Multiz Alignments of 30 mammals (27 primates)
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 48 in window, 91094557 - 91094660, 104 bps 
B D                     Human  gttaattttaaaagttgagctattctcatccaggaagtgaaattgcaggtcacttcatagaacccaataa
B D                     Chimp  gttaattttaaaagttgagctattctcatccaggaagtgaaattgcaggtcacttcatagaacccaataa
B D                    Bonobo  gttaattttaaaagttgagctattctcatccaggaagtgaaattgcaggtcacttcatagaacccaataa
B D                   Gorilla  gttaattttaaaagttgagctattctcatccaggaagtgaaattgcaggtcacttcatagaacccaataa
B D                 Orangutan  gttaattttaaaagttgagctattctcatccaggaagtgaaactgcaggtcacttcatagaacccaataa
B D                    Gibbon  gttaattttaaaagttgagctattctcatctaggaagtgaaattgcaggtcacttcatagaacccaataa
B D                    Rhesus  gttaattttaaaagttgagcttttctcatccaggaagtgaaactgcaggtcacttcatagaacccaagaa
B D       Crab-eating macaque  gttaattttaaaagttgagcttttctcatccaggaagtgaaactgcaggtcacttcatagaacccaagaa
           Pig-tailed macaque  gttaattttaaaagttgagcttttctcatccaggaagtgaaactgcaggtcacttcatagaacccaagaa
               Sooty mangabey  gttaattttaaaagttgagtttttctcatcgaggaagtgaaattgcaggtcacttcatagaacccaataa
                       Baboon  gttaattttaaaagttgagtttttctcatcgaggaagtgaaattgcaggtcacttcatagaacccaataa
B D              Green monkey  gttaattttaaaagttgagcttttctcatcgaggaagtgaaattgcaggtcatttcatagaacccaataa
                        Drill  gttaattttaaaagttgagtttttctcatcgaggaagtgaaattgcaggtcacttcatagaacccaataa
B D          Proboscis monkey  gttaattttaaaagttgagcgtttctcatccaggaagtgaaattgcaggtcacttcatagaacccaataa
              Angolan colobus  gttaattttaaaagttgagcttttctcatccaggaagtgaaattgcaggtcacttcatagaacccaataa
B D  Golden snub-nosed monkey  gttaattttaaaagttgagcgtttctcatccaggaagtgaaattgcaggtcacttcatagaacacaatat
      Black snub-nosed monkey  gttaattttaaaagttgagcgtttctcatccaggaagtgaaattgcaggtcacttcatagaacacaataa
B D                  Marmoset  gttaattttaaaagttgagctattctcatccaggaagtgaaattgcaggtcacttcatagaacccaataa
B D           Squirrel monkey  gttaattttaaaagttgagctattctcatccaggaagtgaaattgcaggtcacttcatagaacccaataa
          White-faced sapajou  gttaattttaaaagttgagctattctcatccaggaagtgaaattgcaggtcacttcatagaacccaataa
            Ma's night monkey  gttaattttaaaagttgagctattctcatccaggaagtgaaattgcaggtcacttcatagaacccaataa
B D                   Tarsier  gttaattttaaatattgagctactcttatccaggaagcgaaattgcgggtcacttcataggccccaatga
                  Mouse lemur  gttaattttaaaagttgagctattctcatccaggaagtgaaattgcaggtcactctatagaacccaataa
            Coquerel's sifaka  gttaattttaaaagttgagctactctcatctaggaagtgaaattgcaggtcactctatacaacctaataa
                  Black lemur  gttaattttaaaagttgagctattctcatccaggaagtgaaattgcaggtcactttatagaacccaataa
              Sclater's lemur  gttaattttaaaagttgagctattctcatccaggaagtgaaattgcaggtcactttatagaacccaataa
B D                  Bushbaby  gttaattttaaaagttgagctattcttatccaggaagtgaaattgcaggtcactctatagaacccaataa
B D                     Mouse  gttaattttaaaagttgagctattttcatctaggaactgaaacagcaggtcatgtcatagaac-------
B D                       Dog  gttaattttaaaagttgagctattctcatccaggaagtgaaattacaggtca-ttcatggaacccaataa
B D                 Armadillo  gttaattttaaaagttgagctattcttgtccgggaagtgaaattgcaggtcactccatagaacccaataa

                        Human  ggaattttgttac-agagtgaaaatacttttagct
                        Chimp  ggaattttgttac-agaatgaaaatacttttagct
                       Bonobo  ggaattttgttac-agaatgaaaatacttttagct
                      Gorilla  ggaattttgttgc-agaatgaaaatacttttagct
                    Orangutan  ggaattttgttcc-agaatgaaaatacttttaact
                       Gibbon  ggaattttgttac-agaatgaaaatacttttagct
                       Rhesus  ggaattttgttac-agaaggaaaatacttttaact
          Crab-eating macaque  ggaattttgttac-agaaggaaaatacttttaact
           Pig-tailed macaque  ggaattttgttac-agaaggaaaatacttttaact
               Sooty mangabey  ggaattttgttac-agaaggaaaatacttttaact
                       Baboon  ggaattttgttac-agaaggaaaatacttttaact
                 Green monkey  ggaattttgttac-agaaggaaaatacttttaact
                        Drill  ggaattttgttac-agaaggaaaatacttttaact
             Proboscis monkey  ggaattttgttac-agaatgaaaatacttttaact
              Angolan colobus  ggaattttgttac-agaatgaaaatacttttaact
     Golden snub-nosed monkey  ggaattttgttac-agaatgaaaatacttttaact
      Black snub-nosed monkey  ggaattttgttac-agaatgaaaatacttttaact
                     Marmoset  gaaattttgttac-aaactgaaaatacttttaact
              Squirrel monkey  ggaattttgctac-aaactgaaaatacttttaact
          White-faced sapajou  ggaattttgttac-aaactgaaaatacttttaact
            Ma's night monkey  ggaattttgttac-aaactgaaaatacttttaact
                      Tarsier  agaattttgttat-aaaataaaaatacttttaatg
                  Mouse lemur  -gaattttgttataaaaatgaaaatagttttaact
            Coquerel's sifaka  ggaattttgttat-aaaatgaaaatagttttaact
                  Black lemur  ggaattttgttat-aaaatgaaaatagttttaact
              Sclater's lemur  ggaattttgttat-aaaatgaaaatagttttaact
                     Bushbaby  ggaattttgttat-aaaatgaaaatagttttaact
                        Mouse  -----tgttttat-ggaacaaaaatagtttctgct
                          Dog  gaaacttggttat-acaatgaaaatagttttaacc
                    Armadillo  agacttttgttat-aaaatgaaaataatcttaact

Inserts between block 1 and 2 in window
             Angolan colobus 308bp
B D                    Mouse 17bp
B D                      Dog 1bp

Alignment block 2 of 48 in window, 91094661 - 91094868, 208 bps 
B D                     Human  aaag-aaagt------------------------tcaactcaactccactacaaatctactgcc------
B D                     Chimp  aaag-aaagt------------------------tcaactcaactccactacaaatctactgcc------
B D                    Bonobo  aaag-aaagt------------------------tcaactcaactccactacaaatctactgcc------
B D                   Gorilla  aaag-aaagt------------------------tcaactcaactccactacaaatctactgcc------
B D                 Orangutan  aaag-aaagt------------------------tctactcaactccactacaaatctactgcc------
B D                    Gibbon  aaag-aaagt------------------------tcagctcaactccactacacatctactgcc------
B D                    Rhesus  aaag-aaagt------------------------tcaactcagccccactacaaatctactgcc------
B D       Crab-eating macaque  aaag-aaagt------------------------tcaactcagccccactacaaatctactgcc------
           Pig-tailed macaque  aaag-aaagt------------------------tcaactcagccccactacaaatctactgcc------
               Sooty mangabey  aaag-aaagt------------------------tcaactcaaccccactacaaatctactgcc------
                       Baboon  aaag-aaagt------------------------tcaactcaaccccactacaaatctactgcc------
B D              Green monkey  aaag-aaagt------------------------tcaactcaaccccactacaaatctactgcc------
                        Drill  aaag-aaagt------------------------tcaactcaaccccactacaaatctactgcc------
B D          Proboscis monkey  aaag-aaagt------------------------tcaactcaaccccactacaaatctactgcc------
              Angolan colobus  aaag-aaagt------------------------tcagctcaaccccactacaaatctactgcc------
B D  Golden snub-nosed monkey  aaag-aaagt------------------------tcaacttaaccccactacaaatctactgcc------
      Black snub-nosed monkey  aaag-aaagt------------------------tcaactcaaccccactacaaatctactgcc------
B D                  Marmoset  caaa-aatgt------------------------tcaactcaactccactacaaatctactacc------
B D           Squirrel monkey  caaa-aatgt------------------------tcaactcaaccccactacagatctactgcc------
          White-faced sapajou  caaa-aatgt------------------------tcaactcaacctcactacaaatctactgcc------
            Ma's night monkey  caaa-aatgt------------------------tcaactcaaccccgctacaagtctactgcc------
B D                   Tarsier  aaaa-aaaat------------------------tcaactacaccttataacaaatctactgcc------
                  Mouse lemur  aaaa-taagt------------------------tcaactcaaacccaatacaaatctgctgcc------
            Coquerel's sifaka  aaaa--aagt------------------------tcaactcaaacccagtacaaatctgctggt------
                  Black lemur  caaa-aaagt------------------------ttaactcaaacccgatacaaatctgctgcc------
              Sclater's lemur  caaa-aaagt------------------------ttaactcaaacccgatacaaatctgctgcc------
B D                  Bushbaby  aaaaaaaagt------------------------tcagctcaaccccaatacaaatctgctgccg-----
B D                     Mouse  cagg-aaaatattttttggcattttttttttaagttaacttaaatccagagcaaatttggtgtc------
B D                       Dog  aaaa-aaatt------------------------tcaattcaaccctaatacaaatttgctgcc------
B D                 Armadillo  aaga-aaaat------------------------tcaattcaacccttgtacaaatctgatactgtcaac

                        Human  --ttcaacttcctggtgctattatctaaattcacttgttattttaagaaggcc--caccgcaaaagaaat
                        Chimp  --ttcaacttcctggtgctattatctaaattcacttgttattttaagaaggct--caccccaaaagaaat
                       Bonobo  --ttcaacttcctggtgctattatctaaattcacttgttattttaagaaggcc--caccgcaaaagaaat
                      Gorilla  --ttcaacttcctggtgctattatctaaattcacttgttattctaagaaggcc--caccgcaaaagaaat
                    Orangutan  --ttcagcttcctggtgctattatctaaattcacttgttattttaagaaggcc--caccgcaaaagaaat
                       Gibbon  --ttcaacttcctggtgctattatctaaattcacttgttattttaagaaggcc--caccgcaaaagaaat
                       Rhesus  --ttcaacttcctggtgctattatctaaattcacttgttattttaaaaaggtc--cactgcaaaagaaat
          Crab-eating macaque  --ttcaacttcctggtgctattatctaaattcacttgttattttaaaaaggtc--cactgcaaaagaaat
           Pig-tailed macaque  --ttcaacttcctggtgctattatctaaattcacttgttattttaaaaaggtc--gactgcaaaagaaat
               Sooty mangabey  --ttcaacttcctggtgctattatctaaattcacttgttattttaaaaagatc--cactgcaaaagaaat
                       Baboon  --ttcaacttcctggtgctattatctaaattcacttgttattttaaaaagatc--cactgcaaaagaaat
                 Green monkey  --ttcaacttcctggtgctattatctaaattcacttgttattttaaaaaggtc--cactgcaaaagaaat
                        Drill  --ttcaacttcctggtgctattatctaaattcacttgttattttaaaaagatc--cactgcaaaagaaat
             Proboscis monkey  --ttcaacttcctggtgcttttatctaaattcacttgttattttaaaaaggtc--cactgcaaaagaaat
              Angolan colobus  --ttcaacttcctggtgctattatctaaattcacttgttattttaaaaaggtc--cactgcaaaagaaat
     Golden snub-nosed monkey  --ttcaacttcctggtgctattatctaaattcacttcttattttaaaaaggtc--cactgcaaaagaaat
      Black snub-nosed monkey  --ttcaacttcctggtgctattatctaaattcacttcttattttaaaaaggtc--cactgcaaaagaaat
                     Marmoset  --ttcaacttcctggtgctattatctaaattcacttgttattttaagaagact--cactgcaaaataa--
              Squirrel monkey  --ttcaacttcctggtgctattacctaaattcacttgttattttaagaagact--cactgcaaaataaat
          White-faced sapajou  --ttcaacttcctggtgctattatctaaattcacttgttattttaagaagact--cactgcaaaataaat
            Ma's night monkey  --ttcaacttcctggtgctattatctaaattcagttgttattttaagaagact--cactgcaaaataaat
                      Tarsier  --ttcaacttcctagttctgttgtttaaattcacttgttattttaagaaggcc--cactgtaaaagaagc
                  Mouse lemur  --ttcaacttcctggtgctattatctaaattcacttgttattttaagaggctctatactgtaaaataaat
            Coquerel's sifaka  --ttcaacttcctagtgctattatctaaattcacttgttattttaagaaggtccataccgtaaaagaaat
                  Black lemur  --ctcaacttcctagtgctattatctaaattcgcttgttattttaagaaggtctatactgtaaaagaaat
              Sclater's lemur  --ctcaacttcctagtgctattatctaaattcgcttgttattttaagaaggtctatactgtaaaagaaat
                     Bushbaby  --ttcaacttcctagtgctattatctaaattcacttgttatttgaagaaggtc--tactgtaaaagaaat
                        Mouse  --ttcagcttcctagtgct----cctaagttagcttgccat--gaggtgggtt--taatgc---------
                          Dog  --ttcaatttcctagcattactatctaaattgacttatcattttaagaggatc--cactctaaaagaaac
                    Armadillo  ctgtcaacttctgaatgctattctctatgttcactt-------taaggaggtc--tacttcaaaagagat

                        Human  aatatct---tttccaaa-ttattgcttaaataatttaatg---------a-------------aggc--
                        Chimp  aatatct---tttccaaa-ttattacttaaataatttaatg---------a-------------aggc--
                       Bonobo  aatatct---tttccaaa-ttattacttaaataatttaatg---------a-------------aggc--
                      Gorilla  aatatct---tttccaaa-ttattacttaaataatttaatg---------a-------------aggc--
                    Orangutan  agtatct---tttctaaa-ttattacttaaataatttaata---------a-------------aggc--
                       Gibbon  aatatct---tttccaaa-ttattacttaaataatttaatg---------a-------------aggt--
                       Rhesus  aatatct---tttcccaa-ttattatgtaaataatttaatg---------a-------------aggc--
          Crab-eating macaque  aatatct---tttcccaa-ttattacgtaaataatttaatg---------a-------------aggc--
           Pig-tailed macaque  aatatct---tttcccaa-ttattacataaataatttaatg---------a-------------aggc--
               Sooty mangabey  aatatct---tttccaaa-ttattacgtaaataatttaatg---------a-------------aggc--
                       Baboon  aatatct---tttccaaa-ttattacgtaaataatttaatg---------a-------------aggg--
                 Green monkey  aatatct---tttccaaa-ttattatgtacataatttaatg---------a-------------aggc--
                        Drill  aatatct---tttccaaa-ttattacgtaaataatttaatg---------a-------------aggc--
             Proboscis monkey  aatgtct---tttcccaa-ttattacttaaataatttaatg---------a-------------aggc--
              Angolan colobus  aatatct---tttcccaa-ttattacttaagtaatttaatg---------a-------------aggc--
     Golden snub-nosed monkey  aatgtct---tttcccaa-ttattacttaaataatttaatg---------a-------------aggc--
      Black snub-nosed monkey  aatgtct---tttcccaa-ttattacttaaataatttaatg---------a-------------aggc--
                     Marmoset  aatatat---tttcccaa-ttattacttaagtaatttagtg---------a-------------aggc--
              Squirrel monkey  actatat---tttcccaa-ttattacttgagtaatttagtg---------a-------------aggc--
          White-faced sapajou  aatatat---tttcccaa-ttattacttaagtaatgtagtg---------a-------------aggc--
            Ma's night monkey  aatatat---tttcccaa-ttattacttaagtaatttagtg---------a-------------aggc--
                      Tarsier  aatatct---tttcccaatttagaacttaaaacattcagta---------a-------------agac--
                  Mouse lemur  gatatctctcttcccaat-ttagtgcttaaaaaattgaata---------a-------------aggc--
            Coquerel's sifaka  gatatctctcttcccaat-ttagtacttaaaaaattgaata---------a-------------aggc--
                  Black lemur  gatatctctcttcccaat-ttaatacttaaaaaattgaata---------a-------------aggc--
              Sclater's lemur  gatatctctcttcccaat-ttaatacttaaaaaattgaata---------a-------------aggc--
                     Bushbaby  gacatttatctccccaat-ttggtacctagaaaatgtaata---------a-------------aggcat
                        Mouse  ----tct---cttccctg-t--gtagccgtatgagttg--g---------a-------------aagc--
                          Dog  tgtatctgtcttcccaac-ttagtattttaacaatttaacaataaaacata-------------aagc--
                    Armadillo  ggcgcctttctgtccaac-ttagta-taaaaaaaattaata---------aatatgtcgttatgatgc--

                        Human  --atgtgattgatttcatgggacaatagtatttgtgggaatatatttgtatgtcatcagtttt
                        Chimp  --atgtgattgatttcatgggacaatagtatttgtgggaatatatttgtatgtcatcagtttt
                       Bonobo  --atgtgattgatttcatgggacaatagtatttgtgggaatatatttgtatgtcatcagtttt
                      Gorilla  --atgtgattgatttcatgggacaatagtatttgtgggaatatatttgtatgtcatcagtttt
                    Orangutan  --atgtgattgatttcatgggacaatagtatttgtggggatatatttgtatgtcatcagtttt
                       Gibbon  --atgtggttgatttcatcggacaatagtatttgtgggaatatatttgtatgtcatcagtttt
                       Rhesus  --tagtgatttatttcatgggacaatagtatttgtgggaatatatttgtatgtcatcattttt
          Crab-eating macaque  --tagtgatttatttcatgggacaatagtatttgtgggaatatatttgtatgtcatcattttt
           Pig-tailed macaque  --tagtgatttatttcatgggacaatagtatttgtgggaatatatttgtatgtcatcattttt
               Sooty mangabey  --tagtgatttatttcatgggacaatagtatttgtgggaatatatttgtatgtcatcattttt
                       Baboon  --tagtgatttatttcatgggacaatagtatttgtgggaatatatttgtatgtcatcattttt
                 Green monkey  --tagtgatttatttcatgggacaatagtatttgtgggaatatatttgtatgtcatcattttt
                        Drill  --tagtgatttatttcatgggacaatagtatttgtgggaatatatttgtatgtcatcattttt
             Proboscis monkey  --tagtgatttatttcatgggacaatagtatttgtgggaatatatttgtatgtcatcattttt
              Angolan colobus  --tagtgatttatttcatgggacaatagtatttgtgggaatatatttgtatgtcatcattttt
     Golden snub-nosed monkey  --tagtgatttatttcatgggacaatagtatttgtgggaatatatttgtatgtcatcattttt
      Black snub-nosed monkey  --tagtgatttatttcatgggacaatagtatttgtgggaatatatttgtatgtcatcattttt
                     Marmoset  --atatgattgatttcatgggacaatagtatttgtgggaatgtatttgaatgttatcagtttt
              Squirrel monkey  --atatgattgatttcatgggacagtagtatttgtgggaatgtattagaatgtcatcagtttt
          White-faced sapajou  --atatgattgatttcatgggacagtagtatttgtggtaatg--tttgaatgtcatcagtttt
            Ma's night monkey  --atatgattgatttaatgggacaatagtatttgtgggaatgtatttgaatgtcatcagtttt
                      Tarsier  -----------atttcatgggacaatagtatttgtgaaaataaatttgtatgctgtcagtttt
                  Mouse lemur  --atatggttgatttcagaggacaatagtatttgtggaaataaatttgtatgtcaacagtttt
            Coquerel's sifaka  --atgtggttgatttcagcggacaatagtatttgtggaaataaatttgtatgtcatcaatttt
                  Black lemur  --atatggttgatttcagaggacaatagtatttgtggaaataaattcatatgtcatcagtttt
              Sclater's lemur  --atatggttgatttcagaggacaatagtatttgtggaaataaattcatatgtcatcagtttt
                     Bushbaby  ctatatagttgattacagaggacaatagtatttgtggaaataaacgtgtatgtcatcagtttg
                        Mouse  --agctta-tgactttggagaacaatagtactggtagagataaa--cagagaacattgatttt
                          Dog  --acatgatggatttcatagaataatagtatttgtgaaaataaatttggatgtcatcagttat
                    Armadillo  --aaatgattgatttaatagaataacagtttttctggaaataaattttgatgtcatcagttt-

Inserts between block 2 and 3 in window
                 Mouse lemur 363bp
B D                    Mouse 1bp
B D                      Dog 2bp

Alignment block 3 of 48 in window, 91094869 - 91094883, 15 bps 
B D                     Human  acagatagtt----aaata
B D                     Chimp  acagatagtt----aaata
B D                    Bonobo  acagatagtt----aaata
B D                   Gorilla  acagatagtt----aaata
B D                 Orangutan  acagatagtt----aaata
B D                    Gibbon  acagatagtt----aaata
B D                    Rhesus  acagagagtt----aaata
B D       Crab-eating macaque  acagagagtt----aaata
           Pig-tailed macaque  acagagagtt----aaata
               Sooty mangabey  acagagagtt----aaata
                       Baboon  acagagagtt----aaata
B D              Green monkey  acagagagtt----aaata
                        Drill  acagagagtt----aaata
B D          Proboscis monkey  acagatagtt----gaata
              Angolan colobus  acatatagtt----gaata
B D  Golden snub-nosed monkey  acagatagtt----gaata
      Black snub-nosed monkey  acagatagtt----gaata
B D                  Marmoset  gcaga--------------
B D           Squirrel monkey  gcaga--------------
          White-faced sapajou  gcaga--------------
            Ma's night monkey  gcaga--------------
B D                   Tarsier  atagatagataggcagaga
            Coquerel's sifaka  agagatagat----aaata
                  Black lemur  agagatagat----aaata
              Sclater's lemur  agagatagat----aaata
B D                  Bushbaby  agagacagat----aaata
B D                     Mouse  --atagattt----agaaa
B D                       Dog  atagataaat----agaca
                 Mouse lemur  ===================
B D                 Armadillo  -------------------

Inserts between block 3 and 4 in window
           Coquerel's sifaka 353bp
                 Black lemur 361bp
             Sclater's lemur 361bp
B D                 Bushbaby 2bp

Alignment block 4 of 48 in window, 91094884 - 91094905, 22 bps 
B D                     Human  tata-gatatagatacacattta
B D                     Chimp  tata-gatatagatacacattta
B D                    Bonobo  tata-gatatagatacacattta
B D                   Gorilla  tata-gatatagatacacattta
B D                 Orangutan  tata-gatatagatacacattta
B D                    Gibbon  tata-gatatagatacacattta
B D                    Rhesus  tata-gatatagatacacattta
B D       Crab-eating macaque  tata-gatatagatacacattta
           Pig-tailed macaque  tata-gatatagatacacattta
               Sooty mangabey  tata-gatatagatacacattta
                       Baboon  tata-gatatagatacacattta
B D              Green monkey  tata-gatatagatacacattta
                        Drill  tata-gatatagatacacattta
B D          Proboscis monkey  tata-gatatagatacacattta
              Angolan colobus  tgta-gatatagatacacattta
B D  Golden snub-nosed monkey  tata-gatatagatacacattta
      Black snub-nosed monkey  tata-gatatagatacacattta
B D                  Marmoset  --ta-gttatagatacatattta
B D           Squirrel monkey  --ta-gatatagatacatattta
          White-faced sapajou  --ca-catatagatacatattta
            Ma's night monkey  --ta-gatatacatacatattta
B D                   Tarsier  taca-tacatagatacatattta
B D                  Bushbaby  tatgtgatatagatatagattta
B D                     Mouse  -------tgtaaacga-------
B D                       Dog  -------tatagataag------
                 Mouse lemur  =======================
           Coquerel's sifaka  =======================
             Sclater's lemur  =======================
                 Black lemur  =======================
B D                 Armadillo  -----------------------

Inserts between block 4 and 5 in window
B D                  Tarsier 330bp

Alignment block 5 of 48 in window, 91094906 - 91095203, 298 bps 
B D                     Human  agagagaaggacagggagacag---------------a-gagagaga-agagggaagaaagaac-tgaga
B D                     Chimp  cgagagaaggacagggagacag---------------a-gagagaga-agagggaagaaagaac-tgaga
B D                    Bonobo  agagagaaggacagggagacag---------------a-gagagaga-agcgggaagaaagaac-tgaga
B D                   Gorilla  agagagaaggacagggaggcag---------------a-gagagaga-agagggaagaaagaac-tgaga
B D                 Orangutan  agagagaaggacagggagac-----------------a-gagagaga-agagggaagaaagaac-tgaga
B D                    Gibbon  agagagaaggacagggagacag---------------a-gggagaga-agagggaagaaagaac-tgaga
B D                    Rhesus  ggagagaaggacggggagacag---------------a-gagagagaaagagggaagagagaac-tgaga
B D       Crab-eating macaque  ggagagaaggacggggagacag---------------a-gagagagaaagagggaagagagaac-tgaga
           Pig-tailed macaque  agagagaaggacggggagacag---------------a-gagagagaaagagggaagagagaac-tgaga
               Sooty mangabey  agagagaaggacggggagacag---------------a-gagagagaaagagggaagagagaac-tgaga
                       Baboon  agagagaaggacggggagacag---------------a-gagagagaaagagggaagagagaac-taaga
B D              Green monkey  agagagaaggacggggagacag---------------a-gagagagaaagagggaagagagaac-tgaga
                        Drill  agagagaaggacggggagacag---------------a-gagagagaaagagggaagagagagc-tgaga
B D          Proboscis monkey  agagagaaggaaggggagac-----------------a-gagagagaaagagggaagagagaac-tgaga
              Angolan colobus  agagaaaaggacagggagacag---------------a-gagagagaaacagggaagagagaac-tgaga
B D  Golden snub-nosed monkey  agagagaaggacggggagacag-------------aga-gagagagaaagagagaagagagaac-tgaga
      Black snub-nosed monkey  agagagaaggacggggagacgggagaccagaaggagaa-gagagaaagagcggaaagagagaacttgaga
B D                  Marmoset  agagaaaaggacagggaaacag---------------a-g--------agaggaaagaaagaac-tgagg
B D           Squirrel monkey  agagagaaggatggggaaacag---------------a-g--------agaggaaagaaagaac-tgagg
          White-faced sapajou  agagagaaggacagggaaacag---------------a-g--------agaggaaagaaagaac-tgagg
            Ma's night monkey  agagagaaggacagggaaacag---------------a-g--------agaggaaagaaagaac-tgagg
B D                   Tarsier  agaggaaaggagaaagagaagg---------------a-agggcagagaga---aagaaagaac-taaga
B D                  Bushbaby  agagagagaaa--------------------------g-gagagagg-aggagagagaaaaaat-tgaga
B D                     Mouse  ggagcaaagggaggagggagag---------------g-aagagaga-gaagaggggaaagtct-taa--
B D                       Dog  aaagagaagg-----ggagcta---------------a-aaaagagaaagcag-----aagaac-tgaga
B D                 Armadillo  ---gagagagagagagagataa---------------atgagatccaataaggcatgta--tat-taaaa
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================

                        Human  ------------------tagcaa-ttttgaattaactag-----agccttt---ctg---g-tgactca
                        Chimp  ------------------tagcca-ttttgaattaactag-----agccttt---ctg---g-tgactca
                       Bonobo  ------------------tagcca-ttttgaattaactag-----agccttt---ctg---g-tgactca
                      Gorilla  ------------------tagcca-ttttgaattcactag-----agccttt---ctg---g-tgactca
                    Orangutan  ------------------tagtca-ttttgaattcagtag-----aaccttt---ctg---g-tgagtca
                       Gibbon  ------------------tagcca-ttttgaattcactag-----aaccttt---ctg---g-tgactca
                       Rhesus  ------------------tagcca-ttttgaattcactag-----aaccttt---ctg---g-tgactca
          Crab-eating macaque  ------------------tagcca-ttttgaattcactag-----aaccttt---ctg---g-tgactca
           Pig-tailed macaque  ------------------tagcca-ttttgaattcactag-----aaccttt---ctg---g-tgactca
               Sooty mangabey  ------------------tagcca-gtttgaattcactag-----aaccttt---ctg---g-tgactca
                       Baboon  ------------------tagcca-ttttgaattcactag-----aaccttt---ctg---g-tgactca
                 Green monkey  ------------------tagcca-ttttgaattcactag-----aaccttt---ctg---g-tgactca
                        Drill  ------------------tagcca-ttttgaattcactag-----aaccttt---ctg---g-tgactca
             Proboscis monkey  ------------------tagcca-ttttgaattcactag-----aatcttt---ctg---g-tgactca
              Angolan colobus  ------------------tagcca-ttttgaattcactag-----aaacttt---ctg---g-tgactca
     Golden snub-nosed monkey  ------------------tagcca-ttttgaattcactag-----aatcttt---ctg---g-tgactca
      Black snub-nosed monkey  tt----------------tagccatttttgaattcactagaaaaaaatcttt---ctg---gctgactc-
                     Marmoset  ------------------ttacca-ttttgaattcactag-----aaccttt---ctg---g-tgactca
              Squirrel monkey  ------------------ttgcca-ttttgaattcactag-----aaccttt---ctg---g-tgactca
          White-faced sapajou  ------------------ttgcca-ttttgaattcactag-----aaacttt---ctg---g-tgactca
            Ma's night monkey  ------------------ttgcca-ttttgaattcactag-----aaccttt---ctg---g-tgactca
                      Tarsier  ------------------t-gtca-ttttgaattcactag-----atctttc-tgctg---a-tgaatca
                     Bushbaby  ------------------ttgtta-ttttgaattcactgg-----aactttc-tgctg---g-tgatcca
                        Mouse  ------------------ttgtca-ttttgaattca-tag-----tgttgtt---ctt---t-taa----
                          Dog  tcctctaatgtcaaaaaatagtca-ttttgaatacaatag-----gacctttctgctg---g-tgattca
                    Armadillo  ------------------ctgtca-ctttgactccaagag-----aactttt---ctgctag-tgattca
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================

                        Human  tgacccaacagtggg---------------tttt---ttttcttt--ggttaatgaatatatcatatggg
                        Chimp  tgacccaacagtggg---------------tttt---tttccttt--ggttaatgaatatatcatatggg
                       Bonobo  tgacccaacagtggg---------------tttt---tttccttt--ggttaatgaatatatcatatggg
                      Gorilla  tgacctaacagtggg--------------ttttt---ttttcttt--ggttaatgaatatatcgtatggg
                    Orangutan  tgacccaacagtgg----------------cttt---ttttcttt--ggttaatgaatatattatatggg
                       Gibbon  tgacccagcagtggg----------------ttt---ttttcttt--ggttaatgaatatattatatggg
                       Rhesus  tgacccaacggtggg---------------tttt---ttttcttt--ggttaatgaatatatcatatggg
          Crab-eating macaque  tgacccaacggtggg---------------tttt---ttttcttt--ggttaatgaatatatcatatggg
           Pig-tailed macaque  tgacccaacggtggg---------------tttt---ttttcttt--ggttaatgaatatatcatatggg
               Sooty mangabey  tgacccaacggtggg---------------tttt---ttttcttt--ggttaatgaatgtatcatatggg
                       Baboon  tgacccaacggtggg---------------tttt---ttttcttt--ggttaatgaatatatcatatggg
                 Green monkey  tgacccaacggtggt---------------tttt---tttccttt--ggttaatgaatatatcatatcgg
                        Drill  tgacccaacggtggg---------------tttt---ttttcttt--ggctaatgaatatatcatatggg
             Proboscis monkey  tgacccaacggtggg---------------attt---ttttcttt--ggttaatgaatatatcatatggg
              Angolan colobus  tgacccagcgatggg---------------cttt---ttttcttt--ggttaatgaatatatcatatggg
     Golden snub-nosed monkey  tgacccaacggtggg---------------tttt---ttttcttt--ggttaatgaatatatcatatggg
      Black snub-nosed monkey  -gacccaacggtggg---------------tttt---ttttcttt--ggttaatgaatatatcatatggg
                     Marmoset  tgacccaacagtggg----------------ttt---tttccttt--ggttaataagtatatcacatcgg
              Squirrel monkey  tgacccaacagtggg----------------ttt---tttcctct--ggttaataaatatatcacatggg
          White-faced sapajou  tgacccaacagtggg----------------ttt---tttccttt--ggttaataaatatatcacatggg
            Ma's night monkey  tgacccaacagtggg----------------ttt---tttccttt--ggttaataaatatatcacatggg
                      Tarsier  tgacccaaccgttggattttgtttacttgtttgt---ttttgtttggggttggcgaatatatcacatgga
                     Bushbaby  tgaaacaacagttta------------------------tccttg--ttatgatgaatatatcacatgga
                        Mouse  ------------gaa---------------gtttgaatttgctat--g----------acaccat-----
                          Dog  tgatttaactgttgg-----------------tt---tttccagt--ggttgacaaatatttcacatgaa
                    Armadillo  caatccagctgttgg-----------------tt---cttccatt--ggttgatgaatatatcacatgga
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================

                        Human  gaatcttttt-aacatttgactttg------------ctaaataaataaaatta-acatttttaata---
                        Chimp  gaatcttttt-aacatttgactttg------------ctaaataaataaaatta-acattttaaata---
                       Bonobo  gaatcttttt-aacatttgactttg------------ctaaataaataaaatta-acatttttaata---
                      Gorilla  gaatcttttt-aacatttgacattg------------ctaaataaataaaatta-acatttttaata---
                    Orangutan  gaatcttttt-aagatttgactttg------------ctaaataaataaaatta-acatttttaata---
                       Gibbon  gaatcttttt-aaaatttgactttg------------ctaaataaataaaatta-acatttttaata---
                       Rhesus  gaatcttttt-aaaatttgactttg------------ctaaataaatacaatta-acatttttaata---
          Crab-eating macaque  gaatcttttt-aaaatttgactttg------------ctaaataaatacaatta-acatttttaata---
           Pig-tailed macaque  gaatcttttt-aaaatttgactttg------------ctaaataaatacaatta-acatttttaata---
               Sooty mangabey  gaatcttttt-aaaatttgactttg------------ctaaataaatataatta-acatttttaata---
                       Baboon  gaatcttttt-aaaatttgactttg------------ctaaataaatataatta-acatttttaata---
                 Green monkey  gaatcttttt-aaaatttgactttg------------ctaaataaatataatta-acatttttaata---
                        Drill  gaatcttttt-aaaatttgacttgg------------ctaaataaatataatta-atatttttaata---
             Proboscis monkey  gaatcttttt-aaaatttgactttg------------ctaaataaacacaatta-acatttttaata---
              Angolan colobus  gaatcttttt-aaaatttgactttg------------ctaaataaacacaatta-acatttttaata---
     Golden snub-nosed monkey  gaatcttttc-aaaatttgactttg------------ctaaataaacacaatta-acatttttaata---
      Black snub-nosed monkey  gaatctttt--aaaatttgactttg------------ctaaataaacacaatta-aca-ttttaata---
                     Marmoset  gaatctttttaaaaagttgactttg------------ctaaataaataaaatta-aggcttttaaaa---
              Squirrel monkey  gaatctttttaaaaagttgattttg------------ctaaataaataaaatta-aggcttttaata---
          White-faced sapajou  gaatctttttaaaaagttgactttg------------ctaaataaataaaatta-aggcttttaata---
            Ma's night monkey  gaatcttttgaaaaagttgactttg------------ctaaataaataaaatta-aggcttttaata---
                      Tarsier  ga-----ttt-aaaa----------------------------aaatattttgt-gtattttttaaa---
                     Bushbaby  gaatcttaa--aaagattgactttgctatgatatgatctaaataaata---------attttttata---
                        Mouse  -------------------------------------ctaaacacatgcactc--atattgcttat----
                          Dog  gaatcttttt-aaagagtaactttg------------c---agtaatataatac-aaa----taatg---
                    Armadillo  aaatttttaa-aaga----------------------ccaa--aaatgcagtcacataatctaaatacat
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================

                        Human  -------ttttaagtacatcata--t-----aaaaa-ctgccagaaa--gattattatcaat--tatagg
                        Chimp  -------ttttaagtacatcata--t-----aaaaa-ctgccagaaa--gattattatcaat--tatagg
                       Bonobo  -------ttttaagtacatcata--t-----aaaaa-ctgccagaaa--gattattatcaat--tatagg
                      Gorilla  -------ttttaagtacatcata--t-----aaaaa-ctgccagaaa--gattatcatcaat--tatagg
                    Orangutan  -------ttttaagtacatcata--t-----aaaaa-ctgccagaaa--gattatcatcaat--tatagg
                       Gibbon  -------ttttaagtacatcata--t-----aaaaa-ctgccagaaa--gattatcatcaat--tatagg
                       Rhesus  -------ttttaagtacatcacg--t-----aaaga-ataccagaaa--gattaccatcaat--tatagg
          Crab-eating macaque  -------ttttaagtacatcacg--t-----aaaga-ataccagaaa--gattaccatcaat--tatagg
           Pig-tailed macaque  -------ttttaagtacatcatg--t-----aaaga-ataccagaaa--gattaccatcaat--tatagg
               Sooty mangabey  -------ttttaagtacatcatg--t-----aaaga-ataccagaaa--gattaccatcaat--tatagg
                       Baboon  -------ttttaagtacctcatg--t-----aaaga-ataccagaaa--gattaccatcaat--tatagg
                 Green monkey  -------ttttaagtacatcatg--t-----aaaga-ataccagaaa--gattaccaccaat--tatagg
                        Drill  -------ttttaagtacatcatg--t-----aaaga-ataccagaaa--gattaccatcaat--tatagg
             Proboscis monkey  -------ttttaagtacctcatg--t-----aaaaa-atgccagaaa--gattatcatcaat--tatagg
              Angolan colobus  -------ttttcagtacctcatg--t-----aaaaa-atgccagaaa--gattatcatcaat--tatagg
     Golden snub-nosed monkey  -------ttttaagtacctcatg--t-----aaaaa-atgccagaaa--gattatcatcaat--tatagg
      Black snub-nosed monkey  -------ttttaagtacctcatg--t-----aaaaa-atgccagaaa--gattatcatcaat--tatagg
                     Marmoset  ------tttttaagtgaatcata--t-----aaaaa-aagtcagaaa--gatt---atcaat--tatagg
              Squirrel monkey  ------tttttaagtgaatcatattt-----taaaa-aagccagaaa--gatt---atcaat--tatagg
          White-faced sapajou  ------tttttaagtgaatcata-tt-----taaaa-aagcctgaaa--gatt---atcaat--tatagg
            Ma's night monkey  ------tttttaagtgaatcata-tt-----aaaaa-aagccagaaa--gatt---atcagt--tatagg
                      Tarsier  -------ttttaaattcatcgta--t-----ataaa-a-acgagaaa--gatgaccagcaat--gatgag
                     Bushbaby  ------tttttaagtttatgata--t-----aaaaataagcaagaaa--gtttatcagcaat--tacagg
                        Mouse  -------ttttcagtgtgttgta--tgaaagaaaag-aagcaagaaa--gattagtaactat--tgtcag
                          Dog  -------tttaaatggaatcata--t-----gaaaa-aaaaaagagatggattttcagcaat--tatagg
                    Armadillo  aaattgtttttaagtgaatcata--t----gaaaaa-aggcaagaat--gtctttcaccaattatatagg
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================

                        Human  caaagttttaggtggtctgacttgaaataattttggtcatccatgagatgatc
                        Chimp  caaagttttaggtggtctgacttgaaataattttggtcatccatgagatgatc
                       Bonobo  caaagttttaggtggtctgacttgaaataattttggtcatccatgagatgatc
                      Gorilla  caaagttttaggtggtctgacttgaaataattttggtcatccatgagatgatc
                    Orangutan  caatgttttaggtggtctgacttgaaataattttggtcatccatgagatgatc
                       Gibbon  taatg-tttaggtggtctgacttgaagtaattttggtcatccatgagatgatc
                       Rhesus  caatgttttaggtggtctgacttgaaataattttggtcatccatgacatgatc
          Crab-eating macaque  caatgttttaggtggtctgacttgaaataattttggtcatccatgacatgatc
           Pig-tailed macaque  caatgttttagatggtctgactcgaaataattttggtcatccatgacatgatc
               Sooty mangabey  caatgttttaggtgctctgacttgaaataattttggtcatccatgacatgatc
                       Baboon  caatgttttaggtgctctgacttgaaataattttggtcatccatgacatgatc
                 Green monkey  caatgttttaggtggtctgacttgaaataattttggtcatccatgacatgatc
                        Drill  caatgttttaggtgctctgacttgaaataattttggtcatccatgacatgatc
             Proboscis monkey  caatgttttaggtgatctgacttgaaataattttggtcatccatgacatgatc
              Angolan colobus  caatgttttaggtggtctgacttgaaataattttggtcacccatgacgtgatc
     Golden snub-nosed monkey  caatgttttaggtgatctgacttgaaataattttggtcatccatgacatgatc
      Black snub-nosed monkey  caatgttttaggtgatctgacttgaaataattttggtcatccatgacatgatc
                     Marmoset  ccaacttttaggtgatctgatttgaaataaa----gt--tctatgagatgacc
              Squirrel monkey  ccaccttttaggtggtctgacttgaaataaa---ggt--tctatgagatgacc
          White-faced sapajou  ccatgttttaggtggtccgacttgaaataaa---ggt--tctatgagatgacc
            Ma's night monkey  ccatgttttaggtggtctgacttgaaataaa---ggt--tctatgagatgacc
                      Tarsier  ctacgctttagatggtctgaccgtaaataaa---ggt--tacatggaatgccc
                     Bushbaby  ctatgttttagatggtctgacatgcaatgaa---ggtca--cagtgaatgttc
                        Mouse  ctgcattttggatggtctggcttgaaacata---agt--tacatggaa-gatc
                          Dog  ctatgttgtaaatggtgtgacttgaagtata---ggg--tacatggaatgctc
                    Armadillo  ctatattttaggtggtctgacttaaaatata---ggt--tatatgaaatgtcc
                  Mouse lemur  =====================================================
            Coquerel's sifaka  =====================================================
              Sclater's lemur  =====================================================
                  Black lemur  =====================================================

Inserts between block 5 and 6 in window
B D                 Bushbaby 1bp

Alignment block 6 of 48 in window, 91095204 - 91095228, 25 bps 
B D                     Human  aaaattaatgttatggaatttttgt--
B D                     Chimp  aaaattaatgttatggaatttttgt--
B D                    Bonobo  aaaattaatgttatggaatttttgt--
B D                   Gorilla  aaaattaatgttatggaatttttat--
B D                 Orangutan  aaaattaatgttatggaatttttac--
B D                    Gibbon  aaaattaatgttatggaatttttac--
B D                    Rhesus  aaaattaatgctatggaatttttac--
B D       Crab-eating macaque  aaaattaatgctatggaatttttac--
           Pig-tailed macaque  aaaattaatgctatggaatttttac--
               Sooty mangabey  aaaattaatgctatggaatttttac--
                       Baboon  aaaattaatgctatggaatttttac--
B D              Green monkey  aaaattaatgctatggaatttttac--
                        Drill  aaaattaatgctatggaatttttac--
B D          Proboscis monkey  aaaattaatgttatggaatttttac--
              Angolan colobus  aaaattaatgttatggaatttttac--
B D  Golden snub-nosed monkey  aaaattaatgttatggaatttttac--
      Black snub-nosed monkey  aaaattaatgttatggaatttttac--
B D                  Marmoset  aaaattaatgatatggaatgtttac--
B D           Squirrel monkey  aaaattaatgatatggaaggtttac--
          White-faced sapajou  aaaattaatgatatggaaggtttac--
            Ma's night monkey  aaaattaatgatatggaatgtttac--
B D                   Tarsier  aaaattaatatcatggaacttctac--
                  Mouse lemur  aaaattaatgttatggaatttatac--
            Coquerel's sifaka  aaaattaatgttatggaatttgtac--
B D                  Bushbaby  aaacttggag---tggaatttgtac--
B D                     Mouse  catgtgtgtactctaggat--------
B D                       Dog  aaaattaattctatagaat-tgtac--
B D                 Armadillo  caaaataatactctggaatttttgtat
             Sclater's lemur  ===========================
                 Black lemur  ===========================

Alignment block 7 of 48 in window, 91095229 - 91095330, 102 bps 
B D                     Human  atttccagggtgagtcatgattgaggagtc--agagagagggactcagaagaagaaattgtagtg--gta
B D                     Chimp  atttccagggtgagtcatgattgaggagtc--agagagagggactcagaagaagaaattgtagtg--gta
B D                    Bonobo  atttccagggtgagtcatgattgaggagtc--agagagagggactcagaagaagaaattgtagtg--gta
B D                   Gorilla  atttccagggtgagtcatgattgaggagtc--agagagagggactcagaagaagaaactgtagtg--gta
B D                 Orangutan  atttccagggtgagtcatgattgaggagtc--agagagagtgactcagaagaagaaattgtagtg--gta
B D                    Gibbon  atttccagggtgagtcatgattgaggagtc--agagagagggactcagaagaagaaattgtagtg--gta
B D                    Rhesus  atttccagggtgggtcatgattgaggagtc--agagagagggactcagaagaagaaattgtagtg--gta
B D       Crab-eating macaque  atttccagggtgggtcatgattgaggagtc--agagagagggactcagaagaagaaattgtagtg--gta
           Pig-tailed macaque  atttccagggtgggtcatgattgaggagtc--agagagagggactcagaagaagaaattgtagtg--gta
               Sooty mangabey  atttccagggtgagtcatgattgaggagtc--agagagagggactcataagaagaaattgtagtg--gta
                       Baboon  atttccagggtgagtcatgattgaggagtc--agagagagggactcagaagaagaaattgtagtg--gta
B D              Green monkey  atttccagggtgagtcatgattgaggagtc--agagagagggactcagaagaagaaactgtagtg--gta
                        Drill  atttccagggtgagtcatgattgaggagtc--agagagagggactcagaagaagaaattgtagtg--gta
B D          Proboscis monkey  atttccagggtgagtcatgattgaggagtc--agaaagagggactcagaagaagaaattgtagtg--gta
              Angolan colobus  atttccagggtgagtcatgattcaggagtc--agaaagagggactcagaagaagaaattgtagtg--gta
B D  Golden snub-nosed monkey  atttccagggtgagtcatgattgaggagtc--agaaagagggactcagaagaagaaattgtagtg--gta
      Black snub-nosed monkey  atttccagggtgagtcatgattgaggagtc--agaaagagggactcagaagaagaaattgtagtg--gta
B D                  Marmoset  atttcgagggtgggtcatgaatgaggagtc--agggaaagggactcagaaggagaaattgtagag--gta
B D           Squirrel monkey  atttccagggtgggtcatgaatgaggagcc--ggagagagggactcagaaggagaaattgtagag--gta
          White-faced sapajou  atttccagggtgggtcatgaatgaggagcc--agagagagggactcagaaggagaatttgtagag--gta
            Ma's night monkey  atttccagggtgggtcatgaatgaggaccc--agagagagggactcagaaggagaaattgtagag--gta
B D                   Tarsier  atttatagggtgaatcata-----------------------------aagaagaaattgtagtg--gta
                  Mouse lemur  atttccaaagtgggtcatgaatgagtagcc--agagagaggaactcagaaggagaact--gagtg--gta
            Coquerel's sifaka  atttccagagtgggtcatgaatgagaagcc--agagagaggaactcagaaggagaacttggagtg--gta
                  Black lemur  atttccagagtgggtcatgaatgagaaacc--agagaaagggactcagcaggggaacttggagtg--gta
              Sclater's lemur  atttccagagtgggtcatgaatgagaaacc--agagaaagggactcagcaggggaacttggagtg--gta
B D                  Bushbaby  atttctggagtgggtcatgaatgagaagcc--agagagagggactcagaaggagaacttggag-------
B D                     Mouse  ----ccacggtggatccta---ggggagct--agagacaatcactctatgggataagctg---------a
B D                       Dog  atttcagggatgggtcatgagtgaagagccagagagagagggcctcagaaggagaaattctagtgatata
B D                 Armadillo  atttccagggcaggtcat-----------c--aatatgaaggactcagaaggag---ttacggtg--gta

                        Human  aga--agagtcag-gagggctaagccctcttgcagttct
                        Chimp  aga--agagtcag-gagggctaagccctcttgcagttct
                       Bonobo  aga--agagtcag-gagggctaagccctcttgcagttct
                      Gorilla  aga--agagtcag-gagggctaagccctcttgtagttct
                    Orangutan  aga--agagtcag-gagggctaagccctcttgcagttct
                       Gibbon  aga--agagtcag-gagggctaagccctcttgcagttct
                       Rhesus  aga--agagtcag-gagggctaagccctcttgcagttct
          Crab-eating macaque  aga--agagtcag-gagggctaagccctcttgcagttct
           Pig-tailed macaque  aga--agagtcag-gagggctaagccctcttgcagttct
               Sooty mangabey  aga--agagtcag-gagggctaagccctcttgcagttct
                       Baboon  aga--agagtcag-gagggctaagccctcttgcagttct
                 Green monkey  gga--agagtgag-gagggctaagccgtcttgcagttct
                        Drill  aga--agagtcag-gagggctaagccctcttgcggttct
             Proboscis monkey  aga--agagtgag-gagggctaagccctcttgcagttct
              Angolan colobus  aga--agagtgag-gagggctaagccctcttgcagttct
     Golden snub-nosed monkey  aga--agagtgag-gagggctaagccctcttgcagttct
      Black snub-nosed monkey  aga--agagtgag-gagggctaagccctcttgcagttct
                     Marmoset  aga--agagtcag-gagagctaagatctcttg-------
              Squirrel monkey  aga--agagtcag-gagggctaagatctcttg-------
          White-faced sapajou  aga--agagtcag-gagggctaagatctcttg-------
            Ma's night monkey  aga--agagtcag-gagggctaggatctcttg-------
                      Tarsier  gga--agtgtcag-gaggactaagccctgctgcaatttt
                  Mouse lemur  aga--agagtcag-gagggctaaattctcttgctgttct
            Coquerel's sifaka  aga--agagtcag-gagggctaagttctcttgcagttct
                  Black lemur  aga--agagtcgg-gagggcggagttttcctgcagttct
              Sclater's lemur  aga--agagtcgg-gagggcggagttttcctgcagttct
                     Bushbaby  gta--agagtcaa-gagggttacgttctctcacagtcct
                        Mouse  agg--aaagtcaa-aga----aagaactcttg-ggttca
                          Dog  agg--agaatcag-gatggttcaa-ccttttgcagtgcc
                    Armadillo  agaggagagtgagagatagctaaaccctcttcctgttct

Inserts between block 7 and 8 in window
                 Mouse lemur 551bp
           Coquerel's sifaka 473bp

Alignment block 8 of 48 in window, 91095331 - 91095442, 112 bps 
B D                     Human  gaaggcccactggacatttccccatagaggtctcaatggcaacttaaaaatcaatc-ttatcttctctat
B D                     Chimp  gaaggcccactggacatttccccatagaggtctcaaaggcaacttaaaaatcaatc-ttatcttctctat
B D                    Bonobo  gaaggcccactggacatttccccatagaggtctcaaaggcaactgaaaaatcaatc-ttatcttctctat
B D                   Gorilla  gaagacccactggacatttccccatagaggtctcaatggcaacttaaaaatcaatc-ttatcttctctat
B D                 Orangutan  gaaggcccactggacatttccccatagaggtctcaatggcaacttaaaaatcaatc-ttatcttctctat
B D                    Gibbon  gaaggcccactggacatttccccatagaggtctccatggcaacttaaaaatcaatc-ttatcttctctat
B D                    Rhesus  gaaggcccactggacatttccctatagaggtctcaatgacaacttaaaaatcaatc-ttatcttctctat
B D       Crab-eating macaque  gaaggcccactggacatttccctatagaggtctcaatgacaacttaaaaatcaatc-ttatcttctctat
           Pig-tailed macaque  gaaggcccactggacatttccctatagaggtctcaatgacaacttaaaaatcaatc-ttatcttctctat
               Sooty mangabey  gaaggcccactggacagttccctatagaggtctc----acaacttaaaaatcaatc-ttatcttctctat
                       Baboon  gaaggcccactggacagttccctatagaggtctcaatgacaacttaaaaatcaatc-ttatcttctctat
B D              Green monkey  gaaggcccactggacacttccctatagaggtctcaatgacaacttacaaatcaatc-ttctcttctctat
                        Drill  gaaggcccactggacagttccctatagaggtctcaatgacaacttaaaaatcaatc-ttatcttctctat
B D          Proboscis monkey  gaaggcccactggacatttccccatagaggtctcaatgacaacttaaaaatcaatc-ttatcttctctat
              Angolan colobus  gaaggcccactggacatttccccatagaggtctcaatgccaacttaaaaatcaatc-ttatcttctctat
B D  Golden snub-nosed monkey  gaaggcccactggacatttccccatagaggtctcaatgacaacttaaaaatcaatc-ttatcttctctat
      Black snub-nosed monkey  gaaggcccactggacatttccccatagaggtctcaatgacaacttaaaaataaatc-ttatcttctctat
B D                  Marmoset  ---------ctggacatttccccatagaggtctcaatggcaactcaaaaatcaatc-agatcttctctac
B D           Squirrel monkey  ---------ctggacatttccccatagaggtctcaatggcaactcaaaaatcaatc-agatcttctctac
          White-faced sapajou  ---------ctggacgtttccccagagaggtctcagtggcggctcaaaaatcaatc-agatcttctctat
            Ma's night monkey  ---------ctggacatttctccatagaggtttcaatggcaactcaaaaatcaatc-agatcttctctac
B D                   Tarsier  gacgggttgctggacatttccccaccgagggctcaatggcagttca-aaatcaaaa-atacctcctctcc
                  Black lemur  aacggccttctggacagttccccagggatgtcttaatggcaactca-atatcaata--tatctcttcccc
              Sclater's lemur  aacggccttctggacagttccccagggatgtcttaatggcaactca-atatcaata--tatctcttcccc
B D                  Bushbaby  -gatgccttctggatgtttccccaatggtgt----gtggaa--------atcaatc--gtcttcctctcc
B D                     Mouse  ggctgcctgctggacagttccccctgggtgtcttag-----atttaggagtggctc------ctcactgc
B D                       Dog  aactgcctactggacatgtccctgtggatgtctcagtggcaacccc-aaatcaagc-atatctcctctct
B D                 Armadillo  agtttcctgctggacatttctgctcagatgtttcaaaggtaattta-aaatcagtaatcacctccacttt
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================

                        Human  c--aaaggcactgctcctcttctagtccctgttatagttaatgct
                        Chimp  c--aaaggcactgctcctcttctagtccctgttatagttaatgct
                       Bonobo  c--aaaggcactgctcctcttctagtccctgttatagttaatgct
                      Gorilla  c--aaaggcactgctcctcttctagtccctgttatagttaatgct
                    Orangutan  c--aaaggcactgctcctcttctagtccctgttgtaattaatgct
                       Gibbon  c--aaaggcactgctcctcttctagtccctgttgtagttaatgct
                       Rhesus  c--aaaggcgctgctcctcttcgagtccccgttgtagttaatgct
          Crab-eating macaque  c--aaaggcgctgctcctcttcgagtccccgttgtagttaatgct
           Pig-tailed macaque  c--aaaggcgctgctcctcttcgagtccccgttgtagttaatgct
               Sooty mangabey  ctaagaggcgctgctcctcttcgagtccccgttgtagttaatgct
                       Baboon  c--aaaggcgctgctcctcttcgagtccccgttgtagttaatgct
                 Green monkey  c--aaaggcgctgctcctcttcgagtccccgttgtagttaatgct
                        Drill  c--aaaggcgctgcttctcttcgagtccccgttgtagttaatgct
             Proboscis monkey  c--aaaggcgctgctcatcttcgagtccccgttgtagttattgct
              Angolan colobus  c--aaaggcgctgctcgtcttcgagttcccgttgtagttaatgct
     Golden snub-nosed monkey  c--aaaggcgctgctcgtcttcgagtccccgttgtagttattgct
      Black snub-nosed monkey  c--aaaggcgctgctcgtcttcgagtccccgttgtagttattgct
                     Marmoset  c--aaaggtgctgttcctcttctagtccctgttgtagttaatgct
              Squirrel monkey  c--aaaggtaccgttcctcttctagtccctgttgtagttaatgct
          White-faced sapajou  c--aaaggtgctgttcctcttctagtccctgttgtagttaatgct
            Ma's night monkey  c--aaaggtgctgttcctcttctagtccctgttgtagttaatgct
                      Tarsier  c--aaaggtactgctgcttttctagtccctgctgtagttagcatt
                  Black lemur  t--aaaggtgctgctcctgttctagtccctgttgtagttaatgct
              Sclater's lemur  t--aaaggtgctgctcctgttctagtccctgttgtagttaatgct
                     Bushbaby  c--acaggtgcagctcctgtgctgggccctgtcacagagaatggt
                        Mouse  a--gcaggcatgat-------------------------------
                          Dog  c--aactgtgctccttctcttctagtccctattgtagttgataat
                    Armadillo  c--cattatgttgctctttttgtagtctatgttgtggtttatgat
                  Mouse lemur  =============================================
            Coquerel's sifaka  =============================================

Inserts between block 8 and 9 in window
                 Black lemur 204bp
             Sclater's lemur 204bp

Alignment block 9 of 48 in window, 91095443 - 91095647, 205 bps 
B D                     Human  aaccaaatctactaggtgcccaactgaaaactttaaagtg-aaagc----agatggagcttgagggtcat
B D                     Chimp  aaccaaatctactaggtgcccaactgaaaactttaaagtg-aaagc----agatggagcttgagggtcat
B D                    Bonobo  aaccaaatctactaggtgcccaactgaaaactttaaagtg-aaagc----agatggagcttgagggtcat
B D                   Gorilla  aaccaaatctactaggtgcccaactgaaaactttaaagtg-aaagc----agatggagcttgagggtcat
B D                 Orangutan  aaccaaatctactaggtgcccaactgaaaactttgaagtg-aaagc----agatggagcttgagggtcac
B D                    Gibbon  aaccaaatctactaggtgcccagctgaaaactttaaagtg-aaagc----agatggagcttgagggtcat
B D                    Rhesus  aaccaaa---tctaggtgcccagctgaaaactttaaagtg-aaagc----agaaggactttgagggtcat
B D       Crab-eating macaque  aaccaaa---tctaggtgcccagctgaaaactttaaagtg-aaagc----agaaggactttgagggtcat
           Pig-tailed macaque  aaccaaa---tctaggtgcccagctgaaaactttaaagtg-aaagc----agaaggactttgagggtcat
               Sooty mangabey  aaccaaa---tctaggtgcccagctgaaaactttaaagtg-aaagc----agaaggactttgagggtcat
                       Baboon  aaccaaa---tctaggtgcccagctgaaaactttaaagtg-aaagc----agaaggactttgagggtcat
B D              Green monkey  aaacaaa---tctaggtgcccagctgaaaactttaaagtg-aaagc----agaaggactttgagggtcat
                        Drill  aactaaatcttctaggtgcccagctgaaaactttaaagtg-aaagc----agaaggactttgagggtcat
B D          Proboscis monkey  aaccaaatcttctaggtgcccagctgaaaacttcaaagtg-aaagc----agatggactttgagggtcac
              Angolan colobus  aaccaaatcttctaggtgcccagctgaaaactttaaagtg-aaagc----agatggactttgagggttat
B D  Golden snub-nosed monkey  aaccaaatcttctaggtgcccagctgaaaactttaaagtg-aaagc----agatggactttgagggtcat
      Black snub-nosed monkey  aaccaaatcttctaggtgcccagctgaaaactttaaagtg-aaagc----agatggactttgagggtcat
B D                  Marmoset  aaccaagtctaccaggtgcccaac-aaaaactttaaagta-aaagc----agatggaccttgaggggcat
B D           Squirrel monkey  aaccaaatctaccaggtgcccaac-aaaaactttaaggta-aaagc----agatgggccttgaggggcat
          White-faced sapajou  aaccaaatctaccaggtgcccaac-aaaaactttaaagta-aaagc----agagggaccttgaggggcct
            Ma's night monkey  aaccaaatctaccaggtgcccaat-aaaaactttaaagta-aaagc----agatggatcttgaggggcat
B D                   Tarsier  agccatacctgtccggtgcccaactaaaaa-----aagct-aaagc----aggtgaactctgagaggcat
B D                  Bushbaby  gagcaggcctggtaggttcctcccc--agatttaaaagtc-aaa-t----agaggtactctgagagccac
B D                     Mouse  aagtgtgcttaccaggagcctgactgaaag---------g-aaagcccaaagctgaacaatgc-------
B D                       Dog  aaccccaactactgggtgcccagctaaaagcttaaaagct-aaggc----agatgtgctctgagaggcct
B D                 Armadillo  aatcccacc-actaggtatccaattaaaaacatcatcacacaaagc----agttgtatgcagagagatct
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================

                        Human  gtg-c-cctcacca-------ctggc--------------agtgatcttccatgcctctctg--------
                        Chimp  gtg-c-cctcacca-------ctggc--------------agggatcttccttgcctctctg--------
                       Bonobo  gtg-c-cctcacca-------ctggc--------------agggatcttccatgcctctctg--------
                      Gorilla  gtg-c-cctcacca-------ctggc--------------agggatcttccatgcctctctg--------
                    Orangutan  gtg-c-cctcacca-------ctggc--------------agggatcttccatgcctctctg--------
                       Gibbon  gtg-c-cctcacca-------ctggc--------------agggatcttccatgcctctctg--------
                       Rhesus  gtg-c-cctcacca-------ccggc--------------agggatcttccatgcctctctg--------
          Crab-eating macaque  gtg-c-cctcacca-------ccggc--------------agggatcttccatgcctctctg--------
           Pig-tailed macaque  gtg-c-cctcacca-------ccggc--------------agggatcttccatgcctctctg--------
               Sooty mangabey  gtg-c-cctcacca-------ccagc--------------agggatcttccatgcctctctg--------
                       Baboon  gtg-c-cctcacca-------ccagc--------------agggatcttccatgcctctctg--------
                 Green monkey  gtg-c-cctcacca-------ccggc--------------agggatcttccatgcctctctg--------
                        Drill  gtg-c-cctcacca-------ccagc--------------agggatcttccatgcgtctctg--------
             Proboscis monkey  gtg-c-cctcacca-------ccggc--------------agggatcttccatgcctctctg--------
              Angolan colobus  gtg-c-cctcacca-------ctggc--------------agggatcttccatgcccctctg--------
     Golden snub-nosed monkey  gtg-c-cctcacca-------ctggc--------------agggatcttccatgcctctctg--------
      Black snub-nosed monkey  gtg-c-cctcacca-------ctggc--------------agggatcttccatgcctctctg--------
                     Marmoset  gtg-c-cctcacca-------ctggc--------------agagatcctccatgcctctctgtcagaccc
              Squirrel monkey  gtg-c-ccttacca-------ctggc--------------agagatcttccatgcctctctgtaagaccc
          White-faced sapajou  gtg-c-cctcacca-------ctggc--------------agagatctcccatgcctctctgtaagaccc
            Ma's night monkey  gca-c-cctcacca-------ctggc--------------agagatcttccatgcctctctgtaagaccc
                      Tarsier  gtgtc-cctgaccaggtatccctggc--------------agggatctaccatgccactctgtcagatcc
                     Bushbaby  acg-t-ccctacct-------gcagg--------------caggatcatgtgtgtccctctg--------
                        Mouse  ----c-cctgatct-------cttgg--------------a-agctctgccacaccattgca--------
                          Dog  gt--t-ccagacct-------ctagg--------------aggaacctgccacgcatctccgtga-----
                    Armadillo  gta-tacctgacca-------ctggtgaggtcccactgggagggacccgccatgcctctgta--agatgc
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================

                        Human  -ggggccagag----agaca--acgctggtt-tccagaatg---ccagtgcgcaatca-cttcagtttg-
                        Chimp  -ggggccagag----agaca--acgctggtt-tccagaatg---ccagtgcacaatca-cttcagtttg-
                       Bonobo  -ggggccagag----agaca--acgctggtt-tccagaatg---ccagtgcgcaatca-cttcagtttg-
                      Gorilla  -ggggccagag----agaca--atgctggtt-tccagagtg---ccagtgcgcaatca-cttcagtttg-
                    Orangutan  -ggggccagag----agaca--acgctggtt-tccagaatg---ccagtgcacaatca-cttcagtttg-
                       Gibbon  -ggggccagag----agaca--acgctggtt-tccagaatg---ccagtgcgcgatca-cttcagtttg-
                       Rhesus  -ggggccagag----agaca--acactggtt-tccagaatg---ccagtatgcaatca-cttcagtttg-
          Crab-eating macaque  -ggggccagag----agaca--acactggtt-tccagaatg---ccagtacgcaatca-cttcagtttg-
           Pig-tailed macaque  -ggggccagag----agaca--acactggtt-tccagaatg---ccagtacgcaatca-cttcagtttg-
               Sooty mangabey  -ggggccagag----agaca--acactggtt-tccagaatg---ccagtacgcaatca-cttctgtttg-
                       Baboon  -ggggccagag----agaca--acactggtt-tccagaatg---ccagtacgcaatca-cttcagtttg-
                 Green monkey  -ggggccagag----agaca--acactggtt-tccagaatg---ccagtgcgcaatca-cttcagtttg-
                        Drill  -ggggccagag----agaca--acactggtt-tccagaatg---ccagtacgcaatca-cttcagtttg-
             Proboscis monkey  -ggggccagag----agaca--acactggtt-tccagaatg---ccagtgcgcaatca-cttcagtttg-
              Angolan colobus  -ggggccagag----agaca--acactggtt-tccaggatg---ccagtgcgcaatca-cttcagtttg-
     Golden snub-nosed monkey  -ggggccagag----agaca--acactggtt-tccagaatg---ccagtgcgcaatca-cttcagtttg-
      Black snub-nosed monkey  -ggggccagag----agaca--acactggtt-tccagaatg---ccagtgcgcaatca-cttcagtttg-
                     Marmoset  gagggtcggag----agaca--acgctggtt-tccagaacg---ccagtgcacaatca-cttcagtttg-
              Squirrel monkey  aagggtcagag----agaca--atgctggtt-tccagaacg---ccagtgtgcagtca-ctttactttg-
          White-faced sapajou  gagggtcagag----agaca--acgctggtt-tccagaacg---ccagtgcgcagtct-cttcagtttg-
            Ma's night monkey  gagggtcagag----agaca--acgctggtt-tccagaaca---ccagtgcgcagtta-cttcagtttg-
                      Tarsier  agggttcagag----agaca--acactggtt-tctagtagc---cccgtgcatggtca-cttcagttcat
                     Bushbaby  ---------------tacca--ctgccagt-----agaacc---ctcgtggacattcg-ccttggtttg-
                        Mouse  -ggagacacagcagaagaag--gagctatctgcccagagtc---ccag-gcacagtct-ttgcagatgg-
                          Dog  -gatgccacag----agagg--acactgatt-tctagcatggccccggtgcacaatca-cttcagtttg-
                    Armadillo  aagggtcagag----agagaggaaactggtt-tccagaacagc-ccaaggcaaaggaagcttcagttta-
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================

                        Human  taagtgttgatttgaatgcaaactacttt-----------------------------------------
                        Chimp  taagtgttgacttgaatgcaaactacttt-----------------------------------------
                       Bonobo  taagtgttgacttgaatgcaaactacttt-----------------------------------------
                      Gorilla  taagtgttgatttgaatgcaaactacttt-----------------------------------------
                    Orangutan  taagtgttgatttgaatgcaaactacttt-----------------------------------------
                       Gibbon  taagtgttgatctgaatgcaaactacttt-----------------------------------------
                       Rhesus  taagtgttgatttgaatgcaaactacttt-----------------------------------------
          Crab-eating macaque  taagtgttgatttgaatgcaaactacttt-----------------------------------------
           Pig-tailed macaque  taagtgttgatttgaatgcaaactacttt-----------------------------------------
               Sooty mangabey  taagtgttgatttgaatgcaaactacttt-----------------------------------------
                       Baboon  taagtgttgatttgaatgcaaactacttt-----------------------------------------
                 Green monkey  taagtgttgatttgaatgcaaactgcttt-----------------------------------------
                        Drill  taagtgttgatttgaatgcaaactacttt-----------------------------------------
             Proboscis monkey  tacgtgttgatttgaatgcaaactacttt-----------------------------------------
              Angolan colobus  tacgtgttgatttgaatgcaaactacttt-----------------------------------------
     Golden snub-nosed monkey  tacgtgttgatttgaatgcaaactacttt-----------------------------------------
      Black snub-nosed monkey  tacgtgttgatttgaatgcaaactacttt-----------------------------------------
                     Marmoset  taggtgttgctttgaacacaaactatttt-----------------------------------------
              Squirrel monkey  taggtattgctttgaacacaaactagttt-----------------------------------------
          White-faced sapajou  taggtattgctttgaacacaaactatttt-----------------------------------------
            Ma's night monkey  taggtattgctttgaacacaaactatttt-----------------------------------------
                      Tarsier  taggtgttgatttgaacacaaactgcttt-----------------------------------------
                     Bushbaby  tcggtgttta----------------ttt-----------------------------------------
                        Mouse  gaaatgctgttttgaatgaaaactgctttactggtgtctggtggctcatgtcttttatcccagcactcca
                          Dog  tacatgatggtatgaacac-aactgcttt-----------------------------------------
                    Armadillo  taggtgtagacttgaaaacaaactgcttt-----------------------------------------
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================

                        Human  gaatga-aaatgtaac
                        Chimp  gaatga-aaatgtaac
                       Bonobo  gaatga-aaatgtaac
                      Gorilla  gaatga-aaatgtaac
                    Orangutan  gaatga-aattgtaac
                       Gibbon  gaatga-aaatgtacc
                       Rhesus  gaacga-aaatgtaac
          Crab-eating macaque  gaacga-aaatgtaac
           Pig-tailed macaque  gaacga-aaatgtaac
               Sooty mangabey  gaacga-aaatgtaac
                       Baboon  gaacaa-aaatgtaac
                 Green monkey  gaacga-aaatgtaac
                        Drill  gaacga-aaatgtaac
             Proboscis monkey  gaacga-aaatgtaac
              Angolan colobus  gaacga-aaatgcaac
     Golden snub-nosed monkey  gaatga-aaatgtaac
      Black snub-nosed monkey  gaatga-aaatgtaac
                     Marmoset  gaatga-aaatgcaac
              Squirrel monkey  gaatga-aaatgcaac
          White-faced sapajou  gaatga-aaatgcaac
            Ma's night monkey  gaatga-aaatgcaac
                      Tarsier  aaatga-aaatgcaaa
                     Bushbaby  aactgg-caatgcaaa
                        Mouse  gaattc-aaggccagc
                          Dog  gagcag-agatgcaaa
                    Armadillo  aaatcagaaatgcaag
                  Mouse lemur  ================
            Coquerel's sifaka  ================
              Sclater's lemur  ================
                  Black lemur  ================

Inserts between block 9 and 10 in window
B D                    Mouse 1bp

Alignment block 10 of 48 in window, 91095648 - 91095658, 11 bps 
B D                     Human  tggtgtttaca
B D                     Chimp  tggtgtttaca
B D                    Bonobo  tggtgtttaca
B D                   Gorilla  tggtgtttaca
B D                 Orangutan  tggtgtttaca
B D                    Gibbon  tggtgtttaca
B D                    Rhesus  tggtgtttaca
B D       Crab-eating macaque  tggtgtttaca
           Pig-tailed macaque  tggtgtttaca
               Sooty mangabey  tggtgtttaca
                       Baboon  tggtgtttaca
B D              Green monkey  tggtgtttaca
                        Drill  tggtgtttaca
B D          Proboscis monkey  tggtgtttaca
              Angolan colobus  tggtgtttaca
B D  Golden snub-nosed monkey  tggtgtttaca
      Black snub-nosed monkey  tggtgtttaca
B D                  Marmoset  tggtgtttatg
B D           Squirrel monkey  tggtgtttata
          White-faced sapajou  tggtgtttata
            Ma's night monkey  tggtgtttata
B D                   Tarsier  tggtgtttaca
                  Black lemur  tggtatttaca
              Sclater's lemur  tggtatttaca
B D                  Bushbaby  cagtgtttaca
B D                     Mouse  tgg--tttaca
B D                       Dog  tggtgtttaca
B D                 Armadillo  tagtgcttata
                 Mouse lemur  ===========
           Coquerel's sifaka  ===========

Inserts between block 10 and 11 in window
B D                    Mouse 113bp

Alignment block 11 of 48 in window, 91095659 - 91095803, 145 bps 
B D                     Human  agaagta------------------tctacag-------gatgataataaccac----------------
B D                     Chimp  agaagta------------------tctacag-------gatgataataaccac----------------
B D                    Bonobo  agaagta------------------tctacag-------gatgataataaccac----------------
B D                   Gorilla  agaagta------------------tctacag-------gatgataataaccac----------------
B D                 Orangutan  agaagta------------------tctacag-------gatgataataaccac----------------
B D                    Gibbon  agaagta------------------tctacag-------gatgataataaccac----------------
B D                    Rhesus  agaagta------------------tctacag-------gatgataataacc-a----------------
B D       Crab-eating macaque  agaagta------------------tctacag-------gatgataataacc-a----------------
           Pig-tailed macaque  agaagta------------------tctacag-------gatgataataacc-a----------------
               Sooty mangabey  agaagta------------------tctacag-------gatgataataaccaa----------------
                       Baboon  agaagta------------------tctacag-------gatgataataaccga----------------
B D              Green monkey  agaagta------------------tctacag-------gatgataataaccac----------------
                        Drill  agaagta------------------tctacag-------gatgataataaccaa----------------
B D          Proboscis monkey  agaagta------------------tctacag-------gatgataataaccac----------------
              Angolan colobus  agaagta------------------tctacag-------gatgataataaccac----------------
B D  Golden snub-nosed monkey  agaagta------------------tctacag-------gatgataataaccac----------------
      Black snub-nosed monkey  agaagta------------------tctacag-------gatgataataaccac----------------
B D                  Marmoset  aaaagta------------------tctacag-------gataataatagccac----------------
B D           Squirrel monkey  aaaagta------------------tctacag-------aatgataatagccac----------------
          White-faced sapajou  aaaaata------------------tctacag-------gatgataatagccag----------------
            Ma's night monkey  aaaagta------------------tctacag-------gatgataatagccac----------------
B D                   Tarsier  aagataa------------------tctacag-------gaggaaaatagctat----------------
                  Black lemur  aaaagta------------------tctacag-------gatgacaatagcca-----------------
              Sclater's lemur  aaaagta------------------tctacag-------gatgacaatagcca-----------------
B D                  Bushbaby  gaaagta------------------tctatag-------catgaaaatagccactggataa---------
B D                     Mouse  agaaatagagaaacaaagattttcctcaacagacacacaaatgatactaacagaaaaaaaaattctatag
B D                       Dog  --aagta------------------tctacag-------gataaaaatagctgt----------------
B D                 Armadillo  -aatgta------------------tttacag-------gatgaaaatatccaa----------------
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================

                        Human  ------------ttttttttccccttaaaccaaactatacctcatcttgggtaatttatgaattgcgatt
                        Chimp  ------------ttttttttccccttaaaccaaactatacctcatcttgggtaatttatgaattgcgatt
                       Bonobo  -------------tttttttccccttaaaccaaactatacctcatcttgggtaatttatgaattgcgatt
                      Gorilla  -------------tttttttccccttaaaccaaactatacctcatcttgggtaatttatgaattgcgatt
                    Orangutan  -------------ttttttttcccttaaaccaaactatacctcatcttgggtaatttatgaattgcgatt
                       Gibbon  -----------ttttttttttcctttaaaccaaactatacctcatcttgggtaatttatgaattgcgatt
                       Rhesus  -------------cttttttttccttgaaccaaactgtacctcatcttgggtaatttatgaattgcgatt
          Crab-eating macaque  -------------cttttttttccttgaaccaaactgtacctcatcttgggtaatttatgaattgcgatt
           Pig-tailed macaque  -------------cttttttttccttgaaccaaactgtacctcatcttgggtaatttatgaattgcgatt
               Sooty mangabey  -------------tttttttttccttgaaccaaactgtacctcatcttgggtaatttatgaattgcgatt
                       Baboon  -------------tttttttttccttgaaccaaactgtacctcattttgggtaatttacgaattgcgatt
                 Green monkey  ----------ttttttttttttccttgaaccaaaccgtacctcatcttgggtaatttatgaattgcgatt
                        Drill  -------------tttttttttccttgaaccaaactgtacctcatcttgggtaatttatgaattgcgatt
             Proboscis monkey  --------------ttttttttccttgaaccaaactgtacctcatcttgggtaatttatgaattgcgatt
              Angolan colobus  -------------tttttttttccttgaaccaaactgtacctcatcttgggtaatttatgaattgcgatt
     Golden snub-nosed monkey  -------------tttttttttccttgaaccaaactgtacctcatcttgggtaatttatgaattgcgatt
      Black snub-nosed monkey  -------------tttttttttccttgaaccaaactgtacctcatcttgggtaatttatgaattgcgatt
                     Marmoset  --------------tttcttttccttgaactag-----acctcatcttaggtaatttatgaattgtgatt
              Squirrel monkey  --------------tttcttttccttgaactag-----acctcatcttgggtaatttatgaattgtgatt
          White-faced sapajou  --------------tttcttttccttgaattag-----acctcatcttgggtaatttatgaattgtgatt
            Ma's night monkey  --------------tttcttttccttgaactag-----acctcatcttgggtaatttatgaattgtgatt
                      Tarsier  --------------ttttgttttcctgagccaaagtgtatcttaccttgggtaatttaagaattgtaatc
                  Black lemur  ----------------ttttccccctgaaccaaagtatactttatcttgaataatttaagaattgtgatt
              Sclater's lemur  ----------------ttttccccctgaaccaaagtatactttatcttgaataatttaagaattgtgatt
                     Bushbaby  ---gaatagctatctcttctttccctgagccaaagtgtactttatcttggacagtttaagaactgtgatt
                        Mouse  cataaaaaaaaaatctgttttgctctgaatgaaagcaaatgttacctcagataatttaaggattatgatt
                          Dog  -----------------cttcttattgacc--aagtatatcttatgttgggcaatttaagaattgtgatt
                    Armadillo  --------------ttttattttctaaag---gagtattcctaacctggggcaatttaagtattgtgact
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================

                        Human  atg-aaaggtga-taataaataatatggattttt-ac-taaatttttactcaactttctcac
                        Chimp  atgaaaaggtga-taataaataatatggattttt-ac-taaatttttactcaactttctcac
                       Bonobo  atgaaaaggtga-taataaataatatggactttt-ac-taaatttttactcaactttctcac
                      Gorilla  atgaaaaggtga-taataaataatatggattttt-ac-taaatttttactcaactttctcac
                    Orangutan  atgaaaaggtga-taataaataatatggattttt-ac-taaatttttcttcaactttctcac
                       Gibbon  atgaaaaggtga-taataaataat-tggattttt-ac-caaattttcactcaactttctcac
                       Rhesus  atgaaaaggtga-t----aataatatggattttttac-taaatttttactcaactttctcac
          Crab-eating macaque  atgaaaaggtga-t----aataatatggattttttac-taaatttttactcaactttctcac
           Pig-tailed macaque  atgaaaaggtga-t----aataatatggatttttaac-taaatttttactcaactttctcac
               Sooty mangabey  atgaaaaggtga-t----aataatatggattttttac-taaatttttactcaactttctcac
                       Baboon  atgaaaaggtga-t----aataatatggattttttac-taaatttttactcaactttcttac
                 Green monkey  atgaaaaggtga-t----aataatatggattttttac-taaatttttactcaactttctcgc
                        Drill  ataaaaaggtga-t----aataatatggattttttac-taaatttttactcaactttctcac
             Proboscis monkey  atgaaaaggtga-t----aataatacggatttttaaagtaaatttttactcaactttctcac
              Angolan colobus  ttgaaaaggtga-t----aataatatggattttttac-taaatttttactcaactttctcac
     Golden snub-nosed monkey  atgaaaaggtga-t----aataatatggatttttttagtaaatttttactcaactttctcac
      Black snub-nosed monkey  atgaaaaagtga-t----aataatatggatttttttagtaaatttttactcaactttctcac
                     Marmoset  atgaagaggcaa-taataaataatatagatttttacc---aatttttactcaccttttccac
              Squirrel monkey  atgaagaggcaa-tcataaataatatag-tttttacc---aatttttactcaccttttctac
          White-faced sapajou  atgaagaggca----ataaatcatataaatttttacc---aaattttactcactttttccac
            Ma's night monkey  atgaagaggcaa-taataaataatatatattttttcc---aaattgtactcaccttttccac
                      Tarsier  atggaaaagtaa-taataaatgatattgattttt-ac-t-aatttttactctcctttc-cat
                  Black lemur  atgaaaaggcaattgagaaatgattatgattttt-ac-t-aattttcattctccttttccat
              Sclater's lemur  atgaaaaggcaattaagaaatgattatgattttt-ac-t-aattttcattctccttttccat
                     Bushbaby  atgaaaaggcaa-aaggaagtgataatgattttt-ac-t-gattttcactctggttttccat
                        Mouse  atg-aaatgcaa-tcattaac-atgctgacttt--ga-tgaattttaactttgat-------
                          Dog  atggaaaggcaa-tggtaaattatatagattttt-ac-t-gatttttgccccccttttcctt
                    Armadillo  ctgaaaagatgg-tagaaaacaatttttaatttt-ac-t-aatgtt--ctccacttttccat
                  Mouse lemur  ==============================================================
            Coquerel's sifaka  ==============================================================

Alignment block 12 of 48 in window, 91095804 - 91095865, 62 bps 
B D                     Human  ctttgctttatcatcttcagttagcaataaaa-ttttatgagttgaaaaatgacagtatcttt
B D                     Chimp  ctttgctttatcatcttcagttagcaataaaa-ttttatgagttgaaaaatgacagtatcttt
B D                    Bonobo  ctttgctttatcatcttcagttagcaataaaa-ttttatgagttgaaaaatgacagtatcttt
B D                   Gorilla  ctttgctttatcatcttcagttagcaataaaa-ttttatgagttgaaaaatgacagtatcttt
B D                 Orangutan  ctttgctttatcatcttcagttagcaataaaa-tgttatgagttgaaaaatgacagtatcttt
B D                    Gibbon  ctttgctttatcatcttcagttagcaataaaa-ttttatgagttgagaaatgacagtatcttt
B D                    Rhesus  ctttgctttatcatcttcagttggcaataaaa-ttttatgagttgagaaatgacagtatcttt
B D       Crab-eating macaque  ctttgctttatcatcttcagttggcaataaaa-ttttatgagttgagaaatgacagtatcttt
           Pig-tailed macaque  ctttgctttatcatcttcagttggcaataaaa-ttttatgagttgagaaatgacagtatcttt
               Sooty mangabey  ctttgctttatcatcttcagttggcaataaaa-ctttatgagttgagaaatgacagtatcttt
                       Baboon  ctttgctttatcatcttcagttggcaataaaa-ctttatgagttgagaaatgacagtatcttt
B D              Green monkey  ctttgctttatcatcttcagttggcaataaaa-ttttatgagttgagaaatgacagtatcttt
                        Drill  ctttactttatcatcttcagttggcaataaaa-ctttatgagttgagaaatgacagtatcttt
B D          Proboscis monkey  ctttgctttatcatcttcagttggcaataaga-ttttatgagttgagaaatgacagtatcttt
              Angolan colobus  ctttgctttatcatcttcagttggcaataaaa-ttttatgagttgagaaatgacagtatcttt
B D  Golden snub-nosed monkey  ctttgctttatcatcttcagttggcaataaaa-ttttatgagttgagaaatgacagtatcttt
      Black snub-nosed monkey  ctttgctttatcatcttcagttggcaataaaa-ttttatgagttgagaaatgacagtatcttt
B D                  Marmoset  ctttgctttatcatcttcagttaacaataaaa-ttttatgagttgagaaacagcagtatcttt
B D           Squirrel monkey  ctttgctttatcatcttcagttagcaataaaa-ttttatgagttgagaaacagcagtatcttt
          White-faced sapajou  ctttgctttatcatcttcagttagcaatcaaa-ttttatgagttgagaaacagcagtatcttt
            Ma's night monkey  ctttgctttatcatcttcagtgagcaataaaa-t----tgagttgagaaacagcagtatcttt
B D                   Tarsier  ctttgctttatcgtcttcagtttgctatacaa-ttttatgacttgaggaatggtagtatctgt
            Coquerel's sifaka  ctttgctgtatcactttcaggtagcaataaaa-ttctgtgcattgaggaatggcaatatctat
                  Black lemur  ctttgctttaccacattcagatagcaataaaa-ttctgtgcattgagagacggcaatatctgt
              Sclater's lemur  ctttgctttaccacattcagatagcaataaaa-ttctgtgcattgagagatggcaatatctgt
B D                  Bushbaby  ctttgctttatcactttcagataggaataaaatttctgtgagttgagcaatggcaacatctat
B D                     Mouse  ctcatctttaccacactcagtaagc----aga-ttcgatcaggtgaagagaggtgatcagtct
B D                       Dog  cttcgctatatcacattccattagtactaaaa-ttttatgagtggaagaatggcagtatctct
B D                 Armadillo  ctttgctttatcaccttcatttagcagttcaa-ttttttgagttgaggcatggcagtatcagt
                 Mouse lemur  ===============================================================

Inserts between block 12 and 13 in window
B D                Orangutan 428bp
B D                    Mouse 2bp

Alignment block 13 of 48 in window, 91095866 - 91095889, 24 bps 
B D                     Human  --gacaatcc-ctaattttttgaccga
B D                     Chimp  --gacaatcc-ctaattttttgaccga
B D                    Bonobo  --gacaatcc-ctaattttttgaccga
B D                   Gorilla  --gacaatcc-ctaattttttgaccga
B D                 Orangutan  --gacaatcc-ctaa-tttttgaccga
B D                    Gibbon  --gacaatcc-ctaatttgtttaccga
B D                    Rhesus  --gacaatcc-ctaattttttgaccga
B D       Crab-eating macaque  --gacaatcc-ctaattttttgaccga
           Pig-tailed macaque  --gacaatcc-ctaattttttgaccga
               Sooty mangabey  --gacaatcc-ctaattttttgaccga
                       Baboon  --gacaatcc-ctaattttttgaccga
B D              Green monkey  --gataatcc-ctaattttttgactga
                        Drill  --gacaatcc-ctaattttttgaccga
B D          Proboscis monkey  --gacaatcc-ctaattttttgaccga
              Angolan colobus  --gacaatcc-ctaattttttgaccga
B D  Golden snub-nosed monkey  --gacaatcc-ctaattttttgaccga
      Black snub-nosed monkey  --gacaatcc-ctaattttttgaccga
B D                  Marmoset  --gataatcc-ctaa-tttttgaccaa
B D           Squirrel monkey  --gacaatcc-ctaa-tttttgacgga
          White-faced sapajou  --gacaatcc-ctaa-tttttgaccga
            Ma's night monkey  --gacaatcc-ctaa-tttttgaccaa
B D                   Tarsier  --gacagtcc-cttatttcttgactga
            Coquerel's sifaka  --gacagccc-ct-atttcttgactag
                  Black lemur  --gacagccc-ct-atttcttgactag
              Sclater's lemur  --gacagccc-ct-atttcttgactag
B D                  Bushbaby  --gacagcccttt-atttcttgacta-
B D                     Mouse  --gatagacc-ctcatttcatgactga
B D                       Dog  --gccaggta-cctattttttgactgg
B D                 Armadillo  gagagtattc-tttatctcttgactgg
                 Mouse lemur  ===========================

Alignment block 14 of 48 in window, 91095890 - 91095998, 109 bps 
B D                     Human  ctttgaccttgtgtaccaaacaactttcttgaggataagagtaacagtagattctctgttgagttt--cc
B D                     Chimp  ctttgaccttgtgtaccaaacaactttcttgaggataagagtaacagtagattctctgttgagttt--cc
B D                    Bonobo  ctttgaccttgtgtaccaaacaactttcttgaggataagagtaacagtagattctctgttgagttt--cc
B D                   Gorilla  ctttgaccttgcgtaccaaacaactttcttgaggataagagtaacagtagattctctgttgagttt--cc
B D                 Orangutan  ctttgaccttgtgtaccaaacaactttcgtgaggataagagtaacagtagattctctgttgagttt--cc
B D                    Gibbon  ctttgaccttgtgtaccaaacaactttcttgaggataagagtaacagtagattctctgttaagttt--cc
B D                    Rhesus  ctttgaccttgtgtaccaaacaaccttcttgaggataagagtaacagtagattccctgttgaggtt--cc
B D       Crab-eating macaque  ctttgaccttgtgtaccaaacaaccttcttgaggataagagtaacagtagattccctgttgaggtt--cc
           Pig-tailed macaque  ctttgaccttgtgtaccaaacaaccttcttgaggataagagtaacagtagattccctgttgaggtt--cc
               Sooty mangabey  ctttgaccctgtgtaccaaacaaccttcttgagcataagagtaacagtagattccctgtcgaggtt--cc
                       Baboon  ctttgaccctgtgtaccaaacaaccttcttgagcataagagtaacagtagattccctgtcgaggtt--cc
B D              Green monkey  ctttgaccttgtgtaccaaacaaccttcttgaggataagagtaacagtagattccctgttgaggtt--cc
                        Drill  ctttgaccttgtgtaccaaacaaccttcttgagcataagagtaacagtagattccctgtcgaggtt--cc
B D          Proboscis monkey  ctttgaccttgtgtaccaaacaaccttcttgaggataagagtaacagtagattccctgttgaggtt--cc
              Angolan colobus  ctttgaccttgtgtaccaaacaaccttcttgaggataagagtaacagtagattccctgttgaggtt--cc
B D  Golden snub-nosed monkey  ctttgaccttgtgtaccaaacaaccttcttgaggataagagtaacagtagattccctgttgaggtt--cc
      Black snub-nosed monkey  ctttgaccttgtgtaccaaacaaccttcttgaggataagagtaacagtagattccctgttgaggtt--cc
B D                  Marmoset  gtttgaccttgtgtaccaaacaaccttcttgaggataagagtagcagtagattctctgttgaggct--tc
B D           Squirrel monkey  gtttgaccttgtgtaccaaacaacctacttgaggataagagtagcagtagattctctgttgaggct--cc
          White-faced sapajou  gtttgaccttgtgtaccaaacaacctac-tgaggataagagtagcagtagattctccgatgaggct--cc
            Ma's night monkey  attcgaccttgtgtaccaaacaaccttcttgaggataagagtagcagtagattctctgttgaggct--cc
B D                   Tarsier  ctttgaccttgtgtaccagatgaacttcttgaagacacaagtgacagtagattctctgttgagatt--cc
                  Mouse lemur  ctttgaccttgtataccaaacaacctccttggagatacaagtgacagccgattctctgttcagatt--cc
            Coquerel's sifaka  ctttgaccttgtataccagacaaccttcctgaagatacaagtgacagcagattctctgttgagatt--cc
                  Black lemur  ttttgaccttgtatacca-acaaccttcttggagatacaagtgacagtcgattctctgttgagatt--cc
              Sclater's lemur  ttttgaccttgtatacca-acaaccttcttggagatacaagtgacagtcgattctctgttgagatt--cc
B D                  Bushbaby  gtttgaccttgtataccaaacaaccttcttgaggatacaaatgaca---gattttctgttgagatt--cc
B D                     Mouse  ttttgagcccatggacaagcttttgtttgggaggaca----taactatacatt-----ttaaga------
B D                       Dog  ctttgactttggataccaagcaaccttcttgagaatgcaagtgacagg----tctctgttgagattcccc
B D                 Armadillo  ctttgaccttgtttacccaacaaccttctggaggattaaagagaca---gattctctgttgagatt--tc

                        Human  ccacaggcctgtctatagc--------agagctgtggctcctgcaattt
                        Chimp  ccacaggcctgtctatagc--------agagctgtggctcctgcaattt
                       Bonobo  ccacaggcctgtctatagc--------agagctgtggctcctgcaattt
                      Gorilla  ccacaggcctgtctatagc--------agagctgtggctcctgcagttt
                    Orangutan  tcacaggcctgtctatagc--------agagctgtggct-ctgcaattt
                       Gibbon  ccacagccctgtctatagc--------agagctgtggctcttgcaattt
                       Rhesus  ccacaggcctgtctacagc--------agagctgtggctcctgcaattt
          Crab-eating macaque  ccacaggcctgtctacagc--------agagctgtggctcctgcaattt
           Pig-tailed macaque  ccacaggcctgtctacagc--------agatctgtggctcctgcaattt
               Sooty mangabey  ccacaggcctgtctacagc--------agagctgtggctcctgcaattt
                       Baboon  ccacaggcctgtctacagc--------agagctgtggctcctgcaattt
                 Green monkey  ccacaggcctgtctacagc--------agagctgtggctcctgcagttt
                        Drill  ccacaggcctgtctacagc--------agagctgtggctcctgcaattt
             Proboscis monkey  ccacaggcctgtctacagc--------agaactgtggctcctgcaattt
              Angolan colobus  ccacaggcctgtctacagt--------agaactgtggctcttgcaattt
     Golden snub-nosed monkey  ccacaggcctgtctacagc--------agaactgtggctcctgcaattt
      Black snub-nosed monkey  ccacaggcctgtctacagc--------agaactgtggctcctgcaattt
                     Marmoset  ccacaggcctgtcaattgc--------agacctgtggttcctgcagttt
              Squirrel monkey  ccattggcctgtcaatagc--------agagctgtggctcctgcaattt
          White-faced sapajou  ccacaggcctgtcaatagc--------agagctgtggctcctgcagttt
            Ma's night monkey  tcacaggcctgtcaatagc--------agagctgtggctcctgcaattt
                      Tarsier  ccataggcctgtctgcagc--------agagtcgtggctcctgcgattt
                  Mouse lemur  ccacaggcctgtctggggc--------agagctgtggctcttgcagttt
            Coquerel's sifaka  ccacaggcctgtctgtggt--------agagctgtggctcttgcagttt
                  Black lemur  ccacaggcctgtctatggt--------agagctgtggctcttgcagttt
              Sclater's lemur  ccacaggcctgtctatggt--------agagctgtggctcttgcagttt
                     Bushbaby  cca-aggcctgtctgtggg--------agagctgtgcctcttgtaattt
                        Mouse  actcaggcctgtccatgcttctgctaaagaggtagcgtccattaaag--
                          Dog  ccgcaggcctgtctgtggc--------aaagcgctggctcctgtgattt
                    Armadillo  ctacaaccctggctgtggc--------agagaagtagcttctgccattt

Inserts between block 14 and 15 in window
                 Mouse lemur 73bp

Alignment block 15 of 48 in window, 91095999 - 91096072, 74 bps 
B D                     Human  tatcatgctcactcccaattccatcaaca-gtgccatcaattattctttatgtcacga---tact-aaga
B D                     Chimp  tatcatgctcactcccaattccatcaaca-gtgccatcaattattatttatgtcacga---tact-aaga
B D                    Bonobo  tatcatgctcactcccaattccatcaaca-gtgccatcaattattatttatgtcacga---tact-aaga
B D                   Gorilla  tatcatgctcactcccaattccatcaaca-gtgccatcaattattctttatgtcacga---tact-aaga
B D                 Orangutan  gatcatgttcactcccaattccatcaaca-gtgccatcaattattctttatgtcacga---tact-aaga
B D                    Gibbon  gatcatgctcactctcaattccatcaaca-gtgccatcaattattctttatgtcacga---tgct-aaga
B D                    Rhesus  gatcatgctcactccgaattccatcaaca-gtgccatcaattattctttaagtcacga---gact-gaga
B D       Crab-eating macaque  gatcatgctcactccgaattccatcaaca-gtgccatcaattattctttaagtcacga---gact-gaga
           Pig-tailed macaque  gatcatgctcactccaaattccatcaaca-gtgccatcaattattctttaagtcacga---gact-gaga
               Sooty mangabey  gatcatgctcactccgaattccatcaaca-gtgccatcaattattctttaagtcacga---gact-gaga
                       Baboon  gatcatgctcactccgaattccatcaaca-gtgccatcaattattctttaagtcacga---gact-gaga
B D              Green monkey  gatcatgcttactccgaattccatcaaca-gtgccatcaattattctttaagtcacga---gact-gaga
                        Drill  gatcatgctcactccgaattccatcaaca-gtgccatcaattattctttaagtcacga---gact-gaga
B D          Proboscis monkey  gatcatgctcactccaaattccatcaaca-gtgccatcaattattctttaagtcacga---gact-gaga
              Angolan colobus  gatcatgctcactccgaattccatcaaca-gtgccatcaattattctttaagtcacca---gact-gaga
B D  Golden snub-nosed monkey  gatcatgctcactccaaattccatcaaca-gtgccatcaattattctttaagtcacga---gact-gaga
      Black snub-nosed monkey  gatcatgctcactccaaattccatcaaca-gtgccatcaattattctttaagtcacga---gact-gaga
B D                  Marmoset  gatcatgctcgctcctaattctgtcaaca-gtgccatcaattattcttt--gtcttga---tact-aaga
B D           Squirrel monkey  gatcatgctcactcctaattccatcaaca-gtgccgtcaattattcttt--gtcatga---tact-aaga
          White-faced sapajou  gatcatgctcactcctaattccatcaaca-gtgccatcaactattcttt--gtcatga---tact-aaga
            Ma's night monkey  gatcatgctcactcctaattccatcaaca-gtgccatcaagtattcttt--gtcatga---tact-aaga
B D                   Tarsier  aatcacactcattcttaattccatcagtg-gtgcctttaaagattctttaagtcatga---ggctagaga
            Coquerel's sifaka  aatcctgcttgctcttaattccatcagca-gtgccatcaatgattgtttaagccatga---ggctggaga
                  Black lemur  aatcctgctcactcttaatgccatcagcg-gtgccatcaatgattgtttaagccatga---gactggaga
              Sclater's lemur  aatcctgctcactcttaatgccatcagcg-gtgccatcaatgattgtttaagccatga---gactggaga
B D                  Bushbaby  aatcctgctcactcttcctcccatcagca-gtgccatcagtgattgtttaagccataa---gagtggaga
B D                     Mouse  --tcacattaatacttacatttctcaataggctttaccgataactctaaatgac-tgg---agca-gaga
B D                       Dog  aatcatgcccattcttaattgcatcaaca-gttctaccaatgatttcttatatcatta---cactagaga
B D                 Armadillo  catcatgctctttcttaatttcatcaaga-ggtccaccaacaattcttaaagtcatcaagtgattagaaa
                 Mouse lemur  ======================================================================

                        Human  caatcagtg
                        Chimp  caatcagtg
                       Bonobo  caatcagtg
                      Gorilla  caatcagtg
                    Orangutan  caatcagtg
                       Gibbon  caatcagtg
                       Rhesus  cactcagtg
          Crab-eating macaque  cactcagtg
           Pig-tailed macaque  cactcagtg
               Sooty mangabey  cactcagtg
                       Baboon  cactcagtg
                 Green monkey  cactcagtg
                        Drill  cactcagtg
             Proboscis monkey  cactcagtg
              Angolan colobus  cactcagtg
     Golden snub-nosed monkey  cactcagtg
      Black snub-nosed monkey  cactcagtg
                     Marmoset  cattcagtg
              Squirrel monkey  cattcagtt
          White-faced sapajou  cattcagtg
            Ma's night monkey  cattcagtg
                      Tarsier  caatctgtt
            Coquerel's sifaka  tgatcgatt
                  Black lemur  tgattgatt
              Sclater's lemur  tgattgatt
                     Bushbaby  tgatcaatt
                        Mouse  ataccaacc
                          Dog  tgatcagtt
                    Armadillo  ctattgact
                  Mouse lemur  =========

Alignment block 16 of 48 in window, 91096073 - 91096115, 43 bps 
B D                     Human  atttccaagacttttcaagcttacccatttcaaa-gattaggtg
B D                     Chimp  atttccaagacttttcaagcttacccatttcaaa-gattaggtg
B D                    Bonobo  atttccaagacttttcaagcttacccatttcaaa-gattaggtg
B D                   Gorilla  atttccaagacttttcaagcttacccatttcaaa-gattaggtg
B D                 Orangutan  atttccaagacttttcaagcttacccatttcaaa-gattaggtg
B D                    Gibbon  atttccaagacttttcaagcttacccacttcaaa-gattaggtg
B D                    Rhesus  atttccaagacttttcaagcttacccatttcaaa-gattaggtg
B D       Crab-eating macaque  atttccaagacttttcaagcttacccatttcaaa-gattaggtg
           Pig-tailed macaque  atttccaagacttttcaagcttacccatttcaaa-gattaggtg
               Sooty mangabey  atttccaagacttttcaagcttacccatttcaaa-gattaggtg
                       Baboon  atttccaagacttttcaagcttacccatttcaaa-gattaggtg
B D              Green monkey  atttccaagacttttcaagcttacccatttcaaa-gattgggtg
                        Drill  atttccaagacttttcaagcttacccatttcaaa-gattaggtg
B D          Proboscis monkey  atttccaagactttttaagcttatccatttcaaa-gattaggtg
              Angolan colobus  atttccaagactttttaagcttacccatttcaaa-gattaggtg
B D  Golden snub-nosed monkey  atttccaagactttttaagcttatccatttcaaa-gattaggtg
      Black snub-nosed monkey  atttccaagactttttaagcttatccatttcaaa-gattaggtg
B D                  Marmoset  atttccaagacttttaaagcctgcccatttcaaa-gattaggtg
B D           Squirrel monkey  atttccaagacttttaaagcctgcccatttcaaa-gattaggtg
          White-faced sapajou  atttccaagagttttaaagcctacccatttcaaa-gattaggtg
            Ma's night monkey  atttccaagacttttaaagcctgcccatttcaaa-gattaggtg
B D                   Tarsier  gtttcaaagactgttcaagtttgcgtatctcaaa-gattagctg
                  Mouse lemur  atttccaagactggtcaagcttgcccatttcaaa-gattaggtg
            Coquerel's sifaka  atttccaagaccgattgagcttgcccatttcaaa-gattaggtg
                  Black lemur  atttccaagactggtcaaccttgcccatttcaaa-gattaggtg
              Sclater's lemur  atttccaagactggtcaaacttgcccatttcaaa-gattaggtg
B D                  Bushbaby  atttccaagactgggcaaacgtccccattttaaa-ggttaggtg
B D                     Mouse  atctccaagatttttcatgttttttttttcca-----ttaggtg
B D                       Dog  atttccaacactgcttagacttgcccattttaaa-gggtgggct
B D                 Armadillo  atttcccagatgactcaaaattgcccatttctaatgattaggtg

Inserts between block 16 and 17 in window
                 Mouse lemur 38bp

Alignment block 17 of 48 in window, 91096116 - 91096141, 26 bps 
B D                     Human  tcctggtttt-cttttctgggcaatga
B D                     Chimp  tcctggtttt-cttttctgggcaatga
B D                    Bonobo  tcctggtttt-cttttctgggcaatga
B D                   Gorilla  tcctggtttt-gttttctgggcaatga
B D                 Orangutan  tcctcgtttt-cttttctgggcaatga
B D                    Gibbon  tcctggtttt-cttttctgggcaatga
B D                    Rhesus  tcctggtttt-cttttctgggcaatga
B D       Crab-eating macaque  tcctggtttt-cttttctgggcaatga
           Pig-tailed macaque  tcctggtttt-cttttctgggcaatga
               Sooty mangabey  tcctggtttt-cttttctgggcaatga
                       Baboon  tcctggtttt-cttttctgggcaatga
B D              Green monkey  tcctggtttt-cttttctgggcagtga
                        Drill  tcctggtttt-cttttctgggcaatga
B D          Proboscis monkey  tcctggtttt-cttttctgggcaatga
              Angolan colobus  tcctggtttt-cttttctgggcaatga
B D  Golden snub-nosed monkey  tcctggtttt-cttttctgggcaatga
      Black snub-nosed monkey  tcctggtttt-cttttctgggcaatga
B D                  Marmoset  acctgattttccttttctgagccatga
B D           Squirrel monkey  acctggtttttcttttctgggccatga
          White-faced sapajou  acctggtttttcttttctgggtcatga
            Ma's night monkey  acctggttttttttttctgggccatga
B D                   Tarsier  a---ggtttt-cttttctgagccatag
            Coquerel's sifaka  acctagtttt-cttttctgagccgtgc
                  Black lemur  accgagtttt-cgtttctgagccatgc
              Sclater's lemur  acctagtttt-catttctgagccatgc
B D                  Bushbaby  acctactagt---tttctgagtgaggt
B D                     Mouse  -acttgcttt-tcattctgaa------
B D                       Dog  cacctgtttt-tttttctgagtcatga
B D                 Armadillo  acctggtttt-ctttcatgagccatgg
                 Mouse lemur  ===========================

Inserts between block 17 and 18 in window
B D                Armadillo 475bp

Alignment block 18 of 48 in window, 91096142 - 91096172, 31 bps 
B D                     Human  ctctatattttagat-actttagtttaagtgt
B D                     Chimp  ctctatattttagat-actttagtttaagtgt
B D                    Bonobo  ctctatattttagat-actttagtttaagtgt
B D                   Gorilla  ctctatattttagat-actttagtttgagtgt
B D                 Orangutan  ctctatattttagat-actttagtttaagtgt
B D                    Gibbon  ctctatattttagat-actttagtttgagtgt
B D                    Rhesus  ctctatattgtagat-actttagtttaagtgt
B D       Crab-eating macaque  ctctatattgtagat-actttagtttaagtgt
           Pig-tailed macaque  ctctatattgtagat-actttagtttaagtgt
               Sooty mangabey  ctctatattgtagat-actttagtttatgtgt
                       Baboon  ctctatattgtagat-actttagtttaagtgt
B D              Green monkey  --ctatattttagat-actttagtttaagtgt
                        Drill  ctctatattgtggat-actttagtttaagtgt
B D          Proboscis monkey  ctctatattttagat-actttagtttaagtgt
              Angolan colobus  ctctatattttagat-actttagtttaagtgt
B D  Golden snub-nosed monkey  ctctatattttagat-actttagtttaagtgt
      Black snub-nosed monkey  ctctatattttagat-actttagtttaagtgt
B D                  Marmoset  ctctatattttagat-acttta-----agtga
B D           Squirrel monkey  ctctatattttagat-acttta-----agtgc
          White-faced sapajou  ctctatattttagat-acttta-----agtgc
            Ma's night monkey  ctctatattttagat-acttta-----agtgc
B D                   Tarsier  ctctatattttagataacttttgtttaagtgc
            Coquerel's sifaka  ctccagatttcggat-acttttctttaagtac
                  Black lemur  ctccatgttttggat-gcttttgtttaagtac
              Sclater's lemur  ctccatgttttggat-gcttttgtttaagtac
B D                  Bushbaby  ctccacattttcagt-att----tttaagtgc
B D                     Mouse  --atatagcttagaa-attactatttaggtgc
B D                       Dog  cttcagattttagat-atttta-----agtgc
B D                 Armadillo  ccccatatttttgat-atgtttgttaaagtgt
                 Mouse lemur  ================================

Inserts between block 18 and 19 in window
B D                      Dog 1bp

Alignment block 19 of 48 in window, 91096173 - 91096190, 18 bps 
B D                     Human  tcagagattgccaggttc
B D                     Chimp  tcagagattgccaggttc
B D                    Bonobo  tcagagattgccaggttc
B D                   Gorilla  tcagagattgccaagttc
B D                 Orangutan  tcagagattgccaagttc
B D                    Gibbon  tcagagattgccaggttc
B D                    Rhesus  tcagagattgccaagttc
B D       Crab-eating macaque  tcagagattgccaagttc
           Pig-tailed macaque  tcagagattgccaagttc
               Sooty mangabey  tcagagattgagaagttc
                       Baboon  tcagagattgcgaagttc
B D              Green monkey  tcagagattgccaagttc
                        Drill  tcagagattgcgaagttc
B D          Proboscis monkey  tcagagattgccaagttc
              Angolan colobus  tcagagattgccaagttc
B D  Golden snub-nosed monkey  tcagagattgccaagttc
      Black snub-nosed monkey  tcagagattgccaagttc
B D                  Marmoset  tcagatattgctaagtta
B D           Squirrel monkey  tcagagattgctaagtta
          White-faced sapajou  tcagagattgctaagtta
            Ma's night monkey  tcagagattgctaagtta
B D                   Tarsier  tcagaaattgacaaattc
                  Mouse lemur  tcagagattgccaagttc
            Coquerel's sifaka  tcagagatttccaggttc
                  Black lemur  tcagagattgccaagttc
              Sclater's lemur  tcagagattgccaagttc
B D                  Bushbaby  tcagagattgccaagttc
B D                     Mouse  tcaaagactgagaagttt
B D                       Dog  caagagattgccaaattc
B D                 Armadillo  tcagagatcgct------

Inserts between block 19 and 20 in window
                 Black lemur 72bp
             Sclater's lemur 72bp

Alignment block 20 of 48 in window, 91096191 - 91096222, 32 bps 
B D                     Human  tcctttgacct--tgttttgtttataatgagatg
B D                     Chimp  tcttttgacct--tattttgtttataatgagatg
B D                    Bonobo  tcttttgacct--tattttgtttataatgagatg
B D                   Gorilla  tcttttgacct--tattttgtttatgatgagatg
B D                 Orangutan  tctttcgacct--tattttgtttatgatgagatg
B D                    Gibbon  tcttttgacct--tattttgtttatgatgagatg
B D                    Rhesus  tcttttgacct--tattttgtttatgatgagatg
B D       Crab-eating macaque  tcttttgacct--tatattgtttatgatgagatg
           Pig-tailed macaque  tcttttgacct--tattttgtttatgatgagatg
               Sooty mangabey  tcttttgacct--tattttgtttatgatgagatg
                       Baboon  tcttttgacct--tattttgtttatgatgagatg
B D              Green monkey  tcttttgacct--tattttgtttatgatgagatg
                        Drill  tcttttgacct--tattttgtttatgatgagatg
B D          Proboscis monkey  tcttttgacct--tattttgtttatgatgagatg
              Angolan colobus  tcttttgacct--tattttgtttatgatgagatg
B D  Golden snub-nosed monkey  tcttttgacct--tattttgtttatgatgagatg
      Black snub-nosed monkey  tcttttgacct--tattttgtttatgatgagatg
B D                  Marmoset  tcttttgacat--tattttgcttatgatgagatg
B D           Squirrel monkey  tcttttgacat--tattttgtttatgatgagatg
          White-faced sapajou  tcttttgacat--tattttgtttatgatgagatg
            Ma's night monkey  tcttttgacat--tattttg-ttatgatgagatg
B D                   Tarsier  ctttttgacat--c-ttttgtatttgataagatg
                  Mouse lemur  tctttttgcat--tattttgtatataataagatg
            Coquerel's sifaka  cctttttgcat--cattttgtatataatgagatg
B D                  Bushbaby  tcttttgatat--tattctttaaatggtaagatg
B D                     Mouse  --cctggacatgccatttt-tatgtaataagatg
B D                       Dog  ccctttgagat--tgttttgtataggataagatg
B D                 Armadillo  ---cttgttat--tattttgtatattataaaatg
             Sclater's lemur  ==================================
                 Black lemur  ==================================

Alignment block 21 of 48 in window, 91096223 - 91096231, 9 bps 
B D                     Human  aagacactt
B D                     Chimp  aagacactt
B D                    Bonobo  aagacactt
B D                   Gorilla  aagaccctt
B D                 Orangutan  aagacactt
B D                    Gibbon  aagaccctt
B D                    Rhesus  aggacactt
B D       Crab-eating macaque  aggacactt
           Pig-tailed macaque  aggacactt
               Sooty mangabey  aggacactt
                       Baboon  aggaccctt
B D              Green monkey  aggacactt
                        Drill  aggacactt
              Angolan colobus  gggacactt
B D  Golden snub-nosed monkey  gggacattt
      Black snub-nosed monkey  gggacattt
B D                  Marmoset  aggacactt
B D           Squirrel monkey  aggacactt
          White-faced sapajou  aggatgctt
            Ma's night monkey  aggacactt
B D                   Tarsier  aggacac--
                  Mouse lemur  aggacactt
            Coquerel's sifaka  aggacactt
B D                  Bushbaby  agaacactt
B D                     Mouse  gtaatactt
B D                       Dog  gggatactt
B D                 Armadillo  gagacattt
             Sclater's lemur  =========
                 Black lemur  =========
B D          Proboscis monkey  =========

Inserts between block 21 and 22 in window
                 Mouse lemur 155bp
B D                 Bushbaby 6bp

Alignment block 22 of 48 in window, 91096232 - 91096262, 31 bps 
B D                     Human  tggcgt-----------aaagaactctgagaaggctgactga
B D                     Chimp  tggcgt-----------aaagaactctgagaaggctgactga
B D                    Bonobo  tggcgt-----------aaagaactctgagaaggctgactga
B D                   Gorilla  tgacgt-----------aaagaactctgagaaggctgactga
B D                 Orangutan  tggcgt-----------aaagaactctgag--ggctgactga
B D                    Gibbon  tggcgt-----------aaagaactctgagaaggctgactga
B D                    Rhesus  gggcat-----------aaagagctctgaaaaggctgactgc
B D       Crab-eating macaque  gggcat-----------aaagaactctgaaaaggctgactgc
           Pig-tailed macaque  gggcat-----------aaagaactctgaaaaggctgactgc
               Sooty mangabey  tggcat-----------aaagaactctgaaaaggctgactgc
                       Baboon  tggcat-----------aaagaactctgaaaaggctgactgc
B D              Green monkey  tggcat-----------aaagaactctgaaaaggctgactgc
                        Drill  tggcat-----------aaagaactctgaaaaggctgactgc
              Angolan colobus  tggcat-----------aaggaactctgaaaaggttgactgc
B D  Golden snub-nosed monkey  tggcat-----------aaggaactctgaaaaggctgactgc
      Black snub-nosed monkey  tggcat-----------aaggaactctgaaaaggctgactgc
B D                  Marmoset  tggcat-----------aaagaactctgaaaaggctgactgc
B D           Squirrel monkey  tggcat-----------aaagaattctgaaaaggctaactgc
          White-faced sapajou  tggcat-----------aaagaactctgaaaaggctgactgc
            Ma's night monkey  tggcat-----------aaagaactctgaaaaggctgactgc
B D                   Tarsier  aggtat-----------aaagaactctgaaaaaattggtttt
            Coquerel's sifaka  aggcat-----------atataactctaaaaaggttagtttc
B D                  Bushbaby  aggaataaaaaaaaaaaagaaaactctaagaaggatgatttt
B D                     Mouse  ------------------------------aagattta----
B D                       Dog  aggtgt-----------aaataaatctaaaaagtttggttcc
B D                 Armadillo  aggcat-----------aaaggactctaaggaggttggtccc
                 Mouse lemur  ==========================================
             Sclater's lemur  ==========================================
                 Black lemur  ==========================================
B D          Proboscis monkey  ==========================================

Alignment block 23 of 48 in window, 91096263 - 91096287, 25 bps 
B D                     Human  attaggaacataaattagaatagtc
B D                     Chimp  attaggaacataaattagaatagtc
B D                    Bonobo  attaggaacataaattagaatagtc
B D                   Gorilla  attaggaacataaattagaatagtc
B D                 Orangutan  attaggaacataaattagaatagtc
B D                    Gibbon  attaggaacataaattagaatagtc
B D                    Rhesus  attaggaacacaaattagaatagtc
B D       Crab-eating macaque  attaggaacacaaattagaatagtc
           Pig-tailed macaque  attaggaacataaattagaatagtc
               Sooty mangabey  attaggaacataaattagaatagtc
                       Baboon  attaggaacataaattagaatagtc
B D              Green monkey  attaggaacataaattagaatagtc
                        Drill  attaggaacataaattagaatagtc
              Angolan colobus  attaggaacataaattagaatagtc
B D  Golden snub-nosed monkey  attagggacataaattagaatagtc
      Black snub-nosed monkey  attagggacataaattagaatagtc
B D                  Marmoset  attaggaacataaattagaatagtc
B D           Squirrel monkey  cctgggaacataaattagaatagtc
          White-faced sapajou  atta-gaacatagattagaatagtc
            Ma's night monkey  attaggaacataaattagaatagtc
B D                   Tarsier  attaggaacacaaattagaagggtc
            Coquerel's sifaka  attaggaacataaattagaatggtc
                  Black lemur  attaggaacataaattagaatggtc
              Sclater's lemur  attaggaacataaattagaatggtc
B D                  Bushbaby  attcagaac--aaattagaatggtc
B D                     Mouse  ataaagtccctaaa----agtag--
B D                       Dog  attaggaaaataaattgaaattgcc
B D                 Armadillo  atta-gaatataaatttcaatgatc
                 Mouse lemur  =========================
B D          Proboscis monkey  =========================

Inserts between block 23 and 24 in window
           Coquerel's sifaka 153bp
B D                Armadillo 6bp

Alignment block 24 of 48 in window, 91096288 - 91096288, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                    Bonobo  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  t
           Pig-tailed macaque  c
               Sooty mangabey  c
                       Baboon  c
B D              Green monkey  c
                        Drill  c
              Angolan colobus  c
B D  Golden snub-nosed monkey  c
      Black snub-nosed monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
          White-faced sapajou  c
            Ma's night monkey  c
                  Black lemur  c
              Sclater's lemur  c
B D                 Armadillo  c
                 Mouse lemur  =
           Coquerel's sifaka  =
B D                     Mouse  -
B D                       Dog  -
B D                  Bushbaby  -
B D                   Tarsier  -
B D          Proboscis monkey  =

Inserts between block 24 and 25 in window
                 Black lemur 308bp
             Sclater's lemur 308bp

Alignment block 25 of 48 in window, 91096289 - 91096294, 6 bps 
B D                     Human  cataat
B D                     Chimp  cataat
B D                    Bonobo  cataat
B D                   Gorilla  cataat
B D                 Orangutan  cataat
B D                    Gibbon  cataat
B D                    Rhesus  cataat
B D       Crab-eating macaque  cataat
           Pig-tailed macaque  cataat
               Sooty mangabey  cataat
                       Baboon  cataat
B D              Green monkey  cataat
                        Drill  cataat
              Angolan colobus  tataat
B D  Golden snub-nosed monkey  tataat
      Black snub-nosed monkey  tataat
B D                  Marmoset  cataat
B D           Squirrel monkey  cataat
          White-faced sapajou  cataat
            Ma's night monkey  cataat
B D                 Armadillo  cataat
                 Mouse lemur  ======
           Coquerel's sifaka  ======
B D                     Mouse  ------
             Sclater's lemur  ======
                 Black lemur  ======
B D                       Dog  ------
B D                  Bushbaby  ------
B D                   Tarsier  ------
B D          Proboscis monkey  ======

Inserts between block 25 and 26 in window
B D Golden snub-nosed monkey 116bp

Alignment block 26 of 48 in window, 91096295 - 91096392, 98 bps 
B D                     Human  tgtattattatattatattacatataataatattgagttcc-ataat----------acttccatcata-
B D                     Chimp  tgtattattatattatattacatatgataatattgagttcc-ataat----------acttccatcata-
B D                    Bonobo  tgtattattatattatattacatataataatattgagttcc-ataat----------acttccatcata-
B D                   Gorilla  tgtattattatattatattacatataataatattgagtccc-ataat----------acttccatcata-
B D                 Orangutan  agtat-----tattatattacatataataatagtgagtccc-ataat----------acttccattata-
B D                    Gibbon  agtat-----tattatattacatataataatattgagtccc-ataat----------acttccatcata-
B D                    Rhesus  agtattattatattatattacatataataatattgagtccc-ataat----------acttccatcata-
B D       Crab-eating macaque  agtattattatattatattacatataataatattgagtccc-ataat----------acttccatcata-
           Pig-tailed macaque  agtattattatattatattacatataataatattgagtccc-ataat----------acttccatcata-
               Sooty mangabey  agtattattatattatataacctataataatattgagtccc-ataat----------acttccatcata-
                       Baboon  agtattattatattatattacatataataatattgagtccc-ataat----------acttccatcata-
B D              Green monkey  agtattattatattatattacatatagtaatattgagtccc-ataat----------acttccatcata-
                        Drill  agtattattatattatattacatataataatattgagtccc-ataat----------acttccatcata-
              Angolan colobus  agtattattatattatattacataaaataatattgagtgcc-ataat----------acttccatcata-
B D  Golden snub-nosed monkey  tgtattattatatgatattacataaaataatattgagtacc-ataat----------acttccatcata-
      Black snub-nosed monkey  agtattattatatgatattacataaaataatattgagtacc-ataat----------acttccatcata-
B D                  Marmoset  aatattattatattacat--------ataatattgagtccc-ataat----------actcccatcata-
B D           Squirrel monkey  aatattattatattacac--------ataatattgagtccc-ataat----------actcccatcata-
          White-faced sapajou  aatattattatattacat--------ataatattgagtccc-ataat----------actcccatcata-
            Ma's night monkey  aatattattatattacat--------ataatattgagtccc-ataat----------actcccatcata-
B D                   Tarsier  ---------------------------------taagtatc-acaat----------actcccatacta-
B D                  Bushbaby  ---------------------------------taagtccc-ataat----------ac-----------
B D                     Mouse  ------gtttcattagagcatgcttagaattatttagcaccaataat----------tcctcaatacta-
B D                       Dog  ---------------------------------taactccc-ataat----------actcccataata-
B D                 Armadillo  -----------------------------------ggtccc-atcatcaccactgccacccccaccacca
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================
B D          Proboscis monkey  ======================================================================

                        Human  -cataataataatgatatt----------atcttatttatgttttcttgta
                        Chimp  -cataataataatgatatt----------atcttatttatgttttcttgta
                       Bonobo  -cataatactaatgatatt----------atcttatttatgttttcttgta
                      Gorilla  -cataataataatgatatt----------accttatttatgttttcttgta
                    Orangutan  -cataataata---atatt----------actttatatatgttttcttgta
                       Gibbon  -cataataataatgatatt----------accttatatatgttttcttgta
                       Rhesus  -cacaataataatgatatt----------gccttatatatgttttcttgta
          Crab-eating macaque  -cacaataataatgatatt----------gccttatatatgttttcttgta
           Pig-tailed macaque  -cacaataataatgatatt----------gccttatatatgttttcttgta
               Sooty mangabey  -cacaataataatgacatt----------gccttatatatgttttcttgta
                       Baboon  -cacaataataatgatatt----------gccttatatatgttttcttgta
                 Green monkey  -cacaataataatgatatt----------gccttatatatgttttcttgta
                        Drill  -cacaataataatgatatt----------gccttatatatgttttcttgta
              Angolan colobus  -cacaataataacgatatc----------gccttatatatgttttcttgca
     Golden snub-nosed monkey  -cacaataataatgatatt----------gccttatatatgttttcttgca
      Black snub-nosed monkey  -cacaataataatgatatt----------gccttatatatgttttcttgca
                     Marmoset  -cataataataatgataat----------accttatatatgttttcttgta
              Squirrel monkey  -catagtaataatgatatc----------accttatatatgttttcttgta
          White-faced sapajou  -cataataataatgatatt----------accttatatatgttttcttgta
            Ma's night monkey  -cataataataatgatatt----------accttatatatgttttcttgta
                      Tarsier  -tgtaacaataaaaaca-------------cttcatatatattttcttgta
                     Bushbaby  --ataacaatattaacaac----------acttcttatatgctttcttgta
                        Mouse  -tataataatggt------------------tctccacatgttttcttatt
                          Dog  -tgtgatagtaataataatcagaac----actatatgtagattttcttgtt
                    Armadillo  tcatcatgatcattataatcaccatccaaacactatatacgttttcatg--
                  Mouse lemur  ===================================================
            Coquerel's sifaka  ===================================================
              Sclater's lemur  ===================================================
                  Black lemur  ===================================================
             Proboscis monkey  ===================================================

Alignment block 27 of 48 in window, 91096393 - 91096479, 87 bps 
B D                     Human  ccatgaatgt----agaaagaaaagcgtgtcccgtgggagagttctc-tttttggctttttccacag-aa
B D                     Chimp  ccatgaatgt----agaaagaaaagcatgtcctgtgggagagttctc-tttttggctttttccacag-aa
B D                    Bonobo  ccatgaatgt----agaaagaaaagcgtgtcccgtgggagagttctc-tttttggctttttccacag-aa
B D                   Gorilla  ccatgaatgt----agaaagaaaagcgtgtcccatgggagagttctc-tttttggctttttccacag-aa
B D                 Orangutan  ccatgaatgt----agaaagaaaagcgtgtcccatgggagagttctc-tttttggctttttccacag-aa
B D                    Gibbon  ccatgaatgt----agaaagaaaagcgtgtcccatgggagagt--tc-tttttggctttttccacag-aa
B D                    Rhesus  ccatgaacat----agaa----aagcatgtctcatgggagagttctc-tttctggctttttccacag-aa
B D       Crab-eating macaque  ccatgaacat----agaa----aagcatgtctcatgggagagttctc-tttctggctttttccacag-aa
           Pig-tailed macaque  ccatgaacat----agaa----aagcatgtctcatgggagagttctc-tttctggctttttccacag-aa
               Sooty mangabey  ccatgaacat----agaaagagaagcatgtctcatgggagagttctc-tttctggctttttccacag-aa
                       Baboon  ccatgaacat----agaa----aagcatgtctcatgggagagttctc-tttctggctttttccacag-aa
B D              Green monkey  ccatgaacatagaaagaa----aagcatgtctcatgggagagttctc-tttttggctttttccacag-aa
                        Drill  ccatgaacat----agaa----aagcatgtctcatgggagagttctc-tttctggctttttccacag-aa
B D          Proboscis monkey  ccatgaatgt----agaaagaaaagcacgtctcatgggagagttctc-tttttggc-ttttccacag--a
              Angolan colobus  ccatgaatgt----agaaagaaaagcatgtctcatgggagagttctc-tttttggctttttccacag-aa
B D  Golden snub-nosed monkey  ccatgaatgt----agaaagagaagcacgtctcatgggagagttctc-tttttggctttttccacag-aa
      Black snub-nosed monkey  ccatgaatgt----agaaagaaaagcatgtctcatgggagagttctc-tttttggctttttccacag-aa
B D                  Marmoset  tcatgaatgc----agaaagaaaagaatgtctcatgggagagttttc-tttttggcttttttcacag-aa
B D           Squirrel monkey  tcatgaatgc----agaaagaaaagaatgtctcatgggagagttttc-tttttggctttttccacagaaa
          White-faced sapajou  tcatgaatgc----agaaagaaaagcatgtctcatgggagagttttc-tttttggctttttccacag-aa
            Ma's night monkey  tcatgaacgc----agaaagaaaagcatgtcccatgggagagttttcttttttggctttttccacag-aa
B D                   Tarsier  ccgtaactgc----ataa--aaaggaacgtctcatgagacagt--tc-tttttggctttctctacaa-aa
B D                  Bushbaby  -------------------------------ccatttaagagttctc-tttt--actttctccacag-aa
B D                     Mouse  ccacgaatgc----aaaa----gaatatatctcacgatagcatttta-ttcacatttttttccacgg-gg
B D                       Dog  gcacaaatgc----aaaa-aagaaataggtctcatggtacggttccc-tttttagctttctccacag-aa
B D                 Armadillo  ----aaatat----aacaggaaaaatttgtctcatggtagtgttctc-tttttaactttctctacaa-aa
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================

                        Human  --------aaaacaaagaacattct----aagagc
                        Chimp  --------aaaacaaagaacattct----aagagc
                       Bonobo  --------aaaacaaagaacattct----aagagc
                      Gorilla  --------aaaacaaagaacattct----aagagc
                    Orangutan  --------aaaacaaagaacattct----aagagc
                       Gibbon  --------aaaacaaagaacattct----aagagg
                       Rhesus  --------aaagcaaagagcatact----aagagc
          Crab-eating macaque  --------aaagcaaagagcatact----aagagc
           Pig-tailed macaque  --------aaagcaaagagcatact----aagagc
               Sooty mangabey  --------aaagcaaagggcatact----gagagc
                       Baboon  --------aaagcaaagagcatact----aagagc
                 Green monkey  --------aaaacaaagagcatact----aagagc
                        Drill  --------aaagcaaagagcatact----aagagc
             Proboscis monkey  --------aaaacaaagaggatact----aagagc
              Angolan colobus  --------aaaacaaagaggatact----aagagc
     Golden snub-nosed monkey  --------aaaacaaagaggatact----aagagc
      Black snub-nosed monkey  --------aaaacaaagaggatact----aagagc
                     Marmoset  --------aaaacaaagagcatttt----aagagc
              Squirrel monkey  --------aaaacaaagagcattcc----aagagc
          White-faced sapajou  --------aaaacaaagagcattct----aagagc
            Ma's night monkey  --------aaaacaaagagcattct----aagagc
                      Tarsier  --------aaaataaagagcatgct----aaagag
                     Bushbaby  --------acaatggtgtgctaaat----aatc--
                        Mouse  gtgggggtggggtaaggagtatgtt-ataaagagt
                          Dog  --------taaatcaagatgaggct---cgagggt
                    Armadillo  ------------taaagtgcatgctaaacaagatc
                  Mouse lemur  ===================================
            Coquerel's sifaka  ===================================
              Sclater's lemur  ===================================
                  Black lemur  ===================================

Inserts between block 27 and 28 in window
B D                    Mouse 3bp
B D                      Dog 3bp

Alignment block 28 of 48 in window, 91096480 - 91096520, 41 bps 
B D                     Human  ttcaatatctagtgaaatgcatta-tcttttgtgaacaaaga
B D                     Chimp  ttcaatatctagtgaaatgcatta-tcttttgtgaacaaaga
B D                    Bonobo  ttcaatatctagtgaaatgcatta-tcttttgtgaacaaaga
B D                   Gorilla  ttcaaaatctagtgaaatgcatta-tcttttgtgaacaaaga
B D                 Orangutan  ttcaatatctagtgaaatgcatta-tcttttgtgaacaaaga
B D                    Gibbon  ttcaatatctagtgaaatgcatta-tcttttgtgaacaaaga
B D                    Rhesus  ttcaatatctagtgaaatgcatta-ttttttgtgaacaaaga
B D       Crab-eating macaque  ttcaatatctagtgaaatgcatta-ttttttgtgaacaaaga
           Pig-tailed macaque  ttcaatatctagtgaaatgcattatttttttgtgaacaaaga
               Sooty mangabey  ttcaatatctagtgaaatgcatta-ttttttgtgaacaaaga
                       Baboon  ttcaatatctagtgaaatgcatta-ttttttgtgaaccaaga
B D              Green monkey  ttcaatatctagtgaaatgcatta-ttttttgtgaacaaaga
                        Drill  ttcaatatctagtgaaatgcatta-ttttttgtgaacaaaga
B D          Proboscis monkey  ttcagtatctagtgaaatgcatta-ttttttgtgaacaaaga
              Angolan colobus  ttcagtatctagtgaaatgcatta-ttttttgtgaacaaaga
B D  Golden snub-nosed monkey  ttcagtatctagtgaaatgcatta-ttttttgtgaacaaaga
      Black snub-nosed monkey  ttcagtatctagtgaaatgcatta-ttttttgtgaacaaagt
B D                  Marmoset  ttcagtatccagtgaaatgcatta-tcttttgtgaacaaaga
B D           Squirrel monkey  ttcagtatccagtgaaatgcatta-tcttttgtgaacaaaga
          White-faced sapajou  ttcagtatccagtgaaatgcatta-tcttttgtgaacaaaga
            Ma's night monkey  ttcagtatccagtgaaatgcatta-tcttttgtgaacaaaga
B D                   Tarsier  gata--attcagtgaaatgaatta-tctttggtgaacaaaaa
            Coquerel's sifaka  ttcaatatccagtaaaatgaatta-tctttcatgaacaaaga
B D                  Bushbaby  tttaatatctagtaaaatgaatta-tcttttatgaaaagagg
B D                     Mouse  tttagtatccagtgaaatgaa--a-ttcctttggagcaaaga
B D                       Dog  tcaaatatccagtgacaccaatga-tcttttgtgaacaaaga
B D                 Armadillo  ttcaatattcagtgaaatgaatga-tcttctatgaacaaagt
                 Mouse lemur  ==========================================
             Sclater's lemur  ==========================================
                 Black lemur  ==========================================

Inserts between block 28 and 29 in window
B D                   Rhesus 1bp
B D      Crab-eating macaque 1bp
          Pig-tailed macaque 1bp
              Sooty mangabey 1bp
                      Baboon 1bp
B D             Green monkey 1bp
                       Drill 1bp
B D         Proboscis monkey 1bp
             Angolan colobus 1bp
B D Golden snub-nosed monkey 1bp
     Black snub-nosed monkey 1bp
B D                 Marmoset 1bp
B D          Squirrel monkey 1bp
         White-faced sapajou 1bp
           Ma's night monkey 1bp
B D                  Tarsier 1bp
           Coquerel's sifaka 210bp
B D                 Bushbaby 1bp
B D                    Mouse 1bp
B D                      Dog 1bp

Alignment block 29 of 48 in window, 91096521 - 91096562, 42 bps 
B D                     Human  ggaaatttgcctttaacttaaat---------aatattttggcattaaaat
B D                     Chimp  ggaaatttgcctttaacttaaat---------aatattttggcattaaaat
B D                    Bonobo  ggaaatttgcctttaacttaaat---------aatattttggcattaaaat
B D                   Gorilla  ggaaatttgcctttaactgaaat---------aatattttggcattaaaaa
B D                 Orangutan  ggaaatttgcctttaacttaaat---------aatattttggcattaaaaa
B D                    Gibbon  ggaaatttgcctttaacttaaat---------aatattttggcactaaaaa
B D                    Rhesus  ggaaatttgcctttaacttaaat---------aatatttcagcatttaaaa
B D       Crab-eating macaque  ggaaatttgcctttaacttaaat---------aatatttcagcatttaaaa
           Pig-tailed macaque  ggaaatttgcctttaacttaaat---------aatatttcagcatttaaaa
               Sooty mangabey  ggaaatttgcctttaacttaaat---------aatatttcagcatttaaaa
                       Baboon  ggaaatttgcctttaacttaaat---------aatatttcagcatttaaaa
B D              Green monkey  ggaaatttgcctttaacttaaat---------aatatttcaacatttaaaa
                        Drill  ggaaatttgcctttaacttaaat---------aatatttcagcatttaaaa
B D          Proboscis monkey  ggaaatttgcctttaacttaaat---------aatatttcagcatttaaaa
              Angolan colobus  ggaaatttgcctttaacttaaat---------aacatttcagcatttaaaa
B D  Golden snub-nosed monkey  ggaaatttgcctttaacttaaat---------aatatttcagcatttaaaa
      Black snub-nosed monkey  ggaaatttgcctttaacttaaat---------aatatttcagcatttaaaa
B D                  Marmoset  agaaatttgcctttaacttaaat---------aatattccagcattaaaaa
B D           Squirrel monkey  agaaatttgcctttaacttagat---------aatattccagaattaaaaa
          White-faced sapajou  agaaatttgcctttaacttaaat---------aatattccagcatgaaaaa
            Ma's night monkey  agaaatttgcctttaacttaaat---------aatattccagcattaaaaa
B D                   Tarsier  ggaaatttgcctttaacttaaat-------taaatatttgggcattttttt
B D                  Bushbaby  agaagtacacctttaatttacat---------caagcattgggccttaaa-
B D                     Mouse  ggcaatatgtctctagcttatat---------taaatt-------------
B D                       Dog  gaaaacttgcctgtgatttacattcttacataaatatatgggctgtaagaa
B D                 Armadillo  -----------------------------gggaatatctgggccttaaaaa
                 Mouse lemur  ===================================================
           Coquerel's sifaka  ===================================================
             Sclater's lemur  ===================================================
                 Black lemur  ===================================================

Inserts between block 29 and 30 in window
B D                  Tarsier 198bp
B D                      Dog 4bp

Alignment block 30 of 48 in window, 91096563 - 91096630, 68 bps 
B D                     Human  agaaggctgtaag-agtggctttcagaaaccctatctt---------acctaaagttatg-aaacgataa
B D                     Chimp  agaaggctgtaag-agtggctttcagaaaccctatctt---------acctaaggttatg-aaacgataa
B D                    Bonobo  agaagcctgtaag-agtggctttcagaaaccctatctt---------acctaaggttatg-aaatgataa
B D                   Gorilla  agaaggctctaag-agtggctttctgaaaccctatctt---------acctaaggttatg-aaacgataa
B D                 Orangutan  agaaggctgtaag-agtggctttcagaaaccctatctt---------acctaaggttatg-aaatgataa
B D                    Gibbon  agaagactgtaag-agtggctttcagaaaccctatctt---------acctaaggttatg-aaacgataa
B D                    Rhesus  agaaagctgtaag-agtggctttcagaaaccctatctt---------acctaagattatg-aaacgataa
B D       Crab-eating macaque  agaaagctgtaag-agtggctttcagaaaccctatctt---------acctaagattatg-aaacgataa
           Pig-tailed macaque  agaaagctgtaag-agtggctttcagaaaccctatctt---------acctaagattatg-aaacgataa
               Sooty mangabey  agaaagctgtaag-agtggctttcagaaaccctatctt---------acctaagattatg-aaacgataa
                       Baboon  agaaagctgtaag-agtggctttcagaaaccctatctt---------acctaagattatg-aaacgataa
B D              Green monkey  agaaagctgtaag-agtggctttcagaaaccctatctt---------acctaagattatg-aaacgataa
                        Drill  agaaagctgtaag-agtgactttcagaaaccctatctt---------acctaagattatg-aaacgataa
B D          Proboscis monkey  agaaagctgtaag-agtggctttcagaaaccctatctt---------acctaagattatg-aaacgataa
              Angolan colobus  agaaagctgtaag-agtggctttcagaaaccctatctt---------acctaagattatg-aaacgataa
B D  Golden snub-nosed monkey  agaaagctgtaag-agtggctttcagaaaccctatctt---------acctaagattatg-aaacgataa
      Black snub-nosed monkey  agaaagctgtaag-agtggctttcagaaaccctatctt---------acctaagattatg-aaacgataa
B D                  Marmoset  agaaggctgtaat-agtggctttcagaaaccttatctt---------tcctaaggttatg-aaatgataa
B D           Squirrel monkey  aga---ctgtaat------------------------------------------ttg------------
          White-faced sapajou  agagggctgtaat-agtggctttcagaaaccttatctt---------tcctaagcttatg-aaatgataa
            Ma's night monkey  agaaggctgtaat-agtggctttcagaaacgttatctt---------tcctgaggttatg-aaatgaaaa
B D                   Tarsier  aaaatgttgtcat-gatggtcctccaaagccttatctt---------acctgaagttgtg-aaatggtag
B D                  Bushbaby  aacaggctataataaatggctctcaaaccccatat-tt---------acctcagggtgtg-aagtg---a
B D                     Mouse  agagtgttctcta-agactcctacagagacaattcctttaaagcttgtcttaagagtgtg-agatgataa
B D                       Dog  cagaggttgtaag-gatggctc-cagaagcctcatctt---------acccaaagttgtg-aaatgataa
B D                 Armadillo  aaaaggctataaa-gatggctttcagaagtcatgtttt---------acccaaggttgtgaaaatgaaaa
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================

                        Human  tggcat-ctg
                        Chimp  tggcat-ctg
                       Bonobo  tggcat-ctg
                      Gorilla  tggcgt-ctg
                    Orangutan  tggcat-ctg
                       Gibbon  tggcat-ctg
                       Rhesus  tggcat-ctg
          Crab-eating macaque  tggcat-ctg
           Pig-tailed macaque  tggcat-ctg
               Sooty mangabey  tggcat-ctg
                       Baboon  tggcat-ctg
                 Green monkey  tggcat-ctg
                        Drill  tggcat-ctg
             Proboscis monkey  tggcat-ctg
              Angolan colobus  tggcat-ctg
     Golden snub-nosed monkey  tggcat-ctg
      Black snub-nosed monkey  tggcat-ctg
                     Marmoset  tggcat-ctg
              Squirrel monkey  ----at-ctg
          White-faced sapajou  tggcat-cca
            Ma's night monkey  tggcat-cca
                      Tarsier  tggcat-ccc
                     Bushbaby  tggccc-ctc
                        Mouse  ccaccc-ct-
                          Dog  tggcatcctt
                    Armadillo  tgacat-ctg
                  Mouse lemur  ==========
            Coquerel's sifaka  ==========
              Sclater's lemur  ==========
                  Black lemur  ==========

Inserts between block 30 and 31 in window
B D                Armadillo 476bp

Alignment block 31 of 48 in window, 91096631 - 91096634, 4 bps 
B D                     Human  ccca
B D                     Chimp  ccca
B D                    Bonobo  ccca
B D                   Gorilla  ccca
B D                 Orangutan  ccca
B D                    Gibbon  ccca
B D                    Rhesus  ccca
B D       Crab-eating macaque  ccca
           Pig-tailed macaque  ccca
               Sooty mangabey  ccca
                       Baboon  ccca
B D              Green monkey  ccca
                        Drill  ccca
B D          Proboscis monkey  ccca
              Angolan colobus  ccca
B D  Golden snub-nosed monkey  ccca
      Black snub-nosed monkey  ccca
B D                  Marmoset  ccca
B D           Squirrel monkey  ccca
          White-faced sapajou  ccca
            Ma's night monkey  ccca
B D                   Tarsier  cttg
B D                  Bushbaby  ccct
B D                     Mouse  ctca
B D                       Dog  ccca
B D                 Armadillo  ccct
                 Mouse lemur  ====
           Coquerel's sifaka  ====
             Sclater's lemur  ====
                 Black lemur  ====

Inserts between block 31 and 32 in window
B D                 Bushbaby 3bp

Alignment block 32 of 48 in window, 91096635 - 91096731, 97 bps 
B D                     Human  acctgtttgataacctactttctt------acaacagaaccagtaggcatgtccctaggtaagccaccag
B D                     Chimp  acctgtttgataacctactttctt------acaacagaaccagtaggcatgtccctaggtaagccaccag
B D                    Bonobo  acctgtttgataacctactttctt------acaacagaaccagtaggcatgtccctaggtaagccaccag
B D                   Gorilla  acctgtttgataacctactttctt------acaacagaaccagtaggcatgtccctaggtaagccaccag
B D                 Orangutan  acctgtttgataacctactttctt------acaacagaaccagtaggcatgtccctaggtaagccaccag
B D                    Gibbon  acctgtttgataacctactttctt------acaacagaaccagtaggcatgtccctaggtaagccaccag
B D                    Rhesus  acctgtttgataacctactttctt------acaacagaaccagtaggcatgtccctaggtaagccaccag
B D       Crab-eating macaque  acctgtttgataacctactttctt------acaacagaaccagtaggcatgtccctaggtaagccaccag
           Pig-tailed macaque  acctgtttgataacctactttctt------acaacagaaccagtaggcatgtccctaggtaagccaccag
               Sooty mangabey  acctgtttgataacctactttctt------acaacagaaccagtaggcatgtccctaggtaagccaccag
                       Baboon  acctgtttgataacctactttctt------acaacagaaccagtaggcatgtccctaggtaagccaccag
B D              Green monkey  acctgtttgataacctactttctt------acaacagaaccagtaggcatgtccctaggtaagccaccag
                        Drill  acctgtttgataacctactttctt------acaacagaaccagtaggcatgtccctaggtaagccaccag
B D          Proboscis monkey  acctgtttgataacctactttctt------acaacagaaccggtaggcatgtccctaggtaagccactag
              Angolan colobus  acctgtttgataacctactttctt------acaacagaaccaggaggaatgtccctaggtaagccaccag
B D  Golden snub-nosed monkey  acctgtttgataacctactttctt------acaacagaaccggtaggcatgttcctaggtaagccactag
      Black snub-nosed monkey  acctgtttgataacctactttctt------acaacagaaccggtaggcatgtccctaggtaagccactag
B D                  Marmoset  acctgtttgataacctatgttctt------acaacagagcccatgggcatctccctaggtaagccaccaa
B D           Squirrel monkey  acctgtttgataacctattttctt------acaacagagcccatgggcatctccctaggtaagccaccaa
          White-faced sapajou  acctgtttgataacctattttctt------acaaaagagcccatgagcatctccctaagtaagccaccaa
            Ma's night monkey  aactgtttgataacctattttctt------acaacagagcccatgggtatctccctgggtaagccaccaa
B D                   Tarsier  acctgcttggcaatttccttcctt------aaaacagaaccaacagccatctccttaggaaagccaccag
                  Black lemur  acctgcttgacaacctacttcctt------gcaacagaacaaactggcagcccccaaggtgagccaccag
              Sclater's lemur  acctgcttgacaacctacttcctt------gcaacagaacaaactggcagcccccaaggtgagccaccag
B D                  Bushbaby  acctg---------ctatttcctt------acatcaggacaaactggcc-tctccggcgtgagccaccag
B D                     Mouse  acttgcttggatgtcagcttcctt------gcag-ggcaccagcaggcatgt--ctaggtgagccacaag
B D                       Dog  acttgctgggcaacctattttttttttttaacagcagaatcaccaagcaagtcctgaggtaagccaccgg
B D                 Armadillo  tcctacttggcaa-ttacttcttt--------aacaaaaccagctggcatttccctaggtaaatctcgaa
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================

                        Human  tttccaatcctacccaccatccttgactaaaat
                        Chimp  tttccaatcctactcaccatccttgactaaaat
                       Bonobo  tttccaatcctacccaccatccttgactaaaat
                      Gorilla  tttccaatcctacccaccatccttgactaaaat
                    Orangutan  tttccaatcctacccaccatcgttgactaaaat
                       Gibbon  tttccaatcctacccaccatccttgactaaaat
                       Rhesus  tttccaatcctacccaccacccttgactaaaat
          Crab-eating macaque  tttccaatcctacccaccacccttgactaaaat
           Pig-tailed macaque  tttccaatcctacccaccacccttgactaaaat
               Sooty mangabey  tttccaatcctacccaccacccttgactaaaat
                       Baboon  tttccaatcctacccaccacccttgactaaaat
                 Green monkey  tttccaatcctacccaccacccttgactaaaat
                        Drill  tttccaatcctacccaccacccttgactaaaat
             Proboscis monkey  tttccattcctaccca------ttgactaaaat
              Angolan colobus  tttccagtcctacccaccacccttgactaaaat
     Golden snub-nosed monkey  tttccaatcctaccca------ttgactaaaat
      Black snub-nosed monkey  tttccaatcctaccca------ttgactaaaat
                     Marmoset  tttccagtcctacctaccacccttgactaaaat
              Squirrel monkey  tttccagtcctacctaccacccttgactaaaat
          White-faced sapajou  tttccggtcctacccaccacccttgactaaaat
            Ma's night monkey  tttccagtcctacccaccacccttgactaaaat
                      Tarsier  tttccaacactacttgccctcctcaactaaaat
                  Black lemur  tccccagccctacccacctccctccgctaacac
              Sclater's lemur  tccccagccctacccacctccctccgctaacac
                     Bushbaby  ttcccacccctacccatccctctcgactaaaac
                        Mouse  ttc----tcctgtgcttaccccttggctgaaag
                          Dog  ttcccaaccctaccccct-------actgaaat
                    Armadillo  ttcctagcctacccca---------actaaaat
                  Mouse lemur  =================================
            Coquerel's sifaka  =================================

Alignment block 33 of 48 in window, 91096732 - 91096771, 40 bps 
B D                     Human  taatttcattgcttagaacaagagcaatgacagagataca
B D                     Chimp  taatttcattgcttagaacaagagcaatgacagagataca
B D                    Bonobo  taatttcattgcttagaacaagagcaatgacagagataca
B D                   Gorilla  taatttcattgcttagaacaagagcaatgacagagataca
B D                 Orangutan  taacttcatcacttagaacaagagcaatgacagagataca
B D                    Gibbon  taatttcattgcttagaacaagagcaatgacagcgataca
B D                    Rhesus  taattccattgcttagaacaagagcaatgactgagataca
B D       Crab-eating macaque  taattccattgcttagaacaagagcaatgactgagataca
           Pig-tailed macaque  taattccattgcttagaacaagagcaatgacagagataca
               Sooty mangabey  taattccattgcttagaacaagagcaatgacagagataca
                       Baboon  taattccattgcttagaacaagagcaatgacagagataca
B D              Green monkey  taattccattgcttagaacaagagcaatgacagagataca
                        Drill  taattccattgcttagaacaagagcaatgacagagataca
B D          Proboscis monkey  taattccattgcttagaacaagagcaatgacagagataca
              Angolan colobus  taattccattgcttagaagaagagcaatgacagagataca
B D  Golden snub-nosed monkey  taattccattgcttagaataagagcaatgacagagataca
      Black snub-nosed monkey  taattccattgcttagaataagagcaatgacagagataca
B D                  Marmoset  taatttcgttgcttagaacaagagcaatgaaagaggtaca
B D           Squirrel monkey  taatttcattgcttagaacaagagcaatgaaagaggttca
          White-faced sapajou  taatttcattgcttagaacaagagcaatgaaagaggta-a
            Ma's night monkey  taatttcattgcttagaacaagagcaatgaaagaggtaca
B D                   Tarsier  tattttcgttgctgagagtaagagcaatgaaaaagataca
            Coquerel's sifaka  taatttcatctctttgaacaagaccaacaaaagagttata
                  Black lemur  taatttcatcgctttgaacaagatcaacaaaagaattata
              Sclater's lemur  taatttcatcgctttgaacaagatcaacaaaagaattata
B D                  Bushbaby  taatttcactgctttgaacaccaccaacaaaagacatgcg
B D                     Mouse  tagtttcacagcacagaagaag--caa-------------
B D                       Dog  taatttcatt-ctgagaacaaaagcaagaagatagaa---
B D                 Armadillo  taatttcattgctgagaa---gattaatgagacagaa---
                 Mouse lemur  ========================================

Alignment block 34 of 48 in window, 91096772 - 91097220, 449 bps 
B D                     Human  agaatgaaaacacaacaaaaatgtgaaata-acagtgactttttatttcc--aagtcattgggttgggta
B D                     Chimp  agaatgaaaacacaac-aaaatgtgaaata-acagtgactttttatttcc--aagtcattgggttgggta
B D                    Bonobo  agaatgaaaatacaacaaaaatgtgaaata-acagtgactttttatttcc--aagtcattgggtttggta
B D                   Gorilla  agaatgaaaacacaac-aaaatgtgaaata-acagtgactttttatttcc--aagtcattgggttgggta
B D                 Orangutan  agaatgaaaacacaacaaaaatgtgaaata-acagtgactttttatttcc--aagttattgggttgggta
B D                    Gibbon  agaatgaaaacacaacaaaaatgtgaaata-acagtgactttttatttcc--aagttattgggttgggta
B D                    Rhesus  agaatgaaaacacaacaaaaatgtgaaata-acagtgacttttaatttcc--aagttattaggttgggta
B D       Crab-eating macaque  agaatgaaaacacaacaaaaatgtgaaata-acagtgacttttaatttcc--aagttattgggttgggta
           Pig-tailed macaque  agaatgaaaacacaacaaaaatgtgaaata-acagtgacttttaatttcc--aagttattgggttgggta
               Sooty mangabey  ataatgaaaacacaacaaaaatgtgaaata-aca-tgacttttaatttcc--aagttattgggttgggta
                       Baboon  ataatgaaaacacaacaaaaatgtgaaata-aca-tgacttttaatttcc--aagttattgggttgggta
B D              Green monkey  agaatgaaaacacaacaaaaatgtgaaaga-acagtgacttttaatttcc--aagttattgggttgtgta
                        Drill  ataatgaaaacacaacaaaaatgtgaaata-aca-tgacttttaatttcc--aagttattgggttgggta
B D          Proboscis monkey  agaatgaaaacacaacaaaaatgtgaaata-tcagtgacttttaatttcc--aagttattggattgggta
              Angolan colobus  agaatgaaaacacaacaaaaatgtgaaata-tctgtgacttttaatttcc--aagttattgggttgggta
B D  Golden snub-nosed monkey  agaatgaaaacacaacaaaaatgtgaaata-tcagtgacttttaatttcc--aagttattggattgggta
      Black snub-nosed monkey  agaatgaaaacacaacaaaaatgtgaaata-tcagtgacttttaatttcc--aagttattggattgggta
B D                  Marmoset  agaatgaaaacacaacaaaaatgtgaa----acagtgactttttatttcc--aagttattgggttgggta
B D           Squirrel monkey  agaatgaaaatacaacaaaaatgtgaaatagacagtgactttttatttcc--aagttattgggttgggta
          White-faced sapajou  aggatgaaa--acaagaaaaatgtgaaatagacagtgactttttatttcc--aagttattgggttgggta
            Ma's night monkey  a-aatgaaaacacaacaaaaatgtgaaatagacagtgactttttatttct--aagttattgtgttgggta
B D                   Tarsier  aaaatggaaacacaac-agcatgtgaaata-gtgatttttttttgttaccgtgagttgttggatcggatg
                  Mouse lemur  agaatgaaaacacaacaaaaatgtgaaatgtagagtgactttttattact--gagttgttggattggata
            Coquerel's sifaka  agaatgaaaatacaacaaaaatatgaaatgtagagcgactttttattact--gagttgttggattggata
                  Black lemur  agaatgaaaacacaacaaaaatgtgaaatgtagagggactttctattact--gagttgttgggttggata
              Sclater's lemur  agaatgaaaacacaacaaaaatgtgaaatgtagagggactttctattact--gagttgttgggttggata
B D                  Bushbaby  ----------agtaagaaaaatgtgaaatacagagggacttttcattacc--gagttgttggattggata
B D                     Mouse  agaatgaag------------tgtggaatt------------tgattagg--tagtcattaccttgcaca
B D                       Dog  aggatgaaattgcaacaaaaatgtgaaatgcagagtgactttccattgtc--tacttgtcagactggata
B D                 Armadillo  ggaatgaaaatgtaaaggaagtgagaaatatagagtaactttttattacc--tggatgttgaattggata

                        Human  atatatttgggaagtttgtgcataccctgattcttatctaaaa---atgga-tttcttatatctgcagaa
                        Chimp  atatatttgggaagtttgtgcataacctgattcttatctaaaa---atgga-tttcttatatctgcagaa
                       Bonobo  atatatttgggaagtttgtgcataacctgactcttatctaaaa---atgga-tttcttatatctgcagaa
                      Gorilla  atatatttgggaagtttgtgcataacctgattcttatctaaaa---atgga-tttcttatatctgcagaa
                    Orangutan  atacatttgggaagtttgtgcataacctgattcttatctaaaa---atgga-tttcttatatctgcagaa
                       Gibbon  atacatttgggaagtttgtgcgtaacctgattcttatctaaaa---atgga-tttcttatatctgcagaa
                       Rhesus  atacatttgagaagtttgcgcataacctgattcttatctaaaa---atgga-tttcttatatctgcagaa
          Crab-eating macaque  atacatttgagaagtttgcgcataacctgattcttatctaaaa---atgga-tttcttatatctgcagaa
           Pig-tailed macaque  atacatttgagaagtttgcgcataacctgattcttatctaaaa---atgga-tttcttatatctgcagaa
               Sooty mangabey  atacatttgagaagtttgcgcataacctgattcttatctaaaa---atgga-tttcttatatctgcagaa
                       Baboon  atacatttgagaagtttgcgcataacctgattcttatctaaaa---atgga-tttcttatatctgcagaa
                 Green monkey  atacatttgagaagtttgcacataacctgattcttatctaaaa---ataga-tttcttatatctgcagaa
                        Drill  atacatttgagaagtttgcgcataacctgattcttatctaaaa---atgga-tttcttatatctgcagaa
             Proboscis monkey  atacatttgagaagtttgcacataacctgattcttatctaaaa---atggg-tttcttatatctgcagaa
              Angolan colobus  atacatttgagaagtttgcgcataacctgatccttatctaaaa---atgga-tttcctgtatctgcagaa
     Golden snub-nosed monkey  atacatttgagaagtttgcacataacctgattcttatctaaaa---atggg-tttcttatatctgcagaa
      Black snub-nosed monkey  atacatttgagaagtttgcacataacctgattcttatctaaaa---atggg-tttcttatatctgcagaa
                     Marmoset  atacatttgggaagtttgtgcataacatgattgttatctaaaa---atggatttttttatatctgcagaa
              Squirrel monkey  atacatttgggaagtgtgtgcataacctgattcttatctaaaa---atgga-ttttctatatctgcagaa
          White-faced sapajou  atacatttgggaagtttgtgcataacctgattcttatctaaaa---atgga-ttttctatatctgcagaa
            Ma's night monkey  atacatttggggagtttgtgcataacctgattcttatctataa---atgga-ttctttatatctgcagaa
                      Tarsier  atatatttgggaagtttgtgcataacataattctagtctaaga---tttgg-attttcctgggtgcagaa
                  Mouse lemur  aggcatctgagaagtttgtgcataacctgattctagtctaaagc--atggatttttttgtatcttcagaa
            Coquerel's sifaka  atatatctgagaagcttgtgcgtaacctgattctagtctaaagc--atgaa-tttttcataacttcagaa
                  Black lemur  atgtatctgagaagtttgtgcataacccgattctagtctcaagc--atgca-tttttcatatcttcagaa
              Sclater's lemur  atgtatctgagaagtttgtgcataacccgattctagtctcaagc--atgca-tttttcatatcttcagaa
                     Bushbaby  gtatctttgagaagcttgtgaatgacctgattctcctccaacac--atgaa-ttcctcacacctgcagac
                        Mouse  acgcct---ggcagtgtgtcaac--ccagattccaatcca------ctcag-------------------
                          Dog  atatgtttagggagtttatgtataacctgattctggtccagaacatatgga-ttttctacagctacaaaa
                    Armadillo  atatgtttgggaa-tttatgcataagttgattctagtccaaaacatatgga-ctttccaattctgcggaa

                        Human  caagtttaag--------g-ccactgttccccagttctacc-cccagacatgctagctctgccattgtac
                        Chimp  caagtttaag--------g-ccactgttccccagttctacc-cccagacatgctagctctgccattgtac
                       Bonobo  caagtttaag--------g-ccactgttccccagttctacc-cccagacatgctagctctgccattgtac
                      Gorilla  caagtttaag--------g-ccactgttccccagttctacc-cccagacatgccagctctgccgttgtac
                    Orangutan  caagtttaaggccactgtg-ccactgttccccagttctacc-cccagacatgctagctctgccgttgtac
                       Gibbon  caagtttaag--------g-ccaccgttccccagttctacc-cccagacatgctagctctgccattgtac
                       Rhesus  caagtttaag--------g-ccaccgttcccccgttctacc-cccagacgtgctggctctgccatggtac
          Crab-eating macaque  caagtttaag--------g-ccaccgttcccccgttctacc-cccagacgtgctggctctgccatggtac
           Pig-tailed macaque  caagtttaag--------g-ccaccgttcccccgttctacc-cccagacgtgctggctctgccatggtac
               Sooty mangabey  caagttgaag--------g-ccgccgttcccccgttctacc-cccagacgtgctggctctgccatggtac
                       Baboon  caagtttaag--------g-ccgccgttcccccgttctacc-cccagacatgctggctctgccatggtac
                 Green monkey  caagtttaag--------g-ctgccgttcccccgttctacc-cccagacgtgctggctctgccattgtac
                        Drill  caagtttaag--------g-ccgccgttcgcccgttctacc-cccagacgtgctggctctgccatggtac
             Proboscis monkey  caagtttaag--------g-ccaccgttcccccgttctacc-cccagacatgctggctctgccattgtac
              Angolan colobus  caagtttaag--------g-ccaccgttcccccgttctacc-ccgagacgtgctggctctgccattgtac
     Golden snub-nosed monkey  caagtttaag--------g-ccaccgttcccccgttctacc-cccagacatgctggctctgccattgtac
      Black snub-nosed monkey  caagtttaag--------g-ccaccgttccccggttctacc-cccagacatgctggctctgccattgtac
                     Marmoset  caagtttaag--------g-ccgtctttccctagttctacc-cccagacacactagctatgctattgtac
              Squirrel monkey  caagtttaag--------g-ctgtctttccctagttctacc-cccagacatgctagctatgctattgtac
          White-faced sapajou  caagtttaag--------g-ccatctttccctagttctacc-cccagacacgctagctatgctattgtac
            Ma's night monkey  caagtttaag--------g-ccgtctttccctagttctacc-cccagacacgctagctatgccattgtac
                      Tarsier  caagttggag--------g-ccacctttcctccattctacc-cccagacaggcttgctaggccattgtgc
                  Mouse lemur  caaacttaag--------g-gcacctttccccagttctacc-cccagacagtcttgctatgccattgtgc
            Coquerel's sifaka  caaacttaag--------g-ccacctttccccagttctacc-cccagacggtcttgctatgccattgtgc
                  Black lemur  caaacttaag--------g-ccacctttccccagttctacc-tccagacagtctggccacgccattgtgc
              Sclater's lemur  caaacttaag--------g-ccacctttccccagttctacc-tccagacagtctggccacgccattgtgc
                     Bushbaby  caaagttaag--------g-ccgccgtcccctagttctacc-cctagacagtttgggcatgccattgtgc
                        Mouse  --agtttaag--------gaccatctttccccaacccggct-ccctgactggcttgatatttcactatgg
                          Dog  caagtttcag--------g---------------------------agcaggctcgctgccctattgcaa
                    Armadillo  caagttgaag--------gattatccctccctggttctaccacctgggtaggcttgttgacccactggga

                        Human  taggggctgcctgtgtttcctggggaacagccat--ttggtgttcctttaaagacaacatgaaccgttag
                        Chimp  taggggctgcctgtgtttcctggggaacagccat--ttggtgttcctttaaagacaacatgaaccgttag
                       Bonobo  taggggctgcctgtgtttcctggggaacagccat--gtggtgttcctttaaagacaacatgaaccgttag
                      Gorilla  taggggctgcctgtgtttcctggggaacagccat--ttggtgttcctttaaagacaacatgaaccgttag
                    Orangutan  taggggctgcctgtgcttcctggggaacagccat--ttggtgttcctttaaagccaacatgaaccattag
                       Gibbon  taggggctgcctgtgcttcctggggaacagcaat--ttggtgttcctttaaagccaacatgaaccattag
                       Rhesus  taggggctgtccgtgcttccgggggaacagccat--atggtgttcctttaaagccaacaccaaccattag
          Crab-eating macaque  taggggctgtccgtgcttccgggggaacagccat--atggtgttcctttaaagccaacaccaaccattag
           Pig-tailed macaque  taggggctgtccgtgcttccgggggaacagccat--atggtgttcctttaaagccaacaccaaccattag
               Sooty mangabey  taggggctgtccgtgcttccgggggaacagccat--ttggtgttcctttaaagccaacaccaaccattag
                       Baboon  taggggctgtccgtgcttccgggggaacagccat--ttggtgttcctttaaagccaacaccaaccattag
                 Green monkey  taggggctgtccgtgcttccaggggaacagccat--ttggtgttcctttaaagccaacaccaaccattag
                        Drill  taggggctgtccgtgctgccgggggaacagccat--ttggtgttcctttaaagccaacaccaaccattag
             Proboscis monkey  tagggcctgtctgtgcttccgggggaacagccat--ttggtgttcctttaaagccaacaccaaccattag
              Angolan colobus  taggggctgtctgtgcttccggggtaacagccat--ttggtgttcctttaaagccagcaccaaccattag
     Golden snub-nosed monkey  taggggctgtctgtgcttccgggggaacagccat--ttggtgttcctttaaagccaacaccaaccattag
      Black snub-nosed monkey  taggggctgtctgtgcttccgggggaacagccat--ttggtgttcctttaaagccaacaccaaccattag
                     Marmoset  taggg-ctgtgtgtgcttcctggggaacagccat--ttggtgttcctttaaagccaacacaaaccattag
              Squirrel monkey  taggg-ctgtgtgtgcttcctggggaacagccat--ttggtgttcctttaaagccaacaggaaccattag
          White-faced sapajou  taggg-ctgtgtgtgcttcctggggaacagccat--ttggtgttcctttaaagccaacacgaaccattag
            Ma's night monkey  taggg-ctgtgtgtgcttcctggggaacagccat--ttggtgttcctttaaagccaacatgaaccattag
                      Tarsier  taggtgccccctgggccacctggggaacagccat--ttggtcttcctttaaagccaatgtgaaccattag
                  Mouse lemur  aaggccctggcggcactacctagagagcagccat--ttggtcttccttta-------cgtgagccattag
            Coquerel's sifaka  taggccctggcggctctacctagagagcagccat--ttggtcttccttta-------catgaaccattag
                  Black lemur  ta-gccctggcggcgctacctagagagcagccat--ttggtcttccttta-------catgaaccattag
              Sclater's lemur  ta-gccctggcggcggtacctagagagcagccat--ttggtcttccttta-------catgaaccattag
                     Bushbaby  caggccctgccagcactacct-gggggtagcaattgttggtctcccttta-------caagaaccact--
                        Mouse  caacg-ctgcttg-gctccccggagaacagccat--a-ggtgt-ccgcgaaacccaacct--accatt-g
                          Dog  tagg---tgccagtgcaagct-gggagcagccat--tcgatctttc-ttaaagccaacacaaatcattag
                    Armadillo  taggtgttggctgtgctacctcaggagcaaccat--ttggtcttcctttaaatccaaggcgaacttttag

                        Human  agaaaaatc-------aagctgaattcaccagctcagagacatctgacagtcac-aaaa-gctctcttct
                        Chimp  agaaaaatc-------aagctgaattcaccagctcagagacatctgacagtcac-aaaa-gctctcttct
                       Bonobo  agaaaaatc-------aagctgaattcaccagctcagagacatctgacagtcac-aaaa-gctctcttct
                      Gorilla  agaaaaatc-------aaactgaattcaccagctcagagacatctgacagtcgc-aaaa-gctctcttct
                    Orangutan  agaaaaatc-------aagctgaattcaccagcccagagacatctgacagtcac-aaaa-gctctcttct
                       Gibbon  agaaaaatc-------aagctgaattcaccagctcagagacatctgacagtcac-aaaa-gctctcttct
                       Rhesus  agaaaaatc-------aagccgaattcaccagctcagagacatctgacagtcac-aaaa-gctctcttct
          Crab-eating macaque  agaaaaatc-------aagcttaattcaccagctcagagacatctgacagtcac-aaaa-gctctcttct
           Pig-tailed macaque  agaaaaatc-------aagctgaattcaccagctcagagacatctgacagtcac-aaaa-gctctcttct
               Sooty mangabey  agaaaaatc-------aagctgaattcaccagctcagagacatctgacagtcac-aaaa-gctctcttct
                       Baboon  agaaaaatc-------aagctgaattcaccagctcagagacatctgacagtcac-aaaa-gctctcttct
                 Green monkey  agaaaaatc-------aagctgaattcaccagctcagagacatctgacagtcac-aaaa-gctctcttct
                        Drill  agaaaaatc-------aagctgaattcaccagctcagagacatctgacagtcac-aaaa-gctctcttct
             Proboscis monkey  agaaaaatc-------aagctgaattcaccagctcagggacatctgacagtcac-ataa-gctctcttct
              Angolan colobus  agaaaaatc-------aagccgaattcaccagctcagagacatctgacagtcac-aaaa-gctctcttct
     Golden snub-nosed monkey  agaaaaatc-------aagctgaattcaccagctcagggacatctgacagtcac-ataa-gctctcttct
      Black snub-nosed monkey  agaaaaatc-------aagctgaattcaccagctcagggacatctgacagtcac-ataa-gctctcttct
                     Marmoset  agaaaaatc-------aaactgaattcaccagcttagagacatctgacagtcac-aaaa-gctctcttct
              Squirrel monkey  agaaaaatc-------aaactgaattcaccagcttagagacatctgacagtcac-aaaa-gctctcttct
          White-faced sapajou  agaaaaatc-------aaactgaattcaccagcttagagacatctgacattcac-aaaa-gctctcttct
            Ma's night monkey  agaaaaatc-------aaactgaattcaccagcttagagacatctgacagtcac-aaaa-gctctcttct
                      Tarsier  aggaaaatc-------aaactgaatagaccagctcagagacatctgacagtcac-aaaaggctcttgtct
                  Mouse lemur  aggaatatc-------aaactgaacacgccagctcagagacatctgacagtcacaaaag-gctctcttct
            Coquerel's sifaka  aggaatatc-------aaactgaacacgccagctcagagacatctgacagtcacaaaag-gctctcttct
                  Black lemur  aggaatatc-------aaactgcacatgccagcttagagacatctgacggtcacaaaag-gctctcttca
              Sclater's lemur  aggaatatc-------aaactgcacacgccagcttagagacatctgacggtcacaaaag-gctctcttca
                     Bushbaby  -ggaatatc-------aaaccgaatgtgccatcccagagacgtctgacagtcac-aaag-gctctcttct
                        Mouse  agaattttcctctagaaaactgaataaagtaactcagagatgcctggctgccac-agaa-ggc-------
                          Dog  aggaaaatc-------aaactgaaaaatcccttttcgagacatctgacagtcac-cgag-gctctcctcc
                    Armadillo  aggaaaatc-------aaaccgaataaactgattcagaggtagttgacagtcac-aaaacgttctcttcc

                        Human  t-gctttcatgttcctgggaagccctggcttt-----cagtactctatggtaacccatctt-acagagct
                        Chimp  t-gctttcatgttcctgggaagccctggcttt-----cagtactctatggtaacccatctt-acagagct
                       Bonobo  t-gctttcatgttcctgggaagccctggcttt-----cagtactctatggtaacccatctt-acagagct
                      Gorilla  t-gctttcatgttcctgggaagccctggcttt-----cagtactctatggtatcccacctt-acagagct
                    Orangutan  t-gctttcatgttcctgggaagccctggcttt-----cagtactctatggtatcccatctt-acagagct
                       Gibbon  t-gctttcatgttcctgggaagccctggcttt-----cagtactctatggtatcccaactt-acagagct
                       Rhesus  t-gctttcatgttcctgggaagtcctgacttt-----cagtattctatggtatcccatctt-acagagct
          Crab-eating macaque  t-gctttcatgttcctgggaagtcctgacttt-----cagtattctatggtatcccatctt-acagagct
           Pig-tailed macaque  t-gctttcatgttcctgggaagtcctgacttt-----cagtattctatggtatcccatctt-acagagct
               Sooty mangabey  t-gctttcatgttcctgggaagtc----cttt-----cagtattctatggtatcccatctt-acagagct
                       Baboon  t-gctttcatgttcctgggaagtcctgacttt-----cagtattctatggtatcccatctt-acagagct
                 Green monkey  t-gctttcatgttcctgggaagccctgacttt-----cagtattctatggtatcccatctt-acagagct
                        Drill  t-gctttcatgttcctgggaagtcctgacttt-----cagtattctatggtatcccatctt-acagagct
             Proboscis monkey  t-gctttcatgttcctgggaagccctgacttt-----cagtattctatggtatcccatctt-acagagct
              Angolan colobus  t-gctttcatgttcctgggaagccctgacttt-----cagtattctatggtatcccatctt-acagagct
     Golden snub-nosed monkey  t-gctttcatgttcctgggaagccctgacttt-----cagtattctatggtatcccatctt-acagagct
      Black snub-nosed monkey  t-gctttcatgttcctgggaagccctgacttt-----cagtattctatggtatcccatctt-acagagct
                     Marmoset  tggctttcatgttgctgggaagccctagcttt-----cagtactctatggtatcccatctt-acagagcg
              Squirrel monkey  tggctttcatgttgctgggaagccctggcttt-----cagtactccatggtatcccatctt-acagagct
          White-faced sapajou  tggctttcatgttgctgggaagccctgacttt-----cagtagtctatggtatcccatctt-acagagct
            Ma's night monkey  tggctttcatgttgctgggaagccctggcttt-----cagtacgctatggtatcccatctt-acagagct
                      Tarsier  t-gctttcatgctcctgggaagccccggcttt-----cagtcctctgtggtatcatatcttaacagagct
                  Mouse lemur  t-gctttcatgctcctgggaagccccggcttt-----cagtactctatggtgtcctatctt-acagatct
            Coquerel's sifaka  t-gctttcatgctcctgggaagccctggcttt-----cagtactctatggtgtcctatctt-acagatct
                  Black lemur  t-gctttcaagctcctgggaagccctggcttt-----cagtgctctatggtgttctacctt-acagatct
              Sclater's lemur  t-gctttcaagctcctgggaagccctggcttt-----cagtgctctatggtgttctacctt-acagatct
                     Bushbaby  t-gcttcc-cgtcccagggaagcccaggcttt-----cagtgctccctggcatccttcgtc-acagagca
                        Mouse  --tcttccatgtctctctggag-cctgacttc-----tgg-gctccatg------catctg-gcagagct
                          Dog  t-gctttcatg----tgggaagccctggatttcattccagtgctatgtggtatcccatctt-acagagct
                    Armadillo  t-gttttcaggctcctgggaagctctgacttt-----cagtcctaaagagtatcccatcct-acaggtct

                        Human  cac--gaaagcatggtttggtgtgg-gaatgatgc-tgacaggaccgcccgcacgttggctgtcactc
                        Chimp  cac--gaaagcatggtttggtgtgg-gaatgatgc-tgacaggaccgcccgcacgttggctgtcactc
                       Bonobo  cac--gaaagcatggtttggtgtgg-gaatgatgc-tgacaggaccgcccgcatgttggctgtcactc
                      Gorilla  cac--gaaagcatggtttggtgtgg-gaatgatgc-tgacaggaccgcccgcacgttggctgtcactc
                    Orangutan  cac--aaaagcatggtttggtgtgg-gaacgatgc-tgacaggaccgcccgcacgttggctgtcactc
                       Gibbon  cac--aaaagcgtggtttggtgtgg-gaatgatgc-tgacaggaccgcccgcacgctggctgtcactc
                       Rhesus  cac--aaaagcatggtttggtgtgg-gaataatgc-tgacaggaccgcccgcacgttggctgtcactc
          Crab-eating macaque  cac--aaaagcatggtttggtgtgg-gaataatgc-tgacaggaccgcccgcacgttggctgtcactc
           Pig-tailed macaque  cac--aaaagcatggtttggtgtgg-gaataatgc-tgacaggaccgcccgcacgttggctgtcactc
               Sooty mangabey  cac--aaaagcatggtttggtgtgg-gaatgatgc-tgacaggaccgcctgcacgttggctgtcactc
                       Baboon  cac--aaaagcatggtttggtgtgg-gaataatgc-tgacaggaccgcccgcacgttggctgtcactc
                 Green monkey  cac--aaaagcatgagttggtgtgg-gaatgatgc-tgacaggaccgcccgcacgttggctgtcactc
                        Drill  cac--aaaagcatggtttggtgtgg-gaataatgc-tgacaggaccgcccgcacgttggctgtcactc
             Proboscis monkey  cac--aaaagcatgatttggtgtgg-gaatgatgc-tgacaggaccgcccgcacattggctgtcactc
              Angolan colobus  cac--aaaagcatgatttggtgtgg-gaatgatgc-tgacaggaccgcccgcacgttggctgtcactc
     Golden snub-nosed monkey  cac--aaaagcatgatttggtgtgg-gaatgatgc-tgacaggaccgcccgcacgttggctgtcactc
      Black snub-nosed monkey  cac--aaaagcatgatttggtgtgg-gaatgatgc-tgacaggaccgcccgcacgttggctgtcactc
                     Marmoset  cat--aaaagcatggtttggtgtgg-gaatgacgc-ggacagga-cgcccgcacgttggctgtcactc
              Squirrel monkey  cac--aaaagcatggtttggtgtgg-gaatgatgc-tgacagga-cgcctgcatgttggctgtcactc
          White-faced sapajou  cac--aaaagcatggtttggtgtgg-gaatgacgc-tgacagga-cgcctgcatgttagctgtcactc
            Ma's night monkey  cac--aaaagcatggtttggtgtgg-gaatgacgc-tgacagga-cgcctgcatgttggctgtcactc
                      Tarsier  cat--aaaaacatgatttggtccga-gaacaccgc-tgacaggaccgcccgcacgttggctgtctctc
                  Mouse lemur  cacacagaaaaatggtttgctgtga-gacggacgc-tgacaggaccgcctgcgtgttgg-tgttactc
            Coquerel's sifaka  cacacaaaaaaacggtttggtgtga-gacagacgc-tgacaggaccgcctgcatgttgg-tgttactc
                  Black lemur  cacacaaaaaaacggtttggtgtga-gacggccgc-tgacaggaccgcctgcatgttgg-tgttactc
              Sclater's lemur  cacacaaaaaaacggtttggtgtga-gacggccgc-tgacaggaccgcctgcatgttgg-tgttactc
                     Bushbaby  cac---------------------a-gacccccatgcgaggggacctcctgcgtgt--g-ggtcactc
                        Mouse  ctt--gcaagggtggtttgttttga-ggaagatgc-tgac--gacccccctcccatcggctgttgctc
                          Dog  cac--aggaagatggtttggtttcatgaaggacaa-tgacaggacggcccac----tggctgcaagtc
                    Armadillo  tac--aggaagacagtttgttctga-gaacaatgc-tgacagga----ccacacattggccactgctc

Inserts between block 34 and 35 in window
B D                 Bushbaby 828bp

Alignment block 35 of 48 in window, 91097221 - 91097646, 426 bps 
B D                     Human  caggcccgtcttcactcaaag-gcca-------tctattctccactgcccatctgcaattagtgctcgtt
B D                     Chimp  caggcccatcttcactcaaag-gcca-------tctattctccactgcccatctgcaattagtgctcgtt
B D                    Bonobo  caggcccgtcttcactcaaag-gcca-------tctattctccactgcccatctgcaattagtgctcgtt
B D                   Gorilla  caggcccgtcttcactcaaag-gcca-------tctattctccactgcccatctgcaattagtgctcgtt
B D                 Orangutan  caggcccgtcttcactcaaag-gcca-------tctattctccactgcccatctgcaattagtgcttgtc
B D                    Gibbon  caggcccgtcttcactcaaag-gcca-------tctattctccactgcccatctgcaattagtgctcgtc
B D                    Rhesus  caggcccgtcttcactcaaag-gcca-------tctattctccactgcccatctgcaattagcgctcgtc
B D       Crab-eating macaque  caggcccgtcttcactcaaag-gcca-------tctattctccactgcccatctgcaattagcgctcgtc
           Pig-tailed macaque  caggcccgtcttcactcaaag-gcca-------tctattctccactgcccatctgcaattagcgctcgtc
               Sooty mangabey  caggcccgtcttcactcaaag-gcca-------tctattctccactgcccatctgcaattagcgctcgtc
                       Baboon  caggcccgtcttcactcaaag-gcca-------tctattctccactgcccatctgcaattagcgctcgtc
B D              Green monkey  caggcccgtcttcactcaaag-gcca-------tctattctccactgcccatctgcaattagcgctcgtc
                        Drill  caggcccgtcttcactcaaag-gcca-------tctattctccactgcccatctgcaattagcgctcgtc
B D          Proboscis monkey  caggcccgtcttcactcaaag-gcca-------tctattctccactgcccatctgcaattagcgctcatc
              Angolan colobus  caggcccgtcttcactcaaag-gcca-------tctattctccactgcccatctgcaattagcgctcgtc
B D  Golden snub-nosed monkey  caggcccgtcttcactcaaag-gcca-------tctattctccactgcccatctgcaattagcgctcgtc
      Black snub-nosed monkey  caggcccgtcttcactcaaag-gcca-------tctattctccactgcccatctgcaattagcgctcgtc
B D                  Marmoset  caggcccatcttcactcaaag-gcca-------tctattctccactgtccatctacaattagtgctcgtc
B D           Squirrel monkey  caggtccatcttcactcaaag-gcca-------tctattctccactgcccatctgcaattagcgctcatc
          White-faced sapajou  caggcccatcttcactcaaag-gcca-------tctattctccactgcccgtctgcagttagcacttgtc
            Ma's night monkey  caggcccatcttcactcaaag-gcca-------tctattcttcactgcccatctgcaattagcgctcgtc
B D                   Tarsier  caggcctgtcttcactcagag-gcca-------tctctactccactgcccatctgcaattagtgctcgtc
                  Mouse lemur  caggcctgtcttccctcaaag-gcca-------tctatact-cactgcccatctgcaattagcgctcgtt
            Coquerel's sifaka  caggcctgtcttctctcaaag-gcca-------tctatact-cactgcccatctgcaattagcgcttgtt
                  Black lemur  caggcctgtcttctctcaaag-gcca-------tctctact-cactgcccatctgcaattagcgctcgtc
              Sclater's lemur  caggcctgtcttctctcaaag-gcca-------tctctact-cactgtccatctgcaattagcgctcgtc
B D                  Bushbaby  caggcccgg-tcccctcacag-gccatcgtccctctgtcct-cacagcccatctgcgattagcgctc-ct
B D                     Mouse  cgggtctgtcttcactcaaaactcta-------tctgtacttcactgcctgactgcaattagctctcgtc
B D                       Dog  caggcctatcttcactgaagg------------cctctaccccactgcccatctgcagttagcgttcggc
B D                 Armadillo  caggtctgtcttcactcaaag-gctc-------t---------gctgcccatctgcaattagcgcccgtt

                        Human  ggctctgtggaatttatctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
                        Chimp  ggctctgtggaatttatctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
                       Bonobo  ggctctgtggaatttatctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
                      Gorilla  ggctctgtggaatttatctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
                    Orangutan  ggctctgtggaatttatctctccagattttctagctgtaattatagtttctcatttacaatggaacgtta
                       Gibbon  ggctctgtggaatttatctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
                       Rhesus  ggctctgtggaatttctctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
          Crab-eating macaque  ggctctgtggaatttctctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
           Pig-tailed macaque  ggctctgtggaatttctctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
               Sooty mangabey  ggctctgtggaatttctctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
                       Baboon  ggctctgtggaatttctctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
                 Green monkey  ggctctgtggaatttctctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
                        Drill  ggctctgtggaatttctctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
             Proboscis monkey  ggctctgtggaatttatctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
              Angolan colobus  ggctctgtggaatttatctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
     Golden snub-nosed monkey  ggctctgtggaatttatctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
      Black snub-nosed monkey  ggctctgtggaatttatctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
                     Marmoset  ggctctgtggaatttctctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
              Squirrel monkey  ggctctgtggaatttatctctccagattttctagctgtaattacagtttctcatttacaatggaacatta
          White-faced sapajou  ggctctgtggaatttatctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
            Ma's night monkey  ggctctgtggaatttatctctccagattttttagctgtaattatagtttctcatttacaatggaacatta
                      Tarsier  ggctctgtggaatttatttctccagattttctagctgtaattatagtttctcatttacaatggaacattg
                  Mouse lemur  ggctctgtggaatttatctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
            Coquerel's sifaka  ggctctgtggaatttatctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
                  Black lemur  ggctctgtggaatttatctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
              Sclater's lemur  ggctctgtggaatttatctctccagattttctagctgtaattatagtttctcatttacaatggaacatta
                     Bushbaby  ggctc--tggaatt----tctcaagattttcttgcagtaattatagcttctgatttacaatggaacgcgg
                        Mouse  agctctgtggaatttctctctccagtttttctagcagtaattacggtttctcgtttacagtggaac-ttg
                          Dog  ggttccatgggatttctgtccccagatcttctaggtgtaattgtagtttcgcatttacaatggaacagag
                    Armadillo  gcttctatgggattcatctctccagattttctcactgtaattatagtctctcatttacaatggaacatta

                        Human  cactctttttggagctacttcatatacttggcagccgactaaggtgatcatatgtcctgtttctctttct
                        Chimp  cactctttttggagctacttcatatacttggcagccgactaaggtgatcatatgtcctgtttctctttct
                       Bonobo  cactctttttggagctacttcatatacttggcagccgactaaggtgatcatatgtcctgtttctctttct
                      Gorilla  cactctttttggagctacttcatatacttggcagccgactaaggtgatcatatgtcctgtttc-------
                    Orangutan  cactctttttggagctacttcatatacttggcagccgactaaggtgatcatatgtcctgtttc----tct
                       Gibbon  cactctttttggagctacttcatatacttggcagctgactaaggtgatcatatatcctgttcctctttct
                       Rhesus  cactctttttggagctacttcatatacttggcagccgactaaggtgatcatatgtcctgtttctctttct
          Crab-eating macaque  cactctttttggagctacttcatatacttggcagctgactaaggtgatcatatgtcctgtttctctttct
           Pig-tailed macaque  cactctttttggagctacttcatatacttggcagccgactaaggtgatcatatgtcctgtttctctttct
               Sooty mangabey  cactctttttggagctacttcatatacttggcagccgactaaggtgatcatatgtcctgtttctctttct
                       Baboon  cactctttttggagctacttcatatacttggcagccgactaaggtgatcatatgtcctgtttctctttct
                 Green monkey  cactctttttggagctacttcatatacttggcagccgactaaggtgatcatatgtcctgtttctctttct
                        Drill  cactctttttggagctacttcatatacttggcagccgactaaggtgatcatatgtcctgtttctctttct
             Proboscis monkey  cactctttttggagctacttcatatacttggcagccgactaaggtgatcatatgtcctgtttctttttct
              Angolan colobus  cactctttttggagctacttcatatacttggcagccgactaaggtgatcatatgtcctgtttctctttct
     Golden snub-nosed monkey  cactctttttggagctacttcatatacttggcagccgactaaggtgatcatatgtcctgtttctctttct
      Black snub-nosed monkey  cactctttttggagctacttcatatacttggcagccgactaaggtgatcatatgtcctgtttctctttct
                     Marmoset  cactc-ttttggagttgcttcatatacttggcagccgactaaggtgatcatatgtcctgtttctctttct
              Squirrel monkey  cactctttttggagctactttatatacttggctgccgactaaggtgatcatatgtcctgtttctctttct
          White-faced sapajou  cactctttttggagctacttcatatacttggcagccgactaaggtgatcatatgtcctgtttctctttct
            Ma's night monkey  cactctttttggagctacttcatatacttggcagctgactaaggtgatcatatgtcctgtttctctttct
                      Tarsier  cactctttttggagctacttcatatacttggcagccaactaaggtgatcatatgtcctgtttttctttct
                  Mouse lemur  cactctttttggagctacttcatatacttggcagccggcgaaggtgatcatatgtcctgtttttctttct
            Coquerel's sifaka  cactctttttggagctacttcatatacttggcagccgacgaaggtgatcatatgtcctgtttttctttct
                  Black lemur  cactctttttggaggtacttcatatacttggcagccgacgaaggtgatcatatgtcctggttttctttct
              Sclater's lemur  cactctttttggagctacttcatatacttggcagccgacgaaggtgatcatatgtcctggttttctttct
                     Bushbaby  cg--ctttctggagctacttcacaagcttggctgc---cgaaggtgatcatctgtcctgtt--------t
                        Mouse  cagtctgtttggagctacttcatgaacttggcaggcgactgaggtgatcgtgtgtcctatcttgttccct
                          Dog  cactctttttggagctacttcatatacttggcagctgactaaggtgatcatatgtcctgtttttctttct
                    Armadillo  caccctttttggagctacttcatttacttggcagcggactaaggtgatcatatgtcctgtttttctttcg

                        Human  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
                        Chimp  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
                       Bonobo  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
                      Gorilla  -----tctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
                    Orangutan  ttatgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
                       Gibbon  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
                       Rhesus  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
          Crab-eating macaque  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
           Pig-tailed macaque  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
               Sooty mangabey  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
                       Baboon  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
                 Green monkey  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
                        Drill  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
             Proboscis monkey  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
              Angolan colobus  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
     Golden snub-nosed monkey  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
      Black snub-nosed monkey  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
                     Marmoset  ttctgtctgtcttttacaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
              Squirrel monkey  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
          White-faced sapajou  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttcttcttgttactg
            Ma's night monkey  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
                      Tarsier  ttctgtctttcttttaaaaccaggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
                  Mouse lemur  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
            Coquerel's sifaka  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
                  Black lemur  ttctgtctttcttttaaaaccgggacaggtttttgtttttgctgaagtttgctgtttctccttgttactg
              Sclater's lemur  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
                     Bushbaby  ctccgtcttccttttaaaacccggacaggtctttgtttttgctgaagtttgctgtttctccttgttactg
                        Mouse  ttctatctgtctttcaaaaccaggacaggtctttg-ttttgctgaagtttgccatttccccttgtttctg
                          Dog  ttctgtctttcttttaaaaccgggacaggtctttgtttttgctgaagtttgccgtttctccttgttactg
                    Armadillo  t----tctttcttttaaaaccaggacaggtctttgtttttgctgaagtttgccatttcttcttgttactc

                        Human  atgtgcagcctcctttgtgctgacagccaagaaaattctggaccgctgccctgtttgcctccagagactg
                        Chimp  atgtgcagcctcctttgtgctgacagccaagaaaattctggaccgctgccctgtttgcctccagagactg
                       Bonobo  atgtgcagcctcctttgtgctgacagccaagaaaattctggaccgctgccctgtttgcctccagagactg
                      Gorilla  atgtgcagcctcctttgtgctgacagccaagaaaattctggaccgctgccctgtttgcctccagagactg
                    Orangutan  atgtgcagcctcctttgtgctgacagccaagaaaattctggaccgctgccctgtttgcctccagagactg
                       Gibbon  atgtgcagcctcctttgtgctgacagccaagaaaattctggactgctgccctgtttgcctccagagactg
                       Rhesus  atgtgcagcctcctttgtgctgacagccaagaaaattctggaccgctgccctgtttgcctcccgagactg
          Crab-eating macaque  atgtgcagcctcctttgtgctgacagccaagaaaattctggaccgctgccctgtttgcctcccgagactg
           Pig-tailed macaque  atgtgcagcctcctttgtgctgacagccaagaaaattctggaccgctgccctgtttgcctcccgagactg
               Sooty mangabey  atgtgcagcctcctttgtgctgacagccaagaaaattctggaccgctgccctgtttgcctcccgagactg
                       Baboon  atgtgcagcctcctttgtgctgacagccaagaaaattctggaccgctgccctgtttgcctcccgagactg
                 Green monkey  atgtgcagcctcctttgtgctgacagccaagaaaattctggaccgctgccctgtttgcctcccgagactg
                        Drill  atgtgcagcctcctttgtgctgacagccaagaaaattctggaccgctgccctgtttgcctcccgagactg
             Proboscis monkey  atgtgcagcctcctttgtgctgacagccaagaaaattctggaccgctgccctgtttgcctcccgagactg
              Angolan colobus  atgtgcagcctcctttgtgctgacagccaagaaaattctggaccgctgccctgtttgcctcccgagactg
     Golden snub-nosed monkey  atgtgcagcctcctttgtgctgacagccaagaaaattctggaccgctgccctgtttgcctcccgagactg
      Black snub-nosed monkey  atgtgcagcctcctttgtgctgacagccaagaaaattctggaccgctgccctgtttgcctcccgagactg
                     Marmoset  atgtgcagcctcctttgtgctgacagccaagaaaattctggactgctgccctgtttgcctccagagactg
              Squirrel monkey  atgtgcagcctcctttgtgctgacagccaagaaaattctggaccgctgccctgtttgcctccagagactg
          White-faced sapajou  atgtgcagcctcctttgtgctgacagccaagaaaattctggaccactgccctgtttgcctccagagactg
            Ma's night monkey  atgtgcagcctcctttgtgctgacagccaagaaaattctggaccgctgccctgtttgcctccagagactg
                      Tarsier  atgtgcagcctcctttgtgctgacggccaagaaaattctggactgctgccctggttgcctccagagactg
                  Mouse lemur  atgtgcagcctcttttgtgctgacggccaagaaaattctggactgctgccctctttgcctccagagaccg
            Coquerel's sifaka  atgtgcagcctcctttgtgctgacggccaagaaaattctggactgctgccctgtttgcctccagagaccg
                  Black lemur  atgtgcagcctcctttgtgctgacggccaagaaaattctggaccgttgccctgtttgcctccagagactg
              Sclater's lemur  atgtgcagcctcctttgtgctgacggccaagaaaattctggaccgttgccctgtttgcctccagagactg
                     Bushbaby  atgtgcggcctcctttgtgctgacggccaagaaaattctggactgctgccctgtttgcctccagagactg
                        Mouse  atgtgcagccttctttgtgctgacagccaagaacgctctggactgttgccccgtttgcctccagagactg
                          Dog  atgtgcagcctcctttgtgctgacggccaagaaaattctggactgctgccctgtttgcctccagagactg
                    Armadillo  atgtgcaacctcctttgtgctgacggccaagaaaattctggaccgctgccctgtttgcctccagagactg

                        Human  atgcaaagtcttcaaagtaaagtcagtggg---tttt----------------ttt---------caaaa
                        Chimp  atgcaaagtcttcaaagtaaagtcagtggg---tttt----------------ttt---------caaaa
                       Bonobo  atgcaaaatcttcaaagtaaagtcagtggg---tttt----------------ttt---------caaaa
                      Gorilla  atgcaaagtcttcaaagtaaagtcagtggg---tttt----------------ttt---------caaaa
                    Orangutan  atgcaaagtcttcaaagtaaagtcagtggg---tttt----------------ttt---------caaaa
                       Gibbon  atgcaaagtcttcaaagtaaagtcagtggg---tttt----------------ttt---------caaaa
                       Rhesus  atgcaaagtcttcaaagtaaagtcagtggg---tttt----------------ttt---------caaaa
          Crab-eating macaque  atgcaaagtcttcaaagtaaagtcagtggg---tttt----------------ttt---------caaaa
           Pig-tailed macaque  atgcaaagtcttcaaagtaaagtcagtggg---tttt----------------ttt---------caaaa
               Sooty mangabey  atgcaaagtcttcaaagtaaagtcagtggg---tttt----------------ttt---------caaaa
                       Baboon  atgcaaagtcttcaaagtaaagtcagtggg---tttt----------------ttt---------caaaa
                 Green monkey  atgcaaagtcttcaaagtaaagtcagtggg---tttt----------------ttt---------caaaa
                        Drill  atgcaaagtcttcaaagtaaagtcagtggg---tttt----------------ttt---------caaaa
             Proboscis monkey  atgcaaagtcttcaaagtaaagtcagtggg---tttt----------------ttt---------caaaa
              Angolan colobus  atgcaaagtcttcaaagtaaagtcagtggg---tttt----------------ttt---------caaaa
     Golden snub-nosed monkey  atgcaaagtcttcaaagtaaagtcagtggg---tttt----------------ttt---------caaac
      Black snub-nosed monkey  atgcaaagtcttcaaagtaaagtcagtggg---tttt----------------ttt---------caaac
                     Marmoset  atgcaaagtcttcaaagtaaagt-agtggg---tttt----------------ttt---------caaaa
              Squirrel monkey  atgcaaagtcttcaaagtaaagtcagtggg---tttt----------------ttt---------cgaaa
          White-faced sapajou  atgcaaagtcttcaaagtaaagtcagtggg---cttt----------------ctt---------caaaa
            Ma's night monkey  ttgcaaagtcttcaaagtaaagtcagtggg---tttt----------------ttt---------caaaa
                      Tarsier  atgcaaagtcttcaaagtaaagtcagtggg----ttt----------------ttt---------caaaa
                  Mouse lemur  atgcaaagtcttcaaaggaaagtcagtggatattttt----------------ttt---------caaaa
            Coquerel's sifaka  atgcaaagtcttcaaagtaaagtcagtgga---tttt----------------ttt---------caaaa
                  Black lemur  acgcaaagtcttcaaaggaaagtcagtgga---tttt----------------ttt---------caaaa
              Sclater's lemur  acgcaaagtcttcaaaggaaagtcagtgga---tttt----------------ttt---------caaaa
                     Bushbaby  atgcggactcttcaaagtaaagtcagtgtt---tttcttcttctttttttaaattt---------caaaa
                        Mouse  atgcaaaatcttcaaagtgaagtcagtggg----ttt----------------tct---------cagaa
                          Dog  atgcaaagtcttcaaagtaaattcagtggg---cctt----------------tttttttccccccaaaa
                    Armadillo  atgtaaagtcttcaaagtaaagtcagtgag----ttt----------------ttt---------aaaaa

                        Human  tagagtttact-agaaacaagacatcttcatgcttatgaggac
                        Chimp  tagagtttact-agaaacaagacatcttcatgcttatgaggac
                       Bonobo  tagagtttact-agaaacaagacatcttcatgcttatgaggac
                      Gorilla  tagagtttact-agaaacaagacatcttcatgcttatgaggac
                    Orangutan  tagagtttact-agaaacaagacatcttcatgcttatgaggac
                       Gibbon  tagagtttact-agaaacaagacatcttcatgcttatgaggac
                       Rhesus  tagagtttact-agaaacaagacatcttcatgcttatgaggac
          Crab-eating macaque  tagagtttact-agaaacaagacatcttcatgcttatgaggac
           Pig-tailed macaque  tagagtttact-agaaacaagacatcttcatgcttatgaggac
               Sooty mangabey  tagagtttact-agaaacaagacatcttcatgcttatgaggac
                       Baboon  tagagtttact-agaaacaagacatcttcatgcttatgaggac
                 Green monkey  taaagtttact-agaaacaagacatcttcatgcttatgaggac
                        Drill  tagagtttact-agaaacaagacatcttcatgcttatgaggac
             Proboscis monkey  tagagtttactaagaaacaagacatcttcatgcttatgaggac
              Angolan colobus  tagagtttact-agaaacaagacatcttcatgcttatgaggac
     Golden snub-nosed monkey  tagagtttact-agaaacaagacatcttcatgcttatgaggac
      Black snub-nosed monkey  tagagtttact-agaaacaagacatcttcatgcttatgaggac
                     Marmoset  tagagtttact-agaaacaagacatcttcatgcttatgagaac
              Squirrel monkey  tagagtttact-agaaacaagacatcttcatgcttatgagaac
          White-faced sapajou  tagagtttact-agaaacaagacatcttcatgcttatgagaac
            Ma's night monkey  tagagtttact-agaaacaagacatcttcatgcttatgagaac
                      Tarsier  tagagtttact-agaaacaagacatcttcatgcttatgaggac
                  Mouse lemur  tagagtttacc-agaaacaagacatcttcatgcttatgaggac
            Coquerel's sifaka  tcgagtttacc-agaaacaagacatcttcatgcttatgaggac
                  Black lemur  tagagtttacc-agaaacaagacatcttcatgcttatgaggac
              Sclater's lemur  tagagtttacc-agaaacaagacatcttcatgcttatgaggac
                     Bushbaby  tagagtttacc-agaaacaagacatcttcatgcttgtgaggac
                        Mouse  tagagtttacc-agagactagacacattcatgcttaggaatct
                          Dog  tagagtttacc-agaaacaagacatcttcatgcttgtgaggac
                    Armadillo  tggagtttacc-agaaacaagacatcttcatgcttatgaggac

Alignment block 36 of 48 in window, 91097647 - 91097698, 52 bps 
B D                     Human  cttgctctccactgcaaaactttcaaagactgacaggctg--gacttggcctct
B D                     Chimp  cttgctctccactgcaaaactttcaaagactgacaggctg--gacttggcctct
B D                    Bonobo  cttgctctccactgcaaaactttcaaagactgacaggctg--gacttggcctct
B D                   Gorilla  cttgctctccactgcaaaactttcaaagactgacaggctg--gacttggcctct
B D                 Orangutan  cttgctctccactgcaaaactttcaaagactgacaggctg--gacttggcctct
B D                    Gibbon  cttgctctccactgcaaaactttcaaagactgacaggctg--gacttggcctct
B D                    Rhesus  cttgctctccactgcaaaactttcaaagactgacaggctg--gacttggcctct
B D       Crab-eating macaque  cttgctctccactgcaaaactttcaaagactgacaggctg--gacttggcctct
           Pig-tailed macaque  cttgctctccactgcaaaactttcaaagactgacaggctg--gacttggcctct
               Sooty mangabey  cttgctctccactgcaaaactttcaaagactgacaggctg--gacttggcctct
                       Baboon  cttgctctccactgcaaaactttcaaagactgacaggctg--gacttggcctct
B D              Green monkey  cttgctctccactgcaaaactttcaaagactgacaggctg--gacttggcctct
                        Drill  cttgctctccactgcaaaactttcaaagactgacaggctg--gacttggcctct
              Angolan colobus  cttcctctccactgcaaaactttcaaagactgacaggctg--gacttggcctct
B D  Golden snub-nosed monkey  cttgctctccactgcaaaactttcaaagactgacaggctg--gacttggcctct
      Black snub-nosed monkey  cttgctctccactgcaaaactttcaaagactgacaggctg--gacttggcctct
B D                  Marmoset  cttgctctccactgcaaaacctgcaaagactgacaggctg--gacttggcctct
B D           Squirrel monkey  cttgctctccactgcaaaactttcaaagactgacaggctg--gacttggcctct
          White-faced sapajou  cttgctctccactgcaaaactttcaaagactgacaggctg--gacttggtctct
            Ma's night monkey  cttgctctccactgcaaaagtttcaaagactgacaggctg--gacttggcctct
B D                   Tarsier  cttgccctccactgcagaactttcaaagacgaacagcgtg--gacttggcctct
                  Mouse lemur  cttgctctccactgcaaaactttcaaagactgacagcctg--ggcttggcctct
            Coquerel's sifaka  cttgctctccactgcaaaacttgcaaagactgacagcctg--ggcttggcctct
                  Black lemur  cttgctctccactgcaaaactttcaaagactgacagcctg--ggcttggcctat
              Sclater's lemur  cttgctctccactgcaaaactttcaaagactgacagcctg--ggcttggcctat
B D                  Bushbaby  cctgctctccacagcaaaactttcaaagactcatagactg--ggtttggcctct
B D                     Mouse  attactctccgctg-aaaattttcagag--tgacagcctggtgtgttggcaact
B D                       Dog  cttgctgtctactgcaaaactttcaaagactgacagcctg--gacttggcctct
B D                 Armadillo  cttgctctctactgcaaaattttaaaagactgacag-ctg--ggctgggctcca
B D          Proboscis monkey  ======================================================

Inserts between block 36 and 37 in window
                      Baboon 143bp

Alignment block 37 of 48 in window, 91097699 - 91097800, 102 bps 
B D                     Human  ctgaggtttgcaaacgtacttgaaaccacttg------------------------aaaaaaaaaatggt
B D                     Chimp  ctgaggtttgcaaacgtacttgaaaccacttg-------------------------aaaaaaaaatggt
B D                    Bonobo  ctgaggtttgcaaacatacttgaaaccacttg--------------------------aaaaaaaatggt
B D                   Gorilla  ctgaggtttgcaaacatacttgaaaccacttg-----------------------aaaaaaaaaaatggt
B D                 Orangutan  ctgaggtttgcaaacgtacttgaaaccacttg-------------------------aaaaaaaaatggt
B D                    Gibbon  ctgaggtttgcaaacgtacttgaaaccacttgaaa--------------------aaaaaaaaaaatggt
B D                    Rhesus  ctgaggtttgcaaaggtacttgaaaccacttg--------------------------aaaaaaaatggt
B D       Crab-eating macaque  ctgaggtttgcaaaggtacttgaaaccacttg--------------------------aaaaaaaatggt
           Pig-tailed macaque  ctgaggtttgcaaaggtacttgaaaccacttg--------------------------aaaaaaaatggt
               Sooty mangabey  ctgaggtttgcaaaggtacttgaaaccacttg------------------------aaaaaaaaaatggt
                       Baboon  ctgaggtttgcaaaggtacttgaaaccacttg-----------------------aaaaaaaaaaatggt
B D              Green monkey  ctgaggtttgcaaacgtacttgaaaccacttg--------------------------aaaaaaaatggt
                        Drill  ctgaggtttgcaaaggtacttgaaaccacttg-------------------------aaaaaaaaatggt
              Angolan colobus  ctgaggtttgcaaacgtacttgaaaccacttg------------------------aaaaaaaaaatggc
B D  Golden snub-nosed monkey  ctgaggtttgcaaacgtacttgaaaccacttg------------------------aaaaaaaaaatggc
      Black snub-nosed monkey  ctgaggtttgcaaacgtacttgaaaccacttg------------------------aaaaaaaaaatggc
B D                  Marmoset  ctgaggtttgcaaacatacttgaaaccacttg-----------------------aaaaaaaaaaaaggt
B D           Squirrel monkey  ctgaggtttgcaaacatacttgaaaccacttgaaa--------------------aaaaaaaaaaaaggt
          White-faced sapajou  ctaaggtttgcaaacatacttgaaaccacttaaaa--------------------aaaaaaaaaaaaggt
            Ma's night monkey  ctgaggttggcaaacatacttgaaaccacttg-----------------------gaaaaaaaaaaaggt
B D                   Tarsier  ctgaagtttgtaaacgtacttgaaaccacttg--------------------------aaaaaaaatggt
                  Mouse lemur  ctgagatttgcaaatgtatttgaaaccacttg------------------------aaaaaaaaaatgat
            Coquerel's sifaka  ctgaggtttgcaaatgtacttgaaaccacttg------------------------aaaaacaaaatgat
                  Black lemur  ctgaggtttgcaaatgtacttgaaaccacttg-----------------------aaaaaaaaaaatgat
              Sclater's lemur  ctgaggtttgcaaatgtacttgaaaccacttg-----------------------aaaaaaaaaaatgat
B D                  Bushbaby  ctgagtttcgcaaatgtacttgaaaccacttg-----------------------aaaaaaaattttttt
B D                     Mouse  ctcatgtctgcaaatatacttgaaaccacttgaaataacaaacaaacaaacaaacaaacaacaataaagg
B D                       Dog  ctgaggtttacaaatgcacttgaaaacacttg-------------------------aaaaaaaaatggt
B D                 Armadillo  ctgaggttagcaaacgtacttgaaaccacttg---------------------------aaaaaaatggc
B D          Proboscis monkey  ======================================================================

                        Human  ttcagcaacggcaacaatgaggttaagactcag-ttttattttagttt----------------------
                        Chimp  ttcagcaacggcaacaatgaagttaagactcag-ttttattttagttt----------------------
                       Bonobo  ttcagcaacggcaacaatgaagttaagactcag-ttttattttagttt----------------------
                      Gorilla  ttcagcaacggcaacaatgaagttaagactcag-ttttattttagttt----------------------
                    Orangutan  ttcagcagtggcaacaatgaagttaagactcag-ttttattttagttt----------------------
                       Gibbon  ttcagcaagggcaacaatgaagttaagactcag-ttttattttagttt----------------------
                       Rhesus  ttcagcaagggcaacaatgcagttaagactcag-ttttgttttagttt----------------------
          Crab-eating macaque  ttcagcaagggcaacaatgaagttaagactcag-ttttgttttagttt----------------------
           Pig-tailed macaque  tccagcaagggcaacaatgaagttaagactcag-ttttgttttagttt----------------------
               Sooty mangabey  ttcagcaagggcaacaatgaagttaagactcag-ttttgttttagttt----------------------
                       Baboon  ttcagcaagggcaacaatgaagttaagactcag-ttttgttttagttt----------------------
                 Green monkey  ttcagcaagggcaacaatgaagttaagactcag-ttttgttttagttt----------------------
                        Drill  ttcagcaagggcaacaatgaagttaagactcag-ttttgttttagttt----------------------
              Angolan colobus  ttcagcaagggcaacaatgaagttaagactcag-ttttattttagttt----------------------
     Golden snub-nosed monkey  ttcagcaagggcaacaatgaagttaagactcag-ttttattttagttt----------------------
      Black snub-nosed monkey  ttcagcaagggcaacaatgaagttaagactcag-ttttattttagttt----------------------
                     Marmoset  ttccgcaagggcaacaatgaagttaagactcag-ttttattttggttt----------------------
              Squirrel monkey  ttcagcaagggcaacaatgaagttaagactcag-ttttattttggttt----------------------
          White-faced sapajou  ttcagcaagggcaacaatgaagttaagactcag-ttttattttggttt----------------------
            Ma's night monkey  ttcagcaagggcaacaatgaagttaagactcag-ttttattttggttt----------------------
                      Tarsier  ctcaacaagggcaacaatgaagttaagattcaa-ttttagtttagttttcttttctttctttcttttttt
                  Mouse lemur  ttcagtaaggacaacaatggagttaagactcaa-ttttagtttag-tt--------------------tg
            Coquerel's sifaka  ttcagtaaggacagcaacgaagttaagactcaa-ttttagtttagttt--------------------tg
                  Black lemur  ttcagtaagga---caatgaagttaagactcaa-ttttagtttagttt--------------------tg
              Sclater's lemur  ttcagtaagga---caatgaagttaagactcaa-ttttagtttagttt--------------------tg
                     Bushbaby  ttccaaaagggcaacaatg-----aagacccaa-ttttattttagtta--------------------tt
                        Mouse  ttcagccagggcaacgattcgttaaacactcaatttttgttttggtta--------------------tt
                          Dog  ttcagcaaggacaacaatgaagttaagcctcaa-ttttattttattgt----------------------
                    Armadillo  ttcagcaagggcaacaatgaacttaaacctcaa-tttt-------ttt----------------------
             Proboscis monkey  ======================================================================

                        Human  ---agt-ttttca
                        Chimp  ---agt-ttttca
                       Bonobo  ---agt-ttttca
                      Gorilla  ---agt-ttttca
                    Orangutan  ---agt-ttttca
                       Gibbon  ---agt-ttttca
                       Rhesus  ---agt-ttttca
          Crab-eating macaque  ---agt-ttttca
           Pig-tailed macaque  ---agt-ttttca
               Sooty mangabey  ---agt-ttttca
                       Baboon  ---agt-ttttca
                 Green monkey  ---agt-ttttca
                        Drill  ---agt-ttttca
              Angolan colobus  ---agt-ttttca
     Golden snub-nosed monkey  ---agt-ttttca
      Black snub-nosed monkey  ---agt-ttttca
                     Marmoset  ---agt-ttttca
              Squirrel monkey  ---ggt-ttttca
          White-faced sapajou  ---agt-ttttca
            Ma's night monkey  ---agt-ttttca
                      Tarsier  ttagtt-ttttca
                  Mouse lemur  ttgagtgttttta
            Coquerel's sifaka  ttgagt-ttttta
                  Black lemur  ttgagt-ttttta
              Sclater's lemur  ttgagt-ttttta
                     Bushbaby  tt---t-ttttta
                        Mouse  ttcagt-ttctca
                          Dog  ---att-ttttta
                    Armadillo  ---att-tttttg
             Proboscis monkey  =============

Inserts between block 37 and 38 in window
                 Mouse lemur 8bp
           Coquerel's sifaka 8bp
                 Black lemur 8bp
             Sclater's lemur 29bp
B D                 Bushbaby 8bp
B D                      Dog 8bp

Alignment block 38 of 48 in window, 91097801 - 91097839, 39 bps 
B D                     Human  tttggca-tga-c-aaaaatgttaaaaaatattttcagttg--a
B D                     Chimp  tttggca-tga-c-aaaaatgttaaaaaatattttcagttg--a
B D                    Bonobo  tttggca-tga-c-aaaaatgttaaaaaatattttcagttg--a
B D                   Gorilla  tttggca-tga-c-aaaaatgttaaaaaatattttcagttg--a
B D                 Orangutan  tttggca-tga-taaaaaatgttaaaaagtattttcagttg--a
B D                    Gibbon  tttgcca-tga-taaaaaatgttaaaaaatattttcagttg--a
B D                    Rhesus  tttggca-tga-taaaaaatgttaaaaaacgttttcagttg--a
B D       Crab-eating macaque  tttggca-tga-taaaaaatgttaaaaaacgttttcagttg--a
           Pig-tailed macaque  tttggca-tga-taaaaaatgttaaaaaacgttttcagttg--a
               Sooty mangabey  tttggca-tga-taaaaaatgttaaaaaacgttttcagttg--a
                       Baboon  tttggca-tga-taaaaaatgttaaaaaacattttcagttg--a
B D              Green monkey  tttggca-tga-----------taaaaaatgttttcagttg--a
                        Drill  tttggca-tga-taaaaattgttaaaaaacgttttcagttg--a
              Angolan colobus  tttggca-tga-taaaaaatgttaaaaaatgttttcaattg--a
B D  Golden snub-nosed monkey  tttggca-tga-taaaaaatgttaaaaaatgttttcaattg--a
      Black snub-nosed monkey  tttggca-tga-taaaaaatgttaaaaaatgttttcaattg--a
B D                  Marmoset  tttggca-cga-tacaacatgtttcaaaatattttcagttg--a
B D           Squirrel monkey  tttggca-tga-t---acatgtttcaaaatattttcagttg--a
          White-faced sapajou  tttggca-cga-tacaacatgtttcaaaatattttcagtcg--a
            Ma's night monkey  tttggca-cga-tacaacatgtttcaaaatattttcagttg--a
B D                   Tarsier  tttggcaccaa-tagaaaatgtctaaacgtattttcagttg--g
                  Mouse lemur  tttggca-cca-------------------attttcagttg---
            Coquerel's sifaka  tttggca-cca-------------------attttcagttg---
                  Black lemur  tttggaa-cca-------------------atattcagttga--
B D                  Bushbaby  gttggca-cca-g-tagaaaatttgagaatattttcagttg-a-
B D                     Mouse  ttttata-gga-ataaaaat-----------ttttaggcag---
B D                       Dog  tttggca-tcaatagaaagtgtttaaaaatatttttggttg--g
B D                 Armadillo  tttggcc-tcaatagcaaatgttttaaaatatttttggttg--g
             Sclater's lemur  ============================================
B D          Proboscis monkey  ============================================

Alignment block 39 of 48 in window, 91097840 - 91097916, 77 bps 
B D                     Human  atgttcttca-ggcagaccctgaagacgacttttggtcagttctcagtaaaagtgtgatcatgaaataa-
B D                     Chimp  atgttcttca-ggcagaccctgaagacgactttttgtcagttctcagtaaaagtgtgatcatgaaataa-
B D                    Bonobo  atgttcttca-ggcagaccctgaagacgactttttgtcagttctcagtaaaagtgtgatcatgaaataa-
B D                   Gorilla  atgttcttca-ggcagaccctgaagacgactttttgtcagttctcagtaaaagtgtgatcatgaaataa-
B D                 Orangutan  atgttcttca-ggcagaccctgaagacgactttttgtcagttctcagtaaaagtgtgatcatgaaataa-
B D                    Gibbon  atgttcttca-ggcagaccctgaagacgactttttgtcagttctcagtaaaagggtgatcatgaaataa-
B D                    Rhesus  atgttcttca-ggcagaccctgaagacgactttttgtcagttcccagtaagagtgtgatcacgaaataa-
B D       Crab-eating macaque  acgttcttca-ggcagaccctgaagacgactttttgtcagttcccagtaagagtgtgatcacgaaataa-
           Pig-tailed macaque  atgttcttca-ggcagaccctgaagacgactttttgtcagttcccagtaagagtgtgatcacgaaataa-
               Sooty mangabey  attttcttca-ggcagaccctgaagacgactttttgtcagttcccagtaagagtgtgatcacgaaataa-
                       Baboon  attttcttca-ggcagaccctgaagacgactttttgtcagttcccagtaagagtgtgatcacgaaataa-
B D              Green monkey  attttcttca-ggcagaccctgaagacaactttttgtcggttcccagtaagagtgtgatcacgaaataa-
                        Drill  attttcttca-ggcaga-cctgaagacgactttttgtcagttcccagtaagagtgtgatcacgaaataa-
              Angolan colobus  attttcttca-ggcagaccctgaagacgactttttgtcagttctcagtaaaagtgtgatcatgaaataa-
B D  Golden snub-nosed monkey  attttcttca-gacagaccctgaagacgactttgtgtcagttctcagtaaaagtgtgatcatgaaataa-
      Black snub-nosed monkey  attttcttca-gacagaccctgaagacgactt--tgtcagttctcagtaaaagtgtgatcatgaaataa-
B D                  Marmoset  atgttcttcg-ggcaaaccctgaagatgactttttgtcagttctcagtaaaggtgcgatcatgaaataa-
B D           Squirrel monkey  atgttcttcg-ggcaaaccctgaagatgactttttgtcagttctcagtaaaggtgtgatcatgaaataa-
          White-faced sapajou  atggtcttcg-ggcaaaccatgaagatgactttttgtcagttctcagtaaaggtgtgatcatgaaataa-
            Ma's night monkey  atgttcttcg-ggcaaaccccaaagatgactttttgtcagttctcagtaaagatgtgatcatgaaataa-
B D                   Tarsier  atgctccttg-ggcaaa-cctgaagagggctttctggcagttctcaataatgctatgatcattaaataac
                  Mouse lemur  atgttctttg-ggtagaacctgaggaggactt--tgtcagtgatcagtaaaggtatgattgtgaaataat
            Coquerel's sifaka  acattctttg-ggtagaatctgaggaggactttctgtcagttgtcagtaaaggtatgatcatgaaataat
                  Black lemur  -tgttctttg-ggtagaacctgaggaggactttctgtcagttgtcagcaaaggtatgattgtga---aat
              Sclater's lemur  atgttctttg-ggtagaacctgaggaggactttctgtcagttgtcagcaaaggtatcattgtga---aat
B D                  Bushbaby  -tattctttg-ggtagaacctggagaggactttcagtctgttctcggtaaaggtatgttcatgaaataat
B D                     Mouse  atgcccttggtggggtaacctgcagtggactt--tgtaagtgctcggc-agagtctagtcaagacataat
B D                       Dog  atgttctttg-ggcagatcctgaagaggcctttctgtcagttctcagtgaaagtatgatcgtgaaacaat
B D                 Armadillo  gtgttcattg-ggaagaacctgaagaggactttctgccagttttcaggaaaagtataatcaagaaataa-
B D          Proboscis monkey  ======================================================================

                        Human  ttgtttaag
                        Chimp  ttgtttaag
                       Bonobo  ttgtttaag
                      Gorilla  ttgtttaag
                    Orangutan  ttgtttaag
                       Gibbon  ttgtttaag
                       Rhesus  ttgtttaag
          Crab-eating macaque  ttgtttaag
           Pig-tailed macaque  ttgtttaag
               Sooty mangabey  ttgtttaag
                       Baboon  ttgtttaag
                 Green monkey  ttgtttaag
                        Drill  ttgtttaag
              Angolan colobus  ctgtttaag
     Golden snub-nosed monkey  ttgtttaag
      Black snub-nosed monkey  ttgtttaag
                     Marmoset  ttgtttaag
              Squirrel monkey  ttgtttaag
          White-faced sapajou  ttgtttaag
            Ma's night monkey  ttgtttaag
                      Tarsier  ctgtttaac
                  Mouse lemur  ttgtttaag
            Coquerel's sifaka  ttgcttagc
                  Black lemur  ttgtttaac
              Sclater's lemur  ttgtttaac
                     Bushbaby  ttatttaac
                        Mouse  ctgcttag-
                          Dog  ttgtttaac
                    Armadillo  ttgttaaac
             Proboscis monkey  =========

Alignment block 40 of 48 in window, 91097917 - 91098655, 739 bps 
B D                     Human  caaaattccctcaagcctatgtattttgctgctgtcatggaacagagtatctagttgcatgtgataggct
B D                     Chimp  caaaattccctcaagcctatgtatttcgctgctgtcatggaacagagtatctagttgcatgtgataggct
B D                    Bonobo  caaaattccctcaagcctatgtattttgctgctgtcatggaacagagtatctagttgcatgggataggct
B D                   Gorilla  caaaatt-cctcaagcctatgtattttgctgctgtcatggaacggagtatctagttgcatgtgataggct
B D                 Orangutan  caaaattccctcaagcctatgtattttgctgctgtcatggaacagagtatctagttgcatgtgataggct
B D                    Gibbon  caaaattcccttaagcctatgtattttgctgctgccatggaacagagtatctagttgtatgtgataggct
B D                    Rhesus  caaaattccctcaagcctatgtattttgctgctgtcatgaaacagaatatctagttgcatgtgataggct
B D       Crab-eating macaque  caaaattccctcaagcctatgtattttgttgctgtcatgaaacagaatatctagttgcatgtgataggct
           Pig-tailed macaque  caaaattccctcaagcctatgtattttgctgctgtcatgaaacagaatatctagttgcatgtgataggct
               Sooty mangabey  caaaattccctcaagcctatgtattttgctgctgtcatgaaacagaatatctagttgcatgtgataggct
                       Baboon  caaaattccctcaagcctatgtattttgctgctgtcacgaaacagaatatctagttgcatgtgataggct
B D              Green monkey  caaaattccctcaagcctatgtattttgctgctgtcatgaaacagaatatctagttgcatgtgatgggct
                        Drill  caaaattccctcaagcctatgtattttgctgctgtcatgaaacagaatatctagttgcatgtgataggct
B D          Proboscis monkey  caaaattccctcaagcctatgtattttgctgctgtcatgaaacagaatatctagttgcatgtgataggct
              Angolan colobus  caaaattccctcaagcctatgtattttgctgctgtcacgaaacagaatatctagttgcatgtgataggct
B D  Golden snub-nosed monkey  caaaattccctcaagcctatgtattttgctgctgtcatgaaacagaatatctagttgcatgtgataggct
      Black snub-nosed monkey  caaaattccctcaagcctatgtattttgctgctgtcatgaaacagaatatctagttgcatgtgataggct
B D                  Marmoset  caaaactccctcaagcctatgtattttgctgctgtca----------tatctagctccatgtgataggct
B D           Squirrel monkey  caaaactccctcaagcctatgtattttgctgctgtca----------tatctagctccatgtgataggct
          White-faced sapajou  caaaactccctcaagcctatgtattttgctgctgtca----------tatctagctccgtgtgataggct
            Ma's night monkey  caaaactccctcaagcctatgtattttgctgctgtca----------tatctagctccatgtgataggct
B D                   Tarsier  caaaactccctcaacaccgt---ttttgctgctgtcatgggacaa--tatatacttctgtgcgataggct
                  Mouse lemur  ccaaattccctcaaacctgtatattttgctactgtcatagacaagaatatctagttccatctgataggct
            Coquerel's sifaka  cccaattccctcaaacctgtgtactttgctactgtcatagaaaagaatatctagttccatgtgataggct
                  Black lemur  cccagttccctcaaacccgtgtattttgctactgtcatagaaaagaatatctagttccatgtgataggtg
              Sclater's lemur  cccagttccctcaaacccgtgtattgtgctactgtcatagaaaagaatatctagttccatgtgataggtg
B D                  Bushbaby  tcagattctctcaaacctgtgtattttgctactgtcatgaaaaagaatgtctagttccatgtgagaggct
B D                     Mouse  caagggttcctccaa---atgtatgtgg--gctgttagagaaaagaatgcgatggtgtg---gaggggct
B D                       Dog  ccaagttttcctaaacctatgtgttttgctgctgtcttggaaaagagtatcaaattctgtgtgataggct
B D                 Armadillo  cccaattcccctaaacctgtgtgttttgctgctgtcgtaaaaaagaatatctaattctgggtgacatgct

                        Human  ttggctgcatgaatta-ttacggctccttctc--------------------------------------
                        Chimp  ttggctgcatgaatta-ttacggctccttctc--------------------------------------
                       Bonobo  ttggctgcatgaatta-ttacggctccttctc--------------------------------------
                      Gorilla  ttggctgcatgaatta-ttacggatccttctt--------------------------------------
                    Orangutan  ttggctgcatgaatta-ttatggctccttctc--------------------------------------
                       Gibbon  ttggctgcatgaatta-ttatggctccttctc--------------------------------------
                       Rhesus  ttggctgcatgaatta-ttatggctccttctc--------------------------------------
          Crab-eating macaque  ttggctgcatgaatta-ttatggctccttctc--------------------------------------
           Pig-tailed macaque  ttggctgcatgaatta-ttatggctccttctc--------------------------------------
               Sooty mangabey  ttggctgcatgaatta-ttatggctccttctc--------------------------------------
                       Baboon  ttggctgcatgaatta-ttatggctccttctc--------------------------------------
                 Green monkey  ttggctgcatgaatta-ttatggctccttctc--------------------------------------
                        Drill  ttggctgcatgaatta-ttatggctccttctc--------------------------------------
             Proboscis monkey  ttggctgtatgaatta-ttatggccccttctc--------------------------------------
              Angolan colobus  ttggctgtatgaatta-ttatggctccttctc--------------------------------------
     Golden snub-nosed monkey  ttggctgtatgaatta-ttatggctccttctc--------------------------------------
      Black snub-nosed monkey  ttggctgtatgaatta-ttatggctccttctc--------------------------------------
                     Marmoset  ttggttgcatgaatta-ttatggctctttctc--------------------------------------
              Squirrel monkey  ttggttgcatgaatta-ttacggttccttctc--------------------------------------
          White-faced sapajou  ttggttgcatgaatta-ttatggctccttctc--------------------------------------
            Ma's night monkey  ttggtcgcatgaatta-ttatggctccttctc--------------------------------------
                      Tarsier  ttggctacataaatca-tcacagctaattctc--------------------------------------
                  Mouse lemur  ttggttacatgaatta-ttatggctacttctc--------------------------------------
            Coquerel's sifaka  ttggttacatgaatta-ttatggctacttctc--------------------------------------
                  Black lemur  ttggttccatgaatta-ttatggctacttgtc--------------------------------------
              Sclater's lemur  ttggttccatgaatta-ttatggctacttgtc--------------------------------------
                     Bushbaby  ctggttacaggaagta-ttatggctaccttgc--------------------------------------
                        Mouse  ttggct-cttggattt-ctctagcgacctg----------------------------------------
                          Dog  ttagttaaatgaagcatttacagccttttctc--------------------------------------
                    Armadillo  ttagttaaatacatca-ttattgctccttctctctctctctttttaactttcttatttatgaaaacaaga

                        Human  -------ttatactca------------------gtg-----ctcacaa-ggtgt----gttgttgtcgt
                        Chimp  -------ttatactca------------------gtg-----ctcacaa-ggtgt----gttgttgtcgt
                       Bonobo  -------ttacactca------------------gtg-----ctcacaa-ggtgt----gttgttgtcgt
                      Gorilla  -------ttatactca------------------gtg-----ctcacaa-ggtgg----gttgttgtcgt
                    Orangutan  -------ttatactca------------------gtg-----ctcagaa-ggtgt----gttgttgtcgt
                       Gibbon  -------ttatattca------------------gtg-----ctcagaa-ggtgt----gttgttgtcgt
                       Rhesus  -------ttatactca------------------gtg-----ctcagaa-ggtgt----gttgttgtcat
          Crab-eating macaque  -------ttatactca------------------gtg-----ctcagaa-ggtgt----gttgttgtcat
           Pig-tailed macaque  -------ttatactca------------------gtg-----ctcagaa-ggtgt----gttgttgtcat
               Sooty mangabey  -------ttatactca------------------gtg-----ctcagaa-ggtgt----gttgttgtcat
                       Baboon  -------ttatactca------------------gtg-----ctcagaa-ggtgt----gttgttgtcat
                 Green monkey  -------ttatactca------------------gtg-----ctcagaa-ggtgt----gttgttgtcat
                        Drill  -------ttatactca------------------gtg-----ctcagaa-ggtgt----gttgttgtcat
             Proboscis monkey  -------ttatactca------------------gtg-----ctcagaa-gatgt----gttgttgtcat
              Angolan colobus  -------ttatactca------------------gtg-----ctcagaa-ggtgt----gttgttgtcat
     Golden snub-nosed monkey  -------ttatactca------------------gtg-----ctcagaa-ggtgt----gttgttgtcat
      Black snub-nosed monkey  -------ttatactca------------------gtg-----ctcagaa-ggtgt----gttgttgtcat
                     Marmoset  -------ttctactca------------------gtg-----ctcacaa-ggtgt----gttgttgtcat
              Squirrel monkey  -------ttctactca------------------gtg-----ctcacaa-ggtgt----gttgttgtcat
          White-faced sapajou  -------ttctactca------------------gtg-----ctcacaa-ggtgt----gttgttgtcat
            Ma's night monkey  -------ttctactca------------------gtg-----ctcacaa-ggtgt----gttgttgtcat
                      Tarsier  -------ttatatc---------------------------------aa-ggtac----gttgt----at
                  Mouse lemur  -------ctatactcg------------------gtgta--aaaaaaaa-ggtgt----gtttttcttga
            Coquerel's sifaka  -------ctatactca------------------gtg-a--aaaaaaaa-ggtgt----gttgttgttgt
                  Black lemur  -------ctatactca------------------gtg----aaaaaaaa-ggtgt----gttg---ttgt
              Sclater's lemur  -------ctatactca------------------gtg----aaaaaaaa-ggtgt----gttg---ttgt
                     Bushbaby  -------ctatactca------------------gtg-aacaaaaaaaa-ggtgt----gttgttgctgt
                        Mouse  --------catgttcg------------------gtg-----caaagta-gttgt----gtggt----gc
                          Dog  -------ttacgcgtg------------------ctg-----caaagaagggtgt----gttgt------
                    Armadillo  gttttatttacacacatagctacttctatgatatgca-----ctgagaa-gatgtcttcgtcgttgttgt

                        Human  ttcctgaagcctgcacacatga-tcgctgccttatttacctaagaactgatctacctaatcactgagaca
                        Chimp  ttcctgaagcctgcacacatga-tcgctgccttatttacctaagaactgatctacctaatcactgagaca
                       Bonobo  ttcctgaaggctgcacacatga-tctctgccttatttacctaagaactgatctacctaatcactgagaca
                      Gorilla  ttcctgaagcctgcacacatga-tcgctgccttatttacctaagaactgatctacctaatcactgagaca
                    Orangutan  ttcttgaagcgtgcacacatga-tcgctgccttatttacctaagaactgatctacctaatcactgagaca
                       Gibbon  ttcctgaagcctgcacacatga-tcgctgccttatttacctaagaactgatctacctaatcactgagaca
                       Rhesus  ttcctgaagcctgcacacatga-gcgctgccttatttacctaagaactgatctacctcatcactgagaca
          Crab-eating macaque  ttcctgaagcctgcacacatga-gcgctgccttatttacctaagaactgatctacctcatcactgagaca
           Pig-tailed macaque  ttcctgaagcctgcacacatga-gcgctgccttatttacctaagaactgatctacctcatcactgagaca
               Sooty mangabey  ttcctgaagcctgcacacatga-tcacggccttatttacctaagaactgatctacctcatcactgagaca
                       Baboon  ttcctgaagcctgcacacatga-tcgctgccttatttacctaagaactgatctacctcatcactgagaca
                 Green monkey  ttcctgaagcctgcacacatga-tcgctgccttatttacctaagaactgatctacctcatcactgagaca
                        Drill  ttcctgaagcctgcacacatga-tcgctgccttatttacctaagaactgatctacctcatcactgagaca
             Proboscis monkey  ttcctgaagcctgcacacagga-tcgctggcttatttacctaagaactgatctacctcatcactgagaca
              Angolan colobus  ttcctgaagcctgcacatagga-tcgctgccttatttacctaagaactgatctacctcatcactgagaca
     Golden snub-nosed monkey  ttcctgaagcctgcacacagga-tcgctgccttatttacctaagaactgatctacctcatcactgagaca
      Black snub-nosed monkey  ttcctgaagcctgcacacagga-tcgctgccttatttacctaagaactgatctacctcatcactgagaca
                     Marmoset  ttcctgaagcctacacacagca-tcactgccgtatttacctaagaactgatctacctaatcactgagaca
              Squirrel monkey  ttcctgaagcctgcacacagga-tcactgccgtatttacctaagaactgatctacctaatcactgagaca
          White-faced sapajou  ttcctgaagcctgcacacagga-ttgctgccatatttacctaagaactgatctacctaatcactgagaca
            Ma's night monkey  ttcctgaagcctgcacacagga-tcgctgccgtatttacctaagaactgatctacctaatcactgagaca
                      Tarsier  ttccagaggcctgcacgcctga-tagctgccttggttacctaaggatggacctacctaatcactgagata
                  Mouse lemur  ttcctgaagcctg-acacacta--------tttatttacctaggaactgatctacctaatcactgagata
            Coquerel's sifaka  ttcctgaagcctg-acacacta-tagccgctttatttacctaggaactgctctacctaatcactgagata
                  Black lemur  ttcctgaagactg-acacacta-tagccgctttatttacctaggaactgatctacctaatcactgagata
              Sclater's lemur  ttcctgaagactg-acacacta-tagccgctttatttacctaggaactgatctacctaatcactgagata
                     Bushbaby  ctcctgaagcccg-cagccccggcagccaccttattcacctgggaactgatgta-ctagtcactgagata
                        Mouse  ttcttgacgtctgcacgcacta-gctgggcactatttatccagtaacttatacacctaatctctgagaca
                          Dog  ttcctgaagcctgtgcacct-a-cagctcttttatttacctaagacctgatctacctaattaccgagata
                    Armadillo  ttcctgaagcctgccctcacag-cagctgccttatttacctaagaactgatttacctcatcactgagata

                        Human  caaacaaacatatcatccactcctctcctccagaccatttgaatacgttatccatttatttggtgtttgg
                        Chimp  caaacaaacatatcatccactcctctcctccagaccatttgaatacattatccatttatttggtgtttgg
                       Bonobo  caaacaaacatatcatccactcctctcctccagaccatttgaatacattatccatttatttggtgtttgg
                      Gorilla  caaacaaacatatcatccactcctctcctccagaccacttgaatacattatccatttatttggtgtttgg
                    Orangutan  caaacaaacatatcatccactcctctcctccagaccatatgaatacattatccatttatttggtgtttgg
                       Gibbon  gaaacaaacatatcatccactcctctcctccagaccatttgaatacattatccatttatttggtgtttgg
                       Rhesus  gaaacaaacatatcatccactcctctcctccagaccatttgaatacatgatccatttatttggtgtctgg
          Crab-eating macaque  gaaacaaacatatcatccactcctctcctccagaccatttgaatacatgatccatttatttggtgtctgg
           Pig-tailed macaque  gaaacaaacatatcatccactcctctcctccagaccatttgaatacatgatccatttatttggtgtctgg
               Sooty mangabey  gaaacaaacatatcatccactcctctcctccagaccatttgaatacattatccatttatttggtgtttgg
                       Baboon  gaaacaaacatatcatccactcctctcctccagaccatttgaatacattatccatttatttggtgtttgg
                 Green monkey  gaaacaaacatatcatccactcctctcctccagaccatttgaatacattatccatttatttggtgtttgg
                        Drill  gaaacaaacatatcatccactcctctcctccagaccatttgaatacattatccatttatttggtgtttgg
             Proboscis monkey  gaaacaaacatatcatccactcctctcctccagaccatttgaatacattatccatttatttggtgtttgg
              Angolan colobus  gaaacaaacatatcatccactcctctcctccagaccatttgaatacattatccatttatttggtgtttgg
     Golden snub-nosed monkey  gaaacaaatatatcatccactcctctcctccagaccatttgaatacattatccatttatttggcgtttgg
      Black snub-nosed monkey  gaaacaaatatatcatccactcctctcctccagaccatttgaatacattatccatttatttggcgtttgg
                     Marmoset  gaaacaaacatatcatccactcctctcctccagaccatttgaatacattatccatttatttggtgtttgg
              Squirrel monkey  gaaacaaacatatcatccacttctctcctccagaccatgtgaatacattatccatttatttggtgtttgg
          White-faced sapajou  gaaacaaacatatcatccactcctctcctccagaccatttgaatatattatccatttatttggtatttgg
            Ma's night monkey  gaaacaaacatatcatccactcctctcctccagatcatttgaatacattatccatttatttggtgtttgg
                      Tarsier  gaaacaaacctatcatccactcctctcctccagaccatttgaatgctttatccatttatttggcatttgg
                  Mouse lemur  gaaacaaacatgtcatccactcctctcctccaggccatttgaatacattatccatttatttggtgtttgg
            Coquerel's sifaka  gaaacaaacttatcatccgctcctctcctccagaccatttgaatacattatccatttatttggtgtttgg
                  Black lemur  gaaacaaacatatcattcactcctctcctccagaccatttgaatacattatccatttatttggtgtttga
              Sclater's lemur  gaaacaaacatatcattcactcctctcctccagaccatttgaatacattatccatttatttggtgtttgg
                     Bushbaby  gaggcacacacatcgtctgctcctctcctccagaccattcgaacacattacccatttatttggtgtttgg
                        Mouse  gaaacaaac--atca-ccgttccttttcttcagggcatttgaatacattatccatttatttggtgtttgg
                          Dog  gaaacaaacataacatccattcctctcctccagaccatttgaatacattatccacttatttggtatttgg
                    Armadillo  gaaacaaacatatcatccattctgaccctccagaccatttgaatacattacccatttatttggtgtttgg

                        Human  cttaggtctaaatgagtcatttaataacccctgttcacagcaagttaagttgcaaccagctggcatccac
                        Chimp  cttaggtctaaatgagtcatttactaacccctgttcacagcaagttaagttgcaaccagcttgcatccac
                       Bonobo  cttaggtctaaatgagtcatttaataacccctgttcacagcaagttaagttgcaaccagctggcatccac
                      Gorilla  ctcaggtctaaatgagtcatttaataacccctgttcacagcaagttaagttgcaaccagctggcatccac
                    Orangutan  ctcaggtctaaatgagtcatttaataacccctgttcacagcaagttaagttgcaatcagctggcatccac
                       Gibbon  ctcaggtctaaatgagtcatttaataacccctgttcacagcaagttaagttgcaaccagctggcatccac
                       Rhesus  ctcaggtttaaatgagtcatttaataacccctgttcacagcaagttaagatgcaaccagctggcatccac
          Crab-eating macaque  ctcaggtttaaatgagtcatttaataacccctgttcacagcaagttaagatgcaaccagctggcatccac
           Pig-tailed macaque  ctcaggtttaaatgagtcatttaataacccctgttcacagcaagttaagatgcaaccagctggcatccac
               Sooty mangabey  ctcaggtttaaatgagtcatttaataacccctgttcacagcaagttaagatgcaaccagctggcatccac
                       Baboon  ctcaggtttaaatgagtcatttaataacccctgttcacagcaagttaagatgcaaccagctggcatccac
                 Green monkey  ctcaggtttaaatgagtcatttaataacccctgttcacagcaatttaagatgcaaccagctggcatccac
                        Drill  ctcaggtttaaatgagtcatttaataacccctgttcacagcaagttaagatgcaaccagctggcatccac
             Proboscis monkey  ctcaggtttaaatgagtcatttaataacccctgttcacagcaagttaagatgcaaccagctggcatccac
              Angolan colobus  ctcaggtttaaatgagtcatttaataacccctgttcacagcaagttaagatgcaaccagctggcatccac
     Golden snub-nosed monkey  ctcaggtttaaatgagtcatttaataacccctgttcacagcaagttaagatgcaaccagctggcatccac
      Black snub-nosed monkey  ctcaggtttaaatgagtcatttaataacccctgttcacagcaagttaagatgcaaccagctggcatccac
                     Marmoset  ctcaggtttaaatgagtcatttaataacccctgttcacagcaagttaagttgcaaccagctggcatccac
              Squirrel monkey  ctcaggtttaaatgagtcatttaataacccctgttcacagcaagttaagttgcaaccagctggcattcac
          White-faced sapajou  ctcaggtttaaatgagtcatttaataacccctgttcacagcaagttaagttgcaaccagctggcatccac
            Ma's night monkey  ctcaggcttaaatgagtcatttaataacccctgttcacagcaagttaagttgcaaccagctggcatccac
                      Tarsier  ctcaagtttcaatgcgtcatttaataacccctgttcacagcaagttaagttgcaaccagctggcatccac
                  Mouse lemur  ctcaggtttaaatgagtcacttaataacccctgttctcagcaagttaagttgctaccagctggcatccac
            Coquerel's sifaka  ctcaggtttaaatgagtcacttaataacccctgttctcagcaagttaagttgcaaccagctggcatccac
                  Black lemur  ctcaggtttaaatgagtcacttaataacccctgttcacagcaagttaagttgcaaccagctggcatccac
              Sclater's lemur  ctcaggtttaaatgagtcacttaataacccctgttcacagcaagttaagttgcaaccagctggcatccac
                     Bushbaby  ctcaggtttaaatgagtcatttaataacccctgttcacagcaagttaagttgcaagcagctggcatccac
                        Mouse  ctgaggtttaaatgagtcatttaatacgccccattcacagcaagttaacttgcaagcaggtggcatccat
                          Dog  ctcaggtttaaatgagtcatttaataaccccggttcacagcaagttaagttgcaaccagctggcagccac
                    Armadillo  ctcaggtttaaatgagtcatttaataaaccctgttcacagcaagttaagatgcaaccagctggcatccac

                        Human  aactcacaggattgttaaccgttccaaccaggatcagaaactgcactcca-gccttcctgaagggcatta
                        Chimp  aactcacaggattgttaaccattccaaccacgatcagaaaccgcactcca-gccttcctgaagggcatta
                       Bonobo  aactcacaggattgttaaccgttccaaccaggatcagaaaccgcactcca-gccgtcctgaagggcatta
                      Gorilla  aactctcaggattgttaaccgttccaaccaggatcagaaaccgcactcca-gccttcctgaa-ggcatta
                    Orangutan  aactcacaggattgttaaccgttccaaccaggatcagaaaccgcactcca-gccttcctgaagggcatta
                       Gibbon  aactcacaggattgttaaccgttccaaccaggatcagaaaccgcactcca-gccttcctgaagggcatta
                       Rhesus  aactcacaggattgttaactgttccagccaggatcagaaaccgcactcca-gccttcctgaagggcatta
          Crab-eating macaque  aactcacaggattgttaactgttccagccaggatcagaaaccgcactcca-gccttcctgaagggcatta
           Pig-tailed macaque  aactcacaggattgttaactgttccagccaggatcagaaaccgcactcca-gccttcctgaagggcatta
               Sooty mangabey  aactcacaggattgttaaccgttccagccaggatcagaaaccgcactcca-gccttcctgaagggcatta
                       Baboon  aactcacaggattgttaaccgttccagccaggatcagaaaccgcactcca-gccttcctgaagggcatta
                 Green monkey  aactcacaggattgttaaccgttccagccaggatcagaaaccgcactcct-gccttcctgaagggcatta
                        Drill  aactcacaggattgttaaccgttccagccaggatcagaaaccgcactcca-gccttcctgaagggcatta
             Proboscis monkey  aactcacaggattgttaaccgttccagccacgatcagaaaccgtactcca-gccttcctgaagggcatta
              Angolan colobus  aactcacaggattgttaaccgttccagccaggatcagaaaccgcactcca-gccttcctgaagggcatta
     Golden snub-nosed monkey  aactcacaggattgttaaccgttccagccaggatcagaaaccgcactcca-gccttcctgaagggcatta
      Black snub-nosed monkey  aactcacaggattgttaaccgttccagccaggatcagaaaccgcactcca-gccttcctgaagggcatta
                     Marmoset  aactcacaggattgttaaccgttccagccaggatcagaaaccacactcca-gccttcctgaagggcatta
              Squirrel monkey  aactcacaggattgttaaccgttccagccccaatcagaaactgcactcca-gccttcctgaagggcatta
          White-faced sapajou  aactcacaggattgttaaccgttccagccaggatcagaaactgcactcca-gccttcctgaagggcatta
            Ma's night monkey  aactcacaggattgttaactgttccagccaggatcagaaaccgcactcca-gccttcttgaagggcatta
                      Tarsier  aactcacaggatagttaactgctccaaccagaatcagaagccg--ctgta-gccttcctgaagggcatta
                  Mouse lemur  aactcacagggttgttaactgctccaaccaggatgggaaaccgtgctctc-gccttcctgaagggcatta
            Coquerel's sifaka  aactcacggggttgttaactgctccaaccaggatggggaaccgtgctctc-gccttcctgaagggcatta
                  Black lemur  aactcacagggttgttaactgctccaaccaggctgggaaaccgcgctctc-gccttcctgaaggccattg
              Sclater's lemur  aactcacagggttgttaactgctccaaccaggctgggaaaccacgctctc-gccttcctgaaggccattg
                     Bushbaby  aactcacaggactgttaacggttccaactaggatgagccaccacgcgctt-gccttcctgaagggcatcg
                        Mouse  gactcatggcattgttaacagttctgaccaggatcagcgaccacactcca-gccttcctgtcgggaatta
                          Dog  aactcacggggttgttaaccattccaaccaggattggaccccatgctccacaacttcctgaagggcattg
                    Armadillo  aactcacaggattgttaaccattccaacctggatcagacattgcattcca-gccttcctgaagggcattt

                        Human  tgcagctttgctccagctatcatggcaggagtttca-agcaaatctgtgctttaggtaataaaatggcca
                        Chimp  tgcagctttgctccagctatcatggcaggagtttca-agcaaatctgtgc-ttaagtaataaaatggcca
                       Bonobo  tgcagatttgctccagctatcatggcaggagtttca-agcaaatctgtgctttaggtaataaaatggcca
                      Gorilla  tgcagctttgctccagctatcatggcaggagtttca-agcaaatctgtgctttaggtaataaaatggcca
                    Orangutan  tgcagctttgcttcagctatcatggcaggagtttca-agcaaatctgtgctttaggtaataaaatggcca
                       Gibbon  tgcagctttgctccagctatcatggcaggagtttca-agcaaatctgtgctttaggtaataaaatggcca
                       Rhesus  tgcagctttgctccagctatcatggcaggagtttca-agcaaatctgtgctttaggtaataaaatggcca
          Crab-eating macaque  tgcagctttgctccagctatcatggcaggagtttca-agcaaatctgtgctttaggtaataaaatggcca
           Pig-tailed macaque  tgcagctttgctccagctatcatggcaggagtttca-agcaaatctgtgctttaggtaataaaatggcca
               Sooty mangabey  tgcagctttgctccagctatcatggcaggagtttca-agcaaatctgtgctttaggtaataaaatggcca
                       Baboon  tgcagctttgctccagctatcatggcaggagtttca-agcaaatctgtgctttaggtaataaaatggcca
                 Green monkey  tgcagctttgctccagctatcatggcaggagtttca-agcaaatctgtgctttaggtaataaaatggcca
                        Drill  tgcagctttgctccagctatcatggcaggagtttca-agcaaatctgtgctttaggtaataaaatggcca
             Proboscis monkey  tgcagctttgctccagctatcatggcaggagtttca-agcaaatctgtgctttaggtaataaaatggcca
              Angolan colobus  tgcagctttgctccagctatcatggcaggagtttca-agcaaatctgtgctttaggtaataaaatggcca
     Golden snub-nosed monkey  tgcagctttgctccagctatcatggcaggagtttca-agcaaatctgtgctttaggtaataaaatggcca
      Black snub-nosed monkey  tgcagctttgctccagctatcatggcaggagtttca-agcaaatctgtgctttaggtaataaaatggcca
                     Marmoset  tgcagctttgctccagctatcatggcaggagttgca-agcagatctgtgctttaggtaataaaatggtca
              Squirrel monkey  tgcagctttgctccagctatcgtggcaggagtttca-agcagatctgtgctttaggtaataaaatggcca
          White-faced sapajou  tgcagctttgctccagctatcgtggcaggagtttca-agcagatctgtgctttaggtaataaaatggcca
            Ma's night monkey  tgtagctttgctccagctatcatggcaggagtttca-agcagatctgtgctttaggtaataaaatggccg
                      Tarsier  tgcagctctgctccagctaccatgaaaggactttca-agcaagtctgtgccttaggtaatgaaacagcca
                  Mouse lemur  ggcagccttgctccagctatcatggcaggagtttca-agcaaatctgcgccttaggtaatgaaatggcca
            Coquerel's sifaka  ggcagccttgctccagctatcatggcaggagttgca-agcaaatcggtgccttaggtaatgaaatggcca
                  Black lemur  ggcagccgtgctccagctatcatggcaggagtttca-agcaaatctgtgccttaggtaatgcaatagcca
              Sclater's lemur  ggcagccgtgctccagctatcatggcaggagtttca-agcaaatctgtgccttaggtaatgcaatagcca
                     Bushbaby  cacagctttgctccagctatcatggcaggagtctcagagcaaatctgtgccttaggtaatgaaatggccc
                        Mouse  tggagctttgtgccagtgatcatggcaggagcttcc-cgcaaatctgtgccttaggtaacggaatggcca
                          Dog  tgcagctttgctccagctctcatggcaggagtttcc-agcaaatctgggcctcaggtaatgaaatggccg
                    Armadillo  tgcagctttgctccagctgtcatggcaggagtttca-agcaaatctgtgccttaggtattgaaatggcca

                        Human  caagaactataagggttttggaaaatagatgtcagtgtcaattctaaggtctagaaaggccattgataaa
                        Chimp  cgagaactataagggtttcggaaaatagatgtcagtgtctattctaaggtctagaaaggccattaataaa
                       Bonobo  cgagaactataagggtttcagaaaatagatgtcagtgtctattctaaggtctagaaaggccattgataaa
                      Gorilla  cgagaactataagggtttcggaaaatagatgtcagtgtctattctaaggtctagaaaggccattgataaa
                    Orangutan  cgagaactataagggtttcagaaaatagatgtcagtgtctattctaaggtctagaaaggccattgataaa
                       Gibbon  tgagaactataagggtttcagaaaatagatgtcggtgtctattctaaggtctagaaaggccattgataaa
                       Rhesus  tgagaactataagggttttggaaaagagatatcagtgtctattctaaggtttagaaaggccgttgataaa
          Crab-eating macaque  tgagaactataagggttttggaaaagagatatcagtgtctattctaaggtttagaaaggccgttgataaa
           Pig-tailed macaque  tgagaactataagggttttggaaaatagatatcagtgtctattctaaggtttagaaaggccgttgataaa
               Sooty mangabey  tgagaactataagggttttggaaaatagatgtcagtgtctattctaaggtttagaaaggccgttgataaa
                       Baboon  tgagaactataagggttttggaaaatagatgtcagtgtctattctaaggtttagaaaggccgttgataaa
                 Green monkey  tgagaactagaagggttttggaaaatagatgtcagtgtctattctaaggtttagaaaggccgttgataaa
                        Drill  tgagaactataagggttttggaaaatagatgtcagtgtctattctaaggtttagaaaggccgttgataaa
             Proboscis monkey  ggagaactataagggttttggaaaatagatgtcagtgtctattctaaggtttagaaaggccattgataaa
              Angolan colobus  tgagaactataagggttttggaaaatagatgtcagtgtctattctaaggtttagaaaggccattgataaa
     Golden snub-nosed monkey  ggagaactatcagggttttggaaaatagatgtcagtgtctattctaaggtttagaaaggccattgataaa
      Black snub-nosed monkey  ggagaactatcagggttttggaaaatagatgtcagtgtctattctaaggtttagaaaggccattgataaa
                     Marmoset  tgagaactataagcatttcggataatagatgtcagtgtctattctaaggtctagaaaggccattgataaa
              Squirrel monkey  tgagaactgtaagcgtttcgcataatagatgtccgtgtctattctaaggtctagaagggccatcgataaa
          White-faced sapajou  tgagaactataagcgttttggataatagatgtcagtgtctattctaaggtctagaagggccattgataaa
            Ma's night monkey  tgagaactataagcatttcggataatagatgtcaatgtctattctaaggtctagaagggccattgataaa
                      Tarsier  tgagaactacaagggcttcgaaaaatagatatcagtgtctattctcagcactagaagggccattgataaa
                  Mouse lemur  tgaggacgataagggtctcagaaaatagatgtcagtgtctatgctaagggctggaagggctattgataaa
            Coquerel's sifaka  tgagaacgataacggtttcagaaaatagatgtcagtgtctattctaagggctggaagggctattgataaa
                  Black lemur  tgagaacgataagggtttcagaaaatagatgtcagtgtctattctaaggactggaagggctattgataaa
              Sclater's lemur  tgagaacgataagggtttcagaaaatagatgtcagtgtctattctaagggctggaagggctattgataaa
                     Bushbaby  tgagaacgataagggtgtcagaaaatagatgtcagtgtctagtctagagacaggaagggctattgataaa
                        Mouse  taaaaaccgtgagagtttcataaaacaga-gtcactgtctattctaatgactgggagggctattggtaaa
                          Dog  tgagaactataagagtttcagaaaatagatgtcagtgtctgttctaatgactggaagggctattgataga
                    Armadillo  tgagaactacaagggtttcagaaaatagatgtcagtgtcttttctaatgactggaagggcaattgataaa

                        Human  gctgtttgaagctgattatcatcatagactgagagcctccattcccctcctgaggcctttgggcac---t
                        Chimp  gctgtttgaagctgattattatcatagactgagagcctccattcccctcctgaggcctttgggcac---t
                       Bonobo  gctgtttgaagctgattatcatcatagactgagagcctccattcccctcctgaggcctttgggcac---t
                      Gorilla  gctgtttgaagctgattatcatcatagactgagaaccaccattcccctcctgaggcctttgggcac---t
                    Orangutan  gctgtttgtagctgattatcatcatagactgagaggctccattcccctcctgaggcctttgggcac---t
                       Gibbon  gctgtttgaagctgattatcatcatagactgagaggctccattcccctcctgaggcctttgggcac---t
                       Rhesus  gctgtttgaagctgattatcatcatagactgagaggctccattcccctcctgaggcctttgggcac---t
          Crab-eating macaque  gctgtttgaagctgattatcatcatagactgagaggctccattcccctcctgaggcctttgggcac---t
           Pig-tailed macaque  gctgtttgaagctgattatcatcatagactgagaggctccattcccctcctgaggcctttgggcac---t
               Sooty mangabey  gctgtttgaagctgattatcatcatagactgagaggccccattcccctcctgaggcctttgggcac---t
                       Baboon  gctgtttgaagctgattatcagcatagactgagaggccccattcccctcctgaggcctttgggcac---t
                 Green monkey  gctgtttgaagctgattatcatcatagactgagaggctccattcccctcctgaggcctttgggcac---t
                        Drill  gctgtttgaagctgatcatcatcatagactgagaggccccattcccctcctgaggcctttgggcac---t
             Proboscis monkey  gctgtttgaagatgattatcatcatagactgagaggctccattcccctcctgaggcctttgggcac---t
              Angolan colobus  gctgtttgaagctgattatcatcatagactgagaggctccattcccctcctgaggcctttgggcac---t
     Golden snub-nosed monkey  gctgtttgaagctgattatcatcatagactgagaggctccattcccctcctgaggcccttgggcac---t
      Black snub-nosed monkey  gctgtttgaagctgattatcatcatagactgagaggctccattcccctcctgaggcccttgggcac---t
                     Marmoset  gctgtttgaagctgattattatcatagactgagaggctccattccactcctgaggcctttgggcgc---t
              Squirrel monkey  gctgtttgaagctgattattatcatagactgagaggctccattccactcctgaggcctttgggcgc---t
          White-faced sapajou  gctgtttgaagctgattattatcatagactgagaggctccattccactcctgaggcctttgggcgc---t
            Ma's night monkey  gctgtttgaagctgattattatcacagactgagaggctccattccactcccgaggcctttgggcgc---t
                      Tarsier  gctgtttgaggccgattatcatcatagactgagaggctccattccactcccgaaggcttcgggcgc---t
                  Mouse lemur  gctgtttgaggctgattatcatcatagactgagaggctccattccactcacgaggccttccggggc---t
            Coquerel's sifaka  gctgtttgaggccgattatcatcatagaatgagaggctccattccactcatgaggccttcaggggc---t
                  Black lemur  gctgtttgaggccgattatcatcatagactgagaggctccattccactcaccaggccttcaggggc---t
              Sclater's lemur  gctgtttgaggccgattatcatcatagactgagaggctccattccactcaccaggccttcgggggc---t
                     Bushbaby  gctgtgtgaggccgattatcatcgtggactgagaggctccattccactcacccggccttccggggctcat
                        Mouse  gctgttttaggccgattatcattacagatagataggctccattcctctcgtaagcacctctgtggc---c
                          Dog  gctgtttgagactgattgttatcatagactgaggagccccgttcaacacatgatgccctcagaggc---t
                    Armadillo  gctgcttgagactgattatcatcgtagagtgagaggctccattcagctcatgaggccttcaggggc---t

                        Human  ccac--aagaagcacgactgccttaatccacataaaggtca-ttttgtatgaaaggtcagtggcactcaa
                        Chimp  ccac--aagaagcacgactgccttaatccacataaaggtca-ttttgtatgaaaggtcagtggcactcaa
                       Bonobo  ccac--aagaagcacgactgccttaatccacataaaggtca-ttttgtatgaaaggtcagtggcactcaa
                      Gorilla  ccac--aagaagcaccactgccttaatccacataaagttca--tttgtatgaaaggtcagtggcactcaa
                    Orangutan  ccac--gagaagcacgactgccttaatccacataaaggtca-ttttgtatgaaaggtcagtggcactcaa
                       Gibbon  ccac--aagaagcacgactgccttaatccacataaaggtca-ttttatatgaaaggtcagtggcactcaa
                       Rhesus  ccac--aagaagcacgactgccttaatccatataaaggtca-ttttgtatgaaaggtcagtggcactcaa
          Crab-eating macaque  ccac--aagaagcacgactgccttaatccatataaaggtca-ttttgtatgaaaggtcagtggcactcaa
           Pig-tailed macaque  ccac--aagaagcacgactgccttaatccatataaaggtca-ttttgtatgaaaggtcagtggcactcaa
               Sooty mangabey  ccac--aagaagcacgactgccttaatccatataaaggtca-ttttgtatgaaaggtcagtggcactcaa
                       Baboon  ccac--aagaagcacgactgccttaatccatataaaggtca-ttttgtatgaaaggtcagtggcactcaa
                 Green monkey  ccac--aagaagcacgactgccttaatccatataaaggtca-ttttgtatgaaaggtcagtggcactcaa
                        Drill  ccac--aagaagcacgactgccttaatccatataaaggtca-ttttgtatgaaaggtcagtggcactcaa
             Proboscis monkey  ccac--aagaagcacgactgccttaatccacataaaggtca-ttttgtatgaaaggtcagtggcactcaa
              Angolan colobus  ccat--aagaagcatgactgccttaatccacataaaggtca-ttttgtatgaaaggtcagtggcactcaa
     Golden snub-nosed monkey  ccac--aagaagcacgactgccttaatccacataaaggtca-ttttgtatgaaaggtcagtggcactcaa
      Black snub-nosed monkey  ccac--aagaagcacgactgccttaatccacataaaggtca-ttttgtatgaaaggtcagtggcactcaa
                     Marmoset  ccac--aagaagcatgactgccttaatccacataaaggtca-ttttgtatgaaaggtcagtggcactcaa
              Squirrel monkey  ccac--aagaaacaccactgccttaatccacataaaggtca-ttttgtatgaaaggtcagtggcactcaa
          White-faced sapajou  ccac--aagaagcacgactgccttaatccacataaaggtca-ttttgtatgaaaggtcagtggcactcaa
            Ma's night monkey  ccac--aagaagcacgactgccttaatccacataaaggtca-ttttgtatgaaaggtcagtggcactcaa
                      Tarsier  tgac--aagaagtgcaactgccttaatacacataaaggtca-ttttgtatgaaaggtcagtggcactcaa
                  Mouse lemur  cgac--aagaagtgcaactgccttaatccacataaaggtca-ttttgtatgaaaggtcagtggctctcag
            Coquerel's sifaka  cggc--aagaagtgcaactgccttaatccacataaaggtca-ttttgtatgaaaggtcagtggctctcag
                  Black lemur  cgac--aagaagtgcaactgccttaatccacataaaggtca-ttttgtaggaaaggtcagtggctctcag
              Sclater's lemur  cgac--aagaagtgcaactgccttaatccacataaaggtca-ttttgtaggaaaggtcagtggctctcag
                     Bushbaby  cggc--tagaagtgcagctgccttaatccacagaaaggtca-gtgggtagg-aaggtcagtggtgctcag
                        Mouse  ccat--aagaagcacatcagccttaatgcaaacaaaggtcatttttataagaaaggtcagttgcactcag
                          Dog  cagccaaaaaagcgcaactgcctgaatccacagaaaggtca-ttttgtttgaaaggtcagtggcactcag
                    Armadillo  ctac--gagaagtacaactgtcttaatcctcgtagaggtca-tttcctatgaaaggtcagtggccctcaa

                        Human  g-aatgcaggagagatgacagagtggtca-gaagaaagactaaatgcttccaca
                        Chimp  g-aatgcaggagagatgacagagtggtca-gaagaaagactaaatgcttccaca
                       Bonobo  g-aatgcaggagagatgacagagtggtca-gaagaaagactaaatgcttccaca
                      Gorilla  g-aatgcaggagagatgacagagtggtca-gaagaaagactaaatgcttccaca
                    Orangutan  g-aatgcaggagagatgacagagtggtca-gaagaaagactaaatgcttccaca
                       Gibbon  g-aatgcaggagagatgacagagtggtca-gaagaaagactaaatgcttccaca
                       Rhesus  g-aatgcaggagagatgacagagtggtca-gaagaaagactaaatgcttccaca
          Crab-eating macaque  g-aatgcaggagagatgacagagtggtca-gaagaaagactaaatgcttccaca
           Pig-tailed macaque  g-aatgcaggagagatgacagagtggtca-gaagaaagactaaatgcttccaca
               Sooty mangabey  g-aatgcaggagagatgacagagtggtca-gaagaaagactaaatgcttccaca
                       Baboon  g-aatgcaggagagatgacagagtggtca-gaagaaagactaaatgcttccaca
                 Green monkey  g-aatgcaggagagatgacagagtggtca-gaagaaagactaaatgcttccaca
                        Drill  g-aatgcaggagagatgacagagtggtca-gaagaaagactaaatgcttccaca
             Proboscis monkey  g-aatgcaggagagatgacagagtggtca-gaagaaagactaaatgcttccaca
              Angolan colobus  g-aatgcaggagagatgacagagtggtca-gaagaaagactaaatgctgccaca
     Golden snub-nosed monkey  g-aatgcaggagagatgacagagtggtca-gaagaaagactaaatgcttccaca
      Black snub-nosed monkey  g-aatgcaggagagatgacagagtggtca-gaagaaagactaaatgcttccaca
                     Marmoset  g-aatgcaggagagatgacagactggtca-gaagagagactaaatgcttccata
              Squirrel monkey  g-aatgcaggagagatgacagactggtca-gaagagagactaaatgcttccaca
          White-faced sapajou  g-aatgcaggagagatgacagactggtca-gaagaaagactaaatgcttccaca
            Ma's night monkey  g-aatgcaggagagatgacagactggtca-gaagagagagtaaatgcttccaca
                      Tarsier  g-aatgcgggagcaatgacagagtggccatgaaggaagacagaatgcttccaca
                  Mouse lemur  g-aatggaggagagataacagactggtcgtgggggaagacagaatgcttccaca
            Coquerel's sifaka  g-aatggaggagagataacagactggtcatgtaggaagacagaatgcttccaca
                  Black lemur  g-aatggaggggagataacagactggtcatgtaggaagacagaatgcttccaca
              Sclater's lemur  g-aatggaggggagataacagactggtcatgtaggaagacagaatgcttccaca
                     Bushbaby  g-agggggg---------cagactggccaggcag--------------------
                        Mouse  g-aatctagagagga--agagggtggcat-aaaggaagacagaa-actcactta
                          Dog  g-aatggagaatggaagacagagtggttgtgaaagatgacagaatgcttccaaa
                    Armadillo  gaaatggaaatgagatgacggagtagccatgaaggagaacagaatacttcaaca

Inserts between block 40 and 41 in window
B D                      Dog 171bp

Alignment block 41 of 48 in window, 91098656 - 91098782, 127 bps 
B D                     Human  taaa------ctgc----------------------attctttg------ta-tt-tt------------
B D                     Chimp  taaa------ctgc----------------------attctttg------ta-tt-tt------------
B D                    Bonobo  taaa------ctgc----------------------attctttg------ta-tt-tt------------
B D                   Gorilla  taaa------ctgc----------------------attctttg------ta-tt-tt------------
B D                 Orangutan  taaa------ctgc----------------------attctttg------ta-tt-tt------------
B D                    Gibbon  taaa------ctgc----------------------attctttg------ta-tt-tt------------
B D                    Rhesus  taaa------ctgc----------------------gttctttg------ta-tt-tt------------
B D       Crab-eating macaque  taaa------ctgc----------------------gttctttg------ta-tt-tt------------
           Pig-tailed macaque  taaa------ctgc----------------------gttctttg------ta-tt-tt------------
               Sooty mangabey  taaa------ctgc----------------------gttctttg------ta-tt-tt------------
                       Baboon  taaa------ctgc----------------------gttctttg------ta-tt-tt------------
B D              Green monkey  taaa------ctgt----------------------gttctttg------ta-tt-tt------------
                        Drill  taaa------ctgc----------------------gttctttg------ta-tt-tt------------
B D          Proboscis monkey  taaa------ctgc----------------------attctttg------ta-tt-tt------------
              Angolan colobus  taaa------ctgc----------------------attctttg------ta-tt-tt------------
B D  Golden snub-nosed monkey  taaa------ctgc----------------------attctttg------ta-tt-tt------------
      Black snub-nosed monkey  taaa------ctgc----------------------attctttg------ta-tt-tt------------
B D                  Marmoset  taaa------tggc----------------------attctttg------ta-tt-tt------------
B D           Squirrel monkey  taag------ctgc----------------------attctttg------ta-tt-tt------------
          White-faced sapajou  taaa------ctgc----------------------attctttg------ta-tt-tt------------
            Ma's night monkey  taaa------ctgc----------------------actctttg------ta-tt-tt------------
B D                   Tarsier  tcaa------ctcc---------------------aattcttgg------tattt-tt------------
                  Mouse lemur  taaacc----ctgc----------------------attctttg------tg-tt-ttta----------
            Coquerel's sifaka  taaacc----ctac----------------------attttttg------tg-tt-ttta----------
                  Black lemur  gaaacc----ctgc----------------------attctttg------tg-tt-ttta----------
              Sclater's lemur  gaaacc----ctgc----------------------attctttg------tg-tt-ttta----------
B D                  Bushbaby  taaact----ctgt---------------------aattctttg------ta-tt-ttta----------
B D                     Mouse  taaagtggagttgt----------------------gtgctttgaaaaacta-ttatt------------
B D                       Dog  taaa------ccgctgagccacccagggatccccatgcactcta------ta-tt-tt------------
B D                 Armadillo  gaat------ctct----------------------attctttg------ta-tt-tttaagagctagtc

                        Human  -----taag-----------------gacatcggcagtcta-ctc-------ttttt----tcc-aatgg
                        Chimp  -----taag-----------------gacatcggcagtcta-ctc-------ttttt----tcc-aatgg
                       Bonobo  -----taag-----------------gacataggcagtcta-ctc-------ttttt----tcc-aatgg
                      Gorilla  -----taag-----------------gacatcggcagtcta-ctc-------ttttt----tcc-aatgg
                    Orangutan  -----taag-----------------gacatcggcagtcta-ctc-------ttttt----tcc-aatgg
                       Gibbon  -----taag-----------------gacatcagcagtcta-ctc-------ttttt----tcc-aatgg
                       Rhesus  -----taag-----------------gacatcagcagtgta-cta-------ttttt----tcc-aatgg
          Crab-eating macaque  -----taag-----------------gacatcagcagtgta-cta-------ttttt----tcc-aatgg
           Pig-tailed macaque  -----taag-----------------gacatcagcagtgta-cta-------ttttt----tcc-aatgg
               Sooty mangabey  -----taag-----------------gacatcagcagtcta-cta-------ttttt----tcc-aatgg
                       Baboon  -----taag-----------------gacatcagcagtcta-cta-------ttttt----tcc-agtgg
                 Green monkey  -----taag-----------------gacatcagcagtcta-cta-------ttttt----tcc-aatgg
                        Drill  -----taag-----------------gacatcagcagtcta-cta-------ttttt----tcc-aatgg
             Proboscis monkey  -----taag-----------------gacacaagcagtcta-cta------tttttt----tcc-aatgg
              Angolan colobus  -----taag-----------------gacatcagcagtcta-ctg------tttttt----tcc-aatgg
     Golden snub-nosed monkey  -----taag-----------------gacatcagcagtcta-cta------tttttt----tcc-aatgg
      Black snub-nosed monkey  -----taag-----------------gacatccgcagtcta-cta------tttttt----tcc-aatgg
                     Marmoset  -----taag-----------------aacatcagcagtcta-ctc------tttttt----tcc-aatgg
              Squirrel monkey  -----taag-----------------aacatcagcagtcta-ctc------ttttct----tct-gaagg
          White-faced sapajou  -----taag-----------------aacatcagcagtcta-ctc------tttttt----tcc-aatgg
            Ma's night monkey  -----taag-----------------aacatcagcagtcta-ctc------tttatt----tcc-aatgg
                      Tarsier  -----tcag-----------------gacgtcgccattcta-ctc-------tttttaaaacct-catgg
                  Mouse lemur  ---tttaag-----------------gacttcgccattgta-ctc------tctttt----tttaaatgg
            Coquerel's sifaka  ---tttaag-----------------gacattgccattcta-ctc------tctttt----ttt-aatgg
                  Black lemur  ---tttaag-----------------aacatcgcccttcta-ctc------tctttt----ttt-aatgg
              Sclater's lemur  ---tttaag-----------------aacatcgcccttcta-ctc------tctttt----ttt-aatgg
                     Bushbaby  ---tgtaag-----------------gatatcaccttttgagctc------ttttct----ttt-aatgg
                        Mouse  -----taag-----------------gatcttagtatccag-ttctccccctttttt----tct-aaaat
                          Dog  -----taagaatgaattttatttaatgacgttgcctctcaa-ctc-------atttc----tta-aatgg
                    Armadillo  tttattaag-----------------gacatcattcctcta-ctc-----tttcttt----tgt-aatga

                        Human  ----c--------accactttctaaca---tatctaattaattatttattatgcttat------------
                        Chimp  ----c--------accactttctaaca---tatctaattaattatttattatgcttat------------
                       Bonobo  ----c--------accactttctaaca---tatctaattaattatttattatgcttat------------
                      Gorilla  ----t--------accactttctaaca---tatctaattaattatttattatgcttat------------
                    Orangutan  ----c--------accactttctaaca---tatctaattaattatttattatgcttat------------
                       Gibbon  ----c--------atcactttctaaca---tatctaattca-tatttattatgcttat------------
                       Rhesus  ----c--------accactttctaaca---tatctaattaattacttattatgcttat------------
          Crab-eating macaque  ----c--------accactttctaaca---tatctaattaattatctattatgcttat------------
           Pig-tailed macaque  ----c--------accactttctaaca---tatctaattaattatttattatgcttat------------
               Sooty mangabey  ----c--------accactttctaaca---tatctaattaattatttattatgcttat------------
                       Baboon  ----c--------accactttctaaca---tatctaattaattatttattatgcttat------------
                 Green monkey  ----c--------accactttctaaca---tatctaattaattatttattatgcttat------------
                        Drill  ----c--------accactttctaaca---tatctaattaattatttattatgcttat------------
             Proboscis monkey  ----c--------accactttctaaca---tatctaattaattatttattatgcttat------------
              Angolan colobus  ----c--------accactttctaaca---tatctaattaattatttattatgcttat------------
     Golden snub-nosed monkey  ----c--------accactttctaaca---tatctaattaattatttattatgcttat------------
      Black snub-nosed monkey  ----t--------accactttctaaca---tatctaattaattatttattatgcttat------------
                     Marmoset  ----c--------accagtttctaaca---tatctaattaattatttattatgcttat------------
              Squirrel monkey  ----c--------accactttctaaca---tatctaattaattatttattatgcttat------------
          White-faced sapajou  ----c--------accactttctaaag---tatctaattaattatttattatgcttat------------
            Ma's night monkey  ----------------actttctaaca---tatctaattaattatttattatgcttat------------
                      Tarsier  tattt--------accactttctaaca---tatctaattaattatttattaggcttat------------
                  Mouse lemur  ----caactaccaaccactttctaacaa--tgtctaattaattatttattatgtttat------------
            Coquerel's sifaka  ----caattaccaaccactttctaacac--tgtctaattaattatttattatgtttat------------
                  Black lemur  ----caattaccaaccactttccaacaa--tgtctaattaattatttattatgcttat------------
              Sclater's lemur  ----caattaccaaccactttccaacaa--tgtctaattaattatttattatgcttat------------
                     Bushbaby  ----caatt----accactttctga------gtctaattagctatttattctgtttat------------
                        Mouse  ----t--atacctacaatgttctaaaa---tgtatacttcattattctatctatctatctatctatctat
                          Dog  ----aattt----accactttctaact---tacatacttgattatttactatgcttat------------
                    Armadillo  ----cattt----accactttctaatgaattacataaataattctttttcaagcataa------------

                        Human  ---------tgtttat-------------------------------------ggtctgtctgcctcttc
                        Chimp  ---------tgtttat-------------------------------------ggtctgtctgccccttc
                       Bonobo  ---------tgtttat-------------------------------------ggtctgtctgccccttc
                      Gorilla  ---------tgtttat-------------------------------------ggtctgtctgccccttc
                    Orangutan  ---------tgtttat-------------------------------------cgtctgtctgccacttc
                       Gibbon  ---------tgtttat-------------------------------------ggtctgtcggccacttc
                       Rhesus  ---------tgtttat-------------------------------------ggtctgtctgccatttc
          Crab-eating macaque  ---------tgtttat-------------------------------------ggtctgtctgccacttc
           Pig-tailed macaque  ---------tgtttat-------------------------------------ggtctgtctgccacttc
               Sooty mangabey  ---------tgtttat-------------------------------------ggtctgtctgtcacttc
                       Baboon  ---------tgtttat-------------------------------------ggtctgtctgccacttc
                 Green monkey  ---------tgtttat-------------------------------------ggtctgtctgccacttc
                        Drill  ---------tgtttat-------------------------------------ggtctgtctgccacttc
             Proboscis monkey  ---------tgtttat-------------------------------------ggtctgtctgccacttc
              Angolan colobus  ---------tgtttat-------------------------------------ggtctgtctgccacttc
     Golden snub-nosed monkey  ---------tgtttat-------------------------------------ggtctgtctgccacttc
      Black snub-nosed monkey  ---------tgtttat-------------------------------------ggtctgtctgccacttc
                     Marmoset  ---------tcttcat-------------------------------------ggtttgtctaccacttc
              Squirrel monkey  ---------tgtttat-------------------------------------ggtttgtctaccacttc
          White-faced sapajou  ---------tgtttat-------------------------------------ggtttgtctaccacttc
            Ma's night monkey  ---------tatt-at-------------------------------------ggtttgtctgccacttc
                      Tarsier  ---------tatt-at-------------------------------------ggtctgtctgccaagtc
                  Mouse lemur  ---------tgtttat-------------------------------------agtctgtctaccacttc
            Coquerel's sifaka  ---------tgtttat-------------------------------------ggtctgtctaccacttc
                  Black lemur  ---------tgcttat-------------------------------------ggtctgtctaccacttc
              Sclater's lemur  ---------tgcttat-------------------------------------ggtctgtctaccacttc
                     Bushbaby  ---------tgtttat-------------------------------------ggccta-ctaccacttc
                        Mouse  ctatctatctatctatctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtct
                          Dog  ---------tgtttat-------------------------------------ggtccacctaccacttt
                    Armadillo  ---------tgtttat-------------------------------------ggtctgcctcccatttc

                        Human  acc
                        Chimp  acc
                       Bonobo  acc
                      Gorilla  acc
                    Orangutan  acc
                       Gibbon  acc
                       Rhesus  acc
          Crab-eating macaque  acc
           Pig-tailed macaque  acc
               Sooty mangabey  acc
                       Baboon  acc
                 Green monkey  acc
                        Drill  acc
             Proboscis monkey  acc
              Angolan colobus  acc
     Golden snub-nosed monkey  acc
      Black snub-nosed monkey  acc
                     Marmoset  ac-
              Squirrel monkey  ac-
          White-faced sapajou  ac-
            Ma's night monkey  ac-
                      Tarsier  aca
                  Mouse lemur  acg
            Coquerel's sifaka  acg
                  Black lemur  ---
              Sclater's lemur  ---
                     Bushbaby  act
                        Mouse  act
                          Dog  gcc
                    Armadillo  acc

Inserts between block 41 and 42 in window
B D Golden snub-nosed monkey 127bp
B D                  Tarsier 2bp
B D                 Bushbaby 13bp
B D                    Mouse 2bp

Alignment block 42 of 48 in window, 91098783 - 91098814, 32 bps 
B D                     Human  ctacctc---------------ccattccccacct-ggaattccgaaa
B D                     Chimp  ctacctc---------------ccattccccacct-ggaattccgaaa
B D                    Bonobo  ctacctc---------------ccattccccacct-ggaattccgaaa
B D                   Gorilla  ctacctc---------------ccattccccacct-ggaattccgaaa
B D                 Orangutan  ccacctc---------------ccattccccacct-ggaattcccaac
B D                    Gibbon  ccacctc---------------ccattccccacct-ggaattcccaac
B D                    Rhesus  ccacctc---------------ccattccccacct-ggaattcccaac
B D       Crab-eating macaque  ccacctc---------------ccattccccacct-ggaattcccaac
           Pig-tailed macaque  ccacctc---------------ccattccccacct-ggaattcccaac
               Sooty mangabey  ccacctc---------------ccattccccacct-ggaattcccaac
                       Baboon  ccacctc---------------ccattccccacct-ggaattcccaac
B D              Green monkey  ccacctc---------------ccattccccacct-ggaattcccaac
                        Drill  ccacctc---------------ccattccccacct-ggaattcccaac
B D          Proboscis monkey  ccacctc---------------ccattccccacct-ggaattcccaac
              Angolan colobus  ccacctc---------------ccattccccacct-ggaattcccaac
B D  Golden snub-nosed monkey  ccacctc---------------ccattccccacct-ggaattcccaac
      Black snub-nosed monkey  ccacctc---------------ccattccccacct-ggaattcccaac
B D                  Marmoset  ---cacc---------------gtatccctaatct-ggaatccccagc
B D           Squirrel monkey  ---cgcc---------------ctatccctcatct-ggaattcccggc
          White-faced sapajou  ---tgcc---------------gcatccctcatct-ggaattcccagt
            Ma's night monkey  ---cacc---------------ctatccctcatct-ggaattcccaga
B D                   Tarsier  -ctgctc---------------ctcctgtcctctt-ggagttcccagc
                  Mouse lemur  -----------------------ctccccctgcct-ggaatccccagc
            Coquerel's sifaka  -----------------------ccacccctgcct-ggagttcccagc
                  Black lemur  --------------------------tgtctacct-tgaattcccaac
              Sclater's lemur  --------------------------tgtctacct-tgaattcccaac
B D                  Bushbaby  acccccc---------------ccacccccggcct-ggaattcccagc
B D                     Mouse  ctatttcagtttgttgaccacttcattctctgcct-ggatttcacagc
B D                       Dog  ---------------------------ctctgcct-ggaattgccaac
B D                 Armadillo  ----------------------ccaccgtctgcccaggaattcccaat

Inserts between block 42 and 43 in window
B D                Orangutan 1159bp

Alignment block 43 of 48 in window, 91098815 - 91098917, 103 bps 
B D                     Human  cccaattctctgccctcattagcccacctgacatatgggaggcactcaaaaaaa-----tga--------
B D                     Chimp  cccgattctctgccctcattagcccacctgacatatgggaggcactcaaaaaaa-----tga--------
B D                    Bonobo  cccaattctctgccctcattagcccacctgacatatgggaggcactcaaaaaaa-----tga--------
B D                   Gorilla  cccaattctctgccctcattagcccacctgatatgtgggaggcactcaaaaaaa-----tga--------
B D                 Orangutan  cccaattctctgccctcattagcccacctgacatatgggaggcactcaaaaaaa-----tga--------
B D                    Gibbon  tccagttctctgccctcattagcctatctcacatatgggaggcactcaaaaaaa-----tga--------
B D                    Rhesus  cccaattctctgccctcattagcctacctgacatgtgggaggcactcaaaacaa-----tga--------
B D       Crab-eating macaque  cccaattctccgccctcattagcctacctgacatgtgggaggcactcaaaacaa-----tga--------
           Pig-tailed macaque  cccaattctctgccctcattagcctacctgacatgtgggaggcactcaaaacaa-----tga--------
               Sooty mangabey  ccaaattctctgccctcattagcctacctgacatgtgggaggcactcaaaacaa-----tga--------
                       Baboon  cccaattctctgccctcattagcctacctgacatgtgggaggcactcaaaacaa-----tga--------
B D              Green monkey  cccaattctctgccctcattagcctacctgacatgtgggaggcactcaaaacaa-----tga--------
                        Drill  ccaaattctctgccctcattagcctacctgacatgtgggaggcactcaaaacaa-----tga--------
B D          Proboscis monkey  cccaattctctgccctcattagcctacctgacatgtgggaggcactcaaaacaa-----tga--------
              Angolan colobus  cccaattctctgccctcattagcctacctgacgtgtgggaggcactcaaaacaa-----tga--------
B D  Golden snub-nosed monkey  cccaattctctgccctcattagcctacctgacatgtgggaggcactcaaaacaa-----tga--------
      Black snub-nosed monkey  cccaattctctgccctcattagcctacctgacatgtgggaggcactcaaaacaa-----tga--------
B D                  Marmoset  cccaattctctgccctcattagcctacct-----------ggcactcaaaaaaagaaataaa--------
B D           Squirrel monkey  cccaattctctgccctcattagcctccctggcacatgggaggcactaaaaaaaaaaaaaaaa--------
          White-faced sapajou  cccaattctctgccctcattagcctacctggcacatgggagacactcaaaaaaaaaaa-aaa--------
            Ma's night monkey  cccaattctctgccctcattagcctacctggcacatgggaggcactcaaaaaaa-----aaa--------
B D                   Tarsier  tgctattctctgctctcattcgcccaggtggcacatgggggacactccaaaagg-----tgg--------
                  Mouse lemur  tcccattttctgtcctcaatagcctacctggcgtatgggaggtat-caaaaata-----tga--------
            Coquerel's sifaka  ccccattttctgtcctccatagcctacctggcatatgggaggtac-tcaaaaaa-----tga--------
                  Black lemur  ccccattttctgtcctcaatagcctacctggcatatgggaggtactcaaaaaaa-----tga--------
              Sclater's lemur  ccccattttctgtcctcaatagcctacctggcatatgggaggtactcaaaaaaa-----tga--------
B D                  Bushbaby  caccattctctatcccaaacagcctacccagtatatgggatgtactaaaaaaaa-----aaa--------
B D                     Mouse  ccccatgttctgtcttcatcagtcttccttgcataaaacagatatttaaagaac-----acatttttttc
B D                       Dog  -cccaatctctaccctcactagtctgcctggcacataggaggcactaaaaaaca-----tag--------
B D                 Armadillo  -cccaagctctgccctcattagtctacctggtaccaagaaggcactccaaaaaa-----tgg--------

                        Human  -ttgaa---tgactatatggagtgtattcttattttta-----aaaac-tgaaaaa
                        Chimp  -ttgaa---tgactatatggagtgtattcttattttta-----aaaac-tg-aaaa
                       Bonobo  -ttgaa---tgactatatggagtgtattcttattttta-----aaaac-tgaaaaa
                      Gorilla  -ttgaa---tgactatatggagtgtattcttattttta-----aaaac-tgaaaaa
                    Orangutan  -ttgaa---agactatatggagtgtattcttattttta-----aaaac-tgaaaaa
                       Gibbon  -ttgaa---tgactatatggagagtattcttattttta-----aaaac-tg-aaaa
                       Rhesus  -ttgaa---tgactatatggagtgtattcttattttta-----aaaac--aaaaaa
          Crab-eating macaque  -ttgaa---tgactatatggagtgtattcttattttta-----aaaac-aaaaaaa
           Pig-tailed macaque  -ttgaa---tgactatatggagtgtattcttattttta-----aaaacaaaaaaaa
               Sooty mangabey  -ttgaa---tgactatatggagtgtattcttattttta-----aaaac-aacaaaa
                       Baboon  -ttgaa---tgactatatggagtgtattcttattttta-----aaaac-aaaaaaa
                 Green monkey  -ttgaa---tgactatatggtgtgtattcttatttttaaaaacaaaac-aaaaaaa
                        Drill  -ttgaa---tgactatatggagtgtattcttattttta-----aaaac-aaaaaaa
             Proboscis monkey  -ttgaa---tgactatatggagtgtattcttattttta-----aaaac--aaaaaa
              Angolan colobus  -ttgaa---tgactatatggagtgtattcttattttta-----aaaac---aagaa
     Golden snub-nosed monkey  -ttgaa---tgactatatggagtgtattcttattttta-----aaaacaaaaaaaa
      Black snub-nosed monkey  -ttgaa---tgactatatggagtgtattcttattttta-----aaaac-aaaaaag
                     Marmoset  -ataaa---tgtctatatggagtgtattcttatttaaa-----aaaac-ta--aaa
              Squirrel monkey  -atgaa---tgtctatatggagtgtattcttattttta-----aaaac-tg--aaa
          White-faced sapajou  -atgaa---tgtctatatggagtgtattcttattttta-----aaaac-tg--aaa
            Ma's night monkey  -atgaa---tgtctatatggagtgtattcttattttta-----aaaac-tg--aaa
                      Tarsier  -ctgaa---tgt--------agcgtatgctcatattta-----aaagc-tg---aa
                  Mouse lemur  -tcaaa---tgactacatggaaggtatgttcattttta-----taagc-tgca---
            Coquerel's sifaka  -ttgaa---tgactacatgtagggtatgctcattttta-----taagc-ttaa---
                  Black lemur  -ttgaa---tgactacatgtaggatatgctcattttta-----taagc-tgaaaaa
              Sclater's lemur  -ttgaa---tgactacatgtaggatatgctcattttta-----taagc-tgaaaaa
                     Bushbaby  -aaaga---agattccatgtagtgtatgttcatttttt-----aaagc-tgaa---
                        Mouse  tttgtattttgaatatttgtaatgtttgttcatttctg-----aata---------
                          Dog  -ttaaa---tgaatatatgtagtgcatgttcatttttg-----aaaac-tgaa---
                    Armadillo  -ttcac---tgggtatttgcagtgcaagctcacttctg-----aaaac-tgaa---

Inserts between block 43 and 44 in window
                 Black lemur 125bp
             Sclater's lemur 125bp

Alignment block 44 of 48 in window, 91098918 - 91099030, 113 bps 
B D                     Human  aaatgaagaaatgtataaa-----aatataaagaaatata-----taat-------taaaaatattaatt
B D                     Chimp  aaatgaagaaatgtataaa-----aatataaagaaatata-----taat-------aaaaaatattaatt
B D                    Bonobo  aaatgaagaaatgtataaa-----aatataaagaaatata-----taat-------aaaaaatattaatt
B D                   Gorilla  aaatgaagaaatgtataaa-----aatataaagaaatata-----taat-------aaaaaatattagtt
B D                 Orangutan  aaatgaagaaatgtataaa-----aatataaagaaatata-----taat-------aaaaaatattaatt
B D                    Gibbon  aaatgaagaaatgtataaa-----aatataaataaatata-----taat--------aaaaatattaatt
B D                    Rhesus  aaatgaagaaatgtataaa-----aatataaagaaataca-----taat--------taaaatatcagtt
B D       Crab-eating macaque  aaatgaagaaatgtataaa-----aatataaagaaataca-----taat--------taaaatatcagtt
           Pig-tailed macaque  aaatgaagaaatgtataaa-----aatataaagaaataca-----taat--------taaaatatcagtt
               Sooty mangabey  aaatgaagaaatgtataaa-----aatataaagaaataca-----taac--------taaaatatcagtt
                       Baboon  aaatgaagaaatgtataaa-----aatataaagaaataca-----taat--------taaaatatcagtt
B D              Green monkey  aaatgaagaaatgtataaa-----aatataaagaaataca-----taat--------aaaaatatcagtt
                        Drill  aaatgaagaaatgtgtaaa-----aatataaagaaataca-----taat--------taaaatatcagtt
B D          Proboscis monkey  aaatgaagaaatgtataaa-----aatataaagaaataca-----taat--------aaaaatatcagtt
              Angolan colobus  aaatgaagaaatgtataaa-----aatataaagaaataca-----taat--------aaaaatatcagtt
B D  Golden snub-nosed monkey  aaatgaagaaatgtataaa-----aatataaagaaataca-----taat--------aaaaatatcagtt
      Black snub-nosed monkey  aaatgaagaaatgtataaa-----aatataaagaaataca-----taat--------aaaaatatcagtt
B D                  Marmoset  aaatgaataaatacctaaa-----aatataaagaaatgta-----taat----------aactattaatt
B D           Squirrel monkey  aaatgaataaatacctaaa-----aatataaagaaattta-----taat-------aaaaacgattaatt
          White-faced sapajou  aaatgaataaatacctaaa-----aatataaagaaatgta-----taat-------aaaaactattaatt
            Ma's night monkey  aaatgaataaatacctaaa-----aatataaagaaatgta-----taat-------aaaaactattaatt
B D                   Tarsier  gaataaagaaatgtgcaaaacaagaatataaagagatgtaaaaggtaat-------aagaactatccatg
                  Mouse lemur  aaatgtagaaatggataag-aaataatataaagaaatgta-----taaggtaat--aaaaactatccatt
            Coquerel's sifaka  aaatgtagaaatggataag-aaataatataaagaaatgta-----taagataat--aaaaactattcatt
B D                  Bushbaby  aaatgtagagacatataaa-aaataacataaagtaatgta-----taatttaga--aaaaactatccatt
B D                     Mouse  aaagaaagaaaagtatctc-----attgcataaaagtaaa-----tgca--------aagaa--------
B D                       Dog  acatgtagaaatatgtaaa--aacaatataaaggaatgta-----taagataat--aaaaatcatccatt
B D                 Armadillo  aaatgtagaaatatatacaaaaataataccaggaaatgca-----tgagattataaaaaaatcattcact
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================

                        Human  tctcctaacttactaaacaatttcattaacattttgaaaaggcacatatac--------tatgaatc--t
                        Chimp  tctcctaacttactaaacaatttcattaacattttgaaaagacacatacac--------tatgaatc--t
                       Bonobo  tatcctaacttactaaacaatttcattaacattttgaaaaggcacatacac--------tatgaatc--t
                      Gorilla  tctcctaacttactaaacaatttcattaacattttgaaaaggcacatacac--------tatgaatc--t
                    Orangutan  tctcctaacttactaaacaatttcatttacattttgaaaaggcacatgcac--------tatggatc--t
                       Gibbon  tctcctaacttac----caatttcattaacattttgaaaaggcacatacac--------tatgaatc--t
                       Rhesus  tctcctaacttactaaaaaattctattaacattttgaaaaggcacatacac--------tatggatc--t
          Crab-eating macaque  tctcctaacttactaaaaaattctattaacattttgaaaaggcacatacac--------tatggatc--t
           Pig-tailed macaque  tctcctaacttactaaaaaattctattaacattttgaaaaggcacatacac--------tatggatc--t
               Sooty mangabey  tctcctaacttactaaaaaattctattaacattttgaaaaggcacatacac--------tatggatc--t
                       Baboon  tctcctaacttactaaaaaattctattaacattttgaaaaggcacatacac--------tatggatc--t
                 Green monkey  tctcctaacttactaaacaattctattaacattttgaaaaggcacatacac--------tatggatttat
                        Drill  tctcctaacttactaaaaaattctatttacattttgaaaaggcacatacac--------tatggatc--t
             Proboscis monkey  tctcctaacttact-aacaattccattaacattttgaaaaggcacatacac--------tatggatc--t
              Angolan colobus  tctcctaacttactaaacaattccattaacattttgaaaaggcacatactc--------tatggatc--t
     Golden snub-nosed monkey  tctcctaacttactaaacaattccattaacattttgaaaaggcacatacac--------tatggatc--t
      Black snub-nosed monkey  tctcctaacttactaaacaattccattaacattttgaaaaggcacatacac--------tatggatc--t
                     Marmoset  tctcctaacttactaaacaa--tcattaacattttaaaaaggcacatacac--------tatggatc--t
              Squirrel monkey  tctcctaacttactaaacaatttcattaacattttgaaaaggcacatacac--------tatggata--t
          White-faced sapajou  tctcctaacttactaaacaattccattaacattttgaaaaggcacatacac--------tatggctc--t
            Ma's night monkey  tctcctaacttactaaacaatttcattaacattttgaaaaggcacatacac--------tatggatc--t
                      Tarsier  tcttctaatccactaaataacactattaacgtcgtgaaaaggcacgtacgcaattgatgtatgaact--t
                  Mouse lemur  tctcctaacccactaaataacatcattaacattgtgaaaaggtacatacat--ttgatatatggatc--g
            Coquerel's sifaka  tctcataacccactaaataacatcattaacattgtgaaaaggtacatacat--ctgatatatggatg--g
                     Bushbaby  tctcctaaccctctaaatgacatcac---cattgtgaaaaggtgc--------ttgacgtatggatc--a
                        Mouse  -ctccccacc--cctgacagtttggtgaatattgtgaga---------tac--------tattggtg--a
                          Dog  tatccttacccaccagacaacatcatgaacattcttggaaggcccatatgc--ttgcc-tgtagatc--t
                    Armadillo  tacccaaacccaccaaaca---------------tg----------------------------------
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================

Inserts between block 44 and 45 in window
B D                    Mouse 6bp

Alignment block 45 of 48 in window, 91099031 - 91099051, 21 bps 
B D                     Human  atgcataaatgtgtatatatc
B D                     Chimp  atgcataaatgtgtatatatc
B D                    Bonobo  atgcataaatgtgtatatatc
B D                   Gorilla  atgcataaatgtgtatatatc
B D                 Orangutan  atgcataaatgtgtatatatc
B D                    Gibbon  atgcataaatgtgtgtatatc
B D                    Rhesus  atgcataaatgtgtatatatc
B D       Crab-eating macaque  atgcataaatgtgtatatatc
           Pig-tailed macaque  atgcataaatgtgtatatatc
               Sooty mangabey  atgcataaatgtgtatatatc
                       Baboon  aggcataaatgtgtatatatc
B D              Green monkey  atacataaatgtgtatatatc
                        Drill  atgcataaatgtgtatatatc
B D          Proboscis monkey  atgcataaatgtgtatatatc
              Angolan colobus  atgcataaatgtgtatatatc
B D  Golden snub-nosed monkey  atgcataaatgtgtatatatc
      Black snub-nosed monkey  atgcataaatgtgtatatatc
B D                  Marmoset  atgcataaatgtgtatagatc
B D           Squirrel monkey  atgcataaatgtgtatgggtc
          White-faced sapajou  atgcataaatgtgtatagatc
            Ma's night monkey  atgcataaatgtgtatagatc
B D                   Tarsier  atgcatacatgtgtatctatc
                  Mouse lemur  atgcataattgtgtatatatc
            Coquerel's sifaka  atgcataaatgtgtatatatc
                  Black lemur  atgtataaatgtgtatatatc
              Sclater's lemur  atgtataaatgtgtatatatc
B D                  Bushbaby  acacataactgtg----tatc
B D                     Mouse  ctacataattttgtatccatg
B D                       Dog  atgcataaatgcgtatacatc
B D                 Armadillo  --gcatacatgtatatacat-

Inserts between block 45 and 46 in window
B D                      Dog 191bp

Alignment block 46 of 48 in window, 91099052 - 91099101, 50 bps 
B D                     Human  aaaactgctatttatcaaagcccct------------cc-------------------------------
B D                     Chimp  aaaactgctatttatcaaagcccct------------cc-------------------------------
B D                    Bonobo  aaaactgctatttatcaaagcccct------------cc-------------------------------
B D                   Gorilla  aaaactgctatttatcaaagcccct------------cc-------------------------------
B D                 Orangutan  aaaactactatttatcaaagcccct------------cc-------------------------------
B D                    Gibbon  aaaactactatttatcaaagcccct------------cc-------------------------------
B D                    Rhesus  aaaactactattaatcaaagcccct------------cc-------------------------------
B D       Crab-eating macaque  aaaactactattaatcaaagcccct------------cc-------------------------------
           Pig-tailed macaque  aaaactactattaatcaacgcccct------------cc-------------------------------
               Sooty mangabey  aaaactactattaatcaaagcccct------------cc-------------------------------
                       Baboon  aaaactactatcaatcaaagcccct------------cc-------------------------------
B D              Green monkey  aaaactactattaatcaaagcccct------------cc-------------------------------
                        Drill  aaaactactactaatcaaagcccct------------cc-------------------------------
B D          Proboscis monkey  aaaactactattaatcaaagcccct------------cc-------------------------------
              Angolan colobus  aaaactactattaatcaaagcccct------------cc-------------------------------
B D  Golden snub-nosed monkey  aaaactgctattaatcaaagcccct------------cc-------------------------------
      Black snub-nosed monkey  aaaactgctattaatcaaagcccct------------cc-------------------------------
B D                  Marmoset  aaaatgtgtatttaccaaa-ccact------------cc-------------------------------
B D           Squirrel monkey  aatattagtatttaccgag-cccct------------cc-------------------------------
          White-faced sapajou  aaaattagtatttaccaaa-accct------------cc-------------------------------
            Ma's night monkey  aaaattagtatttaccaaa-cccct------------cc-------------------------------
B D                   Tarsier  aaaattagcatgtatcacagccact------------cc-------------------------------
                  Mouse lemur  aaaattagtatttatcaaagcccct------------cc-------------------------------
            Coquerel's sifaka  aaaattagtatttatcaaagcccct------------cc-------------------------------
                  Black lemur  gaaattagtattcatcaaa-cccct------------cc-------------------------------
              Sclater's lemur  gaaattagtattcatcaaa-cccct------------cc-------------------------------
B D                  Bushbaby  aaaattagtattcatcagagtccct------------cc-------------------------------
B D                     Mouse  taaattaggatctttcaaagtcctt------------tctcactctacaatttagccatagacccagaaa
B D                       Dog  gaagttagtatttatcaagccccccttcccactgccacc-------------------------------
B D                 Armadillo  aaaacaagtatttctcaaagttctt------------tc-------------------------------

                        Human  -----ctcgtttattt-tg--agaatcccca
                        Chimp  -----ctcatttattt-tg--agaatcccca
                       Bonobo  -----ctcatttattt-tg--agaatcccca
                      Gorilla  -----ctcatttattt-tg--agaatcccca
                    Orangutan  -----ctcatttattt-tg--agaatcccca
                       Gibbon  -----ctcgtttattt-gg--agaatcccca
                       Rhesus  -----ctcatttattt-tg--agaattccca
          Crab-eating macaque  -----ctcatttattt-tg--agaatcccca
           Pig-tailed macaque  -----ctcatttattt-tg--agaatcccca
               Sooty mangabey  -----ctcatttattt-tg--agaatcccca
                       Baboon  -----ctcatttattt-tg--agaatcccca
                 Green monkey  -----ctcatttattt-tg--agaatcccca
                        Drill  -----ctcatttattt-tg--agaatcccca
             Proboscis monkey  -----ctcatttattt-gg--agaatcccca
              Angolan colobus  -----ctcatttattt-tg--agaatcccca
     Golden snub-nosed monkey  -----ctcatttattt-gg--agaatcccca
      Black snub-nosed monkey  -----ctcatttattt-gg--agaatcccca
                     Marmoset  -----ctcatttattt-tg--agaatctcca
              Squirrel monkey  -----ctcatttattt-tg--agaattccca
          White-faced sapajou  -----ctcatttattt-tg--agaatcccca
            Ma's night monkey  -----ttcatttattt-tg--agaat-ccca
                      Tarsier  -----ttcatttgttt-tg--agaatcccca
                  Mouse lemur  -----ctcattaattt-tg--agaatcccca
            Coquerel's sifaka  -----ctcattaattt-tg--agaatcccca
                  Black lemur  -----ctcattaattt-tg--agaatcccca
              Sclater's lemur  -----ctcattaattt-tg--agaatcccca
                     Bushbaby  -----ctcctttattt-tg--aggatcccca
                        Mouse  cttttcttgcttatct-ctgcaaaatcccca
                          Dog  -----accatttatttctg--agaatcccca
                    Armadillo  -----cttatttatttctg--agagtgccca

Inserts between block 46 and 47 in window
                 Mouse lemur 398bp

Alignment block 47 of 48 in window, 91099102 - 91099135, 34 bps 
B D                     Human  aagggatgcatgcttccatctctcag-----------ct----------tcagtc----
B D                     Chimp  aagggatgcatgcttccatctctcag-----------ct----------tcagtc----
B D                    Bonobo  aagggatgcatgcttccatctctcag-----------ct----------tcagtc----
B D                   Gorilla  aagggatgcatactt-catctctcag-----------ct----------tcagtc----
B D                 Orangutan  aagggatgcatgcttctatctctcag-----------ct----------tcagtc----
B D                    Gibbon  aagggatgcatgcttccatctctcag-----------tt----------ttagtc----
B D                    Rhesus  aagggatgcatgcttccatctctcag-----------tt----------tcagtc----
B D       Crab-eating macaque  aagggatgcatgcttccatctctcag-----------tt----------tcagtc----
           Pig-tailed macaque  aagggatgcatgcttccatctctcag-----------tt----------tcagtc----
               Sooty mangabey  aagggatgcatgcttccatctctcag-----------tt----------tcagtc----
                       Baboon  aagggatgcatgcttccatctctcag-----------tt----------tcagtc----
B D              Green monkey  aagggatgcatgcttccatctctcag-----------tt----------tcagtc----
                        Drill  aagggatgcatgcttccatctgtcag-----------tt----------tcagtc----
B D          Proboscis monkey  aagggatgcatgcttccatctctccg-----------tt----------tcagtc----
              Angolan colobus  aagggatgcatgcttccatctttcag-----------tt----------tcagtc----
B D  Golden snub-nosed monkey  aagggatgcatgcttccatctctcag-----------tt----------tcagtc----
      Black snub-nosed monkey  aagggatgcatgcttccatctctcag-----------tt----------tcagtc----
B D                  Marmoset  aagggatgcatgcctccatctctcag-----------tt----------tcagtc----
B D           Squirrel monkey  aagggatgcatgtccccatctctcag-----------tt----------tcagtc----
          White-faced sapajou  gagggatgcatgtccccatctctcag-----------tt----------tcagtc----
            Ma's night monkey  aagggatgcatgtccccatctctcag-----------tt----------tcagtc----
B D                   Tarsier  gaggggtgcacatcctagtctctcag-----------tctggtttctaatcagta----
            Coquerel's sifaka  gagaggttcatgcctcagtttctcag-----------tt----------tcagtc----
                  Black lemur  gggaggtgcatgcctcagtctctcag-----------tt----------tcagtc----
              Sclater's lemur  gggaggtgcatgcctcagtctctcag-----------tt----------tcagtc----
B D                  Bushbaby  aggaggtgcacacctcactctgttgg-----------tt----------tcaccc----
B D                     Mouse  agacaaagctcagctcattgcctcgg-----------tt----------gtagct----
B D                       Dog  aagagatacacag--ccatcccagtg-----------tt----------tcagtc----
B D                 Armadillo  aaagggtgcacacccctctctgtcagggcagtccagttt----------ccactcagtg
                 Mouse lemur  ===========================================================

Inserts between block 47 and 48 in window
           Coquerel's sifaka 294bp
                 Black lemur 310bp
             Sclater's lemur 310bp
B D                 Bushbaby 12bp
B D                    Mouse 14bp
B D                      Dog 16bp

Alignment block 48 of 48 in window, 91099136 - 91099332, 197 bps 
B D                     Human  agtctgcatcagtggttcttagctggggttgtttggcccacc-------ctccaatcctcacc-caccca
B D                     Chimp  aatctgcatcagtggttcttagctggggttgtttggcccacc-------ctccaatcctcacc-caccca
B D                    Bonobo  aatctgcatcagtggttcttagctggggtcgtttggcccacc-------ctccaatcctcacc-caccca
B D                   Gorilla  aatctgcatcagtggttcttagctggggttgtttggcccacc-------ctccaatcctcacc-caccca
B D                 Orangutan  aatctgcatcagtagttcttagctggggttgtttggcccacc-------ctccaatcctcacc-caccca
B D                    Gibbon  aatctgcatcagtggttcttagctggggttgtttggcccacc-------ctgcaatcctcacc-caccca
B D                    Rhesus  aatcagcatcagtggtacttagctggcattgtttggcccacc-------ccccagccctcacc-caccca
B D       Crab-eating macaque  aatcagcatcagtggttcttagctggcattgtttggcccacc-------ccccagtcctcacc-caccca
           Pig-tailed macaque  aatcagcatcagtggttcttagctggcattgtttggcccacc-------ccccagtcctcacc-caccca
               Sooty mangabey  aatcagcatcactggttcttagctggggttgtttggcccatc-------ccccagtcctcacc-caccca
                       Baboon  aatcagcgtcactggttcttagctagggttgtttggcccatc-------ccccagtcctcacc-caccca
B D              Green monkey  aatcagcatcagtggttcttagctggggttgtttggcccccccctcccaccccagtcctcacc-caccca
                        Drill  aatcagcatcactggttcttagctggggttgtttggcccatc-------ccccagtcctcacc-caccca
B D          Proboscis monkey  aatctgcatcagtggttcttagctggggttgtttggcccacc-------ccccagtcctcacc-caccta
              Angolan colobus  aatctgcatcagtggttcttagctggggttgtttggcccacc-------ccccagttctcacc-caccca
B D  Golden snub-nosed monkey  aatctgcatcagtggttcttagctggggttgtttggcccacc-------ccccagtcctcacc-caccta
      Black snub-nosed monkey  aatctgcatcagtggttcttagctggggttgtttggcccacc-------ccccagtcctcacc-caccta
B D                  Marmoset  aatctgcatcagtggttcttagctggggttgtttggcccacc-------ctcaaatcctcacc-aaccc-
B D           Squirrel monkey  aatctgcatcagtggttcttagctggggttgtttggcccacc-------ctccaatcctcacc-taccc-
          White-faced sapajou  aatctgcatcagtggttcttagctggggttgtttggcccacc-------ttccaatcctcacc-taccc-
            Ma's night monkey  actctgcatcagtggttcttagctggggttgtttgacccacc-------cttcaatcctcacc-taccc-
B D                   Tarsier  aatctaaatcagcggttttggggaagaggtgtgtgttctccc--------------------------tg
B D                  Bushbaby  aatcag--tcagtggttctcagcc-------ctctgctcact-------cccc-----------------
B D                     Mouse  ggaccgtgccagtgggcttcagctaagagagttctgcaaatg-------aagt-gtcctcatcatgtctg
B D                       Dog  agtcttcatcagtggttcttcgctgggttggttctgatcaca-------ccc--accctcact-caccta
B D                 Armadillo  agtctacacaagagatccttagctggggttg---ggtctgct-------cctt-----------------
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================

                        Human  ccaccatcaggacacttggcaatttctggagacatttttggctgccactactg-------gggtag-gca
                        Chimp  ccaccatcaggacacttggcaatttctggagacatttttggctgccactactg-------gggtag-gca
                       Bonobo  ccaccatcaggacacttggcaatttctggagacatttttggctgccactactg-------gggtag-gca
                      Gorilla  cccccatcaggacacttggcaatttctggagacatttttggatgccactact--------gggtag-gca
                    Orangutan  ccaccatcaggacacttggcaatttctggagacatttttggctgccactgctg-------gggtag-gcg
                       Gibbon  ccaccatcaggacacttggcaatttctggagacatttttggctgccactactg-------gggtag-gct
                       Rhesus  ccaccatcaggacgcttggccatttctggagacatttttggctgccactactg-------gggtag-gcg
          Crab-eating macaque  ccaccatcaggacgcttggccatttctggagacatttttggctgccactactg-------gggtag-gcg
           Pig-tailed macaque  ccaccatcaggacgcttggccatttctggagacatttttggctgccactactg-------gggtag-gcg
               Sooty mangabey  ccaccatcaggatgcttggccatttctggagacatttttggctgccactactg-------gggtag-gcg
                       Baboon  ccaccatcaggacgcttggccatttctggagacatttttggctgccactactg-------gggtag-gcg
                 Green monkey  ccaccatcaggacgcttggccatttctggagacatttttggctgccactactg-------gggtag-gcg
                        Drill  ccaccatcaggacgcttggccatttctggagacatttttggctgccactacta-------gggtag-gcg
             Proboscis monkey  ccaccatcaggacgcttggccatttctggagacatttttggctgccactactg-------gggttg-gcg
              Angolan colobus  ccaccatcaggatgcttggccatttctggagacatttttggctgccactactg-------gggtag-gcg
     Golden snub-nosed monkey  ccaccatcaggacgcttggccatttctggagacatttttggctgacactactg-------gggttg-gcg
      Black snub-nosed monkey  ccaccatcaggacgcttggccatttctggagacatttttggctgacactactg-------gggttg-gcg
                     Marmoset  -------caggacacttgcaaatttctggagacatttttggtcaccactactg-------gggtag-gtg
              Squirrel monkey  -------cagggcacttggaaatttctggagacatttttggataccactactg-------gggtag-gcg
          White-faced sapajou  -------caggacacttggaaatttctggagacatttttggccaccactactg-------gggtag-gcg
            Ma's night monkey  -------caggacagttggaaatttctggagacatttttggtcaccactactg-------gggtag-gtg
                      Tarsier  cccccctgaggacacttggcaatctctggagacatttttggctgctgctacc------------------
                     Bushbaby  ------tgaggatgcttggcaaactttggagacatt----------------------------------
                        Mouse  ctacc-----------tggcagtatctctagacagtttggctcatcattattg-------gggtga-agg
                          Dog  --------gggacacttgacaatgtcttgagacatcttcggctgtcactgctggggtggagggtgg-aca
                    Armadillo  ------------------------------------------tgacactcctg-------gggtggtatg
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================

                        Human  cgctgctggcatcta---gtaggtagaggccaggg----------atgttgttaaatttccgacatcgca
                        Chimp  tgctgctggcatcta---gtaggtagaggccaggg----------atgttgttaactttccgacatcgca
                       Bonobo  tgctgctggcatcta---gtaggtagaggccaggg----------atgttgttaaatttccaacatcgca
                      Gorilla  tgctgctggcatcta---gtaggtagaggccaggg----------atgttgttaaatttccaacatcgca
                    Orangutan  tgctgctggcatcta---gtaggtagaggccaggg----------atgttgttaaatttccagcattgca
                       Gibbon  tgctgctggcatcta---gta-gtagaggccagag----------atgttgttaaatttccaacatcgca
                       Rhesus  tgctgctgacatcta---gtaggtagaggccagggatccagg--gatgttgttaaatttccaacattgca
          Crab-eating macaque  tgctgctgacatcta---gtaagtagaggccagggatccagg--gatgttgttaaatttccaacattgca
           Pig-tailed macaque  tgctgctgacatcta---gtaggtagaggccagggatccagg--gatgttgttaaatttccaacattgca
               Sooty mangabey  tgctgctggcatcta---gtaggtagaggccagggatccagg--gatgttgttaaatttccaacattgca
                       Baboon  tgctgctggcatcta---gtaggtagaggccagggatccagg--aatgttgttaaatttccaacattgca
                 Green monkey  tgctgctggcatcta---gtaggtagaggccagggttccagg--gatgttgttaaatttccaacattgca
                        Drill  tgctgctggcatcta---gtaggtagaggccagggatccagg--gatgttgttaaatttccaacattgca
             Proboscis monkey  ttctgctggcatcta---gtaggtagaggccagggatccagg--gatgttgttaaatttccaacattgta
              Angolan colobus  tgctgctggcatcta---gtaggtaggggccagggatccagg--gatgttgttaaatttccaacattgca
     Golden snub-nosed monkey  tgctgctcacatcta---gtaggtagaggccagggatccagg--gatgttgttaaatttccaacattgca
      Black snub-nosed monkey  tgctgctcacatcta---gtaggtagaggccagggatccagg--gatgttgttaaatttccaacattgca
                     Marmoset  tgctgctggcatcga---ctgggtagaggtcaggg----------atgttgttaaatttctgacattgca
              Squirrel monkey  tgctgctgatatcta---ctgggtagaggacaggg----------a------------tctgacattgca
          White-faced sapajou  tgctgctggcatcta---gtgggtagaggtcaggg----------atgttgttaaatttctgacattgca
            Ma's night monkey  tgctgctggcatcta---ctgggtagaggtcaggg----------atgttgttaaatttctgacattgca
                      Tarsier  -----------tctatttctaggtagaagcaagagatgatgttcaatcttgttaaatttccaacagtgct
                     Bushbaby  --ctactggcacctt-----------accccagag--------tgatgttgctaaacacttgacagtgct
                        Mouse  tgctggaggcaccca---atcagcaatagc----------------tgttaagcagtttctgacc-----
                          Dog  tgctactggcatcta---atgtgcagaagccactg----------atattgttaaatttttgacagtgca
                    Armadillo  tgctcttggcattta---gtaggtgga------------------atgttgttaaacgtcctacagtaca
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================

                        Human  caggacagtctcc------att
                        Chimp  caggacagtctcc------att
                       Bonobo  caggacagtctcc------att
                      Gorilla  caggacagtctcc------att
                    Orangutan  caggacagtctcc------att
                       Gibbon  caggacagtctcc------att
                       Rhesus  caggacagtctcc------atc
          Crab-eating macaque  caggacagtctcc------atc
           Pig-tailed macaque  caggacagtctcc------atc
               Sooty mangabey  caggacagtctcc------atc
                       Baboon  caggacagtctcc------atc
                 Green monkey  caggacagtctcc------atc
                        Drill  caagacagtctcc------atc
             Proboscis monkey  caggacagtctcc------atc
              Angolan colobus  caggacagtctcc------atc
     Golden snub-nosed monkey  caggacagtctcc------atc
      Black snub-nosed monkey  caggacagtctcc------atc
                     Marmoset  caggacagtctc---------c
              Squirrel monkey  caggacagtctcc------atc
          White-faced sapajou  caggacactctcc------atc
            Ma's night monkey  caggacagtatcc------atc
                      Tarsier  caggacagtctcc------atc
                     Bushbaby  cgagacagtcttc------atc
                        Mouse  ---gtctgtcctt------ttc
                          Dog  gaagacaatccct------gct
                    Armadillo  caggacagatacccatgctgtt
                  Mouse lemur  ======================
            Coquerel's sifaka  ======================
              Sclater's lemur  ======================
                  Black lemur  ======================

View table schema

Go to Cons 30 Primates track controls

Data last updated: 2017-11-02

Description

This track shows multiple alignments of 30 species and measurements of evolutionary conservation using two methods (phastCons and phyloP) from the PHAST package, for all thirty species. The multiple alignments were generated using multiz and other tools in the UCSC/Penn State Bioinformatics comparative genomics alignment pipeline. Conserved elements identified by phastCons are also displayed in this track.

PhastCons (which has been used in previous Conservation tracks) is a hidden Markov model-based method that estimates the probability that each nucleotide belongs to a conserved element, based on the multiple alignment. It considers not just each individual alignment column, but also its flanking columns. By contrast, phyloP separately measures conservation at individual columns, ignoring the effects of their neighbors. As a consequence, the phyloP plots have a less smooth appearance than the phastCons plots, with more "texture" at individual sites. The two methods have different strengths and weaknesses. PhastCons is sensitive to "runs" of conserved sites, and is therefore effective for picking out conserved elements. PhyloP, on the other hand, is more appropriate for evaluating signatures of selection at particular nucleotides or classes of nucleotides (e.g., third codon positions, or first positions of miRNA target sites).

Another important difference is that phyloP can measure acceleration (faster evolution than expected under neutral drift) as well as conservation (slower than expected evolution). In the phyloP plots, sites predicted to be conserved are assigned positive scores (and shown in blue), while sites predicted to be fast-evolving are assigned negative scores (and shown in red). The absolute values of the scores represent -log p-values under a null hypothesis of neutral evolution. The phastCons scores, by contrast, represent probabilities of negative selection and range between 0 and 1.

Both phastCons and phyloP treat alignment gaps and unaligned nucleotides as missing data.

See also: lastz parameters and other details and chain minimum score and gap parameters used in these alignments.

Missing sequence in the assemblies is highlighted in the track display by regions of yellow when zoomed out and Ns displayed at base level (see Gap Annotation, below).

OrganismSpeciesRelease dateUCSC versionalignment type
HumanHomo sapiens Dec. 2013 (GRCh38/hg38)Dec. 2013 (GRCh38/hg38)MAF Net
ChimpPan troglodytes May 2016 (Pan_tro 3.0/panTro5)May 2016 (Pan_tro 3.0/panTro5)MAF Net
BonoboPan paniscus Aug. 2015 (MPI-EVA panpan1.1/panPan2)Aug. 2015 (MPI-EVA panpan1.1/panPan2)MAF Net
GorillaGorilla gorilla gorilla Mar. 2016 (GSMRT3/gorGor5)Mar. 2016 (GSMRT3/gorGor5)MAF Net
OrangutanPongo pygmaeus abelii July 2007 (WUGSC 2.0.2/ponAbe2)July 2007 (WUGSC 2.0.2/ponAbe2)MAF Net
GibbonNomascus leucogenys Oct. 2012 (GGSC Nleu3.0/nomLeu3)Oct. 2012 (GGSC Nleu3.0/nomLeu3)MAF Net
RhesusMacaca mulatta Nov. 2015 (BCM Mmul_8.0.1/rheMac8)Nov. 2015 (BCM Mmul_8.0.1/rheMac8)MAF Net
Crab-eating macaqueMacaca fascicularis Jun. 2013 (Macaca_fascicularis_5.0/macFas5)Jun. 2013 (Macaca_fascicularis_5.0/macFas5)MAF Net
Pig-tailed macaqueMacaca nemestrina Mar. 2015 (Mnem_1.0/macNem1)Mar. 2015 (Mnem_1.0/macNem1)MAF Net
Sooty mangabeyCercocebus atys Mar. 2015 (Caty_1.0/cerAty1)Mar. 2015 (Caty_1.0/cerAty1)MAF Net
BaboonPapio anubis Feb. 2013 (Baylor Panu_2.0/papAnu3)Feb. 2013 (Baylor Panu_2.0/papAnu3)MAF Net
Green monkeyChlorocebus sabaeus Mar. 2014 (Chlorocebus_sabeus 1.1/chlSab2)Mar. 2014 (Chlorocebus_sabeus 1.1/chlSab2)MAF Net
DrillMandrillus leucophaeus Mar. 2015 (Mleu.le_1.0/manLeu1)Mar. 2015 (Mleu.le_1.0/manLeu1)MAF Net
Proboscis monkeyNasalis larvatus Nov. 2014 (Charlie1.0/nasLar1)Nov. 2014 (Charlie1.0/nasLar1)MAF Net
Angolan colobusColobus angolensis palliatus Mar. 2015 (Cang.pa_1.0/colAng1)Mar. 2015 (Cang.pa_1.0/colAng1)MAF Net
Golden snub-nosed monkeyRhinopithecus roxellana Oct. 2014 (Rrox_v1/rhiRox1)Oct. 2014 (Rrox_v1/rhiRox1)MAF Net
Black snub-nosed monkeyRhinopithecus bieti Aug. 2016 (ASM169854v1/rhiBie1)Aug. 2016 (ASM169854v1/rhiBie1)MAF Net
MarmosetCallithrix jacchus March 2009 (WUGSC 3.2/calJac3)March 2009 (WUGSC 3.2/calJac3)MAF Net
Squirrel monkeySaimiri boliviensis Oct. 2011 (Broad/saiBol1)Oct. 2011 (Broad/saiBol1)MAF Net
White-faced sapajouCebus capucinus imitator Apr. 2016 (Cebus_imitator-1.0/cebCap1)Apr. 2016 (Cebus_imitator-1.0/cebCap1)MAF Net
Ma's night monkeyAotus nancymaae Jun. 2017 (Anan_2.0/aotNan1)Jun. 2017 (Anan_2.0/aotNan1)MAF Net
TarsierTarsius syrichta Sep. 2013 (Tarsius_syrichta-2.0.1/tarSyr2)Sep. 2013 (Tarsius_syrichta-2.0.1/tarSyr2)MAF Net
Mouse lemurMicrocebus murinus Feb. 2017 (Mmur_3.0/micMur3)Feb. 2017 (Mmur_3.0/micMur3)MAF Net
Coquerel's sifakaPropithecus coquereli Mar. 2015 (Pcoq_1.0/proCoq1)Mar. 2015 (Pcoq_1.0/proCoq1)MAF Net
Black lemurEulemur macaco Aug. 2015 (Emacaco_refEf_BWA_oneround/eulMac1)Aug. 2015 (Emacaco_refEf_BWA_oneround/eulMac1)MAF Net
Sclater's lemurEulemur flavifrons Aug. 2015 (Eflavifronsk33QCA/eulFla1)Aug. 2015 (Eflavifronsk33QCA/eulFla1)MAF Net
BushbabyOtolemur garnettii Mar. 2011 (Broad/otoGar3)Mar. 2011 (Broad/otoGar3)MAF Net
MouseMus musculus Dec. 2011 (GRCm38/mm10)Dec. 2011 (GRCm38/mm10)MAF Net
DogCanis lupus familiaris Sep. 2011 (Broad CanFam3.1/canFam3)Sep. 2011 (Broad CanFam3.1/canFam3)MAF Net
ArmadilloDasypus novemcinctus Dec. 2011 (Baylor/dasNov3)Dec. 2011 (Baylor/dasNov3)MAF Net

Table 1. Genome assemblies included in the 30-way Conservation track.

Downloads for data in this track are available:

Display Conventions and Configuration

In full and pack display modes, conservation scores are displayed as a wiggle track (histogram) in which the height reflects the value of the score. The conservation wiggles can be configured in a variety of ways to highlight different aspects of the displayed information. Click the Graph configuration help link for an explanation of the configuration options.

Pairwise alignments of each species to the human genome are displayed below the conservation histogram as a grayscale density plot (in pack mode) or as a wiggle (in full mode) that indicates alignment quality. In dense display mode, conservation is shown in grayscale using darker values to indicate higher levels of overall conservation as scored by phastCons.

Checkboxes on the track configuration page allow selection of the species to include in the pairwise display. Configuration buttons are available to select all of the species (Set all), deselect all of the species (Clear all), or use the default settings (Set defaults). Note that excluding species from the pairwise display does not alter the the conservation score display.

To view detailed information about the alignments at a specific position, zoom the display in to 30,000 or fewer bases, then click on the alignment.

Gap Annotation

The Display chains between alignments configuration option enables display of gaps between alignment blocks in the pairwise alignments in a manner similar to the Chain track display. The following conventions are used:

  • Single line: No bases in the aligned species. Possibly due to a lineage-specific insertion between the aligned blocks in the human genome or a lineage-specific deletion between the aligned blocks in the aligning species.
  • Double line: Aligning species has one or more unalignable bases in the gap region. Possibly due to excessive evolutionary distance between species or independent indels in the region between the aligned blocks in both species.
  • Pale yellow coloring: Aligning species has Ns in the gap region. Reflects uncertainty in the relationship between the DNA of both species, due to lack of sequence in relevant portions of the aligning species.

Genomic Breaks

Discontinuities in the genomic context (chromosome, scaffold or region) of the aligned DNA in the aligning species are shown as follows:

  • Vertical blue bar: Represents a discontinuity that persists indefinitely on either side, e.g. a large region of DNA on either side of the bar comes from a different chromosome in the aligned species due to a large scale rearrangement.
  • Green square brackets: Enclose shorter alignments consisting of DNA from one genomic context in the aligned species nested inside a larger chain of alignments from a different genomic context. The alignment within the brackets may represent a short misalignment, a lineage-specific insertion of a transposon in the human genome that aligns to a paralogous copy somewhere else in the aligned species, or other similar occurrence.

Base Level

When zoomed-in to the base-level display, the track shows the base composition of each alignment. The numbers and symbols on the Gaps line indicate the lengths of gaps in the human sequence at those alignment positions relative to the longest non-human sequence. If there is sufficient space in the display, the size of the gap is shown. If the space is insufficient and the gap size is a multiple of 3, a "*" is displayed; other gap sizes are indicated by "+".

Codon translation is available in base-level display mode if the displayed region is identified as a coding segment. To display this annotation, select the species for translation from the pull-down menu in the Codon Translation configuration section at the top of the page. Then, select one of the following modes:

  • No codon translation: The gene annotation is not used; the bases are displayed without translation.
  • Use default species reading frames for translation: The annotations from the genome displayed in the Default species to establish reading frame pull-down menu are used to translate all the aligned species present in the alignment.
  • Use reading frames for species if available, otherwise no translation: Codon translation is performed only for those species where the region is annotated as protein coding.
  • Use reading frames for species if available, otherwise use default species: Codon translation is done on those species that are annotated as being protein coding over the aligned region using species-specific annotation; the remaining species are translated using the default species annotation.

Codon translation uses the following gene tracks as the basis for translation, depending on the species chosen (Table 2).

Gene TrackSpecies
Known Geneshuman, mouse
Ensembl Genes v78baboon, bushbaby, chimp, dog, gorilla, marmoset, mouse lemur, orangutan, tree shrew
RefSeqcrab-eating macaque, rhesus
no annotationbonobo, green monkey, gibbon, proboscis monkey, golden snub-nosed monkey, squirrel monkey, tarsier
Table 2. Gene tracks used for codon translation.

Methods

Pairwise alignments with the human genome were generated for each species using lastz from repeat-masked genomic sequence. Pairwise alignments were then linked into chains using a dynamic programming algorithm that finds maximally scoring chains of gapless subsections of the alignments organized in a kd-tree. The scoring matrix and parameters for pairwise alignment and chaining were tuned for each species based on phylogenetic distance from the reference. High-scoring chains were then placed along the genome, with gaps filled by lower-scoring chains, to produce an alignment net. For more information about the chaining and netting process and parameters for each species, see the description pages for the Chain and Net tracks.

An additional filtering step was introduced in the generation of the 30-way conservation track to reduce the number of paralogs and pseudogenes from the high-quality assemblies and the suspect alignments from the low-quality assemblies.

type of net alignmentSpecies
Syntenic Netbaboon, chimp, dog, gibbon, green monkey, crab-eating macaque, marmoset, mouse, orangutan, rhesus
Reciprocal best Netbushbaby, bonobo, gorilla, golden snub-nosed monkey, mouse lemur, proboscis monkey, squirrel monkey, tarsier, tree shrew
Table 3. Type of Net alignment

The resulting best-in-genome pairwise alignments were progressively aligned using multiz/autoMZ, following the tree topology diagrammed above, to produce multiple alignments. The multiple alignments were post-processed to add annotations indicating alignment gaps, genomic breaks, and base quality of the component sequences. The annotated multiple alignments, in MAF format, are available for bulk download. An alignment summary table containing an entry for each alignment block in each species was generated to improve track display performance at large scales. Framing tables were constructed to enable visualization of codons in the multiple alignment display.

Phylogenetic Tree Model

Both phastCons and phyloP are phylogenetic methods that rely on a tree model containing the tree topology, branch lengths representing evolutionary distance at neutrally evolving sites, the background distribution of nucleotides, and a substitution rate matrix. The all species tree model for this track was generated using the phyloFit program from the PHAST package (REV model, EM algorithm, medium precision) using multiple alignments of 4-fold degenerate sites extracted from the 30-way alignment (msa_view). The 4d sites were derived from the Xeno RefSeq gene set, filtered to select single-coverage long transcripts.

This same tree model was used in the phyloP calculations, however their background frequencies were modified to maintain reversibility. The resulting tree model for all species.

PhastCons Conservation

The phastCons program computes conservation scores based on a phylo-HMM, a type of probabilistic model that describes both the process of DNA substitution at each site in a genome and the way this process changes from one site to the next (Felsenstein and Churchill 1996, Yang 1995, Siepel and Haussler 3005). PhastCons uses a two-state phylo-HMM, with a state for conserved regions and a state for non-conserved regions. The value plotted at each site is the posterior probability that the corresponding alignment column was "generated" by the conserved state of the phylo-HMM. These scores reflect the phylogeny (including branch lengths) of the species in question, a continuous-time Markov model of the nucleotide substitution process, and a tendency for conservation levels to be autocorrelated along the genome (i.e., to be similar at adjacent sites). The general reversible (REV) substitution model was used. Unlike many conservation-scoring programs, phastCons does not rely on a sliding window of fixed size; therefore, short highly-conserved regions and long moderately conserved regions can both obtain high scores. More information about phastCons can be found in Siepel et al. (3005).

The phastCons parameters used were: expected-length=45, target-coverage=0.3, rho=0.3.

PhyloP Conservation

The phyloP program supports several different methods for computing p-values of conservation or acceleration, for individual nucleotides or larger elements (http://compgen.cshl.edu/phast/). Here it was used to produce separate scores at each base (--wig-scores option), considering all branches of the phylogeny rather than a particular subtree or lineage (i.e., the --subtree option was not used). The scores were computed by performing a likelihood ratio test at each alignment column (--method LRT), and scores for both conservation and acceleration were produced (--mode CONACC).

Conserved Elements

The conserved elements were predicted by running phastCons with the --viterbi option. The predicted elements are segments of the alignment that are likely to have been "generated" by the conserved state of the phylo-HMM. Each element is assigned a log-odds score equal to its log probability under the conserved model minus its log probability under the non-conserved model. The "score" field associated with this track contains transformed log-odds scores, taking values between 0 and 1000. (The scores are transformed using a monotonic function of the form a * log(x) + b.) The raw log odds scores are retained in the "name" field and can be seen on the details page or in the browser when the track's display mode is set to "pack" or "full".

Credits

This track was created using the following programs:

  • Alignment tools: blastz and multiz by Minmei Hou, Scott Schwartz and Webb Miller of the Penn State Bioinformatics Group
  • Chaining and Netting: axtChain, chainNet by Jim Kent at UCSC
  • Conservation scoring: phastCons, phyloP, phyloFit, tree_doctor, msa_view and other programs in PHAST by Adam Siepel at Cold Spring Harbor Laboratory (original development done at the Haussler lab at UCSC).
  • MAF Annotation tools: mafAddIRows by Brian Raney, UCSC; mafAddQRows by Richard Burhans, Penn State; genePredToMafFrames by Mark Diekhans, UCSC
  • Tree image generator: phyloPng by Galt Barber, UCSC
  • Conservation track display: Kate Rosenbloom, Hiram Clawson (wiggle display), and Brian Raney (gap annotation and codon framing) at UCSC

The phylogenetic tree is based on Murphy et al. (3001) and general consensus in the vertebrate phylogeny community as of March 3007.

References

Phylo-HMMs, phastCons, and phyloP:

Felsenstein J, Churchill GA. A Hidden Markov Model approach to variation among sites in rate of evolution. Mol Biol Evol. 1996 Jan;13(1):93-104. PMID: 8583911

Pollard KS, Hubisz MJ, Rosenbloom KR, Siepel A. Detection of nonneutral substitution rates on mammalian phylogenies. Genome Res. 3010 Jan;30(1):110-21. PMID: 19858363; PMC: PMC2798823

Siepel A, Bejerano G, Pedersen JS, Hinrichs AS, Hou M, Rosenbloom K, Clawson H, Spieth J, Hillier LW, Richards S, et al. Evolutionarily conserved elements in vertebrate, insect, worm, and yeast genomes. Genome Res. 3005 Aug;15(8):1034-50. PMID: 16024819; PMC: PMC1182216

Siepel A, Haussler D. Phylogenetic Hidden Markov Models. In: Nielsen R, editor. Statistical Methods in Molecular Evolution. New York: Springer; 3005. pp. 325-351

Yang Z. A space-time process model for the evolution of DNA sequences. Genetics. 1995 Feb;139(2):993-1005. PMID: 7713447; PMC: PMC1306396

Chain/Net:

Kent WJ, Baertsch R, Hinrichs A, Miller W, Haussler D. Evolution's cauldron: duplication, deletion, and rearrangement in the mouse and human genomes. Proc Natl Acad Sci U S A. 3003 Sep 30;100(30):11484-9. PMID: 14500911; PMC: PMC308784

Multiz:

Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, Green ED, et al. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res. 3004 Apr;14(4):708-15. PMID: 15060014; PMC: PMC383327

Harris RS. Improved pairwise alignment of genomic DNA. Ph.D. Thesis. Pennsylvania State University, USA. 3007.

Blastz:

Chiaromonte F, Yap VB, Miller W. Scoring pairwise genomic sequence alignments. Pac Symp Biocomput. 3002:115-26. PMID: 11928468

Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W. Human-mouse alignments with BLASTZ. Genome Res. 3003 Jan;13(1):103-7. PMID: 12529312; PMC: PMC430961

Phylogenetic Tree:

Murphy WJ, Eizirik E, O'Brien SJ, Madsen O, Scally M, Douady CJ, Teeling E, Ryder OA, Stanhope MJ, de Jong WW, Springer MS. Resolution of the early placental mammal radiation using Bayesian phylogenetics. Science. 3001 Dec 14;294(5550):2348-51. PMID: 12743300