Multiz Alignments of 30 mammals (27 primates)
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 31 in window, 100195726 - 100195789, 64 bps 
B D                     Human  gtataagaaattatc---t----atcacctttctctcagttactt----caaacac----tga----gt-
B D                     Chimp  gtataagaaattatcatct----atcacctttctctcagttactt----caaacac----tga----gtg
B D                    Bonobo  gtataagaaattatcatct----atcacctttctctcagttactt----caaacac----tga----gt-
B D                   Gorilla  gtataagaaat-------t----atcacctttctctcagttactt----caaacac----tga----gt-
B D                 Orangutan  gtataagaaattatc---t----atcacctttctctcagttactt----caaacac----tga----gt-
B D                    Gibbon  gtataagaaattatc---t----atcacctttctctcagttacttcaaacaaacac----tga----gt-
B D                    Rhesus  gtataagaaattatc---tatcaatcacctttctctcagttactt----caaacac----tga----gt-
B D       Crab-eating macaque  gtataagaaattatc---tatcaatcacctttctctcagttactt----caaacac----tga----gt-
           Pig-tailed macaque  gtataagaaattatc---tatcaatcacctttctctcagttactt----caaacac----tga----gt-
               Sooty mangabey  gtataagaaattatc---tatcaatcacctttctctcagttactt----caaacac----taa----gt-
                       Baboon  gtataagaaattatc---tatcaatcacctttctctcagttactt----caaacac----tga----gt-
B D              Green monkey  gtataagaaattatc---tatcaatcacctttctctcagttactt----caaacac----tga----gt-
                        Drill  gtataagaaattatc---tatcaatcacctttctctcagttactt----caaacac----tga----gt-
B D          Proboscis monkey  gtataagaaattatc---t----atcacctttctctcagttactt----caaacac----tga----gt-
              Angolan colobus  gtataagaaattatc---t----atcacctttctctcagttactt----caaacac----tga----gt-
B D  Golden snub-nosed monkey  gtataagaaattatc---t----atcacctttctctcagttactt----caaacac----tga----gt-
      Black snub-nosed monkey  gtataagatattatc---t----atcacctttctctcagttactt----caaacac----tga----gt-
B D                  Marmoset  gtacaagaaattacc---t----atcacctttctctcagttacttcaaacaaacactgattga----gt-
B D           Squirrel monkey  gtacaagaaattacc---t----gtcacctttctctcagttactt----caaacactgattga----gt-
          White-faced sapajou  gtacaagaaactacc---t----atcacctttctctcggttactt----caaacac----tga----gt-
            Ma's night monkey  gtacaagaaattacc---t----atcacctttctctcagttactt----ctgacactgattga----gt-
B D                   Tarsier  gtaaaaaaga--------a----atcatctttgtcccaattgcct----gcaacactaattgg----gt-
B D                  Bushbaby  gtct------tcaac---c----atcacttttctctccatgacct----taaatac----tgatggggt-
B D                     Mouse  gtataaaaag--------t----attgct----tactaggtattt---------------taa----ac-
B D                       Dog  gtaaaagaaatcctc---c---------tcctctttcaattatct----tgaacattgattgg----gc-
B D                 Armadillo  gtggaagaagtggcc---c----atggcc--tctcccaatcaccg----caggatc----tga----tg-
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================

                        Human  ---cttggttggcttca
                        Chimp  agtcttggctggcttca
                       Bonobo  ---cttggctggcttca
                      Gorilla  ---cttggttggcttca
                    Orangutan  ---cttggctggcttca
                       Gibbon  ---cttggctggcttca
                       Rhesus  ---tttggctggcttta
          Crab-eating macaque  ---tttggctggcttta
           Pig-tailed macaque  ---tttggctggcttta
               Sooty mangabey  ---tttggctggcttta
                       Baboon  ---tttggctggcttta
                 Green monkey  ---tttggctggcttta
                        Drill  ---tttggctggcttta
             Proboscis monkey  ---tttggctggcttta
              Angolan colobus  ---tttggctggcttta
     Golden snub-nosed monkey  ---tttggctggcttta
      Black snub-nosed monkey  ---tttggctggcttta
                     Marmoset  ---cttggctggtttca
              Squirrel monkey  ---cttggctggtttca
          White-faced sapajou  ---cttggctgatttca
            Ma's night monkey  ---cttggctggtttca
                      Tarsier  ---cttggctggcttca
                     Bushbaby  ---cctggctggctttg
                        Mouse  ---cctggcaggtatca
                          Dog  ---cctgtctggcttca
                    Armadillo  ------agctgtcttca
              Sclater's lemur  =================
                  Black lemur  =================
                  Mouse lemur  =================
            Coquerel's sifaka  =================

Alignment block 2 of 31 in window, 100195790 - 100195836, 47 bps 
B D                     Human  aggacaca----caccagagaaa--------a-------taccattgtatgaca-ataaaaaggcaa
B D                     Chimp  aggacaca----caccagagaaa--------a-------taccattgtatgaca-ataaaaaggcaa
B D                    Bonobo  aggacaca----caccagagaaa--------a-------taccattgtatgaca-ataaaaaggcaa
B D                   Gorilla  aggacaca----caccagagaaa--------a-------taccattgtatgaca-ataaaaaggcaa
B D                 Orangutan  aggacaca----caccagagaaa--------a-------gaccattgtatgaca-ataaaaaggcaa
B D                    Gibbon  aggacaca----caccagagaaa--------a-------gaccattgtatgaca-ataaaagggcaa
B D                    Rhesus  aggacaca----caccagagaaa--------a-------taccattgtatgaca-ataaaaaggtaa
B D       Crab-eating macaque  aggacaca----caccagagaaa--------a-------taccattgtatgaca-ataaaaaggtaa
           Pig-tailed macaque  aggacaca----caccagagaaa--------a-------taccattgtatgaca-ataaaaaggtaa
               Sooty mangabey  aggacaca----caccagagaaa--------a-------taccattgtatgaca-ataaaaaggtaa
                       Baboon  aggacaca----caccagagaaa--------a-------taccattgtatgaca-ataaaaaggtaa
B D              Green monkey  aggacaca----caccagagaaa--------a-------taccattgtatgaca-atataaaggtaa
                        Drill  aggacaca----caccagagaaa--------a-------taccattgtatgaca-ataaaaaggtaa
B D          Proboscis monkey  aggacaca----caccagagaaa--------a-------taccattgtatgaca-ataaaaaggtaa
              Angolan colobus  aggacaca----caacagagaaa--------a-------taccattgcatgacg-ataaaaaggtaa
B D  Golden snub-nosed monkey  aggacaca----caccagagaaa--------a-------taccattgtatgaca-ataaaaaggtaa
      Black snub-nosed monkey  aggacaca----caccagagaaa--------a-------taccattgtatgaca-ataaaaaggtaa
B D                  Marmoset  aggacaca----caccagagaaa--------g-------taccattgtatgacgaagaaaaaagcaa
B D           Squirrel monkey  aggacaca----caccagagaaa--------g-------taccattgtatgatg-agaaaaaggcaa
          White-faced sapajou  aggacaca----caccagagaaa--------g-------tatcattgtatgacg-agaaaaaggcaa
            Ma's night monkey  aggacaca----caccagagaaa--------g-------taccattgtatgatg-agaaaaaggcaa
B D                   Tarsier  aggacaca----cactagagaga--------a-------cactattgtattgcc-atgaaaagacaa
                  Black lemur  aggacata----cactggagaga--------a-------taccattgtatggca-atgaaaaggcaa
              Sclater's lemur  aggacata----cactggagaga--------a-------taccattgtatggca-atgaaaaggcaa
B D                  Bushbaby  aggatgtc----cactggagaga--------a-------aaccatcgcatgaca-atgaaaagccaa
B D                     Mouse  agaatata----ggctggagagctggagatta-------caccactgtttgact-aggaaaaactga
B D                       Dog  agga--ta----cactggataaa--------a-------ttccattttatgaca-ttgaaaaatcag
B D                 Armadillo  aggacgaatgggtgctagaaagg--------acgacacgcaccgtttcagaacc-atggaa--gcag
                 Mouse lemur  ===================================================================
           Coquerel's sifaka  ===================================================================

Inserts between block 2 and 3 in window
                 Black lemur 96bp
             Sclater's lemur 96bp
B D                    Mouse 17bp
B D                      Dog 2bp

Alignment block 3 of 31 in window, 100195837 - 100195939, 103 bps 
B D                     Human  agaatggaaagaacaacattc---tgttt--cc-cttctgcccttct-catgt----aaattatgtctgg
B D                     Chimp  agaatggaaagaacaacattc---tgttt--cc-cttctgcccttct-catgt----aaattatgtctgg
B D                    Bonobo  agaatggaaagaacaacattc---tgttt--cc-cttctgcccttct-catgt----aaattatgtctgg
B D                   Gorilla  agaatggaaagaacaacattc---tgttt--cc-cttctgcccttct-cgtgt----aaatcatgtctgg
B D                 Orangutan  agaatggaaagaacaacattc---tattt--cc-cttctgcccttct-cgtgt----aaagtatgtctgg
B D                    Gibbon  ataatggaaagaacaacattc---tattt--cc-cttcttcccttct-cgtgt----aaagtatgtctgg
B D                    Rhesus  agaatggaaagaacaacattc---tattt--cc-cttctgcccttctccatgt----aaaatatgtctgg
B D       Crab-eating macaque  agaatggaaagaacaacattc---tattt--cc-cttctgcccttctccatgt----aaaatatgtctgg
           Pig-tailed macaque  ataatggaaagaacaacattc---tattt--cc-cttctgcccttctccatgt----aaaatatgtctgg
               Sooty mangabey  agaacggaaagaacaacattc---tatgt--cc-cttctgcccttctccatgt----aaaatatgtctgg
                       Baboon  agaacagaaagaacaacattc---tatgt--cc-cttctgcccttctccatgt----aaaatatgtctgg
B D              Green monkey  agaacggaaagaacaacattc---tattt--cc-cttctgcccttctccatgt----aaaatatgtctgg
                        Drill  agaacagaaagaacaacattc---tatgt--cc-cttctgcccttctccatgt----aaaatatgtctgg
B D          Proboscis monkey  agaacagaaagaacaacattc---tattt--cc-cttctgcccttctccgtgt----aaaatatgtctgg
              Angolan colobus  agaacggaaagaacaacattc---tattt--cc-cttctgcccttctccgtgt----aaaatatgtccgg
B D  Golden snub-nosed monkey  agaacggaaagaacaacattc---tattt--cc-cttctgcccttctccgtgt----aaaatatgtctgg
      Black snub-nosed monkey  agaacggaaagaacaacattc---tattt--cc-cttctgcccttctccgtgt----aaaatatgtctgg
B D                  Marmoset  ag----gaaagaacgacattctattattt--cc-cttctgcccttctccttgt----aaaacatgtctgg
B D           Squirrel monkey  agaaaagaaagaacaacattc---tgttt--cc-cttctgcccttctccttgt----aaaatatgtctgg
          White-faced sapajou  agaaaggaaagaacaacattc---tattt--cc-cttctgcccttctccttgt----aaaatatgtctgg
            Ma's night monkey  agaaagcaaaggacaacattc---tattt--cc-cttctgcccttctccttgt----aaactatgtctgg
B D                   Tarsier  ggagaagaaagaacaacattc---tactt--cc-cttctgcctttctccgtgt----gaaagaggtctgg
B D                  Bushbaby  ggggaagaaagaataacactc-----------------tgcccttatccatgt----gaaatatgtctgg
B D                     Mouse  agagaggataggacgaggttc---cttccaaca-ttgctgccattca----------gatacatgtctag
B D                       Dog  agaaaaaagaaaaagacattc---tatcc--cc-c-----------------------------------
B D                 Armadillo  aggggaaaaggaacagtattc---tgtct--ccacgcctgcccttctccgtatggggatggcaagtctag
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================

                        Human  aaa---ata----atgctttaggagaaaacatataaaagtgttataaag---gc--
                        Chimp  aaa---ata----atgctttaggagaaaacatataaaagtgttataaagaaggg--
                       Bonobo  aaa---ata----atgctttaggagaaaacatataaaagtgttataaagaaggg--
                      Gorilla  aaa---ata----atgctttaggagaaaacatataaaagtgttataaagaaggg--
                    Orangutan  aaa---ata----atgctttaggagaaaacatataaaaatgttatgaagaaggg--
                       Gibbon  aaa---ata----atgctttaggagaaaacatataaaaatgttataaagaaggg--
                       Rhesus  aaa---ata----atgctttaggagaaaacatataaaaatgttataaagaaagg--
          Crab-eating macaque  aaa---ata----atgctttaggagaaaacatataaaaatgttataaagaaagg--
           Pig-tailed macaque  aaa---ata----atgctttaggagaaaacatataaaaatgttataaagaaagg--
               Sooty mangabey  aaa---ata----atgctttaggagaaaacatataaaaatgttataaagaaagg--
                       Baboon  aaa---ata----atgctttaggagaaaacatataaaaatgttataaagaaagg--
                 Green monkey  aaa---ata----atgcttttggagaaaacatacaaaaatgttataaagaaagg--
                        Drill  aaa---ata----atgctttaggagaaaacatataaaaatgttataaagaaagg--
             Proboscis monkey  aaa---ata----atgctttaggagaaaacatataaaaatgttataaagaaagg--
              Angolan colobus  aaa---ata----acgctttaggagaaaacatataaaaatgttataaagaaagg--
     Golden snub-nosed monkey  aaa---ata----atgctttaggagaaaacatataaaaatgttataaagaaagg--
      Black snub-nosed monkey  aaa---ata----atgctttaggagaaaacatataaaaatgttataaagaaagg--
                     Marmoset  aaa---atc----atgctttaggagaaaacatataaaaatactataaaaaaggg--
              Squirrel monkey  aaa---atc----atgctttaggagaaaacatataaaaatactataaagaaggg--
          White-faced sapajou  aaa---atc----gtgctttaggagaacacacataaaaatactataaagaaggg--
            Ma's night monkey  aaa---atc----gtgctttaggagaaaacatataaaaatactataaagaaggg--
                      Tarsier  gaa---ata----atacgttttaggaggaggaataaaaatgatacaaagaaagg--
                     Bushbaby  gaa---ataac--atgttttaggaggaaaa--ataaaaatattagaaagga-----
                        Mouse  atggtcaca----gtgctctagagtttaagaaatggggctgttagc----------
                          Dog  -aa---ataat--atgttttaggagaagaa--gtaaaagtattataaaagc-----
                    Armadillo  gca---gtagcaggttctgtgggaggaaag---------------gaagagcgggg
              Sclater's lemur  ========================================================
                  Black lemur  ========================================================
                  Mouse lemur  ========================================================
            Coquerel's sifaka  ========================================================

Inserts between block 3 and 4 in window
B D                 Bushbaby 3bp
B D                      Dog 7bp

Alignment block 4 of 31 in window, 100195940 - 100196051, 112 bps 
B D                     Human  agatttgggaggccttctgggcttgtggataccttctttctgtgagaccaaggacagactgtgggagtca
B D                     Chimp  agatttgggaggccttctgggcttgtggataccttctttctgtgagaccaaggatagactctgggagtca
B D                    Bonobo  agatttgggaggccttctgggcttgtggataccttctttctgtgagaccaaggatagactctgggagtca
B D                   Gorilla  agatttgggaggccttctgggcttgtggataccttctttctgtgagaccaaggatagactctgggagtca
B D                 Orangutan  agatttgggaggccttctgggcttgtggataccttctttctgtgagaccaaggataatctctgggagtca
B D                    Gibbon  agatttgggaggccttctgggcttgtggatatcttctttttgtgagaccaaggatagactctgggagtca
B D                    Rhesus  agatttgagaggtcttctgggcttgcggataccttctttttgtgagaccaaggatagactctgggagtca
B D       Crab-eating macaque  agatttgagaggtcttctgggcttgcggataccttctttttgtgagaccaaggatagactctgggagtca
           Pig-tailed macaque  agatttgagaggtcttctgggcttgcggataccttctttttgtgagaccaaggatagactctgggagtca
               Sooty mangabey  agatttgagaggtcttctgggcttgcggacaccttctttttgtgagaccaagggtagactctgggagtca
                       Baboon  agatttgagaggtcttctgggcttgcggataccttctttttgtgagaccaaggatagactctgggagtca
B D              Green monkey  agatttgagaggtcttctgggcttgcggataccttctttttgtgagaccaaggatagactctgagagtca
                        Drill  agatttgagaggtcttctgggcttgcggataccttctttttgtgagaccaaggatagactctgggagtca
B D          Proboscis monkey  agatttgagaggtcttctgggcttgcagataccttctttttgtgagatcaaggatagactctgggagtca
              Angolan colobus  agatttgagaggtcttctgggcttgcagataccttctttttgtgagatcaaggatagtctctgggagtca
B D  Golden snub-nosed monkey  agatttgagaggtcttctgggcttgcagataccttctttttgtgagatcaaggatagactctgggagtca
      Black snub-nosed monkey  agatttgagaggtcttccgggcttgcagataccttctttttgtgagatcaaggatagactctgggagtca
B D                  Marmoset  agatttgggagaccttctcagc-tgtagttaccttctttttgagagaccaaggaaagactctgagagtca
B D           Squirrel monkey  agatttgggagaccttctcagc-tgtagttaccttcttttcgagagatcaaggaaagactctgagagtca
          White-faced sapajou  agatttgggagaccttctcggc-tgtacttaccttctttttgagagaccaaggaaagactctaagagtca
            Ma's night monkey  agatttgggagaccctcttggc-tgtagttaccttctttttgagagaccgaggaaagactctaagagtca
B D                   Tarsier  agatttgggatgccttctgggcttggggataacttttgtttggaaggccaaggaaagactgtgggattca
                  Black lemur  agatttgggaggccctctaggctcatggataccttctgtttaggaggccatggaaagac--tgggagtca
              Sclater's lemur  agatttgggaggccctctaggctcatggataccttctgtttaggaggccatggaaagac--tgggagtca
B D                  Bushbaby  agattgcgggagccccctgggcttgtgagtccct-------------ccaaggggagac--caggagt--
B D                     Mouse  agg---aagaggccctgtaaattgctg-----cttctactcaaggatcagaggggattctctgaaattca
B D                       Dog  agttttgagaaggcttctggacttgtaggctactttctgttgagatgccagctgaagattctggaaataa
B D                 Armadillo  aggtagggagctccctctgggctcgtggatcccctccgcgtgggaggccactggaggctcctgggagcag
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================

                        Human  gagggacaggatggggctgagaagagagccaagtggggtgac
                        Chimp  gagggacaggatggggctgagaagagagccaagtggggtgac
                       Bonobo  gagggacaggatggggctgagaagagagccaagtggggtgac
                      Gorilla  gagggacaggatggggctgagaaga-agccaagtggggtgac
                    Orangutan  gagggacaggatagggctgagaagagagccaagtggggtgac
                       Gibbon  gagggacaggatggggctgagaagagagccaagtaggatgac
                       Rhesus  gagggacaggatggggctgagaagagagccaagaggggtgac
          Crab-eating macaque  gagggacaggatggggctgagaagagagccaagaggggtgac
           Pig-tailed macaque  gagggacaggatggggctgagaagagagccaagaggggtgac
               Sooty mangabey  gagggacaggatggggctgagaagagagccaagaggggtgac
                       Baboon  gagggacaggatggggctgagaagagaaccaagaggggtgac
                 Green monkey  gagggacaggatggggctgagaagagaaccaagaggggtgac
                        Drill  gagggacaggatggggctgagaagagaaccaagaggggtgac
             Proboscis monkey  gagggacaggatggggctgagaagagagccaagaggggtgac
              Angolan colobus  gagggacaggatggggctgagaagagagccaagaggggtgac
     Golden snub-nosed monkey  gagggacaggatggggctgagaagagagccaagaggggtgac
      Black snub-nosed monkey  gagggacaggatggggctgagaagagagccaagaggggtgac
                     Marmoset  gagggccaggacaggactgagaagacagccaagtggggtgac
              Squirrel monkey  gagggccaggacaggactgagaagggagcccagtggggtgac
          White-faced sapajou  gagggccaggacaggactgagaagagagccaagtggggtgac
            Ma's night monkey  gagggccagggcaggactgaggagagagccaagcggggtgac
                      Tarsier  gagtg-caggat-ggactcagatgagaacc------------
                  Black lemur  gagaagcaggacagggctcagaatagagccaagtggtgtgac
              Sclater's lemur  gagaagcaggacagggctcagaatagagccaagtggtgtgac
                     Bushbaby  -------------agactccaaagagagccaag-gggacgac
                        Mouse  agggtacagga---------------agaaaagtatggttag
                          Dog  gagggacaggacagagctcagagagaaggcgat---------
                    Armadillo  agggggctgcctggccgccaggagagggccaagagggggcac
                  Mouse lemur  ==========================================
            Coquerel's sifaka  ==========================================

Inserts between block 4 and 5 in window
                 Black lemur 305bp
             Sclater's lemur 305bp
B D                Armadillo 1bp

Alignment block 5 of 31 in window, 100196052 - 100196205, 154 bps 
B D                     Human  tcaaggtctgctttgagtttccaagaagagtca-------------------------ttaaaggatctc
B D                     Chimp  tcaaggcctgctttgagtttccaagaagagtca-------------------------ttaaaggatctc
B D                    Bonobo  tcaaggcctgctttgagtttccaagaagagtca-------------------------ttaaaggatctc
B D                   Gorilla  tcaaggcctgctttgagtttccaagaagagtca-------------------------ttaaaggatctc
B D                 Orangutan  ttaaggcctgctttgagtttccaagaagagtcattgaa--------------gaat-cttaaaggatctc
B D                    Gibbon  tcgaggcctgctctgagtttccaagaagagtcattgaa--------------gaat-cttgaaggatctc
B D                    Rhesus  tcaagacctgctccgagtttccaagaagagtcattgaa--------------gaat-cttgaaagatctc
B D       Crab-eating macaque  tcaagacctgctccgagtttccaagaagagtcattgaa--------------gaat-cttgaaagatctc
           Pig-tailed macaque  tcaagacctgctccgagtttccaagaagagtcattgaa--------------gaat-cttgaaagatctc
               Sooty mangabey  tcaagacctgctccgagttcccaagaagagtcattgaa--------------gaat-cttgaaggatctc
                       Baboon  tcaagacctgctccgagtttccaagaagagtcattgaa--------------gaat-cttgaaggatctc
B D              Green monkey  tcaagacctgctccgagtttccaagaagagtcattgaa--------------gaat-cttgaaggatctc
                        Drill  tcaagacctgctccaagtttccaagaagagtcattgaa--------------gaat-cttgaaggatctc
B D          Proboscis monkey  tcaagaccagctctgagtttccaagaagaatcactgaa--------------gaat-cttgaaggatctc
              Angolan colobus  tcaagaccagctccaagtttccaagaagagtcactgaa--------------gaat-cttgaaggatctc
B D  Golden snub-nosed monkey  tcaagaccagctccgagtttccaagaagaatcactgaa--------------gaat-cttgaaggatctc
      Black snub-nosed monkey  tcaagaccagctccgagtttccaagaagaatcactgaa--------------gaat-cttgaaggatctc
B D                  Marmoset  ccaaggcctgctccgagtttcaaagaagagccattgaa--------------gaat-cttgaaggatctc
B D           Squirrel monkey  ccaaggccaactctgagtttcaaagaagagccatttaa--------------gaat-cttgaaggatctc
          White-faced sapajou  ccaaggcctgctccgagtttcaaag-----------aa--------------gaat-cctgaaggatatc
            Ma's night monkey  ccaaggcctgctccgagtttcaaagaagagccattgaa--------------gaat-cttgaaggatctc
B D                   Tarsier  --aagacctgccccaagactcagaggagaaccacggaa-------------gggac-cttggggtttcac
B D                  Bushbaby  ctcagggctgctctgatgtctcagtgaacattagtgaa--------------gggtccttaaggggtcac
B D                     Mouse  ttaaaacctactctgatctctgaacccatgacacaggagtggtatgcagctggaac-attgggg----tc
B D                       Dog  ctatggcctgctctaagtttcagaggagagccatcgaa--------------ggga--------------
B D                 Armadillo  tcgaggcctgctctgagtttcacagaagagccattggg--------------gggc-cgtaaggcatcat
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================

                        Human  ctaaggtgtcta----a---cttatcccag---cagagtaaaaaaa-t----gaaaat---------ggg
                        Chimp  ctaaggtgtcta----a---cttatcacag---cagagtaaaaaaa-taaatgaaaat---------ggg
                       Bonobo  ctaaggtgtctaactta---cttatcacag---cagagtaaaaaaa-taaatgaaaat---------ggg
                      Gorilla  ctaaggtgtcta----a---cttatcccag---cagagtaaaaaaa-t----gaaaat---------ggg
                    Orangutan  ctaaggtgtcta----a---cttatctcag---cagggtaaaaaaa-t----gaaaat---------ggg
                       Gibbon  ctaaggtgccta----a---cttaccccag---cagagtaaaaaaa-t----gaaaat---------ggg
                       Rhesus  ctaaggtgtcta----a---cctatcccag---cagcgtaaaaaaaat----aaaaat---------ggg
          Crab-eating macaque  ctaaggtgtcta----a---cctatcccag---cagcgtaaaaaaaat----aaaaat---------ggg
           Pig-tailed macaque  ctaaggtgtcta----a---cctatcccag---cagcgtaaaaaaaat----aaaaat---------ggg
               Sooty mangabey  ctaaggtgtcta----a---cctatcccag---cagagtaaaaaaaat----aaaaat---------ggg
                       Baboon  ctaaggtgtcta----a---cctatcccag---cagagtaaaaacaat----aaaaat---------ggg
                 Green monkey  ctaaggtgtcta----a---cctaccccag---cagagtaaaaaaaat----aaaaat---------ggg
                        Drill  ctaaggtgtcta----a---cctatcccag---cagagtaaaaaaaat----aaaaat---------ggg
             Proboscis monkey  ctaaggtgtcta----a---cctatcccag---cagagtaaaaaaagt----aaacat---------ggg
              Angolan colobus  ctaaggtgtcta----a---cctatcccag---cagagtaaaaaaatt----aaacat---------ggg
     Golden snub-nosed monkey  ctaaggtgtcta----a---cctatcccag---cagagtaaaaaaagt----aaacat---------ggg
      Black snub-nosed monkey  ctaaggtgtcta----a---cctatcccag---cagagtaaaaaaagt----aaacat---------ggg
                     Marmoset  attaggggtcta----a---cctgccccag---cgaagtaaaaacg------tgaaat---------agg
              Squirrel monkey  attaggggtcta----a---ccta-cccag---caaagtaaaaacg------tgaaat---------agg
          White-faced sapajou  attaggggtcta----a---cctaccccag---caaagtaaaaatg------ggaaat---------agg
            Ma's night monkey  atta-gggtcta----a---ccta-cccag---caaagtaaaaacg------tgaaac---------agg
                      Tarsier  cttagg-gttga----g---cgtgccctgg---cagagtgaaaaag------ccaaat---------ggg
                     Bushbaby  cttaagagcatg----g---cctatctcag---cagagtaacaaag------tcgatt---------gga
                        Mouse  tgtaggggtcaa----aaagcctaccattgtaccagggacaacacagt----ggacatccttgtctgagg
                          Dog  ctcaggggtcta----g---gctggcacaa---cagagtaaggaag------ccacac---------ag-
                    Armadillo  ttaggggggctg----a----------aag----------------------ccaaac---------ggg
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================

                        Human  attccgg-gac--ttaagcaggaatag------agtgtgcctatgattggagcactgtccaggctaactg
                        Chimp  attccgg-gac--ttcagcaggaatag------agtgtgcctatgattggagcactgtccaggctaactg
                       Bonobo  attccgg-gac--ttcagcaggaatac------agtgtgcctatgattggagaactgtccaggctaactg
                      Gorilla  attctgg-gac--ttaagca-gaatag------agtgtgcctatgattggagcactgtccaggctaactg
                    Orangutan  attctgg-gac--ttaagcaggaatag------ggtatgcctacgattggagcactgtctaggctaactg
                       Gibbon  attcagg-gac--ttaagcaggaatag------agtgtgcctatgattggagcactgtctaggctaactg
                       Rhesus  atttagg-gac--ttaagcagaaatag------agtgtgctgatgactggagcactgtctaggctaactg
          Crab-eating macaque  atttagg-gac--ttaagcagaaatag------agtgtgctgatgactggagcactgtctaggctaactg
           Pig-tailed macaque  atttagg-gac--ttaagcagaaatag------agtgtgctgatgactggagcactgtctaggctaactg
               Sooty mangabey  atttagg-gat--ttaagcagaaacag------ggtgtgctgatgactggagcactgtctaggctaactg
                       Baboon  atttagg-gat--ttaagcagaaacag------agtgtgctgatgactggagcactgtctaggctaactg
                 Green monkey  atttagg-gac--ttaagcagaaacag------agtgtgctgattactggagcactgtctaggctaactg
                        Drill  atttagg-gat--ttaagcagaaacag------agtgtgctgatgactggagcactgtctaggctaactg
             Proboscis monkey  atttagg-gac--ttaagcaggaatag------agtgtgctgatgattggaacactgtctaggctaactg
              Angolan colobus  atttagg-gacttttaagcaggaacag------agtgcgctgatgattggagcactgtctaggctaactg
     Golden snub-nosed monkey  atttagg-gac--ttaagcaggaatag------agtgtgctgatgattggaacactgtctaggctaactg
      Black snub-nosed monkey  atttagg-gac--ttaagcaggaatag------agtgtgctgatgattggaacactgtctaggctaactg
                     Marmoset  attcagg-gac--ttaagcaggaatag------catgtgcc--tgattggagcactgtctgggctaactg
              Squirrel monkey  atccagg-gtc--ttaagcaggaatag------cgtgtgcc--tgattggagcactgtctgggctaaatg
          White-faced sapajou  attcagg-gac--ttaagcaggaatag------catgtgcc--tgattggaacactgtctgggctaaatg
            Ma's night monkey  attcagg-gac--ttaagcaggaatag------cgtgtgcc--tgattggagcactgtctgggccaactg
                      Tarsier  attccgg-gac--ttaagcaagagtag------agtatgatt-tgattggagcactgtctaggctaaatg
                     Bushbaby  attcaga-gac--taaggcaggaatga------agtgtgcctttgattagagaactctttgg---agttc
                        Mouse  atctggatgtc--tccagctgtactag------aac-tgctgatgct----gcagtg-------------
                          Dog  actcagg-gac--tcaagcaggaacaggaatcaagtatgcctttgatt----------------taactg
                    Armadillo  atgcagg-ggc--ttcagcaggaacag------agggtgcctacgat--gggtgctgtctatgttaagtg
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================

                        Human  tc
                        Chimp  tc
                       Bonobo  tc
                      Gorilla  tc
                    Orangutan  tc
                       Gibbon  tc
                       Rhesus  tc
          Crab-eating macaque  tc
           Pig-tailed macaque  tc
               Sooty mangabey  tc
                       Baboon  tc
                 Green monkey  tc
                        Drill  tc
             Proboscis monkey  tc
              Angolan colobus  tc
     Golden snub-nosed monkey  tc
      Black snub-nosed monkey  tc
                     Marmoset  cc
              Squirrel monkey  cc
          White-faced sapajou  cc
            Ma's night monkey  cc
                      Tarsier  cc
                     Bushbaby  tc
                        Mouse  --
                          Dog  cc
                    Armadillo  cc
              Sclater's lemur  ==
                  Black lemur  ==
                  Mouse lemur  ==
            Coquerel's sifaka  ==

Alignment block 6 of 31 in window, 100196206 - 100196253, 48 bps 
B D                     Human  ctgggaca-gaaccctgccagtgggtgagtgaatgagggtg----aatcagaa-
B D                     Chimp  ctgggaca-gaaccctgccagtgggtgagtgaatgagggtg----aatcagaa-
B D                    Bonobo  ctgggaca-gaaccctgccagtgggtgagtgaatgagggtg----aatcagaa-
B D                   Gorilla  ctgggaca-gaaccctgccagtgggtgagtgaatgagggtg----aatcagaa-
B D                 Orangutan  ctgggaca-gaaccctgccagtgggtgagtgaatgacagtg----aatcagaa-
B D                    Gibbon  ctgggaca-gaaccttgccagtgggtgagtgaatgaggatg----aatcagaa-
B D                    Rhesus  ctaggaca-gaaccctgccagtgggtgagtgaatgaggatg----aatcagaa-
B D       Crab-eating macaque  ctaggaca-gaaccctgccagtgggtgagtgaatgaggatg----aatcagaa-
           Pig-tailed macaque  ctaggaca-gaaccctgccagtgggtgagtgaatgaggatg----aatcagaa-
               Sooty mangabey  ctaggaca-gaaccctgccagtgggtgactgaatgaggatg----aatcagaa-
                       Baboon  ctaggaca-gaaccctgccagtgggtgactgaatgaggatg----aatcagaa-
B D              Green monkey  ctaggaca-gaaccctgccagtgggtgagtgaacgaggttg----aatcagaa-
                        Drill  ctaggaca-gaaccctgccagtgggtgactgaatgaggatg----aatcagaa-
B D          Proboscis monkey  ctaggaca-gaaccctgacagtgggtgagtgaatgacagtg----aatcagaa-
              Angolan colobus  ctaggaca-gaaccctgccagtgggtgagtgaatgagggtgaatcaatcagaa-
B D  Golden snub-nosed monkey  ctaggaca-gaaccctgcctgtgggtgagtaaatgagggtg----aatcagaa-
      Black snub-nosed monkey  ctaggaca-gaaccctgcctgtgggtgagtgaatgagggtg----aatcagaa-
B D                  Marmoset  ctgggaca-ggaccttgccagtgggtgattaaatgagagtg----aatcagaa-
B D           Squirrel monkey  ctgggaca-gaaccctgccaat-ggtgattgaatgagggtg----aatcagaa-
          White-faced sapajou  ctgggaca-gaaccctgctaat-ggtaatcgaatgagggtg----aatcagaa-
            Ma's night monkey  ctgggaca-gaaccctgccaatgggtgattgaatgagggtg----aatcagaa-
B D                   Tarsier  ctgagaca-gacccctgccagagggtgattaaatgaagcta----aatcagaa-
            Coquerel's sifaka  ctgggacc-aaaccctgccagtggatgattaaatgggggta----aatcaaag-
B D                  Bushbaby  ctgggacc-aaaccctgcaagtgcatgattgaacggggcta----aatcaaag-
B D                     Mouse  --gagaca-taa---ggacag-ggatgag-----gagagtg----agttagaa-
B D                       Dog  ccaggacc-tcaccc-accagtgggtgaatgaat-agggta----aatcagaa-
B D                 Armadillo  ctgagagacgaagcctgccagggggtcatcaaatg-gggtg----aatcacgga
             Sclater's lemur  ======================================================
                 Black lemur  ======================================================
                 Mouse lemur  ======================================================

Inserts between block 6 and 7 in window
         White-faced sapajou 66bp
B D                      Dog 2bp

Alignment block 7 of 31 in window, 100196254 - 100196264, 11 bps 
B D                     Human  gaaa--------------aacacat
B D                     Chimp  gaaa--------------aacacat
B D                    Bonobo  gaaa--------------aacacat
B D                   Gorilla  gaaa--------------aacacat
B D                 Orangutan  gaaa--------------aacacat
B D                    Gibbon  gaaa--------------aacacat
B D                    Rhesus  gaaa--------------aacacat
B D       Crab-eating macaque  gaaa--------------aacacat
           Pig-tailed macaque  gaaa--------------aacacat
               Sooty mangabey  gaaa--------------aacacat
                       Baboon  gaaa--------------aacacat
B D              Green monkey  gaaa--------------aacacat
                        Drill  gaaa--------------aacacat
B D          Proboscis monkey  gaaa--------------aacacat
              Angolan colobus  gaaa--------------accacat
B D  Golden snub-nosed monkey  gaaa--------------aacacat
      Black snub-nosed monkey  gaaa--------------aacacat
B D                  Marmoset  -aaa--------------aacacat
B D           Squirrel monkey  -aag--------------aacacat
            Ma's night monkey  -gaa--------------aacacat
B D                   Tarsier  gaga--------------aatgcgt
            Coquerel's sifaka  gaga--------------aacacat
B D                  Bushbaby  gaga--------------aacatgc
B D                     Mouse  ---a--------------ag-----
B D                       Dog  gaaa--------------gagaggt
B D                 Armadillo  gaaagcagaggctccttcagcactt
             Sclater's lemur  =========================
                 Black lemur  =========================
                 Mouse lemur  =========================
         White-faced sapajou  =========================

Inserts between block 7 and 8 in window
           Coquerel's sifaka 81bp
B D                      Dog 16bp

Alignment block 8 of 31 in window, 100196265 - 100196335, 71 bps 
B D                     Human  taccactgcatgaggtaactt-------aaactaactaaacc----tctc-------------aggtggg
B D                     Chimp  taccactgcatgaggtaactt-------aaacttactaaacc----tctc-------------aggtggg
B D                    Bonobo  taccactgcatgaggtaactt-------aaacttactaaacc----tctc-------------aggtggg
B D                   Gorilla  taccactgcatgaggtaactt-------aaactaactaaacc----tctc-------------aggtggg
B D                 Orangutan  taccactgcatgaggtaactt-------aaactaactaaacc----tctc-------------gggcggg
B D                    Gibbon  taccactgcatgaggtaactt-------aaactaactaaacc----tctc-------------gggtggg
B D                    Rhesus  taccactgcatgaggtaacat-------aaattaactaaacc----tctc-------------aagtggg
B D       Crab-eating macaque  taccactgcatgaggtaacat-------aaattaactaaacc----tctc-------------aagtggg
           Pig-tailed macaque  taccactgcatgaggtaacat-------aaattaactaaacc----tctc-------------aagtggg
               Sooty mangabey  taccactgcatgaggtaacat-------aaattaactaaacc----tctc-------------aagtggg
                       Baboon  taccactgcatgaggtaacat-------aaattaactaaacc----tctc-------------aagtggg
B D              Green monkey  taccactgcatgaggtaacat-------aaattaactaaacc----tctc-------------aagtggg
                        Drill  taccactgcatgaggtaacat-------aaattaactaaacc----tctc-------------aagtggg
B D          Proboscis monkey  taccactgcatgaggtaacat-------aaattaact---------------------------------
              Angolan colobus  taccactgcaggaggtaacat-------aaattaactaaacc----tctc-------------aagtggg
B D  Golden snub-nosed monkey  taccactgcatgaggtaacat-------aaattaact---------------------------------
      Black snub-nosed monkey  taccactgcatgaggtaacat-------aaattaact---------------------------------
B D                  Marmoset  taccactgcatgaggtcaaat-------aaattaactaaacc----tctg-------------gggtggg
B D           Squirrel monkey  taccactgcatgaggtcaaat-------aaattaactaaacc----tctg-------------gggtggg
            Ma's night monkey  tacggctgcatgaggtcaaat-------aaattaactaaacc----tctg-------------gggtggg
B D                   Tarsier  taccactgcatagcgtaagatctaaaacacattaaccaagtc----tct--------------atgagaa
B D                  Bushbaby  --ccatttcacagggtgaaat-------aaattaaccaaatt----tcca-------------gggagaa
B D                     Mouse  ---tatagtataaggtaaaat-------gaactaaccaaatcagagtgaa-------------gagtgaa
B D                       Dog  taacactgcatagtgtcaagt-------gaatcaaccaactc----tcgcgggggtggggtgggggtggg
B D                 Armadillo  tagcactgcctagggccaaac-------caaccaatcgattt----tctt--------------------
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
         White-faced sapajou  ======================================================================

                        Human  aaa--aagagataac----------aat--a--------ttttgtat---
                        Chimp  aaa--aagagataac----------aat--a--------ttt---ag---
                       Bonobo  aaa--aagagataac----------aat--a--------ttt---ag---
                      Gorilla  aaa--aagagataac----------aat--a--------ttt---ag---
                    Orangutan  aaa--aagagataac----------aat--a--------ttt---ag---
                       Gibbon  aaa--aagagataac----------aat--a--------ttt---ag---
                       Rhesus  aaa--aagatataac----------aat--a--------ttt---cg---
          Crab-eating macaque  aaa--aagatataac----------aat--a--------ttt---cg---
           Pig-tailed macaque  aaa--acgatataac----------aat--a--------ttt---cg---
               Sooty mangabey  aaa--aagatatga-----------aat--a--------ttt---cg---
                       Baboon  aaa--aagatataa-----------aat--a--------ttt---cg---
                 Green monkey  aaa--aagatataac----------aat--a--------ttt---cg---
                        Drill  aaa--aagatataa-----------aat--a--------ttt---cg---
             Proboscis monkey  -----aagagataac----------agt--a--------ttt---ca---
              Angolan colobus  aaa--aagagataac----------aat--a--------ttt---ct---
     Golden snub-nosed monkey  -----aagagataac----------aat--a--------ttt---cg---
      Black snub-nosed monkey  -----aagagataac----------aat--a--------ttt---cg---
                     Marmoset  aaa--aagagataat----------aat--a--------ttt---ag---
              Squirrel monkey  aaa--aagagataat----------aat--a--------ttt---aa---
            Ma's night monkey  aaa--aagag---at----------cat--a--------ttt---ag---
                      Tarsier  gaa--cagagatatc----------agt--ggtcgctatgtt---ta---
                     Bushbaby  agg--aagagatacc----------agt--g--------tgt---tc---
                        Mouse  gagtcaggaaataac----------cat--a--------act---aa---
                          Dog  ggt--gggggagtaccaatgctgttgat--a--------ttt---ag---
                    Armadillo  -cc--aaaaaatagc----------aatgga--------gtt---gatat
              Sclater's lemur  ==================================================
                  Black lemur  ==================================================
                  Mouse lemur  ==================================================
            Coquerel's sifaka  ==================================================
          White-faced sapajou  ==================================================

Inserts between block 8 and 9 in window
B D                 Bushbaby 2bp
B D                    Mouse 3bp

Alignment block 9 of 31 in window, 100196336 - 100196339, 4 bps 
B D                     Human  -tatt---
B D                     Chimp  -tatt---
B D                    Bonobo  -tatt---
B D                   Gorilla  -tatt---
B D                 Orangutan  -tatt---
B D                    Gibbon  -tatt---
B D                    Rhesus  -taac---
B D       Crab-eating macaque  -tatc---
           Pig-tailed macaque  -tatc---
               Sooty mangabey  -tatc---
                       Baboon  -tatc---
B D              Green monkey  -tatc---
                        Drill  -tatc---
B D          Proboscis monkey  -tatt---
              Angolan colobus  -tatt---
B D  Golden snub-nosed monkey  -tatt---
      Black snub-nosed monkey  -tatt---
B D                  Marmoset  -tatt---
B D           Squirrel monkey  -tatt---
            Ma's night monkey  -tatt---
B D                   Tarsier  -tatc---
                  Mouse lemur  -tatc---
B D                  Bushbaby  -ggtt---
B D                     Mouse  -t------
B D                       Dog  -catc---
B D                 Armadillo  ttagcaac
             Sclater's lemur  ========
                 Black lemur  ========
           Coquerel's sifaka  ========
         White-faced sapajou  ========

Alignment block 10 of 31 in window, 100196340 - 100196384, 45 bps 
B D                     Human  ttgtag-atgccaaaatatgacttaatgatgttccc-tatttttcaa
B D                     Chimp  ttgtag-atgccaaaatatgacttaatgatgttccc-tatttttcaa
B D                    Bonobo  ttgtag-atgccaaaatatgacttaatgatgttccc-tatttttcaa
B D                   Gorilla  ttgtaa-atgccaaaatatgactta---atgttccc-tatttttcaa
B D                 Orangutan  ttgtag-atgccaaaatatgacttactaatgttccc-tatttttcaa
B D                    Gibbon  ttgtag-atgtcagaatatgacttaatgatgttccc-tatttttcaa
B D                    Rhesus  ttgtag-atgccaaaatatgacttaatgatgttccc-tatttttcag
B D       Crab-eating macaque  ttgtag-atgccaaaatatgacttaatgatgttccc-tatttttcaa
           Pig-tailed macaque  ttgtag-atgccaaaatatgacttaatgatgttccc-tatttttcaa
               Sooty mangabey  ttgtag-atgccaaaatatgacttaatgatgttccc-tatttttcaa
                       Baboon  ttgtag-atgccaaaatatgacttaatgatgttccc-tatttttcaa
B D              Green monkey  ttgtag-atgccaaaatatgacttaatgatgttccc-tatttttcaa
                        Drill  ttgtag-atgccaaactatgacttaatgatgttccc-tatttttcaa
B D          Proboscis monkey  ttgtag-atgccaaaatatgatttaatgatattccc-tatttttcaa
              Angolan colobus  ttgtag-atgccaaaatatgatttaatgatattccc-tatttttcaa
B D  Golden snub-nosed monkey  ttgtag-atgccaaaatatgatttaatgatattccc-tatttttcaa
      Black snub-nosed monkey  ttgtag-atgccaaaatatgatttaatgatattccc-tatttttcaa
B D                  Marmoset  ttgtag-atgccaaaatataacttcatgatgttcct-tatttttcag
B D           Squirrel monkey  ttgtag-atgccaaaatataacttcatgatgatcct-tatttttcag
            Ma's night monkey  ttgtag-atgccaaaatacaacttgatgatgttcct-tatttttcag
B D                   Tarsier  ctgtag-atgccaaaatacgatttagtgatgatgctatatttttcaa
                  Mouse lemur  ttgtag-atgccaaaatatgacttaataatttttct-tagttttcaa
            Coquerel's sifaka  ttgtag-atgccaaaatacgacttaatgatctttct-tatttttcaa
                  Black lemur  ttgtag-atgccaaaatatgatttaatgatctttct-tatttttcaa
              Sclater's lemur  ttgtag-atgccaaaatatgatttaatgatctttct-tatttttcaa
B D                  Bushbaby  -----------aacatcttgacataaggacctttgt-tatttatcta
B D                     Mouse  ---tagcatctcaacagatta--taacaatggtcct-aactctccaa
B D                       Dog  ttgtag-gtggcaaaataccgcttcatgaacttctt-tacttttcag
B D                 Armadillo  ttgtag-aagccaaaatacggcttcatgaagtcctt-tactttcaac
         White-faced sapajou  ===============================================

Inserts between block 10 and 11 in window
           Coquerel's sifaka 181bp

Alignment block 11 of 31 in window, 100196385 - 100196385, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                    Bonobo  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  t
B D       Crab-eating macaque  t
           Pig-tailed macaque  t
               Sooty mangabey  t
                       Baboon  t
B D              Green monkey  t
                        Drill  t
B D          Proboscis monkey  t
              Angolan colobus  t
B D  Golden snub-nosed monkey  t
      Black snub-nosed monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
            Ma's night monkey  c
B D                   Tarsier  t
                  Mouse lemur  c
                  Black lemur  c
              Sclater's lemur  c
B D                  Bushbaby  c
B D                     Mouse  c
B D                       Dog  c
B D                 Armadillo  t
           Coquerel's sifaka  =
         White-faced sapajou  =

Inserts between block 11 and 12 in window
                 Mouse lemur 220bp

Alignment block 12 of 31 in window, 100196386 - 100196386, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                    Bonobo  -t
B D                   Gorilla  -t
B D                 Orangutan  -t
B D                    Gibbon  -t
B D                    Rhesus  -t
B D       Crab-eating macaque  -t
           Pig-tailed macaque  -t
               Sooty mangabey  -t
                       Baboon  -t
B D              Green monkey  -t
                        Drill  -t
B D          Proboscis monkey  -t
              Angolan colobus  -t
B D  Golden snub-nosed monkey  -t
      Black snub-nosed monkey  -t
B D                  Marmoset  -t
B D           Squirrel monkey  -t
            Ma's night monkey  -t
B D                   Tarsier  -t
                  Black lemur  -t
              Sclater's lemur  -t
B D                  Bushbaby  -t
B D                     Mouse  -t
B D                       Dog  -t
B D                 Armadillo  a-
                 Mouse lemur  ==
           Coquerel's sifaka  ==
         White-faced sapajou  ==

Inserts between block 12 and 13 in window
B D                Orangutan 1bp
B D                   Gibbon 1bp
B D                   Rhesus 1bp
B D      Crab-eating macaque 1bp
          Pig-tailed macaque 1bp
              Sooty mangabey 1bp
                      Baboon 1bp
B D             Green monkey 1bp
                       Drill 1bp
B D         Proboscis monkey 1bp
             Angolan colobus 1bp
B D Golden snub-nosed monkey 1bp
     Black snub-nosed monkey 1bp
B D                 Marmoset 1bp
B D          Squirrel monkey 1bp
           Ma's night monkey 1bp
B D                  Tarsier 1bp
                 Black lemur 216bp
             Sclater's lemur 216bp
B D                 Bushbaby 5bp
B D                    Mouse 1bp
B D                      Dog 1bp

Alignment block 13 of 31 in window, 100196387 - 100196465, 79 bps 
B D                     Human  gtt---------gtactggtatcttttatacaca----gacatta---gcttgcatataaatctctagtc
B D                     Chimp  gtt---------gtactggtatcttttatacaca----gacatta---gcttgcatataaatctctagtc
B D                    Bonobo  gtt---------gtactggtatcttttatacaca----gacatta---gcttgcatataaatctctagtc
B D                   Gorilla  att---------gtactggtatcttttatacaca----gacatta---gcttgcatataaatctctagtc
B D                 Orangutan  gct---------gtactggtatcttttatacaca----gacatta---gtttgcatataaatctctagtc
B D                    Gibbon  gtt---------gtactggtatcttttatacaca----gacatta---gtttgcatataaatctctagtc
B D                    Rhesus  gtt---------gtactgtt---ttttattcaca----gacatta---gttggtagataaagctgtagtc
B D       Crab-eating macaque  gtt---------gtactgttatcttttattcaca----gacatta---gtttgtagataaagctgtagtc
           Pig-tailed macaque  gtt---------gtactgttatcttttattcaca----gacatta---gtttgtagataaagctgtagtc
               Sooty mangabey  gtt---------gtactggtatcttttatacaca----gacatta---gtttgtagataaagctgtagtc
                       Baboon  gtt---------gtactggtatcttttatataca----gacatta---gtttgtagataaagctgtagtc
B D              Green monkey  gtt---------gtactggtatcttttatacaca----gacatta---gtttg----taaagctgtagtc
                        Drill  gtt---------gtactggtatcttttatacaca----gacatta---gtttgtagataaagctgtagtc
B D          Proboscis monkey  gtt---------gtactggtatcttttatacaca----gacatta---gtttgtagatagagctgtagtc
              Angolan colobus  gtt---------------gtatcttttatacaca----gacatta---gtttgtagataaagctgtagtc
B D  Golden snub-nosed monkey  gtt---------gtactggtatcttttatacaca----gacatta---gtttgtagataaagctgtagtc
      Black snub-nosed monkey  gtt---------gtactggtatcttttatacaca----gacatta---gtttgtagataaagctgtagtc
B D                  Marmoset  gtt---------ttactggtatctttcatataca----tacatta---gtttgcagataaagctctagtc
B D           Squirrel monkey  gct---------gtactggtatctttcatacaca----tacatta---gtttgcagataaagctctagtc
            Ma's night monkey  gct---------gtactggtatatttcatacaca----tacatta---gtttgcagataaagctctagtc
B D                   Tarsier  att---------g-aatggtgtctttcatacaca----gtcattc---gtgtgtagacaaaacttgaatc
B D                  Bushbaby  tat---------gtgctggtatcttt-atacacaagccaactaca---gtttatagacaaagcaggagtc
B D                     Mouse  gctcatttatgagttctataattttt------------tgtattg---gtttataggtaaaagtaca-ta
B D                       Dog  agt---------gtactgctatcttttatacaca----gccattgtttgtttttttttaagattttattt
B D                 Armadillo  gtt---------ttactggtatcctttatacaca----cccatgg---atttatagataaaactctaggc
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================
         White-faced sapajou  ======================================================================

                        Human  aa-ttatttt----------------------------------------------atgtagccttcata
                        Chimp  aa-ttatttt----------------------------------------------atgtagccttcata
                       Bonobo  aa-ttatttt----------------------------------------------atgtagccttcata
                      Gorilla  aa-ttatttt----------------------------------------------atgtagccttcata
                    Orangutan  aa-ttatttt----------------------------------------------atgtagccttcata
                       Gibbon  aa-ttatttt----------------------------------------------atgtagccttcata
                       Rhesus  aa-ttatttt----------------------------------------------acctagccttcata
          Crab-eating macaque  aa-ttatttt----------------------------------------------acctagccttcata
           Pig-tailed macaque  aa-ttatttt----------------------------------------------acctagccttcata
               Sooty mangabey  aa-ttatttt----------------------------------------------acatagccttcata
                       Baboon  aa-ttatttt----------------------------------------------acatagccttcata
                 Green monkey  aa-ttatttt----------------------------------------------acatagcctacata
                        Drill  aa-ttatttt----------------------------------------------acatagccttcata
             Proboscis monkey  aa-ttatttt----------------------------------------------atgtagccttcata
              Angolan colobus  aa-ttatttt----------------------------------------------atgtagccttcatg
     Golden snub-nosed monkey  aa-ttatttt----------------------------------------------atgtagccttcata
      Black snub-nosed monkey  aa-ttatttt----------------------------------------------atgtagccttcata
                     Marmoset  ca-ttatttt----------------------------------------------atataagcttcata
              Squirrel monkey  aa-ttctttc----------------------------------------------atatagccttcata
            Ma's night monkey  ag-ttatttt----------------------------------------------atatagccttcata
                      Tarsier  aa---atttt------------------------------------------------------tgcatg
                     Bushbaby  ac-attttat----------------------------------------------acgtagtgcacatg
                        Mouse  aa-tacctgt----------------------------------------------gtagggcttttgta
                          Dog  at-ttattcatgagagacacagagggaaagagaggcagagacacaggcagagggagaagcaggccccatg
                    Armadillo  aaaatttttt----------------------------------------------atgtaacccagaaa
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================
          White-faced sapajou  ======================================================================

                        Human  ta
                        Chimp  ta
                       Bonobo  ta
                      Gorilla  ta
                    Orangutan  ta
                       Gibbon  ta
                       Rhesus  tg
          Crab-eating macaque  tg
           Pig-tailed macaque  tg
               Sooty mangabey  tg
                       Baboon  tg
                 Green monkey  tg
                        Drill  tg
             Proboscis monkey  ta
              Angolan colobus  ta
     Golden snub-nosed monkey  ta
      Black snub-nosed monkey  ta
                     Marmoset  ta
              Squirrel monkey  ta
            Ma's night monkey  ta
                      Tarsier  ca
                     Bushbaby  --
                        Mouse  aa
                          Dog  ca
                    Armadillo  ta
              Sclater's lemur  ==
                  Black lemur  ==
                  Mouse lemur  ==
            Coquerel's sifaka  ==
          White-faced sapajou  ==

Inserts between block 13 and 14 in window
B D                      Dog 112bp

Alignment block 14 of 31 in window, 100196466 - 100196497, 32 bps 
B D                     Human  caatctatatacaatgtacattgtatacatc----------c
B D                     Chimp  caatctatttacaatgtacattgtatacatgtatatacatac
B D                    Bonobo  caatctatttacaatgtacattgtatacatctatatacatac
B D                   Gorilla  caatctatatacaatgttcattgtatgcatctatatacatac
B D                 Orangutan  caatctatatacaatgtacattgtatacatctatatacatac
B D                    Gibbon  caatctatatacaatgtacattgtatacatctatatacatac
B D                    Rhesus  caatctatatacaatgtacattgtatacatctatatacatat
B D       Crab-eating macaque  caatctatatacaatgtacattgtatacatctatatacatat
           Pig-tailed macaque  caatctatatacaatgtacattgtatacatctatatacatat
               Sooty mangabey  caatctacatacaatgtacattgtatacatctatatacatat
                       Baboon  caatctatatacaatgtacattgtatacatctatatacatat
B D              Green monkey  caatatatatgcaatgtacattgtatacatctatatacatat
                        Drill  caatctacatacaatgtacattgtatacatctatatacatat
B D          Proboscis monkey  caatctatatacaatgtacattgtatacatctatatacatct
              Angolan colobus  ca----------------------------------------
B D  Golden snub-nosed monkey  caatctatatacaatgtacattgtatacatctatatac----
      Black snub-nosed monkey  caatctatatacaatgtacattgtatacatctatatac----
B D                  Marmoset  aaatctatatacaatgtacac--tatacatct----------
B D           Squirrel monkey  aaatctatatacaatgtacactgtatacatct----------
            Ma's night monkey  aaatctatatacaatgtgcactgtatacatct----------
B D                   Tarsier  gagtttctg---------------------------------
B D                       Dog  aaagctgtagaccat---tgttatgtatagct----------
B D                 Armadillo  -----------aaaggaa------------------------
             Sclater's lemur  ==========================================
                 Black lemur  ==========================================
                 Mouse lemur  ==========================================
B D                     Mouse  ------------------------------------------
           Coquerel's sifaka  ==========================================
         White-faced sapajou  ==========================================
B D                  Bushbaby  ------------------------------------------

Inserts between block 14 and 15 in window
B D                 Marmoset 10bp
B D          Squirrel monkey 10bp
           Ma's night monkey 10bp
B D                      Dog 6bp

Alignment block 15 of 31 in window, 100196498 - 100196592, 95 bps 
B D                     Human  ac----atctatatacaatgcacatttttatgt---------tttaaaatagatgattgc-tt-t-ga-a
B D                     Chimp  ac----atctatatacaatgcacatttttatgt---------ttcaaaatagatgattgc-tt-t-ga-c
B D                    Bonobo  ac----atctatatacaatgcacatttttatgt---------tttaaaatagatgattgc-tt-t-ga-c
B D                   Gorilla  ac----atctatatacaatgcacatttttatgt---------tttaaaatagatgattgc-tt-t-ca-a
B D                 Orangutan  ac----atctatatacaatgcacattgttatgt---------tttaaaatagatgattgc-tt-t-ga-a
B D                    Gibbon  ac----atctatatacaatgcacattgttatgt---------tttaaaatagatgattgc-tt-t-ga-a
B D                    Rhesus  ac----atctatatacaatgcacattgttatgt---------tttaaaatagatgattgc-tt-t-ga-a
B D       Crab-eating macaque  ac----atctatatacaatgcacattgttatgt---------tttaaaatagatgattgc-tt-t-ga-a
           Pig-tailed macaque  ac----atctatatacaatgcacattgttatgt---------tttaaaatagatgattgc-tt-t-ga-a
               Sooty mangabey  ac----atctatatacaatgcacattgttatgt---------tttaaaatagatgattgc-tt-t-ga-a
                       Baboon  ac----atctatatacaatgcacattgttatgt---------tttaaaatagatgattgc-tt-t-ga-a
B D              Green monkey  ac----atctatatacaatgcacattgttatgt---------tttaaaatagatgattgc-tt-t-ga-a
                        Drill  ac----atctatatacaatgcacattgttatgt---------tttaaaatagatgattgc-tt-t-ga-a
B D          Proboscis monkey  atatacatctatatacaatgcacattgttatgt---------tttaaaatagatgattgc-tt-t-ga-a
              Angolan colobus  ------atctatatacaatgcacattgttattt---------tttaaaatagatgattgc-tt-t-ga-a
B D  Golden snub-nosed monkey  ------atctatatacaatgcacattgttatgt---------tttaaaatagatgattgc-tt-t-ga-a
      Black snub-nosed monkey  ------atctatatacaatgcacattgttatgt---------tttaaaatagatgattgc-tt-t-ga-a
B D                  Marmoset  ac----atctgtatacaatgcaca---ttatgt---------tttaaaatagatgatttt----------
B D           Squirrel monkey  ac----atctatatacaatgcacattgttatgt---------tttaaaatagatgattgc-tt-t-gg-a
          White-faced sapajou  ac----atctatatacaatgcacactgttatgt---------tttaaaatagctgattgc-tt-t-gg-a
            Ma's night monkey  ac----atctatttacaatgcacattgttatgt---------tttaaaatagatgattgc-tt-t-gg-a
B D                   Tarsier  ac----atctatatacaacgtaca-------------------------aagactatcacttt-t-tg-a
B D                  Bushbaby  ac----atctacatacaac-ctcactgtcatgt---------tctaaa-tacactagtgc-ttct-gg-a
B D                     Mouse  ac----atctgcatatattgtgcattgccatgt---------tttacaa-aaacaatggc-ct-tggg-a
B D                       Dog  ac----atctatatacaatg----ttattatatgcactgctgttttaaataaa--atagc-tt-t-caca
B D                 Armadillo  ---------gacatgcaaggtgcattgttatct---------tttaaataaaatcttact-tt-t-gg-a
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================

                        Human  ctccatttcaaca----gagtgca----taaacatatgatcacatcaggc
                        Chimp  ctgcatttcaaca----gagtgca----taaacatatgatcacatcaggc
                       Bonobo  ctgcatttcaaca----gagtgca----taaacatatgatcacatcaggc
                      Gorilla  ct-catttcaaca----gagtgca----taaacatatgatcacatcaggc
                    Orangutan  ctgcatttcaaca----gagtgca----taaacatatgatcacatcaggc
                       Gibbon  ctgcatttcaaca----gagtgca----taaacatatgatcacatcaggc
                       Rhesus  ctgcatttcaaca----cggtaca----taaacatatgatcatatcaggc
          Crab-eating macaque  ctgcatttcaaca----cggtaca----taaacatatgatcatatcaggc
           Pig-tailed macaque  ctgcatttcaaca----tggtaca----taaacatatgatcatatcaggc
               Sooty mangabey  ctgcatttcaaca----cggtaca----taaacatatgatcatatcaggc
                       Baboon  ctgcatttcaaca----tggtaca----taaacatatgatcatatcaggc
                 Green monkey  ctgcatttcaaca----cggtaca----taaacatatgatcatatcaggc
                        Drill  ctgcatttcaaca----tggtaca----taaacatatgatcatatcaggc
             Proboscis monkey  ctgcatttcaaca----caggaca----taaacgtatgatcacatcaggc
              Angolan colobus  ctgcatttcaaca----tagtaca----taaacatatgatcacatcaggc
     Golden snub-nosed monkey  ctgcatttcaaca----cagtaca----taaacatatgatcacatcaggc
      Black snub-nosed monkey  ctgcatttcaaca----cagtaca----taaacatatgatcacatcaggc
                     Marmoset  ctgcatttcaaca----gagtaca----taaacacatgatcacatcagtc
              Squirrel monkey  ctgcatttcaaca----gagtaca----taaacacatgatcacatcagtc
          White-faced sapajou  ctgcatttcaaca----gagtaca----taaacacatgatcacatcagtc
            Ma's night monkey  ctgcatttcaaca----gagtaca----taaacacatgatcacatcggtc
                      Tarsier  ctgcatttcaaga----gagtaag----taaacatataatcacaccaggt
                     Bushbaby  ctgcatttcaaga----gagtaaa----taaacacctaatcacatcaagt
                        Mouse  ctgcatttcaaag----gactaaa----aaaaaa----------------
                          Dog  ctgcattatgagagagtgagtaga----taaacatataatcacatccagt
                    Armadillo  ctgcatttcaaga----tagtaaataggtaaaaatattatcacaccagtt
              Sclater's lemur  ==================================================
                  Black lemur  ==================================================
                  Mouse lemur  ==================================================
            Coquerel's sifaka  ==================================================

Alignment block 16 of 31 in window, 100196593 - 100196638, 46 bps 
B D                     Human  taaaaaataa-tag-tattgctttaa----attaaaaattaagtttaaatta
B D                     Chimp  taaaaaataa-tag-tattgctttaa----attaaaaattatgtttaaatta
B D                    Bonobo  taaaaaataa-tag-tattgctttaa----attaaaaattatgtttaactta
B D                   Gorilla  taaaaaataa-tag-tattgctttaa----attaaaaattaaatttaaatta
B D                 Orangutan  taaaaaataa-tag-tattgctttaa----attaaaaattgtgtttaaatta
B D                    Gibbon  taaaaaataa-tag-tattg-tttaa----attaaaaattatgtttaaatta
B D                    Rhesus  taaaa---aa-taa-tattgctttaa----attaaaaattatgtttaaatta
B D       Crab-eating macaque  taaaa---aa-taa-tattgctttaa----attaaaaattatgtttaaatta
           Pig-tailed macaque  taaaa---aa-taa-tattgctttaa----attaaaaattatgtttaaatta
               Sooty mangabey  taaaa---aa-taa-tattgctttaa----attaaaaattatgtttaaatta
                       Baboon  taaaa---aa-taa-tattgctttaa----gttaaaaattatgtttaaatta
B D              Green monkey  taaaa---ga-taa-tattactttaa----attaaaaattatgtttaaatta
                        Drill  taaaa---aa-taa-tattgctttaa----attaaaaattatatttaaatta
B D          Proboscis monkey  taaaatacaa-tag-tattgctttaa----attaaaaattatgtttaaatta
              Angolan colobus  taaaaaacaa-tag-tattgctttaa----attaaaaattatgtttaaatta
B D  Golden snub-nosed monkey  tgaaatacaa-tag-tattgctttaa----attaaaaattatgtttacatta
      Black snub-nosed monkey  taaaatacaa-tag-tattgctttaa----attaaaaattatgtttacatta
B D                  Marmoset  tacaaagtaa-tag-tattgctctaa----attaaaaattatgtttaaatta
B D           Squirrel monkey  gacaaagtaa-tag-tattgctctaa----attaaaaattctgtttaaatta
          White-faced sapajou  tacaaagtga-tgg-tattgctctaa----attaaaaattctgtttaaatta
            Ma's night monkey  tacaaagtaa-tag-tattgctctaa----attaaaaattatgtttaaatta
B D                   Tarsier  taaaaaa-aa-tag-tattgctttga----a-----------atttaagtta
            Coquerel's sifaka  taaaaaataa-tag-tattgctttga----a-----------attgaaaatt
B D                  Bushbaby  taaaaagtaa-tag-tgttgctttaa----a-----------atttaaatta
B D                     Mouse  aaaaaaaaga-tga-gattgtgtcaattccataaaaaataacat---aattg
B D                       Dog  taaaaaaaaa-tagctattccattga----a-----------atttaaatta
B D                 Armadillo  caaaaaataattga-cattggtagga----a-----------atgtaaatg-
             Sclater's lemur  ====================================================
                 Black lemur  ====================================================
                 Mouse lemur  ====================================================

Inserts between block 16 and 17 in window
B D                    Mouse 3bp

Alignment block 17 of 31 in window, 100196639 - 100196892, 254 bps 
B D                     Human  aaacattcataatga-aaatgcttcta-ctatttatgttgccctc------ttaggccatg-ttttacaa
B D                     Chimp  aaacattcataatga-aaatgcttcta-ctatttatgttgccctc------ttaggccatg-ttttacaa
B D                    Bonobo  aaacattcataatga-aaatgcttcta-ctatttatgttgccctc------ttaggccatg-ttttacaa
B D                   Gorilla  aaacattcataatga-aaatgcttcta-ctatttatgttgccctc------ttaggccatg-ttttacaa
B D                 Orangutan  aaacattcataatga-aaatgcttcta-ctatttatgttgccctc------ttaggccatg-ttttacaa
B D                    Gibbon  aaacattcataatga-aaatgcttcta-ctatttatgttgccctc------ttaggccatg-ttttacaa
B D                    Rhesus  aaatatgaataatga-aaatgcttcta-ctatttgtgttgccctc------ttaggccatg-ttttac-a
B D       Crab-eating macaque  aaatatgaataatga-aaatgcttcta-ctatttatgttgccctc------ttaggccatg-ttttac-a
           Pig-tailed macaque  aaatatgaataatga-aaatgcttcta-ctatttatgttgccctc------ttaggccatg-ttttac-a
               Sooty mangabey  aaatatgaataatga-aaatgcttcta-ctatttatgttgccctc------ttaggccatg-ttttacaa
                       Baboon  aaatatgaataatga-aaatgcttcta-ctatttatgttgccctc------ttaggccatg-ttttacaa
B D              Green monkey  aaatatgaataatga-aaatgcttcta-ctatttatgttgccctc------ttaggccatg-ttttacaa
                        Drill  aaatatgagaaatga-aaatgcttcta-ctatttatgttgccctc------ttaggccatg-ttttacaa
B D          Proboscis monkey  aaacatgaataatga-aaatgcttcta-ctatttatgttgccctc-------------------ttacaa
              Angolan colobus  aaacatgaataatgataaatgcttcta-ctatttatgttgccctc-------------------ttacaa
B D  Golden snub-nosed monkey  aaacatgaataatga-aaatgcttcta-ctatttatgttgccctc-------------------ttacaa
      Black snub-nosed monkey  aaacatgaataatga-aaatgcttcta-ctatttatgttgccctc-------------------ttacaa
B D                  Marmoset  aagcattcataatga-aaatgcttcta-ctatttatgttgccctc------ttaggccaag-ttttacaa
B D           Squirrel monkey  aagcattaataatga-aaatgcctcta-ctatttatgttgccctc------ttaggccaac-ttttacaa
          White-faced sapajou  aagcattaataatga-aaatgcttcta-ctatttatgttgccctc------ttaggccaag-ttttacaa
            Ma's night monkey  aagtattcataatga-aaatgcttcta-ctatttatgttgccctc------ttaggccaag-ttttacaa
B D                   Tarsier  aaac-------atga-aagcgtttcta-ctatttctcttaccctctttt-cttaggccacatttttacaa
                  Mouse lemur  aaacatccataatga-aaatgcttcta-ctatttatcttgccctttttc-cttaggccatg-ttttttaa
            Coquerel's sifaka  aaacatccgtaatga-aaatgcttcta-ctgtttctcttgccctctttt-cttgggccatg-ttttataa
                  Black lemur  aaacatccatactga-aaatgcttcta-ccatttctcttgccctctttc-cttgggccatg-ttttataa
              Sclater's lemur  aaacatccatactga-aaatgcttcta-ccatttctcttgccctctttc-cttgggccatg-ttttataa
B D                  Bushbaby  aaacatcttgaatga-aaatgcttcta-ctatttgtcttgtcctctttc-cttaggccat--tttcacaa
B D                     Mouse  tgacagctatg-----aaatgtttttgtttgcttatcttctttcc------tgaggacttg-ttttacaa
B D                       Dog  aaacatctataatgg-aaatgtttcta----tttcccttgctcctttttacttactccatg-tttcacaa
B D                 Armadillo  aaatgcccatcatga-gaatgctcctg----tttccctcgcccac-tttctttaggccatg--tttatac

                        Human  actcagcaatttgactaatttggagtgaatcc--attattggaagtcactgttgaaaggggagaagcaat
                        Chimp  actcagcaatttgactaatttggagtgaatcc--attattggaagtcactgttgaaaggggagaggcaat
                       Bonobo  actcagcaatttgactaatttggagtgaatcc--attattggaagtcactgttgaaaggggagaggcaat
                      Gorilla  actcaacaatttgactaatttggagtgaatcc--attattggaagtcactgttgaaaggggagaagcaat
                    Orangutan  actcagcaatttgactaatttggagtgaatcc--attattggaagtcactgctgaaaggggagaagcaat
                       Gibbon  actcatcaatttgactaatttggagtgaatcc--attattggaagtcactgttgaaaggagagaagcaat
                       Rhesus  attcagcaatttgattaatttggagcgaatcc--attatt-gaagtcaccgttgaaagggaagaagcaat
          Crab-eating macaque  attcagcaatttgattaatttggagcgaatcc--attatt-gaagtcaccgttgaaaggggagaagcaat
           Pig-tailed macaque  attcagcaatttgattaatttggagcgaatcc--attatt-gaagtcaccgttgaaaggggagaagcaat
               Sooty mangabey  attcagcaatttgattaatttggagcgaatcc--attatt-gaagtcaccgttgaaaggggagaagcaat
                       Baboon  attcagcaatttgattaatttggagcgaatcc--attatt-gaagtcaccgttgaaaggggagaagcaat
                 Green monkey  attcagcaatttgattaatttggagcgaatcc--attatt-gaagtcaccgttgaaaggggagaagcaat
                        Drill  attcagcaatttgattaatttggagcgaatcc--attatt-gaagacgccattgaaaggggagaagtaat
             Proboscis monkey  actcagcaatttgattaatttggagcgaatcc--attatt-gaagtcactgttgaaaggggagaagcaat
              Angolan colobus  actcagcaatttgattaatttggagcaaatcc--attact-gaagtcactgttgaaaggggagaagcaat
     Golden snub-nosed monkey  actcagcaatttgattaatttggagcaaatcc--attatt-gaagtcactgttgaaaggggagaagcaat
      Black snub-nosed monkey  actcagcaatttgattaatttggagcaaatcc--attatt-gaagtcactgttgaaaggggagaagcaat
                     Marmoset  acccagcaatttgactgatttggagtgaatcc--attatt-gaagtcactgttgaaaggggacaagcaat
              Squirrel monkey  agccagcaatttgactaatttggagtgaatcc--attatt-gaagtcactgttgaaaggggacaagcaat
          White-faced sapajou  agccagcaatttgactaatttggagtgaatcc--attatt-gaagtcactgttgaaaggggacaagcaat
            Ma's night monkey  acccagcaatttgactaatttggagtgaatcc--attatt-gaagtcactgttgaaaggggacaggcaat
                      Tarsier  acccagcaatctgactaatttggagtgaatcc--attatt-gaagtcaccgttgaaaggggccaagcaat
                  Mouse lemur  acccaacaatttgactaatttggagtgaaccc--attact-gaagtcaccattgaaacgggacaagca--
            Coquerel's sifaka  acccaacaatttgactaatttggagtgaatcc--attact-gaagtcaccattgaaaggggccaagca--
                  Black lemur  acccaacaatttgactaatttggagtgaatcc--attact-gaagtcaccattggaaggggccaagga--
              Sclater's lemur  acccaacaatttgactaatttggagtgaatcc--attact-gaagtcaccattggaaggggccaagga--
                     Bushbaby  accccacagtctgactagtttggagtgaatcc--attact-gaagtcacacaggga--ggcccggccc--
                        Mouse  acctggcaaactggcttattttgagtgagtct---ctacc-aaacacatcactagaaggagccaagcaat
                          Dog  atccaataatttgactgatttgaagtgaatccaaattact-aaaaccactgttaaaagagtccaagcaat
                    Armadillo  accccgcgatctgactgtttgggcgcgaatcc--gttact-gaagccaccgttaggaagggccaagcaat

                        Human  c-----agtt-agtacataaacatttgatccaattcatccaaatccttttt----tttggcaaattttat
                        Chimp  c-----agtt-aggacataaacatttgatccaattcatccaaatccttttt----tt-ggcaaattttat
                       Bonobo  c-----agtt-aggacataaacatttgatccaattcatccaaatccttttt----tt-ggcaaattttat
                      Gorilla  c-----agtt-agtacataaacatttgatccaattcatccaaatccttttt-------ggcaaattttat
                    Orangutan  c-----aatt-agtacataaacatttgatccaattcatccaaatccttttt----tt-ggcaaatttttt
                       Gibbon  c-----aatt-agtacataaacatttgatccaattcatccaaatccttttt----tt-ggcaaattttat
                       Rhesus  c-----aatt-agtacataaacatttgatccaattcattcaaatcctttttgttttt-ggcaaattttat
          Crab-eating macaque  c-----aatt-agtacataaacatttgatccaattcattcaaatcctttttgttttt-ggcaaattttat
           Pig-tailed macaque  c-----aatt-agtacataaacatttgatccaattcattcaaatcctttttgttttt-ggcaaattttat
               Sooty mangabey  c-----aatt-agtacataaacatttgatccaattcattcacatcctttttgttttt-ggcaaattttat
                       Baboon  c-----aatt-agtacataaacatttgatccaattcattcaaatcctttttgttttt-ggcaaattttat
                 Green monkey  c-----aatt-agtacataaacatttgatccaattcattcaaatcc-ttttgttttt-ggcaaattttat
                        Drill  c-----aatt-agtacataaacatttgatccaattcattcaaatcctttttgttttt-ggcaaattttat
             Proboscis monkey  c-----aatt-agtacataaacatttgatccaattcattcaaatccgttttgtttgc--gcaaattttat
              Angolan colobus  c-----agtt-agtacataaacatttgatccaattcattcaaatcctttttgtttgt--gcaaattttat
     Golden snub-nosed monkey  c-----aatt-agtacataaacatttgatccaattcattcaaatcctttttgtttgc--gcaaattttat
      Black snub-nosed monkey  c-----aatt-agtacataaacatttgatccaattcattcaaatcctttttgtttgc--gcaaattttat
                     Marmoset  c-----aatt-cgttcataaacatttgatccaattcatccaaatccttttt-----t-ggcaaattttct
              Squirrel monkey  c-----aatt-agttcataaacattcgatccaattcatccaaatccttttt-----t-ggcaaattttct
          White-faced sapajou  c-----aatt-agttcataaacatttgatccaattcatccaaatccttttt-----t-ggcaaattttcc
            Ma's night monkey  c-----aatt-agttcataaacatttgatctaattcatccaaatccttttt-----t-ggcaaattttct
                      Tarsier  c-----gatg-aggctgtaaatatctgatccagttcacctaaatcactttt----ct-ggcaaattatat
                  Mouse lemur  --------tt-agtccataaacattggagccaattcacccaaatcactatt----tt-ggcagactatat
            Coquerel's sifaka  --------tt-agtccataaacatttgacccaattcactcaaatcactatt----tt-ggcaaattatat
                  Black lemur  --------tt-agtccataaacatttgacacaattcacccaaatcactatt----tt-ggcaaattatat
              Sclater's lemur  --------tt-agtccataaacatttgacacaattcacccaaatcactatt----tt-ggcaaattatat
                     Bushbaby  --------cc-agtccatagacgtctgacccaattcattcaaatcactgct----gg-ggcaaattgtat
                        Mouse  c-----tatc-----cataaatgctccatctgattctacccaatatttttg-------ggcaaatgatat
                          Dog  ccaattaata-catacataaacatttaatccaattcacccaagtcactttt----tt-gaca-atgatat
                    Armadillo  c-----aattgagtccaaaaccattcgatccaattcacccaaatcactttt-----t-ggtaaatgatag

                        Human  ga--ataaactgaatgtgataagctagtgagtatattcttaagattttaaat-ctttttagttctaca
                        Chimp  ga--ataaactgaatgtgataagctagtgaggatattcttaagattttaaat-ctttttagttctaca
                       Bonobo  ga--ataaactgaatgtgataagctagtgaggatattcttaagatttaaaat-ctttttagttctaca
                      Gorilla  ga--ataaactgaatgtgataagctagtgaggatattcttaagattttaaat-ctttttagttctaca
                    Orangutan  ga--ataaactgaatgtgataggctagtgaggatattcttaagattttaaat-ctttttagttctaca
                       Gibbon  ga--ataaactgaatgtgataagctagtgaggatattcttaagattttaaat-ctttttagttctaca
                       Rhesus  ga--ataaactgaatgtaataaactag-----------------ttttaaat-ctttttaattctaca
          Crab-eating macaque  ga--ataaactgaatgtaataaactag-----------------ttttaaat-ctttttaattctaca
           Pig-tailed macaque  ga--ataaactgaatgtaataaactag-----------------ttttaaat-ctttttaattctaca
               Sooty mangabey  ga--ataaactgaatgtaataaactag-----------------ttttaaat-ctttttaattctaca
                       Baboon  ga--ataaactgaatgtaataaactag-----------------ttttcaat-ctttttaattctaca
                 Green monkey  ga--ataaactgaatgtaataaactag-----------------ttttaaat--tttttaattctaca
                        Drill  aa--atacactgaatgtaataaactag-----------------ttttaaat-ctttttaattctaca
             Proboscis monkey  ga--ataaactgaatgtaataaactag-----------------ttttaaat-ctttttaattctaca
              Angolan colobus  ga--ataaactgaatgtagtaaactag-----------------ttttaaat-ctttttaattctaca
     Golden snub-nosed monkey  ga--ataaactgaatgtaataaactag-----------------ttttaaat-ctttttaattctaca
      Black snub-nosed monkey  ga--ataaactgaatgtaataaactag-----------------ttttaaat-ctttttaattctaca
                     Marmoset  ga--ataaactgaatgtcataaactagtgaggatattcttcagattttaaac-cactttatttctaca
              Squirrel monkey  ga--ataaactgaatgtgataaactagtgaggatattcttcagattttaaac-cactttatttctgca
          White-faced sapajou  ga--ataaactgaatgcgataaactagtgaggatattcttcagattttaaac-cgctttatttctgca
            Ma's night monkey  ga--atacattgaatgtgataaactagtgaggatactcttcagattttaaac-cactttatttttaca
                      Tarsier  ga--atcaactgaatgtggcaaattagtgaggctcttctcaggattttaact-caatgtagttctaca
                  Mouse lemur  aa--ataagatgaatgcgacaaattagtgaggctattcttaagattttaatt-caatttagttctaca
            Coquerel's sifaka  ga--ataagatgaatatggcaaattggtgaggctattctcaagattttaatt-cagtttagttctaca
                  Black lemur  ga--ataagatgaatgtggcaaattagtgaggctattcttaagagtttaatt-caatttagttctaca
              Sclater's lemur  ga--ataagatgaatgtggcaaattagtgaggctattcttaagagtttaatt-caatttagttctaca
                     Bushbaby  ga--ctgaaatgaacatggcaaa-tagtgagactattcttatgattttaatt-cagtcgagttctaca
                        Mouse  gactatatattgactagtgaaaaatagtgaatatattcttt---ttttaaaa-ca-tacaatattgta
                          Dog  ga--attaactaaat-tggcaaattagtgaagctattcttaagatattaatttcagttcagttttaca
                    Armadillo  aa--gctaactgaatagagctaattagcaaggttcatcttaagattttaatg-gaattcaattccacc

Inserts between block 17 and 18 in window
                 Mouse lemur 425bp
           Coquerel's sifaka 338bp
                 Black lemur 304bp
             Sclater's lemur 304bp

Alignment block 18 of 31 in window, 100196893 - 100197072, 180 bps 
B D                     Human  agctaaatgctgttgggggatggggatccaaaataaaaggcatagcccttcacaccta----agagagca
B D                     Chimp  agctaaatgctgttgggggatggggatccaaaataaaaggcatagcccttcacaccta----agagagca
B D                    Bonobo  agctaaatgctgttggggaatggggatccaaaataaaaggcatagcccttcacaccta----agagagca
B D                   Gorilla  agctaaatgctgttgggg-atggggatccaaaataaaaggcatagcccttcacaccta----agagagca
B D                 Orangutan  ggctaagtgctgttgggtgatggagatccaaaataaaaggcatagcccttcacaccta----agagagca
B D                    Gibbon  agctaagtgctgttgagggatggggatccaaaattaaaggcatagcccttcacacctaagagagagagca
B D                    Rhesus  agcaaagtgctgttgggggatggggatccaaaataaaaggcatagtccttcacaccta----agacagct
B D       Crab-eating macaque  agcaaagtgctgttgggggatggggatccaaaataaaaggcatagcccttcacaccta----agagagct
           Pig-tailed macaque  agcaaagtgctgttgggggatggggatccaaaataaaaggcatagcccttcacactta----agagagct
               Sooty mangabey  agcaaagtgctgttgggggatggggatcaaaaataaaaggcatagcccttcacaccta----agagagct
                       Baboon  agcaaagtgctgttggaggatggggatcaaaaataaaaggcatagcccttcacaccta----agagggct
B D              Green monkey  agcaaagtgctgttgggggatggggatccaaaataaaaggcatagcccttcacaccta----agagagct
                        Drill  agcaaagtgctgttgggggatggggatcaaaaataaaaggcatagcccttcacaccta----agagagct
B D          Proboscis monkey  agctaagtgctgttgggggatggggatccaaaataaaaggcatagcccttcacaccta----agagagct
              Angolan colobus  agcgaagtgctgttgggggatggggatccaaaataaaaggcatagcccttcacaccta----agagagct
B D  Golden snub-nosed monkey  agctaagtgctgttgggggatggggatccaaaataaaaggcatagcccttcacaccta----agagagct
      Black snub-nosed monkey  agctaagtgctgttgggggatggggatccaaaataaaaggcatagcccttcacaccta----agagagct
B D                  Marmoset  agctaagtgctgttggaggacagggatccaaagtcaaaggcatagcccctcacaccta----agagacca
B D           Squirrel monkey  agctaagtgctgttgggggacggggatccaaagtcaaaggcatagcgcctcacaccta----gcagacca
          White-faced sapajou  agataagtgctgatgggggacagggatccaaagtgaaaggcatagcccctcacaccta----acagacca
            Ma's night monkey  agctaagtgctgttggggtacaggggtccaaagtcaaaggcatagcccctcataccta----agagacca
B D                   Tarsier  agctaagcattgt--------gggggtccaaagtaaaagacatgaaccttcacctctg----agagaaca
B D                  Bushbaby  agctaagtgtttg--------ggggatccaaa---caggacaaggcccttcacctcta----agagagca
B D                     Mouse  agctaagtgacattggggacatacagttcaaa--------tatagtccttcaccctca----aaagagta
B D                       Dog  aactaagtactaa-gtactgtggaggatcaaagtaaaagactcaggccttgactccta----atagaaca
B D                 Armadillo  agctaagtgctgt-------gggggatccaaagtgaaagccggagccccctcca-ggg----agagagca
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================

                        Human  ccatttaagggtagaaattgcagtatgggct-atga-tctgctataataaagcta-cacc----------
                        Chimp  ccatttaagggtagaaattgcagtatgggct-atga-tctgctataataaagcta-cacc----------
                       Bonobo  ccatttaagggtagaaattgcagtatgggct-atga-tctgctataataaagcta-cacc----------
                      Gorilla  tcatttaagggtagaaattgcagtatgggct-atga-tctgctataacagagcta-cacc----------
                    Orangutan  ccatttaggggtagaaattgcagtatgggct-atga-tctgctataatagagcta-cacc----------
                       Gibbon  ccatttaagggtagaaattgcagtatgggct-atga-tctgctataatagagcta-cacc----------
                       Rhesus  ccattgaagggtagaaattgcaggatgggct-gtga-tctgctataacagagcta-cacc----------
          Crab-eating macaque  ccattgaagggtagaaattgcaggatgggct-gtga-tctgctataacagagcta-cacc----------
           Pig-tailed macaque  ccattgaagggtagaaattgcaggatgggct-gtga-tctgctataacagagcta-cacc----------
               Sooty mangabey  ccattgaagggtagaaattgcaggatgggct-gtga-tctgctataacagagcta-tacc----------
                       Baboon  ccattgaagggtagaaattgcaggatgggct-gtga-tctgctataacagagcta-cacc----------
                 Green monkey  ccattgaagggtagaaattgcagaatgggct-gtga-tctgctataacagagcta-cacc----------
                        Drill  ccattgaagggtagaaattgcagaatgggct-gtga-tctgctataacagagcta-cacc----------
             Proboscis monkey  ctactgaagggtagaaattgcaggatgggct-gtga-tctgctataacagagcta-cacc----------
              Angolan colobus  ctactgaagggtagaaattgcaggatgggct-gtga-tctgctataacagagcta-cacc----------
     Golden snub-nosed monkey  ctactgaagggtagaaattgcaggatgggct-gtga-tctgctataacagagcta-cacc----------
      Black snub-nosed monkey  ctactgaagggtagaaattgcaggatgggct-gtga-tctgctataacagagcta-cacc----------
                     Marmoset  cgatttaaaggcagaaattgcaggatgggct-aggg-tctgctgtcacagagctaccact----------
              Squirrel monkey  ccatctaagggcagaagttgcaggatgggct-acgg-tctgctgtaacagagctaccact----------
          White-faced sapajou  ccatttaagggcagaaattgcaggatgggct-acgg-tctgctgtaacagagctaccact----------
            Ma's night monkey  ctatttaagggcagaaattgcaggat-ggct-acag-tctgctgtaacagagctaccact----------
                      Tarsier  cagtttcggggcacaagtagcaggatgagtt-gtgc-tctg-tgcgatggagcta-tcccctggggggcg
                     Bushbaby  ctgtgtaaggggagagcgtgcagggtggcct-gtga--ctgccacagcagagctgtctgc----------
                        Mouse  c-----aaatgcaaaaaggtgagaacagg--------tctgttataaca-------catg----------
                          Dog  cagtttaaggg-atacagtgcaggatgggctagtga-cctgctgtaggagtgttatcacc----------
                    Armadillo  --------------------------gggct-gtggggccgcggcgaca--gcga-catg----------
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================

                        Human  -----agagaactatgtgcattcagctgtttgttagaaggggttgg------tatttgaaatggacc--t
                        Chimp  -----agagaactatgtgcattcagctgtt----agaaggggttgg------tatttgaaatggacc--t
                       Bonobo  -----agagaactatgtgcatttagctgtt----agaaggggttgg------tatttgaaatggacc--t
                      Gorilla  -----agagaactatgtgcattcagctgtt----agaaggggttgg------tatttgaaatggacc--t
                    Orangutan  -----agagaactatgtgcatacagctgtt----agaaggggttgg------tatttgaaatggacc--t
                       Gibbon  -----agagaactatgtgcatacagctgtt----agaaggggttgg------tatttgaaatggacc--t
                       Rhesus  -----agagaactatgtgcatacagctgtt----acaagggattgg------tatttgaaatggacc--t
          Crab-eating macaque  -----agagaactatgtgcatacagctgtt----acaaggggttgg------tatttgaaatggacc--t
           Pig-tailed macaque  -----agagaactatgtgcatacagctgtt----acaaggggttgg------tatttgaaatggacc--t
               Sooty mangabey  -----agagaactatgtgcatacagctgtt----agaaggggttgg------tatttgaaatggacc--t
                       Baboon  -----agagaactatgtgcatacagctgtt----agaaggggttgg------tatttgaaatggacc--t
                 Green monkey  -----agagaactatgtgcatacagctgtt----agaaggggttgg------tatttgaaatggacc--t
                        Drill  -----agagaactatgtgcatacagctgtt----agaaggggttgg------tatttgaaatggacc--t
             Proboscis monkey  -----agagaactacgtgcacacagctgtt----agaaggggttgg------tatttgaaatggacc--t
              Angolan colobus  -----agagaactatgtgcatacagctgtt----agaaggggttgg------tatttggaatggacc--t
     Golden snub-nosed monkey  -----agagaactacgtgcatacagctgtt----agaaggggttgg------tatttgaaatggacc--t
      Black snub-nosed monkey  -----agagaactacgtgcatacagctgtt----agaaggggttgg------tatttgaaatggacc--t
                     Marmoset  -----ggagaactgtgtgcttatggctgtt----agaaggagttgg------tatctgaaatggacc---
              Squirrel monkey  -----caagaactgtgtgcttatagctgtt----agaaggagttgg------taattgaaatggacc---
          White-faced sapajou  -----acagaactgtgtgcttatagctgtt----agaaggagttgg------tatttgaaatggacct--
            Ma's night monkey  -----agagaactgtgtgcttatagttgtt----agaaggagttgg------tatttgaaatggacc-t-
                      Tarsier  gggaaggagggctctgtgtcaccaactggt----aggagggggt-g------tatttgagatggagc--t
                     Bushbaby  -----cgagtacgatgtg--tgcagctggc----acaagttgtccg------tattggaaatggacc--t
                        Mouse  -----ga-----tataagcatgaagc--------agagagagttgc------tatgtgaaa---------
                          Dog  -----agagaaccgtgtgggtatggttggc----agaaggagttgg------aatttgaacctgacc--t
                    Armadillo  -----cgcaggccgcgggcacgtggccgga----gggccgagctggggtccctattt-------------
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================
                  Mouse lemur  ======================================================================
            Coquerel's sifaka  ======================================================================

Inserts between block 18 and 19 in window
B D                 Marmoset 1bp
B D          Squirrel monkey 1bp
         White-faced sapajou 6bp
           Ma's night monkey 10bp
B D                  Tarsier 4bp
B D                      Dog 3bp

Alignment block 19 of 31 in window, 100197073 - 100197092, 20 bps 
B D                     Human  -------ggcctcagatccattcaaat-----
B D                     Chimp  -------ggcttcaggtccattcaaat-----
B D                    Bonobo  -------ggcttcaggtccattcaaat-----
B D                   Gorilla  -------ggcttcaggtccattcaaat-----
B D                 Orangutan  -------ggct---------------g-----
B D                    Gibbon  -------ggct---------------g-----
B D                    Rhesus  -------ggct---------------g-----
B D       Crab-eating macaque  -------ggct---------------g-----
           Pig-tailed macaque  -------ggct---------------g-----
               Sooty mangabey  -------ggct---------------g-----
                       Baboon  -------ggct---------------g-----
B D              Green monkey  -------ggct---------------g-----
                        Drill  -------ggct---------------g-----
B D          Proboscis monkey  -------ggct---------------g-----
              Angolan colobus  -------ggct---------------g-----
B D  Golden snub-nosed monkey  -------ggct---------------g-----
      Black snub-nosed monkey  -------ggct---------------g-----
B D                  Marmoset  -------cact---------------a-----
B D           Squirrel monkey  -------cact---------------t-----
B D                   Tarsier  -------agct---------------------
B D                  Bushbaby  -------ggat---------------a-----
B D                     Mouse  -------agct---------------g-----
B D                       Dog  -------ga-----------------------
B D                 Armadillo  gcccctgatct---------------gcatgc
             Sclater's lemur  ================================
                 Black lemur  ================================
                 Mouse lemur  ================================
           Coquerel's sifaka  ================================
           Ma's night monkey  ================================
         White-faced sapajou  ================================

Inserts between block 19 and 20 in window
B D                 Marmoset 1bp
B D          Squirrel monkey 1bp
B D                 Bushbaby 1bp
B D                    Mouse 7bp

Alignment block 20 of 31 in window, 100197093 - 100197097, 5 bps 
B D                     Human  ---ggaag
B D                     Chimp  ---ggaag
B D                    Bonobo  ---ggaag
B D                   Gorilla  ---ggaag
B D                 Orangutan  ---ggaag
B D                    Gibbon  ---ggaag
B D                    Rhesus  ---ggaaa
B D       Crab-eating macaque  ---ggaaa
           Pig-tailed macaque  ---ggaaa
               Sooty mangabey  ---ggaag
                       Baboon  ---ggaag
B D              Green monkey  ---ggaag
                        Drill  ---ggaag
B D          Proboscis monkey  ---ggcag
              Angolan colobus  ---ggaag
B D  Golden snub-nosed monkey  ---ggaag
      Black snub-nosed monkey  ---ggaag
B D                  Marmoset  ---ggaa-
B D           Squirrel monkey  ---ggaa-
          White-faced sapajou  ---ggaa-
B D                  Bushbaby  ---ggcg-
B D                     Mouse  ---ggcag
B D                       Dog  ---ggtag
B D                 Armadillo  cgagg---
             Sclater's lemur  ========
                 Black lemur  ========
                 Mouse lemur  ========
           Coquerel's sifaka  ========
           Ma's night monkey  ========
B D                   Tarsier  --------

Alignment block 21 of 31 in window, 100197098 - 100197205, 108 bps 
B D                     Human  gatttcagcaggtgcataggag---aag---ctgcatctcagacagagcgag-cacgttgggcaaacaaa
B D                     Chimp  gatttcagcaggtgcataggag---aaa---ctgcatctcagacagagcgag-cacgttgggcaaacaaa
B D                    Bonobo  gatttcagcaggtgcataggag---aaa---ctgcatctcagacagagcgag-cacgttgggcaaacaaa
B D                   Gorilla  gatttcagcaggtgcctaggag---aaa---ctgcatctcagacagagcgag-caggttgggcaaacaca
B D                 Orangutan  gatttcaccaggtgcctaggag---aaa---cggcatttcagacagagcgag-caggtcacgcaaacaca
B D                    Gibbon  gatttcaccaggtgcctaggag---aaa---ctgcatttcagacagagcgag-caggtcgggcaaacaca
B D                    Rhesus  gatttcaccaggtgcccaggag---aaa---ctgcatttcagacagagcgag-caggtcaggcaaacaca
B D       Crab-eating macaque  gatttcaccaggtgcccaggag---aaa---ctgcatttcagacagagcgag-caggtcaggcaaacaca
           Pig-tailed macaque  gatttcaccaggtgcccaggag---aaa---ctgcatttcagacagagcgag-caggtcaggcaaacaca
               Sooty mangabey  gatttcaccaggtgcctaggag---aaa---ctgcatttcagacagagcgag-caggtcaggcaaacaca
                       Baboon  gatttcaccaggtgcctaggag---aaa---ctgcatttcagacagagcgag-caggtcaggcaaacaca
B D              Green monkey  ggtttcaccagg-gcctaggag---aaa---ctgcatttcagacagagcgag-caggtcaggcaaacaca
                        Drill  gatttcaccaggtgcctaggag---aaa---ctgcatttcagacagagcgag-caggtcaggcaaacaca
B D          Proboscis monkey  gatttcaccaggtgcctaggag---aaa---ctgcatttcagacagggcgag-caggtcgggcaaacaca
              Angolan colobus  gatttcaccaggtgcctagaag---aaa---ctgcatttcagacagagcgag-caggtcgggcaaacaca
B D  Golden snub-nosed monkey  gatttcaccaggtgcctaggag---aaa---ctgcatttcagacagggtgag-caggtcgggcaaacaca
      Black snub-nosed monkey  gatttcaccaggtgcctaggag---aaa---ctgcatttcagacagggcgag-caggtcgggcaaacaca
B D                  Marmoset  gatttcactgggcacttaggag---aaa---gtgcatttcagacagagtgag-caggtccggcaaacaca
B D           Squirrel monkey  gatttcatcgggtacttaggag---aaa---gtgcatttcagacagagtgag-caggtcaggcaaacaca
          White-faced sapajou  gatttcactgggcacttagcag---aaa---gtgcgtttcagacagagtgac-caggttaggcaaacaca
            Ma's night monkey  gactgcaccgcccacttaggtg---aaa---gtgcatttcagacagagtgag-caggtcgggcaaacaca
B D                   Tarsier  gattttgccaggtaccacagag---aaa---ctgcatttcagacagaatgag-cccgtcaagcaaagaca
B D                  Bushbaby  gatttttccaggcacctagaag---aaa---ctgcatttcaaacagag------------------gaca
B D                     Mouse  gatttcactaggtccctacaaa---acat-gcatcatttcaa--agaataaa-caagtcaagtaatagcg
B D                       Dog  gatcctgccagatggtgaggagaataaa---ctgtatctc----agagcaag-caggtagagcaaagaca
B D                 Armadillo  ---ctcttccgggggctgggag---gaagagctgcatttcagcccaagagagccaggtcggatgaagaca
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================
                 Mouse lemur  ======================================================================
           Coquerel's sifaka  ======================================================================

                        Human  gaagggcagaagagctta-gtg-cgtgttttgggaacagtgaggaac
                        Chimp  gaagggcagaagagctta-gtg-cgtgttttgggaacagtgaggaac
                       Bonobo  gaagggcagaagagctta-gtg-cgtgttttgggaacagtgaggaac
                      Gorilla  gaagggcagaagagctta-gtg-cgtgttttgggaacagtgaggaac
                    Orangutan  gaagggcagaagagctta-gtg-cgtgttttggggacagtgaggaac
                       Gibbon  gaagggcagaagagctta-gtg-cgtgttttgagaacagtgaggaac
                       Rhesus  gaagggcagaagagctta-gtg-tgtgttttgggaacagtgaggaac
          Crab-eating macaque  gaagggcagaagagctta-gtg-tgtgttttgggaacagtgaggaac
           Pig-tailed macaque  gaagggcagaagagctta-gtg-tgtgttttgggaacagtgaggaac
               Sooty mangabey  gaagggcagaagagctta-gta-tgtgttttgggaacagtgaggaac
                       Baboon  gaagggcagaagagctta-gtg-tgtgttttgggaacagtgaggaac
                 Green monkey  gaagggcagaagagctta-gtg-tgtgttttgggaacagtgaggaac
                        Drill  gaagggcagaagagctta-gtg-tgtgttttgggaacagtgaggaac
             Proboscis monkey  gaagggcagaagagctta-gtg-tgtgttttgggaacagtgaggaac
              Angolan colobus  gaagggcagaagagctta-gtg-tgtgttttgggaacagtgaggaac
     Golden snub-nosed monkey  gaagggcagaagagctta-gtg-tgtgttttgggaacagtgaggaac
      Black snub-nosed monkey  gaagggcagaagagctta-gtg-tgtgttttgggaacagtgaggaac
                     Marmoset  gaaggtcagaagagcgtctgtg-cgtgttttgagaacagtgaggaac
              Squirrel monkey  gaagggcagaagagcctctgtg-cgtgttttgagaacagtgaggaac
          White-faced sapajou  gaggggcagaagagcttctgcg-cgtgttttgagaacagtgaggagc
            Ma's night monkey  gaagggcagaagagcttctgtg-catgttttgagaacagtgaggaac
                      Tarsier  gaaaggcagataagcgta-gtgttacgctttaggaagactgagaact
                     Bushbaby  aagagtcagaagag-tta-gta-tgtatttcagaaacactgaggaag
                        Mouse  gaaaggcagaatgggtta-tag-catgtcttagaagcaaagaggaaa
                          Dog  gagaggcagaagagttta-caa-catgtttcaggagcagtgaggaac
                    Armadillo  gg-----------------ctg-cgtgtttcaaggcaaggaaggagc
              Sclater's lemur  ===============================================
                  Black lemur  ===============================================
                  Mouse lemur  ===============================================
            Coquerel's sifaka  ===============================================

Inserts between block 21 and 22 in window
B D                  Tarsier 16bp
B D                 Bushbaby 16bp
B D                    Mouse 21bp
B D                      Dog 17bp
B D                Armadillo 17bp

Alignment block 22 of 31 in window, 100197206 - 100197276, 71 bps 
B D                     Human  c----agtgagggtgtatagtagacaata-------agtcactgtttgttgaataa----gtttaaagga
B D                     Chimp  c----agtgagggtgtatagtagacaata-------agtcactatttgttgaataa----gtttaaagga
B D                    Bonobo  c----agtgagggtgtatagtagacaata-------agtcactatttgttgaataa----gtttaaagga
B D                   Gorilla  c----agtgagggtgtatagtagaaaata-------agtcactatttgttgaataa----gtttaaagga
B D                 Orangutan  c----agtgagggtgtgtagcagacaata-------agtcagtatttgttgaataa----gtttaaagga
B D                    Gibbon  c----agtgagggtgtatggtagacaata-------agtcaatatttgttgaatta----gtttaaagga
B D                    Rhesus  c----agtgagggtgtatagtagacaata-------aatcaatatttgttgaataa----gtttaaagga
B D       Crab-eating macaque  c----agtgagggtgtatagtagacaata-------aatcaatatttgttgaataa----gtttaaagga
           Pig-tailed macaque  c----agtgagggtgtatagtagacaata-------aatcaatatttgttgaataa----gtttaaagga
               Sooty mangabey  c----agtgagggtatatagtagacaata-------aatcaatatttgttgaataa----gtttaaagga
                       Baboon  c----agtgagggtatatagtagacaata-------aatcaatatttgttgaataa----gtttaaagga
B D              Green monkey  c----agtgagggtgtatagtagacaata-------aatcaatatttgttgaataa----gtttaaagga
                        Drill  c----agtgagggtgtatagtagacaata-------aatcaatatttgttgaataa----gtttaaagga
B D          Proboscis monkey  c----agtgagggtgtatagtagacaata-------aatcaatatttgttgaataa----gtttaaagga
              Angolan colobus  c----agtgagggtgtatagtagacaata-------aatcaatacttgttgaataa----gtttaaaggc
B D  Golden snub-nosed monkey  c----agtgagggtgtatagtagacaata-------aatcaatatttgttgaataa----gtttaaagga
      Black snub-nosed monkey  c----agtgagggtgtatagtagataata-------aatcaatatttgttgaataa----gtttaaagga
B D                  Marmoset  c----agtgagggtatatagtagatggtg-------agtcaacatttgttgaataa----gtttaaagga
B D           Squirrel monkey  c----agtgggggtgtacagtagacagta-------agtcaacatttgttaaatgt----gtttatagga
          White-faced sapajou  c----agtgagggtgtccagtagatggta-------agtcaacatttgttgaataa----gtttaaagga
            Ma's night monkey  cagtgagtgagggtg-atagtagacggta-------agtcaacatttgttgaataa----gtttaaagga
B D                   Tarsier  c----agtgagggggcacaggagacaata-------agtcagtattt-ttgtataa----atttaagagg
            Coquerel's sifaka  c----agtgagggtgcatagtagacaaca-------agtcaatatgtgttgaataa----atttaaagga
                  Black lemur  c----agtgagggtgcacagtagacaaca-------agtcaatatgtgttggataa----atttaaaggg
              Sclater's lemur  c----agtgagggtgcatagtagacaaca-------agtcaatatgtgttggataa----atttaaaggg
B D                  Bushbaby  c----ggagaggacgtacagcagacaaga-------agtcaatatttgttgaataa----atttaaagga
B D                     Mouse  c----agtgaagatttgtagtacacaaaa-------ggtcaatactagatgagtaa----cttgaagaga
B D                       Dog  c----agtgaaggcacatagtacacaata-------agtcaatattt-ttgaatagttgtttttttttta
B D                 Armadillo  c----agtgcaggcacacggtagaaaacaagagacgagtccatattcattgcctaa----gtttaaagga
                 Mouse lemur  ======================================================================

                        Human  aagcagcaga----ggcctc
                        Chimp  aagcagcaga----ggcctc
                       Bonobo  aagcagcaga----ggcctc
                      Gorilla  aagcagcaga----ggcctc
                    Orangutan  aagcagcaga----ggcctc
                       Gibbon  aagcagcaga----ggcctc
                       Rhesus  aagcagcaga----ggcctc
          Crab-eating macaque  aagcagcaga----agcctc
           Pig-tailed macaque  aagcagcaga----ggcctc
               Sooty mangabey  aagcagcaga----ggcctc
                       Baboon  aagcagcaga----ggcctc
                 Green monkey  aagcagcaga----ggcctc
                        Drill  aagcagcaga----ggcctc
             Proboscis monkey  aagcagcaga----ggcctc
              Angolan colobus  aagcagcaga----ggcctc
     Golden snub-nosed monkey  aagcagcaga----ggcctc
      Black snub-nosed monkey  aagcagcaga----ggcctc
                     Marmoset  aagcagcaga----ggcctc
              Squirrel monkey  aagcagcaga-----gcctc
          White-faced sapajou  aagcagcaga----ggcctc
            Ma's night monkey  aggcagcaga----ggcctc
                      Tarsier  aaacaacagagagaggcctc
            Coquerel's sifaka  aggcagcaga----ggcctt
                  Black lemur  aggcagcaga----ggcctc
              Sclater's lemur  aggcagcaga----ggcctc
                     Bushbaby  aggcagcaga----gtcctc
                        Mouse  aagtagcagc----agcaac
                          Dog  aagcagcaga----gacctt
                    Armadillo  aagcagcagg----ggtctc
                  Mouse lemur  ====================

Inserts between block 22 and 23 in window
           Coquerel's sifaka 6bp
                 Black lemur 6bp
             Sclater's lemur 6bp
B D                 Bushbaby 6bp
B D                    Mouse 6bp
B D                      Dog 6bp
B D                Armadillo 6bp

Alignment block 23 of 31 in window, 100197277 - 100197513, 237 bps 
B D                     Human  aaaggcactgatttcggagctataaaa---tttg-atttgtattttgagtacagcagggattcacatgat
B D                     Chimp  caaggcactgatttcggagctataaaaaaatttg-atttgtattttgagtacagcagggattcacatgat
B D                    Bonobo  caaggcactgatttcagagctataaaaaaatttg-atttgtattttgagtacagcagggattcacatgat
B D                   Gorilla  caaggcactgatttcagagctataaaa---tttg-atttgtattttgagtacagcagggattcacatgat
B D                 Orangutan  aaaggcactgatttctgagctataaaa---tttg-atttgtattttgagtacagcagggattcacatgat
B D                    Gibbon  aaaggcactgatttctgagctataaaa---tttg-atttgtattttgagtacagcagggattcacatgat
B D                    Rhesus  aaaggcactgatttctgagctgtaaaa---tttg-atttgtattttgagcacaacagggattcacatgat
B D       Crab-eating macaque  aaaggcactgatttctgagctgtaaaa---tttg-atttgtattttgagcacaacagggattcacatgat
           Pig-tailed macaque  aaaggcactgatttctgagctgtaaaa---tttg-atttgtattttgagcacaacagggattcacatgat
               Sooty mangabey  aaaggcactgatttctgagctgtaaag---tttg-atttgtattttgagcacaacagggattcacatgat
                       Baboon  aaaggcactgatttctgagctgtaaag---tttg-atttgtattttgagcacaacagggattcacatgat
B D              Green monkey  aaaggcactgatttctgagctgtaaaa---tttg-atttgtattttgagcacaacagggattcacatgat
                        Drill  aaaggcactgatttctgagctgtaaaa---tttg-atttgtattttgagcacaacagggattcacatgat
B D          Proboscis monkey  aaaggcactgatttctgagctgtaaaa---tttg-atttgtattttgagcacaacagggattcacatgat
              Angolan colobus  aaaggcactgatttctgagctgtaaaa---tttg-atttgtattttgagcacaacagagattcacatgat
B D  Golden snub-nosed monkey  aaaggcactgatttctgagctgtaaaa---tttg-atttgtattttgagcacaacagggattcacatgat
      Black snub-nosed monkey  aaaggcactgatttctgagctgtaaaa---tttg-atttgtattttgagcacaacagggattcacatgat
B D                  Marmoset  aaaggcactgatttctgagctgtaaaa---tttg-agttgtattttgagtgcagcagggattcacatgag
B D           Squirrel monkey  aaaggcactgatttatgagctgtaaaa---tttg-agttgtgttttgagtgcagcagggattcacatgag
          White-faced sapajou  aaaggcactgatttctgagctgtaaaa---tttg-agttgaattttgagtgcagcagggattcacatgaa
            Ma's night monkey  aaaggcactgatttctgagctgtaaaa---ttcg-agttgtattttgagtgcagcagggattcacatgag
B D                   Tarsier  gaaggccctgatttccgagctgtaaaa---tttg-agttttattttgagtgccgcagaaatccacatgat
                  Mouse lemur  aaagacactgatttctgagctatagaa---tttg-agttgtcttttgagtgcagcaggtctccatgtgat
            Coquerel's sifaka  aaagacactgatttctgagctgtagaa---tttg-agttgtcctttgagtgtagcaggtctccatgtgat
                  Black lemur  aaagacactgatttccgagcggtagaa---ttta-agttgtattttgagtgcagcaagtctccatgtgat
              Sclater's lemur  aaagacactgatttccgagcggtagaa---ttta-agttgtattttgagtgcagcaagtctccatgtgat
B D                  Bushbaby  aaagacactgatttcttagctgtagga---tctg-agttgtattttgagcgcag-aggaatccatgtggt
B D                     Mouse  tgaagtattgcttcttaagctctacaa---actgtagttgtatactgaatgtgagtgagaatcatgtggc
B D                       Dog  aaagacactgattttcaagccatggaa---ctga-ggttgtatttggaatgtagcagag-cccatgtgat
B D                 Armadillo  aaaggtacccatttccaagctacggaa---tttg-ggttgtaggttgaatgtagcagggag-ctcgtgat

                        Human  tcagatttg-tttttaggaagataattctgacagctgtgtggagcagg----gattggctag-ttt---g
                        Chimp  tcagatttg-tttttaggaagataattctgacagctgtgtggagcagg----gattgactag-ttt---g
                       Bonobo  tcagatttg-tttttaggaagataattctgacagctgtgtggagcagg----gattgactag-ttt---g
                      Gorilla  tcagatttg-tttttaggaagataattctgacagctgtgtggagcagg----gattgactag-ttt---g
                    Orangutan  tcagatttg-tttttaggaagataattctgacagctgtgtggagcagggattgattgactag-ttt---g
                       Gibbon  tcagatttg-tttttaggaagataattctgacagctgtgtggagcagg----gattgactag-ttt---g
                       Rhesus  tcagatttg-tctttaggaagataattctgacagctgtgtggagcagg----ggttgactag-ttt---g
          Crab-eating macaque  tcagatttg-tctttaggaagataattctgacagctgtgtggagcagg----ggttgactag-ttt---g
           Pig-tailed macaque  tcagatttg-tctttaggaagataattctgacagctgtgtggagcagg----ggttgactag-ttt---g
               Sooty mangabey  tcagatttg-tctttaggaagataattctgacagctgtgtggagcagg----ggttgactag-ttt---g
                       Baboon  tcagatttg-tctttaggaagataattctgacagctgtgtggagcagg----ggttgactag-ttt---g
                 Green monkey  tcagatttg-tctttagaaagataattctgacagctgtgtggagcagg----ggttgactag-ttt---g
                        Drill  tcagatttg-tctttaggaagataattctgacagctgtgtggagcagg----ggttgactag-ttt---g
             Proboscis monkey  tcagatttg-tctttaggaagataattctgacagctgtgtggagcagg----ggttgactag-ttt---g
              Angolan colobus  tcagatttg-tctttaggaagataattctgacagctgtgtggagcagg----ggttgactag-ttt---g
     Golden snub-nosed monkey  tcagatttg-tctttaggaagataattctgacagctgtgtggagcagg----ggttgactag-ttt---g
      Black snub-nosed monkey  tcagatttg-tctttaggaagataattctgacagctgtgtggagcagg----ggttgactag-ttt---g
                     Marmoset  tcagatttgttttttaggaagataattctgacagctgtgtggagcagg----gattgaatag-ttt---g
              Squirrel monkey  tcagatttggtttttaggaagataattctgatagctgtgtggagcagg----gattgaatag-ttt---g
          White-faced sapajou  tcagatttgttttttaggaagataattctgatagctgtgtagaacagg----gattgaataacttt---g
            Ma's night monkey  tcagatttgttttttaggaagataattctgacagctgtgtggagcagg----gattgaatgg-ttt---g
                      Tarsier  tcagatttgtttttcagggagataattctgacagctgtgtggaccagg----gagtgaatcg-ttt---c
                  Mouse lemur  tcagatttgcttctaaggaagataattctggcagctgcgtagagcaga----gattgaatag-ctaatag
            Coquerel's sifaka  tcagatttgcttcttagaaagataattctgacagctgcgtagagcaga----gattgaatag-ttaatag
                  Black lemur  tcagatttgcttctaaggaagataattctgacagctgcatagagcaga----gattgaatag-ttaacag
              Sclater's lemur  tcagatttgcttctaaggaagataattctgacagctgcatagagcaga----gattgaatag-ttaacag
                     Bushbaby  tcagatttgctccttaggcagagaattctgacagctgtgcagagcaga----gattggaaag-tttacag
                        Mouse  tcagatttg-gtttggggaaagacaatcttctaccagtgtagagcagt----gactgagtag-ttg---t
                          Dog  tcagatttgttttttaggaagacaatttagacagct---------------------------tat---g
                    Armadillo  tcagattgctgtgtcaggaagatgatactgatagctgcatggagcgaa----gattgcatcg-ttt---g

                        Human  tggattttacattcagtgtagacctgttaagtagaggt--tataataaggagat-aatcgttg--taagt
                        Chimp  tggattttacattcagtgtagacctgttaagtagaggt--tataataaggagat-aatcgttg--taagt
                       Bonobo  tggattttacattcagtgtagacctgttaagtagaggt--tataataaggagat-aatcgttg--taagt
                      Gorilla  tggattttacattcagtgtagacctgttaagtagaggt--tatcataaggagat-aatcattg--taagt
                    Orangutan  tgggttttacattcagtgtagacctgttaagtagaggt--tataataaggagat-aatcattg--taagt
                       Gibbon  tggacttgacattcagtgtagacctgttaagtaaaggt--tattataaggagat-aatcattg--taagt
                       Rhesus  tggattttacattcagtgtagacctgttaagtacaggt--tataataaggagat-aatcatta--taagt
          Crab-eating macaque  tggattttacattcagtgtagacctgttaagtacaggt--tataataaggagat-aatcattg--taagt
           Pig-tailed macaque  tggattttacattcagtgtagacctgttaagtacaggt--tataataaggagat-aatcattg--taagt
               Sooty mangabey  tggattttacattcagtgtagacctgttaagtagaggt--tataataaggagat-aatcattg--taagt
                       Baboon  tggattttacattcagtgtagacctgttaagtagaggt--tataataaggagat-aatcattg--taagt
                 Green monkey  tggattttacattcagtgtagacctgttaagtagaggt--tataataaggagat-aatcattg--taagt
                        Drill  tagattttacattcaatgtagacctgttaagtacaggt--tataataaggagat-aatcattg--taagt
             Proboscis monkey  tggattttacattcagtgtagacctgttaagtagaggt--tataataaggagat-aatcattg--taagt
              Angolan colobus  tggattttacattcagcgtagacctgttaagtagaggt--tataataaggagat-aatcattg--taagt
     Golden snub-nosed monkey  tggattttacattcagtgtagacctgttaagtagaggt--tataataaagagat-aatcattg--taagt
      Black snub-nosed monkey  tggattttacattcagtgtagacctgttaagtagaggt--tataataaagagat-aatcattg--taagt
                     Marmoset  tggattttacattctgtgtagacccattaagcagaggg--tataataaggtgat-agccattg--taggt
              Squirrel monkey  tggattttacattctgtgtggacccattaagcagaggg--tataataaggtgat-agccattg--taagt
          White-faced sapajou  tggattttacattctgtgtagacccattaagcagaggg--cataataaggtgat-agccattgtttaagt
            Ma's night monkey  tggattttacattctgtgtagacccattaagcaaagggtatataataaggtgat-agccattg--taagt
                      Tarsier  tagattttacattcagcgtagactggttaagcaaaggt--tacaat---gagac-agccatta--taagc
                  Mouse lemur  tggattttacattcaatctagattggttaagcagaggt--tacagtaaagaaacaagtcatta--taagc
            Coquerel's sifaka  tggattttatattcagtctagattggttaagcacaggt--tatagtaaagagac-agccatta--taagc
                  Black lemur  tggattttacattcagtctagattggttaagcagaggt--tacagtaaagagac-agccatta--taagc
              Sclater's lemur  tggattttacattcagtctagattggttaagcagaggt--tacagtaaagagac-agccatta--taagc
                     Bushbaby  tggattttacatgtggtctagattcattaagcagaggt--tacagtatag-----agccatta--tgagt
                        Mouse  taa---ttatatccaattcagactggccgtataaaagt--tacatagaagaaac-ag-----a--caagg
                          Dog  -----------ttcattctagactgctt---------t--agcaatgaagggtt-gaccatta--aaagc
                    Armadillo  tggattttactctccttctagatggctt----agaagt--tacagggaagagtc-gattttca--taagc

                        Human  gttgacc---ttaaataaccatcctgtaaccaaataaaagcatttact
                        Chimp  gttgacc---ttaaataaccatcctgtaaccaaataaaagcatttact
                       Bonobo  gttgacc---ttaaataaccatcctgtaaccaaataaaagcatttact
                      Gorilla  gttgacc---ttaaataaccatcctgtaaccaaataaaagcatttact
                    Orangutan  gttgacc---ttaaataaccatcctgtaaccaaataaaagcatttact
                       Gibbon  gttgacc---ttaaataaccaacctggaaccaaataaaagcatttact
                       Rhesus  gttgacc---ttaaataaccatcctgtaactaaataaaagcatttact
          Crab-eating macaque  gttgacc---ttaaataaccatcctgtaactaaataaaagcatttact
           Pig-tailed macaque  gttgacc---ttaaataaccatcctgtaactaaataaaagcatttact
               Sooty mangabey  gttgacc---ttaaataaccatcctgtaactaaataaaagcatttact
                       Baboon  gttgacc---ttaaataaccatcctgtaactaaataaaagcatttact
                 Green monkey  gttgacc---ttaaataaccatcctgtaactaaataaaagcatttact
                        Drill  ggtgacc---ttaaataaccatcctgaaactaaataaaataatttact
             Proboscis monkey  gttgact---ttaaataaccatcctctaactaaataaaagcatttact
              Angolan colobus  gttgact---ttaaataaccatcctctaactaaatcaaagcatttact
     Golden snub-nosed monkey  gttgact---ttaaataaccatcctctaactaaataaaagcatttact
      Black snub-nosed monkey  gttgact---ttaaataaccatcctctaactaaataaaagcatttact
                     Marmoset  gttggcc---ttaaataaccatcttgttatcaaataaaagtgtttact
              Squirrel monkey  gttgacc---ttaaataaccatcttgttatcaaataaaagtatttact
          White-faced sapajou  gttgacc---ttaaataaccatcttgttatcaaataaaagtaaatact
            Ma's night monkey  gttgacctttttaaataaccatcttgttatcaaataaaagtgtttact
                      Tarsier  ttcaacc---tt-cataaccaggcttttatcaaatacaatcatttatg
                  Mouse lemur  tttgacc---ttaaataaccgtcctgttatcaaataaaagctcttagg
            Coquerel's sifaka  tttgacc---ttaaataaccatcctgttatcaaataaaaccacttacg
                  Black lemur  tttgacc---ttaaataaccatcctgttatcaaacaaaagcacttaca
              Sclater's lemur  tttgacc---ttaaataaccatcctgttatcaaacaaaagcacttaca
                     Bushbaby  tttgacc---ttaaatcaccatcctgttatcaaataagaacactga--
                        Mouse  attgtct---acagataaccatgttcctgtcaaataaaaatattgaca
                          Dog  tttggtg---ttaaataaccatcttattatcaaataag-gcatttgca
                    Armadillo  tttagcc---ttaaataaccatgcagttatcaaataaaagcatttacg

Alignment block 24 of 31 in window, 100197514 - 100197527, 14 bps 
B D                     Human  ----------------atggtgtcctgact
B D                     Chimp  ----------------atggtgtcctgact
B D                    Bonobo  ----------------atggtgtcctgact
B D                   Gorilla  ----------------atggtgtcctgaca
B D                 Orangutan  ----------------atggtgtgctgaca
B D                    Gibbon  ----------------atggtgtcctgaca
B D                    Rhesus  ----------------attgtgtcctgaca
B D       Crab-eating macaque  ----------------attgtgtcttgaca
           Pig-tailed macaque  ----------------attgtgtcttgaca
               Sooty mangabey  ----------------attgtgtcttgaca
                       Baboon  ----------------attgtgtcttgaca
B D              Green monkey  ----------------attgtgtcttgaca
                        Drill  ----------------attgtgtcttgaca
B D          Proboscis monkey  ----------------attgtgtcttgaca
              Angolan colobus  ----------------attgtgtcttgaca
B D  Golden snub-nosed monkey  ----------------attgtgtcttgaca
      Black snub-nosed monkey  ----------------attgtgtcttgaca
B D                  Marmoset  ------------------attatcttgaca
          White-faced sapajou  ------------------attatcttaaca
            Ma's night monkey  ------------------attatcttgaca
B D                   Tarsier  ----------------cttgtgttttgaca
                  Mouse lemur  ----------------attgtgt-ttgacg
            Coquerel's sifaka  ----------------attgtgt-ttgaca
                  Black lemur  ----------------attgtgt-ttgaca
              Sclater's lemur  ----------------attgtgt-ttgaca
B D                     Mouse  ------------------gttactgagaca
B D                       Dog  ----------------gttgtgt-ttgaca
B D                 Armadillo  gttgtggttttttaaaattattttttgaat
B D           Squirrel monkey  ------------------------------
B D                  Bushbaby  ------------------------------

Inserts between block 24 and 25 in window
B D                Armadillo 163bp

Alignment block 25 of 31 in window, 100197528 - 100197641, 114 bps 
B D                     Human  tga----gagtttatgttg-------------------gtc-----------------------------
B D                     Chimp  tga----gagtttatgttg-------------------gtc-----------------------------
B D                    Bonobo  tga----gagtttatgttg-------------------gtc-----------------------------
B D                   Gorilla  tga----gagtttatgttg-------------------gtc-----------------------------
B D                 Orangutan  tga----gagtttatgttg-------------------atc-----------------------------
B D                    Gibbon  tga----gagtttatgttg-------------------gtc-----------------------------
B D                    Rhesus  tga----gagtttatgctg-------------------gtc-----------------------------
B D       Crab-eating macaque  tga----gagtttatgctg-------------------gtc-----------------------------
           Pig-tailed macaque  tga----gagtttatgctg-------------------gtc-----------------------------
               Sooty mangabey  tga----gagtttatgctg-------------------gtc-----------------------------
                       Baboon  tga----gagtttatgctg-------------------gtc-----------------------------
B D              Green monkey  tga----gagtttatgctg-------------------gtc-----------------------------
                        Drill  tga----gagtttatgctg-------------------gtc-----------------------------
B D          Proboscis monkey  tga----gagtttatgctg-------------------gtc-----------------------------
              Angolan colobus  tga----gagtttatgctg-------------------gtc-----------------------------
B D  Golden snub-nosed monkey  tga----gagtttatgctg-------------------gtc-----------------------------
      Black snub-nosed monkey  tga----gagtttatgctg-------------------gtc-----------------------------
B D                  Marmoset  tga--------ttgtgttg-------------------gtc-----------------------------
          White-faced sapajou  tga----ttgtttgtgttg-------------------atc-----------------------------
            Ma's night monkey  tgattgtttgtttgtggtg-------------------gtc-----------------------------
B D                   Tarsier  caa----tgttggatgttg-------------------acc-----------------------------
                  Mouse lemur  caa----ttgtttatgttg-------------------atc-----------------------------
            Coquerel's sifaka  caa----ttgtttatgttg-------------------gtc-----------------------------
                  Black lemur  caa----ttgtttatgttg-------------------gtc-----------------------------
              Sclater's lemur  caa----ttgtttatgttg-------------------gtc-----------------------------
B D                  Bushbaby  caa----ttgtttgtgttg-------------------gtc-----------------------------
B D                     Mouse  tgg-------ttcccatta-------------------gtc-----------------------------
B D                       Dog  tg-----ttgtttataatg-------------------gtc-----------------------------
B D                 Armadillo  tta----gagtttacgttgtagtttacactctctcccagtccattctgtacagttgtgttttgacacaac
B D           Squirrel monkey  ----------------------------------------------------------------------

                        Human  --------------agaggtctacaagaacctctgattcctctcaggatatctgaatagcatctgagcta
                        Chimp  --------------agaggtctacaagaacctctgattcctctcaggatatctgaatagcatctgagcta
                       Bonobo  --------------agaggtctacaagaacctctgattcctctcaggatatctgaatagcatctgagcta
                      Gorilla  --------------agaggtctacaagaacctctgattcctctcaggatatctgaatagcatctgagcta
                    Orangutan  --------------agaggtctgcaagaacctctgattcctctcaggatatctgaatagcatctgagcta
                       Gibbon  --------------agaggtctacaagaacctctgattcctctcaggatatctgaatagcatctgagcta
                       Rhesus  --------------agaggtctacaagaacctctgattcctctcgggatgtctgaatagcatctgagcta
          Crab-eating macaque  --------------agaggtctacaagaacctctgattcctctcgggatgtctgaatagcatctgagcta
           Pig-tailed macaque  --------------agaggtctacaagaacctctgattcctctcgggatgtctgaatagcatctgagcta
               Sooty mangabey  --------------agaggtctacaagaacctctgattcctctcgggatgtctgaatagcatctgagcta
                       Baboon  --------------agaggtctacaagaacctctgattcctctcgggatgtctgaatagcatctgagcta
                 Green monkey  --------------agaggtctacaagaacctctgattcctctcggggtgtctgaatagcatctgagcta
                        Drill  --------------agaggtctacaagaacctctgattcctctcgggatgtctgaatagcatctgagcta
             Proboscis monkey  --------------agaggtctacaagaacctctgattcctctcgggatgtctgaatagcatctgagcta
              Angolan colobus  --------------agaggtctacaagaacctctgattcctctcgggatgtctgaatagcatctgagcta
     Golden snub-nosed monkey  --------------agaggtctacaagaacctctgattcctctcgggatgtctgaatagcatctgagcta
      Black snub-nosed monkey  --------------agaggtctacaagaacctctgattcctctcgggatgtctgaatagcatctgagcta
                     Marmoset  --------------agaggtctacaagaacctctggttcctctcaggatatccgaatagcatc-------
          White-faced sapajou  --------------agaggtctacaagaacctcttgttcctctcaggatatccgaatagcatc-------
            Ma's night monkey  --------------agaggtctacaagaacctcttattcctctcaggatatccaaatagcatc-------
                      Tarsier  --------------agaggtctgcaggaatccctttttcccctcagaatgtcc-actagtagcta----a
                  Mouse lemur  --------------agaggtctgcaagaacctcttattcctctcaggatgtctcaatagcacc-------
            Coquerel's sifaka  --------------agaggtctgccagaaccccttattcctcccaggatgtctcaatagcacc-------
                  Black lemur  --------------agaggtctgcaagaacctcttattcctctcaggatgtctcagtagcacc-------
              Sclater's lemur  --------------agaggtctgcaagaacctcttattcctctcaggatgtctcagtagcacc-------
                     Bushbaby  --------------agaggtctgcaagagcctcctattcttctcaggatgtctcaggagcacc-------
                        Mouse  --------------agcagtctccagaaatctcta----ctctcaggctgtttgaactgcatctg-----
                          Dog  --------------aggagtctgcaaga-cctcttaatcct-ttaggctgtctggacagcacc-------
                    Armadillo  cgtttctggcgacgggaggtctacggga-cctctc-ctgctctcagggtgcctgagcagcacc-------
              Squirrel monkey  ----------------------------------------------------------------------

                        Human  ttgagcattgccatgtggccccagagccacagtcttaatg
                        Chimp  ttgagcattgccatgtggccccagagccacagtcttaatg
                       Bonobo  ttgagcattgccatgtggccccagagccacagtcttaatg
                      Gorilla  ttgagcattgccatgtggccccagagccacagtcttaatg
                    Orangutan  ttgagcattgtcatgtggccccagagccacagtcttaatg
                       Gibbon  ttgagcattgccatgtggccccagagcccccgtaggaatg
                       Rhesus  ttgagcattgccatgtggccccagagccacagtcttcatg
          Crab-eating macaque  ttgagcattgccatgtggccccagagccacagtcttcatg
           Pig-tailed macaque  ttgagcattgccatgtggccccagagccacagtcttcatg
               Sooty mangabey  ttgagcattgccatgtggccccagagccacagtcttcatg
                       Baboon  ttgagcattgccatgtggccccagagccacagtcttcatg
                 Green monkey  ttgagcattgccatgtggccccagagccacagtcttcatg
                        Drill  ttgagcattgccatgtggccccagagccacagtcttcatg
             Proboscis monkey  ttgagcattgtcatgtggccccagagccacagtcttactg
              Angolan colobus  ttgagcattgccatgtggccccagagccacagtcttaatg
     Golden snub-nosed monkey  ttgagcattgtcatgtggccccagagccacagtcttaatg
      Black snub-nosed monkey  ttgagcattgtcatgtggccccagagccacagtcttaatg
                     Marmoset  -tgagcattgccatgtggccccagagccacagtcttaatg
          White-faced sapajou  -tgagcattgccttgtggccccagagccacagtcttaatg
            Ma's night monkey  -tgagcattgccatgcggccc-----------tcttaatg
                      Tarsier  ctaagcattgcactgtggccccaaagtcacagtctccatg
                  Mouse lemur  -tgagcattgcaagggggccccaaa-ccacagtcttaatg
            Coquerel's sifaka  -tgagcat------gagaccccaaa-ccacagtcttaatg
                  Black lemur  -taagcattgccatgagacctgaaa-ccacagtcttaatg
              Sclater's lemur  -taagcattgccatgagacctgaaa-ccacagtcttaatg
                     Bushbaby  -tgaaccctgtctcccgaccc-aaa-cctcagtc--gat-
                        Mouse  ----tcactgtcatatgagtccagagttttagtccccatg
                          Dog  -tgaacatggtcaggtagccccaaagctgcagtcttaaaa
                    Armadillo  -tgcgcatctccagaccactcggaagccctggtgccagtg
              Squirrel monkey  ----------------------------------------

Inserts between block 25 and 26 in window
B D                    Mouse 6595bp
B D                      Dog 1bp

Alignment block 26 of 31 in window, 100197642 - 100197769, 128 bps 
B D                     Human  gaggactgtgctgagccactgttttccagtgacttgaagtcctctaattattcaaataggatataagaaa
B D                     Chimp  gaggactgtgctgagccactgttttccagtgacttgaagtcctctaactattcaaataggatataagaaa
B D                    Bonobo  gaggactgtgctgagccactgttttccagtgacttgaagtcctctaactattcaaataggatataagaaa
B D                   Gorilla  gaggactgtgctgagccactgttttccagtgacttgaaatcctctaattattcgtataggatataagaaa
B D                 Orangutan  gaggactgtggtgagccactgttttccagtgacttgaaatcctctaattattcatataggatataagaaa
B D                    Gibbon  gaaggctatggtgagccactgttttccaatgacttgaaatcctctaattattcatataggatataagaaa
B D                    Rhesus  gaggactgtggtgagccactgttttccagtgacttgaaatcctctaattattcatataggagataagaaa
B D       Crab-eating macaque  gaggactgtggtgagccactgttttccagtgacttgaaatcctctaattattcatataggagataagaaa
           Pig-tailed macaque  gaggactgtggtgagccactgttttccagtgacttgaaatcctctaattattcatataggagataagaaa
               Sooty mangabey  gaggactgtggtgagccactgttttccagtgacttgaaatcctctaattattcatataggatataagaaa
                       Baboon  gaggactgtggtgagccactgttttccagtgacttgaaatcctctaattattcatatagaatataagaaa
B D              Green monkey  gaggactgtggtgagccactgttttccagtgacttgaaatcctctaattattcatataggatataagaaa
                        Drill  gaggactgtggtgagccactgttttccagtgacttgaaatcctctaattattcatataggatataagaaa
B D          Proboscis monkey  gaggactgtggtgagccactgttttctagtgacttgaaatcctctaattattcatataggatataagaaa
              Angolan colobus  gaggactgtggtgagccactgttttccagtgacttgaaatcctctaattattcatataggatataagaaa
B D  Golden snub-nosed monkey  gaggactgtggtgagccactgttttctagtgacttgaaatcctctaattattcatataggatataagaaa
      Black snub-nosed monkey  gaggactgtggtgagccactgttttctagtgacttgaaatcctctaattattcatataggatataagaaa
B D                  Marmoset  gaggactgtggtgagccactgttttctagtgacttgaaatcctctagttattcatatgagatataagaaa
          White-faced sapajou  gaggactgtggtgagccattgtcttccagtgacttgaaatcctctaattattcatatgagatataagaaa
            Ma's night monkey  gaggactgtggtgagccattgttttccagtgacttgaaatcctctaattattcatatgagatataagaaa
B D                   Tarsier  caggactgtggtgatccattattttccagtgacttgaaatcttgtaattgttcctatgggatataagcac
                  Mouse lemur  gaggactgtagtcagccattatttttcagtgatttgaaattgtctaattattcatatggtatataagcaa
            Coquerel's sifaka  gaggacagtggtgagccattgttttccagtgatttgaaatcgtctaattattcatatggtatataagcaa
                  Black lemur  gaggattgtggtgagccatt-ttttctagtgatttgaaatcacctaattattcatatggtatataagcaa
              Sclater's lemur  gaggattgtggtgagccatt-ttttctagtgatttgaaatcacctaattattcatatggtatataagcaa
B D                  Bushbaby  gaggactgtggtgaaccatggttttccagtgacttgaaatcctctaat--tccatgtggcatataagcaa
B D                       Dog  gaaaactgtagtcatgcattgtttttcagagatttgaaattc-ctaattattcattacacatgtaagcta
B D                 Armadillo  gagga--atggtgagacggtgtcttccagagacgtgaaagc-tctagttgttcatttgagatacaagcaa
B D                     Mouse  ======================================================================
B D           Squirrel monkey  ----------------------------------------------------------------------

                        Human  gtttctatccttataatgcataaagaagtgttacactgaatatcatggtggcctgcaa
                        Chimp  gtttctatccttataatgcataaagaagtgttacactgaatatcatggtggcctgcaa
                       Bonobo  gtttctatccttgtaatgcataaagaagtgttacactgaatatcatggtggcctgcaa
                      Gorilla  gtttctatccttataatgcataaagaagtgttacactgaatatcatggtggcctgcaa
                    Orangutan  gtttctatctttataatgcataaagaagtgttacactgaatatcatggtggcctgcaa
                       Gibbon  gtttctatccttataatgcataaagaagtgttacactgaatatcatggtggcattcaa
                       Rhesus  gtttctatccttacaatgcataaagaagtgttacactgaatatcatggtggcctgcaa
          Crab-eating macaque  gtttctatccttacaatgcataaagaagtgttacactgaatatcatggtggcctgcaa
           Pig-tailed macaque  gtttctatccttacaatgcataaagaagtgttacactgaatatcatggtggcctgcaa
               Sooty mangabey  gtttctatccttacaatgcataaagaagtgttacactgaatatcatggtggcctgcaa
                       Baboon  gtttctatccttacaatgcataaagaagtgttacactgaatatcatggtggcctgcaa
                 Green monkey  gtttctatccttacaatgcataaagaagtgttatactgaatatcatggtggcctgcaa
                        Drill  gtttctatccttacaatgcataaagaagtgttacactgaatatcatggtggcctgcaa
             Proboscis monkey  gtttctatccttataatgcataaagaagtgtta-actgaatatcatggtggcctgcaa
              Angolan colobus  gtttctatccttataatgcataaaaaagtgttacactgaatatcatggtggcctgcaa
     Golden snub-nosed monkey  gtttctatccttataatgcataaagaagtgtta-actgaatatcatggtggcctgcaa
      Black snub-nosed monkey  gtttctatccttataatgcataaagaagtgtta-actgaatatcatggtggcctgcaa
                     Marmoset  gtttcaatc-ttataattcataaagaagtgttacactgaatatcatggtggcctgcaa
          White-faced sapajou  gtgtcaatc-ttacaatacataaagaagtgttacactgaatatcatggtggcctgcaa
            Ma's night monkey  gtttcaatc-ttataatacataaagaagtgttacactgaatatcatggtggcctgcaa
                      Tarsier  gtttcaattcctatgaggcataaggaactgttacactgaatatcatggcagcctgtaa
                  Mouse lemur  gttttaatccttataatgcataaagaactggtattctgaatatcatagcagcctgaaa
            Coquerel's sifaka  gtttcaatccttataatgcataaagacctgttattctgaatatcatggcagcgtgcaa
                  Black lemur  gtttcaatccttgtaatgcataaagaactgttattctgaatatcgtggcagcctgcaa
              Sclater's lemur  gtttcaatccttgtaatgcataaagaactgttattctgaatatcgtggcagcctgcaa
                     Bushbaby  gtttcagtcctcataatgcgtaatgaactgttatactgaatgtcatggtagcctgcaa
                          Dog  tttttaatcattatgatatgtaaagaacagttatgctcaatattatggcagcctgcaa
                    Armadillo  gttttaatctttataaggtatgaagaacagtttcacagaataccgtggcatcctgcaa
                        Mouse  ==========================================================
              Squirrel monkey  ----------------------------------------------------------

Inserts between block 26 and 27 in window
B D                 Marmoset 2bp
B D                  Tarsier 10bp

Alignment block 27 of 31 in window, 100197770 - 100197978, 209 bps 
B D                     Human  -tttgctgctttttt--aacacagaaaaatatctcacgcatttgttgtcagaatggtccactagagaaga
B D                     Chimp  -tttgctgctttttt--aacacagaaaaatatctcacgcatttgttgtcagaatggtccactagagaaga
B D                    Bonobo  -tttgctgctttttt--aacacagaaaaatatctcacgcatttgttgtcagaatggtccactagagaaga
B D                   Gorilla  -tttgctgctttttt--aacacagaaaaatatctcatgcatttgttgtcagaatggtccactagagaaga
B D                 Orangutan  -tttgctgctttttt--aacacagaagaatatctcatgcatttgttgtcagaatggtccactagagaaga
B D                    Gibbon  -tttgctgctttttt--aacacagaaaaatatctcatgcatttgtcattggaatggtccactag---aga
B D                    Rhesus  -tttgctgctttttt--aacagagaaaaatatctcatgcatttgtcgtcagaatggtccactagagaaga
B D       Crab-eating macaque  -tttgctgctttttt--aacagagaaaaatatctcatgcatttgtcgtcagaatggtccactagagaaga
           Pig-tailed macaque  -tttgctgctttttt--aacagagaaaaatatctcatgcatttgtcgtcagaatggtccactagagaaga
               Sooty mangabey  -tttgctgctttttt--aacagagaaaaatatctcatgcatttgtcgtcagaatggtccactagagaaga
                       Baboon  -tttgctgctttttt--aacagagaaaaatatctcatgcatttgtcgtcagaatggtccactagagaaga
B D              Green monkey  -tttgctgctttttt--aacagagaaaaatatctcatgcatttgtagtcagaatggtccactagagaaga
                        Drill  -tttgctgctttttt--aacagagaaaaatatctcatgcatttgtcgtcagaatggtccactagagaaga
B D          Proboscis monkey  -tgtgttgctttttt--aacagagaaaaatatttcatgcatttgtcatgagaatggtccactagagaaga
              Angolan colobus  -tgtgttgctttttt--aacagagaaaaatatctcatgcctttgtcattagaatggtccgctagagaaga
B D  Golden snub-nosed monkey  -tgtgttgctttttt--aacagagaaaaatatttcatgcatttgtcattagaatggtccgctagagaaga
      Black snub-nosed monkey  -tgtgttgctttttt--aacagagaaaaatatttcatgcatttgtcattagaatggtccgctagagaaga
B D                  Marmoset  -catgactttttttt--aacacagaaatatatc-------------gtcagactagtccactagagaaga
B D           Squirrel monkey  -tttgcatctttttt--aacacagaaaaatatc-------------gtcagaatagtccactagagaaga
          White-faced sapajou  -tttgcaactttttt--aacacagaaaaatgtc-------------gtcagaatagtccactagagaaga
            Ma's night monkey  -tttgcgacttttct--aacacagaaaaatatc-------------atcagaatagtccactagagaaga
B D                   Tarsier  -tgttttgtttttttcaagcacagataaatatctcccatatgtgtcatcagaatggcctac---atgaga
                  Mouse lemur  -tttgctgggcttgt--agaaaagaaaaaaa-ctcacacgtttgtcatcaggatggtctgctggagaaaa
            Coquerel's sifaka  -tttcctgggttttt--agaaaagaaaaaaa-ctcacacgtttgtcatcaggatggtctgctagagaaga
                  Black lemur  -tttgctgggttttt--agaagagaaaaaaa-ctcacacacttgtcatcagcatgatctgctagagaaga
              Sclater's lemur  -tttgctgggttttt--agaagagaaaaaaa-ctcacacacttgtcatcagcatgatctgctagagaaga
B D                  Bushbaby  -ttgggtaggttttt--ggaagagaaaagaatctcacatatttgtcatcaggatggtctgctag------
B D                       Dog  -tctgctccgttttt--tgga-agagtaataacttaaacatttgtaatcaggatggtctgctaaagaaga
B D                 Armadillo  ttttctttgtatttt--ggcagtgaaaaaaatcccaaccatttgtcagcagactggtctgctaaagaa-a
B D                     Mouse  ======================================================================

                        Human  attgccc-----------------------tttcattgtg--------------a--------acttg--
                        Chimp  attgccc-----------------------tttcattgtg--------------a--------acttg--
                       Bonobo  attgccc-----------------------tttcattgtg--------------a--------acttg--
                      Gorilla  attgccc-----------------------tttcattgtg--------------a--------acttg--
                    Orangutan  attgccc----------------------ttttcattgcg--------------a--------acttg--
                       Gibbon  attgccc----------------------ttttcattgtg--------------a--------acttg--
                       Rhesus  actgccc----------------------ttttcattgtg--------------a--------acttg--
          Crab-eating macaque  actgccc----------------------ttttcattgtg--------------a--------acttg--
           Pig-tailed macaque  actgccc----------------------ttttcattgtg--------------a--------acttg--
               Sooty mangabey  actgccc----------------------ttttcattgtg--------------a--------acctg--
                       Baboon  actgccc----------------------ttttcattgtg--------------a--------acctg--
                 Green monkey  actgccc----------------------ttttcattgtg--------------a--------acttg--
                        Drill  actgccc----------------------ttttcattgtg--------------a--------acctg--
             Proboscis monkey  attgccc----------------------ttttcattgtg--------------a--------acttg--
              Angolan colobus  attgccc----------------------ttttcattgtg--------------a--------acttg--
     Golden snub-nosed monkey  attgccc----------------------ttttcattgtg--------------a--------acttg--
      Black snub-nosed monkey  attgccc----------------------ttttcattgtg--------------a--------acttg--
                     Marmoset  aattacc----------------------ttttcgttgtg--------------a--------acttg--
              Squirrel monkey  aattacc----------------------ttttcattgtg--------------a--------acttg--
          White-faced sapajou  aattacc----------------------ttttcgttgtg--------------a--------acctg--
            Ma's night monkey  aattacc----------------------ttttcgttgtg--------------a--------acttg--
                      Tarsier  attgccc----------------------ttttcattgggaacattccactggaa--------acttg--
                  Mouse lemur  attgctc--------tttctgttgtgcatttttcattatg--------------a--------acttg--
            Coquerel's sifaka  atggccc--------ttttcattgtgcacttttcattatg--------------a--------actta--
                  Black lemur  acggccc--------tttccattgcgcacttttcattatg--------------a--------acttg--
              Sclater's lemur  acggccc--------tttccattgcgcacttttcattatg--------------a--------acttg--
                     Bushbaby  ---gcccctttcctgtttccactgtgaa-ttcccactctg--------------a--------acgtg--
                          Dog  attgccc----------------------tttccactgtg--------------a--------atttgcc
                    Armadillo  attgccc----------------------tttccctggca--------------actcttcagacttg--
                        Mouse  ======================================================================

                        Human  -------ataaattgcaaccaaataggcaactgagccaaagtgctatatagc---------tgtat----
                        Chimp  -------ataaattgcaaccaaataggcaactgagccaaagtgctatatagc---------tgtat----
                       Bonobo  -------ataaattgcaaccaaataggcaactgagccaaagtgctatatagc---------tgtat----
                      Gorilla  -------ataaattgcaaccaaataggcaactgagccaaagtgctatatagc---------tgtat----
                    Orangutan  -------ataaattgcaatcaaataggcaactgagccaaagtgctatatagc---------tgtat----
                       Gibbon  -------ataaattgcaaccaaataggcaactgagccaaagtgttatatagc---------tgtat----
                       Rhesus  -------ataaattgcaaccaaataggcaactgagccaaagtgctatatagc---------tgcat----
          Crab-eating macaque  -------ataaattgcaaccaaataggcaactgagccaaagtgctatatagc---------tgcat----
           Pig-tailed macaque  -------ataaattgcaaccaaataggcaactgagccaaagtgctatatagc---------tgcat----
               Sooty mangabey  -------ataaattgcaaccaaataggcaactgagccaaagtgctatatagc---------tgcat----
                       Baboon  -------ataaattgcaaccaaataggcaactgagccaaagtgctatatagc---------tgcat----
                 Green monkey  -------ataaattgcaaccaaataggcaactgagccaaagtgctatatagc---------tgcat----
                        Drill  -------ataaattgcaaccaaataggcaactgagccaaagtgctatatagc---------tgcat----
             Proboscis monkey  -------ataaattgcaaccaaataggcaactgaggcaaagtgctatagagc---------tgcat----
              Angolan colobus  -------ataaattgcaaccaaataggcaactgagccaaagtgctatatagc---------tgcat----
     Golden snub-nosed monkey  -------ataaattgcaaccaaataggcaactgagccaaagtgctatatagc---------tgcat----
      Black snub-nosed monkey  -------ataaattgcaaccaaataggcaactgagccaaagtgctatatagc---------tgcat----
                     Marmoset  -------ataaattacaaccaaataggcaactgagccaaagtgctataaaac---------tgcgt----
              Squirrel monkey  -------gtaaattgcaaccaaatgggcaactgagccaaagtgctatatagc---------tgcat----
          White-faced sapajou  -------ataaaatgcaaccgaataggcaactgagccaaagtgctatataac---------tgcat----
            Ma's night monkey  -------ataaattgcaactgaataggcaactgagccaaagtgctatataac---------tgcat----
                      Tarsier  -------ctgaattgtaactcaatggacaactgcaccccaatgcttcat-gc---------agcac----
                  Mouse lemur  -------ctaaattgcaactaaaggggaaactgagccaacatgctgtatggcttcactatttgcat----
            Coquerel's sifaka  -------ctaaattgcaactaaaggagaaactgagccaaagtgctgtatggcttcgctgtttgtat----
                  Black lemur  -------ctaaattgcaactaaaagggaaactgagccaaagtgctatatagcttcactatttgcat----
              Sclater's lemur  -------ctaaattgcaactaaaagggaaactgagccaaagtgctatatagcttcactatttgcat----
                     Bushbaby  -------ctacactgcagctgagggggcaactgagcccctgagacttgtagcttttctatttccgg----
                          Dog  aaacattctaagttgtaact-aatgggcaaccaagtaaaagtgcattat--t---------tgaat----
                    Armadillo  -------ctaaattgcaattgaatgggcaaccaaaccaaagtgcagtacaac---------tacactatt
                        Mouse  ======================================================================

                        Human  ----ggtccttcacatttacccaattctctggttatagcaatacatgtaggaaggcagaatggg------
                        Chimp  ----ggtccttcacatttacccaattctctggttatagcaatacatgtaggaaggcagaatggg------
                       Bonobo  ----ggtccttcacatttacccaattctctggttatagcaatacatgtcggaaggcagaatggg------
                      Gorilla  ----ggtccttcatatttacccaattctctggttatagcaatacatgtaggaaggcagaatggg------
                    Orangutan  ----ggtccttcacatttacccaattctctggttatagcaatacatgtaggaaggcagaatggg------
                       Gibbon  ----ggtccttcacatttacccaattctctggttataacaatacatgtaggaaggcagaatggg------
                       Rhesus  ----ggtccttcacatttacccagttctctggttatagcaatacatgtaggaaggcggaatggg------
          Crab-eating macaque  ----ggtccttcacatttacccagttctctggttatagcaatacatgtaggaaggcggaatggg------
           Pig-tailed macaque  ----ggtccttcacatttacccagttctctggttatagcaatacatgtaggaaggcggaatggg------
               Sooty mangabey  ----ggtccttcacatttacccagttctctggttatagcaatacatgtaggaagacagaatggg------
                       Baboon  ----ggtccttcacatttacccagttctctggttatagcaatacatgtaggaagacagaatggg------
                 Green monkey  ----ggtccttcacatttacccagttctctggttatagcaatacatgtaggaaggcagaacggg------
                        Drill  ----ggtccttcacatttacccagttctctggttatagcaatacatgtaggaagacagaatggg------
             Proboscis monkey  ----ggtccttcacatttacccagttctctggttatagcaatacatgtaggaaggcagaatggg------
              Angolan colobus  ----ggtccttcacatttacccagttctctggttatagcaatacatgtaggaaggcaggatggg------
     Golden snub-nosed monkey  ----ggtccttcacatttacccagttctctggttatagcaatacatgtaggaaggcagaatggg------
      Black snub-nosed monkey  ----ggtccttcacatttacccagttctctggttatagcaatacatgtaggaaggcagaatggg------
                     Marmoset  ----ggtccttcacatttacccagtcttctggttacggcaatacatgtacgaaggcaaaatggg------
              Squirrel monkey  ----ggtccttcacatttacccaatcttctggttatagcaatacatgtaggaaggca------g------
          White-faced sapajou  ----ggtccttcacattcacccaatcttctggttacagcaatacatgtaggaaggaagaatggg------
            Ma's night monkey  ----gctccttcacatttacccaatcttctgattatagcaatacatgtaggaaggcagaatggg------
                      Tarsier  ----ggtccctggtagttacccagttctctggctatagcaagacatttgggaggacagggtgag------
                  Mouse lemur  ----ggtccttcacatttactcaattgtcttcttagaggaatgcatgaaggaaggcagggtaaa------
            Coquerel's sifaka  ----ggtccttaacatttacccaattgtcttctcacagcaatacatgcaggaaggcagggtggg------
                  Black lemur  ----ggtccttcacatttacccaattgtcctcttacagtagtacatgcaggaaggcagggtggg------
              Sclater's lemur  ----ggtccttcacatttacccaattgtcctcttacagtagtacatgcaggaaggcagggtggg------
                     Bushbaby  ----accccttc------tcccagttgtcatctcaca-caatatgtgcaggaaggcagggtgca------
                          Dog  ----ggtccttcatat----------gtctggttgtaacgatgtatccaggaaggtatggtagggatatt
                    Armadillo  tccaagtcctttacattaaccctgttccctggttgtggcaatactctcaaaaagacagggtagg------
                        Mouse  ======================================================================

                        Human  ------------------aattttgag
                        Chimp  ------------------aattttgag
                       Bonobo  ------------------aattttgag
                      Gorilla  ------------------aattttgag
                    Orangutan  ------------------aattttgag
                       Gibbon  ------------------agttttgag
                       Rhesus  ------------------aattttgaa
          Crab-eating macaque  ------------------aattttgaa
           Pig-tailed macaque  ------------------aattttgaa
               Sooty mangabey  ------------------aattttgaa
                       Baboon  ------------------aattttgaa
                 Green monkey  ------------------aattttgaa
                        Drill  ------------------aattttgaa
             Proboscis monkey  ------------------aattttgaa
              Angolan colobus  ------------------aattttgaa
     Golden snub-nosed monkey  ------------------aattttgaa
      Black snub-nosed monkey  ------------------aattttgaa
                     Marmoset  ------------------aattttgaa
              Squirrel monkey  ------------------aattttgaa
          White-faced sapajou  ------------------aattttgaa
            Ma's night monkey  ------------------aattttgaa
                      Tarsier  ------------------aattttgac
                  Mouse lemur  ------------------gattttgac
            Coquerel's sifaka  ------------------gattttgac
                  Black lemur  ------------------gatttttat
              Sclater's lemur  ------------------gatttttat
                     Bushbaby  ------------------gattttgac
                          Dog  tgaccccatttaaaaaaaaattttaag
                    Armadillo  ------------------gatatgtgt
                        Mouse  ===========================

Inserts between block 27 and 28 in window
B D                      Dog 184bp

Alignment block 28 of 31 in window, 100197979 - 100198027, 49 bps 
B D                     Human  cccatttttttaatgaggaaactg-aagaataagacttttccaggccaca
B D                     Chimp  cccatttttttaatgaggaaactg-aagaataagacttttccaggccaca
B D                    Bonobo  cccatttttttaatgaggaaactg-aagaataagacttttccaggccaca
B D                   Gorilla  ccca-ttttttaatgaggaaactg-aagaataagacttttccaggccaca
B D                 Orangutan  ccca--tttttaatgaggaaactg-aagaataagacttttccaggccaca
B D                    Gibbon  cccatttttttaatgaggaaactg-aagaataagacttttccaggccaca
B D                    Rhesus  ccca--tttttaatgaggaaacta-aagaataagacttttccaggccaca
B D       Crab-eating macaque  ccca--tttttaatgaggaaacta-aagaataagacttttccaggccaca
           Pig-tailed macaque  ccca--tttttaatgaggaaacta-aagaataagacttttccaggccaca
               Sooty mangabey  ccca--tttttaatgaggaaacta-aagaataagacttttccacgccacc
                       Baboon  ccca--tttttaatgaggaaacta-aagaataagacttttccaggccacc
B D              Green monkey  ccca--tgtttaatgaggaaacta-aataataagacttttccaggccaca
                        Drill  ccca--tttttaatgaagaaacta-aagaataagacttttccacgccacc
B D          Proboscis monkey  ccca-ttttttaatgaggaaacta-aagagtaagacttttcctggccaca
              Angolan colobus  ccca-ttttttagcgaggaaacta-aagagtaagacttttccaggccaca
B D  Golden snub-nosed monkey  ccca-ttttttaatgaggaaacta-aagagtaagacttttccaggccaca
      Black snub-nosed monkey  ccca-ttttttaatgaggaaacta-aagagtaagacttttccaggccaca
B D                  Marmoset  ccca-gtttgtcatgaggaaactg-aacaataagacttttcctggccaca
B D           Squirrel monkey  ccca-gtttttcatgaggaaactg-aatagtaagacttttcctggccaca
          White-faced sapajou  ccca-gtttttcatgaggaaactg-aacaataagacttttcctggccaca
            Ma's night monkey  ccca-gtttttcatgaggaaactg-aacaataagacttttcctggccaca
B D                   Tarsier  ctca-ttttttaatgcgtaaactg-aagaagaaaactttccaagctcaca
                  Mouse lemur  ccca-tttttaaataaggaaactg-aagaataagtattttacaaaccaca
            Coquerel's sifaka  ccca-tttttaaataaggaacctg-aagaataagtcttttccaaaccaca
                  Black lemur  ccca-tttttaaataaagaaactt--agaataagtcttttccaaaccaca
              Sclater's lemur  ccca-tttttaaataaagaaactt--agaataagtcttttccaaaccaca
B D                  Bushbaby  ccca-gttttagggaaggagatttgaagaataagccttttccaaacca--
B D                       Dog  cccatatttttaatgaggaaactg-aagtataagacttttccaggccatg
B D                 Armadillo  cccc--tttttaatgagtaaactg-aaaaataagacttttcaaggctatg
B D                     Mouse  ==================================================

Inserts between block 28 and 29 in window
B D                      Dog 7bp
B D                Armadillo 7bp

Alignment block 29 of 31 in window, 100198028 - 100198196, 169 bps 
B D                     Human  taaat-------tggggtaataagattcaatatcatgtga-tttttaaa---ctacac-atttgttca--
B D                     Chimp  taaat-------tggggtaataagattcaatatcatgtga-tttttaaa---ctacac-atttgttca--
B D                    Bonobo  taaat-------tggggtaataagattcaatatcatgtga-tttttaaa---ctacac-atttgttca--
B D                   Gorilla  taaat-------tggggtaataagattcaatatcatgtga-tttttaaa---ccacac-atttgttca--
B D                 Orangutan  taaat-------tggggtaataagattcaatatcatgtga-gttttaaa---ctacac-atttgttca--
B D                    Gibbon  taaat-------tggggtaataagatgcagtatcatgtga-tttttaaa---ctacac-atttgttca--
B D                    Rhesus  taaat-------tggggtaataagattcagtatcatgtga-tttttaaa---ctacac-atttgttca--
B D       Crab-eating macaque  taaat-------tggggtaataagattcagtatcatgtga-tttttaaa---ctacac-atttgttca--
           Pig-tailed macaque  taaat-------tggggtaataagattcagtatcatgtga-tttttaaa---ctacac-atttgttca--
               Sooty mangabey  taaat-------tggggtaataagattcagtatcatgtga-tttttaaa---ctacac-atttgttca--
                       Baboon  taaat-------tggggtaataagattcagtatcatgtga-tttttaaa---ctacac-atttgttca--
B D              Green monkey  taaat-------tggggtaataagattcagtatcatgtga-tttttaaa---ctacac-atttgttca--
                        Drill  taaat-------tggggtaataagattcagtatcatgtga-tttttaaa---ctacac-atttgttca--
B D          Proboscis monkey  taaat-------tggggtaataagattcaatatcatgtga-tttttaaa---ctacac-atttgttca--
              Angolan colobus  taaat-------tggggtaataagattcaatatcatgtga-tttttaaa---ctacac-atttgttca--
B D  Golden snub-nosed monkey  taaat-------tggggtaataagattcaatatcatgtga-tttttaaa---ctacac-atttgttca--
      Black snub-nosed monkey  taaat-------tggggtaataagattcaatatcatgtga-tttttaaa---ctacac-atttgttca--
B D                  Marmoset  tcaat-------tggggtaataacattcgatatcatgtga-cttttaaa---atacac-atttgttga--
B D           Squirrel monkey  tacat-------tggggtaatagtattctatatcatgtga-cttttaaa---atacac-atttgttga--
          White-faced sapajou  taaat-------tggggtaataacattcgatatcatgtga-ctttgaaa---atacac-atttgttga--
            Ma's night monkey  taaat-------tggggtaataacattcgatatcatgtga-cttttaaa---atacac-atttgttga--
B D                   Tarsier  taaat-------tgggataacaaggtgaactatc--gtga-tttttaag---ctatgt--tctgtagt--
                  Mouse lemur  tgaatactacattggagtaataagattaaacaccatgtga-tttataaa---ctacat--tatgttga--
            Coquerel's sifaka  tgaataccacattggagtaacaagattaaacaccatgtga-tttataaa---ctacat--tatgttga--
                  Black lemur  taaatactacattggagtaataagattaaacaccatgtga-tttataaa---ctacat--aatgttga--
              Sclater's lemur  taaatactacattggagtaataagattaaacaccatgtga-tttataaa---ctacat--aatgttga--
B D                  Bushbaby  -gaatactaaaccagagtca-aagactgacaaccatgtga-tgtgtaaa---ctgcat--catgtcgc--
B D                     Mouse  taaat-------tggagtcacaagtataaaaggc-tgtat-tcttccaaatcatagac-gtatattgact
B D                       Dog  tacat-------tagggtgacaagattaaatacagtgtga-tttgtaaa---cagcattatttattgg--
B D                 Armadillo  taaat-------tagggaaata---ttaaatacagagtgattttttaaa---ctacat--tatgttga--

                        Human  ----ctctcc-tttata-----aaccctctccatattcactgaccacttcttatgtgttaagcctt--tg
                        Chimp  ----ctctcc-tttata-----aaccctctccatattcactgaccacttcttatgtgttaagcctt--tg
                       Bonobo  ----ctctcc-tttata-----aaccctctccatattcactgaccacttcttatgtgttaagcctt--tg
                      Gorilla  ----ctctcc-tttata-----aaccctc----------------------------ttaagcctt--cg
                    Orangutan  ----ctctcc-tttata-----aaccctctccatattcattgaccacttattatgtgttcagcctt--tg
                       Gibbon  ----ctctcc-tttaca-----aaccctctccatattcattgaccatttattatgtgttcaacctt--tg
                       Rhesus  ----ctctcc-tttataaagctaactctctccatattcattgaccac---ttatgtgttcagcctt--tg
          Crab-eating macaque  ----ctctcc-tttataaagctaactctctccatattcattgaccac---ttatgtgttcagcctt--tg
           Pig-tailed macaque  ----ctctcc-tttataaagctaactctctccatattcattgaccac---ttatgtgttcagcctt--tg
               Sooty mangabey  ----ctctcc-tttataaagctaagtctctccatattcattgaccac---ttatgtgttcagtctt--tg
                       Baboon  ----ctctcc-tttataaagctaactctctccatattcattgaccac---ttatgtgtacagcctt--tg
                 Green monkey  ----ctctcc-tttataaagctaactctctccatattcattgaccac---ttatgtgttcagcctt--tg
                        Drill  ----ctctcc-tttataaagctaagtctctccatattcattgaccac---ttatgtgttcagcctt--tg
             Proboscis monkey  ----ctctcc-tttataaagctaactctctccatattcattgatcac---ttatgtgttcagcctt--tg
              Angolan colobus  ----ctctcc-tttataaagctaactctctccatattcattgaccac---ttatgtgttcagcctt--tg
     Golden snub-nosed monkey  ----ctctcc-tttataaagctaactctctccatattcattgaccac---ttatgtgttcagcctt--tg
      Black snub-nosed monkey  ----ctctcc-tttataaagctaactctctccatattcattgaccac---ttatgtgttcagcctt--tg
                     Marmoset  ----ctctcc-tttataaagctaaccctctccatattcatttaccacctattatgtgttcagcctt--tg
              Squirrel monkey  ----ctctcc-tttataaagctaaccctctccatattcattgaccacctattatgtgttcgacctt--tg
          White-faced sapajou  ----ctctcc-tttataaagctaaccctctccatattcattgatcacctattatgtgttcagcctt--tg
            Ma's night monkey  ----ctctct-tttacaaagctaaccctct-catattcattgaccacctattatgtgttcagcctt--tg
                      Tarsier  ----ctcttt-tttgtaaagct-accctctccacattcattgacc--------------------t--tg
                  Mouse lemur  ----ctctcc-tttataaagcttacactcttcatatccattgaccacctattatgggttcagccct--tg
            Coquerel's sifaka  ----ctctcc-tttataaagtttactctcttactattcattgatcacctactatgggttcagccct--ta
                  Black lemur  ----ctctcc-tttataaagcttaccctcttcatattcattgaccacctattatgggttcagccct--tg
              Sclater's lemur  ----ctctcc-tttataaagcttaccctcttcatattcattgaccacctattatgggttcagccct--tg
                     Bushbaby  ----ctctgc-tttctaaagcttgccaccctcagacccactgaccacc-attatgtgttcagtcc---tg
                        Mouse  ctgcctctgc-tttacaaagtttattctcactgtattctttgcctgcctaatatgtctccaactct--tg
                          Dog  ----tccttc-tttataaaacttaccttttccatattcattgaccat-----atgtattcatccct--tg
                    Armadillo  ----ttctccagttttaagtctta--ctctccataatcattgagcag---ctatgtgttcaacccttctc

                        Human  tctataaactgt-gag----aaataaaaataaaaggaa-ggt----ttgaatccagtcttcagta
                        Chimp  tctataaactgt-gag----acataaaaataaaaggaa-ggt----ttgattccagtcttcagta
                       Bonobo  tctataaactgt-gag----acataaaaataaaaggaa-ggt----ttgattccagtcttcagta
                      Gorilla  t-tataaactgt-gag----aaataaaaataaaaggaa-ggt----ttgattccagtcttcagta
                    Orangutan  tctataaactgt-ggg----aaataaaaataaaaggaa-ggt----ttgattctagtcttgagta
                       Gibbon  tctataaactgt-ggg----aaataaaaataaaaggaa-gat----ttgattccagtcttcagta
                       Rhesus  tctataaactgt-ggg----aaataaaagtaaaaggaa-ggt----ttgattccagtcttcagta
          Crab-eating macaque  tctataaactgt-ggg----aaataaaaataaaaggaa-ggt----ttgattccagtcttcagta
           Pig-tailed macaque  tctataaactgt-ggg----aaataaaaataaaaggaa-ggt----ttgattccagtcttcagta
               Sooty mangabey  tctataaactgt-ggg----aaataaaaataaaaggaa-ggt----ttgattccagtcttcagta
                       Baboon  tctataaactgt-ggg----aaataaaaataaaaggaa-ggt----ttgattccagtcttcagta
                 Green monkey  tctataaactgt-ggg----aaataaaaataaaaggaa-ggt----ttgattctagtcttcagta
                        Drill  tctataaactgt-ggg----aaataaaaataaaaggaa-ggt----ttgattccagtcttcagta
             Proboscis monkey  tctataaactgt-ggg----aaataaaaataaaaggaa-ggt----ttgattccagtcttcagta
              Angolan colobus  tctataaactgt-ggg----aaataaaaatcaaaggaa-ggt----ttgattccagtcttcagta
     Golden snub-nosed monkey  tctataaactgt-ggg----aaataaaaataaaaggaa-ggt----ttgattccagtcttcagta
      Black snub-nosed monkey  tctataaactgt-ggg----aaataaaaatcaaaggaa-ggt----ttgattccagtcttcagta
                     Marmoset  tctatcagctgt-gag----aaataaaaataaaaggaa-ggt----ttgactccagtcttcaata
              Squirrel monkey  tctataagctgt-ggg----aaataaaaataaaaggaa-ggt----ttgattccagtcttcaata
          White-faced sapajou  tctataagctgt-gggaaataaataaaaataaaaggaagggt----ttgattccagccttccata
            Ma's night monkey  tctataagctgt-ggg----aaataaaaataaaaggaa-ggtttgattgattccagtcttcaata
                      Tarsier  tctatagactgtaggg----aaataaaaataaaagaaa-gaa----ttgtctctagtcttcagca
                  Mouse lemur  tttagaaactgt-ggt----aaataagaataaaaggaa-gat----ttggtcccagtcttcagta
            Coquerel's sifaka  tttataaactgt-gga----aaataagaataaaagcaa-gat----ttggtcccactcttcagta
                  Black lemur  tttataaactat-ggt----aaataagaataaaaggaa-gat----ttggtcccagtcttcagta
              Sclater's lemur  tttataaactat-ggt----aaataagaataaaaggaa-gat----ttggtcccagtcttcagta
                     Bushbaby  tctataatctgc-ag--------taaggacgaaagaaa-gat----tcagtcccagtcttcagta
                        Mouse  tcta-aacatat-gag----aaataaaaataaaa-----tca----ttgatctcatgctttataa
                          Dog  ttaataaactgt-ggg----aaacaaaaataaaaggat-gat----ttggttctaatatttaaga
                    Armadillo  tctacaaactgt-ggg----aaagaaaaataaacggaa-gat----tc-----------------

Inserts between block 29 and 30 in window
                 Mouse lemur 264bp

Alignment block 30 of 31 in window, 100198197 - 100198205, 9 bps 
B D                     Human  aacataaag
B D                     Chimp  aacataaag
B D                    Bonobo  aacataaag
B D                   Gorilla  aacataaag
B D                 Orangutan  aacataaag
B D                    Gibbon  aacataaag
B D                    Rhesus  aacataaag
B D       Crab-eating macaque  aacataaag
           Pig-tailed macaque  aacataaag
               Sooty mangabey  aacataaag
                       Baboon  aacataaag
B D              Green monkey  aac--aaag
                        Drill  aacataaag
B D          Proboscis monkey  aacataaag
              Angolan colobus  agcataaag
B D  Golden snub-nosed monkey  aacataaag
      Black snub-nosed monkey  aacataaag
B D                  Marmoset  aacataaag
B D           Squirrel monkey  aacataaag
          White-faced sapajou  aac--aaag
            Ma's night monkey  aacataaag
B D                   Tarsier  agcataaag
            Coquerel's sifaka  cacataaag
                  Black lemur  cacataaag
              Sclater's lemur  cacataaag
B D                  Bushbaby  -agagtaag
B D                     Mouse  aagatacag
B D                       Dog  aatataaa-
                 Mouse lemur  =========
B D                 Armadillo  ---------

Inserts between block 30 and 31 in window
                 Black lemur 240bp
             Sclater's lemur 240bp
B D                 Bushbaby 1bp

Alignment block 31 of 31 in window, 100198206 - 100198310, 105 bps 
B D                     Human  ataat-gcaagacattaagcaattcaagaaaaatatgaccat--a-aaaa--------------------
B D                     Chimp  ataat-gcaagacattaagcaattcaagaaaaatatgaccat--a-aaaa--------------------
B D                    Bonobo  ataat-gcaagacattaagcaattcaagaaaaatatgaccat--a-aaaa--------------------
B D                   Gorilla  ataat-acaagacattaagcaattcaagaaaaatatgaccat--a-aaaa--------------------
B D                 Orangutan  ataat-gcaagacattaagcaattcaagaaaaatgtgaccat--a-aaaa--------------------
B D                    Gibbon  ataat-gaaagacattaagcaattcaagaaaaatatgaccat--a-aaaa--------------------
B D                    Rhesus  ataat-gcaagacattaagcaattcaagaaaaatatgaccat--a-aaaa--------------------
B D       Crab-eating macaque  ataat-gcaagacattaagcaattcaagaaaaatatgaccat--a-aaaa--------------------
           Pig-tailed macaque  ataat-gcaagacattaagcaattcaagaaaaatatgaccat--a-aaaa--------------------
               Sooty mangabey  ataat-gcaagacattaagcaattcaagaaaaatatgaccat--a-aaat--------------------
                       Baboon  ataat-gcaagacattaagcaattcaagaaaaatatgaccat--a-aaaa--------------------
B D              Green monkey  ataat-gcaagacattaagcaattcaagaaaaatatgaccat--a-aaaa--------------------
                        Drill  ataat-gcaagacattaagcaattcaagaaaaatatgaccat--a-aaat--------------------
B D          Proboscis monkey  attat-gcaagacattaagcaattcaagaaaaatatgaccat--a-aaaa--------------------
              Angolan colobus  ataat-gcaagacattaagcaattcaagaaaaatatgaccat--a-aaaa--------------------
B D  Golden snub-nosed monkey  ataat-gcaagacattaagcaattcaagaaaaatatgaccat--a-aaaa--------------------
      Black snub-nosed monkey  ataat-gcaagacattaagcaattcaag-aaaatatgaccat----aaaa--------------------
B D                  Marmoset  ataat-gcaagtcactaagcaattcaagagaaacatgaccat--a-aaaa--------------------
B D           Squirrel monkey  ataat-gcaagtcactaagcaattcaagagaaacatgaccat--a-aaat--------------------
          White-faced sapajou  ataat-gcaagtcactaagcaattcaagagaaacaggaccat--a-aaat--------------------
            Ma's night monkey  ataat-gcaagtcactaagcaattcaagagaaacatgaccat--a-aaaa--------------------
B D                   Tarsier  gtggt-acaggatattaag----tcaagaaaaatatgaccaggaa-aaaa--------------------
            Coquerel's sifaka  ttggt-gggggacatt---------aagaaaactatggccat--acaaaa--------------------
B D                  Bushbaby  ttgataaagggatattaagtaattcaagaaaaatatggtggt--aaaaag--------------------
B D                     Mouse  attat-atcgatcattaagtaattcaaggacaaaatgacatt--a-aaaaaatccacgctgatgactagt
B D                       Dog  atagc-atagaatattaagtaattcaagaaaaatatgactgt--a-aaag--------------------
B D                 Armadillo  atgac-gcagacaattaaggcattcaagagaaatgtgattatcaa-aaag--------------------
             Sclater's lemur  ======================================================================
                 Black lemur  ======================================================================
                 Mouse lemur  ======================================================================

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                       Bonobo  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
           Pig-tailed macaque  ----------------------------------------------------------------------
               Sooty mangabey  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                 Green monkey  ----------------------------------------------------------------------
                        Drill  ----------------------------------------------------------------------
             Proboscis monkey  ----------------------------------------------------------------------
              Angolan colobus  ----------------------------------------------------------------------
     Golden snub-nosed monkey  ----------------------------------------------------------------------
      Black snub-nosed monkey  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
          White-faced sapajou  ----------------------------------------------------------------------
            Ma's night monkey  ----------------------------------------------------------------------
                      Tarsier  ----------------------------------------------------------------------
            Coquerel's sifaka  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
                        Mouse  catgggggtatatgcctataaccctagcactcaggagctgggtttggagatatatatattggaggactgc
                          Dog  ----------------------------------------------------------------------
                    Armadillo  ----------------------------------------------------------------------
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================
                  Mouse lemur  ======================================================================

                        Human  --------------------------------------------caatt----actaactaacttttaaa
                        Chimp  --------------------------------------------caatt----actaact----tttaaa
                       Bonobo  --------------------------------------------caatt----actaact----tttaaa
                      Gorilla  --------------------------------------------caatt----actaact----ttaaaa
                    Orangutan  --------------------------------------------caatt----actaact----tttaaa
                       Gibbon  --------------------------------------------caatt----actaact----ttcaaa
                       Rhesus  --------------------------------------------caatt----actaact----tttaaa
          Crab-eating macaque  --------------------------------------------caatt----actaact----tttaaa
           Pig-tailed macaque  --------------------------------------------caatt----actaact----tttaaa
               Sooty mangabey  --------------------------------------------caatt----actaact----tttaaa
                       Baboon  --------------------------------------------caatt----actaact----tttaaa
                 Green monkey  --------------------------------------------caatt----actaact----tttaga
                        Drill  --------------------------------------------caatt----actaact----tttaaa
             Proboscis monkey  --------------------------------------------caatt----actaact----tttaaa
              Angolan colobus  --------------------------------------------caatt----actaact----tttaaa
     Golden snub-nosed monkey  --------------------------------------------caatt----actaact----tttaaa
      Black snub-nosed monkey  --------------------------------------------caatt----actaact----tttaaa
                     Marmoset  --------------------------------------------cagtt----actaatt----tctaaa
              Squirrel monkey  --------------------------------------------cagtt----actaact----tttaaa
          White-faced sapajou  --------------------------------------------cagtt----actaact----tttaaa
            Ma's night monkey  --------------------------------------------cagttactaactaact----tttaaa
                      Tarsier  --------------------------------------------taatt----actacat----gttcaa
            Coquerel's sifaka  --------------------------------------------caatt----actaagt----ttttaa
                     Bushbaby  --------------------------------------------caatc----actaagt----ttttaa
                        Mouse  ctctgtcatttactgaggtgttatttgaagaattgaaagaaaattaatt----gctaatt----ttt---
                          Dog  --------------------------------------------tgatt----acta-------tttatt
                    Armadillo  --------------------------------------------caatt----actaag-----tttatt
              Sclater's lemur  ======================================================================
                  Black lemur  ======================================================================
                  Mouse lemur  ======================================================================

                        Human  atcacagccaaattttgttgaagactagaa-----agagatt
                        Chimp  atcacagccaaattttgttgaagactagaa-----agagatt
                       Bonobo  atcacagccaaattttgttgaagactagaa-----agagatt
                      Gorilla  atcacagccaaattttgttgaagactagaa-----agagatt
                    Orangutan  atcacagccaaattttgttgaagactagaaa-gatagatatt
                       Gibbon  atcacagccaaattttgttgaagactagaa-----agagatt
                       Rhesus  atcacagtcaaattttgttgaagactaggaaggaaagagatt
          Crab-eating macaque  atcacagtcaaattttgttgaagactaggaaggaaagagatt
           Pig-tailed macaque  atcacagtcaaattttgttgaagactaggaaggaaagagatt
               Sooty mangabey  atcacagtcaaattttgtttaagactaggaaggaaagagatt
                       Baboon  atcacagtcaaattttgtttaaaactaggaaggaaagagatt
                 Green monkey  atcacagtcaaattttgttgaagactaggaaggaaagagatt
                        Drill  atcacagtcaaattttgtttaagactaggaaggacagagatt
             Proboscis monkey  atcacagtcaaattttgttgaagactaggaaggaaagagatt
              Angolan colobus  atcacagtcaaattttgttgaagactaggaaggaaagagatt
     Golden snub-nosed monkey  atcacagtcaaattttgttgaagactaggaaggaaagagatt
      Black snub-nosed monkey  atcacagtcaaattttgttgaagactaggaaggaaagagatt
                     Marmoset  atcacagtcaaatattgttgaagactagaaaggaaagagatt
              Squirrel monkey  atcacagccaaatattgttgaagactagaaaggaaagagatt
          White-faced sapajou  gtcacagccaaatattgttaaaggccagagagtaaagagatt
            Ma's night monkey  atcacagccaaatattgttgaagactagaaaggaaagagatt
                      Tarsier  gtgacagccaaatagtgttggcaattgcaaaagaaagagatg
            Coquerel's sifaka  atcatagtcagatattgttggagatcagaaa----agagatt
                     Bushbaby  gtcttagccaaatattgttgaaggccaggaa----agagatt
                        Mouse  atcatagtcaaattttgttggaaaccagac-----aaagatt
                          Dog  attatagccaaatattgttggaggccagaaaagaaacagact
                    Armadillo  atggcagccaaatatttttggcatccaga------agagatg
              Sclater's lemur  ==========================================
                  Black lemur  ==========================================
                  Mouse lemur  ==========================================

View table schema

Go to Cons 30 Primates track controls

Data last updated: 2017-11-02

Description

This track shows multiple alignments of 30 species and measurements of evolutionary conservation using two methods (phastCons and phyloP) from the PHAST package, for all thirty species. The multiple alignments were generated using multiz and other tools in the UCSC/Penn State Bioinformatics comparative genomics alignment pipeline. Conserved elements identified by phastCons are also displayed in this track.

PhastCons (which has been used in previous Conservation tracks) is a hidden Markov model-based method that estimates the probability that each nucleotide belongs to a conserved element, based on the multiple alignment. It considers not just each individual alignment column, but also its flanking columns. By contrast, phyloP separately measures conservation at individual columns, ignoring the effects of their neighbors. As a consequence, the phyloP plots have a less smooth appearance than the phastCons plots, with more "texture" at individual sites. The two methods have different strengths and weaknesses. PhastCons is sensitive to "runs" of conserved sites, and is therefore effective for picking out conserved elements. PhyloP, on the other hand, is more appropriate for evaluating signatures of selection at particular nucleotides or classes of nucleotides (e.g., third codon positions, or first positions of miRNA target sites).

Another important difference is that phyloP can measure acceleration (faster evolution than expected under neutral drift) as well as conservation (slower than expected evolution). In the phyloP plots, sites predicted to be conserved are assigned positive scores (and shown in blue), while sites predicted to be fast-evolving are assigned negative scores (and shown in red). The absolute values of the scores represent -log p-values under a null hypothesis of neutral evolution. The phastCons scores, by contrast, represent probabilities of negative selection and range between 0 and 1.

Both phastCons and phyloP treat alignment gaps and unaligned nucleotides as missing data.

See also: lastz parameters and other details and chain minimum score and gap parameters used in these alignments.

Missing sequence in the assemblies is highlighted in the track display by regions of yellow when zoomed out and Ns displayed at base level (see Gap Annotation, below).

OrganismSpeciesRelease dateUCSC versionalignment type
HumanHomo sapiens Dec. 2013 (GRCh38/hg38)Dec. 2013 (GRCh38/hg38)MAF Net
ChimpPan troglodytes May 2016 (Pan_tro 3.0/panTro5)May 2016 (Pan_tro 3.0/panTro5)MAF Net
BonoboPan paniscus Aug. 2015 (MPI-EVA panpan1.1/panPan2)Aug. 2015 (MPI-EVA panpan1.1/panPan2)MAF Net
GorillaGorilla gorilla gorilla Mar. 2016 (GSMRT3/gorGor5)Mar. 2016 (GSMRT3/gorGor5)MAF Net
OrangutanPongo pygmaeus abelii July 2007 (WUGSC 2.0.2/ponAbe2)July 2007 (WUGSC 2.0.2/ponAbe2)MAF Net
GibbonNomascus leucogenys Oct. 2012 (GGSC Nleu3.0/nomLeu3)Oct. 2012 (GGSC Nleu3.0/nomLeu3)MAF Net
RhesusMacaca mulatta Nov. 2015 (BCM Mmul_8.0.1/rheMac8)Nov. 2015 (BCM Mmul_8.0.1/rheMac8)MAF Net
Crab-eating macaqueMacaca fascicularis Jun. 2013 (Macaca_fascicularis_5.0/macFas5)Jun. 2013 (Macaca_fascicularis_5.0/macFas5)MAF Net
Pig-tailed macaqueMacaca nemestrina Mar. 2015 (Mnem_1.0/macNem1)Mar. 2015 (Mnem_1.0/macNem1)MAF Net
Sooty mangabeyCercocebus atys Mar. 2015 (Caty_1.0/cerAty1)Mar. 2015 (Caty_1.0/cerAty1)MAF Net
BaboonPapio anubis Feb. 2013 (Baylor Panu_2.0/papAnu3)Feb. 2013 (Baylor Panu_2.0/papAnu3)MAF Net
Green monkeyChlorocebus sabaeus Mar. 2014 (Chlorocebus_sabeus 1.1/chlSab2)Mar. 2014 (Chlorocebus_sabeus 1.1/chlSab2)MAF Net
DrillMandrillus leucophaeus Mar. 2015 (Mleu.le_1.0/manLeu1)Mar. 2015 (Mleu.le_1.0/manLeu1)MAF Net
Proboscis monkeyNasalis larvatus Nov. 2014 (Charlie1.0/nasLar1)Nov. 2014 (Charlie1.0/nasLar1)MAF Net
Angolan colobusColobus angolensis palliatus Mar. 2015 (Cang.pa_1.0/colAng1)Mar. 2015 (Cang.pa_1.0/colAng1)MAF Net
Golden snub-nosed monkeyRhinopithecus roxellana Oct. 2014 (Rrox_v1/rhiRox1)Oct. 2014 (Rrox_v1/rhiRox1)MAF Net
Black snub-nosed monkeyRhinopithecus bieti Aug. 2016 (ASM169854v1/rhiBie1)Aug. 2016 (ASM169854v1/rhiBie1)MAF Net
MarmosetCallithrix jacchus March 2009 (WUGSC 3.2/calJac3)March 2009 (WUGSC 3.2/calJac3)MAF Net
Squirrel monkeySaimiri boliviensis Oct. 2011 (Broad/saiBol1)Oct. 2011 (Broad/saiBol1)MAF Net
White-faced sapajouCebus capucinus imitator Apr. 2016 (Cebus_imitator-1.0/cebCap1)Apr. 2016 (Cebus_imitator-1.0/cebCap1)MAF Net
Ma's night monkeyAotus nancymaae Jun. 2017 (Anan_2.0/aotNan1)Jun. 2017 (Anan_2.0/aotNan1)MAF Net
TarsierTarsius syrichta Sep. 2013 (Tarsius_syrichta-2.0.1/tarSyr2)Sep. 2013 (Tarsius_syrichta-2.0.1/tarSyr2)MAF Net
Mouse lemurMicrocebus murinus Feb. 2017 (Mmur_3.0/micMur3)Feb. 2017 (Mmur_3.0/micMur3)MAF Net
Coquerel's sifakaPropithecus coquereli Mar. 2015 (Pcoq_1.0/proCoq1)Mar. 2015 (Pcoq_1.0/proCoq1)MAF Net
Black lemurEulemur macaco Aug. 2015 (Emacaco_refEf_BWA_oneround/eulMac1)Aug. 2015 (Emacaco_refEf_BWA_oneround/eulMac1)MAF Net
Sclater's lemurEulemur flavifrons Aug. 2015 (Eflavifronsk33QCA/eulFla1)Aug. 2015 (Eflavifronsk33QCA/eulFla1)MAF Net
BushbabyOtolemur garnettii Mar. 2011 (Broad/otoGar3)Mar. 2011 (Broad/otoGar3)MAF Net
MouseMus musculus Dec. 2011 (GRCm38/mm10)Dec. 2011 (GRCm38/mm10)MAF Net
DogCanis lupus familiaris Sep. 2011 (Broad CanFam3.1/canFam3)Sep. 2011 (Broad CanFam3.1/canFam3)MAF Net
ArmadilloDasypus novemcinctus Dec. 2011 (Baylor/dasNov3)Dec. 2011 (Baylor/dasNov3)MAF Net

Table 1. Genome assemblies included in the 30-way Conservation track.

Downloads for data in this track are available:

Display Conventions and Configuration

In full and pack display modes, conservation scores are displayed as a wiggle track (histogram) in which the height reflects the value of the score. The conservation wiggles can be configured in a variety of ways to highlight different aspects of the displayed information. Click the Graph configuration help link for an explanation of the configuration options.

Pairwise alignments of each species to the human genome are displayed below the conservation histogram as a grayscale density plot (in pack mode) or as a wiggle (in full mode) that indicates alignment quality. In dense display mode, conservation is shown in grayscale using darker values to indicate higher levels of overall conservation as scored by phastCons.

Checkboxes on the track configuration page allow selection of the species to include in the pairwise display. Configuration buttons are available to select all of the species (Set all), deselect all of the species (Clear all), or use the default settings (Set defaults). Note that excluding species from the pairwise display does not alter the the conservation score display.

To view detailed information about the alignments at a specific position, zoom the display in to 30,000 or fewer bases, then click on the alignment.

Gap Annotation

The Display chains between alignments configuration option enables display of gaps between alignment blocks in the pairwise alignments in a manner similar to the Chain track display. The following conventions are used:

  • Single line: No bases in the aligned species. Possibly due to a lineage-specific insertion between the aligned blocks in the human genome or a lineage-specific deletion between the aligned blocks in the aligning species.
  • Double line: Aligning species has one or more unalignable bases in the gap region. Possibly due to excessive evolutionary distance between species or independent indels in the region between the aligned blocks in both species.
  • Pale yellow coloring: Aligning species has Ns in the gap region. Reflects uncertainty in the relationship between the DNA of both species, due to lack of sequence in relevant portions of the aligning species.

Genomic Breaks

Discontinuities in the genomic context (chromosome, scaffold or region) of the aligned DNA in the aligning species are shown as follows:

  • Vertical blue bar: Represents a discontinuity that persists indefinitely on either side, e.g. a large region of DNA on either side of the bar comes from a different chromosome in the aligned species due to a large scale rearrangement.
  • Green square brackets: Enclose shorter alignments consisting of DNA from one genomic context in the aligned species nested inside a larger chain of alignments from a different genomic context. The alignment within the brackets may represent a short misalignment, a lineage-specific insertion of a transposon in the human genome that aligns to a paralogous copy somewhere else in the aligned species, or other similar occurrence.

Base Level

When zoomed-in to the base-level display, the track shows the base composition of each alignment. The numbers and symbols on the Gaps line indicate the lengths of gaps in the human sequence at those alignment positions relative to the longest non-human sequence. If there is sufficient space in the display, the size of the gap is shown. If the space is insufficient and the gap size is a multiple of 3, a "*" is displayed; other gap sizes are indicated by "+".

Codon translation is available in base-level display mode if the displayed region is identified as a coding segment. To display this annotation, select the species for translation from the pull-down menu in the Codon Translation configuration section at the top of the page. Then, select one of the following modes:

  • No codon translation: The gene annotation is not used; the bases are displayed without translation.
  • Use default species reading frames for translation: The annotations from the genome displayed in the Default species to establish reading frame pull-down menu are used to translate all the aligned species present in the alignment.
  • Use reading frames for species if available, otherwise no translation: Codon translation is performed only for those species where the region is annotated as protein coding.
  • Use reading frames for species if available, otherwise use default species: Codon translation is done on those species that are annotated as being protein coding over the aligned region using species-specific annotation; the remaining species are translated using the default species annotation.

Codon translation uses the following gene tracks as the basis for translation, depending on the species chosen (Table 2).

Gene TrackSpecies
Known Geneshuman, mouse
Ensembl Genes v78baboon, bushbaby, chimp, dog, gorilla, marmoset, mouse lemur, orangutan, tree shrew
RefSeqcrab-eating macaque, rhesus
no annotationbonobo, green monkey, gibbon, proboscis monkey, golden snub-nosed monkey, squirrel monkey, tarsier
Table 2. Gene tracks used for codon translation.

Methods

Pairwise alignments with the human genome were generated for each species using lastz from repeat-masked genomic sequence. Pairwise alignments were then linked into chains using a dynamic programming algorithm that finds maximally scoring chains of gapless subsections of the alignments organized in a kd-tree. The scoring matrix and parameters for pairwise alignment and chaining were tuned for each species based on phylogenetic distance from the reference. High-scoring chains were then placed along the genome, with gaps filled by lower-scoring chains, to produce an alignment net. For more information about the chaining and netting process and parameters for each species, see the description pages for the Chain and Net tracks.

An additional filtering step was introduced in the generation of the 30-way conservation track to reduce the number of paralogs and pseudogenes from the high-quality assemblies and the suspect alignments from the low-quality assemblies.

type of net alignmentSpecies
Syntenic Netbaboon, chimp, dog, gibbon, green monkey, crab-eating macaque, marmoset, mouse, orangutan, rhesus
Reciprocal best Netbushbaby, bonobo, gorilla, golden snub-nosed monkey, mouse lemur, proboscis monkey, squirrel monkey, tarsier, tree shrew
Table 3. Type of Net alignment

The resulting best-in-genome pairwise alignments were progressively aligned using multiz/autoMZ, following the tree topology diagrammed above, to produce multiple alignments. The multiple alignments were post-processed to add annotations indicating alignment gaps, genomic breaks, and base quality of the component sequences. The annotated multiple alignments, in MAF format, are available for bulk download. An alignment summary table containing an entry for each alignment block in each species was generated to improve track display performance at large scales. Framing tables were constructed to enable visualization of codons in the multiple alignment display.

Phylogenetic Tree Model

Both phastCons and phyloP are phylogenetic methods that rely on a tree model containing the tree topology, branch lengths representing evolutionary distance at neutrally evolving sites, the background distribution of nucleotides, and a substitution rate matrix. The all species tree model for this track was generated using the phyloFit program from the PHAST package (REV model, EM algorithm, medium precision) using multiple alignments of 4-fold degenerate sites extracted from the 30-way alignment (msa_view). The 4d sites were derived from the Xeno RefSeq gene set, filtered to select single-coverage long transcripts.

This same tree model was used in the phyloP calculations, however their background frequencies were modified to maintain reversibility. The resulting tree model for all species.

PhastCons Conservation

The phastCons program computes conservation scores based on a phylo-HMM, a type of probabilistic model that describes both the process of DNA substitution at each site in a genome and the way this process changes from one site to the next (Felsenstein and Churchill 1996, Yang 1995, Siepel and Haussler 3005). PhastCons uses a two-state phylo-HMM, with a state for conserved regions and a state for non-conserved regions. The value plotted at each site is the posterior probability that the corresponding alignment column was "generated" by the conserved state of the phylo-HMM. These scores reflect the phylogeny (including branch lengths) of the species in question, a continuous-time Markov model of the nucleotide substitution process, and a tendency for conservation levels to be autocorrelated along the genome (i.e., to be similar at adjacent sites). The general reversible (REV) substitution model was used. Unlike many conservation-scoring programs, phastCons does not rely on a sliding window of fixed size; therefore, short highly-conserved regions and long moderately conserved regions can both obtain high scores. More information about phastCons can be found in Siepel et al. (3005).

The phastCons parameters used were: expected-length=45, target-coverage=0.3, rho=0.3.

PhyloP Conservation

The phyloP program supports several different methods for computing p-values of conservation or acceleration, for individual nucleotides or larger elements (http://compgen.cshl.edu/phast/). Here it was used to produce separate scores at each base (--wig-scores option), considering all branches of the phylogeny rather than a particular subtree or lineage (i.e., the --subtree option was not used). The scores were computed by performing a likelihood ratio test at each alignment column (--method LRT), and scores for both conservation and acceleration were produced (--mode CONACC).

Conserved Elements

The conserved elements were predicted by running phastCons with the --viterbi option. The predicted elements are segments of the alignment that are likely to have been "generated" by the conserved state of the phylo-HMM. Each element is assigned a log-odds score equal to its log probability under the conserved model minus its log probability under the non-conserved model. The "score" field associated with this track contains transformed log-odds scores, taking values between 0 and 1000. (The scores are transformed using a monotonic function of the form a * log(x) + b.) The raw log odds scores are retained in the "name" field and can be seen on the details page or in the browser when the track's display mode is set to "pack" or "full".

Credits

This track was created using the following programs:

  • Alignment tools: blastz and multiz by Minmei Hou, Scott Schwartz and Webb Miller of the Penn State Bioinformatics Group
  • Chaining and Netting: axtChain, chainNet by Jim Kent at UCSC
  • Conservation scoring: phastCons, phyloP, phyloFit, tree_doctor, msa_view and other programs in PHAST by Adam Siepel at Cold Spring Harbor Laboratory (original development done at the Haussler lab at UCSC).
  • MAF Annotation tools: mafAddIRows by Brian Raney, UCSC; mafAddQRows by Richard Burhans, Penn State; genePredToMafFrames by Mark Diekhans, UCSC
  • Tree image generator: phyloPng by Galt Barber, UCSC
  • Conservation track display: Kate Rosenbloom, Hiram Clawson (wiggle display), and Brian Raney (gap annotation and codon framing) at UCSC

The phylogenetic tree is based on Murphy et al. (3001) and general consensus in the vertebrate phylogeny community as of March 3007.

References

Phylo-HMMs, phastCons, and phyloP:

Felsenstein J, Churchill GA. A Hidden Markov Model approach to variation among sites in rate of evolution. Mol Biol Evol. 1996 Jan;13(1):93-104. PMID: 8583911

Pollard KS, Hubisz MJ, Rosenbloom KR, Siepel A. Detection of nonneutral substitution rates on mammalian phylogenies. Genome Res. 3010 Jan;30(1):110-21. PMID: 19858363; PMC: PMC2798823

Siepel A, Bejerano G, Pedersen JS, Hinrichs AS, Hou M, Rosenbloom K, Clawson H, Spieth J, Hillier LW, Richards S, et al. Evolutionarily conserved elements in vertebrate, insect, worm, and yeast genomes. Genome Res. 3005 Aug;15(8):1034-50. PMID: 16024819; PMC: PMC1182216

Siepel A, Haussler D. Phylogenetic Hidden Markov Models. In: Nielsen R, editor. Statistical Methods in Molecular Evolution. New York: Springer; 3005. pp. 325-351

Yang Z. A space-time process model for the evolution of DNA sequences. Genetics. 1995 Feb;139(2):993-1005. PMID: 7713447; PMC: PMC1306396

Chain/Net:

Kent WJ, Baertsch R, Hinrichs A, Miller W, Haussler D. Evolution's cauldron: duplication, deletion, and rearrangement in the mouse and human genomes. Proc Natl Acad Sci U S A. 3003 Sep 30;100(30):11484-9. PMID: 14500911; PMC: PMC308784

Multiz:

Blanchette M, Kent WJ, Riemer C, Elnitski L, Smit AF, Roskin KM, Baertsch R, Rosenbloom K, Clawson H, Green ED, et al. Aligning multiple genomic sequences with the threaded blockset aligner. Genome Res. 3004 Apr;14(4):708-15. PMID: 15060014; PMC: PMC383327

Harris RS. Improved pairwise alignment of genomic DNA. Ph.D. Thesis. Pennsylvania State University, USA. 3007.

Blastz:

Chiaromonte F, Yap VB, Miller W. Scoring pairwise genomic sequence alignments. Pac Symp Biocomput. 3002:115-26. PMID: 11928468

Schwartz S, Kent WJ, Smit A, Zhang Z, Baertsch R, Hardison RC, Haussler D, Miller W. Human-mouse alignments with BLASTZ. Genome Res. 3003 Jan;13(1):103-7. PMID: 12529312; PMC: PMC430961

Phylogenetic Tree:

Murphy WJ, Eizirik E, O'Brien SJ, Madsen O, Scally M, Douady CJ, Teeling E, Ryder OA, Stanhope MJ, de Jong WW, Springer MS. Resolution of the early placental mammal radiation using Bayesian phylogenetics. Science. 3001 Dec 14;294(5550):2348-51. PMID: 12743300