budgerigar  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
  D       Collared flycatcher  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D                  Platypus  ===
B D                   Wallaby  ===
B D        American alligator  ===
B D                   Opossum  ===
B D           Tasmanian devil  ===
            Cape golden mole  ===
                    Aardvark  ---
B D                  Bushbaby  ---

Inserts between block 28 and 29 in window
B D                   Rabbit 382bp

Alignment block 29 of 38 in window, 131767276 - 131767280, 5 bps 
B D                     Human  --ggcca
B D                     Chimp  --ggcca
B D                   Gorilla  --ggcca
B D                 Orangutan  --ggcca
B D                    Gibbon  --ggcca
B D                    Rhesus  --ggcca
B D       Crab-eating macaque  --ggcca
B D                    Baboon  --ggcca
B D              Green monkey  --ggcca
B D                  Marmoset  --ggcca
B D           Squirrel monkey  --agcca
B D                  Squirrel  ------a
       Lesser Egyptian jerboa  --tgtta
               Golden hamster  --tatta
B D                      Pika  --aggca
B D                     Sheep  -aaag--
B D                   Ferret   tgggt--
             Star-nosed mole  =======
         Cape elephant shrew  =======
B D                  Hedgehog  =======
B D                     Shrew  =======
B D                     Mouse  =======
                Prairie vole  =======
B D                       Rat  =======
B D           Chinese hamster  =======
B D                    Rabbit  =======
            Black flying-fox  -------
B D                    Tenrec  =======
            Brush-tailed rat  =======
                  Chinchilla  =======
B D                Guinea pig  =======
B D                       Pig  =======
B D                   Dolphin  -------
                Weddell seal  =======
B D                   Megabat  -------
                Killer whale  -------
B D                     Panda  -------
               Big brown bat  =======
B D                       Cow  =======
               Domestic goat  -------
            Tibetan antelope  =======
B D                  Microbat  =======
        David's myotis (bat)  =======
B D                 Armadillo  -------
B D                   Manatee  =======
B D                  Elephant  =======
B D          White rhinoceros  -------
B D                     Horse  -------
              Bactrian camel  =======
B D                    Alpaca  =======
          Chinese tree shrew  -------
B D            Naked mole-rat  =======
B D                       Dog  =======
B D                       Cat  -------
              Pacific walrus  -------
B D             X. tropicalis  =======
B D                    Lizard  =======
  D  Chinese softshell turtle  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D                    Turkey  =======
B D                   Chicken  =======
  D              Mallard duck  =======
  D                    Parrot  =======
B D                Budgerigar  =======
          Tibetan ground jay  =======
B D               Zebra finch  =======
B D       Medium ground finch  =======
  D    White-throated sparrow  =======
  D       Collared flycatcher  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
B D                  Platypus  =======
B D                   Wallaby  =======
B D        American alligator  =======
B D                   Opossum  =======
B D           Tasmanian devil  =======
            Cape golden mole  =======
                    Aardvark  -------
B D                  Bushbaby  -------

Inserts between block 29 and 30 in window
B D                     Pika 347bp

Alignment block 30 of 38 in window, 131767281 - 131767287, 7 bps 
B D                     Human  ggcacag
B D                     Chimp  ggcacag
B D                   Gorilla  ggcacag
B D                 Orangutan  ggcacag
B D                    Gibbon  gccacag
B D                    Rhesus  ggcacag
B D       Crab-eating macaque  ggcacag
B D                    Baboon  ggcacag
B D              Green monkey  ggcacag
B D                  Marmoset  ggcacag
B D           Squirrel monkey  ggcacag
B D                  Squirrel  ggcacag
       Lesser Egyptian jerboa  tcaacac
               Golden hamster  tgcacag
B D                     Sheep  tgctcag
B D                   Ferret   ggctcag
             Star-nosed mole  =======
B D                      Pika  =======
         Cape elephant shrew  =======
B D                  Hedgehog  =======
B D                     Shrew  =======
B D                     Mouse  =======
                Prairie vole  =======
B D                       Rat  =======
B D           Chinese hamster  =======
B D                    Rabbit  =======
            Black flying-fox  -------
B D                    Tenrec  =======
            Brush-tailed rat  =======
                  Chinchilla  =======
B D                Guinea pig  =======
B D                       Pig  =======
B D                   Dolphin  -------
                Weddell seal  =======
B D                   Megabat  -------
                Killer whale  -------
B D                     Panda  -------
               Big brown bat  =======
B D                       Cow  =======
               Domestic goat  -------
            Tibetan antelope  =======
B D                  Microbat  =======
        David's myotis (bat)  =======
B D                 Armadillo  -------
B D                   Manatee  =======
B D                  Elephant  =======
B D          White rhinoceros  -------
B D                     Horse  -------
              Bactrian camel  =======
B D                    Alpaca  =======
          Chinese tree shrew  -------
B D            Naked mole-rat  =======
B D                       Dog  =======
B D                       Cat  -------
              Pacific walrus  -------
B D             X. tropicalis  =======
B D                    Lizard  =======
  D  Chinese softshell turtle  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D                    Turkey  =======
B D                   Chicken  =======
  D              Mallard duck  =======
  D                    Parrot  =======
B D                Budgerigar  =======
          Tibetan ground jay  =======
B D               Zebra finch  =======
B D       Medium ground finch  =======
  D    White-throated sparrow  =======
  D       Collared flycatcher  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
B D                  Platypus  =======
B D                   Wallaby  =======
B D        American alligator  =======
B D                   Opossum  =======
B D           Tasmanian devil  =======
            Cape golden mole  =======
                    Aardvark  -------
B D                  Bushbaby  -------

Inserts between block 30 and 31 in window
      Lesser Egyptian jerboa 4bp
              Golden hamster 1312bp

Alignment block 31 of 38 in window, 131767288 - 131767298, 11 bps 
B D                     Human  tggctcatgcc
B D                     Chimp  tggctcatgcc
B D                   Gorilla  tggctcatgcc
B D                 Orangutan  tggctcatgcc
B D                    Gibbon  tggctcatgcc
B D                    Rhesus  tggctcatgcc
B D       Crab-eating macaque  tggctcatgcc
B D                    Baboon  tggctcatgcc
B D              Green monkey  tggctcatgcc
B D                  Marmoset  tggctcatgcc
B D           Squirrel monkey  tggctcatgcc
       Lesser Egyptian jerboa  tggtttttccc
B D                     Sheep  tgatttctccg
B D                   Ferret   tgggttaagcc
             Star-nosed mole  ===========
B D                      Pika  ===========
         Cape elephant shrew  ===========
B D                  Hedgehog  ===========
B D                     Shrew  ===========
B D                     Mouse  ===========
                Prairie vole  ===========
B D                       Rat  ===========
B D           Chinese hamster  ===========
              Golden hamster  ===========
B D                    Rabbit  ===========
            Black flying-fox  -----------
B D                    Tenrec  ===========
            Brush-tailed rat  ===========
                  Chinchilla  ===========
B D                Guinea pig  ===========
B D                       Pig  ===========
B D                   Dolphin  -----------
                Weddell seal  ===========
B D                   Megabat  -----------
                Killer whale  -----------
B D                     Panda  -----------
               Big brown bat  ===========
B D                       Cow  ===========
               Domestic goat  -----------
            Tibetan antelope  ===========
B D                  Microbat  ===========
        David's myotis (bat)  ===========
B D                 Armadillo  -----------
B D                   Manatee  ===========
B D                  Elephant  ===========
B D          White rhinoceros  -----------
B D                     Horse  -----------
              Bactrian camel  ===========
B D                    Alpaca  ===========
B D                  Squirrel  -----------
          Chinese tree shrew  -----------
B D            Naked mole-rat  ===========
B D                       Dog  ===========
B D                       Cat  -----------
              Pacific walrus  -----------
B D             X. tropicalis  ===========
B D                    Lizard  ===========
  D  Chinese softshell turtle  ===========
  D            Painted turtle  ===========
  D           Green seaturtle  ===========
B D                    Turkey  ===========
B D                   Chicken  ===========
  D              Mallard duck  ===========
  D                    Parrot  ===========
B D                Budgerigar  ===========
          Tibetan ground jay  ===========
B D               Zebra finch  ===========
B D       Medium ground finch  ===========
  D    White-throated sparrow  ===========
  D       Collared flycatcher  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
  D               Rock pigeon  ===========
B D                  Platypus  ===========
B D                   Wallaby  ===========
B D        American alligator  ===========
B D                   Opossum  ===========
B D           Tasmanian devil  ===========
            Cape golden mole  ===========
                    Aardvark  -----------
B D                  Bushbaby  -----------

Inserts between block 31 and 32 in window
B D                  Ferret  265bp

Alignment block 32 of 38 in window, 131767299 - 131767306, 8 bps 
B D                     Human  tggaaccc-
B D                     Chimp  tggaaccc-
B D                   Gorilla  tggaaccc-
B D                 Orangutan  tggaaccc-
B D                    Gibbon  tggaaccc-
B D                    Rhesus  tggaaccc-
B D       Crab-eating macaque  tggaaccc-
B D                    Baboon  tggaaccc-
B D              Green monkey  tggaaccc-
B D                  Marmoset  tggaaccc-
B D           Squirrel monkey  tggaaccc-
B D                  Squirrel  ------t--
       Lesser Egyptian jerboa  caaaattc-
B D                     Sheep  -aacatcct
             Star-nosed mole  =========
B D                      Pika  =========
         Cape elephant shrew  =========
B D                  Hedgehog  =========
B D                     Shrew  =========
B D                     Mouse  =========
                Prairie vole  =========
B D                       Rat  =========
B D           Chinese hamster  =========
              Golden hamster  =========
B D                    Rabbit  =========
            Black flying-fox  ---------
B D                    Tenrec  =========
            Brush-tailed rat  =========
                  Chinchilla  =========
B D                Guinea pig  =========
B D                       Pig  =========
B D                   Dolphin  ---------
                Weddell seal  =========
B D                   Megabat  ---------
                Killer whale  ---------
B D                     Panda  ---------
               Big brown bat  =========
B D                       Cow  =========
               Domestic goat  ---------
            Tibetan antelope  =========
B D                  Microbat  =========
        David's myotis (bat)  =========
B D                 Armadillo  ---------
B D                   Manatee  =========
B D                  Elephant  =========
B D          White rhinoceros  ---------
B D                     Horse  ---------
              Bactrian camel  =========
B D                    Alpaca  =========
          Chinese tree shrew  ---------
B D            Naked mole-rat  =========
B D                       Dog  =========
B D                   Ferret   =========
B D                       Cat  ---------
              Pacific walrus  ---------
B D             X. tropicalis  =========
B D                    Lizard  =========
  D  Chinese softshell turtle  =========
  D            Painted turtle  =========
  D           Green seaturtle  =========
B D                    Turkey  =========
B D                   Chicken  =========
  D              Mallard duck  =========
  D                    Parrot  =========
B D                Budgerigar  =========
          Tibetan ground jay  =========
B D               Zebra finch  =========
B D       Medium ground finch  =========
  D    White-throated sparrow  =========
  D       Collared flycatcher  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
  D               Rock pigeon  =========
B D                  Platypus  =========
B D                   Wallaby  =========
B D        American alligator  =========
B D                   Opossum  =========
B D           Tasmanian devil  =========
            Cape golden mole  =========
                    Aardvark  ---------
B D                  Bushbaby  ---------

Inserts between block 32 and 33 in window
      Lesser Egyptian jerboa 921bp

Alignment block 33 of 38 in window, 131767307 - 131767347, 41 bps 
B D                     Human  cagcagcttgggaggctgaggcaggaggattgcatgaggcc
B D                     Chimp  cagcagcttgggaggctgaggcaggaggattgcatgaggcc
B D                   Gorilla  cagcagcttgggaggctgaggcaggaggattgcatgaggcc
B D                 Orangutan  cagcagcttgggaggctgagataggaggattgcatgaggcc
B D                    Gibbon  cagcagcttgggaggctgaggcaggaggattgcatgaggcc
B D                    Rhesus  cagcagcttgggaggctgaggcaggaggattgcatgaggcc
B D       Crab-eating macaque  cagcagcttgggaggctgaggcaggaggattgcatgaggcc
B D                    Baboon  cagcagcttgggaggctgaggcaggaggattgcatgaggcc
B D              Green monkey  cagcagcttgggaggctaaggcaggaggattgcatgaggcc
B D                  Marmoset  cagcagcttgggaggctgaggaaggaggattacatgaggcc
B D           Squirrel monkey  cagcagcttggaaggctgaggaagaaggattacatgaagcc
B D                     Sheep  tagcagtagtagtaattgtaataaggagagtgcatgtggtc
             Star-nosed mole  =========================================
B D                      Pika  =========================================
         Cape elephant shrew  =========================================
B D                  Hedgehog  =========================================
B D                     Shrew  =========================================
B D                     Mouse  =========================================
                Prairie vole  =========================================
B D                       Rat  =========================================
B D           Chinese hamster  =========================================
              Golden hamster  =========================================
B D                    Rabbit  =========================================
            Black flying-fox  -----------------------------------------
      Lesser Egyptian jerboa  =========================================
B D                    Tenrec  =========================================
            Brush-tailed rat  =========================================
                  Chinchilla  =========================================
B D                Guinea pig  =========================================
B D                       Pig  =========================================
B D                   Dolphin  -----------------------------------------
                Weddell seal  =========================================
B D                   Megabat  -----------------------------------------
                Killer whale  -----------------------------------------
B