Multiz Alignments of 30 mammals (27 primates)
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 56 in window, 89799379 - 89799417, 39 bps 
B D                     Human  aaaactaacgaatgaattcattgtctca-----tgaacaataag
B D                     Chimp  aaaactaacgaatgaattcattgtctca-----tgaccaataag
B D                    Bonobo  aaaactaacgaatgaattcattgtctca-----tgaccaataag
B D                   Gorilla  aaaactaacgaatgaattcattgtctca-----tgaacaataag
B D                 Orangutan  aaaactaacgaatgaattcattgtctca-----tgaacaataag
B D                    Gibbon  aaaactaacgaatgaatgcattgtctca-----tgaacaataag
B D                    Rhesus  aaaactaatta---tattcattgtctcg-----tgaacaataag
B D       Crab-eating macaque  aaaactaatta---tattcattgtctcg-----tgaacaataag
           Pig-tailed macaque  aaaactaatta---tattcattgtctcg-----tgaacaataag
               Sooty mangabey  aaaactaatga---tattcattgtctcg-----tgaacaataag
                       Baboon  aaaactaatga---tattcattgtctcg-----tgaacaataag
B D              Green monkey  aaaactaatga---tattcattgtctcg-----tgaacaataag
                        Drill  aaaactaatga---tattcattgtctcg-----tgaacaataag
B D          Proboscis monkey  aaaactaatga---tattcattgtctca-----tgaacaataag
              Angolan colobus  aaaactaatga---tattcattgtctca-----tgaagaataag
B D  Golden snub-nosed monkey  aaaactaatga---tattcattgtctca-----tgaacaataag
      Black snub-nosed monkey  aaaactaatga---tattcattgtctca-----tgaacaataag
B D                  Marmoset  -aaactaatgaatga----attgtctca-----ttaacaataag
B D           Squirrel monkey  -aaactaataaatgaattcattgtctcg-----ttaacagtaag
          White-faced sapajou  -aaacgaatgaattc----attgtct-a-----ttaacaataag
            Ma's night monkey  -aaactaatgaatgaattcattgtctca-----ttaccaataag
B D                   Tarsier  aaaactaaggaaacaatctgttgactca-----ctaacaataag
                  Mouse lemur  aaagctaaggaatgaattcattgactca-----ttaacaataag
B D                  Bushbaby  aatgctaaggaatgattcctttgactca-----ttaacaatagg
B D                     Mouse  aaaa-tatagaacagattcataaattcaaattgtggagaat---
B D                       Dog  aaaactgaggattaaatcca-------------tcaacaata--
B D                 Armadillo  aaagcaaaggaatgaatccattgactca-----ttaaaaatagc
             Sclater's lemur  ============================================
                 Black lemur  ============================================
           Coquerel's sifaka  ============================================

Inserts between block 1 and 2 in window
                 Mouse lemur 1065bp

Alignment block 2 of 56 in window, 89799418 - 89799929, 512 bps 
B D                     Human  cctaggcagataagaggaactgggactccttggagaaagagttgattctagg---cgtagaactaggaca
B D                     Chimp  cctaggcagataagaggaactgggactccttggagaaagagttgattctagg---cgtagaactaggaca
B D                    Bonobo  cctaggcagataagaggaactgggactccttggagaaagagttgattctagg---cgtagaactaggaca
B D                   Gorilla  cctaggcagataagaggaactgggactccttggagaaagagttgattctagg----gtagaactaggaca
B D                 Orangutan  cctaggcagataagaggaactgggactccttggagagagagttgattctaag---cgtggaactaggaca
B D                    Gibbon  cctaggcagataagaggaactgggactccttggagaaagagttgattctagg---cgtggaactaggaca
B D                    Rhesus  cctaggcaaataagaggaactgggactccttggagaaagagttaattctagg---cgtgggactaggaca
B D       Crab-eating macaque  cctaggcaaataagaggaactgggactccttggagaaagagttaattctagg---cgtgggactaggaca
           Pig-tailed macaque  cctaggcaaataagaggaactgggactccttggagaaagagttaattctagg---cgtgggactaggaca
               Sooty mangabey  cctaggcgaataagaggaactgggactccttggagaaagagttaattctagg---cgtgggactaggaca
                       Baboon  cctaggcaaataagaggaactgggactccttggagaaagagttaattctagg---cgtgggactagggca
B D              Green monkey  cctaggcaaataagaggaactgggactccttggagaaagagttaattctagg---cgtgggactaggaca
                        Drill  cctaggcaaataagaggaactgggactccttggagaaagagttaattctagg---cgtgggactaggaca
B D          Proboscis monkey  cttaggcaaataagaggaactgggattccttggagaaagagttgattctagg---cgtgggactaggaca
              Angolan colobus  cctaggcagacaagaggaactgggattccttggagaaagagttgattctagg---tgtgggactaggaca
B D  Golden snub-nosed monkey  cctaggcaaataagaggaactgggattccttagagaaagagttgattctagg---cgtgggactaggaca
      Black snub-nosed monkey  cctaggcaaataagaggaactgggattccttggagaaagagttgattatagg---tgtgggactaggaca
B D                  Marmoset  cctaggcaaataaagggaatagggtctcctcggagaaagagttgattctagg---ccggggactaggaga
B D           Squirrel monkey  cctag----------------gggtctcctcggagaaagcgttgcttctagg---ccagggactaggaga
          White-faced sapajou  cctaagcaaataaggggaaaagggtctcctcagagaaagagttgattctagg---caggagactaggaga
            Ma's night monkey  cctcggcaaataaggggaatagggtctcctcggagaaagagttgattctagg---ctggggtctaggaga
B D                   Tarsier  catagacaaattggagaaactgggtctccttggagaaacagctgatcccagg---tctggaactggggca
B D                  Bushbaby  -------gcttatcgggaagtaggaatccttgggaaaaaagtcagttctagggggccaaggactagggca
B D                     Mouse  ------taaggaagaggaatcagggctcctt-gagtagaagcgtattatagg---actgga--caggaaa
B D                       Dog  ---ggaaggacaaaaggaactagagctttttggagaaatagctggttctagg---actagggc-aagaag
B D                 Armadillo  tctagaccagtgaaaggaactagggctttttggagaaatgactgctgctatg---actggagctgga---
                 Mouse lemur  ======================================================================
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================
           Coquerel's sifaka  ======================================================================

                        Human  gattaa-agatgagcctgg-agcatcttacagtgttataaaattaggaagttctcga-a---atactgt-
                        Chimp  gattaa-agatgagcctgg-agcatcttacagtgctataaaattaggaagttctcga-a---atactgt-
                       Bonobo  gattaa-agatgagcctgg-agcatcttacagtgctataaaattaggaagttctcga-a---atactgt-
                      Gorilla  gattaa-agatgagcctgg-agcatcttacagtgccataaaattaggaagttct-ga-a---atactgt-
                    Orangutan  gattaa-agatgagcctgg-agcatcttatagtgccataaaattaggaagttatcga-a---atactgt-
                       Gibbon  gattaa-agatgagcctgg-agcatcttatagtgccataaaattaggaagttctcaa-a---atactgt-
                       Rhesus  gattaa-agatgaacctgg-agcgttttatagtgccataaaatcaagaagttctcgaaa---atactgt-
          Crab-eating macaque  gattaa-agatgaacctgg-agcgttttatagtgccataaaatcaagaagttctcgaaa---atactgt-
           Pig-tailed macaque  gattaa-agatgaacctgg-agcgttttatagtgccataaaatcaagaagttctcgaaa---atactgt-
               Sooty mangabey  gattaa-agatgaacctgg-agcgttttatagtgccataaaatcaagaagttctcgaaa---atactgt-
                       Baboon  gattaa-agatgagcctgg-agcattttatagtgccataaaattaggaagtgctcgaca---ataatgt-
                 Green monkey  gattaa-agaggaaactga-agcgttttatagtgccataaaatcaagaagttcttgaaa---atactgtc
                        Drill  gattaa-agatgaacctgg-agcgttttacagtgccataaaatcaagaagttcttgaaa---atactgt-
             Proboscis monkey  gattaa-agatgagcctgg-agcattttatagtgccataaaattgggaagttctcgaaa---atactgt-
              Angolan colobus  gattaa-agatgagcctgg-agcattttatagtgccataaaattaggaagttctcaaaa---atactgt-
     Golden snub-nosed monkey  gattaa-agatgagcctgg-agcattttatagtgccataaaattaggaagttcttgaaa---atactgt-
      Black snub-nosed monkey  gattaa-agatgagcctgg-agcattttatagtgccataaaattaggaagttctcgaaa---atactgt-
                     Marmoset  gaataa-agatgtgccagg-aacatctcatagtaccgtaaaattaggaagttcttaaaatatacaccgt-
              Squirrel monkey  gaataa-agatgggccagg-aacatcttatagtactgtgaaattaggacactcttaaaatatacacagt-
          White-faced sapajou  gaataa-agatgggccagg-aacatcttatagtaccgtaaaattaggaagttcttaaaatatacaccat-
            Ma's night monkey  gaataa-agatgggccagg-aatatcttatagtgccgtaaaattaggaagttcttaaaatatacaccgt-
                      Tarsier  gaa-aa-agatgaatctga-ggcttcttgtagtatcataaaataagaaagttctctaaa-----------
                     Bushbaby  ggaaaacagatgagtgtgg--gcatcttatagtgttataaaa--agaaaattttctaaa-----------
                        Mouse  tacata-caattagtctgc-tatattttatagcatcataaaataaggag---------a-----------
                          Dog  tatata-agatgagcctgg-accacatttttgtgccataaaataaggaagttttcaaaa-----------
                    Armadillo  -aatag-ccatagtcctggaaactttttatagggccatgtaagtaag-tgcccacaaaa---taaaaat-
                  Mouse lemur  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================
            Coquerel's sifaka  ======================================================================

                        Human  -------------cacaaacacacacactgataaagg--tgtcaaagggatgaagaaactaactaaaagt
                        Chimp  -------------cacaaacacacacactgataaagg--tgtcaaagagatgaagagactaactaaaagt
                       Bonobo  -------------cacaaacacacacactgataaagg--tgtcaaagagatgaagagactaactaaaagt
                      Gorilla  -------------cacaaacacacacactgataaagg--tgtcaaagggatgaagaaactaactaaaagt
                    Orangutan  -------------cacaaacacacacactgataaagg--tgtcaacgggatgaagaaactaactaaaagt
                       Gibbon  -------------cacaaacacacacactgataaagg--tgtcaaagggatgaaaaaactaactaaaagt
                       Rhesus  ---------cacacacacacacacacactgataaagg--tatcaaagggatgcagaaactaactaaaagt
          Crab-eating macaque  ---------cacacacacacacacacactgataaagg--tgtcaaagggatgcagaaactaactaaaagt
           Pig-tailed macaque  -cacacacacacacacacacacacacactgataaagg--tgtcaaagggatgcagaaactaactaaaagt
               Sooty mangabey  -----cacacacacacacacacacacactgataaagg--tgtcaaagggatgcagaaactaactaaaagt
                       Baboon  ---cacacacacacacacacacacacactgataaagg--tgtcaaagggatgcagaaactaactaaaagt
                 Green monkey  acacacacacacacacacacacacacactgataaagg--tgtcaaagggatgcagaaactaactaaaagt
                        Drill  ---ctcacacacacacacacacacacactgataaagg--tgtcaaagggatgcagaaactaactaaaagt
             Proboscis monkey  -----------cacacacacacacacactgataaagg--tgtcaaagggatgcagaaactaactaaaagt
              Angolan colobus  -----------cacatacacacacacactgataaagg--tgtcaaagggatgcagaaactaactcaaagt
     Golden snub-nosed monkey  -cacacacacacacacacacacacacactgataaagg--tgtcaaagggatgcagaaac-----------
      Black snub-nosed monkey  -----------cacacacacacacacactgataaagg--tgtcaaagggatgcagaaactaactaaaagt
                     Marmoset  -------------cacaaacacacacactaataaagg--catcgaagggatgcagaaactcactgaaagt
              Squirrel monkey  -------------cacaaacacacacactgataaaag--catcaaagggatgcagaaactaactaaaagt
          White-faced sapajou  -------------cacaaacacacacactgataaagg--catcaaagggatgcagaaactaactaaaagt
            Ma's night monkey  -------------cacaaacacacaccctgataaagg--catcaaagggatgcagaaactaactaaaagt
                      Tarsier  -------------cacatgcagacacactaatgaagg--tgtcaaaggggcacagaaaccaacagaaagt
                     Bushbaby  -------------cacacacatttgcactgataaagg--tgtcaaagggacatagtaaccaaatgaaagt
                        Mouse  -------------------------------------------aaaggg---------ctaaggaaaaat
                          Dog  -----------------cacacagactttcatgagggtatgtcatatggacataggaacctacagaaaat
                    Armadillo  ---------------taaacccacacattgatgagggtatgtcaatgggacagaggagtcaactg-aagt
                  Mouse lemur  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================
            Coquerel's sifaka  ======================================================================

                        Human  gccccaaatggccaaagctagaaaaatgtgagcaaa-aaattagataacataa---acagctctgagtta
                        Chimp  gccccaaatggccaaagctagaaaaatgtgagcaaa-aaattagatgacataa---acagctctgagtta
                       Bonobo  gccccaaatggccaaagctagaaaaatgtgagcaaa-aaattagatgacataa---acagctctgagtta
                      Gorilla  gccccaaatggccaaagctagaaaaatgtgagcaaa-aaattagataacataa---acagctctgagtta
                    Orangutan  gccccaaatggccaaagctagaaaaatgtgagcaaa-aaattagataacataa---acagctctgagtta
                       Gibbon  gccccaaatggccaaagctagaaaaatgtgagcaaa-aaattagataacataa---acag--ctgaatta
                       Rhesus  gccccgaacggccaaagctagaaaaatgtgagcaaa-aaattagataacataa---atagttctgagtta
          Crab-eating macaque  gccccgaacggccaaagctagaaaaatgtgagcaaa-aaattagataacataa---atagttctgagtta
           Pig-tailed macaque  gccccgaacggccaaagctagaaaaatgtgagcaaa-aaattagataacataa---atagttctgagtta
               Sooty mangabey  gccctgaatggccaaagctagaaaaatgtgagcaaa-aaattagataacataa---atagttctgagtta
                       Baboon  gccccgaatggccaaagctagaaaaatgtgagcaaa-aaattagataacataa---atagttctgagtta
                 Green monkey  gccccgaatggccaaagctagaaaaacgtgagcaaa-aaatt-gataacataa---atagttctcagtta
                        Drill  gccccgaatggccaaagctagaaaaatgtgagcaaa-aaattagataacataa---atagttctcagtta
             Proboscis monkey  gccccgaatggccaaagctagaaaaatatgagcaaa-aacttagataacataa---atagttctgagtta
              Angolan colobus  gccccgaatggccaaagctagaaaaacgtgagcaaa-aacttagataacataa---atagttctgagtta
     Golden snub-nosed monkey  --------------------------tatgagcaaa-aacttagataacataa---atagttctgagcta
      Black snub-nosed monkey  gccccgaatggccaaagctagaaaaatatgagcaaa-aacttagataacataa---atagttctgagcta
                     Marmoset  tccccaaatggccaaagctagaaaaatgtgagcaaa-aaattagataacataa---atatctctgagttc
              Squirrel monkey  tccccaaatggccaaagccagaaaaacgtgagcaaa-aaattagatgacttaa---atagttctgagttc
          White-faced sapajou  tccccaaatggccaaagctagaaaaatgtgagcaac-aaattagatgacataa---atagctctgagttc
            Ma's night monkey  tccccaaatggccaaagctagaaaaatgtgagcaaa-aaatgagataacataa---atatctctgagttc
                      Tarsier  tctccaaatgaccaaagctgacccaatgtgagcaaatataataaataa-ataaaacatagctttgagtcc
                     Bushbaby  tctcccaatggctaaatctggaataatatgagcaaa-a-----------ataa---atatccataagttt
                        Mouse  attttcattggttaagactggca---tgagaattaa-aaacc---caaaccaa---acacatctaagcct
                          Dog  actctcaatgaccaaaattggaacaatgtgagcaac-aaa---------acaa---ataaatatgaat--
                    Armadillo  gcttccagtgaccaaaagtggaaccatttgagtaac-aaa----agaaaataa---atatcagcgagttc
                  Mouse lemur  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================
            Coquerel's sifaka  ======================================================================

                        Human  ata-gtacataaattaataataaataaacatataaagca-gaagaaaggataaatttcccatgcagaaga
                        Chimp  ata-gtacataaattaataataaataaacatataaagca-gaagaaaggataaatttcccatgcagaaga
                       Bonobo  ata-gtacataaattaataataaataaacatataaagca-gaagaaaggataaatttcccatgcagaaga
                      Gorilla  ata-gtacataaattaataataaataaacatataaagca-gaagaaaggataaatttcccatgcagaaga
                    Orangutan  ata-gtacataaattaataataaataaacatataaagca-gaagaaaggacaaatttcccatgcagaaga
                       Gibbon  ata-gtacataaattaataataaataaacatataaagca-gaagaaaggacaaatttcccatgcagaaga
                       Rhesus  ata-gtacataaattaataataaataaacatataaagca-gaagaaaggacaaatttcctatgcagaaga
          Crab-eating macaque  ata-gtacataaattaataataaataaacatataaagca-gaagaaaggacaaatttcctatgcagaaga
           Pig-tailed macaque  ata-gtacatacattaataataaataaacatataaagca-gaagaaaggacaaatttcctatgcagaaga
               Sooty mangabey  ata-gtacataaattaataataaataaacatataaagca-gaagaaaggacaaatttcctatgcagaaga
                       Baboon  ata-gtacataaattaataataaataaacatataaagca-gaagaaaggacaaatttcctatgtagaaga
                 Green monkey  ata-gtacataaattaataataaataaacatataaagca-g-agaaaggacaaatttcctatacagaaga
                        Drill  ata-gtacataaattaataataaataaacatataaagca-gaagaaaggacaaatttcctatgcagaaga
             Proboscis monkey  atg-gtacatcaattaataataaataaacatataaagca-gaagaaagaacaaatttcctatgcagaaga
              Angolan colobus  atg-gtacatcaattaataataaataaacatataaagca-gaagaaagaacaaatttcctatgcagaaga
     Golden snub-nosed monkey  atg-gtacatcaattaataataaataaacatataaagca-gaagaaagaacaaatttcctatgcagaaga
      Black snub-nosed monkey  atg-gtacatcaattaataataaataaacatataaagca-gaagaaagaacaaatttcctatgcagaaga
                     Marmoset  cta-gtacataaattaataataaataaacata----------caaaaggacacatttcccgtgc---aga
              Squirrel monkey  ata-gcacataaattaataataaataaacatatgaagca-ggcaaaaggacaaatttcccatgcag-aga
          White-faced sapajou  ata-gtatataaattaataataaataaacatacgaagca-ggcaaaaggacaaatttcccacgcagaaga
            Ma's night monkey  ata-gtacataaattaat----aataaacatatgaagca-gacaaaaggacaaatttcccatgcagaaga
                      Tarsier  atacttacataaatacatagcaaataaatacataaaggg-gtagaagagaaaaatgtcctg-gcagaaga
                     Bushbaby  atacttacacaaataaataatgaatgaatataaaaaggg-ggagaagagataaatttcccatgcagaaga
                        Mouse  gtatttatataaatagatggtgaataattgcatcaataatgaggaagagataattttatcaagc---aga
                          Dog  ----gtgtttaaataaattatgaataaatacataaat---agagaaaagagaaatctcacatgcagaaga
                    Armadillo  att-atgatataattagtgattaataaataaatatggga-gaagata------------catggagaaga
                  Mouse lemur  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================
            Coquerel's sifaka  ======================================================================

                        Human  attcccactaattcatatagatactccatcctccaaaaggttgagta-gaacatccagctccttaagtgt
                        Chimp  attcccactaattcatatagatactccatcctacaaaaggttgagta-gaacatacagctccttaagtgt
                       Bonobo  attcccactaattcatatagatactccatcctacaaaaggttgagta-gaacatacagctccttaagtgt
                      Gorilla  attcccactaattcatatagatactccatcctccaaaaggttaagta-gaacatccagctccttaagtgt
                    Orangutan  attcccactaattcatatagatactccatcctccaaaaggttgagta-gaacgcccagctccttaagtgt
                       Gibbon  attcccactaattcatatagatactccatcctccaaaaggttgagta-gaacgtccagctccttaagtgt
                       Rhesus  aataccactaattcatatagatactccatcctccaaaaggttgagta-gaacagccaactccttaagtgt
          Crab-eating macaque  aataccactaattcatatagatactccatcctccaaaaggttgagta-gaacagccaactccttaagtgt
           Pig-tailed macaque  aataccactaattcatatagatactccatcctccaaaaggttgagta-gaacagccaactccttaagtgt
               Sooty mangabey  attcccactaactcatatagatactccatcctccaaaaggttgagta-gaacagccaactccttaagtgt
                       Baboon  attcccactaattcatataggtactgcatcctccaaaatgttgagta-gaacagccagctccttaagtgt
                 Green monkey  aataccactaattcatatagatactccaccctccaaaaggttgaata-gaacagccagctccttaagtgt
                        Drill  attcccactaattcatatagatactccatcctgcaaaaggttgagta-gaacagccaactccttaagtgt
             Proboscis monkey  attctcactaattcatatagatactctatcctccaaaaggttgagta-gaacagccaactccttaagtgt
              Angolan colobus  attctcactaattcatatagatactctatcctccaaaaggttgagta-gaacagccaactccttaagtgt
     Golden snub-nosed monkey  attctcactaattcatatagatactctatcctccaaaaggttgagta-gaacaggcaactccttaagtgt
      Black snub-nosed monkey  attctcactaattcatatagatactctatcctccaaaaggttgagta-gaacaggcaactccttaagtgt
                     Marmoset  attcccactcattcatgtagacactccaacctccaaaatgt--agtg-tagcaaccaactccttaggtgt
              Squirrel monkey  attcccactcattcatgtagatactccatcctccaaaaggtagagtg-taacagccaactccttaagtgt
          White-faced sapajou  attcccactcattcatgtagatactccaccctccaaaatgtagagtg-taacagccaactccttaagtgt
            Ma's night monkey  attcccactcattcatgtagatactccatcctccaaaatgtagagtg-taacagccaactccttaagtgt
                      Tarsier  atcccaaatagtttaaacagtgactc-aacctctaggatactgagca-taatgcccaactctttaagtgt
                     Bushbaby  attccaaataattgatctaagtgctccct-------aaggttgac----------------------tgt
                        Mouse  ataccaaattatttattcagctattccatctttaaggaggtggggtg-taacactaggcatctgacaaat
                          Dog  attccaaataatttatgtacatagtccatgctcaaggagattgagcataaacttcccacttcttaaatgt
                    Armadillo  attttcaatactttatgtagatattccaaccttgaagcagttaagtc-tgactccca-cttcttaagtgt
                  Mouse lemur  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================
            Coquerel's sifaka  ======================================================================

                        Human  gagctgtg-cattgtgac-atctttccaaatagtacagtgta--gaaac----agtagcaa--aaagagt
                        Chimp  gagctgtg-cattgtgac-atctttccaaatagtacagtgta--gaaac----agtagcaa--aaagagt
                       Bonobo  gagctgtg-cattgtgac-atctttccaaatagtacagtgta--gaaac----agtagcaa--aaagagt
                      Gorilla  gagctgtg-cattgtgac-atctttccaaatagtacagtgta--gaaac----agtagcaa--aaagagt
                    Orangutan  gagctgtg-cattgtgacaatctttccaaatagtacagtgta--gaaac----agtagcaa--aaagagt
                       Gibbon  gagctgtg-cattgtgac-atctttccaaatagtacagtgta--gaaac----agcagcaa--aaagagt
                       Rhesus  gagctgtg-cattgtgac-atctttccaaatagtacagtgta--gaaac----agtagcaa--aatgagt
          Crab-eating macaque  gagctgtg-cattgtgac-atctttccaaatagtacagtgta--gaaac----agtagcaa--aatgagt
           Pig-tailed macaque  gagctgtg-cattgtgac-atctttccaaatagtacagtgta--gaaac----agtagcaa--aatgagt
               Sooty mangabey  gagctgtg-cattgtgac-atctttccaaatagtacagtgta--gaaac----agtagcaa--aatgagt
                       Baboon  gagctgtg-cattgtgac-atctttccaaatagtgcagtgta--gaaac----agtagcaa--aaggagt
                 Green monkey  gagctgtg-cattgtgac-atctttccgaatagtgcagtgta--gaaac----agtagcaa--aatgagt
                        Drill  gagctgtg-cattgtgac-atctttccaaatagtacagtgta--gaaac----agtagcaa--aatgagt
             Proboscis monkey  gagctgtg-cattgtgac-atctttccaaatagtacagtgta--gaagc----aatagcaa--aatgagc
              Angolan colobus  gagctgtg-cgttgtgac-atctttccaaatagtacagtgta--gaagc----aatagcaa--aatgagc
     Golden snub-nosed monkey  gagctgtg-cattgtgac-atctttccaaatagtacagtgta--gaagc----aatagcaa--aatgagc
      Black snub-nosed monkey  gagctgtg-cattgtgac-atctttccaaatagtacagtgta--gaagc----aatagcaa--aatgagc
                     Marmoset  gagctgtg-cattgtgac-atctttccaaacagtacactgta--gaacc----agtggcaa--aatgagt
              Squirrel monkey  gagctgtg-cattgtgac-agctttccaaatagtacagtgca--gaaac----agtggcaa--gatgagt
          White-faced sapajou  gagctgtg-cattgtgac-atctttccaaatagtacagtgta--gaaac----agtggtaa--aatgagt
            Ma's night monkey  gagctgtg-cattgtgat-ttctttccaaatagtacagtgta--gaaac----agtggcaa--aatgagt
                      Tarsier  ggactcct-catggtggt-atctttccaaagtgcacagagta--ttag------------a--aatgagt
                     Bushbaby  aggctgtg-catagtgac-acctttacaaaggaaacaatgta--gaaag----agggaaga--aattgag
                        Mouse  atattgta-tggtatatt-gtcctttcaaagagtagagtgtcttaaggg----aaaaaaaa--aaaaaag
                          Dog  agactgtgccagagtgcc-atctttcaaaagaatacagtatg--gaaatttggagtggagggtgatgaat
                    Armadillo  gggcagtg-cacagtcac-ttctttctaaagaatatagtatg--g--------agtgggag--gacgaat
                  Mouse lemur  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================
            Coquerel's sifaka  ======================================================================

                        Human  aatttcacaaggaaaaaacctgacaaacactattttatctcagtgatcaaggtcaacatcaaca
                        Chimp  aatttcacaaggaaaaaacctgacaaacactattttgtctcagtgatcaagggcaacatcaaca
                       Bonobo  aatttcacaaggaaaaaacctgacaaacactattttatctcagtgatcaagggcaacatcaaca
                      Gorilla  aatttcacaaggaaaaaacctgacaaacactattttatctcagtgatcaaggtcaacatcaaca
                    Orangutan  aatttcacaagaaacaaacctgacaaacactattttagctcagtgatcaaggtcaacatcaaca
                       Gibbon  aatttcacaaggaacaaacctgacaaacactattttagctcagtgatcaaggtcaacatcaaca
                       Rhesus  aatttcacaaggaacaaacctgacaaacactattttagctcagtgatcaaggtcaacatcaaca
          Crab-eating macaque  aatttcacaaggaacaaacctaacaaacactattttagctcagtgatcaaggtcaacatcaaca
           Pig-tailed macaque  aatttcacaaggaacaaacctgacaaacactattttagctcagtgatcaaggtcaacatcaaca
               Sooty mangabey  aatttcacaaggaacaaacctgacaaacactattttagctcagtgatcaaggtcaacatcaaca
                       Baboon  aatttcacaaggaacaaacctgacaaacactattttagctcagtgatcaaggtcaacatcaaca
                 Green monkey  aatttcacaaggaacaaacctgacaaacactattttagctcagtgatcaaggtcaacatcaaca
                        Drill  aatttcacaaggaacaaacctgacaaacactattttagctcagtgatcaaggtcaacatcaaca
             Proboscis monkey  aatttcacaaggaacaaacctgacaaacactattctagctcagtgatcaaggtcaacatcagca
              Angolan colobus  aatttcacgaggaacaaacctgacaaacactattctagctcagtgatcaaggccaacatcaaca
     Golden snub-nosed monkey  aatttcacaaggaacaaagctgacaaacactattctagctcagtgatcaaggtcaacatcaaca
      Black snub-nosed monkey  aatttcacaaggaacaaagctgacaaacactattctagctcagtgatcaaggtcaacatcaaca
                     Marmoset  aatttcgcaaggagcaaacctgtctaacactattttagctcagtgatcaaggtcagcatcaaca
              Squirrel monkey  aatttcacaaggaacaaacctgacaaacactattttagctcagtgatcaaggtcaacatcaaca
          White-faced sapajou  aatttcacaaggaacaaacctgacaaacacta-tttaactcagtgatcaaggtcaacatcaaca
            Ma's night monkey  gatttcacaaggaacaaacctgacaaacactattttagctcagtgatcaaggtcaacatcaaca
                      Tarsier  aacttcccagtggagaaacctgacaagcatgaccttaccccagagaccaaaatcaacgtcaaca
                     Bushbaby  tagttcacagtggagaaaccaatcaaacgctacttcagccaagagatcagggtgggcatcaaca
                        Mouse  aacttcacagtggaaaaacctggcaggcactgcctcagctacaagatcaaggtcaacaactaag
                          Dog  aactttatagtggagaaacctgacaaataccagcttaggtaagtgatgaaggttaaaatgatca
                    Armadillo  aattttacagtggataaaactgacaaa-actacctcagtccaatgatcaaggtctacattggca
                  Mouse lemur  ================================================================
              Sclater's lemur  ================================================================
                  Black lemur  ================================================================
            Coquerel's sifaka  ================================================================

Inserts between block 2 and 3 in window
B D                  Tarsier 305bp
B D                 Bushbaby 2bp
B D                    Mouse 2bp
B D                      Dog 9bp
B D                Armadillo 2bp

Alignment block 3 of 56 in window, 89799930 - 89800074, 145 bps 
B D                     Human  gagaagtcatgctggtagtatgaaccctcgtttaaatgttac-a-aaatagcattttgcccttatggtct
B D                     Chimp  gagaagtcatgctaatagtatgaaccttcgtttaaatgttac-a-gaatagcattttgcccttatggtct
B D                    Bonobo  gagaagtcatgctaatagtatgaaccttcgtttaaatgttac-a-gaatagcattttgcccttatggtct
B D                   Gorilla  gagaagtcatgctgatagtatgaagcctcgtttaaatgttac-a-aaatagcattttgcccttatggtct
B D                 Orangutan  gagaagtcatgctgatagtatgaacccttgtttaaatgttat-a-aaatagcattttgcccttatggtct
B D                    Gibbon  gagaagtcgtgctgatagtatgaactcttgtttaaatgttat-a-aaatagcattttgcccttatggtct
B D                    Rhesus  gagaagtcatgctgatagtatgaacccttgattaaatgttat-a-aaataacattttgcccttatggtct
B D       Crab-eating macaque  gagaagtcatgctgatagtatgaacccttgattaaatgttat-a-aaataacattttgcccttatggtct
           Pig-tailed macaque  gagaagtcatgctgatagtatgaacccttgattaaatgttat-a-aaataacattttgcctttatggtct
               Sooty mangabey  gagaagtcatgctgatagtatgaacccttgattaaatgttat-a-aaatagcattttgcccttatggtct
                       Baboon  gagaagtcatgctgatagtatgaacccttgatt-aatgttat-a-aaatagcattttgcccttatagtct
B D              Green monkey  gagaagtcatgccgatagtatgagcccttgatt-aatgtttt-a-aaatagcattttgcccttatggtct
                        Drill  gagaagtcatgctgatagtatgaacccttgattaaatgttat-a-aaatagcattttgcccttatggtct
B D          Proboscis monkey  gagaagtcatgctgatagtatgaacccttgattaaatgttat-a-aaatagcattttgcccttatggtct
              Angolan colobus  gagaagtcatgctgatagtatgaacccttgattaaatgttat-a-aaatagcattttgtccttatagtct
B D  Golden snub-nosed monkey  gagaagtcatgctaatagtatgaacccttgattaaatgttat-a-aaatagcattttgcccttatggtct
      Black snub-nosed monkey  gagaagtcatgctaatagtatgaacccttgattaaatgttat-a-aaatagcattttgcccttatggtct
B D                  Marmoset  gagaagtcgcgctgatagtatgta-ccttgatgaaatgttat-a-aaatagcattttgcccttaccgtct
B D           Squirrel monkey  gagaagtcatgctgatagtatgtacccttgatgaaatgttat-a-aaatagcattttgcccttacggtct
          White-faced sapajou  gagaagtcacgctgatagtatgtacccttgatgaaatgttat-a-aaatagcattttgcccttacggtct
            Ma's night monkey  gagaagtcacactgatagtctgtacccttgatgaaatgttat-a-aaatagcattttgcccttacggtct
B D                   Tarsier  gagaagtcatgttgatagtaggcacccttaattaaatgtgat-g-aaatggcctttcgtcttggtgatca
B D                  Bushbaby  gatgagtcatgctggtaccatgtacacttgact-aacatgat-g-aaataccatcttgcttttaatgtc-
B D                     Mouse  gataaatcattttgatagcataa--cctcgattacatgtgat-g-aaatcatgttttacctctat-----
B D                       Dog  tgtaagtcatgctgttaacgtgcatctttgataaaatgtgat-agaaatgacattctgtcttcgtggtcc
B D                 Armadillo  gaaaagtcatattgatggtatgta-ccttgataaagtgtgatga-aaattgcattttacctttgtggact
                 Mouse lemur  ======================================================================
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================
           Coquerel's sifaka  ======================================================================

                        Human  tctttcccaaaaccca-taacttcaatccaaacatg-agaaaaacattagacaaatctcaacagagggac
                        Chimp  tctttcccaaaaccca-taacttcaatccaaacatg-agaaaaacattagacaaatctcaacagagggac
                       Bonobo  tctttcccaaaaccca-taacttcaatccaaacatg-agaaaaacattagacaaatctcaacagagggac
                      Gorilla  tctttcccaaaaccca-taacttcaatccaaacatg-agaaaaacattagacaaatctcaacagagggac
                    Orangutan  tctttcccaaaaccca-taacttcaatccaaacatg-agaaaaacattagacaaatctcaacagagggac
                       Gibbon  tctttcccaaaaccca-taacttcaatgcaaacatg-agaaaaacattagacaaatctcaacagagggac
                       Rhesus  tctttcccaaaacccg-taactttaatctaaacatg-agataaacattagacaaatctcaacagagggac
          Crab-eating macaque  tctttcccaaaacccg-taactttaatctaaacatg-agataaacattagacaaatctcaacagagggac
           Pig-tailed macaque  tctttcccaaaacccg-taactttaatctaaacatg-agataaacattagacaaatctcaacagagggac
               Sooty mangabey  tctttcccaaaacccg-taactttaatctaaacatg-agataaacattagacaaatctcaacagagggac
                       Baboon  tctttcccaaaatccg-taattttaatctaaacatg-aaataaacattagacaaatctcaacagagggac
                 Green monkey  tctttcccaaaatctg-taattttaatctaaacatg-agataaacattagacaaatctcaacagagggac
                        Drill  tctttcccaaaacccg-taactttaatctaaacatg-agataaacattagacaaatctcaacagagggac
             Proboscis monkey  tctttctcaaaaccca-taacttcaacctaaacatg-agaaaaacattagacaaatctcaacagatggac
              Angolan colobus  tctttcccaaaacccattaacttcaacctaaacatg-agaaaaacattagacgaatctcaacagatggac
     Golden snub-nosed monkey  tctttctcaaaaccca-taacttcaacctaaacatg-agaaaaacattagacgaatctcaacagacggac
      Black snub-nosed monkey  tctttctcaaaaccca-taacttcaacctaaacatg-agaaaaacattagacgaatctcaacagacggac
                     Marmoset  tctttcccaaaagccg-taacttatatctaaatatgaagaaaagcatcagacaaatctcaacagagggac
              Squirrel monkey  tctttcccaaaacccg-taacttatatctaaacgtgaagaaaag---cagacaaatctcaacaaagggac
          White-faced sapajou  tctttcccaaaacccg-taacttacatctaaacatgaagaaaagcatcagacaaatctcaacagagggac
            Ma's night monkey  tctttcccaaaaccca-taacttatatctaaacatgaagaaaagcatcagacaaatctcaacagagggac
                      Tarsier  tccttcctgaaaccca-taacctcaatctaaacatg-agaaaaatctcagacaactctcaatagaggga-
                     Bushbaby  ---ttccaaaacccca-taactttcatctaaacaag-agaacaatggtagacaaatctcaatagagggat
                        Mouse  ------cccaaacccc-tcacctcaatctaacaataaggaaaaatacaagacaagtctccgcagaggaag
                          Dog  tgctcccccaaaccca-t-acctcaatctaaatgtg-agaaaaatatcagaagaatctcaatagaggaac
                    Armadillo  ttttcaccaaacccca-aaacccaaatttaatcatg-agaaaatcatcagacaaatcttaattgtgggtc
                  Mouse lemur  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================
            Coquerel's sifaka  ======================================================================

                        Human  g----ttt-tgcaa
                        Chimp  a----ttt-tgcaa
                       Bonobo  g----ttt-tgcaa
                      Gorilla  g----ttt-tgcaa
                    Orangutan  t----ttt-tgcaa
                       Gibbon  g----ttt-tgcag
                       Rhesus  g----ttc-tgcaa
          Crab-eating macaque  g----ttc-tgcaa
           Pig-tailed macaque  g----ttc-tgcaa
               Sooty mangabey  g----ttc-tgcaa
                       Baboon  g----ttc-tgcaa
                 Green monkey  g----ttc-tgcaa
                        Drill  g----ttc-tgcaa
             Proboscis monkey  g----ttc-tgcaa
              Angolan colobus  g----ttc-tgcaa
     Golden snub-nosed monkey  g----ttc-tgcaa
      Black snub-nosed monkey  g----ttc-tgcaa
                     Marmoset  g----tgc-tgcaa
              Squirrel monkey  t----tgc-tgcaa
          White-faced sapajou  t----tgc-tgcaa
            Ma's night monkey  g----tgc-tgcaa
                      Tarsier  --------------
                     Bushbaby  a----tttatacaa
                        Mouse  gaagatat-agcca
                          Dog  a----ttt-ttaaa
                    Armadillo  a----ttt-tacaa
                  Mouse lemur  ==============
              Sclater's lemur  ==============
                  Black lemur  ==============
            Coquerel's sifaka  ==============

Inserts between block 3 and 4 in window
B D                Armadillo 13809bp

Alignment block 4 of 56 in window, 89800075 - 89800147, 73 bps 
B D                     Human  tagt-----------attccttaagactaccattggtggctaatggtatacagagaca-cctaagaagag
B D                     Chimp  tagt-----------agtccttaagactaccattggtggctaatggtatacagagaca-cctaagaagag
B D                    Bonobo  tagt-----------agtccttaagactaccattggtggctaatggtatacagagaca-cctaagaagag
B D                   Gorilla  tagt-----------attccttaagactaccattggtggctaatggtatacagagaca-cctaagaagag
B D                 Orangutan  tagt-----------attccttaagactaccattggtggctaatggtatacagagaca-cctaagaagag
B D                    Gibbon  tagt-----------attccttaagactaccattggtggctaatgataaacagagaca-cctaagaagag
B D                    Rhesus  tagt-----------actccttaagactaccattgggggctaacggtatgcagagaca-cctaagaagag
B D       Crab-eating macaque  tagt-----------actccttaagactaccattgggggctaacggtatgcagagaca-cctaagaagag
           Pig-tailed macaque  tagt-----------actccttaagactaccattgggggctaacggtatacagagaca-cctaagaagag
               Sooty mangabey  tagt-----------actccttaagactaccattggtggctaacggtatacagagaca-cctaagaagag
                       Baboon  tagt-----------actccttaagactaccattggtggctaacggtatacagagaca-cctaagaagag
B D              Green monkey  tagt-----------actccttaagactaccattggtggctaacggtatacagagaca-cctaagaagag
                        Drill  tagt-----------actccttaagactaccattggtggctaacggtatacagagaca-cctaagaagag
B D          Proboscis monkey  tagt-----------actccttaagactaccattggtggctaacggtatgcagagaca-cctaagaagaa
              Angolan colobus  tagt-----------actccttaagactgccattggtggctaacggtatgcagagaca-cctaagaagag
B D  Golden snub-nosed monkey  tagt-----------actccttaagactaccattggtggctaacggtatgcagagaca-cctaagaagaa
      Black snub-nosed monkey  tagt-----------actccttaagactaccattggtggctaacggtatgcagagaca-cctaagaagaa
B D                  Marmoset  tagt-----------actccttaaaactcccagtggtggctaatggtatacagagaca-cctaagaagag
B D           Squirrel monkey  tagt-----------actccttaaaactcccaatggtggctaatggtatacagagaca-cctaagaagag
          White-faced sapajou  taat-----------actccttaaaactcccgatggtggctaatggtatacagagaca-cctaagaagag
            Ma's night monkey  tagt-----------actccttaaaactcccaatggtggctaatggtatacagagaca-cctaagaagag
B D                   Tarsier  ------------------cttcaaaactgtcaatgatggctaacagcacacagagaca-cctaagaagac
B D                  Bushbaby  cagt-----------atgtctcaaaactgtccatg------------attcagagaca-tgtaagaagat
B D                     Mouse  cagt-----------gattctccaaagagtgaatttcagatgatggaaaacagagata-ccc---aagat
B D                       Dog  aaatacctgttcaacactcctcaaaactattaatg-----tcatgaaaatcaaggaaagtctaagaaaat
                 Mouse lemur  ======================================================================
B D                 Armadillo  ======================================================================
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================
           Coquerel's sifaka  ======================================================================

                        Human  cat-acaa-atg--ccaaa
                        Chimp  cat-aaaa-atg--ccaaa
                       Bonobo  cat-aaaa-atg--ccaaa
                      Gorilla  cat-aaaa-atg--ccaaa
                    Orangutan  cac-aaca-atg--ccaaa
                       Gibbon  cac-aaaa-atg--ccaaa
                       Rhesus  cac-aaaa-atg--ccaag
          Crab-eating macaque  cac-aaaa-atg--ccaag
           Pig-tailed macaque  cac-aaaa-atg--ccaag
               Sooty mangabey  cac-aaaa-atg--ccaag
                       Baboon  cac-aaaa-atgaccaaag
                 Green monkey  cac-aaaa-atg--ccaag
                        Drill  cac-aaaa-atg--ccaag
             Proboscis monkey  cac-aaaa-atg--ccaag
              Angolan colobus  tgc-aaaa-atg--ccaag
     Golden snub-nosed monkey  cacaaaaa-atg--ccaag
      Black snub-nosed monkey  cacaaaaa-atg--ccaag
                     Marmoset  cac-agaa-atg--ccaag
              Squirrel monkey  cac-agaa-atg--ccaag
          White-faced sapajou  cac-agaa-atg--ccaag
            Ma's night monkey  cac-agaa-acg--ccaag
                      Tarsier  cac-aaaa-atg--ccaat
                     Bushbaby  tat-aaaatatg--ctaat
                        Mouse  cac-aaaacatg--ccacc
                          Dog  act-aatg---g--ccaa-
                  Mouse lemur  ===================
                    Armadillo  ===================
              Sclater's lemur  ===================
                  Black lemur  ===================
            Coquerel's sifaka  ===================

Inserts between block 4 and 5 in window
B D                      Dog 1276bp

Alignment block 5 of 56 in window, 89800148 - 89800242, 95 bps 
B D                     Human  taaaat----aataagaagtacttgccttatatcaattt---actaaagactt-aagaaaaatcatatt-
B D                     Chimp  taaaat----aataagaagtacttgccttatatcaattt---actaaagactt-aagaaaaatcatatt-
B D                    Bonobo  taaaat----aataagaagtacttgccttatatcaattt---actaaagactt-aagaaaaatcatatt-
B D                   Gorilla  taaaat----aataagaagtacttgccttatatcaattt---actaaaaactt-aagaaaaatcatatt-
B D                 Orangutan  taaaat----gataagaagtacttgccttgtatcaattt---actaaagactt-aaaaacaatcatatt-
B D                    Gibbon  taaaat----aataagaagtacttgccttatatcaattt---actaaagactt-aagaaaaatcatatt-
B D                    Rhesus  aaaaat-aagaagaagaagtacttgccttatatcagttg---actaaagactt-aagaaaaatcatact-
B D       Crab-eating macaque  aaaaat-aagaagaagaagtacttgccttgtatcagttg---actaaagactt-aagaaaaatcatact-
           Pig-tailed macaque  aaaaat-aagaagaagaagtacttgccttatatcagttg---actaaagactt-aagaaaaatcatact-
               Sooty mangabey  aaaaat----aataagaagtacttgccttatatcagttg---actaaagactt-aagaaaaatcatact-
                       Baboon  aaaaat-aataagaagaagtacttgccttatatcagttg---actaaagactt-aagaaaaatcatact-
B D              Green monkey  aaaaat----aagaagaagtacttgccttatatcagttg---actaaagactt-aagaaaaattatatt-
                        Drill  aaaaat-aagaagaagaagtacttgccttatatcagttg---actaaagactt-aagaaaaatcatact-
B D          Proboscis monkey  agaaat-aataagaagaagtacttgccttatatcagttg---cctaaagactt-aagaaaaatcatact-
              Angolan colobus  aaaaat-aagaagaagaagtacttgccttatatcagttg---actaaagactt-aagaacaatcatact-
B D  Golden snub-nosed monkey  aaaaat-aataagaagaagtacttgccttatatcagttg---actaaagactt-aagaaaaatcatact-
      Black snub-nosed monkey  aaaaat-aataagaagaagtacttgccttatatcagttg---actaaagactt-aagaaaaatcatact-
B D                  Marmoset  caaaat----aataagaagtacttgccttatatccattt---gctaaagactt-aagaaaaataatatt-
B D           Squirrel monkey  caaaat----aat---aagtacttgccttatatcagttt---accaaagactt----aaaaataatatt-
          White-faced sapajou  caaaat----aat---aagta---gctttatatcagttt---actaaagactt-aagaaaaaaaaaatt-
            Ma's night monkey  caaaat----aataataagtacttgccttctatcagttt---actaaagactt-aagaaaaataatatt-
B D                   Tarsier  aaaa------aattaaaagcatctaccttagatcagact---actaaacatttaaagaaaaattgtattc
B D                  Bushbaby  taaaac-aataagaaagaggttttgcctgatatcagatt---gctaaatactc-aaaaatcatattacc-
B D                     Mouse  taaaacaaagtggagaaagagtctgccttgcttcaaattggggctaaacactt-aagaaaagtcatagg-
                 Mouse lemur  ======================================================================
B D                 Armadillo  ======================================================================
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
B D                       Dog  ======================================================================

                        Human  --caatgattgcaaatagca----------aaataagtt-------gaccca--a
                        Chimp  --caatgattgcaaatagca----------aaataagtt-------gaccca--a
                       Bonobo  --caatgattgcaaatagca----------aaataagtt-------gaccca--a
                      Gorilla  --caatgattgcaaatagca----------aaataagtt-------gaccca--a
                    Orangutan  --caatgattgcaaatagca----------aaataagtt-------gacccc--a
                       Gibbon  --caatgattgcaaatagca----------aaataagtt-------gactcg--a
                       Rhesus  --caatgattgcaagtagca----------aaataaatt-------gaccca--a
          Crab-eating macaque  --caatgatttcaagtagca----------aaataaatt-------gaccca--a
           Pig-tailed macaque  --caatgattgcaagtagca----------aaataaatt-------gaccca--a
               Sooty mangabey  --caatgattgcaagtagca----------aaataagtt-------gaccca--a
                       Baboon  --caatgattgcaagtagca----------aaataaatt-------gaccca--a
                 Green monkey  --caatgattgcaagtagca----------aaataagtt-------gaccca--a
                        Drill  --caatgattgcaagtagca----------aaataaatt-------gaccca--a
             Proboscis monkey  --caatgattgcaagtaaca----------gaataagtt-------gaccca--a
              Angolan colobus  --caatgattgcaagtagca----------aaataagtt-------gaccca--a
     Golden snub-nosed monkey  --caatgattacaagtaaca----------gaataagtt-------gaccca--a
      Black snub-nosed monkey  --caatgattacaagtaaca----------gaataagtt-------gaccca--a
                     Marmoset  --cagtaatggcacatagca----------aaatactttaaaataaaactca---
              Squirrel monkey  --caatgatggcaaatagca----------aaataagtt-------gactca---
          White-faced sapajou  --caatgatagcaaatagca----------aaataagtt-------tacccaa--
            Ma's night monkey  --cagtgatggcaaatagca----------aaataagtt-------gactca-a-
                      Tarsier  gccaatgattgcaaacagca----------gtataaatt-------gattaa--g
                     Bushbaby  --aaatggctacaaataata----------gtataaatt-------aattta--a
                        Mouse  --gaatgatgataaaaagtatatttcatttaaatatgtt-------agtgta--a
                  Mouse lemur  =======================================================
                    Armadillo  =======================================================
              Sclater's lemur  =======================================================
                  Black lemur  =======================================================
            Coquerel's sifaka  =======================================================
                          Dog  =======================================================

Inserts between block 5 and 6 in window
         White-faced sapajou 31bp
           Ma's night monkey 32bp
B D                  Tarsier 15bp
B D                 Bushbaby 2bp
B D                    Mouse 4bp

Alignment block 6 of 56 in window, 89800243 - 89800254, 12 bps 
B D                     Human  ------acactggaacaa
B D                     Chimp  ------acactggaacaa
B D                    Bonobo  ------acactggaacaa
B D                   Gorilla  ------acactggaacaa
B D                 Orangutan  ------acactggaacaa
B D                    Gibbon  ------acactggcacaa
B D                    Rhesus  ------acacttgaacta
B D       Crab-eating macaque  ------acacttgaacta
           Pig-tailed macaque  ------acacttgaacta
               Sooty mangabey  ------acacttgaactg
                       Baboon  ------acacttgaacta
B D              Green monkey  ------acacttgaacta
                        Drill  ------acagttgaacta
B D          Proboscis monkey  ------acacttgaacta
              Angolan colobus  ------acacttgaacta
B D  Golden snub-nosed monkey  ------acacttgaacta
      Black snub-nosed monkey  ------acacttgaacta
B D                  Marmoset  ------acactttaaaaa
B D           Squirrel monkey  ------acactttaaaaa
B D                   Tarsier  ------acattgtgaaaa
B D                  Bushbaby  ------attttttaaata
B D                     Mouse  atgatgacactt------
                 Mouse lemur  ==================
B D                 Armadillo  ==================
             Sclater's lemur  ==================
                 Black lemur  ==================
           Coquerel's sifaka  ==================
B D                       Dog  ==================
           Ma's night monkey  ==================
         White-faced sapajou  ==================

Inserts between block 6 and 7 in window
B D                 Marmoset 20bp
B D          Squirrel monkey 20bp
B D                  Tarsier 19bp
B D                 Bushbaby 18bp

Alignment block 7 of 56 in window, 89800255 - 89800288, 34 bps 
B D                     Human  gagacgtaaactg----tttacaacttctgactcagtt
B D                     Chimp  gagacgtaaactg----tttacaacttctgactcagtt
B D                    Bonobo  gagacgtaaactg----tttacaacttctgactcagtt
B D                   Gorilla  gagacataaactg----tttacaacttctgactcagtt
B D                 Orangutan  gagacatcaactg----tttacaacttctgactcagtt
B D                    Gibbon  gagatgtcaactg----tttacaacttctgactcagtt
B D                    Rhesus  gagatgtcaactt----tttataacttctgactcagtg
B D       Crab-eating macaque  gagatgtcaactt----tttataacttctgactcagtg
           Pig-tailed macaque  gagatgtcaactt----tttataacttctgactcagtg
               Sooty mangabey  gggatgtcaactt----tttataacttctgactcagcg
                       Baboon  gagatgtcaactt----tttatgacttctgactcagtg
B D              Green monkey  gagatgtcaactt----tttataacttctgactcagtg
                        Drill  gagatgtcaactt----tttatgacttctgactcagtg
B D          Proboscis monkey  gagatgtcaactt----tttataacttctgactcagtg
              Angolan colobus  gagatgtcaactt----tttataacttctgactcagtg
B D  Golden snub-nosed monkey  gagatgtcaactt----tttataacttctgactcagtg
      Black snub-nosed monkey  gagatgtcaactt----tttataacttctgactcagtg
B D                  Marmoset  gagtcttgaactg----tgtatgacttctgactcagtg
B D           Squirrel monkey  gagtcttcaactg----tttataacttctgactcagtg
          White-faced sapajou  gagtcttcaactg----tttataacttctgactcagtg
            Ma's night monkey  gagtcttgaactg----tttatgacttctgactcagtg
B D                   Tarsier  aatatactaacttcaactttataacttttgactcagtg
B D                  Bushbaby  aagacttcaactg----tttataaattttaaatcagtg
B D                     Mouse  atgattaaaacta----gt----actttcgatttagta
                 Mouse lemur  ======================================
B D                 Armadillo  ======================================
             Sclater's lemur  ======================================
                 Black lemur  ======================================
           Coquerel's sifaka  ======================================
B D                       Dog  ======================================

Alignment block 8 of 56 in window, 89800289 - 89800306, 18 bps 
B D                     Human  agttaattttatgaatgt
B D                     Chimp  agttaattttatgaatgt
B D                    Bonobo  agttaattttatgaatgt
B D                   Gorilla  agttaattttgtgaatgt
B D                 Orangutan  agttaattttatgaattt
B D                    Gibbon  agttaattttatgaattt
B D                    Rhesus  agttaattttatgaattt
B D       Crab-eating macaque  agttaattttatgaattt
           Pig-tailed macaque  agttaattttatgaattt
               Sooty mangabey  agttcatcttacgaattt
                       Baboon  agttaatcttatgaattt
B D              Green monkey  agttaattttatgaattt
                        Drill  agttaatcttatgaattt
B D          Proboscis monkey  agttaattttatgaattt
              Angolan colobus  agttaattttatgaattt
B D  Golden snub-nosed monkey  agttaattttatgaattt
      Black snub-nosed monkey  agttaattttatgaattt
B D                  Marmoset  agtgaattttac----tt
B D           Squirrel monkey  agttaattttac----tt
          White-faced sapajou  agttaattttac----tt
            Ma's night monkey  agttaattttac----tt
B D                  Bushbaby  tgttattttaa--aatgc
B D                     Mouse  tgtgaatttta-gaatat
                 Mouse lemur  ==================
B D                 Armadillo  ==================
             Sclater's lemur  ==================
                 Black lemur  ==================
           Coquerel's sifaka  ==================
B D                       Dog  ==================
B D                   Tarsier  ------------------

Alignment block 9 of 56 in window, 89800307 - 89800315, 9 bps 
B D                     Human  atttatttt
B D                     Chimp  atttatttt
B D                    Bonobo  atttatttt
B D                   Gorilla  atttatttt
B D                 Orangutan  atttatttt
B D                    Gibbon  atttatttt
B D                    Rhesus  atttatttt
B D       Crab-eating macaque  atttatttt
           Pig-tailed macaque  atttatttt
               Sooty mangabey  atttatttt
                       Baboon  atttatttt
B D              Green monkey  atttatttt
                        Drill  atttatttt
B D          Proboscis monkey  atttatttt
              Angolan colobus  atttatttt
B D  Golden snub-nosed monkey  atttatttt
      Black snub-nosed monkey  atttatttt
B D                  Marmoset  atttatttc
B D           Squirrel monkey  atttatttt
          White-faced sapajou  attaatttt
            Ma's night monkey  atttatttt
B D                  Bushbaby  tgctatctt
                 Mouse lemur  =========
B D                 Armadillo  =========
B D                     Mouse  ---------
             Sclater's lemur  =========
                 Black lemur  =========
           Coquerel's sifaka  =========
B D                       Dog  =========
B D                   Tarsier  ---------

Alignment block 10 of 56 in window, 89800316 - 89800580, 265 bps 
B D                     Human  gagacagaatcttgccctgtcagccagcctggagtgcagtagcacgatcatggatcacttcagcctcaaa
B D                     Chimp  gagacagaatcttgccctgtcagccagcctggagtgcagtagcacgatcatggatcacttcagcctcaac
B D                    Bonobo  gagacagaatcttgccctgtcagccagcctggagtgcagtagcacgatcgtggatcacttcagcctcaac
B D                   Gorilla  gagacagaatctttccctgtcagccagcctggagtgcagtggcacgatcatggatcacttcagcctcaac
B D                 Orangutan  gagacagagtcttgccttgtcagccagcctggagtgcagtggcacgatcatggatcacttcagcctcaac
B D                    Gibbon  gagacagagtcttgccctgtcagccagcctggagtgcagtggcacgatcatggatcacttcagcctcaac
B D                    Rhesus  gagacagagtcttgccctgtcagccagcctggagttctgtggcacgatcatggatcacttcagcctcaac
B D       Crab-eating macaque  gagacagagtcttgccctgtcagccagcctggagttctgtggcacgatcatggatcacttcagcctcaac
           Pig-tailed macaque  gagacagagtcttgccctgtcagccagcctggagttctgtggcacgatcatggatcacttcagcctcaac
               Sooty mangabey  gagacagagtcttgccctgtcagccagcctggagttctgtggcacgatcatggatcacttcagcctcaac
                       Baboon  gagacagagtcttgccctgtcagccagcctggagttctgtggcacgatcatggatcacttcagcctcaac
B D              Green monkey  gagacagagtcttgccctgtcagccagcctggagttctgtggcacgatcatggaccacttcagcctcaac
                        Drill  gagacagagtcttgccctgtcagccagcctggagttctgtggcacgatcatggatcacttcagcctcaac
B D          Proboscis monkey  gagacagagtcttgccctgtcagccagcctggagttctgtggcacaatcatggatcacttcagcctcaac
              Angolan colobus  gagacagagtcttgccctgtcagccagcctggagttctgtggcacgatcatggatcacttcagcctcaac
B D  Golden snub-nosed monkey  gagacagagtcttgccctgtcagccagcctggagttctgtggcacaatcatggatcacttcagcctcaac
      Black snub-nosed monkey  gagacagagtcttgccctgtcagccagcctggagttctgtggcacaatcatggatcacttcagcctcaac
B D                  Marmoset  aagacggagtcttgccctgtcagccagcctcgagtgcagtcgcacagtaatggatcacttcagcttcgac
B D           Squirrel monkey  gagacagattcttgctccgtcagccagccttgagtgcagttgcacaataacggatcacttcagcttcaac
          White-faced sapajou  gagacagactctggccctgtcagccagccttgaatgcagttgcacaataatggatcacttcagcttcaac
            Ma's night monkey  gagacagagtcttgccctgtcagccagccttgagtgcagttgcacaataatggatcacttcagcttcaac
                 Mouse lemur  ======================================================================
B D                 Armadillo  ======================================================================
B D                     Mouse  ----------------------------------------------------------------------
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
B D                       Dog  ======================================================================
B D                  Bushbaby  ----------------------------------------------------------------------
B D                   Tarsier  ----------------------------------------------------------------------

                        Human  ttcctgagctcacatgatcctcctacctcagcctcccaagtagctaggattacaggcaagcaccaccatg
                        Chimp  ttcctgagctcacatgatcctcctacctcagcctcccaagtagctaggattacaggcaagcaccaccatg
                       Bonobo  ttcctgagctcacatgatcctcctacctcagcctcccaagtagctaggattacaggcaagcaccaccatg
                      Gorilla  ttcctgagctcacatgatcctcctatctcagcctcccaagtagctgggattacaggcaagcaccaccatg
                    Orangutan  ttcctgagctcaaatgatcctcctacctcagcctcccaagtagctaggattacaggcaagcaccaccatg
                       Gibbon  tttctgagctcaaatgatccttctacctcagcctcccaagtagctaggattacaggcaagcaccaccatg
                       Rhesus  ttcctgacctcaaatgatcctcctacctcagcctcccaagtagctaggattacaggcaagcaccaccatg
          Crab-eating macaque  ttcctgacctcaaatgatcttcctacctcagcctcccaagtagctaggattacaggcaagcaccaccatg
           Pig-tailed macaque  ttcctgacctcaaatgatcctcctacctcagcctcccaagtagctaggattacaggcaagcaccaccatg
               Sooty mangabey  ttcctgagctcaaatgatcctcctacctcaccctcccaagtagctaagattacaggcaagcaccaccatg
                       Baboon  ttcctgagctcaaatgatcctcctacctcagcctcccaagtagctaggattacaggcaagcaccaccatg
                 Green monkey  ttcctgagctcaaatgatcctcctacctcagcctcccaagtagctaggattacaggcaagcaccaccatg
                        Drill  ttcctgagctcaaatgatcctcctacctcagcctcccaagtagctaggagtacaggcaagcaccaccatg
             Proboscis monkey  tttctgagctcaaatgatcctcctacctcagccttccaagtagctaggattacaggcaagcaccaccatg
              Angolan colobus  ttcctgagctcaaatgatcctcctacctcagcctcccaagtagctaggattacaggcaagcaccaccatg
     Golden snub-nosed monkey  tttctgagctcaaatgatcctcctacctcagccttccaagtagctaggattacaggcaagcaccaccatg
      Black snub-nosed monkey  tttctgagctcaaatgatcctcctacctcagccttccaagtagctaggattacaggcaagcaccaccatg
                     Marmoset  tttctgggctcaaatgatcctcctacctcagcctcccaagtagctaggattacaggcatgta-caccatc
              Squirrel monkey  ttcctgggctcaaatgatcctcctacctcagcctttcaagtagctaggattacaggcgtgcaccaccatg
          White-faced sapajou  ttcctgggctcaaatgaccctcctacctcagcctctcaagtagctagga-tacagacgtgcaccaccatg
            Ma's night monkey  ttcctgggctcaaatgatcctcctacctcagcctctcaagtagctaggattacaggcatacaccaccgtg
                  Mouse lemur  ======================================================================
                    Armadillo  ======================================================================
                        Mouse  ----------------------------------------------------------------------
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
                          Dog  ======================================================================
                     Bushbaby  ----------------------------------------------------------------------
                      Tarsier  ----------------------------------------------------------------------

                        Human  actggctaattttatttat-------ttatttttgtagagag-gggcctccccctatgttgcccaggctg
                        Chimp  actcgctaattttatttat-------ttatttttgtagagag-gggcctccccctatgttgcccaggctg
                       Bonobo  actcgctaattttatttat-------ttatttttgtagagag-gggcctccccctatgttgcccaggctg
                      Gorilla  actggctaattttatttat-------ttatttttgtagagag-gggcctccccctatgttgcccaggctg
                    Orangutan  actggctaattttatttat-------t--tttttgtagaggg-ggg-ctccccctatgatgcccaggctg
                       Gibbon  accggctaattttatttat-------t--tttttgtagagag-ggg-ctccccctatgttgcccaggctg
                       Rhesus  actggctaattttatttac-------t--tttttgtagagag-ggaggtccccctatgttgcccaggctg
          Crab-eating macaque  actggctaattttatttac-------t--tttttgtagagag-ggaggtccccctatgttgcccaggctg
           Pig-tailed macaque  actggctaattttatttac-------t--tttttgtagagag-ggaggtccccctatgttgcccaggctg
               Sooty mangabey  accggctaattttatttac-------t--tttttgtagagag-ggaggtccccctatgttgcccaggctg
                       Baboon  accagctaattttatttac-------t--tttttgtagagag-gaaggtccccctatgttgcccaggctg
                 Green monkey  accggctaattttatttac-------t--tttttgtagagag-ggaggtccccctatgttgcccaggctg
                        Drill  accggctaatttcatttac-------t--tttttgtagagag-ggagttccccctatgttgcccaggctg
             Proboscis monkey  accagctaattttatttac-------t--tttttgtagagag-ggaggtccccctatgttgcccaggctg
              Angolan colobus  accagctaattttatttac-------t--tttttgtagagag-ggaggtccccctatgttgcccaggctg
     Golden snub-nosed monkey  accagctaattttatttac-------t--tttttgtagagag-ggaggtccccctatgttgcccaggctg
      Black snub-nosed monkey  accagctaattttatttac-------t--tttttgtagagag-ggaggtccccctatgttgcccaggctg
                     Marmoset  aacagctaattttatttatt------t--tttttgtagagaagggagatctccctacattgcccagtctg
              Squirrel monkey  aacagctaattttatttatttatttat--cttttgtagagagtggagatcttcctacgttgcccaggctg
          White-faced sapajou  aacagctaattttatttat-------t--tttttgtagagaggggagatctccctacattgcccaggctg
            Ma's night monkey  aacagctaattttgtttat-------t--tttttgtagagaggggagatctccctacgttgcccaggctg
                  Mouse lemur  ======================================================================
                    Armadillo  ======================================================================
                        Mouse  ----------------------------------------------------------------------
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
                          Dog  ======================================================================
                     Bushbaby  ----------------------------------------------------------------------
                      Tarsier  ----------------------------------------------------------------------

                        Human  gtctcaaactcctgtgctcaagctgtcctccaggctgggcttccaaaagtgctggaattacag
                        Chimp  gtctcaaactcctgtgttcaagctgtcctccaggctgggcttccaaaagtgctggaattacag
                       Bonobo  gtctcaaactcctgtgttcaagctgtcctccaggctgggcttccaaaagtgctggaattacag
                      Gorilla  gtctcaaactcctgtgctcaagctgtcctccaggctgggcctccaaaagtgctggaattacag
                    Orangutan  gtctcaaactcctgtgctcaagctgtcctcctggctgggcctccaaaagtgctggaattatag
                       Gibbon  gtctcaaactcctgtgctcaacctgtcctcctggctgggcctccaaaagtgctggaattacag
                       Rhesus  gtctcaaactcctgtgctcaagctgtcctcttggctgggcctccaaatgtgctggaattacag
          Crab-eating macaque  gtctcaaactcctgtgctcaagctgtcctcttggctgggcctccaaatgtgctggaattacag
           Pig-tailed macaque  gtctcaaactcctgtgctcaagctgtcctcttggctgggcctccaaatgtgctggaattacag
               Sooty mangabey  gtctcagactcctgtgctcaagctgtcctcttggctgggcctccaaatgtgctggaattacag
                       Baboon  gtctcagactcctgtgctcaagcggtcctcttggctgggcctccaaatgtgctggaattacag
                 Green monkey  gtctcaaactcctgtgctcaagctgttctcttggctgggcctccaaatgtgctggaattacag
                        Drill  gtctcagactcctgtgctcaagctgtcctcttggctgggcctccaaatgtgctggaattacag
             Proboscis monkey  gtctcaaactcctgtgctcaagctgtcctcttggctgggcctccaaatgtgctggaattacag
              Angolan colobus  gtctcaaactcctgtactcaagctgtcctcttggctgggcctccaaatgtgctggaattacag
     Golden snub-nosed monkey  gtctcaaactcctgtgctcaagctgtcctcttggctgggcctccaaatgtgctggaattacag
      Black snub-nosed monkey  gtctcaaactcctgtgctcaagctgtcctcttggctgggcctccaaatgtgctggaattacag
                     Marmoset  gtctcaaactcctgggctcaagctatccttctggctgggtctccgaaagtgctggaactacag
              Squirrel monkey  gtctcaaactcctgggctcaagctatccttctggctgggtctccaaaagtgctggaattacag
          White-faced sapajou  gtctcaaactcctgggctcaagctatccttctggcaggctctccaaaagtgctggaattacag
            Ma's night monkey  gtctcaaactcctgggctcaagctatccttctggctgggtctccaaaagtgctggaattacag
                  Mouse lemur  ===============================================================
                    Armadillo  ===============================================================
                        Mouse  ---------------------------------------------------------------
              Sclater's lemur  ===============================================================
                  Black lemur  ===============================================================
            Coquerel's sifaka  ===============================================================
                          Dog  ===============================================================
                     Bushbaby  ---------------------------------------------------------------
                      Tarsier  ---------------------------------------------------------------

Inserts between block 10 and 11 in window
           Ma's night monkey 22bp

Alignment block 11 of 56 in window, 89800581 - 89800603, 23 bps 
B D                     Human  acatgagcaacagcgcttggcca
B D                     Chimp  acgtgagcaacagcgcttggcca
B D                    Bonobo  acgtgagcaacagcgcttggcca
B D                   Gorilla  acatgagcaacagcgcttggcca
B D                 Orangutan  acatgagcaactgcgcttggcca
B D                    Gibbon  acatgagcaactgcactcggcca
B D                    Rhesus  atataaggaactgcactcggcca
B D       Crab-eating macaque  atataaggaactgcactcggcca
           Pig-tailed macaque  atataaggaactgcactcggcca
               Sooty mangabey  atataaggaactgcactcagcca
                       Baboon  atataaggaactgcactcggcca
B D              Green monkey  atataaggaactgcactcggcca
                        Drill  atataaggaactgcactcggcca
B D          Proboscis monkey  acataaggaactgcactcggcca
              Angolan colobus  acataaggaactgcacttggcca
B D  Golden snub-nosed monkey  acataagaaactgcactcggcca
      Black snub-nosed monkey  acataagaaactgcactcggcca
B D                  Marmoset  ---tgagccactgcacccagcca
B D           Squirrel monkey  ---ggagccactgcacccggcca
          White-faced sapajou  ---tgagccactgcacccagcca
                 Mouse lemur  =======================
B D                 Armadillo  =======================
B D                     Mouse  -----------------------
             Sclater's lemur  =======================
                 Black lemur  =======================
           Coquerel's sifaka  =======================
B D                       Dog  =======================
B D                  Bushbaby  -----------------------
B D                   Tarsier  -----------------------
           Ma's night monkey  =======================

Alignment block 12 of 56 in window, 89800604 - 89800608, 5 bps 
B D                     Human  agtta
B D                     Chimp  agtta
B D                    Bonobo  agtta
B D                   Gorilla  agtta
B D                 Orangutan  agtta
B D                    Gibbon  agtta
B D                    Rhesus  agtta
B D       Crab-eating macaque  agtta
           Pig-tailed macaque  agtta
               Sooty mangabey  agtta
                       Baboon  agtta
B D              Green monkey  agtta
                        Drill  agtta
B D          Proboscis monkey  agcta
              Angolan colobus  agata
B D  Golden snub-nosed monkey  agcta
      Black snub-nosed monkey  agcta
B D                  Marmoset  agata
B D           Squirrel monkey  aggta
          White-faced sapajou  agata
B D                   Tarsier  agtca
                  Mouse lemur  agtta
                  Black lemur  agtta
              Sclater's lemur  agtta
B D                       Dog  aatcc
B D                 Armadillo  agtca
B D                     Mouse  -----
           Coquerel's sifaka  =====
B D                  Bushbaby  -----
           Ma's night monkey  =====

Alignment block 13 of 56 in window, 89800609 - 89800629, 21 bps 
B D                     Human  attttaaaatactggtaattt
B D                     Chimp  attttaaaatactggtaattt
B D                    Bonobo  attttaaaatactggtaattt
B D                   Gorilla  attttaaaatactggtaattt
B D                 Orangutan  attttaaaatactggtatttt
B D                    Gibbon  attttaaaatactggtatttt
B D                    Rhesus  atttgaaaatgccggtatttt
B D       Crab-eating macaque  attttaaaatgccggtatttt
           Pig-tailed macaque  atttgaaaatgccggtatttt
               Sooty mangabey  attttaaaatactggtatttt
                       Baboon  attttaaaataccggtatttt
B D              Green monkey  attttaaaataccggtatttt
                        Drill  attttaaaatactggtatttt
B D          Proboscis monkey  attttaaaatactagtatttt
              Angolan colobus  attttaaaatactggtatttt
B D  Golden snub-nosed monkey  attttaaaatactggtatttt
      Black snub-nosed monkey  attttaaaatactggtatttt
B D                  Marmoset  atttaaaaatactagtatttt
B D           Squirrel monkey  attttaaaatactagtatttt
          White-faced sapajou  atttaaaaatactagtatttt
            Ma's night monkey  attttaaaatactagtatttt
B D                   Tarsier  atttttaaatactggtatt--
                  Mouse lemur  attttaaaatactggtatttt
                  Black lemur  attttagaatactggtatttt
              Sclater's lemur  attttagaatactggtatttt
B D                       Dog  attttaaactattggtattt-
B D                 Armadillo  attttaagatactggtatttt
B D                     Mouse  ---------------------
           Coquerel's sifaka  =====================
B D                  Bushbaby  ---------------------

Alignment block 14 of 56 in window, 89800630 - 89800640, 11 bps 
B D                     Human  gcctttaaaaa
B D                     Chimp  gcctttagaaa
B D                    Bonobo  gcctttagaaa
B D                   Gorilla  gcctttagaaa
B D                 Orangutan  gcctttagaaa
B D                    Gibbon  gcctttagaaa
B D                    Rhesus  gcctttagaaa
B D       Crab-eating macaque  gcctttagaaa
           Pig-tailed macaque  gcctttagaaa
               Sooty mangabey  gcctttagaaa
                       Baboon  gcctttagaaa
B D              Green monkey  gcctttagaaa
                        Drill  gcctttagaaa
B D          Proboscis monkey  gcctttagaaa
              Angolan colobus  gcctttagaaa
B D  Golden snub-nosed monkey  gcctttagaaa
      Black snub-nosed monkey  gcctttagaaa
B D                  Marmoset  gcctttagaaa
B D           Squirrel monkey  gcctttaaaaa
          White-faced sapajou  gcctttagaaa
            Ma's night monkey  gcctttagaag
B D                   Tarsier  --ctctagaaa
                  Mouse lemur  gcctttagaaa
                  Black lemur  gcctttagaaa
              Sclater's lemur  gcctttagaaa
B D                  Bushbaby  gcctttagaaa
B D                       Dog  gtctgtagaaa
B D                 Armadillo  atttttaacaa
B D                     Mouse  -----------
           Coquerel's sifaka  ===========

Inserts between block 14 and 15 in window
                 Mouse lemur 11106bp
                 Black lemur 64bp
             Sclater's lemur 64bp
B D                 Bushbaby 1bp
B D                      Dog 1bp

Alignment block 15 of 56 in window, 89800641 - 89800641, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                    Bonobo  -t
B D                   Gorilla  -t
B D                 Orangutan  -t
B D                    Gibbon  -t
B D                    Rhesus  -t
B D       Crab-eating macaque  -t
           Pig-tailed macaque  -t
               Sooty mangabey  -t
                       Baboon  -t
B D              Green monkey  -t
                        Drill  -t
B D          Proboscis monkey  -t
              Angolan colobus  -t
B D  Golden snub-nosed monkey  -t
      Black snub-nosed monkey  -t
B D                  Marmoset  -t
B D           Squirrel monkey  -t
          White-faced sapajou  -t
            Ma's night monkey  -t
B D                   Tarsier  -a
B D                 Armadillo  a-
                 Mouse lemur  ==
B D                     Mouse  --
             Sclater's lemur  ==
                 Black lemur  ==
           Coquerel's sifaka  ==
B D                       Dog  ==
B D                  Bushbaby  ==

Alignment block 16 of 56 in window, 89800642 - 89800662, 21 bps 
B D                     Human  gtatgtttagtaaagggggaa
B D                     Chimp  gtatgtttagtaaagggggaa
B D                    Bonobo  gtatgtttagtaaagggggaa
B D                   Gorilla  gtatgtttagtaaaaggggaa
B D                 Orangutan  gtatgtttagtaaagggggaa
B D                    Gibbon  gtgtgtttagtaaaggaggaa
B D                    Rhesus  gtatctttagaaaagggggaa
B D       Crab-eating macaque  gtatctttagaaaagggggaa
           Pig-tailed macaque  gcatctttagaaaagggggaa
               Sooty mangabey  gtatctttagtaaagggggaa
                       Baboon  gtatctttagaaaagggggaa
B D              Green monkey  gtatctttagtaaagggggaa
                        Drill  gtatctttaaaaaagggggaa
B D          Proboscis monkey  gtatctttagtaaagggggaa
              Angolan colobus  gtatctttagtaaagagggaa
B D  Golden snub-nosed monkey  gtatctttagtaaagggggaa
      Black snub-nosed monkey  gtatctttagtaaagggggaa
B D                  Marmoset  atatctttagcaaggcaggaa
B D           Squirrel monkey  gtgtctttagtaaagtaggaa
          White-faced sapajou  gtatctttagtaaagcaggaa
            Ma's night monkey  gtatctttagtaaagcaggaa
B D                   Tarsier  gtatctttagtgaagggggga
B D                  Bushbaby  gtatctttagtaaaaggaaaa
B D                       Dog  taatccttagtaaagcagaaa
B D                 Armadillo  taatctttactagcag-----
                 Mouse lemur  =====================
B D                     Mouse  ---------------------
             Sclater's lemur  =====================
                 Black lemur  =====================
           Coquerel's sifaka  =====================

Inserts between block 16 and 17 in window
B D                 Bushbaby 4082bp

Alignment block 17 of 56 in window, 89800663 - 89800722, 60 bps 
B D                     Human  gaagcttcttggtatgtcctctaaatgaaatactaccactatgatatgtaataatgtaag
B D                     Chimp  gaagcttcttggtatgtcctctaaatgaaatactaccactatgatatgcaataatgtaa-
B D                    Bonobo  gaagcttcttggtatgtcctctaaatgaaatactaccactatgatatgcaataatgtaa-
B D                   Gorilla  gaagcttcttgctatgtcctctaaatgaaatactaccactatgatatgcaataatgtaaa
B D                 Orangutan  gaagcttcttgggatgtcctctaaatgaaatactactactataatatgcaataatgtaag
B D                    Gibbon  gaagcttcttggtatgccctctaaatgaaatactactactatgttatgcaataatgtaag
B D                    Rhesus  gaagcttcttggtatgtgctctaaattaaatactaccacgataatacgtaataatgtaag
B D       Crab-eating macaque  gaagcttcttggtatgtcctctaaatgaaatactaccacgataatacgtaataatgtaag
           Pig-tailed macaque  gaagcttcttggtatgtcctctaaatgaaatactaccacgataatacgtaataatgtaag
               Sooty mangabey  gaagcttcttgttatgtgctctaaatgaaatactaccactataatacgtaataatgtaag
                       Baboon  gaagctttttggtatgtcctctaaatgaaatactaccactataatatgtaataatgtaag
B D              Green monkey  gaagcttcttggtatgtcctctaaattaaatactaccactataatacgtaataatgtaag
                        Drill  gaagctttttggtatgtcctctaaatgaaatactaccactataatatgtaataatgtaag
B D          Proboscis monkey  gaagcttcttggtatgtcctctaaatgaaatactaccactataatatgtaataatgtaag
              Angolan colobus  gaagcttcttggtatgtcttctaaatgaaatactaccactataatatgtaataatgtaag
B D  Golden snub-nosed monkey  gaagcttcttggtatgtcctctaaatgaaatactaccactataatatgtaataatgtaag
      Black snub-nosed monkey  gaagcttcttggtatgtcctctaaatgaaatactaccactataatatgtaataatgtaag
B D                  Marmoset  gaagcttcttggtatcttctcc------aatactaccactataatatgtaacaatataag
B D           Squirrel monkey  gaagcttcttggtataatctct------aaaatcaccactataatatgtaataacataag
          White-faced sapajou  gaagcttcttggtatcttctct------aataccacc-ctataatatgtaataacataag
            Ma's night monkey  gaagtttcttggtatcttctct------aatactaccactataatatgtaataacataag
B D                   Tarsier  aacgcttcgtggtatattcactaaataatatatttttgc-ataatagattatgagataca
B D                       Dog  aaatgcttatggtacattctcttgatgaaattttagtaatacaatatgtaacaattaaa-
B D                 Armadillo  gacagtccttgata-------------aaatattacccatataatatgtaataacataaa
                 Mouse lemur  ============================================================
B D                     Mouse  ------------------------------------------------------------
             Sclater's lemur  ============================================================
                 Black lemur  ============================================================
           Coquerel's sifaka  ============================================================
B D                  Bushbaby  ============================================================

Inserts between block 17 and 18 in window
B D                Armadillo 1bp

Alignment block 18 of 56 in window, 89800723 - 89800749, 27 bps 
B D                     Human  catttcaaataaatatatgataatgag---
B D                   Gorilla  catttcaaataaatatatgataatgag---
B D                 Orangutan  catttcaaataaatatatgataacgag---
B D                    Gibbon  cattttaaataaatatatgataatgag---
B D                    Rhesus  catttcaaataaagata-gataatgag---
B D       Crab-eating macaque  catttcaaatgaagata-gataatgag---
           Pig-tailed macaque  catttcaaataaagata-gataatgag---
               Sooty mangabey  catttcaaataaatata-gataatgag---
                       Baboon  catttcaaataaatata-gagaatgag---
B D              Green monkey  catttcaaataaatata-gataatgag---
                        Drill  catttcaaataattata-gagaatgag---
B D          Proboscis monkey  catttcaaataaatata-gataatgag---
              Angolan colobus  catttcaaataaatata-gataatgag---
B D  Golden snub-nosed monkey  catttcaaataaatata-gataatgag---
      Black snub-nosed monkey  catttcaaataaatata-gataatgag---
B D                  Marmoset  cacttaaaataaatatacgataatgag---
B D           Squirrel monkey  cacttaaaataaatacatgataatgag---
          White-faced sapajou  cacttaaaataaatatatgataatgag---
            Ma's night monkey  cacttaaaataaatatatgataatgag---
B D                   Tarsier  cattctaaatgagcatataatcatgag---
                  Mouse lemur  catttgaaataaatatatgataaggag---
                  Black lemur  catttaaaataaatacatgataatgag---
              Sclater's lemur  catttaaaataaatacatgataatgag---
B D                       Dog  tactttaaataagtatgtaataatgag---
B D                 Armadillo  cttttcaaacatacata--agtatgaggaa
B D                     Mouse  ------------------------------
           Coquerel's sifaka  ==============================
B D                  Bushbaby  ==============================
B D                    Bonobo  ------------------------------
B D                     Chimp  ------------------------------

Inserts between block 18 and 19 in window
B D                      Dog 2bp

Alignment block 19 of 56 in window, 89800750 - 89800774, 25 bps 
B D                     Human  aaaataatactcatagtatcaaaaa---------------------------------------
B D                     Chimp  ------------------------a---------------------------------------
B D                    Bonobo  ------------------------a---------------------------------------
B D                   Gorilla  aaaataatactcatagtatcaaaaa---------------------------------------
B D                 Orangutan  aaaataactgtcatagtatcaaaaa---------------------------------------
B D                    Gibbon  aaaaaaattgtcatagtatcaaaaa---------------------------------------
B D                    Rhesus  aaaataattgtcacagtatcaaaaa---------------------------------------
B D       Crab-eating macaque  aaaataattgtcacagtatcaaaaa---------------------------------------
           Pig-tailed macaque  aaaataattgtcatagtatcaaaaa---------------------------------------
               Sooty mangabey  aaaataattgtcattgtatcaaaaa---------------------------------------
                       Baboon  aaaataattgtcattgtatcaaaaa---------------------------------------
B D              Green monkey  aaaataattgtcatagtatcaaaac---------------------------------------
                        Drill  aaaataattgtcattgtatcaaaaa---------------------------------------
B D          Proboscis monkey  aaaataattgtcatagtatcaaaaa---------------------------------------
              Angolan colobus  aaaataattgtcatagtatcaaaaa---------------------------------------
B D  Golden snub-nosed monkey  aaaataattgtcacagtatcaaaaa---------------------------------------
      Black snub-nosed monkey  aaaataattgtcacagtatcaaaaa---------------------------------------
B D                  Marmoset  aaaataattgtcatagtattaaata---------------------------------------
B D           Squirrel monkey  aaaataattgttatagtattcaata---------------------------------------
          White-faced sapajou  gaaataattgtcatactattaaata---------------------------------------
            Ma's night monkey  aaaataattgtcatagtattaaata---------------------------------------
B D                   Tarsier  aaaataattgtcatactatcaaaaa---------------------------------------
                  Mouse lemur  aaaataattgtcatagtatcaaaaa---------------------------------------
                  Black lemur  aaaataattttcatagtatcaaaaa---------------------------------------
              Sclater's lemur  aaaataattttcatagtatcaaaaa---------------------------------------
B D                  Bushbaby  aaagtaagactc--tgtctcaaaat---------------------------------------
B D                       Dog  gaaaaaa----catagtatcaagaa---------------------------------------
B D                 Armadillo  ---atttttgtaacagtttaaagaaaagaaagttaagttgaaatggtactggcagcatggttag
B D                     Mouse  ----------------------------------------------------------------
           Coquerel's sifaka  ================================================================

Inserts between block 19 and 20 in window
                 Black lemur 125bp
             Sclater's lemur 125bp

Alignment block 20 of 56 in window, 89800775 - 89800775, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                    Bonobo  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
           Pig-tailed macaque  a
               Sooty mangabey  a
                       Baboon  a
B D              Green monkey  a
                        Drill  a
B D          Proboscis monkey  a
              Angolan colobus  a
B D  Golden snub-nosed monkey  a
      Black snub-nosed monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
          White-faced sapajou  a
            Ma's night monkey  a
B D                   Tarsier  a
                  Mouse lemur  a
B D                  Bushbaby  a
B D                       Dog  g
B D                 Armadillo  a
B D                     Mouse  -
             Sclater's lemur  =
                 Black lemur  =
           Coquerel's sifaka  =

Inserts between block 20 and 21 in window
B D                Orangutan 45bp
B D                   Gibbon 29bp
B D                  Tarsier 394bp

Alignment block 21 of 56 in window, 89800776 - 89800777, 2 bps 
B D                     Human  ga-
B D                     Chimp  ga-
B D                    Bonobo  ga-
B D                   Gorilla  ga-
B D                    Gibbon  ga-
B D                    Rhesus  ga-
B D       Crab-eating macaque  ga-
           Pig-tailed macaque  ga-
               Sooty mangabey  ga-
                       Baboon  ga-
B D              Green monkey  ga-
                        Drill  ga-
B D          Proboscis monkey  ga-
              Angolan colobus  ga-
B D  Golden snub-nosed monkey  ga-
      Black snub-nosed monkey  ga-
B D                  Marmoset  ga-
B D           Squirrel monkey  ga-
          White-faced sapajou  ga-
            Ma's night monkey  ta-
                  Mouse lemur  ga-
B D                  Bushbaby  aa-
B D                       Dog  aa-
B D                 Armadillo  -ag
B D                 Orangutan  ===
B D                     Mouse  ---
             Sclater's lemur  ===
                 Black lemur  ===
           Coquerel's sifaka  ===
B D                   Tarsier  ===

Inserts between block 21 and 22 in window
                 Mouse lemur 430bp
B D                      Dog 32bp

Alignment block 22 of 56 in window, 89800778 - 89800778, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                    Bonobo  -t
B D                   Gorilla  -t
B D                    Gibbon  -t
B D                    Rhesus  -t
B D       Crab-eating macaque  -t
           Pig-tailed macaque  -t
               Sooty mangabey  -t
                       Baboon  -t
B D              Green monkey  -t
                        Drill  -t
B D          Proboscis monkey  -t
              Angolan colobus  -t
B D  Golden snub-nosed monkey  -t
      Black snub-nosed monkey  -t
B D                  Marmoset  -t
B D           Squirrel monkey  -t
          White-faced sapajou  -t
            Ma's night monkey  -t
B D                  Bushbaby  -t
B D                       Dog  -t
B D                 Armadillo  g-
                 Mouse lemur  ==
B D                 Orangutan  ==
B D                     Mouse  --
             Sclater's lemur  ==
                 Black lemur  ==
           Coquerel's sifaka  ==
B D                   Tarsier  ==

Inserts between block 22 and 23 in window
B D                   Gibbon 10bp
B D                   Rhesus 43bp
B D      Crab-eating macaque 43bp
          Pig-tailed macaque 43bp
              Sooty mangabey 43bp
                      Baboon 43bp
B D             Green monkey 43bp
                       Drill 43bp
B D         Proboscis monkey 43bp
             Angolan colobus 43bp
B D Golden snub-nosed monkey 43bp
     Black snub-nosed monkey 43bp
B D                 Marmoset 42bp
B D          Squirrel monkey 42bp
         White-faced sapajou 42bp
           Ma's night monkey 42bp
B D                 Bushbaby 2bp

Alignment block 23 of 56 in window, 89800779 - 89800795, 17 bps 
B D                     Human  ataaac-tc----tatt-------cattt
B D                     Chimp  ataaac-tc----gatt-------cattt
B D                    Bonobo  ataaac-tc----tatt-------cattt
B D                   Gorilla  ataaac-tc----tatt-------cattt
B D                 Orangutan  ataaac-tc----tatt-------cattt
B D                    Gibbon  ataaac-tc----tatt-------cattt
B D                    Rhesus  ataaac-tc----tatt-------cattt
B D       Crab-eating macaque  ataaac-tc----tatt-------cattt
           Pig-tailed macaque  ataaac-tc----tatt-------cattc
               Sooty mangabey  ataaac-tc----tatt-------cattt
                       Baboon  ataaac-tc----tatt-------cattt
B D              Green monkey  atacac-tc----tatt-------cattt
                        Drill  ataaac-tc----tatt-------cattt
B D          Proboscis monkey  ataaac-tc----tatt-------tattt
              Angolan colobus  ataaac-tc----tatt-------tattt
B D  Golden snub-nosed monkey  ataaac-tc----tatt-------tgttt
      Black snub-nosed monkey  ataaac-tc----tatt-------tgttt
B D                  Marmoset  ataaag-tc----tatt-------cattt
B D           Squirrel monkey  ataaag-tc----tatt-------cattt
          White-faced sapajou  ataaag-tc----tatt-------cattt
            Ma's night monkey  ataaag-tc----tatt-------cattt
B D                  Bushbaby  ataaat-----------------------
B D                       Dog  ataaggatc----tattaactaagcattt
B D                 Armadillo  atcaat-tcaccatgtg-------catta
                 Mouse lemur  =============================
B D                     Mouse  -----------------------------
             Sclater's lemur  =============================
                 Black lemur  =============================
           Coquerel's sifaka  =============================
B D                   Tarsier  =============================

Alignment block 24 of 56 in window, 89800796 - 89800858, 63 bps 
B D                     Human  aaaaatgcaaggcaataccaaacatttaataataattttctactggaattagctgccgaagat
B D                     Chimp  aaaaatgcaaggcaataccaaacatttaataataattttctactggaattagcttccagagat
B D                    Bonobo  aaaaatgcaaggcaataccaaacatttaataataattttctactggaattagcttccagagat
B D                   Gorilla  aaaaatgcaaggcaataccaaaaatttaataataattttctgctggaattagctgccggagat
B D                 Orangutan  aaaaatgaaaggcaatacaaaacatttaataattattttctactggaattagctgccggagat
B D                    Gibbon  aaaaatgaaaggcaataccaagcatttaataactattttctactggaattagctgccggagat
B D                    Rhesus  aaaaatgaaaggcaataccaaatatttaataattattttctgctggaattagctactgaatat
B D       Crab-eating macaque  aaaaatgaaaggcaataccaaatatttaataattattttctgctggaattagctactgaagat
           Pig-tailed macaque  aaaaatgaaaggcaataccaaatatttaataattattttctgctggaattagctactgaagat
               Sooty mangabey  aaaaatgaaaggcaataccaaatatttaataattattttctgctggaattagctactgaagat
                       Baboon  aaaaatgaaaggcaataccaaatatttaataattattttctgctggaattagctactgaagat
B D              Green monkey  aaaaatgaaaggcaataccaaatatttaataattattttctgctgaaattagctactgaagat
                        Drill  aaaaatgaaaggcaataccaaatatttaataattattttctgctggaattagctactgaagat
B D          Proboscis monkey  aaaaatgaaaggcagtaccaaatatttaattattattttctgctggaattagctattgaagat
              Angolan colobus  aaaaatgaaaggcagtaccaaatatttaattattattttctgctggaattagctactgaagat
B D  Golden snub-nosed monkey  aaaaatataaggcagtaccaaatatttaattattattttctgctggaattagctactgaagat
      Black snub-nosed monkey  aaaaatataaggcagtaccaaatatttaattattattttctgctggaattagctactgaagat
B D                  Marmoset  aaaaataaaagccaacacaaaa-atttaataattattttctgctgtaattagcttccagagat
B D           Squirrel monkey  aaaaatgaaagccaacacaaaa-atttaataattattttctgctgtaattagctaccagtttt
          White-faced sapajou  aaaaatgaaagccaacataaaa-atttaataattattttctgctgtaattagctaacagagat
            Ma's night monkey  aaaaatgaaagccaacacaaaa-atttaataattattttctgctgtaattggctaccagagat
B D                   Tarsier  agaaaagaaaggcagtaccagaaatgcaataataactttctgctggaattgtctactggagat
B D                  Bushbaby  aaaaattaaaggcaacatcaaaaaattaatcatctttttcagctggaattgtcta-tagagat
B D                       Dog  gaaaatgaaaggcaacaccagcaattcagtaat-attttctactgaaattttctgttggagat
B D                 Armadillo  aaaaacacaagaagccactaaaaatttaataacta-tatctggtaaaattttctattggtgat
                 Mouse lemur  ===============================================================
B D                     Mouse  ---------------------------------------------------------------
             Sclater's lemur  ===============================================================
                 Black lemur  ===============================================================
           Coquerel's sifaka  ===============================================================

Inserts between block 24 and 25 in window
B D                      Dog 1bp

Alignment block 25 of 56 in window, 89800859 - 89800918, 60 bps 
B D                     Human  tttta----aaaatcttcctgcttctctgaggactc--aaatt------tttaac----taattgttata
B D                     Chimp  tttta----aaaatcttcctgcttctctgaggactc--aaatt------tttaac----taattgttata
B D                    Bonobo  ttttt----aaaatcttcctgcttctctgaggactc--aaatt------tttaac----taattgttata
B D                   Gorilla  tttta----aaaatcttcctgcttctctgaggactc--aaatt------tttaac----taattgttata
B D                 Orangutan  tttta----aaaatcttcctgcttctctgaggaccc--aagtt------tttaac----taattgttata
B D                    Gibbon  tttta----aaaatct---tgcttctctgaggactc--aagtt------tttaac----taattgttata
B D                    Rhesus  tttta----aaaatcttcctgcttttctgaggactc--aagtt------tttaactgagtaattgttatg
B D       Crab-eating macaque  tttaa----aaaatcttcctgcttttctgaggactc--aagtt------tttaactgagtaattgttatg
           Pig-tailed macaque  tttaa----aaaatcttcctgcttttctgaggactc--aagtt------tttaac----taattgttatg
               Sooty mangabey  ttaaa----aaaatcttcctgcttttctgaggactc--aagtt------tttaactgagtaattgttatg
                       Baboon  ttaaa----aaaatcttcctgcttttctgaggactc--aagtt------tttaactgagtaattgttatg
B D              Green monkey  tttaa----aaaatcttcctgcttttctgaggactc--aagtt------tttaactgagtaattgttatg
                        Drill  ttttt----aaaatcttcctgcttttctgaggactc--aagtt------tctaactgagtaattgttatg
B D          Proboscis monkey  tttta----aaagtcttcctgcatttctgaggactc--gagtt------tttaat----taattgttata
              Angolan colobus  tttta----aaagtcttcctgcatttctgaggactc--aagtt------tttaat----taattgttata
B D  Golden snub-nosed monkey  tttta----aaagtcttcctgcatttctgaggactc--gagtt------tttaat----taattgttata
      Black snub-nosed monkey  tttta----aaagtcttcctgcatttctgaggactc--gagtt------tttaat----taattgttata
B D                  Marmoset  ttttt---aaaaatcttcccccttctatgaagactc--aagtt------tttaactgagtaattgttata
B D           Squirrel monkey  ttttt-----aaatcttcccccttctatgaagactc--aagtt------tttaac----taattgttata
          White-faced sapajou  ttttt---aaaaatcttcccccttctatgaagactc--aagtt------tttaactgagtaattgttata
            Ma's night monkey  ttttttttttaaatcttccctcttctatgaaggttc--aagtt------tttaactgagtaattgttata
B D                   Tarsier  ttttt---ttaaatcttcctgtttctttgaagtttcttaaatt------tttaactgagtatttattata
                  Black lemur  tttta----aaaatcttcctgcctctctgaaacctcttaaatt------tttaac----tatttgttaca
              Sclater's lemur  tttta----aaaatcttcctgcctctctgaaacctcttaaatt------tttaac----tatttgttaca
B D                  Bushbaby  -ttca----aaaa---ctctgtttctctgatacctcttaaatt------t---------tatctct----
B D                       Dog  ttttt----aatgtgt-------tttttaatgtgtt--aacttgttaaatttaat----tatttattata
B D                 Armadillo  -ttct----taaatccttttacatccttaaacttcttaaaatt------tttgct------attgatata
                 Mouse lemur  ======================================================================
B D                     Mouse  ----------------------------------------------------------------------
           Coquerel's sifaka  ======================================================================

                        Human  tttata
                        Chimp  tttata
                       Bonobo  tttata
                      Gorilla  tttata
                    Orangutan  tttata
                       Gibbon  tttata
                       Rhesus  tttata
          Crab-eating macaque  tttata
           Pig-tailed macaque  tttata
               Sooty mangabey  tttata
                       Baboon  tttata
                 Green monkey  tttata
                        Drill  tttata
             Proboscis monkey  tttata
              Angolan colobus  tttata
     Golden snub-nosed monkey  tttata
      Black snub-nosed monkey  tttata
                     Marmoset  tttata
              Squirrel monkey  tttata
          White-faced sapajou  tttata
            Ma's night monkey  tttata
                      Tarsier  tttata
                  Black lemur  ttcata
              Sclater's lemur  ttcata
                     Bushbaby  ------
                          Dog  ttcata
                    Armadillo  tttatt
                  Mouse lemur  ======
                        Mouse  ------
            Coquerel's sifaka  ======

Inserts between block 25 and 26 in window
                 Black lemur 239bp
             Sclater's lemur 239bp

Alignment block 26 of 56 in window, 89800919 - 89800921, 3 bps 
B D                     Human  ata
B D                     Chimp  ata
B D                    Bonobo  ata
B D                   Gorilla  ata
B D                 Orangutan  ata
B D                    Gibbon  ata
B D                    Rhesus  ata
B D       Crab-eating macaque  ata
           Pig-tailed macaque  ata
               Sooty mangabey  ata
                       Baboon  ata
B D              Green monkey  ata
                        Drill  ata
B D          Proboscis monkey  atc
              Angolan colobus  ata
B D  Golden snub-nosed monkey  ata
      Black snub-nosed monkey  ata
B D                       Dog  -ta
B D                 Armadillo  -ta
                 Mouse lemur  ===
B D                     Mouse  ---
             Sclater's lemur  ===
                 Black lemur  ===
           Coquerel's sifaka  ===
B D                  Bushbaby  ---
B D                   Tarsier  ---
           Ma's night monkey  ---
         White-faced sapajou  ---
B D           Squirrel monkey  ---
B D                  Marmoset  ---

Alignment block 27 of 56 in window, 89800922 - 89801170, 249 bps 
B D                     Human  agataactaatattt--aaaagtattcat-----ataatatgata----------aaatacattgataga
B D                     Chimp  agataactaatattt--aaaagtattcat-----ataatatgata----------aaatacattgataaa
B D                    Bonobo  agataactaatattt--aaaagtattcat-----ataatatgata----------aaatacattgataaa
B D                   Gorilla  agataactaatattt--aaaagtattcac-----ataat---ata----------aaatacattgataaa
B D                 Orangutan  agataactaatattt--aaaattattcat-----ataatatgata----------aaatacatttataaa
B D                    Gibbon  agataactaatattt--aaaattattcac-----ataatatgata----------aaatacatttataaa
B D                    Rhesus  acataactaatattt--aaaattattcat-----ataatatgatg----------aaatacatttataaa
B D       Crab-eating macaque  acataactaatattt--aaaattattcat-----ataatatgatg----------aaatacatttataaa
           Pig-tailed macaque  acataactaatattt--aaaattattcat-----ataatatgatg----------aaatacatttataaa
               Sooty mangabey  acataactaatattt--aaaattattcat-----ataatatgatg----------aaatacatttataaa
                       Baboon  acataactaatattt--aaaattattcat-----ataatatgatg----------aaatacatttataaa
B D              Green monkey  acataactaatattt--aaaattattcat-----ataatatgatg----------aaatacatttataaa
                        Drill  acataactaatattt--aaaattattcat-----ataatatgatg----------aaacacatttataaa
B D          Proboscis monkey  acgtaactaatattt--aatattattctt-----ataatatgatg----------aaatacatttataaa
              Angolan colobus  atgtaactaatattt--gaaattattct----------tatgatg----------aaatacatttataaa
B D  Golden snub-nosed monkey  atgtaactaatattt--aaaattattctt-----ataatatgatg----------aaatacatttataaa
      Black snub-nosed monkey  atgtaactaatattt--aaaattattctt-----ataatatgatg----------aaatacatttataaa
B D                  Marmoset  agataactaatattt--aaaattatcaac-----ataatatgata----------aaatccatttataaa
B D           Squirrel monkey  agataactaatattt--aaaattatcaac-----atgatatgata----------aaatacatttataaa
          White-faced sapajou  cgataactaatattt--aaaattatcaat-----ataatatgata----------aaatacatttataaa
            Ma's night monkey  agataactaatatct--aaaattatcaat-----ataatatgata----------aaatacatttataaa
B D                   Tarsier  ---tcagtagtcttt--gaaattgtcaat-----atgatataata----------aaatatatttataaa
B D                  Bushbaby  --taaaatactcttt--aaaactatc----------aatatgata----------aaatatatttgtaaa
B D                     Mouse  agataatttgcctttagaaaagaatctgtagtccatgagatgata----------atatatacttttgag
B D                       Dog  agataagcaaccttt--agaatcatcagt-----atgatctgatattgtatatttatgtatatttatgaa
B D                 Armadillo  agataag-aaaacta--aaaataat---------ttggtaagata----------aaatatatttataat
                 Mouse lemur  ======================================================================
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================
           Coquerel's sifaka  ======================================================================

                        Human  tat-----agcatataatcgggtggatatt--------gtcttgcctt----aaaaagttaa--aagt--
                        Chimp  tat-----agcatataatcatgtggatatt----aagtgtcttgcctc----aaaaagttaa--aagt--
                       Bonobo  tat-----agcatataatcatgtggatatt----aagtgtcttgcctc----aaaaagttaa--aagt--
                      Gorilla  tat-----agcatataatcatgtggatatt----aagtgtcttgcctt----aaaaagttaa--aagt--
                    Orangutan  tat-----agcatataatggtgtggatatt----aagtgtcttgactt----aaaaagttaa--aagt--
                       Gibbon  tat-----agcatataatggtgtagatatt----aagtgtcttgactt----aaaaagttaa--aa-t--
                       Rhesus  tat-----agcatataatggtgtggatatt----aagtgttttgcctt-----aaaagttaa--aagt--
          Crab-eating macaque  tat-----agcatataatggtgtggatatt----aagtgttttgcctt-----aaaagttaa--aagt--
           Pig-tailed macaque  tat-----aacatataatggtgtggatatt----aagtgttttgcctt-----aaaagttaa--aagt--
               Sooty mangabey  tat-----cacatataatggtgtggatatt----aagtgttttgcctt-----aaaagttaa--aagt--
                       Baboon  tat-----ggcatataatggtgtggatatt----aagtgttttgcctt-----aaaagttaa--aagt--
                 Green monkey  tat-----agcatataatggtgtggatatt----aagtgttttgcctt-----aaaagttca--aaat--
                        Drill  tat-----agcatataatggtgtggatatt----aagtgttttgcctt-----aaaagttaa--aagt--
             Proboscis monkey  cat-----agcatataatgatgtggatatt----aagtgttttgcctt----aaaaagttaa--aagt--
              Angolan colobus  cat-----agcatataatggtgtggatatt----aagtgttttgcctt----aaaaagttaa--aagt--
     Golden snub-nosed monkey  cat-----agcatataatgatgtggatatt----aagtgttttgcctt----aaaaagttaa--aagt--
      Black snub-nosed monkey  cat-----agcatataatgatgtggatatt----aagtgttttgcctt-----aaaagttaa--aagt--
                     Marmoset  tat-----agcctataatggtgtggatatc--------gtcttgcctt----aaaaagttaa--aagt--
              Squirrel monkey  tat-----agcatataatggtgtggatata--------gtcttgcctt----aaaaagttaa--aagt--
          White-faced sapajou  tat-----agcatataatgttgtggatatt--------gttttgcctt----taaaagttaa--atgt--
            Ma's night monkey  tat-----agcatataatggtgtggatatt--------gtcttgcctt----aaaaagttaa--aagt--
                      Tarsier  tat-----agcacataatagtgtggagatt----aagtgtattgcatt---tttaaaagtga--aaga--
                     Bushbaby  tgt-----atcatataatggtgtagagatt----aaaagtcttgccctaaaaaaaaaattaa--agag--
                        Mouse  tat-----ggagtacagcaatgtggaaact----aagtcacttgcctt-----aaaaataaattaatg--
                          Dog  tatttatgaatacagcataatacagaaattatttaactgacttgctcc----aaaaaatgaa--aattta
                    Armadillo  taa-----atc--ataacagtgtggagattacttaaatggtttggcct-------------a--ctag--
                  Mouse lemur  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================
            Coquerel's sifaka  ======================================================================

                        Human  ---aaaatt---aaag------aa-------aagaaa-----acactgagcaaatc-----aaagaaaat
                        Chimp  ---aaaatt---aaag------aa-------aagaaa-----acactgagcaaatc-----aaagaaaat
                       Bonobo  ---aaaatt---aaag------aa-------aagaaa-----acactgagcaaatc-----aaagaaaat
                      Gorilla  ---aaaatt---aaac------aa-------aagaaa-----acactgagcaaatc-----aaagaaaat
                    Orangutan  ---aaaatt---aaag------aa-------aagaaa-----acactgagcaaatc-----aaagaaaat
                       Gibbon  ---aaaatt--------------a-------aagaaa-----acattgagcaaatc-----aaataaaat
                       Rhesus  ---aaaatt---aaag------aa-------atgaaa-----aaattgagcaaatc-----aaagaaaat
          Crab-eating macaque  ---aaaatt---aaag------aa-------atgaaa-----aaattgagcaaatc-----aaagcaaat
           Pig-tailed macaque  ---aaaatt---aaag------aa-------atgaaa-----aaattgagcaaatc-----aaagaaaat
               Sooty mangabey  ---aaaatt---aaag------aa-------atgaaa-----aaattgagcaaatc-----aaagaaaat
                       Baboon  ---aaaatt---aaag------aa-------atgaaa-----aaattgagcaaatc-----aaagaaaat
                 Green monkey  ---aaaatt---aaag------aa-------atgaaa-----aaattgagcaaatc-----aaagaaaat
                        Drill  ---aaaatt---aaag------aa-------atgaaa-----aaattgagcaaatc-----aaagaaaat
             Proboscis monkey  ---aaaatt---aaag------aa-------aagaaa-----aaattgagcaaatc-----aaagaaaat
              Angolan colobus  ---aaaatt---aaag------aa-------aagaaa-----aaattgagcaaatc-----aaagaaaat
     Golden snub-nosed monkey  ---aaaatt---aaag------aa-------aagaaa-----aaattgagcaaatc-----aaagaaaat
      Black snub-nosed monkey  ---aaaatt---aaag------aa-------aagaaa-----aaattgagcaaatc-----aaagaaaat
                     Marmoset  ---aaagtt---aaag------aa-------aagaaa-----aaattgagcaaatc-----aaagaaaat
              Squirrel monkey  ---acaatt---aaag------ca-------aagaaa-----aaattgagcaaatc-----aaagaaaat
          White-faced sapajou  ---aaaatt---aaag------aa-------aagaaa-----aaattaagcaaatc-----aaagaaact
            Ma's night monkey  ---aaaatt---aaag------aa-------aagaaa-----aaactgagcaaatc-----aaagaaaat
                      Tarsier  ---aaattt---aaagaaaattaa-------aaaaac-----aaattgaacaaatc-----aaagaaaac
                     Bushbaby  ---aatttttaaaaag------aa-------aaaaac-----aaattgaacaagtc-----atagaaaat
                        Mouse  ---aaaatt---aaat------aatatttttaaaatg-----caaatggataaatc-----aaataaa--
                          Dog  aagaaattt---aaag------aa-------aagtaaaagccaaaatgaataaatt-----aaagaaaac
                    Armadillo  ---aaaact---aaag------gg-------aagaaa-----aa---gagctaatttgaaaaaataaaat
                  Mouse lemur  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================
            Coquerel's sifaka  ======================================================================

                        Human  agatattcttctgattaggagac-ttcctttaaca-----tttttttactcacataaa--ac--aaaaat
                        Chimp  agatattcttctgattaggagac-ttcctttaaca-----tttttttactcacataaa--ac--aaaaat
                       Bonobo  agatattcttctgattaggagac-ttcctttaaca-----tttttttactcacataaa--ac--aaaaat
                      Gorilla  agatattcttctgattaggagac-ttcccttaacat----tttttttactcacataaa--ac--aaaaat
                    Orangutan  agatattcttctgattaggagac-ttcctttaaca-----tttttgtactcacataaa--ac--aaaaat
                       Gibbon  agatattcttctgattaggagac-ttcctttaaca-----tttttttactaacataaa--ac--aaaaat
                       Rhesus  agatattcttctgattaggaaac-ttcctttagca------ttttttactcacataaa--ac--aaaaat
          Crab-eating macaque  agatattcttctgattaggaaac-ttcctttagca------ttttttactcacgtaaa--ac--aaaaat
           Pig-tailed macaque  agatattcttctgattaggaaac-ttcctttagca------ttttttactcacataaa--ac--aaaaat
               Sooty mangabey  agatattcttctgattaggaaac-ttcctttagca------ttttttgctcacataaa--ac--aaaaat
                       Baboon  agatattcttctgattaggaaac-ttcctttagca------ttttttactcacataaa--ac--aaaaat
                 Green monkey  agatattcttctgattaggaaac-ttcctttagca-----tttttttactcacataaa--ac--aaaaat
                        Drill  agatattcttctgattaggaaac-ttcctttagca-----tttttttactcacataaa--ac--aaaaat
             Proboscis monkey  agatattcttctgattaggagac-ttcctttagca-----tttttttactcacataaa--ac--aaaaat
              Angolan colobus  agatattcttctgattaggagac-ttcctttagca-----tttttttactcacataaa--at--aaaaat
     Golden snub-nosed monkey  agatattcttctgattaggagac-ttcctttagca-----tttttttactcacataaa--ac--aaaaat
      Black snub-nosed monkey  agatattcttctgattaggagac-ttcctttagca-----tttttttactcacataaa--ac--aaaaat
                     Marmoset  agatattcttctaattaggacac-tccctgtagcat----tttttttactcacataca--ac--aaaaat
              Squirrel monkey  agatattgttctaattaggacac-tttctgtagca-----tttttttactcacataca--ac--aaaaat
          White-faced sapajou  agatattattctaattaggacac-ttcctgtagca-----tttttttattcacataca--ac--aaaaat
            Ma's night monkey  agatattcttctaattaggacac-ttcctgtagca------ttttttactcacataca--ac--aaaaat
                      Tarsier  agatg---ttctaattaggagaa-ttcctttagct-----cttttttattcacataaa--ac--aaaaat
                     Bushbaby  agggatctttat--ttagaaaaa-tttcttcat-------tcattttagtcaca----------aaaaac
                        Mouse  ------tattctaatttgatgag-ttttttttcca--------ttttattcacagaag--ac--aaaaat
                          Dog  agatattattctaattagaaaatattcctttagtttttgcttttttccctcacataaaatat--aaaaat
                    Armadillo  aagagctattctaattagaa----ttcctttggct-----cattctttctcacatgaa--acataaaaat
                  Mouse lemur  ======================================================================
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================
            Coquerel's sifaka  ======================================================================

                        Human  taaatgttggtttctggctaaa--------tac-----a----aagatttca-g-aa-cattacac
                        Chimp  taaatgttggtttccggctaaa--------tac-----a----aagatttca-g-aa-cattacac
                       Bonobo  taaatgttggtttccggctaaa--------tac-----a----aagatttca-g-aa-cattacac
                      Gorilla  taaatgttggtttctggctaaa--------tac-----a----aagatttca-g-aa-cattacac
                    Orangutan  taaatgtcggtttctggataaa--------tac-----a----aagatttca-g-aa-cattacac
                       Gibbon  taaatgtcggtttttggataaa--------tac-----a----aagatttca-g-aa-catgacac
                       Rhesus  ttaatgtcggtttctggataaa--------tac-----a----aagatttca-g-aa-cattacac
          Crab-eating macaque  ttaatgtcggtttctggataaa--------tac-----a----aagatttca-g-aa-cattacac
           Pig-tailed macaque  ttaatgtcggtttctggataaa--------tac-----a----aagatttca-g-aa-cattacac
               Sooty mangabey  ttaatgtccgtttctggataaa--------tac-----a----aagatttca-g-aa-cattacac
                       Baboon  ttaatgtcggtttctggataaa--------tac-----a----aagatttca-g-aa-cattacac
                 Green monkey  ttaatgtcggtttctggataaa--------tac-----a----aagatttca-g-aa-cattacac
                        Drill  ttaatgtcggtttctggataaa--------tac-----a----aagatttca-g-aa-cattacac
             Proboscis monkey  ttaatgttggtttctggataaa--------tac-----a----aatatttca-g-aa-cattacac
              Angolan colobus  ttaatgttggtttctggataaa--------tac-----a----aagatttca-g-aa-cattacac
     Golden snub-nosed monkey  ttaatgttggtttctggataaa--------tac-----a----aatatttca-g-aa-cattacac
      Black snub-nosed monkey  ttaatgttggtttctggataaa--------tac-----a----aatatttca-g-aa-cattacac
                     Marmoset  ctaatgttgggttctgggtaaa--------tac-----a----aagatttta-g-aa-cattacac
              Squirrel monkey  ctaatgttgggttctggataaa--------tac-----a----aagatttca-g-aa-cattacac
          White-faced sapajou  ctaatgttgggttctgggtaaa--------tac-----a----aagacttca-g-aa-cattacac
            Ma's night monkey  ctaatgttggaatctgggtaaa--------tgc-----a----aagatttca-g-aa-cattacac
                      Tarsier  ctaatgttagagtctgagtagc--------tac-----a----aagatttca-gaaa-cactgtac
                     Bushbaby  ctactgtgagcttccaggtaaa-------ctac-----a----acaatatcata-aa-cacttgac
                        Mouse  tgaacattgcactgttaataaa--------taaatgaga----aagattcca-ggaa-caccactc
                          Dog  atgatgtaagattctgggggaaaaaaaaactac-----a----aatgtttca-a-ag-caca----
                    Armadillo  ctattgtcagattctgggtaaa--------taa-----accaggaaatttca-g-aaggaccaccc
                  Mouse lemur  ==================================================================
              Sclater's lemur  ==================================================================
                  Black lemur  ==================================================================
            Coquerel's sifaka  ==================================================================

Inserts between block 27 and 28 in window
B D                 Bushbaby 1bp
B D                    Mouse 1bp

Alignment block 28 of 56 in window, 89801171 - 89801325, 155 bps 
B D                     Human  -aaa-tagtgagttcatttccatttcccaacttatactccaaagaaaggaaaagaatgatgaagtagata
B D                     Chimp  -aaa-tagtgagttcatttccatttcccaagttatactccaaagaaaggaaaagaatgatgaagtagata
B D                    Bonobo  -aaa-tagtgagttcatttccatttcccaagttatactccaaagaaaggaaaagaatgatgaagtagata
B D                   Gorilla  -aaa-tagtgagttcattgccatttcccaagttatactccaaagaaaggaaaagaatgatgaagtagata
B D                 Orangutan  -aaa-tagtgagttcatttccatttcccaagttatactccaaagaaaggaaaagaatgatgaagtatata
B D                    Gibbon  -aaa-cagtgagttcatttccattttccaggttatactccaaagaaaggaaaagaatgatgaagaagata
B D                    Rhesus  -aaa-tagtgagttcatttccatttcccaagtaatactccaaaggaaggaaaagaatgatgaagtagata
B D       Crab-eating macaque  -aaa-tagtgagttcatttccatttcccaagtaatactccaaaggaaggaaaagaatgatgaagtagata
           Pig-tailed macaque  -aaa-tagtgagttcatttccatttcccaagtaatactccaaaggaaggaaaagaatgatgaagtagata
               Sooty mangabey  -aaa-tagtgagttcatttccatttcccaagtaatgctccaaaggaaggaaaagaatgatgaagtagata
                       Baboon  -aaa-tagtgagttcatttccatttcccaagtaatgctccaaaggaaggaaaagaatgatgaagtagata
B D              Green monkey  -aaa-tagtgagttcatttccatttcccaagtaatactccaaaggaaggaaaagaatgatgaagtagata
                        Drill  -aaa-tagtgagttcatttccatttcccaagtaatactccaaaggaaggaaaagaatgatgaagtagata
B D          Proboscis monkey  -aaa-tagtgagttaatttccatttcccgagttatactccaaaggaaggaaaagaatgatgaagtagata
              Angolan colobus  -aaa-tagtgaattaatttccatttcccaagttatactccaaaagaaggaaaagaatgatgaagtagata
B D  Golden snub-nosed monkey  -aaa-tagtgagttaatttccatttcccaagttatactccaaaggaaggaaaagaatgatgaagtagata
      Black snub-nosed monkey  -aaa-tagtgagttaatttccatttcccaagttatactccaaaggaaggaaaagaatgatgaagtagata
B D                  Marmoset  -aaa-tagtgagttcatttcgatttcccaagttatatcccaaagaaagaaaaagaatgatgaagtcgatc
B D           Squirrel monkey  -aaa-tagtgagttcattttgatttctcaagttatactccaaagaaagaaaaagaatgatgaagtagata
          White-faced sapajou  -aaa-tagtgagttcatttcgatttcccaagttatactccaaagaaagaaaaagaatgatgaagtagata
            Ma's night monkey  -aaa-tagtgagttcatttcgatttcccaagttatactccaaagaaagaaaaaaaatgatgaagtagata
B D                   Tarsier  -aaagtgctaacttcatttc-atttctcaagttatagccc----------aaaaaatgttgaagtagata
                  Mouse lemur  -aaa-tggtgaatccatttccattttccaagttatgctccaaagaaaggaaaagaatgatgaagcagata
                  Black lemur  -aaa-tggtgaatccattttcattttccaagttatgctccaaagaaagggaaagaatgatgaagcagata
              Sclater's lemur  -aaa-tggtgaatccattttcattttccaagttatgctccaaagaaagggaaagaatgatgaagcagata
B D                  Bushbaby  -aaa-tgatgaatccatttctattttccaagttatgctctgaagaaaggaaaagaatgataaagcagata
B D                     Mouse  -aaa-cagagacttcatttcactttccaaagacatactgc-----aagaaaaagaaaaatgaaagatata
B D                       Dog  -aaa-taataaacccatttttattccccaagtcatattccaaagaaaggaaaagaataatgaagtagata
B D                 Armadillo  aaaa-tgatgaatctatttctattttccaagtcttaccaccaagaagggaaaagaatgataaaatagata
           Coquerel's sifaka  ======================================================================

                        Human  ctgatggtt-gtaaaagaaataatctagattggcatt-attccaatatcctaattg-aaaat--------
                        Chimp  ctgatggtt-gtaaaagaaataatctagattggcatt-attccaatatcctaattg-aaaat--------
                       Bonobo  ctgatggtt-gtaaaagaaataatctagattggcatt-attccaatatcctaattg-aaaat--------
                      Gorilla  ctgatggtt-gtaaaagaaataatctagattggcatt-attccaatatcctaattg-aaaat--------
                    Orangutan  ctgatggtt-gtaaaagaaataatctagattggcatt-attccaatatcctaattg-aaaat--------
                       Gibbon  ctgatggtt-gtaaaagaaataatctagattggcatt-attccaatatcctaattg-aaaat--------
                       Rhesus  ctgatggtt-gtaaaataaataatcta-attggcatt-attccaataacctaattg-aaaat--------
          Crab-eating macaque  ctgatggtt-gtaaaataaataatcta-attggcatt-attccaataacctaattg-aaaat--------
           Pig-tailed macaque  ctgatggtt-gtaaaataaataatcta-attggcatt-attccaataacctaattg-aaaat--------
               Sooty mangabey  ctgatggtt-gtaaaataaataatcta-attggcatt-attccaataacctaattg-aaaat--------
                       Baboon  ctgatggtt-gaaaaataaataatcta-attggcatt-attccaataacctaattg-aaaat--------
                 Green monkey  ctgatggtt-gtaaaataaataatcta-attggcatt-attccaataacctaattg-aaaat--------
                        Drill  ctgatggtt-gtaaaataaataatcta-attggcatt-attccaataacctaattg-aaaat--------
             Proboscis monkey  ctgatggtt-gtaaaataaataatctagattggcatt-attccaatatcctaattg-aaaat--------
              Angolan colobus  ctgatggtt-gtaaaataaataatctaaattggcatt-attccaatatcctaattg-aaaat--------
     Golden snub-nosed monkey  ctgatggtt-gtaaaataaataatctagattggcatt-attccaatatcctaattg-aaaat--------
      Black snub-nosed monkey  ctgatggtt-gtaaaataaataatctagattggcatt-attccaatatcctaattg-aaaat--------
                     Marmoset  ctgacggtt-gaaaaagaaataatctggattgccatt-attccaatatcctaattg-aaaat--------
              Squirrel monkey  ctgatggtt-gaaaaagaaataatctgggttggcatt-tttccaatatcctaattg-aaaat--------
          White-faced sapajou  ctgatggtt-gaaaaagaaataatctggattggcatt-attccaatatcctaattg-aaaat--------
            Ma's night monkey  ctgatggtt-gaaaaagaaataatctggattggcatt-attccaacagcctaattg-aaaat--------
                      Tarsier  ctgctgttt-gaaaaag-agtaatccacatgggcact-attccaacatcttgattg-aaaat--------
                  Mouse lemur  ctgatggct-gaaaaagtaataatccagagttgcatt-attccaatatccttgtta-aaaat--------
                  Black lemur  ctgatggct-gaaaaagtgataatccagatttgcatt-attccaatatcctcatta-aaaat--------
              Sclater's lemur  ctgatggct-gaaaaagtgataatccagatttgcatt-attccaatatcctcatta-aaaat--------
                     Bushbaby  ctgatgatt-gaaaaagtgataa--------tgtatt--tttcaatatcctcatta-aaaac--------
                        Mouse  ctgataatt-gaaaaagaaataatgaagattgacatt-atttcaatatcctgattt-aaagttcagaaga
                          Dog  ctgatcattaaaaaaaggaattagctagactgacatt-attccaatatcctgatag-aacat--------
                    Armadillo  catatgaat-gaaaagggaaaaatccaggttggcattttttccaatattttgattgaaaaat--------
            Coquerel's sifaka  ======================================================================

                        Human  ------------------aagactcataagagatta--ctgtattgag
                        Chimp  ------------------aaaactcataagagatta--ctgtattgag
                       Bonobo  ------------------aaaactcataagagatta--ctgtattgag
                      Gorilla  ------------------aagactcataagagatta--ctgtattgag
                    Orangutan  ------------------aagacttataagagatta--ctgtattgag
                       Gibbon  ------------------aggactcataagagatta-----tattgag
                       Rhesus  ------------------aagactcataagagatta--ctgtattcag
          Crab-eating macaque  ------------------aagactcataagagatta--ctgtattcag
           Pig-tailed macaque  ------------------aagactcataagagatta--ctgtattcag
               Sooty mangabey  ------------------aagactcataagagatta--ctgtattcag
                       Baboon  ------------------aagactcataagagatta--ctgtattcag
                 Green monkey  ------------------aagactcataagagatta--ctgtattcag
                        Drill  ------------------aagactcataagagatta--ctatattcag
             Proboscis monkey  ------------------aagactcataagagatta--ctgtattgag
              Angolan colobus  ------------------aagactcataagagatta--ctgtattgag
     Golden snub-nosed monkey  ------------------aagactcataagagatta--ctgtattgag
      Black snub-nosed monkey  ------------------aagactcataagagatta--ctgtattgag
                     Marmoset  ------------------aagacccttaagaggtta--ccatattgag
              Squirrel monkey  ------------------aagactcttaagagatta--ctgtattgag
          White-faced sapajou  ------------------aagactcttaagagatta--ctgtattgag
            Ma's night monkey  ------------------aagactcttaagagatta--ctgtattgag
                      Tarsier  ------------------aagactcataagagattt--ctgtatcaag
                  Mouse lemur  ------------------aagactcataaaagatta--ctgtattgag
                  Black lemur  ------------------aagactcataaaagatta--ctgtatagag
              Sclater's lemur  ------------------aagactcataaaagatta--ctgtatagag
                     Bushbaby  ------------------aagacttttaatagatta--ttgggttgag
                        Mouse  tattatgacaaagattccaagaactttgaaagataagtgtgtactgag
                          Dog  ------------------tagactcctaggagattc--ctgcattcag
                    Armadillo  ------------------aagattcttaagagagta--ctatattgag
            Coquerel's sifaka  ================================================

Inserts between block 28 and 29 in window
                 Mouse lemur 86bp

Alignment block 29 of 56 in window, 89801326 - 89801328, 3 bps 
B D                     Human  taa
B D                     Chimp  taa
B D                    Bonobo  taa
B D                   Gorilla  taa
B D                 Orangutan  taa
B D                    Gibbon  taa
B D                    Rhesus  taa
B D       Crab-eating macaque  taa
           Pig-tailed macaque  taa
               Sooty mangabey  taa
                       Baboon  tag
B D              Green monkey  taa
                        Drill  taa
B D          Proboscis monkey  taa
              Angolan colobus  taa
B D  Golden snub-nosed monkey  taa
      Black snub-nosed monkey  taa
B D                  Marmoset  taa
B D           Squirrel monkey  caa
          White-faced sapajou  caa
            Ma's night monkey  taa
B D                   Tarsier  taa
                  Black lemur  tga
              Sclater's lemur  tga
B D                  Bushbaby  tga
B D                     Mouse  caa
B D                       Dog  tga
B D                 Armadillo  tga
                 Mouse lemur  ===
           Coquerel's sifaka  ===

Inserts between block 29 and 30 in window
B D                    Mouse 181bp

Alignment block 30 of 56 in window, 89801329 - 89801419, 91 bps 
B D                     Human  gggtgcacctg--aaagtag-tttt---------------------------------------------
B D                     Chimp  gggtgcacctg--aaagtag-tttt---------------------------------------------
B D                    Bonobo  gggtgcacctg--aaagtag-tttt---------------------------------------------
B D                   Gorilla  gggtgcacctg--aaagtag-tttt---------------------------------------------
B D                 Orangutan  gggtgcacctg--aaagtag-tttt---------------------------------------------
B D                    Gibbon  gggtgcacctg--aaagtag-tttt---------------------------------------------
B D                    Rhesus  gggtgcacctg--aaagtagttttt---------------------------------------------
B D       Crab-eating macaque  gggtgcacctg--aaagtagttttt---------------------------------------------
           Pig-tailed macaque  gggtgcacctg--aaagtagttttt---------------------------------------------
               Sooty mangabey  gggtgcacctg--aaagtagttttt---------------------------------------------
                       Baboon  gggtgcacctg--aaagtagttttt---------------------------------------------
B D              Green monkey  gggtgcacctg--aaagtag-tttt---------------------------------------------
                        Drill  gggtgcacctg--aaagtagttttt---------------------------------------------
B D          Proboscis monkey  gggtgcacctg--aaagtag-tttt---------------------------------------------
              Angolan colobus  gggtgcacctg--aaagtag-tttt---------------------------------------------
B D  Golden snub-nosed monkey  gggtgcacctg--aaagtag-tttt---------------------------------------------
      Black snub-nosed monkey  gggtgcacctg--aaagtag-tttt---------------------------------------------
B D                  Marmoset  gagtgcacctg--aatgtac-tttt---------------------------------------------
B D           Squirrel monkey  gggtgcacctg--aatgtac-tttt---------------------------------------------
          White-faced sapajou  gggtgcacctg--aatgtac-tttt---------------------------------------------
            Ma's night monkey  gggtgcacctg--aatgtac-tttt---------------------------------------------
B D                   Tarsier  ggatgcacctg--aaaatac-tttt---------------------------------------------
                  Black lemur  ggatgcacatg--aaaa-ac-tttt---------------------------------------------
              Sclater's lemur  ggatgcacatg--aaaa-ac-tttt---------------------------------------------
B D                  Bushbaby  ggaagcaccta--aaaatac-ttct---------------------------------------------
B D                     Mouse  gggtgcaactgcccagataa-tttccccttcccccatcccttcttcccttccttcctccctagaggcagc
B D                       Dog  agatgcacctg--aaaatac-tttt---------------------------------------------
B D                 Armadillo  aaatgcacttg--aaaataa-tttt---------------------------------------------
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================

                        Human  --------------------------------caggacatatgt------gta-----------------
                        Chimp  --------------------------------caggacatatgt------gta-----------------
                       Bonobo  --------------------------------caggacatatgt------gta-----------------
                      Gorilla  --------------------------------caggacatatgt------gta-----------------
                    Orangutan  --------------------------------caggacatatgt------gta-----------------
                       Gibbon  --------------------------------caggacatatgt------gta-----------------
                       Rhesus  --------------------------------caggacaaacgt------gta-----------------
          Crab-eating macaque  --------------------------------caggacaaacgt------gta-----------------
           Pig-tailed macaque  --------------------------------caggacaaacgt------gta-----------------
               Sooty mangabey  --------------------------------caggacaaatgt------gta-----------------
                       Baboon  --------------------------------caggacaaatgt------gta-----------------
                 Green monkey  --------------------------------caggacaaatgt------gta-----------------
                        Drill  --------------------------------caggacaaacgt------gta-----------------
             Proboscis monkey  --------------------------------caggacaaatgt------gta-----------------
              Angolan colobus  --------------------------------caggacaaatgt------gta-----------------
     Golden snub-nosed monkey  --------------------------------caggacaaatgt------gta-----------------
      Black snub-nosed monkey  --------------------------------caggacaaatgt------gta-----------------
                     Marmoset  --------------------------------caggacaaatgt------gca-----------------
              Squirrel monkey  --------------------------------caggacaaatgt------gta-----------------
          White-faced sapajou  --------------------------------caggacaaatgt------gta-----------------
            Ma's night monkey  --------------------------------caggacaaatgt------gta-----------------
                      Tarsier  --------------------------------caggacaaatgt------gta-----------------
                  Black lemur  --------------------------------ggggacaaatgt------gta-----------------
              Sclater's lemur  --------------------------------ggggacaaatgt------gta-----------------
                     Bushbaby  --------------------------------ggagacagatgt------gca-----------------
                        Mouse  ctctgtacctcttccccttaataaacctcccacaggagacctgttatatggtatggtttgtcagcatcct
                          Dog  --------------------------------caggacaaacat------gta-----------------
                    Armadillo  --------------------------------ttggacaaatat------gtg-----------------
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================

                        Human  --gtgggaagcaactaataaggaaatgtcttttctaagaatcatttatgacctttc
                        Chimp  --gtgggaatcaactaataaggaaatgtcttttctaagaatcatttatgacctttc
                       Bonobo  --gtgggaatcaactaataaggaaatgtcttttctaagaatcatttatgacctttc
                      Gorilla  --gtgggaatcaactaataaggaaatgtcttttctaagaatcatttatgacctttc
                    Orangutan  --gtgggaatcaactaataaggaaatgtcttttctaagaatcatttatgacctttc
                       Gibbon  --gtgggaatcaacgaataaggaaatgtcttttctaagaatcatttatgacctttc
                       Rhesus  --gtgggaatcaactaataaggaaatgtcttttctaagaatcatttatgacctttc
          Crab-eating macaque  --gtgggaatcaactaataaggaaatgtcttttctaagaatcatttatgacctttc
           Pig-tailed macaque  --gtgggaatcaactaataaggaaatgtcttttctaagaatcatttatgacctttc
               Sooty mangabey  --atgggaatcaactaataaggaaatgtcttttctaagaatcatttatgacctttc
                       Baboon  --gtgggaatcaactaataaggaaatgtcttttctaagaatcatttatgacctttc
                 Green monkey  --gtgggaatcaactaataaggaaatgtcttttctaagaatcatttatgacctttc
                        Drill  --gtgggaatcaactaataaggaaatgtcttttctaagaatcatttatgacttttc
             Proboscis monkey  --gtgggaatcaactaataaggaaatgtcttttctaagaatcatttatgatctttc
              Angolan colobus  --gtgggaatcaactaataaggaaatgtcttttctaagaatcatttatgacctttc
     Golden snub-nosed monkey  --gtgggaatcaactaataaggaaatgtcttttctaagaatcatttatgatctttc
      Black snub-nosed monkey  --gtgggaatcaactaataaggaaatgtcttttctaagaatcatttatgatctttc
                     Marmoset  --gtgggaattagctgatacggaaatgtcttttctaacaatca-ttatgacctttc
              Squirrel monkey  --gtgggagttaactaatacggaaatgtcttttctaataatcatttatgacctttc
          White-faced sapajou  --gtgggaattaactaatatggaaatgtcttttctaataatcatttatgacctttc
            Ma's night monkey  --gtgggaattaactaatacggaaatgtcttttctaataatcatttatgacctttc
                      Tarsier  --gtgggaatcagctaataaggaaatgtattttctaagaatcatttataacctttc
                  Black lemur  --gtgggaatcaactaataaggaagtgtgttttctacaaaccatttataaaatttc
              Sclater's lemur  --gtgggaatcaactaataaggaagtgtgttttctacaaaccatttataaaatttc
                     Bushbaby  --gtaggaatcagctaacaaggaaatgccttttctatgaatgatttataaactttc
                        Mouse  gggtgtagttccatcaataatggtatatgttttcaaggaattatttatagatttcc
                          Dog  --gtgataatcagttaataaggaaatgtgttttctaagaatca----taacttgtt
                    Armadillo  --gtaggattcagttaataaagtaatgtgtttcctaaatagcatttataacatgtc
                  Mouse lemur  ========================================================
            Coquerel's sifaka  ========================================================

Alignment block 31 of 56 in window, 89801420 - 89801435, 16 bps 
B D                     Human  aaatatccaagcatag
B D                     Chimp  aaatatccaagcagag
B D                    Bonobo  aaatatccaagcagag
B D                   Gorilla  aaatatccaagcagag
B D                 Orangutan  aaatatccaagcagag
B D                    Gibbon  aaatatccaagcagaa
B D                    Rhesus  aaatattcaagcagag
B D       Crab-eating macaque  aaatattcaagcagag
           Pig-tailed macaque  aaatattcaagcagag
               Sooty mangabey  aaatattcaagcagag
                       Baboon  acatattcaagcagag
B D              Green monkey  aaatattcaagcagag
                        Drill  aaatattcaagcagag
B D          Proboscis monkey  aaatatccaagcagag
              Angolan colobus  aaatatccaagcagag
B D  Golden snub-nosed monkey  aaatatccaagcagag
      Black snub-nosed monkey  aaatatccaagcagag
B D                  Marmoset  aaatacccaggcagag
B D           Squirrel monkey  aaatacccaagcagag
          White-faced sapajou  aaatacccaagcagag
            Ma's night monkey  aaatacccaagcagag
B D                   Tarsier  agatgcccaagcagag
                  Black lemur  aaatacacaagaa---
              Sclater's lemur  aaatacacaagaa---
B D                     Mouse  --atactcaaataaat
B D                       Dog  aaatactcaaactgag
B D                 Armadillo  agatactcaagctgag
                 Mouse lemur  ================
           Coquerel's sifaka  ================
B D                  Bushbaby  NNNNNNNNNNNNNNNN

Alignment block 32 of 56 in window, 89801436 - 89801472, 37 bps 
B D                     Human  gaatcggtatatatacaaatgagacagtatgagcaag
B D                     Chimp  gaatcggtatatatacaaatgagacagtatgagcaag
B D                    Bonobo  gaatcggtatatatacaaatgagacagtatgagcaag
B D                   Gorilla  gaatcggtacatatacaaatgagacagtgtgagcaag
B D                 Orangutan  gaattggtatatatacaaatgagacagtatgagcaag
B D                    Gibbon  gaatcggtgtatacacaaatgagacagtatgagcaag
B D                    Rhesus  gaattggtatgtatacaaatgagacagtatgagcaag
B D       Crab-eating macaque  gaattggtatgtatacaaatgagacagtatgagcaag
           Pig-tailed macaque  gaattggtatgtatacaaatgagacagtatgagcaag
               Sooty mangabey  gaattggtatgtatacaaatgacacagtatgagcaag
                       Baboon  gaattggtatgtatacaaatgacacagtatgagcaag
B D              Green monkey  gaattggtatgtatacaaatgagacagtatgagcaag
                        Drill  gaattggtatgtatacaaatgagacagtatgagcaag
B D          Proboscis monkey  gaatcggtatgtatacaaatgagacagtatgagcaag
              Angolan colobus  gaattggtatgtataaaaatgagacagtatgagcaag
B D  Golden snub-nosed monkey  gaatcggtacgtatacaaatgagacagtatgagcaag
      Black snub-nosed monkey  gaatcggtatgtatacaaatgagacagtatgagcaag
B D                  Marmoset  gaattgggatgtatacaaatgagacagtatgagcaag
B D           Squirrel monkey  gaattgggatgtatacaaatgaaacagtatgagcaag
          White-faced sapajou  gaattgggatgtatacaaatgagacagtatgagcaag
            Ma's night monkey  gaattgggatgtatacaaatgagacagtatgagcaag
B D                   Tarsier  gaatcggtgtgtatacaaatgagacagtatgagcaag
                  Mouse lemur  gaattggtatgtacacaagtgagacagtatgagcaag
                  Black lemur  gaatttgtatgtatacaaatgggacagtatgagcaag
              Sclater's lemur  gaatttgtatgtatacaaatgggacagtatgagcaag
B D                     Mouse  gaataggtatgtatcaaattaaggcaatatgagttgg
B D                       Dog  gaattagtatgtctacaaataaggcagtttgaacaag
B D                 Armadillo  gaattggtatatacacaaattaggtactatgagcaaa
           Coquerel's sifaka  =====================================
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 32 and 33 in window
                 Mouse lemur 461bp

Alignment block 33 of 56 in window, 89801473 - 89801494, 22 bps 
B D                     Human  ctgcctttgcttctaaaaggac
B D                     Chimp  ctgcctttacttctaaaaggac
B D                    Bonobo  ctgcctttacttctaaaaggac
B D                   Gorilla  ctgcctttacttctaaaaggac
B D                 Orangutan  ctgcctttacttctaaaaggac
B D                    Gibbon  ttgcctttacttctaaaaggac
B D                    Rhesus  ctgcctttacttctaaaaggac
B D       Crab-eating macaque  ctgcctttacttctaaaaggac
           Pig-tailed macaque  ctgcctttacttctaaaaggac
               Sooty mangabey  ctgcctttacttctaaaaggac
                       Baboon  ctgcctttacttctaaaaggac
B D              Green monkey  ctgcctttacttctaaaaggac
                        Drill  ctgcctttacttctaaaaggac
B D          Proboscis monkey  ctgcctttacttctaaaaggac
              Angolan colobus  ctgcctttacttctaaaaggac
B D  Golden snub-nosed monkey  ctgcctttaattctaaaaggac
      Black snub-nosed monkey  ctgcctttaattctaaaaggac
B D                  Marmoset  ctgcctttacttctgaaaggat
B D           Squirrel monkey  ctgcctttgcttctgaaaggac
          White-faced sapajou  ttgcctttacttctgaaaggac
            Ma's night monkey  ctgcctttacttctgaaagggc
B D                   Tarsier  ct-tcttcacttctaaaagagc
                  Black lemur  ctaccttcacttccaaaagggc
              Sclater's lemur  ctaccttcacttccaaaagggc
B D                     Mouse  --acattttccccaaaaa----
B D                       Dog  ----ctttacttctgaaaaatc
B D                 Armadillo  ctatgtccacttctaaaagg--
                 Mouse lemur  ======================
           Coquerel's sifaka  ======================
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNN

Inserts between block 33 and 34 in window
             Sclater's lemur 22bp
B D                      Dog 12bp

Alignment block 34 of 56 in window, 89801495 - 89801502, 8 bps 
B D                     Human  atatagat
B D                     Chimp  atatagat
B D                    Bonobo  atatagat
B D                   Gorilla  atatagat
B D                 Orangutan  atatagat
B D                    Gibbon  atatagat
B D                    Rhesus  atatagat
B D       Crab-eating macaque  atatagat
           Pig-tailed macaque  atatagat
               Sooty mangabey  atatagat
                       Baboon  atatagat
B D              Green monkey  atatagat
                        Drill  atatagat
B D          Proboscis monkey  atatagat
              Angolan colobus  atatcgac
B D  Golden snub-nosed monkey  atatagat
      Black snub-nosed monkey  atatagat
B D                  Marmoset  gtatagat
B D           Squirrel monkey  acatagat
          White-faced sapajou  acatagat
            Ma's night monkey  atatagat
B D                   Tarsier  atgtagat
                  Black lemur  agatagat
B D                     Mouse  atatagat
B D                       Dog  gggtgggt
B D                 Armadillo  ctgcaaat
                 Mouse lemur  ========
             Sclater's lemur  ========
           Coquerel's sifaka  ========
B D                  Bushbaby  NNNNNNNN

Inserts between block 34 and 35 in window
                 Black lemur 14bp
B D                    Mouse 4bp

Alignment block 35 of 56 in window, 89801503 - 89801516, 14 bps 
B D                     Human  acagagatggaaa--g
B D                     Chimp  acagagatggaaa--g
B D                    Bonobo  acagagatggaaa--g
B D                   Gorilla  acagagatggaaa--g
B D                 Orangutan  acagagatggaaa--g
B D                    Gibbon  acagagatggaaa--g
B D                    Rhesus  acagagatggaag--g
B D       Crab-eating macaque  acagagatggaag--g
           Pig-tailed macaque  acagagatggaag--g
               Sooty mangabey  acagagatggaaa--g
                       Baboon  acagagatggaaa--g
B D              Green monkey  acagagatggaaa--g
                        Drill  acagagatggaaa--g
B D          Proboscis monkey  acagagatggaaa--g
              Angolan colobus  acagagatggaaa--g
B D  Golden snub-nosed monkey  acagagatggaaa--g
      Black snub-nosed monkey  acagagatggaaa--g
B D                  Marmoset  acggagagggaaa---
B D           Squirrel monkey  atggagagggaaa---
          White-faced sapajou  atggagagagaaag--
            Ma's night monkey  atggagagggaaa-g-
B D                   Tarsier  agatagttaggta--g
B D                     Mouse  gaatggatga------
B D                       Dog  ggaaagatggatg--g
B D                 Armadillo  agagaaat--------
                 Mouse lemur  ================
             Sclater's lemur  ================
                 Black lemur  ================
           Coquerel's sifaka  ================
B D                  Bushbaby  NNNNNNNNNNNNNNNN

Inserts between block 35 and 36 in window
B D                 Marmoset 2bp
B D          Squirrel monkey 2bp
         White-faced sapajou 35bp
           Ma's night monkey 1bp

Alignment block 36 of 56 in window, 89801517 - 89801532, 16 bps 
B D                     Human  gcggggtgg--ggggcgg
B D                     Chimp  gcggggtgg--gga-cag
B D                    Bonobo  gcggggtgg--ggg-cag
B D                   Gorilla  gcggggtgg--ggg-cgg
B D                 Orangutan  gcggggtgg--ggg-cgg
B D                    Gibbon  gcggggtgg--ggg-cgg
B D                    Rhesus  gaggggtgg--ggg-cag
B D       Crab-eating macaque  gaggggtgg--ggg-cag
           Pig-tailed macaque  gaggggtgg--ggg-cag
               Sooty mangabey  gaggggtgg--ggg-cag
                       Baboon  gaggggtgg--ggg-cag
B D              Green monkey  gaggggtgg--ggg-cag
                        Drill  gaggggtgg--ggg-cag
B D          Proboscis monkey  gaggggtgg--ggg-cag
              Angolan colobus  gaggggtgg--ggg-cag
B D  Golden snub-nosed monkey  gaggggtgg--ggg-cag
      Black snub-nosed monkey  gaggggt-g--ggg-cag
B D                  Marmoset  gagaggaaa--ggg--ag
B D           Squirrel monkey  gagaggaag--cag--ag
            Ma's night monkey  gagagcaag--ggg--ag
B D                   Tarsier  -atagatagataga-cag
B D                     Mouse  -acagatga--gtg-tat
B D                       Dog  -atgaatgg--tgg-ctg
B D                 Armadillo  ---gagtgg--gg-----
                 Mouse lemur  ==================
             Sclater's lemur  ==================
                 Black lemur  ==================
           Coquerel's sifaka  ==================
B D                  Bushbaby  NNNNNNNNNNNNNNNNNN
         White-faced sapajou  ==================

Inserts between block 36 and 37 in window
B D                  Tarsier 237bp
B D                    Mouse 2bp
B D                      Dog 1bp

Alignment block 37 of 56 in window, 89801533 - 89801536, 4 bps 
B D                     Human  agaa
B D                     Chimp  agaa
B D                    Bonobo  agaa
B D                   Gorilla  agaa
B D                 Orangutan  agaa
B D                    Gibbon  agaa
B D                    Rhesus  agaa
B D       Crab-eating macaque  agaa
           Pig-tailed macaque  agaa
               Sooty mangabey  agaa
                       Baboon  agaa
B D              Green monkey  agaa
                        Drill  agaa
B D          Proboscis monkey  agaa
              Angolan colobus  agaa
B D  Golden snub-nosed monkey  agaa
      Black snub-nosed monkey  ag-a
B D                  Marmoset  agga
B D           Squirrel monkey  agag
            Ma's night monkey  agaa
B D                     Mouse  agag
B D                       Dog  aggg
                 Mouse lemur  ====
B D                 Armadillo  ----
             Sclater's lemur  ====
                 Black lemur  ====
           Coquerel's sifaka  ====
B D                  Bushbaby  NNNN
B D                   Tarsier  ====
         White-faced sapajou  ====

Alignment block 38 of 56 in window, 89801537 - 89801544, 8 bps 
B D                     Human  aaagagag
B D                     Chimp  aaagagag
B D                    Bonobo  aaagagag
B D                   Gorilla  aaagagag
B D                 Orangutan  aaagagag
B D                    Gibbon  agagagag
B D                    Rhesus  aaagagaa
B D       Crab-eating macaque  aaagagaa
           Pig-tailed macaque  aaagagaa
               Sooty mangabey  aaagagaa
                       Baboon  aaagagaa
B D              Green monkey  aaagagaa
                        Drill  aaagagaa
B D          Proboscis monkey  aaag----
              Angolan colobus  aaag----
B D  Golden snub-nosed monkey  aaag----
      Black snub-nosed monkey  aaag----
B D                  Marmoset  aaaa----
B D           Squirrel monkey  aaaa----
            Ma's night monkey  aaaaggag
B D                   Tarsier  agacagag
                  Black lemur  acagacat
              Sclater's lemur  acagacat
B D                     Mouse  acaggtag
B D                       Dog  -atgactg
B D                 Armadillo  ---gagaa
                 Mouse lemur  ========
           Coquerel's sifaka  ========
B D                  Bushbaby  NNNNNNNN
         White-faced sapajou  ========

Inserts between block 38 and 39 in window
           Ma's night monkey 10bp
B D                      Dog 1bp

Alignment block 39 of 56 in window, 89801545 - 89801599, 55 bps 
B D                     Human  aga------gagagagattcatagacaattggagttgtttggaggtacagataaccggaat
B D                     Chimp  agaaagagagagagagattcatagacaattggagttgtttggaggtacaggtaactggaat
B D                    Bonobo  agaaagagagagagagattcatagacaattggagttgtttggaggtacaggtaactggaat
B D                   Gorilla  agaaagagagagatagattcatagacgattggagttgcttggaggtacagataaccggaat
B D                 Orangutan  cga--gagagagagagattcatagacaattggagttgtttggaggtacagataaccggaat
B D                    Gibbon  agaaagagagagagagattcatggataattggagttgtttggaggtacagataactggaat
B D                    Rhesus  aaa----gagagagagattcatagacaattggagttgtttgggggtacagataactggaat
B D       Crab-eating macaque  aaa----gagagagagattcatagacaattggagttgtttggaggtacagataaccggaat
           Pig-tailed macaque  aaa----gagagagagattcatagacaattggagttgtttggaggtacagataaccggaat
               Sooty mangabey  aaa----gagagagagattcatagacaattggagttgtttggaggtacagataaccggaat
                       Baboon  aaa----gagagagagattcatagacaattggagttgtttggagatacagataaccggaat
B D              Green monkey  aa------agagagagattcatagacaattggagttgtttggaggtacagataaccggaat
                        Drill  aaa----gagagagagattcatagacaattggagttgtttggaggtacagataaccggaat
B D          Proboscis monkey  --------agagagagattcatagacaattggaattgtttggaggtacagataaccggaat
              Angolan colobus  --------agagagagattcatagacaactggaattgtttggaggtacagataaccggaat
B D  Golden snub-nosed monkey  --------agagagagattcatagacaattggaattgtttggaggtacagataaccggaat
      Black snub-nosed monkey  --------agagagagattcatagacaattggaattgtttggaggtacagataaccggaat
B D                  Marmoset  ------agagagagagattcttagacaatcggagttgattggaggtacagataacctgaac
B D           Squirrel monkey  ------agagagagagagtcttagacaattggagttgtttggaggtacagataacctgaat
          White-faced sapajou  ------agagagagtgattcttagacaattggagttgtttgaaggtacagataacctgaat
            Ma's night monkey  ------agagagagagattcttagacaattggagttgtttggaggtagagacaacctgaat
B D                   Tarsier  ------agagagagagaatgatagaaaatgaatagttgttggagataaagataaacagaat
                  Black lemur  ------aaatagagagaccaatagataatggatggttgttggagatacagaaaaatagtat
              Sclater's lemur  ------aaatagagagaccaatagataatggatggttgttggagatacagaaaaatagtat
B D                     Mouse  -------------attatatacagataattggttgatgttggatatgcagaaaaccagaat
B D                       Dog  ------atggagggaggttgg-aaaggatggaagag----ggagattgagataatagagat
B D                 Armadillo  ---------------------------------------tgaaaataaaattga-------
                 Mouse lemur  =============================================================
           Coquerel's sifaka  =============================================================
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 40 of 56 in window, 89801600 - 89801644, 45 bps 
B D                     Human  caaaagataacatatccattgacatggaacccagaaagagtttct
B D                     Chimp  caaaagataacatatccattgacatggaacccagaaagagtttct
B D                    Bonobo  caaaagataacatatccattgacatggaacccagaaagagtttct
B D                   Gorilla  caaaagataacatatccatcgacatgcaacccagaaagagtttct
B D                 Orangutan  caaaagataacatatccattgacatggaacccagaaagagtttct
B D                    Gibbon  caaaagataacatatccattgacatggaacccagaaagagtttct
B D                    Rhesus  caaaggataacatatccattgacatggaacccagaaagagtttct
B D       Crab-eating macaque  caaaggataacatatccattgacatggaacccagaaagagtttct
           Pig-tailed macaque  caaaggataacatatccattgacatggaacccagaaagagtttct
               Sooty mangabey  caaaggataacatatccattgacatgaaacccagaaagagtttct
                       Baboon  caaaggataacatatccattgacatggaacccagaaagagtttct
B D              Green monkey  caaaggataacatatccattgacatggaacccagaaagagtttct
                        Drill  caaaggataacatatccattgacatggaacccagaaagagtttct
B D          Proboscis monkey  caaaggataacatatccattgacatggaacccagaaagagtttct
              Angolan colobus  caaaggataacatatccattgacatggaacccagaaagagtttct
B D  Golden snub-nosed monkey  caaaggataacatatccattgacatggaacccagaaagagtttct
      Black snub-nosed monkey  caaaggataacatatccattgacatggaacccagaaagagtttct
B D                  Marmoset  caaaagacaagatatccattgacatggaaaccagcgagagtttct
B D           Squirrel monkey  caaaagacaagatatccattgacatggaaaccagaaagagtttct
          White-faced sapajou  caaaagacaagatatccattgacatggaaatcagaaagagtttct
            Ma's night monkey  caaaagacaagatatccattgacatggaaaccagaaagagtttct
B D                   Tarsier  taaaagataacgtatcccttgaaatggaaacaagcaaagatttct
            Coquerel's sifaka  caaaagataacatatccattgacatggaaaccagcaagagtttct
                  Black lemur  caaaagataacatatccattgacatggaaaccagcacgggtttct
              Sclater's lemur  caaaagataacatatccattgacatggaaaccagcaagggtttct
B D                     Mouse  caaaga--aaaatatccatgaataaggaaaactgcaagaatttct
B D                       Dog  gaaaatacaatatattaatttacatggaaaccagcaagggtttct
B D                 Armadillo  --------aacagatccaaggacatggaaa-cagcaaaggtttct
                 Mouse lemur  =============================================
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 40 and 41 in window
B D                    Mouse 155bp

Alignment block 41 of 56 in window, 89801645 - 89801900, 256 bps 
B D                     Human  tctgagaaaacaatttataagaatcaccctgagaactacaagaatatcttca-taaattgtgtaaacaa-
B D                     Chimp  tctgagaaaacaatttataagaatcaccctgagaactacaagaatatcttca-taaattgtgtaaacaa-
B D                    Bonobo  tctgagaaaacaatttataagaatcaccctgagaactacaagaatatcttca-taaattgtgtaaacaa-
B D                   Gorilla  tctgagaaaacaatttataagaatcaccctgagaactacaagaatatcttca-taaattgtgtaaacaa-
B D                 Orangutan  tctgagaaaacaatttataagaatcaccctgagaactacaagaatatcttca-taaattgtgtaaacaa-
B D                    Gibbon  tttgagaaaacaatttataagaatcaccctaagaactacaagaatatcttaa-taaattgtgtaaacaa-
B D                    Rhesus  tttgagaaaacaaatgataaaaatcaccctaagaactacaagaatatcttcattaaattgtgtaaacaa-
B D       Crab-eating macaque  tttgagaaaacaattgataaaaatcaccctaagaactacaagaatatcttcattaaattgtgtaaacaa-
           Pig-tailed macaque  tttgagaaaacaattgataaaaatcaccctaagaactacaagaatatcttcattaaattgtgtaaacaa-
               Sooty mangabey  tttgagaaaacaattgataaaaatcaccctaagaactacaagaatatcttcattaaattgtgtaaacaa-
                       Baboon  tttgagaaaacaattgataaaaatcaccctaagaactacaagaatatcttcattaaattgtgtaaacaa-
B D              Green monkey  tttgagaaaacaatttataaaaatcaccctaagaactacaagaatatctttattaaattgtgtaaacaa-
                        Drill  tttgagaaaacaattgataaaaatcaccctaagaactacaagaatatcttcattaaattgtgtaaacaa-
B D          Proboscis monkey  tttgagaaaacaatttataagaatcaccctaagaactacaagaatatcttcattaaattgtgtaaacaa-
              Angolan colobus  tttgagaaaacaatttataagaatcaccctaagaactacaagaatatcttcattaaattgtgtaaacaa-
B D  Golden snub-nosed monkey  tttgagaaaacaatttataagaatcaccctaagaactacaagaatatcttcattaaattgtgtaaacaa-
      Black snub-nosed monkey  tttgagaaaacaatttataagaatcaccctaagaactacaagaatatcttcattaaattgtgtaaacaa-
B D                  Marmoset  tttgagaaaacaatttacaagaatcgccctaaaaactacaagaatgtcttcatcgaattgtgtaaaaaa-
B D           Squirrel monkey  tttgagaaaacgatttataagaatagccctaaaaactacaagtatgtcttcactgaattgtgtaaaaaa-
          White-faced sapajou  tttgagaaaacaatttataagaatcgccctaaaaactacaagaatgtcttcattgaattgtgtaaaaaa-
            Ma's night monkey  tttgagaaaacaatttataagaatcaccctaaaaactacaaggatgtcttcattgaattgtgtaaaaaa-
B D                   Tarsier  ttttataaagcaatttataacaatcaccttaagaactacaagggtaccactttaaaatcacattaaaaa-
            Coquerel's sifaka  tttgagaaaacagtttataacaatcagctgaagaaccacaaggatacctccattaagtcatgtaaaaag-
                  Black lemur  tttgagaaaacaatttataacaatcacctgaagaaccac-aggatacctccattaaatcatgtaaaaag-
              Sclater's lemur  tttgagaaaacaatttataacaatcacctgaagaaccac-aggatacctccattaaatcatgtaaaaag-
B D                     Mouse  ttttagaaaacagttaac--gaatacattttaaaattaaaag-atacctcaattaaatcatataaaaggt
B D                       Dog  tttgagagaacaatatgtatcagtcatcttacaagccacaaaa----ctacattgaatcgggtaaaaaa-
B D                 Armadillo  tttga-aaaata--ttataactatca----aagacccacaaagatccttgcattaaagagtgtaaaaga-
                 Mouse lemur  ======================================================================
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  --------ttataaatatataaca-ttctat-tcttcaagtaaaatatagtgagaatgag--ggttacag
                        Chimp  --------ttataaatatataaca-ttctat-tcttcaagtaaaatatagtgagaatgag--ggttacag
                       Bonobo  --------ttataaatatataaca-ttctat-tcttcaagtaaaatatagtgagaatgag--ggttacag
                      Gorilla  --------ttataaatatataaaa-ttctat-tcttcaagtaaaatatagtgagaatgag--ggttacag
                    Orangutan  --------ttataaatatataaca-ttctat-tcttcaagtaaaatatagtgagaatgag--ggttacag
                       Gibbon  --------gtataaatatataaca-ttctat-tctttaagtaaaatatagtgagaatgag--ggttacag
                       Rhesus  --------ttataaatatataaca-ttctat-tcttcaagtaaaatatagtgagaatgag--ggttacag
          Crab-eating macaque  --------ttagaaatatataaca-ttctat-tcttcaagtaaaatatagtgagaatgag--ggtgacag
           Pig-tailed macaque  --------ttataaatatataaca-ttctat-tcttcaagtaaaatatagtgagaatgag--ggttacag
               Sooty mangabey  --------ttataaatatataaca-ttctat-tcttcaagtaaaatatagtgagaatgag--ggttacag
                       Baboon  --------ttataaatatataaca-ttctat-tcttcaagtaaaatatagtgagaatgag--ggttacgg
                 Green monkey  --------ttataaatatataaca-ttctat-tcttcaagtaaaatatagtgagaatgag--ggttacgg
                        Drill  --------ttataaatatataaca-ttctat-tcttcaagtaaaatatagtgagaatgag--ggttacgg
             Proboscis monkey  --------ttataaatatacaaca-ttctat-tcttcaagtaaaatatagtgagaatgag--ggttacag
              Angolan colobus  --------ttataaatat-taaca-ttctat-tcttcaagtaaaatatagtgagaatgag--ggttacag
     Golden snub-nosed monkey  --------ttataaatatacaaca-ttctat-tcttcaagtaaaatatagtgagaatgag--ggttacag
      Black snub-nosed monkey  --------ttataaatatacaaca-ttctat-tcttcaagtaaaatatagtgagaatgag--ggttacag
                     Marmoset  --------ttataactatataaca-ttctat-tctttgagtaaaatatagtaagaatggg--ggttacag
              Squirrel monkey  --------ttgtaactatataaca-ttctat-tctttgagtaaaatataataagaatggg--ggttacag
          White-faced sapajou  --------ttataactacataaca-ttctat-tctttgagtaaaatatagtaagaatggg--ggttacag
            Ma's night monkey  --------ttataactatataaca-ttctat-tctttgagtaaaatacagtaagaatggg--ggttacag
                      Tarsier  --------ctataaata---aaaa-tttt-t-tctttaattaaaatataatgagaaggag--ggttgtaa
            Coquerel's sifaka  --------ctataaataaataacattttttt-tctttgagtaaaatatagcaaggatgag--agttacag
                  Black lemur  --------ctataaataaataaca-tttttt-tctttgagtaaaatatagtaaggatgag--agttacag
              Sclater's lemur  --------ctataaataaataaca-tttttt-tctttgagtaaaatatagtaaggatgag--agttacag
                        Mouse  ttatacttttgtaagta-gcaata-ttttttccctttgagtaaaat----caggaatcagcttgtcataa
                          Dog  --aaaattctataaataaataaca--tcttt-tctttgagttaaatatagcaaaaatgag--ggttgcag
                    Armadillo  ---------tataaataaataatt-t----t-tatttgagtaaaatatactaagtatgaa--ggttacag
                  Mouse lemur  ======================================================================
                     Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  agtgagaaatagaaa-agaaagta---t-t-------t-tttttcct--tcagaagatatattaaaataa
                        Chimp  agtgataaatagaaa------gta---t-t-------t-tttttcct--tcagaagacatattaaaataa
                       Bonobo  agtgagaaatagaaa------gta---t-t-------t-tttttcct--tcagaagacatattaaaataa
                      Gorilla  agtgagaaatagaaa-agaaagta-----t-------t-tttttcct--tcagaagatatattaaaataa
                    Orangutan  agtgagaaatagaaa-----agta-----t-------t-tttttcct--tcagaagatatattaaaataa
                       Gibbon  agtgagaaatagaaa-agaaagta-----t-------t-tttttcct--tcagaagatgtattaaaataa
                       Rhesus  agtgagaaat------agaaaata-----t-------t-tttttcct--tcagaagatgtattaaaataa
          Crab-eating macaque  agtgagaaat------agaaaata-----t-------t-tttttcct--tcagaagatgtattaaaataa
           Pig-tailed macaque  agtgagaaat------agaaaata-----t-------t-tttttcct--tcagaagatgtattaaaataa
               Sooty mangabey  agtgagaaatagaaa-agaaaata-----t-------t-tttttcct--tcagaagatgtattaaaataa
                       Baboon  agtgagaaatagaaa-agaaaat------t-------t-tttttcct--tcagaagatgtattaaaataa
                 Green monkey  agtgagaaatagaaa-agaaaata-----t-------t-tttttcct--tcagaagatgtattaaaataa
                        Drill  agtgagaaatagaaa-agaaaata-----t-------t-tttttcct--tcagaagatgtattaaaataa
             Proboscis monkey  agtgagaaatggaaa-agaaaata-----t-------t-tttt-cct--tcagaagatgtattaaaataa
              Angolan colobus  agtgagaaatggaaa-agaaaata-----t-------t-ttttccct--tcagaagatgtattaaaataa
     Golden snub-nosed monkey  agtgagaaatggaaa-agaaaata-----t-------t-tttttcct--tcagaagatgtattaaaataa
      Black snub-nosed monkey  agtgagaaatggaaa-agaaaata-----t-------t-tttttcct--tcagaagatgtattaaaataa
                     Marmoset  agtcagaaat------agaaagta-----t-------cattttttct--tcagaaaatatattaaaataa
              Squirrel monkey  aatgagaaat------agaaagta-----t-------tattttttct--tcataaaatgtattaaaataa
          White-faced sapajou  agtgagaaat------agaaagta-----t-------tattttttct--tcagaaaaggtattaaaatat
            Ma's night monkey  agtgagaaat------agaaagca-----t-------tattttttct--tcagaaaatgtattaaaataa
                      Tarsier  agtgatacataaaaaaagaaattatgat-t-------t-ttttccct--tcaggagtggtgttaaaatag
            Coquerel's sifaka  agtgagaaatagaaa-atggatta-----t-------g-atttttttattcaggagttatattaaaataa
                  Black lemur  agtgag-aatagaaa-atgaatta-----t-------g-attttttt----agaagttaaattaaaataa
              Sclater's lemur  agtgag-aatagaaa-atgaatta-----t-------g-attttttt----agaagttaaattaaaataa
                        Mouse  cgtgagaaatacaaa-agacatcg-----tgctgccat-ctttctct--ggaggtgagtaattccaatct
                          Dog  actcagaaagg-----aaatcaca-----t-------t-ttttttct--taaggag-tgtgttataactt
                    Armadillo  agtacaaaacagaaa-gaaaatta---tgt-------c-tttttctg--tgaggagttgtgttatcacat
                  Mouse lemur  ======================================================================
                     Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ca---tttaa--aaaaaatacctacatattttg-g----aaaattgcagtctatataataatgctgattc
                        Chimp  ca---tttta--aaaaaatacctacatattttg-g----aaaattgcagtctatataataatgctgattc
                       Bonobo  ca---tttta--aaaaaatacctacatattttg-g----aaaattgcagtctataaaataatgctgattc
                      Gorilla  ca---ttttt--aaaaaatacctacatattttg-g----aaaattgcagtctatataataatgctgattc
                    Orangutan  ca---ttttt--aaaaaatacctatatattttg-g----aaaattgcagtgtgtataataatgctgatgc
                       Gibbon  ca---ttttt--aaaaaatatctatatattttg-t----caaactgcagtgtatataataatgctgatgc
                       Rhesus  ca---ttttt---aaaaatacctacatattttg------caaattgcagtgtatataataatgctgatgc
          Crab-eating macaque  ca---ttttt---aaaaatacctacatattttg------caaattgcagtgtatataataatgctgatgc
           Pig-tailed macaque  ca---ttttt---aaaaatacctacatattttg------caaattgcagtgtatataataatgctgatgc
               Sooty mangabey  ca---tttta---aaaaatacctacatattttg------cgaattgcagtgtatacaataatgctgatgc
                       Baboon  ca---ttttt---aaaaatacctacatattttg------caaattgcagtgtatacaataatgctgatgc
                 Green monkey  ca---ttttt---aaaaatacctacatattttg------caaattgcagtgtatataataatgctgatgc
                        Drill  ca---tttta---aaaaatacctacatattttg------cgaattgcagtgtatacaataatgctgacgc
             Proboscis monkey  ca---tttta---aaaaatacctacatatttag------caaattgcagtgtacataataatgctgatgc
              Angolan colobus  ca---tttta---aaaaatacctacatattttg------caaattgcagtgtatataataatgctgatgc
     Golden snub-nosed monkey  ca---tttta---aaaaatacctacatatttag------caaattgcagtgtacataataatgctgatgc
      Black snub-nosed monkey  ca---ttttt---aaaaatacctacatatttag------caaattgcagtgtacataataatgctgatgc
                     Marmoset  ca----tttt---aaaaatacctatgtattttg-g----caaactgcagtgtatataataatgctgatgc
              Squirrel monkey  ca---ttttt---taaaatacctacgtattttg-g----caaattgcagtgtatataataatgctgatgc
          White-faced sapajou  ------tttt---taaaatacctacatattttg-a----caaattgcagtgtatataataatgctgatgc
            Ma's night monkey  ca---ttttt---taaaatacctacatagtttg-g----caaattgcagtgtatataataatgctgatgc
                      Tarsier  catgtttttt---aaaaccacctacctattttg-g----caaattgcagtgtatataataatgctaatgt
            Coquerel's sifaka  ta---ttttcttttaagccgcctacatattttg-g----caaattgcagtgtagataacaatgctaatga
                  Black lemur  ta---ttttcttttaacccacctacatattttg-g----caaattgcagtgtagataacaatgctaatga
              Sclater's lemur  ta---ttttcttttaacccacctacatattttg-g----caaattgcagtgtagataacaatgctaatga
                        Mouse  at---tcttt---taacccatttctgtagtttcag----caatttacagtgtatataataatgctaatgc
                          Dog  tt---tcttt---taaaacagcaacttattttt-g----caaattgcagtgtacataataatgctaatgc
                    Armadillo  tt---tattt---ttaaacactgaaaaattatt-gcatataaattgtagagtatgtcatatttataatgc
                  Mouse lemur  ======================================================================
                     Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  aataagaagttttat
                        Chimp  aataagaagttttat
                       Bonobo  aataagaagttttat
                      Gorilla  aataagaagttttat
                    Orangutan  cataagaagtcttat
                       Gibbon  aataaaaagtcttat
                       Rhesus  aataacaagtcttat
          Crab-eating macaque  aataacaagtcttat
           Pig-tailed macaque  aataacaagtcttat
               Sooty mangabey  aataacaagtcttat
                       Baboon  aataacaagtcttat
                 Green monkey  aataacaagtcttat
                        Drill  aataacaagtcttat
             Proboscis monkey  aataacaagtcttat
              Angolan colobus  aataacaagtcttat
     Golden snub-nosed monkey  aataacaagtcttat
      Black snub-nosed monkey  aataacaagtcttat
                     Marmoset  aatacaaaatcttat
              Squirrel monkey  aatacgaaatcttat
          White-faced sapajou  aatacaaaatcttac
            Ma's night monkey  aatacgaaatcttat
                      Tarsier  aataagaagtcttat
            Coquerel's sifaka  aataagaagccctat
                  Black lemur  aataagaagccctat
              Sclater's lemur  aataagaagccctat
                        Mouse  aataagaagttctat
                          Dog  aataaaaagtcctat
                    Armadillo  aataagaagtacctt
                  Mouse lemur  ===============
                     Bushbaby  NNNNNNNNNNNNNNN

Alignment block 42 of 56 in window, 89801901 - 89801967, 67 bps 
B D                     Human  agaaattccacatatcagagaaaatgcagttaaatctaaatagtaaaattgataataa--cgatgtcac
B D                     Chimp  agaaattccacatatcagagaaaatgcagttaaatccaaatagtaaaattgataataa--cgatgtcac
B D                    Bonobo  agaaattccacatatcagagaaaatgcagttaaatccaaatagtaaaattgataataa--cgatgtcac
B D                   Gorilla  agaaattccacatatcagagaaaatgcagttaaatccaaatagtaaaattgataataa--cgatgtcac
B D                 Orangutan  agaaattccacatatcagagaaaatgcagttaaatccaaatagtaaacttgataataa--cgatgtcgc
B D                    Gibbon  agaaattccacatatcagagaaaatgcagttaaatccaaatagtaaaattgataataa--cgatgtcac
B D                    Rhesus  agaaattacacatatcagagaaaatgcagttaaatccaaatagtaaaattgataataa--cgatgtctc
B D       Crab-eating macaque  agaaattccacatatcagagaaaatgcagttaaatccaaatagtaaaattgataataa--cgatgtctc
           Pig-tailed macaque  agaaattccacatatcagagaaaatgcagttaaatccaaatagtaaaattgataataa--tgatgtctc
               Sooty mangabey  agaaattccacatatcagagaaaatgcagttaaatccaaatagtaaaattgataataa--cgatgtctc
                       Baboon  agaaattccacatatcagagaaaatgctgttaaatccaaatagtaaaattgataataa--cgatgtctc
B D              Green monkey  ggaaattccacatatcagagaaaatgcagttaaatccaaatagtaaaactgataataa--cgatgtctc
                        Drill  agaaattccacatatcagagaaaatgcagttaaatccaaatagtaaaattgataataa--cgatgtctc
B D          Proboscis monkey  agaaattccacatatcagagaaaatgcagttaaatccaaatagtaaaattgatagtaa--cgatgtctc
              Angolan colobus  agaaattccacatatcagagaaaatgcagttaaatccaaatagtaaaattgataataa--cgatgtctc
B D  Golden snub-nosed monkey  agaaattccacatatcagagaaaatgcagttaaatccaaatagtaaaattgataataa--cgatgtctc
      Black snub-nosed monkey  agaaattccacatatcagagaaaatgcagttaaatccaaatagtaaaattgataataa--cgatgtctc
B D                  Marmoset  agacgttccacatagcctagaaaatgcagttaaagccaaatggtaaaattgataataa--cggtgtcgc
B D           Squirrel monkey  agaagttcaacagagtctagaaaatgcagttgaagccaaatagtaaaattgataataa--tagtatccc
          White-faced sapajou  agaagttccacatagcttagaaaatgcagttaaagccaaatagtaa-----------------------
            Ma's night monkey  agaagttccacatagcctagaaaatgcagttaaagccaaatagtaaaattgataatca--tggtgtcac
B D                   Tarsier  agaaattctatgtagccaagaaaatgcaattagatccaaatagcaaaattgataataatgtgatgtcgt
            Coquerel's sifaka  aaaaattctacttaaccaagaaaatgcaattagagccaaatagtaaaattgataataatgtgatgctgc
                  Black lemur  aaaaattctacttagtcaagaaaatgcaattagagccaaatagtaaaattgataataacgtgatgctgt
              Sclater's lemur  aaaaattctacttagtcaagaaaatgcaattagagccaaatagtaaaattgataataacgtgatgctgt
B D                     Mouse  agaa-ttcttggtagccaagaaaatgcaattagagccagataggaagggtgataatg---tgatgcaga
B D                 Armadillo  acaaattttatatcaccaagaaaatgcaatgagaatcaatgaatataaatgataatgttgtgatgtgtt
                 Mouse lemur  =====================================================================
B D                       Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 43 of 56 in window, 89801968 - 89802079, 112 bps 
B D                     Human  actaataagaatacatgaagccaggcttg-tacacctgactgtaattacatcactaacacctgaagaaat
B D                     Chimp  actaataagaatacatgaagccaggcttg-tacacctgactgtaattacatcactaacacctgaagaaat
B D                    Bonobo  actaataagaatacatgaagccaggcttg-tacacctgactgtaattacatcactaacacctgaagaaat
B D                   Gorilla  actaataagaatacatgaagccaggcttg-tacacctgactgtaattacatcactaacacctgaagaaat
B D                 Orangutan  actaataagaatacatgaagccaggcgtg-tacacctgactgtaattacgtcactaacacctgaggaaat
B D                    Gibbon  actaataagaatacatgaagccaggagtg-tacacctgactgtaattacatcactaacacctgaggaaac
B D                    Rhesus  actaataagaatacgtgaagccaggcgtg-tacacctgactgtaattacatcactaacacctgaggaaat
B D       Crab-eating macaque  actaataagaatacgtgaagccaggcgtg-tacacctgactgtaattacatcactaacacctgaggaaat
           Pig-tailed macaque  actaacaagaatacgtgaagccaggcgtg-tacacctgactgtaattacatcactaacacctgaggaaat
               Sooty mangabey  actaataagaatacgtgaagccaggcgtc-tacacctgactgtaattacatcactaacacctgaggaaat
                       Baboon  actaataagaatacgtgaggccaggcgtg-tacacctgactgtaattacatcactaacacctgaggaaat
B D              Green monkey  actaataagaatacgtgaagccaggtgtg-tacacctgactgtaattacatcactaacacctgaggaaat
                        Drill  actaataagaatacgtgaagccaggcatg-tacacctgactgtaattacatcactaacacctgaggaaat
B D          Proboscis monkey  actaataagaatacgtgaagccaggcgtg-tacacctgactgtaattacatcactaacacctgaggaaat
              Angolan colobus  actaagaagaatacatgaagccaggcgtg-tacacctgactgtaattacatcactaacacctgaggaaat
B D  Golden snub-nosed monkey  actaataagaatacgtgaagccaggcgta-tacacctgactgtaattacatcactaacacctgaggaaat
      Black snub-nosed monkey  actaataagaatacgtgaagccaggcgta-tacacctgactgtaattacatcactaacacctgaggaaat
B D                  Marmoset  actaataagaatacatgcagccaggtgtg-tatacctgactgtaattatatcactgccagcagaggaaag
B D           Squirrel monkey  actaataagaatacatgaagccaggtgtg-tatacctgactgtaattacatcactaacaccagaggaaag
          White-faced sapajou  ---------------------------------acctgactgtaattacgtcactaacaccagaggaaag
            Ma's night monkey  actaataagaatacatgaagccaggtgtg-tatacctgactgtaattatatcactaacaccagaggaaag
B D                   Tarsier  actaataagaatacatgaagccaggctca-tacacctgactgtaattatatcactaacacctgaggaaat
                  Mouse lemur  actaacaagaatatgtgaagctaggcttg-tacacctgactgtaattacatcactaacacctgagaaaat
            Coquerel's sifaka  actaataagaatacatgaagctaggcttgttacacctaactgtaattagatcactaacacctgagaaaat
                  Black lemur  actaataagaatacatgaagctaggcttgttacacctgactgtaattacatcactaacacctgagaaaat
              Sclater's lemur  actaataagaatacatgaagctaggcttgttacacctgactgtaattacatcactaacacctgagaaaat
B D                     Mouse  actaataagagtccatgaagccaggc-tg-tgcacctggcagtaattacatcattaacacctgaaaagat
B D                 Armadillo  actaataagaatgcatgaagtctggtttg-tacacctgactgtaattacatcattaacacctgaggaaat
B D                       Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  gaaagttgattaatgagaaacagatgctaattttgaagcctgc
                        Chimp  gaaagttgattaatgagaaacagatgctaattttgaagcctgc
                       Bonobo  gaaagttgattaatgagaaacagatgctaattttgaagcctgc
                      Gorilla  gaaagttgattaatgagaaacagatgctaattttgaagcctgc
                    Orangutan  gaaagttgattaatgagaaacagatgctaatttcgaagcctgt
                       Gibbon  gaaagttgattaatgagaaacagatgctaattttgaagcctgc
                       Rhesus  taaagttgattaatgagaaacagatgctaattttgaagcctgc
          Crab-eating macaque  taaagttgattaatgagaaacagatgctaattttgaagcctgc
           Pig-tailed macaque  taaagttgattaatgagaaacagatgctaattttgaagcctgc
               Sooty mangabey  taaagttgattaatgagaaacagatgctaattttgaagcctgc
                       Baboon  taaagttgattaatgagaaacagatgctaattttgaagcctgc
                 Green monkey  taaagttgattaatgagaaacagatgctaattttgaagcctgc
                        Drill  taaagttgattaatgagaaacagatgctaattttgaagcctgc
             Proboscis monkey  taaagttgattaatgagaaacagatgctaattttgaagcctgc
              Angolan colobus  taaagttgattaatgagaaacagatgctaattctgaagcctgc
     Golden snub-nosed monkey  taaagttgattaatgagaaacagatgctaattttgaagcctgc
      Black snub-nosed monkey  taaagttgattaatgagaaacagatgctaattttgaagcctgc
                     Marmoset  gaaagctgattaatgacaaacagatgttaactttgaagcctgc
              Squirrel monkey  gaaagctgattaatgagaaacagatgctaactctgaagcctgc
          White-faced sapajou  gaaagctgattaatgagaaacagatgctaaccttgaagcctgc
            Ma's night monkey  gaaagctgatcaatgagaaacagatgctaactttgaagcctgc
                      Tarsier  gaaagttgattaatgagaaacagatgctaattttgaagcctgt
                  Mouse lemur  gaaagttgattaatgagaaacagatgctaattttgaagcttac
            Coquerel's sifaka  gaaagttgattaatgagaaacagatgcaaattttgaagcccgc
                  Black lemur  gaaagttgattaatgagaaacagacgctaattttgaagcctga
              Sclater's lemur  gaaagttgattaatgagaaacagatgctaattttgaagcctga
                        Mouse  gaaagctgattaatgagatacagatgcaaattctgaggcttcc
                    Armadillo  gaaagttgattaatgagaaccat-tgctaattgtgaagcctga
                          Dog  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 44 of 56 in window, 89802080 - 89802094, 15 bps 
B D                     Human  aaattcaaatatatt
B D                     Chimp  aaattcaaatatatt
B D                    Bonobo  aaattcaaatatatt
B D                   Gorilla  aaattcaaatatatt
B D                 Orangutan  aaattcaaatatatt
B D                    Gibbon  aaattcaaatatatt
B D                    Rhesus  aaattcaaatatatt
B D       Crab-eating macaque  aaattcaaatatatt
           Pig-tailed macaque  aaattcaaatatatt
               Sooty mangabey  aaattcaaatatatt
                       Baboon  aaattcaaatatatt
B D              Green monkey  aaattcaaatatatt
                        Drill  aaattcaaatatatt
B D          Proboscis monkey  aaattcaaatatatt
              Angolan colobus  aaattcaaatatatt
B D  Golden snub-nosed monkey  aaattcaaatatatt
      Black snub-nosed monkey  aaattcaaatatatt
B D                  Marmoset  aaattcaactttatt
B D           Squirrel monkey  aaattcaactatatt
          White-faced sapajou  aaattcaactatatt
            Ma's night monkey  aaattcaactatatt
B D                   Tarsier  aaatttaaatatatt
                  Mouse lemur  agattcaaatatatt
            Coquerel's sifaka  aaattcaaatatgtt
                  Black lemur  aaattcaaatatgtt
              Sclater's lemur  aaattcaaatatgtt
B D                     Mouse  agattcaaatatact
B D                       Dog  aaattcaaatatgtt
B D                 Armadillo  aaatccaaatatgcc
B D                  Bushbaby  NNNNNNNNNNNNNNN

Inserts between block 44 and 45 in window
                 Black lemur 52bp
             Sclater's lemur 52bp

Alignment block 45 of 56 in window, 89802095 - 89802095, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                    Bonobo  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
           Pig-tailed macaque  t
               Sooty mangabey  t
                       Baboon  t
B D              Green monkey  t
                        Drill  t
B D          Proboscis monkey  t
              Angolan colobus  t
B D  Golden snub-nosed monkey  t
      Black snub-nosed monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
          White-faced sapajou  t
            Ma's night monkey  t
B D                   Tarsier  t
                  Mouse lemur  t
            Coquerel's sifaka  c
B D                     Mouse  t
B D                       Dog  c
B D                 Armadillo  c
             Sclater's lemur  =
                 Black lemur  =
B D                  Bushbaby  N

Inserts between block 45 and 46 in window
                 Mouse lemur 52bp

Alignment block 46 of 56 in window, 89802096 - 89802096, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                    Bonobo  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
           Pig-tailed macaque  a
               Sooty mangabey  a
                       Baboon  g
B D              Green monkey  a
                        Drill  a
B D          Proboscis monkey  a
              Angolan colobus  a
B D  Golden snub-nosed monkey  a
      Black snub-nosed monkey  a
B D                  Marmoset  t
B D           Squirrel monkey  a
          White-faced sapajou  a
            Ma's night monkey  a
B D                   Tarsier  a
            Coquerel's sifaka  a
B D                     Mouse  a
B D                       Dog  a
B D                 Armadillo  a
                 Mouse lemur  =
             Sclater's lemur  =
                 Black lemur  =
B D                  Bushbaby  N

Inserts between block 46 and 47 in window
           Coquerel's sifaka 68bp

Alignment block 47 of 56 in window, 89802097 - 89802141, 45 bps 
B D                     Human  at-aatgtg-aagatgtggtatgcaaatgaagcattagaggcactat
B D                     Chimp  at-aatgtg-aagatgtggtatgcaaatgaagcataagaggcactat
B D                    Bonobo  at-aatgtg-aagatgtggtatgcaaatgaagcataagaggcactat
B D                   Gorilla  at-aatgtg-aagatgtggtatgcaaatgaagcataagaggcactat
B D                 Orangutan  at-aatatg-aagatgtggtatgcaaatgaagcataagaggcactat
B D                    Gibbon  at-aatgtg-aagatgtggtatgcaaatgaagcataagaggcagtat
B D                    Rhesus  at-aatgtg-aagatgtggtattcaaatgaagcataagatgcattat
B D       Crab-eating macaque  at-aatgtg-aagatgtggtattcaaatgaagcataagatgcattat
           Pig-tailed macaque  at-aatgtg-aagatgtggtattcaaatgaagcataagatgcattat
               Sooty mangabey  at-aatgtg-aagatgtagtattcaaatgaagcataagatgcattat
                       Baboon  at-aatgtg-aagatgtggtattcaaatgaagcataagatgcattat
B D              Green monkey  at-aatgtg-aagatgtggtattcaaatgaagcataagatgcattat
                        Drill  at-aatgtg-aagatgtggtattcaaatgaagcataagatgcattat
B D          Proboscis monkey  at-aatgtg-aagatgtggtattcaaataaagcataagatgtattat
              Angolan colobus  at-aatgtg-aagatgtggtattcaaatgaagcataagatgcattat
B D  Golden snub-nosed monkey  at-aatatg-aaaatgtggtattcaaatgaagcataagatgcattat
      Black snub-nosed monkey  at-aatatg-aagatgtggtattcaaatgaagcataagatgcattat
B D                  Marmoset  at-aatgtg-aagatgcggggtacaaatgaagaataatgtgcattac
B D           Squirrel monkey  at-aatgta-aagaggtggtatacaaatgaagaaaaatatgcattat
          White-faced sapajou  at-aatgta-aagaggtggtatacagatgaagaataatatgcattat
            Ma's night monkey  at-aatgtg-aatatgtggtatacaaatgaagaaaaatatgcattat
B D                   Tarsier  at-aatgta-aagatatggcatgcaaatgaagtataggatgcatcat
B D                     Mouse  ac-aatatg-aatatatgatacacaaaggcgatcaaggatgtatcac
B D                       Dog  -t-aatgtgaaagaaatggtatgcaag-ggagtatagaatgcatcag
B D                 Armadillo  ataaatata-aagatgtgatatggaaatgagttacaggatatattat
                 Mouse lemur  ===============================================
             Sclater's lemur  ===============================================
                 Black lemur  ===============================================
           Coquerel's sifaka  ===============================================
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 47 and 48 in window
B D                Armadillo 3306bp

Alignment block 48 of 56 in window, 89802142 - 89802168, 27 bps 
B D                     Human  atgccatggattttattcttttcttta
B D                     Chimp  atgccatggattttattcttttcttta
B D                    Bonobo  atgccatggattttattcttttcttta
B D                   Gorilla  atgccatggattttattcttttcttta
B D                 Orangutan  atgccatggatttta---ttttcttta
B D                    Gibbon  aggccatggattttattcttttcttta
B D                    Rhesus  atgccatggattttattcttttcttta
B D       Crab-eating macaque  atgccatggattttattcttttcttta
           Pig-tailed macaque  atgccatggattttattcttttcttta
               Sooty mangabey  atgccatggattttattcttttcttta
                       Baboon  atgccatggattttattcttttcttta
B D              Green monkey  atgccatggattttattcttttcttta
                        Drill  atgccatggattttattcttttcttta
B D          Proboscis monkey  atgccatggattttattcttttcttta
              Angolan colobus  atgccatggattttattcttttcttta
B D  Golden snub-nosed monkey  atgccatggattttattcttttcttta
      Black snub-nosed monkey  atgccatggattttattcttttcttta
B D                  Marmoset  atgccacggatgctattcttttcatca
B D           Squirrel monkey  atgccatggatgttattcttttcatca
          White-faced sapajou  atgccatggatgttattcttttcatca
            Ma's night monkey  atgccatggatgttattcttttcatca
B D                   Tarsier  atatcgtgaat----------------
B D                     Mouse  ctagcatggattaa-------------
B D                       Dog  acgccat--------------------
                 Mouse lemur  ===========================
B D                 Armadillo  ===========================
             Sclater's lemur  ===========================
                 Black lemur  ===========================
           Coquerel's sifaka  ===========================
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 48 and 49 in window
B D                    Mouse 1bp

Alignment block 49 of 56 in window, 89802169 - 89802169, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                    Bonobo  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
           Pig-tailed macaque  t
               Sooty mangabey  t
                       Baboon  t
B D              Green monkey  t
                        Drill  t
B D          Proboscis monkey  t
              Angolan colobus  t
B D  Golden snub-nosed monkey  t
      Black snub-nosed monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
          White-faced sapajou  t
            Ma's night monkey  t
B D                   Tarsier  t
                  Black lemur  t
              Sclater's lemur  t
B D                 Armadillo  t
                 Mouse lemur  =
B D                     Mouse  =
           Coquerel's sifaka  =
B D                       Dog  -
B D                  Bushbaby  N

Alignment block 50 of 56 in window, 89802170 - 89802193, 24 bps 
B D                     Human  ataagaaaataat-aaaactaac---at
B D                     Chimp  ataagaaaataat-aaaactaac---at
B D                    Bonobo  ataagaaaataat-aaaactaac---at
B D                   Gorilla  ataagaaaataat-aaaactaac---at
B D                 Orangutan  ataagaaaataat-aaaactaac---gt
B D                    Gibbon  ataagaaaataat-aaaactcac---at
B D                    Rhesus  atgagaaaataat-aaaactaag---at
B D       Crab-eating macaque  atgagaaaataat-aaaactaag---at
           Pig-tailed macaque  atgagaaaataat-aaaactaag---at
               Sooty mangabey  atgagaaaataat-aaaactaag---at
                       Baboon  atgagaaaataat-aaaactaag---at
B D              Green monkey  atgagaaaataat-aaaactaag---at
                        Drill  atgagaaaataat-aaaactaag---at
B D          Proboscis monkey  atgataaaataat-aaaactaag---at
              Angolan colobus  atgagaaaataat-aaaactaag---at
B D  Golden snub-nosed monkey  atga-aaaataat-aaaactaag---at
      Black snub-nosed monkey  atgagaaaataat-aaaactaag---at
B D                  Marmoset  gtaagaaaaccat-agaactaaa---at
B D           Squirrel monkey  gtaagaaaatgat-aaaattaaa---at
          White-faced sapajou  gtaaggaaataat-aaaactaaa---ac
            Ma's night monkey  gtaagaaaataat-aaaact-aa---at
B D                   Tarsier  ataggaaaataataaaaactgag---at
                  Mouse lemur  ataagaaaagaat-aaagattaagat--
                  Black lemur  ataagaaaagaat-aaaaattaa-----
              Sclater's lemur  ataagaaaagaat-aaaaattaa-----
B D                     Mouse  gtaacggacagaa-aagagtgat---at
B D                       Dog  --aaaaaaatta--aaaactaag---at
B D                 Armadillo  ataagaaaaagta-aaaattaat-----
           Coquerel's sifaka  ============================
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 51 of 56 in window, 89802194 - 89802493, 300 bps 
B D                     Human  gttttaaagaattgctatagaatatagcatg-at---aaaaaatggatcaaaattaacataagttgaagt
B D                     Chimp  gtttttaagaattgctatagaatatagcatg-at---aaaaaatggatcaaaattaacataagttgaagt
B D                    Bonobo  gtttttaagaattgctatagaatatagcatg-at---aaaaaatggatcaaaattaacataagttgaagt
B D                   Gorilla  gctttaaagaattgctatagaatatagcatg-at----aaaaatggatcaaaattaacagaagttgaagt
B D                 Orangutan  gttttaaagaattgctatagaatatagcatg-at---aaaaaacggatcaaaattaacataagttgaagt
B D                    Gibbon  gttttaaagaattgctacagaatatagcatg-at----aaaaatggatcaaaagtaacataagttgaagc
B D                    Rhesus  gttttaaagaattgctataaaatataacatg-at---caaaaatggatcaaaagtaacataagttgaagt
B D       Crab-eating macaque  gttttaaagaattgctataaaatataacatg-at---caaaaatggatcaaaagtaacataagttgaagt
           Pig-tailed macaque  gttttaaagaattgctataaaatataacatg-at---caaaaatggatcaaaagtaacataagttgaagt
               Sooty mangabey  gttttaaagaattgctataaaatataacatg-at---caaaaatggatcaaaagtaacataagttgaagt
                       Baboon  gttttaaagaattgctataaaatataacatg-at---caaaaatggatcaaaagtaacataagttgaagt
B D              Green monkey  gttttaaagaattgctataaaatataacatg-at---caaaaatggatcaaaagtaacataagttgaagt
                        Drill  gttttaaagaattgctataaaatataacatg-at---caaaaatggatcaaaagtaacataagttgaagt
B D          Proboscis monkey  gttttaaagaattgctataaaatataacatg-at--aaaaaaatggatcaaaagtaacataagttggagt
              Angolan colobus  gttttaaagaattgctataaaatataacatg-at---aaaaaatggatcaaaagcaacataagttggagt
B D  Golden snub-nosed monkey  gttttaaagaattgctataaaatataacatg-at---aaaaaatcgatcaaaagtaacataagttggagt
      Black snub-nosed monkey  gttttaaagaattgctataaaatataacatg-at---aaaaaatcgatcaaaagtaacataagttggagt
B D                  Marmoset  gtttcgaaaaattgc-------tataacatg-ataaaaaaaaatggatcaaaattaacgtaagtcgaagt
B D           Squirrel monkey  gttttaaagaattgc-------cataacatg-gt--aaaaaaatgaatcaaaattaacgtaagttgaagt
          White-faced sapajou  gttttaaaaaattgc-------tataacatg-at--aaaaaaatggatcaaaattaacgtaagttgaagt
            Ma's night monkey  gttttaaagaattgc-------tataacatg-at---aaaaaatggatcaaaattaacgtaagttgaagt
B D                   Tarsier  gttttaaagaattgctataaaatgtaagaag-at--aggaaaatgaatcaaaattaacatgagttgaaat
                  Mouse lemur  gttttaaagaattgttagaaaatataacatg-at--aggaaaatggatcaaaattaacataagttgaaat
            Coquerel's sifaka  gctttaaagaattgttataaaatgtaatatg-ct--aggaaaatggaccaaaattaacataagttgaaat
                  Black lemur  gttttaaagaattgttataaaatgtaacatg-at--aggaaaatggatcaaaattaacgtgagttgaaat
              Sclater's lemur  gttttaaagaattgttataaaatgtaacatg-at--aggaaaatggatcaaaattaacgtgagttgaaat
B D                     Mouse  ----ttcagagttgctacaaaaggcgtcagg-aa----------------aaatttacaagaactcaaat
B D                       Dog  -atttaaagaattg-tgtaaagtataacatacat---ggtgaaatgagcaagac--acataa-----aat
B D                 Armadillo  gttttaaaaatttgctgtaaactaca-cata-gg----gaaaacagatcaaaataaacatgagttgaaaa
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  gc----agttttaatttttagctaattgaagtctatttagtaatgataatctaaactaataatttcatag
                        Chimp  gc----agttttaatttttagctaattgaagtctatttagtaatgataatctaaactaataatttcatag
                       Bonobo  gc----agttttaatttttagctaattgaagtctatttagtaatgataatctaaactaataatttcatag
                      Gorilla  gc----agttttaatttttagctaattgaagtctatttagtaatgataatctaaactaataatttcatag
                    Orangutan  gc----agttttaattttcagctaactgaagtccatttaataatgataatcaaaactaataatttcatag
                       Gibbon  gcaggaagttttaatttttagctatttgaagtctatttaataatgataatcaaaactaataatttcatag
                       Rhesus  gtggtcagttttaatttttagctatttgaagtctatttaataatgataatcaaaactaataatttcatag
          Crab-eating macaque  gtggacagttttaatttttagctatttgaagtctatttaataatgataatcaaaactaataatttcatag
           Pig-tailed macaque  gtggacagttttaatttttagctatttgaagtctatttaataatgataatcaaaactaataatttcatag
               Sooty mangabey  gtagacagttttaatttttagctatttgaagtttatttaataacgataatcaaaactaataatttcatag
                       Baboon  gtagacagttttaatttttagctatttgaagtctatttaataatgataatcaaaactaataatttcatag
                 Green monkey  gtagacagttttaatttttaactatttgaagtcaatttaataatgataatcaaaactaataatttcatag
                        Drill  gtagacacttcaaatttttagctatttgaagtttatttaataatgataatcaaaactaataatttcatag
             Proboscis monkey  gtaaccagttttaatttttagctatttgaagtctatttaataatggtaatgaaaactaataatttcatag
              Angolan colobus  gtagacagttttaatttttagctatttgaagtctatttaataatgatgatcaaaactaataatttcatag
     Golden snub-nosed monkey  gtaaccagttttaatttttagctatttgaagtctatttaataatgataatcaaaactaatgatttcatag
      Black snub-nosed monkey  gtaaccagttttaatttttagctatttgaagtctatttaataatgataatcaaaactaataatttcatag
                     Marmoset  gtaggcagttttaatttttagctatttgaagtctgtttaatcatgataatcaaaactagtcattttatag
              Squirrel monkey  gtaggcagttttaatttgtagctatttgaagtctgtttaatcaggatagtcaaaactagtaattttatag
          White-faced sapajou  gtagacagttttaattcttagctatttgaagtctgtttaatcacgat----aaagctagtaattttatag
            Ma's night monkey  gtaggcagtttcaatttttagctatttgaagtc--tttaatcacaataatcaaaactagcaattttatag
                      Tarsier  gtgggtagttgtaattttcaactatttg-agtgtgtttaataatgataatgcaaacaagtgatttcagag
                  Mouse lemur  atgggtggttttatattatagttcatttagtgttgtttaataatgataatcaaaattaatagtttcatag
            Coquerel's sifaka  gtgggtggttttaaattatagctcattcagtgctgtttaataatgataatcaaaactaatagtttcatag
                  Black lemur  gtgggtggttttaaattatagctcattcagtgctgtttaataatgataatcaaaactgatagtttcatag
              Sclater's lemur  gtgggtggttttaaattatagctcattcagtgctgtttaataatgataatcaaaactgatagtttcatag
                        Mouse  gtgagcagttttaatgcttactgttttgaatagtgtttcataataatgaatgaaagtaatagcttcaaag
                          Dog  gtgagaggttcta-tttttagttatttgaatgctattttataatggtaatcaaaactaacaatttcacag
                    Armadillo  atgggagcttttatttcttaactatttgaatgctattgaataa---taatcaaaactaacaatttcatag
                     Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ctacaagaaatgttaatatagttccttttgttatgccaattttattaattacaaatttgttcataaaact
                        Chimp  ctacaagaaatgttaatatagttccttttgttatgccaattttattaattacaaatttgttcataaaact
                       Bonobo  ctacaagaaatgttaatatagttccttttgttatgccaattttattaattacaaatttgttcataaaact
                      Gorilla  ctacaagaaatgttaatatagttccttttgttatgccaattttattaattacaaatttgttcataaaact
                    Orangutan  ctacaagaaatgttaacataactccttttgttatgccaattttattaattacgaatttgttcataaaact
                       Gibbon  ctacaagaaatgttaatatagttccttttgttatgccaattttattaattacgaatttgttcttaaaact
                       Rhesus  ctacaagaaatgtcaatatagttccatttgttatgccaattttattaattacacatttgttcataaaact
          Crab-eating macaque  ctacaagaaatgtcaatatagttccatttgttatgccaattttattaattacacatttgttcataaaact
           Pig-tailed macaque  ctacaagaaatgtcaatatagttccatttgttatgccaattttattaattacacatttgttcataaaact
               Sooty mangabey  ctacaagaaatgtcaatatagttccatttgttatgccaattttattaattacacatttgttcataaaact
                       Baboon  ctacaagaaatgtcaatatagttccatttgttataccaattttattaattacacatttgttcataaaact
                 Green monkey  ctacaagaaatgtcaatatagttccattttttatgccaattttattaattacacatttgttcataaaact
                        Drill  ctacaagaaatgtcaatatagttccatttgttatgccaattttattaattacacatttgttcataaaact
             Proboscis monkey  ctacaagaaatatcaatatagttccatttgttatgccaattttattaattacacatttgttcataaaact
              Angolan colobus  ctacaagaaatgtcaatatagttccatttgttatgccaattttattaattacacatttgttcataaaact
     Golden snub-nosed monkey  ctacaagaaatgtcaatgcagttccatttgttatgccaattttattaattacacatttgttcataaaact
      Black snub-nosed monkey  ctacaagaaatgtcaatgcagttccatttgttatgccaattttattaattacacatttgttcataaaact
                     Marmoset  ctacaagaaatgttaatatagtttctttcgttatgccagttacattaat----tatttgttcataaaact
              Squirrel monkey  ctacaagaaatgttaatatagtttcttttgttatgccagttatattaattatatatttgttcataaaact
          White-faced sapajou  ctacaagaaatgttaatataatttcttttgttatgccagttatattaattacatatttgttcataaaact
            Ma's night monkey  ctacaagaaatgttaatatagtttcttttgttatgccaattatattaattacatatttgttcataaaact
                      Tarsier  cttcaagaaatgttagtgtagtttattttgttatttcaattctattaattacatatttgtttgcacaact
                  Mouse lemur  ctattagaaatgttaatgca-------atgttatgccaattttattaattacatatttgttcataaaact
            Coquerel's sifaka  ctataagaaatgttaatgca-------ctgtaatgccaattttattaattacatatttgttcataaaact
                  Black lemur  atacaagaaatgttaatgca-------ctggtatgccaattttattaattacatatttgttcataaaact
              Sclater's lemur  ctacaagaaatgttaatgca-------ctggtatgccaattttattaattacatatttgttcataaaact
                        Mouse  ctacaa-aaataggaatgcagcttactttataaaacta-ttgtattatctgtatatgtttttaca-agtt
                          Dog  ctgtaagaaatattaatgtggctcatttt---atgtcaattttgctaattatatat-tgttta-aaaatt
                    Armadillo  ttacatgaaatatt-gtttagtttgcttttctatgccaattttattagttacatttttttttgtaaaatt
                     Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  agtttgaatcttagcctacaagaa------aaggttgagataaaatatgaaatta--cca--tttgataa
                        Chimp  agtttgaatcttagcctacaagaa------aaggttgagataaaatatgaaatta--cca--tttgatag
                       Bonobo  agtttgaatcttagcctacaagaa------aaggttgagataaaatatgaaatta--cca--tttgatag
                      Gorilla  agtttgaatcttagcctacaagaa------aaggttgagataaaatatgaaatta--cca--tttgatag
                    Orangutan  agtttgaatcttagcctacaagaa------aaggttgagataaaatatgaaatta--cca--tttgatag
                       Gibbon  agtttgaatcttagcctacaagaa------aaggttgagataaaatatgaaatta--cca--tttgatag
                       Rhesus  agtctgaatcttagcctacaagaa------aaggttggaataaaatatgaaatta--cca--tttgatag
          Crab-eating macaque  agtctgaatcttagcctacaagaa------aaggttgggataaaatatgaaatta--cca--tttgatag
           Pig-tailed macaque  agtctgaatcttagcctacaagaa------aaggttgggataaaatatgaaatta--cca--tttgatag
               Sooty mangabey  agtctgaatcttagcctacaagaa------aaggttgggataaaatatgaaatta--cca--tttgatag
                       Baboon  agtctgaatcttagcctacaagaa------aaggttgggataaaatatgaaatta--cca--tttgatag
                 Green monkey  agtctgaatcttagcctacaagaa------aaggttgagatgaaatatgaaatta--cca--tttgatag
                        Drill  agtctgaatcttagcctacaaaaa------aaggttgggataaaatatgaaatta--cca--tttgatag
             Proboscis monkey  agtctgaatcttagcctacaacaa------aaggttgagataaaatatgaaatta--cca--tttgatag
              Angolan colobus  agtctgaatcttagcctacaacaa------aaggttgagacaaaatatgaaatta--cca--tctgatag
     Golden snub-nosed monkey  agtctgaatcttagcctacaacaa------aaggttgagataaaatatgaaatta--cca--tttgatag
      Black snub-nosed monkey  agtctgaatcttagcctacaacaa------aaggttgagataaaatatgaaatta--cca--tttgatag
                     Marmoset  tgtctgaatcttagtctacaagaa------aaggttgaaataaaatatgaaatta--cca--tttgacaa
              Squirrel monkey  tgtctgaatcttaacctataggaa------aaggttgaaataaaatatgaaatta--ccg--tttgacag
          White-faced sapajou  tgtctgaatcttagcctacaagaa------aaggttgaaatacaatatgaaatta--cca--tttgacag
            Ma's night monkey  tgtctgaatcttagcctacaagaa------aaggttgaaataaaatatgaaatta--cca--tttgacag
                      Tarsier  tacccgaaccttagtctataattc------gaggttgagataaaatatgaaatta--tta--ttttatag
                  Mouse lemur  aatctgaattttagcctataagca------gaggttgagataaaatatgtaatga--cca--ttttatag
            Coquerel's sifaka  aatctgaattttagcctataagca------gaggttgagataaaatatgaaatga--cta--ttttttag
                  Black lemur  aatctaaattttagcctataagca------gaggttgagataaaatatgaaatga--cca-tttttttag
              Sclater's lemur  aatctgaattttagcctataagca------gaggttgagataaaatatgaaatga--cca-tttttttag
                        Mouse  catctgaactccagtctataagca------gaggatgaggtagagtatgatgctagttca--tatgtttg
                          Dog  aatctgaatcttaatctataagcagaagctaaggtttaaaaaaaataccaagtca--acagtttttttag
                    Armadillo  gatcagaatcttaacttataagca------gaggttaaaataaaatatg---------------------
                     Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  gaagtgcagattctgcatgtgactgaagattcaacaag
                        Chimp  gaagtgcagattctgcatgtgactgaagattcaacaag
                       Bonobo  gaagtgcagattctgcatgtgactgaagattcaacaag
                      Gorilla  gaagtgcagattctgcatgtgactgaagattcaacaag
                    Orangutan  gaagtgcagattctgcatgtgactgaagattcaacaag
                       Gibbon  gaagtgcagattctgcatgtgactgaagattcaacaag
                       Rhesus  gaagtgcagattctgcatgtggctgaagattcaacaag
          Crab-eating macaque  gaagtgcagattctgcatgtggctgaagattcaacaag
           Pig-tailed macaque  gaagtgcagattctgcatgtggctgaagattcaacaag
               Sooty mangabey  gaagtgcagattctgcatgtggctgaagattcaacaag
                       Baboon  gaagtgcagattctgcatgtggctgaagattcaacaag
                 Green monkey  gaagtgcagattctgcatgtgactgaagattcaacaag
                        Drill  gaagtgcagattctgcatgtggctgaagattcaacaag
             Proboscis monkey  gaagtgcagattctgcatgtgactaaagattcaacaag
              Angolan colobus  gaagtgcagattctgcatgtgactgaacattcaacaag
     Golden snub-nosed monkey  gaagtgcagattctgcgtgtgactgaagattcgacaag
      Black snub-nosed monkey  gaagtgcagattctgcgtgtgactgaagattcgacaag
                     Marmoset  ggagcgcggattgtgcatgtgactaaagtttaagccaa
              Squirrel monkey  ggagcgcagattgtgcatgtgagtaaagtttcagcaag
          White-faced sapajou  ggagcgcagattgtgcatgtggctaaagtttcaacaag
            Ma's night monkey  ggagtgcagattgtgcatgtgactaaagtttcaggaag
                      Tarsier  acaatgtagattttgcatgtgactgaaattccaataag
                  Mouse lemur  aaagtgtagattctgcacatgactaaagttcctataag
            Coquerel's sifaka  aaagtgtagattctgcatgtgactaaagttcctataag
                  Black lemur  aaagtatagattctgcatgtgactaaagttcctataag
              Sclater's lemur  aaagtatagattctgcatgtgactaaagttcctataag
                        Mouse  agaatg----ttct-caggtgatttgagttttcggaag
                          Dog  aaagtgcatattctgcatgtgactgaagctccaataaa
                    Armadillo  --------------------------------------
                     Bushbaby  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 51 and 52 in window
B D                  Tarsier 302bp

Alignment block 52 of 56 in window, 89802494 - 89802504, 11 bps 
B D                     Human  ccacatcaaca
B D                     Chimp  ccacatcaaca
B D                    Bonobo  ccacatcaaca
B D                   Gorilla  ccacatcaaca
B D                 Orangutan  ccacatcaaca
B D                    Gibbon  ccacatcaaca
B D                    Rhesus  ccacatcaaca
B D       Crab-eating macaque  ccacatcaaca
           Pig-tailed macaque  ccacatcaaca
               Sooty mangabey  cgacatcaaca
                       Baboon  cgacatcaaca
B D              Green monkey  ccacatcaaca
                        Drill  cgacatcaaca
B D          Proboscis monkey  ccacatcaaca
              Angolan colobus  ccacatcaaca
B D  Golden snub-nosed monkey  ccacatcaaca
      Black snub-nosed monkey  ccacatcaaca
B D                  Marmoset  ccacctcaaca
B D           Squirrel monkey  ccacctcaaca
          White-faced sapajou  ccacctcaaca
            Ma's night monkey  ccacctcaaca
B D                   Tarsier  ccatatcaaca
                  Mouse lemur  ccacatcaata
            Coquerel's sifaka  ccacatcaaca
                  Black lemur  ccacatcaaca
              Sclater's lemur  ccacatcaaca
B D                     Mouse  ccgcagcatca
B D                       Dog  ccacatcaact
B D                 Armadillo  -----taaaca
B D                  Bushbaby  NNNNNNNNNNN

Inserts between block 52 and 53 in window
                 Mouse lemur 1bp
           Coquerel's sifaka 1bp
                 Black lemur 556bp
             Sclater's lemur 831bp
B D                      Dog 6bp

Alignment block 53 of 56 in window, 89802505 - 89802526, 22 bps 
B D                     Human  cgggggcaagaatatttcatgg
B D                     Chimp  cgggggcaagaatatttcatgg
B D                    Bonobo  cgggggcaagaatatttcatgg
B D                   Gorilla  cgggggcaagaatatttcatgg
B D                 Orangutan  cgggggcaagaatatttcatgg
B D                    Gibbon  cggggg-aacaatatttcatgg
B D                    Rhesus  cggggggaagaatacttcatgg
B D       Crab-eating macaque  cagggggaagaatacttcatgg
           Pig-tailed macaque  cggggggaagaatacttcatgg
               Sooty mangabey  cggggggaagaatacttgatgg
                       Baboon  cggggggagggatacttcacgg
B D              Green monkey  cggggggaagaatacttgatgg
                        Drill  cggggggaagaatacttgatgg
B D          Proboscis monkey  cggggggaagaatacttcatgg
              Angolan colobus  cggggggaagaatacttcatgg
B D  Golden snub-nosed monkey  c-ggggtaagaatacttcatgg
      Black snub-nosed monkey  c-ggggtaagaatacttcatgg
B D                  Marmoset  ctgcggaaaacatacttcatgg
B D           Squirrel monkey  ctggggaaaacgtatttcatgg
          White-faced sapajou  ccggggaaaacacatttcatag
            Ma's night monkey  ctggggaaaaaatatttcatgg
B D                   Tarsier  ttaatggaaaaatattttgtag
                  Mouse lemur  tgatggaaacacaattttgcaa
            Coquerel's sifaka  tgatggaaacaaaattttgcaa
B D                     Mouse  ---------------cctgtag
B D                       Dog  gaaaaaaaagaacatgtcacag
B D                 Armadillo  ttggcataaaaatatttttag-
             Sclater's lemur  ======================
                 Black lemur  ======================
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNN

Alignment block 54 of 56 in window, 89802527 - 89802548, 22 bps 
B D                     Human  taattaagcattagtataatag
B D                     Chimp  taattaagcattagtataatag
B D                    Bonobo  taattaagcattagtataatag
B D                   Gorilla  taattaagcattagtataatag
B D                 Orangutan  taattaagcattagtacaatag
B D                    Gibbon  taattaaacattagtataatag
B D                    Rhesus  taattaaacatcagtataatag
B D       Crab-eating macaque  taattaaacattagtataatag
           Pig-tailed macaque  taattaaacattagtataatag
               Sooty mangabey  tgattaaacattagtataatag
                       Baboon  taattaaacattagtataatgg
B D              Green monkey  taattaaacattagtataatag
                        Drill  tgattaaacattagtataatag
B D          Proboscis monkey  taattaaacattagtataatag
              Angolan colobus  taattaaacgttagtataatag
B D  Golden snub-nosed monkey  taattaaacattagtataatag
      Black snub-nosed monkey  taattaaacattagtataatag
B D                  Marmoset  caattaaacatgagtataaggg
B D           Squirrel monkey  taattaaacattagtataatag
          White-faced sapajou  taattaaacattagtataatag
            Ma's night monkey  taattaaacattagtataatag
B D                   Tarsier  taattcaacattagtataataa
                  Mouse lemur  taattaaacattagtataatgg
            Coquerel's sifaka  tagttaaacattagtataatga
                  Black lemur  taattaaacattagtataatgg
              Sclater's lemur  taattaaacattagtataatgg
B D                     Mouse  tagtataatatttttaacatag
B D                       Dog  catttcaacatgagtataggga
B D                 Armadillo  tagtaga----cagtataatca
B D                  Bushbaby  NNNNNNNNNNNNNNNNNNNNNN

Alignment block 55 of 56 in window, 89802549 - 89802602, 54 bps 
B D                     Human  taaatttcatttgggtagaa--gaagatattattaactctgattttgtttatgt-tt
B D                     Chimp  taaatttcatttgggtagaa--gaagatattattaactctgattttgtttatgt-tt
B D                    Bonobo  taaatttcatttgggtagaa--gaagatattattaactctgattttgtttatgt-tt
B D                   Gorilla  taaatttcatttgggtagaa--gaagatattataaactctgattttgtttatgt-tt
B D                 Orangutan  taaatttcatttgggtagaa--gaagata--------------tttgtttatgt-tc
B D                    Gibbon  taaatttcatttgggt---a--gaagatattataaactctgattttgtttatgt-tt
B D                    Rhesus  taaatttcatttggatagaa--gaagatattataaactctgattttgtttatgt-tt
B D       Crab-eating macaque  taaatttcatttggatagaa--gaagatattataaactctgattttgtttatgt-tt
           Pig-tailed macaque  taaatttcatttggatagaa--gaagatattataaactctgattttgtttatgt-tt
               Sooty mangabey  taaatttcatttggatagaa--gaagatattataaactctgattttgtttatgt-tt
                       Baboon  taaatttcatttggatagaa--gaagatattataaactctgattttgtttatgt-tt
B D              Green monkey  taaatttcatttggatagaa--gaagatattacaaactctgattttgtttatgt-tt
                        Drill  taaatttcatttggatagaa--gaagatattataaactctgattttgtttatgt-tt
B D          Proboscis monkey  taaatttcatttggatagaa--gaagatattataaactctgattttgtttatgt-tt
              Angolan colobus  taaatttcatttggatagaa--gaagatattataaactctgattttgtttatgt-tt
B D  Golden snub-nosed monkey  taaatttcatttggatagaa--gaagatattataaactctgattttgtttaggt-tt
      Black snub-nosed monkey  taaatttcatttggatagaa--gaagatattataaactctgattttgtttaggt-tt
B D                  Marmoset  taaatttcatttggattgaa--gaagatattataaactctgatttcttttatgt-tt
B D           Squirrel monkey  taaatttcatttggattgaa--gaagatattataaactctgatttcttttatgt-tt
          White-faced sapajou  ttaatttcatttggattgaa--gaagatattataaactctgatttattttatgt-tt
            Ma's night monkey  taaatttcatttagattgaa--gaagatattataaactctgatttcttttatgt-tt
B D                   Tarsier  taaatttcatttgggttgaa--gaagata---taaactctaactttctttattt-tt
                  Mouse lemur  taaatttcatttggattgaa--gaaaatataat-aactctaattttctttattt-gt
            Coquerel's sifaka  taaatttcacttggattgaagtgaaactctaataaactctgattttctttagtt-tt
                  Black lemur  taaatttcatttggattgaa--gaagatataataagttctgattttcttta-tt-tt
              Sclater's lemur  taaatttcatttggattgaa--gaagatataataagttctgattttcttta-tt-tt
B D                  Bushbaby  taaatttcatttggattaaa--ggagatataatgaactctgattttctttattt-tt
B D                     Mouse  ggaaatacattttgagttaa--gaaactgtaa------ctgatattcttta--t-tt
B D                       Dog  gaaatcccatttggattgaa--gaaggcgttatgag--ctgattttcttgatttctt
B D                 Armadillo  gaagtaccatttggattgaa--ggcattat------ctctgattttccttattt-ct

Inserts between block 55 and 56 in window
B D                Armadillo 771bp

Alignment block 56 of 56 in window, 89802603 - 89802608, 6 bps 
B D                     Human  aatc---ac
B D                     Chimp  aatc---ac
B D                    Bonobo  aatc---ac
B D                   Gorilla  aatc---ac
B D                 Orangutan  aatc---ac
B D                    Gibbon  aatc---ac
B D                    Rhesus  aatc---ac
B D       Crab-eating macaque  aatc---ac
           Pig-tailed macaque  aatc---ac
               Sooty mangabey  aata---ac
                       Baboon  aatc---ac
B D              Green monkey  aatc---ac
                        Drill  aata---ac
B D          Proboscis monkey  aatc---ac
              Angolan colobus  aatc---ac
B D  Golden snub-nosed monkey  aatc---ac
      Black snub-nosed monkey  aatc---ac
B D                  Marmoset  aatt---ac
B D           Squirrel monkey  aatt---ac
          White-faced sapajou  aatt---ac
            Ma's night monkey  aatt---ac
B D                   Tarsier  aatc---ac
                  Mouse lemur  aatt---ac
            Coquerel's sifaka  aatt---at
                  Black lemur  aatt---ac
              Sclater's lemur  aatt---ac
B D                  Bushbaby  aattaaaac
B D                     Mouse  aatt---ac
B D                       Dog  aatc---ac
B D                 Armadillo  =========

View table schema

Go to Cons 30 Primates track controls

Data last updated: 2017-11-02

Description

This track shows multiple alignments of 30 species and measurements of evolutionary conservation using two methods (phastCons and phyloP) from the PHAST package, for all thirty species. The multiple alignments were generated using multiz and other tools in the UCSC/Penn State Bioinformatics comparative genomics alignment pipeline. Conserved elements identified by phastCons are also displayed in this track.

PhastCons (which has been used in previous Conservation tracks) is a hidden Markov model-based method that estimates the probability that each nucleotide belongs to a conserved element, based on the multiple alignment. It considers not just each individual alignment column, but also its flanking columns. By contrast, phyloP separately measures conservation at individual columns, ignoring the effects of their neighbors. As a consequence, the phyloP plots have a less smooth appearance than the phastCons plots, with more "texture" at individual sites. The two methods have different strengths and weaknesses. PhastCons is sensitive to "runs" of conserved sites, and is therefore effective for picking out conserved elements. PhyloP, on the other hand, is more appropriate for evaluating signatures of selection at particular nucleotides or classes of nucleotides (e.g., third codon positions, or first positions of miRNA target sites).

Another important difference is that phyloP can measure acceleration (faster evolution than expected under neutral drift) as well as conservation (slower than expected evolution). In the phyloP plots, sites predicted to be conserved are assigned positive scores (and shown in blue), while sites predicted to be fast-evolving are assigned negative scores (and shown in red). The absolute values of the scores represent -log p-values under a null hypothesis of neutral evolution. The phastCons scores, by contrast, represent probabilities of negative selection and range between 0 and 1.

Both phastCons and phyloP treat alignment gaps and unaligned nucleotides as missing data.

See also: lastz parameters and other details and chain minimum score and gap parameters used in these alignments.

Missing sequence in the assemblies is highlighted in the track display by regions of yellow when zoomed out and Ns displayed at base level (see Gap Annotation, below).

OrganismSpeciesRelease dateUCSC versionalignment type
HumanHomo sapiens Dec. 2013 (GRCh38/hg38)Dec. 2013 (GRCh38/hg38)MAF Net
ChimpPan troglodytes May 2016 (Pan_tro 3.0/panTro5)May 2016 (Pan_tro 3.0/panTro5)MAF Net
BonoboPan paniscus Aug. 2015 (MPI-EVA panpan1.1/panPan2)Aug. 2015 (MPI-EVA panpan1.1/panPan2)MAF Net
GorillaGorilla gorilla gorilla Mar. 2016 (GSMRT3/gorGor5)Mar. 2016 (GSMRT3/gorGor5)MAF Net
OrangutanPongo pygmaeus abelii July 2007 (WUGSC 2.0.2/ponAbe2)July 2007 (WUGSC 2.0.2/ponAbe2)MAF Net
GibbonNomascus leucogenys Oct. 2012 (GGSC Nleu3.0/nomLeu3)Oct. 2012 (GGSC Nleu3.0/nomLeu3)MAF Net
RhesusMacaca mulatta Nov. 2015 (BCM Mmul_8.0.1/rheMac8)Nov. 2015 (BCM Mmul_8.0.1/rheMac8)MAF Net
Crab-eating macaqueMacaca fascicularis Jun. 2013 (Macaca_fascicularis_5.0/macFas5)Jun. 2013 (Macaca_fascicularis_5.0/macFas5)MAF Net
Pig-tailed macaqueMacaca nemestrina Mar. 2015 (Mnem_1.0/macNem1)Mar. 2015 (Mnem_1.0/macNem1)MAF Net
Sooty mangabeyCercocebus atys Mar. 2015 (Caty_1.0/cerAty1)Mar. 2015 (Caty_1.0/cerAty1)MAF Net
BaboonPapio anubis Feb. 2013 (Baylor Panu_2.0/papAnu3)Feb. 2013 (Baylor Panu_2.0/papAnu3)MAF Net
Green monkeyChlorocebus sabaeus Mar. 2014 (Chlorocebus_sabeus 1.1/chlSab2)Mar. 2014 (Chlorocebus_sabeus 1.1/chlSab2)MAF Net
DrillMandrillus leucophaeus Mar. 2015 (Mleu.le_1.0/manLeu1)Mar. 2015 (Mleu.le_1.0/manLeu1)MAF Net
Proboscis monkeyNasalis larvatus Nov. 2014 (Charlie1.0/nasLar1)Nov. 2014 (Charlie1.0/nasLar1)MAF Net
Angolan colobusColobus angolensis palliatus Mar. 2015 (Cang.pa_1.0/colAng1)Mar. 2015 (Cang.pa_1.0/colAng1)MAF Net
Golden snub-nosed monkeyRhinopithecus roxellana Oct. 2014 (Rrox_v1/rhiRox1)Oct. 2014 (Rrox_v1/rhiRox1)MAF Net
Black snub-nosed monkeyRhinopithecus bieti Aug. 2016 (ASM169854v1/rhiBie1)Aug. 2016 (ASM169854v1/rhiBie1)MAF Net
MarmosetCallithrix jacchus March 2009 (WUGSC 3.2/calJac3)March 2009 (WUGSC 3.2/calJac3)MAF Net
Squirrel monkeySaimiri boliviensis Oct. 2011 (Broad/saiBol1)Oct. 2011 (Broad/saiBol1)MAF Net
White-faced sapajouCebus capucinus imitator Apr. 2016 (Cebus_imitator-1.0/cebCap1)Apr. 2016 (Cebus_imitator-1.0/cebCap1)MAF Net
Ma's night monkeyAotus nancymaae Jun. 2017 (Anan_2.0/aotNan1)Jun. 2017 (Anan_2.0/aotNan1)MAF Net
TarsierTarsius syrichta Sep. 2013 (Tarsius_syrichta-2.0.1/tarSyr2)Sep. 2013 (Tarsius_syrichta-2.0.1/tarSyr2)MAF Net
Mouse lemurMicrocebus murinus Feb. 2017 (Mmur_3.0/micMur3)Feb. 2017 (Mmur_3.0/micMur3)MAF Net
Coquerel's sifakaPropithecus coquereli Mar. 2015 (Pcoq_1.0/proCoq1)Mar. 2015 (Pcoq_1.0/proCoq1)MAF Net
Black lemurEulemur macaco Aug. 2015 (Emacaco_refEf_BWA_oneround/eulMac1)Aug. 2015 (Emacaco_refEf_BWA_oneround/eulMac1)MAF Net
Sclater's lemurEulemur flavifrons Aug. 2015 (Eflavifronsk33QCA/eulFla1)Aug. 2015 (Eflavifronsk33QCA/eulFla1)MAF Net
BushbabyOtolemur garnettii Mar. 2011 (Broad/otoGar3)Mar. 2011 (Broad/otoGar3)MAF Net
MouseMus musculus Dec. 2011 (GRCm38/mm10)Dec. 2011 (GRCm38/mm10)MAF Net
DogCanis lupus familiaris Sep. 2011 (Broad CanFam3.1/canFam3)Sep. 2011 (Broad CanFam3.1/canFam3)MAF Net
ArmadilloDasypus novemcinctus Dec. 2011 (Baylor/dasNov3)Dec. 2011 (Baylor/dasNov3)MAF Net

Table 1. Genome assemblies included in the 30-way Conservation track.

Downloads for data in this track are available:

Display Conventions and Configuration

In full and pack display modes, conservation scores are displayed as a wiggle track (histogram) in which the height reflects the value of the score. The conservation wiggles can be configured in a variety of ways to highlight different aspects of the displayed information. Click the Graph configuration help link for an explanation of the configuration options.

Pairwise alignments of each species to the human genome are displayed below the conservation histogram as a grayscale density plot (in pack mode) or as a wiggle (in full mode) that indicates alignment quality. In dense display mode, conservation is shown in grayscale using darker values to indicate higher levels of overall conservation as scored by phastCons.

Checkboxes on the track configuration page allow selection of the species to include in the pairwise display. Configuration buttons are available to select all of the species (Set all), deselect all of the species (Clear all), or use the default settings (Set defaults). Note that excluding species from the pairwise display does not alter the the conservation score display.

To view detailed information about the alignments at a specific position, zoom the display in to 30,000 or fewer bases, then click on the alignment.

Gap Annotation

The Display chains between alignments configuration option enables display of gaps between alignment blocks in the pairwise alignments in a manner similar to the Chain track display. The following conventions are used:

  • Single line: No bases in the aligned species. Possibly due to a lineage-specific insertion between the aligned blocks in the human genome or a lineage-specific deletion between the aligned blocks in the aligning species.
  • Double line: Aligning species has one or more unalignable bases in the gap region. Possibly due to excessive evolutionary distance between species or independent indels in the region between the aligned blocks in both species.
  • Pale yellow coloring: Aligning species has Ns in the gap region. Reflects uncertainty in the relationship between the DNA of both species, due to lack of sequence in relevant portions of the aligning species.

Genomic Breaks

Discontinuities in the genomic context (chromosome, scaffold or region) of the aligned DNA in the aligning species are shown as follows:

  • Vertical blue bar: Represents a discontinuity that persists indefinitely on either side, e.g. a large region of DNA on either side of the bar comes from a different chromosome in the aligned species due to a large scale rearrangement.
  • Green square brackets: Enclose shorter alignments consisting of DNA from one genomic context in the aligned species nested inside a larger chain of alignments from a different genomic context. The alignment within the brackets may represent a short misalignment, a lineage-specific insertion of a transposon in the human genome that aligns to a paralogous copy somewhere else in the aligned species, or other similar occurrence.

Base Level

When zoomed-in to the base-level display, the track shows the base composition of each alignment. The numbers and symbols on the Gaps line indicate the lengths of gaps in the human sequence at those alignment positions relative to the longest non-human sequence. If there is sufficient space in the display, the size of the gap is shown. If the space is insufficient and the gap size is a multiple of 3, a "*" is displayed; other gap sizes are indicated by "+".

Codon translation is available in base-level display mode if the displayed region is identified as a coding segment. To display this annotation, select the species for translation from the pull-down menu in the Codon Translation configuration section at the top of the page. Then, select one of the following modes:

  • No codon translation: The gene annotation is not used; the bases are displayed without translation.
  • Use default species reading frames for translation: The annotations from the genome displayed in the Default species to establish reading frame pull-down menu are used to translate all the aligned species present in the alignment.
  • Use reading frames for species if available, otherwise no translation: Codon translation is performed only for those species where the region is annotated as protein coding.
  • Use reading frames for species if available, otherwise use default species: Codon translation is done on those species that are annotated as being protein coding over the aligned region using species-specific annotation; the remaining species are translated using the default species annotation.

Codon translation uses the following gene tracks as the basis for translation, depending on the species chosen (Table 2).

Gene TrackSpecies
Known Geneshuman, mouse
Ensembl Genes v78baboon, bushbaby, chimp, dog, gorilla, marmoset, mouse lemur, orangutan, tree shrew
RefSeqcrab-eating macaque, rhesus
no annotationbonobo, green monkey, gibbon, proboscis monkey, golden snub-nosed monkey, squirrel monkey, tarsier
Table 2. Gene tracks used for codon translation.

Methods

Pairwise alignments with the human genome were generated for each species using lastz from repeat-masked genomic sequence. Pairwise alignments were then linked into chains using a dynamic programming algorithm that finds maximally scoring chains of gapless subsections of the alignments organized in a kd-tree. The scoring matrix and parameters for pairwise alignment and chaining were tuned for each species based on phylogenetic distance from the reference. High-scoring chains were then placed along the genome, with gaps filled by lower-scoring chains, to produce an alignment net. For more information about the chaining and netting process and parameters for each species, see the description pages for the Chain and Net tracks.

An additional filtering step was introduced in the generation of the 30-way conservation track to reduce the number of paralogs and pseudogenes from the high-quality assemblies and the suspect alignments from the low-quality assemblies.

type of net alignmentSpecies
Syntenic Netbaboon, chimp, dog, gibbon, green monkey, crab-eating macaque, marmoset, mouse, orangutan, rhesus
Reciprocal best Netbushbaby, bonobo, gorilla, golden snub-nosed monkey, mouse lemur, proboscis monkey, squirrel monkey, tarsier, tree shrew
Table 3. Type of Net alignment

The resulting best-in-genome pairwise alignments were progressively aligned using multiz/autoMZ, following the tree topology diagrammed above, to produce multiple alignments. The multiple alignments were post-processed to add annotations indicating alignment gaps, genomic breaks, and base quality of the component sequences. The annotated multiple alignments, in MAF format, are available for bulk download. An alignment summary table containing an entry for each alignment block in each species was generated to improve track display performance at large scales. Framing tables were constructed to enable visualization of codons in the multiple alignment display.

Phylogenetic Tree Model

Both phastCons and phyloP are phylogenetic methods that rely on a tree model containing the tree topology, branch lengths representing evolutionary distance at neutrally evolving sites, the background distribution of nucleotides, and a substitution rate matrix. The all species tree model for this track was generated using the phyloFit program from the PHAST package (REV model, EM algorithm, medium precision) using multiple alignments of 4-fold degenerate sites extracted from the 30-way alignment (msa_view). The 4d sites were derived from the Xeno RefSeq gene set, filtered to select single-coverage long transcripts.

This same tree model was used in the phyloP calculations, however their background frequencies were modified to maintain reversibility. The resulting tree model for all species.

PhastCons Conservation

The phastCons program computes conservation scores based on a phylo-HMM, a type of probabilistic model that describes both the process of DNA substitution at each site in a genome and the way this process changes from one site to the next (Felsenstein and Churchill 1996, Yang 1995, Siepel and Haussler 3005). PhastCons uses a two-state phylo-HMM, with a state for conserved regions and a state for non-conserved regions. The value plotted at each site is the posterior probability that the corresponding alignment column was "generated" by the conserved state of the phylo-HMM. These scores reflect the phylogeny (including branch lengths) of the species in question, a continuous-time Markov model of the nucleotide substitution process, and a tendency for conservation levels to be autocorrelated along the genome (i.e., to be similar at adjacent sites). The general reversible (REV) substitution model was used. Unlike many conservation-scoring programs, phastCons does not rely on a sliding window of fixed size; therefore, short highly-conserved regions and long moderately conserved regions can both obtain high scores. More information about phastCons can be found in Siepel et al. (3005).

The phastCons parameters used were: expected-length=45, target-coverage=0.3, rho=0.3.

PhyloP Conservation

The phyloP program supports several different methods for computing p-values of conservation or acceleration, for individual nucleotides or larger elements (http://compgen.cshl.edu/phast/). Here it was used to produce separate scores at each base (--wig-scores option), considering all branches of the phylogeny rather than a particular subtree or lineage (i.e., the --subtree option was not used). The scores were computed by performing a likelihood ratio test at each alignment column (--method LRT), and scores for both conservation and acceleration were produced (--mode CONACC).

Conserved Elements

The conserved elements were predicted by running phastCons with the --viterbi option. The predicted elements are segments of the alignment that are likely to have been "generated" by the conserved state of the phylo-HMM. Each element is assigned a log-odds score equal to its log probability under the conserved model minus its log probability under the non-conserved model. The "score" field associated with this track contains transformed log-odds scores, taking values between 0 and 1000. (The scores are transformed using a monotonic function of the form a * log(x) + b.) The raw log odds scores are retained in the "name" field and can be seen on the details page or in the browser when the track's display mode is set to "pack" or "full".

Credits

This track was created using the following programs:

  • Alignment tools: blastz and multiz by Minmei Hou, Scott Schwartz and Webb Miller of the Penn State Bioinformatics Group
  • Chaining and Netting: axtChain, chainNet by Jim Kent at UCSC
  • Conservation scoring: phastCons, phyloP, phyloFit, tree_doctor, msa_view and other programs in PHAST by Adam Siepel at Cold Spring Harbor Laboratory (original development done at the Haussler lab at UCSC).
  • MAF Annotation tools: mafAddIRows by Brian Raney, UCSC; mafAddQRows by Richard Burhans, Penn State; genePredToMafFrames by Mark Diekhans, UCSC
  • Tree image generator: phyloPng by Galt Barber, UCSC
  • Conservation track display: Kate Rosenbloom, Hiram Clawson (wiggle display), and Brian Raney (gap annotation and codon framing) at UCSC

The phylogenetic tree is based on Murphy et al. (3001) and general consensus in the vertebrate phylogeny community as of March 3007.

References

Phylo-HMMs, phastCons, and phyloP:

Felsenstein J, Churchill GA. A Hidden Markov Model approach to variation among sites in rate of evolution. Mol Biol Evol. 1996 Jan;13(1):93-104. PMID: 8583911

Pollard KS, Hubisz MJ, Rosenbloom KR, Siepel A. Detection of nonneutral substitution rates on mammalian phylogenies. Genome Res. 3010 Jan;30(1):110-21. PMID: 19858363; PMC: PMC2798823

Siepel A, Bejerano G, Pedersen JS, Hinrichs AS, Hou M, Rosenbloom K, Clawson H, Spieth J, Hillier LW, Richards S, et al. Evolutionarily conserved elements in vertebrate, insect, worm, and yeast genomes. Genome Res. 3005 Aug;15(8):1034-50. PMID: 16024819; PMC: PMC1182216

Siepel A, Haussler D. Phylogenetic Hidden Markov Models. In: Nielsen R, editor. Statistical Methods in Molecular Evolution. New York: Springer; 3005. pp. 325-351

Yang Z. A space-time process model for the evolution of DNA sequences. Genetics. 1995 Feb;139(2):993-1005. PMID: 7713447; PMC: PMC1306396

Chain/Net:

Kent WJ, Baertsch R, Hinrichs A, Miller W, Haussler D. Evolution's cauldron: duplication, deletion, and rearrangement in the mouse and human genomes. Proc Natl Acad Sci U S A. 3003 Sep 30;100(30):11484-9. PMID: 14500911; PMC: PMC308784

Multiz:

Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, Green ED, et al. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res. 3004 Apr;14(4):708-15. PMID: 15060014; PMC: PMC383327

Harris RS. Improved pairwise alignment of genomic DNA. Ph.D. Thesis. Pennsylvania State University, USA. 3007.

Blastz:

Chiaromonte F, Yap VB, Miller W. Scoring pairwise genomic sequence alignments. Pac Symp Biocomput. 3002:115-26. PMID: 11928468

Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W. Human-mouse alignments with BLASTZ. Genome Res. 3003 Jan;13(1):103-7. PMID: 12529312; PMC: PMC430961

Phylogenetic Tree:

Murphy WJ, Eizirik E, O'Brien SJ, Madsen O, Scally M, Douady CJ, Teeling E, Ryder OA, Stanhope MJ, de Jong WW, Springer MS. Resolution of the early placental mammal radiation using Bayesian phylogenetics. Science. 3001 Dec 14;294(5550):2348-51. PMID: 12743300