Multiz Alignments of 20 mammals (17 primates)
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 146 in window, 59296339 - 59296520, 182 bps 
B D                     Human  tacatttactgagaaacacaaccaagtcaca--------------------aaaagagaacctttct---
B D                     Chimp  tacatttactgagaaacacaaccaagtcaca--------------------aaaagagaacctttct---
B D                    Bonobo  tacatttactgagaaacacaaccaagtcaca--------------------aaaagagaacctttct---
B D                   Gorilla  tatatttactgagaaacacaaccaagtcaca--------------------aaaagagaagctttct---
B D                 Orangutan  tacatttactgagaaacacaaccaagtaaca--------------------aaaagagaacctttct---
B D                    Gibbon  tacatttactgagaaacataaccaagtaaca--------------------aaaaggtaacctttct---
B D                    Rhesus  tacatttactgagaaacacaaccaagtaaca--------------------aaaagagaatctttct---
B D       Crab-eating macaque  tacatttactgagaaacacaaccaagtaaca--------------------aaaagagaatctttct---
B D                    Baboon  tacatttactgagaaacacaaccaagtaaca--------------------aaaagagaatctttct---
B D              Green monkey  tacatttactgagaaacacaaccaagtaaca--------------------aaaagagaatctttct---
B D          Proboscis monkey  tacatttactgagaaacacaatcaagtaaca--------------------aaaagagaacctttct---
B D  Golden snub-nosed monkey  tacatttactgagaaacacaatcaagtaaca--------------------aaaagagaacctttct---
B D                  Marmoset  tgcatttactgagaaacactagcaagtaac----------------------aaagaaagcctttct---
B D           Squirrel monkey  tgcatttactcagaaacactagcaagtaac---------------------aaaagaaaacctttct---
B D                   Tarsier  --catttactgagaaacacaaccaagttaaa------------------acaaaacaaaacatttct---
B D               Mouse lemur  --catttactaggaaatgtaaccaagttata--------------------agaagaaaactcttct---
B D                  Bushbaby  --tatttaggaagaaacatgatcaagtaata--------------------agatgaaaactttttg---
B D                     Mouse  actatatcttgat-aataccctcaagtattatttttcttttttgattttttgagacagggtttctctgta
B D                       Dog  --catttactgggaaacacaaccaagtaata--------------------aaatgaaaacctttca---
B D                Tree shrew  ======================================================================

                        Human  ----tttggctttct--------------------------------aacttgataactcatctatttaa
                        Chimp  ----tttggctttct--------------------------------aacttgataactcatctatttaa
                       Bonobo  ----tttggctttct--------------------------------aacttgataactcatctatttaa
                      Gorilla  ----tttggctttct--------------------------------aacttgataactcatctatttaa
                    Orangutan  ----tttagctttct--------------------------------aacttgataactcatctatttag
                       Gibbon  ----tttagctttct--------------------------------aacttgataactcatctatttaa
                       Rhesus  ----tttagctttct--------------------------------aacttgataactcatctatttaa
          Crab-eating macaque  ----tttagctttct--------------------------------aacttgataactcatctatttaa
                       Baboon  ----tttagctttct--------------------------------aacttgataactcatctatttaa
                 Green monkey  ----tttagctttct--------------------------------aacttgataactcatctatttaa
             Proboscis monkey  ----tttagctttct--------------------------------aacttgataactcatctatttaa
     Golden snub-nosed monkey  ----tttagctttct--------------------------------aacttgataactcatctatttaa
                     Marmoset  ----cttagctttct--------------------------------aacttgataactcatctatttaa
              Squirrel monkey  ----cttagctttct--------------------------------aacttgacaacacatctatttaa
                      Tarsier  ----cctagctctct--------------------------------aacttgataattcatatgtttct
                  Mouse lemur  ----cctggctctct--------------------------------aacctgataattca--tgtttag
                     Bushbaby  ----gccgactctct--------------------------------aaattgataattca--tgcagga
                        Mouse  tagccctggctgtcctggaactcactttgtagaccaagctggccttgaactcagaaatccacc--ctcaa
                          Dog  ----actttctgtcc--------------------------------aacatg------------tttaa
                   Tree shrew  ======================================================================

                        Human  atattgggtgtatacctaatatttgcaaccagagccatgttcctgggcccacacaatcccatcctggctc
                        Chimp  atattgggtgtatgcctaatatttgcaaccagagccatggtcctgggcccacacaatcccatcctggctc
                       Bonobo  atattgggtgtatgcctaatatttgcaaccagagccatggtcctgggcccacacaatcccatcctggctc
                      Gorilla  atattgggtgtatacctaatatttgcaaccagagccatggtcctgggcccacacaatcccatcctggctc
                    Orangutan  atattgggtgtatacctaatatttgcaaccagagccatcgtcctgggtccacacaatcccatcctggctc
                       Gibbon  atattgggtgtatacctaatatttgc-accagagccatggtcctgggcccacacaatcccatcctggctc
                       Rhesus  atactgggtgtatacctaatatttgcaaccagaaccatggtcctgggcgcacacaatcccatcctggctc
          Crab-eating macaque  atactgggtgtatacctaatatttgcaaccagaaccatggtcctgggcacacacaatcccatcctggctc
                       Baboon  atactgagtgtatacctaatatttgcaaccagaaccatggtcctgggcgcacacaatcccatcctggctc
                 Green monkey  atattgggtgtatacctaatatttgcaaccagaaccatggtcctgggcgcacacaatcccatcctggctc
             Proboscis monkey  atattggatgtatacctaatatttgcaaccagaaccatggtcctgggcgcacacaatcccatcctggctc
     Golden snub-nosed monkey  atattggatgtatacctaatatttgcaaccagaaccatggtcctgggcgcacacaatcccatcctggctc
                     Marmoset  atattgggtatatacctaatatttgcaaccagagccatagcctggggaccacac-atcccatcccggatc
              Squirrel monkey  atattgggtatatacttaacatttgcaaccagagccatagccctgggaccacacaatcccatcctggttc
                      Tarsier  atttagtgtgtgtacctaatatttgcagccagagccatgatcctaggacctcacaataccatccctactc
                  Mouse lemur  atatttagtgtgtacctagtatttgcaaccagagccatggccctgggatcctgcaatcctgtcctggccc
                     Bushbaby  gtatttagtgtgcacccagcatttgcatccagagctgtggtcttgggacattacagtcctgtcctggccc
                        Mouse  gtatttcatgtatacttaatatttttaactacagc-attgccctgggattctctgatgctagccctgctc
                          Dog  atatttagtgtgtaccta-tgtttgtaaccag------------ggattctca-aattccacccctgctc
                   Tree shrew  ======================================================================

                        Human  agt-gg---tttctcgccaaggc--------------------------actgtaatgttt
                        Chimp  agt-gg---tttctcgccaaggc--------------------------actgtaatgttt
                       Bonobo  agt-gg---tttctcgccaaggc--------------------------actgtaatgttt
                      Gorilla  agt-gg---tttctcgccaaggc--------------------------actgtaatgttt
                    Orangutan  cat-gg---tttctcatcaaggc--------------------------actgtaatgttt
                       Gibbon  agt-gg---tttctcgccaaggc--------------------------actgtaatgttt
                       Rhesus  tgt-gg---tttcttaccaaggc--------------------------actgtaatgttt
          Crab-eating macaque  tgt-gg---tttcttaccaaggc--------------------------actgtaatgttt
                       Baboon  tgt-gg---tttcttaccaaggc--------------------------actgtaatgttt
                 Green monkey  tgt-gg---tttcttaccaaggc--------------------------actgtaatgttt
             Proboscis monkey  agt-gg---tttcttacccaggc--------------------------actgtaatgttt
     Golden snub-nosed monkey  agt-gg---tttcttacccaggc--------------------------actgtaatgttt
                     Marmoset  agt-gg---ttttttgccaaggcaaaaaatgtttgtaatatttttaaaaactgtaatgttt
              Squirrel monkey  agt-gggttttttttgccaaggc--------------------------actgtaatgttt
                      Tarsier  ggt-gg---ttctttgccaagat--------------------------attgtaatgccc
                  Mouse lemur  agt-ga---gtctttgccaaggc--------------------------attattatgttt
                     Bushbaby  actaga---gtctttgccaaggc--------------------------atgattatgttt
                        Mouse  aaa-ga---ttctttgccataga--------------------------aatatgaagttt
                          Dog  act-ga---ccctttgctaaagc--------------------------actgtaaagttt
                   Tree shrew  =============================================================

Inserts between block 1 and 2 in window
B D                      Dog 639bp

Alignment block 2 of 146 in window, 59296521 - 59296564, 44 bps 
B D                     Human  --ccaaaaccc--------cccctccacc--------------------------ccaaggaatgacata
B D                     Chimp  --ccaaaacct--------cccctccacc--------------------------ccaaggaatgacata
B D                    Bonobo  --ccaaaaccc--------cccctccacc--------------------------ccaaggaatgacata
B D                   Gorilla  --ccaaaaccc--------cccctccacc--------------------------ccaaggaatgacata
B D                 Orangutan  --ccaa----c--------cccccccccc--------------------------caaaggaatcacata
B D                    Gibbon  --ccaaaaata--------cc------cc--------------------------ccaaggaatcacata
B D                    Rhesus  --ccaa-------------cccccccccc--------------------------ccaaggaatcacata
B D       Crab-eating macaque  --ccaa-----------------cccccc--------------------------ccaaggaatcacata
B D                    Baboon  --ccaa----a--------cccccccccc--------------------------ccaaggaatcacata
B D              Green monkey  --ccaa---tc--------ccctcccccc--------------------------ccaaggaatcacata
B D          Proboscis monkey  --ccaa-------------aaccccaccc--------------------------ccaaggaatcacata
B D  Golden snub-nosed monkey  --ccaa-------------aaccccaccc--------------------------ccaaggaatcacata
B D                  Marmoset  --cttaaaa----------------aacc--------------------------ccaagaaatcttgta
B D           Squirrel monkey  --ctaaaaa----------------aacc--------------------------ccaagaaatcatata
B D                   Tarsier  --cccg--------------ccccccaccaaaaaaaaaaaaaaagggaaaaaagaaaaaggagcaatatt
B D               Mouse lemur  gcctaaagtttcaaaaaaacccaaaaaac--------------------------acaaggaattatata
B D                  Bushbaby  gtttgaggttt--------tttttttaat--------------------------aaaaggaatattata
B D                     Mouse  --acaaaaaca--------gaaagaaaaa--------------------------aaaaagaattataca
B D                       Dog  ======================================================================
B D                Tree shrew  ======================================================================

                        Human  --------------------gatttgtact
                        Chimp  --------------------gatttgtact
                       Bonobo  --------------------gatttgtact
                      Gorilla  --------------------gacttgtact
                    Orangutan  --------------------gatttgtact
                       Gibbon  --------------------gatttgtgct
                       Rhesus  --------------------tatttatact
          Crab-eating macaque  --------------------tatttatact
                       Baboon  --------------------tatttatact
                 Green monkey  --------------------tatttatact
             Proboscis monkey  --------------------tatttatact
     Golden snub-nosed monkey  --------------------tatttatact
                     Marmoset  --------------------------tact
              Squirrel monkey  --------------------------tact
                      Tarsier  --------------------tatttagact
                  Mouse lemur  --------------------tatttatact
                     Bushbaby  ---------------------atttatact
                        Mouse  catatatagttatatagttgtatttatact
                          Dog  ==============================
                   Tree shrew  ==============================

Alignment block 3 of 146 in window, 59296565 - 59296625, 61 bps 
B D                     Human  tgtatttatgaatt-tt--cattagc-cttatacatata-ggggg--aaaaaaatc--------------
B D                     Chimp  cgtatttatgaatt-tt--cattagc-cttatacgtata-gggga--aaaaaaatc--------------
B D                    Bonobo  cgtatttatgaatt-tt--cattagc-cttatacgtata-gggga--aaaaaaatc--------------
B D                   Gorilla  tgtatttatgaatt-tt--cattagc-cttatacgtata-ggggg---aaaaaatc--------------
B D                 Orangutan  tgtatttatgactt-tt--cattagc-cttatacatatt-ggggg----gaaaatc--------------
B D                    Gibbon  tgtatttatgaatt-tt--cactaac-cttatatatatt-ggggg---aaaaaatc--------------
B D                    Rhesus  tgtatttatgaatt-tt--cattagc-cttatacatatt-ggagg---aaaaaatc--------------
B D       Crab-eating macaque  tgtatttatgaatt-tt--cattagc-cttatacatatt-ggagg---aaaaaatc--------------
B D                    Baboon  tgtatttatgaatt-tt--cattagc-cttatacatatt-ggagg---aaaaaatc--------------
B D              Green monkey  tgtatttatgactt-tt--cattagc-cttatacatatt-ggagg---aaaaaatc--------------
B D          Proboscis monkey  tgtatttatgaatt-tt--cattatc-cttatacatatt-ggagg---aaaaaatc--------------
B D  Golden snub-nosed monkey  tgtatttatgaatt-tt--cattatc-cttatacatatt-ggagg---aaaaaatc--------------
B D                  Marmoset  tgtgtttatgaatt-tt--tattagt-cttacacatatc-tgggc-aaaaaaaatc--------------
B D           Squirrel monkey  tgtatttatgaatt-tg--tattagt-cttacacatatc-tggacaaaaaaaaatc--------------
B D                   Tarsier  tgtgtttgtg-----------------ct---------------g-------------------------
B D               Mouse lemur  tgtttttatggttt-tt--tattagc-cttatacatgttgggaag---ggaaaatc--------------
B D                  Bushbaby  tg----------ta-tt--tattagc-cttatacatact-gcaag---agaaaatt--------------
B D                     Mouse  tatacttatatattata--tataaatacttgtatttatg-ggttt---aaaaaatcacatatatattcta
B D                       Dog  tatatttatgattt-tttgtattaac-cttatacatatt-gggaa--aagataatc--------------
B D                Tree shrew  ======================================================================

                        Human  --------aatagctgactg
                        Chimp  --------aatagctgactg
                       Bonobo  --------aatagctgactg
                      Gorilla  --------aatagctgactg
                    Orangutan  --------aatagtcgactg
                       Gibbon  --------agtagccgactg
                       Rhesus  --------aatagccgactg
          Crab-eating macaque  --------aatagccgactg
                       Baboon  --------aatagccgactg
                 Green monkey  --------aatagccgactg
             Proboscis monkey  --------aatagccgactg
     Golden snub-nosed monkey  --------aatagccgactg
                     Marmoset  --------aatagctgactg
              Squirrel monkey  --------aatagccgactg
                      Tarsier  ------------------tg
                  Mouse lemur  --------aatagctgactt
                     Bushbaby  --------aatagttgacta
                        Mouse  atatgaataatgacttcttg
                          Dog  --------aataacagattg
                   Tree shrew  ====================

Inserts between block 3 and 4 in window
B D              Mouse lemur 319bp
B D                 Bushbaby 2bp
B D                    Mouse 16bp
B D                      Dog 2bp

Alignment block 4 of 146 in window, 59296626 - 59296764, 139 bps 
B D                     Human  acttttag---------------------acgtccaaagacaaggaaaatttttg-aaa-----ttaag-
B D                     Chimp  acttttag---------------------acatccaaagacaaggaaaatttttg-aaa-----ttaag-
B D                    Bonobo  acttttag---------------------acgtccaaagacaaggaaaatttttg-aaa-----ttaag-
B D                   Gorilla  acttttag---------------------acgtccaaagacaaggaaaatttttg-aaa-----ttaag-
B D                 Orangutan  acttttag---------------------acttccaaagacaaggaaaatttttg-aaa-----ttaag-
B D                    Gibbon  acgtttag---------------------acttccaaagacaaggaaaatttttg-aaa-----ttaag-
B D                    Rhesus  ccttttag---------------------acttccaaagtcaagg-aaattgttg-aaa-----ttaag-
B D       Crab-eating macaque  ccttttag---------------------acttccaaagtcaagg-aaattgttg-aaa-----ttaagt
B D                    Baboon  ccttttag---------------------acttccaaagtcaaag-aaattgttg-aaa-----ttaag-
B D              Green monkey  ccttttag---------------------acttccaaagtcaagg-aaattgttg-aaa-----ttaag-
B D          Proboscis monkey  actttcag---------------------acttccaaagtcaagg-aaattgttg-aaa-----ttaag-
B D  Golden snub-nosed monkey  actttcag---------------------acttccaaagtcaagg-aaattgttg-aaa-----ttaag-
B D                  Marmoset  acttttag---------------------acttctaaagacatggaaaattgttgaaaa-----ttaag-
B D           Squirrel monkey  acttttag---------------------acttctaaagacatggaaaattgttgaaaa-----ttaag-
B D                   Tarsier  acttttac---------------------acttcaaaagacaagg-----atttg---a-----ttaag-
B D               Mouse lemur  acttttag---------------------acatcaaaagacaaag------tttt-gat-----tgaat-
B D                  Bushbaby  acttttag---------------------acttccaaagacaaag------tttc-aat-----tgaat-
B D                     Mouse  tcttgtagctttgtcaacagcatgttcctgctctgaaaggcaagcaagagtgttt-gtgacctttcaac-
B D                       Dog  actttaag---------------------acttcaaaagacaagg-atttgattg---a-----ttaag-
B D                Tree shrew  ======================================================================

                        Human  -atttt-ctt---ttc-----tgat---tctaaatgagtgttctgaa--------------cagagagca
                        Chimp  -atttt-ctt---ttc-----tgat---tctaaatgagtgttctgaa--------------cagagagca
                       Bonobo  -atttt-ctt---ttc-----tgat---tctaaatgagtgttctgaa--------------cagagagca
                      Gorilla  -atttt-ttt---ttc-----tgat---tctaaatgagtgttctgaa--------------cagagagca
                    Orangutan  -atttt--tt---ttc-----tgat---tctaaatgagtgttctgaa--------------cagagagca
                       Gibbon  -atttttttt---ttc-----tgat---tctaaatgagtgttctgaa--------------cagagagca
                       Rhesus  -atttttttt---ttc-----tgat---tctaaatgagtgttttgaa--------------cagagagca
          Crab-eating macaque  tttttttttt---ttc-----tgat---tctaaatgagtgttttgaa--------------cagagagca
                       Baboon  -atttttttt---ttc-----tgat---tctaaatgagtgttttgaa--------------cagagagca
                 Green monkey  -a-ttttctt---ttc-----tgat---tctaaatgagtgttttgaa--------------cagagagca
             Proboscis monkey  -atttttttt---ttc-----tgat---tctaaatgagtattttgaa--------------cagagagca
     Golden snub-nosed monkey  -atttttttt---ttc-----tgat---tctaaatgagtattttgaa--------------cagagagca
                     Marmoset  -attttttttt--ttc-----tgat---tctaaatgaatgttttgaa--------------cagagagca
              Squirrel monkey  -attttttttttcttc-----tgat---tctaaatgaatgttttgaa--------------cagagagta
                      Tarsier  -gcttttttt---tttttaaatgat---tctaaatgcatatt-tgaa--------------cagaaagca
                  Mouse lemur  -agattttttaaattg-----ttat---tctaaatgtgtattttgaa--------------cagagggca
                     Bushbaby  -gtattttttaaatta-----atat---tctaaatgcgtattttgaa--------------cagagagca
                        Mouse  -atttaaaga---cta-----ggat---tcaagagaaagaatttgaaaggtacctttctactagggaaca
                          Dog  -ggttttttt---ttt-----taatgagtct--atgattctgttgaa--------------gagagagca
                   Tree shrew  ======================================================================

                        Human  gcagacg-tatcatccgtaacttgagaccactaaatttacttctt---gagaa-tttgg
                        Chimp  gcagaca-tatcatccgtaacttgagaccactaaatttacttctt---gagaa-tttgg
                       Bonobo  gcagaca-tatcatccgtaacttgagaccactaaatttacttctt---gagaa-tttgg
                      Gorilla  gcagacg-tatcatccgtaacttgagaccactaaatttacttctt---gagaa-tttgg
                    Orangutan  gcagacg-tatcatccataacttgagaccactaaatttacttctt---gagaa-tttgg
                       Gibbon  gcagacg-tatcatccataacttgagaccactaaatttacttctt---gagaa-tttgg
                       Rhesus  gcagacg-tatcatccctaacttgagaccactaaatttacttctt---gagaa-tttgg
          Crab-eating macaque  gcagacg-tatcatccctaacttgagaccactaaatttacttctt---gagaa-tttgg
                       Baboon  gcagacg-tatcatccctaacttgagaccactaaatttacttctt---gagag-tttgg
                 Green monkey  gcagacgttatcatccctaacttgagaccactaaagttacttctt---gagaa-tttgg
             Proboscis monkey  gcagaca-tatcatccataacttgagaccactaaatttacttctt---gagaa-tttgg
     Golden snub-nosed monkey  gcagaca-tatcatccataacttgagaccactaaatttacttctt---gagaa-tttgg
                     Marmoset  gcagacg-tatcatccataacttgagaccactaaatttacttcta---gagaattttgg
              Squirrel monkey  gcagacg-tatcatccataacttgagaccactaaatttacttcta---gagaa-tttag
                      Tarsier  gcagatt-tatcatccatgacttgagaccacgaaatttacttctcccagagat-tttgt
                  Mouse lemur  gcagtct-tatcatccacaacccgagaccatgaaatttacttatcccagagaa-tttgg
                     Bushbaby  gcagatt-tatcaatcacaacctgagaccatgaacttttcttatctcagagaa-tttgt
                        Mouse  gcacaat-ttttacttacaacctacaaccatgccattacttttctccagagaa-cttgg
                          Dog  gcagat--tatcatccataacttgagaccactaagtttacttatcccagagaa-tttgg
                   Tree shrew  ===========================================================

Inserts between block 4 and 5 in window
B D                 Bushbaby 4bp

Alignment block 5 of 146 in window, 59296765 - 59296838, 74 bps 
B D                     Human  gg------tttctcttc--ca--------tttgtgggaagatccttaaaactcagagctgaatcttagct
B D                     Chimp  gg------tttctcttc--ca--------tttgtgggaagatccttaaaactcagagctgaatcttagct
B D                    Bonobo  gg------tttctcttc--ca--------tttgtgggaagatccttaaaactcagagctgaatcttagct
B D                   Gorilla  gg------tttctcttc--ca--------tttgtgggaagatccttaaaactcagagctgaatcttagct
B D                 Orangutan  gg------tttctcttc--ca--------tttgtgggaagatccttaaaactcagagctgaatcttagct
B D                    Gibbon  gg------tttctcttc--ca--------cttgtgggaagatccttaaaactcagagctgaatcttagct
B D                    Rhesus  gg------tttctcttc--ca--------tttgtgggaagatccttaaaactcagagcagaatcttagct
B D       Crab-eating macaque  gg------tttctcttc--ca--------tttgtgggaagatccttaaaactcagagcagaatcttagct
B D                    Baboon  gg------tttctcttc--ca--------tttgtgggaagatccttaaaactcagagcagaatcttagct
B D              Green monkey  gg------tttctcttc--ca--------tttgtgggaagatccttaaaactcagagctgaatcttagct
B D          Proboscis monkey  gg------tttctcttc--ca--------tttgtgggaagatccttaaaactcagagctgaatcttagct
B D  Golden snub-nosed monkey  gg------tttctcttc--ca--------tttgtgggaagatccttaaaactcagagctgaatcttagct
B D                  Marmoset  gg------tttctcttc--ga--------tttgtgggaagatccttaaaactcagagctgaatgttagct
B D           Squirrel monkey  gg------tttctcttt--ca--------tttgtgggaagatccttaaaactcagagctgaatgttagct
B D                   Tarsier  gg------ttactcttt--ca--------tatgtgggaagattcttaaatctcaaggttgactctttgct
B D                  Bushbaby  tt------ttttttttt--taattccatttttgtgggataatcctcaaagctcagggctaactcttagct
B D                     Mouse  ggaacacctttctctgcctca--------tttggggaaaaagttttaattctcctggct-----------
B D                       Dog  gg------tttcttttc--ca--------tttgtgggaagatcctcagagatcaaggctgaatcttggct
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Tree shrew  ======================================================================

                        Human  ttaagcataaacattagttc
                        Chimp  ttaagcataaacattagttc
                       Bonobo  ttaagcataaacattagttc
                      Gorilla  ttaagcataaacattagttc
                    Orangutan  ttaagcataaacattagttc
                       Gibbon  ttaagcataaacattagttc
                       Rhesus  ttaagcataaacattagttc
          Crab-eating macaque  ttaagcataaacattagttc
                       Baboon  ttaagcataaacattagttc
                 Green monkey  ttaagcataaacattagttc
             Proboscis monkey  ttaagcataaacattagttc
     Golden snub-nosed monkey  ttaagcataaacattagttc
                     Marmoset  ttaagcataaacgttagttc
              Squirrel monkey  ttaagcataaacattagttc
                      Tarsier  gtaagcgtaaacgttagttc
                     Bushbaby  ttaagcataaacatcagttc
                        Mouse  ----gcacaaacagaaggtt
                          Dog  ttaagcataaacattagttc
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNN
                   Tree shrew  ====================

Inserts between block 5 and 6 in window
B D                    Mouse 125bp

Alignment block 6 of 146 in window, 59296839 - 59296976, 138 bps 
B D                     Human  caaaatggttgtccatatgctatattggtatttacgttacatgatattatataacaaaactagcaaaccc
B D                     Chimp  caaaatggttgtccatatgctatattggtatttacgttgcatgatattatataacaaaactagcaaaccc
B D                    Bonobo  caaaatggttgtccatatgctatattggtatttacgttgcatgatattatataacaaaactagcaaaccc
B D                   Gorilla  caaaatggttgtccatatgctatattggtatttacattgcatgatattatataacaaaactagcaaaccc
B D                 Orangutan  caaaatggttgtccatatgctatattggtatttacattgcatgatattatataacaaaactagcaaaccc
B D                    Gibbon  caaaatggttgtccatatgctatattggtatttacattgcatgatattatataacaaaactagcaagccc
B D                    Rhesus  caaaatggttgtccatatgctatattggtatttacattgcatgatattatataacaaaactagcaaaccc
B D       Crab-eating macaque  caaaatggttgtccatatgctatattggtatttacattgcatgatattatataacaaaactagcaaaccc
B D                    Baboon  caaaatggttgtccatatgctatattggtatttacattgcatgatattatataacaaaactagcaaaccc
B D              Green monkey  caaaatggttgtccatatgctatattggtatttacattgcatgatattatataacaaaactagcaaaccc
B D          Proboscis monkey  caaaatggttgtccatatgctatattggtatttacattgcatgatattatataacaaaactagcaaaccc
B D  Golden snub-nosed monkey  caaaatggttgtccatatgctatattggtatttacattgcatgatattatataacaaaactagcaaaccc
B D                  Marmoset  caaaatggttgtccatatgctatattggtatttacattgcatgatattatataacaaaactagcaaaccc
B D           Squirrel monkey  caaaatggttgtccatatgctatattggtatttacattgcatgatattatataacaaaactagcaaaccc
B D                   Tarsier  caaaatcattatccataggctatattgatatttacattgcatgatattgtataacaaaaccagtaaacgc
B D                  Bushbaby  caaattggttgtacatatgctatattggta------tagcaaaatatggtat---------agcaagccc
B D                       Dog  cgaaatgatcgtccacatactctattggtatttacatcacatcatattatataccacaatcagcaaaccc
B D                     Mouse  ======================================================================
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Tree shrew  ======================================================================

                        Human  tgcaagttctggaacacacagatttg---aaaaaaaaaaaagcagtaaagttcggttcaaactcctacat
                        Chimp  tgcaagttctggaacacacagatttg---aaaaaaaaaaaagcagtaaagttcggttcaaactcctacat
                       Bonobo  tgcaagttctggaacacacagatttg-----aaaaaaaaaagcagtaaagttcggttcaaactcctacat
                      Gorilla  tgcaagttctggaacacacagatttg----gaaaaaaaaaagcagtaaagttcggttcaaactcctacat
                    Orangutan  tgcaagttctggaacacacagatttg-----aaaaaaaaaagcagtaaagttcggttcaaactcctacat
                       Gibbon  tgcaagttctggaacacacagatttg-----aaaaaaaaaagcagtaaagttcggctcaaactcctacat
                       Rhesus  tgcaagttctggaacacacagatttg-aaaaaaaaaaaaaagcagtaaagttcggttcaaactcctacat
          Crab-eating macaque  tgcaagttctggaacacacagatttg-----aaaaaaaaaagcagtaaagttcggttcaaactcctacat
                       Baboon  tgcaagttctggaacacacagatttg----aaaaaaaaaaagcagtaaagttcggttcaaactcctacat
                 Green monkey  tgcaagttctggaacacacagatttg-aaaaaaaaaaaaaagcagtaaagttcggttcaaactcctacat
             Proboscis monkey  tgcaagttctggaacacacagatttgaaaaaaaaaaaaaaagcagtaaagttcggttcaaactcctacat
     Golden snub-nosed monkey  tgcaagttctggaacacacagatttgaaaaaaaaaaaaaaagcagtaaagttcggttcaaactcctacat
                     Marmoset  tgcaagttctggaacacacagatttg---ggggaaaaaaaagcagtaaagtttggttcagactcctacat
              Squirrel monkey  tgcaagttctggaacacacagatttg---ggggaaaaaaaagcagtaaagtttggttcaaactcctacat
                      Tarsier  tgtaagttctcgaacacatggatttg-----gggaaaaaaaacagtcaagtttagctcaaactcccacat
                     Bushbaby  tgaaaattctggaacacacaaacttg---ggggaaaaaaaactgataaatttcaattcaaccctctacat
                          Dog  cagaaattctggaatacaaagactta--ctgaaaaaaataaacagtaaagtttagttcagactcctacat
                        Mouse  ======================================================================
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Tree shrew  ======================================================================

                        Human  g
                        Chimp  g
                       Bonobo  g
                      Gorilla  g
                    Orangutan  g
                       Gibbon  g
                       Rhesus  g
          Crab-eating macaque  g
                       Baboon  g
                 Green monkey  g
             Proboscis monkey  g
     Golden snub-nosed monkey  g
                     Marmoset  g
              Squirrel monkey  g
                      Tarsier  g
                     Bushbaby  g
                          Dog  g
                        Mouse  =
                  Mouse lemur  N
                   Tree shrew  =

Alignment block 7 of 146 in window, 59296977 - 59297299, 323 bps 
B D                     Human  tgttatactttt----------------------g--ag-------------------------------
B D                     Chimp  tgttatactttt----------------------g--ag-------------------------------
B D                    Bonobo  tgttatactttt----------------------a--ag-------------------------------
B D                   Gorilla  tgttatactttt----------------------g--ag-------------------------------
B D                 Orangutan  tgttatactttt----------------------g--ag-------------------------------
B D                    Gibbon  tgttatactttt----------------------g--ag-------------------------------
B D                    Rhesus  tgttatactttt----------------------g--ag-------------------------------
B D       Crab-eating macaque  tgttatactttt----------------------g--ag-------------------------------
B D                    Baboon  tgttatactttt----------------------g--ag-------------------------------
B D              Green monkey  tgttatactttt----------------------g--ag-------------------------------
B D          Proboscis monkey  tgttatactttt----------------------g--ag-------------------------------
B D  Golden snub-nosed monkey  tgttatactttt----------------------g--ag-------------------------------
B D                  Marmoset  tgttatactttt----------------------g--ag-------------------------------
B D           Squirrel monkey  tgttatactttt----------------------g--ag-------------------------------
B D                   Tarsier  cattatactttt----------------------c--ag-------------------------------
B D                  Bushbaby  cattatactttttttttctttattaaatcataaag--aggtagatcatgtatacattaatgcatttacag
B D                     Mouse  tatgacacttca----------------------ggtac-------------------------------
B D                       Dog  tattatactttt----------------------a--aa-------------------------------
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Tree shrew  ======================================================================

                        Human  --------------------------------------------------------------tttgccat
                        Chimp  --------------------------------------------------------------tttgccat
                       Bonobo  --------------------------------------------------------------tttgccat
                      Gorilla  --------------------------------------------------------------tttgccat
                    Orangutan  --------------------------------------------------------------tttgccat
                       Gibbon  --------------------------------------------------------------tttgccat
                       Rhesus  --------------------------------------------------------------tttgccat
          Crab-eating macaque  --------------------------------------------------------------tttgccat
                       Baboon  --------------------------------------------------------------tttgccat
                 Green monkey  --------------------------------------------------------------tttgccat
             Proboscis monkey  --------------------------------------------------------------tttgccat
     Golden snub-nosed monkey  --------------------------------------------------------------tttgccat
                     Marmoset  --------------------------------------------------------------tttgccgt
              Squirrel monkey  --------------------------------------------------------------tttgccat
                      Tarsier  --------------------------------------------------------------tttgccat
                     Bushbaby  ggtacaatgtgctgatttcatatacaatttagaatgcttacatcttattggttaatatttcccttgccat
                        Mouse  --------------------------------------------------------------gttgccac
                          Dog  --------------------------------------------------------------tttgccat
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Tree shrew  ======================================================================

                        Human  cacagtatgact-aaaggaaaaagttatttgactggagtttaga-cagcagc-tttttgaggaaagggac
                        Chimp  cacagtatgact-aaaggaaaaagttatttgactggagtttaga-cagcagc-tttttgaggaaagggac
                       Bonobo  cacagtatgact-aaaggaaaaagttatttgactggagtttaga-cagcagc-tttttgaggaaagggac
                      Gorilla  cacagtatgact-aaaggaaaaagttatttgactggagtttaga-cagcagc-tttttgaggaaagggtc
                    Orangutan  cacagtatgact-aaaggaaaaagttatttgactggagtttaga-cagcagc-tttttgaggaaagggac
                       Gibbon  cacagtatgact-aaaggaaaaagctatttgactggagattaga-cagcagc-tttttgaggaaagggac
                       Rhesus  cacagtatgact-aaaggaaaaaattatttggctggagtttaga-cagtagcttttttgaggaaagggac
          Crab-eating macaque  cacagtatgact-aaaggaaaaaattatttggctggagtttaga-cagtagcttttttgaggaaagggac
                       Baboon  cacagtatgact-aaaggaaaaaattatttggctggagtttaga-cagtagcttttttgaggaaagggac
                 Green monkey  cacagtatgact-aaaggaaaaaattatttggctggagtttaga-cagtagcttttttgaggaaagggac
             Proboscis monkey  cacagtatgact-aaaggaaaaagttatttggctggagtttaga-tagcagcttttttgaggaaagggac
     Golden snub-nosed monkey  cacagtatgact-aaaggaaaaagttatttggctggagtttaga-tagcagcttttttgaggaaagggac
                     Marmoset  cacagtatgact-aaaggaaaaagttatttggctggagtttaga-cagcagc-tttttgaggaaagggac
              Squirrel monkey  cacagtatgact-aaaggaaaaagttatttggctggagtttaga-cggcagc-tttttgaggaaagggac
                      Tarsier  cacaatacaactaaaaggggtaagttctttggctggagtttagt-ctgcagc-tgtttgaaggaagggac
                     Bushbaby  cacagtaagact-aaaggggaaagttctgtggctggcatttaga-ccaaaac-tccttgagggaagggac
                        Mouse  ca-aacatggct--aagaagaaagttctatatgtaggagttaga-gcttgac-ctctctagagaaaggac
                          Dog  cacagtgtgacttaaaaaaaaaaaatcttcggctgcagtttagattatcagt-tccttgagggaagggac
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Tree shrew  ======================================================================

                        Human  cctgtttcattcattcccagcag---------t----aaaacctggt-ggtactcaataaatattttctg
                        Chimp  cctgtttcattcattcccagcag---------t----aaaacctggt-ggtactcaataaatattttctg
                       Bonobo  cctgcttcattcattcccagcag---------t----aaaacctggt-ggtactcaataaatattttctg
                      Gorilla  cctgtttcattcattcccagcag---------t----aaaacctggt-ggtactcaataaatattttctg
                    Orangutan  cctgttttattcattcccagcag---------t----aaaacctggt-ggtactcaagaaatattttctg
                       Gibbon  cctgttttattcatttgcagcag---------t----aaaacctggt-ggtactcaaaaaatattttctg
                       Rhesus  cctgttttattcattcccagcag---------t----gaaacctggt-ggtactcaataaatattttctg
          Crab-eating macaque  cctgttttattcattcccagcag---------t----gaaacctggt-ggtactcaataaatattttctg
                       Baboon  cctgttttattcattcctagcag---------t----gaaacctggt-ggtactcaataaatattttctg
                 Green monkey  cctgttttattcattcccagcag---------t----gaaacctggt-ggtactcaataaatattttctg
             Proboscis monkey  cctgttttattcattcccagcag---------t----gaaacctggt-ggtactcaataaatattttctg
     Golden snub-nosed monkey  cctgttttattcattcccagcag---------t----gaaacctggt-ggtactcaataaatattttctg
                     Marmoset  cctgttttattcattcccagcag---------t----aaaacctggtgggtactcaataaatgttttctg
              Squirrel monkey  cctgttttattcattcccagcag---------t----aaaacctggtgggtactcaataaatgttttctg
                      Tarsier  ------tcattcgatccatgcagactgtctaaa----aaaacctagtgggtgatccataaatattttctg
                     Bushbaby  cacattttattcattccccagag---------tgttaaaaacctactgggtcctcaatacatat----tg
                        Mouse  ctcatcttattccaccccagcac---------tgactgaaagcttgg-agtact----agacattttct-
                          Dog  cctacct-gttcactcccagcacagcgcc---t----gatatctagaaggtactcagtaagca-----ta
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Tree shrew  ======================================================================

                        Human  aattgatgaattaatggccatgttaa-taagacacttatgatcattgaggctccaaaggctgtagcatgt
                        Chimp  aattgatgaattaatggccatgttaa-taagacacttatgatcattgaggctccaaaggctgtagcatgt
                       Bonobo  aattgatgaattaatggccatgttaa-taagacacttatgatcattgaggctccaaaggctgtagcatgt
                      Gorilla  aattgatgaattaatggccatgttaa-taagacacttatgatcattgaggctccaaaggctgtagcatgt
                    Orangutan  aatggatgaattaatggctatgttaa-taagacacttatgatcattgaggctccaaaggctgtagcatgt
                       Gibbon  aatggatgaattaatggctatgttga-taagacacttatgatcattgaggctccaaaggctgtagcatgt
                       Rhesus  aatggatgaattaatggctatgttaa-taagacatttgtggtcattgagggtccaaaggctctagcatgt
          Crab-eating macaque  aatggatgaattaatggctatgttaa-taagacatttgtggtcattgagggtccaaaggctctagcatgt
                       Baboon  aatggatgaattaatggctatgttaa-taagacatttgtggtcattgagggtccaaaggctctagcatgt
                 Green monkey  aatggatgaattaatggctatgttaa-taagacatttgtggtcattgagggtccaaaggctctagcatgt
             Proboscis monkey  aatggatgaattaatggctatgttaa-taagacatttgtgatcattgagggtccaaaggctctagcatgt
     Golden snub-nosed monkey  aatggatgaattaatggctatgttaa-taagacatttgtgatcattgagggtccaaaggctctagcatgt
                     Marmoset  aatggatgaattattggctatgttaa-------------------tgaggctccaaaggctctagcatgt
              Squirrel monkey  aatgaatgaattaatggctatgttaa-taagactcttatgatcattgaagctccaaaggctctagcatgt
                      Tarsier  aatagatgaattaatgactacattaa-taagacacttgcaatcgttgaggctccaaaggtgttagcacat
                     Bushbaby  aattgattaattaatggctgtgttagttaagtgctttgtgatcactgag--tccagaggccctagcgtgt
                        Mouse  ---------ataactggctgtgttac-------acctatgttagc--agcctccaaaggctcacacaaat
                          Dog  aatggatgaattcatggctgtgataa-agagatgcttgtgattggtgaggctcgaaaggccttggcacct
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Tree shrew  ======================================================================

                        Human  cccaaactcagatacggtgggggaactccaggtgc-------agcttttcatgggg-aact---------
                        Chimp  cccaaactcagatgcggtgggggaactccaggtgc-------agcttttcatgggg-aact---------
                       Bonobo  cccaaactcagatgcggtgggggaactccaggtgc-------agcttttcatgggg-aact---------
                      Gorilla  cccaaactcagatacggtgggggaactccaggtgc-------agcttttcatgggg-aact---------
                    Orangutan  cccaaactcagatatgatgggggaactccaggtgc-------agcttttcatgggg-aact---------
                       Gibbon  cccaaactcagatgcagtgggggagctccaggtgc-------agcttttcatgggg-aact---------
                       Rhesus  cccaaactcagatatggtgggggagctccaggtgc-------agcttttcatgggg-aact---------
          Crab-eating macaque  cccaaactcagatatggtgggggagctccaggtgc-------agcttttcatgggg-aact---------
                       Baboon  cccaaactcagatatggtgggggagctccaggtgc-------agcttttcatggag-aact---------
                 Green monkey  cccaaactcagatatggtgggagagctccaggtgc-------agcttttcatgggg-aact---------
             Proboscis monkey  cccaaactcagatatggtgggggagctccaggtgc-------agcttttcatgggg-aact---------
     Golden snub-nosed monkey  cccaaactcagatatggtgggggagctccaggtgc-------agcttttcatgggg-aact---------
                     Marmoset  ccctaactcagatgtggtgggggagctccagattc-------agcttttcatggggaaact---------
              Squirrel monkey  ccccaactcagatatgacggggggactccagattc-------agcttttcatggggaaact---------
                      Tarsier  cccaaacacaaatatggtgggagagctgtagacat-------cgcttttcgtaggg-aact---------
                     Bushbaby  cccaaacatgagcac-atgggagatttctagttacttaatggggtacataatgggg-aattattacactt
                        Mouse  cacacattcaaacgaga-------------------------agctttccagagag-agct---------
                          Dog  cccgtacccaaatatggtgggagggttcc--ttac-------tccatttccaggag-ggct---------
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Tree shrew  ======================================================================

                        Human  -------------ctcacg------atgctagaagtcaatgaagcatatttattcatgcctgtttcaggg
                        Chimp  -------------ctcacg------atgctagaagtcaatgaagcatatttattcatgcctgtttcaggg
                       Bonobo  -------------ctcacg------atgctagaagtcaatgaagcatatttattcatgcctgtttcaggg
                      Gorilla  -------------ctcacg------atgctagaagtcaatgaagcatatttattcatgcttgtttcaggg
                    Orangutan  -------------ctcacg------atgctagaagtcaatgaagcatatttattcatacctgtttcaggg
                       Gibbon  -------------ctcacg------atgctagaagtcaatgaagcatatttattcatgcctgtttcaggg
                       Rhesus  -------------ctcatg------atgctagaagtcaatgaagcatatttattcatgcctgtttcaggg
          Crab-eating macaque  -------------ctcatg------atgctagaagtcaatgaagcatatttattcatgcctgtttcaggg
                       Baboon  -------------ctcatg------atgctagaagtcaatgaagcatatttattcatgcctgtttcaggg
                 Green monkey  -------------ctcatg------atgctagaagtcaatgaagcatatttattcatgcctgtttcaggg
             Proboscis monkey  -------------ctcatg------atgctagaagtcaatgaagcatatttattcatgcctgtttcaggg
     Golden snub-nosed monkey  -------------cgcatg------atgctagaagtcaatgaagcatatttattcatgcctgtttcaggg
                     Marmoset  -------------ctcatg------aagctagaagtcaatgaagcatatgt-ctcatgcctggttcaggg
              Squirrel monkey  -------------ctcaca------atgctagaagtcagtgaagcgtatgt-gtcatgcctgtttcaggg
                      Tarsier  -------------cccaag------atgctagatgccaacaaagcattttaaattattccttttctagag
                     Bushbaby  gtccttggcataactcacgtccagcatgttaaaaatcaagaaagcacttttcattatgtctgtttcagag
                        Mouse  -------------gccaga------aagctgaatgccaataaaatgcttttgttggt---catttcagag
                          Dog  -------------tctgtg------atgctggaagccaaggagacattcctattacatcctgtttctgag
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Tree shrew  ======================================================================

                        Human  tggg
                        Chimp  tggg
                       Bonobo  tggg
                      Gorilla  tggg
                    Orangutan  tggg
                       Gibbon  tggg
                       Rhesus  tagg
          Crab-eating macaque  tagg
                       Baboon  tagg
                 Green monkey  tagg
             Proboscis monkey  tggg
     Golden snub-nosed monkey  tggg
                     Marmoset  cagg
              Squirrel monkey  cagg
                      Tarsier  cagg
                     Bushbaby  gatg
                        Mouse  tggt
                          Dog  cggg
                  Mouse lemur  NNNN
                   Tree shrew  ====

Alignment block 8 of 146 in window, 59297300 - 59297399, 100 bps 
B D                     Human  cattgcaaaaaccacatcagggaaatgtcagt----agctgctgttatttcgaagctaggaattcatgg-
B D                     Chimp  cattgcaaaaaccacatcagggaaatgtcagt----agctgctgttatttcgaagctaggaattcatgg-
B D                    Bonobo  cattgcaaaaaccacatcagggaaatgtcagt----agctgctgttatttcgaagctaggaattcatgg-
B D                   Gorilla  cattgcaaaaaccacatcagggaaatgtcagt----agctgctgttatttcgaaactaggaattcatgg-
B D                 Orangutan  cattgcaaaaactacatcagggaaatgtcagt----agctgctgttatttcgaaactaggaattcatgg-
B D                    Gibbon  cattgcaaaaaccacatcagggaaatggcagt----agctgctgttatttcaaaactaggaattcatgg-
B D                    Rhesus  cattgcaaaaatcacatcagggaaacggcagt----agctgctgttatttcgaaactaggaattcatgg-
B D       Crab-eating macaque  cattgcaaaaatcacatcagggaaacggcagt----agctgctgttatttcgaaactaggaattcatgg-
B D                    Baboon  cattgcaaaaatcacatcagggaaacggcagt----agctgctgttatttcgaaactaggaattcatgg-
B D              Green monkey  cattgcaaaaatcacatcagggaaatggcagt----agctgctgttatttcgaaactaggaattcatgg-
B D          Proboscis monkey  cattgcaaaaatcacatcagggaaatggcagt----agctgctgttatttcgaaactaggaattcatgg-
B D  Golden snub-nosed monkey  cattgcaaaaatcacatcagggaaatggcagt----agctgctgttatttcgaaactaggaattcatgg-
B D                  Marmoset  cactgcaaaagccatatcagggaaa----------------ctgttatttcaaaattaggaattcatgac
B D           Squirrel monkey  cactgcaaaaactgcatcagggaaatagtagt----agctgctgttatttcaaaattaggaattcatggc
B D                   Tarsier  cat---agaactcacagcaggaaaatggcagt----agttggtgttattttaaaactaggaatttatggc
B D                  Bushbaby  cataacaaaactcacatcagggagatagcagt----agttgctgtgattctgaaactaggatttcatggc
B D                Tree shrew  cacagtgagactcgcaccaagga-atggcggt----agttgctattagtttggaagtaggaattaatgat
B D                     Mouse  cacagggaaactccaat--gggaaacagtggtgggcagaggctaccacactgagagaaaacattcatgg-
B D                       Dog  cataacaaaactc-catcaggggcttagcagt----agttgccattcttttgaaaggagacatccatggc
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  agatttctaggtatggtttgaactttaggact-----ttt
                        Chimp  agatttctaggtatggtttgaactttaggact-----ttt
                       Bonobo  agatttctaggtatggtttgaactttaggact-----ttt
                      Gorilla  agatttctaggtatggtttgaactttaggact-----ttt
                    Orangutan  agatttctaggtatggtttgaacttcaggact-----ttt
                       Gibbon  agatttctaggtatggtttgaactttaggact-----ttt
                       Rhesus  agatttctaggtatggtttgaactttaggact-----ttt
          Crab-eating macaque  agatttctaggtatggtttgaactttaggact-----ttt
                       Baboon  agatttctaggtatggtttgaactttaggact-----ttt
                 Green monkey  agatttctagttatggtttgaactttaggact-----ttt
             Proboscis monkey  agatttctaggtatggtttgaactttaggact-----ttt
     Golden snub-nosed monkey  agatttctaggtatggtttgaactttaggact-----ttt
                     Marmoset  agatttctaagtatagtttgaactttagagc------ttc
              Squirrel monkey  agatttctaagtatggtttgaactttaggact-----ttt
                      Tarsier  aaatttctacatatggtttggacttcag-act-----ttt
                     Bushbaby  agatttctacgtatagtttggacttccaggc------att
                   Tree shrew  gggtttctgcatatggtttgaattttaggactatctactt
                        Mouse  tgacttttggcattcagttgggatttcagact-----ttt
                          Dog  ctgtttgtgcatctggtttggattttaggact-----ttt
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 9 of 146 in window, 59297400 - 59297425, 26 bps 
B D                     Human  t---tgtttcaatt--atatattgtttaaaa
B D                     Chimp  t---tgtttcaatt--atatattgtttaaaa
B D                    Bonobo  t---tgtttcaatt--atatattgtttaaaa
B D                   Gorilla  t---tgtttcaatt--atatattgtttaaaa
B D                 Orangutan  t---tgtttcaatt--atatattgtttaaaa
B D                    Gibbon  t---tgtttcaatt--atatattgtttaaaa
B D                    Rhesus  t---tgtttcaatt--atatattgtttaaaa
B D       Crab-eating macaque  t---tgtttcaatt--atatattgtttaaaa
B D                    Baboon  t---tgtttcaatt--atatattgtttaaaa
B D              Green monkey  t---tgtttcaatt--atatattgtttaaaa
B D          Proboscis monkey  t---tgtttcaatt--atatattgtttaaaa
B D  Golden snub-nosed monkey  t---tgtttcaatt--atatattgtttaaaa
B D                  Marmoset  t---tgtttcaatt--atatattctttaaaa
B D           Squirrel monkey  t---tgtttcaatt--atatattctttaaaa
B D                   Tarsier  taaaaatttcaatg--atatattcttttaaa
B D                  Bushbaby  t---tgttttgatt--atatagtctattaaa
B D                Tree shrew  c---tgtctcagtctgttattttgttagaaa
B D                       Dog  -------------------------ggaaaa
B D                     Mouse  -------------------------------
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 9 and 10 in window
B D               Tree shrew 642bp

Alignment block 10 of 146 in window, 59297426 - 59297459, 34 bps 
B D                     Human  ttctatcta----tctatct------atctatctatctatcta---------------------------
B D                     Chimp  t-ctatcta----tctatct------atctatctatctatcta---------------------------
B D                    Bonobo  t-ctatcta----tctatct------atctatctatctatcta---------------------------
B D                   Gorilla  t-ctatcta----tctatct------atctatctatctatcta---------------------------
B D                 Orangutan  t-ctatcta----tctatct------atctatctatctatcta---------------------------
B D                    Gibbon  t-ctatctg----tctatct------atctatctatctatcc----------------------------
B D                    Rhesus  t-gtatctata--tctatc-------atctatgtatctgtttaaaa------------------------
B D       Crab-eating macaque  t-gtatctata--tctatc-------atctatgtatctgtttaaaa------------------------
B D                    Baboon  t-gtatcta-------------------------------------------------------------
B D              Green monkey  t-gtatctata--tctatc-------atctatgtatctgtttaaaa------------------------
B D          Proboscis monkey  t-gtatctata--tctatc-------atctatgtatctgtttaaaa------------------------
B D  Golden snub-nosed monkey  t-gtatctata--tctatc-------atctatctatctctttaaaa------------------------
B D                  Marmoset  t-atgtctctatctctatca------atcaatca------------------------------------
B D           Squirrel monkey  t-atgtctctatatctatca------atcaatcaatctatctatgaatgactcaaggtctgtctatctat
B D                  Bushbaby  a-ttatttttaaatcgatacactgtaattgtcttatctat------------------------------
B D                       Dog  ------------tcct------------------------------------------------------
B D                     Mouse  ----------------------------------------------------------------------
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Tree shrew  ======================================================================
B D                   Tarsier  ----------------------------------------------------------------------

                        Human  ---------------t
                        Chimp  ---------------t
                       Bonobo  ---------------t
                      Gorilla  ---------------t
                    Orangutan  ---------------t
                       Gibbon  ---------------t
                       Rhesus  ---------tgtatct
          Crab-eating macaque  ---------tgtatct
                       Baboon  ----------------
                 Green monkey  ---------tgtatct
             Proboscis monkey  ---------tgtatct
     Golden snub-nosed monkey  ---------tgtatct
                     Marmoset  --------------at
              Squirrel monkey  ttatctatctatctat
                     Bushbaby  ----------------
                          Dog  ----------------
                        Mouse  ----------------
                  Mouse lemur  NNNNNNNNNNNNNNNN
                   Tree shrew  ================
                      Tarsier  ----------------

Inserts between block 10 and 11 in window
B D                 Bushbaby 258bp

Alignment block 11 of 146 in window, 59297460 - 59297466, 7 bps 
B D                     Human  ctatcta
B D                     Chimp  ctatcta
B D                    Bonobo  ctatcta
B D                   Gorilla  ctatcta
B D                 Orangutan  ctatcct
B D                    Gibbon  ctatgta
B D                    Rhesus  gtatcta
B D       Crab-eating macaque  gtatcta
B D                    Baboon  -tatcta
B D              Green monkey  gtatcta
B D          Proboscis monkey  gtatcta
B D  Golden snub-nosed monkey  gtatcta
B D                  Marmoset  caatcaa
B D           Squirrel monkey  ctatcta
B D                     Mouse  -------
B D                       Dog  -------
B D               Mouse lemur  NNNNNNN
B D                  Bushbaby  =======
B D                Tree shrew  =======
B D                   Tarsier  -------

Inserts between block 11 and 12 in window
B D                 Marmoset 21bp
B D          Squirrel monkey 8bp

Alignment block 12 of 146 in window, 59297467 - 59297496, 30 bps 
B D                     Human  tcctctatg------------------tatctatgtatccatgtgtct
B D                     Chimp  tcctctatg------------------tatctatgtatccatgtgtct
B D                    Bonobo  tcctctatg------------------tatctatgtatccatgtgtct
B D                   Gorilla  tcctctatg------------------tatctatgtatccatgtgtct
B D                 Orangutan  ctatgtatc------------------tatctatgtatccatgtgtct
B D                    Gibbon  tc-------------------------tatctatgtatccatgtgtct
B D                    Rhesus  tcatctatg--------------tatctatctatgtatccttgtgtct
B D       Crab-eating macaque  tcatctatg--------------tatctatctatgtatccttgtgtct
B D                    Baboon  tcatctatg--------------tatctatctatgtatccttgtgtct
B D              Green monkey  tcatctatg--------------tatctatctatgtatccttgtgtct
B D          Proboscis monkey  tcatctatg--------------tatctatctatgtatccttgtgtct
B D  Golden snub-nosed monkey  tcatctatg--------------tatctatctatgtatccttgtgtct
B D           Squirrel monkey  ---tctatgaatgactcaagatctgtctatctatctatctatctatct
B D                   Tarsier  ------------------------------------a-----------
B D                     Mouse  ------------------------------------------------
B D                       Dog  ------------------------------------------------
B D                  Marmoset  ================================================
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Bushbaby  ================================================
B D                Tree shrew  ================================================

Inserts between block 12 and 13 in window
B D          Squirrel monkey 4bp
B D                  Tarsier 4bp

Alignment block 13 of 146 in window, 59297497 - 59297557, 61 bps 
B D                     Human  atctatctatctatct----atgaatgacccaagatattatttgacccaatgtaattgtacatgt-
B D                     Chimp  atctatctat------------gaatgacccaagatattatttgacccaatgtaattgtacatgt-
B D                    Bonobo  atctatctat------------gaatgacccaagatattatttgacccaatgtaattgtacatgt-
B D                   Gorilla  atctatctat----ct----atgaatgacccaagatattatttgacccaatgtcattgtacatgt-
B D                 Orangutan  atctatctat------------gaatgacccaagatattatttgacccagtgtaattgtacatgt-
B D                    Gibbon  atctatctat----ct----atgaatgacccaagatattatttgacccagtgtaat------tgt-
B D                    Rhesus  atctatctat----ct----atgaatgacccaaggtattatttgacccaatgtaattgtacatgt-
B D       Crab-eating macaque  atctatctat----ct----atgaatgacccaaggtattatttgacccaatgtaattgtacatgt-
B D                    Baboon  atctatctat----ct----atgaatgacccaaggtattatttgacccaatgtaattgtacatgt-
B D              Green monkey  atctatctat----ct----atgaatgacccaaggtattatttgacccaatgtaattgtacatgt-
B D          Proboscis monkey  atctatctat----ct----atgaataacccaaggtattatttcacccaatgtaattgtacatgt-
B D  Golden snub-nosed monkey  atctatctat----ct----atgaataacccaaggtattatttcacccaatgtaattgtacatgt-
B D                  Marmoset  atctatctgt----ct----atgactgacccaaggtattatttgacccaatgtaattgtacatgt-
B D           Squirrel monkey  atccatctat----ctatgaatgactgacccaaggtatcatttgacccaatgtaattgtacatgt-
B D                   Tarsier  agttatttat----tt----ttaaa----------------ttgacacaatataatcatacgtct-
B D                       Dog  --------------------------------------------------------tgctcacgaa
B D                     Mouse  ------------------------------------------------------------------
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Bushbaby  ==================================================================
B D                Tree shrew  ==================================================================

Alignment block 14 of 146 in window, 59297558 - 59297569, 12 bps 
B D                     Human  ctacaggttaca
B D                     Chimp  ctacaggttaca
B D                    Bonobo  ctacaggttaca
B D                   Gorilla  ctacaggttaca
B D                 Orangutan  ctacagggtaca
B D                    Gibbon  ctacagggtaca
B D                    Rhesus  ctacagggtaca
B D       Crab-eating macaque  ctacagggtaca
B D                    Baboon  ctacagggtaca
B D              Green monkey  ctacagggtaca
B D          Proboscis monkey  ctacagggtaca
B D  Golden snub-nosed monkey  ctacagggtaca
B D                  Marmoset  cta-aggggacc
B D           Squirrel monkey  cta-agggaaca
B D                   Tarsier  ctatgggttgca
B D                  Bushbaby  ctgcggcctccc
B D                     Mouse  ------------
B D                       Dog  ------------
B D               Mouse lemur  NNNNNNNNNNNN
B D                Tree shrew  ============

Alignment block 15 of 146 in window, 59297570 - 59297581, 12 bps 
B D                     Human  ggaattttagga
B D                     Chimp  ggaattttagga
B D                    Bonobo  ggaattttagga
B D                   Gorilla  ggaattttagga
B D                 Orangutan  gggattttagga
B D                    Gibbon  ggaattttagga
B D                    Rhesus  ggaattttagga
B D       Crab-eating macaque  ggaattttagga
B D                    Baboon  ggaattttagga
B D              Green monkey  ggaattttagga
B D          Proboscis monkey  ggaattttagga
B D  Golden snub-nosed monkey  ggaattttagga
B D                  Marmoset  gaatttttagga
B D           Squirrel monkey  ggatttttagga
B D                   Tarsier  gaaa-tttagga
B D                  Bushbaby  agagtgctagga
B D                     Mouse  ggaaggc-----
B D                       Dog  ------------
B D               Mouse lemur  NNNNNNNNNNNN
B D                Tree shrew  ============

Inserts between block 15 and 16 in window
B D                  Tarsier 646bp

Alignment block 16 of 146 in window, 59297582 - 59297582, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                    Bonobo  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D          Proboscis monkey  t
B D  Golden snub-nosed monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
B D                     Mouse  t
B D                       Dog  -
B D               Mouse lemur  N
B D                Tree shrew  =
B D                   Tarsier  =

Inserts between block 16 and 17 in window
B D                 Bushbaby 23bp

Alignment block 17 of 146 in window, 59297583 - 59297603, 21 bps 
B D                     Human  ttttggaacggc-cttt--------------tc--------------tac
B D                     Chimp  ttttggaacggc-cttt--------------tc--------------tac
B D                    Bonobo  ttttggaacggc-cttt--------------tc--------------tac
B D                   Gorilla  ttttggaacggc-cttt--------------tc--------------tac
B D                 Orangutan  ttttggaatggc-cttt--------------tc--------------tac
B D                    Gibbon  ttttggaacagc-cttt--------------tc--------------tac
B D                    Rhesus  ttttggaatagc-cctt--------------tc--------------tac
B D       Crab-eating macaque  ttttggaacagc-cttt--------------tc--------------tac
B D                    Baboon  ttttggaacagc-cttt--------------tc--------------tac
B D              Green monkey  ttttggaacagc-cttt--------------tc--------------tac
B D          Proboscis monkey  ttttggaacagc-cttt--------------tc--------------tat
B D  Golden snub-nosed monkey  ttttggaacagc-cttt--------------tc--------------tat
B D                  Marmoset  ctttggaacagt-cttt--------------tc--------------tac
B D           Squirrel monkey  ctttgaaacaat-gttt--------------tc--------------tac
B D                   Tarsier  ttttggaagact-cttt--------------tctaaagatgattatttat
B D                  Bushbaby  ggctggaagaga-ctttgccacaagtgagtatc--------------cac
B D                     Mouse  tttctccacagtggttt--------------tc--------------tgt
B D                       Dog  ---------ggc-catc--------------tc--------------c--
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Tree shrew  ==================================================

Alignment block 18 of 146 in window, 59297604 - 59297740, 137 bps 
B D                     Human  ctccctcaggatgattccagcatgctacagaagagcctgagaactaaggtcccgaatctgttaaaatgtg
B D                     Chimp  ctccctcaggatgattccagcatgctacagaagagcctgagaactaaggtcccgaatctgttaaaatgtg
B D                    Bonobo  ctccctcaggatgattccagcatgctacagaagagcctgagaactaaggtcccgaatctgttaaaatgtg
B D                   Gorilla  ctccctcaggatgattccagcatgctacagaagagcctgagaactaaggtcccgaatctgttaaaatgtg
B D                 Orangutan  ctccctcaggatgattccagcatgctacagaagagcctgagaactaa-gtcccgaatctgttaaaatgtg
B D                    Gibbon  ctccctcaggatgattccagcatgctacagaagagcctgagaactaaggtcccgaatctgttaaaatgtg
B D                    Rhesus  ctccctcaggatgattacaacatgctacagaagagcctgagaactaagatcccaagtctgttaaaatgtg
B D       Crab-eating macaque  ctccctcaggatgattacaacatgctacagaagagcctgagaactaagatcccaagtctgttaaaatgtg
B D                    Baboon  ctccctcaggatgattacaacatgctacagaagagcttgagaactaagatcccaagtttgttaaaatgtg
B D              Green monkey  ctccctcaggatgattacaacatgctacagaagagcctgagaactaagatcccaagtctgttaaaatgtg
B D          Proboscis monkey  ctccctcaggatgattacaacatgctacagaaaagcctgagaactaagatcccaagtctgttaaaatgtg
B D  Golden snub-nosed monkey  ctccctcaggatgattacaacatgctacagaagaacctgagaactaagatcccaagtctgttaaaatgtg
B D                  Marmoset  ctccttcaggatgactccagcatgctacagaagagcctgagaactaaggtcctgagcctgttgcaatgtg
B D           Squirrel monkey  ctcctttaggatgactccagcatgctacagaagagcctgagaactaagatcctgagcctgttgaaatgtg
B D                   Tarsier  ctccctcaggatgactccagaatgctacaaaagagcctgagaattaagatccccaatctgttaaaatgca
B D                  Bushbaby  ctccctcagggggttaccaaaattccacaggagagcctaagaactgaggtgctgagcctgttaaaatgc-
B D                Tree shrew  cctcctcaggatgattaca--attctacagaagagcctgagaactaaggtcctgaacctgttaaaatgca
B D                     Mouse  tcctattaggatgaccccagcactctacaaaatatccttagagctcagatggccagcctattaaaatgca
B D                       Dog  ctccctcgagctgaccgcagaattctacaggagagcctgaagactaaggccatgaccctggtacagtgca
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  agtatcctggggatggttgtcagccaacaccct-agcacccatagcatcct-gacaacaattaaaatgt
                        Chimp  agtatcctggggatggttgtcagccaacaccct-agcacccatagcatcct-gacaacaataaaaatgt
                       Bonobo  agtatcctggggatggttgtcagccaacaccct-agcacccatagcatcct-gacaacaataaaaatgt
                      Gorilla  agtatcctggggatggttgtcagccaacaccctaagcacccatagcatcct-gacaacaataaaaatgt
                    Orangutan  agtatcctggggatggttgtcagtcaacaccctaagcacccatagcatctt-gacaacaataaaaatgt
                       Gibbon  agtatcctgg----gcttgtcagccaacaccctaagcacctatagcatctt-gacaacaataaaaatgt
                       Rhesus  agtatcctggggatggttgacacccaacaccctaagcacccagagaatctt-gacaacaataaaaatgt
          Crab-eating macaque  agtatcctggggatggttgacacccaacaccctaagcacccagagaatctt-gacaacaataaaaatgt
                       Baboon  agtatcctggggatggttgacacccaacgctctaagcacccagagaatctt-gacaacaataaaaatgt
                 Green monkey  agtatcctggggatggttgatacccaacaccctaagcacccagagaatctt-gacaacaataaaaatgt
             Proboscis monkey  agtatcctggggatggttgacacccaacaccctaagcgcccagagaatctt-gacaacaataaaaatgt
     Golden snub-nosed monkey  agtatcctggggatggttgacacccaacaccctaagcacccagagaatctt-gacaacaataaaaatgt
                     Marmoset  agtatcctggggatggttgatacccaacaccctaagcacccataacatctt-gaaaacaataaaactgt
              Squirrel monkey  aatatcctggggatggttgatatccaacaccttaagcacccataacatctt-gaaaacaataaaaatgt
                      Tarsier  cgtgtccctgggagggtggacacccaac------------------atctt-gagaacagtcaaagcgg
                     Bushbaby  attatccctgggagggttgagactcaactccctcagcactcataacatgttcaaaaacaatcaaaatgt
                   Tree shrew  aatgtccctgagagggttaacacccaacaccctaagcacccatagcgtctc-gagaacaatcaaaaggt
                        Mouse  agcactcc------------tacccaccacgcaaaccacctggaccatctt-aagagcccagacaaagc
                          Dog  ggtggcctgaaag--------agccaactcgc--aacacctaa--------------------------
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 18 and 19 in window
B D                 Bushbaby 1bp

Alignment block 19 of 146 in window, 59297741 - 59297949, 209 bps 
B D                     Human  tttctaatgacatgaaagaga---ttttgataagatctggaattattgcttatggccttg--gtgtgaac
B D                     Chimp  tttctaatgacatgaaagaga---ttttgatatgatctggaattattgcttatggccttg--gtgtgaac
B D                    Bonobo  tttctaatgacatgaaagaga---ttttgatatgatctggaattattgcttatggccttg--gtgtgaac
B D                   Gorilla  tttccaatgacatgaaagaga---ttttgatatgatctggaattattgcttatggccttg--gtgtgaac
B D                 Orangutan  tttccaatgacatgaaagaga---ttttgatatgatctggaattattgcttatggccttg--gtgtgaac
B D                    Gibbon  tttccaatgacatgaaagaga---ttttgatatgatctggaattattgcttatgaccttg--gtgtgaac
B D                    Rhesus  tttccaatgacgtgaaagaga---ttttgacatgatctggaattattacttatgaacttg--gtgtgaac
B D       Crab-eating macaque  tttccaatgacgtgaaagaga---ttttgacatgatctggaattattacttatgaatttg--gtgtgaac
B D                    Baboon  tttccaatgacatgaaagaga---ttttgacatgatctggaattattacttatgaacttggtgtgtgaac
B D              Green monkey  tttccaatgacgtgaaagaga---ttttgacatgatctggaattattacttatgaacttg--gtgtgaac
B D          Proboscis monkey  tttccaatgacgtgaaagaga---ttttgacatgatctggaattattacttatgaacttg--gtgtgaac
B D  Golden snub-nosed monkey  tttccaataacgtgaaagaga---ttttgacatgatctggaattattacttatgaacttg--gtgtgaac
B D                  Marmoset  tttgcaatgacatgaaagaga---tattgatacgatctggaattattacatatggctttg--gtgtaaac
B D           Squirrel monkey  tttgcaattacatgaaagaga---ttttgatatgatctggaattattacatatggccttg--gtgtaaac
B D                   Tarsier  ttttcaatttcttgaaagggattttttttatatgatctggtattattacatatgtctttg--gtataag-
B D               Mouse lemur  tttttcacagcatgaaagaga---ttttgatgtgatctgtaattattgcatatgtccttg--gtgt-aac
B D                  Bushbaby  atttcaacaacaggaaagaga---ttttgatatgatctggaattattacacttgtccttg--gtgt-aac
B D                Tree shrew  tttgtaactgcatgaaagaag---ttttgatatgatctggaattatt----atgcccttg--gtgt-aac
B D                     Mouse  tcctcaactacaagaaagaaa---atccatttgtgtttggaatagt-----gtatcctgg--ctgt-cat
B D                       Dog  ---------------------------------------gaattatt----atgtcctcg--gtgt-aac

                        Human  tcacttaccacgccctgtgctgtaaataggcttta---agg--ga--------------ga---------
                        Chimp  tcacttaccacgccctgtgctgtaaataggcttta---agg--ga--------------ga---------
                       Bonobo  tcacttaccacgccctgtgctgtaaatgggcttta---agg--ga--------------ga---------
                      Gorilla  tcacttaccaagccctgtgctgtaaataggcttta---agg--ga--------------ga---------
                    Orangutan  tcacttaccatgccctgtgctgtaaataggcttta---agg--ga--------------ga---------
                       Gibbon  tcacttaccacgccctgtgctgtaaataggcttta---agg--ga--------------ga---------
                       Rhesus  tcacttatcacgccctgtgctgtaaataggcttta---agg--ga--------------ga---------
          Crab-eating macaque  tcacttaccacgccctgtgctgtaaaaaggcttta---agg--ga--------------ga---------
                       Baboon  tcacttaccacaccctgtgctgtaaataggcttta---agg--ga--------------ga---------
                 Green monkey  tcacttaccacgccctgtgctgtaaataggcttta---agg--ga--------------ga---------
             Proboscis monkey  tcacttaccacaccctgtgctataaataggcttta---agg--ga--------------ga---------
     Golden snub-nosed monkey  tcacttaccacgccctgtgttataaataggcttta---agg--ga--------------ga---------
                     Marmoset  tcacttaccaggacctgtgatataaataggctttaaataag--ga--------------ga---------
              Squirrel monkey  ccacttaccggaccctgtgatattaataggctttaaataag--ga--------------ga---------
                      Tarsier  ----tcaccaggttccatgctgcaaacaggcttca---agg--ga--------------gg---------
                  Mouse lemur  tcactcaccaggccctgtgctacatacaggcttga---aag--ggttag---ggttattgt---------
                     Bushbaby  tcacttaccaggccctgtgctacaaataggcttca---aagaagagttg---gctagttgt---------
                   Tree shrew  tttcttaccaggccc-gtgctgcaaataggcttca---aag--aaagggaaaaataattgc---------
                        Mouse  tcatgtactagggtctgagctgcaaatgggtttca---aag--ga--------------gaacaaagtca
                          Dog  ttgctttccagctcctgtgctgccaacaggctttg---aag--ga--------------ga---------

                        Human  ----gatagaagatacccaaaggtgagagt--ctgagaataaag----tgggaatgttgagacaatcttc
                        Chimp  ----gatagaagatacccaaagatgagagt--ctgagaataaag----tgggaatgttgagacaatcttc
                       Bonobo  ----gatagaagatacccaaagatgagagt--ctgagaataaag----tgggaatgttgagacaatcttc
                      Gorilla  ----gatagaagatacccaaaggtgagagt--ctgagaataaag----tgggaatgttgagacaatcttc
                    Orangutan  ----gacagaagatacccaaagatgagagt--ctaagaataaag----tgggaatgttgagacaatcttc
                       Gibbon  ----gatagaagatacccaaaggtgagagt--ctgagaatgaag----tgggaatgttgagacaatcttc
                       Rhesus  ----cacagaagacacccaaaggtgagagt--ctgagaataaag----tgggaatgttgaaacaatcttc
          Crab-eating macaque  ----cacagaagacacccaaaggtgagagt--ctgagaataaag----tgggaatgttgaaacaatcttc
                       Baboon  ----cacagaagacacccaaaggtgagagt--ctgagaataaag----tgagaatgttgagacaatcttc
                 Green monkey  ----cacagaagacacccaaaggtgagagt--ctgagaataaag----tgggaatgttgaaacaatcttc
             Proboscis monkey  ----cacagaagatacccaaagatgagagt--ctgagaataaag----tgggaatgttgagacaatcttc
     Golden snub-nosed monkey  ----cacagaagatacccaaagatgagagt--ctgagaataaag----tgggaatgttgagacaatcttc
                     Marmoset  ----gagagaagat-ctcaagggtgagagt--ctgagaat-aag----tgggaatgttgagacagtcttc
              Squirrel monkey  ----gccagaagatactcaagggtgagagt--ctgagaataaag----tgggaatgttgagacagtcttc
                      Tarsier  ----gacaaaagatactcatgtgtgagggc--ctgaaaat-agg----ttgagatgctgagacaaccctc
                  Mouse lemur  ----ggtggaagacacccagatctgagggg--ctggaaatagaaatgttggtgacgttgagacacacttc
                     Bushbaby  ----ggtggcggatactcaaatttgagggg--ct-gaaacagaaaagttggagattttgagacaaacttc
                   Tree shrew  ----ggttgaagataccaagtactgaggag--ctggaaacagatggtttggagaggtcgagacaagtttt
                        Mouse  ccctgcttgaagatgccagggtatgagggg--ctgtgcatagagaagctagggatgccaaaaag----tg
                          Dog  ----gg--aaaggtaattacggtcgaagataactggaaatggagaagctgggga------------cttc

                        Human  ctattcactatgttgggagaacacggacacactccatatatc
                        Chimp  ctattcactatgttgggagaacacggacacactccatatatc
                       Bonobo  ctattcactatgttgggagaacacggacacactccatatatc
                      Gorilla  ctattcactatgttgggagaacacggacacactccatatatc
                    Orangutan  ctattcactatgttgggagaacaaagacacactccatatatc
                       Gibbon  ctattcactatactgggggaacacggacccactccatatatc
                       Rhesus  ctattcactatgttgagggaacacagacacactcaatatatc
          Crab-eating macaque  ctattcactatgttgggggaacacagacacactcaatatatc
                       Baboon  ctattcactatgttgggggaacacagacacactcaatatatc
                 Green monkey  ctattcactatgttaggggaacacagacacactcaatatatc
             Proboscis monkey  ctattcactatgttgggggaacacagacacactcaatatatc
     Golden snub-nosed monkey  ctattcactatgttgggggaacacagacacactcaatatatc
                     Marmoset  cagctcactatgttaggggaacactgacacattaaatatatc
              Squirrel monkey  caattcactgtgttaggggaacactgacacattaaatatatc
                      Tarsier  ctattcagtttgttggtggaaaacagacatgataaaggtatc
                  Mouse lemur  ctattcactacgtctggagagcacagacagggtaaaggtatc
                     Bushbaby  ctaatcattatgtcaggagaacacagacatgataaatgtatc
                   Tree shrew  gtagttatcatgttaggggagcatagacatgataaaaatagc
                        Mouse  atatttgctatgtagggca---gcaaacacagtcaaggtgtc
                          Dog  ccattcacggtggtgggggaacatagtcatgagaaagatact

Inserts between block 19 and 20 in window
B D               Tree shrew 320bp

Alignment block 20 of 146 in window, 59297950 - 59298022, 73 bps 
B D                     Human  ttg-ttagagttattaggattagtgaaagtgacttt---------------ctttcataaagcttta-ct
B D                     Chimp  ttg-ttagagttattaggattaatgaaagtgacttt---------------ctttcataaagcttta-ct
B D                    Bonobo  ttg-ttagagttattaggactaatgcaagtgacttt---------------ctttcataaagcttta-ct
B D                   Gorilla  ttg-ttagagttattaggattaatgaaagtgacttt---------------ctttcataaagcttta-ct
B D                 Orangutan  ttg-ttagagttattaggattaatgaaagtgacttt---------------ctttcataaagcttta-ct
B D                    Gibbon  ttg-ttagagttattaggattaatgaaagtgacttt---------------ctttcacaaagctttg-ct
B D                    Rhesus  ttg-ttagagttattaggattaatgaaagtgacttt---------------ctttcataaaccttta-ct
B D       Crab-eating macaque  ttg-ttagagttattaggattaatgaaagtgacttt---------------ctttcataaaccttta-ct
B D                    Baboon  ttg-ttagagttattaggattaatgaaagtgacttt---------------ctttaataaaccttta-ct
B D              Green monkey  ttg-ttagagttattaggataaatgaaagtgacttt---------------ctttaataaaccttta-ct
B D          Proboscis monkey  ttg-ttagagttattaggattaatgaaagtgacttt---------------ctttcataaaccttta-ct
B D  Golden snub-nosed monkey  ttg-ttagagttattaggattaatgaaagtgacttt---------------ctttcataaaccttta-ct
B D                  Marmoset  ttg-ttagagttattagggttaaagaaagtgacttt---------------ctttcataaacctttatct
B D           Squirrel monkey  ttg-ttagagttattaggattaaagaaagtgac------------------ctttcataaacctttatct
B D                   Tarsier  tta-tt--agttatttgagttaattaaaatgacttt---------------cctaatgaaactttaa-ct
B D               Mouse lemur  ttg-ttagaattatttgtatgaatggaaaccacttt---------------cttttatgaacacttatct
B D                  Bushbaby  ttgtttagagttatttgtattaatgg-aatgacatt---------------ctttcttgaacctttatct
B D                Tree shrew  ttg-tt--aattattcgagttagtgccaacaactgt---------------cttttataaactgctttct
B D                     Mouse  tta-tcagggttgctttacttcattcagaaaactttggggggggagggctactttaat----------tt
B D                       Dog  gtg-ttagaattattgaaattaatgcaaacgacttt---------------tctttatgcacctttatct

                        Human  gggatccagtgccaacacat
                        Chimp  gggatccagtgccaacacat
                       Bonobo  gggatccagtgccaacacat
                      Gorilla  gagatccagtgccaacacat
                    Orangutan  gggatccattgccaacacat
                       Gibbon  gggatccagtgccaacacat
                       Rhesus  gggatccagtgccaatacat
          Crab-eating macaque  gggatccagtgccaatacat
                       Baboon  gggatccagtgccaatactt
                 Green monkey  gggatccagtgccaatacat
             Proboscis monkey  gggatccagtgccaatacat
     Golden snub-nosed monkey  gggatccagtgccaatacat
                     Marmoset  gggctccagtgccaatacat
              Squirrel monkey  gggctccagtgccaatacat
                      Tarsier  gggattcagtgccaatatgt
                  Mouse lemur  gggattccatgtcaatacat
                     Bushbaby  gggattccatgacaatattt
                   Tree shrew  gggatgcagtgtcgatgtgt
                        Mouse  ggaaagctaggccaacacaa
                          Dog  gggattcagtggcagtacct

Inserts between block 20 and 21 in window
B D                 Bushbaby 184bp
B D                    Mouse 3bp

Alignment block 21 of 146 in window, 59298023 - 59298031, 9 bps 
B D                     Human  ---tt-taaaaaa
B D                     Chimp  ---tt-taaaaaa
B D                    Bonobo  ---tt-taaaaaa
B D                   Gorilla  ---tt-taaaaaa
B D                 Orangutan  ---ttaaaaaaaa
B D                    Gibbon  ---tt-taaaaaa
B D                    Rhesus  ---tt-ttaaaaa
B D       Crab-eating macaque  ---tt-ttaaaaa
B D                    Baboon  ---tt-ttaaaaa
B D              Green monkey  ---tt-ttaaaaa
B D          Proboscis monkey  ---tt-ttaaaaa
B D  Golden snub-nosed monkey  ---tt-tt-aaaa
B D                  Marmoset  ---tt-tt-taag
B D           Squirrel monkey  ---tt-tt-taag
B D                   Tarsier  ---tt-taaaaaa
B D               Mouse lemur  ----t-ttagtaa
B D                  Bushbaby  ----t-ttaaaca
B D                Tree shrew  ---ct-ttaaaaa
B D                     Mouse  ---tt-ttaaaa-
B D                       Dog  ttttt-ttaaaaa

Inserts between block 21 and 22 in window
B D              Mouse lemur 199bp

Alignment block 22 of 146 in window, 59298032 - 59298065, 34 bps 
B D                     Human  tagag-ttttactttctctttccctgg-ttggtgtt
B D                     Chimp  tagag-ttttactttctctttccctgg-ttggtgtt
B D                    Bonobo  tagag-ttttactttctctttccctgg-ttggtgtt
B D                   Gorilla  tagag-ttttactttctctttccctgg-ttggtgtt
B D                 Orangutan  taggg-ttttactttctcttt-cctgg-ttggtgtt
B D                    Gibbon  tagag-ttttattttctcttt-cctgg-ttggtgtt
B D                    Rhesus  tagag-ttttattttctcttt-cctgg-ttggtgtt
B D       Crab-eating macaque  tagag-ttttattttctcttt-cctgg-ttggtgtt
B D                    Baboon  tagag-ttttactttctcttt-cctgg-ttggtgtt
B D              Green monkey  tagag-ttttattttctcttt-cctgg-ttggtgtt
B D          Proboscis monkey  tagaa-ttttattttctcttt-cctag-ttggtgtt
B D  Golden snub-nosed monkey  tagaa-ttttattttctcttt-cctgg-ttggtgtt
B D                  Marmoset  tagag-ttttattctctcctt-cctgattttgtgtt
B D           Squirrel monkey  tagag-ttttattctctcctt-cctga-ttggtgtt
B D                   Tarsier  tagaatttttattttctcctt-cttgg-ttggaatt
B D               Mouse lemur  cagaa-ttttatcttttcctt-cttga-tcggtggt
B D                  Bushbaby  tataa-ttttattttcctctt-cttgg-ttgggttt
B D                Tree shrew  gtgaa-ttatatttgttcctc-cttgc-ttcatgtt
B D                     Mouse  gagac-tttttgttgttgttt-att-----------
B D                       Dog  tagac-t----ctgtttcctc-cttgt-tttgtgtt

Inserts between block 22 and 23 in window
B D                   Rhesus 1bp
B D      Crab-eating macaque 1bp
B D                   Baboon 1bp
B D             Green monkey 1bp
B D                  Tarsier 3bp
B D              Mouse lemur 3bp
B D                 Bushbaby 3bp
B D               Tree shrew 4bp

Alignment block 23 of 146 in window, 59298066 - 59298134, 69 bps 
B D                     Human  tttgccttgact-aa--c-t-tctacctgaagcacctaaagcactc---agtattaatagctccttgaag
B D                     Chimp  tttgccttgact-aa--c-t-tctacctgaagcacctaaagcactc---agtattaatagctccttgaag
B D                    Bonobo  tttgccttgact-aa--c-t-tctacctgaagcacctaaagcactc---agtattaatagctccttgaag
B D                   Gorilla  tttgccttgact-aa--c-t-tctacctgaagcacctaaagcactc---ggtattaatagctccttgaag
B D                 Orangutan  tttgccttgact-aa--c-t-tctacctgaagcacctaaagcactc---agtattaatagctccttgaag
B D                    Gibbon  tttgccttgact-aa--c-t-cctacctgaagcacctaaagcactc---agtattaatagctccttgaag
B D                    Rhesus  tttgccttgact-aa--c-t-tctacctgaagcacctaaagcactc---agtattaatagctccttgaag
B D       Crab-eating macaque  tttgccttgact-aa--c-t-tctacctgaagcacctaaagcactc---agtattaatagctccttgaag
B D                    Baboon  tttgccttgact-aa--c-t-tctacctgaagcacctaaagcactc---agtatgaatagctccttgaag
B D              Green monkey  tttgccttgact-aa--c-t-tctacctgaagcacctgaagcactc---agtattaatagctccttgaag
B D  Golden snub-nosed monkey  tttgccttgact-aa--c-t-tctacctgaagcacctaaagcactc---agtattaatagctccttgaag
B D                  Marmoset  tttgccttgact-aa--c-a-tctatctgaagcacct-aagtgctcattagtattaatagcttcttcaag
B D           Squirrel monkey  tttgccttgact-aa--c-c-tctatctgaagcacctaaagtactcattagtattaatagcttcttcaag
B D                   Tarsier  tttgtctggactaaa--c-t-tctacccaaagcacctgaagtgtttatcagtgttaatagctccctggaa
B D               Mouse lemur  tttgccttgacc-ta--a-tgtctacctgaagtacctgaaacgctcatgagtattaatagctccctgaag
B D                  Bushbaby  tttgcctgaact-ga--a-t-tggacctgaagtgcctaaagcactcctgagtattaatagctcctggcaa
B D                Tree shrew  ttttcctcgact-ga--cgt-tctagctgagacgcct-aagtgctcatcagtgttaagagctccttgaag
B D                     Mouse  gtagcattg----ag--c-t-tatactagaagcacctgaaactctcctcagaatgaacaagcccctgaac
B D                       Dog  tctgcctgctcg-gaact-t-cctgcctcaatcacctaacccactccccagtggtagtggcgtcctgggg
B D          Proboscis monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ----aaaaacc
                        Chimp  ----aaaaacc
                       Bonobo  ----aaaaacc
                      Gorilla  ----aaaaacc
                    Orangutan  ----aaaaacc
                       Gibbon  ----agaaacc
                       Rhesus  ----aaaaaag
          Crab-eating macaque  ----aaaaaag
                       Baboon  ----aaaaaag
                 Green monkey  ----aaaaaag
     Golden snub-nosed monkey  ----aaaaaag
                     Marmoset  ----aaaaatc
              Squirrel monkey  ----aaaaacc
                      Tarsier  ggataaaaat-
                  Mouse lemur  ----aaaaacc
                     Bushbaby  ----gagaacc
                   Tree shrew  ----aaaaacc
                        Mouse  ----tgaagcc
                          Dog  ----ac-----
             Proboscis monkey  NNNNNNNNNNN

Inserts between block 23 and 24 in window
B D                    Mouse 4bp

Alignment block 24 of 146 in window, 59298135 - 59298501, 367 bps 
B D                     Human  agagaat--ttggttacaggatcttcctttcttct-ccagcagg--tctagtctcta-ctgtcaaccact
B D                     Chimp  agagaat--ttggttacaggatcttcctttcttct-ccagcagg--tctagtctcta-ctgtcaaccact
B D                    Bonobo  agagaat--ttggttacaggatcttcctttcttct-ccagcagg--tctagtctcta-ctgtcaaccact
B D                   Gorilla  agagaat--ttggttacaggatcttcctttcttct-ccagcagg--tctagtctcta-ctgtcaaccgct
B D                 Orangutan  agagaat--ttggttacagaatcttcctttcttct-ccagcagg--tctagtctcta-ctgtcaaccact
B D                    Gibbon  agagaat--ttggttacagaatcttcctttctttt-ccaacagg--tctagtctctc-ctgtcaaccact
B D                    Rhesus  agataat--ttggttacagaatcttcctttcttct-ccaacagg--tctagtctcta-ctgtcaaccact
B D       Crab-eating macaque  agataat--ttggttacagaatcttcctttcttct-ccaacagg--tctagtctcta-ctgtcaaccact
B D                    Baboon  agataat--ttggttacagaatcttcctttcttct-ccaacagg--tctagtctcta-ctgtcaaccact
B D              Green monkey  agataat--ttggttacagaatcttcctttcttct-ccaacagg--tctagtctcta-ctgtcaaccact
B D          Proboscis monkey  agataat--ttggttacagaatcttcctt-----------------tctagtctcta-ctgtcaaccact
B D  Golden snub-nosed monkey  agataat--ttggttacagaatcttcctttcttct-ccaacagc--tctagtctcta-ctgtcaaccact
B D                  Marmoset  agagaat--ttggttacagaatgttcctttcttct-ctaacagt--tctagtcccca-ctgtcaactact
B D           Squirrel monkey  agagaat--ttggttacagaatgttcctttcttct-ccaacagt--tctagtcgcc--ccatcaactact
B D                   Tarsier  aaaaaataattggttataaagttttcctttcttct-ctaacagg--tctaatctttg-ctgtcaactcct
B D               Mouse lemur  aaagaat--ccagttgtggagtttcccctcccttc-ccaaatgggccctagtctctg-ttgtcaacgcct
B D                  Bushbaby  aggggat--ccacctgtggagtttctccttcctct-tccaattg------------------------ct
B D                Tree shrew  aaagaat--ttggccatggaatttttttttcttct-ctaataag--cctgatctcta-ctgtcaactact
B D                     Mouse  ctaagat--ttggttagcgactgt-actttcttct-ccagcagg--ccgcctctcta-ccgtcag--gtc
B D                       Dog  ---------------------ttttcctctcctctcccaccacg--ctttgtctctatttgtcacatact

                        Human  gaccc--agaggtgct---taa-aacc----agaatc-caatatgtgcattcgctcatcatttaaaatct
                        Chimp  gaccc--agaggtgct---taa-aacc----agaatc-caatatgtgctttcgctcatcatttaaaatct
                       Bonobo  gaccc--agaggtgct---taa-aacc----agaatc-caatatgtgctttcgctcatcatttaaaatct
                      Gorilla  gaccc--agaggtgct---taa-aacc----agaatc-taatatgtgctttcgctcatcatttaaaatct
                    Orangutan  gaccc--agaggtgct---taa-aacc----agaatc-taatatgtgctttggctcatcatttaaaatct
                       Gibbon  gaccc--agaagtgct---taa-aacc----agaatc-taatatgtgcttttgctcatcatttaaaatct
                       Rhesus  gaccc--aaaagtgct---taa-aacc----agaatc-taatatatgctttcgctcatcatttaaaatct
          Crab-eating macaque  gaccc--aaaagtgct---taa-aacc----agaatc-taatatatgctttcgctcatcatttaaaatct
                       Baboon  gaccc--aaaggtgct---taa-aacc----agaatc-taatatatgctttcgctcatcatttaaaatct
                 Green monkey  gaccc--aaaggtgct---taa-aacc----agaatc-taatatatgctttcgctcatcatttaaaatct
             Proboscis monkey  gaccc--aaaggtgct---taa-aacc----aaaatc-taatacatgctttcgctcatcatttaaaatct
     Golden snub-nosed monkey  gaccc--aaaggtgct---taa-aacc----aaaatc-taatatatgctttcgctcatcatttaaaatct
                     Marmoset  gatcc--agaggtgct---caa-aacc----aaaacc-taatatgtgctttcgcccatcacttaaaatcc
              Squirrel monkey  gatcc--agaggtgct---caa-aacc----aaaatt-taatatgtgctttcgctcatcacttaaaatcc
                      Tarsier  gacct--tgaggggct---caa-aaccaag-aaaatc-tagcatgtgctttcatttatcttttttaattt
                  Mouse lemur  gagcc--agaggtgttcagaaa-taaa----aaatccatactgtgtgctttcattcatcattttaattct
                     Bushbaby  aaccc--agaggtgct---aaa-caaa----caaacc-tactgtgtgctttcattcagcgttttaatgtt
                   Tree shrew  aacacagagaggtggt---caa-aaccaag-agaatc-aaacatgtgctatcattcatttatttaaattc
                        Mouse  aagct--ggagtggct---cagttaga----gggaaa-tgaacttcaccttcagtcagcatcagacttct
                          Dog  aaccc--agaggtgtt---caa-aaccaggaaaagct-taatgtatgctttcatttatcattctgattct

                        Human  -ttctgctctacaagggagaaacat-ttttctctcgtagccttattaactgcagaaaagagca-ttttta
                        Chimp  -ttctgctctacaagggagaaacat-ttttctctcgtagccttattaactgcagaaaagagca-ttttta
                       Bonobo  -ttctgctctacaagggagaaacat-ttttctctcgtagccttattaactgcagaaaagagca-ttttta
                      Gorilla  -ttctgctctacaagggagaaacat-ttttctctcgtagccttattaactgctgaaaagagca-ttttta
                    Orangutan  -ttctgctctacaagggagaaacat-tcttctctcatagccttattaactgctgaaaagagca-ttttta
                       Gibbon  -ttctgctctacaagggagaaacat-ttttctctcatagccttattaacggctgaaaagagca-ttttta
                       Rhesus  -ttctgctctactagggagaaacat-ttttctctcatagccttattaactgctgaaaagagca-ttttta
          Crab-eating macaque  -ttctgctctactagggagaaacat-ttttctctcatagccttattaactgctgaaaagagca-ttttta
                       Baboon  -ttctgctctactagggagaaacat-ttttctctcatagccttattaactgctgagaagagca-ttttta
                 Green monkey  -ttctgctgtactagggagaaacat-ttttctctcatagccttattaactgctgaaaagagca-ttttta
             Proboscis monkey  -ttctgctctactagggagaaacat-ttttctctcatagccttattaactgctgaaaagagca-ttttta
     Golden snub-nosed monkey  -ttctgctctactagggagaaacat-ttttctctcatagccttattaactgctgaaaagagca-ttttta
                     Marmoset  -ttctcctctgcaagggagaaatgc-ttttctctcatggccttattaattgctgaaaagagta-tttcta
              Squirrel monkey  -ttctactctaccagggagaaaagt-tttttcctcatggccttattaattgctgaaaagagtg-tttcta
                      Tarsier  cttttactgtacaagggagaaacat-ttttctctcctagctttattaactgttgaaaagaacatttttta
                  Mouse lemur  -ttctactctataagggagagatat-ttttctcacacagctttattaactattgaaaagagca-tctgta
                     Bushbaby  -------tctaaagagggaagagat-cgttctttcatagctttatgagctgttgaaatgagca-tttata
                   Tree shrew  -ttctactgtacaagggagaaatag-ttttctct--tagctttattaactgtagtcaagaaaa-tgtata
                        Mouse  -ttctggtctacaagagggaaatgtggttcctgtctgagccatattaactcttcaagagaaca-attgca
                          Dog  -ttctactctatcagggagaagcat-ttttctctcttagccttattaactgttgaaaagagca-tttata

                        Human  ttcttaatttatgttctgaaagcatgtcagcttttgtgtctgtcatttagaagctatgattcacaaacat
                        Chimp  ttcttaatttatgttctgaaagcatgtcagcttttgtctctgtcatttagaagctatgattcacaaacat
                       Bonobo  ttcttaatttatgttctgaaagcatgtcagcttttgtctctgtcatttagaagctatgattcacaaacat
                      Gorilla  ttcttaatttatgttctgaaagcatgtcagcttttctctctgtcatttagaagctatgattcacaaacat
                    Orangutan  ttcttaatttatgttctgaaagcgtgtcagcttttgtctctgtcatttagaagctatgattcacaaacat
                       Gibbon  ttcttaatttatgttctgaaagcatgtcagcttttgtctctgtcatttagaagctatgattcacaaacat
                       Rhesus  ttcttaatttatgttctgaaagcatgtcagcttttgtctctgtcatttagaagctacgattcacaaacat
          Crab-eating macaque  ttcttaatttatgttctgaaagcatatcagcttttgtctctgtcatttagaagctacgattcacaaacat
                       Baboon  ttcttaatttatgttctgaaagcatgtcagcttttgtctgtgtcatttagaagctacgattcacaaacat
                 Green monkey  ttcttaatttatgttctgaaagcatgtcagcttttgtctgtgtcatttagaagctacgattcacaaacat
             Proboscis monkey  ttcttaatttatgttctgaaagcatgtcagcttttgtctctgtcatttagaagctacaattcacaaacac
     Golden snub-nosed monkey  ttcttaatttatgttctgaaagcatgtcagcttttgtctctgtcatttagaagctacaattcacaaacac
                     Marmoset  ttcttaatgtatgttctgaaggcatgtcggcttttgtctctgtcgtttagaagctatgattcataaacat
              Squirrel monkey  ttcttaatttatgttctgaaagcatgctggcttttgtctctgtcatttagaagctatgattcacaaacat
                      Tarsier  tccttaatttatgtt-tgaaaacatgtcagtttttgtttctgtcacttaaaaatcatgattcacaa--at
                  Mouse lemur  ttcttaatttaagttctgaaagcatgtcag-ttttgtttctgtcatttggaaaccatgattcacaaacat
                     Bushbaby  ttcttaatttaagttccaaaagtatgtcca-tcttatctctgtcatttagaactcatgattcacaaacat
                   Tree shrew  ttctt-gtttatgttctgaaagcatgttggtgtttggctttgtcgtttagaaaccatgattcacagttgt
                        Mouse  ttctgcgtctgtgttctaaaggtatgcatg-gttcaacttcatcacataaaagtcac---------acat
                          Dog  ttcttaatttatgttcagagagcatgtcagtttttgtcttcgt----taggagccatgattcacaaacaa

                        Human  gggtgagttcattagctgccaaggctcaggtg-actgttggggtggcccttggtttgatgtaaaagcaca
                        Chimp  gggtgagttcattagctgccaaggctcaggtg-actgttggggtggcccttggtttgacgtaaaagcgca
                       Bonobo  gggtgagttcattagctgccaaggctcaggtg-actgttggggtggcccttggtttgacgtaaaagcgca
                      Gorilla  gggtgagttcattagctgccaaagttcaggtg-actgttggggtggcccttggtttgatgtaaaagcaca
                    Orangutan  gggtgagttcattagctgccaaagttcagatg-actgttggggtggcccttggtttgatgtaaaagcaca
                       Gibbon  gggtgagttcattagctgccaaggttcagatg-actgttggggtggcccttggtttgatgtaaaagcaca
                       Rhesus  gggtgagttcattagctgccaaggttcggatg-gctgttggggtggcccttggtttgatgtaaaagcaca
          Crab-eating macaque  gggtgagttcattagctgccaaggttcggatg-gctgttggggtggcccttggtttgatgtaaaagcaca
                       Baboon  gggtgagttcattagctgccaaggttcggatg-gctgttggggtggcccttggtttgatgtaaaagcaca
                 Green monkey  gggtgagttcattagctgccaaggttcggatg-gctgttggggtggcccttggtttgatgtaaaagcaca
             Proboscis monkey  gggtgagttcattagctgccaaggttcagatg-gctgttggggtggcccgtggtttgatgtaaaagcaca
     Golden snub-nosed monkey  gggtgagttcattagctgccaaggttcagatg-gctgttggggtggcccttggtttgatgtaaaagcaca
                     Marmoset  gggtgagttcattagccgccatggtccagatg-actgttggggtggcccttggtttgatgtaaaagccca
              Squirrel monkey  gggtgagttcattagctgccaaggtctagatg-accgttggggtggcccctggtttgatgtaaaagccca
                      Tarsier  gggtgagttcccaagctgcctggatacagata-acgattggggtggcccttggtttgatgtaagagtgca
                  Mouse lemur  -----agttcattcact-cctaggaggagttg-actgttggggtggccctttgtttgatataaaagcaca
                     Bushbaby  agctgagttctttcactgccaaggtggggctg-actactggggtggcccttggtttgatgcaaaagcata
                   Tree shrew  -gccgagtatgtcggctgcctgggtgaagatc-acggttggggaggccctgggttctgtgtaaaagcaca
                        Mouse  ---tgagcac-ttggctgtgcagg--gggatgtattgtttgggtggcccttgcct--atgcagaaccgga
                          Dog  gattgagttcattagctgcctaggaggacatt-ac----gaggtggcccttggtttgatataaatacaga

                        Human  agtgcccataatatcctgagagccagcagaatgttttt
                        Chimp  agtgcccataatatcctgagagccagcagaatgttttt
                       Bonobo  agtgcccataatatcctgagagccagcagaatgttttt
                      Gorilla  agtgcccataatatcctgagagccagcagaatgttttt
                    Orangutan  agtgcccataatatcctgagagccagcagaatgttttt
                       Gibbon  agtgcccataatatcctgagagccaacagaatgttttt
                       Rhesus  agtgcctataatatcctgagagccagcagaatgttttt
          Crab-eating macaque  agtgcctataatatcctgagagccagcagaatgttttt
                       Baboon  agtgcctataatatcctgagagccagcagaatgttttt
                 Green monkey  agtgcctataatatcctgagagccagcagaatgttttt
             Proboscis monkey  agtgcctatcatatcctgagagccagcagaaggttttt
     Golden snub-nosed monkey  agtgcctataatatcctgagagccagcagaaggttttt
                     Marmoset  aa-gcctgtaatattctgagagccagcagaatgtcttt
              Squirrel monkey  aa-gcctgtaatatcctgaaagccagcagaat-ttttt
                      Tarsier  agtgcctgtaaaatcttgagagccagcaaaatgtttt-
                  Mouse lemur  agtgtctgtaacatcttgagggcaagcaaaatattttt
                     Bushbaby  agtttctgtaacatcttgaggacatgcaaaatatttta
                   Tree shrew  cctgcccaagacaccttgagagcaaccaaaatgcttct
                        Mouse  tatgctca-aatgcttggtgga----cagag-------
                          Dog  agtgcccataacatcttgagagcaggca-aatgttttc

Alignment block 25 of 146 in window, 59298502 - 59298542, 41 bps 
B D                     Human  aagctgcataaaagagattttgatatgatctggaattcttt
B D                     Chimp  aagctgcataaaagagattttgatatgatctggaattcttt
B D                    Bonobo  aagctgcataaaagagattttgatatgatctggaattcttt
B D                   Gorilla  aagctgcataaaagagattttgatatgatctggaattcttt
B D                 Orangutan  aagctgcataaaagagattttgatatgatctggaattcttt
B D                    Gibbon  aagctgcataaaagagattttgatatgatctagaatccttt
B D                    Rhesus  cagctgcataaaagagattttgatatgatctggaattcttt
B D       Crab-eating macaque  cagctgcaaaaaagagattttgatatgatctggaattcttt
B D                    Baboon  cagctgcataaaagagattttgatatgatctggaatccttt
B D              Green monkey  cagctgcataaaagagattttgatatgatctggaattcttt
B D          Proboscis monkey  cagctgcatacaagagattttgatatgatctggaattcttt
B D  Golden snub-nosed monkey  cagctgcatacaagagattttgatatgatctggaattcttt
B D                  Marmoset  aagctgcataaaagagattttgatatgatttggaattcttt
B D           Squirrel monkey  aagctgcataaaagagattttgatatgatctggaattcttt
B D                   Tarsier  -aactacataaaagagattttgatatgatctggaattcttt
B D                  Bushbaby  aaactacattaaagagattttgatatgatctggaattcttt
B D                Tree shrew  aaatgacatgaaggaaattttgatatggtctgtaattcttt
B D                     Mouse  aaactatttgaaagaaacttccttatgat-tggaatttcct
B D                       Dog  atactacatgaaggagattttgatccaatctggaattcttt
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 26 of 146 in window, 59298543 - 59298584, 42 bps 
B D                     Human  ggctaactggaggccaaattgcattcaatgtcttaaaag-cca
B D                     Chimp  ggctaactggaggccaaattgcattcaatgtcttaaaag-cca
B D                    Bonobo  ggctaactggaggccaaattgcattcaatgtcttaaaag-cca
B D                   Gorilla  ggctaactggaggccaaattgcattcaatgtcttaaaag-cca
B D                 Orangutan  ggctaactggaggccaaattgcattcaatgtcttaaaag-ccg
B D                    Gibbon  ggctaactggaggccaaattgcattcaatgtcttaaaag-cca
B D                    Rhesus  ggctaactggagaccaaattgcattcaatgtcttaaaag-cca
B D       Crab-eating macaque  ggctaactggagaccaaattgcattcaatgtcttaaaag-cca
B D                    Baboon  ggctaactggagaccaaattgcattcaatgtcttaaaag-cca
B D              Green monkey  ggctaactgcagaccaaattgcattcaatgtcttaaaag-cca
B D  Golden snub-nosed monkey  gactaactggagaccaaattgcattcactgtcttaagag-cca
B D                  Marmoset  ggctaactggaggccaaattgcattcaatgtctta-aag-cca
B D           Squirrel monkey  ggctaactggaggccaaattgcattcaatgtcttagaag-cca
B D                   Tarsier  ggctaactggaggccataatgcattcaatgccttaaagg-ctg
B D                  Bushbaby  ggctaattggacgccaaatggcattcaatgccttcaaaa-gca
B D                Tree shrew  ggccaggtgggggccaaatcatattcaatgccttagaagtcca
B D                     Mouse  ggcgaattgaatgtccgaaaggattccattcctcaaaag-cca
B D                       Dog  ggctacctggaagccaaatcaccttcattgaactgatta-cca
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          Proboscis monkey  ===========================================

Inserts between block 26 and 27 in window
B D                    Mouse 540bp

Alignment block 27 of 146 in window, 59298585 - 59298620, 36 bps 
B D                     Human  gtataaatgattacagaacatccatttctttagcag
B D                     Chimp  gtataaatgattacagaacatccatttctttagcag
B D                    Bonobo  gtataaatgattacagaacatccatttctttagcag
B D                   Gorilla  gtataaatgattacagaacatccatttctttagcag
B D                 Orangutan  gtataaatgattacagaacatccatttctttagcag
B D                    Gibbon  gtataaatgattacagaacatccatttctttagcag
B D                    Rhesus  gtatgaatgattacagaacatccatttcattagcag
B D       Crab-eating macaque  gtatgaatgattacagaacatccatttcattagcag
B D                    Baboon  gtatgaatgattacagaacatccatttcattagcag
B D              Green monkey  gtatgaatgattacagaacatccatttcattagcag
B D  Golden snub-nosed monkey  ctatgaatgattacagaacatccatttcgttagcag
B D                  Marmoset  gtatgaatgattgcagagcatccatttctttagcag
B D           Squirrel monkey  gtatgaatgattgcagagcgtccatttctttagcag
B D                   Tarsier  gtaggaatgattagagaacatccttttctttagcag
B D                  Bushbaby  gtaagaataattagagaacgttcatttctttagcag
B D                Tree shrew  gt--gaatggtta-agaacatccatttctttagtag
B D                     Mouse  gtgtgaatattgagaaaatattcttttttttttttt
B D                       Dog  acgtgaatgataggaggtcatctgtctcttttccag
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          Proboscis monkey  ====================================

Inserts between block 27 and 28 in window
B D               Tree shrew 270bp
B D                    Mouse 4bp

Alignment block 28 of 146 in window, 59298621 - 59298769, 149 bps 
B D                     Human  atggtcatttgttttcact-ttctgcttaatttaatgtaaatattcagattgacctttgtttttc-caca
B D                     Chimp  atggtcatttgttttcact-ttctgcttaatttaatgtaaatattcagattgacctttgtttttc-caca
B D                    Bonobo  atggtcatttgttttcact-ttctgcttaatttaatgtaaatattcagattgacctttgtttttc-caca
B D                   Gorilla  atggtcatttgttttcact-ttctgcttaatttaatgtaaatattcagattgacctttgtttttc-caca
B D                 Orangutan  atggtcatttgttttcact-ttctgcttaatttaatgtaaatattcaaattgacctttgtttttc-caca
B D                    Gibbon  atggtcatttgttttccct-ttctgcttaatttaatgtaaatattcaaattgacctttatttttc-caca
B D                    Rhesus  atggtcatttgttttcact-ttctgcttaatttaatgtaaatattcaaattgacctttgtttttc-caca
B D       Crab-eating macaque  atggtcatttgttttcact-ttctgcttaatttaatgtaaatattcaaattgacctttgtttttc-caca
B D                    Baboon  at-gtcatttgttttcact-ttctgcttaatttaatgtaaatattcaaattgacctttgtttttc-caca
B D              Green monkey  atggtcatttgttttcact-ttctgcttaatttaatgtaaatattcaaattgacctttgtttttc-caca
B D  Golden snub-nosed monkey  atggtcatttgttttcact-ttctgcttaatttaatgtaaatattcaaattgacctttgtttttc-cata
B D                  Marmoset  atggtcatttgtctccact-ttctgcttaattcaatgtaaatattcaaattgacctttatttttc-caca
B D           Squirrel monkey  atggtcatttgtctccact-ttctgcttaattcaatgtaaatattcaaatcgacctttatttttc-caca
B D                   Tarsier  atggccatttgctttaacc-ttct-cctaattcagtgtaaat-ttaaaattgacctttatttttc-caca
B D                  Bushbaby  atggccatttgtttc-------------accttaacgtaaatatgcaaattgacc-ttatttttc-caca
B D                Tree shrew  atggccatctcttttaattcttttccctatactaatgctagtatcc-gattgagctttattttttgcaca
B D                     Mouse  aaggccatgtct----aaa-ttttgcctaa--cagtgtaaatattcaagttgaactttgttttcc-caca
B D                       Dog  atgcccatttgttctcacc-tcctgcctcatttaatgtaaatattcaaattgaccttcatttttc-cata
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          Proboscis monkey  ======================================================================

                        Human  gtcttacagattgttcttgaaatatcatgtcaga---------gaatctggct----------tat-agg
                        Chimp  gtcttacagattgttcttgaaatatcatgtcaga---------gaatctggct----------tat-agg
                       Bonobo  gtcttacagattgttcttgaaatatcatgtcaga---------gaatctggct----------tat-agg
                      Gorilla  gtcttacagattgttcttgaaatatcatgtcaga---------gaatctggct----------tat-agg
                    Orangutan  gtcttacagattgttcttgaaatatcatgtcaga---------gaatctggct----------gat-agg
                       Gibbon  gtcttacagattgttcttgaaatatcatgtcaga---------gaatctggtt----------tat-agg
                       Rhesus  gtcttacagactgtccttgaaatatcatgtcaga---------gaatctggtt----------tat-agg
          Crab-eating macaque  gtcttacagactgtccttgaaatatcatgtcaga---------gaatctggtt----------tat-agg
                       Baboon  gtcttacagactgtccttgaaatatcatgtcaga---------gaatctggtt----------tat-agg
                 Green monkey  gtcttacagactgtccttgaaatatcatgtcaga---------gaatctggtt----------tat-aag
     Golden snub-nosed monkey  gtcttacagactgtccttgaaatatcatgtcaga---------gaatctggtt----------tat-agg
                     Marmoset  gtcttatggattgtccttgaaatattatatcaga---------gaatctggtt----------taa-agg
              Squirrel monkey  gtcttatgggttgtccttgaaatatcgtgtcaga---------gaatctggtt----------taa-agg
                      Tarsier  gtctcacggattgtccttgaaatacaacgttaaa---------gaatatgctt----------tat-aag
                     Bushbaby  gtcttatggattatccttgagatatta-accataatgccccccaaacctggtt----------tatgggg
                   Tree shrew  gtcctatgg-ttgtccttgggatataatatcaaa---------gaatctgact----------taa-ggg
                        Mouse  atgtcgtagattattttcaaaataaaatgtcaaa---------gaatgtattttgttgcacagtat-aga
                          Dog  gtctcatggattgtccttgacttatcctatcaga---------gaatctggtt----------tat-ggg
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================

                        Human  gtagctttttag-a------------------------------------------acagtaattctt--
                        Chimp  gtagctttttag-a------------------------------------------acagtaattctt--
                       Bonobo  gtagctttttag-a------------------------------------------acagtaattctt--
                      Gorilla  gtagctttttag-a------------------------------------------acagtaattctt--
                    Orangutan  gtaactttttag-a------------------------------------------acagtaattctt--
                       Gibbon  gtagctttttag-a------------------------------------------acagtaattctt--
                       Rhesus  gtagcttttcag-a------------------------------------------acagtaattctt--
          Crab-eating macaque  gtagcttttcag-a------------------------------------------acagtaattctt--
                       Baboon  gtagcttttcag-a------------------------------------------acagtaattcct--
                 Green monkey  gtagcttttcag-a------------------------------------------acagtaattctt--
     Golden snub-nosed monkey  gtggcttttcag-a------------------------------------------acagtaattctt--
                     Marmoset  gtagctttttag-a------------------------------------------acagtaattctt--
              Squirrel monkey  gtagctttttag-a------------------------------------------acagcaattctt--
                      Tarsier  gtagctttttag-c------------------------------------------aaagtgattctt--
                     Bushbaby  gtagctttttag-c------------------------------------------atagtaattctt--
                   Tree shrew  gtagcttttgaaca------------------------------------------acggaattcctt--
                        Mouse  ttaattttttat-acatgaagaacctccctgtgtagctcaggttggcctcaaactgacaataatcctttc
                          Dog  gtagccacttag-c------------------------------------------acagtaatttgt--
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================

                        Human  ---------------------------------------------------gctttt
                        Chimp  ---------------------------------------------------gctttt
                       Bonobo  ---------------------------------------------------gctttt
                      Gorilla  ---------------------------------------------------gctttt
                    Orangutan  ---------------------------------------------------gctttt
                       Gibbon  ---------------------------------------------------gctttt
                       Rhesus  ---------------------------------------------------gctttt
          Crab-eating macaque  ---------------------------------------------------gctttt
                       Baboon  ---------------------------------------------------gctttt
                 Green monkey  ---------------------------------------------------gctttt
     Golden snub-nosed monkey  ---------------------------------------------------gctttt
                     Marmoset  ---------------------------------------------------gctttt
              Squirrel monkey  ---------------------------------------------------gctttt
                      Tarsier  ---------------------------------------------------gctttt
                     Bushbaby  ---------------------------------------------------gctttt
                   Tree shrew  ---------------------------------------------------acttt-
                        Mouse  tcagcctccagagttctggaactactatcatctatcactgtgccagggcaggttttt
                          Dog  ---------------------------------------------------gcttct
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  =========================================================

Inserts between block 28 and 29 in window
B D                  Tarsier 7151bp
B D                    Mouse 55bp

Alignment block 29 of 146 in window, 59298770 - 59298971, 202 bps 
B D                     Human  aaaggatctcaa--ttttattacaaaaatgtaagatcacctt-at--attgatttaactcta-catcagt
B D                     Chimp  aaaggatctcaa--ttttattacaaaaatgtaagatcacctt-at--attgatttaactcta-catcagt
B D                    Bonobo  aaaggatctcaa--ttttattacaaaaatgtaagatcacctt-at--attgatttaactcta-catcagt
B D                   Gorilla  aaaggatctcaattttttattacaaaaatgtaagatcacctt-at--attgatttaactcta-catcagt
B D                 Orangutan  aaagggtctcaa--ttttattacaaaaatgtaaaatcacttt-at--attgatttaactctg-catcagt
B D                    Gibbon  aaaggatctcaa--ttttattacaaaaatgtaaaatcacttt-at--attgatttacttcta-catcagt
B D                    Rhesus  aaaggatctcaa--ttttattaaaaaaatgtaaaatcacttt-at--aatgatttaattcta-tatcagt
B D       Crab-eating macaque  aaaggatctcaa--ttttattaaaaaaatgtaaaatcacttt-at--aatgatttaattcta-tatcagt
B D                    Baboon  aaaggatctcaa--ttttattaaaaaaatgtaaaatcacttt-at--aatgatttaattctg-tatcagt
B D              Green monkey  aaaggatctcaa--ttttattaaaaaaatgtaaaatcacttt-at--aatgatttaattcta-tatcagt
B D  Golden snub-nosed monkey  aaaggatctcaa--ttttattacaaaaatgtaaaatcacttt-at--attgatttaattcta-tattagt
B D                  Marmoset  aaaggatctcaa--ttttattataaaaatgtaaaatcacttt-at--attgatttaactcta-catcagt
B D           Squirrel monkey  aaaggatctcaa--ttttattataaaaatgtaaaatcacttt-at--attgatttaactcta-catcagt
B D                   Tarsier  aaatggttctga--ttttatt-taaaagtgtaaaatcacttt-ct--attgatttaactcaa-catcagt
B D                  Bushbaby  aaagcatcccaa--gtttattataaaaatataaaatcacttt--t--attaacttaattcta-cattcat
B D                Tree shrew  taagggtcacaa--ttctacaataaaa-tgcaaaactgccct-gt--taagactcaaccctagcatcctt
B D                     Mouse  ttgggatcattc--tttttctataaaaatataaaaacattttttt--gttcactaaaccata-tatcagt
B D                       Dog  aaacgatcctaa--tttcattatacaaatataaaatgacttt-ctagatagatttaatcctg--------
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          Proboscis monkey  ======================================================================

                        Human  gatcactgatga-aaaatataaaatttgtaagagt--------aaaggccacattacatgtaatcatgg-
                        Chimp  gatcactgatga-aaaatgtaaaatttataagagt--------aaaggccacattacatgtaatcatgg-
                       Bonobo  gatcactgatga-aaaatgtaaaatttataagagt--------aaaggccacattacatgtaatcatgg-
                      Gorilla  gaacactgatga-aaaatgtaaaatttgtaagagt--------aaaggccacattacatgtaatcatgg-
                    Orangutan  gaacactgatga-aaaatgtaaaatttgtaagagt--------aaaggccacattacatgtaatcatgg-
                       Gibbon  gaacactgatga-aaaatgtaaaatttgtaagagt---------aaggccacattacatgtaatcatgg-
                       Rhesus  gaacactgatga-aaaatgtaaaatttgtaagagt--------aaaggccacattacatgtaatcacgg-
          Crab-eating macaque  gaacactgatga-aaaatgtaaaatttgtaagagt--------aaaggccacattacatgtaatcacgg-
                       Baboon  gaacactgatga-aaaatgtaaaatttgtaagagt--------aaaggccacattacatgtaatcatgg-
                 Green monkey  gaacactgatga-aaaatgtaaaatttgtaagagt--------aaaggccacattacatgtaatcatgg-
     Golden snub-nosed monkey  gaacactgatga-aaaatgtaaaatttgtaagagt--------aaaggccacattacatgtaatcatgg-
                     Marmoset  gaacactgatga-aaaatgtaaaaatggtaagggt--------aaagaccatattacatgtaatcatgg-
              Squirrel monkey  gaacactgatga-aaaatgtaaatatggtaagagt--------aaagaccacattacatgtaatcatgg-
                      Tarsier  gaacactgatgagaaaatgtaaaaactgccagagt--------aaagaccacattaaatgtaatcatgg-
                     Bushbaby  aaacactgatga-aaaattttaaaactgtaagagt--------aaagaccccaataaacataatcatgg-
                   Tree shrew  gattaa-gatgc-aacattcaccacttccacatct--------aa------cactacattgtatcccaga
                        Mouse  gaatattgatta-aaaa-----aatttgtagatgtttactcatgaagaacacagtcagcatacccatgg-
                          Dog  --------atga-aaaatttaaaaactctcagatt--------caagaccacatgagatgtaatcatgg-
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================

                        Human  -aaaagaagca-gtgattga-tggcggaaatgcacaatga---tcttcctttcatggatattgttttg-c
                        Chimp  -aaaagaagca-gtgattga-tggcggaaatgcacaatga---tcttcctttcatggatattgttttg-c
                       Bonobo  -aaaagaagca-gtgattga-tggcggaaatgcacaatga---tcttcctttcatggatattgttttg-c
                      Gorilla  -aaaagaagca-gtgattga-tggcggaaatgcacaatga---tcttcctttcatggatattgttttg-c
                    Orangutan  -aaaagaagca-gtgattga-tggcggaaatgcataatga---tcttcctttcatggatattgttttg-a
                       Gibbon  -aaaagaagca-gtgattga-tggctgaaatgcacaatgatcttcttcttttcatggatattgttttg-a
                       Rhesus  --aaagaagca-gtgattga-tggcagaaatgcacaatga---tcttcctttcatggatatcgttttg-a
          Crab-eating macaque  --aaagaagca-gtgattga-tggcagaaatgcacaatga---tcttcctttcatggatatcgttttg-a
                       Baboon  --aaagaagca-gtgattga-tcgcagaaatgcacgatga---tcttcctttcatggatatcgttttg-a
                 Green monkey  --aaagaagca-gtgattga-tggcagaaatgcacaatga---tcttcctttcatggatatcgttttg-a
     Golden snub-nosed monkey  -aaaagaagca-gtgattga-tggcagaaatgcacgatga---tcttcctttcatggatatcgttttg-a
                     Marmoset  -aaaagaagca-gtgattga-tggcagaaatacacagtaa---tcttcctctcatggatattgtttgg-a
              Squirrel monkey  -aaaagaagca-gtgattga-tggcagaaatgcacagtaa---tcttcctttcatggacagcgtttga-a
                      Tarsier  --aataaaacc-atcactga-tggaagacatgcacaatga---tgttccccttgtggccatagttt-g-a
                     Bushbaby  -aaaagaagca-gtagttgg-tggaagaaatgtacaatga---tcttcctttcgtccacacattttgg-a
                   Tree shrew  taaaagaag-a-atcaccgc-tatccaacgtgcacaatat---cgttattttaatggaga--gtcttgca
                        Mouse  -gcaagaagcc-atgcttcactgggggaaaggcactatgg-----------------aggaaggcttg-a
                          Dog  -aaaagaagcaggtgattga-tggaagaaatgcaccatga---tcttctgttcaggcgcacggttttg-a
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================

                        Human  gaaattttgaactag
                        Chimp  gaaattttgaactag
                       Bonobo  gaaattttgaactag
                      Gorilla  gaaattttgaactag
                    Orangutan  gaaattttgaactgg
                       Gibbon  gaaattttgaactgg
                       Rhesus  gaaattttgaactgg
          Crab-eating macaque  gaaattttgaactgg
                       Baboon  gaaattttgaactgg
                 Green monkey  gaaattttgaactgg
     Golden snub-nosed monkey  gaaattttgaactgg
                     Marmoset  gacattttgaactgg
              Squirrel monkey  gaaattttgaactgg
                      Tarsier  gacacttggaaccag
                     Bushbaby  aaaatttggagctgg
                   Tree shrew  gatatttagagttgg
                        Mouse  gaaatttgcaactgg
                          Dog  gagatttagaactgg
                  Mouse lemur  NNNNNNNNNNNNNNN
             Proboscis monkey  ===============

Inserts between block 29 and 30 in window
B D                 Bushbaby 2bp
B D               Tree shrew 121bp

Alignment block 30 of 146 in window, 59298972 - 59299317, 346 bps 
B D                     Human  aaataaattaatggtttggctttaccttttctgattgggggaatatt-cattacaaactcgtcagaataa
B D                     Chimp  aaataaattaatggtttggctttatcttttctgattgagggaatatt-cattacaaactcgtcagaataa
B D                    Bonobo  aaataaattaatggtttggctttaccttttctgattgagggaatatt-cattacaaactcatcagaataa
B D                   Gorilla  aaataaattaatggtttggctttaccttttcagattgggggaatatt-cattacaaactcgtcagaataa
B D                 Orangutan  aaataaattaatggtttggctttaccttttcagattgggggaatatt-cattacaaactcgtcagaataa
B D                    Gibbon  aaataaattaatgatttggctttaccttttcagattgggggaatatt-cattacaaactcgtcagaataa
B D                    Rhesus  atataaattaatggtttggctttacgttttcagattgggggaatatt-cattacaaactcatcagaataa
B D       Crab-eating macaque  atataaattaatggtttggctttacgttttcagattgggggaatatt-cattacaaactcatcagaataa
B D                    Baboon  atataaattaatggtttggctttacgttttcagattggaggaatatt-cattacaaactcatcagaataa
B D              Green monkey  atataaattaatggtttggctttatgttttcagattgggggaatatt-cattacaaactcatcagaataa
B D  Golden snub-nosed monkey  atataaattaatggtttggctttaccttttcagattgggggaatatt-aattacaaactcatcagaataa
B D                  Marmoset  acataaattaatggtttggctttactgcttcagattggggaaatatt-cattacaaactcaacagaataa
B D           Squirrel monkey  acataaattaatggtttggctttacctcttcagattgggaaactatt-cgttacaaactcaacagaataa
B D                   Tarsier  atataaatgtatggctttcctctaccttttcagattg-ggaaatatc-aattacaaacccttcagaacaa
B D                  Bushbaby  atataaattaatggttctgctttgacttttcagactgggggaatatt-aattgtaaactcttcagaacta
B D                Tree shrew  atataagtgaatagctctgctttatca-ttcggattaggggaatattaaataacaaaattttcagaacaa
B D                     Mouse  tcaccaattaatcggccaggtatttcccttcaaa-tagagcaatatt-aatttttagtccttcttagcaa
B D                       Dog  atctagagtaatgggcctgctttaccttttcaggctgggtggatatt-aattataaactctttagaacaa
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          Proboscis monkey  ======================================================================

                        Human  agagg-aaaaatgtttttctacctaccatgtactttcttcagttcagctaaagaattgacctagttatcc
                        Chimp  agagg-aaaaatgtttttctacctaccatgtactttcttcagttcagctaaagaattgacctagttatcc
                       Bonobo  agagg-aaaaatgtttttctacctaccatgtactttcttcagttcagctaaagaattgacctagttatcc
                      Gorilla  agagg-aaaaatgtttttctacctgccatctactttcttcagttcagctaaagaattgacctagttatcc
                    Orangutan  agaggaaaaaatgtttttctacctaccatctactttcttcagttcagctaaagaattgacctagttatcc
                       Gibbon  agaggaaaaaatgtttttctacctaccatctactttcttcagttcagctaaagaattgacctagttatct
                       Rhesus  agaagaaaaaatgtttttctacctaccgtctactttcttcaattcagctaaagaattgacctagttatcc
          Crab-eating macaque  agaagaaaaaatgtttttctacctaccgtctactttcttcaattcagctaaagaattgacctagttatcc
                       Baboon  agaagaaaaaatgtttttctacctaccgtctactttcttcaattcagctgaagaattgacctagttttcc
                 Green monkey  agaagaaaaaatgtttttctgcctaccgtctactttcttcaattcagctaaagaattgacctagttatcc
     Golden snub-nosed monkey  agaggaaaaaatgtttttctacctatcgtctactttcttcaattcagctaaagaattgacctagttatcc
                     Marmoset  agaggaaaaaatgtttttctacctactatctactctcttcaa-tcagcccaagaattgacctagttatcc
              Squirrel monkey  agagg-aaaaatgcttttttacctactatctactctcttcaattcagccaaagaattgacccagttgtcc
                      Tarsier  agaggaaaagatatttttctgcctaccatctgctctcttcaactcaacaaaacaattgagctatt-----
                     Bushbaby  agaggaaaacat-tttttccacctaccatctatgctctttaattcagctaaagaactgtcttagttaact
                   Tree shrew  agaagagag-----ttccctgcct-ttgtttactgccttcaattcagt---ggaactgacctggct----
                        Mouse  agaaa-acagatatactttcaagtcctccttcttttcttcaact----taaagaactgacttagt-----
                          Dog  aaagaaaagatattttttctacctgtcgtctgctctcttcaattcagcaaaagaattggcataaatatcc
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================

                        Human  ttttggcttagctgtagctg--gggaggtagtgcactttttctttcagagagtcttgacttgttgggaaa
                        Chimp  ttttggcttagctgtagctg--gggaggtagtgcactttttctttcagagagtcttgacttgttgggaaa
                       Bonobo  ttttggcttagctgtagctg--gggaggtagtgcactttttctttcagagagtcttgacttgttgggaaa
                      Gorilla  ttttggcttagctgtagctg--gggaggtagtgcactttttctttcagagagtcttgacttgttgggaaa
                    Orangutan  ttttggcttaactgtagatg--gggaggtagtgcgctttttctttcagagagtcttgacttgttgggaaa
                       Gibbon  ttttggctaacctgtggctg--gggaggtagtgcactttttctttcagagagtcttgatttgttgggaaa
                       Rhesus  ttttggctgaactgtggctt--gggaggtagtgcatattttgtttcagagagtcttgatttgttgagaaa
          Crab-eating macaque  ttttggctgaactgtggctt--gggaggtagtgcatattttgtttcagagagtcttgatttgttgagaaa
                       Baboon  ttttggctgaactgtggctt--gggaggtagtgcatattttgtttcagagagtcttgatttgttgagaaa
                 Green monkey  ttttggctgaactgtggctt--gggagatagtgcacattttgtttcagagagtcttgatttgttgagaaa
     Golden snub-nosed monkey  ttttggctgaactgtggc-t--ggggggtagtgcacattttgtttcagagagtcttgatttgttgggaaa
                     Marmoset  ttttggctgaactgtggctg--gggaagtagtgcactttttattttggagagtcttgatttgttgggaaa
              Squirrel monkey  ttttggctgaactgtggctg--gggaggtactgcactttttatttcagagagtcttgatttgttgggaaa
                      Tarsier  ctttgtctgcaagctggttg--gaaaggtaatgcacttgctgtttcagaaagtcttaatctgtcatgaaa
                     Bushbaby  ttttggctgtatgatggct----ggaggtgatgtactttttgtttcagaaagtcttgatttgtcagaaaa
                   Tree shrew  -----------ctgaggttgccaggaagtaacgaacttttagtttccg--agttcggatttctcatgaag
                        Mouse  --ttcgcaacaaggtagt----gggaggtgatctactccatatttc----agccttgatttat-gtgaaa
                          Dog  ttttggctgcacagtggct---gggaagcaatgtacttgcagcttcagaaagtctccatttgtcagcgac
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================

                        Human  tatagatgtccattaattgagcttggttcaaatgtagaaacccacttgataaga-cccatgatagttga-
                        Chimp  tatagatgtccattaattgagcttggttcaaatgtagaaacccacttgataaga-cccatgatagttga-
                       Bonobo  tatagatgtccattaattgagcttggttcaaatgtagaaacccacttgataaga-cccatgatagttga-
                      Gorilla  tatagatgtccattaatttagcttggttcaaatgtagaaacccacttgataaga-cccatgatagttga-
                    Orangutan  tatagatgtccattaatttagcttggttcaaatgtagaaacccacttgataaga-cccatgatagttga-
                       Gibbon  tatagatgtccattaatttagcttggttcaaatgtagaaacccacttgataaga-cccatgatagttga-
                       Rhesus  tatagatgtccattaatttagcttggttcaaatgtagaaacccacttgataaga-cccatgatagttga-
          Crab-eating macaque  tatagatgtccattaatttagcttggttcaaatgtagaaacccacttgataaga-cccatgatagttga-
                       Baboon  tatagatgtccattaatttagcttggttcagatgtagaaacccacttgataaga-cccatgatagttga-
                 Green monkey  tatagatgtccattaatttagcttggttcaaatgtagaaacccacttgataaga-cccatgatagttga-
     Golden snub-nosed monkey  tatagatgtccattaatttagcttggttcaaatgtagaaacccacttgataaga-tccatgatagttga-
                     Marmoset  tacagatgtccattaatttagcttggttcagacaaagaaacacacttgataaga-cccatgatagttga-
              Squirrel monkey  tagagatatccattaatttagcttggttcaaatgtagaaacacacttgataaga-cccatgatagttga-
                      Tarsier  tacagacatccattaatt----ttgttccaaatgtagaaacccaagtgaaaaaa-ttcatagtagctggc
                     Bushbaby  tatagac-tctattcattgagcttggttcaaatgcagaaaccca---------------------gtga-
                   Tree shrew  tacagatgtccgttaactgagcttggttccgatgtagagactcatgtgacaaaagcccaaaccggttggc
                        Mouse  gaaaaataagcaataatc-------------------aaacatgtgtgacatga-ttagtggtcacttg-
                          Dog  cctcaacattctttaactgagcttggtacaaatggaggaagccaggtgacaaaa-cctatgatagctgac
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================

                        Human  catacaacctctgcttgcat----acggtcagtaatattgaattatttacttttcaaggaaatccatttt
                        Chimp  catacaacctctgcttgtat----atggtcagtaatattgaattatttacttttcaaggaaatccatttt
                       Bonobo  catacaacctctgcttgtat----atggtcagtaatattgaattatttacttttcaaggaaatccatttt
                      Gorilla  catacaacctctgcttgtat----atggtcagtaatattgaattatttacttttcaaggaaatccatttt
                    Orangutan  catacagcctctgcttgtat----atggtcagtaatattgaattatttattttccaaggaaatccatttt
                       Gibbon  catacagcctctgcttgtat----atggtcagtaatattgaattatttacttttcgaggaaatccatttt
                       Rhesus  catacagcttctgcttgtat----atggtcagtaatatggaattatttacttttcaaataaatccatttt
          Crab-eating macaque  catacagcttctgcttgtat----atggtcagtaatatggaattatttacttttcaaataaatccatttt
                       Baboon  catacagcttctgcttgtat----atggtcagtaatatggaattatttacttttcaacgaaatccatttt
                 Green monkey  catacagcttctgcttgtat----atggtcagtaatatggaattatttacttttcaacgaaatccatttt
     Golden snub-nosed monkey  catacagcctctgcttgtat----atggtcagtaatatggaattatttacttttcaaggaaatccatttt
                     Marmoset  catacagcctctgcttatat----aaggtca-taaaatggaactatttacttttcaaggaaacctatttt
              Squirrel monkey  catacagcctctgcttatat----aaggtcagtaaaatgggactatttacttttcaaggaaatctatttt
                      Tarsier  catataacctctgcttgtgt----atagtcagt---atagaattctttacttttcaaggaaattctcttc
                     Bushbaby  cct----------cttgt------------------atggaattatttaccttttaaggatatcgatttt
                   Tree shrew  catacggcctctgcacat-------tgatcaggaacgtggaattatctacttttcaggacaacccatttt
                        Mouse  c-tgcagattctgctcatgttcacatgccaggtaatggagaattatctgttcttctagaatacatatctt
                          Dog  cacacagcccctgcttatat----gtggttactgatacagaattactta--tttcaaggaaatccagttt
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================

                        Human  attttt
                        Chimp  attttt
                       Bonobo  attttt
                      Gorilla  attttt
                    Orangutan  attttt
                       Gibbon  attttt
                       Rhesus  attttt
          Crab-eating macaque  attttt
                       Baboon  attttt
                 Green monkey  attttt
     Golden snub-nosed monkey  attttt
                     Marmoset  attttt
              Squirrel monkey  tttttt
                      Tarsier  cttcct
                     Bushbaby  attttt
                   Tree shrew  acttct
                        Mouse  aaaccc
                          Dog  attttt
                  Mouse lemur  NNNNNN
             Proboscis monkey  ======

Inserts between block 30 and 31 in window
B D                  Tarsier 1360bp
B D               Tree shrew 1bp
B D                    Mouse 1bp
B D                      Dog 1bp

Alignment block 31 of 146 in window, 59299318 - 59299341, 24 bps 
B D                     Human  a--ataactcttactg-tagaatattc
B D                     Chimp  a--ataactcttactg-tagaatattc
B D                    Bonobo  a--ataactcttactg-tagaatattc
B D                   Gorilla  a--ataactcttactg-tagaatattc
B D                 Orangutan  a--ataactcttactg-tagaatattc
B D                    Gibbon  a--ataactcttactg-tagaattttc
B D                    Rhesus  a--ataactcttactg-tagaatattc
B D       Crab-eating macaque  a--ataactcttactg-tagaatattc
B D                    Baboon  a--ataactcttactg-tagaatattc
B D              Green monkey  a--ataactcttactg-tagaatattc
B D  Golden snub-nosed monkey  a--ataactcttactg-tagaatattc
B D                  Marmoset  g--ataaatcgaaatg-tagaatattc
B D           Squirrel monkey  at-ataactcttaatg-tagaatattc
B D                  Bushbaby  -atgtaactctcattacttgaatgttc
B D                Tree shrew  a--ataactcctattgttagaatattc
B D                     Mouse  --gatagttcttatggctacaagc---
B D                       Dog  a--ataattcttattgttagcatgttc
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          Proboscis monkey  ===========================
B D                   Tarsier  ===========================

Inserts between block 31 and 32 in window
B D                 Bushbaby 110bp

Alignment block 32 of 146 in window, 59299342 - 59299682, 341 bps 
B D                     Human  ttctttttaaaatcaaacttaaaac-----tgcttctctgtaacttccaacctttgcatttggttctgct
B D                     Chimp  ttctttttaaaatcaaacttaaaac-----tgcttctctgtaacttccaacctttgcatttggttctgct
B D                    Bonobo  ttctttttaaaatcaaacttaaaac-----tgcttctctgtaacttccaacctttgcatttggttctgct
B D                   Gorilla  ttctttttaaaatcaaactcaaaac-----tgcttctctgtaacttccagcctttgcatttggttctgct
B D                 Orangutan  ttctttttaaaatcaaactcaaaac-----tgcttctctgtaatttccaatctttgcatttggttctgct
B D                    Gibbon  ttctttttaaaatcaaactcaaaat-----tgcttctctgtaatttccaacttttgcatttggttctgct
B D                    Rhesus  ttctttttaaaatcaaactcgaaac-----tgcttctctgaaatttccaacctttgcatttggttctgct
B D       Crab-eating macaque  ttctttttaaaatcaaactcgaaac-----tgcttctctgaaatttccaacctttgcatttggttctgct
B D                    Baboon  ttctttttaaaatcaaactcgaaac-----tgcttctctgaaatttccaacctttgcgtttggttctgct
B D              Green monkey  ttctttttaaaatcaaactcgaaac-----tacttctccgaaatttccaacctttgcatttggttctgct
B D  Golden snub-nosed monkey  ttctttttaaaatcaaactcgaaac-----tgcttctctgaaatttccaacctttacatttggttctgct
B D                  Marmoset  ttctttttaaaatcaaactc-aaac-----tgcttctctgtaattttcaacccttgcattttgttctgct
B D           Squirrel monkey  ttctttttaaaatcaaactcaaaac-----tgcttctctgtagttttcaacccttgcatttggttctgct
B D                  Bushbaby  ttcttttaaaaatcaaactctaaacaacaatacttccgtgtggtgtccaaccctgacatttggttctgct
B D                Tree shrew  ---ttttt---attaaacccaaaac-----tgcttctctgtgatttccaccctgtgccttgggttctgct
B D                     Mouse  ttctttctataac--acttaaaaac-----t--ttccttgccatgtccaattcttccatgt-gtgctgct
B D                       Dog  -----tttctaatcaaacacaaaac-----tgcttctctataattttcaactcttacatttggttctgct
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          Proboscis monkey  ======================================================================
B D                   Tarsier  ======================================================================

                        Human  ttctggaacatcattgaataaactgaattt---------------------------cacatggagacta
                        Chimp  ttctggaacatcattgaataaactgaattt---------------------------cacatggagacta
                       Bonobo  ttctggaacatcattgaataaactgaattt---------------------------cacatggagacta
                      Gorilla  ttctggaacatcattgaataaactgaattt---------------------------cacatggagacta
                    Orangutan  ttctggaacatcattgaataaactgaattt---------------------------cacatggagacta
                       Gibbon  ttctggaacatcattgaataaactgaattt---------------------------cacatggagacta
                       Rhesus  ttctggaacatcattgaataaactgcattt---------------------------cacttggagacta
          Crab-eating macaque  ttctggaacatcattgaataaactgcattt---------------------------cacttggagacta
                       Baboon  ttctggaacatcattgaataaactgcattt---------------------------cacatggagacta
                 Green monkey  ttctggaacatcattgaataaactgcattt---------------------------cacatggagacta
     Golden snub-nosed monkey  ttctggaacatcattgaataaactgcattt---------------------------cacatggagacta
                     Marmoset  ttctgaaatatcactgaataaattgaattt---------------------------tacatggagacta
              Squirrel monkey  ttctgaactatcattgaataaattgaattt---------------------------cacatggagacta
                     Bushbaby  ttccgaaatgtcattgaatacattgaattt---------------------------cacgtggaaaata
                   Tree shrew  ttctgcaacatcattaaataaatcaaattg---------------------------cacatggaaattg
                        Mouse  ttctaaaa-gtcatcaaataaaatgaattt---------------------------cacatggagac--
                          Dog  ttctggaccatcattgaataaattgaattttacatgttgactattcacatatgtggctacatggaggcta
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================
                      Tarsier  ======================================================================

                        Human  ttca---tatatgtggcatgctgatttttcaattcaaatattccaagcttcttcagctattcctcatatg
                        Chimp  ttca---tatatgtggcatgctgatttttcaattcaaatattccaagcttcttcagctattcctcatatg
                       Bonobo  ttca---tatatgtggcatgctgatttttcaattcaaatattccaagcttcttcagctattcctcatatg
                      Gorilla  ttca---tatatgtggcatgctgatttttcaattcaaatattccaagcttcttcagctattcctcatatg
                    Orangutan  ttca---tatatgtggcatgctgatttttcaattcaaatattccaagcttctttagcttttcctcatatg
                       Gibbon  ttca---tatatgtggcatgctgatttttcaattcaaatattccaagcttcttcaggtgttcctcatatg
                       Rhesus  ttca---tatatgtggcatgctgatttttcaaatcaaatattccaagcttcttcagcagttcctcatatg
          Crab-eating macaque  ttca---tatatgtggcatgctgatttttcaaatcaaatattccaagcttcttcagcagttcctcatatg
                       Baboon  ttca---tatatgtggcatgctgatttttcaaatcaaatattccaagcttcttcagcagttcctcatatg
                 Green monkey  ttca---tatatgtggcatgctgatttttcaaatcaaatattccaagcttcttcagcagttcctcatatg
     Golden snub-nosed monkey  ttta---tatatgtggcatgctgatttttcaaatcaaatattccaagcttcttcagcagttcctcatatg
                     Marmoset  ttca---tatatgtggcatgctgatttttcaaatcaaatattccaaggttcttctgttgttcctcatatg
              Squirrel monkey  ttca---tatacgtggcatgctgatttttcaaatcaaatataataaggtttttccgctgttcctcatacg
                     Bushbaby  ttcatactatatgtgacatactgatttttcacatcaaacattccaagcttc---------tccttatatg
                   Tree shrew  ttca---tataagcatcttgctcgctttccaaatcaaacat-ccatgtttactttacttttcctcatacg
                        Mouse  ttca---tatatgt-------ttgtgttataaatccaacgcttaatgtttcttctgctgtttctcccctg
                          Dog  atca---tatatgtggcatgctagattttgaaatcacatgttctgagcttcttgagctgcttgtcatatg
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================
                      Tarsier  ======================================================================

                        Human  taatggttgagggatttgtc-ttt--tttgctgctcttttgatgtcttctagattgcc-aatgtttttcc
                        Chimp  taatggttgagggatttgtc-ttt--tttgctgctcttttgatgtcttctagattgcc-aatgtttttcc
                       Bonobo  taatggttgagggatttgtc-ttt--tttgctgctcttttgatgtcttctagattgcc-aatgtttttcc
                      Gorilla  taatggttgagggatttgtc-ttt--tttgctgctcttttgatgtcttctagattgcc-aatatttttcc
                    Orangutan  taatggttgagggatttgtc-ttt--tttgctgctcttttgacgtcttctagattgcc-aatgtttttcc
                       Gibbon  taatggttgagggatttgtc-ttt--tttgctgctcttttgatgtcttctagatcgcc-aatgtctttac
                       Rhesus  taatggtcgagggatttgcc-ttt--tttgcccctcttttgatgtcttctagattgccaaatgtctttcc
          Crab-eating macaque  taatggtcaagggatttgcc-ttt--tttgcccctcttttgatgtcttctagattgccaaatgtctttcc
                       Baboon  taatggttgagggatttgcc-ttt--tttgcccctcttttgatgtcttcaagattgccaaatgtctttcc
                 Green monkey  taatggtcaagggatttgcc-ttt--tttgcccctcttttgatgtcttctagattgccaaatgtctttcc
     Golden snub-nosed monkey  taatggttgagggatttggc-ttt--tttgcccctcttttgatgtcttctagattgccaaatgtctttcc
                     Marmoset  taatcgttgagggacttgtc-ttt--tttgcccctcttttgatgtcttctagattgcc-aatatctttcc
              Squirrel monkey  taattgttgagggacttgcctttt--tttgcccttcttttgatgtcttctagattgcc-aatgtctttcc
                     Bushbaby  tag-------------tatc-ttt--tttgcctctctttccatgtgctctaaattgtc-catgcctttcc
                   Tree shrew  taatagt---------tgtc-ttt--gt-----ctctctggataccctttagattatc-aatgtctttca
                        Mouse  ttcaggcagagagatgtttc-cat--ct-----ctcttcagatgctatctggacagcc-attccctatct
                          Dog  taatgatcgaggcactggtc-ttttgttcacctctcttgggatgagctctggattgcc-agtgtctttcc
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================
                      Tarsier  ======================================================================

                        Human  tatgg-aatacttg---------------gcagaactgaaa--a---tgcatc-----------------
                        Chimp  tatgg-aatacttg---------------gcagaactgaaa--a---tgcatc-----------------
                       Bonobo  tatgg-aatactcg---------------gcagaactgaaa--a---tgcatc-----------------
                      Gorilla  tatgg-aatacttg---------------gcagaactgaaa--a---tgcatc-----------------
                    Orangutan  tatgg-aatacttg---------------gcagaactgaaa--a---tgcatc-----------------
                       Gibbon  tatgg-aatacttg---------------gcagaactgaaa--a---tgtaac-----------------
                       Rhesus  tatgg-aatacttg---------------gcagaactaaaa--a---tgtatc-----------------
          Crab-eating macaque  tatgg-aatacttg---------------gcagaactaaaa--a---tgtatc-----------------
                       Baboon  tatgg-aatacttg---------------ccagaactaaaa--a---tgtagc-----------------
                 Green monkey  tatgg-aatacttg---------------gcagaactaaaa--a---tgtatc-----------------
     Golden snub-nosed monkey  tatgg-aatacttg---------------gcagaactaaaa--a---tgtatc-----------------
                     Marmoset  tatgg-aatacttg---------------gcagaactaaaa-ta---tatatc-----------------
              Squirrel monkey  tatgg-aatacttg---------------gcagaactaaag-ta---cgtatc-----------------
                     Bushbaby  tatgg-aacgctggaacttacatacacacacacatatacat--a---tgtatacatatatacactatttt
                   Tree shrew  taagg-cacactgt---------------ccagaaccaaaa-aa---tgtatc-----------------
                        Mouse  -------gtgcttg---------------ggctaaatataa--aatttaaatg-----------------
                          Dog  taaggttacactag---------------tcagagctaaatata---tgtatc-----------------
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================
                      Tarsier  ======================================================================

                        Human  -----------------------------taaatgtgatctgaataataaaaagtagaatggatctctca
                        Chimp  -----------------------------taaatgtgatctgaataataaaaagtagaatggatctctca
                       Bonobo  -----------------------------taaatgtgatttgaataataaaaagtagaatggatctctca
                      Gorilla  -----------------------------taaatgtgatctgaataataaaaagtagaatggatctctca
                    Orangutan  -----------------------------taaatgtgatctgaataataaaaagtagaaaggatctctca
                       Gibbon  -----------------------------taaatgtgatctgaataataaaaagtagaatggatctctca
                       Rhesus  -----------------------------taaatgtgatctgaataataaaaaatagaatggatctctca
          Crab-eating macaque  -----------------------------taaatgtgatctgaataataaaaaatagaatggatctctca
                       Baboon  -----------------------------taaatgtgatctgaataataaaaaatggaatgaatctctca
                 Green monkey  -----------------------------taaatgtgatctgaataataaaaaatagaatggatctctca
     Golden snub-nosed monkey  -----------------------------taaatgtgatctgaataataaaaaatagaatggatctctca
                     Marmoset  -----------------------------tgaatgtgagatgaatagtaaagagtagaacgtatctctca
              Squirrel monkey  -----------------------------tgaatgtgatatgaat--------------tttctctctca
                     Bushbaby  aaatttcacattaactttatggacacctgtatatgtcatctgaataatggagaatataatggatct----
                   Tree shrew  -----------------------------caaatgttgtctaaataataaagaaca-aatgtgtcttcca
                        Mouse  -----------------------------taaatgccatataagtaacaaagagaataatgaagatcatt
                          Dog  -----------------------------caaatgtcagctgagtaacaaagagtgtgatggttctttca
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================
                      Tarsier  ======================================================================

                        Human  cctcctttaatatacaagccatac-ttc
                        Chimp  cctcctttaatatacaagccatac-ttc
                       Bonobo  cctcctttaatatacaagccatac-ttc
                      Gorilla  cctcctttaatatgcaagccatac-tta
                    Orangutan  cctcctttaatatccaagccatac-ttc
                       Gibbon  cctcctttaatatgcaagctgtac-ttt
                       Rhesus  cctc--ttaatatgcaagccataa-ttt
          Crab-eating macaque  cctc--ttaatatgcaagccataa-ttt
                       Baboon  cttc--ttgatatgcaagccatactttt
                 Green monkey  cctc--ttaatatgcaagccatac-ttt
     Golden snub-nosed monkey  cctc--ttaatatgcaagccatactttt
                     Marmoset  cctcctttagtatgcaaggcatac-ttc
              Squirrel monkey  cctcctttagtatgcaaggcatac-ttc
                     Bushbaby  -ttcctttaatctgcgcactatac-ttc
                   Tree shrew  cctcctttaatgtgcaaactatac-tac
                        Mouse  catcc-acaacatgtgtgc---ac-ttc
                          Dog  ccgcctttgatctgaaaaccctac-ttc
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ============================
                      Tarsier  ============================

Alignment block 33 of 146 in window, 59299683 - 59299684, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                    Bonobo  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  tt
B D                    Rhesus  at
B D       Crab-eating macaque  at
B D                    Baboon  at
B D              Green monkey  tt
B D  Golden snub-nosed monkey  tt
B D                  Bushbaby  tt
B D                Tree shrew  tt
B D                     Mouse  at
B D                       Dog  --
B D                  Marmoset  --
B D               Mouse lemur  NN
B D          Proboscis monkey  ==
B D                   Tarsier  ==
B D           Squirrel monkey  --

Inserts between block 33 and 34 in window
B D                 Bushbaby 822bp

Alignment block 34 of 146 in window, 59299685 - 59299691, 7 bps 
B D                     Human  ttattat--
B D                     Chimp  ttatcat--
B D                    Bonobo  ttatcat--
B D                   Gorilla  ttattat--
B D                 Orangutan  tttttat--
B D                    Gibbon  tt---at--
B D                    Rhesus  tt---at--
B D       Crab-eating macaque  tt---at--
B D                    Baboon  tt---at--
B D              Green monkey  tt---at--
B D  Golden snub-nosed monkey  tt---at--
B D                Tree shrew  --gtaat--
B D                     Mouse  --ctgatag
B D                       Dog  ---------
B D                  Marmoset  ---------
B D               Mouse lemur  NNNNNNNNN
B D          Proboscis monkey  =========
B D                  Bushbaby  =========
B D                   Tarsier  =========
B D           Squirrel monkey  ---------

Alignment block 35 of 146 in window, 59299692 - 59299692, 1 bps 
B D                     Human  -g
B D                     Chimp  -g
B D                    Bonobo  -g
B D                   Gorilla  -g
B D                 Orangutan  -g
B D                    Gibbon  -g
B D                    Rhesus  -t
B D       Crab-eating macaque  -t
B D                    Baboon  -t
B D              Green monkey  -t
B D  Golden snub-nosed monkey  -t
B D                     Mouse  c-
B D                       Dog  --
B D                  Marmoset  --
B D               Mouse lemur  NN
B D          Proboscis monkey  ==
B D                  Bushbaby  ==
B D                Tree shrew  ==
B D                   Tarsier  ==
B D           Squirrel monkey  --

Alignment block 36 of 146 in window, 59299693 - 59300380, 688 bps 
B D                     Human  ttt--ttgttttttaattatactttaagttctgggatacatgtgcagaatgtgcaggtttgtaacatagg
B D                     Chimp  ttt--ttgttttttaattatactttaagttctgggatacatgtgcagaatgtgcaggtttgtaacatagg
B D                    Bonobo  ttt--ttgttttttaattatactttaagttctgggatacatgtgcagaatgtgcaggtttgtaacatagg
B D                   Gorilla  ttt--ttgttttttaattatactttaagttctgggatacatgtgcagaatgtgcaggtttgtaacatagg
B D                 Orangutan  ttt--tatttttttaattatactttaagttctgggatacatgtgcagaacgtgcaggtttgtaacatagg
B D                    Gibbon  tgt--ctttttttaaattatactttaagttctgggatacatgtacagaatgtgcaggtttgtaacataag
B D                    Rhesus  tat--ttatttttaaattatactttaagttctgggatacacgtgcagaatgtgcaggtttgtagcatagg
B D       Crab-eating macaque  tat--ttatttttaaattatactttaagttctgggatacatgtgcagaatgtgcaggtttgtagcatagg
B D                    Baboon  tattatttttttaaaattatactttaagttctgggatacatgtgcagaacgtgcaggtttgttacatagg
B D              Green monkey  tat--ttattttttaattatgctttaagttctgggatacatgtgcagaatgtgcaggtttgtagcataag
B D  Golden snub-nosed monkey  tattatttttttaaaactatactttaagttctgggatacatgtgcataatgtgcaggtttgtagcatagg
B D                     Mouse  ----------------------------------------------------------------------
B D                       Dog  ----------------------------------------------------------------------
B D                  Marmoset  ----------------------------------------------------------------------
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          Proboscis monkey  ======================================================================
B D                  Bushbaby  ======================================================================
B D                Tree shrew  ======================================================================
B D                   Tarsier  ======================================================================
B D           Squirrel monkey  ----------------------------------------------------------------------

                        Human  -----tatacacatgccatggtggtttgctgcacccatcaacccgtcatctacattagatatttctccca
                        Chimp  -----tatacacatgccatggtggtttgctgcacccatcaacccgtcatctacattagatatttctccca
                       Bonobo  -----tatacacatgccatggtggtttgctgcacccatcaacccgtcatctacattagatatttctccca
                      Gorilla  -----tatacacgtgccatggtggtttgctgcacccatcaacccgtcatctacattagatatttctccca
                    Orangutan  -----tatacacgtgccatggtggtttgctgcacccatcaacccatcatctacattagatatttctcgca
                       Gibbon  -----tatacacgtgccatagtggtttgccgcacccatcaacccgtcatctacattaggtatttctccca
                       Rhesus  ttagatatacacgtggcatggtggtttgctgcacccatcaaaccattatctacattaggtatttctccta
          Crab-eating macaque  -----tgtacacgtgccatggtggtttgctgcacccatcaaaccattatctacattaggtatttctccta
                       Baboon  -----tatacacgtgccatggtggtttgctgcacccatcaacccgttatctacattaggtatttctccta
                 Green monkey  -----tgtacacgtgccatggtggtttgctgcacccatcaaaccattatctacattaggtatttctccta
     Golden snub-nosed monkey  -----tatacacgtgccatggtggtttactgcacccatcaacccgttgtctacattaggtatttctccta
                        Mouse  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================
                     Bushbaby  ======================================================================
                   Tree shrew  ======================================================================
                      Tarsier  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------

                        Human  gtactatccctcccctagccctcca-cccgccgacaggccctggtgtgtgatattcccctccctgtgtcc
                        Chimp  gtactatccctcccctagccctcca-cccgccgacaggccctggtgtgtgatattcccctccctgtgtcc
                       Bonobo  gtactatccctcccctagccctcca-cccgccgacaggccctggtgtgtgatattcccctccctgtgtcc
                      Gorilla  gtactatccctcccctagccctcca-cccgctgacaggccctggtgtgtgatattcccctccctgtgtcc
                    Orangutan  atactatccctcccctagccctcca-cccgccgacaggccctggtgtgtgatattcccctccctgtgtcc
                       Gibbon  atactatccctcccctagccctcca-cccgccgacaggtcctggtgtgtgatattcccctctctgtgtcc
                       Rhesus  atactgtctctcccctagccctcca-cccactgacaggccccggtgtgtgatgttcccctccctgtgtcc
          Crab-eating macaque  atactgtctctcccctagccctcca-cccactgacaggccccggtgtgtgatgttcccctccctgtgtcc
                       Baboon  atactgtctctcccctagccctcca-cccactgacaggccccagtgtgtgatgttcccctctctgtgtcc
                 Green monkey  atactgtctctcccctagccctcca-cccactgacaggccccggtgtgtgatgttcccctccctgtgtcc
     Golden snub-nosed monkey  atactgtctctcccctagctcttcaccccactgacaggcccctgtgtgtgatattcccctccctgtgtcc
                        Mouse  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================
                     Bushbaby  ======================================================================
                   Tree shrew  ======================================================================
                      Tarsier  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------

                        Human  gtgtgttctcattgttcaactcccacttatgagtgagaacatgcggtgtttggttttctgttactgtgtt
                        Chimp  atgtgttctcattgttcaactcccacttatgagtgagaacatgcggtgtttggttttctgttactgtgtt
                       Bonobo  atgtgttctcattgttcaactcccacttatgagtgagaacatgcggtgtttggttttctgttactgtgtt
                      Gorilla  gtgtgttctcattgttcaactcccacttatgagtgagaacatgcggtgtttggttttctgttactgtgtt
                    Orangutan  atgtgttctcgttgttcaactcccacttatgagtgagaacatgtggtgtttggttttctgttactgtgtt
                       Gibbon  atgtgttctcattgttcagctcccacttatgagtgagaacatgtggtgtttggttttctgttactgtgtt
                       Rhesus  atgtgttctcattgttcagctcccacttatgaataagaacatgtggtgtttggttttctgttcttgtgtt
          Crab-eating macaque  atgtgttctcattgttcagctcccacttatgaataagaacatgtggtgtttggttttctgttcttgtgtt
                       Baboon  atgtgttctcattgttcaactcccacttatgagtgaaaacatgcggtgtttggttttctgttcttgtgtt
                 Green monkey  atgtgttctcattgttcagctcccacttatgaataagaacatgcggtgtttggttttctgttcttgtgtt
     Golden snub-nosed monkey  atgtgttctcattgttcagctcccacttatgagtgagaacatgtggtgtttgtttttctgttcttgtgtc
                        Mouse  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================
                     Bushbaby  ======================================================================
                   Tree shrew  ======================================================================
                      Tarsier  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------

                        Human  agttagctgagaatgatggtttccagcttcatccatgtccctgcaaaggacatgaactcatcctttttta
                        Chimp  agttagctgagaatgatggtttccagcttcatccatgtccctgcaaaggacatgaactcatcctttttta
                       Bonobo  agttagctgagaatgatggtttccagcttcatccatgtccctgcaaaggacatgaactcatcctttttta
                      Gorilla  agtttgctgagaatgatggtttccagcttcatccatgtccctgcaaaggacatgaactcatcctttttta
                    Orangutan  agtttgctgagaatgatggtttccagcttcatccatgtccctgcaaaggacatgaactcatcctttttta
                       Gibbon  agtttgctgagaatgatggtttccatctccatccatgtccctgcaaaagacatgaactcatcctttttta
                       Rhesus  tgtttgctgagaatgatggtttccaacttcatccatgtccctgcagaggacatgaactcatcctttttta
          Crab-eating macaque  tgtttgctgagaatgatggtttccaacttcatccatgtccctgcagaggacatgaactcatcctttttta
                       Baboon  tgtttgctgagaatgatggtttccaacttcatccatgtccctgcagaggacatgaactcatcctttttta
                 Green monkey  tgtttgctgagaatgatggtttccaacttcatccgtgtccctgcagaggacatgaactcatcctttttta
     Golden snub-nosed monkey  tgtttgctgagaatgatggtttccaacttcatccatgtccctgcagaggacatgaactcatccattttta
                        Mouse  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================
                     Bushbaby  ======================================================================
                   Tree shrew  ======================================================================
                      Tarsier  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------

                        Human  tggctgcatagtattccatggtgtatgtgtgccacattttctttatccagtctatcattgatgggcattt
                        Chimp  tggctgcatagtattccatggtgtatgtgtgccacattttctttatccagtctatcattggtgggcattt
                       Bonobo  tggctgcatagtattccatggtgtatgtgtgccacattttctttatccagtctatcattggtgggcattt
                      Gorilla  tggctgcatagtattccatggtgtatgtgtgccacattttctttatccagtctatcattgatgggcattt
                    Orangutan  tggctgcatagtattccatagtgtatgtgtgccacattttctttatccagtctatcattgataggcattt
                       Gibbon  tggctgcatagtattccatggtgtatgtgtcccacattttctttatccaatctatcattgatgggcattt
                       Rhesus  tggttgcatagtattccatggtgtatatgtagcacattttctttatccagtctatcattgatgggcat--
          Crab-eating macaque  tggttgcatagtattccatggtgtatatgtagcacattttctttatccagtctatcattgatgggcat--
                       Baboon  tggttgcatagtattccatggtgtatatgtagcacattttctttttccagtctatcattgatgggcat--
                 Green monkey  tggttgcatagtattccatggtgtatatgtagcacattttctttatccagtctatcattgatgggcat--
     Golden snub-nosed monkey  tggctgcatagtattccatggtgtatatgtagcacattttctttatccagtctatcattgatgtgcat--
                        Mouse  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================
                     Bushbaby  ======================================================================
                   Tree shrew  ======================================================================
                      Tarsier  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------

                        Human  gggttggttccaagtctttgctattgtgaacagtgttgcaataaacatacgtgtgcatgtgtgtttatag
                        Chimp  gggttggttccaagtctttgctattgtgaacagtgttgcaataaacatacgtgtgcacgtgtgtttataa
                       Bonobo  gggttggttccaagtctttgctattgtgaacagtgttgcaataaacatacgtgtgcacgtgtgtttataa
                      Gorilla  gggttggttccaagtctttgctattgtgaacagtgttgcaataaacatacgtgtgcatgtgtgtttatag
                    Orangutan  gggttggttccaagtctttgctattgtgaacagtgttgcaataaacatatgtgtgcatgtgtgtttatag
                       Gibbon  gggttggttccaagtctttgctattgtgaatagtgttgcaataaacatacgtgtgcatgtgtgtttatag
                       Rhesus  ---ttggttccaagtctttgctgttgtgaacagtgttgcaataaacatacgtgtgcatgtgtctttatag
          Crab-eating macaque  ---ttggttccaagtctttgctgttgtgaacagtgttgcaataaacatacgtgtgcatgtgtctttatag
                       Baboon  ---ttggttccaagtctttgctgttgtgaacagtgttgcaataaacatacgtgtgcatgtgtc-------
                 Green monkey  ---ttggttccaagtctttgctgttgtgaacagtgttgcaataaacatatgtgtgcatgtgtctttatag
     Golden snub-nosed monkey  ---ttggttctaagtctttgctgttgtgaacagtgttgcaataaacatacgtgtgcctgtgtctttatag
                        Mouse  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================
                     Bushbaby  ======================================================================
                   Tree shrew  ======================================================================
                      Tarsier  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------

                        Human  taagattatttataatcgtttgggtatatactcagtaatgggattgctgggtcaaatggta--tttctgc
                        Chimp  taggattatttataatcgtttgggtatatactcagtaatgggattgctgggtcaaatggta--tttctgc
                       Bonobo  taggattatttataatcgtttgggtatatactcagtaatgggattgctgggtcaaatggta--tttctgc
                      Gorilla  taggattatttataattgtttgggtatatactcagtaatgggattgctgggtcaaatggta--tttctgt
                    Orangutan  taggattatttataatcgtttgggtatatactcagtaatgggattcctgggtcaaatggta--tttctgc
                       Gibbon  tagaattatttataatcctttgggtatatactcagtaatgggattgctgggtcaaatggta--tctctgc
                       Rhesus  tagaatgatttataatcctttgggtatatactcagtaatgggatcactgggtcaaatggtatttttctgc
          Crab-eating macaque  tagaatgatttataatcctttgggtatatactcagtaatgggatcactgggtcaaatggtatttttctgc
                       Baboon  -agaatgatttgtaatcctttgggtatatactcagtaatgggatcactgggtcaaatggtatttttctgc
                 Green monkey  tagaatgatttataatcctttgggtatatactcagtaatgggatcactgggtcaaatggtatttttctgc
     Golden snub-nosed monkey  tagaatgacttataatcctttgggtatatactcagtaatgggatcaccaggtcaaatggtatttttctgc
                        Mouse  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================
                     Bushbaby  ======================================================================
                   Tree shrew  ======================================================================
                      Tarsier  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------

                        Human  ttctagatccttgaggaatca-cacactgttttccacaatggttgaactaatttacattcccaccaacag
                        Chimp  ttctagatccttgaggaatca-cacactgttttccacaatggttgaactaatttacattcccaccaacag
                       Bonobo  ttctagatccttgaggaatca-cacactgttttccacaatggttgaactaatttacattcccaccaacag
                      Gorilla  ttctagatccttgaggaatcg-cacactgttttccacaatggttgaactaatttacactcccaccaacag
                    Orangutan  ttctagatccttgaggaatca-cacactgttttccacaatggttgaactaatttacactcccaccaacag
                       Gibbon  tgctagatccttgaggaatca-cacactgtcttccacaatggttgaactaatttacactcccaccaacgg
                       Rhesus  ttctagatccttgaggaatcaccacacagtcttccacaatggttgaactaatttacactcccaccaacag
          Crab-eating macaque  ttctagatccttgaggaatcaccacacagtcttccacaatggttgaactaatttacactcccaccaacag
                       Baboon  ttctagatccttaaggaatcaccacactgtcttccacaatggttgaactaatttacactcccaccaacag
                 Green monkey  ttctagatccttgaggaatcaccacactgtcttccacaatggttgaactaatttacactcccaccaacag
     Golden snub-nosed monkey  ttctagatccttgagaaatcaccacactgtcttccacagtggttgaactaatttacactcccaccaacag
                        Mouse  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  ======================================================================
                     Bushbaby  ======================================================================
                   Tree shrew  ======================================================================
                      Tarsier  ======================================================================
              Squirrel monkey  ----------------------------------------------------------------------

                        Human  tgtagaagcattcctatttctccacatcctctccagcatctgttgtttcctgactttttaatgattgcc
                        Chimp  tgtagaagcgttcctatttctccacatcctctccagcatctgttgtttcctgactttttaatgattgcc
                       Bonobo  tgtagaagcgttcctatttctccacatcctctccagcatctgttgtttcctgactttttaatgattgcc
                      Gorilla  tgtagaagtgttcctatttctccacatcctctccag-atctgttgtttcctgactttttaatgattgcc
                    Orangutan  tgtagaagcgttcctatttctccacatcctctccagcatctgttgtttcctgactttttaatggttgcc
                       Gibbon  tgtagaagccttcctatttctccacatcctctccagcatctgttgtttcctgactttttaatgattgcc
                       Rhesus  tgtaaaagcggtactatttctccatatcctttccagcatctgttgtttcctgactttttaataattgcc
          Crab-eating macaque  tgtaaaagcgatactatttctccatatcctttccagcatctgttgtttcctgactttttaataattgcc
                       Baboon  tgtaaaagcgatactatttgtccacatcctttccagcatctgttgtttcctgactttttaatgattgcc
                 Green monkey  tgtaaaagcgatactatttctccacatcctttccagcatctgttgtttcctgactttttaatgattgcc
     Golden snub-nosed monkey  tgtaaaagcgatactatttatccacatcctttccagcatctgttgtttcctgacttttaaatgattgcc
                        Mouse  ---------------------------------------------------------------------
                          Dog  ---------------------------------------------------------------------
                     Marmoset  ---------------------------------------------------------------------
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Proboscis monkey  =====================================================================
                     Bushbaby  =====================================================================
                   Tree shrew  =====================================================================
                      Tarsier  =====================================================================
              Squirrel monkey  ---------------------------------------------------------------------

Alignment block 37 of 146 in window, 59300381 - 59300385, 5 bps 
B D                     Human  attta
B D                     Chimp  attta
B D                    Bonobo  attta
B D                   Gorilla  attta
B D                 Orangutan  atttc
B D                    Gibbon  acttc
B D                    Rhesus  acttt
B D       Crab-eating macaque  acttc
B D                    Baboon  acttc
B D              Green monkey  acttc
B D  Golden snub-nosed monkey  acttc
B D                   Tarsier  acttt
B D                     Mouse  -----
B D                       Dog  -----
B D                  Marmoset  -----
B D               Mouse lemur  NNNNN
B D          Proboscis monkey  =====
B D                  Bushbaby  =====
B D                Tree shrew  =====
B D           Squirrel monkey  -----

Alignment block 38 of 146 in window, 59300386 - 59300395, 10 bps 
B D                     Human  ttataatgta
B D                     Chimp  ttataatgta
B D                    Bonobo  ttataatgta
B D                   Gorilla  ttataatgta
B D                 Orangutan  ttataatgta
B D                    Gibbon  ttgtaatgta
B D                    Rhesus  ttataatgta
B D       Crab-eating macaque  ttataatgta
B D                    Baboon  ttataatgta
B D              Green monkey  ttataatgta
B D  Golden snub-nosed monkey  ttataatgta
B D                  Marmoset  ttatgatgta
B D           Squirrel monkey  ttaggatgtg
B D                   Tarsier  ttatgatgta
B D                       Dog  tcatgatgta
B D                     Mouse  ----------
B D               Mouse lemur  NNNNNNNNNN
B D          Proboscis monkey  ==========
B D                  Bushbaby  ==========
B D                Tree shrew  ==========

Alignment block 39 of 146 in window, 59300396 - 59300397, 2 bps 
B D                     Human  gc
B D                     Chimp  gc
B D                    Bonobo  gc
B D                   Gorilla  gc
B D                 Orangutan  gc
B D                    Gibbon  gc
B D                    Rhesus  gc
B D       Crab-eating macaque  gc
B D                    Baboon  gc
B D              Green monkey  gc
B D  Golden snub-nosed monkey  gc
B D                  Marmoset  gc
B D           Squirrel monkey  gc
B D                   Tarsier  tc
B D                Tree shrew  gc
B D                       Dog  gc
B D                     Mouse  --
B D               Mouse lemur  NN
B D          Proboscis monkey  ==
B D                  Bushbaby  ==

Alignment block 40 of 146 in window, 59300398 - 59300416, 19 bps 
B D                     Human  ctagaataccttgtgcttt
B D                     Chimp  ctagaataccttgtgcttt
B D                    Bonobo  ctagaataccttgtgcttt
B D                   Gorilla  ctagaataccttgtgcttt
B D                 Orangutan  ctagaataccttgtgcttt
B D                    Gibbon  ctagaataccttgtgcttt
B D                    Rhesus  ctagaataccttgtgcttt
B D       Crab-eating macaque  ctagaataccttgtgcttt
B D                    Baboon  ctagaataccttgtgcttt
B D              Green monkey  ctagaataccttgtgcttt
B D          Proboscis monkey  ctagaataccttgtg----
B D  Golden snub-nosed monkey  ctagaataccttgtg----
B D                  Marmoset  ctagaatatcttgtgcttt
B D           Squirrel monkey  ctagaatatcttgtgcttt
B D                   Tarsier  ctagaatatgtagtccttt
B D                Tree shrew  ctataatacctt------t
B D                       Dog  ctcaaatatcttgttcttt
B D                     Mouse  -------------------
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNN
B D                  Bushbaby  ===================

Alignment block 41 of 146 in window, 59300417 - 59300443, 27 bps 
B D                     Human  tcagcacttactaactgaattcatgat
B D                     Chimp  tcagcacttactaactgaattcatgat
B D                    Bonobo  tcagcacttactaactgaattcatgat
B D                   Gorilla  tcagcacttactaactgaattcatgat
B D                 Orangutan  tcagcaattactaactgaattcatgat
B D                    Gibbon  tcagcacttactaattgaattcatgat
B D                    Rhesus  tcagcacttactaattgaactcatgat
B D       Crab-eating macaque  tcagcacttactaattgaactcatgat
B D                    Baboon  tcagcacttactaattgaactcatgat
B D              Green monkey  tcagcacttactaattgaactcatgat
B D          Proboscis monkey  ------cttgctaattgaactcatgat
B D  Golden snub-nosed monkey  ------cttgctaattgaactcatgat
B D                  Marmoset  tcagcacttactaattgagctcatgag
B D           Squirrel monkey  tcagcacttcctaattgagctcgtgag
B D                   Tarsier  tcagcaattgctaattgagctcatgat
B D                Tree shrew  tcagcagttgctgaaggagctcacaat
B D                     Mouse  tcagtgattgttcacggacttc-tcat
B D                       Dog  tcagcatttgctaattgagctcatgat
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Bushbaby  ===========================

Alignment block 42 of 146 in window, 59300444 - 59300625, 182 bps 
B D                     Human  aatctaaa-attccaggtatttt-ccatgaagaat-tc-tgacaaatgaacacctctcccttctattctg
B D                     Chimp  aatctaaa-attccaggtgtttt-ccatgaagaac-tc-tgacaaatgaacacctctcccttctattctg
B D                    Bonobo  aatctaaa-attccaggtgtttt-ccatgaagaac-tc-tgacaaatgaacacctctcccttctattctg
B D                   Gorilla  aatctaaa-attccaggtatttt-ccatgaagaac-tc-tgacaaatgaacacctctcccttctattctg
B D                 Orangutan  aatctaaa-atcccaggtatttt-ccatgaagaac-tc-tgacaaatgaacacctctcccttctattctg
B D                    Gibbon  aatctaaa-attccaggtatttt-ccatgaagaac-tc-tgacaaatgaacacctcttccttctattctg
B D                    Rhesus  aatctaaa-attccaggtatttt-ccatgaagaac-tc-tgacaaatgaatacctctcccttctattctg
B D       Crab-eating macaque  aatctaaa-attccaggtatttt-ccatgaagaac-tc-tgacaaatgaatacctctcccttctattctg
B D                    Baboon  aatctaaa-attccaggtatttt-ccatgaagaac-tc-tgacaaatgaatacctctcccttctattctg
B D              Green monkey  aatctaaa-attccaggtatttt-ctatgaagaac-tc-tgacaaatgaatacctctcccttctattctg
B D          Proboscis monkey  aatctaaa-attcc-ggtatttt-ccatgaagaac-tc-tgacaaatgaacacctctcccttctattctg
B D  Golden snub-nosed monkey  aatctaaa-attccaggtatttt-ccatgaagaac-tc-tgacaaatgaacacctctcccttctattctg
B D                  Marmoset  aatctaaa-attccaggtatttt-ccatgaggagc-tc-tgacaaatgaacacctctcccttctatcctg
B D           Squirrel monkey  aatctaaa-attccaggtatttt-ccatgaggagc-tc-tgacaaatgaacacctctcccttctatcctg
B D                   Tarsier  aatctgaa-ataccatgtgtttt-ccacgaagaacacc-tgacaaatcagcacctctcccttctgtccta
B D                  Bushbaby  aatccaaa-atcacaggaatttt-ccatgaagaac-tcatgacaagccagcaccttccccttctgtgcta
B D                Tree shrew  agtccaaacactcc---tgtttt-atactaaaaac----tgacagatca-cacctcttttttctgtacta
B D                     Mouse  -gctttaa-gccctgagtgttttgctatcagaact-cc-taatgaaccagcagtcctcctgtttgtgctg
B D                       Dog  gatctaaa-aactcaagtgtttt-ccatggagagc-tcctgacaaattagctcctctcccttctgggcga
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  gtgcaagcacttgaagggg-aaataatt-------a-------aaaactgttaatattttaataaggtga
                        Chimp  gtgcaagcacttgaaaggg-aaataatt-------a-------aaaactgttaatattttaataaggtga
                       Bonobo  gtgcaagcacttgaagggg-aaataatt-------a-------aaaactgttaatattttaataaggtga
                      Gorilla  gtgcaagcacttgaagggg-aaataatt-------a-------aaaactgttaatattttaataagatga
                    Orangutan  gtgcaagcacttgaagggg-aaataatt-------a-------aaaactgttaatattttaataaggtga
                       Gibbon  gtgcaagcacttgaagggg-aaataatt-------a-------aaaactgttactattttaataaggtga
                       Rhesus  gtgcaaacacttgaagggg-aaataatt-------a-------aagattgttaatattttaataaggtga
          Crab-eating macaque  gtgcaaacacttgaagggg-aaataatt-------a-------aaaattgttaatattttaataaggtga
                       Baboon  gtgcaaacacttgaagggg-aaataatt-------a-------aagattgttaatattttaataaggtga
                 Green monkey  gtgcaaacacttgaagggg-aaataatt-------a-------aagattgttaatattttaataaggtga
             Proboscis monkey  gtgcaaacacttgaagggg-aaataatt-------a-------aagactgttaatatttgaataaggtga
     Golden snub-nosed monkey  gtgcaaacacttgaagggg-aaataatt-------a-------aagactgttaatatttgaataaggtga
                     Marmoset  gtgcaaacacttgaagggg-taaaaatt-------a-------aaaactgttaatattttaataaggtga
              Squirrel monkey  gcgcaaacacttgaagggg-taaaaatt-------t-------aaaacggttaatattttaataaggtga
                      Tarsier  gttcaagcacttgaagggg-aaatatttatatt-aa-------aatattgttaatattttaatagggtgt
                     Bushbaby  atgcaagcccttgaaaggg-aaataatt-------atatg---aaaaatattaatatttttaaagtatga
                   Tree shrew  gtgcaagcgctagaaggaa-aaataattatattgaa-------gacattgctaatactttcagagagtga
                        Mouse  tcatgagcaa-agaagagg-aaataact-------agattggcaatattgccaatagttttgcatgacag
                          Dog  gtgcaaacatttgaaagggaaaataatg-------atattaaggacactgttaatagtcttatagggtga
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  t-aaaatcatcacagta-tttttggaaatgaat-tgactttagaagtcatctagtatgatcctt
                        Chimp  t-aaaatcatcacagta-tttttggaaatgaat-tgactttagaagtcatctagtatgatcctt
                       Bonobo  t-aaaatcatcacagta-tttttggaaatgaat-tgactttagaagtcatctagtatgatcctt
                      Gorilla  t-aaaatcatcacagta-tttttggaaatgaat-tgactttagaagtcatctagtatgatcctt
                    Orangutan  t-aaaatcatcacagta-tttttggaaatgaat-tgactttagaagtcatctagcatgatcctt
                       Gibbon  t-aaaatcatcacagta-attttggaaatgaat-tgactttagaagtcatctagcatgatcctt
                       Rhesus  taaaaatcatcacagtattttttggaactggat-tgactttagaagtcatctaggatgatcctt
          Crab-eating macaque  taaaaatcatcacagtattttttggaactggat-tgactttagaagtcatctagtatgatcctt
                       Baboon  taaaaatcatcacagtattttttggaactggat-tgactttagaagtcatctagtatgatcctt
                 Green monkey  taaaaatcatcacagtattttttggaactggat-tgactttagaagtcatctagtatgatcctt
             Proboscis monkey  taaaaatcatcacagta-attttggaactggat-tgactttagaagtcatctagtatgatcctt
     Golden snub-nosed monkey  taaaaatcatcacagta-attttggaactggat-tgactttagaagtcatctagtatgatcctt
                     Marmoset  t-aaaatcatcacagta--ttttggaaataaat-tgactttaaaagtcatctagtatgatcctc
              Squirrel monkey  t-aaaatcataacagta--ttttggacacaaat-tgacttcaaaagtcatctactatgatccat
                      Tarsier  t-aa---cattatagta--tttggggattggatgtgattttagaagccacctactatgccctt-
                     Bushbaby  c-aaagtcatagaattc-----------------tgacttgagaagtcatctagtatgaaccta
                   Tree shrew  taaaaatc-----agta--ttttggaattggatatgactttagaagtcatctagcataatcctt
                        Mouse  c-taaagga----acta-tttgcgaactttacc-tggctatggatgtcacctagtatgattgct
                          Dog  t-aaaa--atcagagca--ttttagaattgaatatgactttagaagtcatcccgtatgatcatt
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 42 and 43 in window
B D                  Tarsier 301bp
B D                    Mouse 1bp

Alignment block 43 of 146 in window, 59300626 - 59301345, 720 bps 
B D                     Human  aaattttacagatgataaatttgagagtccagagaaaataagcacattggccaaagaacatttgacagcg
B D                     Chimp  aaattttacagatgataaatttgagagtccagagaaaataagcacattggccaaagaacatttgacagcg
B D                    Bonobo  aaattttacagatgataaatttgagagtccagagaaaataagcacattggccaaagaacatttgacagcg
B D                   Gorilla  aaattttacagatgataaatttgagagtccagagaaaataagcacattggccaaagaacatttgacagca
B D                 Orangutan  aaattttacagatgataaatttgagagtccagagataataagcaca-tggccaaagaacatttgacagtg
B D                    Gibbon  aaattttacagatgataaatttgagagtccagagaaaataagcatattggccaaagaacatttgacagtg
B D                    Rhesus  aaattttacagatgataaatttgagagtccagagaaaataagcacactggcc--agaatatttgacc--g
B D       Crab-eating macaque  aaattttacagatgataaatttgagagtccagagaaaataagcacactggcc--agaatatttgaccgtg
B D                    Baboon  aaattttacagatgataaatttgagagtccagagaaaataagcacactggcc--agaacatttgaccgtg
B D              Green monkey  aaattttacagatgataaatttgagagtccagagaaaataagtacactggcc--agaacatttgaccgtg
B D          Proboscis monkey  aaattttacagatgataaatttgagagtccagagaaaataagcacactggcc--agaacatttgaccgtg
B D  Golden snub-nosed monkey  aaattttacagatgataaatttgagagtccagagaaaataagcacactggcc--agaacatttgaccgcg
B D                  Marmoset  aaattttacagatgataaacttgaaagtccagagaaaataagcacattggccaaagaacatatgccagtg
B D           Squirrel monkey  aaattttacagatgataaacttgaaagtccagagaaaataagcacattggccaaagcacatatgccagtg
B D                   Tarsier  aaaatttatagaggagaaattagaaaatccagggcaaataaaaacattggccaaagaacatatgacattg
B D                  Bushbaby  tatttttaaggaggggaaattaaaaactttagagaaaacaaacacattggccgaagaacatgtgactgtg
B D                Tree shrew  acattttattgaggagaaatgtaaaagtccagaga-aataagtgagtcggacacggggcacgtgacagta
B D                     Mouse  ---gtgaacaaaagagacattcagaagtccagaggaaatatgtgctctg----------------tggtg
B D                       Dog  cagttttacagaggagaaattttaaagtacagagaaaataagtacgttaaccaaagaacatgtgatagta
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  tgtgttgaggcagggccagg-ccctcaatccttcaattcac-tgagagcagaaatactgtttaacaactt
                        Chimp  tgtgttgaggcagggccagg-ccctcaatccttcaattcac-tgagagcagaaatactgtttaacaactt
                       Bonobo  tgtgttgaggcagggccagg-ccctcaatccttcaattcac-tgagagcagaaatactgtttaacaactt
                      Gorilla  tgtgttgaggcagggccagg-ccctcaatccttcagttcac-tgagagcagaaatactgtttaacaactt
                    Orangutan  tgtgttgaggcagggccagg-ccctcaatccttcaactcac-tgagagcagaaatactgtttaacaactt
                       Gibbon  tgtgttgaggcagggccagg-ccctcaatccttcaattcac-tgagagcagaaatactgtttaacaactt
                       Rhesus  tgtgttgagacagggccagg-cccccaattcttcaatttacttgagagcagaaatactgtttaataactt
          Crab-eating macaque  tgtgttgagacagggccagg-cccccaattcttcaatttacttgagagcagaaatactgtttaataactt
                       Baboon  tgtgttgagacagggccagg-ccctcaattcttcaatttacttgagagcagaaatactgtttaataactt
                 Green monkey  tgtgttgagacagggccagg-ccctcaattcttcaatttacttgagagcagaaatactgtttaataactt
             Proboscis monkey  tgtgttgagacagggccagg-ccctcaattcttcaatttacttgagagcagaaatactgtttaataactt
     Golden snub-nosed monkey  tgtgttgagacagggccagg-ccctcaattcttcaatttacttgagagcagaaatactgtttaataactt
                     Marmoset  tgtgttgaggcggggccaag-ccctcaatccttcagtttac-tgagggcagaaacactgtttaacaactt
              Squirrel monkey  tgtgttgaggcagggccaag-ccctcaatccttcagtttac-tgagagcagaaatactgtttaataactt
                      Tarsier  tgtggaaagaca--gttaga-ccttcaatccttagaattac-tgaaaggagaaatgcagtgtaataaccc
                     Bushbaby  tatactgagatggggcgagg-ccctcagtcagtagacttac--aggagcagacagtgtatttaacaactc
                   Tree shrew  cgtgctaag-------------ccccaatcttcagatttgc-taagagcagaaatatcgtttaataactc
                        Mouse  tgtgctgagacaggcctaggcccccctagcctgcatccagc-cggggacagaaa---attctagaagctc
                          Dog  tgcactgaggcagggttagg-ccatcaatctttagatttgc-tgagatcagaaatattgtttaataattt
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  cataactaagacagaaaaggcactggctactgagcactggtaaagcaaactggctgaacccactggctaa
                        Chimp  cataactaagacagaaaaggcactggctactgagcactggtaaagcaaactggctgaacccactggctaa
                       Bonobo  cataactaagacagaaaaggcactggctactgagcactggtaaagcaaactggctgaacccactggctaa
                      Gorilla  cataactaagacagaaaaggcactggctactgagcactggtaaagcaaactggctgaacccactggctaa
                    Orangutan  cataactaagacagaaaaggcactggctactgagcactggtaaagcaaactggctgaacccactggctaa
                       Gibbon  cataactaagacagaaaaggcactggctactgagcactggtaaagcaaacgggctgaacccactggctaa
                       Rhesus  cataacgaagacagaaaaggcattggttattgagcattggtaaagcaaactggctgaacccactggctaa
          Crab-eating macaque  tataacgaagacagaaaaggcattggttattgagcattggtaaagcaaactggctgaacccactggctaa
                       Baboon  cataacgaagacagaaaaggcattggctactgagcattggtaaagcaaactggctgaactcactggctaa
                 Green monkey  cataacgaagacagaaaaggcattggctactgagcattggtaaagcaaactggctgaacccactggctaa
             Proboscis monkey  cataacgaagacagaaaaggcattggctactgagcattggtaaagcaaactggctgaacccactggctaa
     Golden snub-nosed monkey  cataacgaagacagaaaaggcattggctactgagcattggtaaagcaaactggctggacccactggctaa
                     Marmoset  cataacgaagacagaaaagg----------------------------------------cactggctaa
              Squirrel monkey  cataacgaagacagaaaaggcactggctgctaagcactggtaaagcaaactggct---cccactggctaa
                      Tarsier  t----ctaaggcagaaactgtacaggctactgagtattgataaagcgaactggttgaacccactggctga
                     Bushbaby  cctctctaaggcaggaagggtccaggctactgagtgttgttagagcaaattgg-tgaacctactggctaa
                   Tree shrew  cctaagtaaggcggaaaaggtagaggttactgagtgttgataaagcaaactgcttgaatccactggctca
                        Mouse  tataa--aaggacacaagggta-gagccaaggcaaactgataaagcaaactgaatgaattaacaggctgc
                          Dog  cctaaagaaggcagaaaaggaagagcctattgaatgttgataaagtgaactggttgagcccattgg-taa
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  -ttttagcaactgtcatctgcaaattaatttcaggaagctatatccagctagagatttgaattgtgaaag
                        Chimp  -ttttaacaactgtcatctgcaaattaatttcaggaagctatatccagctagagatttgaattgtgaaag
                       Bonobo  -ttttaacaactgtcatctgcaaattaatttcaggaagctatatccagctagagatttgaattgtgaaag
                      Gorilla  -ttttaacaactgtcatctgcaaattaatttcgggaagctatattcagctagagatttgaattgtgaaag
                    Orangutan  -ttttaacaactgtcatctgcaaattaatttcaggaagctatatccagctagaggtttgaattgtgaaag
                       Gibbon  -ttttaacaactgtcatctgcaaattaatttcaggaagctatatctagctagagatttgaattgtgaaag
                       Rhesus  -ttttaacaactgtcatctgcaaattaatttcaggaagttatatccagctagagatttgaactgtgaaag
          Crab-eating macaque  -ttttaacaactgtcatctgcaaattaatttcaggaagttatatccagctagagatttgaactgtgaaag
                       Baboon  -ttttaacaactgtcatctgcaaattaatttcaggaagttatatccagctagagatttgaactgtgaaag
                 Green monkey  -ttttaacaactgtcatctgcaaattaatttcaggaagttatatccacctagagatttgaactgtgaaag
             Proboscis monkey  -ttttaacaactgccatctgcaaattaatttcaggaagttatatccagctagagatttgaactgtgaaag
     Golden snub-nosed monkey  -ttttaacaactgtcatctgcaaattaatttcaggaagttatatccagctagagatttgaactgtgaaag
                     Marmoset  -ttttaacaactgtcatcttcaaattaatttcaggaagctacatccagctagaaatttgaattgcgaaag
              Squirrel monkey  -ttttaacaactgtctccttcaaattaatttcaggaagcaatatccagctagagatttgaattgtgaaag
                      Tarsier  tttttaaccactgttatcttcaaattaatttacataagctctattcaactggagatttgaatggtgaaag
                     Bushbaby  -ttttaacaaatgttatcttcaaattaattt---------atattcagctagaga-cagcagggtgtaag
                   Tree shrew  -ttttaatcactattatcttccaattcatttcagaaaaccagatccagctagagatttgaatggcagatg
                        Mouse  -tttttataagcgtttcttctaatttcattggagtatgctctatccagctacagatttgaatggtaaaag
                          Dog  -ttttaatcattgttatcattaagt--------ataagctacatccagctagagatttaaatggtaaaag
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  gccgcttgacatttctttaaggtaaaagtgtagaattattttattgccttccaagtactcag-cccctgg
                        Chimp  gccgcttgacatttctttaaggtaaaagtgtagaattattttattgccttccaagtactcag-cccctgg
                       Bonobo  gccgcttgacatttctttaaggtaaaagtgtagaattattttattgccttccaagtactcag-cccctgg
                      Gorilla  gccgcttgacatttctttaaggtaaaagtgtagaattattttattgccttccaagtactcag-cccctgg
                    Orangutan  gccgcttgacatatctttaaggtaaaagtgtagaattattttattgccttccaagtactcag-cccctgg
                       Gibbon  gccgcttgacatttctttaaggtaaaagtgcggaattattttattgccttccaagtactcag-cccctgg
                       Rhesus  gccgcttgacatttctttaaggtgaaagtgtagaattattttattgccttccaagtcctcag-ccgctgg
          Crab-eating macaque  gccgcttgacatttctttaaggtgaaagtgtagaattattttattgccttccaagtcctcag-ccgctgg
                       Baboon  gccgcttgacatttctttaaggtgaaagtgtagaattattttattgccttccaagtcctcag-cccctgg
                 Green monkey  gccgcttgacatttctttaaggtgaaagtgtagaattattttattgccttccaagtcctcag-cccctgg
             Proboscis monkey  gacgcttgacatttctt-----taaaagtgtagaattattttattgccttccaagtactcag-cccctgg
     Golden snub-nosed monkey  gacgcttgacatttctttaaggtaaaagtgtagaattattttattgccttccaagtactcag-cccctga
                     Marmoset  gccgcttgacatttctttaaggtaaaagtgtagaattattttattgtcttccaagtact------cctgg
              Squirrel monkey  gccgcttgacatttctttaag---------------tgtcttattgtcttccaagtactcag-cccctgg
                      Tarsier  acaatttggcattttttaaagggaaacatgtagaattattttagtgtcttctaagtacgctg-tgcctgg
                     Bushbaby  gcagcttgatatttctttaagg-ggaagtacagaagtactttattctcttctaaggactcag-cccctgg
                   Tree shrew  gcagtctcacctttctttaaggtaaaagtgtggaatcatct---tgtctgctaagtactcagccccctgg
                        Mouse  gtattgtgatgtttctttaatgtaagagtgta-------------------------------t------
                          Dog  gcaacttgccgtttctttaacttgaaagtgtagaatcac---attgtcttctcaatactcag-cccctgg
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ctgtagtagggtctcaatgggattatgttgctctatca---------ttttcctcccagtttt---actt
                        Chimp  ctgtagtagggtctcaatgggattatgttgctctatca---------ttttcctcccagtttt---actt
                       Bonobo  ctgtagtagggtctcaatgggattatgttgctctatca---------ttttcctcccagtttt---actt
                      Gorilla  ctgtagtagggtctcaatgggattatgttgctctatca---------ttttcctcccagtttt---actt
                    Orangutan  ctgtagtagggtctcaatgggattatgttgctctatca---------ttttcctcccagtttt---actt
                       Gibbon  ctgtagtagggtctcaacgggattatgttgctctatca---------ttttcctcccagtttt---actt
                       Rhesus  ccgtagtagggtctcaatgggattatgttgttctatca---------ttttcctcctagttct---attt
          Crab-eating macaque  ccgtagtagggtctcaatgggattatgttgttctatca---------ttttcctcctagttct---attt
                       Baboon  ccgtagtagggtctcaatgggattatgttgttttatca---------ttttcctcccagttct---attt
                 Green monkey  ccgtagtacggtctcaatgagattatgttgttctatca---------ttttcctcccagttct---attt
             Proboscis monkey  ctgtagcagggtctcaatgggattatgttgttctatca---------ttttccccccagttct---atat
     Golden snub-nosed monkey  ctgtagcagggtctcaatgggattatgttgttctatca---------ttttccccccagttct---attt
                     Marmoset  ttagagtagggtttcaatgggattgtggggctctgtca---------ttttccttccagtttt---actt
              Squirrel monkey  ctatagtagagtctcaatgggattgtggggctctgtca---------ttttccttccagtttt---actt
                      Tarsier  ccacattaggatttcaatgggattatggcagtc--------------ttttccctcccttttt---actt
                     Bushbaby  ccactttagggtctcaatggaatcataccactctcatt---------ttttcctccc--ttttaaaactt
                   Tree shrew  ccacaggagggtct-ggtgggattacactactcagtca---------cctccccctc--cctc---actc
                        Mouse  -----gtagaattt---------------------------------------------ttct---gctg
                          Dog  ccacgttagggtctcaatgggattatgttactctatcacttttttttttttcctcctcttttt---actt
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ctttc--------aagtggtgaaaggacagaatagcag-aaaaagatgcagtagaattagga--acagga
                        Chimp  ctttc--------aagtggtgaaagggcagaatagcag-aaaaagatgcagtagaattagga--acagga
                       Bonobo  ctttc--------aagtggtgaaaggacagaatagcag-aaaaagatgcagtagaattagga--acagga
                      Gorilla  ctttc--------aagtggtgaaaggacagaatagcag-aaaaagatgcagtagaattagga--acagga
                    Orangutan  ctttc--------aagttgcaaaaggacagaatagcag-aaaaagatgcagtagaattagga--acagga
                       Gibbon  ctttc--------aagttgcaaaaggacagaatagcag-aaaaagatgctgtagaattagga--acagga
                       Rhesus  gtttc--------aagttgcaaaaggacaggatagcag-aaaaagatgcagtagaattagga--acagga
          Crab-eating macaque  gtttc--------aagttgcaaaaggacaggatagcag-aaaaagatgcagtagaattagga--acagga
                       Baboon  gtttc--------aagttgcaaaaggacaggatagcag-aaaaagatgcagtagaattagga--acagga
                 Green monkey  ctttc--------aagctgcaaaaggacaggatagcag-aaaaagatgcagtagaattagga--acagga
             Proboscis monkey  ctttc--------aagttgcaaaaggacaggatagcag-aaaaagatgcagtagaattagga--acagga
     Golden snub-nosed monkey  ctttc--------aagttgcaaaaggacaggatagcag-aaaaagatgcagtagaattagga--acagga
                     Marmoset  ctttc--------gagttgcaaaaggacagaacagcag-aaaaagatgcagtagaattagga--acagga
              Squirrel monkey  ctttc--------gagttgcaaaaggacagaacagcag-aaaaagatgcagtagaattagga--acagga
                      Tarsier  ctttc--------caatag-aaaaggacagagtagcagaaaaaagatgcagcagaactgggg--acagga
                     Bushbaby  ctttca-------aagtagcaaaaggacaaagtagcag-aaaaagatgcagaagaaccagga--acagga
                   Tree shrew  cttgcagagttctaagcagtcgaaggatagagcagcag-aaaaagctgtggtcgggccagga--acagga
                        Mouse  tcttc--------tagaggtagaagcactgagtaacag-aaaaagatgtggtcaacctaggagtacagga
                          Dog  ctttc--------aagtggcaaaaggacagagcagcagaaaaaagatgcagtggaactagaa--acagga
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  aaccgcagaaaagaaactgtttatttatcttgctccctggcagttattcctctt-ctaacagtgagaga-
                        Chimp  aaccgcagaaaagaaactgtttatttatcttgctccctggcagttattcctctt-ctaacagtgagaga-
                       Bonobo  aaccgcagaaaagaaactgtttatttatcttgctccctggcagttattcctctt-ctaacagtgagaga-
                      Gorilla  aaccgcagaaaagaaactgtttatttatcttgctccctggcagttattcctctt-ctaacagtgagaga-
                    Orangutan  aaccgcagaaaagaaactgtttatttatcttgctccctggcagttattcctctt-ctaacagtgagaga-
                       Gibbon  aaccgcagaaaagaaactgtttatttatcttgctccctggcagttattcctctt-ctaacagtgagaga-
                       Rhesus  aaccgcagacaagaaactgtttatttatcttgctccctggcagttattcctcct-ctaacagtgagaga-
          Crab-eating macaque  aaccgcagacaagaaactgtttatttatcttgctccctggcagttattcctcct-ctaacagtgagaga-
                       Baboon  aaccgcagacaagaaactgtttatttatcttgctccctggcagttattcctcct-ctaacagtgagaga-
                 Green monkey  aaccacagacaagaaactgtttatttatcttgctctctggcagttattcctcct-ctaacagtgagaga-
             Proboscis monkey  aaccgcagacaagaaactgtttatttatcttgctccctggcagttattcctact-ctaacagtgagaga-
     Golden snub-nosed monkey  aaccgcagacaagaaactgtttatttatcttgctccctggcagttattcctact-ctaacagtgagaga-
                     Marmoset  aaccacagacaagaaactgtttatttatcttgctccctggcagtta---ttctt-ctaacagtgacaga-
              Squirrel monkey  aaccgcagaagagaaactgtttatttatcttgctccctggcagttattcttctt-ctaacagtgagaga-
                      Tarsier  aaccac-----agaaactgtttctttatcttgctccctggcagttcttcctcttgttaacagtgagaga-
                     Bushbaby  aaccacagaagagaaactgtttctttatctcgctccctggcagttattcctctt-atagcagtgacaga-
                   Tree shrew  aaccacagaggagaaactgtttctttatctggctccctgtcagttattcctctt-ataacagggagcga-
                        Mouse  aaccacaga--aggaactagttctttatcttgctctctggtgattcttcctctt-ctatcagtggggga-
                          Dog  aaccacagaagagaaactgtttctttatcttgctccctggcagttattcctctt-ataacagcaagagag
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ggagtgaggctcgtttctgtcagataagcagcaagaggtgctttgatgatgggttaacatgaagattgag
                        Chimp  ggagtgaggctcgtttctgtcagataagcagcaagaggtgctttgatgatgggttaacatgaagattgag
                       Bonobo  ggagtgaggctcgtttctgtcagataagcagcaagaggtgctttgatgatgggttaacatgaagattgag
                      Gorilla  ggagtgaggctcgtttctgtcagataaacagcaagaggtgctttgatgatgggttaacatgaagattgag
                    Orangutan  ggagtgaggctcgtttctgtcagataagcagcaagaggtgctttgatgatgggttaacatgaagactgag
                       Gibbon  cgagtgaggctcgtttctgtcagataagcagcaagaggtgctttgatgatgggttaacgtgaagattgag
                       Rhesus  ggagcgaggctcgtttctgtcagataagcggcaagaggtgctttgatgatgggttagcgtgaagatggag
          Crab-eating macaque  ggagcgaggctcgtttctgtcagataagcggcaagaggtgctttgatgatgggttagcgtgaagatggag
                       Baboon  ggagcgaggctcatttctgtcagataagcggcaagaggtgctttgatgatgggttagcgtgaagatggag
                 Green monkey  ggagcgaggctcgtttctgtcagataagcggcaagaggtgctttgatgatgggttagcgtgaagatggag
             Proboscis monkey  ggagtgaggctcgtttctgtcagataagcggcaagaggtgctttgatgatgggttagcatgaagattgag
     Golden snub-nosed monkey  ggagtgaggctcgtttatgtcagataagtggcaagaggtgctttgatgatgggttagcatgaagattgag
                     Marmoset  ggagcgaggctcgtctctgccagataagca-caagaggggctttgatggtgagttcacatgaagactgag
              Squirrel monkey  ggagcgaggctcgtttctgtcagataagca-caagtgggactttgatgatgagttcacatgaagattgag
                      Tarsier  ggagtgagactcttttctgtcagataagtagcaagaggtgctttgatgatgagttaatgtgaagactaag
                     Bushbaby  gcagaggggctcattt-tgccagataagcagcaagggatgctctgatgatgagttaatgtgaagactgag
                   Tree shrew  agagggaggcacaattctgcccgagaagcagcaagaggagcttggaggctgag-tagcgtgaagacggag
                        Mouse  ctgatggg-------cctgtcag--aagtgg-gggaggaatttagatgatgga--gggatgaaggt--ag
                          Dog  ggagtgaggcgggttt-tgtcagataagcagcaagaggtgctttgacg--------------aggttgag
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  tacaaactccctgcaaatttagaatttatttcaagga-aaagacaatttcaggattagtgagaaaagtgc
                        Chimp  tacaaactccctgcaaatttagaatttatttcaaggg-aaagacaatttcaggattagtgagaaaagtac
                       Bonobo  tacaaactccctgcaaatttagaatttatctcaaggg-aaagacaatttcaggattagtgagaaaagtac
                      Gorilla  tacaaactccctgcaaatttagaatttatttcaagga-aaagacaatttcaggattagtgagaaaagtac
                    Orangutan  tacaaactccctgcaaatttagaatttatttcaagga-aaagataatttcaggattaatgagaaaagtac
                       Gibbon  tacaaactccctgcaaatttagaatttatttcaagga-aaagacaatttcaggattattgagaaaagtgc
                       Rhesus  tacggactacctgcaaatgtagaatttatttcaagga-aaagacaatttcaggattaatgagaaaagtat
          Crab-eating macaque  tacagactacctgcaaatgtagaatttatttcaagga-aaagacaatttcaggattaatgagaaaagtat
                       Baboon  tacagactacctgcaaatgtagaatttatttcaagga-aaagacaatttcaggattaatgagaaaagtac
                 Green monkey  tacagactacctgcaaatttagaatttatttcaagga-aaagacaatttcaggattaatgagaaaagtac
             Proboscis monkey  tacagactacctgcaaatttagaatttatttcaagga-aaaggcaatttcaggattaatgagaaaagtac
     Golden snub-nosed monkey  tacagactacctgcaaatttagaatttatttcaagga-aaaggcaatttcaggattaatgagaaaagtac
                     Marmoset  tacacactccctacaaatttacaatttatttcaagga-aaagacaatttcaggattagtaagaaaagtac
              Squirrel monkey  tacacactccctgcaaatttagaatttatttcaagga-aaagacaattgcaggattagtaataaaggtac
                      Tarsier  gaccaactccctgcaaatttagagtttatttcaagaa-aaagacaatttcaagattagtgagaaaagtgg
                     Bushbaby  tacaaattccttgctaatttagaatttatttcaagga-gaagacaatttgaggattagtgagaaaagcag
                   Tree shrew  tacaatctcccccc--atctagaattcagtttaagga-agtga-acgttcaggattagtgacgcaggtgg
                        Mouse  cctcaatgttctgtgcatttggaatcaatcttgaagg-aaggaagatttgaag-----------aggtat
                          Dog  tacaaactccctgaacatttagaattcattttaaggagaaagaaaatttcaggactagtgagaaagctat
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  agaattttcctc---ta----gg----ttgttattagtgggaggccgaaaagtgccacaca
                        Chimp  agaattttcctc---ta----gg----ttgttattagtgggaggccgaaaagtgccacaca
                       Bonobo  agaattttcctc---ta----gg----ttgttattagtgggaggccgaaaagtgccacaca
                      Gorilla  agaattctcctc---ta----gg----ttgttattagtgggaggccgaaaagtgccacaca
                    Orangutan  agaattttcctc---ta----gg----ttgttattagtgggaggctgaaaagtgccacaca
                       Gibbon  agaattttcctc---ta----gg----ttgttattagtgggaggccgaaaagtaccacaca
                       Rhesus  agaattttcctc---ta----gg----ttgttattagtgggaggctgagaagtgccacacg
          Crab-eating macaque  agaattttcctc---ta----gg----ttgttattagtgggaggctgagaagtgccacacg
                       Baboon  agaattttcctc---ta----gg----tttttattagtgagaggccgagaagtgccacacg
                 Green monkey  agaattttcctc---ta----gg----ttgttattagtgagaggccgagaagtgcctcaca
             Proboscis monkey  agaattttcatc---ta----gg----ttgttattagtgggaggctgagaagtgccacaca
     Golden snub-nosed monkey  agaattttcatc---ta----gg----ttgttattagtgggaggctgagaagtgccacaca
                     Marmoset  agaattttgcta---ta----ag----gtattattagtgggaggccaaaaagtgccacaca
              Squirrel monkey  ggaattttgctc---ta----ag----ttattattagtgggaggccgaaaagtgccacaca
                      Tarsier  aaaattgtgttc---taagttag----ttgttcctagtgggaggcagaaaaccgaaacact
                     Bushbaby  agaattgggctc---taacttag----ttgtcattagtggcagacagaaaggtgcaagacc
                   Tree shrew  agaactgtgcccacgtg----ag----ccggaaacctccggagtcaggaaagtgccatgcc
                        Mouse  ggatttagactc---cc-----a----ctgttatcagtgggaggcagagaaaaactgccca
                          Dog  agaattgtgcct---ca----agttcattgctatgagtggggagccgaaaagtgtaacatg
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 44 of 146 in window, 59301346 - 59301441, 96 bps 
B D                     Human  actggtcacaagcctctctgcataac-------cctgtgg-aatggaagctgctga------------ga
B D                     Chimp  actggtcacaagcctctctgcataac-------cctgtgg-aatggaagctgctga------------ga
B D                    Bonobo  actggtcacaagcctctctgcataac-------cctgtgg-aatggaagctgctga------------ga
B D                   Gorilla  attggtcacaagcctctctgcataac-------cctgtgg-aatggaagctgctga------------ga
B D                 Orangutan  attggtcacaagcctctctgcataac-------cctgtgg-aatggaagctgctca------------ga
B D                    Gibbon  attggtcacaatcctctctgcataac-------tctgtgg-aatggaagctgctca------------ga
B D                    Rhesus  gttggtcacaagcttctctgcataac-------cctgtgg-aatggaggctgctca------------ca
B D       Crab-eating macaque  gttggtcacaagcctctctgcataac-------cctgtgg-aatggaggctgctca------------ca
B D                    Baboon  gttggtcacaagcctctctgcataac-------gctgtgg-aatggaggctgctca------------ga
B D              Green monkey  gttggtcacaagcatctctgcataac-------cctgtgc-aatggaggctgctca------------ga
B D          Proboscis monkey  gttggtcacaagcctctctgcataac-------cctgtgg-aatggaagctgctca------------ga
B D  Golden snub-nosed monkey  gttggtcacaagcctctctgcataac-------cctgtgg-aatggaagctgctca------------ga
B D           Squirrel monkey  attggtcacaagcctgtctgcataac-------cctgtggaaatggaagctgctcagattctgattctga
B D                   Tarsier  gttggctgcaagcaggtctacataac-------cctgtgg-gatggaagatgcctg------------ga
B D                  Bushbaby  gttggttgcaagcctatccgcagagc-------cctgtgg-agctgaagatgctga------------ga
B D                Tree shrew  gctggtcacgatcc----------------------gtgg-gactgagagttctca------------gc
B D                     Mouse  ----cttgcatgcaagtcagcaaata-------tctgagg--gttaaagatgctgg------------ga
B D                       Dog  gtcggttgcaggtctgtcaacacaatccaattgcctgtgc-aactaaacattctta------------ga
B D                  Marmoset  ----------------------------------------------------------------------
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ttctgattctgtaggcttggggaagttccagtgctttt----agaattgc
                        Chimp  ttctgattctgtaggcttggggaagttccagtgctttt----agaattgc
                       Bonobo  ttctgattctgtaggcttggggaagttccagtgctttt----agaattgc
                      Gorilla  ttctgattctgtaggcttggggaagttccagtgctttt----agaattgc
                    Orangutan  ttctgattctgtaggcttggggaagttccagtgctttt----agaattgc
                       Gibbon  ttctgattctgtaggctcggggaagttccagtcctttt----agaattgc
                       Rhesus  gtctgattcagtaggcttggggaaattccagtgctttt----agaattgc
          Crab-eating macaque  gtctgattcagtaggcttggggaagttccagtgctttt----agaattgc
                       Baboon  gtctgattcagtaggcttggggaagttccagtgctttt----agaattgc
                 Green monkey  ttctgattcagtagactgggggaagttccagtgctttt----agaattgc
             Proboscis monkey  ttctgactcagtaggcttggggaagttccagtgctttt----agaattgc
     Golden snub-nosed monkey  ttctgactcagtaggcttggggaagttccagtgctttt----agaattgc
              Squirrel monkey  ttctgattctgtaggctgggggaacttcgagtgctttt----agaattgc
                      Tarsier  ttccaattctgtagcctt---gaagttctagtgctttc----agaaatgt
                     Bushbaby  ttctggttctgcaggcacggagaagttccactgctttc--agagaaaggc
                   Tree shrew  gtcgggtgctgcagccatggagagggtgccatgtgtgg----ggaaga--
                        Mouse  ctctgatctattgacc--agtaaggtcccagcgcttcttataataattgt
                          Dog  ttctaattccgtgggcatggaaagcttccagtgctttc---aagaaatgt
                     Marmoset  --------------------------------------------------
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 44 and 45 in window
B D                  Tarsier 124bp

Alignment block 45 of 146 in window, 59301442 - 59301463, 22 bps 
B D                     Human  tcctcaagttaccatgatgcac
B D                     Chimp  tcctcaagttgccatgatgcac
B D                    Bonobo  tcctcaagttgccatgatgcac
B D                   Gorilla  ttctcaagttaccatgatgcac
B D                 Orangutan  ttctcaagttaccatgatgcac
B D                    Gibbon  ttctcaagttaccgtgatgcac
B D                    Rhesus  ttctcaagttaccgcaatgcac
B D       Crab-eating macaque  ttctcaagttaccgcaatgcac
B D                    Baboon  ttctcaagttaccgcgatgcac
B D              Green monkey  ttctcaagttaccgcgatgcac
B D          Proboscis monkey  ttctcaagttaccatgatgcac
B D  Golden snub-nosed monkey  ttctcaagttaccatgttgcac
B D           Squirrel monkey  tcctcaagttaccgtgacgcac
B D                   Tarsier  tccccaagttcccaggatgtac
B D                  Bushbaby  -tccccagtt-ccatgttttat
B D                Tree shrew  cagtcgagtcaccagggtggac
B D                     Mouse  --gttaaggtaccacagtatcc
B D                       Dog  tctccaagttagcgtggtgtaa
B D                  Marmoset  ----------------------
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNN

Alignment block 46 of 146 in window, 59301464 - 59301582, 119 bps 
B D                     Human  agttaaggttcatcatcactgatataatggttaagagcctgggctgtgtatgtagttgatctgctgattt
B D                     Chimp  agttaaggttcatcatcgctgatataatggttaagagcctgggctgtgtatgtagttgatctgctgattt
B D                    Bonobo  agttaaggttcatcatcgctgatataatggttaagagcctgggctgtgtatgtagtcgatctgctgattt
B D                   Gorilla  agttaaggttcatcatcactgatataatggttaagagcctgggctgtgtatgtagttggtctgctgattt
B D                 Orangutan  agttaaggttcataatcactgatataatggttaagagcctgagctgtgtgtgtagttgatctgctgattt
B D                    Gibbon  agttaaggttcataattactgatataatggttaagagcctgggctgtgtatgtagttgatctgctgattt
B D                    Rhesus  tgttaaggttcataatcactgataaaatagttaagagcctgggctgtgtatgtagttgatctgctgattt
B D       Crab-eating macaque  tgttaaggttcataatcactgataaaatagttaagagcctgggctgtgtatgtagttgatctgctgattt
B D                    Baboon  tgttaaggttcataatcactgatataatagttaagagcctgggctgtgtatgtagttgatctgctgattt
B D              Green monkey  tgttaaggttcataatcactgatataatagttaagagcctgggctatgtatgtagttgatccgctg----
B D          Proboscis monkey  tgttaaggtttataatcaccgatataatagttaagagcctgggctgtgtatgtagttgatctgctgattt
B D  Golden snub-nosed monkey  tgttaaggtttataatcaccgatataatagttaagagcctgggctgtgtatgtagttgatctgctgattt
B D                  Marmoset  agttaaggttcataatcactgatataatggtcaggagcctgggccatgtatgtagctgatctgctgattt
B D           Squirrel monkey  agttaaggttcataatcactgatataatggttaggagcctgggctgtgtatgtagctgagctgctgatct
B D                   Tarsier  agttaaggttgacaatcgct-atatgatggttaacagcctgagttttgtgtgccgttggtctgctgattt
B D                  Bushbaby  agttaaggttaatagttaccaatacgttggttaagagcttggatgaggtatg--gctggtctgctgactt
B D                Tree shrew  ggtgaaggctaatac---ctgatg-ggtgcttcagagcc-gggccgtgggtgcggctggcgggctcgttt
B D                     Mouse  aaataaagttaataactactg-catggcacttgtgggcttggcatatgcatacacttggttgactctttt
B D                       Dog  agtcaaggttaagaaccacaggtaatgtggtcaagagctggggc----tatgcagtaggtcagctcattt
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  gaatctgagctgatccctt---------atta--actacatgtctttc-----gttg--------tg---
                        Chimp  gaatctgagctggtccttt---------atta--actacatgtcttta-----gttg--------tg---
                       Bonobo  gaatctgagctggtccttt---------atta--actacatgtcttta-----gttg--------tg---
                      Gorilla  gaatctgagctgatctctt---------atta--actacatgtcttta-----gttg--------tg---
                    Orangutan  gaatctgagctga-ctctt---------atta--actacatgtcttta-----gttg--------tg---
                       Gibbon  gaatctgagctgatctctt---------atta--actacatgtcttta-----gttg--------tg---
                       Rhesus  gaatctgagctgatctctt---------atta--actatatgtcttga-----gttg--------tg---
          Crab-eating macaque  gaatctgagctgatctctt---------atta--actatatgtcttga-----gttg--------tg---
                       Baboon  gaatctgcgctgatctctt---------atta--actatatgtcttta-----gttg--------tg---
                 Green monkey  ---------------tctt---------atta--actatatgtcttta-----gttg--------tg---
             Proboscis monkey  gaatctgagctgatctctt---------atta--actatatgtcttta-----gttg--------ta---
     Golden snub-nosed monkey  gaatctgagctgatctctt---------atta--actatatgtcttta-----gttg--------tg---
                     Marmoset  gaatctgagctgatctctt---------atta--actatatgtcttta-----gttg--------tg---
              Squirrel monkey  gaatctgagctgatctctt---------gtta--actatatgtcttta-----attg--------tg---
                      Tarsier  aaatctgaactgatctctt---------------actatgtgcaatta-----gtta--------tc---
                     Bushbaby  gaatttatgctgatctctctaacctatagttagtactataggtattta-----gtta--------gttaa
                   Tree shrew  cagtctgagccagtctgtt---------acaactccggtgtgccttta-----gtga--------ggtgt
                        Mouse  aactccaggcttgtttctt--------aacca--gctaggcaacttta-----gtcag------ttg---
                          Dog  gcatctaagctgatctctt---------acca--accatttgcctttataccggttagacaccacag---
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  -ccctct---
                        Chimp  -ccctct---
                       Bonobo  -ccctct---
                      Gorilla  -ccctct---
                    Orangutan  -ccctct---
                       Gibbon  -ccctct---
                       Rhesus  -ccctct---
          Crab-eating macaque  -ccctct---
                       Baboon  -ccctct---
                 Green monkey  -ccctct---
             Proboscis monkey  -ccctct---
     Golden snub-nosed monkey  -ccctct---
                     Marmoset  -ccctct---
              Squirrel monkey  -ccctct---
                      Tarsier  -ccctct---
                     Bushbaby  cccctct---
                   Tree shrew  -ccccct---
                        Mouse  -cccttt---
                          Dog  -ccccccgcc
                  Mouse lemur  NNNNNNNNNN

Inserts between block 46 and 47 in window
B D                    Mouse 613bp

Alignment block 47 of 146 in window, 59301583 - 59301716, 134 bps 
B D                     Human  aagctcaattttctcatacgtaaaatgccaatgatattgggaaga----tattattatgattcagcttca
B D                     Chimp  aagctcaattttctcatacgtaaaatgccaatgatattgggaaga----tattattatgattcagcttca
B D                    Bonobo  aagctcaattttctcatacgtaaaatgccaatgatattgggaaga----tattattatgattcagcttca
B D                   Gorilla  aagctcaattttctcatacgtaaaatgccagtaatatggggaaga----tattattatgaatcagcttca
B D                 Orangutan  aagctcaattttctcatacgtaaaatgccaatgatattgggaaaa-tattattattatgaatcagcttca
B D                    Gibbon  aagctcaattttctcatatgtaaaatgccaatgatattgggaaaa-tattattattatgaatcagcttca
B D                    Rhesus  aagctcagttttctcatatgtaaaatgcaagtgatattgggaaac-tattattattatgagccagcttca
B D       Crab-eating macaque  aagctcagttttctcatatgtaaaatgcaagtgatattgggaaac-tattattattatgagccagcttcg
B D                    Baboon  aagctcagttttctcatacgtaaaatgcaaatgatattgggaaac-tattattattatgagccagcttcg
B D              Green monkey  aagctcagttttctcatatgtaaaatgcaaatgatattgggaaac-tattattattatgagccagcttcg
B D          Proboscis monkey  aagctcagtttcctcatacataaaatgtaaatgatattgggaaaa-tattattattatgagccagcttca
B D  Golden snub-nosed monkey  aagctcagttttctcatacataaaatgtaaatgatattgggaaaa-tattattattatgagccagcttca
B D                  Marmoset  aagcttagttttctcatatgtaaaatgggaatgatattgggaaaa-cattattattatgaaccagcttca
B D           Squirrel monkey  gagctcagttttctcgtatgtaaaatgcgaacgatattgggaaaa-cattattattatgaaccagcttca
B D                   Tarsier  aagttcagtctcctcatatgtaaaatgggcataagaacgggaaaaatattattattacgaaccaacttga
B D                  Bushbaby  aagctcaatttcctcctatgtagaatgggattaatattaggaaaa----tattattatgaataaacttca
B D                Tree shrew  aagctccatttcctcatgtgccaaatgggagtaatattgggaataataatattattatgaatcaactttc
B D                       Dog  aacgtccatttcctcaaatgtgaaatggaagtagtattgggacctgcgttattcttatgaaccaacttca
B D                     Mouse  ======================================================================
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  taaggtt------gttatgatgatcaaataaacttaca--ggcaaagtacttg-----gta-aagatatg
                        Chimp  taaggtt------gttatgatgatcaaataaacttaca--ggcaaagtacttg-----gta-aagatatg
                       Bonobo  taaggtt------gttatgatgatcaaataaacttaca--ggcaaagtacttg-----gta-aagatatg
                      Gorilla  taaggtt------gttatgatgatcaaataaacttata--ggcaaagtacttg-----gta-aagatatg
                    Orangutan  taaggtt------gttatgatgatcaaataaacttata--ggcaaaatgcttg-----gta-aagatatg
                       Gibbon  taaggtt------gttatgatgatcaaataaacttaca--ggcaaagtacttg-----gta-aagatacg
                       Rhesus  taaggtt------gttatgatgattaaataaacttata--ggcaaaatacttggtagagta-aagatact
          Crab-eating macaque  taaggtt------gttatgatgattaaataaacttata--ggcaaagtacttggtagagta-aagatact
                       Baboon  taaggtt------gttatgatgattaaataaacttata--ggcaaagtacttgctagagta-aagatatg
                 Green monkey  taaggtt------gttatgatgattgaataaacttata--ggcaaagtacttg-----gta-aagatact
             Proboscis monkey  taaggtt------attatgatgattaaataaacttata--ggcaaagtacttg-----gta-aagatacg
     Golden snub-nosed monkey  taaggtt------attacgatgattaaataaacttata--ggcaaagtacttg-----gta-aagatacg
                     Marmoset  taaggtg------gttatgatgattaaataaacttata--ggccaagtacttggtagagga-cagatacg
              Squirrel monkey  taaggtg------gttatgatgattaaataaacttata--ggccaagtacttggtagagga-cagatacg
                      Tarsier  taagatt------gttatgaggattaaataaaattatg--agcgaagtacttggtacagtaccagatata
                     Bushbaby  taagatt------gttaggagaatgaaataaaattatgcttaccaagtactta-----gtaccaagtaca
                   Tree shrew  taagatttcgagagtta-ggtga--aagtgtgcttatg------aagtacttaggacagaaccaggcgca
                          Dog  taagctt------gttgtgaagattaaataaaattatacctctaaagggcttagcacgttaccaggtacc
                        Mouse  ======================================================================
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  cagtaaacatcc
                        Chimp  cagtaaacatcc
                       Bonobo  cagtaaacatcc
                      Gorilla  cagtaaacatcc
                    Orangutan  cagtaaacatcc
                       Gibbon  cagtaaacatcc
                       Rhesus  cagtaaacatcc
          Crab-eating macaque  cagtaaacatcc
                       Baboon  cagtaaacatcc
                 Green monkey  cagtaaacatcc
             Proboscis monkey  cagtaaacatct
     Golden snub-nosed monkey  cagtaaacatct
                     Marmoset  tagtcaacatcc
              Squirrel monkey  tagtcaatatcc
                      Tarsier  tagtaaacattc
                     Bushbaby  caggaaacatcc
                   Tree shrew  ccgtgggcaacc
                          Dog  ccgtaatcatcc
                        Mouse  ============
                  Mouse lemur  NNNNNNNNNNNN

Inserts between block 47 and 48 in window
B D                 Bushbaby 352bp

Alignment block 48 of 146 in window, 59301717 - 59301730, 14 bps 
B D                     Human  gatgcctactggt-a
B D                     Chimp  gatgcctactggt-a
B D                    Bonobo  gatgcctactggt-a
B D                   Gorilla  gatgcctactggt-a
B D                 Orangutan  gatgcctactggt-a
B D                    Gibbon  gatgcctactggt-a
B D                    Rhesus  gatgcctactggt-a
B D       Crab-eating macaque  gatgcctactggt-a
B D                    Baboon  gatgcctactggt-a
B D              Green monkey  gatgcctactggt-a
B D          Proboscis monkey  gatgcctactggt-a
B D  Golden snub-nosed monkey  gatgcctactggt-a
B D                  Marmoset  aatgcctattggc-a
B D           Squirrel monkey  aatgcctattggt-a
B D                   Tarsier  tatgcttactggcaa
B D                  Bushbaby  tatgcctattgacaa
B D                Tree shrew  tccttccactgct-g
B D                       Dog  catgcatgttggc-a
B D                     Mouse  ===============
B D               Mouse lemur  NNNNNNNNNNNNNNN

Inserts between block 48 and 49 in window
B D                      Dog 1bp

Alignment block 49 of 146 in window, 59301731 - 59302053, 323 bps 
B D                     Human  tcctgagtatttctttagaagttcctctaaaatgc----aatcttcataaatatgatactgttcagatat
B D                     Chimp  tcctgagtatttctttagaagttcctctaaaatgc----aatcttcataaatatgatactgttcagatat
B D                    Bonobo  tcctgagtatttctttagaagttcctctaaaatgc----aatcttcataaatatgatactgttcagatat
B D                   Gorilla  tcctgagtatttctttagaagttcctctaaaatgc----aatcttcataaatatgatactgttcagatat
B D                 Orangutan  tcctgagtatttctttagaagttcctctaaaatgc----aatcttcataaatatgatactgttcagatat
B D                    Gibbon  tcctgagtatttctttagaagttcctctaaaatgc----aatcttcataaatatgatactgttcagatat
B D                    Rhesus  tcctgagcatttatttagaagtgcctctaaaatgc----aatcttcgtaaatatgatactgttcagatat
B D       Crab-eating macaque  tcctgagcatttatttagaagtgcctctaaaatgc----aatcttcgtaaatatgatactgttcagatat
B D                    Baboon  tcctgaacatttatttagaagttcctctaaaatgc----aatcttcgtaaatatgatactgttcagatat
B D              Green monkey  tcctgagcatttatttagaagttcctctaaaatgc----aaccttcgtaaataagatactgttcagatat
B D          Proboscis monkey  tcctgagcatttatttagaagttcctctaaaatac----aatcttcgtaaatatgatactgttcagatat
B D  Golden snub-nosed monkey  tcctgagcatttatttagaagttcctctaaaatac----aatcttcgtaaatatgatactgttcagatat
B D                  Marmoset  tcctgagtatttctttagaagtttctctaaaatgc----gaacttcataaatacgacactgttcagatat
B D           Squirrel monkey  acctgagtatttctttagaagtttctctaaaatga----gaacttcataaatatgacactgatcagatat
B D                   Tarsier  ttccgagcatttctttagaagtttctctacagagc----aatcttcataaatgtgatattgttctgatag
B D                  Bushbaby  tcctgagtactttttacacagtttctgtaaaatga----aatcttcatgaatacaatattgttcagatat
B D                Tree shrew  tcctgcgagcttcttcgcaagtttctccgacgtgc----agacttcctcgatacgatgtggtgcagacat
B D                     Mouse  tcctggttatctctttgggagttcccttacagtgctatagatcttcaaaattacagcactgtttatatat
B D                       Dog  tcttgagtatttctttagaagtttctctaagatgc----tatctttataaatatgaga---tacatatat
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  tatgacaaatacatatcacacatgt----atata-------------------cataatac---------
                        Chimp  tatgacaaatacatatcacacttgt----atata-------------------cataatac---------
                       Bonobo  tatgacaaatacatatcacacttgt----atata-------------------cataatac---------
                      Gorilla  tatgacaaatacatatcacacatgt----atata-------------------cataatac---------
                    Orangutan  tatgacaaatacatatcacacatgt----atata-------------------cataatac---------
                       Gibbon  tatgacaaatacatatcacacatgt----atata-------------------cataatac---------
                       Rhesus  tatgacaaatacatatcacacacgt----atata-------------------cataatac---------
          Crab-eating macaque  tatgacaaatacatatcacacacgt----atata-------------------cataatac---------
                       Baboon  tatgacaaatacatatcacacacgt----atata-------------------cataatac---------
                 Green monkey  tatgacaaata-atatcacacacgt----atata-------------------cataatac---------
             Proboscis monkey  tatgacaaatacatatcacacatgc----atata-------------------cataatac---------
     Golden snub-nosed monkey  tatgacaaatacatatcacacatgc----atata-------------------cataatac---------
                     Marmoset  tatgacaaataaatactgaacatgt----atata-------------------cataatac---------
              Squirrel monkey  tataacaaatacatatcgaacatgt----atata-------------------cataacac---------
                      Tarsier  catgataaatacatatcatatttgt----gtata-------------------c--aatat---------
                     Bushbaby  tatgaaaaatacatatcatatatgtggacatatagatgtatgggcaaatggctcatagcactctgggagg
                   Tree shrew  tatgataaatatgtacctc----gc----acaca-------------------cgtaactt---------
                        Mouse  tgtgattaacacgtgtcat---tat-----tatt-------------------aaaagtat---------
                          Dog  --------atatatat-acatatat----atgta-------------------tata-------------
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ---------------------aat-ttaaaaattggaatgtgaacagc----------------------
                        Chimp  ---------------------aat-ttaaaaattggaatgtgaacagc----------------------
                       Bonobo  ---------------------aat-ttaaaaattggaatgtgaacagc----------------------
                      Gorilla  ---------------------aat-ttaaaaattggaatgtgaacagc----------------------
                    Orangutan  ---------------------aat-ttaaaaattggaatgtgaacagc----------------------
                       Gibbon  ---------------------aat-ttaaaaattggaatgtgaacagc----------------------
                       Rhesus  ---------------------aat-ttaaaaagtggaatgtgaacagc----------------------
          Crab-eating macaque  ---------------------aat-ttaaaaattggaatgtgaacagc----------------------
                       Baboon  ---------------------aat-ttaaaaattggaatgtgaacagc----------------------
                 Green monkey  ---------------------aat-ttaaaaattggaatgtgaacagc----------------------
             Proboscis monkey  ---------------------aat-ttaaaaattggaatatgaacagc----------------------
     Golden snub-nosed monkey  ---------------------aat-ttaaaaattggaatatgaacagc----------------------
                     Marmoset  ---------------------aat-ttaactattggaatgtgaacagc----------------------
              Squirrel monkey  ---------------------aat-ttaaaaattggaatgttaacagc----------------------
                      Tarsier  ---------------------ggt-tttaaaatgggaatgtggagagc----------------------
                     Bushbaby  ctgggggtgggtgagtgcctgagt-ttagaagtttga----gaccagcctgagcaagagcaagaccctgt
                   Tree shrew  ---------------------a------------------------------------------------
                        Mouse  ---------------------attattaaaagttgcaatgtgggcagc----------------------
                          Dog  ---------------------tat-tttaaaattggaatgtgggcagc----------------------
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  --------aaaatgt----gagaattg---------------------------gctggaa-ggggctg-
                        Chimp  --------aaaatgt----gagaattg---------------------------gctggaa-ggggctg-
                       Bonobo  --------aaaatgt----gagaattg---------------------------gctggaa-ggggctg-
                      Gorilla  --------aaaatgt----gagaattg---------------------------gctggaa-ggggctg-
                    Orangutan  --------aaaatgt----gagaattg---------------------------gctggaa-ggggctg-
                       Gibbon  --------aaaatgt----gagaattg---------------------------gctggaa-ggggctg-
                       Rhesus  --------aaaatgt----gagaactg---------------------------gctggaa-agggctg-
          Crab-eating macaque  --------aaaatgt----gagaactg---------------------------gctggaa-agggctg-
                       Baboon  --------aaaaagt----gagaattg---------------------------gctggaa-agggctg-
                 Green monkey  --------aaaatgt----gagaactg---------------------------gctggaa-agggctg-
             Proboscis monkey  --------aaaatgt----gagaattg---------------------------gctggaa-agggccg-
     Golden snub-nosed monkey  --------aaaatgt----gagaattg---------------------------gctggaa-agggccg-
                     Marmoset  --------aaaatgc----gagaattg---------------------------gctgtgc-agggctg-
              Squirrel monkey  --------aaaatgt----gagaattg---------------------------gctgtgc-ggggctg-
                      Tarsier  --------aaaatat----gagagttg---------------------------actcaga-gggtatg-
                     Bushbaby  ctctattaaaaatag----aaaaactgaggcaagaggatgtcttgagcccaagagtttgag-gttgctgt
                   Tree shrew  --------aaaatg-------gcattg---------------------------------------tgg-
                        Mouse  --------acaatgtatcaacaagctg---------------------------gctgggt-gtgactg-
                          Dog  --------aaaatgt----gagaatct---------------------------gctgggagggggctg-
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  -------gattttatg------------ggctggcaaa-caagatgtagtgtatcacag-----------
                        Chimp  -------gattttatg------------ggctggcaaa-caagatgtagtgtatcacag-----------
                       Bonobo  -------gattttatg------------ggctggcaaa-caagatgtagtgtatcacag-----------
                      Gorilla  -------gattttatg------------ggctggcaaa-caagatgtagtgtatcacag-----------
                    Orangutan  -------gattttatg------------ggctggcaaa-caagatgtagtgtatcacag-----------
                       Gibbon  -------gattttatg------------ggctggcaaa-taagatgtagtgtatcacag-----------
                       Rhesus  -------gattt---------------------gcaaa-caagatgtagtgtatcgcag-----------
          Crab-eating macaque  -------gattt---------------------gcaaa-caagatgtagtgtatcgcag-----------
                       Baboon  -------gattt---------------------gcaaa-caagatgtagtgtatcgcag-----------
                 Green monkey  -------gattt---------------------gcaaa-caagatgtagtgtatcgcag-----------
             Proboscis monkey  -------gattt---------------------gcaaa-caagatgtagtgtatcgcag-----------
     Golden snub-nosed monkey  -------gattt---------------------gcaaa-caagatgtagtgtatcgcag-----------
                     Marmoset  -------gattttatg------------ggctggcaaa-caagatgtagtgtatcacgg-----------
              Squirrel monkey  -------gattttatg------------ggctggcaaa-caagatgtagtgtatcacag-----------
                      Tarsier  -------gattttatg------------atgtcacaaa-caagatatgatgcatcggag-----------
                     Bushbaby  gagtgatgatgccatggcactccacccagggtgacaaagtgagatgc--tgtctcaaagaaaaaaaaaaa
                   Tree shrew  -------gattttatg------------ggccggcaaa-ggagaggtagtttgtcagag-----------
                        Mouse  -------aagcctgga------------agctgttaag-caaaattccatgtgtc---------------
                          Dog  -------gattttatg------------ggctggcaaa-caagatgcagtgtttcggag-----------
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  -----------------------gactagaaagggctgaagtgtg-tccctgctgttaaagaataggatg
                        Chimp  -----------------------gactagaaagggctgaagtgtg-tccctgctgttaaagaataggatg
                       Bonobo  -----------------------gactagaaagggctgaagtgtg-tccctgctgttaaagaataggatg
                      Gorilla  -----------------------gactagaaagggctgaagtgtg-tccctgctgttaaagaataggatg
                    Orangutan  -----------------------gactagaaagggctgaagtatg-tccctgctgttaaagaataggatg
                       Gibbon  -----------------------gactagaaagggctgaagtgtg-tccctgctgttaaagaataggatg
                       Rhesus  -----------------------gaccagaaaggactcaagtgtg-tccctgctgttaaagaatagtttg
          Crab-eating macaque  -----------------------gaccagaaaggattcaagtgtg-tccctgctgttaaagaatagtttg
                       Baboon  -----------------------gaccagaaaggactgaagtgta-tccctgctgttaaagaatagtttg
                 Green monkey  -----------------------gaccagaaaggacttaagtgtg-tccctgctgttaaagaatagtttg
             Proboscis monkey  -----------------------gaccagaaaggactgaagtgtg-tccctgctgttcaagaatagtttg
     Golden snub-nosed monkey  -----------------------gaccagaaaggactgaagtgtg-tccctgctgttcaagaatagtttg
                     Marmoset  -----------------------gaccagaaaggcctgacgtgtg-tccctgctgttaaagaatagtctg
              Squirrel monkey  -----------------------gaccagaaaggcctgatgtgtg-tccctgctgttaaagaatagtctg
                      Tarsier  -----------------------ggccagaaaaggctgaagtata-ctcttatgcttcaagaatagtctg
                     Bushbaby  ttagaacatgggaagcaaaatgtgaacagaaagggataaagtgta-ttcctattgttaaagaaccatctg
                   Tree shrew  -----------------------gaacagaaagggccggtgtgca-ttcctgatgttaaagc--------
                        Mouse  ------------------------------------tgaagtggt-cttctgttgccaaagaatagtcca
                          Dog  -----------------------gaacagagagggttgaagtgtactccttgttgttaaagaatagtcta
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  aaaaact-------atgtaagatattggattaagggaaaagataaagaattccagctggttaatacacat
                        Chimp  aaaaact-------atgtaagatactggattaagggaaaagataaagaattccagctggttaatacacat
                       Bonobo  aaaaact-------atgtaagatactggattaagggaaaagataaagaattccagctggttaatacacat
                      Gorilla  aaaaact-------atgtaagatattggattaagggaaaagataaagaattccagctggttaatacacat
                    Orangutan  aaaaact-------atgtaagatattggattaagggaaaagataaagaattccagctggttaatacacat
                       Gibbon  aaaaact-------atgtaagatattggattaagggaaaagataaagaattccagctggttaatacacat
                       Rhesus  aaattctttacaaactataagatattggattaagggaaaagataaagaattccagctggttaatacacat
          Crab-eating macaque  aaattctttacaaactataagatattggattaagggaaaagataaagaattccagctggttaatacacat
                       Baboon  aaagact-------ctgtaagatattggattaagggaaaagataaagaattccagctggttaatacacat
                 Green monkey  aaattctttacaagctgtaagatattggattaagggaaaagataaagaattccagctggttaatacacat
             Proboscis monkey  aaagact-------ctgtaagatattggattaagggaaaagataaagaattccagctggttaatacacat
     Golden snub-nosed monkey  aaagact-------ctgtaagatattggattaagggaaaagataaagaattccagctggttaatacacat
                     Marmoset  aaaaact-------acgtaagataatggattaagggaaaagacaaagcattccagctggttaatacacac
              Squirrel monkey  aaaaact-------acatcagataatggattaaggaaaaaaacaaagcattccagctggttaatacacac
                      Tarsier  aaatacc-------atctaagatattggattaaggaaaaagataaaacattctaggtggttaatgcacat
                     Bushbaby  aaatacc-------atagaagaaattgatttaagagaaaaaataaaacattgcaggtggttaatacacat
                   Tree shrew  aaacacc-------gtataaaatactggattaggggaaaaggt-aagtaggccaagagattaacatgcac
                        Mouse  gagcacc-------aaatctgatcttggaccaaggggaaagggttaacactgcaagaggctactatacac
                          Dog  gaatact-------gcataagctactggattaaaagagaagatcaagcattccaggaggttagtgtacat
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  tgaatgtct---ttgtatc
                        Chimp  tgaatgtct---ttgtatc
                       Bonobo  tgaatgtct---ttgtatc
                      Gorilla  tgaatgcct---ttgtatc
                    Orangutan  tgcatgcct---ttgtatc
                       Gibbon  tgaatgcct---ttgtatc
                       Rhesus  tgaatgcct---ttgtatc
          Crab-eating macaque  tgaatgcct---ttgtatc
                       Baboon  tgaatgcct---ttgtatc
                 Green monkey  tgaatgcct---ttgtatc
             Proboscis monkey  tgaatgcct---ttgtatc
     Golden snub-nosed monkey  tgaatgcct---ttgtatc
                     Marmoset  tgaatacca---gtgtatc
              Squirrel monkey  tgaatacct---gtgtatc
                      Tarsier  tgaatgtct--gttgtgtc
                     Bushbaby  caagtgcct--gttatgtc
                   Tree shrew  cggatccct--gttgtgcc
                        Mouse  taaatgtctctcgtgtgtc
                          Dog  tgaacgcct--gttctgtc
                  Mouse lemur  NNNNNNNNNNNNNNNNNNN

Inserts between block 49 and 50 in window
B D                 Bushbaby 603bp
B D                    Mouse 2bp

Alignment block 50 of 146 in window, 59302054 - 59302138, 85 bps 
B D                     Human  ctattattttatttaattctcagaacca---attta-tgaagtcaatactgatattattt--gatttca-
B D                     Chimp  ctattattttatttaattctcagaacca---attta-tgaagtcaatactgatattattt--gatttca-
B D                    Bonobo  ctattattttatttaattctcagaacca---attta-tgaagtcaatactgatattattt--gatttca-
B D                   Gorilla  ctattattttatttaattctcagaacta---attta-tggagtcaatactgatattattt--gatttca-
B D                 Orangutan  ctattattttatttaattctcagaacca---attta-tgaagtcaatactgatattattt--gatttca-
B D                    Gibbon  ctattattttatttaattctcagaacca---attta-tgaagtcaatactgatattattt--gatttca-
B D                    Rhesus  ctgttattttatttaattctcagaaccaattattta-tgaagtcaatactgatattattt--gatttca-
B D       Crab-eating macaque  ctgttattttatttaattctcagaaccaattattta-tgaagtcaatactgatattattt--gatttca-
B D                    Baboon  ctattattttatttaattctcagaacca---attta-tgaagtcaatactgatattattt--gatttca-
B D              Green monkey  ctgttattttatttaattctcagaaccaattattta-tgaagtcaatactcatattattt--gatttca-
B D          Proboscis monkey  ctattattttatttaattctcagaacca---attta-tgaagtcaatactgatattattt--gatttca-
B D  Golden snub-nosed monkey  ctattattttatttaattctcagaacca---attta-tgaagtcaatactgatattattt--gatttca-
B D                  Marmoset  cttttattttatttaatcctcaggatca---attta-tgaagtcaatactgatattatta--gatttca-
B D           Squirrel monkey  cttttattttatttaatcctcagaatca---attta-tgaagtcaacactgatattatta--gatttca-
B D                   Tarsier  tcattattttatttaattctgagaacca---attta-taaaatcagcactaacactattc--catttca-
B D                  Bushbaby  ccattattttatttaattatcggaatca---atttagtggtttcatt-----tattactg--cattttg-
B D                Tree shrew  cctttggctcatttattcttcacaacga------cg-tacagtcagtactaatattattc--cttttca-
B D                     Mouse  caattatttcactta-ctctcagcaaaa---ggtta-tgaagccaat--tactgttgttc--cgtttcaa
B D                       Dog  ccattacttcatttaatcctctgaccta---attta-tgacatcattaataatgtttttttcattttca-
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  -----aactgagaagtcagggcttgca
                        Chimp  -----aactgagaagtcagggcttgca
                       Bonobo  -----aactgagaagtcagggcttgca
                      Gorilla  -----aactgagaagtcagggcttgca
                    Orangutan  -----aactgagaagtcagggcttgca
                       Gibbon  -----aaccgagaagtcaggacttgca
                       Rhesus  -----aactgagaagtcagggcttgga
          Crab-eating macaque  -----aactgagaagtcagggcttgga
                       Baboon  -----aactgagaagtcagggcttgga
                 Green monkey  -----aactgagaagtcagggcttgga
             Proboscis monkey  -----aactgagaagtcagggcttgga
     Golden snub-nosed monkey  -----aactgagaagtcagggcttgga
                     Marmoset  -----aattgagaagtcagggcttgga
              Squirrel monkey  -----aattgagaagccagggcttgga
                      Tarsier  -----cacagaggagacagggcttgga
                     Bushbaby  -----aac--acaggtttggacttgga
                   Tree shrew  -----aacaggggagtcagccatcggg
                        Mouse  gagatagctatggcttaagggcttgta
                          Dog  -----ggcagggcaggcagggcttggt
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 50 and 51 in window
B D                    Mouse 287bp

Alignment block 51 of 146 in window, 59302139 - 59302154, 16 bps 
B D                     Human  gtggtt-aaaaaacgtg
B D                     Chimp  gtggtt-aaaaaacgtg
B D                    Bonobo  gtggtt-aaaaaacgtg
B D                   Gorilla  gtggtt-aaaaaatgtg
B D                 Orangutan  gtggtt-aaaaaatgtg
B D                    Gibbon  gtggttaaaaaaatgtg
B D                    Rhesus  gtggtt-aaataatttg
B D       Crab-eating macaque  gtggtt-aaataatttg
B D                    Baboon  gtggtt-aaataatttg
B D              Green monkey  gtggtt-aaataatttg
B D          Proboscis monkey  gtggtt-aaataatttg
B D  Golden snub-nosed monkey  gtggtt-aaataatttg
B D                  Marmoset  gtggtt-aacaaatttg
B D           Squirrel monkey  gtcgtt-aacatatttg
B D                   Tarsier  gtagat-aacaaacttg
B D                  Bushbaby  gtgatt-aacaaagctg
B D                Tree shrew  gtggtt-catagacctg
B D                       Dog  gtgctt-aacaggcttg
B D                     Mouse  =================
B D               Mouse lemur  NNNNNNNNNNNNNNNNN

Inserts between block 51 and 52 in window
B D               Tree shrew 1382bp

Alignment block 52 of 146 in window, 59302155 - 59302172, 18 bps 
B D                     Human  taagatatattgttagta
B D                     Chimp  taagatatattgttagta
B D                    Bonobo  taagatatattgttagta
B D                   Gorilla  taagatatattgttagta
B D                 Orangutan  taagatatattgttagta
B D                    Gibbon  taagatatattgttagta
B D                    Rhesus  taagatatattgttagta
B D       Crab-eating macaque  taagatatattgttagta
B D                    Baboon  taagatatattgttagta
B D              Green monkey  taagatatattgttagta
B D          Proboscis monkey  taagatacattgttagta
B D  Golden snub-nosed monkey  taagatacattgttagta
B D                  Marmoset  taagatacattgttagta
B D           Squirrel monkey  taagatatattgttagta
B D                   Tarsier  taagatatattgctggta
B D                  Bushbaby  taagatacattgttag--
B D                       Dog  tgagatactctgttagta
B D                     Mouse  ==================
B D               Mouse lemur  NNNNNNNNNNNNNNNNNN
B D                Tree shrew  ==================

Inserts between block 52 and 53 in window
B D                 Marmoset 318bp

Alignment block 53 of 146 in window, 59302173 - 59302273, 101 bps 
B D                     Human  agtgatggagactc-tcaaacatatggactgtatagtaattgccatttagaccacaaagtaatgattgaa
B D                     Chimp  agtgatggagactc-tcaaacatatggactgtatagtaattgccatttagaccacaaagtaatgattgaa
B D                    Bonobo  agtgatggagactc-tcaaacatatggactgtatagtaattgccatttagaccacaaagtaatgattgaa
B D                   Gorilla  agtgatggagactc-tcaaacatatggactgtatagtacttgccatttagaccacaaagtaatgattgaa
B D                 Orangutan  agtgatggagactc-tcaaacatatggactgtatagtaattgccatttagaccacaaagtaatgattgaa
B D                    Gibbon  agtgatggagactc-tcaaacatatgaactgtagagtaattgccatttagaccacaaagtaatgactgaa
B D                    Rhesus  agtgatgaagactc-tcaaacatacggactgtatagtaattgccatctagaccacaaagtaatgactgaa
B D       Crab-eating macaque  agtgatgaagactc-tcaaacatatggactgtatagtaattgccatctagaccacaaagtaatgactgaa
B D                    Baboon  agtgatgaagactc-tcaaacatatggactgtatagtaattgccatctagaccacaaagtaatgactgaa
B D              Green monkey  agtgatgaagactc-tcaaacatatggactatatagtaattgccatctagaccacaaagtaatgactgaa
B D          Proboscis monkey  agtgatgaagactc-tcaaacatatggactgtatagtaattgccatctagaccacaaagtaatgactgaa
B D  Golden snub-nosed monkey  agtgatgaagactc-tcaaacatatggactgtatagtaattgccatctagaccacaaagtaatgactgaa
B D                  Marmoset  agtgatggagcctc-tcagacatatggaatgtatag-agcttccatttacattgcaaagtaatgactgaa
B D           Squirrel monkey  agtgatagagactc-tcaaacatacgaaatgtatag-aacttccatttacattgcaaagtaacgattgaa
B D                   Tarsier  agtaatggagtgtc-tcaagcacatatactgtatagcaattgacatttagaccaaaaagtaatggttgaa
B D                  Bushbaby  --------agactc-tcaaacctacaggctatatagtaataaccacgtagaccagaaagtaatgactgag
B D                       Dog  agtgatggaaactcttcaaacacacaga----gtagtaattgccctttgaatcacaaagtaacaatcgaa
B D                     Mouse  ======================================================================
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Tree shrew  ======================================================================

                        Human  gaccttctaccacctaatggcagaatatccaa
                        Chimp  ggccttctaccacctaatggcagaatatccaa
                       Bonobo  gaccttctaccacctaatggcagaatatccaa
                      Gorilla  gaccttctaccacctaatggcagaatatccaa
                    Orangutan  gaccttctaccacctaatggcagaatatccaa
                       Gibbon  gaccttctaccacctaatggcagaatatccaa
                       Rhesus  gaccttctaccacctaatggcagaatatccaa
          Crab-eating macaque  gacctcctaccacctaatggcagaatatccaa
                       Baboon  gaccttctaccacctaatggcagaatatccaa
                 Green monkey  gaccttctaccacctaatggcagaatatccaa
             Proboscis monkey  gatcttctaccacctgatggcagaatatccaa
     Golden snub-nosed monkey  gatcttctaacacctgatggcagaatatccaa
                     Marmoset  gaccttctaccacctgatggcagaatatccaa
              Squirrel monkey  gacctcctaccacctgatggcagaatatccaa
                      Tarsier  caccttctaccacctagtgactgaatacccaa
                     Bushbaby  a--cgttggccactg------agaacacccaa
                          Dog  ga---tccgccacctagtggctgtctacccaa
                        Mouse  ================================
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Tree shrew  ================================

Alignment block 54 of 146 in window, 59302274 - 59302559, 286 bps 
B D                     Human  attgcaggttttgtttat-ttgaggtttgaagaaatttcaca-------------tttaaaattttagca
B D                     Chimp  attgcaggttttgtttat-ttgaggtttgaagaaatttcaca-------------tttaaaattttagca
B D                    Bonobo  attgcaggttttgtttat-ttgaggtttgaagaaatttcaca-------------tttaaaattttagca
B D                   Gorilla  attgcaggttttgtttat-ttgaggtttgaagaaatttcaca-------------tttaaaattttagca
B D                 Orangutan  attgcaggttttggttat-ttgaggtttgaaaaaatttcaca-------------tttaaaattttagca
B D                    Gibbon  attgcgggttttgtttat-ttgaggtttgaagaaatctcaca-------------tttaaaattttagca
B D                    Rhesus  attgcaggttttgtttat-ttgagtgttgaagaaatttcaca-------------tttaaaattttagca
B D       Crab-eating macaque  attgcaggttttgtttat-ttgagggttgaagaaatttcaca-------------tttaaaattttagca
B D                    Baboon  attgcaggttttgtttat-ttgagggttgaagaaatttcaca-------------tttaaaattttagca
B D              Green monkey  attgcaggttttgtttat-ttgagggttgaagaaatttcaca-------------tttaaaattttagca
B D          Proboscis monkey  attgcaggttttgtttat-ttgagggttgaagaaatttcaca-------------tttaaaattttagca
B D  Golden snub-nosed monkey  attgcaggttttgtttat-ttgagggttgaagaaatttcaca-------------tttaaaattttagca
B D                  Marmoset  atcgcaggttttgtttat-ttgagggttg---aaatttcatc-------------tgtaaagttttagca
B D           Squirrel monkey  attgcaggttttgttttc-ttgagggttg---aaatttcacc-------------tgtaaagttttagca
B D                   Tarsier  attgcaggtcctatttat-ttgagggctgaagaaatttcacaaagttgtttgtttttt----ttttagca
B D                  Bushbaby  actgtaggttttgtgtat-ttgagatttgga-aaatttcacg-------------t-taaagttttagca
B D                     Mouse  attatatattatatttatattgcattatagaaagattgaaat-------------ttcacagaattagta
B D                       Dog  attgcaggtt-tgtttat-ttgaagatcgaacaccttcaaca-------------ttcagtttgggcaca
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Tree shrew  ======================================================================

                        Human  gaactctaagattctgcagggtgtga--------------------atgggacttgactcaatatttgcc
                        Chimp  gaactctaagattctgcagggtgtga--------------------ataggacttgactcaatatttgtc
                       Bonobo  gaactctaagattctgcagggtgtga--------------------ataggacttgactcaatatttgtc
                      Gorilla  gaactctaagattctgcagggtgtaa--------------------ataggacttgactcaatatttgtc
                    Orangutan  gaactct--gattctgcagggtgtga--------------------gtagaacttgactcaatatttgtc
                       Gibbon  gagctgtaagattctgcagggtgtga--------------------atagaacttgagtcaatatttgtc
                       Rhesus  gaaatctaagattctgcagggtgtga--------------------acagaacttgagtcaatatttgtc
          Crab-eating macaque  gaaatctaagattctgcagggtgtga--------------------acagaacttgagtcaatatttgtc
                       Baboon  gaaatctaagattctgcagggtgtga--------------------acagaacttgagtcaatatttgtc
                 Green monkey  gaaatctaagattctgcagggtgtga--------------------acagaacttgagtcaatatttgtc
             Proboscis monkey  gaaatctaagattatgtagggtgtga--------------------acagaacttgagtcaatatttgtc
     Golden snub-nosed monkey  gaaatctaagattctgcagggtgtga--------------------acagaacttgagtcaatatttgtc
                     Marmoset  gaaatctaaaattctgcagggtgtgaacagaacttgacagaacttgacagaacttgactcaatatttgtc
              Squirrel monkey  gaaatctaagattctgcagggtgtga--------------------acagaacttgactcaatatttgtc
                      Tarsier  gaaatctaggattctggagtgtgtga--------------------agagaattcaattcaatatttttc
                     Bushbaby  gatagctaagattctggaaggtatga--------------------agcaaatttgcttcaatatttgtc
                        Mouse  gaatcctaatatgctgcagggtacaa--------------------aaggaattggacttagtagctggc
                          Dog  aaaagctaaggttctgaagtccatta--------------------ggagaaattgtctcaatatttgtc
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Tree shrew  ======================================================================

                        Human  accgc----acc----aacaaa----tttg----actag----gaggtatcgtaccata-ttttagaa--
                        Chimp  accac----acc----aacaaa----tttg----actag----gaggtatcgtaccata-ttttagaa--
                       Bonobo  accac----acc----aacaaa----tttg----actag----gaggtatcgtaccata-ttttagaa--
                      Gorilla  accac----acc----aacaaa----tttg----actag----gaggtgtcgtatcata-ttttagaa--
                    Orangutan  accac----acc----aacaaa----tttg----actag----gaggtattgtaccata-ttttagaa--
                       Gibbon  accac----acc----aacaaa----tttg----actag----ggggtattgtaccata-ttttacaa--
                       Rhesus  accac----acc----aacaaa----tttg----actag----gaggtatcataccata-ttttagaa--
          Crab-eating macaque  accac----acc----aacaaa----tttg----actag----gaggtatcataccata-ttttagaa--
                       Baboon  accac----acc----aacaaa----tttg----actag----gaagtatcataccata-ttttagaa--
                 Green monkey  accag----acc----aacaaa----tttg----actag----gaggtatcataccatc-ttttagaa--
             Proboscis monkey  accac----acc----aacaaa----tttg----actag----gaggtatcataccata-ttttagaa--
     Golden snub-nosed monkey  accac----acc----aacaaa----tttg----actag----gaggtatcataccata-ttttagaa--
                     Marmoset  accgc----acc----aacaaa----attg----actag----gaggtatcatactata-ttttagga--
              Squirrel monkey  actgc----acc----aacaaa----actg----actag----gaggtgtcatactata-ttttagaa--
                      Tarsier  accaa----accaacaaacaaa----tgtg----actag----aaggcatcacggagta-ttacagaa--
                     Bushbaby  accacaacaacc----aaaaaa----tttg----actag----gcgatatcagagcata-gtgtagaa--
                        Mouse  catca----act----aataaa----cctaccctactagagtagcagtatcatactgtagttataggata
                          Dog  agcat----acc----aaccaaccagtttg----accag----g----atcccagcatg-tgatatta--
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Tree shrew  ======================================================================

                        Human  -----------tatatagca-----ttgtttagtgctcagaaaaacatgggttgggacttcatcactttt
                        Chimp  -----------tatatagca-----ttgtttagtgctcagaaaaacatgggttgggacttcatcactttt
                       Bonobo  -----------tatatagca-----ttgtttagtgctcagaaaaacatgggttgggacttcatcactttt
                      Gorilla  -----------tatatagca-----ttgtttagtgctcagaaaaacatgggttgggacttcatcactttt
                    Orangutan  -----------tatatagca-----ttgcttagtgctcagaaaaacatgggttgggacttcatcactttt
                       Gibbon  -----------cacatagca-----ttgtttggtgctcagaaaaacatgggttgggacttcatcactttt
                       Rhesus  -----------tatgtaaca-----ttgtttagtgctcagaaaaacatgagttgggacttcatcactttt
          Crab-eating macaque  -----------tatgtaaca-----ttgtttagtgctcagaaaaacatgagttgggacttcatcactttt
                       Baboon  -----------tatgtaaca-----ttgtttagtgctcagaaaaacatgagttgggacttcatcactttt
                 Green monkey  -----------tatataaca-----ttgtttattgttcagagaaacatgagttgggacttcatcactttt
             Proboscis monkey  -----------tatgtaaca-----ttgtttagtgctcagaaaaacatgagttgggacttcaacactttt
     Golden snub-nosed monkey  -----------tatgtaaca-----ttgtttagtgctcagaaaaacatgagttgggacttcaacactttt
                     Marmoset  -----------tatatagca-----ttatttagtattcagaaaagcacaaattggaacttcatcag----
              Squirrel monkey  -----------tatatagca-----ttatttagtattcagaaaatcaaggattggaacttcatcagtttt
                      Tarsier  -----------gatatagca-----ttattttgtgttcatgaaaactggggttggaacttcattaagttt
                     Bushbaby  -----------gatgcagta-----ttgttttgggctcagaaaaacttgagctggaactttatcaggttt
                        Mouse  tcacaacatactatatagcatatactgactctgtgtttagaaaagcttgagttagacttgcaccaggttc
                          Dog  -----------gatgtaacg-----ttgtttggtcttcagaaaaatttgagcttggacttgatcacattt
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Tree shrew  ======================================================================

                        Human  gggatcttgtgcaaa----ct--ttgacctctgtgagtgagctttatgtcttattatgtaaaatagggac
                        Chimp  gggatcttgtgcaaa----ct--ttgacctctgtgagtgagctttatgtcttattatgtaaaatagggac
                       Bonobo  gggatcttgtgcaaa----ct--ttgacctctgtgagtgagctttatgtcttattatgtaaaatagggac
                      Gorilla  gggatcttgtgcaaa----ct--ttgacctctgtgagtgagctttatgtcttattatgtaaaatagggac
                    Orangutan  gggatcttgtgcaaa----ct--ttgacctctgtgagtgagctttatgtcttattatgtaaaataaggac
                       Gibbon  gggatcttgtgcaaa----ct--ttgacctctgtgagtgaactttatgtcttagtatgtaaaatagggac
                       Rhesus  gggatcttgtgccaa----ct--ctgacctctgtgagcaagctttatgtct---tatataaaatagggac
          Crab-eating macaque  gggatcttgtgccaa----ct--ctgacctctgtgagcaagctttatgtct---tatataaaatagggac
                       Baboon  gggatcttgtgccaa----ct--ctgacctctgtgagcaagctttatgtct---tatataaaatagggac
                 Green monkey  gggatcttgtgccaa----ct--ctgacctctgtgagcaagctttatgtct---tatataaaatagggac
             Proboscis monkey  gggatcttgtgccaa----ct--ctgacctctgtgagcaagctttatgtct---tatataaaatagggac
     Golden snub-nosed monkey  gggatcttgtgccaa----ct--ctgacctctgtgagcaagctttatgtct---tatataaaatagggac
                     Marmoset  ----tcttgtgcaaa----ct--ttgccctctgtgagtgagctttacgtcttcttacgtaaaatgggcag
              Squirrel monkey  gtgatcttgtgcaaa----ct--ttgccctctgtgagtgagctttatggcttcttatgtaaaatgggcac
                      Tarsier  gggatctttaacaaa-agttt--tttatctctgtgagtgagccttgtttcctcttctgttaaatagtaac
                     Bushbaby  gtggtcttgaacaattttttt--ttaacctctgtgggtgagttttatttcctcttatgtaaaatagcaac
                        Mouse  aagat-ttggacagt----tt--cttttttagactatgaaactctccttct-cttatat-aaatacagat
                          Dog  gtcatcttggacacg----tttcttagactctatgagtgagc--------------------atgagtat
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Tree shrew  ======================================================================

                        Human  aaagttttatacttt
                        Chimp  aaagttttatacttt
                       Bonobo  aaagttttatacttt
                      Gorilla  aaagttttatacttt
                    Orangutan  aaagttttatacttt
                       Gibbon  aaagtttcatacttt
                       Rhesus  aaagtttcatactct
          Crab-eating macaque  aaagttttatactct
                       Baboon  aaagttttatacttt
                 Green monkey  aaagttttatacttt
             Proboscis monkey  caag-tttatacttt
     Golden snub-nosed monkey  aaagttttatacttt
                     Marmoset  aaagttttatacttt
              Squirrel monkey  aaagttttatacttt
                      Tarsier  aaagtttcacacttt
                     Bushbaby  aaagtttcatacttt
                        Mouse  catgctgtatacttt
                          Dog  gaagatccatacttt
                  Mouse lemur  NNNNNNNNNNNNNNN
                   Tree shrew  ===============

Inserts between block 54 and 55 in window
B D                    Mouse 125bp

Alignment block 55 of 146 in window, 59302560 - 59302804, 245 bps 
B D                     Human  tcaagcttctttatgcataagaaataatacacattgaaataatttggcacagttcctggcacatagaaga
B D                     Chimp  tcaagcttctttatgcataagaaataatacacattgaaataatttggcacagttcctggcacatagaaga
B D                    Bonobo  tcaagcttctttatgcataagaaataatacacattgaaataatttggcacagttcctggcacatagaaga
B D                   Gorilla  tcaagcttctttatgcattagaaataatacacattgaaataatttggcacagttcctggcacatagaaga
B D                 Orangutan  tcaagcttctttttgcattagaaataatacacattgaaataatttggcacagttcctggcacatagaaga
B D                    Gibbon  tcaagcttctttatgcatcagaaataatacacattgaaataatttggcacagttcctggcacatagaaga
B D                    Rhesus  tcaagctcctttatgcattagaaataatacacattgaaataatttggcacagttcctggcacatacaaga
B D       Crab-eating macaque  tcaagctcctttatgcattagaaataatacacattgaaataatttggcacagttcctggcacatacaaga
B D                    Baboon  tcaagctgctttatgcattagaaataatacacattgaaataatttggcacagttcctggcacatacaaga
B D              Green monkey  tcaagctcctttatgcattagaaataatacacattgaaataatttggcacagttcctggcacatacaaga
B D          Proboscis monkey  tcaagctcctttatgcaatagaaataatacacgttgaaataatttggcacaattcctggcacatacaaga
B D  Golden snub-nosed monkey  tcaagctcctttatgcaatagaaataatacacgttgaaataatttggcacaattcctggcacatacaaga
B D                  Marmoset  tcaagcttctttatgcattagaaataatacacgtagaaataatttggcacagttcctggcacatagaaga
B D           Squirrel monkey  tcaagcttctttatgcattagaaataatacacatagaaagaatttggcacagttcctggcacatagaaga
B D                   Tarsier  tcagaattttttatgtattaaaaataatacacatccagaggactgagcaccattcctggcacatactaga
B D                  Bushbaby  taaaatgtctttaggcattagaaacagtatacaaatgaaagactcagcacagctcatggcacatacttgt
B D                       Dog  tcaaatttctttatgcattggaaataatacgtagccaaataatttagcacaattcctggcttgtactaga
B D                     Mouse  ======================================================================
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Tree shrew  ======================================================================

                        Human  tgcttagtaaatgataatgcacttgcttcaggtgcacacttaactt-acctaaaagcaa-cta-ttgaga
                        Chimp  tgcttagtaaatgataatgcacttgcttcaggtgcacacttaactt-acctaaaagcaa-cta-ttgaga
                       Bonobo  tgcttagtaaatgataatgcacttgcttcaggtgcacacttaactt-acctaaaagcaa-cta-ttgaga
                      Gorilla  tgcttagtaaatgataatgcacttgcttcaggtgcacacttaactt-acctaaaagcaa-cta-ttgaga
                    Orangutan  tgcttagtaaatgataatgcacttgcttcaggtgcacacttaactt-acctaaaagcaa-cta-ttgaga
                       Gibbon  tgcttagtaaatgataatgcacttgcttcaggtgcacacttaactt-acctaaaa-caa-cta-ttgaga
                       Rhesus  tgcttagtaaatgataatgcacttgcttccggtgcacacttcactt-acctaaaagcaa-cta-ttcaga
          Crab-eating macaque  tgcttagtaaatgataatgcacttgcttccggtgcacacttcactt-acctaaaagcaa-cta-ttcaga
                       Baboon  tgcttagtaaatgataatgcacttgcttctggtgcacacttcactt-tcctaaaagcaa-cta-ttcaga
                 Green monkey  tgcttagtaaatgataatgcacttgcttccggtgcacacttcactt-acctaaaagcaa-cta-ttcaga
             Proboscis monkey  tgcttagtaaacgataatgcacttgcttccggtgcacacttcactt-acctaaaagcaa-cta-ttcaga
     Golden snub-nosed monkey  tgcttagtaaacgataatgcacttgcttccggtgcacacttcactt-acctaaaagcaa-cta-ttcaga
                     Marmoset  tgcttagtaaatgataatgcacttgcttcaggtgcacacttcactt-acctaaaagcaa-tta-tagaga
              Squirrel monkey  tgcttagtaaatgataatgcacttgcttcaggtgcacacttcactt-acctaaaagcag-cta-ttgaga
                      Tarsier  tgctcagtaaatgaaaatgtggccgcttcaggtgcacatttaactt-acccaaaagcaaccta-ttgaga
                     Bushbaby  tgcccagtaagtgataatgtacctgcttcaggtgcagatttaacttaacctaaaagcaa-ctcttttaga
                          Dog  ggctcagtgaatgacaatgcacttgcttcaggcacttacttaactt-ccctaaaagcag-cta-ctgaga
                        Mouse  ======================================================================
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Tree shrew  ======================================================================

                        Human  gggaaagagagga---agaaggggagaagaaat------ggggaagggaagagggaggaagatggagagg
                        Chimp  gggaaagagagga---agaaggggagaagaaat------ggggaagggaagagggaggaagatggagagg
                       Bonobo  gggaaagagagga---agaaggggagaagaaat------ggggaagggaagagggaggaagatggagagg
                      Gorilla  gggaaagagagga---agaaggggagaagaaat------ggggaagggaagagggaggaagatggagagg
                    Orangutan  gggaaagagagga---agaaggggagaagaaat------ggggaagggaagagggaggaagatggagagg
                       Gibbon  ggaaaatagagga---agaagggaagaagaaat------ggggaagggaagagggaggaagatggagagg
                       Rhesus  gggaaagagagga---agaagaggagaagaaat------ggggaagggaagagggatgaggatggagagg
          Crab-eating macaque  gggaaagagagga---agaagaggagaagaaat------ggggaagggaagagggatgaggatggagagg
                       Baboon  gggaaagagagga---agaaggggagaagaaat------ggggaagggaagagggacgaggatggagagg
                 Green monkey  gggaaagagagga---agaagaggagaagaaat------ggggaagggaagagggatgaggatggagagg
             Proboscis monkey  gggacagagagga---agaaggggagaagaaat------ggggaagggaagagggacgaggatggagagg
     Golden snub-nosed monkey  gggacagagagga---agaaggggagaagaaat------ggggaagggaagagggacgaggatggagagg
                     Marmoset  aagaaaaagagga---agaaggggagaagaaat------ggggaagggaagaacgaggaaaatggagagg
              Squirrel monkey  aagaaagagagga---agaagaggagaagaaataaggaaggggaagggaagaaggaggaaggtggagagg
                      Tarsier  -ggaaaaagagga---ggagga----aggaagg------aaggagaggaagagggaggggggaggaaagg
                     Bushbaby  gaacaagaagggagtgagaggggcagatgaagt------ggggaggagaag------gcaaagggagagg
                          Dog  gagaaggaggagt---aggagggacagggagag------gaataaggggagggggagaggagaggggagg
                        Mouse  ======================================================================
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Tree shrew  ======================================================================

                        Human  gaga-gattttcaacagagaaagaagcctctagaccaaaagcagagag
                        Chimp  gaga-gattttcaacagagaaagaagcctctagaccaaaagcagagag
                       Bonobo  gaga-gattttcaacagagaaagaagcctctagaccaaaagcagagag
                      Gorilla  gaga-gattttcaacagagaaagaagcctctagaccaaaagcagagag
                    Orangutan  gaga-gattttcaacagagaaagaagcctctagaccaaaagcagagag
                       Gibbon  gaga-gattttcaacagagaaagaagcctctacaccaaaaccagagag
                       Rhesus  gaga-gatttttaacagagaaagaagcctctagaccaaaagcagagag
          Crab-eating macaque  gaga-gatttttaacagagaaagaagcctctagaccaaaagcagagag
                       Baboon  gaga-ggttttcaacagagaaagaagcctctagaccaaaggcagagag
                 Green monkey  gaga-gatttttaacagagaaagaagcctctagaccaaaagcagagag
             Proboscis monkey  gaga-gattttcaacagagaaagaagcctctagaccaaaggcagagag
     Golden snub-nosed monkey  gaga-gattttcaacagagaaagaagcctctagaccaaaggcagagag
                     Marmoset  gaga-gattttcaacagagaaagaagcctctagaccaaaagcagagag
              Squirrel monkey  gaga-gattttcaacagagaaagaagcctctagaccaaaagcagagag
                      Tarsier  gaga-gattttcaa---------gaacctctgggccaaaaggagagag
                     Bushbaby  aaga-gatgttca---------ggagcttctacagcaagatcagagag
                          Dog  gaaatgatttgcagcagggaaaggaccacagaaaccaaaaccagagag
                        Mouse  ================================================
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Tree shrew  ================================================

Alignment block 56 of 146 in window, 59302805 - 59302807, 3 bps 
B D                     Human  at------a
B D                     Chimp  at------a
B D                    Bonobo  at------a
B D                   Gorilla  at------a
B D                 Orangutan  atagagaaa
B D                    Gibbon  atagagaaa
B D                    Rhesus  atagggaaa
B D       Crab-eating macaque  atagggaaa
B D                    Baboon  atagggaaa
B D              Green monkey  atagggaaa
B D          Proboscis monkey  atagggaaa
B D  Golden snub-nosed monkey  atagggaaa
B D                  Marmoset  tt-gggaaa
B D           Squirrel monkey  tt-gggaaa
B D                   Tarsier  aga------
B D                       Dog  ------ata
B D                     Mouse  =========
B D               Mouse lemur  NNNNNNNNN
B D                  Bushbaby  ---------
B D                Tree shrew  =========

Inserts between block 56 and 57 in window
B D                  Tarsier 2bp
B D                      Dog 2bp

Alignment block 57 of 146 in window, 59302808 - 59302848, 41 bps 
B D                     Human  aagttaataaatgggccgggcactcctggtggctcacccct
B D                     Chimp  aagttaataaatgggccgggcactcctggtggctcacccct
B D                    Bonobo  aagttaataaatgggccgggcactcctggtggctcacccct
B D                   Gorilla  aagttaataaataggccgggcactcctggtggctcacacct
B D                 Orangutan  aagttaacaaatgggctgggcactcctggtggctcacacct
B D                    Gibbon  aagttaataaatgggcctggcactcctggtggctcacacct
B D                    Rhesus  aagttaacaaatgggctgggcactcttggtggctcacacct
B D       Crab-eating macaque  aagttaacaaatgggctgggcactcttggtggctcacacct
B D                    Baboon  aagttaataaatggcctgggcactcttggtggctcacacct
B D              Green monkey  aagttaataaatgggctgggcactcttagtggctcacacct
B D          Proboscis monkey  aagttaataaatgggctgggcactcttggtgcctcacacct
B D  Golden snub-nosed monkey  aagttaataaatgggctgggcactcttggtggctcacacct
B D                  Marmoset  aagttaacaaatgggccaggcgctctt-gtggctcatgcct
B D           Squirrel monkey  aagttaacgaatgggccaggcactcttggtgtctcatgctt
B D                       Dog  aagttaataaatggtc--ggagttcctaagtgtttattcct
B D                     Mouse  =========================================
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Bushbaby  -----------------------------------------
B D                Tree shrew  =========================================
B D                   Tarsier  =========================================

Inserts between block 57 and 58 in window
B D                      Dog 123bp

Alignment block 58 of 146 in window, 59302849 - 59303130, 282 bps 
B D                     Human  gtgatcccagcactttgggaggtcgaggcaggtggatcacttgaggtcaggagctcgagaccaggctggc
B D                     Chimp  gtgatcccagcactttgggaggtcgaggcaggtggatcacttgaggtcaggagctcgagaccaggctggc
B D                    Bonobo  gtgatcccagcactttgggaggtcgaggcaggtggatcacttgaggtcaggagctcgagaccaggctggc
B D                   Gorilla  gtgatcccagcactttgggaggtcgaggcaggtggatcacttgaggtcaggagctcgagaccaggctggc
B D                 Orangutan  gtgatcccagcactttgggaggtcgaggcaggtggatcgcttgaggtcaggagcttgagaccaggctggc
B D                    Gibbon  gtgatcccagcactttgggaggtcgaggcaggtggatcacttgaggtcaggagctcgagaccaggctggc
B D                    Rhesus  gtgatctcagcactttgggaggtcgaggcaggtggatcacctgaggtcaggagctcgagatcagcctgac
B D       Crab-eating macaque  gtgatctcagcactttgggaggtcgaggcaggtggatcacctgaggtcaggagctcgagaccagcctgac
B D                    Baboon  gtaatctcagtactttgggaggtcgaggcaggtggatcacctgaggtcaggagctcgagaccagcctggc
B D              Green monkey  gtgatctcagcactttgggaggtcgaggcaggtggattacctgaggtcaggagctcgagaccagcctggc
B D          Proboscis monkey  gtaatctcagcaa-ttgggaggtcgaggcaggtggatcacctgaggtcaggagctcgagaccagcctggc
B D  Golden snub-nosed monkey  gtaatctcagcaa-ttgggaggtcgaggcaggtggatcacctgaggtcaggagctcgagaccagcctggc
B D                  Marmoset  atgatcccagcactttgggaagccaaggcaggtggattacttgaggtcagaagatcgagaccagcctggc
B D           Squirrel monkey  atgatcccagcactttgggaagccaaggcaggtggattacttgaggtcaggagatcgaaaccagcctggc
B D                     Mouse  ======================================================================
B D                       Dog  ======================================================================
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Bushbaby  ----------------------------------------------------------------------
B D                Tree shrew  ======================================================================
B D                   Tarsier  ======================================================================

                        Human  caacatggtg-aaaaccctgtctccagcaaaaatac-aaaaattagccaggcatggtggtgcatgtctgt
                        Chimp  cagcatggtg-aaa-ccctgtttccagcagaaatac-aaaaattagccaggcatggtggtgcatgtctgt
                       Bonobo  cagcatggtg-aaa-ccctgtctccagcagaaatac-aaaaattagccaggcatggtggtgcatgtctgt
                      Gorilla  caacatggtg-aaa-ccccgtctccagtaaaaatac-aaaaattagccaggcatggtggtgcatgtctgt
                    Orangutan  caacatggtg-aaa-ctccgtctccagtaaaaatac-aaaaattagctgggcatggtggtgcatgtctgt
                       Gibbon  caacatggag-aaa-ccccatctccagtaaaaatacaaaaaattagccgggcatggtggtgcatgtctgt
                       Rhesus  caacatggtg-aaa-ccccatctccagtaaaaatac-aaaaattagccgggcatggtggtgcatgtctgt
          Crab-eating macaque  caacatggtg-aaa-ccccatctccagtaaaaatac-aaaaattagccgggcatggtggtgcatgtctgt
                       Baboon  caacatggtgaaaa-ccccgtctccagtaaaaatac-aaaaattagccgggcatggtggtgcatgtctgt
                 Green monkey  caacatggtg-aaa-cctcatctccagtaaaaatac-aaaaattagccgggcatggtggtgcatgtctgt
             Proboscis monkey  caacatggtg-aaa-ccccgtctccagtaaaaatac-aaaaattagccaggcatggtggtgcatgtctgt
     Golden snub-nosed monkey  caacatggtg-aaa-ccccgtctccagtaaaaatac-aaaaattagccaggcatggtggtgcatgtctgt
                     Marmoset  caacttggtg-aac-ccctgtttccgctaaaaatac-aaaaattagtcaggcatggtggtgcatgactgt
              Squirrel monkey  caatttggtg-aaa-ccctgtttccgctaaaaataa-aaaaattagccaggcatggtggtgcatgcctgt
                        Mouse  ======================================================================
                          Dog  ======================================================================
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Bushbaby  ----------------------------------------------------------------------
                   Tree shrew  ======================================================================
                      Tarsier  ======================================================================

                        Human  agtcccagctactcaggaggttgaggcaggagaatcacttgaacctaggaaatggtggttgcagtgagct
                        Chimp  agtcccagctactcaggaggttgaggcaggagaatcacttgaacctaggaaatggtggttgcagtgagct
                       Bonobo  agtcccagctactcaggaggttgaggcaggagaatcacttgaacctaggaaatggtggttgcagtgagct
                      Gorilla  agtcccagctactcaggaggttgaggcaggagaatcacttgaacctaggagatggtggttgcagtgagct
                    Orangutan  agtcccagctactcaggaggttgaggcaggagaatcacttgaacccaggaaatggtggttgcagtgagct
                       Gibbon  agtcccagctactcaggaggttgaggcaggagaatcacttgaacctaggaaatggtggttgcagtgagct
                       Rhesus  agtctcagctactcaggaggttgaggcaggtgaatcacttgaacccaggaaacggtggttgtagtgggct
          Crab-eating macaque  agtctcagctactcaggaggttgaggcaggtgaatcacttgaacccaggaaacggtggttgtagtgagct
                       Baboon  agtctcagccactcaggaggttgaggcaggagaatcacttgaacccaggaaatggtggttgcagtgagct
                 Green monkey  agtctcagatactcaggaggttgaggcaggtgaatcacttgaacccaggaaatggtggttgtagtgagct
             Proboscis monkey  agtctcagctactcaggaggttgaggcaggagaatcacttgaacccaggaaatggtggttgcagtgagct
     Golden snub-nosed monkey  agtctcagctactcaggaggttgaggcaggagaatcacttgaacccaggaaatggtggttgcagtgagct
                     Marmoset  agtcccagctactcagaaggctgaggcaggagaatcaattgaacccaggaagtgctggttgcagtgagct
              Squirrel monkey  agtcccagctactcagaaggctgaggcaggataatcacctgaatccaggaaatgctgattgcagtgagct
                        Mouse  ======================================================================
                          Dog  ======================================================================
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Bushbaby  ----------------------------------------------------------------------
                   Tree shrew  ======================================================================
                      Tarsier  ======================================================================

                        Human  gacattgcaccactgcactccagtctgggccacagagcaagactctgtctt-aaaaaaaacaaaaaaaaa
                        Chimp  gacattgcaccactgcactccagtctgggccatagagcaagactctgtctt-aaaaaaaacaaaaacaa-
                       Bonobo  gacattgcaccactgcactccagtctgggccatagagcaagactctgtcttaaaaaaaaacaaaaacaa-
                      Gorilla  gacattgcaccactgcactccaatctgggccatagagcaagactccgtctt-aaaaaaaacgaaaaaaa-
                    Orangutan  gacattgcaccaccgcactccagtctgggccatagagcaagactccgtctt----------aaaaacaa-
                       Gibbon  gacattgcaccactgcactgcagtctgggccatagagcaagactccgtctt-aaaaaaaacaaaaaaca-
                       Rhesus  gacattgcaccactgcactccagtctgggccgtagagcaagactccgcctt-aaaaaaacaaaaaacaa-
          Crab-eating macaque  gacattgcaccactgcactccagtctgggccgtagagcaagactccgcctt-aaaaaaacaaaaaacaa-
                       Baboon  gacattgcaccactgcactccagtctgggccgtagagcaagactccgcctt-aaaaaaacaaaaaacaa-
                 Green monkey  gacgttgcaccactgcactccagtctgggccgtagagcaagactccgcctt-gaaaaaacaaaaaacaa-
             Proboscis monkey  gacattgcaccactgcactccagtctaggctgtagagcaagactccgcctt-aaaaaaacaaaaaacaa-
     Golden snub-nosed monkey  gacattgcaccactgcactccagtctgggccgtagagcaagactccgcctt-aaaaaaacaaaaaacaa-
                     Marmoset  gacatcacactactgcactccagtctgagtgacagagcaagactctatctc-ataaaaaaaaaaaaa---
              Squirrel monkey  gacatcgcactactgcactccagtccgggtgacagagcaagattccatctc-aaaaacaaaacaaaaca-
                        Mouse  ======================================================================
                          Dog  ======================================================================
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Bushbaby  ----------------------------------------------------------------------
                   Tree shrew  ======================================================================
                      Tarsier  ======================================================================

                        Human  aacaa
                        Chimp  --caa
                       Bonobo  --caa
                      Gorilla  --ccc
                    Orangutan  -----
                       Gibbon  -----
                       Rhesus  -----
          Crab-eating macaque  -----
                       Baboon  -----
                 Green monkey  -----
             Proboscis monkey  -----
     Golden snub-nosed monkey  -----
                     Marmoset  -----
              Squirrel monkey  -----
                        Mouse  =====
                          Dog  =====
                  Mouse lemur  NNNNN
                     Bushbaby  -----
                   Tree shrew  =====
                      Tarsier  =====

Alignment block 59 of 146 in window, 59303131 - 59303140, 10 bps 
B D                     Human  aacaacaaca
B D                     Chimp  aacaacaaca
B D                    Bonobo  aacaacaaca
B D                   Gorilla  caaaacaaca
B D                 Orangutan  --taacaaca
B D                    Gibbon  --aaacaaca
B D                    Rhesus  ------aaca
B D       Crab-eating macaque  ------aaca
B D                    Baboon  ------aaca
B D              Green monkey  ------aaca
B D          Proboscis monkey  ------aaca
B D  Golden snub-nosed monkey  ------aaca
B D           Squirrel monkey  --aaacaaac
B D                       Dog  agtaacaaca
B D                     Mouse  ==========
B D                  Marmoset  ----------
B D               Mouse lemur  NNNNNNNNNN
B D                  Bushbaby  ----------
B D                Tree shrew  ==========
B D                   Tarsier  ==========

Alignment block 60 of 146 in window, 59303141 - 59303145, 5 bps 
B D                     Human  acaac
B D                     Chimp  acaac
B D                    Bonobo  acaac
B D                   Gorilla  acaac
B D                 Orangutan  acaac
B D                    Gibbon  gcaac
B D                    Rhesus  tcaac
B D       Crab-eating macaque  tcaac
B D                    Baboon  acaac
B D              Green monkey  acaac
B D          Proboscis monkey  ataac
B D  Golden snub-nosed monkey  ataac
B D                  Marmoset  ----a
B D           Squirrel monkey  aaaca
B D                  Bushbaby  --aaa
B D                       Dog  atggc
B D                     Mouse  =====
B D               Mouse lemur  NNNNN
B D                Tree shrew  =====
B D                   Tarsier  =====

Inserts between block 60 and 61 in window
B D                 Bushbaby 2bp

Alignment block 61 of 146 in window, 59303146 - 59303206, 61 bps 
B D                     Human  aaaaaagttaataaatgcttggttggagctcc----taagtgtccattt-atagacattaaaatgt
B D                     Chimp  aaaaaagttaataaatgcttgcttggagctcc----taagtgtccattt-atagacattaaaatgt
B D                    Bonobo  aaaaaagttaataaatgcttgcttggagctcc----taagtgtccattt-atagacattaaaatgt
B D                   Gorilla  aaaaaagttaataaatgcttggttggagctcc----taagtgtccattt-atagacattaaaatgt
B D                 Orangutan  aacaaagttaataaatgcttggttggagctcc----taagtgtcaattt-atagacgttaaaatat
B D                    Gibbon  aaaaaagttaataaatgcttggttggagctcc----taagtgtcaattt-atagacattaaaatgt
B D                    Rhesus  aaaaaagttaataaatgctcgattggaactcc----taagtgtcaattt-ctagacattaaaatgt
B D       Crab-eating macaque  aaaaaagttaataaatgctcgattggaactcc----taagtgtcaattt-ctagacattaaaatgt
B D                    Baboon  aaaaaagttaataaatgcttgattggaactgc----taagtgtcaatttcctagacattaaaatgt
B D              Green monkey  aaaaaagttaataaatgctcgattggaactcc----taagtgtcaattt-ctagacattaaaatgt
B D          Proboscis monkey  aaaaaagttaataaacgcttgattggaactcc----taagtgtccattt-ctagacattaaaatgt
B D  Golden snub-nosed monkey  aaaaaagttaataaacgcttgattggaactcc----taagtgtcaattt-ctagacattaaaatgt
B D                  Marmoset  aaaaaggtcaataattgcttgattggagctac----taagcgtcaattt-ctagacattaaaatgt
B D           Squirrel monkey  aaaacccttaataattgcttcattggagctac----taagtgtcaattt-ctagatattaaaatgt
B D                   Tarsier  aagggagatagtaaatgctttggtggagctcc----taagtg--gattt-ctgtactttaagatgt
B D                  Bushbaby  aaggaagttagcaagtactcagttggagcccccacataagcgtctactc-ctagacatttaaaaag
B D                       Dog  -aaaatagtaata-----------------------ta------------atatacattagaatat
B D                     Mouse  ==================================================================
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Tree shrew  ==================================================================

Alignment block 62 of 146 in window, 59303207 - 59303321, 115 bps 
B D                     Human  gatttaagtggttttatggggacaattttggcttaatttcctctttaaacattgactaaaaaacgaaaaa
B D                     Chimp  gatttaagtggttttatggggacaattttggcttaatttcctctttaaacattgactaaaaaacaaaaaa
B D                    Bonobo  gatttaagtggttttatggggacaattttggcttaatttcctctttaaacattgactaaaaaacaaaaaa
B D                   Gorilla  gatttaggtggttttatggggacaattttggcttaattttctctttaaacattgactagaaaatgaaaaa
B D                 Orangutan  gatttaagtggttttatggggacaattttggcttaatttcctctttaaacattgactaaaaaactaaaaa
B D                    Gibbon  gatttaagtggttttatggggacaattttggtttaatttcctctttaaacattgactaaaaaactaaaaa
B D                    Rhesus  gatttaaatggttttatggggacaattttgacttaatttcc-ctttaaacattgactagagaactaaaaa
B D       Crab-eating macaque  gatttaaatggttttatggggacaattttgacttaatttcc-ctttaaacattgactagaaaactaaaaa
B D                    Baboon  gatttaaatggttttatggggacaattttgacttaatttcc-ctttaaacattgactagaaaactaaaaa
B D              Green monkey  gatttaaatggttttatggggacaattttgacttaatttcc-ctttaaacattgactagaaaacaaaaaa
B D          Proboscis monkey  gatttaaatggttttatggggacaattttgacttaatttcc-ctttaaactttgactagaaaactaaaaa
B D  Golden snub-nosed monkey  gatttaaatggttttatggggacaattttgacttaatttcc-ctttaaacattgactagaaaactaaaaa
B D                  Marmoset  catgtaagtggttttatggggacaaatttgtcttaatttcctctttatacattgactaaaaaactagaac
B D           Squirrel monkey  gatgtaagtggttttatggggacaattttgtcttaatttcccctttatacattgactaaaaaactaaaac
B D                   Tarsier  gatttaagtcattttatgggaataatttttgcttaatttcctccttatacactgaata-aaaaccaaaaa
B D                  Bushbaby  gatgtatttgattttatggcaataatttcaacttaagtttttctttacacattgactaaaaaactacaaa
B D                     Mouse  ======================================================================
B D                       Dog  ----------------------------------------------------------------------
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Tree shrew  ======================================================================

                        Human  ttgaatgtgttttactctatggt----cagt--agcagtattaataacaa--a
                        Chimp  ttgaatgtgttttactctatggt----cagt--agcagtattaataacaa--a
                       Bonobo  ttgaatgtgttttactctatggt----cagt--agcagtattaataacaa--a
                      Gorilla  ttgaatgtgttttactctatggt----cagt--agcagtattaataacaa--a
                    Orangutan  ttgaatgtgttttactctatggt----cagt--agcagtattaataacaa--a
                       Gibbon  ttgaatgtgttttactctatggtaaaacagtaaagcagtattaataacag--a
                       Rhesus  ttgaatgtgttttactctacggt----cagt--agtagtatt-ataacag--a
          Crab-eating macaque  ttgaatgtgttttactctacggt----cagt--agtagtatt-ataacag--a
                       Baboon  ttgaatgtgttttactctacggt----cagt--agtagtatt-ataacag--a
                 Green monkey  ttgaatgtgttttactctacggt----cagt--agtaatatt-ataacag--a
             Proboscis monkey  ttgaatgtgttttactctacggt----cagt--agtagtatt-ctaacag--a
     Golden snub-nosed monkey  ttgaatgtgttttactctgcggt----cagt--agtagtttt-ctaacag--a
                     Marmoset  ttgaatatattttgctctgtggt----cagt--agt------------ac--g
              Squirrel monkey  ttgaatatattttgctctatggt----cagt--agt------------gc--g
                      Tarsier  tagattgtgcaccacatttttgg----aagt--agtaataataataatga--a
                     Bushbaby  gagaatgtggtgcaccctactgg----caga--aataataacagtaacaaaca
                        Mouse  =====================================================
                          Dog  -----------------------------------------------------
                  Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Tree shrew  =====================================================

Alignment block 63 of 146 in window, 59303322 - 59303327, 6 bps 
B D                     Human  acgata
B D                     Chimp  atgata
B D                    Bonobo  atgata
B D                   Gorilla  atgata
B D                 Orangutan  atgata
B D                    Gibbon  ataata
B D                    Rhesus  ataata
B D       Crab-eating macaque  ataata
B D                    Baboon  ataata
B D              Green monkey  ataata
B D          Proboscis monkey  ataatc
B D  Golden snub-nosed monkey  ataaca
B D                  Marmoset  ataata
B D           Squirrel monkey  ataaca
B D                   Tarsier  ataata
B D                  Bushbaby  attata
B D                       Dog  ataatg
B D                     Mouse  ======
B D               Mouse lemur  NNNNNN
B D                Tree shrew  ======

Inserts between block 63 and 64 in window
B D                  Tarsier 19bp

Alignment block 64 of 146 in window, 59303328 - 59303333, 6 bps 
B D                     Human  atatta
B D                     Chimp  atattc
B D                    Bonobo  atattc
B D                   Gorilla  atattc
B D                 Orangutan  atattc
B D                    Gibbon  atattc
B D                    Rhesus  atattc
B D       Crab-eating macaque  atattc
B D                    Baboon  atattc
B D              Green monkey  atattc
B D          Proboscis monkey  atattc
B D  Golden snub-nosed monkey  atattc
B D                  Marmoset  tcatcc
B D           Squirrel monkey  atatcc
B D                   Tarsier  atatac
B D                  Bushbaby  gtagta
B D                     Mouse  atattg
B D                       Dog  atataa
B D               Mouse lemur  NNNNNN
B D                Tree shrew  ======

Inserts between block 64 and 65 in window
B D                    Mouse 3bp

Alignment block 65 of 146 in window, 59303334 - 59303349, 16 bps 
B D                     Human  taagtgtgatgctcta
B D                     Chimp  taagtgtgtcactcta
B D                    Bonobo  taagtgtgtcactcta
B D                   Gorilla  taagtgtgtcgctcta
B D                 Orangutan  taagtgtgttgctcta
B D                    Gibbon  taagtgtgttgctcta
B D                    Rhesus  taaatgtgttgctcta
B D       Crab-eating macaque  taaatgtgttgctcta
B D                    Baboon  taagtgtgttgctcta
B D              Green monkey  taaatgtgttgctcta
B D          Proboscis monkey  taagtgtgttgctcta
B D  Golden snub-nosed monkey  taagtgtgttgctcta
B D                  Marmoset  taagtgtgttgctcta
B D           Squirrel monkey  taagtgtgttgctctg
B D                   Tarsier  taagtgtattgctcta
B D                  Bushbaby  taa---tagtgctata
B D                Tree shrew  taaatgtatctgtgtg
B D                     Mouse  gaattgtctg------
B D                       Dog  taaatgtgtctctcta
B D               Mouse lemur  NNNNNNNNNNNNNNNN

Inserts between block 65 and 66 in window
B D                 Bushbaby 352bp

Alignment block 66 of 146 in window, 59303350 - 59303394, 45 bps 
B D                     Human  ttttaaag--gtatcgatgaggattcagtaaggtaagattgaaaact
B D                     Chimp  ttttaaag--gtattgatgaggattcagtaaggtaagattgaaaact
B D                    Bonobo  ttttaaag--gtattgatgaggattcagtaaggtaagattgaaaact
B D                   Gorilla  ttttaaag--gtattgatgaggattcagtaaggtaagattgaaaact
B D                 Orangutan  ttttaaag--gtattgatgaggattcagtaaggtaagattgaaaact
B D                    Gibbon  ttttaaag--gtattgatgaggattcagtaaggtaagattgaaaact
B D                    Rhesus  ttttaaag--gtattgatgaggattcagtaaggtaagattgaaaact
B D       Crab-eating macaque  ttttaaag--gtattgatgaggattcagtaaggtaagattgaaaact
B D                    Baboon  ttttaaag--gtattgatgaggattcagtaaggtaagattgaaaact
B D              Green monkey  ttttaaa---gtattgatgaggattctgtaaggtaagattgaaaact
B D          Proboscis monkey  ttttaaag--gtattgatgaggattcagtaaggtaagattgaaaact
B D  Golden snub-nosed monkey  ttttaaag--gtattgatgaggattcagtaaggtaagattgaaaact
B D                  Marmoset  ttttaaag--gtgttggtgaggatttaataaggtaagtttgaaaacg
B D           Squirrel monkey  ttttaaag--gtattggtgaggatttaataaggtaagtttgaaaact
B D                   Tarsier  ttttgaag--gtattggtgaggattcaataagccaagattg-acaca
B D                  Bushbaby  tttgaaag--gcattggtgaggattcaat-aggtaagattgaaaagc
B D                Tree shrew  ttccaaag--gccctggggaggagtccgtgagatgctgcggaacagt
B D                     Mouse  --ataaagatgtgtttgtgaggttgtagcaaagtgacattgagcat-
B D                       Dog  ttttaaag--g------tgaggactcagtaaggtaagattaaaaag-
B D               Mouse lemur  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 66 and 67 in window
B D               Tree shrew 1bp

Alignment block 67 of 146 in window, 59303395 - 59303654, 260 bps 
B D                     Human  taaaatgcct-tgccaataattggtgctctaa----aatgcgagttctcttc-ccatt-gttgcaggcgc
B D                     Chimp  taaaatgcct-tgccaataattggtgctctaa----aatgcgagttctcttc-ccatt-gttgcaggcgc
B D                    Bonobo  taaaatgcct-tgccaataattggtgctctaa----aatgcgagttctcttc-ccatt-gttgcaggcgc
B D                   Gorilla  taaaatgcct-tgccaataattggtgctctaa----aatgcgagttctcttc-ccgta-gttgcaggcac
B D                 Orangutan  taaaatgcct-tgccagtaattgatgctctaa----aatgcgagttctcttc-ccgtt-gttgcaggcac
B D                    Gibbon  taaaatgcct-tgccaataattggtgctctaa----aatgcaagttctcttc-ccgtt-gttgcaggcac
B D                    Rhesus  taaaatgcct-tgccaataattggcgctttaa----aatgcgagttctcttc-ccgtt-gttgcaggcat
B D       Crab-eating macaque  taaaatgcct-tgccaataattggcgctttaa----aatgcgagttctcttc-ccgtt-gttgcaggcat
B D                    Baboon  taaaatgcct-tgccaataattggcgctttaa----aatgcgagttctcttc-ccgtt-gttgcaggcac
B D              Green monkey  taaaatgcct-tgccaataattggtgctttaa----aatgcgagttctcttc-ccgtt-gttgcaggcat
B D          Proboscis monkey  taaaatgcct-tgccaataattggtgctttaa----aatgcgagttctcttc-ccgtt-gttgcaggcac
B D  Golden snub-nosed monkey  taaaatgcct-tgccaataattggcgctttaa----aatgcgagttctcttc-ccgtt-gttgcaggcac
B D                  Marmoset  taaaatgcct-tgtcgataattggtgctctaa----aatgcgagttctattc-tcgttagttgcaggcac
B D           Squirrel monkey  taaaatgcct-cgacagtaattggtgctctaa----aatgtgagttctattc-ttgttagttgcaggcac
B D                   Tarsier  taaaatacct-gacttataattggtgctctga----aatgtgagttattttctttgtt-gtttcaggcat
B D               Mouse lemur  taaaatgcctggaggaatatctggggctctaa----agtgtaagttctactctttgtt-gttgtggtcac
B D                  Bushbaby  -caaacatct-gaccaatgtttggcattctga----aatgtgagttttattctttgtt-atggtaggtac
B D                Tree shrew  caaagc-----tggctgtcatcagagctctgactctgaagtgtgctcccttccttgct-gctgcagacac
B D                     Mouse  tgtcatgcct-agatgctcatgggagctctga----cttgtaaacactcctt-ttag--gaggcaggtct
B D                       Dog  taaaacgctt-ggccaatgaaggttgctctga----aatgtgagttctcttcttcgtt-gctgcaggcac

                        Human  gt-cccctcaaaatttcaatgaagtgtgac---accgtgagaatcttcacacaggcccctgaattataat
                        Chimp  at-cccctcaaaatttcaatgaagtgtgac---accatgagaatcttcacataggcccctgaattataat
                       Bonobo  at-cccctcaaaatttcaatgaagtgtgac---accatgagaatcttcacataggcccctgaattataat
                      Gorilla  at-cccctcaaaatttcaatgaagtgtgac---accgtgagaatcttcacataggcccctgaattataat
                    Orangutan  at-cccctcaaaatttcaatgaagtgtgac---accgtgagaatcttcacataggcccctgaattataat
                       Gibbon  at-ctcctcaaaatttcaatgaagtgtgac---gccgtgagaatcttcacataggcccctgaattataat
                       Rhesus  gt-ccccttgaaatttcagtgaagtgtgac---accgtgagaatcttcacacgggcccctgaattataat
          Crab-eating macaque  gt-ccccttgaaatttcagtgaagtgtgac---accgtgagaatcttcacacgggcccctatattataat
                       Baboon  gtcccccttgaaatttcagtgaagtgtgac---accgtgagaatcttcacataggcccctgaattataat
                 Green monkey  gt-ccccttgaaatttcagtgaagcgtgac---accgtgagaatcttcacataggcccctgaattataat
             Proboscis monkey  gt-ccccttgaaatttcagtgaagtgtgac---gccgtgagaatcttcacataggcccctgaattataat
     Golden snub-nosed monkey  gt-ccccttgaaatttcagtgaagtgtgac---gccgtgagaatcttcacataggcccctgaattataat
                     Marmoset  atccccctctaaatttcactgaagtgtgac---actgtgacagtcctcacataggcccctgagttataat
              Squirrel monkey  at-cccctcaaaatttcactgaagtgtgac---actgtgagaatcttcacataggcccctgaattataat
                      Tarsier  at-cccctcaaaatctcaatgaagtgtcgt---actgccagaaccttctaacaggccactgagttttaag
                  Mouse lemur  at-cccttcagaatttcagtgaagtgtcac---gatgccagcaccttcaaacaggcctgtgaattataat
                     Bushbaby  at-cctctcaaaatttcaccaaagtgtcac---actgccaggatcttcaaacaagccactgaattatagt
                   Tree shrew  a--cccctcacactttc-------cattcc---cttgctggaaactttaaataggccactgacttgcatt
                        Mouse  gt-tccttaaaacttccaatgacctgtccc----ccatcagaatcttcatatgggctattaaattataat
                          Dog  ag-cctctcaaaatttctacgaagtgtcactcacctgccacaacctttaaataggccactgaattataat

                        Human  ttagaaaaa--a-gg-tttttttcctcccatagaaggttgagaacttcctgtgaaatgatttgattattt
                        Chimp  ttagaaaaa--a-gg-tttttttcctcccatagaaggttgagaacttcctgtgaaatgatttgattattt
                       Bonobo  ttagaaaaa--a-gg-tttttttcctcccatagaaggttgagaacttcctgtgaaatgatttgattattt
                      Gorilla  ttagaaaaa--a-gg-tttttttcctcccatagaaggttgagaacttcctgtgaaatgatttgattattt
                    Orangutan  ttagaaaaa--a-ga-tttttttcctcccatagaaggttgagaacttcctgtgaaatgatttgattattt
                       Gibbon  ttagaaaaa--a-gg-tttttttcctcccatagaaagttgagaacttcctgtgaaatgatttgattattt
                       Rhesus  ttagaaaaatta-ggttttttttactcccatagaaggttgagaacttcctgtgaaatgatttgattattt
          Crab-eating macaque  ttagaaaaatta-ggttttttttactcccatagaaggttgagaacttcctgtgaaatgatttgattattt
                       Baboon  ttagaaaaatta-ggttttttttactcccatagaaggttgagaacttcctgtgaaatgatttgattattt
                 Green monkey  ttagaaaaatta-gg-tttttttactcccatagaaggttgagaacttcctgtgaaatgatttgattattt
             Proboscis monkey  ttagaaaaatta-gg-tttttttactcccatagaaggttgagaacttcctgtgaaatgatttgattattt
     Golden snub-nosed monkey  ttagaaaaatta-gg-tttttttactcccatagaaggttgagaacttcctgtgaaatgatttgattattt
                     Marmoset  ttagaaaaatta-gt-tttttttcctcccatataaagttgacaacttcctgtgaaatgatttgattattt
              Squirrel monkey  ttagaaaaattaggt-tttttttcctcccatagaaagttgagaacttcctgtgaaatgatttgattattt
                      Tarsier  ctagaaaaatta-g--ttttttactccaaacagaaagttgagaactttctgtgaaatgat----ttatgt
                  Mouse lemur  tttgaaaaatta-ga---cttttcctcctatagaaagttgagaattttctgtgaaatgatttgattattt
                     Bushbaby  ttccaaaaatga-ga---tttttccttccagagaaagttgagaattttctgtgaaatgatttgattattt
                   Tree shrew  tgagaggaa--g-ga-atgtttttccctcacagaagttagagaactttctgtaaaatggc-tgattattt
                        Mouse  gcagaagaatca-gg----gctccttcccactgaagtttgaaaatcgtttgtgaaatgatatttatattt
                          Dog  ttggaaatcgta-gc-ttttctctctctggcagaacgttgagaattttctgtgaaatgaattgattgttt

                        Human  gttttcaca---------gagcattaaaacagagtgat------tttcttagtgattatagacttaatat
                        Chimp  gttttcaca---------gggcattaaaacagagtgat------tttcttagtgattatagacttaatat
                       Bonobo  gttttcaca---------gggcattaaaacagagtgat------tttcttagtgattatagacttaatat
                      Gorilla  gttttcaca---------gagcattaaaacagagtgat------tttcttagtgcttatagacttaatat
                    Orangutan  gttttcaca---------gagcattaaaacagagtgat------tttcttagtgattatggacttaatat
                       Gibbon  gttttcacc---------gagcattaaaaccgagtgat------tttcttagtgattatagacttaatat
                       Rhesus  gttttcaca---------gagcattaaaacagagtgtt------tttcttagtgattacagacttaatat
          Crab-eating macaque  gttttcaca---------gagcattaaaacagagtgtt------tttcttagtgattacagacttaatat
                       Baboon  gttttcaca---------gagcgttaaaacagagtgtt------tttcttagtgattatagacttaatat
                 Green monkey  tttttcaca---------gagcattaaaacagagtgtt------tttcttagtgattacagacttaatat
             Proboscis monkey  gttttcaca---------gagcattaaaacagagtgtt------tttcttagtgattatagacttaatat
     Golden snub-nosed monkey  gttttcaca---------gagcattaaaacagagtgtt------tttcttagtgattatagacttaatat
                     Marmoset  gctttcaca---------gagcattaaaacagagtgat------tttcttagtgattacagatttaatat
              Squirrel monkey  actttcata---------gagcattaaaacagagtga-------tttcttagtgattataggtttaacat
                      Tarsier  gctttcaca---------gaggattgctgcagagttat------ttttttagtgattataaacttaatat
                  Mouse lemur  gctttcaca---------gagaattaaaacaggatcat------tttcttagtgattatggacttaatgt
                     Bushbaby  gctttcaca---------gagaattcaagcaggatcat------tttcttagcaagcccagacttaatgt
                   Tree shrew  gttttcaca---------gaggattaaaatagaagtat------tgttttagtggttatgaatttaatgt
                        Mouse  atttccatatatatttgtgaaggtcaaaagacaattttgagaactcatctagtaattt--gatttaatta
                          Dog  gctttcaca---------gaggattaaaacagagttat------tttcttagtgattgtgggcttcattt

                        Human  gg-aggtacat
                        Chimp  gg-aggtacat
                       Bonobo  gg-aggtacat
                      Gorilla  gg-aggtacat
                    Orangutan  gg-aggtacat
                       Gibbon  gg-cggtacat
                       Rhesus  gg-aggtagat
          Crab-eating macaque  gg-aggtagat
                       Baboon  gg-aggtaaat
                 Green monkey  gg-aggtaggt
             Proboscis monkey  gg-aggtagat
     Golden snub-nosed monkey  gg-aggtagat
                     Marmoset  gg-aggtacat
              Squirrel monkey  gg-aggtacat
                      Tarsier  gg-gagtaaaa
                  Mouse lemur  gg-agatacat
                     Bushbaby  gg-aggctcct
                   Tree shrew  ggaaggcatat
                        Mouse  ag-attttac-
                          Dog  gaaaggcacac

Inserts between block 67 and 68 in window
B D                   Gibbon 325bp

Alignment block 68 of 146 in window, 59303655 - 59303740, 86 bps 
B D                     Human  gggttttgtaatgtttattgaaatacagaaaattttaaat-------tacatttcttaatattcttcaaa
B D                     Chimp  gggttttgtaatttttattgaaatacagaaaattttaaat-------tacatttcttaatattcttcaaa
B D                    Bonobo  gggttttgtaatttttattgaaatacagaaaattttaaat-------tacatttcttaatattcttcaaa
B D                   Gorilla  gggttttgtaatttttattgaaatacagaaaattttaaat-------tacatttcttaatattcttcaaa
B D                 Orangutan  gggttttgtaatttttattgaaatacagaaaatttttaat-------tacatttcttaatattcatcaaa
B D                    Gibbon  gggttttgtaatttttattgaaatacagaaaattttaaat-------tacatttcttagtattcttcaaa
B D                    Rhesus  gggttttgtaatttttattgaaatacagaaaattttaaat-------tacatatcttaatattcttccaa
B D       Crab-eating macaque  gggttttgtaatttttattgaaatacagaaaattttaaat-------tacatatcttaatattcttcaaa
B D                    Baboon  gggttttgtaatttttattgacatacagaaaattttaaat-------tacatatcttaatattcttcaaa
B D              Green monkey  gggttttgtaatttttattgaaatacagaaaattttaaat-------tacatatcttaatattcttcaaa
B D          Proboscis monkey  gggttttgtaatttttattgaaatacagaaaattttaaat-------tacataccttaatattcttcaaa
B D  Golden snub-nosed monkey  gggttttgtaatttttattgaaatacagaaaattttaaat-------tacatatcttaatattcttcaaa
B D                  Marmoset  gggttttgtaatatttagtgaaatacagaaaaatttaaat-------tacatttcttattattcttcgaa
B D           Squirrel monkey  gggttttgtaatttttagtgaaatacagaaaaatttaaat-------tacatttcttaatattcttcaaa
B D                   Tarsier  gggttttgtaatctttattgaaata-agaaaaaattaaat-------tgcatttctttgt----------
B D               Mouse lemur  gggttttgtaatttttattgagatatggaaaaatttaaat-------tatgtttcttaatattcttcaat
B D                  Bushbaby  gggttttgtagcttgtattgagatatggaaaaaattaagt-------tacatttccaaatagtcctcaat
B D                Tree shrew  caattttgtaacttacatggaaagttgaggttatttaatttacataatacatttatcaat-tgttttaaa
B D                     Mouse  atgtcttataatttatatagaaacac--------tttggt-------tacatttttcatcatccttaaag
B D                       Dog  aagttttgtgacctatactgaaatatgggagcatttagat-------tgcatttcttgatttac------

                        Human  tcaaaaactagttgaaatctttc
                        Chimp  tcaaaaactagttgagatctttc
                       Bonobo  tcaaaaactagttgagatctttc
                      Gorilla  tcaaaaactagttgagatctttc
                    Orangutan  tcaaaaactagttgtgatctttc
                       Gibbon  tcaaaaactagctgtgatctttc
                       Rhesus  tcaaaaactagttgtgatctttc
          Crab-eating macaque  tcaaaaactagttgtgatcgttc
                       Baboon  tcaaaaactagttgtgatctttc
                 Green monkey  tcaaaaactagttgtgatctttc
             Proboscis monkey  tcaaaaactagttgtgatctttc
     Golden snub-nosed monkey  tcaaaaactagttgtgatctttc
                     Marmoset  tcaaaaactagtagtgatctctc
              Squirrel monkey  tcaaaaactagtagtgaactttc
                      Tarsier  -----------------------
                  Mouse lemur  taaaaaattagtgatgatcttta
                     Bushbaby  tcaaaatttagtcatgatcttta
                   Tree shrew  taaaaatttagttatagtctttt
                        Mouse  tgaaatattagccaggaacttcc
                          Dog  -----------------------

Alignment block 69 of 146 in window, 59303741 - 59303764, 24 bps 
B D                     Human  cttgttttagtgtacttttttt-gt
B D                     Chimp  cttgttttagtgtacttttttttgt
B D                    Bonobo  cttgttttagtgtacttttttt-gt
B D                   Gorilla  cttgttttagtgtacttttttt-gt
B D                 Orangutan  cttgttttagtgtacttttttt-gt
B D                    Gibbon  cttgttttagtgtacttttttt-gt
B D                    Rhesus  cttatttta--gtac-tttttt-gt
B D       Crab-eating macaque  cttatttta--gtacttttttt-gt
B D                    Baboon  tttgtttta--gtactttcttt-gt
B D              Green monkey  cttgtttta--gtacttttttt-gt
B D          Proboscis monkey  cttgtttta--gtacttttttt-gt
B D  Golden snub-nosed monkey  cttgtttta--gtacttttgtt-gt
B D                  Marmoset  attgtttta--gttttttttat-tt
B D           Squirrel monkey  attgtttta--gtctttt---t-tt
B D                   Tarsier  ----ttttg--gttcttttttt---
B D               Mouse lemur  attgttttagtttacttttact-gt
B D                  Bushbaby  atggttttactttacttt-------
B D                       Dog  ------ttagtttact---------
B D                     Mouse  -------------------------
B D                Tree shrew  -------------------------

Alignment block 70 of 146 in window, 59303765 - 59303934, 170 bps 
B D                     Human  tgttgctgttgttggcaacagtgtcttgctctgttgcccaggctgcagtgcaatggtgtgatctcggctc
B D                     Chimp  tgttgctgttgttggcaacagtgtcttgctctgttgcccaggctgcagtgcaatggtgtgatctcggttc
B D                    Bonobo  tgttgctgttgttggcaacagtgtcttgctctgttgcccaggctgcagtgcaatggtgtgatctcggttc
B D                   Gorilla  tgttgctgttgttggcaacagtgtcttgctctgttgcccaggctgcagtgcaatggtgtgatctcggttc
B D                 Orangutan  tgttgctgttgttggcaacagtgtctcactctgttgcccaggctgcagtgcaatggtgcgatctcggctc
B D                    Gibbon  ------tgttgttggcaacagtgtcttgctctgttgcccaggctggagtgcaatggtgcgatctcggctc
B D                    Rhesus  tgttgatgttgttggcaacagtgtctcgctctgttgcccaggctgcagtgcaatggtgcgatcttggctc
B D       Crab-eating macaque  tgttgatgttgttggcaacagtgtctcgctctgttgcccaggctgcagtgcaatggtgcgatcttggctc
B D                    Baboon  tgttgatgttgttggcaacagtgtctcgctctgttgcccaggctgcagtgcaatggtgcgatcttggctc
B D              Green monkey  tgttgatgttgttggcaacagtgtctcgctctgttgcccaggctacagtgcaatggtgcgatcttgactc
B D          Proboscis monkey  tgttgatgttgttggcaacagtgtctcgctctgttgcccaggctgcagtgcaatggtgcaatcttggctc
B D  Golden snub-nosed monkey  tgttgatgttgttggcaacagtgtctcgctctgttgcccaggctgcagtgcaatggtgtgatcttggctc
B D                  Marmoset  tttatttttttttggcaacagggtcttgctctgttgcccaggctgcagtgcaatggtatgatcttggctc
B D           Squirrel monkey  tttttttttttttggcaacagggtcttgctctgttgcccaggttgcagtgcaacggtatgatcttggctc
B D                   Tarsier  --------------gcgacaaggtctcactctgctgcccaggctggaatgcagtggcatgatcatgaaac
B D                  Bushbaby  -------------------------------tgatacctaaat---------------------------
B D                       Dog  -------------------------------------------tgcaattca------------------
B D                     Mouse  ----------------------------------------------------------------------
B D               Mouse lemur  ----------------------------------------------------------------------
B D                Tree shrew  ----------------------------------------------------------------------

                        Human  actgcaacctccgcctcccaggttcaagcgcttcttgtgcctcagcctcccgagtagctgggactacagg
                        Chimp  actgcaacctccacctcccaggttcaagcgcttcttgtgcctcagcctcccgagtagctgggactacagg
                       Bonobo  actgcaacctccacctcccaggttcaagcgcttcttgtgcctcagcctcccgagtagctgggactacagg
                      Gorilla  actgcaacctccacctcccaggttcaagcgcttcttgtgcctcagcctcccgagtagctgggactacagg
                    Orangutan  actgcaacctccgtctcccaggttcaagcgcttcttgtgcctcagcctcccgagtagctgggactacagg
                       Gibbon  actgcaacctctgcctcccaggttcaagcgcttcttgtgcctcagcctcccgagtagctgggactacagg
                       Rhesus  actgcaacctctacctcccaggttctaacacttcttgtgcctcagcctcccgagtagctgggactacaag
          Crab-eating macaque  actgcaacctctacctcccaggttctaacacttcttgtgcctcagcctcccgagtagctgggactacaag
                       Baboon  actgcaacctctgcctcccaggttctaatgcttcttgtgcctcagcctcccgagtagctgggactacaag
                 Green monkey  actgcaacctctacctcccaggttctaacgcttcttgtgcctcagcctccggagtagctgggactacaag
             Proboscis monkey  actgcaacctctgcctcccaggttctaacacgtcttgtgcctcagcctcctgagtagctgggactacaag
     Golden snub-nosed monkey  actgcaacctctgcctcccaggttctaacacgtcttgtgcctcagcctcctgagtagctgggactacaag
                     Marmoset  actgcaaccttcacctcccaggttcaagtacttcttctgcttcagcctcccgagtagctggaactacagg
              Squirrel monkey  actgcaaccttcgcctcccaggttcaagtacttcttctgctttagcctcctgagtagttgggactacagg
                      Tarsier  accgcagcttccaactcctgggctcaagtgatcctgctgcctcagcctatcaaatagctgggactacagg
                     Bushbaby  -ctgc--cttctactccccaag------------------------------------------------
                          Dog  ---------------------gttcgaa-----------------------aattaactgtgattgttg-
                        Mouse  ----------------------------------------------------------------------
                  Mouse lemur  ----------------------------------------------------------------------
                   Tree shrew  ----------------------------------------------------------------------

                        Human  tatgtgccaccatgcctggctaa--tttttgt
                        Chimp  tatgtgccaccatgcctggctaa--tttttgt
                       Bonobo  tatgtgccaccatgcctggctaa--tttttgt
                      Gorilla  tatgtgccaccatgcctggctaa--tttttgt
                    Orangutan  tatgtgccaccatgcctggctaa--tttttgt
                       Gibbon  tatgtgccaccatgcctggctaa--tttttgt
                       Rhesus  tatgtgccgccatgcctggctaa--tttttgt
          Crab-eating macaque  tatgtgccgccatgcctggctaa--tttttgt
                       Baboon  tatgtgccgccatgcctggctaa--tttttgt
                 Green monkey  tatgtgccaccatgcctggctaa--tttttgt
             Proboscis monkey  tatgtgccatcatgcctggctaa--tttttgt
     Golden snub-nosed monkey  tatgtgccatcatgcctggctaa--tttttgt
                     Marmoset  catgtaccaccatgcttggctaa--tttttcc
              Squirrel monkey  cacacaccaccatacttggctaa--tttttcc
                      Tarsier  catg--ccaccacacttggttaatgtttttta
                     Bushbaby  -------------------------tttttgt
                          Dog  -------------------------tttttgt
                        Mouse  --------------------------------
                  Mouse lemur  --------------------------------
                   Tree shrew  --------------------------------

Alignment block 71 of 146 in window, 59303935 - 59304060, 126 bps 
B D                     Human  atttttagtagaggcagggtttcacc----atgttggccaggcttgtctcgaactcctgacctcaggtga
B D                     Chimp  atttttagtaaaggcggggtttcacc----atgttggccaggctggtctcaaactcctgacctcgggtga
B D                    Bonobo  atttttagtaaaggcggggtttcacc----atgttggccaggctggtctcaaactcctgacctcgggtga
B D                   Gorilla  atttttagtagaggcggggtttcacc----atgttgaccaggctggtctcgaactcctgacctcaggtga
B D                 Orangutan  atttttagtagaggtggggtttcacc----atgttggccaggctcgtctcgaactcctgacctcaggtga
B D                    Gibbon  atttttagtagaggcggggtttcacc----atgttggccaggctggtctcgaactcctgacctcaggtga
B D                    Rhesus  attttcaatagagacagggtttcacc----attttggccaggctggtcttgaactcctgacctcaggtga
B D       Crab-eating macaque  attttcaatagagacagggtttcacc----attttggccaggctggtcttgaactcctgacctcaggtga
B D                    Baboon  attttcaatagagacagggtttcacc----attttggccaggctggtcttgaactcctgacctcaggtga
B D              Green monkey  attttcaatagagacagggtttcatc----attttggccaggctggtcttgaactcctgacctcaggtga
B D          Proboscis monkey  attttcaatagagacagggtttcacc----atgttggccaagctggtcttgaactcttgacctcaggtga
B D  Golden snub-nosed monkey  attttcaatagagacagggtttcacc----atgttggccaggctggtcttgaactcctgacctcaggtga
B D                  Marmoset  atttttagtagaaatagggtcccatc----atgttggccaggctggtctccaactcctgacctcagggga
B D           Squirrel monkey  atttttagtagaaacagggtctcatc----atgttggccaggctggtctccaactgctgacctcagggga
B D                   Tarsier  aaattttgtagtgatgaggtcttgctcaggctgttacccaggctggtctcaaacttctggcctcaagtga
B D                       Dog  -----------------------------------------------ctttgatatctg-----------
B D                     Mouse  ----------------------------------------------------------------------
B D               Mouse lemur  ----------------------------------------------------------------------
B D                  Bushbaby  ----------------------------------------------------------------------
B D                Tree shrew  ----------------------------------------------------------------------

                        Human  tccacccacctctgcctcccaaagtgctgggattataggcatgagccaccaggcccagcc
                        Chimp  tccacccacctctgcctcccaaagtgctgggattataggcatgagccactgggcccagcc
                       Bonobo  tctacccacctctgcctcccaaagtgctgggattataggcatgagccactgggcccagcc
                      Gorilla  tccacccacctctgcctcccaaagtgctgggattataggcatgagccactgggcccagcc
                    Orangutan  tccacccacctctgcctcccaaagtgctgggattataggcatgagccactgggcccagcc
                       Gibbon  tccacccacctctgcctcccaaagtgctgggattataggcatgagccaccgggcccagcc
                       Rhesus  tcgacccacctcggcctcccaaagtgctgggattataggtgtgagccactgggcccggcc
          Crab-eating macaque  tcgacccacctcggcctcccaaagtgctgggattataggtgtgagccactgggcccggcc
                       Baboon  tcgacccacctcggcctcccaaagtgctgggattataggtgtgagccactgggcccggcc
                 Green monkey  tcgacccaccttggcctcccaaagtgctgggattctaggtgtgagccactgggcccggcc
             Proboscis monkey  tccacccacctcggcctcccaaagtgctgggattataggtgtgagccactgggcccagcc
     Golden snub-nosed monkey  tccacccacctcggcctcccaaagtgctgggattataggtgtgagccactgggcccagcc
                     Marmoset  tccatccaccttggcctcccaaagtgctgggattatagatgtgaaccacagcacccagcc
              Squirrel monkey  tccacccaccttggcctcccaaagtgctggggttataggtgtgagccacagcacctagcc
                      Tarsier  tcctgctacctctaccaccataaatactgggattataggtatgagccactgtggccagct
                          Dog  --------tctttgactccttaagt-----------------------------------
                        Mouse  ------------------------------------------------------------
                  Mouse lemur  ------------------------------------------------------------
                     Bushbaby  ------------------------------------------------------------
                   Tree shrew  ------------------------------------------------------------

Inserts between block 71 and 72 in window
B D                Orangutan 330bp
B D                  Tarsier 52bp

Alignment block 72 of 146 in window, 59304061 - 59304062, 2 bps 
B D                     Human  tg
B D                     Chimp  tg
B D                    Bonobo  tg
B D                   Gorilla  tg
B D                 Orangutan  tg
B D                    Gibbon  tg
B D                    Rhesus  ca
B D       Crab-eating macaque  ca
B D                    Baboon  ca
B D              Green monkey  ca
B D          Proboscis monkey  tg
B D  Golden snub-nosed monkey  cg
B D                  Marmoset  ca
B D           Squirrel monkey  ca
B D                   Tarsier  tg
B D                     Mouse  --
B D                       Dog  --
B D               Mouse lemur  --
B D                  Bushbaby  --
B D                Tree shrew  --

Inserts between block 72 and 73 in window
B D                Orangutan 1bp

Alignment block 73 of 146 in window, 59304063 - 59304066, 4 bps 
B D                     Human  tttt
B D                     Chimp  tttt
B D                    Bonobo  tttt
B D                   Gorilla  tttt
B D                 Orangutan  tttt
B D                    Gibbon  tttt
B D                    Rhesus  tttt
B D       Crab-eating macaque  tttt
B D                    Baboon  tttt
B D              Green monkey  tttt
B D          Proboscis monkey  tttt
B D  Golden snub-nosed monkey  tttt
B D                  Marmoset  tttg
B D           Squirrel monkey  tttt
B D                   Tarsier  cttt
B D                Tree shrew  tttt
B D                     Mouse  ----
B D                       Dog  ----
B D               Mouse lemur  ----
B D                  Bushbaby  ----

Alignment block 74 of 146 in window, 59304067 - 59304082, 16 bps 
B D                     Human  agtctgc-ctttaagac
B D                     Chimp  agtctac-ctttaagac
B D                    Bonobo  agtctac-ctttaagac
B D                   Gorilla  agtctac-ctttaagac
B D                 Orangutan  agtctgc-ctttaagac
B D                    Gibbon  agtctac-ctttaagac
B D                    Rhesus  agtctac-ctttaagac
B D       Crab-eating macaque  agtctac-ctttaagac
B D                    Baboon  agtctat-ctttaagac
B D              Green monkey  agtctac-ctttaagac
B D          Proboscis monkey  agtctac-ctttaagac
B D  Golden snub-nosed monkey  agtctac-ctttaagac
B D                  Marmoset  agtctac-ctttaagac
B D           Squirrel monkey  agtctac-ctttaagac
B D                   Tarsier  aatctactttttcatac
B D                Tree shrew  agtctag-gttccatac
B D                     Mouse  agtctg--ctttgttac
B D                       Dog  -----------------
B D               Mouse lemur  -----------------
B D                  Bushbaby  -----------------

Alignment block 75 of 146 in window, 59304083 - 59304085, 3 bps 
B D                     Human  cta
B D                     Chimp  cta
B D                    Bonobo  cta
B D                   Gorilla  cta
B D                 Orangutan  cta
B D                    Gibbon  cta
B D                    Rhesus  cta
B D       Crab-eating macaque  cta
B D                    Baboon  cta
B D              Green monkey  cta
B D          Proboscis monkey  cta
B D  Golden snub-nosed monkey  cta
B D                  Marmoset  cta
B D           Squirrel monkey  cta
B D                   Tarsier  cta
B D               Mouse lemur  gta
B D                Tree shrew  caa
B D                     Mouse  cta
B D                       Dog  ---
B D                  Bushbaby  ---

Alignment block 76 of 146 in window, 59304086 - 59304124, 39 bps 
B D                     Human  catctgtcttccact-ccccaag-t-ttttttttggtctaaa
B D                     Chimp  catctgtcttccact-ccccaag-t-ttttctt-ggtctaaa
B D                    Bonobo  catctgtcttccact-ccccaag-t-ttttctt-ggtctaaa
B D                   Gorilla  catctgtcttccact-ccccaag-t-ttttttt-ggtctaaa
B D                 Orangutan  catcggtcttccactcccccaag-t-ttttttt-ggtgtaaa
B D                    Gibbon  catctgtcttccact-ccccaag-t-ttttttt-ggtctaaa
B D                    Rhesus  tatctgtcttccact-ccccaagtt-ttttttt-ggtctaaa
B D       Crab-eating macaque  tatctgtcttccact-ccccaag-t-ttttttt-ggtctaaa
B D                    Baboon  tatctgtcttccact-ccccaag-t-ttttttt-ggtctaaa
B D              Green monkey  tatctgtcttccact-ccccaag-t-ttttttt-ggtctaaa
B D          Proboscis monkey  catctgtcttccact-ccccaag-t-ttttatt-ggtctaaa
B D  Golden snub-nosed monkey  catctgtcttccact-ccccaag-t-ttttatt-ggtctaaa
B D                  Marmoset  gatctgtcttctact-cctcaag-ctttttttt-catctaaa
B D           Squirrel monkey  gatctgtcttgtact-ccccaag-a--tttttt-catctaaa
B D                   Tarsier  aatctgtcttcagct-cccctag-t-ctttgtc--atctaaa
B D               Mouse lemur  aatttgccttctact-ccctgag-c-ttttgt--catctaaa
B D                  Bushbaby  ----------------------------------catctgaa
B D                Tree shrew  aatctgtcctttact-caccaag-t-ttctgtc--atctaca
B D                     Mouse  actctgttttccatg-ccctaag-t-ctttggt--aactaaa
B D                       Dog  --------------------------ttttgtt--atctgag

Inserts between block 76 and 77 in window
B D                Orangutan 31bp
B D              Mouse lemur 2bp

Alignment block 77 of 146 in window, 59304125 - 59304154, 30 bps 
B D                     Human  tttgttattgttttgattaatttgacattt
B D                     Chimp  tttgttatcgttttgattaatttgatattt
B D                    Bonobo  tttgttatcgttttgattaatttgatattt
B D                   Gorilla  tttgttatcgttttgattaatttgatattt
B D                    Gibbon  tttgttatcgttttgattaatttgacattt
B D                    Rhesus  tttgttatcattttgattcatttgacattt
B D       Crab-eating macaque  tttgttatcattttgattcatttgacattt
B D                    Baboon  tttgttatcattttgattcatttgacattt
B D              Green monkey  tttgttatcattttgattcatttgacgttt
B D          Proboscis monkey  tttgtt---attttgattcatttgacattt
B D  Golden snub-nosed monkey  tttgtt---attttgattcatttgacattt
B D                  Marmoset  tttgttatcattttgattaatttgacattt
B D           Squirrel monkey  tttgttatcattttgattaatttgacattt
B D                   Tarsier  tttgttactggtttgattaatctgacattt
B D               Mouse lemur  tttgttactattttgatcagtctggcattt
B D                  Bushbaby  tgtattactcttttgagtaatgtgacattt
B D                Tree shrew  tttgtaactatgttgcttaatctgacagtt
B D                     Mouse  aggattaatgtgttgatttatttgacattt
B D                       Dog  -ttgttgctgttttgatcagtctgatattt
B D                 Orangutan  ==============================

Inserts between block 77 and 78 in window
B D                  Tarsier 9bp

Alignment block 78 of 146 in window, 59304155 - 59304206, 52 bps 
B D                     Human  cacata----------------aaaatatatcc------atatatatgtaac------------------
B D                     Chimp  cacata----------------aaaatatatcc------atatatgtgtaac------------------
B D                    Bonobo  cacata----------------aaaatatatcc------atatatgtgtaac------------------
B D                   Gorilla  cacaca----------------aaaatatatcc------atatatgtgtaac------------------
B D                 Orangutan  cacata----------------aaaatatatcc------atatatatgtaac------------------
B D                    Gibbon  cacata----------------aaaatgtatcc------atatatatgtaacatatgaacatttaaaagt
B D                    Rhesus  cgcata----------------aaaatatatccat--atatatatatataac------------------
B D       Crab-eating macaque  cgcata----------------aaaatatatcc----atatatatatataac------------------
B D                    Baboon  cacata----------------aaaatatatcc------atatatatataac------------------
B D              Green monkey  cacata----------------aaaatatatcc----atatatatataaaac------------------
B D          Proboscis monkey  cacata----------------aaaatatatcc------atatatatgtaac------------------
B D  Golden snub-nosed monkey  cacata----------------aaaatatatcc------atatatatgtaac------------------
B D                  Marmoset  cgcata----------------aaaatatatcc------acgtatatgcaac------------------
B D           Squirrel monkey  cacata----------------aaaatataccc------acacatatgtaac------------------
B D                   Tarsier  cacatgtatgtaacagacatgtaaaatgtatcc------acatatatgtaac------------------
B D               Mouse lemur  ca---t----------------aaaatatattc------acatattcgtaac------------------
B