Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 523 in window, 34621455 - 34621472, 18 bps 
B D                     Human  ctctc---agggcaagatgct
B D                     Chimp  ctctc---agggcaagatgct
B D                   Gorilla  ctctc---agggcaaggtgct
B D                    Gibbon  ctctc---agggcaaggtgct
B D                    Rhesus  ctctt---aggggcaggtgct
B D       Crab-eating macaque  ctctt---aggggaaggtgct
B D                    Baboon  ctctt---aggggaaggtgct
B D              Green monkey  ctctc---aggggaaggtgct
B D                  Marmoset  ctctc---agggcaaggtgct
B D           Squirrel monkey  ctctc---agggcaaggtgct
B D                  Bushbaby  gtttt---aggacaaggtgct
           Chinese tree shrew  ctctc---agggcaaggtgct
B D                  Squirrel  ctctc---agggcaaggtgct
       Lesser Egyptian jerboa  ctctc---agggcaaggtgct
                 Prairie vole  ctttc---agggcaaggtgct
B D           Chinese hamster  ctttc---agggcaaggtgct
               Golden hamster  ctttc---agggctaggtgct
B D                     Mouse  ctttc---agggcaaggtact
B D                       Rat  ctttc---agggtaaggtgct
B D            Naked mole-rat  ctctc---agggcaaggggtt
B D                Guinea pig  ttctc---agggtgagatgtt
                   Chinchilla  ctctc---agggcaaggtgtt
             Brush-tailed rat  ctttc---agggcaaggtatt
B D                    Rabbit  ttctc---agggcaaggagct
B D                       Pig  ctctc---agggtgaggtgct
B D                    Alpaca  ctctc---agggtgagacgct
               Bactrian camel  ctctc---agggtgagacgct
B D                   Dolphin  ctctc---agggtgaggcgct
                 Killer whale  ctctc---agggtgaggcgct
             Tibetan antelope  ttctc---agggtgaggtgct
B D                       Cow  ttctc---agggtgaggtgct
B D                     Sheep  ttctc---agggtgaggtgct
                Domestic goat  ttctc---agggtgaggtgct
B D                     Horse  ctctc---agggtgaggcact
B D          White rhinoceros  ctctc---agggtgaggcatt
B D                       Cat  ttctc---agggtgaagtgct
B D                       Dog  ttctc---agggtgaggtgct
B D                   Ferret   ttctc---atggtgaggtgct
B D                     Panda  ttctc---agggtgaggtgct
               Pacific walrus  ttctc---aaggtgaggggct
                 Weddell seal  ttctc---agggtgaggggct
             Black flying-fox  ctctc---agggtaaggtatt
B D                   Megabat  ctctc---agggtaaggtatt
                Big brown bat  gtctc---agggtgaggtgct
         David's myotis (bat)  ctctc---agggtgagatgcc
B D                  Microbat  ctctc---agggtgagatgcc
B D                  Hedgehog  ttctc---agggtgaggtgct
B D                     Shrew  ctctc---agagtgaggtgct
              Star-nosed mole  ctctc---agggtgaggtact
B D                  Elephant  ctctc---agggtgaggtgct
          Cape elephant shrew  ctttc---agggtgaggcgct
B D                   Manatee  ctctc---agggtgaggccct
             Cape golden mole  ttctc---agggcaaggcgct
B D                    Tenrec  ctctc---agggtgaggcgct
                     Aardvark  gtctc---agggcaaggtgcc
B D                 Armadillo  ctctc---aggatgaggcgcc
B D                   Opossum  gtctctttaaggtgaggtgct
B D           Tasmanian devil  gtctc---aaggtgaggtact
  D               Rock pigeon  --------------gcggatt
  D       Collared flycatcher  --------------gggggtt
B D       Medium ground finch  --------------aggggct
B D                Budgerigar  ---tt---gtgtgagggggct
B D                   Chicken  ---ct---ttgtgagggggct
B D                    Turkey  ggccc---taaggagggggcg
B D        American alligator  --ttg---acagcagctggtt
B D                      Pika  ---------------------
  D    Spiny softshell turtle  =====================
                 Spotted gar  =====================
          Tibetan ground jay  =====================
B D               Zebra finch  =====================
  D    White-throated sparrow  =====================
B D             X. tropicalis  ---------------------
  D            Painted turtle  =====================
  D          Peregrine falcon  =====================
  D              Saker falcon  =====================
B D                   Wallaby  =====================
B D                  Platypus  =====================
  D  Chinese softshell turtle  =====================
B D                 Orangutan  NNNNNNNNNNNNNNNNNNNNN

Alignment block 2 of 523 in window, 34621473 - 34621520, 48 bps 
B D                     Human  ggaaggg---ggccctgtgg-----agggtgggggtgcag-ggttggttggac---cctg----
B D                     Chimp  ggaaggg---ggccctgtgg-----agggtgggggtgcag-ggttggttggac---cctg----
B D                   Gorilla  ggaaggg---ggccctgtgg-----agggtgagggtgcag-ggttggttggac---cctg----
B D                    Gibbon  ggaaggg---ggacctgtgg-----agggtgggggtgcag-ggttggttggac---cctg----
B D                    Rhesus  ggaaggg---ggccctgtag-----agggtgggggtgcag-ggttggttggac---cctg----
B D       Crab-eating macaque  ggaaggg---ggccctgtag-----agggtgggggtgcag-ggttggttggac---cctg----
B D                    Baboon  ggaaggg---ggccctgtag-----agggtgggggtgcag-ggttggttggac---cctg----
B D              Green monkey  ggaaggg---ggccctgtag-----agggtgggggtgcag-ggttggttggac---cctg----
B D                  Marmoset  ggaaggg---ggccctgtgg-----agggtgggggtgcag-ggttggttggac---cctg----
B D           Squirrel monkey  ggaaggg---ggccctgtgg-----agggtgggggtgcag-ggttggttggac---cctg----
B D                  Bushbaby  ggaaggg---ggccctatag-----aggattgggacgcag-ggttggttgggc---cctg----
           Chinese tree shrew  ggaaggg---ggccctgtag-----aggacaggggtgcag-agtttgttggac---cctg----
B D                  Squirrel  gggaggg---tgcccagtag-----aaggtgggggtgcag-ggttggttgggc---cctg----
       Lesser Egyptian jerboa  ggaaggg---ggccctgtag-----aggatgggggaggag-gattggttggac---cctg----
                 Prairie vole  ggagggg---ggtcctgtgg-----agggtggaggtgcag-gattggttggcc---ccaa----
B D           Chinese hamster  ggaaggg---ggccctgtag-----agggtgga---ggag-gattggttgggc---ccaa----
               Golden hamster  agaaggg---ggccctgccg-----agggcggagctggag-gattggttgggc---ccaa----
B D                     Mouse  ggaaggg---ggccctgtag-----agggtagaggtggag-gattggttggac---ccaa----
B D                       Rat  ggaaggg---ggccctgtag-----agggtgggggtggag-gattggtcggac---ccaa----
B D            Naked mole-rat  ggcaggg---ggccctgtag-----agggtgggggtgcag-ggttggttggac---cctg----
B D                Guinea pig  gacaggg---ggtcctgttg-----agagtgggggagcag-ggttggtggagc---cctg----
                   Chinchilla  gacaggg---ggtcctgctg-----agggtgggggtgcgg-ggttagctgggc---cctg----
             Brush-tailed rat  gccaggg---ggccctgctg-----agggtgggggtacag-ggttagttgggc---cctg----
B D                    Rabbit  ggaggga---ggccctgtag-----aggatgggggtgcag-gactggctgggc---cctg----
B D                       Pig  ggaaggg---ggccccgtcg-----ggggtgggggtgcag-ggttggttgggc---cttg----
B D                    Alpaca  ggaaggg---ggccctgttg-----ggggtgggggtgcag-ggttggttgggc---cctg----
               Bactrian camel  ggaaggg---ggccctgttg-----ggggtgggggtgcag-ggttggttgggc---cctg----
B D                   Dolphin  ggaaggg---ggccccatca-----ggggtgggggtgcag-ggttggctgggc---cctg----
                 Killer whale  ggaaggg---ggccccatca-----ggggtgggggtgcag-ggttggctgggc---cctg----
             Tibetan antelope  ggaaggg---ggccctgtcg-----ggagtgggggtgcag-ggttggttgggc---cctg----
B D                       Cow  ggaaggg---ggccctgtcg-----ggagttggggtgcag-ggttggttgggc---cctg----
B D                     Sheep  ggaaggg---ggccctgtcg-----ggagtgggggtgcag-ggttggttgggc---cctg----
                Domestic goat  ggaaggg---ggccctgtcg-----ggagtgggggtgcag-ggttggttgggc---cctg----
B D                     Horse  ggaaggg---gcccctgtag-----ggggtgggggtgcag-ggttggttgggc---cctg----
B D          White rhinoceros  ggaaggg---ggccctgtag-----ggggcaggggtacag-ggttggttgggc---cctg----
B D                       Cat  ggaaggt---ggccctgtag-----ggagtgggggtacag-ggttggttgggc---cctg----
B D                       Dog  ggaaggg---ggccctgtag-----ggagaggaggtgcag-ggttggttgggc---cctg----
B D                   Ferret   ggaaggg---ggtcctgtag-----ggagaagaggtgcag-ggttggttggac---cctg----
B D                     Panda  ggaaggg---ggccctgtag-----ggagtggaggtgcag-ggttggttgggc---cctg----
               Pacific walrus  ggaaggg---ggccctgtag-----ggagtggaggtacag-ggttggttgggc---cctg----
                 Weddell seal  ggaaggg---ggccctgtag-----ggagtggaggtacag-ggttggttgggc---cctg----
             Black flying-fox  ggaaggg---ggccctgtag-----gaggtgggggtgcag-ggttggctgggc---cctg----
B D                   Megabat  ggaaggg---ggccctgtag-----gaggtgggggtgcag-ggttggttgggc---cctg----
                Big brown bat  ggaaggg---ggccctgtag-----gggttgggggtacag-ggttaactgggc---cctg----
         David's myotis (bat)  ggaaggg---ggccctgtag-----gggttgggggtacag-ggttaattgggc---cctg----
B D                  Microbat  agaaggg---ggccctgtag-----gggttgggggtacag-ggttaattgggc---cctg----
B D                  Hedgehog  agaagggttcggccctgtag-----ggtccaggggtgtag-ggttggttgggc---actg----
B D                     Shrew  agaagga---ggcccggtag-----ggggtggtggtgcag-ggttggttgtgccggcttg----
              Star-nosed mole  ggaagga---ggccctgtag-----gg------ggtgcag-ggttggttggac---cctg----
B D                  Elephant  ggaaggg---ggacctgtag-----ggggctggggcacag-ggttgtttaggc---cctg----
          Cape elephant shrew  agaaagg---ggccctgtag-----gggttgggggtgcag-gattggtttggc---tctg----
B D                   Manatee  ggaaagg---ggtcctgtag-----cgggctggggtgcag-ggttgtttgggc---cctg----
             Cape golden mole  gaaaggg---ggccttgtag-----ggggtgggggtgcag-ggttggctgggc---cctg----
B D                    Tenrec  gggagag---gaccctgcag-----ggggtgggggcacag-ggttggttggac---cctg----
                     Aardvark  ggaaggg---ggccc-----------atgcaggggtgcag-ggttggttgggc---cctg----
B D                 Armadillo  ggaagga---ggccctgtgg-----ggggttggggtgcag-ggatagttgggc---cctg----
B D                   Opossum  ggagagg---ggacctggag-----gagtatggagtccag-gactccttgggc---cctg----
B D           Tasmanian devil  ggagagg---ggaccaggag-----gggtattagatccag-gacttgttgggc---cctg----
  D               Rock pigeon  cggggcc---ggcacagggt-----ttgggcggctctggg-tgct--ccctcc---acca----
  D       Collared flycatcher  tggggca---ggcatggggt-----ttggacgcgtctggg-tgct--ccctcc---accg----
B D       Medium ground finch  ggggctg---ttcttggag--------------gactggg-ggct--gtcctc---gagg----
B D                Budgerigar  gggagca---g----ggggt-----tcagggcagacatgg-ggtttggccggc---tctg----
B D                   Chicken  ggtggca---g----tgggt-----tcagggtggccgcag-ggtttggcccac---tttg----
B D                    Turkey  tctgacc---a----tagag-----atggtggaggtctac-ggatagagggac---cctg----
B D        American alligator  ctgggag---ggcgctgggc-----ttgcccgcccatggg-tgtt--gccccc---gccg----
B D             X. tropicalis  ggaaggg---aggctggcaggcattggggaagggaaggga-ggctggc-aggc---attg----
B D                 Zebrafish  ggaggag---gaagtggtag-----aggaggaagaacaagaggatgattgaga---agaggagg
B D                      Pika  ----------------------------------------------------------------
  D    Spiny softshell turtle  ================================================================
                 Spotted gar  ================================================================
          Tibetan ground jay  ================================================================
B D               Zebra finch  ================================================================
  D    White-throated sparrow  ================================================================
  D            Painted turtle  ================================================================
  D          Peregrine falcon  ================================================================
  D              Saker falcon  ================================================================
B D                   Wallaby  ================================================================
B D                  Platypus  ================================================================
  D  Chinese softshell turtle  ================================================================
B D                 Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 2 and 3 in window
  D              Rock pigeon 2bp
  D      Collared flycatcher 2bp
B D      Medium ground finch 16bp
B D               Budgerigar 18bp
B D                  Chicken 2bp
B D                   Turkey 2bp
B D       American alligator 11bp
B D            X. tropicalis 11bp

Alignment block 3 of 523 in window, 34621521 - 34621537, 17 bps 
B D                     Human  ggaa------------------------gctggcacagg------------ct
B D                     Chimp  ggaa------------------------gctggcacagg------------ct
B D                   Gorilla  ggaa------------------------gctggcacagg------------ct
B D                    Gibbon  ggaa------------------------gctggcacagg------------ct
B D                    Rhesus  ggaa------------------------gctggcacagg------------ct
B D       Crab-eating macaque  ggaa------------------------gctggcacagg------------ct
B D                    Baboon  ggaa------------------------gctggcacagg------------ct
B D              Green monkey  ggaa------------------------gctggcacagg------------ct
B D                  Marmoset  ggaa------------------------gctggcacagg------------ct
B D           Squirrel monkey  ggaa------------------------gctggcacagg------------ct
B D                  Bushbaby  agaa------------------------gctggcatagg------------ct
           Chinese tree shrew  ggaa------------------------gttggcacagg------------ct
B D                  Squirrel  ggaa------------------------gctggcacagg------------ct
       Lesser Egyptian jerboa  ggaa------------------------gttggcacagg------------ct
                 Prairie vole  ggaa------------------------gctggcacagg------------ct
B D           Chinese hamster  ggaa------------------------gctggcacagg------------ct
               Golden hamster  ggaa------------------------gctggcacagg------------ct
B D                     Mouse  ggaa------------------------gctggcacagg------------tt
B D                       Rat  ggaa------------------------gctggcacagg------------ct
B D            Naked mole-rat  ggaa------------------------gctgttacagg------------ct
B D                Guinea pig  ggaa------------------------gctgttacagg------------ct
                   Chinchilla  ggaa------------------------gctgtgacagg------------ct
             Brush-tailed rat  ggac------------------------gctgttacagg------------ct
B D                    Rabbit  ggga------------------------gctggcacaga------------ct
B D                       Pig  ggaa------------------------gctggcacggt------------ct
B D                    Alpaca  ggaa------------------------gctggcacagg------------ct
               Bactrian camel  agaa------------------------gctggcacagg------------ct
B D                   Dolphin  ggaa------------------------gctggcacggg------------ct
                 Killer whale  ggaa------------------------gctggcacggg------------ct
             Tibetan antelope  ggaa------------------------gctggtacagg------------ct
B D                       Cow  ggaa------------------------gctggtacagg------------ct
B D                     Sheep  ggaa------------------------gctggtacagg------------ct
                Domestic goat  ggaa------------------------gctggtacggg------------ct
B D                     Horse  ggaa------------------------gctggcacagg------------ct
B D          White rhinoceros  ggaa------------------------gctggcacagg------------ct
B D                       Cat  ggaa------------------------gctggcacagg------------ct
B D                       Dog  ggaa------------------------gctggcacaga------------ct
B D                   Ferret   ggaa------------------------gctggcacagg------------ct
B D                     Panda  ggaa------------------------gctggcacagg------------ct
               Pacific walrus  ggaa------------------------gctggcacagg------------ct
                 Weddell seal  ggaa------------------------gctggcacagg------------ct
             Black flying-fox  ggaa------------------------gctggcatagg------------ct
B D                   Megabat  ggaa------------------------gctggcatagg------------ct
                Big brown bat  ggaa------------------------gctggcacagg------------ct
         David's myotis (bat)  ggaa------------------------gctggcacagg------------ct
B D                  Microbat  ggaa------------------------gctggcacagg------------ct
B D                  Hedgehog  ggaa------------------------gctggcacagg------------ct
B D                     Shrew  ggaa------------------------actggcacagg------------tt
              Star-nosed mole  agag------------------------gctggtacagg------------ct
B D                  Elephant  ggaa------------------------gctggcacagg------------ct
          Cape elephant shrew  ggaa------------------------gctggaacagg------------ct
B D                   Manatee  ggaa------------------------gctggcaccgg------------ct
             Cape golden mole  tgaa------------------------gctggcacagg------------ct
B D                    Tenrec  ggaa------------------------gctggcagagg------------ct
                     Aardvark  ggaa------------------------gctggcacagg------------ct
B D                 Armadillo  ggaa------------------------gccggcacagg------------ct
B D                   Opossum  agaattcctgctgttgttggtggctgaggccactgtagg------------tg
B D           Tasmanian devil  agaattcctgttgttggtggtggctgagcccagtgtagg------------tg
B D                  Platypus  ggaa------------------------gatgggacagagacgggtgctcccg
  D               Rock pigeon  tgcc------------------------agcggggccgg------------gg
  D       Collared flycatcher  tgcc------------------------agggtggctga------------gg
B D       Medium ground finch  tacc------------------------tggggaactgc------------gg
B D                Budgerigar  tgcc------------------------gggtgtgctgg------------gg
B D                   Chicken  tgcc------------------------ccctccaccag------------gt
B D                    Turkey  gagg------------------------ctcagcgcagg------------gt
B D        American alligator  ggct------------------------ccgggcaccgc------------tg
B D             X. tropicalis  ggag------------------------gctggcaggca------------tt
B D                 Zebrafish  agga------------------------agtggtagagg------------a-
B D                      Pika  -----------------------------------------------------
  D    Spiny softshell turtle  =====================================================
                 Spotted gar  =====================================================
          Tibetan ground jay  =====================================================
B D               Zebra finch  =====================================================
  D    White-throated sparrow  =====================================================
  D            Painted turtle  =====================================================
  D          Peregrine falcon  =====================================================
  D              Saker falcon  =====================================================
B D                   Wallaby  =====================================================
  D  Chinese softshell turtle  =====================================================
B D                 Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 3 and 4 in window
B D      Medium ground finch 2bp

Alignment block 4 of 523 in window, 34621538 - 34621538, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  g
B D                     Shrew  g
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                   Opossum  g
B D           Tasmanian devil  g
B D                  Platypus  g
  D               Rock pigeon  g
  D       Collared flycatcher  g
B D       Medium ground finch  g
B D                Budgerigar  g
B D                   Chicken  g
B D                    Turkey  g
B D        American alligator  g
B D             X. tropicalis  g
B D                      Pika  -
  D    Spiny softshell turtle  =
                 Spotted gar  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D                 Zebrafish  -
  D            Painted turtle  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                   Wallaby  =
  D  Chinese softshell turtle  =
B D                 Orangutan  N

Inserts between block 4 and 5 in window
B D                  Chicken 16bp
B D                   Turkey 3043bp

Alignment block 5 of 523 in window, 34621539 - 34621546, 8 bps 
B D                     Human  gcggcggg
B D                     Chimp  gcggcggg
B D                   Gorilla  gcggcggg
B D                    Gibbon  gcggcggg
B D                    Rhesus  gcggcggg
B D       Crab-eating macaque  gcggcggg
B D                    Baboon  gcggcggg
B D              Green monkey  gcggcggg
B D                  Marmoset  gcggcggg
B D           Squirrel monkey  gcgacggg
B D                  Bushbaby  tcggcggg
           Chinese tree shrew  gcgtcgag
B D                  Squirrel  gcggcgag
       Lesser Egyptian jerboa  gcgtctgg
                 Prairie vole  gcggcgag
B D           Chinese hamster  gcggcgag
               Golden hamster  gcggcgag
B D                     Mouse  gcgtcgag
B D                       Rat  gcgtcggg
B D            Naked mole-rat  gcgacggg
B D                Guinea pig  gcgacggg
                   Chinchilla  gcgacggg
             Brush-tailed rat  tcgacggg
B D                    Rabbit  gcggcggg
B D                       Pig  gcgacggg
B D                    Alpaca  gcgacggg
               Bactrian camel  gcgacggg
B D                   Dolphin  gcaacggg
                 Killer whale  gcaacggg
             Tibetan antelope  gcgacggg
B D                       Cow  gcgacggg
B D                     Sheep  gcgacggg
                Domestic goat  gcgacggg
B D                     Horse  gcggcggg
B D          White rhinoceros  gcggcggg
B D                       Cat  gcggcgag
B D                       Dog  gcgacggg
B D                   Ferret   gcgacggg
B D                     Panda  gcgacggg
               Pacific walrus  gcgacggg
                 Weddell seal  gcgacggg
             Black flying-fox  gcggcggg
B D                   Megabat  gcggcggg
                Big brown bat  gcggcggg
         David's myotis (bat)  gcggcggg
B D                  Microbat  gcggcggg
B D                  Hedgehog  gtggcggg
B D                     Shrew  gcggcgcg
              Star-nosed mole  acgacggg
B D                  Elephant  gcggcggg
          Cape elephant shrew  gcggcggg
B D                   Manatee  gcggcggg
             Cape golden mole  acggcggg
B D                    Tenrec  gcggcggg
                     Aardvark  gcggcggg
B D                 Armadillo  gcggcggg
B D                   Opossum  tctcctgg
B D           Tasmanian devil  tcgacggg
B D                  Platypus  aggttggg
  D               Rock pigeon  ccggcggg
  D       Collared flycatcher  ccggcggg
B D       Medium ground finch  tccccggg
B D                Budgerigar  ccggcggg
B D                   Chicken  acggcggg
B D        American alligator  ccggcggg
B D             X. tropicalis  gctgcagg
B D                 Zebrafish  --ggaaga
B D                      Pika  --------
  D    Spiny softshell turtle  ========
                 Spotted gar  ========
B D                    Turkey  ========
          Tibetan ground jay  ========
B D               Zebra finch  ========
  D    White-throated sparrow  ========
  D            Painted turtle  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
B D                   Wallaby  ========
  D  Chinese softshell turtle  ========
B D                 Orangutan  NNNNNNNN

Inserts between block 5 and 6 in window
B D      Medium ground finch 2673bp
B D            X. tropicalis 2bp

Alignment block 6 of 523 in window, 34621547 - 34621560, 14 bps 
B D                     Human  caaagaggacacct
B D                     Chimp  caaagaggacacct
B D                   Gorilla  caaagaggacacct
B D                    Gibbon  caaagaggacacct
B D                    Rhesus  caaagaggacacct
B D       Crab-eating macaque  caaagaggacacct
B D                    Baboon  caaagaggacacct
B D              Green monkey  caaagaggacacct
B D                  Marmoset  caaagaggacacct
B D           Squirrel monkey  caaagaggacacct
B D                  Bushbaby  caaagaggacacct
           Chinese tree shrew  caaacagtacgcct
B D                  Squirrel  caaagagaacacct
       Lesser Egyptian jerboa  caaacaggatgcct
                 Prairie vole  caaagaggatacct
B D           Chinese hamster  caaagaggatacct
               Golden hamster  caaagaggatacct
B D                     Mouse  caaagaggatacct
B D                       Rat  caaagaggatacct
B D            Naked mole-rat  caaagaggatgcct
B D                Guinea pig  caaagagaacacct
                   Chinchilla  caaagagaacgcct
             Brush-tailed rat  caaagagaatgcct
B D                    Rabbit  caaagaggacacct
B D                       Pig  caaacaggacgcct
B D                    Alpaca  caaagaggacacct
               Bactrian camel  caaagaggacacct
B D                   Dolphin  caaagaggacgcct
                 Killer whale  caaagaggacgcct
             Tibetan antelope  caaaaaggacacct
B D                       Cow  caaagaggacacct
B D                     Sheep  caaagaggacacct
                Domestic goat  caaagaggacacct
B D                     Horse  caaagaggatgcct
B D          White rhinoceros  caaagaggatgcct
B D                       Cat  caaagaggacacct
B D                       Dog  caaacaggacacct
B D                   Ferret   caaagagaacacct
B D                     Panda  caaagaggacacct
               Pacific walrus  caaagaggacacct
                 Weddell seal  caaagaggacacct
             Black flying-fox  caaagaggatgcct
B D                   Megabat  caaagaggatgcct
                Big brown bat  caaagaggatgcct
         David's myotis (bat)  caaagaggatgcct
B D                  Microbat  caaagaggatgcct
B D                  Hedgehog  caaaaaggacacct
B D                     Shrew  caaaaagaacacct
              Star-nosed mole  caaaaaggacgcct
B D                  Elephant  caaagaggacacct
          Cape elephant shrew  caaagagtacacct
B D                   Manatee  caaagaggacacct
             Cape golden mole  caaagaggacacct
B D                    Tenrec  caaagaggacacct
                     Aardvark  caaagagaacacct
B D                 Armadillo  caaagagaacgcct
B D                   Opossum  caaagaggactcct
B D           Tasmanian devil  caaagaggactcct
B D                  Platypus  caaatagcactcct
  D               Rock pigeon  caaacaggacacct
  D       Collared flycatcher  caaacaggacacct
B D                Budgerigar  caaacaggacacct
B D                   Chicken  caaacaggacacct
B D        American alligator  cgaacaggacacct
B D             X. tropicalis  cagtagaaagacc-
B D                 Zebrafish  acaagaggatgatt
B D                      Pika  --------------
  D    Spiny softshell turtle  ==============
                 Spotted gar  ==============
B D                    Turkey  ==============
          Tibetan ground jay  ==============
B D               Zebra finch  ==============
  D    White-throated sparrow  ==============
  D            Painted turtle  ==============
B D       Medium ground finch  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
B D                   Wallaby  ==============
  D  Chinese softshell turtle  ==============
B D                 Orangutan  NNNNNNNNNNNNNN

Inserts between block 6 and 7 in window
B D                  Opossum 9bp
B D          Tasmanian devil 9bp

Alignment block 7 of 523 in window, 34621561 - 34621561, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                      Pika  g
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  g
B D                     Shrew  g
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                   Opossum  g
B D           Tasmanian devil  g
B D                  Platypus  g
  D               Rock pigeon  g
  D       Collared flycatcher  g
B D                Budgerigar  g
B D                   Chicken  g
B D        American alligator  g
B D             X. tropicalis  a
B D                 Zebrafish  g
  D    Spiny softshell turtle  =
                 Spotted gar  =
B D                    Turkey  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
  D            Painted turtle  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                   Wallaby  =
  D  Chinese softshell turtle  =
B D                 Orangutan  N
             Star-nosed mole  -

Inserts between block 7 and 8 in window
B D       American alligator 1547bp

Alignment block 8 of 523 in window, 34621562 - 34621596, 35 bps 
B D                     Human  gcaaagggg--tgaggagat-gg-tagagggcaaaaaca
B D                     Chimp  gcaaagggg--tgaggagat-gg-tagagggcaaaaaca
B D                   Gorilla  gcaaagggg--tgaggagat-gg-tagagggcaaaaaca
B D                    Gibbon  gcaaagggg--tgaggagat-gg-tagagggcaaaaaca
B D                    Rhesus  gcaaagggg--tgaggagat-gg-tagagggcaaaaaca
B D       Crab-eating macaque  gcaaagggg--tgaggagat-gg-tagagggcaaaaaca
B D                    Baboon  gcaaagggg--tgaggagat-gg-tagagggcaaaaaca
B D              Green monkey  gcaaagggg--tgaggagat-gg-tagagggcaaaaaca
B D                  Marmoset  gcaaagggg--tgagaagat-gg-tagagggcaaaaaca
B D           Squirrel monkey  gcaaagggg--tgagaagat-gg-tagagggcaaaaaca
B D                  Bushbaby  gcaaaggga--tgaggagat-ga-tagagggtaaa----
           Chinese tree shrew  gcaaagggg--taaggagat-ag-tagagggcaaataca
B D                  Squirrel  gcaaagggg--tgaggaaat--g-gcaaaagcaaacaca
       Lesser Egyptian jerboa  gcaaagggg--tgaagagat--g-gtaaacacaaacaca
                 Prairie vole  acaaagggg--cgaagagag-ag-tgaaatgcaaacata
B D           Chinese hamster  atggaggggtataaggagat-ag-taaaatgcaaacata
               Golden hamster  ataaagggg--tgaagaaac-ag-taaaatgcaaacacg
B D                     Mouse  ataaagggt--ataagagat--g-taaaattaaaaaata
B D                       Rat  atgaagggt--tggagaggt--g-tgaaaggcaaaaata
B D            Naked mole-rat  gcgaaaagg--ggagaagat-gg-taaaaggcaaacaaa
B D                Guinea pig  gcgaaaggg--gtaggaggt-gg-taaaaggtaaacaca
                   Chinchilla  gtgagaggg--gcaggaggc-gg-cagaaggcaagcacg
             Brush-tailed rat  gtgaaaggg--gtagaaggt-gg-ta-aaggcaaacaca
B D                    Rabbit  gcaaaggga--tgaggaaat-gg-tagagggcaaacaca
B D                      Pika  gcaaaggag--tgagacaat-gt-tagcaggggaacaca
B D                       Pig  gcaaagggg--tgaggagag-gg-tagagggcaaacaca
B D                    Alpaca  gcaaagggg--tgaggggc---a-aagagggcaaacaca
               Bactrian camel  gcaaagggg--tgaggggc---a-aagagggcaaacgca
B D                   Dolphin  gcaaagggg--tgaggagat-gg-tagagggaaaacaca
                 Killer whale  gcaaagggg--tgaggagat-gg-tagagggaaaacaca
             Tibetan antelope  gcaaagaga--taaggaatt-gg-tacagggcaaagaca
B D                       Cow  gcaaagaga--tgaggaatt-tg-tagagggcaaagaca
B D                     Sheep  gcaaagaga--tgaggaatt-gg-tagagggcaaagaca
                Domestic goat  gcaaagaga--tgaggaatt-gg-tagagggcaaagaca
B D                     Horse  gcaaaggga--tgaggagac-gg-tagagggcaaacaca
B D          White rhinoceros  gcagaggga--tgaggagat-gg-tagagggaaaacaga
B D                       Cat  ataaagggg--tgaggaggt-gg-tggagggaaaacaca
B D                       Dog  acaaagggg--tgaagagat-gg-tggagggaaagcaca
B D                   Ferret   acaaagggg--tgaggagac-agttagagggaaaacaca
B D                     Panda  acaaatggg--tgaggagat-gg-tggagggaaaacaca
               Pacific walrus  acaaaaggg--tgaggagat-gg-tggagggaaaacaca
                 Weddell seal  acaaagggg--tgaggcgat-gg-tggagggaaaacaca
             Black flying-fox  gcaaaggga--tgaggagat-gg-tagaaggcaagcaca
B D                   Megabat  gcaaaggga--tgaggagat-gg-tagaaggcaagcaca
                Big brown bat  gcaaagggg--tgaggagat-gg-tagagggaaaataca
         David's myotis (bat)  ccaaaggag--tgaggagat-gg-tagagggaaaacaca
B D                  Microbat  ccaaagggg--tgaggagat-gg-tagagggaaaataca
B D                  Hedgehog  acaaagggg--tgagaagat-ga-aagaaagcaaaaaca
B D                     Shrew  acaaaaagg--tgagacgat-gg-tagagggcaaacatt
              Star-nosed mole  atagaagga--tgaggagat-gg-cagggagcaaacaca
B D                  Elephant  gcaaaggcg--t---gagat-gg-taaagggcaaacaca
          Cape elephant shrew  gcaaagggg--t---gagat-gg-tagaggtcaaacaca
B D                   Manatee  gcaaagggg--t---gagat-gg-tagagggcaaacaca
             Cape golden mole  gcaaaggat--t---gaaat-gg-tagagggcaaacaca
B D                    Tenrec  gcagatggg--t---gagat-gg-tagaaggcaaacaga
                     Aardvark  gtaaagagg--t---gagat-gg-tagagggcaaacaca
B D                 Armadillo  ggatgag--------gagag-aa-tacagga-aaacaca
B D                   Opossum  aaacagaga-------------g-aagaaaggaaataca
B D           Tasmanian devil  acacagaga-------------g-aagaaaggaaatgca
B D                  Platypus  gggggggga--gggggagacggg-gagaaaggga-----
  D               Rock pigeon  --------------------------gggagcgagagca
  D       Collared flycatcher  --------------------------gaggacaagaaca
B D                Budgerigar  --------------------------gagagcaagagca
B D                   Chicken  --------------------------gggagtgagagaa
B D             X. tropicalis  acagagaga--taggctgta-gg-agcagaaaaaagaca
B D                 Zebrafish  agaagagga--ggaggaagt-gg-tagaggaggaagaag
  D    Spiny softshell turtle  =======================================
                 Spotted gar  =======================================
B D                    Turkey  =======================================
          Tibetan ground jay  =======================================
B D               Zebra finch  =======================================
  D    White-throated sparrow  =======================================
  D            Painted turtle  =======================================
B D        American alligator  =======================================
B D       Medium ground finch  =======================================
  D          Peregrine falcon  =======================================
  D              Saker falcon  =======================================
B D                   Wallaby  =======================================
  D  Chinese softshell turtle  =======================================
B D                 Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 8 and 9 in window
B D                  Opossum 91bp
B D          Tasmanian devil 57bp

Alignment block 9 of 523 in window, 34621597 - 34621598, 2 bps 
B D                     Human  ag
B D                     Chimp  ag
B D                   Gorilla  ag
B D                    Gibbon  ag
B D                    Rhesus  ag
B D       Crab-eating macaque  ag
B D                    Baboon  ag
B D              Green monkey  ag
B D                  Marmoset  ag
B D           Squirrel monkey  ag
           Chinese tree shrew  ag
B D                  Squirrel  ag
       Lesser Egyptian jerboa  at
                 Prairie vole  aa
B D           Chinese hamster  aa
               Golden hamster  ca
B D                     Mouse  aa
B D                       Rat  aa
B D            Naked mole-rat  ag
B D                Guinea pig  ag
                   Chinchilla  ag
             Brush-tailed rat  ag
B D                    Rabbit  ag
B D                      Pika  ag
B D                       Pig  ag
B D                    Alpaca  ag
               Bactrian camel  ag
B D                   Dolphin  ag
                 Killer whale  ag
             Tibetan antelope  ag
B D                       Cow  ag
B D                     Sheep  ag
                Domestic goat  ag
B D                     Horse  ag
B D          White rhinoceros  ag
B D                       Cat  gg
B D                       Dog  gg
B D                   Ferret   gg
B D                     Panda  gg
               Pacific walrus  gg
                 Weddell seal  gg
             Black flying-fox  ag
B D                   Megabat  ag
                Big brown bat  ag
         David's myotis (bat)  ag
B D                  Microbat  ag
B D                  Hedgehog  ag
B D                     Shrew  ag
              Star-nosed mole  at
B D                  Elephant  ag
          Cape elephant shrew  ag
B D                   Manatee  ag
             Cape golden mole  aa
                     Aardvark  ag
B D                 Armadillo  ag
B D                  Platypus  ag
  D               Rock pigeon  aa
  D       Collared flycatcher  ag
B D                Budgerigar  ag
B D                   Chicken  aa
B D             X. tropicalis  ag
B D                 Zebrafish  tg
  D    Spiny softshell turtle  ==
                 Spotted gar  ==
B D                    Turkey  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
  D            Painted turtle  ==
B D        American alligator  ==
B D                   Opossum  ==
B D       Medium ground finch  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D                   Wallaby  ==
B D                    Tenrec  --
B D                  Bushbaby  --
  D  Chinese softshell turtle  ==
B D                 Orangutan  NN

Inserts between block 9 and 10 in window
  D              Rock pigeon 764bp
B D                  Chicken 21bp

Alignment block 10 of 523 in window, 34621599 - 34621601, 3 bps 
B D                     Human  cag
B D                     Chimp  cag
B D                   Gorilla  cag
B D                    Gibbon  cag
B D                    Rhesus  cag
B D       Crab-eating macaque  cag
B D                    Baboon  cag
B D              Green monkey  cag
B D                  Marmoset  cag
B D           Squirrel monkey  cag
B D                  Bushbaby  cag
           Chinese tree shrew  cag
B D                  Squirrel  cag
       Lesser Egyptian jerboa  gag
                 Prairie vole  cag
B D           Chinese hamster  cag
               Golden hamster  cag
B D                     Mouse  cga
B D                       Rat  cag
B D            Naked mole-rat  cag
B D                Guinea pig  caa
                   Chinchilla  agg
             Brush-tailed rat  cgg
B D                    Rabbit  cag
B D                      Pika  cag
B D                       Pig  cag
B D                    Alpaca  cag
               Bactrian camel  cag
B D                   Dolphin  cag
                 Killer whale  cag
             Tibetan antelope  cag
B D                       Cow  tag
B D                     Sheep  cag
                Domestic goat  cag
B D                     Horse  cag
B D          White rhinoceros  cag
B D                       Cat  cag
B D                       Dog  cag
B D                   Ferret   cag
B D                     Panda  ccg
               Pacific walrus  cag
                 Weddell seal  cag
             Black flying-fox  cag
B D                   Megabat  cag
                Big brown bat  cag
         David's myotis (bat)  cag
B D                  Microbat  cag
B D                  Hedgehog  cag
B D                     Shrew  caa
              Star-nosed mole  cag
B D                  Elephant  ca-
          Cape elephant shrew  ca-
B D                   Manatee  ca-
             Cape golden mole  ta-
                     Aardvark  ca-
B D                 Armadillo  cag
B D                  Platypus  aag
B D                   Chicken  cac
B D             X. tropicalis  cag
B D                 Zebrafish  gag
  D    Spiny softshell turtle  ===
                 Spotted gar  ===
B D                    Turkey  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D           Tasmanian devil  ===
  D            Painted turtle  ===
B D        American alligator  ===
B D                Budgerigar  ---
B D                   Opossum  ===
  D               Rock pigeon  ===
B D       Medium ground finch  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
B D                   Wallaby  ===
B D                    Tenrec  ---
  D  Chinese softshell turtle  ===
B D                 Orangutan  NNN
  D       Collared flycatcher  ---

Inserts between block 10 and 11 in window
B D                 Platypus 361bp
B D                  Chicken 2bp
B D            X. tropicalis 1bp

Alignment block 11 of 523 in window, 34621602 - 34621605, 4 bps 
B D                     Human  g-agg--
B D                     Chimp  g-agg--
B D                   Gorilla  g-agg--
B D                    Gibbon  g-agg--
B D                    Rhesus  g-agg--
B D       Crab-eating macaque  g-agg--
B D                    Baboon  g-agg--
B D              Green monkey  g-agg--
B D                  Marmoset  g-agg--
B D           Squirrel monkey  g-agg--
B D                  Bushbaby  a-agg--
           Chinese tree shrew  a------
B D                  Squirrel  g-aga--
       Lesser Egyptian jerboa  g-aga--
                 Prairie vole  g-aga--
B D           Chinese hamster  g-agc--
               Golden hamster  g-agc--
B D                     Mouse  g-aga--
B D                       Rat  g-aga--
B D            Naked mole-rat  g-aga--
B D                Guinea pig  g-aga--
                   Chinchilla  --aga--
             Brush-tailed rat  a-aga--
B D                    Rabbit  g-agg--
B D                      Pika  g-agg--
B D                       Pig  g-aaa--
B D                    Alpaca  g-aaa--
               Bactrian camel  g-aaa--
B D                   Dolphin  a-aaa--
                 Killer whale  a-aaa--
             Tibetan antelope  g-aaa--
B D                       Cow  g-aaa--
B D                     Sheep  g-aaa--
                Domestic goat  g-aaa--
B D                     Horse  g-agg--
B D          White rhinoceros  g-agg--
B D                       Cat  g-agg--
B D                       Dog  g-agg--
B D                   Ferret   g-aag--
B D                     Panda  g-a-g--
               Pacific walrus  g-agg--
                 Weddell seal  g-agg--
             Black flying-fox  g-agc--
B D                   Megabat  g-agg--
                Big brown bat  g-aga--
         David's myotis (bat)  gaaga--
B D                  Microbat  g-aga--
B D                  Hedgehog  g-a-a--
B D                     Shrew  g-aga--
              Star-nosed mole  g-agg--
B D                  Elephant  g-agg--
          Cape elephant shrew  a-gag--
B D                   Manatee  g-agg--
             Cape golden mole  g-agg--
                     Aardvark  g-agg--
B D                 Armadillo  g-aga--
  D       Collared flycatcher  -cagg--
B D                Budgerigar  -ggga--
B D                   Chicken  -cagg--
B D             X. tropicalis  g-ag---
B D                 Zebrafish  ---ggtg
  D    Spiny softshell turtle  =======
                 Spotted gar  =======
B D                    Turkey  =======
          Tibetan ground jay  =======
B D               Zebra finch  =======
  D    White-throated sparrow  =======
B D           Tasmanian devil  =======
  D            Painted turtle  =======
B D        American alligator  =======
B D                   Opossum  =======
  D               Rock pigeon  =======
B D       Medium ground finch  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
B D                   Wallaby  =======
B D                  Platypus  =======
B D                    Tenrec  -------
  D  Chinese softshell turtle  =======
B D                 Orangutan  NNNNNNN

Inserts between block 11 and 12 in window
B D                      Dog 1bp
  D      Collared flycatcher 3bp
B D               Budgerigar 910bp

Alignment block 12 of 523 in window, 34621606 - 34621611, 6 bps 
B D                     Human  gg----gt-ag
B D                     Chimp  gg----gt-ag
B D                   Gorilla  gg----gt-ag
B D                    Gibbon  gg----gt-ag
B D                    Rhesus  gg----gt-ag
B D       Crab-eating macaque  gg----gt-ag
B D                    Baboon  gg----gt-ag
B D              Green monkey  gg----gt-ag
B D                  Marmoset  ga----gt-ag
B D           Squirrel monkey  gg----gt-ag
B D                  Bushbaby  gg----gt-aa
           Chinese tree shrew  gg----at-gg
B D                  Squirrel  gg----gt-gg
       Lesser Egyptian jerboa  gg----gt-gg
                 Prairie vole  gg----gt-gg
B D           Chinese hamster  gg----gt-gg
               Golden hamster  gggggagg-gg
B D                     Mouse  at----gt-gg
B D                       Rat  ct----gt-gg
B D            Naked mole-rat  gg----gt-gg
B D                Guinea pig  gg----gt-gg
                   Chinchilla  gg----gt-gg
             Brush-tailed rat  gg----gtggg
B D                    Rabbit  aa----gt-gg
B D                      Pika  gg----at-gg
B D                       Pig  ag----at-ga
B D                    Alpaca  at----gt-ga
               Bactrian camel  at----gt-ga
B D                   Dolphin  ag----gc-ga
                 Killer whale  ag----gc-ga
             Tibetan antelope  ag----gt-aa
B D                       Cow  ag----gt-aa
B D                     Sheep  ag----gt-aa
                Domestic goat  ag----gt-aa
B D                     Horse  gg----gttag
B D          White rhinoceros  gg----gttgg
B D                       Cat  ag----gt--a
B D                       Dog  gg----gt--a
B D                   Ferret   gg----gt--g
B D                     Panda  gg----gt--g
               Pacific walrus  gg----gt--a
                 Weddell seal  gg----gt--a
             Black flying-fox  gg----gt-ag
B D                   Megabat  gg----gt-ag
                Big brown bat  gg----ga-at
         David's myotis (bat)  gg----gg-at
B D                  Microbat  gg----gg-at
B D                  Hedgehog  gc----at-gg
B D                     Shrew  gg----gt-gg
              Star-nosed mole  ag----gt-gg
B D                  Elephant  gg----gt-ga
          Cape elephant shrew  ga----gt-ga
B D                   Manatee  ga----gt-ga
             Cape golden mole  gg----gt-ga
                     Aardvark  gg----gt-ga
B D                 Armadillo  ag----gt-gg
  D       Collared flycatcher  gg----gc-aa
B D                   Chicken  gg----gc-ag
B D             X. tropicalis  ag----ac-ag
B D                 Zebrafish  ga----ga-ag
  D    Spiny softshell turtle  ===========
                 Spotted gar  ===========
B D                    Turkey  ===========
          Tibetan ground jay  ===========
B D               Zebra finch  ===========
  D    White-throated sparrow  ===========
B D           Tasmanian devil  ===========
  D            Painted turtle  ===========
B D        American alligator  ===========
B D                Budgerigar  ===========
B D                   Opossum  ===========
  D               Rock pigeon  ===========
B D       Medium ground finch  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
B D                   Wallaby  ===========
B D                  Platypus  ===========
B D                    Tenrec  -----------
  D  Chinese softshell turtle  ===========
B D                 Orangutan  NNNNNNNNNNN

Inserts between block 12 and 13 in window
B D                  Chicken 671bp

Alignment block 13 of 523 in window, 34621612 - 34621612, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                      Pika  a
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  g
B D                     Shrew  g
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  g
                     Aardvark  g
B D                 Armadillo  g
  D       Collared flycatcher  g
B D             X. tropicalis  g
B D                 Zebrafish  g
  D    Spiny softshell turtle  =
                 Spotted gar  =
B D                    Turkey  =
B D                   Chicken  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                   Wallaby  =
B D                  Platypus  =
B D                    Tenrec  -
  D  Chinese softshell turtle  =
B D                 Orangutan  N

Inserts between block 13 and 14 in window
  D      Collared flycatcher 809bp

Alignment block 14 of 523 in window, 34621613 - 34621641, 29 bps 
B D                     Human  gtatggaaacagaagaggg--g--aac--aa-aagt
B D                     Chimp  gtatggaaacagaagaggg--g--aac--aa-aagt
B D                   Gorilla  gtatggaaacagaagaggg--g--aac--aa-aagt
B D                    Gibbon  gtatggaaacagaagaggg--g--aac--aa-aagt
B D                    Rhesus  atatggaaacagaagaggg--g--aac--aa-aagt
B D       Crab-eating macaque  atatggaaacagaagaggg--g--aac--aa-aagt
B D                    Baboon  atatggaaacagaagaggg--g--aac--aa-aagt
B D              Green monkey  atatggaaacagaagaggg--g--aac--aa-aagt
B D                  Marmoset  gtgtggaaacagaagaggg--g--aac--ag-aagt
B D           Squirrel monkey  atatggaaacagaagagga--a--aac--ag-aagt
B D                  Bushbaby  ggatggaaacagaagaggg--g--aac--aa-aagt
           Chinese tree shrew  gcatggaaacagaagaaag--g--aac--aa-aagt
B D                  Squirrel  acacag-aaacagaaggaa--a--aaa--aa---gt
       Lesser Egyptian jerboa  tacaaa-agaagagaacaa--g--agt--aa-----
                 Prairie vole  acccaa-aaccaaaaag-------------------
B D           Chinese hamster  acccaa-aacaaaaaaggt--g--ggc--aa-----
               Golden hamster  acccaa-aacagaaaaggt--g--agc--ac-----
B D                     Mouse  actc--------------------------------
B D                       Rat  actc--------------------------------
B D            Naked mole-rat  gcacag-aacagaaaaagg--g--aaa--aaaatgt
B D                Guinea pig  acac------agaaaaagg--g--aaa--aaaatgt
                   Chinchilla  gcacag-aagagaagaagg--g--aaa--aaaatgt
             Brush-tailed rat  gaacag-aacagaagaagg--gaaaaa--aaaatgt
B D                    Rabbit  gcacagaaacagaaaaggg--g--aga--aa--agt
B D                      Pika  gcacagaaacagaagagag--g--aac--ag-----
B D                       Pig  gcaaaggaacagaagagag--a--agc--aa-aagt
B D                    Alpaca  tcaaagaagcagaagaggg--a--aac--aa-aagt
               Bactrian camel  gcaaagaaacagaagaggg--a--aac--aa-aagt
B D                   Dolphin  gcaaagaaacagaagaggg-ga--aaa--aa-aagt
                 Killer whale  gcaaagaaacagaagagggaaa--aaa--aa-aagt
             Tibetan antelope  gcaaagaaatagaagaggg--a--aac--aa-aagt
B D                       Cow  gcaaagaaatagaagaggg--a--aac--aa-aagt
B D                     Sheep  gcaaagaaatagaagaggg--a--aac--aa-aagt
                Domestic goat  gcaaagaaatagaagaagg--a--aac--aa-aagt
B D                     Horse  gcacagaaacagaagaggg--a--aac--aa-aagt
B D          White rhinoceros  gtatggaaacagaagaggg--a--aac--aa-aagt
B D                       Cat  gcacagaaacagaagagga--a--aac--aa-aagt
B D                       Dog  gcacagaaacaaaagagga--a--aac--aa-aagt
B D                   Ferret   gcacagaaacagaagagga--a--aac--aa-aagt
B D                     Panda  gcacagaaacagaagagga--a--aac--aa-aagt
               Pacific walrus  gcacagaaacagaagagga--a--aac--aa-aagt
                 Weddell seal  gcacagaaacagaagggga--a--aac--aa-aagt
             Black flying-fox  gtacagaaacagaagaagg--a--aac--aa-aagt
B D                   Megabat  gtacagaaacagaagaagg--a--aac--aa-aagt
                Big brown bat  acagggaaacagaagaagg--a--aac--aa-aagt
         David's myotis (bat)  acagggaaacacaagaagg--a--aac--ag-aagt
B D                  Microbat  acagggaaacagaagaagg--a--aac--ag-aagt
B D                  Hedgehog  acatggaaacagaagagga--a--aaa--ca-aagt
B D                     Shrew  ccatggaaacagaa----g--a--aac--aa-aagt
              Star-nosed mole  -catggaaacagaagaagg--a--aac--aa-aagt
B D                  Elephant  gcatgaaaacagaagagga--g--aac--aa-aagt
          Cape elephant shrew  gtatgaaaacagaa---gg--g--aac--aa-aagt
B D                   Manatee  gca-gaaaacagaagaggg--a--aac--aa-aagt
             Cape golden mole  gtgtgaaaacagaagaggg--g--aacaaaa-aagt
B D                    Tenrec  gcatggaaacagaagaggg--g--gac--aa-gagt
                     Aardvark  gcatgaaaacagaagaggg--g--aac--aa-aagt
B D                 Armadillo  gcacagaaacagaa--ggg--g--aac--aa-aagt
B D             X. tropicalis  ctgcagaagcagcagaaag--a--aaa--gc-----
B D                 Zebrafish  -ggtaggaagaggaagttg--a--ata--ga-aag-
  D    Spiny softshell turtle  ====================================
                 Spotted gar  ====================================
B D                    Turkey  ====================================
B D                   Chicken  ====================================
          Tibetan ground jay  ====================================
B D               Zebra finch  ====================================
  D    White-throated sparrow  ====================================
B D           Tasmanian devil  ====================================
  D            Painted turtle  ====================================
B D        American alligator  ====================================
B D                Budgerigar  ====================================
B D                   Opossum  ====================================
  D               Rock pigeon  ====================================
B D       Medium ground finch  ====================================
  D          Peregrine falcon  ====================================
  D              Saker falcon  ====================================
B D                   Wallaby  ====================================
B D                  Platypus  ====================================
  D  Chinese softshell turtle  ====================================
B D                 Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D       Collared flycatcher  ====================================

Inserts between block 14 and 15 in window
B D            X. tropicalis 1bp

Alignment block 15 of 523 in window, 34621642 - 34621648, 7 bps 
B D                     Human  aagtgtt
B D                     Chimp  aagtgtt
B D                   Gorilla  aagtgtt
B D                    Gibbon  aagtgtt
B D                    Rhesus  aagtgtt
B D       Crab-eating macaque  aagtgtt
B D                    Baboon  aagtgtt
B D              Green monkey  aagtgtt
B D                  Marmoset  aagtgtt
B D           Squirrel monkey  aagtgtt
B D                  Bushbaby  aagtgtc
           Chinese tree shrew  cagtgtt
B D                  Squirrel  aagtgtc
       Lesser Egyptian jerboa  --gcgtc
                 Prairie vole  --gtgtc
B D           Chinese hamster  aagtgtg
               Golden hamster  aggtgtc
B D            Naked mole-rat  aagtgtt
B D                Guinea pig  aagtgtt
                   Chinchilla  aagcgtg
             Brush-tailed rat  aagtatc
B D                    Rabbit  aagtgcc
B D                      Pika  aagtg-c
B D                       Pig  cagcgtc
B D                    Alpaca  cagtttc
               Bactrian camel  cagtttc
B D                   Dolphin  tagtgtc
                 Killer whale  cagtgtc
             Tibetan antelope  cagtgtc
B D                       Cow  cagtgtc
B D                     Sheep  cagtgtc
                Domestic goat  cagtgtc
B D                     Horse  cagtgtc
B D          White rhinoceros  cagtgtt
B D                       Cat  cagtgtc
B D                       Dog  caatgct
B D                   Ferret   caatgtc
B D                     Panda  cagtgtc
               Pacific walrus  cagtgtc
                 Weddell seal  cagtgtc
             Black flying-fox  cagtgtc
B D                   Megabat  cagtgtc
                Big brown bat  tagtgac
         David's myotis (bat)  tagtgac
B D                  Microbat  tagtgac
B D                  Hedgehog  cagtatt
B D                     Shrew  cagtctc
              Star-nosed mole  cagtgtt
B D                  Elephant  aa-----
          Cape elephant shrew  aa-----
B D                   Manatee  aa-----
             Cape golden mole  aa-----
B D                    Tenrec  ga-----
                     Aardvark  aa-----
B D                 Armadillo  aagtgtc
B D           Tasmanian devil  atttctt
B D             X. tropicalis  gagagac
B D                 Zebrafish  aagtggt
B D                       Rat  -------
B D                     Mouse  -------
  D    Spiny softshell turtle  =======
                 Spotted gar  =======
B D                    Turkey  =======
B D                   Chicken  =======
          Tibetan ground jay  =======
B D               Zebra finch  =======
  D    White-throated sparrow  =======
  D            Painted turtle  =======
B D        American alligator  =======
B D                Budgerigar  =======
B D                   Opossum  =======
  D               Rock pigeon  =======
B D       Medium ground finch  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
B D                   Wallaby  =======
B D                  Platypus  =======
  D  Chinese softshell turtle  =======
B D                 Orangutan  NNNNNNN
  D       Collared flycatcher  =======

Alignment block 16 of 523 in window, 34621649 - 34621663, 15 bps 
B D                     Human  ctgg-----------------------ttgctagaac---a
B D                     Chimp  ctgg-----------------------ttgctagaac---a
B D                   Gorilla  ctgg-----------------------ttgctagaaa---a
B D                    Gibbon  ctgg-----------------------ttgctagaac---a
B D                    Rhesus  ctgg-----------------------ttgctagaac---a
B D       Crab-eating macaque  ctgg-----------------------ttgctagaac---a
B D                    Baboon  ctgg-----------------------ttgctagaac---a
B D              Green monkey  ctgg-----------------------ttgctagaac---a
B D                  Marmoset  ctgg-----------------------ttactcgaacacta
B D           Squirrel monkey  ctgg-----------------------ttgctagaacacta
B D                  Bushbaby  ttga-----------------------ttgc-agaac---a
           Chinese tree shrew  ctga-----------------------ttgctagaat---a
B D                  Squirrel  ctga-----------------------ttgctagagt---a
       Lesser Egyptian jerboa  ctga-----------------------ttgttagaaa---a
                 Prairie vole  tgga-----------------------ttcttagaga---a
B D           Chinese hamster  tgga-----------------------ttcttagaga---a
               Golden hamster  tgga-----------------------ttcttaagag---a
B D            Naked mole-rat  ctga-----------------------ttgccagaac---a
B D                Guinea pig  ccga-----------------------tcactaaaac---a
                   Chinchilla  ctga-----------------------ctgctagaac---a
             Brush-tailed rat  ctgg-----------------------ttgctagaat---a
B D                    Rabbit  ctga-----------------------ttgctagaac---c
B D                      Pika  ctga-----------------------tggttagaac---c
B D                       Pig  ctga-----------------------ttgctagaag---a
B D                    Alpaca  ctta-----------------------ttgctagaac---a
               Bactrian camel  ctta-----------------------ttgctagaac---a
B D                   Dolphin  ctga-----------------------ttgctagaac---a
                 Killer whale  ctga-----------------------ttgctagaac---a
             Tibetan antelope  ctga-----------------------ttactagaat---a
B D                       Cow  ctga-----------------------ttgctagaat---a
B D                     Sheep  ctga-----------------------ttgctagaat---a
                Domestic goat  ctga-----------------------ttgctagaat---a
B D                     Horse  ctga-----------------------tcactaga------
B D          White rhinoceros  ctga-----------------------ctgctagaat---a
B D                       Cat  ctga-----------------------ttgttacaac---a
B D                       Dog  ctga-----------------------ttgttagaac---a
B D                   Ferret   ctga-----------------------ttgttagaac---a
B D                     Panda  ctga-----------------------ttgttagaac---a
               Pacific walrus  ctga-----------------------ttgttagaac---a
                 Weddell seal  ctga-----------------------ttgttagaac---a
             Black flying-fox  ctga-----------------------tggctagaac---a
B D                   Megabat  ctga-----------------------tggctagaac---a
                Big brown bat  ctga-----------------------ttgct---ac---a
         David's myotis (bat)  ctga-----------------------ttgctagaac---a
B D                  Microbat  ctga-----------------------ttgctagaac---a
B D                  Hedgehog  agtg--------------------------ctagaat---a
B D                     Shrew  tgatgctcaagaacatatactgtaaccccacatgcat---a
              Star-nosed mole  tgtt-------------------------------------
B D                  Elephant  --ga-----------------------ttgctagaat---a
          Cape elephant shrew  --ga-----------------------tttctagaag---a
B D                   Manatee  --ga-----------------------ctgctagaac---a
             Cape golden mole  --ta-----------------------ttgctaca------
B D                    Tenrec  --ga-----------------------ttggtaga------
                     Aardvark  --ga-----------------------ctgctataac---a
B D                 Armadillo  ccga-----------------------ttcctagaac---a
B D           Tasmanian devil  ccat-----------------------ttcctagtac---a
B D             X. tropicalis  atg------------------------ctgcaggagc---a
B D                       Rat  -----------------------------------------
B D                     Mouse  -----------------------------------------
  D    Spiny softshell turtle  =========================================
                 Spotted gar  =========================================
B D                    Turkey  =========================================
B D                   Chicken  =========================================
          Tibetan ground jay  =========================================
B D               Zebra finch  =========================================
  D    White-throated sparrow  =========================================
  D            Painted turtle  =========================================
B D        American alligator  =========================================
B D                Budgerigar  =========================================
B D                   Opossum  =========================================
  D               Rock pigeon  =========================================
B D       Medium ground finch  =========================================
  D          Peregrine falcon  =========================================
  D              Saker falcon  =========================================
B D                   Wallaby  =========================================
B D                  Platypus  =========================================
  D  Chinese softshell turtle  =========================================
B D                 Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D       Collared flycatcher  =========================================

Alignment block 17 of 523 in window, 34621664 - 34621665, 2 bps 
B D                     Human  ct
B D                     Chimp  ct
B D                   Gorilla  ct
B D                    Gibbon  ct
B D                    Rhesus  ct
B D       Crab-eating macaque  ct
B D                    Baboon  ct
B D              Green monkey  ct
B D                  Marmoset  ct
B D           Squirrel monkey  ct
B D                  Bushbaby  cc
           Chinese tree shrew  ct
B D                  Squirrel  cc
       Lesser Egyptian jerboa  cc
                 Prairie vole  c-
B D           Chinese hamster  c-
               Golden hamster  c-
B D            Naked mole-rat  cc
B D                Guinea pig  cc
                   Chinchilla  cc
             Brush-tailed rat  cc
B D                    Rabbit  cc
B D                      Pika  cc
B D                       Pig  cc
B D                    Alpaca  cc
               Bactrian camel  cc
B D                   Dolphin  cc
                 Killer whale  cc
             Tibetan antelope  tc
B D                       Cow  tc
B D                     Sheep  tc
                Domestic goat  tc
B D          White rhinoceros  cc
B D                       Cat  cc
B D                       Dog  cc
B D                   Ferret   cc
B D                     Panda  cc
               Pacific walrus  cc
                 Weddell seal  cc
             Black flying-fox  ct
B D                   Megabat  ct
                Big brown bat  cc
         David's myotis (bat)  cc
B D                  Microbat  cc
B D                  Hedgehog  ta
B D                     Shrew  ca
B D                  Elephant  cc
          Cape elephant shrew  ct
B D                   Manatee  cc
                     Aardvark  cc
B D                 Armadillo  cc
B D           Tasmanian devil  ga
B D                       Rat  --
B D                     Mouse  --
  D    Spiny softshell turtle  ==
            Cape golden mole  --
                 Spotted gar  ==
B D                    Turkey  ==
B D                   Chicken  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D             X. tropicalis  ==
  D            Painted turtle  ==
B D        American alligator  ==
B D                Budgerigar  ==
B D                   Opossum  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D                   Wallaby  ==
B D                  Platypus  ==
B D                    Tenrec  --
  D  Chinese softshell turtle  ==
B D                 Orangutan  NN
  D       Collared flycatcher  ==
             Star-nosed mole  --
B D                     Horse  --

Alignment block 18 of 523 in window, 34621666 - 34621677, 12 bps 
B D                     Human  acacacgt----ac-cc
B D                     Chimp  acacacgt----ac-cc
B D                   Gorilla  acacacgt----ac-cc
B D                    Gibbon  acacacgt----ac-cc
B D                    Rhesus  acacacgt----ac-cc
B D       Crab-eating macaque  acacacgt----ac-cc
B D                    Baboon  acacacgt----ac-cc
B D              Green monkey  acacacgt----ac-cc
B D                  Marmoset  acacacgt----ac-cc
B D           Squirrel monkey  acacacgt----ac-cc
B D                  Bushbaby  acacacat----ct-gt
           Chinese tree shrew  acacacac----acacc
B D                  Squirrel  acacacat----ac-cc
       Lesser Egyptian jerboa  acaacccg----cc-cc
                 Prairie vole  -cacatca----tc-cc
B D           Chinese hamster  acacacc-----tc-cc
B D            Naked mole-rat  acacacacacacac-cc
B D                Guinea pig  acgcacac----ac-cc
                   Chinchilla  acacac------gc-cc
             Brush-tailed rat  acacacac--atac-cc
B D                    Rabbit  acacatat----ac-cc
B D                      Pika  acacatgt----ac-tc
B D                       Pig  acacacac----ag-tc
B D                    Alpaca  acacacat----ag-tc
               Bactrian camel  acacacat----ag-tc
B D                   Dolphin  acacacag----ag-cc
                 Killer whale  acacacag----ag-cc
             Tibetan antelope  acacacag----ag-cc
B D                       Cow  acacacag----ag-cc
B D                     Sheep  acacacag----ag-cc
                Domestic goat  tcacacag----ag-cc
B D                     Horse  ----acat----ac-cc
B D          White rhinoceros  acacacgt----ac-cc
B D                       Cat  acacacat----at-cc
B D                       Dog  cctcacat----at-cc
B D                   Ferret   acacacat----at-cc
B D                     Panda  acacacat----at-cc
               Pacific walrus  gcacacat----at-cc
                 Weddell seal  acacacat----at-cc
             Black flying-fox  acacacat----ac-cc
B D                   Megabat  acacacat----ac-cc
                Big brown bat  acacacat----ac-ct
         David's myotis (bat)  acacacat----ac-ct
B D                  Microbat  acacacat----ac-ct
B D                  Hedgehog  acacacat----gc-cc
B D                     Shrew  acacata---------c
B D                  Elephant  acacacat----ac-tc
          Cape elephant shrew  acacacat----ac-cc
B D                   Manatee  acacacat----ac-tc
             Cape golden mole  --acacacata-ac-tc
B D                    Tenrec  --acacat----gc-cc
                     Aardvark  acacacat----ac-cc
B D                 Armadillo  acacacct----ac-cc
B D           Tasmanian devil  ctccccat----cc-ct
B D             X. tropicalis  acacatta----ac-cc
              Golden hamster  -----------------
B D                       Rat  -----------------
B D                     Mouse  -----------------
  D    Spiny softshell turtle  =================
                 Spotted gar  =================
B D                    Turkey  =================
B D                   Chicken  =================
          Tibetan ground jay  =================
B D               Zebra finch  =================
  D    White-throated sparrow  =================
  D            Painted turtle  =================
B D        American alligator  =================
B D                Budgerigar  =================
B D                   Opossum  =================
  D               Rock pigeon  =================
B D       Medium ground finch  =================
  D          Peregrine falcon  =================
  D              Saker falcon  =================
B D                   Wallaby  =================
B D                  Platypus  =================
  D  Chinese softshell turtle  =================
B D                 Orangutan  NNNNNNNNNNNNNNNNN
  D       Collared flycatcher  =================
             Star-nosed mole  -----------------

Inserts between block 18 and 19 in window
B D          Tasmanian devil 14bp
B D            X. tropicalis 4bp

Alignment block 19 of 523 in window, 34621678 - 34621679, 2 bps 
B D                     Human  ct
B D                     Chimp  ct
B D                   Gorilla  ct
B D                    Gibbon  ct
B D                    Rhesus  ct
B D       Crab-eating macaque  ct
B D                    Baboon  ct
B D              Green monkey  ct
B D                  Marmoset  ct
B D           Squirrel monkey  ct
B D                  Bushbaby  ct
           Chinese tree shrew  ct
B D                  Squirrel  tt
       Lesser Egyptian jerboa  tt
                 Prairie vole  tt
B D           Chinese hamster  ag
B D            Naked mole-rat  tt
B D                Guinea pig  gt
                   Chinchilla  tt
             Brush-tailed rat  tt
B D                    Rabbit  ct
B D                      Pika  ct
B D                       Pig  ct
B D                    Alpaca  ct
               Bactrian camel  ct
B D                   Dolphin  ct
                 Killer whale  ct
             Tibetan antelope  ct
B D                       Cow  ct
B D                     Sheep  ct
                Domestic goat  ct
B D                     Horse  ct
B D          White rhinoceros  ct
B D                       Cat  ct
B D                       Dog  ct
B D                   Ferret   ct
B D                     Panda  ct
               Pacific walrus  ct
                 Weddell seal  ct
             Black flying-fox  ct
B D                   Megabat  ct
                Big brown bat  ct
         David's myotis (bat)  ct
B D                  Microbat  ct
B D                  Hedgehog  ct
B D                     Shrew  tg
B D                  Elephant  ct
          Cape elephant shrew  ct
B D                   Manatee  ct
             Cape golden mole  ct
B D                    Tenrec  ct
                     Aardvark  tt
B D                 Armadillo  ct
B D                   Opossum  cc
B D           Tasmanian devil  ac
B D             X. tropicalis  ct
              Golden hamster  --
B D                       Rat  --
B D                     Mouse  --
  D    Spiny softshell turtle  ==
                 Spotted gar  ==
B D                    Turkey  ==
B D                   Chicken  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
  D            Painted turtle  ==
B D        American alligator  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
B D       Medium ground finch  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D                   Wallaby  ==
B D                  Platypus  ==
  D  Chinese softshell turtle  ==
B D                 Orangutan  NN
  D       Collared flycatcher  ==
             Star-nosed mole  --

Alignment block 20 of 523 in window, 34621680 - 34621720, 41 bps 
B D                     Human  gccacaaaccaa------------tg--agga----------------------------caa-------
B D                     Chimp  gccacaaaccaa------------tg--agga----------------------------caa-------
B D                   Gorilla  gccacaaaccaa------------tg--agga----------------------------caa-------
B D                    Gibbon  gccacaaacaaa------------tg--agga----------------------------caa-------
B D                    Rhesus  gccacaaaccaa------------tg--agga----------------------------caa-------
B D       Crab-eating macaque  gccacaaaccaa------------tg--agga----------------------------caa-------
B D                    Baboon  gccacaaaccaa------------tg--agga----------------------------caa-------
B D              Green monkey  gccacaaaccaa------------tg--agga----------------------------caa-------
B D                  Marmoset  gccacaaaccat------------tg--agga----------------------------caa-------
B D           Squirrel monkey  gtcacaaaccaa------------tg--agga----------------------------caa-------
B D                  Bushbaby  gccacaaaccaa----------------------------------------------------------
           Chinese tree shrew  atcataaaccaa------------tg--agaa----------------------------caa-------
B D                  Squirrel  gtcaca-accaa------------tg--agga----------------------------caa-------
       Lesser Egyptian jerboa  gccaca-accaa------------tg--atga----------------------------tga-------
                 Prairie vole  gccacacactac------------cg--agga----------------------------caa-------
B D           Chinese hamster  gccacacactac------------tg--ttga----------------------------caa-------
               Golden hamster  -ccacacaccac------------tg--atga----------------------------caa-------
B D                     Mouse  -ccacaaagcac-----------------gga----------------------------caa-------
B D                       Rat  -ccacgaaccac------------ta--atga----------------------------caa-------
B D            Naked mole-rat  gccacaaaccaa------------ta--agaa----------------------------gaa-------
B D                Guinea pig  gccac---ccagcctccatggttgta--agga----------------------------gaa-------
                   Chinchilla  gccac---ccagcctccttggttgt---agaa----------------------------gaa-------
             Brush-tailed rat  gccac---ccaacctcctttattgta--agga----------------------------gaa-------
B D                    Rabbit  gccacagaccaa------------cg--agaa----------------------------caa-------
B D                      Pika  gctacacaccag------------tg--agga----------------------------caa-------
B D                       Pig  gccac-aaccac------------tg--agca----------------------------caa-------
B D                    Alpaca  gccac-aatcaa------------ca--agga----------------------------caa-------
               Bactrian camel  gccac-aatcaa------------ca--agga----------------------------caa-------
B D                   Dolphin  gccgt-aaccaa------------tg--acga----------------------------aaa-------
                 Killer whale  gccgt-aaccaa------------tg--atga----------------------------aaa-------
             Tibetan antelope  gtcac-aaccaa------------cg--agga----------------------------caa-------
B D                       Cow  gtcac-aaccaa------------cg--agca----------------------------caa-------
B D                     Sheep  gtcac-aaccaa------------cg--agga----------------------------caa-------
                Domestic goat  gtcac-aaccaa------------cg--agga----------------------------caa-------
B D                     Horse  gccacaaaccag------------tg--agga----------------------------caa-------
B D          White rhinoceros  gccacaaaccaa------------tg--agga----------------------------caa-------
B D                       Cat  gccacaaaccaa------------tg--tgga----------------------------caa-------
B D                       Dog  gccacaaaccaa------------tg--agga----------------------------caa-------
B D                   Ferret   gccacaaaccaa------------tg--agga----------------------------caa-------
B D                     Panda  gccacaaatcaa------------tg--agga----------------------------caa-------
               Pacific walrus  gtcacaaaccaa------------tg--agga----------------------------caa-------
                 Weddell seal  gtcacaaaccaa------------tg--agga----------------------------caa-------
             Black flying-fox  aacacgaaccca------------tg--agga----------------------------aaa-------
B D                   Megabat  aacacgaaccca------------tg--agga----------------------------aaa-------
                Big brown bat  gccacaaaccaa------------tg--agga----------------------------caa-------
         David's myotis (bat)  gccacaaaccaa------------tg--agga----------------------------caa-------
B D                  Microbat  gccacaaaccaa------------tg--agga----------------------------caa-------
B D                  Hedgehog  gccacaaaccaa------------tg--agtg----------------------------tga-------
B D                     Shrew  acaacacaccag------------ta--aggg----------------------------caa-------
              Star-nosed mole  ---acaaaccag------------tc--agga----------------------------aaa-------
B D                  Elephant  gacacaaaccaa------------tt--agga----------------------------caa-------
          Cape elephant shrew  gccacagaccaa------------tt--agga----------------------------tac-------
B D                   Manatee  aacacaaaccaa------------tt--agga----------------------------aa--------
             Cape golden mole  gccataa---aa------------tt--agga----------------------------caa-------
B D                    Tenrec  gccacaaaccag------------tt--agga----------------------------caa-------
                     Aardvark  tccacaaaccaa------------tt--tgga----------------------------caa-------
B D                 Armadillo  gccacaaaccag------------ag--agga----------------------------caa-------
B D                   Opossum  ccctaaaaacaa------------ta--ggccactg------------------------tta-------
B D           Tasmanian devil  acgaagaaacat------------ta--aaacaatgtaggctatccctccagggataacttca-------
B D             X. tropicalis  gccagggatcag------------ct--aggg----------------------------agaatgaatc
B D                    Medaka  gtcagaacccaa------------ggacagaa----------------------------ctg-------
  D    Spiny softshell turtle  ======================================================================
                 Spotted gar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D            Painted turtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Platypus  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                 Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D       Collared flycatcher  ======================================================================

                        Human  ------g----ctccttgggtc-----ag--------taagag----
                        Chimp  ------g----ctccttgggtc-----ag--------taagag----
                      Gorilla  ------g----ctccttgggtc-----ag--------taagag----
                       Gibbon  ------g----ctccttgggtc-----ag--------taagcg----
                       Rhesus  ------g----ctccttgggtc-----ag--------taacag----
          Crab-eating macaque  ------g----ctccttgggtc-----ag--------taagag----
                       Baboon  ------g----ctccttgggtc-----ag--------taagag----
                 Green monkey  ------g----ctccttgggtc-----ag--------taagag----
                     Marmoset  ------g----ttccttgggtc-----ag--------tgaaag----
              Squirrel monkey  ------g----ttccttgggtc-----ag--------tgaaag----
                     Bushbaby  --------------------tc-----ag--------tgagag----
           Chinese tree shrew  ------g----c-ccctggact-----gg--------tgagta----
                     Squirrel  ------g----tccctttggtc-----gg--------tgagaa----
       Lesser Egyptian jerboa  ------g----cccctctgatt-----ag--------ggagaa----
                 Prairie vole  ------g----tccctccggcc-----ag--------tgagaa----
              Chinese hamster  ------g----tccctctggtc-----ag--------tgggaa----
               Golden hamster  ------g----tccctctggtc-----ag--------tgagaa----
                        Mouse  ------g----tccctctgacc-----ag--------tgagaa----
                          Rat  ------gtccctccctctggtc-----cg--------tgggaa----
               Naked mole-rat  ------g----cccctcaggcc-----ag--------tgagag----
                   Guinea pig  ------g----gccctcaggtc-----aa--------tgagag----
                   Chinchilla  ------g----acccttaggcc-----ag--------tgagag----
             Brush-tailed rat  ------g----acccttaggtt-----ag--------tgagag----
                       Rabbit  ------g----ccccttggcac-----a-------------ag----
                         Pika  ------g----ccccgtggcac-----a-------------ag----
                          Pig  ------g----ccccttgggta-----ag--------ctaaag----
                       Alpaca  ------g----cccct-gagtc-----ag--------tcagag----
               Bactrian camel  ------g----cccct-gagac-----ag--------tcagag----
                      Dolphin  ------g----cccctcgagtc-----ag--------ttagag----
                 Killer whale  ------g----ccccttgagtc-----ag--------ttagag----
             Tibetan antelope  ------g----tcccttgagtc-----ag--------ttaaag----
                          Cow  ------g----tcccttgaatc-----ag--------ttagag----
                        Sheep  ------g----tcccttgagtc-----ag--------ttaaag----
                Domestic goat  ------g----tcccttgagtc-----ag--------ttaaag----
                        Horse  ------g----ccccttggcttgttagag--------ttagag----
             White rhinoceros  ------g----ccccttgggtc-----ag--------ttagag----
                          Cat  ------g----ctccttaggtc-----ag--------ttagag----
                          Dog  ------g----ccccttaggtc-----ag---------tggag----
                      Ferret   ------a----ccccttaggtc-----aa---------tggag----
                        Panda  ------a----tcccttaggtc-----ag---------tggag----
               Pacific walrus  ------a----ccccttaggtc-----ag---------tggag----
                 Weddell seal  ------a----ccccttaggtc-----ag---------tggag----
             Black flying-fox  ------t----tcccttgggtc-----aa--------ttagac----
                      Megabat  ------t----tcccttgggtc-----ag--------ttagac----
                Big brown bat  ------a----ccccttgggtc-----ag--------tcagag----
         David's myotis (bat)  ------a----ccccttgggtc-----ag--------tcagag----
                     Microbat  ------a----ccccttgggtc-----ag--------tcagag----
                     Hedgehog  ------g----ccctttggatc-----ag--------cg--------
                        Shrew  ------g----gccctggggct-----ag--------tgagat----
              Star-nosed mole  ------g----ccccttgcatt-----ag--------ttaaga----
                     Elephant  ------g----ctccttgtgtc-----ac--------tgagag----
          Cape elephant shrew  -----tt----ttccttgtgtc-----ag--------tgagaa----
                      Manatee  ------g----ctccttgtgtc-----ag--------tgagag----
             Cape golden mole  ------g----ttctttgtgt--------------------------
                       Tenrec  ------g----ctccttgggtc-----tg--------tgggag----
                     Aardvark  ------g----ctcattgtgtc-----ag--------taagag----
                    Armadillo  ------g----ccccttgtgtc-----ag--------tgagag----
                      Opossum  ------g----ctcgtggtgcc-----ag--------tgttat----
              Tasmanian devil  ------g----ctcctgatgcc-----ag--------tgttag----
                X. tropicalis  cctatcg----cgcttggaatc-----ag--------tacagt----
                       Medaka  ------g----ctccagcagcc-----aggtctggggtggggggggc
       Spiny softshell turtle  ===============================================
                  Spotted gar  ===============================================
                       Turkey  ===============================================
                      Chicken  ===============================================
           Tibetan ground jay  ===============================================
                  Zebra finch  ===============================================
       White-throated sparrow  ===============================================
               Painted turtle  ===============================================
           American alligator  ===============================================
                   Budgerigar  ===============================================
                  Rock pigeon  ===============================================
          Medium ground finch  ===============================================
             Peregrine falcon  ===============================================
                 Saker falcon  ===============================================
                      Wallaby  ===============================================
                     Platypus  ===============================================
     Chinese softshell turtle  ===============================================
                    Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
          Collared flycatcher  ===============================================

Inserts between block 20 and 21 in window
B D                    Shrew 218bp
             Star-nosed mole 1bp
B D                  Opossum 8bp
B D          Tasmanian devil 8bp

Alignment block 21 of 523 in window, 34621721 - 34621731, 11 bps 
B D                     Human  actcca------ttgct
B D                     Chimp  actcca------ttgct
B D                   Gorilla  actcca------ttgct
B D                    Gibbon  actcca------ttgat
B D                    Rhesus  actcca------ttgct
B D       Crab-eating macaque  actcca------ttgct
B D                    Baboon  actcca------ttgct
B D              Green monkey  actcca------ttgct
B D                  Marmoset  actcca------ttgct
B D           Squirrel monkey  actcca------ttgct
B D                  Bushbaby  actcct------atgct
           Chinese tree shrew  actcct------aagct
B D                  Squirrel  actcct------atgcc
       Lesser Egyptian jerboa  actcct------aaacc
                 Prairie vole  gcttct------acgtc
B D           Chinese hamster  gctgct------atgcc
               Golden hamster  gctcct------atgcc
B D                     Mouse  gctcct------atgcc
B D                       Rat  gctcct------atggc
B D            Naked mole-rat  attcct------atgcc
B D                Guinea pig  attcct------atacc
                   Chinchilla  attcat------atgcc
             Brush-tailed rat  attcct------atgcc
B D                    Rabbit  actcct------gtgct
B D                      Pika  actcc-------atgcc
B D                       Pig  acttgt------a---c
B D                    Alpaca  actctg------gtgcc
               Bactrian camel  actcta------gtgcc
B D                   Dolphin  actcct------gtgcc
                 Killer whale  actcct------gtgcc
             Tibetan antelope  actctt------gtgcc
B D                       Cow  actctt------gtgcc
B D                     Sheep  actctt------gtgcc
                Domestic goat  actctt------gtgcc
B D                     Horse  actcct------atgcc
B D          White rhinoceros  gttcct------atgcc
B D                       Cat  actcct------atggc
B D                       Dog  acacct------atgcc
B D                   Ferret   a-tcct------gtgcc
B D                     Panda  actcct------atgcc
               Pacific walrus  actcct------atgcc
                 Weddell seal  actcct------atgcc
             Black flying-fox  actctg------atgcc
B D                   Megabat  actccg------atgcc
                Big brown bat  acttct------atgct
         David's myotis (bat)  atttct------atgct
B D                  Microbat  acttct------atgct
              Star-nosed mole  aattgt------atgct
B D                  Elephant  actcct------atgcc
          Cape elephant shrew  attgct------ctgct
B D                   Manatee  attcct------atgcc
             Cape golden mole  ----tt------atgcc
B D                    Tenrec  actcct------atgcc
                     Aardvark  actatt------atgtc
B D                 Armadillo  attcct------ttgtg
B D                   Opossum  --acctccattcaagca
B D           Tasmanian devil  --acct------aggca
B D             X. tropicalis  gttgga------acatt
B D                    Medaka  acactt------ttgac
B D                     Shrew  =================
B D                  Hedgehog  -----------------
  D    Spiny softshell turtle  =================
                 Spotted gar  =================
B D                    Turkey  =================
B D                   Chicken  =================
          Tibetan ground jay  =================
B D               Zebra finch  =================
  D    White-throated sparrow  =================
  D            Painted turtle  =================
B D        American alligator  =================
B D                Budgerigar  =================
  D               Rock pigeon  =================
B D       Medium ground finch  =================
  D          Peregrine falcon  =================
  D              Saker falcon  =================
B D                   Wallaby  =================
B D                  Platypus  =================
  D  Chinese softshell turtle  =================
B D                 Orangutan  NNNNNNNNNNNNNNNNN
  D       Collared flycatcher  =================

Inserts between block 21 and 22 in window
B D                 Elephant 167bp
B D                  Opossum 25bp
B D          Tasmanian devil 5bp

Alignment block 22 of 523 in window, 34621732 - 34621763, 32 bps 
B D                     Human  aa-tgtaga-----------ta-cctcaa-------acaggtaaacaagg--a-a
B D                     Chimp  aa-tgtaga-----------ta-cctcaa-------acaggtaaacaagg--a-a
B D                   Gorilla  aa-tgtaga-----------ta-cctcaa-------acaggtaaacaagg--a-a
B D                    Gibbon  aa-tgtaga-----------taccctcaa-------acaggtaaacaagg--a-a
B D                    Rhesus  aa-tgtaga-----------taccctcaa-------acaggtaaacaa-t--a-a
B D       Crab-eating macaque  aa-tgtaga-----------taccctcaa-------acaggtaaacaa-t--a-a
B D                    Baboon  aa-tgtaga-----------taccctcaa-------acaggtaaacaa-t--a-a
B D              Green monkey  aa-tgtaga-----------taccctcaa-------acaggtaaacaa-t--a-a
B D                  Marmoset  aa-tgtaga-----------taccctcaa-------acaggtaaacaagg--a-a
B D           Squirrel monkey  aa-tgtaga-----------taccctcaa-------acaagtaaacaagg--a-a
B D                  Bushbaby  aa-tgtaga-----------ta---------------caggtaaacca-a--a-a
           Chinese tree shrew  aa-tgtaga-----------tacccttaa-------acaggtaaacaaga--a-a
B D                  Squirrel  aa-tgcaga-----------taccctcaa-------acaggtaaaaaaga--a-a
       Lesser Egyptian jerboa  aa-tgtt-------------tgccctcaa-------gcaggtgaataaga----a
                 Prairie vole  aa-tgttga-----------tacccgtaa-------gtggataaacaata--a-a
B D           Chinese hamster  aa-tgttga-----------tacccttac-------gtgggtaaagaata--a-a
               Golden hamster  aa-tgttga-----------tacccttac-------gtgggtaaagaata--a-a
B D                     Mouse  gt-tgtggg-----------tagcttgaa-------gtaggtgcgcaata--a-a
B D                       Rat  aa-tgtgga-----------tagcttgaa-------gtgggtgaacaatactg-a
B D            Naked mole-rat  ag-tgtaga-----------taccctcaa-------acaggtaaataaga--a-a
B D                Guinea pig  aa-tgtaga-----------taatcttaa-------gc--------aaga--a-a
                   Chinchilla  ag-tgtaaa-----------gacctttga-------gcaggtaaataggc--a-a
             Brush-tailed rat  ag-tgtaga-----------taccttcaa-------gcaggtaaataaga--a-a
B D                    Rabbit  ga-cgtaga-----------taccttcag-------acagctaaacaaga--a-a
B D                      Pika  aa-agcagc-----------taccttcaa-------acaggtgaccaatt--a-a
B D                       Pig  aa-tataaa-----------tggccttga-------acaagtaaacaaga--a-a
B D                    Alpaca  aa-cataga-----------tacccttga-------acaggtaaacaaga--a-a
               Bactrian camel  aa-tacaga-----------tacccttga-------acaggtaaacaaga--a-a
B D                   Dolphin  aa-tacaga-----------taccctcca-------acaactaaacaaga--a-a
                 Killer whale  aa-tacaga-----------taccctcca-------acaactaaacaaga--a-a
             Tibetan antelope  aa-tataga-----------taccctcca-------acatgtaaacaaga--a-a
B D                       Cow  cg-tataga-----------taccctcca-------acatgtaaacaaga--a-a
B D                     Sheep  aa-tataga-----------taccctcca-------acatgtaaacaaga--a-a
                Domestic goat  aa-tataga-----------taccctcca-------acatgtaaacaaga--a-a
B D                     Horse  aa-tacaga-----------aacccttga-------acaggtaaacatga--g-a
B D          White rhinoceros  aa-cacaga-----------tactcttga-------gcaggtaaacaaga--a-a
B D                       Cat  aa-tataga-----------taccctcaa-------acaggtaaacaaga--a-a
B D                       Dog  aa-tataga-----------taccctcaa-------acaggtaaacaaga--a-g
B D                   Ferret   aa-tataga-----------taccctcaa-------acaggtaaacaaga--a-a
B D                     Panda  aa-tataga-----------taccctcaa-------acaggtaaacaaga--a-a
               Pacific walrus  aa-tataga-----------taccctcaa-------tcaggtaaacaaga--a-a
                 Weddell seal  aa-tacaga-----------taccctcaa-------acaggtaaacaaga--a-a
             Black flying-fox  aa-tacaga-----------tatcctcaa-------acaggtaaacaata--a-a
B D                   Megabat  aa-tacaga-----------tatcctcaa-------acaggtaaacaata--a-a
                Big brown bat  aa-cataga-----------taccctcga-------acaggtaaac------a-a
         David's myotis (bat)  aa-tataga-----------taccctcga-------acaggtaaac------a-a
B D                  Microbat  aa-tataga-----------taccctcga-------acaggtaaac------a-a
B D                  Hedgehog  --------a-----------ttcc-------------------------------
              Star-nosed mole  aa-tgtaga-----------taccattaa-------acaggtaaacaaga--a-a
B D                  Elephant  aa-tgtaga-----------tactctcaa-------atgggtaaact-gt--a--
          Cape elephant shrew  ----acaga-----------tac-ctcaa-------atgggtaaa----------
B D                   Manatee  aa-tgaaga-----------taccctcaa-------atgtgtaaactggt--a--
             Cape golden mole  aa-tataga-----------taccctcaa-------atgggtaaactggt--a--
B D                    Tenrec  ag-tataaat----------tgccctcaa-------aagggcaaactggc--a--
                     Aardvark  aa-cgtagg-----------taccctcaa-------ataggtaaattggt--a--
B D                 Armadillo  ----------------------------a-------atgggtaaacaaga--aa-
B D                   Opossum  aa-tataga-----------taatctaga-------accagt---tgagg--a-g
B D           Tasmanian devil  aagtataga-----------tgttccatgactctataccaat--ataaat--a-g
B D             X. tropicalis  ---------aacccatggtctgccaacga-------gcagttacgctg-------
B D                    Medaka  ------------------atgacacccca-------acatgcagacccat--t-g
B D                     Shrew  =======================================================
  D    Spiny softshell turtle  =======================================================
                 Spotted gar  =======================================================
B D                    Turkey  =======================================================
B D                   Chicken  =======================================================
          Tibetan ground jay  =======================================================
B D               Zebra finch  =======================================================
  D    White-throated sparrow  =======================================================
  D            Painted turtle  =======================================================
B D        American alligator  =======================================================
B D                Budgerigar  =======================================================
  D               Rock pigeon  =======================================================
B D       Medium ground finch  =======================================================
  D          Peregrine falcon  =======================================================
  D              Saker falcon  =======================================================
B D                   Wallaby  =======================================================
B D                  Platypus  =======================================================
  D  Chinese softshell turtle  =======================================================
B D                 Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D       Collared flycatcher  =======================================================

Inserts between block 22 and 23 in window
B D                  Opossum 2bp
B D          Tasmanian devil 7bp

Alignment block 23 of 523 in window, 34621764 - 34621790, 27 bps 
B D                     Human  tatttatgc--tgatacatag----gcccaag-------a
B D                     Chimp  tatttatgc--tgatacatag----gcccaag-------a
B D                   Gorilla  tatttatgc--tgatacatag----gcccaag-------a
B D                    Gibbon  tatttatgc--tgatacatag----gcccaag-------a
B D                    Rhesus  tatttatgc--tgatacatag----gcccatg-------a
B D       Crab-eating macaque  tatttatgc--tgatacatag----gcccatg-------a
B D                    Baboon  tatttatgc--tgatacatag----gcccatg-------a
B D              Green monkey  tatttatgc--tgatacatag----gcccatg-------a
B D                  Marmoset  tatttacgc--tgatacatag----acccatg-------a
B D           Squirrel monkey  tatttatgc--tgatacatag----gcccatg-------a
B D                  Bushbaby  tatttacac--gaatacataa----gcccatg-------a
           Chinese tree shrew  tatttacac--gaatacgtag----gcccata-------a
B D                  Squirrel  tattgac------------------actaata-------c
       Lesser Egyptian jerboa  tactgacac------acatgg----gcccctg-------a
                 Prairie vole  tactaac--------gcagag----acccatg-------a
B D           Chinese hamster  tactaac--------acagag----acccatg-------a
               Golden hamster  tactaac--------acggag----acccgcg-------a
B D                     Mouse  tactcac------------ag----atctgtg-------a
B D                       Rat  cactcac------------ag----atccatg-------a
B D            Naked mole-rat  t----acac--tgatacatag----gcccatg-------a
B D                Guinea pig  tattgacac--tga-acatag----gcccatg-------a
                   Chinchilla  tactgacac--tgatacacag----gcccatg-------a
             Brush-tailed rat  tgctaacac--tgacacatag----acccatg-------a
B D                    Rabbit  catttacac--tgatacacag----gtccatg-------a
B D                      Pika  tttttacac--caattcacag----gcccctg-------a
B D                       Pig  tatctacac--tgatacacag----gcccata-------a
B D                    Alpaca  tatttacaa--agatacatag----gcccatg-------a
               Bactrian camel  tatttacaa--agatacatag----gcccatg-------a
B D                   Dolphin  tatttacac--tgatacatag----gcccatg-------a
                 Killer whale  tatttacac--tgatacatag----gcccatg-------a
             Tibetan antelope  catttacac--tgatacacaa----gcccatg-------a
B D                       Cow  catttacac--tgatacac-a----gcccatg-------a
B D                     Sheep  catttacac--tgatacacaa----gcccatg-------a
                Domestic goat  catttacac--tgatacacaa----gcccatg-------a
B D                     Horse  tatttacac--tgatacatag----gcccatg-------a
B D          White rhinoceros  gatttacac--ta----acag----gcccatg-------a
B D                       Cat  tatttacac--tgatacatag----gtccatg-------a
B D                       Dog  tatttacat--tagtacatag----gcccatg-------a
B D                   Ferret   tatttacac--tgatacacag----gcccatg-------a
B D                     Panda  tatttacac--tgatacatag----gcccatg-------a
               Pacific walrus  tatttacac--tgatacatag----gcccatg-------a
                 Weddell seal  tatttacac--tgatacatag----gcccatg-------a
             Black flying-fox  tatttacac--tgatacctag----gcccatg-------a
B D                   Megabat  tatttacac--tgatacctag----gcccatg-------a
                Big brown bat  tatttacac--ggatatatag----gcccatg-------a
         David's myotis (bat)  tatttacac--tgatatatag----gcccatg-------a
B D                  Microbat  tatttacac--tgatatatag----gcccatg-------a
B D                  Hedgehog  ----tatgc--caatacatag----gtccatg-------a
B D                     Shrew  tatttctac--tcatatgtag----gaccatg-------a
              Star-nosed mole  tatttatac--agatatagag----gcccatt-------a
B D                  Elephant  --tctataa--ttatacatgg----gcccatg-------a
          Cape elephant shrew  ----tataa--tgatgcatgg----acccatg-------a
B D                   Manatee  --tctataa--tgatacatgg----gcccatg-------a
             Cape golden mole  --tctgtaa--tgatacatgagcatatatatataatgatg
B D                    Tenrec  --tctacga--tgatacatggatgggcctatg-------a
                     Aardvark  --tctataa--tgatacttag----gcccacg-------a
B D                 Armadillo  tttctacac--tgatacatgg----gcccatg-------a
B D                   Opossum  ttcctcccc--aagcacctaa---------ta-------c
B D           Tasmanian devil  tgtctcccc--tggcatctag---------tg-------c
B D             X. tropicalis  tattaaccctatgatgccagg----ggccaaa-------a
B D                    Medaka  tgcacatgc--acatgcacaa----acaga----------
  D    Spiny softshell turtle  ========================================
                 Spotted gar  ========================================
B D                    Turkey  ========================================
B D                   Chicken  ========================================
          Tibetan ground jay  ========================================
B D               Zebra finch  ========================================
  D    White-throated sparrow  ========================================
  D            Painted turtle  ========================================
B D        American alligator  ========================================
B D                Budgerigar  ========================================
  D               Rock pigeon  ========================================
B D       Medium ground finch  ========================================
  D          Peregrine falcon  ========================================
  D              Saker falcon  ========================================
B D                   Wallaby  ========================================
B D                  Platypus  ========================================
  D  Chinese softshell turtle  ========================================
B D                 Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D       Collared flycatcher  ========================================

Inserts between block 23 and 24 in window
B D            X. tropicalis 41bp

Alignment block 24 of 523 in window, 34621791 - 34621834, 44 bps 
B D                     Human  caag-gcagacatcccctggtactcatg----cc---agagaggtcatgc-ct
B D                     Chimp  caag-gcagacatcccctggtactcatg----cc---agagaggtcatgc-ct
B D                   Gorilla  caag-gcagacatcccctggtactcatg----cc---agagaggtcatgc-ct
B D                    Gibbon  caag-gcagacatcccctggtactcatg----cc---agagagatcatgc-ct
B D                    Rhesus  caag-gcagacatcccctggtactcatg----cc---agagaggtcatgc-ct
B D       Crab-eating macaque  caag-gcagacatcccctggtactcatg----cc---agagaggtcatgc-ct
B D                    Baboon  caag-gcagacatcccctggtactcatg----cc---agagaggtcatgc-ct
B D              Green monkey  caag-gcagacatcccctggtactcatg----cc---agagaggtcatgc-ct
B D                  Marmoset  taag-gcagacatcccctggtacccatg----cc---agagagttcatgc-ct
B D           Squirrel monkey  caag-gcagacatcccctggtacccatg----cc---agagagttcatgc-ct
B D                  Bushbaby  caag-gcagacatcccatggtacccatt----cc---agggaggtcatgc-ct
           Chinese tree shrew  caag-gcagatatcccc-agtacccatg----cc---agaaaggtcatgc-ct
B D                  Squirrel  atag-gcagatatcccatgatcaccacg----cc---acagaggccatgc-ct
       Lesser Egyptian jerboa  caaa-gcagacattctatggtaagcata----cc---acagaggccata--tt
                 Prairie vole  caaa-gccgacatcccatggccaccatg----cc---gcagagagcatg--ct
B D           Chinese hamster  caaa-gcagacatcctgtgtcaatcata----cc---acagaga-catg--ct
               Golden hamster  caaa-gcagaccactcatggcaatcata----cc---gcagagatcatg--ct
B D                     Mouse  caaa-gcagacatcccatggcaaccatg----ct---gcatagaccatg--ct
B D                       Rat  caaa-gcagacatcctatggcaaccatg----at---gcactgaccatg--ct
B D            Naked mole-rat  caag-ccaaacattacatggtaaacatg----cc---acaaaggccatgc-ct
B D                Guinea pig  caag-gcaagcattccatggtaaccatg----cc---ac-agggccatgc-ct
                   Chinchilla  caag-gcaaacattccatggtaaccatg----cc---ac-ggggccatgc-ct
             Brush-tailed rat  caag-gcaaacattccatggtaaccatg----cc---ac-agggccatgc-ct
B D                    Rabbit  caag-gcagacatcccatggtacccatg----cc---agagcggtcatgc-ct
B D                      Pika  caag-ggatacatcccatcgtccccacg----cc---agagagggcatgc-ct
B D                       Pig  caa-----gatgtctcatgatacccatg----cc---agagaagtcatgc-ct
B D                    Alpaca  caa-----gacattccatggtacccatg----cc---agtgaggtcatgc-ct
               Bactrian camel  caa-----gacgttccatgggacccatg----cc---agagaggtcatgc-ct
B D                   Dolphin  caa-----gacatcccatggtattcatg----cc---agagaggtcatgc-ct
                 Killer whale  caa-----gacatcccatggtattcatg----cc---agagaggtcatgc-ct
             Tibetan antelope  taa-----gacatcccatggtattcatg----cc---agagaggtcatgc-ct
B D                       Cow  cga-----gacatcccatggtattcatg----cc---agagaggtcatgc-ct
B D                     Sheep  taa-----gacatcccatggtattcatg----cc---agagaggtcatgc-ct
                Domestic goat  taa-----gacatcccatggtattcatg----cc---agagaggtcatgc-ct
B D                     Horse  cgag-gtggacatcccatggtacccatg----cc---agagaggtcatgc-ct
B D          White rhinoceros  caag-gcagacatcccatggtacccatg----cc---agagaggtcatgc-ct
B D                       Cat  caag-gcagacatcccatggtatccatg----cc---agagaggtcatgc-ct
B D                       Dog  caag-gcagacatcccatggtacccatg----cc---agagaggtcatgc-ct
B D                   Ferret   caag-gcagacatcccatggtacccatg----cc---agagaggtcatgc-ct
B D                     Panda  caag-gcagacatcccatggtacccatg----cc---agagaggtcatgc-ct
               Pacific walrus  caag-tcagacatcccatggtacccatg----cc---agagaggtcatgc-ct
                 Weddell seal  caag-gcagacatcccatggtacccatg----cc---agagaggtcatgc-ct
             Black flying-fox  caag-gcagacatcccatggtacccatg----ccat-gggggattaatg----
B D                   Megabat  caag-gcagacatcccatggtacccatg----ccat-gggggattaatg----
                Big brown bat  caag-gcagacatcccatggtacccatggtacccataagaggggtcatgc-ct
         David's myotis (bat)  caag-gcagacatcccatggtacccatggtaccc---agagaggtcatgc-ct
B D                  Microbat  caag-gcagacatcccatggtacccatggtacccat-agagaggtcatgc-ct
B D                  Hedgehog  taag-gcagacatcgtatggtatccatg----ct---aaagaggtcatgc-ct
B D                     Shrew  caag-gcagacatgccatggtgcgcatg----ct---agagaggtcatgc-tt
              Star-nosed mole  caag-gcaaacgtcccatgatacccatg----cc---aaagaggtcatgc-ct
B D                  Elephant  tagg-gcaggcatcccatggtacccatg----cc---aatgaggtcatgc-ct
          Cape elephant shrew  cagg-gcaaacatcctatggtactcatg----cc---aatgaggttatga-ct
B D                   Manatee  tagg-gcagacatcccatggtacccatg----cc---aatgaggtcatgc-ct
             Cape golden mole  cagg-acagacatcccatggtacccatg----ct---aatgaggtcatgc-ct
B D                    Tenrec  caag-gcaggcatcccatggtacccata----cc---aatgaggtcatgc-ct
                     Aardvark  caag-gcagacatcccatggtacccatg----cc---aatgaggttatac-ct
B D                 Armadillo  cagg-gcagatatcccatggttcccatg----cc---agaaaggtcatgc-ct
B D                   Opossum  tagt-atagacaccctctaacttcta-g----ca---gtagatgaattcc-tt
B D           Tasmanian devil  tagt-acaaacatgctctgctttcca-g----ca---gcagatgaattccttt
B D                    Medaka  caagcacagacgtgcacag--actcctg----tc---agaaa--cagtgc-t-
  D    Spiny softshell turtle  =====================================================
                 Spotted gar  =====================================================
B D                    Turkey  =====================================================
B D                   Chicken  =====================================================
          Tibetan ground jay  =====================================================
B D               Zebra finch  =====================================================
  D    White-throated sparrow  =====================================================
B D             X. tropicalis  =====================================================
  D            Painted turtle  =====================================================
B D        American alligator  =====================================================
B D                Budgerigar  =====================================================
  D               Rock pigeon  =====================================================
B D       Medium ground finch  =====================================================
  D          Peregrine falcon  =====================================================
  D              Saker falcon  =====================================================
B D                   Wallaby  =====================================================
B D                  Platypus  =====================================================
  D  Chinese softshell turtle  =====================================================
B D                 Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D       Collared flycatcher  =====================================================

Alignment block 25 of 523 in window, 34621835 - 34621886, 52 bps 
B D                     Human  tggatcccatgcca-t-------gtaga-cacccc-----------ctttaacccatgccagtctagc-a
B D                     Chimp  tggatcccatgcca-t-------gtaga-cacccc-----------ctttaacccatgccagtctagc-a
B D                   Gorilla  tggatcccatgcca-t-------gtaga-cacccc-----------ctttaacccatgccagtctagc-a
B D                    Gibbon  tggatcccatgccg-t-------gtaga-cacccc-----------ctttaacccatgccagtctagc-a
B D                    Rhesus  tggatcccatgcca-t-------gtagg-cacccc-----------ctttaacccatgccagtctagc-a
B D       Crab-eating macaque  tggatcccatgcca-t-------gtagg-cacccc-----------ctttaacccatgccagtctagc-a
B D                    Baboon  tggatcccatgcca-t-------gtagg-cacccc-----------ctttaacccatgccagtctagc-a
B D              Green monkey  tggatcccatgcca-t-------gtagg-cacccc-----------ctttaacccatgccagtctagc-a
B D                  Marmoset  tggatcccatgcca-t-------gtgga-caccca-----------ctttaacccatgccagtctagc-a
B D           Squirrel monkey  tggatcccatgcca-t-------atgga-cacccc-----------ctttaatccatgccagtctagc-a
B D                  Bushbaby  tggagtgcatgcca-t-------acagg-cacccc-----------ctataatccatgccagtgtagc-a
           Chinese tree shrew  tggacatcatgcca-t-------gtaga-cacact-----------cttaaacccatgccagtgtagc-a
B D                  Squirrel  tggaccccatgcca----------taaa-cacacc-----------ctttaacccatgccagtgtagc-a
       Lesser Egyptian jerboa  ttggacccatgcca-t-------gtaga-ca-tcc-----------ctttaatgcatgccaatgaaac-a
                 Prairie vole  gggaccccatgcca-t-------gcaga-cattct-----------ctctagcccattttagtggaac-a
B D           Chinese hamster  gggacctcatgcca------------------------------------------------tgtaag-a
               Golden hamster  gtgaccccatgcca-t-------ttaga-cattct-----------ccttaacccgttttagtgtaac-a
B D                     Mouse  gggaccccatgcct-t-------gtaga-caaact-----------cttgaatccattttaatgtaac-a
B D                       Rat  gggaccccatgcca-c-------gtaga-cattct-----------ctttaacccgttttagtgtaac-a
B D            Naked mole-rat  taaaccccatgcct-t-------acagattacccc-----------ctttaacccatgccaagggagc-c
B D                Guinea pig  taaaccccatgcct-t-------acaaattaccccg----------ctgtaaactatgcca---------
                   Chinchilla  taaaccccatgcct-t-------acagattacccc-----------ctgtagcccacgcca---------
             Brush-tailed rat  taaaccccatgcct-t-------atagattatccc-----------ctttcacccatacca---------
B D                    Rabbit  tggaacccatgcca-t-------ataga-taccgc-----------tt-taacccatgcca-tgtagc-a
B D                      Pika  gggaccccatgcca-c-------gtaga-tacttc-----------c-----------------------
B D                       Pig  tggaacccatgcca-t-------gtaga-tacccc-----------ctttaacccatgccagtgtagc-a
B D                    Alpaca  tggaccccatgcca-t-------gtaga-cactcc-----------ctttaa-ccatgccagtatagc-a
               Bactrian camel  tggaccccatgcca-t-------gtaga-cacccc-----------ctttaa-ccatgccagtatagc-a
B D                   Dolphin  tggatcccatgcca-t-------gtaga-cacccc-----------ctttaatccatgccagtgtagc-a
                 Killer whale  tggatcccatgcca-t-------gtaga-cacccc-----------ctttaatccatgccagtgtagc-a
             Tibetan antelope  tggaccccatgcca-t-------gtaga-cacccc-----------ctttaatccaggtcagtgtagc-a
B D                       Cow  tggaccccatgcca-t-------gtaga-catccc-----------ctttaatccaggccagtgtagc-a
B D                     Sheep  tggaccccatgcca-t-------gtaga-cacccc-----------ctttaatccaggtcagtgtagc-a
                Domestic goat  tggaccccatgcca-t-------gtaga-cacccc-----------ctttaatccaggtcagtgtagc-a
B D                     Horse  tagaccccatgcca-t-------gtaga-ca-ccc-----------ctttaacccatgctagtgtagc-a
B D          White rhinoceros  tggaccccatgcca-t-------gtaga-ca-ccc-----------ctttaacccatgccagtgtagc-a
B D                       Cat  tagaccccatgccatt-------gtaga-ca--cc-----------ctttaacccatgccattgtagc-a
B D                       Dog  tagaccccatgccatt-------gtaga-ca-ccc-----------ctttaacccatgccattgtagcaa
B D                   Ferret   tagaccccatgccatt-------gtaga-ca-ccc-----------ctttaacccatgccattgtagc-a
B D                     Panda  tagaccccatgccatt-------gttaa-ca-ccc-----------ctttaacccatgccattttaac-a
               Pacific walrus  tagaccccatgccatt-------gtaga-ca-ccc-----------ctttaacccatgccattgtagc-a
                 Weddell seal  tagaccccatgccatt-------gtaga-ca-ccc-----------ctttaacccatgccattgtagc-a
             Black flying-fox  --gaccccatgcca-t-------ataga-tacccc-----------ctttaacccatgccagtgtagc-a
B D                   Megabat  --gaccccatgcca-t-------ataga-tacccc-----------ctttaacccatgccagtgtagc-a
                Big brown bat  tgacccccatgcca-t-------gtaga-cagatc-----------ctttaacccatgacaatgtagc-a
         David's myotis (bat)  tgacccccaggcca-t-------gtaga-ctgacc-----------ctttaacccatgccaatgtagc-a
B D                  Microbat  tcacccccatgcca-tgtagacagtaga-cagacc-----------ctttaacccatgccaatgtagc-a
B D                  Hedgehog  tgtaccccatgcca-t-------gtagc-tacccc-----------ctttagcccatgccaatatcac-a
B D                     Shrew  tggactccatgcca-t-------gcaga-cccccc-----------tttgggcccatgccagtgtagc-a
              Star-nosed mole  cagatcccatgcca-t-------gtaga-taccac-----------ctttaacccatgccagtgttgc-a
B D                  Elephant  tggaccccatgcca-t-------gtaga-cacgcc-----------cttcaacccatgccagtgtagt-a
          Cape elephant shrew  tggaccccatgcca-t-------gtagc-tacccc-----------ctttaacccatgccagtttatc-a
B D                   Manatee  tggaccccatgcca-t-------gtaga-cacccc-----------ctttaacacatgctagtgtagc-a
             Cape golden mole  tggaccccatgcca-t-------gtaga-cac-cc-----------tttgaacccatgccagtgtagt-a
B D                    Tenrec  tggaccccatgcca-t-------gtaga-acc-ca-----------ctatagcccatgccactgtagc-a
                     Aardvark  tggaccccatgcca-t-------gtaga-caaccc-----------cattaacccatgccccggtagc-a
B D                 Armadillo  tgtcccccatgcca-t-------gtaga-cacccc-----------ctttaacccatgccagtgtagc-a
B D                   Opossum  gatgtccagagcca-t-------gtaga-tacctcaattcctatttccccacatcatgtcgatg------
B D           Tasmanian devil  gatgacccaagcca-t-------actgt-cactc------------------------------------
B D             X. tropicalis  tggggccaacacag-t-------gctgg-aa---------------ccttaacccacggcctgccaga-g
B D                    Medaka  aaagtcctgtgcct-c-------agcgg-ccgcct-----------ctccatc-----------------
  D    Spiny softshell turtle  ======================================================================
                 Spotted gar  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D            Painted turtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Platypus  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                 Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D       Collared flycatcher  ======================================================================

                        Human  atc
                        Chimp  atc
                      Gorilla  atc
                       Gibbon  atc
                       Rhesus  atc
          Crab-eating macaque  atc
                       Baboon  atc
                 Green monkey  atc
                     Marmoset  atc
              Squirrel monkey  atc
                     Bushbaby  atc
           Chinese tree shrew  atc
                     Squirrel  atc
       Lesser Egyptian jerboa  atc
                 Prairie vole  att
              Chinese hamster  gtc
               Golden hamster  atc
                        Mouse  atc
                          Rat  gta
               Naked mole-rat  atc
                   Guinea pig  ---
                   Chinchilla  ---
             Brush-tailed rat  ---
                       Rabbit  atc
                         Pika  ---
                          Pig  ata
                       Alpaca  gtc
               Bactrian camel  atc
                      Dolphin  atc
                 Killer whale  atc
             Tibetan antelope  atc
                          Cow  att
                        Sheep  atc
                Domestic goat  atc
                        Horse  atc
             White rhinoceros  atc
                          Cat  atc
                          Dog  atc
                      Ferret   atc
                        Panda  atc
               Pacific walrus  atc
                 Weddell seal  atc
             Black flying-fox  atc
                      Megabat  atc
                Big brown bat  atc
         David's myotis (bat)  atc
                     Microbat  atc
                     Hedgehog  a--
                        Shrew  g--
              Star-nosed mole  gcc
                     Elephant  atc
          Cape elephant shrew  aaa
                      Manatee  atc
             Cape golden mole  atc
                       Tenrec  gtc
                     Aardvark  atc
                    Armadillo  atc
                      Opossum  ---
              Tasmanian devil  ---
                X. tropicalis  atc
                       Medaka  ---
       Spiny softshell turtle  ===
                  Spotted gar  ===
                       Turkey  ===
                      Chicken  ===
           Tibetan ground jay  ===
                  Zebra finch  ===
       White-throated sparrow  ===
               Painted turtle  ===
           American alligator  ===
                   Budgerigar  ===
                  Rock pigeon  ===
          Medium ground finch  ===
             Peregrine falcon  ===
                 Saker falcon  ===
                      Wallaby  ===
                     Platypus  ===
     Chinese softshell turtle  ===
                    Orangutan  NNN
          Collared flycatcher  ===

Inserts between block 25 and 26 in window
B D                  Opossum 2bp
B D          Tasmanian devil 952bp

Alignment block 26 of 523 in window, 34621887 - 34621913, 27 bps 
B D                     Human  ccctgaac-t----ccatgtta------------ctcatgca--------ag
B D                     Chimp  ccctgaac-c----ccatgtta------------ctcatgca--------ag
B D                   Gorilla  ccctgaac-c----ccatgtta------------cccatgca--------ag
B D                    Gibbon  ccctgaac-c----ccatgtta------------cccatgca--------ag
B D                    Rhesus  ccctgaac-c----ccacgtta------------cccatgca--------ag
B D       Crab-eating macaque  ccctgaac-c----ccacgtta------------cccatgca--------ag
B D                    Baboon  ccctgaac-c----ccacgtta------------cccatgca--------ag
B D              Green monkey  ccctgaac-c----ccatgtta------------cccatgca--------ag
B D                  Marmoset  ccctgaat-c----ctatgtta------------cccatgca--------ag
B D           Squirrel monkey  ccctgaat-c----ctatgtta------------cccatgca--------ag
B D                  Bushbaby  ccctgaac-c----ccatgtta------------cccatgca--------aa
           Chinese tree shrew  cactgaac-a----ccacgtta------------cccatgca--------ag
B D                  Squirrel  ccctgaac-c----ccatgtta------------c-catgca--------ag
       Lesser Egyptian jerboa  ctttgaat-c----ccaagtta------------ctcatgca--------at
                 Prairie vole  ctctgaac-c----cc--------------------catgca--------tg
B D           Chinese hamster  ctttgaac-c----cc--------------------catgca--------ag
               Golden hamster  ctctgaac-c----cc--------------------catgca--------ag
B D                     Mouse  ctctaaac-c----cc--------------------caagca--------ag
B D                       Rat  ctctaaac-c----cc--------------------catgca--------ac
B D            Naked mole-rat  ctctgaac-ctgtagc--------------------catgca--------aa
B D                Guinea pig  ccgtgaat-ctgtacc--------------------catgca--------ag
                   Chinchilla  ccctgaac-ctgtacc--------------------catgca--------ag
             Brush-tailed rat  ccctgaac-ctgtact--------------------catgca--------ag
B D                    Rabbit  ccgtgaac-c----cctcatta------------tccatgca--------cg
B D                      Pika  ---tgagc-c----ccaaatca------------tccatgca--------ag
B D                       Pig  ccctgaac-c----ccatgtta------------cccatgca--------a-
B D                    Alpaca  tcctgaac-a----ccatgtta------------cccatgca--------ag
               Bactrian camel  tcctgaac-a----ccatgtta------------cccatgca--------ag
B D                   Dolphin  ccctgaac-c----ccatgtta------------cccatgca--------ag
                 Killer whale  ccctgaac-c----ccatgtta------------cccatgca--------ag
             Tibetan antelope  ccctgaac-c----ccatgtta------------cccatgca--------gg
B D                       Cow  ccccaaac-c----ctatgtta------------cccatgca--------gg
B D                     Sheep  ccctgaac-c----ccatgtta------------cccatgca--------gg
                Domestic goat  ccctgaac-c----ccatgtta------------cccatgca--------gg
B D                     Horse  ccctgaac-c----ccatgtta------------cccatgca--------ag
B D          White rhinoceros  ccctgaac-c----ccatgtta------------cccatgca--------ag
B D                       Cat  ccatgaac-c----ccacatta------------cccatgca--------ag
B D                       Dog  ccctgaac-c----ccacatta------------tccatgca--------ac
B D                   Ferret   ccctgacc-a----ccacatta------------cccatgca--------ag
B D                     Panda  ccctgagc-c----ccacatta------------cccatgca--------ag
               Pacific walrus  ccctgaac-c----ccacatta------------cccatgca--------ag
                 Weddell seal  ccctgaac-c----ccacatta------------cccatgca--------ag
             Black flying-fox  ccctgaac-c----ccatgtta------------cccatgca--------ag
B D                   Megabat  ccctgaac-c----ccatgtta------------cccatgca--------ag
                Big brown bat  ccctgaac-c----ccatatta------------cccatgca--------aa
         David's myotis (bat)  ccctgaac-c----ccatatca------------cccatgca--------ag
B D                  Microbat  ccctgaac-c----ccatatta------------cccatgca--------ag
B D                  Hedgehog  ---------------------a------------cccacata--------g-
B D                     Shrew  ---------c----ccaagtta------------cccatgca--------gg
              Star-nosed mole  ccctgaaa-c----ccatgtct------------cccatgca--------ag
B D                  Elephant  ccctggac-c----ccaagtta-------------ccatgcg--------aa
          Cape elephant shrew  ccctaaac-c----ccagctac-------------ccatgca--------aa
B D                   Manatee  ccctgaac-c----ccatgtta-------------ccatgcg--------aa
             Cape golden mole  ccctgaac-t----ccatgtta------------cccatgca--------ga
B D                    Tenrec  tactgaac-c----ccttgtta------------cccatgca--------ga
                     Aardvark  ccctgaac-c----ccatgttg------------cccatgca--------ga
B D                 Armadillo  cccgaaac-c----ccatgtta------------cccatgcg--------ag
B D                   Opossum  ccctgaccat----acacaacagtgggagtgttccttatacc--------aa
B D           Tasmanian devil  atctgatt-t----ccatttcatttgtag-----------------------
B D             X. tropicalis  -tgcaact-c----caacatta-----------acccttgtactgccagggg
B D                    Medaka  tcatggat-t----ttatag--------------------------------
  D    Spiny softshell turtle  ====================================================
                 Spotted gar  ====================================================
B D                    Turkey  ====================================================
B D                   Chicken  ====================================================
          Tibetan ground jay  ====================================================
B D               Zebra finch  ====================================================
  D    White-throated sparrow  ====================================================
  D            Painted turtle  ====================================================
B D        American alligator  ====================================================
B D                Budgerigar  ====================================================
  D               Rock pigeon  ====================================================
B D       Medium ground finch  ====================================================
  D          Peregrine falcon  ====================================================
  D              Saker falcon  ====================================================
B D                   Wallaby  ====================================================
B D                  Platypus  ====================================================
  D  Chinese softshell turtle  ====================================================
B D                 Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D       Collared flycatcher  ====================================================

Alignment block 27 of 523 in window, 34621914 - 34621924, 11 bps 
B D                     Human  tttagatatc-c
B D                     Chimp  tttagatatc-c
B D                   Gorilla  tttagatatc-c
B D                    Gibbon  tttatatatc-c
B D                    Rhesus  cttagatatc-c
B D       Crab-eating macaque  cttagatatc-c
B D                    Baboon  tttagatatc-c
B D              Green monkey  tttagatatc-c
B D                  Marmoset  tttagatatc-c
B D           Squirrel monkey  tttagatatg-c
B D                  Bushbaby  tttggataac-c
           Chinese tree shrew  ttcagatatt-c
B D                  Squirrel  ttcagctatc-c
       Lesser Egyptian jerboa  ttcagatatc-c
                 Prairie vole  ttcagatacc-c
B D           Chinese hamster  ttcagatacc-c
               Golden hamster  ttcagatacc-c
B D                     Mouse  ttcagatact-c
B D                       Rat  ctcagatagc-c
B D            Naked mole-rat  ttcagatatc-t
B D                Guinea pig  ttcagatatc-c
                   Chinchilla  ttcagatacc-c
             Brush-tailed rat  ttcagatact-c
B D                    Rabbit  ttcagagatc-c
B D                      Pika  t-------tc-c
B D                       Pig  tctggatatc-c
B D                    Alpaca  tgtggatatc-c
               Bactrian camel  tgtggatacc-c
B D                   Dolphin  tttggatatc-t
                 Killer whale  tttggatatc-t
             Tibetan antelope  tttggatatc-c
B D                       Cow  tttggatatc-c
B D                     Sheep  tttggatatc-c
                Domestic goat  tttggatatc-c
B D                     Horse  tttggctatc-c
B D          White rhinoceros  tttggatatc-c
B D                       Cat  tttggatatc-c
B D                       Dog  tttggatatc-t
B D                   Ferret   tttggatatc-c
B D                     Panda  tttggatatc-c
               Pacific walrus  tttggatatc-c
                 Weddell seal  tttggatatc-c
             Black flying-fox  tttggatatc-c
B D                   Megabat  tttggatatc-c
                Big brown bat  tttggatatc-c
         David's myotis (bat)  tttggatatc-c
B D                  Microbat  tttggatatc-c
B D                     Shrew  atgggatatc-t
              Star-nosed mole  tttggatatt-t
B D                  Elephant  tttagacatc-c
          Cape elephant shrew  tttttatatc-c
B D                   Manatee  tttacacatc-c
             Cape golden mole  tttagacacc-t
B D                    Tenrec  cttagatgtc-t
                     Aardvark  tttagacatc-c
B D                 Armadillo  tttagacatc-t
B D                   Opossum  attagatacc-c
B D           Tasmanian devil  ---acattcc-a
B D             X. tropicalis  ttgttatagc-a
B D                    Medaka  caaagacatc--
                  Spotted gar  tctagatgtaa-
B D                  Hedgehog  ------------
  D    Spiny softshell turtle  ============
B D                    Turkey  ============
B D                   Chicken  ============
          Tibetan ground jay  ============
B D               Zebra finch  ============
  D    White-throated sparrow  ============
  D            Painted turtle  ============
B D        American alligator  ============
B D                Budgerigar  ============
  D               Rock pigeon  ============
B D       Medium ground finch  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
B D                   Wallaby  ============
B D                  Platypus  ============
  D  Chinese softshell turtle  ============
B D                 Orangutan  NNNNNNNNNNNN
  D       Collared flycatcher  ============

Alignment block 28 of 523 in window, 34621925 - 34621934, 10 bps 
B D                     Human  ctgaac--ttca
B D                     Chimp  ctgaac--ttca
B D                   Gorilla  ctgaac--ttca
B D                    Gibbon  ctgaac--ttca
B D                    Rhesus  ctgaac--ttca
B D       Crab-eating macaque  ctgaac--ttca
B D                    Baboon  ctgaac--ttca
B D              Green monkey  ctgaac--ttca
B D                  Marmoset  ctgaac--ctca
B D           Squirrel monkey  ctgaac--ctca
B D                  Bushbaby  ctgaac--ctta
           Chinese tree shrew  ctgaat--ctca
B D                  Squirrel  ctgaac--ctca
       Lesser Egyptian jerboa  ctgaac--ctca
                 Prairie vole  tcgaac--ctca
B D           Chinese hamster  ctgaac--ctca
               Golden hamster  ctgaac--ctca
B D                     Mouse  ctgaac--gtca
B D                       Rat  ctgaac--ctca
B D            Naked mole-rat  ctgaac--ctca
B D                Guinea pig  ctgaac--ctca
                   Chinchilla  ctgaac--ctca
             Brush-tailed rat  ctgaac--ctca
B D                    Rabbit  ctggac--ttca
B D                      Pika  ctgacc--ctca
B D                       Pig  ttgaac--ctca
B D                    Alpaca  ctgaac--ctca
               Bactrian camel  ctgaac--ctca
B D                   Dolphin  ctgaac--ctca
                 Killer whale  ctgaac--ctca
             Tibetan antelope  ctgaac--ctca
B D                       Cow  ctgaac--ctca
B D                     Sheep  ctcaac--ctca
                Domestic goat  ctgaac--ctca
B D                     Horse  ctgaac--ctca
B D          White rhinoceros  ctgaac--ctca
B D                       Cat  ctgaac--ctca
B D                       Dog  ctgagc--ctca
B D                   Ferret   ctgagc--ctca
B D                     Panda  ctgaac--ctca
               Pacific walrus  ctgaac--ctca
                 Weddell seal  ctgaac--ctca
             Black flying-fox  ctgaac--ctca
B D                   Megabat  ctgaac--ctca
                Big brown bat  ctgaat--ctca
         David's myotis (bat)  ctgaat--ctca
B D                  Microbat  atgaat--gtca
B D                  Hedgehog  --------ctca
B D                     Shrew  ctgaac--ctca
              Star-nosed mole  ctgaac--ttca
B D                  Elephant  ctgaac--ctca
          Cape elephant shrew  ttgacc--ctca
B D                   Manatee  ttgaac--ctca
             Cape golden mole  tttagc--ttca
B D                    Tenrec  tcgaac--ctca
                     Aardvark  ttgcac--ctca
B D                 Armadillo  ctgaac--ccca
B D                   Opossum  attgatccttca
B D           Tasmanian devil  att-----ttca
B D             X. tropicalis  ctggaa--ataa
B D                 Tetraodon  cttatc--ttca
B D                    Medaka  --aaac--tgca
                  Spotted gar  tttaac--ttca
  D    Spiny softshell turtle  ============
B D                    Turkey  ============
B D                   Chicken  ============
          Tibetan ground jay  ============
B D               Zebra finch  ============
  D    White-throated sparrow  ============
  D            Painted turtle  ============
B D        American alligator  ============
B D                Budgerigar  ============
  D               Rock pigeon  ============
B D       Medium ground finch  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
B D                   Wallaby  ============
B D                  Platypus  ============
  D  Chinese softshell turtle  ============
B D                 Orangutan  NNNNNNNNNNNN
  D       Collared flycatcher  ============

Alignment block 29 of 523 in window, 34621935 - 34621945, 11 bps 
B D                     Human  tg----ctagtag-ag
B D                     Chimp  tg----ctagtag-ag
B D                   Gorilla  tg----ctagtag-ag
B D                    Gibbon  tg----ctagtag-ag
B D                    Rhesus  tg----ctagtag-ag
B D       Crab-eating macaque  tg----ctagtag-ag
B D                    Baboon  tg----ctagtag-ag
B D              Green monkey  tg----ctagtag-at
B D                  Marmoset  tg----ctagtag-ag
B D           Squirrel monkey  tg----ctaatag-ag
B D                  Bushbaby  tg----ctagtag-ag
           Chinese tree shrew  tg----ctagtag-ag
B D                  Squirrel  tg----ctagtag-ag
       Lesser Egyptian jerboa  tg----ctagtag-ag
                 Prairie vole  tg----ctagtag-ag
B D           Chinese hamster  tg----ctggtag-ag
               Golden hamster  tg----ctggtag-ag
B D                     Mouse  tg----ctcatag-ag
B D                       Rat  tg----ctcatag-ag
B D            Naked mole-rat  tg----ctagtagaa-
B D                Guinea pig  tg----ctactgt-a-
                   Chinchilla  tg----ctagtag-a-
             Brush-tailed rat  tg----ctagtac-a-
B D                    Rabbit  tg----ctagtaa-gg
B D                      Pika  tg----ctaattg-gg
B D                       Pig  tg----ctagtag-ag
B D                    Alpaca  tg----ctaatag-ag
               Bactrian camel  tg----ctaatag-ag
B D                   Dolphin  tg----ctagtag-aa
                 Killer whale  tg----ctagtag-aa
             Tibetan antelope  tg----ctagtag-ag
B D                       Cow  tg----ctagtag-ag
B D                     Sheep  tg----ctagtag-ag
                Domestic goat  tg----ctagtag-ag
B D                     Horse  tg----ctaggag-ag
B D          White rhinoceros  tg----ctcgtag-ag
B D                       Cat  tg----ctagctg-ag
B D                       Dog  tg----ctagctg-ag
B D                   Ferret   tg----ctagctg-ag
B D                     Panda  tg----ctagctg-ag
               Pacific walrus  tg----ctagctg-aa
                 Weddell seal  tg----ctagctg-aa
             Black flying-fox  tc----ccagtag-aa
B D                   Megabat  tc----ccagtag-aa
                Big brown bat  tg----caagtag-aa
         David's myotis (bat)  tg----caaatag-aa
B D                  Microbat  tg----caagtag-aa
B D                  Hedgehog  tg----ctagtag-ag
B D                     Shrew  tg----ctagtag-ag
              Star-nosed mole  tg----ctagtag-gg
B D                  Elephant  tg----ctagtag-ag
          Cape elephant shrew  tg----ctagtag-gg
B D                   Manatee  tg----ctagtag-ag
             Cape golden mole  tg----ctggtag-aa
B D                    Tenrec  tg----ctagtag-ag
                     Aardvark  tg----ctcatag-ag
B D                 Armadillo  tg----ctagtaa-ag
B D                   Opossum  ta----ccagtat-ag
B D           Tasmanian devil  t---------------
B D             X. tropicalis  agagccatagaaa-gg
B D                 Tetraodon  -a----ctggcag---
B D                      Fugu  tg----ctggcag-ag
       Yellowbelly pufferfish  tg----ctggcag-ag
B D                    Medaka  -------tggagg-ac
                  Spotted gar  -------tgatag-gc
  D    Spiny softshell turtle  ================
B D                    Turkey  ================
B D                   Chicken  ================
          Tibetan ground jay  ================
B D               Zebra finch  ================
  D    White-throated sparrow  ================
  D            Painted turtle  ================
B D        American alligator  ================
B D                Budgerigar  ================
  D               Rock pigeon  ================
B D       Medium ground finch  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
B D                   Wallaby  ================
B D                  Platypus  ================
  D  Chinese softshell turtle  ================
B D                 Orangutan  NNNNNNNNNNNNNNNN
  D       Collared flycatcher  ================

Inserts between block 29 and 30 in window
B D                 Squirrel 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                 Hedgehog 1bp
B D                  Opossum 892bp
B D            X. tropicalis 1bp

Alignment block 30 of 523 in window, 34621946 - 34621950, 5 bps 
B D                     Human  gaagt
B D                     Chimp  gaagt
B D                   Gorilla  gaagt
B D                    Gibbon  gaagt
B D                    Rhesus  gaagt
B D       Crab-eating macaque  gaagt
B D                    Baboon  gaagt
B D              Green monkey  gaagt
B D                  Marmoset  gaagt
B D           Squirrel monkey  gaagt
B D                  Bushbaby  aaagt
           Chinese tree shrew  aaaat
B D                  Squirrel  aaaat
       Lesser Egyptian jerboa  aaagt
                 Prairie vole  aaaat
B D           Chinese hamster  aaaat
               Golden hamster  aaaat
B D                     Mouse  aaaat
B D                       Rat  aaaat
B D            Naked mole-rat  aaagt
B D                Guinea pig  aaaat
                   Chinchilla  aaagg
             Brush-tailed rat  aaagc
B D                    Rabbit  aaagt
B D                      Pika  aaaat
B D                       Pig  aaagt
B D                    Alpaca  aaagt
               Bactrian camel  aaagt
B D                   Dolphin  aaagt
                 Killer whale  aaagt
             Tibetan antelope  aaagt
B D                       Cow  aaagt
B D                     Sheep  aaagt
                Domestic goat  aaagt
B D                     Horse  aaagt
B D          White rhinoceros  aaagt
B D                       Cat  aaaat
B D                       Dog  taaat
B D                   Ferret   aaatt
B D                     Panda  aaaat
               Pacific walrus  aaaat
                 Weddell seal  aaaat
             Black flying-fox  aaaga
B D                   Megabat  aaaga
                Big brown bat  aaagt
         David's myotis (bat)  aaagt
B D                  Microbat  aaagt
B D                  Hedgehog  aaaat
B D                     Shrew  caaat
              Star-nosed mole  aaagt
B D                  Elephant  acagt
          Cape elephant shrew  acagt
B D                   Manatee  acagt
             Cape golden mole  acagt
B D                    Tenrec  atagt
                     Aardvark  gcagt
B D                 Armadillo  --agt
B D           Tasmanian devil  -aaga
B D             X. tropicalis  agaa-
B D                 Tetraodon  -cgac
B D                      Fugu  aagat
       Yellowbelly pufferfish  aagat
B D                    Medaka  tgagc
                  Spotted gar  tgatc
  D    Spiny softshell turtle  =====
B D                    Turkey  =====
B D                   Chicken  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
  D    White-throated sparrow  =====
  D            Painted turtle  =====
B D        American alligator  =====
B D                Budgerigar  =====
B D                   Opossum  =====
  D               Rock pigeon  =====
B D       Medium ground finch  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
B D                   Wallaby  =====
B D                  Platypus  =====
  D  Chinese softshell turtle  =====
B D                 Orangutan  NNNNN
  D       Collared flycatcher  =====

Alignment block 31 of 523 in window, 34621951 - 34621958, 8 bps 
B D                     Human  ctaaa-----at-c
B D                     Chimp  ctaaa-----at-c
B D                   Gorilla  ctaaa-----at-c
B D                    Gibbon  ctaaa-----at-c
B D                    Rhesus  ctaaa-----at-c
B D       Crab-eating macaque  ctaaa-----at-c
B D                    Baboon  ctaaa-----at-c
B D              Green monkey  ctaaa-----at-c
B D                  Marmoset  ctgaa-----at-c
B D           Squirrel monkey  ctaaa-----at-c
B D                  Bushbaby  ttaaa-----at-c
           Chinese tree shrew  ctaaa-----at-c
B D                  Squirrel  ctaaa-----ac-c
       Lesser Egyptian jerboa  gtaaa-----at-c
                 Prairie vole  ctaaa-----at-c
B D           Chinese hamster  ctaaa-----at-c
               Golden hamster  ctaaa-----gt-c
B D                     Mouse  ctaaa-----atcc
B D                       Rat  ctaaa-----at-c
B D            Naked mole-rat  ctaaa-----gt-c
B D                Guinea pig  ctaaa-----gt-c
                   Chinchilla  ctaaa-----gt-c
             Brush-tailed rat  ctaaa-----gc-c
B D                    Rabbit  ctaaa-----at-c
B D                      Pika  ctaaa-----ct-c
B D                       Pig  ctaaa-----at-c
B D                    Alpaca  ctaaa-----at-c
               Bactrian camel  ctaaa-----at-c
B D                   Dolphin  ct--a-----at-c
                 Killer whale  ctaaa-----at-c
             Tibetan antelope  ctaaa-----ac-c
B D                       Cow  ctaaa-----ac-c
B D                     Sheep  ctaaa-----ac-c
                Domestic goat  ctaaa-----ac-c
B D                     Horse  ctaaa-----at-c
B D          White rhinoceros  ctaaa-----at-c
B D                       Cat  ctaaa-----at-c
B D                       Dog  ctaaa-----at-c
B D                   Ferret   ctaaa-----at-c
B D                     Panda  ctaaa-----at-c
               Pacific walrus  ctaaa-----at-c
                 Weddell seal  ctaaa-----at-c
             Black flying-fox  ctaaa-----at-c
B D                   Megabat  ctaaa-----at-c
                Big brown bat  ctaaa-----at-c
         David's myotis (bat)  ctaaa-----at-c
B D                  Microbat  ctaaa-----at-c
B D                  Hedgehog  ctaaa-----at-c
B D                     Shrew  ctaca-----at-c
              Star-nosed mole  ctaaa-----at-c
B D                  Elephant  ctaaa-----at-c
          Cape elephant shrew  ctaaa-----at-c
B D                   Manatee  ctaaa-----at-c
             Cape golden mole  ctaaa-----at-c
B D                    Tenrec  ctaaa-----at-c
                     Aardvark  ctaaa-----at-c
B D                 Armadillo  ctaaa-----at-c
B D                   Opossum  ctcta-----at-t
B D             X. tropicalis  ttaat-----ag-c
B D                 Tetraodon  atgaa-----ac-c
B D                      Fugu  atgaaggtttat-t
       Yellowbelly pufferfish  aagaaggtttat-t
B D                    Medaka  gccagg----gt-g
                  Spotted gar  tagaa-----ac-t
  D    Spiny softshell turtle  ==============
B D                    Turkey  ==============
B D                   Chicken  ==============
          Tibetan ground jay  ==============
B D               Zebra finch  ==============
  D    White-throated sparrow  ==============
B D           Tasmanian devil  --------------
  D            Painted turtle  ==============
B D        American alligator  ==============
B D                Budgerigar  ==============
  D               Rock pigeon  ==============
B D       Medium ground finch  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
B D                   Wallaby  ==============
B D                  Platypus  ==============
  D  Chinese softshell turtle  ==============
B D                 Orangutan  NNNNNNNNNNNNNN
  D       Collared flycatcher  ==============

Alignment block 32 of 523 in window, 34621959 - 34621961, 3 bps 
B D                     Human  ccc
B D                     Chimp  ccc
B D                   Gorilla  ccc
B D                    Gibbon  ccc
B D                    Rhesus  ccc
B D       Crab-eating macaque  ccc
B D                    Baboon  ccc
B D              Green monkey  ccc
B D                  Marmoset  ccc
B D           Squirrel monkey  ccc
B D                  Bushbaby  gcc
           Chinese tree shrew  ccc
B D                  Squirrel  ccc
       Lesser Egyptian jerboa  ccc
                 Prairie vole  ccc
B D           Chinese hamster  ccc
               Golden hamster  tcc
B D                     Mouse  ccc
B D                       Rat  cac
B D            Naked mole-rat  ccc
B D                Guinea pig  ctc
                   Chinchilla  ccc
             Brush-tailed rat  ccc
B D                    Rabbit  ccc
B D                      Pika  ccc
B D                       Pig  ccc
B D                    Alpaca  ccc
               Bactrian camel  ccc
B D                   Dolphin  ccc
                 Killer whale  ccc
             Tibetan antelope  tcc
B D                       Cow  tcc
B D                     Sheep  tcc
                Domestic goat  tcc
B D                     Horse  ccc
B D          White rhinoceros  ccc
B D                       Cat  ccc
B D                       Dog  ccc
B D                   Ferret   ccc
B D                     Panda  ccc
               Pacific walrus  ccc
                 Weddell seal  ccc
             Black flying-fox  ccc
B D                   Megabat  ccc
                Big brown bat  ccc
         David's myotis (bat)  ccc
B D                  Microbat  ccc
B D                  Hedgehog  ccc
B D                     Shrew  gcc
              Star-nosed mole  ccc
B D                  Elephant  ccc
          Cape elephant shrew  ccc
B D                   Manatee  ccc
             Cape golden mole  ccc
B D                    Tenrec  ccc
                     Aardvark  ccc
B D                 Armadillo  ccc
B D                   Opossum  ccc
B D             X. tropicalis  ccc
B D                 Tetraodon  ctc
B D                      Fugu  ccc
       Yellowbelly pufferfish  ccc
B D                    Medaka  ctg
                  Spotted gar  cca
  D    Spiny softshell turtle  ===
B D                    Turkey  ===
B D                   Chicken  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D           Tasmanian devil  ---
  D            Painted turtle  ===
B D        American alligator  ===
B D                Budgerigar  ===
  D               Rock pigeon  ===
B D       Medium ground finch  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
B D                   Wallaby  ===
B D                  Platypus  ===
  D  Chinese softshell turtle  ===
B D                 Orangutan  NNN
  D       Collared flycatcher  ===

Alignment block 33 of 523 in window, 34621962 - 34621970, 9 bps 
B D                     Human  a--tgccagcc
B D                     Chimp  a--tgccagcc
B D                   Gorilla  a--tgccagcc
B D                    Gibbon  a--tgccagcc
B D                    Rhesus  a--tgccagcc
B D       Crab-eating macaque  a--tgccagct
B D                    Baboon  a--tgccagcc
B D              Green monkey  a--tgccagcc
B D                  Marmoset  a--tgccagcc
B D           Squirrel monkey  a--tgccagcc
B D                  Bushbaby  a--tgccaatc
           Chinese tree shrew  a--tgctagtc
B D                  Squirrel  a--tgctagtc
       Lesser Egyptian jerboa  a--tgccagtt
                 Prairie vole  a--tgccagcc
B D           Chinese hamster  a--tgcctgtt
               Golden hamster  a--tgccagtc
B D                     Mouse  a--tgccaatg
B D                       Rat  a--tgccacag
B D            Naked mole-rat  a--tgccagac
B D                Guinea pig  a--tgccagcc
                   Chinchilla  a--tgccagac
             Brush-tailed rat  a--tgccagac
B D                    Rabbit  a--tgccaatc
B D                      Pika  a--tgccagtc
B D                       Pig  a--tgccagtg
B D                    Alpaca  a--tgccagtg
               Bactrian camel  a--tgccagtg
B D                   Dolphin  a--tgccagtg
                 Killer whale  a--tgccagtg
             Tibetan antelope  a--tgccggca
B D                       Cow  a--tgctggca
B D                     Sheep  a--tgccggca
                Domestic goat  a--tgccggca
B D                     Horse  a--tgccagtg
B D          White rhinoceros  a--tgccagtg
B D                       Cat  a--tgccagag
B D                       Dog  a--tgccagag
B D                   Ferret   a--tgccagag
B D                     Panda  a--tgccagag
               Pacific walrus  a--tgccaaag
                 Weddell seal  a--tgccagag
             Black flying-fox  a--tgccagtg
B D                   Megabat  a--tgccagtg
                Big brown bat  a--tgccaatg
         David's myotis (bat)  a--tgccaatg
B D                  Microbat  a--tgccaatg
B D                  Hedgehog  a--tgccagtg
B D                     Shrew  a--tgccagtg
              Star-nosed mole  a--tgctggtg
B D                  Elephant  a--tgccagtg
          Cape elephant shrew  a--tgccagtg
B D                   Manatee  a--tgccagtg
             Cape golden mole  a--tgccagtg
B D                    Tenrec  a--tgccagtg
                     Aardvark  a--tgccaatg
B D                 Armadillo  a--tgccagtg
B D                   Opossum  a--taccagtg
B D           Tasmanian devil  --------gtg
  D                    Parrot  a--ggccagcc
B D             X. tropicalis  -----ccgggg
B D                 Tetraodon  a--gagagcc-
B D                      Fugu  a--cacaactt
       Yellowbelly pufferfish  a--cacaactt
B D                    Medaka  c--tataactt
                  Spotted gar  aagtgcaggtt
  D    Spiny softshell turtle  ===========
B D                    Turkey  ===========
B D                   Chicken  ===========
          Tibetan ground jay  ===========
B D               Zebra finch  ===========
  D    White-throated sparrow  ===========
  D            Painted turtle  ===========
B D        American alligator  ===========
B D                Budgerigar  ===========
  D               Rock pigeon  ===========
B D       Medium ground finch  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
B D                   Wallaby  ===========
B D                  Platypus  ===========
  D  Chinese softshell turtle  ===========
B D                 Orangutan  NNNNNNNNNNN
  D       Collared flycatcher  ===========

Inserts between block 33 and 34 in window
B D                  Opossum 20bp
B D          Tasmanian devil 20bp
  D                   Parrot 2bp
B D            X. tropicalis 4bp
B D                Tetraodon 21bp

Alignment block 34 of 523 in window, 34621971 - 34621982, 12 bps 
B D                     Human  --taaatacccctg
B D                     Chimp  --taaatacccctg
B D                   Gorilla  --taaatacccctg
B D                    Gibbon  --taaatacccc-g
B D                    Rhesus  --taaatacccctg
B D       Crab-eating macaque  --taaatacccctg
B D                    Baboon  --taaatacccctg
B D              Green monkey  --taaatacccctg
B D                  Marmoset  --taaatgccccca
B D           Squirrel monkey  --taaatgcccctg
B D                  Bushbaby  --taaatatccctg
           Chinese tree shrew  --taaataccacag
B D                  Squirrel  --taaatacccctg
       Lesser Egyptian jerboa  --taaat---tcca
                 Prairie vole  --taaac---ccca
B D           Chinese hamster  --taaat---ccca
               Golden hamster  --taaat---ccca
B D                     Mouse  --aaaaa---gcca
B D                       Rat  --taaat---ccca
B D            Naked mole-rat  --taaata--cccg
B D                Guinea pig  --tgaatat-cctg
                   Chinchilla  --taaatacacctg
             Brush-tailed rat  --taaatatccctg
B D                    Rabbit  --tcaat-------
B D                      Pika  --taaataccactg
B D                       Pig  --taaatacccctg
B D                    Alpaca  --taaatgcccctg
               Bactrian camel  --taaatgcccctg
B D                   Dolphin  --taaatacccctg
                 Killer whale  --taaatacccctg
             Tibetan antelope  --taaatacccctg
B D                       Cow  --taaatacccctg
B D                     Sheep  --taaatacccctg
                Domestic goat  --taaatacccctg
B D                     Horse  --taaatacccctg
B D          White rhinoceros  --taaatacccctg
B D                       Cat  --caaatacccctg
B D                       Dog  --caaatacccctg
B D                   Ferret   --caaatacccctg
B D                     Panda  --caaacacccctg
               Pacific walrus  --caaatacccctg
                 Weddell seal  --caaatacccctg
             Black flying-fox  --taaataccccta
B D                   Megabat  --taaataccccta
                Big brown bat  --taaatacccctg
         David's myotis (bat)  --taaatacccctg
B D                  Microbat  --taaatacccctg
B D                  Hedgehog  --aa----------
B D                     Shrew  --taaatacccctg
              Star-nosed mole  --taaatacccctg
B D                  Elephant  --taaataccccca
          Cape elephant shrew  --taaacatcc---
B D                   Manatee  --taaatacccctg
             Cape golden mole  --taa---------
B D                    Tenrec  --taaataccctgg
                     Aardvark  --taaatacccctg
B D                 Armadillo  --taactacccctg
B D                   Opossum  --tagatattttgg
B D           Tasmanian devil  --tagatatttctg
B D                   Wallaby  --tagatattccta
  D                    Parrot  --tgaccatgcc--
B D             X. tropicalis  --tgtttcccccc-
B D                      Fugu  tgtttaagtcgc--
       Yellowbelly pufferfish  tgtttaagtcac--
B D                    Medaka  attgaatttcct--
                  Spotted gar  taaaaagacaaa--
  D    Spiny softshell turtle  ==============
B D                 Tetraodon  ==============
B D                    Turkey  ==============
B D                   Chicken  ==============
          Tibetan ground jay  ==============
B D               Zebra finch  ==============
  D    White-throated sparrow  ==============
  D            Painted turtle  ==============
B D        American alligator  ==============
B D                Budgerigar  ==============
  D               Rock pigeon  ==============
B D       Medium ground finch  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
B D                  Platypus  ==============
  D  Chinese softshell turtle  ==============
B D                 Orangutan  NNNNNNNNNNNNNN
  D       Collared flycatcher  ==============

Alignment block 35 of 523 in window, 34621983 - 34621989, 7 bps 
B D                     Human  a-------ccccat
B D                     Chimp  a-------ccccat
B D                   Gorilla  a-------ccccat
B D                    Gibbon  a-------ccccat
B D                    Rhesus  a-------ccccat
B D       Crab-eating macaque  a-------ccccat
B D                    Baboon  a-------ccccat
B D              Green monkey  a-------ccccat
B D                  Marmoset  a-------ccccat
B D           Squirrel monkey  a-------ccccat
B D                  Bushbaby  g-------ctccat
           Chinese tree shrew  a-------ccccat
B D                  Squirrel  a-------ctccat
       Lesser Egyptian jerboa  a-------tttcat
                 Prairie vole  a-------cttcat
B D           Chinese hamster  a-------cttcat
               Golden hamster  a-------ctccat
B D                     Mouse  a-------cttcat
B D                       Rat  a-------cttcat
B D            Naked mole-rat  a-------ctccat
B D                Guinea pig  a-------ctccat
                   Chinchilla  a-------ctccac
             Brush-tailed rat  a-------ctccat
B D                    Rabbit  a-------ctccat
B D                      Pika  a-------cttcat
B D                       Pig  a-------cctcat
B D                    Alpaca  a-------cctcat
               Bactrian camel  a-------cttcat
B D                   Dolphin  a-------cctcat
                 Killer whale  a-------cctcat
             Tibetan antelope  a-------cctcat
B D                       Cow  a-------cctcat
B D                     Sheep  a-------cctcat
                Domestic goat  a-------cctcat
B D                     Horse  a-------cctcat
B D          White rhinoceros  a-------cctcat
B D                       Cat  a-------cctcat
B D                       Dog  a-------cctcat
B D                   Ferret   a-------cttcat
B D                     Panda  a-------cctcat
               Pacific walrus  a-------cttcat
                 Weddell seal  a-------cctcat
             Black flying-fox  a-------cctcat
B D                   Megabat  a-------cctcat
                Big brown bat  a-------cctcat
         David's myotis (bat)  a-------cctcat
B D                  Microbat  a-------cctcat
B D                     Shrew  a-------cctcat
              Star-nosed mole  a-------tttcat
B D                  Elephant  a-------acccat
          Cape elephant shrew  ---------cccat
B D                   Manatee  a-------ccccat
B D                    Tenrec  a-------ccccat
                     Aardvark  a-------cctcat
B D                 Armadillo  a-------ccccat
B D                   Opossum  aat-----ccctat
B D           Tasmanian devil  aac-----ccccat
B D                   Wallaby  aa------ccccat
  D                    Parrot  -accctctccctgt
  D             Scarlet macaw  -accctctccctgt
B D             X. tropicalis  -------cccccat
B D                  Hedgehog  --------------
  D    Spiny softshell turtle  ==============
            Cape golden mole  --------------
                 Spotted gar  --------------
      Yellowbelly pufferfish  --------------
B D                      Fugu  --------------
B D                 Tetraodon  ==============
B D                    Turkey  ==============
B D                   Chicken  ==============
          Tibetan ground jay  ==============
B D               Zebra finch  ==============
  D    White-throated sparrow  ==============
B D                    Medaka  --------------
  D            Painted turtle  ==============
B D        American alligator  ==============
B D                Budgerigar  ==============
  D               Rock pigeon  ==============
B D       Medium ground finch  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
B D                  Platypus  ==============
  D  Chinese softshell turtle  ==============
B D                 Orangutan  NNNNNNNNNNNNNN
  D       Collared flycatcher  ==============

Alignment block 36 of 523 in window, 34621990 - 34621999, 10 bps 
B D                     Human  gccagtgtag
B D                     Chimp  gccagtgtag
B D                   Gorilla  gccagtgtag
B D                    Gibbon  gccagtgtag
B D                    Rhesus  gccagtgtag
B D       Crab-eating macaque  gccagtgtag
B D                    Baboon  gccagtgtag
B D              Green monkey  gccagtgtag
B D                  Marmoset  gccactgtag
B D           Squirrel monkey  gccattgtag
B D                  Bushbaby  gccagtgtag
           Chinese tree shrew  gccagtatag
B D                  Squirrel  gccagtgtag
       Lesser Egyptian jerboa  gccagtgtga
                 Prairie vole  gccagtgtag
B D           Chinese hamster  gccagtgtag
               Golden hamster  gccagtgtag
B D                     Mouse  gccaatatag
B D                       Rat  gccaatatag
B D            Naked mole-rat  gccagtgtag
B D                Guinea pig  gccagtgtag
                   Chinchilla  gccagtgtag
             Brush-tailed rat  gccagtgtag
B D                    Rabbit  gctagtgtag
B D                      Pika  gctagtgtag
B D                       Pig  gccagtatag
B D                    Alpaca  gccaatatag
               Bactrian camel  gccaatatag
B D                   Dolphin  gccagtatag
                 Killer whale  gccagtatag
             Tibetan antelope  gcgaacagaa
B D                       Cow  gcgatcagaa
B D                     Sheep  gcgaacagaa
                Domestic goat  gcgaacagaa
B D                     Horse  gccagtgtag
B D          White rhinoceros  gccagtgtag
B D                       Cat  gccagtgtag
B D                       Dog  gccagtatag
B D                   Ferret   gccagtatag
B D                     Panda  gccagtatag
               Pacific walrus  gccagtatag
                 Weddell seal  gccagtatag
             Black flying-fox  gccagtatag
B D                   Megabat  gccagtatag
                Big brown bat  gccagtgcag
         David's myotis (bat)  gccagtgcag
B D                  Microbat  gccagtgcag
B D                  Hedgehog  ---------g
B D                     Shrew  gccactgtag
              Star-nosed mole  gccagtgtga
B D                  Elephant  gccagtgtag
          Cape elephant shrew  gccattgtag
B D                   Manatee  gccagtgtag
B D                    Tenrec  gccagtgtag
                     Aardvark  gccagtataa
B D                 Armadillo  gccagtgtag
B D                   Opossum  gccattatag
B D           Tasmanian devil  gccagtatag
B D                   Wallaby  gccagtatag
  D                    Parrot  gccac-----
  D             Scarlet macaw  gccac-----
B D             X. tropicalis  agtactgaaa
B D                      Fugu  ---------g
       Yellowbelly pufferfish  ---------g
B D                    Medaka  ---------g
                  Spotted gar  ---------g
B D                   Lamprey  gttagtgtcg
  D    Spiny softshell turtle  ==========
            Cape golden mole  ----------
B D                 Tetraodon  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
          Tibetan ground jay  ==========
B D               Zebra finch  ==========
  D    White-throated sparrow  ==========
  D            Painted turtle  ==========
B D        American alligator  ==========
B D                Budgerigar  ==========
  D               Rock pigeon  ==========
B D       Medium ground finch  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
B D                  Platypus  ==========
  D  Chinese softshell turtle  ==========
B D                 Orangutan  NNNNNNNNNN
  D       Collared flycatcher  ==========

Inserts between block 36 and 37 in window
B D                     Fugu 36bp
      Yellowbelly pufferfish 36bp
B D                   Medaka 13bp
                 Spotted gar 11bp

Alignment block 37 of 523 in window, 34622000 - 34622000, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D                  Marmoset  -a