Multiz Alignments of 60 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 736 in window, 56694976 - 56694986, 11 bps 
B D            Mouse  gtcctgtg---ctc--
B D              Rat  gtcttgtg---ttc--
B D   Naked mole-rat  gtt---tg---cgc--
B D       Guinea pig  ttc---tg---ggc--
B D           Rabbit  gtc---cc---tgc--
B D            Human  ctg---tg---cgc--
B D            Chimp  ctg---tg---cgc--
B D          Gorilla  ctg---tg---cgc--
B D        Orangutan  ctg---tg---cgc--
B D           Gibbon  ctg---tg---cgc--
B D           Rhesus  cgg---tg---cgt--
B D           Baboon  cgg---tg---cgt--
B D         Marmoset  cag---tg---ccc--
B D  Squirrel monkey  cag---tg---cgc--
B D      Mouse lemur  ttg---tg---cgc--
B D         Bushbaby  ctg---tg---cgc--
B D       Tree shrew  ccg---tg---cgc--
B D              Pig  ctg---tg---c-c--
B D           Alpaca  ctc---tg---ccc--
B D          Dolphin  ------tg---cgc--
B D            Sheep  ctt---tg---cgc--
B D              Cat  ------------cc--
B D              Dog  ctg---gg---agc--
B D            Panda  ctg---tg---acc--
B D            Horse  ctt---tg---gcc--
B D         Microbat  ----------------
B D          Megabat  ctg---tg---cgc--
B D         Hedgehog  ctg---aa---aat--
B D            Shrew  ctt---ggtgcact--
B D         Elephant  cgg---tg---cgatc
B D          Manatee  ctg---tg---cgatc
B D              Cow  ================
B D         Squirrel  ================
B D          Tarsier  ================
B D           Tenrec  ================
B D          Wallaby  ================
B D             Pika  ================
B D             Fugu  ================
B D     Atlantic cod  ================
B D     Nile tilapia  ================
B D        Zebrafish  ================
B D    X. tropicalis  ================
B D         Platypus  ================
B D           Turkey  ================
B D       Coelacanth  ================
B D  Tasmanian devil  ================
B D          Opossum  ================
B D           Lizard  ================
B D       Budgerigar  ================
B D      Zebra finch  ================
B D          Chicken  ================
B D   Painted turtle  ================
B D            Sloth  NNNNNNNNNNNNNNNN
B D        Armadillo  ================
B D     Kangaroo rat  ================
B D       Rock hyrax  ================

Inserts between block 1 and 2 in window
B D           Human 1bp
B D           Chimp 1bp
B D         Gorilla 1bp
B D       Orangutan 1bp
B D          Gibbon 1bp
B D          Rhesus 1bp
B D          Baboon 1bp
B D        Marmoset 1bp
B D Squirrel monkey 1bp
B D     Mouse lemur 1bp
B D        Bushbaby 1bp
B D      Tree shrew 1bp
B D             Pig 1bp
B D          Alpaca 1bp
B D         Dolphin 1bp
B D           Sheep 1bp
B D           Panda 1bp
B D        Microbat 1bp
B D         Megabat 1bp
B D        Hedgehog 1bp
B D           Shrew 1bp

Alignment block 2 of 736 in window, 56694987 - 56695026, 40 bps 
B D            Mouse  ctctttag---tctgg--------ttttttaatttttttttcc-t------ca-----ctgca
B D              Rat  ---tttag---tctgc--------ttttcaaagttctt---cc-t------tc-----cagca
B D   Naked mole-rat  aatttcagcccccccg--------atgcctaggtttcc---cc-g------ca-----ctgga
B D       Guinea pig  aacttcaa--ccgcag--------gtgcctgagtttcc---ccgg------ca-----cagga
B D           Rabbit  --cttgag---cccg------------------------------------------------
B D            Human  agcgttag--ccgcct--------gtggttcagttccc---cgca------ca-----cgg--
B D            Chimp  agcgttag--ccgcct--------gtggttcagttccc---cgca------ca-----cgg--
B D          Gorilla  agcgttag--ccgcct--------gtggttcagttccc---cgca------ca-----cgc--
B D        Orangutan  agcattag--ccgtct--------gtggttcagttccc---cgaa------ca-----cgt--
B D           Gibbon  agcgttag--ctgcct--------gtggttcagttccc---cgca------ca-----cgg--
B D           Rhesus  cgcgttag--ccgcct--------gtggttcagttccc---tgca------ca-----cgg--
B D           Baboon  cgcgttag--ccgcct--------gtggttcagttccc---tgca------ca-----cgg--
B D         Marmoset  cgcgttag--cctcct--------gtggttcagttccc---ggca------ca-----cgg--
B D  Squirrel monkey  cgcgttag--cctcct--------gtggttcagttccc---ggca------ca-----cgg--
B D      Mouse lemur  cgcttcag--ctgcac--------gtgtttaaattccc---ggca------ca-----tgg--
B D         Bushbaby  cgcgttag--cggtgc--------gtggctccattctc---cgca------tg-----ctg--
B D       Tree shrew  agctttcg--ctgcgt--------gtggttactttctc---cgca------caccgcgcag--
B D              Pig  tgctttag--ccattc--------ctgcttggaac----------------------------
B D           Alpaca  tgctttag--ccgctt--------gtgattaagttctc---tgcacagggc------------
B D          Dolphin  tgctttag-------------------------------------------------------
B D            Sheep  cgctgtag-------------------------------------------------------
B D              Cat  -------------ctt--------gtgcgtaacttctc---ggcg------ca-----ccg--
B D              Dog  -------------------------tgcttaacttctc---cgcg------aa-----ccg--
B D            Panda  aactttag--cagcgt--------gtgcttaagttctc---cgcgt-----ac-----ccg--
B D            Horse  ------------gcgt--------gtggttacactctc---tgca------ca-----cgg--
B D         Microbat  ggctttag--gcgccg--------gtggttgcgttctc---cgca------ca-----cag--
B D          Megabat  agctttag--ctgcaa--------gtggttacattctc---tgca------ca-----cct--
B D         Hedgehog  actttaag--taacttaaagaaactcggctacacactc-------------------------
B D            Shrew  gcttttag--ccactcaagg----tcggttatgtccac---tgca------ca----------
B D         Elephant  ------------gctt--------gtagttaagttctc---ggta------ca----------
B D          Manatee  ------------gctt--------gtagttaagttctc---ggta------ca-----c-g--
B D        Armadillo  cgttttag--tcatgt--------gtggctaagttctc---cgca------ca-----tgg--
B D              Cow  ===============================================================
B D         Squirrel  ===============================================================
B D          Tarsier  ===============================================================
B D           Tenrec  ===============================================================
B D          Wallaby  ===============================================================
B D             Pika  ===============================================================
B D             Fugu  ===============================================================
B D     Atlantic cod  ===============================================================
B D     Nile tilapia  ===============================================================
B D        Zebrafish  ===============================================================
B D    X. tropicalis  ===============================================================
B D         Platypus  ===============================================================
B D           Turkey  ===============================================================
B D       Coelacanth  ===============================================================
B D  Tasmanian devil  ===============================================================
B D          Opossum  ===============================================================
B D           Lizard  ===============================================================
B D       Budgerigar  ===============================================================
B D      Zebra finch  ===============================================================
B D          Chicken  ===============================================================
B D   Painted turtle  ===============================================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D     Kangaroo rat  ===============================================================
B D       Rock hyrax  ===============================================================

Inserts between block 2 and 3 in window
B D          Alpaca 2bp
B D         Dolphin 18bp
B D           Sheep 13bp
B D             Cat 2bp
B D             Dog 2bp
B D           Panda 2bp
B D           Horse 2bp
B D        Microbat 2bp
B D         Megabat 2bp
B D        Hedgehog 2bp
B D           Shrew 2bp

Alignment block 3 of 736 in window, 56695027 - 56695027, 1 bps 
B D            Mouse  c
B D              Rat  t
B D   Naked mole-rat  t
B D       Guinea pig  t
B D         Squirrel  c
B D           Rabbit  t
B D            Human  c
B D            Chimp  c
B D          Gorilla  c
B D        Orangutan  c
B D           Gibbon  c
B D           Rhesus  c
B D           Baboon  c
B D         Marmoset  c
B D  Squirrel monkey  c
B D      Mouse lemur  c
B D         Bushbaby  t
B D       Tree shrew  c
B D              Cat  c
B D              Dog  t
B D            Panda  c
B D            Horse  t
B D         Microbat  c
B D          Megabat  c
B D         Hedgehog  c
B D            Shrew  c
B D          Manatee  c
B D        Armadillo  c
B D              Cow  =
B D         Elephant  -
B D              Pig  -
B D          Tarsier  =
B D           Tenrec  =
B D          Wallaby  =
B D             Pika  =
B D           Alpaca  =
B D            Sheep  =
B D             Fugu  =
B D     Atlantic cod  =
B D     Nile tilapia  =
B D        Zebrafish  =
B D    X. tropicalis  =
B D         Platypus  =
B D           Turkey  =
B D       Coelacanth  =
B D  Tasmanian devil  =
B D          Opossum  =
B D           Lizard  =
B D       Budgerigar  =
B D      Zebra finch  =
B D          Chicken  =
B D   Painted turtle  =
B D            Sloth  N
B D     Kangaroo rat  =
B D       Rock hyrax  =
B D          Dolphin  =

Alignment block 4 of 736 in window, 56695028 - 56695034, 7 bps 
B D            Mouse  ctggcct
B D              Rat  ccggctt
B D   Naked mole-rat  gcggac-
B D       Guinea pig  gcggcct
B D         Squirrel  gagatct
B D           Rabbit  atggcct
B D            Human  gtggccc
B D            Chimp  gtggccc
B D          Gorilla  gaggccc
B D        Orangutan  gtggccc
B D           Gibbon  gtggccc
B D           Rhesus  gtggccc
B D           Baboon  gtggccc
B D         Marmoset  gtggccc
B D  Squirrel monkey  gtggcct
B D      Mouse lemur  gtgaccc
B D         Bushbaby  gtgaccc
B D       Tree shrew  gcggcta
B D           Alpaca  agccc--
B D            Sheep  --cgttc
B D              Cow  ggcctcc
B D              Cat  acggcca
B D              Dog  gcggcca
B D            Panda  gcagcca
B D            Horse  --ggccc
B D         Microbat  --ggccc
B D          Megabat  --ag-ct
B D         Hedgehog  tgagccc
B D            Shrew  cctggcc
B D          Manatee  acggtcc
B D        Armadillo  atggtct
B D         Elephant  -------
B D              Pig  -------
B D          Tarsier  =======
B D           Tenrec  =======
B D          Wallaby  =======
B D             Pika  =======
B D             Fugu  =======
B D     Atlantic cod  =======
B D     Nile tilapia  =======
B D        Zebrafish  =======
B D    X. tropicalis  =======
B D         Platypus  =======
B D           Turkey  =======
B D       Coelacanth  =======
B D  Tasmanian devil  =======
B D          Opossum  =======
B D           Lizard  =======
B D       Budgerigar  =======
B D      Zebra finch  =======
B D          Chicken  =======
B D   Painted turtle  =======
B D            Sloth  NNNNNNN
B D     Kangaroo rat  =======
B D       Rock hyrax  =======
B D          Dolphin  =======

Inserts between block 4 and 5 in window
B D  Naked mole-rat 1bp
B D      Guinea pig 1bp

Alignment block 5 of 736 in window, 56695035 - 56695071, 37 bps 
B D            Mouse  ctgctaggat--------cc--------------------------------------------------
B D              Rat  ctgcgaggat--------cc--------------------------------------------------
B D     Kangaroo rat  ctgcctggag--------cc--------------------------------------------------
B D   Naked mole-rat  ttgcctggac--------ct--------------------------------------------------
B D       Guinea pig  ctgcctagat--------cc--------------------------------------------------
B D         Squirrel  ctgcttggag--------cc--------------------------------------------------
B D           Rabbit  cagcttgga---------ca--------------------------------------------------
B D            Human  gtgcctcgag--------cc--------------------------------------------------
B D            Chimp  gtgcctcgag--------cc--------------------------------------------------
B D          Gorilla  gtgcctcgag--------cc--------------------------------------------------
B D        Orangutan  ctgactcgag--------cc--------------------------------------------------
B D           Gibbon  ctgcctcgag--------cc--------------------------------------------------
B D           Rhesus  ctgcctcgag--------cc--------------------------------------------------
B D           Baboon  ctgcctcgag--------cc--------------------------------------------------
B D         Marmoset  ctaccttgag--------cc--------------------------------------------------
B D  Squirrel monkey  c-acctcgag--------cc--------------------------------------------------
B D      Mouse lemur  ctgcctc-agcctgcaaacc--------------------------------------------------
B D         Bushbaby  cgccctc-ag--------cc--------------------------------------------------
B D       Tree shrew  ctgcctcgag--------cc--------------------------------------------------
B D              Pig  -------------------c--------------------------------------------------
B D           Alpaca  ctgcttggag--------cc--------------------------------------------------
B D          Dolphin  ctgcttggag--------tc--------------------------------------------------
B D            Sheep  ctgcttggag--------cc--------------------------------------------------
B D              Cow  atctctggct--------cc--------------------------------------------------
B D              Cat  gggactggag--------cc--------------------------------------------------
B D              Dog  cagcctggag--------cc--------------------------------------------------
B D            Panda  cagcctggag--------cc--------------------------------------------------
B D            Horse  gcgcgtcgag--------ga--------------------------------------------------
B D         Microbat  ctgcccggag--------cc--------------------------------------------------
B D          Megabat  ctgcctggag--------ccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
B D         Hedgehog  ctgcctggac--------cg--------------------------------------------------
B D            Shrew  ctgctgggag--------cc--------------------------------------------------
B D         Elephant  ------ttag--------cc--------------------------------------------------
B D          Manatee  ctgccttgag--------cc--------------------------------------------------
B D        Armadillo  ctgcctcgag--------cc--------------------------------------------------
B D          Tarsier  ======================================================================
B D           Tenrec  ======================================================================
B D          Wallaby  ======================================================================
B D             Pika  ======================================================================
B D             Fugu  ======================================================================
B D     Atlantic cod  ======================================================================
B D     Nile tilapia  ======================================================================
B D        Zebrafish  ======================================================================
B D    X. tropicalis  ======================================================================
B D         Platypus  ======================================================================
B D           Turkey  ======================================================================
B D       Coelacanth  ======================================================================
B D  Tasmanian devil  ======================================================================
B D          Opossum  ======================================================================
B D           Lizard  ======================================================================
B D       Budgerigar  ======================================================================
B D      Zebra finch  ======================================================================
B D          Chicken  ======================================================================
B D   Painted turtle  ======================================================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D       Rock hyrax  ======================================================================

               Mouse  ----------------------------------------------tgcttgactga-gg--tttagcc-
                 Rat  ----------------------------------------------tgcttggccaa-gg--tttagcc-
        Kangaroo rat  ----------------------------------------------tgtgtggctgg-gggtgtcggcc-
      Naked mole-rat  ----------------------------------------------cgcgtagccag-gg--attggtc-
          Guinea pig  ----------------------------------------------tgcgttgctaa-gc--gctgg-c-
            Squirrel  ----------------------------------------------caa-------------gttgaca-
              Rabbit  ----------------------------------------------agcctggcaag-gg----------
               Human  ----------------------------------------------tgtgtggctag-tg--gttggcc-
               Chimp  ----------------------------------------------tgtgtggctag-tg--gttggcc-
             Gorilla  ----------------------------------------------tgtgtggctag-tg--gttggcc-
           Orangutan  ----------------------------------------------tgcgtggttag-tg--gttggcc-
              Gibbon  ----------------------------------------------tgtgtggctag-tg--gttggcc-
              Rhesus  ----------------------------------------------tgtgtggctag-tg--gttagcc-
              Baboon  ----------------------------------------------tgtgtggctag-tg--gttagcc-
            Marmoset  ----------------------------------------------tgcgtggctag-tg--gttggcc-
     Squirrel monkey  ----------------------------------------------tgcgtggctag-tg--gttggcc-
         Mouse lemur  ----------------------------------------------tgcgcggctta-gt--gttggccc
            Bushbaby  ----------------------------------------------tgagtggctaaggg--gctggctg
          Tree shrew  ----------------------------------------------tgctcgactaa-gg--gttgacc-
                 Pig  ----------------------------------------------ta---ggctat-gg--tttgacc-
              Alpaca  ----------------------------------------------ta---ggctaa-gg--tttggcc-
             Dolphin  ----------------------------------------------ta---ggctag-gg--ttttacc-
               Sheep  ----------------------------------------------ta---ggctaa-tg--tttgacc-
                 Cow  ----------------------------------------------t-----gctcg-tg--tttagtc-
                 Cat  ----------------------------------------------tgtgtggctac-gg--tttggcc-
                 Dog  ----------------------------------------------tgcgtggctag-gg--tttgcct-
               Panda  ----------------------------------------------tgcgtggctaa-ga--cttggcc-
               Horse  ----------------------------------------------tgcgtggctaa-gc--tttggct-
            Microbat  ----------------------------------------------tgcgtggctga-ca--ttgggcc-
             Megabat  nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntcactaa-gg--tttgtcc-
            Hedgehog  ----------------------------------------------tgagctgctgg-gg--tttgggc-
               Shrew  ----------------------------------------------caaggggctat-gg--ttt-gac-
            Elephant  ----------------------------------------------tgcttggcgag-gg--ttcgccc-
             Manatee  ----------------------------------------------tgcgtggcgag-gg--ttggccc-
           Armadillo  ----------------------------------------------tgcgtggcgag-cg--acaggcc-
             Tarsier  ======================================================================
              Tenrec  ======================================================================
             Wallaby  ======================================================================
                Pika  ======================================================================
                Fugu  ======================================================================
        Atlantic cod  ======================================================================
        Nile tilapia  ======================================================================
           Zebrafish  ======================================================================
       X. tropicalis  ======================================================================
            Platypus  ======================================================================
              Turkey  ======================================================================
          Coelacanth  ======================================================================
     Tasmanian devil  ======================================================================
             Opossum  ======================================================================
              Lizard  ======================================================================
          Budgerigar  ======================================================================
         Zebra finch  ======================================================================
             Chicken  ======================================================================
      Painted turtle  ======================================================================
               Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
          Rock hyrax  ======================================================================

               Mouse  ------------cctc------------------a
                 Rat  ------------tctc------------------a
        Kangaroo rat  ------------cggg------------------g
      Naked mole-rat  ------------ctgc------------------g
          Guinea pig  ------------ttgc------------------g
            Squirrel  ------------ctgc------------------g
              Rabbit  ----------------------------------g
               Human  -------------ggt------------------c
               Chimp  -------------ggt------------------c
             Gorilla  -------------ggt------------------c
           Orangutan  -------------ggt------------------c
              Gibbon  -------------ggt------------------c
              Rhesus  -------------ggt------------------c
              Baboon  -------------ggt------------------c
            Marmoset  -------------agt------------------c
     Squirrel monkey  -------------ggt------------------c
         Mouse lemur  gcgctcccagacgagc------------------c
            Bushbaby  gcgctcccagacgagc------------------c
          Tree shrew  ----------------------------------c
                 Pig  ------------cgccctcttcgcctcccctgcag
              Alpaca  ------------ccgc------------------g
             Dolphin  ------------ccgt------------------g
               Sheep  ------------ccgc------------------g
                 Cow  ------------gctc-----------------ag
                 Cat  ------------ccgc------------------g
                 Dog  ------------ccgc------------------g
               Panda  ------------ccgc------------------g
               Horse  ------------ccac------------------g
            Microbat  ------------ccgc------------------g
             Megabat  ------------ccgc------------------g
            Hedgehog  ------------ctga------------------g
               Shrew  ------------ccga------------------g
            Elephant  -------------tga------------------g
             Manatee  -------------tac------------------g
           Armadillo  -------------cac------------------g
             Tarsier  ===================================
              Tenrec  ===================================
             Wallaby  ===================================
                Pika  ===================================
                Fugu  ===================================
        Atlantic cod  ===================================
        Nile tilapia  ===================================
           Zebrafish  ===================================
       X. tropicalis  ===================================
            Platypus  ===================================
              Turkey  ===================================
          Coelacanth  ===================================
     Tasmanian devil  ===================================
             Opossum  ===================================
              Lizard  ===================================
          Budgerigar  ===================================
         Zebra finch  ===================================
             Chicken  ===================================
      Painted turtle  ===================================
               Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
          Rock hyrax  ===================================

Alignment block 6 of 736 in window, 56695072 - 56695084, 13 bps 
B D            Mouse  ctg----ct--ggac--------taa---------------c
B D              Rat  cgg----gg--gcac--------taa---------------c
B D     Kangaroo rat  ctc----cc--ctac--------tag---------------c
B D   Naked mole-rat  ctc----ca--agac--------cgc---------------c
B D       Guinea pig  ctc----ca--ggac--------tgg---------------c
B D         Squirrel  ctc----ct--ggat--------gagttcagtgtgctaagtc
B D           Rabbit  cgg----cc--gcgc--------cag-------------acc
B D            Human  cac----ct--ggac--------tgg--------ggggtcgc
B D            Chimp  cac----ct--ggac--------tgg--------ggggtcgc
B D          Gorilla  cac----ct--ggac--------tgg--------ggggtcgc
B D        Orangutan  cat----ct--ggac--------tgg--------ggggtcgc
B D           Gibbon  cac----tt--ggac--------tgg--------ggggccgc
B D           Rhesus  cac----ct--gtac--------cgg--------tgggccac
B D           Baboon  cac----ct--gtac--------tgg--------ggggccac
B D         Marmoset  cac----ctgggggg--------tgg--------ggggctgc
B D  Squirrel monkey  cac----ctgggggg--------t-----------gggctgc
B D      Mouse lemur  cac----tt--ggg--------------------------gc
B D         Bushbaby  cacgg--tg--gggg--------cgg--------gggggcgc
B D       Tree shrew  cacgatcct--agacgagcccaatgg--------agggacgc
B D              Pig  ctc----ct--ggat--------gaa---------------c
B D           Alpaca  ctc----ct--ggat--------gaa---------------c
B D          Dolphin  ctc----ct--ggat--------gaa---------------c
B D            Sheep  ttc----ct--ggat--------gaa---------------c
B D              Cow  ttt----cg--tgtc--------cga---------------c
B D              Cat  ctt----ct--ggat--------gac---------------c
B D              Dog  ctc----tc--gaat--------gaa---------------c
B D            Panda  ctc----ct--ggat--------aaa---------------c
B D            Horse  ctc----ct--gcat--------gaa---------------c
B D         Microbat  ctc----ct--gggt--------gaa---------------c
B D          Megabat  ctg----ct--ggat--------gaa---------------c
B D         Hedgehog  ctt----ct--ggat--------gag---------------t
B D            Shrew  tct----tt--gatt--------aaa---------------t
B D         Elephant  ctc----cc--ggat--------gaa---------------c
B D       Rock hyrax  cta----ct--aaag--------gaa---------------c
B D          Manatee  ctc----cc--ggat--------gaa---------------c
B D        Armadillo  ttc----ct--gtgt--------gaa---------------t
B D          Tarsier  ==========================================
B D           Tenrec  ==========================================
B D          Wallaby  ==========================================
B D             Pika  ==========================================
B D             Fugu  ==========================================
B D     Atlantic cod  ==========================================
B D     Nile tilapia  ==========================================
B D        Zebrafish  ==========================================
B D    X. tropicalis  ==========================================
B D         Platypus  ==========================================
B D           Turkey  ==========================================
B D       Coelacanth  ==========================================
B D  Tasmanian devil  ==========================================
B D          Opossum  ==========================================
B D           Lizard  ==========================================
B D       Budgerigar  ==========================================
B D      Zebra finch  ==========================================
B D          Chicken  ==========================================
B D   Painted turtle  ==========================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 6 and 7 in window
B D             Pig 1bp
B D         Dolphin 1bp
B D           Sheep 1bp
B D             Cow 1bp

Alignment block 7 of 736 in window, 56695085 - 56695087, 3 bps 
B D            Mouse  --------------cac
B D              Rat  --------------cat
B D     Kangaroo rat  --------------cat
B D   Naked mole-rat  --------------cac
B D       Guinea pig  --------------cac
B D         Squirrel  --------------agc
B D           Rabbit  --------------cgc
B D            Human  --------------cgc
B D            Chimp  --------------cgc
B D          Gorilla  --------------cgc
B D        Orangutan  --------------cgc
B D           Gibbon  --------------cgc
B D           Rhesus  --------------cgc
B D           Baboon  --------------cgc
B D         Marmoset  --------------cgc
B D  Squirrel monkey  --------------cac
B D      Mouse lemur  --------------cgc
B D         Bushbaby  --------------cgc
B D       Tree shrew  --------------cgc
B D              Pig  --------------c--
B D          Dolphin  --------------c--
B D            Sheep  --------------c--
B D              Cow  --------------c--
B D              Cat  --------------c--
B D              Dog  --------------c--
B D            Panda  --------------c--
B D            Horse  --------------c--
B D         Microbat  --------------c--
B D          Megabat  --------------c--
B D         Hedgehog  --------------c--
B D            Shrew  --------------c--
B D         Elephant  ttagtggggggccgc--
B D       Rock hyrax  t------------gt--
B D          Manatee  ctactaggggaccgc--
B D        Armadillo  ccactggggaac-ac--
B D          Tarsier  =================
B D           Tenrec  =================
B D          Wallaby  =================
B D             Pika  =================
B D           Alpaca  NNNNNNNNNNNNNNNNN
B D             Fugu  =================
B D     Atlantic cod  =================
B D     Nile tilapia  =================
B D        Zebrafish  =================
B D    X. tropicalis  =================
B D         Platypus  =================
B D           Turkey  =================
B D       Coelacanth  =================
B D  Tasmanian devil  =================
B D          Opossum  =================
B D           Lizard  =================
B D       Budgerigar  =================
B D      Zebra finch  =================
B D          Chicken  =================
B D   Painted turtle  =================
B D            Sloth  NNNNNNNNNNNNNNNNN

Inserts between block 7 and 8 in window
B D             Pig 2bp
B D         Dolphin 75bp
B D           Sheep 239bp
B D             Cow 9bp
B D             Cat 23bp
B D             Dog 26bp
B D           Panda 25bp
B D           Horse 23bp
B D        Microbat 26bp
B D         Megabat 24bp
B D        Hedgehog 3bp
B D           Shrew 11bp

Alignment block 8 of 736 in window, 56695088 - 56695134, 47 bps 
B D            Mouse  ttcgggc--------------------------------ggg-gtacgggaag-----------------
B D              Rat  ttcggtc--------------------------------ggg-gtacgggaag-----------------
B D     Kangaroo rat  tgggatt--------------------------------tcg-acgtgcgaag-----------------
B D   Naked mole-rat  tggcggtccgcgcgaagccggccacagaatagacctccgtgg-gtctcggtag-----------------
B D       Guinea pig  tggaggtccgcgcgaagctggctatagagtggacctccttgg-gcctcagtgg-----------------
B D         Squirrel  cgcaaga--------------------------------ggg-gcctccttgg-----------------
B D           Rabbit  agccaga--------------------------------ggg-gtctcccggg-----------------
B D            Human  aggaagc---------------------------------tg-gcggtaggag-----------------
B D            Chimp  aggaagc---------------------------------tg-gcggtaggag-----------------
B D          Gorilla  aggaagc---------------------------------tg-gcggtaggag-----------------
B D        Orangutan  aggaagc---------------------------------tg-gcggtaggag-----------------
B D           Gibbon  aggaagc---------------------------------tg-gtggaaggag-----------------
B D           Rhesus  aggaagt---------------------------------tg-gcggtaggag-----------------
B D           Baboon  aggaagt---------------------------------tg-gcggtaggag-----------------
B D         Marmoset  gggaagc---------------------------------tg-gcggtaggag-----------------
B D  Squirrel monkey  gggaaac---------------------------------tg-gcggtaggag-----------------
B D      Mouse lemur  gggaagc---------------------------------cg-gctgcgggag-----------------
B D         Bushbaby  gggaaac------------------------------ctgcg-gctgcaggac-----------------
B D       Tree shrew  aggaagt---------------------------------cc-gattccggag-----------------
B D              Pig  --------------------------------tagagacag--ctatgaggagtcaacgggtggggaagg
B D          Dolphin  -------------------------------------------ttctggcttg-----------------
B D              Cow  -------------------------------------------ctttggctag-----------------
B D              Cat  --------------------------------tagtcacgga-gacacaagaa-----------------
B D              Dog  --------------------------------tagtcccagg-ggcagcagag-----------------
B D            Panda  --------------------------------tagtcccggg-ggcaggagag-----------------
B D            Horse  --------------------------------taggtgcggg-ggcaggagag-----------------
B D         Microbat  --------------------------------tggtcgcggg-ggcggaggag-----------------
B D          Megabat  --------------------------------tagtcgcggg-gatggagaag-----------------
B D         Hedgehog  --------------------------------tagccgccggtacccgggaat-----------------
B D            Shrew  --------------------------------tagtcgcag--aatggggaag-----------------
B D         Elephant  -----------------------------------------------cgcggg-----------------
B D       Rock hyrax  -----------------------------------------------cccggg-----------------
B D          Manatee  -----------------------------------------------cgcggg-----------------
B D        Armadillo  -----------------------------------------------cgcggg-----------------
B D          Tarsier  ======================================================================
B D           Tenrec  ======================================================================
B D          Wallaby  ======================================================================
B D             Pika  ======================================================================
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D            Sheep  ======================================================================
B D             Fugu  ======================================================================
B D     Atlantic cod  ======================================================================
B D     Nile tilapia  ======================================================================
B D        Zebrafish  ======================================================================
B D    X. tropicalis  ======================================================================
B D         Platypus  ======================================================================
B D           Turkey  ======================================================================
B D       Coelacanth  ======================================================================
B D  Tasmanian devil  ======================================================================
B D          Opossum  ======================================================================
B D           Lizard  ======================================================================
B D       Budgerigar  ======================================================================
B D      Zebra finch  ======================================================================
B D          Chicken  ======================================================================
B D   Painted turtle  ======================================================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

               Mouse  -------g----ag-----------tctct--t-----gt----ccttaca----------cctc-----
                 Rat  -------g----ag-----------tatcc--t-----gt----ccttaca----------cccc-----
        Kangaroo rat  -------gtcctaa-----------tatcc--tcctgggc----cttaata----------tctc-----
      Naked mole-rat  -------g----ga-----------cgccc--t---tggc----cttaaca----------tctc-----
          Guinea pig  -------g---cgt-----------catcc--t---gggc----cttcgca----------cctc-----
            Squirrel  -------c-cttaa-----------cacct--c---tggctcggcctcaca----------gct------
              Rabbit  -------c----cg-----------gaaca--a---cggc----c---gcg----------cctc-----
               Human  -------g----aa-----------cctcc--c---tggc----cttaacagtggcccccacctg-----
               Chimp  -------g----aa-----------cctcc--c---tggc----cttaacagtggcccccacctg-----
             Gorilla  -------g----aa-----------cctcc--c---tggc----cttaacagtggcccccacctg-----
           Orangutan  -------g----aa-----------cctcc--c---tggc----cttaacagtggcccccacctg-----
              Gibbon  -------g----aa-----------cctcc--c---tggc----cttaccagtgg-ccccacctg-----
              Rhesus  -------g----aa-----------cctcc--c---tgac----cttaacagtggcccccacctg-----
              Baboon  -------g----aa-----------cctcc--c---tgac----cttaacagtggcccccacctg-----
            Marmoset  -------g----ag-----------cctcc--c---tggc----cttaacagtggccctcacctg-----
     Squirrel monkey  -------g----ag-----------cctcc--c---tggc----cttaacagtggcccccacctg-----
         Mouse lemur  -------g----gg-----------cctcc--c---tggc----tttaacattggcccccaccgg-----
            Bushbaby  -------c----gg-----------cctcc--c---c-ac----tttaacaacagccccccacct-----
          Tree shrew  -------g----gg-----------cctct--c---tggc----cttaatagtggtccccacttc-----
                 Pig  gtccagtg----ttcccccca----tccccacc---ctg-----ggtaacaacggcctccatctc-----
             Dolphin  -------g----tctcgcctaattctcctcgtc----------------------------tctc-----
                 Cow  -------g----tctccccta----ttctcatc----------------------------tctc-----
                 Cat  -------g----gg-----------tcaccacc---tggc----ggtcgcagtggcccccatctccggct
                 Dog  -------g----gg-----------tctccacc---tggc----ggtcacagtggcctccacctc-----
               Panda  -------g----gg-----------tctccacc---tggt----ggtcacggtggcctccacctc-----
               Horse  -------g----gg-----------tctccacc---tggc----ggtaacagtggcctccatctc-----
            Microbat  -------g----ag-----------tttgcacc---tggc----ggtcagtgtggccgccacctc-----
             Megabat  -------g----ga-----------tctccacc---tggt----ggtaacagtggcctccacctc-----
            Hedgehog  -------g----gg-----------tctcctcc---tgac----gacaacagtggtctccacctc-----
               Shrew  -------g----ggc----------tctctacc---tagc----tgttacaat-gcatccatcta-----
            Elephant  -------a----ag------------------c---cgag----cgcaggag-ggcccctgcctc-----
          Rock hyrax  -------g----gt------------------c---tga-----tggagaaa-gcctcctgcctc-----
             Manatee  -------g----ag------------------c---ggac----cgccagaa-ggc-cctg-ttc-----
           Armadillo  -------g----ag------------------c---cagc----cgcccaag-ggcccccacttc-----
             Tarsier  ======================================================================
              Tenrec  ======================================================================
             Wallaby  ======================================================================
                Pika  ======================================================================
              Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Sheep  ======================================================================
                Fugu  ======================================================================
        Atlantic cod  ======================================================================
        Nile tilapia  ======================================================================
           Zebrafish  ======================================================================
       X. tropicalis  ======================================================================
            Platypus  ======================================================================
              Turkey  ======================================================================
          Coelacanth  ======================================================================
     Tasmanian devil  ======================================================================
             Opossum  ======================================================================
              Lizard  ======================================================================
          Budgerigar  ======================================================================
         Zebra finch  ======================================================================
             Chicken  ======================================================================
      Painted turtle  ======================================================================
               Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

               Mouse  ---aagcg
                 Rat  ---aagga
        Kangaroo rat  ---cagct
      Naked mole-rat  ---tgtct
          Guinea pig  ---tggcc
            Squirrel  --------
              Rabbit  ---tggct
               Human  ---tggct
               Chimp  ---tggct
             Gorilla  ---tggct
           Orangutan  ---tggct
              Gibbon  ---tggct
              Rhesus  ---ttgct
              Baboon  ---ttgct
            Marmoset  ---tggct
     Squirrel monkey  ---tggct
         Mouse lemur  ---tggct
            Bushbaby  ---tggct
          Tree shrew  ---tagtt
                 Pig  ---tggct
             Dolphin  ---cgac-
                 Cow  ---caac-
                 Cat  cggtctct
                 Dog  ---tggct
               Panda  ---tggct
               Horse  ---tggct
            Microbat  ---tgcct
             Megabat  ---tggct
            Hedgehog  ---tgg--
               Shrew  ---tgact
            Elephant  ---tggtt
          Rock hyrax  ---ttgcg
             Manatee  ---tggct
           Armadillo  ---gggtt
             Tarsier  ========
              Tenrec  ========
             Wallaby  ========
                Pika  ========
              Alpaca  NNNNNNNN
               Sheep  ========
                Fugu  ========
        Atlantic cod  ========
        Nile tilapia  ========
           Zebrafish  ========
       X. tropicalis  ========
            Platypus  ========
              Turkey  ========
          Coelacanth  ========
     Tasmanian devil  ========
             Opossum  ========
              Lizard  ========
          Budgerigar  ========
         Zebra finch  ========
             Chicken  ========
      Painted turtle  ========
               Sloth  NNNNNNNN

Inserts between block 8 and 9 in window
B D           Human 40bp
B D           Chimp 40bp
B D         Gorilla 39bp
B D       Orangutan 40bp
B D          Gibbon 40bp
B D          Rhesus 40bp
B D          Baboon 40bp
B D        Marmoset 40bp
B D Squirrel monkey 40bp
B D     Mouse lemur 37bp
B D        Bushbaby 40bp
B D      Tree shrew 22bp

Alignment block 9 of 736 in window, 56695135 - 56695155, 21 bps 
B D            Mouse  cctcctcc--------------------------------------------------------------
B D              Rat  gagtctcc--------------------------------------------------------------
B D     Kangaroo rat  ggacctct-cgctatctccaggtct------------tacc------------tcgtta-------c---
B D   Naked mole-rat  ttgcctctcctcaacctcctggtttctccgactgtcccacc------------tcccca-------c---
B D       Guinea pig  cggcctctgctcagcctcctggtctctcccactggcccacc------------tttcca-------t---
B D         Squirrel  -acccact------------ggtctctctgacccacctacc------------ttctca-------c---
B D           Rabbit  cggcctgcccgcaagctccaggtctccgcgaccggcctacc------------ttctca-------c---
B D            Human  ----------------------------------------c------------ttctca-------c---
B D            Chimp  ----------------------------------------c------------ttctca-------c---
B D          Gorilla  ----------------------------------------c------------ttctca-------c---
B D        Orangutan  ----------------------------------------c------------ttctca-------c---
B D           Gibbon  ----------------------------------------c------------ttccca-------c---
B D           Rhesus  ----------------------------------------c------------ttctca-------c---
B D           Baboon  ----------------------------------------c------------ttctca-------c---
B D         Marmoset  ----------------------------------------c------------ttctca-------c---
B D  Squirrel monkey  ----------------------------------------c------------ttctca-------c---
B D          Tarsier  ----------------------------------------c------------ttctca-------c---
B D      Mouse lemur  ----------------------------------------c------------ttccta-------c---
B D         Bushbaby  ----------------------------------------c------------ttctta-------c---
B D       Tree shrew  ----------------------------------------c------------tctcca-------atgg
B D              Pig  --------------------------------tggctttcc------------ttattt-------c---
B D          Dolphin  --------------------------------gggcctacc------------ttctca-------c---
B D              Cow  --------------------------------gggcctacc------------ttctca-------c---
B D              Cat  --------------------------------c--------------------ctaaac-------c---
B D              Dog  --------------------------------cggtctccc------------cttaac-------c---
B D            Panda  --------------------------------cggtctccg------------ctaaac-------c---
B D            Horse  --------------------------------gggtctccc------------ctaaac-------c---
B D         Microbat  --------------------------------cggcctccc------------ctaaac-------c---
B D          Megabat  --------------------------------ccgtctcct------------ctcaat-------c---
B D         Hedgehog  -----------------------------------------------------ttctat-------t---
B D            Shrew  --------------------------------c-tttaccc------------cccaaa-------c---
B D         Elephant  ---------------------------------cggactcc------------ccgtga-------c---
B D       Rock hyrax  ---------------------------------tggcctccgagtcgtgggctccttgagctccccc---
B D          Manatee  ---------------------------------cggccttc------------ccacga-------c---
B D        Armadillo  ---------------------------------cggcctcc-----------------------------
B D           Tenrec  ======================================================================
B D          Wallaby  ======================================================================
B D             Pika  ======================================================================
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D            Sheep  ======================================================================
B D             Fugu  ======================================================================
B D     Atlantic cod  ======================================================================
B D     Nile tilapia  ======================================================================
B D        Zebrafish  ======================================================================
B D    X. tropicalis  ======================================================================
B D         Platypus  ======================================================================
B D           Turkey  ======================================================================
B D       Coelacanth  ======================================================================
B D  Tasmanian devil  ======================================================================
B D          Opossum  ======================================================================
B D           Lizard  ======================================================================
B D       Budgerigar  ======================================================================
B D      Zebra finch  ======================================================================
B D          Chicken  ======================================================================
B D   Painted turtle  ======================================================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

               Mouse  actcgacttctcc
                 Rat  ---taccctttcc
        Kangaroo rat  acctgccttcccg
      Naked mole-rat  acctgcgcactcg
          Guinea pig  atctgcgcgctcc
            Squirrel  acctacgttcttg
              Rabbit  acctgcgcgctcg
               Human  acctgcgctctcg
               Chimp  acctgcgctctcg
             Gorilla  acctgcgctctcg
           Orangutan  acctgcgctctcg
              Gibbon  acctgcgctctcg
              Rhesus  acctgcgctctcg
              Baboon  acctgcgctctcg
            Marmoset  acctgcgctctct
     Squirrel monkey  acctgagctctcg
             Tarsier  acctgcgctcttg
         Mouse lemur  acctgtgctcttg
            Bushbaby  acctgcg--cttg
          Tree shrew  gcctactttctca
                 Pig  tcc----------
             Dolphin  acctg--------
                 Cow  acctg--------
                 Cat  tcctg--------
                 Dog  tcctg--------
               Panda  tccag--------
               Horse  tcctc--------
            Microbat  tcctt--------
             Megabat  tcctt--------
            Hedgehog  tcctc--------
               Shrew  tcctc--------
            Elephant  ctccgcatctct-
          Rock hyrax  ccccacatctct-
             Manatee  ctctgcgtttct-
           Armadillo  --ctgcgtctct-
              Tenrec  =============
             Wallaby  =============
                Pika  =============
              Alpaca  NNNNNNNNNNNNN
               Sheep  =============
                Fugu  =============
        Atlantic cod  =============
        Nile tilapia  =============
           Zebrafish  =============
       X. tropicalis  =============
            Platypus  =============
              Turkey  =============
          Coelacanth  =============
     Tasmanian devil  =============
             Opossum  =============
              Lizard  =============
          Budgerigar  =============
         Zebra finch  =============
             Chicken  =============
      Painted turtle  =============
               Sloth  NNNNNNNNNNNNN

Inserts between block 9 and 10 in window
B D             Pig 34bp
B D         Dolphin 8bp
B D             Cow 8bp
B D             Cat 1bp
B D             Dog 1bp
B D           Panda 1bp
B D           Horse 1bp
B D        Microbat 1bp
B D         Megabat 1bp
B D        Hedgehog 1bp
B D           Shrew 1bp

Alignment block 10 of 736 in window, 56695156 - 56695159, 4 bps 
B D            Mouse  ----------------------------------ccat
B D              Rat  ----------------------------------ccat
B D     Kangaroo rat  ----------------------------------ccac
B D   Naked mole-rat  ----------------------------------tcac
B D       Guinea pig  ----------------------------------tcac
B D         Squirrel  ----------------------------------ccac
B D           Rabbit  ----------------------------------cagc
B D            Human  ----------------------------------ccac
B D            Chimp  ----------------------------------ccac
B D          Gorilla  ----------------------------------ccac
B D        Orangutan  ----------------------------------ccac
B D           Gibbon  ----------------------------------ccac
B D           Rhesus  ----------------------------------ccac
B D           Baboon  ----------------------------------ccac
B D         Marmoset  ----------------------------------ccac
B D  Squirrel monkey  ----------------------------------ccac
B D          Tarsier  ----------------------------------ccac
B D      Mouse lemur  ----------------------------------ccac
B D         Bushbaby  ----------------------------------tcac
B D       Tree shrew  -----------------------------------cac
B D              Pig  ----------------------------------cccg
B D          Dolphin  ----------------------------------ccac
B D              Cow  ----------------------------------tctc
B D              Cat  ----------------------------------tctt
B D              Dog  ----------------------------------tctc
B D            Panda  ----------------------------------tctc
B D            Horse  ----------------------------------tccc
B D          Megabat  ----------------------------------tctc
B D         Hedgehog  ----------------------------------tctg
B D            Shrew  ----------------------------------cctc
B D         Elephant  ccagtgggcctacctgtttacacctgcgctctcaccac
B D       Rock hyrax  ccaataggcctacctttgtccacctgcgctgttgccac
B D          Manatee  cctatgggcctaccttcttacacctgcgctctcgccac
B D        Armadillo  ccaa----------------------------cacctc
B D           Tenrec  ======================================
B D          Wallaby  ======================================
B D             Pika  ======================================
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D            Sheep  ======================================
B D             Fugu  ======================================
B D     Atlantic cod  ======================================
B D     Nile tilapia  ======================================
B D        Zebrafish  ======================================
B D    X. tropicalis  ======================================
B D         Platypus  ======================================
B D           Turkey  ======================================
B D       Coelacanth  ======================================
B D  Tasmanian devil  ======================================
B D          Opossum  ======================================
B D           Lizard  ======================================
B D       Budgerigar  ======================================
B D      Zebra finch  ======================================
B D          Chicken  ======================================
B D   Painted turtle  ======================================
B D         Microbat  ======================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 10 and 11 in window
B D           Shrew 32bp

Alignment block 11 of 736 in window, 56695160 - 56695171, 12 bps 
B D            Mouse  cctga-----gtgaact
B D              Rat  ccttt-----gtgaact
B D     Kangaroo rat  ccaga------cagact
B D   Naked mole-rat  ctgta-----gtagact
B D       Guinea pig  ttgga-----gtagact
B D         Squirrel  ctgga-----gtagtct
B D           Rabbit  ctaac-----gcgccct
B D            Human  ctggc-----atggact
B D            Chimp  ctggc-----atggact
B D          Gorilla  ctggc-----atggact
B D        Orangutan  ctggc-----atggacc
B D           Gibbon  ctggc-----atggact
B D           Rhesus  ctggc-----atggact
B D           Baboon  ctggc-----atggact
B D         Marmoset  ctggc-----atggatt
B D  Squirrel monkey  ctggc-----atggatt
B D          Tarsier  ctgga-----gtggacc
B D      Mouse lemur  cagcc-----atggact
B D         Bushbaby  cagcc------cggatt
B D       Tree shrew  ctg--------tggact
B D              Pig  ctggccaccagtaagct
B D          Dolphin  ctggc-----gtaggct
B D              Cow  tcggc-----gtaggat
B D              Cat  tccga------ggggcc
B D              Dog  tcgga------tcggcc
B D            Panda  tccta------tcggcc
B D            Horse  tccga-----gggggcc
B D          Megabat  ttcga------tgggcc
B D         Hedgehog  gaaga------aaggcc
B D         Elephant  ctggc-----gtggact
B D       Rock hyrax  ctggc-----gtggacc
B D          Manatee  ctcgc-----gtggact
B D        Armadillo  ctggt-----gtggcct
B D   Painted turtle  cttga-----atgaact
B D           Tenrec  =================
B D          Wallaby  =================
B D             Pika  =================
B D           Alpaca  NNNNNNNNNNNNNNNNN
B D            Sheep  =================
B D             Fugu  =================
B D     Atlantic cod  =================
B D     Nile tilapia  =================
B D        Zebrafish  =================
B D    X. tropicalis  =================
B D         Platypus  =================
B D           Turkey  =================
B D       Coelacanth  =================
B D  Tasmanian devil  =================
B D          Opossum  =================
B D           Lizard  =================
B D       Budgerigar  =================
B D      Zebra finch  =================
B D          Chicken  =================
B D            Shrew  =================
B D         Microbat  =================
B D            Sloth  NNNNNNNNNNNNNNNNN

Inserts between block 11 and 12 in window
B D             Cat 40bp
B D             Dog 38bp
B D           Panda 40bp
B D           Horse 39bp
B D         Megabat 69bp
B D        Hedgehog 35bp

Alignment block 12 of 736 in window, 56695172 - 56695233, 62 bps 
B D            Mouse  ggaagg----aga---tagaatttgtggac----a---aga---------ttct-----gacag-tcc--
B D              Rat  gaaagg----agg---tagaatttgtggac----a---aga---------ttct-----gacag-tcc--
B D     Kangaroo rat  ggaacc----aga---cagactcaatgggt----a---agaga-gcccccttcc-----tacca-ccccc
B D   Naked mole-rat  gaaaag----------tggaatcagtgggt----a---acagaggtcccctcct-----gacgc-ctc--
B D       Guinea pig  gaaaag--------------------aagt----a---actgaggtccccactt-----gacgc-ctc--
B D         Squirrel  ggaatg----agg---tggaatcggtgggt----a---acagaacttccctcct-----gacag-ccc--
B D           Rabbit  gaaggg----agg---tggaaccagcgggt----gaccagagagccccgctcct-----gacag-ccc--
B D            Human  gaagtg----agg---tagaatcggcaggt----g---acacagatcctctcct-----gacag-tcc--
B D            Chimp  gaagtg----agg---tagaatcggcaggt----g---acacagatcctctcct-----gacag-tcc--
B D          Gorilla  gaagtg----agg---tagaatcggcaggt----g---acacagatcctctcct-----gacag-tcc--
B D        Orangutan  caagtg----agg---tagaatcggcaggt----g---acacagatcctctcct-----gacag-tcc--
B D           Gibbon  gaagtg----agg---tagaatcggcaggt----g---atacagatcctctcct-----gacag-tcc--
B D           Rhesus  gaagtg----agg---tagaatcggcaggt----g---acacagatcatctcct-----gacag-tcc--
B D           Baboon  gaagtg----agg---tagaatcggcaggt----g---acacagatcatctcct-----gacag-tcc--
B D         Marmoset  gaagtt----agg---tagaatcggcaggt----g---acacagattctct-------------------
B D  Squirrel monkey  gaagtt----agg---tagcatcggcaggt----a---acacagattctct-------------------
B D          Tarsier  gaagag----agg---tagaatgggcgggt----g---acagagatcccctcct-----gatag-tcc--
B D      Mouse lemur  gacttg----agg---tagagtgggcgggt----g---acggag---ctctcct-----cgagg-ccc--
B D         Bushbaby  gacgcgacgtaga---tagaatcttcgggc----g---accaag---ctctctt-----ggcgg-ctg--
B D       Tree shrew  gaagtg----agg---tggaatcggctggt----g---acaaagaa-ctctcct-----gacag-aac--
B D              Pig  ggagtg----tgg---tagtgtccgctggt----g---acagccaccttctcct-----gacag-cct--
B D          Dolphin  ggagcg----cgg---taggacccgccggt----a---acagccatcctctcct-----gatat-ccc--
B D            Sheep  ------------------------------------------ccatcctctctt-----gacaa-cct--
B D              Cow  gtagtg----ctg---taagatccgctggt----a---acagacatcctctctt-----gacaa-cct--
B D              Cat  ggagtg----agg---tagcccctgccggt----a---atag-gttcttctcca-----gacag-ccc--
B D              Dog  ggagtg----agg---tatcatcctcctgt----a---atagcgtccatctccg-----gacag-ccc--
B D            Panda  ggagtg----aggagataagattctccggt----a---atagcgtccttcttca-----gacag-ccc--
B D            Horse  ggagtg----agg---taggatgggccggc----a---acaacattcctctcct-----tgcagcccc--
B D         Microbat  ----------------------------------------------------------------------
B D         Hedgehog  ggagtg----aag---tggcataggtgggt----g---actgcgtggttcacct-----gccag-tcc--
B D            Shrew  ggacag----agg---tagtacagtagcac----t---gtagcactgctttccc-----gacag-tcc--
B D         Elephant  ggcatg----ggg---taggatcggccggt----g---atagcgctcccctcct-----gacag-cct--
B D       Rock hyrax  ggcgtg----ggg---caggaccagctggt----g---acagcgttcccctcct-----gacag-ccc--
B D          Manatee  ggagtg----gga---taggattggccggt----g---ac-gcgctgccttcct-----gccag-cct--
B D        Armadillo  ggagtg----ggg---cagggtcggtaggt----g---ccagcgctcccctcct-----ggcag-ccc--
B D   Painted turtle  aaaagg----cag---gcgtatctacaaactttga---acagattgctttctctaaagcgatat-gac--
B D           Tenrec  ======================================================================
B D          Wallaby  ======================================================================
B D             Pika  ======================================================================
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Fugu  ======================================================================
B D     Atlantic cod  ======================================================================
B D     Nile tilapia  ======================================================================
B D        Zebrafish  ======================================================================
B D    X. tropicalis  ======================================================================
B D         Platypus  ======================================================================
B D           Turkey  ======================================================================
B D       Coelacanth  ======================================================================
B D  Tasmanian devil  ======================================================================
B D          Opossum  ======================================================================
B D           Lizard  ======================================================================
B D       Budgerigar  ======================================================================
B D      Zebra finch  ======================================================================
B D          Chicken  ======================================================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          Megabat  ======================================================================

               Mouse  ---cc-aaaggtcagcatgacaggt----ag
                 Rat  ---cc-aaaggtcagcatgccagat----ag
        Kangaroo rat  ccacc-caaggccgaccagacaggt----ag
      Naked mole-rat  ---cc-gaaggcccacagggcaggt----ta
          Guinea pig  ---ct-gaaggcccacagggcaggt----ta
            Squirrel  ---cc-aaagtcctgcatggtcggt----ta
              Rabbit  ---tt-ggaggcctgcgggaccggc----ca
               Human  ---cc-agaggcccgcatgacagat----tt
               Chimp  ---cc-agaggcccgcatgacagat----tt
             Gorilla  ---cc-agaggcccgcatgacagat----tt
           Orangutan  ---cc-agaggcccgcatgacagat----tt
              Gibbon  ---cc-agaggcccgcatgacagat----tt
              Rhesus  ---cc-agaggcccgcatgacagat----tt
              Baboon  ---cc-agaggcccgcatgacagat----tt
            Marmoset  ---cc-ggtggccctctcgacagat----tt
     Squirrel monkey  ---cc-ggtggccctctcgacagat----tt
             Tarsier  ---cc-ggaggcctgcctggcaggt----aa
         Mouse lemur  ---gc-cgaggcccgcatgacagat----ta
            Bushbaby  ---gc-ggaggcctgcacgacagat----ta
          Tree shrew  ---cc--gaggcctgcaggtcaggg----ta
                 Pig  ---ag-cgaggcttgcacggcaggctattta
             Dolphin  ---ct-cgaggcttacaggacaggc----ta
               Sheep  ---ct-tgaagcttgcatgacaggc----ta
                 Cow  ---ct-tgaagcttgcctgacaggc----ta
                 Cat  ---ct-ggaggcccgcatgacgggc----aa
                 Dog  ---ca-ggaggcccgcaggaccggc----ta
               Panda  ---ct-ggaggcctacgtgtccggc----ta
               Horse  ---cc-ggagccctgcaggacagac----ta
            Microbat  -----------tctctacgacgggc----ct
            Hedgehog  ---ct-ggagaccttcatgatgagt----ta
               Shrew  ---at-ggaggcctcagtgatacat----ta
            Elephant  ---cttggaagctcgtatgacaggg----tg
          Rock hyrax  ---ctctgaggcctgtgtgacaggc----ta
             Manatee  ---cttggaggattgcatgacaggc----ta
           Armadillo  ---tttcgaggcttgcataata-at----ta
      Painted turtle  ---ca-aaatattggcgccg-----------
              Tenrec  ===============================
             Wallaby  ===============================
                Pika  ===============================
              Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Fugu  ===============================
        Atlantic cod  ===============================
        Nile tilapia  ===============================
           Zebrafish  ===============================
       X. tropicalis  ===============================
            Platypus  ===============================
              Turkey  ===============================
          Coelacanth  ===============================
     Tasmanian devil  ===============================
             Opossum  ===============================
              Lizard  ===============================
          Budgerigar  ===============================
         Zebra finch  ===============================
             Chicken  ===============================
               Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Megabat  ===============================

Alignment block 13 of 736 in window, 56695234 - 56695270, 37 bps 
B D            Mouse  ttc----------------tcagtca-----------tcc-----------------c------------
B D              Rat  ttc----------------tcagtca-----------tcctcatgcccaggagctccc------------
B D     Kangaroo rat  tgcaatttcgacgactccttcattca-----------tct-----------------c------------
B D   Naked mole-rat  tga---ttc----------taagata-----------ccc-----------------c------------
B D       Guinea pig  tta---tt-----------taaaata-----------ccc-----------------c------------
B D         Squirrel  ttc----------------taagact-----------ccc-----------------c------------
B D           Rabbit  ttc----------------tgagacg-----------ccc-----------------c------------
B D            Human  tgc----------------taagacaact--------ccc-----------------t------------
B D            Chimp  tgc----------------taagacaact--------ccc-----------------t------------
B D          Gorilla  tgc----------------taagacaact--------ccc-----------------t------------
B D        Orangutan  tgc----------------taagacaact--------ccc-----------------t------------
B D           Gibbon  tgc----------------taagacaact--------ccc-----------------t------------
B D           Rhesus  tgc----------------taagacaact--------ccc-----------------t------------
B D           Baboon  tgc----------------taagacaact--------ccc-----------------t------------
B D         Marmoset  tgc----------------taagacaact--------cc------------------c------------
B D  Squirrel monkey  tgc----------------taaggcaact--------cct-----------------c------------
B D          Tarsier  tgc----------------taagacagcc--------tcc-----------------t--ctggccc---
B D      Mouse lemur  cgc----------------caagac--ctccccggcccct-----------------a------------
B D         Bushbaby  tgc----------------taagac--ct--------cgt-----------------g------------
B D       Tree shrew  ttc----------------taag--cacc--------tct-----------------c------------
B D              Pig  ttc----------------taagaaccct--------ca------------------c------------
B D          Dolphin  ttc----------------taagaacgct--------caccatca------------c------------
B D            Sheep  ttc----------------taagaaccct--------caccatgg------------c------------
B D              Cow  ttc----------------taagaaccct--------caccatgg------------c------------
B D              Cat  ttc----------------taagaaccac--------tgcc----------------c------------
B D              Dog  ttc----------------taagaatacc--------cccc----------------cccccgacacaca
B D            Panda  ttc----------------taagaagcac--------cccc----------------c------------
B D            Horse  ttc----------------taagaagccc--------cctt----------------c------------
B D         Microbat  atc----------------t-----------------tccc----------------g------------
B D         Hedgehog  ttt----------------taacacacac--------acac----------------a--cacacacaca
B D            Shrew  ---------------------------------------------------------------------a
B D         Elephant  tcc----------------taagaccagt--------atc-----------------t------------
B D       Rock hyrax  ttc----------------taaaa----------------------------------------------
B D          Manatee  ttc----------------taagatccgt--------ctt-----------------g------------
B D        Armadillo  ttc----------------taagacccct--------ttc-----------------c------------
B D         Platypus  ----------------------------------------------------------------------
B D   Painted turtle  ----------------------------------------------------------------------
B D           Tenrec  ======================================================================
B D          Wallaby  ======================================================================
B D             Pika  ======================================================================
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Fugu  ======================================================================
B D     Atlantic cod  ======================================================================
B D     Nile tilapia  ======================================================================
B D        Zebrafish  ======================================================================
B D    X. tropicalis  ======================================================================
B D           Turkey  ======================================================================
B D       Coelacanth  ======================================================================
B D  Tasmanian devil  ======================================================================
B D          Opossum  ======================================================================
B D           Lizard  ======================================================================
B D       Budgerigar  ======================================================================
B D      Zebra finch  ======================================================================
B D          Chicken  ======================================================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          Megabat  ======================================================================

               Mouse  --tt----------------------------------------aagggtcg-t--------------gc
                 Rat  --tt----------------------------------------gatggtcg-t--------------gc
        Kangaroo rat  --tttcc-----agcccc-------------------gt--a-aaatggtgg-c--------------ac
      Naked mole-rat  --ca-----------cct-------------------gt--gtaaccggtgg-c--------------gc
          Guinea pig  --ca-----------cct-------------------at--gtatactgcgg-c--------------gc
            Squirrel  --ca-----------tcc-------------------tt--gtaaacagtgc-t--------------gc
              Rabbit  --ca-----------gcc-------------------ca--gtcaacggcgg-c--------------gc
               Human  --ca-----------ccc-------------------ct--gtgcacggtgg-c--------------gc
               Chimp  --ca-----------ccc-------------------ct--gtgcacggtgg-c--------------gc
             Gorilla  --ca-----------ccc-------------------ct--gtgcacggtgg-c--------------gc
           Orangutan  --ca-----------ccc-------------------ct--gtgcacggtgg-c--------------gc
              Gibbon  --cg-----------ccc-------------------ct--gtgcacggtgg-c--------------gc
              Rhesus  --ca-----------ccc-------------------ct--gtgcacggtgg-c--------------g-
              Baboon  --ca-----------ccc-------------------ct--gtgcacggtgg-c--------------g-
            Marmoset  --ca-----------ccc-------------------cc--gtgcaccgtgg-c--------------gc
     Squirrel monkey  --ca-----------ccc-------------------cc--gtgcaccgtgg-c--------------gc
             Tarsier  --ca-----------tct-------------------cc--gtgaacggtgg-c--------------gc
         Mouse lemur  --ct-----------ccc-------------------cc--acaaacggtgg-c--------------gc
            Bushbaby  --tc-----------ccc-------------------ca--gtagacggtgg-c--------------tc
          Tree shrew  --ca-----------ccc-------------------ccaggtaaacagcgg-c--------------ac
                 Pig  --ca-----------cca-------------------cc--aatgacggtgg-c--------------gc
             Dolphin  --ca-----------cca-------------------tc--aaagacggtgg-c--------------gc
               Sheep  --ca-----------cca-------------------tc--aaagacggtgg-c--------------gc
                 Cow  --ca-----------cca-------------------tc--aaagacggtgg-c--------------gc
                 Cat  --ct-----------cgt--------------------------aacggtggcc--------------cc
                 Dog  caca-----------cct--------------------------gacggtgg-c--------------cc
               Panda  --ca-----------cct--------------------------gacggtgg-c--------------cc
               Horse  --ca------------at--------------------------gacggtgg-c--------------gc
            Microbat  --ca-----------ccc--------------------------g-cgctg--t--------------cg
            Hedgehog  caca-----------ctcacacgcgccacgaccaccccc--gaagacggtgg-t--------------at
               Shrew  gaca-----------ctt-------cgacttccatctgc--aaggacagtgg-c--------------gg
            Elephant  --ta-----------acc-------------------gg---------ttgg-c--------------gc
          Rock hyrax  ---g-----------aca-------------------ga---------ttgg-a--------------gc
             Manatee  --ta-----------acc-------------------cg---------tagg-c--------------gc
           Armadillo  --ta-----------aat-------------------gg----------agg-c--------------gc
            Platypus  ----tcctcggtgttccc-------------------ca--aagagccgggg-c--------------cc
      Painted turtle  ------------------------------------------ttgacaatag-cctagtaaaagtattac
              Tenrec  ======================================================================
             Wallaby  ======================================================================
                Pika  ======================================================================
              Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Fugu  ======================================================================
        Atlantic cod  ======================================================================
        Nile tilapia  ======================================================================
           Zebrafish  ======================================================================
       X. tropicalis  ======================================================================
              Turkey  ======================================================================
          Coelacanth  ======================================================================
     Tasmanian devil  ======================================================================
             Opossum  ======================================================================
              Lizard  ======================================================================
          Budgerigar  ======================================================================
         Zebra finch  ======================================================================
             Chicken  ======================================================================
               Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Megabat  ======================================================================

               Mouse  c-act-tgttct
                 Rat  ccgct-ggctac
        Kangaroo rat  a-ccc-acctcc
      Naked mole-rat  c---c-tcctcc
          Guinea pig  c---c-ccct-c
            Squirrel  g------cttcc
              Rabbit  c------cctgc
               Human  c---c-gcctcc
               Chimp  c---c-gcctcc
             Gorilla  c---c-gcctcc
           Orangutan  c---c-gcctcc
              Gibbon  c---c-gcctcc
              Rhesus  c---c-gcctcc
              Baboon  c---c-gcctcc
            Marmoset  c---c-gcctcc
     Squirrel monkey  c---c-gcctcc
             Tarsier  c---c-gcctcc
         Mouse lemur  c---c-gcctcc
            Bushbaby  c---c-gcctcc
          Tree shrew  t---taaattcc
                 Pig  t---c-accttc
             Dolphin  t---c-acctcc
               Sheep  t---c-acctcc
                 Cow  t---c-acctcc
                 Cat  c---c-acctcc
                 Dog  c---c-acctct
               Panda  c---c-accacc
               Horse  c---c-acctcc
            Microbat  c---c-acct--
            Hedgehog  c---c-accttc
               Shrew  t---c-atttct
            Elephant  c---c-acctcc
          Rock hyrax  c---c-acctcc
             Manatee  c---c-acctcc
           Armadillo  c---t-gcctcc
            Platypus  t---g-gcaat-
      Painted turtle  c---a-acc---
              Tenrec  ============
             Wallaby  ============
                Pika  ============
              Alpaca  NNNNNNNNNNNN
                Fugu  ============
        Atlantic cod  ============
        Nile tilapia  ============
           Zebrafish  ============
       X. tropicalis  ============
              Turkey  ============
          Coelacanth  ============
     Tasmanian devil  ============
             Opossum  ============
              Lizard  ============
          Budgerigar  ============
         Zebra finch  ============
             Chicken  ============
               Sloth  NNNNNNNNNNNN
             Megabat  ============

Inserts between block 13 and 14 in window
B D        Platypus 7bp

Alignment block 14 of 736 in window, 56695271 - 56695291, 21 bps 
B D            Mouse  ctgagagctc---taacc--------tccaac
B D              Rat  cttagagccc---taacc--------tgtaat
B D     Kangaroo rat  c-----gccc---cgagt--------ctcaac
B D   Naked mole-rat  c-----actc---agaat--------cgtagc
B D       Guinea pig  c-----accc---ataat--------ttaagc
B D         Squirrel  c-----acct---agagt--------cttaac
B D           Rabbit  c-----acct---ggagc--------cctaac
B D            Human  c-----acct---atagc--------cttaac
B D            Chimp  c-----acct---atagc--------cttaac
B D          Gorilla  c-----acct---atagt--------cttaac
B D        Orangutan  c-----acct---atagt--------cttaac
B D           Gibbon  c-----acct---acagt--------cttaac
B D           Rhesus  c-----acct---atagt--------cttaac
B D           Baboon  c-----acct---atagt--------cttaac
B D         Marmoset  c-----actt---agggt--------tttaac
B D  Squirrel monkey  c-----actt---agggt--------cttaac
B D          Tarsier  c-----acct---agagt--------cttaac
B D      Mouse lemur  c-----actt---agatt--------cttaac
B D         Bushbaby  c-----accc---agatt--------cttaac
B D       Tree shrew  c-----atct---agagt--------cttaat
B D              Pig  c-----atct---agagt--------tttaac
B D          Dolphin  a-----gc-----agaac--------tcaagc
B D            Sheep  c-----acct---agagt--------tttaac
B D              Cow  c-----acct---agagt--------tttaac
B D              Cat  c-----acct---ggagt--------tttaac
B D              Dog  c-----acct---agagt--------tctacc
B D            Panda  c-----ccct---agagt--------tttaac
B D            Horse  c-----accc---agagt--------tttaac
B D         Microbat  g-----gctt---ggggt--------ggcaac
B D         Hedgehog  c-----acttacaagagt--------tttaac
B D            Shrew  c-----acct---agagc--------tttaac
B D         Elephant  c-----acct---agatt--------cttaac
B D       Rock hyrax  t-----acct---ggagt--------cttaac
B D          Manatee  c-----acct---agagt--------cttaac
B D        Armadillo  c-----gtct---ggagt--------------
B D  Tasmanian devil  -------ctg---ataat--------gctaac
B D         Platypus  c-----gccc----------------------
B D   Painted turtle  -------ctg---aaagtatgtaaacttgaac
B D           Tenrec  ================================
B D          Wallaby  ================================
B D             Pika  ================================
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Fugu  ================================
B D     Atlantic cod  ================================
B D     Nile tilapia  ================================
B D        Zebrafish  ================================
B D    X. tropicalis  ================================
B D           Turkey  ================================
B D       Coelacanth  ================================
B D          Opossum  ================================
B D           Lizard  ================================
B D       Budgerigar  ================================
B D      Zebra finch  ================================
B D          Chicken  ================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          Megabat  ================================

Inserts between block 14 and 15 in window
B D Tasmanian devil 10bp
B D        Platypus 1bp

Alignment block 15 of 736 in window, 56695292 - 56695296, 5 bps 
B D            Mouse  tttaa
B D              Rat  ttcat
B D     Kangaroo rat  ttcaa
B D   Naked mole-rat  ttcat
B D       Guinea pig  atcat
B D         Squirrel  ttcca
B D           Rabbit  tccgc
B D            Human  ttcaa
B D            Chimp  ttcaa
B D          Gorilla  ttcaa
B D        Orangutan  ttcaa
B D           Gibbon  ttcaa
B D           Rhesus  ttcaa
B D           Baboon  ttcaa
B D         Marmoset  ttcaa
B D  Squirrel monkey  ttcaa
B D          Tarsier  ttcac
B D      Mouse lemur  ttcaa
B D         Bushbaby  tttaa
B D       Tree shrew  ttgaa
B D              Pig  ttaaa
B D          Dolphin  ctctt
B D            Sheep  ttaaa
B D              Cow  ttaaa
B D              Cat  ttcaa
B D              Dog  ttcag
B D            Panda  ttcaa
B D            Horse  ttcag
B D         Microbat  acctg
B D         Hedgehog  ttcta
B D            Shrew  ttcaa
B D         Elephant  ttcaa
B D       Rock hyrax  ctcaa
B D          Manatee  ttcaa
B D          Opossum  tttga
B D  Tasmanian devil  tttga
B D         Platypus  ttca-
B D   Painted turtle  -t---
B D           Tenrec  =====
B D          Wallaby  =====
B D             Pika  =====
B D           Alpaca  NNNNN
B D             Fugu  =====
B D     Atlantic cod  =====
B D     Nile tilapia  =====
B D        Zebrafish  =====
B D    X. tropicalis  =====
B D           Turkey  =====
B D       Coelacanth  =====
B D           Lizard  =====
B D       Budgerigar  =====
B D      Zebra finch  =====
B D          Chicken  =====
B D            Sloth  NNNNN
B D        Armadillo  -----
B D          Megabat  =====

Inserts between block 15 and 16 in window
B D             Pig 1bp
B D         Dolphin 1bp
B D           Sheep 1bp
B D             Cow 1bp
B D             Cat 6bp
B D             Dog 6bp
B D           Panda 6bp
B D           Horse 6bp
B D        Microbat 8bp
B D        Hedgehog 6bp
B D           Shrew 6bp
B D        Elephant 2bp
B D      Rock hyrax 2bp
B D         Manatee 2bp

Alignment block 16 of 736 in window, 56695297 - 56695337, 41 bps 
B D            Mouse  -----ttt-ga----caaa---------------ttcatctcttcc------------ccaaaag---gt
B D              Rat  -----ttttga----caag---------------tccatctcttcc------------ccaagag---gt
B D     Kangaroo rat  -----ttc-------tgag---------------ttcgtccctacc------------cc----------
B D   Naked mole-rat  -----ttctta----gagg---------------tccatcgttccc------------ccaaaag---ag
B D       Guinea pig  -----taatta----gata---------------gccct-atttct------------tcgcaag---aa
B D         Squirrel  -----ttctga----ggtg---------------ttcaacgttccc------------acctagg---gg
B D           Rabbit  -----ttctga----gggg---------------tcggtcgttccc------------tcaaaga---gg
B D            Human  -----ttctga----gatg---------------tccatcgttccc------------cggag-g---ag
B D            Chimp  -----ttctga----gatg---------------tccatcgttccc------------cggag-g---ag
B D          Gorilla  -----ttctga----gatg---------------tccatcgttccc------------cggag-g---ag
B D        Orangutan  -----ttctga----gacg---------------tccatcgttccc------------cggag-g---ag
B D           Gibbon  -----ttctga----gaag---------------tctatcgttccc------------cggag-g---ag
B D           Rhesus  -----ttctga----gacg---------------tccatcgttccc------------tagag-g---ag
B D           Baboon  -----ttctga----gacg---------------tccatcgttccc------------tagag-g---ag
B D         Marmoset  -----ttctga----gacg---------------tccatcgttccc------------ctgag-g---ag
B D  Squirrel monkey  -----ttctga----gaag---------------tccatctttccc------------ccgag-g---aa
B D          Tarsier  -----ttttga----gatg---------------tccatcgttctt------------ccaag-g---ag
B D      Mouse lemur  -----ttccga----gat----------------gccatcgttccc------------ccaaatg---ag
B D         Bushbaby  -----agttga----gacg---------------gccgtccttccc------------ccaag-g---ag
B D       Tree shrew  -----ttctga----ga----------------------cgttcct------------ccaaa-g---ag
B D              Pig  ------tctga----gatg---------------tctgtatttcac------------ccaaa-g---aa
B D          Dolphin  ------catcg----gggc---------------acagacttcctt------------tta---------
B D            Sheep  ------tctga----gatg---------------tctgccttcccc------------tcaaa-t---aa
B D              Cow  ------tctga----gatg---------------tctgccttcccc------------ccaga-g---aa
B D              Cat  ---------------ggca---------------tctgtccctcct-----------cccctc-ctagaa
B D              Dog  ---------------ggcg---------------tctgttcccccc-----------tcccgc-c---aa
B D            Panda  ---------------cgcg---------------tctgtttccccc------------ctctc-c---aa
B D            Horse  ---------------gatg---------------tccgttcctccccccccaccccccccccc-ccataa
B D         Microbat  ------tctaa----gacg---------------tttgtctgtccc------------ccaaa-g---aa
B D          Megabat  ------tctga----gacg---------------tccatctgtctc------------ccgaa-t---aa
B D         Hedgehog  ---------------gacg----------------ctgtctttagc----------tccccca-a---at
B D            Shrew  ---------------ggcg---------------tctgtcagtccc----------tctttct-c---cg
B D         Elephant  -------ctga----gacg---------------tctgtcatctcc------------gtaaa-a---gg
B D       Rock hyrax  -------ctga----ga-------------------tgtcatatcc------------ctaaa-g---ag
B D          Manatee  -------ctga----gacg---------------tccgtcatttcc------------cca---------
B D        Armadillo  ----------g----ga---------------------tggaaccc------------tcaaa-g---ag
B D          Opossum  ------cccaa----cata---------------attgtttccttc------------tcttc-c---tt
B D  Tasmanian devil  ------cccaa----cgta---------------atcgttcccttc------------tcttc-c---cg
B D         Platypus  ------tctcaacccgatc---------------tctttcccctca------------tcc---------
B D   Painted turtle  aatagatctca----tacacaggtagagacaggatcaattg-----------------------------
B D           Tenrec  ======================================================================
B D          Wallaby  ======================================================================
B D             Pika  ======================================================================
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Fugu  ======================================================================
B D     Atlantic cod  ======================================================================
B D     Nile tilapia  ======================================================================
B D        Zebrafish  ======================================================================
B D    X. tropicalis  ======================================================================
B D           Turkey  ======================================================================
B D       Coelacanth  ======================================================================
B D           Lizard  ======================================================================
B D       Budgerigar  ======================================================================
B D      Zebra finch  ======================================================================
B D          Chicken  ======================================================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

               Mouse  ------gt----------cctcgg-tct
                 Rat  ------gt----------cctcgg-tct
        Kangaroo rat  ------------------cct------t
      Naked mole-rat  ------gt-------ctccctctg-tcc
          Guinea pig  ------gt---ct-cctccctcag-ccc
            Squirrel  ------gt---ct-----cctcgg-tct
              Rabbit  ------aa---ccgggtctttggg-ccc
               Human  ------gt---ct-----cctcgggccc
               Chimp  ------gt---ct-----cctcgggccc
             Gorilla  ------gt---ct-----cctcgggccc
           Orangutan  ------gt---ct------ctcgggccc
              Gibbon  ------gt---ct-----cctcgggccc
              Rhesus  ------gt---ct-----cctagggccc
              Baboon  ------gt---ct-----cctagggccc
            Marmoset  ------gt---ct-----cctcgggtcc
     Squirrel monkey  ------gt---ct-----cctcggctcc
             Tarsier  ------gt---ct-----cctcgg-ccc
         Mouse lemur  ------gt---ct-----cctcg--acc
            Bushbaby  aagtccat---ct-----ccttc--ccc
          Tree shrew  ------gt---ct-----tctcag--cc
                 Pig  ------gt---ct-----tctcag-tcc
             Dolphin  ------------c-----tccttc-ccc
               Sheep  ------ct---tt-----tctcgg-ccc
                 Cow  ------gc---ct-----tctcgg-ccc
                 Cat  ------gt---ct-----cttcaa-ccc
                 Dog  ------gt---tt-----cctcaa-ctc
               Panda  ------gt---ct-----cctcaa-cgc
               Horse  ------gt---ct-----cctcggtccc
            Microbat  ------gt---ct-----cct----agc
             Megabat  ------gt---ct-----cat----ccc
            Hedgehog  ------at---ct-----cttcag-ccc
               Shrew  ------tt---cc-----ccttcg-ccc
            Elephant  ------gt---ct-----cctagt-ccc
          Rock hyrax  ------gt---cc-----ccgagt-ccc
             Manatee  ------gt---at-----cctcgg-ccc
           Armadillo  ------ct---ct-----cctcgg-ccc
             Opossum  ------gttccct---------------
     Tasmanian devil  ------gt---ct---------------
            Platypus  ----------------------------
      Painted turtle  ----------------------------
              Tenrec  ============================
             Wallaby  ============================
                Pika  ============================
              Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Fugu  ============================
        Atlantic cod  ============================
        Nile tilapia  ============================
           Zebrafish  ============================
       X. tropicalis  ============================
              Turkey  ============================
          Coelacanth  ============================
              Lizard  ============================
          Budgerigar  ============================
         Zebra finch  ============================
             Chicken  ============================
               Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 17 of 736 in window, 56695338 - 56695352, 15 bps 
B D            Mouse  c---------------tacccacttaaagt
B D              Rat  c---------------tacccacttaaagt
B D     Kangaroo rat  c---------------gagtcac------t
B D   Naked mole-rat  c---------------tatccccttcgagc
B D       Guinea pig  c---------------taccctctttgagt
B D         Squirrel  c---------------tatcccctcctagt
B D           Rabbit  c---------------gtcccgtttggagt
B D            Human  c---------------ttctcccttcgagt
B D            Chimp  c---------------ttcccccttcgagt
B D          Gorilla  c---------------ttctcccttcgagt
B D        Orangutan  c---------------ttctcccttcgagt
B D           Gibbon  c---------------ttctcccttcgagt
B D           Rhesus  c---------------ttctcccttcgagt
B D           Baboon  c---------------ttctcccttcgagt
B D         Marmoset  c---------------ttctcccttcgaat
B D  Squirrel monkey  c---------------gtatcccttcgaat
B D          Tarsier  c---------------ttccccctccgagt
B D      Mouse lemur  c---------------cttccccttcgagt
B D         Bushbaby  c---------------tttcctcttcgagt
B D       Tree shrew  c---------------cttccccctcgagt
B D              Pig  c---------------ttcccctttggagt
B D          Dolphin  c---------------ttctcccttcgagt
B D            Sheep  c---------------ttctcccttcgagt
B D              Cow  c---------------ttctcccttcaagt
B D              Cat  c---------------ttctcccttcgagt
B D              Dog  c---------------ttcctcctt--agt
B D            Panda  c---------------ttcccccttaaagt
B D            Horse  c---------------ttcccccttcgagt
B D         Microbat  t---------------ccctccctttttga
B D          Megabat  c---------------tcccctcttccagt
B D         Hedgehog  c--------------atccctctccacagt
B D            Shrew  tccaaatctcaggaggtttctctttagtgt
B D         Elephant  c---------------ttcccctctggagt
B D       Rock hyrax  c---------------ttcccccttcgagt
B D           Tenrec  c---------------ttccccctcggagt
B D          Manatee  c---------------ttcccccttcgagt
B D        Armadillo  c---------------ttttccctttgagt
B D          Opossum  -----------------ttccccataatct
B D  Tasmanian devil  -----------------ctttccataatct
B D         Platypus  c---------------taaccgcccacaga
B D   Painted turtle  ---------------atgtttctacaaaat
B D          Wallaby  ==============================
B D             Pika  ==============================
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Fugu  ==============================
B D     Atlantic cod  ==============================
B D     Nile tilapia  ==============================
B D        Zebrafish  ==============================
B D    X. tropicalis  ==============================
B D           Turkey  ==============================
B D       Coelacanth  ==============================
B D           Lizard  ==============================
B D       Budgerigar  ==============================
B D      Zebra finch  ==============================
B D          Chicken  ==============================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 17 and 18 in window
B D         Opossum 1bp
B D Tasmanian devil 1bp

Alignment block 18 of 736 in window, 56695353 - 56695368, 16 bps 
B D            Mouse  ----tattcaaaccgagacc
B D              Rat  ----cattcaaaccaagacc
B D     Kangaroo rat  ----cattcagatcgag---
B D   Naked mole-rat  ----cactcatattccggtc
B D       Guinea pig  ----tactcatattcagacc
B D         Squirrel  ----cattcatattcagacc
B D           Rabbit  ----cactcgcattggggcc
B D             Pika  ----tgctcgcactcagacc
B D            Human  ----cattcacattcagacc
B D            Chimp  ----cattcatatgcagacc
B D          Gorilla  ----cattcatattcagact
B D        Orangutan  ----cattcatattcagacc
B D           Gibbon  ----cattcatattcagacc
B D           Rhesus  ----cattcatattcagaac
B D           Baboon  ----cattcatattcagacc
B D         Marmoset  ----cattcatactcagata
B D  Squirrel monkey  ----cattcatactcagaca
B D          Tarsier  ----cactcatatccaaacc
B D      Mouse lemur  ----cactcatattcagagc
B D         Bushbaby  ----cacccatattcagact
B D       Tree shrew  --------------cagacc
B D              Pig  ----ctctcaaattcagacc
B D          Dolphin  ----ctttcatattcagacc
B D            Sheep  ----ctctcgtattcagacc
B D              Cow  ----ctctcgtattcagacc
B D              Cat  ----ctctcaaattcagacc
B D              Dog  ----ctctc-tattcagact
B D            Panda  ----ctctcatattcagacc
B D            Horse  ----atctcataagcggacc
B D         Microbat  ----gtctcatattgggacc
B D          Megabat  ----ttctcatactgagacc
B D         Hedgehog  ----ctctcaaatttggatc
B D            Shrew  ----ctctcatattcggacc
B D         Elephant  ----cagtcatattcggacc
B D       Rock hyrax  ----cagtc--attcagccc
B D           Tenrec  ----cactc----tcagact
B D          Manatee  ----cactcatattcggacc
B D        Armadillo  ----cactcttactcggacc
B D          Opossum  ----gtttaat---------
B D  Tasmanian devil  ----ggttaatgtttaatt-
B D         Platypus  -------------taggatt
B D   Painted turtle  aatgccttactac-------
B D          Wallaby  ====================
B D           Alpaca  NNNNNNNNNNNNNNNNNNNN
B D             Fugu  ====================
B D     Atlantic cod  ====================
B D     Nile tilapia  ====================
B D        Zebrafish  ====================
B D    X. tropicalis  ====================
B D           Turkey  ====================
B D       Coelacanth  ====================
B D           Lizard  ====================
B D       Budgerigar  ====================
B D      Zebra finch  ====================
B D          Chicken  ====================
B D            Sloth  NNNNNNNNNNNNNNNNNNNN

Inserts between block 18 and 19 in window
B D Tasmanian devil 8bp

Alignment block 19 of 736 in window, 56695369 - 56695410, 42 bps 
B D            Mouse  aa-agcttctgt----t-cgctta-ttcagca--------tttttatca-g--cttgatt
B D              Rat  aa-agcttccgt----t-tgctta-ttcagca--------tttttatca-g--cttgatt
B D     Kangaroo rat  ---cactttctt----t-cgctta-ttcagcatttttttttttttacca-agcctgggtt
B D   Naked mole-rat  aaacgctttcat----t-tgctca-ttcagca--------tttttacca-g--actaatt
B D       Guinea pig  aaccgctttcct----t-tgctaa-ttcagca--------ttttaacca-g--acttatt
B D         Squirrel  aaaagctttcat----t-tgctta-ttcagca--------tttttagca-g--cctgatt
B D           Rabbit  acacactttcat----g-tgctta-ttcagca--------tttttaccg-g--cccaatt
B D             Pika  gaaagcctccga----gttgctgg-ctcagca--------cttgcgccg-g--cctcacg
B D            Human  aaacgctttcat----t-tgttta-ttcagca---------ttttacca-g--cctgatt
B D            Chimp  aaacgctttcat----t-tgttta-ttcagca---------ttttacca-g--cctgatt
B D          Gorilla  aaacgctttcat----t-tgttta-ttcagca---------ttttacca-g--cctgatt
B D        Orangutan  aaacgctttcat----t-ttttta-ttcagca---------tttcacca-g--tctgatt
B D           Gibbon  aaacgctttcat----t-tgttta-ttcagca---------ttttacca-g--cctgatt
B D           Rhesus  aaacgctttcat----t-tgttta-ttcagca---------ttttacca-g--cctgatt
B D           Baboon  aaacgctttcat----t-tgttta-ttcagca---------ttttacca-g--cctgatt
B D         Marmoset  agactctttcat----t-tgttta-ttcagca---------ttttacca-g--cctgatt
B D  Squirrel monkey  agactctttcat----t-tgtttg-ttcagca---------ttttacca-g--cctgatt
B D          Tarsier  gaacgctttcat----g-tgttta-ttcagca--------tttttaccg-g--cctgatt
B D      Mouse lemur  aaacgctttcat----t-tgttta-ttcagca--------tttctacca-g--cctgctt
B D         Bushbaby  aaccgctttcat----t-tgttta-ttcagca--------tttttacca-g--cctgatt
B D       Tree shrew  aaacgctttcatttgct-tgctta-ttcagca--------tttttacta-g--cttgatt
B D              Pig  aaatgctttcat----t-tgctta-ttcagca----------tttaaca-g--cttgatt
B D          Dolphin  aaacgctttcat----t-tgctta-ttcagca--------tttttaaca-g--cctgact
B D            Sheep  aaaagctttcga----t-tgctta-ttcagca--------tttttannn-n--nnnnntt
B D              Cow  aaaagctttcgt----t-tgctta-ttcagca--------tttttaaga-g--cctgatt
B D              Cat  aaacgctttcat----t-tgctta-ttcagca--------tttttatca-g--cccgatt
B D              Dog  aaacgctttcat----t-tgctta-ttcagca--------tttttatca-g--cctgatt
B D            Panda  aaatgctttcat----t-tactta-ttcagca--------tttttatca-g--cctgatt
B D            Horse  aaacgctttcat----t-tgctta-ttcagca--------tttttatga-g--cctgatt
B D         Microbat  aaacgctttaat----g-tgctta-ttcagca--------cttttatca-g--cataatt
B D          Megabat  aaacgctttcat----t-tgctta-ttcagca--------tttttatca-g--cctgact
B D         Hedgehog  caaggatgtcat----t-tgctta-ttcagca---------ttttctca-g--cctgatt
B D            Shrew  gacagattccat----t-tgctta-ttcagca---------ttttatca-g--cctgatt
B D         Elephant  gaacgctctcat----t-tgctta-ctcagca--------tttttacca-g--tctgatt
B D       Rock hyrax  aaacgctctcat----t-tgctta-ttcagca--------tttttacca-g--tctgagt
B D           Tenrec  aaacgctctcat----t-tgctta-ttcagca--------ttttcacca-g--tctcatt
B D          Manatee  aaacgctctaat----t-tgcttatttcagcg--------tttttacca-g--cctgatt
B D        Armadillo  aaacgctttcat----t-tgctga-ttcagca--------tttttaccctg--tctgatt
B D          Opossum  ----attttaat----t-tgacta-ttcaata--------tatattttg-t--tttgatt
B D  Tasmanian devil  ------tttaat----t-tgacta-accaata--------tatatttat-t--catgatt
B D          Wallaby  -aatgttttaat----t-tgacta-ttcggta--------tatatttag-t--c-tgatt
B D         Platypus  aaatgatctcat----t-ggccta-ttcagca--------tattttcgg-g--tttgatt
B D   Painted turtle  -agcgctatcat----t-aaacta-ttccgca--------tatttccta-t--attaatt
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Fugu  ============================================================
B D     Atlantic cod  ============================================================
B D     Nile tilapia  ============================================================
B D        Zebrafish  ============================================================
B D    X. tropicalis  ============================================================
B D           Turkey  ============================================================
B D       Coelacanth  ============================================================
B D           Lizard  ============================================================
B D       Budgerigar  ============================================================
B D      Zebra finch  ============================================================
B D          Chicken  ============================================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 20 of 736 in window, 56695411 - 56695437, 27 bps 
B D            Mouse  t-t--g-cactctgtttgcg--gcg--cccct-ggg
B D              Rat  t-t--g-tgat--gtttgag--gcg--ccctt-ggg
B D     Kangaroo rat  t-t--g-ctgtctgtttgtg--ccg--cccct-gag
B D   Naked mole-rat  t-t--g-t----tatttgtg--acg--gctct-ggg
B D       Guinea pig  t-g--g-ttgtgtatttgcg--ccg--gtcct-ggg
B D         Squirrel  t----g-ctttctgcttgtg--cctccccccc-ccc
B D           Rabbit  t-t--g-ttgtctgtctgtg--cgg--ccc---ggg
B D             Pika  c-t--g-ctgtctgtgcgtg--ccg--ccccgggga
B D            Human  t-t--g-ctgtctttttgtg--ccg--cttct-ggg
B D            Chimp  t-t--g-ctgtctttttgtg--ccg--cttct-ggg
B D          Gorilla  t-t--g-ctgtctttttgtg--ccg--cttct-ggg
B D        Orangutan  t-t--g-ttgtctttttg-g--ccg--cttct-ggg
B D           Gibbon  t-t--g-ctgtctttttgtg--ccg--cttct-ggg
B D           Rhesus  t-t--g-ctgtctttttgtg--cct--cttct-ggg
B D           Baboon  t-t--g-ctgtctttttgtg--cct--cttct-ggg
B D         Marmoset  t-t--g-ctgtctttttgtg--tcg--cttct-ggg
B D  Squirrel monkey  t-t--g-ctgtctttttatg--tcg--cttct-ggg
B D          Tarsier  c-t--g-ctgtc----tgtg--ccg--cttct-gcg
B D      Mouse lemur  t-t--g-ctgtc----tgtg--ccg--ctcct-ggg
B D         Bushbaby  t-t--g-ctgtctgtttgtg--tgg--ctcct-ggg
B D       Tree shrew  t-t--g-ctgtctgtttgtg--ctg--cccct-ggg
B D              Pig  t-t--g-ctgtctgtttgcg--ctg--cccct-ggg
B D          Dolphin  t-t--g-ctgtctgtttgcg--ctg--cccct-ggg
B D            Sheep  t-t--g-----ctgtttgcg--ctg--cccct-ggg
B D              Cow  t-t--g-----ctgtttgcg--ctg--cccct-ggg
B D              Cat  g-t--g-tcgtctgtttgcg--ctg--ctcct-ggg
B D              Dog  t-t--g-ttgtctgtttgcg--ctg--ccgcc-gga
B D            Panda  -------ttgtctgtttgcg--ctg--ccgct-agg
B D            Horse  t-t--g-ctgtctgtttgtg--ctg--cccct-ggg
B D         Microbat  t-t--g-ctgtctatttgcg--ctg--ctcct-cgg
B D          Megabat  t-t--g-ctgtctgtttgcg--ttg--ttcct-cgg
B D         Hedgehog  t-t--g-ctgcctgtttgcg--ctg--ccccc-ggg
B D            Shrew  t-t--t-ccgtctgtttgca--ctg--cccct-tgg
B D         Elephant  t-t--g-cagtctgtctacg--ctg--ccctt-ggg
B D       Rock hyrax  t-t--g-ctgtctgtttacg--ctg--cccct-ggg
B D           Tenrec  t-t--g-ctgtctgtttacg--ctg--ctcct-ggg
B D          Manatee  t-t--g-ctgtctgtttacg--ccg--cctct-ggg
B D        Armadillo  t-t--g-ttgtctgtttgcg--cgg--cccct-ggg
B D          Opossum  ttt--g------------ag--ttc--caatt-ggg
B D  Tasmanian devil  ttt--g-ctttctctttaag--tta--caata-ggg
B D          Wallaby  ttt--acctttctctttgag--tta--caatt-ggg
B D         Platypus  t-tc-a-ccgtcggtgggac--tta--ccact-ggg
B D          Chicken  ---ttg-ctctttgcgtgcggctta--ccgcc-tgg
B D   Painted turtle  -----g-cactctctgtgcgactta--ccact-acg
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Fugu  ====================================
B D     Atlantic cod  ====================================
B D     Nile tilapia  ====================================
B D        Zebrafish  ====================================
B D    X. tropicalis  ====================================
B D           Turkey  ====================================
B D       Coelacanth  ====================================
B D           Lizard  ====================================
B D       Budgerigar  ====================================
B D      Zebra finch  ====================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 21 of 736 in window, 56695438 - 56695473, 36 bps 
B D            Mouse  a-agacgtcaaacactct--tattc-attg-tattt-agt-ca
B D              Rat  a-agacgtcaaacactcc--tattc-attg-tattt-agt-ca
B D     Kangaroo rat  a-agatgtcaaacacctc--tgttc-cttg-cattt-agt-ca
B D   Naked mole-rat  a-agatgtcaaacaccca--ttttc-tttg-tattt-agt-ca
B D       Guinea pig  a-agatgtcaaacacccg--ttttc-tttg-tattt-agt-ca
B D         Squirrel  a-agatgtcaaataccca--ttttc-attc-tattt-agt-ca
B D           Rabbit  a-ggatgtcaaaccccca--ttttc-cttg-tgttc--gt-ca
B D             Pika  g-ggacgtccgacacccattttttc-ctgg-tgtcccagt-ca
B D            Human  a-agatgtcaaacaccca--ttttc-attg-tattt-agt-ca
B D            Chimp  a-agatgtcaaacaccca--ttttc-attg-tattt-agt-ca
B D          Gorilla  a-agatgtcaaacaccca--ttttc-attg-tattt-agt-ca
B D        Orangutan  a-agatgtcaaacaccca--ttttc-attg-tattt-agt-ca
B D           Gibbon  a-agatgtcaaataccga--ttttc-attg-tattt-agt-ca
B D           Rhesus  a-agatgtcaaacaccca--ttttc-attg-tattt-agt-ca
B D           Baboon  a-agatgtcaaacaccca--ttttc-attg-tattt-agt-ca
B D         Marmoset  a-agatgtcaaacaccca--ttttc-gtgg-tattt-agt-ca
B D  Squirrel monkey  a-agatgtcaaaca--ca--ttttc-gttg-tattt-agt-ca
B D          Tarsier  a-agacgtcaaacaccca--ttttt-attg-tattt-agt-ca
B D      Mouse lemur  a-agatgtcaaacaccca--ttttc-attg-tattt-agt-ca
B D         Bushbaby  a-tgatgtcaaacaccca--ttttc-attg-tattt-agt-ca
B D       Tree shrew  a-agatgtcaaacaccca--ttttc-attg-tattt-agt-ca
B D              Pig  a-aggtgtcaaacaccct--ttttc-gttg-cattt-agt-ca
B D          Dolphin  a-aggtgtcaaacacctc--ttttc-attg-tattt-agt-ca
B D            Sheep  a-aggtgtcaaacacctc--ttttc-attg-tattt-agt-ca
B D              Cow  a-aggtgtcaaacacctc--ttttc-attg-tattt-agt-ca
B D              Cat  a-aggtgtcaaactccca--ttttc-attg-tattt-agt-ca
B D              Dog  a-aggtgtcaaacatcca--ttttc-attg-tattt-agt-ca
B D            Panda  a-aggtgtcaaacaccca--ttttc-attg-tattc-agt-ca
B D            Horse  a-aggtgtcaaacaccca--ttttc-attg-tattt-agt-ca
B D         Microbat  a-aggtgtcaaacaccga--atttc-attg-tattt-agt-ca
B D          Megabat  a-aggtgtcaaacaccca--ttttc-attg-tattt-agt-ca
B D         Hedgehog  a-aggtgtcaaacaccta--tttttgattg-tcttt-agt-ca
B D            Shrew  a-aggtgtcaaatgccca--ttttcaattg-tattt-agt-ca
B D         Elephant  a-agatgtcaaacaccca--ttttc-attg-tattt-agt-ca
B D       Rock hyrax  a-cgatgtcaaacaccca--ttttc-gttg-tattt-agt-ca
B D           Tenrec  a-agatgtcaaacaccca--ttttc-attg-tattt-agt-ca
B D          Manatee  a-acatgtcaaacaccca--ttttc-attg-tattt-agt-ca
B D        Armadillo  a-agaagtcaaacaccca---tttc-attg-tattt-agt-ca
B D          Opossum  c-tgatgttaaatattca--tttcc-attgttattt-agt-aa
B D  Tasmanian devil  c-agatgttaaatattca--tttct-attgttattt-aga-aa
B D          Wallaby  c-agatgttaaatattca--tttct-attgttattt-agt-aa
B D         Platypus  gcagatgttaaatattca--tttcc-attg-tattt-agc-ca
B D          Chicken  c-aggtattacgcgggcg--ttgct-gttg-tggta-ggg---
B D   Painted turtle  t-aggtatttaatattcg--tctct-attg-tatta-ggaa--
B D       Coelacanth  a-aaatttaaaataccca--tttca-acta-c-tgt-agt-gg
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Fugu  ===========================================
B D     Atlantic cod  ===========================================
B D     Nile tilapia  ===========================================
B D        Zebrafish  ===========================================
B D    X. tropicalis  ===========================================
B D           Turkey  ===========================================
B D           Lizard  ===========================================
B D       Budgerigar  ===========================================
B D      Zebra finch  ===========================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 22 of 736 in window, 56695474 - 56695586, 113 bps 
B D            Mouse  cccaggtgcggagcc-agccagaaacagacggcgg-aaggagtttccc-ggactgagctgtcactcaccg
B D              Rat  cccaggtgcggagcc-agccagaaacagacggcgg-aaggagtttccccggactgagctgccactcaccg
B D     Kangaroo rat  tccaggtgaggagccaagcccgcagaagacagcgg-aaggagtttccc-ggactgcgctgtcactcaccc
B D   Naked mole-rat  cccaggtgcggagcc-agcctgaagaagacagcgg-aaggagtttccc-ggactgcgctgtcgctcaccg
B D       Guinea pig  tccaggtgcggagcc-agcctgaaaaagacagcgg-aaggaattttcc-ggactgcgctgccgctcacag
B D         Squirrel  cccaggtgcggagcc-agcctgaaaaagacagcgg-aaggagtttccc-ggaccgcgctgtcactcaccg
B D           Rabbit  ctcaggtgcggagac-ggaccgagagagacagcgg-aaggagtttccc-gggctgtgccgtcgctcaccg
B D             Pika  cccaggtgcggagac-gg-tcgcaggagacggcgg-aaggagtttcccggggccgcgctgtcgctcaccg
B D            Human  cccaggtggggagct-agcctgaaagagacagcgg-aaggagtttcct-ggactgcgctgtcgctcaccg
B D            Chimp  cccaggtggggagct-agcctgaaagagacagcgg-aaggagtttcct-ggactgcgctgtcgctcaccg
B D          Gorilla  cccaggtggggagct-agcctgaaagagacagcgg-aaggagtttcct-ggactgcgctgtcgctcaccg
B D        Orangutan  cccaggtggggagcc-agcctgagagagacagcgg-aaggagtttcct-ggactgcgctgtcgctcactg
B D           Gibbon  cccaggtggggagcc-agcctgaaagagacagcgg-aaggagtttcct-ggactgcgctgtcgctcaccg
B D           Rhesus  cccaggtggggagcc-agcctgaaagagacagcgg-aaggagtttcct-ggactgcgctgtagctcaccg
B D           Baboon  cccaggtggggagcc-agcctgaaagagacagcgg-aaggagtttcct-ggactgcgctgtagctcaccg
B D         Marmoset  cccaggtggggggcc-agcctgaaagagatagcgg-aaggagtttcct-ggactgccctgccgctcaccg
B D  Squirrel monkey  cccaggtggggagct-agcctgaaagagacagcgg-aaggagtttcct-ggacctccctgtcgctcaccg
B D          Tarsier  cccaggtggggagcc-agcctgagagagacggcgg-aaggagtttcct-ggactgcgctgtcgctcagcg
B D      Mouse lemur  cccaggtggggagcc-agcccgaaaggaacagcgg-aaggagtttcct-ggactgtgctgtcgctcaccg
B D         Bushbaby  cccaggtggggagcc-agcccgaaagggacggcgg-aaggagtttccc-ggactgcgctgtcgctctccg
B D       Tree shrew  cccaggtgcggagca-agcctg--agagacagcgg-aaggagttgccc-ggattgggctgtcgctcacga
B D              Pig  cccaggtgcagagca-cgattgaaagagacagcgg-aaggactttccc-agactgtgctgtcgttcagca
B D          Dolphin  cccaggtgctgagca-agattgaaagagacagcgg-aaggactttccc-ggactgtgctgtcgctcaacg
B D            Sheep  cccaggtgcagagcg-agattgaaagagacagcgg-aagaactttccc-ggactgtgctgtcgctcaacg
B D              Cow  cccaggtgcagagcg-agattgagagagacagcgg-aagaactttccc-ggactgtgctgtcactcaacg
B D              Cat  cccaggtgcagagca-agcttgaaagagacagcgg-aaggactttccc-ggactgcactgtcgctcagct
B D              Dog  cccaggtgcagagca-agcttgaaagagacagcgg-aagaactttccc-ggactgcactgtcgctcagca
B D            Panda  cccaggtgcagagcg-agcttgaaagagacagcgg-aaggactttccg-ggactgcactgtcgctcagcg
B D            Horse  cccaggtgccgagca-ggcttgaaagagtcagcgg-aaggacttacc--ggaccgcactgtcgctcactg
B D         Microbat  cccaggtgcccagca-agct-ggaggagacagcgg-aaggactttccc--gacggcgctgtcgctcacgg
B D          Megabat  cccaggtgcggagcc-agctcgaaagagacagcgg-aaggactttccc-ggaccgcactgtcgctcaccg
B D         Hedgehog  cccaggtgcggggag-agcctgccaaggacggcgg-aaggactttccc-cgacttcgctgtcgctcagcg
B D            Shrew  ctcaggtgcggagcc-agcctgaaagagacagcgg-aaggactttccc-ggactacagtgtcgctcagca
B D         Elephant  cccaggtgcagagca-agtctgaaagagacaacgg-aaggagcttccc-ggacagcgctgtcgctcaacg
B D       Rock hyrax  cccaggtgcagggcc-agtctg--agagacaacag-aaggagcttcct-ggacagcgctgtcgctcaacg
B D           Tenrec  cccaggtgcagagca-a-tctgaaagagacaacgg-aaggagtttccc-ggcctgcgctgtcgctcaacg
B D          Manatee  cccaggtgcagaaca-agtctgaaagagacaacgg-aaggagtttccc-gtactgcgctgtcgctcaacg
B D        Armadillo  cccaggtgcggagct-agcccgagagagacagcgg-aaggagttcccc-gagccgcgctgctactcaccg
B D          Opossum  tccaggtgcggagct-ctcctaaaagagagaacgg-aaggagttaccg-ggattatactgtctgttacca
B D  Tasmanian devil  tccaggtgctgagta-ctact--aagagagaacgg-aaggagtttcca-ggattgtactgtcagttacct
B D          Wallaby  tccaggtgctgagca-cgcctaaaagagagaacgg-aaggagtttcca-ggattactctgtctgttacct
B D         Platypus  tccaggtgccgagca-tgcctgc-ggagagaacgg-aaggagcttgcg-ggattttgctgtcggtcccag
B D          Chicken  accaggtgctgagca-cgtccgcgagaggcagcgg-aaaggcc-gccg-gccccgcgctgtccgtcatct
B D       Budgerigar  cccaggtgccgggcc-cggtggcggggcagagcgg-aagggcc-gtca-gcgcttcgctgtccgtcatgt
B D   Painted turtle  tccaggtgctgagca-tgcctgcaaaagaaagcgg-aagagccttcct-ggattatgctgtctatcatca
B D       Coelacanth  tcttggtgaggagca-tgcctgatggaaggagcagaaaaaagattcca-ggattgtgctgtcggtcatac
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Fugu  ======================================================================
B D     Atlantic cod  ======================================================================
B D     Nile tilapia  ======================================================================
B D        Zebrafish  ======================================================================
B D    X. tropicalis  ======================================================================
B D           Turkey  ======================================================================
B D           Lizard  ======================================================================
B D      Zebra finch  ======================================================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

               Mouse  -gcctgcaccaattacaacgcagattgctcgcgggcccacctct----tt-t
                 Rat  -gcctgcaccaattacaacgcagattgcccgcgggcccacctct----tt-t
        Kangaroo rat  -atccgaagcaatcagcacgcagcttgctctcgggcccgcctct----tt-a
      Naked mole-rat  -gctcccaccaatcaccatgcagttttccctcgagcccgcctct----tt-g
          Guinea pig  -gcctgcaccaatcaccaagcagttcgccctcgggcccgcctct----tt-a
            Squirrel  -aacgacaccaatcatcacgcagcttgccctcggaccctcctct----tt-g
              Rabbit  -tcgggcgccaatcaacacgcagttttctctcgggcccgcctct----tt-g
                Pika  -gcctgcaccaatcaacacgcggcgtgctgccgggcccgcctct----tg-g
               Human  -acccgcaccaatcaccatgcagcttgccctcggacccgcccct----tt-t
               Chimp  -acccgcaccaatcaccatgcagcttgccctcggacccgcccct----tt-t
             Gorilla  -acccgcaccaatcaccatgcagcttgccctcggacccgcccct----tt-t
           Orangutan  -acccgcaccaatcaccacgcagcttgccctcggacccgcccct----tt-t
              Gibbon  -acccgcaccaatcaccacgcagtttgccctcggacccgcccct----tt-t
              Rhesus  -acccgcaccaatcaccacgcagcttgccctcggacccgcccct----tt-t
              Baboon  -acccgcaccaatcaccacgcagcttgccctcggacccgcccct----tt-t
            Marmoset  -gcccgtaccaatcaccacgcagctcgccctcaggcccgcctct----tt-g
     Squirrel monkey  -gccggcaccaatcaccacgcagcttgccctcgggcccgcctct----tt-g
             Tarsier  -gcccgcaccaaccaccacgcagcttgtcctcgggcccgcctct----tt-g
         Mouse lemur  -gctcgcaccaatcaccatgcagctcgctcttgggcccgcctct----tc-a
            Bushbaby  -gatcgcaccaatcaacacgcagcttgcgcttgggcccgcctct----tt-g
          Tree shrew  -ccctgctccaatcactacgctgcttgccctcaggcccgcctct----tt-g
                 Pig  -gactacaccaatcaccacgcagcttcctctcgggcccgcctct----ttgg
             Dolphin  -gaccaaaccaatcagcatgcagcttgccttcgggccctcctct----tt--
               Sheep  -ggccaaaccaatcatcacgcaggttgcctccgggccctcctct----tt-g
                 Cow  -ggccaaaccaatcatcacgcaggttgcctccgggccctcctct----tt-g
                 Cat  -ggccgcaccaatcaccacgcagcttgccctcggaccctcctct----tt-g
                 Dog  -gcccgcaccaatcaccacgcagcttgacctcgggccctcctct----tt-g
               Panda  -gcccgcaccaatcaccacgcagcttgacctcgggccctcctct----tc-g
               Horse  -gcccgcaccaatcaccacgctgcttgtcctcggaccctcctct----tt-g
            Microbat  -ccccgcaccaatcaccgcgcagcttgccctcgggcccacccct----ttgg
             Megabat  -gcccacaccaatcaccacgcagcttgccctcggaccctcctct----ttgg
            Hedgehog  cggccacaccaatcaccgcacggctggccctcggaccctcctct----ccgg
               Shrew  -ggtcacaccaatcggcgcacagtgtgccccagggccctcctct----tt-g
            Elephant  -actctcaccaatcgcagcacagagtgccctcgggcccgcctct----tt-g
          Rock hyrax  -tcttggaccaatcactgcacatagtggcctagggcccgcctcc----tt-g
              Tenrec  -gctcgtccctatcagcgcgcagattgccctggggcccgcctct----tt-g
             Manatee  -gctcacaccaatcacagcacagagtgccctcgtgcccgcctct----tt-g
           Armadillo  -agccgcaccaatcaccgcgcagctcgccctccggcccgcctcc-----c-g
             Opossum  -tctacagccaatctcaaagtcttcttctttgagtcccgcctcc----tt-g
     Tasmanian devil  -tctgcagccaatctcaaaatcattttctttgaggcccgcctct----tt-g
             Wallaby  -tctacagccaatctcaaagtcgttttctacgagacccgcctcc----tt-g
            Platypus  -ttttgcaccaatcgcaagggcgcctttccgtgatcccgccttt----tt-g
             Chicken  -cccgcggccactggcggggctgcagggccgccgggccgcccccg-------
          Budgerigar  -cctttggccactgggagggaggctgggcggtggggccgccccc--------
      Painted turtle  -tcgagcaccaattggaaggccccttttccttgggtccgccctt-cgg----
          Coelacanth  -tccttagccaataggaagtcaaact-cctttataccctccttc----ct-a
              Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Fugu  ====================================================
        Atlantic cod  ====================================================
        Nile tilapia  ====================================================
           Zebrafish  ====================================================
       X. tropicalis  ====================================================
              Turkey  ====================================================
              Lizard  ====================================================
         Zebra finch  ====================================================
               Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 22 and 23 in window
B D      Budgerigar 1bp
B D  Painted turtle 1bp

Alignment block 23 of 736 in window, 56695587 - 56695666, 80 bps 
B D            Mouse  gg--ggtgtgt--cacaagtgagtgatag-actgagcc-----gcccggccct-gctcagcccagcccac
B D              Rat  gg--ggtgtgt--cacaagtgagtgatag-actgagcc-----gcccggccct-acacagcccagcccac
B D     Kangaroo rat  gg--ggcgtgt--ccctagtgagtgatag-acggagcc-----gcccggccca-gcgcagcccagcccac
B D   Naked mole-rat  gg--ggtgtgt--ccccagtgagtgatag-acggagcc-----gcccggccct-gctcagcccagcccac
B D       Guinea pig  gg--ggtgtgt--ccctagtgagtgatag-acagagcc-----tcccggccca-gctcagcccagcccac
B D         Squirrel  gg--ggtgtgc--ccttagtgagtgatag-acggagcc-----gcccggccct-actcagcccagcccac
B D           Rabbit  ggg-ggcgtgt--ccctagtgagtgatag-acggagcc-----gcccggccct-gctcagcccagcccac
B D             Pika  gggaggcgtgt--cccccgtgagtgatag-acggagcc-----gcccggccct-gctcagcccagcccac
B D            Human  ag--ggcgtgt--ccccagtgagtgatag-acggagcc-----gccctgccct-gctcagcccagcccac
B D            Chimp  ag--ggcgtgt--ccccagtgagtgatag-acggagcc-----gccctgccct-gctcagcccagcccac
B D          Gorilla  ag--ggcgtgt--ccccagtgagtgatag-acggagcc-----gccctgccct-gctcagcccagcccac
B D        Orangutan  ag--ggcgtgt--ccccagtgagtgatag-acggagcc-----gccctgccct-gctcagcccagcccac
B D           Gibbon  ag--ggcgtgt--ccccagtgagtgatag-acggagcc-----gcccggccct-gctcagcccagcccac
B D           Rhesus  ag--ggcgtgt--ccccagtgagtgatag-actgagcc-----gcccggcccc-gctcagcccagcccac
B D           Baboon  ag--ggcgtgt--ccccagtgagtgatag-actgagcc-----gcccggccct-gctcagcccagcccac
B D         Marmoset  ag--ggcgtgt--ccccagtgagtgatag-acggagcc-----gcccggccct-gctcagcccagcccac
B D  Squirrel monkey  ag--ggcgtgt--ccccagtgagtgatag-acggagcc-----gcccggccct-gcgcagcccagcccac
B D          Tarsier  gg--ggcgtgt--ccacagtgagtgatag-acggagcc-----gcccggccct-gctcagcccagcccac
B D      Mouse lemur  gg--ggcgtgt--ccccagtgagtgatag-acggagct-----gcccggccct-gctcagcccagcccac
B D         Bushbaby  gg--ggcgcgt--ctctagtgagtgatag-actgagcc-----gcccggccct-gctcagcccagcccac
B D       Tree shrew  gg--ggcgtgt--ccctagtgagtgatag-acggagcc-----gcccggccca-gatcagcccagcccac
B D              Pig  gg--ggcgtgt--ccctagtgagtgatag-acggagcc-----gcccgg-ccc-gttcagcccagcccac
B D          Dolphin  gg--ggcgtgt--ccctagtgagtgatag-acggagcc-----gcccggcccc-gctcagcccagcccac
B D            Sheep  gg--ggcgtcc--ccctagtgagtgatag-acggagcc-----gcccggcccc-gctcagcccagcccac
B D              Cow  gg--ggcgtgc--ccctagtgagtgatag-acggagcc-----gcccggcccc-gctcagcccagcccac
B D              Cat  ag--ggcgtgt--ccctggtgagtgattg-acggagcc-----gcccggccca-gctcaggccagcccac
B D              Dog  ag--ggcgtgt--ccctggtgagtgatag-acggagcc-----gcccggccca-gctcgggccagcccac
B D            Panda  gg--ggcgtgt--ccccagtgagtgatag-acggagcc-----gcccggccca-gctcaggccagcccac
B D            Horse  gg--ggcgtga--ccctaatgagtgatag-acggagtc-----gcccggcccc-gctcagcccagcccac
B D         Microbat  gg--ggcgtgt--ccttggtgagtgatag-acagagcc-----gcccgg-ccc-gctcagcccagcccac
B D          Megabat  gg--ggcgtgt--ctctagtgagtgatag-acagagct-----gcccggcccc-gctcagcccagcccac
B D         Hedgehog  gg--ggcgtgt--cgctcgtgagtgatag-acggagcc-----gcccggcccc-gcgcagcccagcccac
B D            Shrew  tg--ggcgtgt--ccctagtgagtgatag-acggagcc-----gcccggcccc-actcagcccagcccac
B D         Elephant  gg--ggcgtgt--ccctagtgagtgatag-acggagcc-----gcccggcccc-gctcgacccagcccac
B D       Rock hyrax  gg--ggcgtgt--ccctagtgagtgatag-acggagcc-----gcccggccct-gctgaacccagcccac
B D           Tenrec  gg--ggcgtgt--ccctagtgagtgatagcccgaagcc-----gcccggccccgggtcaacccagcccac
B D          Manatee  gg--ggcgtgt--ccctagtgagtgatag-acggagcc-----gcccggcccc-gctcaacccagcccac
B D        Armadillo  ag--ggcgtgt--ccccagtgagtgatag-acggcgcc-----gcccggcccc-gctcagcccagcccac
B D          Opossum  gg--ggtgggc--cactagtgattgatag-gcagagac-----acccctccca-actcagcccagcccac
B D  Tasmanian devil  ga--ggtgggt--cattggtgattgatag-gcagagac-----actcagccca-actcagcccagcccac
B D          Wallaby  ga--ggtgggt--cactggtgattgatag-gcagagac-----acccagccca-actcagcccagcccac
B D         Platypus  gg--ggcgcgg--ccctggtgactgatag-gcagggtc-----gcccggccca-gcccggcccagcccac
B D          Chicken  gg--ggcggg---ctc--gggagcggggg-gctgcggc-----tcccggccca-gcccggccctgcccac
B D      Zebra finch  gg--ggcggg---ctcgggggggcggtgg-accacgg------gaccggccca-gcccggccctgcccac
B D       Budgerigar  ag--ggcggg---cccgagggagcagggg-gccgctgc-----gcccggccca-gcccagccctgcccac
B D   Painted turtle  gg--ggggggtgcctctggtgactgatag-actgagacgcccggcccagccca-gcccagcccagcccac
B D       Coelacanth  --taggcgcgt--ctttattgatagacag-aaggaatt-----gctttgccta-gccgagcccaacccac
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Fugu  ======================================================================
B D     Atlantic cod  ======================================================================
B D     Nile tilapia  ======================================================================
B D        Zebrafish  ======================================================================
B D    X. tropicalis  ======================================================================
B D           Turkey  ======================================================================
B D           Lizard  ======================================================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

               Mouse  gttgctgc-tta-gattgaaatg
                 Rat  gttgctgc-tta-gattgaaatg
        Kangaroo rat  gttgctgc-tta-gattgaaatg
      Naked mole-rat  gttgctgc-tga-gattgaaatg
          Guinea pig  gttgctgc-tga-gattgaaatg
            Squirrel  gttactgc-tta-gattgaaatg
              Rabbit  gttgctgc-tta-gattgaaatg
                Pika  gccgctgc-tta-gattgaaatg
               Human  gttgctgc-tta-gattgaaatg
               Chimp  gttgctgc-tta-gattgaaatg
             Gorilla  gttgctgc-tta-gattgaaatg
           Orangutan  gttgctgc-tta-gattgaaatg
              Gibbon  gttgctgc-tta-gattgaaatg
              Rhesus  gttgctgc-tta-gattgaaatg
              Baboon  gttgctgc-tta-gattgaaatg
            Marmoset  gttgcagc-tta-gattgaaatg
     Squirrel monkey  gttgctgc-tta-gattgaaatg
             Tarsier  gttgctgc-tta-gattgaaatg
         Mouse lemur  gttgctgc-tta-gattgaaatg
            Bushbaby  gttgctgc-ttg-gattgaaatg
          Tree shrew  gttgctgc-tta-gattgaaatg
                 Pig  gttgctgc-tta-gattgaaatg
             Dolphin  gttgctgc-tta-gattgaaatg
               Sheep  gttgctgc-tta-gattgaaatg
                 Cow  gttgctgc-tta-gattgaaatg
                 Cat  gttgctgc-tta-gattgaaatg
                 Dog  gttgctgc-tta-gattgaaatg
               Panda  gttgctgc-tta-gattgaaatg
               Horse  gttgctgc-tta-gattgaaatg
            Microbat  gttgctgc-tta-gattgaaatg
             Megabat  gttgctgc-ttg-gattgaaatg
            Hedgehog  gttgctgcttta-gattgaaatg
               Shrew  gttgctgc-tta-gattgaaatg
            Elephant  gttgctgc-tta-gattgaaatg
          Rock hyrax  gttgctgc-tta-gattgaaatg
              Tenrec  gttgctgc-ttaggattgaaatg
             Manatee  gttgctgc-tta-gattgaaatg
           Armadillo  gctgctgc-tta-gattgaaatg
             Opossum  tttactgc-tta-gattgaaatg
     Tasmanian devil  tttactgc-tta-gattgaaatg
             Wallaby  tttactgc-tta-gattgaaatg
            Platypus  gttgctgc-ttg-gattgaaatg
             Chicken  gttgcc-c-tga-ggttgaaatg
         Zebra finch  gctgcc-c-tga-ggttgaaatg
          Budgerigar  gttgcc-c-tga-ggttgaaatg
      Painted turtle  gttgct-g-tga-gattgaaatg
          Coelacanth  ttagcta--tta-gtctgaaatg
              Alpaca  NNNNNNNNNNNNNNNNNNNNNNN
                Fugu  =======================
        Atlantic cod  =======================
        Nile tilapia  =======================
           Zebrafish  =======================
       X. tropicalis  =======================
              Turkey  =======================
              Lizard  =======================
               Sloth  NNNNNNNNNNNNNNNNNNNNNNN

Alignment block 24 of 736 in window, 56695667 - 56695723, 57 bps 
B D            Mouse  cagaactcaagcctctttcagcccggcacagacttccttttactctttcc---tt--tggca
B D              Rat  cagaactcaagcctctttcagccgggcacagacttccttttactctttcc---tt--tggca
B D     Kangaroo rat  cagaactcaaacctctttcatcggggcacagacttccttttactccttcc---tt--ttacg
B D   Naked mole-rat  cagaactcaagcctctttcatcggggcacagacttccttttactccttcc---tt--ttgca
B D       Guinea pig  cagaactcaagcctctttcatcggggcacagacttccttttactctttcc---tt--ttgca
B D         Squirrel  cagaactcaagcctctttcatcagggcacagacttccttttactccttcc---tt--ttgca
B D           Rabbit  cagaactcaagcctctttcatcggggcacagacttccttttactccttcc---tt--ttgca
B D             Pika  cagaactcaagcctctttcatcggggcgcagacttccttttactccttcc---tt--ttgca
B D            Human  cagaactcaagcctctttcatcggggcacagacttccttttacttcttcc---tt--ttgcc
B D            Chimp  cagaactcaagcctctttcatcggggcacagacttccttttacttcttcc---tt--ttgcc
B D          Gorilla  cagaactcaagcctctttcatcggggcacagacttccttttacttcttcc---tt--ttgcc
B D        Orangutan  cagaactcaagcctctttcatcggggcacagacttccttttacttcttcc---tt--ttgcc
B D           Gibbon  cagaactcaagcctctttcatcggggcacggacttccttttacttcttcc---tt--ttgcc
B D           Rhesus  cagaactcacgtctctttcatcggggcacagacttccttttacttcttcc---tt--ttgca
B D           Baboon  cagaactcaagtctctttcatcggggcacagacttccttttacttcttcc---tt--ttgca
B D         Marmoset  cagaactcaagcctctttcaccggggcacagacttccttttacttcttcc---tt--ttgca
B D  Squirrel monkey  cagaactcaagcctctttcatcggggcacagacttccttttacttcttcc---tt--ttgca
B D          Tarsier  cagaactcaagcctccttcaaccgggcacagacttccttttactccttcc---tt--ttgca
B D      Mouse lemur  cagagctcaagcctctttcatcggggcacagacttccttttactccttcc---tt--ttgca
B D         Bushbaby  cagagctcaagcctctttcatcggggcacagacttccttttactccttcc---tt--ttgcc
B D       Tree shrew  cagaactcaagcctctttcatcggggcacagacttccttctactccttcc---tt--ttgca
B D              Pig  cagaactcaagcctctttcagcggagcacagacttccttttactccttcc---tt--ttgca
B D          Dolphin  cagaactcaagcctctttcatcggggcacagacttccttttactccttcc---tt--ttgca
B D              Cow  cagaactcaagcctctttcagcggggcacagacttccttttactccttcc---tt--ttgca
B D              Cat  cagaactctagcctctttcatcggggcacagacttccttttactccttcc---tt--ttgca
B D              Dog  cagaactctagcctctttcatcggggcacagacttccttttactccttcc---tt--ctgct
B D            Panda  cagaactctagcctctttcatcggggcacagacttccttttactccttcc---tt--ctgca
B D            Horse  cagaactcaagcctctttcatcggggcacagacttccttttactccttcc---tt--ttgca
B D         Microbat  cagaactcaagcctctttcagcggggcacagacttccttttactccttcc---tt--ttgca
B D          Megabat  cagaactcaagcctctttcatcggggcacagacttccttttactctttcc---tt--ttgca
B D         Hedgehog  cagaactcaagcctctttcatcagggcacagacttccttttacttcttcc---tt--tagct
B D            Shrew  cagaactcaagcctctttcatcggggcacagacttccttttactctttcc---tt--ttgca
B D         Elephant  cagaactcaagcctctttcatcccggcacagacttccttttactccttcc---tt--ttgca
B D       Rock hyrax  cagaactcaagcctctttcatcccggcacagacttccttttactccttcc---tt--ttgca
B D           Tenrec  cagaactcaagcctctttcatccccgcacagacttccttttactccttcc---tt--ttgca
B D          Manatee  cagaactcaagcctctttcatcccggcacagacttccttttactccttcc---tt--ttgca
B D        Armadillo  cagaactcaagcctctttcatcagggcacggacttccttttactccttcc---tt--tcgta
B D          Opossum  cagaactcatacctctttcatcagggcacagacttccttttattcctttc---tc--tttaa
B D  Tasmanian devil  cagaactcgtacctctttcttcgggacacaaacttccttttatccctttc---cccttttaa
B D          Wallaby  cagaactcatacctctttcatcggggcacagacttcc-tttattcctttc---cccctttaa
B D         Platypus  cagaactcaaacctctttcatcgggacacggacttcctttttctcctttcccact--tta--
B D          Chicken  cagaactcaaggctctctcgccgggaagtagatttcctcgtagtcctttt-ttcc--tcgcc
B D      Zebra finch  cagaagtcaaggctctcttgtcgggatgtagatttccttgtagttcttttcttcc--tcacg
B D       Budgerigar  cagaagtcaaggctctctcctcgggaagtagattttcttgtagtcctttttcccc--tccag
B D   Painted turtle  cagaactcaagtctctttcatcgggaaacagacttccttttagccttttt---cc--ttacg
B D       Coelacanth  cagaacttaag--tctttcatcgggaagcaggctcattttcaacccttta---ag--ctacg
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D            Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Fugu  ==============================================================
B D     Atlantic cod  ==============================================================
B D     Nile tilapia  ==============================================================
B D        Zebrafish  ==============================================================
B D    X. tropicalis  ==============================================================
B D           Turkey  ==============================================================
B D           Lizard  ==============================================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 24 and 25 in window
B D         Opossum 1bp
B D Tasmanian devil 1bp
B D         Wallaby 1bp

Alignment block 25 of 736 in window, 56695724 - 56695748, 25 bps 
B D            Mouse  c--tcttgtcgcctcctcccgggaaga
B D              Rat  c--tcttgtcgcctcctcccggggaga
B D     Kangaroo rat  c--tcttgccgcctcctcctggggaga
B D   Naked mole-rat  c--tcgtgccgcctcctcccgggaaga
B D       Guinea pig  c--tcgtgcctcctcctcccggggaga
B D         Squirrel  c--tctcgcctcctcctcccggggaga
B D           Rabbit  c--tctcgccgcctcctcccggggaga
B D             Pika  c--tcttgccgcctcctcccggggaga
B D            Human  c--tctcgcctcctcctcctgggaaga
B D            Chimp  c--tctcgcctcctcctcctgggaaga
B D          Gorilla  c--tctcgcctcctcctcctgggaaga
B D        Orangutan  c--tctcgcctcctcctcctgggaaga
B D           Gibbon  c--tctcgcctcctcctcctgggaaga
B D           Rhesus  c--tctcgcctcctcctcctgggaaga
B D           Baboon  c--tctcgcctcctcctcctgggaaga
B D         Marmoset  c--tctcgcctccacctcctgggaaga
B D  Squirrel monkey  c--tctcgcctcctcctcctgggaaga
B D          Tarsier  c--tctcgccgcctcctccggggaaga
B D      Mouse lemur  c--tcttgcctcctccacccgggaaga
B D         Bushbaby  c--tcttgcctcctcctcctgggaaga
B D       Tree shrew  c--tctcgccgcctcctcccggggaga
B D              Pig  c--tctcgccgcctcctcccggggaga
B D          Dolphin  c--tctcgccgcctcctcccggggaga
B D              Cow  c--tctcgccgcctcctccgggggaga
B D              Cat  c--tctcgccgcctcctcccgggaaga
B D              Dog  c--tctcgccgcctcctcccgggaaga
B D            Panda  c--tctcgccgcctcctcccgggaaga
B D            Horse  c--tctcgccgcctcctcctggggaga
B D         Microbat  c--tctcgccgcctcctcccggagaga
B D          Megabat  c--tctcgccgcctcttctcgggaaaa
B D         Hedgehog  c--tctcgccgcctcctcccgcggcga
B D            Shrew  c--tctcgccgcctcctctcggggtga
B D         Elephant  c--tctcgccgcctcctctcggggaga
B D       Rock hyrax  c--tctcgccgcctcctctcgaggaga
B D           Tenrec  ct-tctcgccgcctcctctcggggaga
B D          Manatee  c--tctcgccgcctcctctcggggaga
B D        Armadillo  c--tctcgccgcctcctccccgggaga
B D          Opossum  t--tctttctgtctgctcctgggatca
B D  Tasmanian devil  t--tcttgttctctgctcctgggttca
B D          Wallaby  t--tcttgctgtctgctcctgggatca
B D         Platypus  -cgtcctagagtctcctcc-ggggaaa
B D          Chicken  c--ccctgctatctcctc--ggcggca
B D      Zebra finch  c--taccgttccctcctc--agcggag
B D       Budgerigar  c--ccttgctgccttctc--cgtggag
B D   Painted turtle  t--tcttgctatctcctag-agtggaa
B D       Coelacanth  t--tctttatatctacttcagtgggaa
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNN
B D            Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Fugu  ===========================
B D     Atlantic cod  ===========================
B D     Nile tilapia  ===========================
B D        Zebrafish  ===========================
B D    X. tropicalis  ===========================
B D           Turkey  ===========================
B D           Lizard  ===========================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 25 and 26 in window
B D      Coelacanth 524bp

Alignment block 26 of 736 in window, 56695749 - 56695847, 99 bps 
B D            Mouse  agc-caaggcacc---c--tcggc---------t-t-ggagcagcgacaggc--------cgg------c
B D              Rat  agc-caaggcacc---c--gcggc---------t-t-ggagcagcgacaggc--------cgg------c
B D     Kangaroo rat  agc-tgaggcacc---c--gccgc---------c-c-agagccgcgacaggc--------cgg------g
B D   Naked mole-rat  agc-tgagacgcc---a--gcagc---------c-c-ggagcagcgacaagc--------cgg------g
B D       Guinea pig  acc-taagatacc---g--gcagc---------c-c-ggagcaccgacaagc--------cgg------g
B D         Squirrel  agc-tgaggtacc---a--gcaac---------c-c-ggagcagcgacaggt--------cgg------g
B D           Rabbit  agc-ggaggcacc---g--gcggc---------c-c-ggggcagcgacaggc--------cgg------g
B D             Pika  acc-cgaggcccc---g--gcggc---------cgc-gggatagagccaggc--------cgg------g
B D            Human  agc-ggaggcgcc---g--gcggt------cggc-c-gggatagcaacaggc--------cgg------g
B D            Chimp  agc-ggaggggcc---g--gcggt------cggc-c-gggatagcaacaggc--------cgg------g
B D          Gorilla  agc-ggaggcgcc---g--gcggt------cggc-c-gggatagcaacaggc--------cgg------g
B D        Orangutan  agc-ggaggcgcc---g--gcggt------cggc-c-gggatagcaacaggc--------cgg------g
B D           Gibbon  agc-ggaggcgcc---a--gcagt------cggc-c-gggatagaaacaggc--------cgg------g
B D           Rhesus  atc-ggaggcgcc---g--gcggt------ccgc-c-cgggtagcaacaggc--------cgg------g
B D           Baboon  atc-ggaggcgcc---g--gcggt------ccgc-c-cgggtagcaacaggc--------cgg------g
B D         Marmoset  agc-ggaggcgcc---g--gcggc---------t-c-ggggtagcaacaggc--------cgg------g
B D  Squirrel monkey  agc-ggaggcgcc---g--gcggc---------c-c-ggggtagcaacaggc--------cgg------g
B D          Tarsier  cgc-ggaggcacc---g--gcggt---------c-c-ggggtcgcgacaggc--------cgg------c
B D      Mouse lemur  agc-ggaggcatc---g--gcggc---------c-t-ggggtagcaacaggc--------tgg------g
B D         Bushbaby  agc-ggaggcacc---g--gcagc---------c-c-ggggtaaccacaggc--------tgg------g
B D       Tree shrew  agc-cgaggcccc---g--gcggc---------c-c-cgggcagcgacaggc--------cgg------t
B D              Pig  agc-ggaggc--------------------------------agcgacaggc--------cgg------g
B D          Dolphin  agc-ggaggcacc---a--gcggc---------c-cggggggagcgacacac--------cgg------g
B D              Cow  agc-ggaggcacc---g--gcggc---------c-c-ggggcagcagcacga--------cgg------g
B D              Cat  agc-ggaggcacc---g--gcggc---------c-c-ggggcagcgacgagc--------cgg------g
B D              Dog  agc-ggaggcacc---g--gcggt---------c-c-ggggcagcggcaagc--------cgg------g
B D            Panda  agc-ggaggcacc---g--gctgc---------c-c-ggggcagcgacaagc--------cgg------g
B D            Horse  agc-ggaggcacc---g--gcggc---------c-c-ggggcagcgacaggc--------cgg------g
B D         Microbat  agc-ggaggcacc---c--acggc---------c-t-ggggcagcgacaggc--------tgg------g
B D          Megabat  agc-agaggcacc---c--acggc---------c-c-agggcatcgacaggc--------tgg------g
B D         Hedgehog  agc-gga---------g--gcggc---------c-g-gggacagcggccgga--------cgg------g
B D            Shrew  agc-ggaggcacc---g--gcggc---------c-c-agagctgcgatagac--------cgg------g
B D         Elephant  agc-ggaggcacc---g--gcggc---------c-c-ggggcaaccataggc--------cgg------t
B D       Rock hyrax  agc-ggaggcaccggag--gaggc---------c-c-ggggcaacgataggc--------tgg------t
B D           Tenrec  agcgggaggcttc---g--gcggc---------c-c-agggcaattataggc--------cggg----tt
B D          Manatee  agc-ggagtcacc---g--gcggc---------c-t-ggggcaacgataggc--------cgg------t
B D        Armadillo  agc-agaggcacc---g--gcggc---------c-c-ggggcaccgacagac--------cgg------g
B D          Opossum  atc-ggagggacc---c--gtggc---------c-a-gagctagagg-agacagaaatatcga------a
B D  Tasmanian devil  aca-ggagggact---c--gtggc---------t-a-gaactagagg-agac--------tga------a
B D          Wallaby  aca-ggagggacc---caggtggc---------c-t-gaggtagaag-agac--------tga------a
B D         Platypus  gca-ggagggacc---g--gtggc---------c-c-gggagaccggggggg--------tggggggttg
B D          Chicken  agc-agggagccc---g--gcgggcgagcgcggc-c-ggggcggcgggaggt--------cgg------g
B D      Zebra finch  atc-agagaggct---c--g-gggccagtgcggc-c-aggagcgcagaaggc--------cgg------g
B D       Budgerigar  ctc-aacgagccg---c--gggagctagtgcagc-c-aggagcgcgggaggc--------tgg------g
B D   Painted turtle  atc-agagagacc---c--gtggacttttccagc-c-gggattgcaggaggc--------cgg------g
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D            Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D             Fugu  ======================================================================
B D     Atlantic cod  ======================================================================
B D     Nile tilapia  ======================================================================
B D        Zebrafish  ======================================================================
B D    X. tropicalis  ======================================================================
B D           Turkey  ======================================================================
B D       Coelacanth  ======================================================================
B D           Lizard  ======================================================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

               Mouse  tcagtgagaacaaga---aaaaagtttc-----------tttctgggagtgcggaactggggccgggttg
                 Rat  ccagtgagagcaagg---aaaaagtttc-----------tttctgggagtgcggaactggggccgggttg
        Kangaroo rat  ccagggagatcgtga---gaaaactttc-----------ttccagggggtgcggcactggggcccggtgg
      Naked mole-rat  ccactgaggccggga---gaaaaccttc-----------tttctgggagtgcggaactggagccgggttg
          Guinea pig  ccactgaggccagga---acaaagtttc-----------ttcctggcagtgcagaactggggccgggttg
            Squirrel  ccactgaggccgtga---gaaaagtttt-----------tttctgggagtgtggaactggggcccggttg
              Rabbit  ctaccgaggccgtgc---gtcaagtttc-----------tttctggaagtgcggg-acagggccgggctg
                Pika  ctaccgaggccgtgcgaagcaaagtttc-----------tttctggaagcgcagc-ctagggccggcttg
               Human  ccactgaggcggtgc---ggaaagtttc-----------tgtctgggagtgcggaactggggccgggttg
               Chimp  ccactgaggcggtgc---ggaaagtttc-----------tgtcttggagtgcggaactggggccgggttg
             Gorilla  ccactgaggcggtgc---ggaaagtttc-----------tgtctgggagtgcggaactggggccgggttg
           Orangutan  ccgctgaggcggtgc---ggaaagtttc-----------cgtctgggagtgcggaactgggtccgggttg
              Gibbon  ccattgaggcggtgc---ggaaagtttc-----------tgtctgggagtgcggaactggggccgggttg
              Rhesus  ccactgaggcggtgc---ggaaagtttc-----------tgtctgggagtgcggaactggggccgggttg
              Baboon  ccactgaggcggtgc---ggaaagtttc-----------tgtctgggagtgcggaactggggccgggttg
            Marmoset  ccattgcggccctgc---ggaaagtttc-----------tgtctggttgtgcggaactggggccgggttg
     Squirrel monkey  ccattgaggcagtgc---ggaaagtttc-----------tgtttggttgcgcggaactggggccgggttg
             Tarsier  ccactaaggccgtga---gaaaagtttc-----------tttttgggagtgcggaactggggccgggttg
         Mouse lemur  ccactgaggccgcgc---gaaaagtttc-----------cttctggcagtgcggagctggggccgggttg
            Bushbaby  ccactgaggccacgg---taaaagtttc-----------ttcctgggagtgcggaactggggcccagttg
          Tree shrew  ccactgaggccgtgc---gaaaagtttc-----------tttctgggagtgtggaactggagccgggttg
                 Pig  ccactgaggccacga---gaaaagtttc-----------tttctgggagtgtggagcttgggccccgttg
             Dolphin  ccactgaggccacgc---gaaaagcttc-----------tttctgggagtgcggagctggggcccggttg
                 Cow  ccactaaggccacac---gaagagtttc-----------tttctgggagcgcggaactggggcccggttg
                 Cat  ccactgaggctgtgc---gaaaagttac-----------tttttgggagtgcggaactggggtcccgttg
                 Dog  ccactggggctgtgc---gaaaagtttc-----------tttttgggagttcggaactggggcccctttg
               Panda  ccactgaggctgtgc---gagaagtttc-----------tttttgggagttcggaactggggccacgtta
               Horse  ccactgaggccgtga---gaaaagtttc-----------tctctgggagtgcggaactggggcccggtcg
            Microbat  acactgaggccgtgc---gaaaagtttc-----------tttctggaagctcggaactggggcccggttg
             Megabat  ccactgaggccgtga---gaaaagtttc-----------tttctgggagcgcggaactggggcccggttg
            Hedgehog  ccaccgaggccgcgc---agaaggtctc-----------tccctgggagcgcggagccggggcgcggcgg
               Shrew  tcactgaggccgagc---gaaaagtttc-----------tttctgggagtgtcgaactggggccccgtgg
            Elephant  ccactgaggccgtgc---gaaaagtatc-----------tttctgggagaacggaacaggggcccggttg
          Rock hyrax  ccactgaggccgtgc---gtgaagttcc-----------tttctgggagaacgtgacaggggtccggctg
              Tenrec  ccactgaggccgtgc---gaaaagtttc-----------tttctgggagaacagaactggagcccggttg
             Manatee  ccactgaggccgtgc---gaaaagtttc-----------tttctgggagaacggaacaggcgccccgttg
           Armadillo  ccactgcggccgtgc---gagaagtttc-----------cttctgggattgcggaactggggccctgtcg
             Opossum  gcactaaggagatag---cgaaaatttg-----------ttcttggaattctagagt----ctcttattg
     Tasmanian devil  gcactgaggaaatag---tcaaagttag-----------ttcttggaagtctagagt-gactgcttattg
             Wallaby  gcactgaagaggtag---tgaaagttag-----------ttcttgggagtctggagc-ggctgttctttg
            Platypus  tcgccgaggcgccgg---tgaaagtttcttttttctttttttttgcaagccagga----gggctccgcgg
             Chicken  agccgg----------------gggctg-----------cggtggggatttagg----gcggccccggag
         Zebra finch  agtcggttcccgggc----atagggat------------ccgttgggatttagg----gccggcctcgag
          Budgerigar  agcctgtctccgggc----acgggtctc-----------cgactgggatttagg----gcagcctcagag
      Painted turtle  agactgaatctgttg----ttaaattcc-----------cttttggaagct--------tagtctcattg
              Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                Fugu  ======================================================================
        Atlantic cod  ======================================================================
        Nile tilapia  ======================================================================
           Zebrafish  ======================================================================
       X. tropicalis  ======================================================================
              Turkey  ======================================================================
          Coelacanth  ======================================================================
              Lizard  ======================================================================
               Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

               Mouse  gtgt-
                 Rat  gtgt-
        Kangaroo rat  gtga-
      Naked mole-rat  gtgt-
          Guinea pig  gtgt-
            Squirrel  gtgt-
              Rabbit  gtgt-
                Pika  gggt-
               Human  gtgt-
               Chimp  gtgt-
             Gorilla  gtgt-
           Orangutan  gtgt-
              Gibbon  gtgt-
              Rhesus  gtgt-
              Baboon  gtgt-
            Marmoset  gtgt-
     Squirrel monkey  gtgt-
             Tarsier  gtgt-
         Mouse lemur  gtgt-
            Bushbaby  gtgt-
          Tree shrew  gtgt-
                 Pig  gtgt-
             Dolphin  gtgt-
                 Cow  gtgt-
                 Cat  gtgt-
                 Dog  gtgt-
               Panda  gtat-
               Horse  gtgt-
            Microbat  gtgt-
             Megabat  ttgt-
            Hedgehog  gtgt-
               Shrew  ctgt-
            Elephant  gtgt-
          Rock hyrax  gtgt-
              Tenrec  gtgt-
             Manatee  gtgt-
           Armadillo  ctgt-
             Opossum  gtgtc
     Tasmanian devil  gtgt-
             Wallaby  gtat-
            Platypus  agac-
             Chicken  gtgt-
         Zebra finch  gtgt-
          Budgerigar  gtgt-
      Painted turtle  gtgt-
              Alpaca  NNNNN
               Sheep  NNNNN
                Fugu  =====
        Atlantic cod  =====
        Nile tilapia  =====
           Zebrafish  =====
       X. tropicalis  =====
              Turkey  =====
          Coelacanth  =====
              Lizard  =====
               Sloth  NNNNN

Alignment block 27 of 736 in window, 56695848 - 56695898, 51 bps 
B D            Mouse  actgctc-agagcaatgggtgagtggctgatggg------------------gg-acgt-tg-tc-agat
B D              Rat  actgctc-ggagcaatgggtgagtgactg-cggg------------------gg-acgt-tg-tc-agaa
B D     Kangaroo rat  ccggctc-ggagcaatgggtgagtggcgg-cggg------------------gg-acgc-tg-tc-aga-
B D   Naked mole-rat  actgctc-ggagcaatgggtgagtggcga-cggg------------------gc-ccgc-tg-tc-agag
B D       Guinea pig  gctgctc-ggagcaatgggtgagtggctg-cggg------------------gg-ctgc-tg-tc-agag
B D         Squirrel  actgttc-ggagcaatgggtgagtggcgg-cggg------------------gg-acgc-tg-tc-agaa
B D           Rabbit  acggctc-ggagcaatgggtgagtggctg-cggg------------------gg-ccgc-tg-tc-agag
B D             Pika  acggctc-ggagcaatgggtgagtggctg-cggg------------------ggcccgc-tg-tcaagag
B D            Human  actgctc-ggagcaatgggtgagtggcgg-cggg------------------gg-actc-tg-tc-agag
B D            Chimp  actgctc-ggagcaatgggtgagtggcgg-cggg------------------ag-actc-tg-tc-agag
B D          Gorilla  actgctc-ggagcaatgggtgagtggcgg-cggg------------------gg-accc-tg-tc-agag
B D        Orangutan  actgctc-ggagcaatgggtgagtggcgg-cggg------------------gg-actc-tg-tc-agag
B D           Gibbon  actgctc-ggagcaatgggtgagtggcgg-cggg------------------gg-actc-cg-tc-agag
B D           Rhesus  actgctc-ggagcaatgggtgagtggcgg-cggg------------------gg-actc-tg-tc-agag
B D           Baboon  actgctc-ggagcaatgggtgagtggcgg-cggg------------------gg-actc-tg-tc-agag
B D         Marmoset  actgctc-ggagcaatgggtgagtggcgg-tgga------------------ag-a--c-tg-tc-ggag
B D  Squirrel monkey  actgctc-ggagcaatgggtgagtggcgg-tgga------------------ag-a--c-cg-tc-ggag
B D          Tarsier  actgctc-ggagcaatgggtgagtggcgg-cggg------------------gg-acac-tg-tc-agag
B D      Mouse lemur  actgctc-ggagcaatgggtgagtgtcgg-cggg------------------cg-actc-tg-tc-aaag
B D         Bushbaby  actgctc-ggagcaatgggtgagtggcgg-cggg------------------cg-actc-tg-tc-aaag
B D       Tree shrew  actgctc-ggagcaatgggtgagtggcgg-cggg------------------gg-acgc-tg-tc-agag
B D              Pig  actgctc-ggagcaatgggtgagtggtgg-cggg------------------gg-acgcttg-ac-agag
B D          Dolphin  actgctc-ggagcaatgggtgagtggcgg-cggg------------------gg-acgc-tg-tc-agaa
B D              Cow  actgctc-ggagcaatgggtgagtggcgg-cagg------------------gt-acgc-tg-tc-agag
B D              Cat  actgctc-ggagcaatgggtgagtggcgg-cggg------------------gg-acgc-tg-tc-agag
B D              Dog  actgctc-ggagcaatgggtgagtggcgg-cggg------------------ga-acgc-tg-tc-agag
B D            Panda  actgctc-ggagcaatgggtgagtggcgg-cggg------------------gg-acgc-tg-tc-agag
B D            Horse  actgctc-ggagcaatgggtgagtggcgg-cggg------------------gg-acgc-tg-tc-agag
B D         Microbat  gctgctc-ggagcaatgggtgagtggcgg-cggg------------------gg-acgc-tg-tc-agag
B D          Megabat  gctgctc-ggagcaatgggtgagtggcag-cggg------------------gg-acac-tg-tc-agag
B D         Hedgehog  cctgccc-ggagcgatgggtgagcggcgg-cgag------------------gg-cggc-tg-tc-agcg
B D            Shrew  actgctc-ggagcaatgggtgagtggcgg-cggg------------------ga-c-gc-tg-tc-agcg
B D         Elephant  actgctc-ggagcaatgggtgagtggcgg-cgag------------------gg-acgc-tg-tc-agag
B D       Rock hyrax  actgctc-ggagcaatgggtgagtggcgg-cggg------------------gg-acac-tg-tc-agag
B D           Tenrec  actgctt-ggagcaatggttgagtggcgg-cggg------------------gg-acgc-tgttc-agac
B D          Manatee  actgctc-ggagcaatgggtgagtggcgg-cggg------------------gg-acgc-tg-tc-agag
B D        Armadillo  gctgctc-ggagcaatgggtgagcggcgg-cggg------------------gg-acgc-tg-tc-agag
B D          Opossum  cccgctc-aaagcaatgggtaagtggttg-cctgttgtatccgcgaaatattca-gtgc-tg-tc-agac
B D  Tasmanian devil  cctggtc-aaaggaatgggtaagtggctg-cgtactgtaatgggaaaattttct-gttc-tg-tc-agac
B D          Wallaby  actgctc-aaagcaatgggtaagtggttg-cgtg-taggatcggtgaattttct-gtgc-tg-tc-agaa
B D         Platypus  cgtgctctggagctatgggtgagtgggtg-cccg------------------gg-agcg-----------
B D          Chicken  cccgctc-ggaggaatgggtgagt-gc---tggg------------------at-ccgc-----------
B D      Zebra finch  cccgctc-agaggaatgggtaagtggc---cggg------------------ag-ccgc-----------
B D       Budgerigar  cccgctc-ggaggaatgggtaagtggc---cggg------------------ag-ccgc-----------
B D   Painted turtle  cctgctc-agcgcaatgggtaagtgcc---tgga------------------ag-ctgc-----------
B D             Fugu  actgcac-acaacagggctgcagtggctg-cgag-----------------cat-ttgt-tg-tc-aaat
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D            Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D     Atlantic cod  ======================================================================
B D     Nile tilapia  ======================================================================
B D        Zebrafish  ======================================================================
B D    X. tropicalis  ======================================================================
B D           Turkey  ======================================================================
B D       Coelacanth  ======================================================================
B D           Lizard  ======================================================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

               Mouse  ccg----a
                 Rat  ccg----a
        Kangaroo rat  ccg----a
      Naked mole-rat  ccg----a
          Guinea pig  ccg----g
            Squirrel  ccg----a
              Rabbit  cgg----c
                Pika  cgg----c
               Human  ccg----g
               Chimp  ccg----g
             Gorilla  ccg----g
           Orangutan  ccg----g
              Gibbon  ccg----a
              Rhesus  ccg----g
              Baboon  ccg----g
            Marmoset  ccg----c
     Squirrel monkey  ccg----c
             Tarsier  ccg----g
         Mouse lemur  ccg----g
            Bushbaby  ccg----t
          Tree shrew  cgg----a
                 Pig  cct----g
             Dolphin  ccg----g
                 Cow  ccg----g
                 Cat  ccg----g
                 Dog  ccg----g
               Panda  ccgggaag
               Horse  tcg----g
            Microbat  tcg----g
             Megabat  ccg----g
            Hedgehog  cc------
               Shrew  ccg----g
            Elephant  ccg----g
          Rock hyrax  ccg----g
              Tenrec  ccg----g
             Manatee  cc------
           Armadillo  ccc----g
             Opossum  tgg----g
     Tasmanian devil  tgg----g
             Wallaby  tgg----g
            Platypus  --------
             Chicken  --------
         Zebra finch  --------
          Budgerigar  --------
      Painted turtle  --------
                Fugu  aca----a
              Alpaca  NNNNNNNN
               Sheep  NNNNNNNN
        Atlantic cod  ========
        Nile tilapia  ========
           Zebrafish  ========
       X. tropicalis  ========
              Turkey  ========
          Coelacanth  ========
              Lizard  ========
               Sloth  NNNNNNNN

Inserts between block 27 and 28 in window
B D             Pig 4bp
B D         Dolphin 4bp
B D             Cow 4bp
B D             Cat 4bp
B D             Dog 4bp
B D           Panda 4bp
B D           Horse 4bp
B D        Microbat 6bp
B D         Megabat 4bp
B D        Hedgehog 1bp
B D           Shrew 4bp
B D        Elephant 11bp
B D      Rock hyrax 3bp
B D          Tenrec 4bp
B D       Armadillo 4bp
B D         Opossum 3bp
B D Tasmanian devil 2bp
B D         Wallaby 2bp

Alignment block 28 of 736 in window, 56695899 - 56695904, 6 bps 
B D            Mouse  -ggaggg
B D              Rat  -ggaggg
B D     Kangaroo rat  -gcgggg
B D   Naked mole-rat  -gaaggg
B D       Guinea pig  -agaggg
B D         Squirrel  -gaaggg
B D           Rabbit  -ggcgg-
B D             Pika  -ggaggg
B D            Human  -gaaggg
B D            Chimp  -gaaggg
B D          Gorilla  -gaaggg
B D        Orangutan  -gaaggg
B D           Gibbon  -gaaggg
B D           Rhesus  -gaaggg
B D           Baboon  -gaaggg
B D         Marmoset  -gaaggg
B D  Squirrel monkey  -gaaggg
B D          Tarsier  -caaggg
B D      Mouse lemur  -gaaagg
B D         Bushbaby  -gaaggg
B D       Tree shrew  -gaa-gg
B D              Pig  -ggaggg
B D          Dolphin  -ggaggg
B D            Sheep  -ggaggg
B D              Cow  -ggaggg
B D              Cat  -ggaggg
B D              Dog  -ggaggg
B D            Panda  -ggaggg
B D            Horse  -ggaggg
B D         Microbat  -ggaggg
B D          Megabat  -ggaggg
B D         Hedgehog  -ggcggg
B D            Shrew  -ggaggg
B D         Elephant  -ggaggg
B D       Rock hyrax  -ggaggg
B D           Tenrec  -ggaggg
B D          Manatee  -ggaggg
B D        Armadillo  -ggaggg
B D          Opossum  -ggggaa
B D  Tasmanian devil  -ggagga
B D          Wallaby  -ggagga
B D         Platypus  -gggggc
B D          Chicken  ----ggg
B D      Zebra finch  ----agg
B D       Budgerigar  ----agg
B D   Painted turtle  ----agg
B D             Fugu  acaagg-
B D           Alpaca  NNNNNNN
B D     Atlantic cod  =======
B D     Nile tilapia  =======
B D        Zebrafish  =======
B D    X. tropicalis  =======
B D           Turkey  =======
B D       Coelacanth  =======
B D           Lizard  =======
B D            Sloth  NNNNNNN

Inserts between block 28 and 29 in window
B D          Rabbit 1bp

Alignment block 29 of 736 in window, 56695905 - 56695910, 6 bps 
B D            Mouse  agggag
B D              Rat  agggag
B D     Kangaroo rat  cgggag
B D   Naked mole-rat  agggag
B D       Guinea pig  agggag
B D         Squirrel  agggag
B D             Pika  agggag
B D            Human  agggag
B D            Chimp  agggag
B D          Gorilla  agggag
B D        Orangutan  agggag
B D           Gibbon  agggag
B D           Rhesus  agggag
B D           Baboon  agggag
B D         Marmoset  agggag
B D  Squirrel monkey  agggag
B D          Tarsier  agggcg
B D      Mouse lemur  agggag
B D         Bushbaby  agggag
B D       Tree shrew  agggag
B D              Pig  agggag
B D          Dolphin  agggag
B D            Sheep  agggag
B D              Cow  agggag
B D              Cat  agggaa
B D              Dog  agggaa
B D            Panda  agggaa
B D            Horse  agggag
B D         Microbat  agggag
B D          Megabat  agggag
B D         Hedgehog  agggag
B D            Shrew  agggag
B D         Elephant  agggag
B D       Rock hyrax  agggag
B D           Tenrec  agggag
B D          Manatee  agggag
B D        Armadillo  cgggcg
B D          Opossum  aaag--
B D  Tasmanian devil  caag--
B D          Wallaby  taag--
B D         Platypus  aggggc
B D          Chicken  gg----
B D      Zebra finch  agg---
B D       Budgerigar  agg---
B D   Painted turtle  agg---
B D      Stickleback  agaaaa
B D           Rabbit  ======
B D           Alpaca  NNNNNN
B D             Fugu  ------
B D     Atlantic cod  ======
B D     Nile tilapia  ======
B D        Zebrafish  ======
B D    X. tropicalis  ======
B D           Turkey  ======
B D       Coelacanth  ======
B D           Lizard  ======
B D            Sloth  NNNNNN

Inserts between block 29 and 30 in window
B D  Naked mole-rat 4bp
B D      Guinea pig 4bp
B D        Squirrel 8bp
B D            Pika 4bp
B D           Human 4bp
B D           Chimp 4bp
B D         Gorilla 4bp
B D       Orangutan 4bp
B D          Gibbon 4bp
B D          Rhesus 4bp
B D          Baboon 4bp
B D        Marmoset 4bp
B D Squirrel monkey 4bp
B D         Tarsier 4bp
B D     Mouse lemur 4bp
B D        Bushbaby 4bp
B D      Tree shrew 4bp
B D        Elephant 12bp
B D      Rock hyrax 12bp
B D          Tenrec 7bp
B D         Manatee 8bp
B D       Armadillo 6bp
B D        Platypus 8bp

Alignment block 30 of 736 in window, 56695911 - 56695938, 28 bps 
B D            Mouse  ------cg----------agcaggc--------------------g--------aggg------------
B D              Rat  ------cg----------agcaggc--------------------g--------aggg------------
B D   Naked mole-rat  ------cg----------ggcgggc--------------------c--------ggcg------------
B D       Guinea pig  ------cg----------agcgggc--------------------g--------ggcg------------
B D         Squirrel  ------cg----------agcgggc--------------------g--------aggg------------
B D           Rabbit  ------cg----------ggcgttc--------------------c--------gctg------------
B D             Pika  ------cg----------ggcgggc--------------------c--------aggg------------
B D            Human  ------cg----------agcgggc--------------------aaggg----aggg------------
B D            Chimp  ------cg----------agcgggc--------------------a--------aggg------------
B D          Gorilla  ------cg----------agcgggc--------------------a--------aggg------------
B D        Orangutan  ------cg----------agcgggc--------------------a--------aggg------------
B D           Gibbon  ------cg----------agcgggc--------------------a--------aggg------------
B D           Rhesus  ------cg----------agcgggc--------------------g--------agga------------
B D           Baboon  ------cg----------aacgggc--------------------g--------agggagggagnnnnnn
B D         Marmoset  ------cg----------agcgaga--------------------g--------aggg------------
B D  Squirrel monkey  ------cg----------agcggga--------------------g--------aggg------------
B D          Tarsier  ------cg----------ggcgtgc--------------------g--------tgcg------------
B D      Mouse lemur  ------ag----------agcaggc--------------------g--------aggg------------
B D         Bushbaby  ------cg----------agcgggc--------------------g--------aggg------------
B D       Tree shrew  ------cg----------agcggga--------------------g--------aggg------------
B D              Pig  ------ca----------agcgggc--------------------g--------aggg------------
B D          Dolphin  ------cg----------agcgggc--------------------g--------aggg------------
B D            Sheep  ------cg----------agcgggc--------------------g--------aggg------------
B D              Cow  ------cg----------agcgggc--------------------g--------aggg------------
B D              Cat  ------cc----------acagggt--------------------g--------aggg------------
B D              Dog  ------gg----------agaaggc--------------------g--------aggg------------
B D            Panda  ------ag----------agagggc--------------------g--------aggg------------
B D            Horse  ------cg----------agctggc--------------------g--------aggg------------
B D         Microbat  ------caagag----agagagaga--------------------g--------agag------------
B D          Megabat  ------cc----------agcgggc--------------------t--------agag------------
B D         Hedgehog  ------gg----------agcgggc--------------------g--------ggag------------
B D            Shrew  ------ag----------agcgggc--------------------g--------aggg------------
B D         Elephant  ------cg----------agcgagcgggcgggcgggcgggcgcggg--------aggg------------
B D       Rock hyrax  ------cc----------agcgagc------gcgagcgggagcggg--------aggg------------
B D           Tenrec  ------ct----------cgcgaga-----------------------------aagg------------
B D          Manatee  ------cg----------agcgaga------------cggcgcggg--------aggg------------
B D        Armadillo  ------------------agcgggc--------------------g--------aggg------------
B D          Opossum  -----------------tggcgggg--------------------g--------gtgg------------
B D  Tasmanian devil  -----------------tggcagag--------------------g--------agaa------------
B D          Wallaby  -----------------tggcgggg--------------------ggggggggaagag------------
B D         Platypus  ------cg----------ggctgtc--------------------a--------gaga------------
B D          Chicken  -------------------gctgtc--------------------a--------agag------------
B D      Zebra finch  -----------gttcaagtgctgtc--------------------a--------agag------------
B D       Budgerigar  -----------gttcaagtgctgtc--------------------a--------agag------------
B D   Painted turtle  -----------gttcaagggctgtc--------------------a--------aaag------------
B D             Fugu  ----ggtg----------ggtgggc--------------------a--------ggaa------------
B D      Stickleback  taaagaag----------tgcgagc--------------------g--------ggag------------
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D     Atlantic cod  ======================================================================
B D     Nile tilapia  ======================================================================
B D        Zebrafish  ======================================================================
B D    X. tropicalis  ======================================================================
B D           Turkey  ======================================================================
B D       Coelacanth  ======================================================================
B D           Lizard  ======================================================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D     Kangaroo rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

               Mouse  -------------------------------------------------------ctagag-ggagg-ga
                 Rat  -------------------------------------------------------ctagag-ggagg-ga
      Naked mole-rat  -------------------------------------------------------agggag-ggag----
          Guinea pig  -------------------------------------------------------cgcgag-ggcgc-gc
            Squirrel  -------------------------------------------------------agggag-ggagg-ga
              Rabbit  -------------------------------------------------------attgac-tttgc-tc
                Pika  -------------------------------------------------------cgggag-ggcgc-cc
               Human  -------------------------------------------------------agggag-ggagg-ga
               Chimp  -------------------------------------------------------agggag-ggagg-ga
             Gorilla  -------------------------------------------------------agggag-ggagg-ga
           Orangutan  -------------------------------------------------------agggag-ggagg-ga
              Gibbon  -------------------------------------------------------agggag-ggagg-ga
              Rhesus  ----------------------------------------------------------------------
              Baboon  nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngcgagggagggagggag-ggagg-ga
            Marmoset  -------------------------------------------------------agggag-ggagg-ga
     Squirrel monkey  -------------------------------------------------------agggag-ggagg-ga
             Tarsier  -------------------------------------------------------ggcggg-cgagg-ga
         Mouse lemur  -----------------------------------------------------------ag-ggagg-ga
            Bushbaby  -----------------------------------------------------------ag-ggagg-gc
          Tree shrew  -----------------------------------------------------------ag-ggagg-ga
                 Pig  -------------------------------------------------------agggag-g-------
             Dolphin  -------------------------------------------------------agggag-ggagg-gc
               Sheep  -------------------------------------------------------agggag-g-------
                 Cow  -------------------------------------------------------agggag-g-------
                 Cat  -------------------------------------------------------agggag-ggagg-ga
                 Dog  -------------------------------------------------------agggag-ggagg-ga
               Panda  -------------------------------------------------------agggcg-ggagg-ga
               Horse  -------------------------------------------------------a----g-ggagg-ga
            Microbat  -------------------------------------------------------agggag-ggaaa-ga
             Megabat  -------------------------------------------------------agggag-ggaga-ga
            Hedgehog  -------------------------------------------------------gcggag-gg------
               Shrew  -------------------------------------------------------agggag-gg-----a
            Elephant  -------------------------------------------------------agggag-ggctc-gg
          Rock hyrax  -------------------------------------------------------agggag-ggcgc-gg
              Tenrec  -------------------------------------------------------agggag-ggcgcggg
             Manatee  -------------------------------------------------------agggag-ggcgc-gg
           Armadillo  -------------------------------------------------------aggga--------gg
             Opossum  -------------------------------------------------------ggggga-ggag----
     Tasmanian devil  -------------------------------------------------------agagag-agag----
             Wallaby  -------------------------------------------------------agagag-agag----
            Platypus  -------------------------------------------------------ggaaag-agggg---
             Chicken  -------------------------------------------------------agaggg-ag------
         Zebra finch  -------------------------------------------------------aggggg-ag------
          Budgerigar  -------------------------------------------------------agggggaag------
      Painted turtle  -------------------------------------------------------agag---ag------
                Fugu  -------------------------------------------------------agaggg-gg------
         Stickleback  -------------------------------------------------------ggagtg-ac------
              Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        Atlantic cod  ======================================================================
        Nile tilapia  ======================================================================
           Zebrafish  ======================================================================
       X. tropicalis  ======================================================================
              Turkey  ======================================================================
          Coelacanth  ======================================================================
              Lizard  ======================================================================
               Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        Kangaroo rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

               Mouse  --g
                 Rat  --g
      Naked mole-rat  ---
          Guinea pig  --t
            Squirrel  gtg
              Rabbit  --g
                Pika  --g
               Human  gcg
               Chimp  gcg
             Gorilla  gcg
           Orangutan  gct
              Gibbon  gcg
              Rhesus  ---
              Baboon  gtg
            Marmoset  gcg
     Squirrel monkey  gcg
             Tarsier  ggg
         Mouse lemur  gcg
            Bushbaby  gcg
          Tree shrew  gcg
                 Pig  ---
             Dolphin  gcg
               Sheep  ---
                 Cow  ---
                 Cat  gag
                 Dog  gcg
               Panda  gcg
               Horse  gcg
            Microbat  gcg
             Megabat  gcg
            Hedgehog  ---
               Shrew  gcg
            Elephant  gcg
          Rock hyrax  gcg
              Tenrec  gcg
             Manatee  gca
           Armadillo  gag
             Opossum  ---
     Tasmanian devil  ---
             Wallaby  ---
            Platypus  ---
             Chicken  ---
         Zebra finch  ---
          Budgerigar  ---
      Painted turtle  ---
                Fugu  ---
         Stickleback  ---
              Alpaca  NNN
        Atlantic cod  ===
        Nile tilapia  ===
           Zebrafish  ===
       X. tropicalis  ===
              Turkey  ===
          Coelacanth  ===
              Lizard  ===
               Sloth  NNN
        Kangaroo rat  NNN

Inserts between block 30 and 31 in window
B D         Opossum 718bp
B D Tasmanian devil 396bp
B D         Wallaby 63bp
B D        Platypus 1bp
B D         Chicken 7bp
B D     Zebra finch 8bp
B D      Budgerigar 8bp
B D  Painted turtle 8bp

Alignment block 31 of 736 in window, 56695939 - 56695959, 21 bps 
B D            Mouse  ctga----g--gcgc--gc--cac--------------cg------------c-gc--tg--
B D              Rat  ctga----g--gcgc--gc--cac--------------cg------------c-gc--tc--
B D   Naked mole-rat  --------g--gagc--gca-cac--------------gg------------c-cccgcg--
B D       Guinea pig  cgga----g--gagc--gcg-ctc--------------gg------------c-tc--cg--
B D         Squirrel  cgag----g--gcgc--gcgccac--------------tgagcgctcacactc-tc--ct--
B D           Rabbit  ---------------------------------------g------------t-ta--c---
B D             Pika  caga----g--gcgc------ccc--------------cg------------c-tc--c---
B D            Human  cgag----g--gcgc--gcgccact----agg------cg------------c-tc------
B D            Chimp  cgag----g--gcgc--gcgccact----agg------cg------------c-tc------
B D          Gorilla  cgag----g--gcgc--gcgccact----aag------cg------------c-tc------
B D        Orangutan  cgag----g--gcgc--gcgccact----aag------cg------------c-tc------
B D           Gibbon  cgag----g--gcgc--gcgccact----aag------cg------------c-tc------
B D           Baboon  cga-----g--gcgc--gcgccact----aag------cg------------c-tc------
B D         Marmoset  agag----g--gcgc--gcgccact----aag------cg------------c-tc------
B D  Squirrel monkey  cgag----g--gcgc--gcgcccct----aag------cg------------c-tc------
B D          Tarsier  agga----a--ttcc--ac------------------------------------c------
B D      Mouse lemur  caa-----g--gcgc--gcgccact----aag------cg------------t-tc------
B D         Bushbaby  caag----g--gcgc--gcgccact----aag------gg------------c-tc------
B D       Tree shrew  cgag----g--gcgc--gcgccacc----gag------cg------------c-tc------
B D              Pig  -gag----g--gcac--gcagcaca----gag------cg------------c-tt------
B D          Dolphin  cgag----g--gcgc--gcaccact----gag------cg------------c-tt------
B D            Sheep  -gag----g--gcgc--gcaccact----gag------cg------------c-tc------
B D              Cow  -gag----g--gcgc--gcaccact----gag------cg------------c-tc------
B D              Cat  cgag----g--gcgc--gcaccact----gag------cg------------c-tc------
B D              Dog  cgag----g--gcgc--gcaccgct----gag------cg------------c-tc------
B D            Panda  cgag----g--gcgc--gcaccact----gag------cg------------t-tc------
B D            Horse  cgag----g--gcgc--gcactact----gag------cg------------c-tc------
B D         Microbat  cgag----g--gcgc--gcacccct----gag------cg------------c-tc------
B D          Megabat  cgag----g--gcgc--gcaccttt----gag------cg------------c-tc------
B D         Hedgehog  --ag----g--gcgc--gcacccct----gag------cg------------c-tc------
B D            Shrew  ccag----g--gcgc--gcaccact----gag------cg------------c-tc------
B D         Elephant  cgag----g--gcgc--gcaccact----gag------cg------------c-tc------
B D       Rock hyrax  cgag----g--gcgc--gcacccct----gag------cg------------c-tc------
B D           Tenrec  cgag----g--gc-t--gcgtcgctcatgggg------cg------------cttc------
B D          Manatee  cgag----g--gcgc--gcaccact----gag------cg------------c-tc------
B D        Armadillo  cgag----g--gcgc--gcaccgct----gag------cg------------c-tc------
B D          Wallaby  --at----a--ctgg--gagtcaca----act------tg------------c-tt------
B D         Platypus  cggg----c--gagccagcgcagct----ggc------tg----------------------
B D          Chicken  cccgcgccg--tcat--gtgccacc----gcggc----tc------------c-t-------
B D      Zebra finch  ctca----g--tcat--ctgccacc----gccgcggctcc------------c-t-------
B D       Budgerigar  cgcc----g--tcat--gagccgcc----gcctcagctcc------------c-t-------
B D   Painted turtle  tgag----a--tcat--gtgcagcc----gcaat---ttg------------c-t-------
B D             Fugu  --ga----gaactac--ttgtcacttttaata------tg------------t-ta----ag
B D      Stickleback  --cg----g--ctgc--gtcccgc--------------cg------------c-tt----gg
B D           Rhesus  --------------------------------------------------------------
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D     Atlantic cod  ==============================================================
B D     Nile tilapia  ==============================================================
B D        Zebrafish  ==============================================================
B D    X. tropicalis  ==============================================================
B D           Turkey  ==============================================================
B D       Coelacanth  ==============================================================
B D  Tasmanian devil  ==============================================================
B D          Opossum  ==============================================================
B D           Lizard  ==============================================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D     Kangaroo rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 31 and 32 in window
B D           Human 8bp
B D           Chimp 8bp
B D         Gorilla 8bp
B D       Orangutan 8bp
B D          Gibbon 8bp
B D          Baboon 8bp
B D        Marmoset 8bp
B D Squirrel monkey 8bp
B D     Mouse lemur 10bp
B D        Bushbaby 10bp
B D      Tree shrew 10bp
B D             Pig 10bp
B D         Dolphin 10bp
B D           Sheep 10bp
B D             Cow 10bp
B D             Cat 10bp
B D             Dog 10bp
B D           Panda 10bp
B D           Horse 10bp
B D        Microbat 10bp
B D         Megabat 10bp
B D        Hedgehog 10bp
B D           Shrew 10bp
B D        Elephant 10bp
B D      Rock hyrax 10bp
B D          Tenrec 11bp
B D         Manatee 10bp
B D       Armadillo 10bp

Alignment block 32 of 736 in window, 56695960 - 56695995, 36 bps 
B D            Mouse  ta-------ttgactcag-actg-cgtcc-gt-c--gagctgt-aagcac-------------------
B D              Rat  ta-------ttgactcag-accg-cgtcc-ctac--gagttgt-atgcac-------------------
B D   Naked mole-rat  tg-------ctgagtttg-ctct-cgttc-ctac--aagttgt-aggagc-------------------
B D       Guinea pig  tg-------ttgactttg-ctct-tgttc-ctac--aagttga-aggaac-------------------
B D         Squirrel  ta-------ttgactttg-ctcg-tgttc-ctac--aagttgt-aggaac-------------------
B D           Rabbit  tg-------ctggg--------------------------tgt-aggact-------------------
B D             Pika  cg-------ctgag-------------------------------ggact-------------------
B D            Human  ta-------ttgactttg-ctcg-tgttc-ctac--aagttgt-aggaac-------------------
B D            Chimp  ta-------ttgactttg-ctcg-tgttc-ctac--aagttgt-agaaac-------------------
B D          Gorilla  ta-------ttgactttg-ctcg-tgttc-ctac--aagttgt-aggaac-------------------
B D        Orangutan  ta-------ttgactttg-ctcg-tgttc-ctac--aagttgt-aggaac-------------------
B D           Gibbon  ta-------ttgactttg-ctcg-tgttc-ctac--aagttgt-aggaac-------------------
B D           Rhesus  ---------------------------tc-ctac--aagttgt-aggaac-------------------
B D           Baboon  ta-------ttgactttg-ctcg-tgttc-ctac--aagttgt-aggaac-------------------
B D         Marmoset  ta-------ttgactttg-ctcg-tgttc-ctac--aagttgt-aggaac-------------------
B D  Squirrel monkey  ta-------ttgactttg-ctcg-tgttc-ctac--aagttgt-aggaac-------------------
B D      Mouse lemur  ta-------ttgactttg-ctcg-tgttc-ctac--aagttgt-atgaac-------------------
B D         Bushbaby  ta-------ttgactttg-ctcg-tgttc-ctac--aagttgt-aggaac-------------------
B D       Tree shrew  ta-------ttgactttg-ctcg-tgttc-gtac--aagttgt-aggaac-------------------
B D              Pig  ta-------ttgactttg-ttca-tgttc-ctac--aagttgt-aggaac-------------------
B D          Dolphin  ta-------ttgactttg-ctcg-tgttc-ctac--aacttgt-aggaac-------------------
B D            Sheep  ta-------ttgactttg-ctcg-tgttc-ctac--aagttgt-gggaac-------------------
B D              Cow  ta-------ttgactttg-ctca-tgttc-ctac--aagttgt-aggaac-------------------
B D              Cat  ta-------ttgactttg-ctcg-tgttt-ctac--aagttgttaggaac-------------------
B D              Dog  ta-------ttgactttg-ctcg-tgttc-ctac--aagttgttaggaac-------------------
B D            Panda  ta-------ttgactttg-cccg-tgttc-ctac--aagttgttagaaac-------------------
B D            Horse  ta-------ttgactttg-ctcg-tgttc-atac--aagttgt--aggac-------------------
B D         Microbat  ta-------ttgactttg-ctcg-tgttc-ctac--aacttgt-aggaac-------------------
B D          Megabat  ta-------ttgactttt-ctcc-tgttc-ctac--aacttgt-aggaac-------------------
B D         Hedgehog  ta-------ttgactttg-ctcg-tgttc-ctac--acgttgt-agcaac-------------------
B D            Shrew  ta-------ttgactttg-ctcg-tgttc-ctac--aagttgt-aggaac-------------------
B D         Elephant  ta-------ttgactttg-ttcg-tgttc-ctac--aaatagt-aggaac-------------------
B D       Rock hyrax  tg-------ttgactttg-ctcg-tgttc-ctac--aagtagt-gggaac-------------------
B D           Tenrec  ta-------tggactttgcctcg-agtct-ctttcaaagttgt-gggtac-------------------
B D          Manatee  ta-------tagactttg-ttcg-ttttc-ctac--aagtagt-aggaac-------------------
B D        Armadillo  ta-------ttgactttg-ctcg-tgttt-ctac--acgttgt-aggaac-------------------
B D  Tasmanian devil  ta-------ttgactttg-cttg-tatttcctac--acgttat-aacaat-------------------
B D          Wallaby  -t-------ttgactttg-ctcg-tgttt-ctac--aagttgt-aacaat-------------------
B D         Platypus  -g-------ttgagtttg-ttcg-tgttc-ttcc--gagttgttagggac-------------------
B D          Chicken  ta-------ttgacttta-ctcg-tgttt-ctac--acgtcgg-gacagc-------------------
B D      Zebra finch  ta-------ttgactttg-ctcg-tgttc-ctac--aagttgt-aagaac-------------------
B D       Budgerigar  ta-------ttgactttg-ctcg-tgttc-gtac--aagttgt-aagaac-------------------
B D   Painted turtle  ta-------ttgactttg-ttcg-tgttc-ctac--aagttgt-aggaac-------------------
B D             Fugu  aatccaggcgcgccctcg-tttg-tgtgg-ccgc--gcgtagcccctggccaccttaaaacgaagtctc
B D      Stickleback  aa-------gcagctcag-tttgatttca-caga--gcgagaccgttgact--------------tcac
B D           Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D     Atlantic cod  =====================================================================
B D     Nile tilapia  =====================================================================
B D        Zebrafish  =====================================================================
B D    X. tropicalis  =====================================================================
B D           Turkey  =====================================================================
B D       Coelacanth  =====================================================================
B D          Opossum  =====================================================================
B D           Lizard  =====================================================================
B D            Sloth  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D     Kangaroo rat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 32 and 33 in window
B D     Mouse lemur 295bp

Alignment block 33 of 736 in window, 56695996 - 56696011, 16 bps 
B D            Mouse  cctc---caagggtcagt-g
B D              Rat  acgc---caagggtcagc-g
B D   Naked mole-rat  aggc---taaggggcagc-g
B D       Guinea pig  tggc---caagggtcaga-g
B D         Squirrel  acgc---taagggtcagc-g
B D           Rabbit  gcgc---caagggccagc-g
B D             Pika  tggg---tgggttcctac-c
B D            Human  acgc---taagggtcagc-g
B D            Chimp  acgc---taagggtcagc-g
B D          Gorilla  acgc---taagggtcagc-g
B D        Orangutan  acgc---taagggtcagc-g
B D           Gibbon  acgc---taagggtcagc-g
B D           Rhesus  acgc---taagggtcagc-g
B D           Baboon  acgc---taagggtcagc-g
B D         Marmoset  acgc---taagggtcagc-g
B D  Squirrel monkey  acgc---taagggtcagc-g
B D         Bushbaby  acgc---taagggtcaac-g
B D       Tree shrew  acgc---tgagggtcagc-g
B D              Pig  actc---taagggtcagc-g
B D          Dolphin  acgc---taagggtcagc-g
B D            Sheep  acgc---taagggtcagc-g
B D              Cow  acgc---taagggtcagc-g
B D              Cat  acgc---taagggtcag--g
B D              Dog  gcgc---taagggtcag--g
B D            Panda  acgc---taagggtcag--g
B D            Horse  ccgc---taagggtcggc-g
B D         Microbat  atgc---taagggtcaga-g
B D          Megabat  acgc---taagggtcaga-g
B D         Hedgehog  acgc---caagggtcagc-g
B D            Shrew  acgc---taagggtcagt-g
B D         Elephant  gctc---taagggtcagc-g
B D       Rock hyrax  attc---gaagggtcagc-g
B D           Tenrec  cacccgtaaggggtcagctg
B D          Manatee  actg---taagggtgagc-g
B D        Armadillo  tcgc---tgagggtcagc-g
B D  Tasmanian devil  aagt---taaaagtcaat-a
B D          Wallaby  gagt---taaaggtcagt-a
B D         Platypus  acgt---tgagggtccgt-a
B D          Chicken  gcgc---cgaggggca-g-a
B D      Zebra finch  atgt---tgagggccagg-a
B D       Budgerigar  acgt---taagggtcagg-a
B D   Painted turtle  atgt---taagggtcagc-a
B D             Fugu  cctc---cgagggtaaac-g
B D      Stickleback  actt---catgt--------
B D           Alpaca  NNNNNNNNNNNNNNNNNNNN
B D     Atlantic cod  ====================
B D     Nile tilapia  ====================
B D        Zebrafish  ====================
B D    X. tropicalis  ====================
B D           Turkey  ====================
B D       Coelacanth  ====================
B D          Opossum  ====================
B D           Lizard  ====================
B D            Sloth  NNNNNNNNNNNNNNNNNNNN
B D      Mouse lemur  ====================
B D     Kangaroo rat  NNNNNNNNNNNNNNNNNNNN

Alignment block 34 of 736 in window, 56696012 - 56696014, 3 bps 
B D            Mouse  gcg
B D              Rat  gct
B D   Naked mole-rat  gcg
B D       Guinea pig  gct
B D         Squirrel  acg
B D           Rabbit  gcg
B D             Pika  acg
B D            Human  gcg
B D            Chimp  gcg
B D          Gorilla  gcg
B D        Orangutan  gcg
B D           Gibbon  gcg
B D           Rhesus  gcg
B D           Baboon  gcg
B D         Marmoset  gcg
B D  Squirrel monkey  gcg
B D         Bushbaby  gcg
B D       Tree shrew  gcg
B D              Pig  gcg
B D          Dolphin  acg
B D            Sheep  gct
B D              Cow  gct
B D              Cat  gcg
B D              Dog  gcg
B D            Panda  gca
B D            Horse  tcg
B D         Microbat  gcg
B D          Megabat  gct
B D         Hedgehog  gcg
B D            Shrew  gcg
B D         Elephant  gtg
B D       Rock hyrax  gtg
B D           Tenrec  gtg
B D          Manatee  gtg
B D        Armadillo  gcg
B D  Tasmanian devil  ata
B D          Wallaby  gta
B D         Platypus  gcg
B D          Chicken  gcg
B D      Zebra finch  gca
B D       Budgerigar  aca
B D   Painted turtle  gca
B D      Stickleback  gtg
B D           Alpaca  NNN
B D             Fugu  ===
B D     Atlantic cod  ===
B D     Nile tilapia  ===
B D        Zebrafish  ===
B D    X. tropicalis  ===
B D           Turkey  ===
B D       Coelacanth  ===
B D          Opossum  ===
B D           Lizard  ===
B D            Sloth  NNN
B D      Mouse lemur  ===
B D     Kangaroo rat  NNN

Inserts between block 34 and 35 in window
B D             Pig 1bp
B D         Dolphin 1bp
B D           Sheep 1bp
B D             Cow 1bp
B D             Cat 1bp
B D             Dog 1bp
B D           Panda 1bp
B D           Horse 1bp
B D        Microbat 1bp
B D         Megabat 1bp
B D           Shrew 1bp

Alignment block 35 of 736 in window, 56696015 - 56696065, 51 bps 
B D            Mouse  gaaag-g-gttctgtg--a----------ga--------gc----ca--------ct----gggt---g-
B D              Rat  aaaag-g-gtgctgtg--g----------ga--------gc----ta--------cc----gagt---g-
B D   Naked mole-rat  cgcagca-gttcaatc--t----------gaac-tctg-gc----ta--------ct----gggt---t-
B D       Guinea pig  tgcggtg-gttccgtg--c----------gaac-gctg-gc----ta--------ct----gggt---t-
B D         Squirrel  cacagca-gttcaatc--c----------gaac-gctg-gc----ta--------ct----gggt---t-
B D           Rabbit  cacggcg-gtccggtg--t----------gcgc-gccg-gc----tg--------ct----gggc---t-
B D             Pika  cgtcccg-ggac------t----------gcgc-gcct-gc----ta--------cc----gggg---tg
B D            Human  cacagca-gttcaatg--t----------gaac-gctg-gc----ta--------ct----gggt---g-
B D            Chimp  cacagca-gttcaatg--t----------gaac-gctg-gc----ta--------ct----gggt---g-
B D          Gorilla  cacagca-gttcaatg--t----------gaac-gctg-gc----ta--------ct----gggt---g-
B D        Orangutan  cacagca-gttcaatg--t----------gaac-gctg-gc----ta--------ct----gggc---g-
B D           Gibbon  cacagca-gttcactg--t----------gaac-gctg-gc----ta--------ct----ggga---g-