Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 61 in window, 114378761 - 114378795, 35 bps 
B D                     Human  ctgctggctttcctttttccctcct-tccatag-taa
B D                     Chimp  ctgctggctttcctttttccctcct-tccatag-taa
B D                   Gorilla  ctgctggctttcctttttccctcct-tccatag-taa
B D                 Orangutan  ctgctggctttcctttttccctcct-tccatag-taa
B D                    Gibbon  ctgctggctttcccttttccctcct-tccatag-taa
B D                    Rhesus  ctgctggctttcattcttccctcct-tccatag-taa
B D       Crab-eating macaque  ctgctggctttcattcttccctcct-tccatag-taa
B D                    Baboon  ctgctggctttccttcttccctcct-tccatag-taa
B D              Green monkey  ctgctggctttccttcttccctcct-tccatag-taa
B D                  Marmoset  ctgctggctttccttctttcttcct-tctgcag-taa
B D           Squirrel monkey  ctgctggctttccttctttcctcct-tccacag-tag
B D                  Bushbaby  ctgctggctttcattcttcct---t-tcaatag-tag
           Chinese tree shrew  ctgctggatttcattcttcccttcc-tccatag-tga
B D                    Rabbit  ctgctacctttcattcttcccttcc-tgcatgg-tct
B D                       Pig  cttctggctttcacgtctccctttgctccatgg-taa
B D                    Alpaca  cttctggctttca---ctgtcttct-tccatag-taa
               Bactrian camel  cttctggctttca---ctgtcttct-tccacag-taa
B D                   Dolphin  cttctgtctttcatttctccctttt-cacagag-taa
                 Killer whale  cttctgtctttcatttctccctttt-tccagag-taa
             Tibetan antelope  tttctggctttcgtgtcttgcttttccccagag-taa
B D                       Cow  tttctggctttcgtgtctcgcttttccccagag-taa
B D                     Sheep  tttctggctgtcatgtctcgcttttccccagag-taa
                Domestic goat  tttctggctttcatgtctcgcttttccccagag-taa
B D                     Horse  ctgctggcttt-attcttcccttct-tccatag-taa
B D          White rhinoceros  ccgctggctttcattcttcccttct-tccatag-taa
B D                       Cat  --------------tctgcccttct-tctatagttca
B D                       Dog  -tgctggctttcagtctgcccttct-tccatag-taa
B D                   Ferret   -tgctggctttcactctgcccttct-tctgtag-taa
B D                     Panda  -tgctggctttcactctgcccttct-tccatag-taa
               Pacific walrus  -tgctggctttcactctgcccttct-tccatag-taa
                 Weddell seal  -tgctggctttcactctgcccttct-tccatag-taa
             Black flying-fox  ctgctggcttccattctttctttca-ttcacac-taa
B D                   Megabat  ctgctggcttccattcttcctttca-ttcacaa-taa
                Big brown bat  ctgctggctttcatcctttctttct-ctcacag-taa
         David's myotis (bat)  ctgctggctttcatcctttctttct-ctcacag-taa
B D                  Microbat  ctgctggcttttatcctttctttct-ctcatag-taa
B D                  Elephant  ctgctggctttcattcttcctgtcc-ttcagag-taa
B D                   Manatee  ctgctggctttcattctttctgtct-tccagag-taa
             Cape golden mole  cagctagctttgattcttcctgtct-ttcagag-taa
B D                 Armadillo  ctgctagctttcacacttggtttct-tccacag-tag
             Star-nosed mole  -------------------------------------
B D                      Pika  =====================================
         Cape elephant shrew  =====================================
B D                  Hedgehog  =====================================
B D                     Shrew  =====================================
B D                     Mouse  =====================================
                Prairie vole  -------------------------------------
B D                       Rat  =====================================
B D           Chinese hamster  =====================================
              Golden hamster  =====================================
      Lesser Egyptian jerboa  =====================================
B D                    Tenrec  =====================================
            Brush-tailed rat  =====================================
                  Chinchilla  =====================================
B D                Guinea pig  =====================================
B D                  Squirrel  =====================================
B D            Naked mole-rat  =====================================
  D  Chinese softshell turtle  =====================================
  D            Painted turtle  =====================================
  D           Green seaturtle  =====================================
B D                    Turkey  =====================================
B D                   Chicken  =====================================
  D              Mallard duck  =====================================
B D                Budgerigar  =====================================
          Tibetan ground jay  =====================================
B D               Zebra finch  =====================================
B D       Medium ground finch  =====================================
  D    White-throated sparrow  =====================================
  D       Collared flycatcher  =====================================
  D          Peregrine falcon  =====================================
  D              Saker falcon  =====================================
B D        American alligator  =====================================
B D                   Opossum  =====================================
B D           Tasmanian devil  =====================================
                    Aardvark  =====================================

Alignment block 2 of 61 in window, 114378796 - 114378804, 9 bps 
B D                     Human  --cag-----------------------aaatgc
B D                     Chimp  --cag-----------------------aaatgc
B D                   Gorilla  --cag-----------------------aaatgc
B D                 Orangutan  --cag-----------------------aaaggc
B D                    Gibbon  --cag-----------------------aaatgg
B D                    Rhesus  --cag-----------------------aaatgg
B D       Crab-eating macaque  --cag-----------------------aaatgg
B D                    Baboon  --cag-----------------------aaatgg
B D              Green monkey  --cag-----------------------aaatgg
B D                  Marmoset  --cag-----------------------agatgg
B D           Squirrel monkey  --cag-----------------------aaatgg
B D                  Bushbaby  --cag-----------------------aaatgt
           Chinese tree shrew  --cag-----------------------aaatgc
             Brush-tailed rat  --cgg-----------------------gaggga
B D                    Rabbit  --cag-----------------------aaatgt
B D                       Pig  --cag-----------------------gagtgt
B D                    Alpaca  --tgg-----------------------aggtgt
               Bactrian camel  --tgg-----------------------aggtgt
B D                   Dolphin  --tgg-----------------------------
                 Killer whale  --tgg-----------------------aagtgt
             Tibetan antelope  --tca-----------------------aagtgt
B D                       Cow  --tca-----------------------aagtgt
B D                     Sheep  --tca-----------------------aagtgt
                Domestic goat  --tca-----------------------aagtgt
B D                     Horse  --cgg-----------------------aaatgt
B D          White rhinoceros  --tgg-----------------------aaaggt
B D                       Cat  --tag-----------------------acatgt
B D                       Dog  --cag-----------------------acatgt
B D                   Ferret   --tgg-----------------------acatg-
B D                     Panda  --tggagcaagtagtaacgttccatagtaaacgt
               Pacific walrus  --tgg-----------------------acatgt
                 Weddell seal  --tgg-----------------------acatgt
             Black flying-fox  --aag-----------------------gaatgt
B D                   Megabat  --aag-----------------------gaatgt
                Big brown bat  --cag-----------------------aaatgt
         David's myotis (bat)  --cag-----------------------aaatgt
B D                  Microbat  --cag-----------------------aaatgt
B D                  Elephant  caagg-----------------------caatgt
B D                   Manatee  caagg-----------------------caatgt
             Cape golden mole  caagg-----------------------cagtgc
B D                 Armadillo  cagag-------------------------gtgt
             Star-nosed mole  ----------------------------------
B D                      Pika  ==================================
         Cape elephant shrew  ==================================
B D                  Hedgehog  ==================================
B D                     Shrew  ==================================
B D                     Mouse  ==================================
                Prairie vole  ----------------------------------
B D                       Rat  ==================================
B D           Chinese hamster  ==================================
              Golden hamster  ==================================
      Lesser Egyptian jerboa  ==================================
B D                    Tenrec  ==================================
                  Chinchilla  ==================================
B D                Guinea pig  ==================================
B D                  Squirrel  ==================================
B D            Naked mole-rat  ==================================
  D  Chinese softshell turtle  ==================================
  D            Painted turtle  ==================================
  D           Green seaturtle  ==================================
B D                    Turkey  ==================================
B D                   Chicken  ==================================
  D              Mallard duck  ==================================
B D                Budgerigar  ==================================
          Tibetan ground jay  ==================================
B D               Zebra finch  ==================================
B D       Medium ground finch  ==================================
  D    White-throated sparrow  ==================================
  D       Collared flycatcher  ==================================
  D          Peregrine falcon  ==================================
  D              Saker falcon  ==================================
B D        American alligator  ==================================
B D                   Opossum  ==================================
B D           Tasmanian devil  ==================================
                    Aardvark  ==================================

Alignment block 3 of 61 in window, 114378805 - 114378808, 4 bps 
B D                     Human  agcc
B D                     Chimp  agcc
B D                   Gorilla  agcc
B D                 Orangutan  agcc
B D                    Gibbon  agcc
B D                    Rhesus  agcc
B D       Crab-eating macaque  agcc
B D                    Baboon  agcc
B D              Green monkey  agcc
B D                  Marmoset  aacc
B D           Squirrel monkey  agcc
B D                  Bushbaby  accc
           Chinese tree shrew  ctca
B D            Naked mole-rat  aggc
             Brush-tailed rat  agaa
B D                    Rabbit  agcc
B D                       Pig  ggca
B D                    Alpaca  agca
               Bactrian camel  agca
B D                   Dolphin  ---a
                 Killer whale  agca
             Tibetan antelope  gata
B D                       Cow  gcta
B D                     Sheep  gata
                Domestic goat  gata
B D                     Horse  agca
B D          White rhinoceros  agca
B D                       Cat  agca
B D                       Dog  agca
B D                     Panda  agca
               Pacific walrus  agca
                 Weddell seal  agca
             Black flying-fox  agca
B D                   Megabat  agca
                Big brown bat  agca
         David's myotis (bat)  agca
B D                  Microbat  agca
B D                  Elephant  acca
B D                   Manatee  acca
             Cape golden mole  agca
B D                 Armadillo  a-ca
             Star-nosed mole  ----
B D                      Pika  ====
         Cape elephant shrew  ====
B D                  Hedgehog  ====
B D                     Shrew  ====
B D                     Mouse  ====
                Prairie vole  ----
B D                       Rat  ====
B D           Chinese hamster  ====
              Golden hamster  ====
      Lesser Egyptian jerboa  ====
B D                    Tenrec  ====
                  Chinchilla  ====
B D                Guinea pig  ====
B D                  Squirrel  ====
B D                   Ferret   ----
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
B D                Budgerigar  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
  D       Collared flycatcher  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
B D        American alligator  ====
B D                   Opossum  ====
B D           Tasmanian devil  ====
                    Aardvark  ====

Alignment block 4 of 61 in window, 114378809 - 114378812, 4 bps 
B D                     Human  aggc
B D                     Chimp  aggc
B D                   Gorilla  aggc
B D                 Orangutan  aggc
B D                    Gibbon  aggc
B D                    Rhesus  aggc
B D       Crab-eating macaque  aggc
B D                    Baboon  aggc
B D              Green monkey  aggc
B D                  Marmoset  agga
B D           Squirrel monkey  aggc
B D                  Bushbaby  a-gc
           Chinese tree shrew  aggc
B D            Naked mole-rat  aggc
                   Chinchilla  aggc
             Brush-tailed rat  aggc
B D                    Rabbit  aggt
B D                       Pig  aggc
B D                    Alpaca  aggc
               Bactrian camel  aggc
B D                   Dolphin  aggt
                 Killer whale  aggt
             Tibetan antelope  aggc
B D                       Cow  aggc
B D                     Sheep  aggc
                Domestic goat  aggc
B D                     Horse  aggc
B D          White rhinoceros  aggc
B D                       Cat  agac
B D                       Dog  aggc
B D                   Ferret   -gac
B D                     Panda  agac
               Pacific walrus  agac
                 Weddell seal  agac
             Black flying-fox  aggc
B D                   Megabat  aggc
                Big brown bat  aggc
         David's myotis (bat)  aggc
B D                  Microbat  agac
B D                  Elephant  aggc
B D                   Manatee  aggc
             Cape golden mole  gaac
B D                 Armadillo  aggc
             Star-nosed mole  ----
B D                      Pika  ====
         Cape elephant shrew  ====
B D                  Hedgehog  ====
B D                     Shrew  ====
B D                     Mouse  ====
                Prairie vole  ----
B D                       Rat  ====
B D           Chinese hamster  ====
              Golden hamster  ====
      Lesser Egyptian jerboa  ====
B D                    Tenrec  ====
B D                Guinea pig  ====
B D                  Squirrel  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
B D                Budgerigar  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
  D       Collared flycatcher  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
B D        American alligator  ====
B D                   Opossum  ====
B D           Tasmanian devil  ====
                    Aardvark  ====

Alignment block 5 of 61 in window, 114378813 - 114378845, 33 bps 
B D                     Human  acagggctgaccagctgg-gcc-acctttccccat-----------------------
B D                     Chimp  acagggctgaccagctgg-gcc-acctttccccat-----------------------
B D                   Gorilla  acagggctgaccagctgg-gcc-acctttccccat-----------------------
B D                 Orangutan  acagggctgaccagctgg-gcc-acctttccccgt-----------------------
B D                    Gibbon  acagggctgaccagctgg-gcc-acctttctccat-----------------------
B D                    Rhesus  acagggctgaccagctgg-gtc-acctttccccat-----------------------
B D       Crab-eating macaque  acagggctgaccagctgg-gtc-acctttccccat-----------------------
B D                    Baboon  acagggctgaccagctgg-atc-acctttccccat-----------------------
B D              Green monkey  acagggctgaccagctgg-gtc-acctttccccat-----------------------
B D                  Marmoset  gcagggctgagcagctag-gct-acctttccccat-----------------------
B D           Squirrel monkey  gcagggctgagcagctgg-gct-acctttccccat-----------------------
B D                  Bushbaby  acagggctgaccccctgg-act-gcctttcacctc-----------------------
           Chinese tree shrew  tcggggctgatcagcttacact-ccctttcaccac-----------------------
B D                Guinea pig  acaagg-tgaccagctac-att-g-gtttcatcac-----------------------
                   Chinchilla  acaaggctgaccaggtat-gtt-gcctctcaccac-----------------------
             Brush-tailed rat  acgaggctgactagctat-gtt-ccctttcaccac-----------------------
B D                    Rabbit  gcagggctcagcagctct-act-gtgtttccctgt-----------------------
B D                       Pig  acagggctgaccccacag-tct-acct-------------------------------
B D                    Alpaca  atggggctgaccagctag-cct-acctttcaccac-----------------------
               Bactrian camel  atggggctgaccagctag-cct-acctttcaccac-----------------------
B D                   Dolphin  acaaggttgagcttctag-ttg-gcctttcaccac-----------------------
                 Killer whale  acaaggttgagctgctag-ttg-gcctttcaccac-----------------------
             Tibetan antelope  acagggctgactggctag-tgg-acctttcaccac-----------------------
B D                       Cow  acagggctgactggctag-tgg-acctttcaccac-----------------------
B D                     Sheep  acagggctgactggctag-tgg-acctttcaccac-----------------------
                Domestic goat  acagggctgactggccag-tgg-acctttcaccac-----------------------
B D                     Horse  acagggctgaccggctat-gcg-acctttcaccac-----------------------
B D          White rhinoceros  actgggctgaccagctat-act-acctttcaccac-----------------------
B D                       Cat  acagtgctgacaggctgt-cct-acctttccccac-----------------------
B D                       Dog  acagggctgacaggctgt-ccg-gcccttcaccac-----------------------
B D                   Ferret   acagggccgacaggctgt-cct-acctttcaccac-----------------------
B D                     Panda  acagggctgacagactgt-cct-a----tcaccac-----------------------
               Pacific walrus  acagggctgacaggctgt-cct-acctttcaccac-----------------------
                 Weddell seal  acagggctgacaggctgt-cct-acctttcaccac-----------------------
             Black flying-fox  ataggactgacca------gct-agctttcaccat-----------------------
B D                   Megabat  ataggactgacca------gct-agctttcaccat-----------------------
                Big brown bat  gcagggctgcccaactac-act-acctttccccac-----------------------
         David's myotis (bat)  gcagggctgcccaactac-act-acctttccctac-----------------------
B D                  Microbat  tcagggctgcccaactac-act-acctttccccac-----------------------
B D                  Elephant  gcagggctggccagctat-act-ggccaactgcaaggctggccagtagctttttaaat
B D                   Manatee  acagggctggccaactat-agc-ggccaagtacaaggctggccagtagctttttaaat
             Cape golden mole  atgaggacaaccgactac-act-ggccaaccacaaggctggtgagtagcttcctaaat
B D                 Armadillo  ccagggctggccagctac-actaggttcactgc-------------------------
             Star-nosed mole  ----------------------------------------------------------
B D                      Pika  ==========================================================
         Cape elephant shrew  ==========================================================
B D                  Hedgehog  ==========================================================
B D                     Shrew  ==========================================================
B D                     Mouse  ==========================================================
                Prairie vole  ----------------------------------------------------------
B D                       Rat  ==========================================================
B D           Chinese hamster  ==========================================================
              Golden hamster  ==========================================================
      Lesser Egyptian jerboa  ==========================================================
B D                    Tenrec  ==========================================================
B D                  Squirrel  ==========================================================
B D            Naked mole-rat  ----------------------------------------------------------
  D  Chinese softshell turtle  ==========================================================
  D            Painted turtle  ==========================================================
  D           Green seaturtle  ==========================================================
B D                    Turkey  ==========================================================
B D                   Chicken  ==========================================================
  D              Mallard duck  ==========================================================
B D                Budgerigar  ==========================================================
          Tibetan ground jay  ==========================================================
B D               Zebra finch  ==========================================================
B D       Medium ground finch  ==========================================================
  D    White-throated sparrow  ==========================================================
  D       Collared flycatcher  ==========================================================
  D          Peregrine falcon  ==========================================================
  D              Saker falcon  ==========================================================
B D        American alligator  ==========================================================
B D                   Opossum  ==========================================================
B D           Tasmanian devil  ==========================================================
                    Aardvark  ==========================================================

Inserts between block 5 and 6 in window
B D                 Elephant 7bp
B D                  Manatee 7bp
            Cape golden mole 37bp

Alignment block 6 of 61 in window, 114378846 - 114378883, 38 bps 
B D                     Human  cttctgtg-aagaagatgagactaagtt-ctctccagaag
B D                     Chimp  cttctgtg-aagaagatgagactaagtt-ctctccagaag
B D                   Gorilla  cttctgtg-aagaagatgagactaagtt-ctctccagaag
B D                 Orangutan  cttctgtg-aagaagatgtgactaagtt-ctctccagaag
B D                    Gibbon  cttctgtg-aagaagatgtgactaagtt-ctctccagaag
B D                    Rhesus  cttctgtg-aagaagatgtgactaagtt-ctctccagagg
B D       Crab-eating macaque  cttctgtg-aagaagatgtgactaagtt-ctctccagagg
B D                    Baboon  cttctgtg-aagaagatgtgactaagtt-ctctccagagg
B D              Green monkey  cttctgtg-aagaagatgtgactaagtt-ctctccagagg
B D                  Marmoset  cttctatg-aagaagatgtgactaagtt-ctctccagaag
B D           Squirrel monkey  cttctgtg-aagaagatgtgactaattt-ctctccagaag
B D                  Bushbaby  cctctg----ggaagatgtgagtgtatt-ctctccagtgg
           Chinese tree shrew  cttctgt----gaagatgtgctgaagtt-ctccccagggg
B D                Guinea pig  cgtgtgtg-aggaagatgtgaccacgtt-cccttccatgg
                   Chinchilla  cttgtgtg-aggaagatgtgactgagtt-cccagtgaggg
             Brush-tailed rat  cttctgtg-a-----ctgtgactaagtt-ccctcggatgg
B D                    Rabbit  ctgctgca-caggagctgtgactagccc-ctctagtaa--
B D                       Pig  cgtctgtg-caggagatgtgactccttt-ttctccaggga
B D                    Alpaca  cttctgtg-caga---tatgactaagtt-ctctccagtga
               Bactrian camel  cttctgtg-caga---tatgactaagtt-ctctccagtga
B D                   Dolphin  cttctgtg-caga---tgtgactacgtt-ctctccagtaa
                 Killer whale  cttctgtg-caga---tgtgactacgtt-ctctccagtaa
             Tibetan antelope  cttccgtg-cagaaaatgtgacagcatt-ctccctagcaa
B D                       Cow  cttccgtg-cagaagatgtgacagcatt-ctccccagtga
B D                     Sheep  cttccgtg-cggaaggcgtgacagcatt-ctccccagtga
                Domestic goat  cttccgtg-cagaaggcgtgacagcatt-ctccccagcga
B D                     Horse  cttctgtg-cagaagatgtgactaagtt-ctctccagtga
B D          White rhinoceros  cttctgca-cagcagatgtgactaagtt-ctttccaatga
B D                       Cat  cttctctg-atgaagatgtgacaaagtt-ctcaacagtga
B D                       Dog  cttctct----gaagatgtgacaaagtt-ctctccactga
B D                   Ferret   cttctcta-aagaagaggtgacaaagtt-ctctccagtga
B D                     Panda  cttctata-aagaagatgtgacagagtt-ctctgcagtga
               Pacific walrus  cttctcta-aagaaggtgtgacaaagtt-ctctccagtga
                 Weddell seal  cttctcta-aagaagatgtgacaaagtt-ctctccagtga
             Black flying-fox  cttctgtg-cagaagatgtgactaaatt-ttctacagtaa
B D                   Megabat  cttctgtg-cagaagatgtgactaaatt-ttctacagtaa
                Big brown bat  cttccctg-cggacaatgtgactaagtt-ctctccagtga
         David's myotis (bat)  cttccctg-cagacgatgttactaagtt-ctctccagaga
B D                  Microbat  cttccctg-cagacgatgtgactaagtt-ctctccagtga
B D                  Elephant  catctgtgcaagaagatgtgactgtt---ttctcccatgg
B D                   Manatee  catctgtgcaaaaagatgtgactgtt---ttctcccatgg
             Cape golden mole  ctcccgtg-gagtggacaggagtgatgtgtcctcccgtgg
B D                    Tenrec  cttcctgg-aagaagatgcaactaagat-tttgccggtgg
B D                 Armadillo  cttcagcg----aagatgtgaccgcttt-ttctccagtgg
             Star-nosed mole  ----------------------------------------
B D                      Pika  ========================================
         Cape elephant shrew  ========================================
B D                  Hedgehog  ========================================
B D                     Shrew  ========================================
B D                     Mouse  ========================================
                Prairie vole  ----------------------------------------
B D                       Rat  ========================================
B D           Chinese hamster  ========================================
              Golden hamster  ========================================
      Lesser Egyptian jerboa  ========================================
B D                  Squirrel  ========================================
B D            Naked mole-rat  ----------------------------------------
  D  Chinese softshell turtle  ========================================
  D            Painted turtle  ========================================
  D           Green seaturtle  ========================================
B D                    Turkey  ========================================
B D                   Chicken  ========================================
  D              Mallard duck  ========================================
B D                Budgerigar  ========================================
          Tibetan ground jay  ========================================
B D               Zebra finch  ========================================
B D       Medium ground finch  ========================================
  D    White-throated sparrow  ========================================
  D       Collared flycatcher  ========================================
  D          Peregrine falcon  ========================================
  D              Saker falcon  ========================================
B D        American alligator  ========================================
B D                   Opossum  ========================================
B D           Tasmanian devil  ========================================
                    Aardvark  ========================================

Alignment block 7 of 61 in window, 114378884 - 114378893, 10 bps 
B D                     Human  aatatgatgg
B D                     Chimp  aatatgatgg
B D                   Gorilla  aatatgatgg
B D                 Orangutan  aatatgatgg
B D                    Gibbon  aatatgacag
B D                    Rhesus  aatatgatgg
B D       Crab-eating macaque  aatatgatgg
B D                    Baboon  aatatgatgg
B D              Green monkey  aatatgatgg
B D                  Marmoset  aatgtgatgg
B D           Squirrel monkey  aatgtgatgg
B D                  Bushbaby  actgtggcga
           Chinese tree shrew  aatatgacag
B D           Chinese hamster  agtatagtag
B D            Naked mole-rat  agcggaacca
B D                Guinea pig  tgtgtgaca-
                   Chinchilla  aatgtgccag
             Brush-tailed rat  aatgtgatag
B D                    Rabbit  aatgtgatag
B D                       Pig  catgtgacag
B D                    Alpaca  catgtgacag
               Bactrian camel  catgtgacag
B D                   Dolphin  tgtgcgacag
                 Killer whale  tgtgcgacag
             Tibetan antelope  tgtgtgacag
B D                       Cow  tgtgtgacgg
B D                     Sheep  tgtgtgacag
                Domestic goat  tgtgtgacag
B D                     Horse  agtatgatgg
B D          White rhinoceros  agagttacaa
B D                       Cat  agtgtgatgg
B D                       Dog  agcatgaaag
B D                   Ferret   agtatgacag
B D                     Panda  agtgtgacag
               Pacific walrus  agtgtgacag
                 Weddell seal  agtgtgacag
             Black flying-fox  agtatggcag
B D                   Megabat  aatatggcag
                Big brown bat  tgtgtgacag
         David's myotis (bat)  tgtgtggcag
B D                  Microbat  cgtgtggcag
B D                  Elephant  aatgtgcaag
B D                   Manatee  aatgtgcagg
             Cape golden mole  agtagacagg
B D                    Tenrec  agtggacagg
B D                 Armadillo  aatgtgactg
             Star-nosed mole  ----------
B D                      Pika  ==========
         Cape elephant shrew  ==========
B D                  Hedgehog  ==========
B D                     Shrew  ==========
B D                     Mouse  ==========
                Prairie vole  ----------
B D                       Rat  ==========
              Golden hamster  ==========
      Lesser Egyptian jerboa  ==========
B D                  Squirrel  ==========
  D  Chinese softshell turtle  ==========
  D            Painted turtle  ==========
  D           Green seaturtle  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
  D              Mallard duck  ==========
B D                Budgerigar  ==========
          Tibetan ground jay  ==========
B D               Zebra finch  ==========
B D       Medium ground finch  ==========
  D    White-throated sparrow  ==========
  D       Collared flycatcher  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
B D        American alligator  ==========
B D                   Opossum  ==========
B D           Tasmanian devil  ==========
                    Aardvark  ==========

Alignment block 8 of 61 in window, 114378894 - 114378908, 15 bps 
B D                     Human  aaatggtgccttcct
B D                     Chimp  aaatggtgccttcct
B D                   Gorilla  aaatggtgccttcct
B D                 Orangutan  aaatgatgccttcca
B D                    Gibbon  aagtggtgccttcca
B D                    Rhesus  aaatgatgccttcca
B D       Crab-eating macaque  aaatgatgccttcca
B D                    Baboon  aaatgatgccttcca
B D              Green monkey  aaatgatgccttcca
B D                  Marmoset  aaatggtgccttcca
B D           Squirrel monkey  aaatggtgtcttcca
B D                  Bushbaby  gagggacaccttc--
           Chinese tree shrew  aagtgatgcatccca
B D           Chinese hamster  tggcaatgtgttcta
B D            Naked mole-rat  ctgagctaaatcccc
B D                Guinea pig  gagtgacgtgttcca
                   Chinchilla  gagtgatgtgttccg
             Brush-tailed rat  gagtgatgcattcca
B D                    Rabbit  gagt-----------
B D                      Pika  aggtggtactttcct
B D                       Pig  gagtggcgtgttcca
B D                    Alpaca  gagtgacacttccca
               Bactrian camel  gagggacgcatccta
B D                   Dolphin  gagtgatgtgtccca
                 Killer whale  gagtgatgtgtccca
             Tibetan antelope  aagtgacgagccccc
B D                       Cow  aagtgacgagtcccc
B D                     Sheep  aagtgacgagtcccc
                Domestic goat  aagtgacgagtcccc
B D                     Horse  cagtgatgtgtcccc
B D          White rhinoceros  cagtgatgtgtccca
B D                       Cat  gagtgatgggtccaa
B D                       Dog  gagctatgtgtctaa
B D                   Ferret   aagcaatgtgcccca
B D                     Panda  gagtgatgtgtccaa
               Pacific walrus  gagcgatgtgtccaa
                 Weddell seal  gagcaatgtgtccaa
             Black flying-fox  gagtgacatggccc-
B D                   Megabat  gagtgacatgtccc-
                Big brown bat  gagtgacatgtccc-
         David's myotis (bat)  gagtgacaagtccc-
B D                  Microbat  gagtgacatgtccc-
B D                  Elephant  -agtgatatatccta
B D                   Manatee  -agtgatgtattcca
             Cape golden mole  -agtgatgtgtccta
B D                    Tenrec  -agtgatgtgtcctg
B D                 Armadillo  -gaaaatgggtcgca
             Star-nosed mole  ---------------
         Cape elephant shrew  ===============
B D                  Hedgehog  ===============
B D                     Shrew  ===============
B D                     Mouse  ===============
                Prairie vole  ---------------
B D                       Rat  ===============
              Golden hamster  ===============
      Lesser Egyptian jerboa  ===============
B D                  Squirrel  ===============
  D  Chinese softshell turtle  ===============
  D            Painted turtle  ===============
  D           Green seaturtle  ===============
B D                    Turkey  ===============
B D                   Chicken  ===============
  D              Mallard duck  ===============
B D                Budgerigar  ===============
          Tibetan ground jay  ===============
B D               Zebra finch  ===============
B D       Medium ground finch  ===============
  D    White-throated sparrow  ===============
  D       Collared flycatcher  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
B D        American alligator  ===============
B D                   Opossum  ===============
B D           Tasmanian devil  ===============
                    Aardvark  ===============

Inserts between block 8 and 9 in window
B D                   Rabbit 8bp
B D                     Pika 20bp

Alignment block 9 of 61 in window, 114378909 - 114378952, 44 bps 
B D                     Human  tt----t----ccagcctggcctcttaataccagaccaagagatatc-at-aag
B D                     Chimp  tt----t----ccagcctggcctcttaataccagaccaggagatatc-at-aag
B D                   Gorilla  tt----t----ccagcctggcctcttaataccagaccaggagatatc-at-aag
B D                 Orangutan  tt----t----ccagcctggcctcttaataccaaaccaggagatatc-at-aag
B D                    Gibbon  tt----t----ccagcctggcctcttaataccaggccagcagatatcaaa-aag
B D                    Rhesus  tt----t----ccagcttggtctcttaataccagaccaggagctatc-at-aag
B D       Crab-eating macaque  tt----t----ccagcttggtctcttaataccagaccaggagctatc-at-aag
B D                    Baboon  tt----t----ccagcttggcctcttaataccagaccaggagctatc-at-aag
B D              Green monkey  tt----t----ccagcttggcctcttaataccagaccaggagctatc-at-aag
B D                  Marmoset  ------------------------ttaggaccagaccaggagcgatc-at-aag
B D           Squirrel monkey  ------------------------tttagaccagaccaggagagatc-at-aag
B D                  Bushbaby  ---------------------------agaccagagaaggacaagtc-at-aag
           Chinese tree shrew  -t----t----cctgcctggagtcttaagatcagaccaggagaactc-at-gtg
B D           Chinese hamster  tc----a----ccattccagcatcttgagaccagaccaagagaagtc-at-atg
               Golden hamster  tt----a----ccattccagcatcttaagaacagaccaagagaagcc-gt-gtg
B D            Naked mole-rat  ag----c----cctgcctgatgtcttaaaactaggtcagaagggttc-at-aca
B D                Guinea pig  tgttctt----cctgcccgatgtcttaaaacctggccaacaggaggc-at-aag
                   Chinchilla  tg----t----cccactaaatgtcttcaaacccggccagaaggggtc-atgaaa
             Brush-tailed rat  tg----t----cctgcctgatgtcttaaaatctggtcagcaggggtc-at-aag
B D                    Rabbit  ----ttt----ccagcctgttgttttaagatcagacccagagaagtc-at-gca
B D                      Pika  ----ctc----ccagcctgctgtctgaagaccagagccagagaagtg-at-tca
B D                       Pig  ----ttg--------tctggttccttgagactagaccaggcgaggtc--t-gtg
B D                    Alpaca  ----gtc----tcagcctggcgcctggagaccagaccaggcgaggtc-ac-gtg
               Bactrian camel  ----gtt----ccagcctggcgcctggagaccagaccaggcgaggtc-at-gtg
B D                   Dolphin  ----ttcccagccaccgtggtgccttgagaccagaccaggcaaggtc-gt-atg
                 Killer whale  ----ttcccagccaccatggtgccttgagaccagaccaggcgaggtc-gt-atg
             Tibetan antelope  ----ttc----cctccctggtaccttgggaccagaccaggcgtggtt-ga-g--
B D                       Cow  ----ttc----ccgccctggtgccttgggaccagaccaggcaaggtc-gt-g--
B D                     Sheep  ----ttc----ccgccctggtgccttgggaccagaccaggcgaggtt-gc-g--
                Domestic goat  ----ttc----ccgccctggtgccttgggaccagaccaggcgaggtt-gc-g--
B D                     Horse  ----ttc----ccagcctggtgtcttgagaccagatcagaagaggtc-at-acg
B D          White rhinoceros  ----ttc----ccagcctggcgtcatgagaccaaaccaggagaggtc-at-atg
B D                       Cat  ----ttc----ccagtgtggtttcttgagaccagaccaggaggggtc-at-agg
B D                       Dog  ----ttc----ccagcccggtgtcttgagaccagaccaggaggggtc-at-atg
B D                   Ferret   ----ggt----tgggcatggagcttacagaaggaaggaaggaaggaa-ga-aag
B D                     Panda  ----ttc----ccagcctgatgtcttgagaccagaccaggaggggtc-at-atg
               Pacific walrus  ----ttc----ccagcctggtgtcttgagactaaaccaggaggggtc-at-atg
                 Weddell seal  ----ttc----ccagcctggtatcttgagactagaccaggaggggtc-at-ata
             Black flying-fox  ----atc----ctggccaggtgtcttgaaaccagaccagaagaggtc-at-ttg
B D                   Megabat  ----atc----ctggccaggtgtcttgaaaccagaccagaagaggtc-at-ttg
                Big brown bat  ----ttt----atagct-ggtgtcttgagaccagaccaagagaggcc-at-atg
         David's myotis (bat)  ----ttt----atagct-ggtgtcttgagaccagaccaagagaggcc-at-atg
B D                  Microbat  ----ttt----acagct-ggtgtcttcagaccagaccaagagaggcc-at-atg
B D                  Elephant  ----ttg----ccagggtggtgtctaaaaaccagaccaggcaaggcc-at-ata
B D                   Manatee  ----ttc----ccagggtgatgtctaaaaaccagaccaggtaaggcc-at-act
             Cape golden mole  ----ttg----tcagggtggtgtctaaaaacca------------ct-t-----
B D                    Tenrec  ----ttc----cctagagggtgtctaaagaccagaccaggccaggcc-a-----
B D                 Armadillo  ----ttc----ccagcctgatggcttaagaccagtccgggcaagccc-at-ttg
             Star-nosed mole  ------------------------------------------------------
         Cape elephant shrew  ======================================================
B D                  Hedgehog  ======================================================
B D                     Shrew  ======================================================
B D                     Mouse  ======================================================
                Prairie vole  ------------------------------------------------------
B D                       Rat  ======================================================
      Lesser Egyptian jerboa  ======================================================
B D                  Squirrel  ======================================================
  D  Chinese softshell turtle  ======================================================
  D            Painted turtle  ======================================================
  D           Green seaturtle  ======================================================
B D                    Turkey  ======================================================
B D                   Chicken  ======================================================
  D              Mallard duck  ======================================================
B D                Budgerigar  ======================================================
          Tibetan ground jay  ======================================================
B D               Zebra finch  ======================================================
B D       Medium ground finch  ======================================================
  D    White-throated sparrow  ======================================================
  D       Collared flycatcher  ======================================================
  D          Peregrine falcon  ======================================================
  D              Saker falcon  ======================================================
B D        American alligator  ======================================================
B D                   Opossum  ======================================================
B D           Tasmanian devil  ======================================================
                    Aardvark  ======================================================

Inserts between block 9 and 10 in window
B D                  Ferret  84bp

Alignment block 10 of 61 in window, 114378953 - 114378965, 13 bps 
B D                     Human  ctttcctttttcc
B D                     Chimp  ctttcctttttcc
B D                   Gorilla  ctttcctttttcc
B D                 Orangutan  ctttcctttttct
B D                    Gibbon  gtttcctttttct
B D                    Rhesus  ctttcgtttttcc
B D       Crab-eating macaque  ctttcgtttttcc
B D                    Baboon  ctttcctttttcc
B D              Green monkey  ctttcctttttcc
B D                  Marmoset  ctttcccctttcc
B D           Squirrel monkey  ctttcccctttcc
B D                  Bushbaby  ctttctctattcc
           Chinese tree shrew  ttttcctcttccc
B D           Chinese hamster  ctcttccttttct
               Golden hamster  ctcttctttttct
B D            Naked mole-rat  ttttcccctttct
B D                Guinea pig  tcttctccttttt
                   Chinchilla  tttcc-cctttct
             Brush-tailed rat  tcttc-ctcttct
B D                    Rabbit  ctttcccccttcc
B D                      Pika  ctttctggtgtcc
B D                       Pig  ctttctgcttccc
B D                    Alpaca  ttttccctttcct
               Bactrian camel  ttttccctttcct
B D                   Dolphin  ctttcccctttcc
                 Killer whale  ctttcccctttcc
             Tibetan antelope  -tttccctgttcc
B D                       Cow  -tttcccttttcc
B D                     Sheep  -tttccctgttcc
                Domestic goat  -tttccctgttcc
B D                     Horse  gttttcctttccc
B D          White rhinoceros  cttttccttttcc
B D                       Cat  ctttcccctttcc
B D                       Dog  ctttctcctttcc
B D                     Panda  ctttcccctttcc
               Pacific walrus  ctttcccctttcc
                 Weddell seal  ctttcccctttcc
             Black flying-fox  ctttcccctttgt
B D                   Megabat  ctttcccctttgt
                Big brown bat  ctttcccctttcc
         David's myotis (bat)  ctttcccctttcc
B D                  Microbat  ctttcccctttcc
B D                  Elephant  ctcttccctttct
B D                   Manatee  ct-ttccctttct
             Cape golden mole  ---tccccactct
B D                    Tenrec  ---tacactttct
B D                 Armadillo  ---ctttctttct
             Star-nosed mole  -------------
         Cape elephant shrew  =============
B D                  Hedgehog  =============
B D                     Shrew  =============
B D                     Mouse  =============
                Prairie vole  -------------
B D                       Rat  =============
      Lesser Egyptian jerboa  =============
B D                  Squirrel  =============
B D                   Ferret   =============
  D  Chinese softshell turtle  =============
  D            Painted turtle  =============
  D           Green seaturtle  =============
B D                    Turkey  =============
B D                   Chicken  =============
  D              Mallard duck  =============
B D                Budgerigar  =============
          Tibetan ground jay  =============
B D               Zebra finch  =============
B D       Medium ground finch  =============
  D    White-throated sparrow  =============
  D       Collared flycatcher  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
B D        American alligator  =============
B D                   Opossum  =============
B D           Tasmanian devil  =============
                    Aardvark  =============

Inserts between block 10 and 11 in window
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp

Alignment block 11 of 61 in window, 114378966 - 114378966, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                    Rabbit  a
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Elephant  a
B D                   Manatee  a
             Cape golden mole  a
B D                 Armadillo  g
             Star-nosed mole  -
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                     Mouse  =
                Prairie vole  -
B D                       Rat  =
B D           Chinese hamster  =
              Golden hamster  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  -
            Brush-tailed rat  =
                  Chinchilla  =
B D                Guinea pig  =
B D                  Squirrel  =
B D            Naked mole-rat  =
B D                   Ferret   =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
                    Aardvark  =

Alignment block 12 of 61 in window, 114378967 - 114378969, 3 bps 
B D                     Human  ctg
B D                     Chimp  ctg
B D                   Gorilla  ctg
B D                 Orangutan  ccg
B D                    Gibbon  cgg
B D                    Rhesus  ctg
B D       Crab-eating macaque  ctg
B D                    Baboon  ctg
B D              Green monkey  ctg
B D                  Marmoset  ctg
B D           Squirrel monkey  ctt
B D                  Bushbaby  ctg
           Chinese tree shrew  ctc
                 Prairie vole  ttg
B D           Chinese hamster  atg
               Golden hamster  atg
B D                     Mouse  ctg
B D            Naked mole-rat  cta
B D                Guinea pig  cta
                   Chinchilla  cca
             Brush-tailed rat  tta
B D                    Rabbit  -ca
B D                      Pika  -cg
B D                       Pig  cgt
B D                    Alpaca  ttt
               Bactrian camel  ttt
B D                   Dolphin  ttg
                 Killer whale  ttg
             Tibetan antelope  ttg
B D                       Cow  ttg
B D                     Sheep  ttg
                Domestic goat  ttg
B D                     Horse  ctg
B D          White rhinoceros  ctg
B D                       Cat  ctt
B D                       Dog  ctt
B D                     Panda  ctt
               Pacific walrus  ctt
                 Weddell seal  ctt
             Black flying-fox  ccg
B D                   Megabat  ccg
                Big brown bat  ctg
         David's myotis (bat)  ctg
B D                  Microbat  ctg
B D                  Elephant  ctg
B D                   Manatee  ctg
             Cape golden mole  ctg
B D                    Tenrec  ctt
B D                 Armadillo  ctg
             Star-nosed mole  ---
         Cape elephant shrew  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                       Rat  ===
      Lesser Egyptian jerboa  ===
B D                  Squirrel  ===
B D                   Ferret   ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
B D                Budgerigar  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
  D       Collared flycatcher  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
B D        American alligator  ===
B D                   Opossum  ===
B D           Tasmanian devil  ===
                    Aardvark  ===

Inserts between block 12 and 13 in window
B D          Chinese hamster 742bp
              Golden hamster 806bp
B D                   Rabbit 1bp
B D                     Pika 1bp

Alignment block 13 of 61 in window, 114378970 - 114378995, 26 bps 
B D                     Human  gctatgacccag--gt---gaggc---acctaca
B D                     Chimp  gctatgacccag--gt---gaggc---acctaca
B D                   Gorilla  gctatgacccag--gt---gaggc---acctaca
B D                 Orangutan  gctatgacccag--gt---gaggc---acctaca
B D                    Gibbon  gctatgacccag--gt---gaggc---acccaca
B D                    Rhesus  gctatgacccag--gt---gaggc---acccaca
B D       Crab-eating macaque  gctatgacccag--gt---gaggc---acccaca
B D                    Baboon  gctatgacccag--gt---gaggc---acccaca
B D              Green monkey  gctatgacccag--gt---gaggc---acccaca
B D                  Marmoset  gcaatggtccag--gt---gaggc---acccaca
B D           Squirrel monkey  gcaatggtccag--gt---gaggc---acccaca
B D                  Bushbaby  gct--------------------c---aaacact
           Chinese tree shrew  actacagcccag--ac---aaggt---gcccact
                 Prairie vole  gttacaacccaccagt---gagac---acttact
B D                     Mouse  gttacagtctac--at---gaggc---acttact
B D            Naked mole-rat  gctatgatccat--gt---gaggc---taccact
B D                Guinea pig  gctatgaccact--gt---gagac---acttgct
                   Chinchilla  gctgtgacccat--at---gacac---acccact
             Brush-tailed rat  gctacaagcaat--gt---gaggc---acccact
B D                    Rabbit  gctgggatccag--atccagatggggcatccat-
B D                      Pika  gctatgatccag--at---aatgg---atccac-
B D                       Pig  gctgtgccccag--at---gaggc---gcccact
B D                    Alpaca  gctgcgccccag--aa---gaggt---gcccact
               Bactrian camel  gctgcgccccag--aa---gaggt---gcccact
B D                   Dolphin  gctgcaccccag--at---aaggt---gcccact
                 Killer whale  gctgcaccccag--at---aaggt---gcccact
             Tibetan antelope  gctgcacgcctg--ac---aagac---atccact
B D                       Cow  gctgcactcctg--ac---aaggt---acccact
B D                     Sheep  gctgcacgcctg--ac---aagat---atccact
                Domestic goat  gctgcacgcctg--ac---aagat---atccact
B D                     Horse  gttgcaacccag--at---gagat---gccctct
B D          White rhinoceros  gctgcaacccag--at---gaggt---tcccact
B D                       Cat  gctgcaacccag--at---gaggt---accctct
B D                       Dog  ggtgcaacccgg--at---gagat---gccctca
B D                     Panda  ggtgcaacccac--at---gaggt---gccctct
               Pacific walrus  ggtgccacccag--at---gaggt---gccctct
                 Weddell seal  ggcgccacccag--at---gaggt---gccctct
             Black flying-fox  gctgcaacctag--at---gaggt---gcccact
B D                   Megabat  gctgcaacctag--at---gaggt---gcccact
                Big brown bat  gctacaacccag--at---gacat---gcccact
         David's myotis (bat)  gctacaacccag--at---gacat---gcccact
B D                  Microbat  gctacaacccag--at---gacat---gcccact
B D                  Elephant  actgcaaaccag--at---aaggt---gaccacc
B D                   Manatee  actgca-------------acagt---gaccact
             Cape golden mole  gttacaacccag--ag---aaggt---agccatt
B D                    Tenrec  tctacagcccag--ag---aagct---gaccctt
B D                 Armadillo  gctgcaacccag--at---gggat---tcccaac
             Star-nosed mole  ----------------------------------
         Cape elephant shrew  ==================================
B D                  Hedgehog  ==================================
B D                     Shrew  ==================================
B D                       Rat  ==================================
B D           Chinese hamster  ==================================
              Golden hamster  ==================================
      Lesser Egyptian jerboa  ==================================
B D                  Squirrel  ==================================
B D                   Ferret   ==================================
  D  Chinese softshell turtle  ==================================
  D            Painted turtle  ==================================
  D           Green seaturtle  ==================================
B D                    Turkey  ==================================
B D                   Chicken  ==================================
  D              Mallard duck  ==================================
B D                Budgerigar  ==================================
          Tibetan ground jay  ==================================
B D               Zebra finch  ==================================
B D       Medium ground finch  ==================================
  D    White-throated sparrow  ==================================
  D       Collared flycatcher  ==================================
  D          Peregrine falcon  ==================================
  D              Saker falcon  ==================================
B D        American alligator  ==================================
B D                   Opossum  ==================================
B D           Tasmanian devil  ==================================
                    Aardvark  ==================================

Inserts between block 13 and 14 in window
B D                      Dog 390bp

Alignment block 14 of 61 in window, 114378996 - 114379002, 7 bps 
B D                     Human  caa-------------------------------------------------------------------
B D                     Chimp  caa-------------------------------------------------------------------
B D                   Gorilla  caa-------------------------------------------------------------------
B D                 Orangutan  caa-------------------------------------------------------------------
B D                    Gibbon  caa-------------------------------------------------------------------
B D                    Rhesus  caa-------------------------------------------------------------------
B D       Crab-eating macaque  caa-------------------------------------------------------------------
B D                    Baboon  caa-------------------------------------------------------------------
B D              Green monkey  caa-------------------------------------------------------------------
B D                  Marmoset  gaa-------------------------------------------------------------------
B D           Squirrel monkey  caa-------------------------------------------------------------------
B D                  Bushbaby  caa-------------------------------------------------------------------
           Chinese tree shrew  cag-------------------------------------------------------------------
                 Prairie vole  caa-------------------------------------------------------------------
B D                     Mouse  tga-------------------------------------------------------------------
B D            Naked mole-rat  caa-------------------------------------------------------------------
B D                Guinea pig  caa-------------------------------------------------------------------
                   Chinchilla  cac-------------------------------------------------------------------
             Brush-tailed rat  caa-------------------------------------------------------------------
B D                    Rabbit  cac-------------------------------------------------------------------
B D                      Pika  cat-------------------------------------------------------------------
B D                       Pig  caa-------------------------------------------------------------------
B D                    Alpaca  cat-------------------------------------------------------------------
               Bactrian camel  cat-------------------------------------------------------------------
B D                   Dolphin  caa-------------------------------------------------------------------
                 Killer whale  caa-------------------------------------------------------------------
             Tibetan antelope  caa-------------------------------------------------------------------
B D                       Cow  caa-------------------------------------------------------------------
B D                     Sheep  caa-------------------------------------------------------------------
                Domestic goat  caaaactggacaaagcagacttccctggcagtccagtgactaagattccacactcccaaagcaggggggc
B D                     Horse  caa-------------------------------------------------------------------
B D          White rhinoceros  caa-------------------------------------------------------------------
B D                       Cat  caa-------------------------------------------------------------------
B D                     Panda  caa-------------------------------------------------------------------
               Pacific walrus  caa-------------------------------------------------------------------
                 Weddell seal  caa-------------------------------------------------------------------
             Black flying-fox  caa-------------------------------------------------------------------
B D                   Megabat  caa-------------------------------------------------------------------
                Big brown bat  caa-------------------------------------------------------------------
         David's myotis (bat)  caa-------------------------------------------------------------------
B D                  Microbat  cga-------------------------------------------------------------------
B D                  Elephant  cag-------------------------------------------------------------------
B D                   Manatee  cag-------------------------------------------------------------------
             Cape golden mole  cac-------------------------------------------------------------------
B D                    Tenrec  caa-------------------------------------------------------------------
B D                 Armadillo  cca-------------------------------------------------------------------
             Star-nosed mole  ----------------------------------------------------------------------
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                       Rat  ======================================================================
B D           Chinese hamster  ======================================================================
              Golden hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                  Squirrel  ======================================================================
B D                       Dog  ======================================================================
B D                   Ferret   ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================
                    Aardvark  ======================================================================

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                 Green monkey  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
                 Prairie vole  ----------------------------------------------------------------------
                        Mouse  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                       Rabbit  ----------------------------------------------------------------------
                         Pika  ----------------------------------------------------------------------
                          Pig  ----------------------------------------------------------------------
                       Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
                      Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
                          Cow  ----------------------------------------------------------------------
                        Sheep  ----------------------------------------------------------------------
                Domestic goat  tgggtgtgatcccaggtcggggaactagatcccacatgctgcacctgaagactccacatgccgccacaaa
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                          Cat  ----------------------------------------------------------------------
                        Panda  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                     Microbat  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
                      Manatee  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
                       Tenrec  ----------------------------------------------------------------------
                    Armadillo  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                          Rat  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                     Squirrel  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================
                     Aardvark  ======================================================================

                        Human  -------------------------------------------------------------------aat
                        Chimp  -------------------------------------------------------------------aat
                      Gorilla  -------------------------------------------------------------------aat
                    Orangutan  -------------------------------------------------------------------aat
                       Gibbon  -------------------------------------------------------------------aat
                       Rhesus  -------------------------------------------------------------------aat
          Crab-eating macaque  -------------------------------------------------------------------aat
                       Baboon  -------------------------------------------------------------------aat
                 Green monkey  -------------------------------------------------------------------aat
                     Marmoset  -------------------------------------------------------------------aat
              Squirrel monkey  -------------------------------------------------------------------aat
                     Bushbaby  -------------------------------------------------------------------cat
           Chinese tree shrew  -------------------------------------------------------------------aaa
                 Prairie vole  -------------------------------------------------------------------aat
                        Mouse  -------------------------------------------------------------------aat
               Naked mole-rat  -------------------------------------------------------------------aat
                   Guinea pig  -------------------------------------------------------------------aat
                   Chinchilla  -------------------------------------------------------------------aat
             Brush-tailed rat  -------------------------------------------------------------------aat
                       Rabbit  -------------------------------------------------------------------aac
                         Pika  -------------------------------------------------------------------aac
                          Pig  -------------------------------------------------------------------aac
                       Alpaca  -------------------------------------------------------------------aac
               Bactrian camel  -------------------------------------------------------------------aac
                      Dolphin  -------------------------------------------------------------------aac
                 Killer whale  -------------------------------------------------------------------aac
             Tibetan antelope  -------------------------------------------------------------------aac
                          Cow  -------------------------------------------------------------------aac
                        Sheep  -------------------------------------------------------------------aac
                Domestic goat  gaagggcgatcccacgtgctacagctgagacctggtgcagcctaaataaatagatatttcaagcaacaac
                        Horse  -------------------------------------------------------------------aat
             White rhinoceros  -------------------------------------------------------------------aat
                          Cat  -------------------------------------------------------------------aat
                        Panda  -------------------------------------------------------------------aat
               Pacific walrus  -------------------------------------------------------------------aat
                 Weddell seal  -------------------------------------------------------------------aac
             Black flying-fox  -------------------------------------------------------------------aat
                      Megabat  -------------------------------------------------------------------aat
                Big brown bat  -------------------------------------------------------------------aat
         David's myotis (bat)  -------------------------------------------------------------------aat
                     Microbat  -------------------------------------------------------------------aat
                     Elephant  -------------------------------------------------------------------aac
                      Manatee  -------------------------------------------------------------------aac
             Cape golden mole  -------------------------------------------------------------------aat
                       Tenrec  -------------------------------------------------------------------gac
                    Armadillo  -------------------------------------------------------------------act
              Star-nosed mole  ----------------------------------------------------------------------
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                          Rat  ======================================================================
              Chinese hamster  ======================================================================
               Golden hamster  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                     Squirrel  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================
                     Aardvark  ======================================================================

                        Human  t
                        Chimp  t
                      Gorilla  t
                    Orangutan  t
                       Gibbon  t
                       Rhesus  t
          Crab-eating macaque  t
                       Baboon  t
                 Green monkey  t
                     Marmoset  t
              Squirrel monkey  c
                     Bushbaby  t
           Chinese tree shrew  t
                 Prairie vole  t
                        Mouse  t
               Naked mole-rat  t
                   Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
                       Rabbit  t
                         Pika  t
                          Pig  t
                       Alpaca  g
               Bactrian camel  g
                      Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
                          Cow  t
                        Sheep  t
                Domestic goat  t
                        Horse  t
             White rhinoceros  c
                          Cat  t
                        Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
                      Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
                     Microbat  t
                     Elephant  a
                      Manatee  a
             Cape golden mole  a
                       Tenrec  a
                    Armadillo  a
              Star-nosed mole  -
          Cape elephant shrew  =
                     Hedgehog  =
                        Shrew  =
                          Rat  =
              Chinese hamster  =
               Golden hamster  =
       Lesser Egyptian jerboa  =
                     Squirrel  =
                          Dog  =
                      Ferret   =
     Chinese softshell turtle  =
               Painted turtle  =
              Green seaturtle  =
                       Turkey  =
                      Chicken  =
                 Mallard duck  =
                   Budgerigar  =
           Tibetan ground jay  =
                  Zebra finch  =
          Medium ground finch  =
       White-throated sparrow  =
          Collared flycatcher  =
             Peregrine falcon  =
                 Saker falcon  =
           American alligator  =
                      Opossum  =
              Tasmanian devil  =
                     Aardvark  =

Alignment block 15 of 61 in window, 114379003 - 114379006, 4 bps 
B D                     Human  ggac------------------
B D                     Chimp  ggac------------------
B D                   Gorilla  cgac------------------
B D                 Orangutan  ggac------------------
B D                    Gibbon  ggac------------------
B D                    Rhesus  ggac------------------
B D       Crab-eating macaque  ggac------------------
B D                    Baboon  ggac------------------
B D              Green monkey  ggac------------------
B D                  Marmoset  ggac------------------
B D           Squirrel monkey  ggac------------------
B D                  Bushbaby  ggac------------------
           Chinese tree shrew  gaat------------------
                 Prairie vole  aggg------------------
B D           Chinese hamster  agaa------------------
               Golden hamster  ggaa------------------
B D                     Mouse  agac------------------
B D            Naked mole-rat  aaac------------------
B D                Guinea pig  aagc------------------
                   Chinchilla  aaac------------------
             Brush-tailed rat  aaac------------------
B D                    Rabbit  ggac------------------
B D                      Pika  tgat------------------
B D                       Pig  gggt------------------
B D                    Alpaca  ggac------------------
               Bactrian camel  ggac------------------
B D                   Dolphin  agac------------------
                 Killer whale  agac------------------
             Tibetan antelope  ggac------------------
B D                       Cow  ggac------------------
B D                     Sheep  ggac------------------
                Domestic goat  ggac------------------
B D                     Horse  ggac------------------
B D          White rhinoceros  agac------------------
B D                       Cat  agaa------------------
B D                     Panda  ggat------------------
               Pacific walrus  ggat------------------
                 Weddell seal  ggat------------------
             Black flying-fox  agac------------------
B D                   Megabat  agac------------------
                Big brown bat  agac------------------
         David's myotis (bat)  aaac------------------
B D                  Microbat  agac------------------
B D                  Elephant  ggttaatgccttagcagatgac
B D                   Manatee  ggataatgccttagtagaggac
             Cape golden mole  ggataatgccttagt-gatgac
B D                    Tenrec  ggataacgctttagtagatgac
B D                 Armadillo  agacaatactttagtaaatgac
             Star-nosed mole  ----------------------
         Cape elephant shrew  ======================
B D                  Hedgehog  ======================
B D                     Shrew  ======================
B D                       Rat  ======================
      Lesser Egyptian jerboa  ======================
B D                  Squirrel  ======================
B D                       Dog  ======================
B D                   Ferret   ======================
  D  Chinese softshell turtle  ======================
  D            Painted turtle  ======================
  D           Green seaturtle  ======================
B D                    Turkey  ======================
B D                   Chicken  ======================
  D              Mallard duck  ======================
B D                Budgerigar  ======================
          Tibetan ground jay  ======================
B D               Zebra finch  ======================
B D       Medium ground finch  ======================
  D    White-throated sparrow  ======================
  D       Collared flycatcher  ======================
  D          Peregrine falcon  ======================
  D              Saker falcon  ======================
B D        American alligator  ======================
B D                   Opossum  ======================
B D           Tasmanian devil  ======================
                    Aardvark  ======================

Inserts between block 15 and 16 in window
          Chinese tree shrew 1bp
B D                    Mouse 577bp
B D                      Cat 162bp
B D                    Panda 165bp
              Pacific walrus 185bp

Alignment block 16 of 61 in window, 114379007 - 114379008, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D                    Baboon  aa
B D              Green monkey  aa
B D                  Marmoset  aa
B D           Squirrel monkey  aa
B D                  Bushbaby  tc
           Chinese tree shrew  ga
                 Prairie vole  aa
B D           Chinese hamster  ga
               Golden hamster  ga
B D                     Mouse  aa
B D            Naked mole-rat  -a
B D                Guinea pig  -a
                   Chinchilla  -a
             Brush-tailed rat  -a
B D                    Rabbit  aa
B D                      Pika  tt
B D                       Pig  ca
B D                    Alpaca  aa
               Bactrian camel  aa
B D                   Dolphin  aa
                 Killer whale  aa
             Tibetan antelope  aa
B D                       Cow  aa
B D                     Sheep  aa
                Domestic goat  aa
B D                     Horse  aa
B D          White rhinoceros  aa
B D                       Cat  aa
B D                       Dog  aa
B D                     Panda  aa
               Pacific walrus  aa
                 Weddell seal  ga
             Black flying-fox  aa
B D                   Megabat  aa
                Big brown bat  aa
         David's myotis (bat)  aa
B D                  Microbat  aa
B D                  Elephant  aa
B D                   Manatee  aa
             Cape golden mole  aa
B D                    Tenrec  aa
B D                 Armadillo  aa
             Star-nosed mole  --
         Cape elephant shrew  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                       Rat  ==
      Lesser Egyptian jerboa  ==
B D                  Squirrel  ==
B D                   Ferret   ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D        American alligator  ==
B D                   Opossum  ==
B D           Tasmanian devil  ==
                    Aardvark  ==

Inserts between block 16 and 17 in window
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp

Alignment block 17 of 61 in window, 114379009 - 114379010, 2 bps 
B D                     Human  ag
B D                     Chimp  ag
B D                   Gorilla  ag
B D                 Orangutan  ag
B D                    Gibbon  ag
B D                    Rhesus  ag
B D       Crab-eating macaque  ag
B D                    Baboon  ag
B D              Green monkey  ag
B D                  Marmoset  ag
B D           Squirrel monkey  ag
B D                  Bushbaby  ag
           Chinese tree shrew  ag
                 Prairie vole  ag
B D           Chinese hamster  ag
               Golden hamster  ag
B D            Naked mole-rat  ag
B D                Guinea pig  ag
                   Chinchilla  ag
             Brush-tailed rat  ag
B D                    Rabbit  at
B D                      Pika  at
B D                       Pig  a-
B D                    Alpaca  ag
               Bactrian camel  ag
B D                   Dolphin  ag
                 Killer whale  ag
             Tibetan antelope  ag
B D                       Cow  ag
B D                     Sheep  ag
                Domestic goat  ag
B D                     Horse  ag
B D          White rhinoceros  ag
B D                       Cat  ag
B D                       Dog  ag
B D                     Panda  ag
               Pacific walrus  ag
                 Weddell seal  ag
             Black flying-fox  ag
B D                   Megabat  ag
                Big brown bat  ag
         David's myotis (bat)  ag
B D                  Microbat  ag
B D                  Elephant  ag
B D                   Manatee  ag
             Cape golden mole  ag
B D                    Tenrec  ag
B D                 Armadillo  ag
             Star-nosed mole  --
         Cape elephant shrew  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                     Mouse  --
B D                       Rat  ==
      Lesser Egyptian jerboa  ==
B D                  Squirrel  ==
B D                   Ferret   ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D        American alligator  ==
B D                   Opossum  ==
B D           Tasmanian devil  ==
                    Aardvark  ==

Inserts between block 17 and 18 in window
B D               Guinea pig 1bp
            Tibetan antelope 204bp

Alignment block 18 of 61 in window, 114379011 - 114379011, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  g
B D                  Bushbaby  a
           Chinese tree shrew  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Elephant  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
B D                 Armadillo  a
             Star-nosed mole  -
B D                      Pika  -
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                     Mouse  -
B D                       Rat  =
      Lesser Egyptian jerboa  =
B D                  Squirrel  =
B D                       Dog  -
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
                    Aardvark  =

Inserts between block 18 and 19 in window
B D                    Sheep 201bp

Alignment block 19 of 61 in window, 114379012 - 114379012, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  c
B D                  Bushbaby  a
           Chinese tree shrew  a
                 Prairie vole  g
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  g
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                       Pig  g
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Elephant  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
B D                 Armadillo  a
             Star-nosed mole  -
B D                      Pika  -
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
      Lesser Egyptian jerboa  =
B D                  Squirrel  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
                    Aardvark  =

Inserts between block 19 and 20 in window
B D                      Cow 210bp

Alignment block 20 of 61 in window, 114379013 - 114379015, 3 bps 
B D                     Human  aga
B D                     Chimp  aga
B D                   Gorilla  aga
B D                 Orangutan  aga
B D                    Gibbon  aga
B D                    Rhesus  aca
B D       Crab-eating macaque  aca
B D                    Baboon  aca
B D              Green monkey  aca
B D                  Marmoset  aca
B D           Squirrel monkey  aca
B D                  Bushbaby  aca
           Chinese tree shrew  aca
                 Prairie vole  att
B D           Chinese hamster  aga
               Golden hamster  aga
B D                     Mouse  gaa
B D                       Rat  gga
B D            Naked mole-rat  aca
B D                Guinea pig  aaa
                   Chinchilla  aca
             Brush-tailed rat  aca
B D                    Rabbit  aca
B D                       Pig  aca
B D                    Alpaca  aca
               Bactrian camel  aca
B D                   Dolphin  aca
                 Killer whale  aca
             Tibetan antelope  aca
B D                       Cow  aca
B D                     Sheep  aca
                Domestic goat  aca
B D                     Horse  aca
B D          White rhinoceros  aca
B D                       Cat  agt
B D                       Dog  aga
B D                   Ferret   aga
B D                     Panda  gga
               Pacific walrus  aga
                 Weddell seal  aca
             Black flying-fox  aca
B D                   Megabat  aca
                Big brown bat  cca
         David's myotis (bat)  cca
B D                  Microbat  cca
B D                  Elephant  aca
B D                   Manatee  aca
             Cape golden mole  tca
B D                    Tenrec  acg
B D                 Armadillo  ata
             Star-nosed mole  ---
B D                      Pika  ---
         Cape elephant shrew  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
      Lesser Egyptian jerboa  ===
B D                  Squirrel  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
B D                Budgerigar  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
  D       Collared flycatcher  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
B D        American alligator  ===
B D                   Opossum  ===
B D           Tasmanian devil  ===
                    Aardvark  ===

Inserts between block 20 and 21 in window
B D                      Dog 1bp
B D                  Ferret  38bp
              Pacific walrus 5bp
                Weddell seal 211bp

Alignment block 21 of 61 in window, 114379016 - 114379038, 23 bps 
B D                     Human  agatggtgaag------actc---tgttccct
B D                     Chimp  agatggtgaag------actc---tgttccct
B D                   Gorilla  agatggtgaag------actc---tgttccct
B D                 Orangutan  agatggtgaag------actc---tgttccct
B D                    Gibbon  agatggtgaag------actc---tggtccct
B D                    Rhesus  agatggtgaag------actc---tggtccct
B D       Crab-eating macaque  agatggtgaag------actc---tggtccct
B D                    Baboon  agatggtgaag------actc---tggtccct
B D              Green monkey  agatggtaaag------actc---tggtccct
B D                  Marmoset  ggatgctgaag------actc---tggtccct
B D           Squirrel monkey  agatgctggag------actc---ctgtccct
B D                  Bushbaby  agatggtaagg------actc---aggcccct
           Chinese tree shrew  agatggtgagg------atgcatgcaggtctg
                 Prairie vole  tgatggaaaag------attt---gggtcccg
B D           Chinese hamster  agatgaaaagg------aactcaaaagtcctg
               Golden hamster  agatggaaagg------aactcaaaagtcctg
B D                     Mouse  agaacaaaagg------aactcaaaattcctg
B D                       Rat  agaagaagaag------aagaaaagg------
B D            Naked mole-rat  atagggaggag------attc---acgtcctt
B D                Guinea pig  atggggtggag------attt---ctgtcctg
                   Chinchilla  acagggaggag------attc---ctgtcctt
             Brush-tailed rat  agagggaggagacaattattc---ttgtcctt
B D                    Rabbit  agacggagagg------gctc---gggtcctt
B D                      Pika  ------tgagg------actc---aggtccct
B D                       Pig  agatggagagg------accc---agggccaa
B D                    Alpaca  agacggagagg------atgc---agggcccg
               Bactrian camel  agacggagagg------atgc---agggcccg
B D                   Dolphin  agatggagagg------accc---agggccca
                 Killer whale  agatggagagg------accc---agggccca
             Tibetan antelope  agatggagagg------accc---agggccca
B D                       Cow  agatggagagg------accc---agggccca
B D                     Sheep  agatggagagg------accc---agggccca
                Domestic goat  agatggagagg------accc---agggccca
B D                     Horse  a----------------accc---aggtccct
B D          White rhinoceros  agatggagagg------accc---a-gtccct
B D                       Cat  agatagagagg------atcc---aggtccct
B D                       Dog  agactgagagg------acct---agatctgt
B D                   Ferret   gagtagagagg------accc---aggtccat
B D                     Panda  agatggagagg------accc---aggtccat
               Pacific walrus  agatggagagg------accc---aggtccat
                 Weddell seal  agatggagagg------accc---aggtccgc
             Black flying-fox  agatgcacagg------aatt---aggacctt
B D                   Megabat  agatgcacagg------aatt---aggacctt
                Big brown bat  agatggagaga------actt-----gtccct
         David's myotis (bat)  agatggagaga------actt-----gtccct
B D                  Microbat  agatggagaga------actt-----gtccct
B D                  Elephant  agatg--cagg------agct---tggctcct
B D                   Manatee  agacg--gagg------agct---aggttcct
             Cape golden mole  agatgaagagg------agct---aggtgcct
B D                    Tenrec  agatgtttctg------aata---atggg---
B D                 Armadillo  agatggcgagg------atcc---a-gtccat
             Star-nosed mole  --------------------------------
         Cape elephant shrew  ================================
B D                  Hedgehog  ================================
B D                     Shrew  ================================
      Lesser Egyptian jerboa  ================================
B D                  Squirrel  ================================
  D  Chinese softshell turtle  ================================
  D            Painted turtle  ================================
  D           Green seaturtle  ================================
B D                    Turkey  ================================
B D                   Chicken  ================================
  D              Mallard duck  ================================
B D                Budgerigar  ================================
          Tibetan ground jay  ================================
B D               Zebra finch  ================================
B D       Medium ground finch  ================================
  D    White-throated sparrow  ================================
  D       Collared flycatcher  ================================
  D          Peregrine falcon  ================================
  D              Saker falcon  ================================
B D        American alligator  ================================
B D                   Opossum  ================================
B D           Tasmanian devil  ================================
                    Aardvark  ================================

Inserts between block 21 and 22 in window
                Prairie vole 1418bp

Alignment block 22 of 61 in window, 114379039 - 114379152, 114 bps 
B D                     Human  gaataatt-gaagggaagaga--------gctgcttgcta---agc----tagttta------t----ga
B D                     Chimp  gaataatt-gtagggaagaga--------gctgcttgcta---agc----tagttta------t----ga
B D                   Gorilla  gaataatt-gtagggaagaga--------gctgcttgcta---agc----tagttta------t----ga
B D                 Orangutan  gaataatt-gtagggaagaga--------gctgcttgcta---agc----tagttta------t----ga
B D                    Gibbon  gaataatt-gtagggaagaga--------tctgcttgcta---agc----tagttta------t----ga
B D                    Rhesus  gaataatt-gcagggaagaga--------gctgcttgcta---agc----tagttta------t----ga
B D       Crab-eating macaque  gaataatt-gcagggaagaga--------gctgcttgcta---agc----tagttta------t----ga
B D                    Baboon  gaataatt-gcagggaagaga--------gctgcttgcta---agc----tagttta------t----ga
B D              Green monkey  gaataatt-gcagggaagaga--------gctgcttgcta---agc----tagttta------t----ga
B D                  Marmoset  gaataatt-gtagggaagaga--------gctgcttgcta---agctagttagttta------t----ga
B D           Squirrel monkey  gaataatt-gtaggaaagaga--------gctgcttgcta---agc----tagttta------t----ga
B D                  Bushbaby  gaataatt-gtggggagggga--------gctgcctgcca---agccggtcagttta------cgaggga
           Chinese tree shrew  gaataact-gtggggaggaga--------actacctgctagtcagc----tggtttt------c----aa
                 Prairie vole  ggataatt-gacggaagaaga--------gaagcttgcta---aacttgtccgctca------t----ca
B D           Chinese hamster  ggataatt-gagggaaaaaga--------gaagcttgcta---agcttgtcagtcca------t----ca
               Golden hamster  ggataattggggggaagaaga--------taagcttgcta---agcttgttagtcta------t----ga
B D                     Mouse  agctgatt-gaagggag--ga--------gaagcttgcta---agcttgtcagctca------t----ca
B D                       Rat  ---------ggaggaag--ga--------agggaattcaa---aagtcctgggttaa------t------
B D            Naked mole-rat  gaataatt-gtgtggaggaga--------gctgcttacta---agttgttcagttta------g----ga
B D                Guinea pig  gaatattt-gtggggaggaca--------gctgtttgcta---agctggtcaggttc------a----ga
                   Chinchilla  gaataatt-gtggggagaaga--------gctgcttgcta---agctgatcagttta------g----ga
             Brush-tailed rat  gaataatc-atggggagaagc--------gctgcttgcta---agttgatcagttta------g----ga
B D                    Rabbit  gaataaat-gt------------------actgcttgctg---agcccatcagttta------c----aa
B D                      Pika  caatagtt-gtggggaagatagtaagacagttgcttgctg---agcccatcagggta------t----a-
B D                       Pig  gaataatc-acagggaggagc--------tcagcctgccg---ggctgggctggcta------c----gg
B D                    Alpaca  gaataact-gcagtgaggaga--------gcagcctgctg---agctggtctgttta------c----gt
               Bactrian camel  gaataact-gcagtgaggaga--------gcagcctgctg---agctggtctgttta------t----gt
B D                   Dolphin  gaataatt-gcagggaggcaa--------gcagcctgctg---agctagtctgttta------t----gt
                 Killer whale  gaataatt-gcagggaggcaa--------gcagcctgctg---agctagtctgttta------t----gt
             Tibetan antelope  gaataatt-acagggaggaga--------gcagcctactg---agctggtctgttta------t----gt
B D                       Cow  gaataatt-acagggaggaga--------gcagcctactg---agctggtctgttta------t----gt
B D                     Sheep  gaataatt-accgggaggaga--------gcagcctactg---agctggtctgttca------t----gt
                Domestic goat  gcataatt-acagggaggaga--------gcagcctactg---agctggtctgttta------t----gt
B D                     Horse  ggttaatt-atggggaggcga--------gctgcctgctg---agccaatctgttga-------------
B D          White rhinoceros  gaataatt-gcagggaggaga--------gctgcctacta---agcaggtctgttga-------------
B D                       Cat  gaataatt-gtgggga---ga--------actgcatgctg---agccagtctgtttacatttac----at
B D                       Dog  gaataatt-gtgggga---aa------------catgctg---agccagtctgttta------c----ct
B D                   Ferret   gagtaatt-gtgggga---ga--------actgcgtgctg---tgccagccagtcta------c----at
B D                     Panda  gaataatt-gtgggga---ga--------actgcatgctg---agccagtctgtttaa---ccc----at
               Pacific walrus  gaataatt-gtgggga---ga--------gctgcatgctg---agccagtcggttta------c----at
                 Weddell seal  aaataatt-gtgggga---ga--------gctgcatgctg---agccagtctgttta------c----at
             Black flying-fox  gaataatt-gtgagaaggaga--------gcggcctacta---agtcagtctgttta------c----at
B D                   Megabat  gaataatt-gtgagaaggaga--------gcggcctacta---agtcagtctgttta------c----at
                Big brown bat  gaattatt-gtggggaggaga--------atggcctgctg---agcaagtctcttta------c----at
         David's myotis (bat)  gaattatt-gt-gggaggaga--------atggcctgctg---atcaagtctctcta------t----at
B D                  Microbat  gaattatt-gtggggaggaga--------atggcctgctg---agcaagtcactcta------c----at
B D                  Elephant  gaataatt-gc-aggagggga--------acttcctgctg---agccaaattgtcta------c----gt
B D                   Manatee  gaataatt-gc-agggggcga--------gcttccagctg---agccacattgttta------t----gt
             Cape golden mole  ------ct-tc-aggagggga--------a-ttcctgctg---agccaaactgttta------t----gt
B D                    Tenrec  ------------aagaaggga--------g-tttcagttg---agctaaactgtttc------c----tt
B D                 Armadillo  gaataatt-gtggggaggaga--------actgcctgctg---agc-ggatggtcta------t----at
             Star-nosed mole  ----------------------------------------------------------------------
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                  Squirrel  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================
                    Aardvark  ======================================================================

                        Human  aat--aaataa-----------------t--tttg-----------------cttgagcaattgcatatt
                        Chimp  aat--aaaaaa-----------------t--tttg-----------------cttgagcaattgcatatt
                      Gorilla  aat--aaaaaa-----------------t--tttg-----------------cttgagcaattgcatatt
                    Orangutan  aat--aaataa-----------------t--tttg-----------------cttgagcaattgcatatt
                       Gibbon  aat--aaatag-----------------t--tttg-----------------cttgagcaattgcatatg
                       Rhesus  aat--aaataa-----------------t--tttg-----------------cttgagcaattgcatatt
          Crab-eating macaque  aat--aaataa-----------------t--tttg-----------------cttgagcaattgcatatt
                       Baboon  aat--aaataa-----------------t--tttg-----------------cttgagcaattgcatatt
                 Green monkey  aat--aaataa-----------------t--tttg-----------------cttgagcaattgcatatt
                     Marmoset  cat--aagtta-----------------t--tttg-----------------cttgaccaattgtgtatt
              Squirrel monkey  aat--aaatta-----------------t--tttg-----------------cttgaccaattgtgtatt
                     Bushbaby  agc--aaagta-----------------t--tttc-----------------cttgagttattgcatttt
           Chinese tree shrew  gaa--aaagaa------------------------------------------ttaaagtattacatttt
                 Prairie vole  a----aataaa-----ataaa---ata-t--tttg-----------------cctgagctgttat-gttt
              Chinese hamster  aaaataataacataaaataaa---ata-t--tctg-----------------cctaagctgttat-gttt
               Golden hamster  aaaataataac-----ataaa---ata-t--tttg-----------------cctgagctgttat-gttt
                        Mouse  cca--aataaa----aataaa---ata-t--tttg-----------------cttgagctattgt-gttt
                          Rat  -------tgaa----gggaaa---att-ttgtttg-----------------ctttagctattgt-gttt
               Naked mole-rat  gag--acagaa-----ttaaa---gta-t--tttg-----------------cttgaactattgcagttt
                   Guinea pig  gaa--aaagga-----ttaaa---ata-t--tttg-----------------cctgagctattgcagttt
                   Chinchilla  gag--aaagaa-----ttaaa---gta-t--tttg-----------------cttgagctcttgcacttg
             Brush-tailed rat  gag--aaagaa-----t--------tg-t--tttg-----------------cttgagttattgcagcta
                       Rabbit  gag--ataaag--------aa---tta-t--tctg-----------------cttcattctttgc-attt
                         Pika  -ag--atagaa--------aa---ttatt--tttg-----------------cttgattctttgt-attt
                          Pig  gtg--gaagaa-----acgaa---gca-t--cttg-----------------cttgagctactgcatttt
                       Alpaca  gag--gaagaa-----ataaa---gca-t--cttg-----------------cttgagctcttgcattct
               Bactrian camel  gag--gaagaa-----agggc---tca-t--cttg-----------------cttgagctcttgcattct
                      Dolphin  gag--gaagaa-----at-ag---gtg-t--cttg-----------------cttgagctattgcacttt
                 Killer whale  gag--gaagaa-----at-ag---gtg-t--ctgg-----------------cttgagctattgcatttt
             Tibetan antelope  gag--gaagaa-----acaat---gtg-t--cttg-----------------cttgagctgctacatttt
                          Cow  gag--gaagaa-----acaag---gtg-t--cttg-----------------cttgagctactacatttt
                        Sheep  gag--gaagaa-----acaag---gtg-t--cttg-----------------cttgagctgctacatttt
                Domestic goat  gag--gaagaa-----acaag---gtg-t--cttg-----------------cttgagctgctacatttt
                        Horse  ---------------------------------------------------------gctattgcatttt
             White rhinoceros  ---------------------------------------------------------gctattgcatttt
                          Cat  ggg--gaggat-----ataaa---gca-t--ctgg-----------------tgtgaggtattgcatttt
                          Dog  gag--gataaa-----ataga---gta-t--cttg-----------------tgtgagctactgcatttt
                      Ferret   ggg--gacaag-----ataaa---ata-c--tttg-----------------cgtgagctattgcatttt
                        Panda  gag--aataaa-----ataaa---gta-t--cttg-----------------tgtgagctattgcatttt
               Pacific walrus  gag--gataaa-----ataaa---gta-t--cttg-----------------tgtgagctactccatttt
                 Weddell seal  gag--gataaa-----ataaa---gta-t--cttg-----------------tgtgagctattccatttt
             Black flying-fox  gag--gaagaa-----ataaa---ata-t--cttg-----------------ctcaagctattgtatttt
                      Megabat  gag--gaagaa-----ataaa---ata-t--cttg-----------------ctcaagctattgtatttt
                Big brown bat  gtg--ggagga-----ataaa---gta-t--cata-----------------ctcaagctatt-tatttt
         David's myotis (bat)  gtg--ggagga-----ataaa---gtt-t--cata-----------------ctcaagctatt-tatttt
                     Microbat  gtg--ggagga-----ataaa---gtt-t--cata-----------------ctcaagctatt-tatttt
                     Elephant  gag--aaaaaa-----aa--tttctta-t--cttg-----------------cttgagctactacatctt
                      Manatee  gag--aaaaaa-----aatttttttta-t--cttg-----------------cttgagctattgcatttt
             Cape golden mole  gag--agaaaa-----actaatttcta-t--tttgagataaaaatcaatttcattgagctattgcatttt
                       Tenrec  gag--agaaaa-----attaatttcta-c--tttg-----------------cttgagctcttgca-tgt
                    Armadillo  aag--aaggaa-----agaaa---cga-t--cttg-----------------cctgggctgttacatttt
              Star-nosed mole  ----------------------------------------------------------------------
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                     Squirrel  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================
                     Aardvark  ======================================================================

                        Human  tcaag-tccc---------t-aaagttcaatcttatcctaat--------tgg---------gta-----
                        Chimp  tcaag-tccc---------t-gaagttcagccttatcctaat--------tgg---------gta-----
                      Gorilla  tcaag-tccc---------t-gaagttcaaccttatcctaat--------tgg---------gta-----
                    Orangutan  tcaag-tccc---------t-gaagttcaaccttatcctaat--------tgg---------gta-----
                       Gibbon  tcaag-tccc---------t-gaagttcagccttatcctaat--------tgg---------gta-----
                       Rhesus  tcaag-tccc---------t-gaagttcaaccttatcctaat--------agg---------gca-----
          Crab-eating macaque  tcaag-tccc---------t-gaagttcaaccttatcctaat--------agg---------gca-----
                       Baboon  tcaag-tccc---------t-gaagttcaaccttatcctaat--------agg---------gca-----
                 Green monkey  tcaag-tccc---------t-gaacttcaaccttatcctaat--------agg---------gca-----
                     Marmoset  tcaag-tttt---------t-gaaattcaaccttatcctagt--------tgg---------gta-----
              Squirrel monkey  tcaag-tttt---------t-gaatttcaaccttatcctagt--------tgg---------gta-----
                     Bushbaby  ggggg-tcct---------taaaagtttaactt-------------------------------------
           Chinese tree shrew  ttaggctctc---------t-ggaatttaacct-atcctagt--------t-g---------gta-----
                 Prairie vole  tgggg-tctt---------a-gaatgttcaccttttcctact--------tga---------gag-----
              Chinese hamster  tgggg-tctt---------g-gaatattcaccttttcctact--------tga---------gag-----
               Golden hamster  tgggg-tctt---------g-gaatattcatcttatcctact--------tga---------gag-----
                        Mouse  tgggg-tctt---------g-gaatgttcattttttcctgct--------tga---------gag-----
                          Rat  tggga-tctg---------g-gaatgttcatcttttcctatt--------tga---------gag-----
               Naked mole-rat  ttggg-ttcc---------t-gag-gtttaacttatcctaat--------tga---------gta-----
                   Guinea pig  tgggg-tcct---------t-gag-atttaacttgtgctaac--------tga---------ata-----
                   Chinchilla  tgggg-tcct---------t-gag-gtttaactcatcc------------tga---------gta-----
             Brush-tailed rat  ttggg-tctt---------t-ggg-gtttaactttccctaaa--------tga---------gta-----
                       Rabbit  tggga-tccc---------t-gatatttaaccttatcatagt--------tgg---------ttc-----
                         Pika  tggga-t-tc---------t-gatatttatcctgatctttgtgtaggggctggggacaaaattac-----
                          Pig  cagga-tccc---------t-aaagcgtaaccttatccaagt--------tgg---------gta-----
                       Alpaca  gggga-tccc---------t-gaagtttaaccttatccaggt--------agg---------gta-----
               Bactrian camel  gggga-tccc---------t-gaagtttaactttatccaggt--------agg---------gta-----
                      Dolphin  gggga-tccc---------t-aaagtttaaccttatccaagc--------tgt---------gta-----
                 Killer whale  gggga-tccc---------t-aaagtttaaccttatccaagt--------tgt---------gta-----
             Tibetan antelope  gggga-tcct---------t-acactttaaccttatccaagt--------cgg---------gtg-----
                          Cow  gggga-tcct---------t-acagtttaaccttatccaggt--------tgg---------gtg-----
                        Sheep  gggga-tcct---------t-acactttaaccttatccaagt--------cgg---------gtg-----
                Domestic goat  gggga-tcct---------t-acactttaaccttatccaagt--------cgg---------gtg-----
                        Horse  tgggg-tccc---------t-gaagtttaaccttatccaagg--------ctg---------gta-----
             White rhinoceros  tgggg-tccc---------t-aaagtttaaccttacccaagg--------agg---------gca-----
                          Cat  ggagg-ttcc-----------aaaggttaaccttatccaggt--------tgg---------gta-----
                          Dog  acaag-tccc---------t-aaagtttaaccttatccaaac--------tgg---------gtg-----
                      Ferret   ggaag-tccc---------t-aaactttaaccttatccaaat--------tgg---------gtg-----
                        Panda  ggagg-tccc---------t-aagttttaaccttatccaaac--------tgg---------gtg-----
               Pacific walrus  ggagg-tccc---------t-aaagtttaaccttatccaaat--------tgg---------gtg-----
                 Weddell seal  ggagg-tccc---------t-aaactttaaccttatccaaat--------tgg---------gtg-----
             Black flying-fox  ggggg-tccc---------t-aaaatttaaccttatccaagc--------tgg---------ata-----
                      Megabat  ggggg-tccc---------t-aaaatttaaccttatccaagc--------tga---------ata-----
                Big brown bat  ggggt-tccc---------t-aaagtttaaccttatccaagt--------tgg---------acactgtt
         David's myotis (bat)  ggaat-tccc---------t-aaagtttaaccttatccaagt--------tgg---------aca-----
                     Microbat  ggggt-tccc---------t-aaagtttaaccttatccaagt--------tgg---------aca-----
                     Elephant  agaga-tctc-tttgctact-gaaggttaaccttattctagt--------tga---------gaa-----
                      Manatee  gggga-tctc-tttgctact-gaagtttaaccttatcctagt--------tga---------gaa-----
             Cape golden mole  cagga-tctc-tgtgttact-gaagtttcacttttaccgaga--------tga---------gta-----
                       Tenrec  aagga-tctcttttgttaat-gaagcttcaacttagcctagt--------tga---------gaa-----
                    Armadillo  cggtg-gccc-tttgctgct-gaaatttaaccttgtcctagt--------tga---------gaa-----
              Star-nosed mole  ----------------------------------------------------------------------
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                     Squirrel  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================
                     Aardvark  ======================================================================

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                 Green monkey  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
                 Prairie vole  ----------------------------------------------------------------------
              Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
                        Mouse  ----------------------------------------------------------------------
                          Rat  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                       Rabbit  ----------------------------------------------------------------------
                         Pika  ----------------------------------------------------------------------
                          Pig  ----------------------------------------------------------------------
                       Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
                      Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
                          Cow  ----------------------------------------------------------------------
                        Sheep  ----------------------------------------------------------------------
                Domestic goat  ----------------------------------------------------------------------
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                          Cat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
                        Panda  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  --------------------------------------------------------------------ct
                      Megabat  --------------------------------------------------------------------ct
                Big brown bat  agaaatgtagaactatttgaagtaaaaaaatgaataaataaaatagaggcagtgccctggccagtatg--
         David's myotis (bat)  ----------------------------------------------------------------------
                     Microbat  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
                      Manatee  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
                       Tenrec  ----------------------------------------------------------------------
                    Armadillo  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                     Squirrel  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================
                     Aardvark  ======================================================================

                        Human  t
                        Chimp  t
                      Gorilla  t
                    Orangutan  t
                       Gibbon  t
                       Rhesus  t
          Crab-eating macaque  t
                       Baboon  t
                 Green monkey  t
                     Marmoset  t
              Squirrel monkey  t
                     Bushbaby  -
           Chinese tree shrew  t
                 Prairie vole  t
              Chinese hamster  t
               Golden hamster  t
                        Mouse  -
                          Rat  t
               Naked mole-rat  g
                   Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  g
                       Rabbit  t
                         Pika  t
                          Pig  t
                       Alpaca  g
               Bactrian camel  g
                      Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
                          Cow  g
                        Sheep  g
                Domestic goat  g
                        Horse  t
             White rhinoceros  t
                          Cat  t
                          Dog  t
                      Ferret   t
                        Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  -
                      Megabat  -
                Big brown bat  -
         David's myotis (bat)  -
                     Microbat  -
                     Elephant  t
                      Manatee  t
             Cape golden mole  c
                       Tenrec  t
                    Armadillo  c
              Star-nosed mole  -
          Cape elephant shrew  =
                     Hedgehog  =
                        Shrew  =
       Lesser Egyptian jerboa  =
                     Squirrel  =
     Chinese softshell turtle  =
               Painted turtle  =
              Green seaturtle  =
                       Turkey  =
                      Chicken  =
                 Mallard duck  =
                   Budgerigar  =
           Tibetan ground jay  =
                  Zebra finch  =
          Medium ground finch  =
       White-throated sparrow  =
          Collared flycatcher  =
             Peregrine falcon  =
                 Saker falcon  =
           American alligator  =
                      Opossum  =
              Tasmanian devil  =
                     Aardvark  =

Inserts between block 22 and 23 in window
               Big brown bat 127bp
B D                   Tenrec 676bp

Alignment block 23 of 61 in window, 114379153 - 114379153, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  g
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
           Chinese tree shrew  c
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
B D                  Elephant  a
B D                   Manatee  a
             Cape golden mole  a
B D                 Armadillo  a
             Star-nosed mole  -
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                     Mouse  -
            Black flying-fox  -
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
B D                   Megabat  -
               Big brown bat  =
B D                  Microbat  -
        David's myotis (bat)  -
B D                  Squirrel  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
                    Aardvark  =
B D                  Bushbaby  -

Inserts between block 23 and 24 in window
B D                     Pika 2bp

Alignment block 24 of 61 in window, 114379154 - 114379158, 5 bps 
B D                     Human  tctca
B D                     Chimp  tctca
B D                   Gorilla  tctca
B D                 Orangutan  tctca
B D                    Gibbon  tctca
B D                    Rhesus  tctca
B D       Crab-eating macaque  tctca
B D                    Baboon  tctca
B D              Green monkey  tctca
B D                  Marmoset  tctca
B D           Squirrel monkey  tctca
           Chinese tree shrew  tctca
                 Prairie vole  tctca
B D           Chinese hamster  cctca
               Golden hamster  tctca
B D                     Mouse  --tca
B D                       Rat  tctca
B D            Naked mole-rat  tctca
B D                Guinea pig  tctta
                   Chinchilla  tctca
             Brush-tailed rat  tctca
B D                    Rabbit  tgtca
B D                      Pika  tctca
B D                       Pig  gctca
B D                    Alpaca  tctca
               Bactrian camel  tctca
B D                   Dolphin  tctca
                 Killer whale  tctca
             Tibetan antelope  tctca
B D                       Cow  tctca
B D                     Sheep  tctca
                Domestic goat  tctca
B D                     Horse  tttca
B D          White rhinoceros  tctca
B D                       Cat  tttca
B D                       Dog  tttca
B D                   Ferret   tttca
B D                     Panda  tatca
               Pacific walrus  tttca
                 Weddell seal  tttca
             Black flying-fox  ---gt
B D                   Megabat  ---gt
                Big brown bat  tctca
         David's myotis (bat)  -ctgt
B D                  Microbat  -ctgt
B D                  Elephant  cctca
B D                   Manatee  cctca
             Cape golden mole  gctca
B D                 Armadillo  cctca
             Star-nosed mole  -----
         Cape elephant shrew  =====
B D                  Hedgehog  =====
B D                     Shrew  =====
      Lesser Egyptian jerboa  =====
B D                    Tenrec  =====
B D                  Squirrel  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D              Mallard duck  =====
B D                Budgerigar  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
B D       Medium ground finch  =====
  D    White-throated sparrow  =====
  D       Collared flycatcher  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
B D        American alligator  =====
B D                   Opossum  =====
B D           Tasmanian devil  =====
                    Aardvark  =====
B D                  Bushbaby  -----

Alignment block 25 of 61 in window, 114379159 - 114379161, 3 bps 
B D                     Human  cag
B D                     Chimp  cag
B D                   Gorilla  cag
B D                 Orangutan  cag
B D                    Gibbon  cag
B D                    Rhesus  cag
B D       Crab-eating macaque  cag
B D                    Baboon  cag
B D              Green monkey  cag
B D                  Marmoset  cag
B D           Squirrel monkey  cag
           Chinese tree shrew  cag
B D                  Squirrel  cag
                 Prairie vole  cag
B D           Chinese hamster  tag
               Golden hamster  cag
B D                     Mouse  cag
B D                       Rat  tag
B D            Naked mole-rat  cag
B D                Guinea pig  tat
                   Chinchilla  ctt
             Brush-tailed rat  cat
B D                    Rabbit  aag
B D                      Pika  atg
B D                       Pig  cag
B D                    Alpaca  cag
               Bactrian camel  cag
B D                   Dolphin  cag
                 Killer whale  cag
             Tibetan antelope  cag
B D                       Cow  cag
B D                     Sheep  cag
                Domestic goat  cag
B D                     Horse  cag
B D          White rhinoceros  cag
B D                       Cat  cca
B D                       Dog  ctg
B D                   Ferret   cta
B D                     Panda  ctg
               Pacific walrus  ctg
                 Weddell seal  ctg
             Black flying-fox  tag
B D                   Megabat  tag
                Big brown bat  cac
         David's myotis (bat)  cag
B D                  Microbat  tag
B D                  Elephant  cag
B D                   Manatee  cag
             Cape golden mole  cag
B D                 Armadillo  cag
             Star-nosed mole  ---
         Cape elephant shrew  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
      Lesser Egyptian jerboa  ===
B D                    Tenrec  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
B D                Budgerigar  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
  D       Collared flycatcher  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
B D        American alligator  ===
B D                   Opossum  ===
B D           Tasmanian devil  ===
                    Aardvark  ===
B D                  Bushbaby  ---

Alignment block 26 of 61 in window, 114379162 - 114379170, 9 bps 
B D                     Human  aactgttgg
B D                     Chimp  aactgttgg
B D                   Gorilla  aactgttgg
B D                 Orangutan  aactgttgg
B D                    Gibbon  aactgtagg
B D                    Rhesus  aactgttgg
B D       Crab-eating macaque  aactgttgg
B D                    Baboon  aactgttgg
B D              Green monkey  aactgttgg
B D                  Marmoset  aactgtgag
B D           Squirrel monkey  aactgttag
           Chinese tree shrew  aactgttag
B D                  Squirrel  aactgttga
                 Prairie vole  aaatgtcag
B D           Chinese hamster  aaatgccag
               Golden hamster  aaatgctat
B D                     Mouse  aaacgtcag
B D                       Rat  aaatatcag
B D            Naked mole-rat  aactgttgg
B D                Guinea pig  tactgctga
                   Chinchilla  atccattgg
             Brush-tailed rat  aactgttgg
B D                    Rabbit  aactgttgg
B D                      Pika  aactgttgg
B D                       Pig  aactggtag
B D                    Alpaca  aactgtcag
               Bactrian camel  aactgttag
B D                   Dolphin  aactgtcaa
                 Killer whale  aactgtcaa
             Tibetan antelope  aactgtcag
B D                       Cow  aactgtcag
B D                     Sheep  aactgtcag
                Domestic goat  aactgtcag
B D                     Horse  aactgctag
B D          White rhinoceros  aattgttag
B D                       Cat  aactgttgg
B D                       Dog  aactgttag
B D                   Ferret   aactgttag
B D                     Panda  aactgttag
               Pacific walrus  aactgttag
                 Weddell seal  aactcttag
             Black flying-fox  aactacaga
B D                   Megabat  aactacaga
                Big brown bat  caatgtttc
         David's myotis (bat)  aactgtaga
B D                  Microbat  aaatgtaga
B D                  Elephant  aactgtggg
B D                   Manatee  aactgtggg
             Cape golden mole  aatcatagg
B D                    Tenrec  aactatggg
B D                 Armadillo  aacttctgg
             Star-nosed mole  ---------
         Cape elephant shrew  =========
B D                  Hedgehog  =========
B D                     Shrew  =========
      Lesser Egyptian jerboa  =========
  D  Chinese softshell turtle  =========
  D            Painted turtle  =========
  D           Green seaturtle  =========
B D                    Turkey  =========
B D                   Chicken  =========
  D              Mallard duck  =========
B D                Budgerigar  =========
          Tibetan ground jay  =========
B D               Zebra finch  =========
B D       Medium ground finch  =========
  D    White-throated sparrow  =========
  D       Collared flycatcher  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
B D        American alligator  =========
B D                   Opossum  =========
B D           Tasmanian devil  =========
                    Aardvark  =========
B D                  Bushbaby  ---------

Inserts between block 26 and 27 in window
            Black flying-fox 7bp
B D                  Megabat 7bp
               Big brown bat 34bp
        David's myotis (bat) 241bp
B D                 Microbat 19bp

Alignment block 27 of 61 in window, 114379171 - 114379197, 27 bps 
B D                     Human  aagccaaggagaaaaaaggaggaggca
B D                     Chimp  aagccaaggagaaaaaaggaggaggca
B D                   Gorilla  aagccaaggagaaaaaaggaggaggca
B D                 Orangutan  aagccaaacagaaaaaaggaggaggca
B D                    Gibbon  aagccaaggagaaaaaaggaggaggca
B D                    Rhesus  aagccaaagagaaaaaaggagaaggca
B D       Crab-eating macaque  aagccaaagagaaaaaaggagaaggca
B D                    Baboon  aagccaaagagaaaaaaggaggaggca
B D              Green monkey  aagccaaagagaaaaaaggaggaggca
B D                  Marmoset  aagccaaagagaaaaaagtaggagaca
B D           Squirrel monkey  aagccaaagagaaaaaaggaggagaca
B D                  Bushbaby  -------------------------ca
           Chinese tree shrew  aagccaaagaaaatggaggatgtgac-
B D                  Squirrel  aagccaaaggaaacagagtatgtgtca
                 Prairie vole  aggccaaggaaagctgagtatgtgcca
B D           Chinese hamster  aagctaagaaatattgagtatgtg---
               Golden hamster  aaactaagaaatattgagtctgca---
B D                     Mouse  aagctaaggaaaagtgagtatgtggtg
B D                       Rat  aagctaaggaaaatcacgtgtgtaaca
B D            Naked mole-rat  tcgctaaagaaaatagaggacaaatca
B D                Guinea pig  tagccaaagaaattaaaacatataaca
                   Chinchilla  tagccaaagaaaacagaggacagaaca
             Brush-tailed rat  tagccaaagaaaatagaggacagaaca
B D                    Rabbit  gagccaaagaacatagaggatgttaca
B D                      Pika  gagccaaggaacataaagaatg-----
B D                       Pig  aggccaaagaaaacagaggctgtgaca
B D                    Alpaca  aagccaaagaaaatagaggatgtgaca
               Bactrian camel  aggccaaagaaaatagaggatgtgaca
B D                   Dolphin  aagccaaagaaaatagaggatgtgaca
                 Killer whale  aagccaaagaaaatagaggatgtgaca
             Tibetan antelope  aagccaaagaaaataaatgatgtgaca
B D                       Cow  aagccaaaggaaataaaggatgtgaca
B D                     Sheep  aagccaaagaaaagaaacgatgtgaca
                Domestic goat  aagccaaagaaaagaaacgatgtgaca
B D                     Horse  aacc-----------------------
B D          White rhinoceros  aagccaaagaaaatagaggatgtgata
B D                       Cat  aagccaaagaaaatagaggatgtgata
B D                       Dog  aagcccaagaaaatagaggagatgaca
B D                   Ferret   aagcccaagaaaatagagaatgcgaga
B D                     Panda  aagcccaagaaaatagaggatgtgaga
               Pacific walrus  aagcccaagaaaacagaggatgtgaga
                 Weddell seal  aagcccaagaaaatagaggatgcaaga
             Black flying-fox  aagccaaagaaaatagaggatatgaca
B D                   Megabat  aagccaaagaaaatagaggatatgaca
                Big brown bat  aaataaaataaaatagaggatgtgaca
         David's myotis (bat)  -----aaataaaatagaggatgtgaca
B D                  Microbat  gaat-aaataaaatagagg------ca
B D                  Elephant  aagccaaggaaaatagagactgtgaca
B D                   Manatee  aagccaaagaaaatagagaatgtgaca
             Cape golden mole  aaatgagaggaaatcgaggctgtgaca
B D                    Tenrec  aaccca-aagaaacaaagactatgaga
B D                 Armadillo  aaataaaagaaaatagaggatgtgacg
             Star-nosed mole  ---------------------------
         Cape elephant shrew  ===========================
B D                  Hedgehog  ===========================
B D                     Shrew  ===========================
      Lesser Egyptian jerboa  ===========================
  D  Chinese softshell turtle  ===========================
  D            Painted turtle  ===========================
  D           Green seaturtle  ===========================
B D                    Turkey  ===========================
B D                   Chicken  ===========================
  D              Mallard duck  ===========================
B D                Budgerigar  ===========================
          Tibetan ground jay  ===========================
B D               Zebra finch  ===========================
B D       Medium ground finch  ===========================
  D    White-throated sparrow  ===========================
  D       Collared flycatcher  ===========================
  D          Peregrine falcon  ===========================
  D              Saker falcon  ===========================
B D        American alligator  ===========================
B D                   Opossum  ===========================
B D           Tasmanian devil  ===========================
                    Aardvark  ===========================

Inserts between block 27 and 28 in window
            Black flying-fox 1bp
B D                  Megabat 1bp
B D                 Microbat 190bp

Alignment block 28 of 61 in window, 114379198 - 114379268, 71 bps 
B D                     Human  acc-t----------------------------cttaca----------aactgtaaagt----atttta
B D                     Chimp  acc-t----------------------------cttaca----------aactgtaaagt----atttta
B D                   Gorilla  acc-t----------------------------cttaca----------aactgtaaagt----atttta
B D                 Orangutan  tcc-t----------------------------cttata----------aactgtaaagt----attttg
B D                    Gibbon  tcc-t----------------------------cttata----------aactgtaaagt----atttta
B D                    Rhesus  tcc-t----------------------------cttata----------aactgtaaagt----atttta
B D       Crab-eating macaque  tcc-t----------------------------cttata----------aactgtaaagt----atttta
B D                    Baboon  tcc-t----------------------------cttata----------aactgtaaagt----atttta
B D              Green monkey  tcc-t----------------------------cttata----------aactgtaaagc----atttta
B D                  Marmoset  tcc-t----------------------------cttata----------aactgtaaagt----gtttta
B D           Squirrel monkey  ccc-t----------------------------cttata----------aactgtaaagt----gtttta
B D                  Bushbaby  tcc-c----------------------------cttata----------aactgtgaagt----gtttta
           Chinese tree shrew  ----------------------------------------------------------------------
B D                  Squirrel  ctc-c----------------------------cttata----------aactgtaaagt----gattta
                 Prairie vole  ctt-c----------------------------cttaga----------aatt-taaatt----gtttca
B D           Chinese hamster  ----c----------------------------cttaga----------acttgtaaagt----gtttta
               Golden hamster  ----c----------------------------cttaga----------acttgtaaagt----gtttta
B D                     Mouse  ctt-c----------------------------cttaga----------ctctgtaaatttgcaatttta
B D                       Rat  ctt-c----------------------------cttaga----------aactgtacattttcaatttta
B D            Naked mole-rat  t---------------------------------------------------------gt----gtttta
B D                Guinea pig  tc--c----------------------------cttata----------aattgtaaag--------tta
                   Chinchilla  tct-c----------------------------tttata----------aact-taaagt----gtttta
             Brush-tailed rat  cca-c----------------------------tttata----------aactgtgaagt----gcttta
B D                    Rabbit  ccc-c----------------------------cttataaactgttataaactgcaaagt----gcttta
B D                      Pika  -------------------------------------------------aactgcaaagt----attata
B D                       Pig  tct-c----------------------------cttgtg----------aaca--gaagt----atttta
B D                    Alpaca  tcc-t----------------------------ctggtg----------aact--aaact----gtttta
               Bactrian camel  tcc-t----------------------------cgggtg----------aact--aaact----gtttta
B D                   Dolphin  tcc-c----------------------------cttgtg----------aact--caagt----gattta
                 Killer whale  tcc-c----------------------------cttgtg----------aact--caagt----gattta
             Tibetan antelope  tcc-c----------------------------cttgta----------aact--cacgt----gtttta
B D                       Cow  tcc-c----------------------------cttgta----------aact--cacgt----gtttta
B D                     Sheep  tct-c----------------------------cttgta----------aact--catgt----gtttta
                Domestic goat  tcc-c----------------------------cttgta----------aact--cacgt----gtttta
B D                     Horse  ----------------------------------------------------------------------
B D          White rhinoceros  tgc-c----------------------------cttgta----------aact--agagt----gcttta
B D                       Cat  tcc-c----------------------------cttata----------aact--aatgt----gtctta
B D                       Dog  tcc-c----------------------------cttata----------aact--aaagt----gtttta
B D                   Ferret   tcc-c----------------------------cttaca----------agct--aaagt----gtttta
B D                     Panda  tcc-c----------------------------cttata----------aaca--aaagt----gtttta
               Pacific walrus  tcc-c----------------------------cttat-----------------aaagt----gtttta
                 Weddell seal  ttc-c----------------------------cttat-----------------aaagt----gtttta
             Black flying-fox  tct-c----------------------------cttata----------aact--aaagt----gtttta
B D                   Megabat  tct-c----------------------------cttata----------aact--aaagt----gtttta
                Big brown bat  tct-c----------------------------catata----------aact--aaagt----gtttta
         David's myotis (bat)  tct-c----------------------------catata----------aact--aaagt----gtttta
B D                  Microbat  ttt-taaaaaataaaataaaatagaggatgtgacatcta----------aact--aaagt----gtttta
B D                  Elephant  -cc-t----------------------------cttacg----------aactataaagt----gtcttg
B D                   Manatee  -cc-c----------------------------cttaca----------aactgtaaggt----gtctta
             Cape golden mole  -gc-c----------------------------cttac-----------aacctgcaagt----ggtttc
B D                    Tenrec  -gt-c----------------------------tttga-----------aacggaaaagc----atttta
B D                 Armadillo  -tctc----------------------------cttata----------aaccataagg-----gtttta
             Star-nosed mole  ----------------------------------------------------------------------
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================
                    Aardvark  ======================================================================

                        Human  caaatatattata---gctgctatataattgaatgaaccac-taatgg
                        Chimp  caaatatattata---gctgctatataattgaatgaaccac-taatgg
                      Gorilla  caaatatattata---gctgctatataattgaatgaaccat-taatgg
                    Orangutan  caaatatattata---gctgctgtgtaattgaatgaaccat-taatgg
                       Gibbon  caaatatattata---gctgctgtgtaattgaatgaaccat-taatgg
                       Rhesus  caaatatattata---gatgctatataattgaatgaaccat-taatgg
          Crab-eating macaque  caaatatattata---gatgctatataattgaatgaaccat-taatgg
                       Baboon  caaatatattata---gatgctatataattgaatgaaccat-taatgg
                 Green monkey  caaatatattata---gatgctatataatttaatgaaccat-taatgg
                     Marmoset  caaatatattata---gctgctctgtaattaaatgacccat-ctatgg
              Squirrel monkey  caaatatattata---gctgctctgtaattgaatgacccat-ccatgg
                     Bushbaby  caaatatattgta---gctgccacatcatcaaataagccctctagagg
           Chinese tree shrew  ----tatgttata---gttgccatataattgaatgagccat-tgatag
                     Squirrel  caaata------------tccttcataattgaatgagtcat-caaatg
                 Prairie vole  caaatatgtcatg---gttgctacataattga--gagtcac-caatgg
              Chinese hamster  caactatgtcatg---gctgctacataattga--gagtcac-caatgg
               Golden hamster  caa-tatgtcatg---gctgctgcataattaa--gagtcac-caacgg
                        Mouse  caaatacattatg---gctgctacataattga--gagtca--caatgg
                          Rat  caaaaatattatg---gctgctacatgattga--gagtca---aatgg
               Naked mole-rat  caaatatattgtg---gctgccacacaatt----gagacac-caatgg
                   Guinea pig  caaatgtattatg---gctgccacataatt----gaattat-taatgg
                   Chinchilla  caaatctattatg---gctgccacatcact----gaatcac-caatgg
             Brush-tailed rat  caaatacattatg---gcggccacatcgtt----gaatcac-caatgg
                       Rabbit  tagatatgttgta---gctgccacgtaattgaatgagccag-caatgg
                         Pika  tgaatatgttata---gctaccacat-------------ag-caat--
                          Pig  caagtagattatg---gctgtcacataattgaacgagctat-taatgg
                       Alpaca  caaatagattacg---gctgccatataattgaacgagccat-cgatgg
               Bactrian camel  caaatagattacg---gctgccatataattgaataagccat-cgatgg
                      Dolphin  caaacagattacg---gtggccacataattgaatgagccat-cagcag
                 Killer whale  caaacagattacg---gtggccacataattgaatgagccat-caacag
             Tibetan antelope  cagagagattact---gcagccacataattgaatgagccat-caatgg
                          Cow  cagagagattact---gcagccacataattgagtgagccat-caatgg
                        Sheep  cagagagattact---gcagccacataattgaatgagccat-caatgg
                Domestic goat  cagagagattact---gcagccgcataattgaataagccat-caatgg
                        Horse  ---atagattatg---gttgccacataattgaatgagcagt-caatga
             White rhinoceros  catataggttatg---gctgccacataattgaatgagccat-caatgg
                          Cat  caagtagattatg---actgccacataattgaatgagccat-cagtgg
                          Dog  caaatagattatg---actgccacataattgaatgagccat-cagtgg
                      Ferret   caaatagattatg---actgccacacaattgaatgagccat-cagtgg
                        Panda  caaatagattatg---actgccacggaattgaatgagccat-cagtgg
               Pacific walrus  caaatagattatg---actgccacataattgaatgagccat-cagtgg
                 Weddell seal  caaatagattatg---actgccacataattgaatgagccat-cagtgg
             Black flying-fox  caaatagattatg---gctgccacataattgaatgagtcat-caatgg
                      Megabat  caaatagattatg---gctgccacataattgaatgagtcat-caatgg
                Big brown bat  caaatagattatg---gctgccacataattgaataagacat-caatgg
         David's myotis (bat)  caaatagattatg---gctgccacataattgaataagacat-caatgg
                     Microbat  caaatagattatggctgctgccacataattgaataagacat-caatgg
                     Elephant  caaatgtattatg---gttgacacataattgagtgagctat-cagtga
                      Manatee  caaatgtattatg---ggtgccatacaattgggtgagccat-cagtga
             Cape golden mole  caagtgtattaca---gctgctgca-aatttaatgagccat-cagcag
                       Tenrec  taggagcattgcg---acagctgc---ataaagtgaaccat-cactgg
                    Armadillo  caaacagatcatg---gctgccactgaattgagcgagccat-cgatgg
              Star-nosed mole  ------------------------------------------------
          Cape elephant shrew  ================================================
                     Hedgehog  ================================================
                        Shrew  ================================================
       Lesser Egyptian jerboa  ================================================
     Chinese softshell turtle  ================================================
               Painted turtle  ================================================
              Green seaturtle  ================================================
                       Turkey  ================================================
                      Chicken  ================================================
                 Mallard duck  ================================================
                   Budgerigar  ================================================
           Tibetan ground jay  ================================================
                  Zebra finch  ================================================
          Medium ground finch  ================================================
       White-throated sparrow  ================================================
          Collared flycatcher  ================================================
             Peregrine falcon  ================================================
                 Saker falcon  ================================================
           American alligator  ================================================
                      Opossum  ================================================
              Tasmanian devil  ================================================
                     Aardvark  ================================================

Alignment block 29 of 61 in window, 114379269 - 114379274, 6 bps 
B D                     Human  aagcaa
B D                     Chimp  aagcaa
B D                   Gorilla  aagcaa
B D                 Orangutan  aagcaa
B D                    Gibbon  aagcaa
B D                    Rhesus  aagcaa
B D       Crab-eating macaque  aagcaa
B D                    Baboon  aagcaa
B D              Green monkey  aagcaa
B D                  Marmoset  aagcaa
B D           Squirrel monkey  aagcaa
B D                  Bushbaby  aagcaa
           Chinese tree shrew  aagcaa
B D                  Squirrel  aaa-aa
                 Prairie vole  aagcaa
B D           Chinese hamster  aagcaa
               Golden hamster  aagcaa
B D                     Mouse  aaacaa
B D                       Rat  aaccaa
B D            Naked mole-rat  aagaaa
B D                Guinea pig  atgaaa
                   Chinchilla  aagaaa
             Brush-tailed rat  aagaaa
B D                    Rabbit  aagcaa
B D                      Pika  ---caa
B D                       Pig  aagcaa
B D                    Alpaca  aagcaa
               Bactrian camel  aagcaa
B D                   Dolphin  ----aa
                 Killer whale  ----aa
             Tibetan antelope  aaacaa
B D                       Cow  aaacaa
B D                     Sheep  aaacaa
                Domestic goat  aaacaa
B D                     Horse  aagcaa
B D          White rhinoceros  aagcaa
B D                       Cat  aagcaa
B D                       Dog  aagcaa
B D                   Ferret   aagcaa
B D                     Panda  aaacaa
               Pacific walrus  aagcaa
                 Weddell seal  aagcaa
             Black flying-fox  aagtaa
B D                   Megabat  aagtaa
                Big brown bat  aagcaa
         David's myotis (bat)  aagcaa
B D                  Microbat  aagcaa
              Star-nosed mole  aagccc
B D                  Elephant  aaacaa
B D                   Manatee  aaacaa
             Cape golden mole  aaacaa
B D                    Tenrec  aaataa
B D                 Armadillo  aaacaa
         Cape elephant shrew  ======
B D                  Hedgehog  ======
B D                     Shrew  ======
      Lesser Egyptian jerboa  ======
  D  Chinese softshell turtle  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
B D                Budgerigar  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
B D       Medium ground finch  ======
  D    White-throated sparrow  ======
  D       Collared flycatcher  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
B D        American alligator  ======
B D                   Opossum  ======
B D           Tasmanian devil  ======
                    Aardvark  ======

Inserts between block 29 and 30 in window
B D                   Tenrec 2bp
B D                Armadillo 2bp

Alignment block 30 of 61 in window, 114379275 - 114379276, 2 bps 
B D                     Human  ca
B D                     Chimp  ca
B D                   Gorilla  ca
B D                 Orangutan  ca
B D                    Gibbon  aa
B D                    Rhesus  ca
B D       Crab-eating macaque  ca
B D              Green monkey  ca
B D                  Marmoset  ca
B D           Squirrel monkey  ca
B D                  Bushbaby  cg
           Chinese tree shrew  cc
B D                  Squirrel  ta
                 Prairie vole  ca
B D           Chinese hamster  ca
               Golden hamster  ca
B D                     Mouse  ca
B D                       Rat  ca
B D            Naked mole-rat  ca
B D                Guinea pig  ta
                   Chinchilla  ca
             Brush-tailed rat  ca
B D                    Rabbit  ca
B D                      Pika  ca
B D                       Pig  ga
B D                    Alpaca  ga
               Bactrian camel  ga
B D                   Dolphin  ga
                 Killer whale  ga
             Tibetan antelope  ga
B D                       Cow  ga
B D                     Sheep  ga
                Domestic goat  gg
B D                     Horse  ca
B D          White rhinoceros  ca
B D                       Cat  ca
B D                       Dog  ca
B D                   Ferret   ca
B D                     Panda  ca
               Pacific walrus  ca
                 Weddell seal  ca
             Black flying-fox  ca
B D                   Megabat  ca
                Big brown bat  ca
         David's myotis (bat)  ca
B D                  Microbat  ca
              Star-nosed mole  ca
         Cape elephant shrew  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
      Lesser Egyptian jerboa  ==
B D                    Tenrec  ==
B D                    Baboon  NN
B D                 Armadillo  ==
B D                   Manatee  --
B D                  Elephant  --
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D        American alligator  ==
B D                   Opossum  ==
B D           Tasmanian devil  ==
            Cape golden mole  --
                    Aardvark  ==

Alignment block 31 of 61 in window, 114379277 - 114379283, 7 bps 
B D                     Human  attgtg--------------a
B D                     Chimp  attgtg--------------a
B D                   Gorilla  attgtg--------------a
B D                 Orangutan  attgtg--------------a
B D                    Gibbon  attgtg--------------a
B D                    Rhesus  attgtg--------------a
B D       Crab-eating macaque  attgtg--------------a
B D              Green monkey  attgtg--------------a
B D                  Marmoset  attgtg---------------
B D           Squirrel monkey  attgtg--------------a
B D                  Bushbaby  attcta--------------a
           Chinese tree shrew  attctg--------------a
B D                  Squirrel  attcta-------------aa
                 Prairie vole  gctgtg--------------a
B D           Chinese hamster  actgtg--------------a
               Golden hamster  attgtg-------------aa
B D                     Mouse  gccgtggaagaaaaaaagaaa
B D                       Rat  gctgtggggggggaaagaaaa
B D            Naked mole-rat  attcta-------------aa
B D                Guinea pig  attctg-------------aa
                   Chinchilla  attctg-------------aa
             Brush-tailed rat  attctg-------------aa
B D                    Rabbit  atcttc---------------
B D                      Pika  atcacc---------------
B D                       Pig  attttg--------------a
B D                    Alpaca  attctg--------------a
               Bactrian camel  attctg--------------a
B D                   Dolphin  attctg--------------a
                 Killer whale  attctg--------------a
             Tibetan antelope  attttg--------------a
B D                       Cow  attttg--------------a
B D                     Sheep  atttcg--------------a
                Domestic goat  atttcg--------------a
B D                     Horse  cttccg--------------a
B D          White rhinoceros  attcag--------------a
B D                       Cat  actctg--------------a
B D                       Dog  gctctg--------------a
B D                   Ferret   actcta--------------a
B D                     Panda  actctg--------------a
               Pacific walrus  actctg--------------a
                 Weddell seal  actctg--------------a
             Black flying-fox  attctg--------------a
B D                   Megabat  attctg--------------a
                Big brown bat  attcag--------------a
         David's myotis (bat)  attcag--------------a
B D                  Microbat  attcag--------------a
              Star-nosed mole  gttctg--------------c
B D                  Elephant  -ttctg--------------a
B D                   Manatee  -ttctg--------------a
             Cape golden mole  -ttcta--------------a
B D                    Tenrec  gttctg--------------a
                     Aardvark  atttta--------------a
B D                 Armadillo  gttctg--------------g
         Cape elephant shrew  =====================
B D                  Hedgehog  =====================
B D                     Shrew  =====================
      Lesser Egyptian jerboa  =====================
B D                    Baboon  NNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  =====================
  D            Painted turtle  =====================
  D           Green seaturtle  =====================
B D                    Turkey  =====================
B D                   Chicken  =====================
  D              Mallard duck  =====================
B D                Budgerigar  =====================
          Tibetan ground jay  =====================
B D               Zebra finch  =====================
B D       Medium ground finch  =====================
  D    White-throated sparrow  =====================
  D       Collared flycatcher  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
B D        American alligator  =====================
B D                   Opossum  =====================
B D           Tasmanian devil  =====================

Inserts between block 31 and 32 in window
B D                 Elephant 754bp

Alignment block 32 of 61 in window, 114379284 - 114379293, 10 bps 
B D                     Human  aa--aactaaaa
B D                     Chimp  aa--aactaaaa
B D                   Gorilla  aa--aactaaaa
B D                 Orangutan  aa--aactaaaa
B D                    Gibbon  aa--aactaaaa
B D                    Rhesus  aa--aactaaaa
B D       Crab-eating macaque  aa--aactaaaa
B D              Green monkey  aa--aactaaaa
B D                  Marmoset  aa--aactaaaa
B D           Squirrel monkey  aa--aactaaaa
B D                  Bushbaby  aa--aattaaca
           Chinese tree shrew  aaagaactaaaa
B D                  Squirrel  aa--aaatcaca
                 Prairie vole  ta--aaataaaa
B D           Chinese hamster  aa--aaataaaa
               Golden hamster  aa--aaataaaa
B D                     Mouse  ag--aaaaggaa
B D                       Rat  ga--aaaaagga
B D            Naked mole-rat  aa--aaat-aaa
B D                Guinea pig  aa-------aaa
                   Chinchilla  aa--aaataaaa
             Brush-tailed rat  aa--aaat-aaa
B D                    Rabbit  -a--agcctaaa
B D                      Pika  -c--aatcagaa
B D                       Pig  aa--aactgaaa
B D                    Alpaca  aa--aactacaa
               Bactrian camel  aa--aactacaa
B D                   Dolphin  aa--aactgaaa
                 Killer whale  aa--aactgaaa
             Tibetan antelope  aa--aactaaga
B D                       Cow  aa--aactaaga
B D                     Sheep  aa--aactaaga
                Domestic goat  aa--aactaaga
B D                     Horse  aa--aactaaaa
B D          White rhinoceros  ga--aactaaaa
B D                       Cat  aa--aactaaac
B D                       Dog  ga--aactaaat
B D                   Ferret   aa--aacgaaat
B D                     Panda  aa--aactaaat
               Pacific walrus  aa--aacgaaat
                 Weddell seal  aa--aactaact
             Black flying-fox  aa--aactaaaa
B D                   Megabat  aa--aactaaaa
                Big brown bat  aa--aactaaa-
         David's myotis (bat)  aa--aactaaa-
B D                  Microbat  aa--aactaaa-
              Star-nosed mole  aa--accttaaa
B D                  Elephant  aa--aagaaaaa
B D                   Manatee  aa--aattaaaa
             Cape golden mole  aa--aattcaaa
B D                    Tenrec  ga--gattaaaa
                     Aardvark  -a--gaaaaaa-
B D                 Armadillo  aa--aattaaaa
         Cape elephant shrew  ============
B D                  Hedgehog  ============
B D                     Shrew  ============
      Lesser Egyptian jerboa  ============
B D                    Baboon  NNNNNNNNNNNN
  D  Chinese softshell turtle  ============
  D            Painted turtle  ============
  D           Green seaturtle  ============
B D                    Turkey  ============
B D                   Chicken  ============
  D              Mallard duck  ============
B D                Budgerigar  ============
          Tibetan ground jay  ============
B D               Zebra finch  ============
B D       Medium ground finch  ============
  D    White-throated sparrow  ============
  D       Collared flycatcher  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
B D        American alligator  ============
B D                   Opossum  ============
B D           Tasmanian devil  ============

Inserts between block 32 and 33 in window
B D                 Squirrel 1bp
B D                    Mouse 6bp
B D                      Rat 9bp
B D           Naked mole-rat 2bp
B D                   Rabbit 1bp
B D                     Pika 1bp
B D                   Tenrec 757bp
B D                Armadillo 5bp

Alignment block 33 of 61 in window, 114379294 - 114379324, 31 bps 
B D                     Human  tt-acccca--------------------------------------------------ctgtctggctg
B D                     Chimp  tt-accaca--------------------------------------------------ctgtctggctg
B D                   Gorilla  tt-acccca--------------------------------------------------ctgtctggctg
B D                 Orangutan  tt-acccca--------------------------------------------------ctgtctggctg
B D                    Gibbon  tt-acccta--------------------------------------------------ctgtctggctg
B D                    Rhesus  tt-acccta--------------------------------------------------ctgtctggctg
B D       Crab-eating macaque  tt-acccta--------------------------------------------------ctgtctggctg
B D              Green monkey  tt-acccta--------------------------------------------------ctgtctggctg
B D                  Marmoset  ttgacccta--------------------------------------------------ctgttcatctg
B D           Squirrel monkey  tt-acccta--------------------------------------------------ctgtccatctg
B D                  Bushbaby  tt-acctga--------------------------------------------------ctgtccagctg
           Chinese tree shrew  tt-actcta--------------------------------------------------tgttccacctg
B D                  Squirrel  tc-aacct---------------------------------------------------ttttccatcta
                 Prairie vole  -c-agcctg--------------------------------------------------ctatccaacta
B D           Chinese hamster  ---agcctg--------------------------------------------------ctttccaacta
               Golden hamster  ---agcctg--------------------------------------------------ctatccaacta
B D                     Mouse  tc-acccca--------------------------------------------------atatccagcga
B D                       Rat  ac-agcccg--------------------------------------------------atatccagcga
B D            Naked mole-rat  tt-atcctg--------------------------------------------------ccatccaacaa
B D                Guinea pig  ct-atccta--------------------------------------------------tcattcaacag
                   Chinchilla  tt-atccta--------------------------------------------------ccattcagcag
             Brush-tailed rat  tt-atccta--------------------------------------------------ccattcgacag
B D                    Rabbit  gt-accctc--------------------------------------------------acatccaactg
B D                      Pika  gc-atcctc--------------------------------------------------ccattgagtgg
B D                       Pig  at-actccaaactcaaaaaaaaaaaacccaaaccaaaaaaaacctaaaaaaaccccgaactgccaaactg
B D                    Alpaca  at-actccaaactcaaaaaaaa--------------------------------cc---ctgccaaactg
               Bactrian camel  at-actccaaactcagaaaaaa--------------------------------cc---ctgccaaactg
B D                   Dolphin  gt-accccaaactcagaaaaa--------------------------------------ctgccaaactg
                 Killer whale  gt-accccaaactcagaaaaa--------------------------------------ctgccaaactg
             Tibetan antelope  at-actccaaactcggaaaaa--------------------------------------ctgccaaacag
B D                       Cow  at-actccaaacttggaaaaa--------------------------------------ctgccaaatgg
B D                     Sheep  at-actccaaacttggaaaaa--------------------------------------ctgccaaacag
                Domestic goat  at-actccaaacttggaaaaa--------------------------------------ctgccaaacag
B D                     Horse  at-attctc--------------------------------------------------ctgccaaactg
B D          White rhinoceros  at-attctc--------------------------------------------------ctgccaaactg
B D                       Cat  at-actcta--------------------------------------------------ctggcaaatgg
B D                       Dog  ac-acccta--------------------------------------------------ctgtcaagcgg
B D                   Ferret   gc-accctc--------------------------------------------------ctgccaggcgg
B D                     Panda  ac-acccta--------------------------------------------------ctgccaagcgg
               Pacific walrus  ac-acccta--------------------------------------------------ccgccaagcgg
                 Weddell seal  ac-acccta--------------------------------------------------ctgccaagcgg
             Black flying-fox  at-atccaa--------------------------------------------------ctgccaaacta
B D                   Megabat  at-atccaa--------------------------------------------------ctgccaaacta
                Big brown bat  -------aa--------------------------------------------------ctgccggagtg
         David's myotis (bat)  -------aa--------------------------------------------------ctgccaaagtg
B D                  Microbat  -------aa--------------------------------------------------ctgccaaagtg
              Star-nosed mole  at-accag---------------------------------------------------ctaccaaactg
B D                  Elephant  at-atccta--------------------------------------------------ttgtttagctg
B D                   Manatee  at-atccta--------------------------------------------------tcatccatccc
             Cape golden mole  at-acccta--------------------------------------------------ttgtccatctt
                     Aardvark  at-atccta--------------------------------------------------tagtttagctg
B D                 Armadillo  ct-acccta--------------------------------------------------tcgtccagctg
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
B D                    Baboon  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  aa----ttatccagcc
                        Chimp  aa----ttatccagcc
                      Gorilla  aa----ttatccagcc
                    Orangutan  aa----ttatccagcc
                       Gibbon  aa----ttctccagcc
                       Rhesus  aa----ttatccagcc
          Crab-eating macaque  aa----ttatccagcc
                 Green monkey  aa----ttatccagcc
                     Marmoset  aa----ttatccagcc
              Squirrel monkey  aa----ttatccagcc
                     Bushbaby  ag----ttcttcagcc
           Chinese tree shrew  aa----ttatttagcc
                     Squirrel  aa----ttatttggac
                 Prairie vole  gg----gtattagctt
              Chinese hamster  gg----tgactc--tt
               Golden hamster  gg----atactctgtt
                        Mouse  gg----ttactcactt
                          Rat  gg----tcactcattt
               Naked mole-rat  ga----ttatcagcca
                   Guinea pig  ca----ttatcagcca
                   Chinchilla  aa----ttagcagccg
             Brush-tailed rat  aa----ttatcagcca
                       Rabbit  atatcaatatctagcc
                         Pika  at----gcagccagtc
                          Pig  ga----ttatccagcc
                       Alpaca  ga----ttatccaacc
               Bactrian camel  ga----ttatccaacc
                      Dolphin  ga----ttatccagtc
                 Killer whale  ga----ttatccagtc
             Tibetan antelope  ta----ttatccagcc
                          Cow  ca----ttatccagcc
                        Sheep  tg----ttatccagcc
                Domestic goat  tg----ttatccagcc
                        Horse  aa----ttacccagcc
             White rhinoceros  aa----ttacccagcc
                          Cat  aa----tcatccagtc
                          Dog  -a----ttacccaggc
                      Ferret   ga----ttacccagcc
                        Panda  ag----ttagccagtg
               Pacific walrus  aa----ttacccagtc
                 Weddell seal  aa----ttacccagtc
             Black flying-fox  aa----ttatccagcc
                      Megabat  aa----ttatccagcc
                Big brown bat  aa----ttatccagcc
         David's myotis (bat)  at----ttattcagcc
                     Microbat  at----ttatccagcc
              Star-nosed mole  --------attcagcc
                     Elephant  ag----ttatccagcc
                      Manatee  ag----ttaattggcc
             Cape golden mole  aa----tttattcgcc
                     Aardvark  aa----ttatccagcc
                    Armadillo  aa----ttctcctgtc
          Cape elephant shrew  ================
                     Hedgehog  ================
                        Shrew  ================
       Lesser Egyptian jerboa  ================
                       Tenrec  ================
                       Baboon  NNNNNNNNNNNNNNNN
     Chinese softshell turtle  ================
               Painted turtle  ================
              Green seaturtle  ================
                       Turkey  ================
                      Chicken  ================
                 Mallard duck  ================
                   Budgerigar  ================
           Tibetan ground jay  ================
                  Zebra finch  ================
          Medium ground finch  ================
       White-throated sparrow  ================
          Collared flycatcher  ================
             Peregrine falcon  ================
                 Saker falcon  ================
           American alligator  ================
                      Opossum  ================
              Tasmanian devil  ================

Alignment block 34 of 61 in window, 114379325 - 114379328, 4 bps 
B D                     Human  taat
B D                     Chimp  taat
B D                   Gorilla  taat
B D                 Orangutan  taat
B D                    Gibbon  taat
B D                    Rhesus  taat
B D       Crab-eating macaque  taat
B D              Green monkey  taat
B D                  Marmoset  taat
B D           Squirrel monkey  taat
B D                  Bushbaby  taat
           Chinese tree shrew  taat
B D                  Squirrel  taat
                 Prairie vole  caat
B D           Chinese hamster  caat
               Golden hamster  caat
B D                     Mouse  cact
B D                       Rat  cact
B D            Naked mole-rat  tttt
B D                Guinea pig  attt
                   Chinchilla  aatt
             Brush-tailed rat  tttt
B D                    Rabbit  tcat
B D                      Pika  tcat
B D                       Pig  tagt
B D                    Alpaca  taat
               Bactrian camel  taat
B D                   Dolphin  taat
                 Killer whale  taat
             Tibetan antelope  taat
B D                       Cow  taat
B D                     Sheep  taat
                Domestic goat  taat
B D                     Horse  taat
B D          White rhinoceros  taat
B D                       Cat  taat
B D                       Dog  tgat
B D                   Ferret   ctct
B D                     Panda  tcat
               Pacific walrus  taat
                 Weddell seal  taat
             Black flying-fox  taaa
B D                   Megabat  taaa
                Big brown bat  taaa
         David's myotis (bat)  taaa
B D                  Microbat  taaa
              Star-nosed mole  taat
B D                  Elephant  tgat
B D                   Manatee  taat
             Cape golden mole  tgat
B D                    Tenrec  tgat
                     Aardvark  tgag
B D                 Armadillo  cgat
         Cape elephant shrew  ====
B D                  Hedgehog  ====
B D                     Shrew  ====
      Lesser Egyptian jerboa  ====
B D                    Baboon  NNNN
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
B D                Budgerigar  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
  D       Collared flycatcher  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
B D        American alligator  ====
B D                   Opossum  ====
B D           Tasmanian devil  ====

Inserts between block 34 and 35 in window
B D                  Manatee 759bp
            Cape golden mole 1539bp

Alignment block 35 of 61 in window, 114379329 - 114379329, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  c
B D                      Pika  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   t
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
              Star-nosed mole  c
         Cape elephant shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  -
B D                    Baboon  N
B D                 Armadillo  -
B D                   Manatee  =
B D                  Elephant  -
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =
            Cape golden mole  =
                    Aardvark  -

Inserts between block 35 and 36 in window
B D                    Mouse 1bp
B D                      Rat 6bp
        David's myotis (bat) 543bp
B D                 Microbat 543bp

Alignment block 36 of 61 in window, 114379330 - 114379331, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  tt
B D                    Rhesus  tt
B D       Crab-eating macaque  tt
B D              Green monkey  tt
B D                  Marmoset  tt
B D           Squirrel monkey  tt
B D                  Bushbaby  tt
           Chinese tree shrew  tt
B D                  Squirrel  tt
                 Prairie vole  -t
B D           Chinese hamster  -t
               Golden hamster  -t
B D                     Mouse  tg
B D                       Rat  tg
B D            Naked mole-rat  tt
B D                Guinea pig  tt
                   Chinchilla  tt
             Brush-tailed rat  tt
B D                    Rabbit  tt
B D                      Pika  tt
B D                       Pig  tt
B D                    Alpaca  tt
               Bactrian camel  tt
B D                   Dolphin  tt
                 Killer whale  tt
             Tibetan antelope  tt
B D                       Cow  tt
B D                     Sheep  tt
                Domestic goat  tt
B D                     Horse  tt
B D          White rhinoceros  tc
B D                       Cat  tt
B D                       Dog  tc
B D                   Ferret   tc
B D                     Panda  tc
               Pacific walrus  tc
                 Weddell seal  tc
             Black flying-fox  tt
B D                   Megabat  tt
                Big brown bat  tt
         David's myotis (bat)  tt
B D                  Microbat  tt
              Star-nosed mole  tt
B D                 Armadillo  ct
         Cape elephant shrew  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
      Lesser Egyptian jerboa  ==
B D                    Tenrec  --
B D                    Baboon  NN
B D                   Manatee  ==
B D                  Elephant  --
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
B D                Budgerigar  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D        American alligator  ==
B D                   Opossum  ==
B D           Tasmanian devil  ==
            Cape golden mole  ==
                    Aardvark  --

Inserts between block 36 and 37 in window
B D           Naked mole-rat 2bp
B D               Guinea pig 1bp
            Brush-tailed rat 13bp
               Big brown bat 588bp

Alignment block 37 of 61 in window, 114379332 - 114379335, 4 bps 
B D                     Human  acta
B D                     Chimp  acta
B D                   Gorilla  acta
B D                 Orangutan  acta
B D                    Gibbon  acta
B D                    Rhesus  actg
B D       Crab-eating macaque  actg
B D              Green monkey  acta
B D                  Marmoset  acta
B D           Squirrel monkey  acta
B D                  Bushbaby  acta
           Chinese tree shrew  acca
B D                  Squirrel  acta
                 Prairie vole  tctg
B D           Chinese hamster  acta
               Golden hamster  acta
B D                     Mouse  ccta
B D                       Rat  tcta
B D            Naked mole-rat  actg
B D                Guinea pig  actg
                   Chinchilla  actg
             Brush-tailed rat  actg
B