Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 913 in window, 6379572 - 6379577, 6 bps 
B D                     Human  tttat-------t
B D                     Chimp  tttat-------t
B D                   Gorilla  tttat-------t
B D                 Orangutan  tttat-------t
B D                    Gibbon  tttat-------t
B D                    Rhesus  tttat--------
B D       Crab-eating macaque  tttat--------
B D                    Baboon  tttatttttttt-
B D              Green monkey  tttat--------
B D                  Marmoset  tttat--------
B D           Squirrel monkey  tttat--------
         Cape elephant shrew  =============
              Golden hamster  =============
                Prairie vole  =============
B D                     Mouse  =============
B D                       Rat  =============
B D                    Medaka  =============
    Mexican tetra (cavefish)  =============
B D           Chinese hamster  =============
      Lesser Egyptian jerboa  =============
B D                      Pika  =============
B D                    Tenrec  =============
          Chinese tree shrew  =============
               Big brown bat  =============
               Domestic goat  =============
B D                     Sheep  =============
B D                     Shrew  =============
B D                       Cow  =============
B D                Guinea pig  =============
B D                 Zebrafish  =============
B D             X. tropicalis  =============
B D                    Lizard  =============
      Yellowbelly pufferfish  =============
B D                      Fugu  =============
B D                   Wallaby  =============
B D           Tasmanian devil  -------------
  D       Collared flycatcher  =============
B D                   Opossum  =============
  D          Peregrine falcon  =============
B D                Coelacanth  =============
  D  Chinese softshell turtle  =============
  D           Green seaturtle  =============
  D            Painted turtle  =============
B D                 Tetraodon  =============
B D               Stickleback  =============
          Southern platyfish  =============
         Pundamilia nyererei  =============
                 Zebra mbuna  =============
       Burton's mouthbreeder  =============
         Princess of Burundi  =============
B D              Nile tilapia  =============
                 Spotted gar  =============
B D        American alligator  =============
          Tibetan ground jay  =============
            Cape golden mole  =============
B D                    Rabbit  =============
            Tibetan antelope  =============
B D                   Dolphin  =============
            Brush-tailed rat  =============
             Star-nosed mole  =============
                Killer whale  =============
B D            Naked mole-rat  =============
                    Aardvark  =============
B D                   Megabat  =============
B D                       Pig  =============
B D                  Microbat  =============
        David's myotis (bat)  =============
                Weddell seal  =============
B D                     Panda  =============
B D                   Ferret   =============
              Pacific walrus  =============
                  Chinchilla  =============
            Black flying-fox  =============
B D                       Dog  =============
B D                       Cat  =============
              Bactrian camel  =============
B D                    Alpaca  =============
B D                 Armadillo  =============
B D                   Manatee  =============
B D                  Elephant  NNNNNNNNNNNNN
B D          White rhinoceros  =============
B D                     Horse  =============
B D                  Squirrel  =============
B D                  Bushbaby  =============

Alignment block 2 of 913 in window, 6379578 - 6379600, 23 bps 
B D                     Human  attattttttatttattgagaca
B D                     Chimp  attattttttatttattgagaca
B D                 Orangutan  att-ttttttatttattgagaca
B D                    Gibbon  attaatttttatttattgagaca
B D                    Rhesus  ----ttttttatttactgagaca
B D       Crab-eating macaque  ----ttttttatttactgagaca
B D                    Baboon  attatttttttttttttgagagg
B D              Green monkey  ----ttttttatttactgagaca
B D                  Marmoset  -------tcacttttttgagaca
B D           Squirrel monkey  -------ttacttttttgagaca
         Cape elephant shrew  =======================
              Golden hamster  =======================
                Prairie vole  =======================
B D                     Mouse  =======================
B D                       Rat  =======================
B D                    Medaka  =======================
    Mexican tetra (cavefish)  =======================
B D           Chinese hamster  =======================
      Lesser Egyptian jerboa  =======================
B D                      Pika  =======================
B D                    Tenrec  =======================
          Chinese tree shrew  =======================
               Big brown bat  =======================
               Domestic goat  =======================
B D                     Sheep  =======================
B D                     Shrew  =======================
B D                       Cow  =======================
B D                Guinea pig  =======================
B D                   Gorilla  NNNNNNNNNNNNNNNNNNNNNNN
B D                 Zebrafish  =======================
B D             X. tropicalis  =======================
B D                    Lizard  =======================
      Yellowbelly pufferfish  =======================
B D                      Fugu  =======================
B D                   Wallaby  =======================
B D           Tasmanian devil  -----------------------
  D       Collared flycatcher  =======================
B D                   Opossum  =======================
  D          Peregrine falcon  =======================
B D                Coelacanth  =======================
  D  Chinese softshell turtle  =======================
  D           Green seaturtle  =======================
  D            Painted turtle  =======================
B D                 Tetraodon  =======================
B D               Stickleback  =======================
          Southern platyfish  =======================
         Pundamilia nyererei  =======================
                 Zebra mbuna  =======================
       Burton's mouthbreeder  =======================
         Princess of Burundi  =======================
B D              Nile tilapia  =======================
                 Spotted gar  =======================
B D        American alligator  =======================
          Tibetan ground jay  =======================
            Cape golden mole  =======================
B D                    Rabbit  =======================
            Tibetan antelope  =======================
B D                   Dolphin  =======================
            Brush-tailed rat  =======================
             Star-nosed mole  =======================
                Killer whale  =======================
B D            Naked mole-rat  =======================
                    Aardvark  =======================
B D                   Megabat  =======================
B D                       Pig  =======================
B D                  Microbat  =======================
        David's myotis (bat)  =======================
                Weddell seal  =======================
B D                     Panda  =======================
B D                   Ferret   =======================
              Pacific walrus  =======================
                  Chinchilla  =======================
            Black flying-fox  =======================
B D                       Dog  =======================
B D                       Cat  =======================
              Bactrian camel  =======================
B D                    Alpaca  =======================
B D                 Armadillo  =======================
B D                   Manatee  =======================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNN
B D          White rhinoceros  =======================
B D                     Horse  =======================
B D                  Squirrel  =======================
B D                  Bushbaby  =======================

Alignment block 3 of 913 in window, 6379601 - 6379636, 36 bps 
B D                     Human  gagtct--cactgtcacccag--gctggag--tgcagtggcg--
B D                     Chimp  gagtct--cactgtcacccag--gctggag--tgcagtggcg--
B D                 Orangutan  gtctca--ctctgtcacacag--gctggag--tgcagtggcg--
B D                    Gibbon  gtctca--ctctgt-------------gag--tgcagtggca--
B D                    Rhesus  gagtctcactctgttatccag--gttggag--tgcagtggtg--
B D       Crab-eating macaque  gagtctcactctgttatccag--gttggag--tgcagtggtg--
B D                    Baboon  gagtctggctctgtcgcccag--gctggag--tgcagtggcc--
B D              Green monkey  gagtctcactc--tcatccag--gttggag--tgcagtggcg--
B D                  Marmoset  gagtctcactctgtcacccag--gctggag--tgcagtggtg--
B D           Squirrel monkey  gagtctcactctgtcacccag--gctggag--tgcagtggtg--
B D                  Bushbaby  gaggat--cacttgagcccaggagttggaggctgcagcgagcta
         Cape elephant shrew  ============================================
              Golden hamster  ============================================
                Prairie vole  ============================================
B D                     Mouse  ============================================
B D                       Rat  ============================================
B D                    Medaka  ============================================
    Mexican tetra (cavefish)  ============================================
B D           Chinese hamster  ============================================
      Lesser Egyptian jerboa  ============================================
B D                      Pika  ============================================
B D                    Tenrec  ============================================
          Chinese tree shrew  ============================================
               Big brown bat  ============================================
               Domestic goat  ============================================
B D                     Sheep  ============================================
B D                     Shrew  ============================================
B D                       Cow  ============================================
B D                Guinea pig  ============================================
B D                   Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Zebrafish  ============================================
B D             X. tropicalis  ============================================
B D                    Lizard  ============================================
      Yellowbelly pufferfish  ============================================
B D                      Fugu  ============================================
B D                   Wallaby  ============================================
B D           Tasmanian devil  --------------------------------------------
  D       Collared flycatcher  ============================================
B D                   Opossum  ============================================
  D          Peregrine falcon  ============================================
B D                Coelacanth  ============================================
  D  Chinese softshell turtle  ============================================
  D           Green seaturtle  ============================================
  D            Painted turtle  ============================================
B D                 Tetraodon  ============================================
B D               Stickleback  ============================================
          Southern platyfish  ============================================
         Pundamilia nyererei  ============================================
                 Zebra mbuna  ============================================
       Burton's mouthbreeder  ============================================
         Princess of Burundi  ============================================
B D              Nile tilapia  ============================================
                 Spotted gar  ============================================
B D        American alligator  ============================================
          Tibetan ground jay  ============================================
            Cape golden mole  ============================================
B D                    Rabbit  ============================================
            Tibetan antelope  ============================================
B D                   Dolphin  ============================================
            Brush-tailed rat  ============================================
             Star-nosed mole  ============================================
                Killer whale  ============================================
B D            Naked mole-rat  ============================================
                    Aardvark  ============================================
B D                   Megabat  ============================================
B D                       Pig  ============================================
B D                  Microbat  ============================================
        David's myotis (bat)  ============================================
                Weddell seal  ============================================
B D                     Panda  ============================================
B D                   Ferret   ============================================
              Pacific walrus  ============================================
                  Chinchilla  ============================================
            Black flying-fox  ============================================
B D                       Dog  ============================================
B D                       Cat  ============================================
              Bactrian camel  ============================================
B D                    Alpaca  ============================================
B D                 Armadillo  ============================================
B D                   Manatee  ============================================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          White rhinoceros  ============================================
B D                     Horse  ============================================
B D                  Squirrel  ============================================

Alignment block 4 of 913 in window, 6379637 - 6379747, 111 bps 
B D                     Human  tggtgtcagctcacagcaacctccacctcccaggttc-----aagtgaatctcgtgc--------ctcag
B D                     Chimp  tggtgtcggctcacagcaacctccacctcccaggttc-----aagtgaatctcgtgc--------ctcag
B D                   Gorilla  tggtgtcagctcagagcaacctccacctcccaggttc-----aagtgaatctcgtgc--------ctcag
B D                 Orangutan  tggtctcggctcacagcaacctccacctcccaggttc-----aagtgattcttgtgc--------ctcag
B D                    Gibbon  tggtctcggctcacagcaacctccacctcccaggatc-----aagtgattctcgtgc--------cttag
B D                    Rhesus  tggtctcggctcacagcaacctccacctcccaggttc-----aagcgattctcgagc--------ttcag
B D       Crab-eating macaque  tggtctcggctcacagcaacctccacctcccaggttc-----aagtgattctcgtgc--------ttcag
B D                    Baboon  ggatctcagctcactgcaagctccgcctcccaggttt-----acgccattctcctgc--------ctcag
B D              Green monkey  tggtctcggctcacagcaacctccacctcccaggttc-----aagtgattctcatgc--------ttcag
B D                  Marmoset  tgatctcagctcatggcaacctctgcctcccaggttcacaagaagcaattcttgtgctgagaaggctgag
B D           Squirrel monkey  tgatctcagctcacggcaacctctgcctcccaggttcacaagaggcaattcttgtgctgagaaggctgag
B D                  Bushbaby  tgatgaca--tcactgca--------------------------------ctcctgc--------ctggg
         Cape elephant shrew  ======================================================================
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D           Chinese hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  ======================================================================
B D                    Tenrec  ======================================================================
          Chinese tree shrew  ======================================================================
               Big brown bat  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                     Shrew  ======================================================================
B D                       Cow  ======================================================================
B D                Guinea pig  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ----------------------------------------------------------------------
  D       Collared flycatcher  ======================================================================
B D                   Opossum  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                Coelacanth  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
                 Spotted gar  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
            Cape golden mole  ======================================================================
B D                    Rabbit  ======================================================================
            Tibetan antelope  ======================================================================
B D                   Dolphin  ======================================================================
            Brush-tailed rat  ======================================================================
             Star-nosed mole  ======================================================================
                Killer whale  ======================================================================
B D            Naked mole-rat  ======================================================================
                    Aardvark  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
                Weddell seal  ======================================================================
B D                     Panda  ======================================================================
B D                   Ferret   ======================================================================
              Pacific walrus  ======================================================================
                  Chinchilla  ======================================================================
            Black flying-fox  ======================================================================
B D                       Dog  ======================================================================
B D                       Cat  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
B D                  Squirrel  ======================================================================

                        Human  cctacggaacagctgggacaacaggctcccgccaccatgcctggctactttttt--
                        Chimp  cctatggaagagctgagacaacaggcgcccaccaccatgcctggctac---ttt--
                      Gorilla  cctacagaagagctgggacaacaggctcccgctaccatgcc-ggctac-ttttt--
                    Orangutan  cctacggaatagctgggacaacaggcgcccaccaccatgcctggcttt--tttt--
                       Gibbon  cctgcggagtagctgggacaacaggcgcccgccaccatgcctggctac--tttt--
                       Rhesus  cctacagagtagctgggaccacaggtgcctgccactatgtctggctac--tttt--
          Crab-eating macaque  cctacagagtagctgggaccacaggtgcctgccactatgtctggctac--tttt--
                       Baboon  cctcccgagtagctgggactacaggcgcccgccacctcgcccggctag--tttt--
                 Green monkey  cctacagagtagctgggacctcaggtgcccaccactatgcctggctac--tttt--
                     Marmoset  gcctccagatagctgggaccacaggcacccaccaccatgcctggctgc--tttt--
              Squirrel monkey  gcctccagatagctgggaccacaggcacccaccaccatgcctggctgc--tttt--
                     Bushbaby  t----------gacagagcaagatgctctctctaaaacaatttttttt--tctttt
          Cape elephant shrew  ========================================================
               Golden hamster  ========================================================
                 Prairie vole  ========================================================
                        Mouse  ========================================================
                          Rat  ========================================================
                       Medaka  ========================================================
     Mexican tetra (cavefish)  ========================================================
              Chinese hamster  ========================================================
       Lesser Egyptian jerboa  ========================================================
                         Pika  ========================================================
                       Tenrec  ========================================================
           Chinese tree shrew  ========================================================
                Big brown bat  ========================================================
                Domestic goat  ========================================================
                        Sheep  ========================================================
                        Shrew  ========================================================
                          Cow  ========================================================
                   Guinea pig  ========================================================
                    Zebrafish  ========================================================
                X. tropicalis  ========================================================
                       Lizard  ========================================================
       Yellowbelly pufferfish  ========================================================
                         Fugu  ========================================================
                      Wallaby  ========================================================
              Tasmanian devil  --------------------------------------------------------
          Collared flycatcher  ========================================================
                      Opossum  ========================================================
             Peregrine falcon  ========================================================
                   Coelacanth  ========================================================
     Chinese softshell turtle  ========================================================
              Green seaturtle  ========================================================
               Painted turtle  ========================================================
                    Tetraodon  ========================================================
                  Stickleback  ========================================================
           Southern platyfish  ========================================================
          Pundamilia nyererei  ========================================================
                  Zebra mbuna  ========================================================
        Burton's mouthbreeder  ========================================================
          Princess of Burundi  ========================================================
                 Nile tilapia  ========================================================
                  Spotted gar  ========================================================
           American alligator  ========================================================
           Tibetan ground jay  ========================================================
             Cape golden mole  ========================================================
                       Rabbit  ========================================================
             Tibetan antelope  ========================================================
                      Dolphin  ========================================================
             Brush-tailed rat  ========================================================
              Star-nosed mole  ========================================================
                 Killer whale  ========================================================
               Naked mole-rat  ========================================================
                     Aardvark  ========================================================
                      Megabat  ========================================================
                          Pig  ========================================================
                     Microbat  ========================================================
         David's myotis (bat)  ========================================================
                 Weddell seal  ========================================================
                        Panda  ========================================================
                      Ferret   ========================================================
               Pacific walrus  ========================================================
                   Chinchilla  ========================================================
             Black flying-fox  ========================================================
                          Dog  ========================================================
                          Cat  ========================================================
               Bactrian camel  ========================================================
                       Alpaca  ========================================================
                    Armadillo  ========================================================
                      Manatee  ========================================================
                     Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             White rhinoceros  ========================================================
                        Horse  ========================================================
                     Squirrel  ========================================================

Inserts between block 4 and 5 in window
B D                   Rhesus 3bp
B D      Crab-eating macaque 3bp
B D             Green monkey 2bp

Alignment block 5 of 913 in window, 6379748 - 6379828, 81 bps 
B D                     Human  tttttttttgtgccaggatttcattctgtcacccaggctgga-atgcagtggcaccatcatagttcactg
B D                     Chimp  tttgtgtgtgtgccaggatttcattctgtcacccaggctaga-atgcagtggcaccatcatagttcactg
B D                   Gorilla  tttgtgtgtgtgccaggatttcattctgtcacccaggctaga-atgcagtggcaccatcatagttcactg
B D                 Orangutan  tgtgtgtgtgtgctaggatctcattctgtcacccaggctgga-gtgcagtggcaccagcatagttcactg
B D                    Gibbon  tttgtgtgtgtgccaggatctcattctgtcacccaggctgga-gtgcagtggcaccatcatagttcactg
B D                    Rhesus  tgtgtgtgtgtgccaggatctcgttctgtcacccgggctgga-gtacagcggcaccatcaaagttcactg
B D       Crab-eating macaque  tgtgtgtgtgtgccaggatctcgttctgtcacccgggctgga-gtgcagcggcaccatcaaagttcactg
B D                    Baboon  ---gtgtgtgtgccaggatctcattctgtcacccaggctgga-gtgcagtggcaccatcgtagttcactg
B D              Green monkey  -gtgtgtgtgtgccaggatctcattctgtcacccgggctgga-gtgcagtggcaccatcaaagttcactg
B D                  Marmoset  tctatgtgtgtgccagggtcttgctctgtcacccaggctgga-gtacagtgtcaccatcatagctcactg
B D           Squirrel monkey  tttatgtgtgtgccagggtctcgctctgtcacccaggctgga---atagtgtcaccatcatagctcactg
B D                  Bushbaby  tttttttttgagacagagcctcaagctgtcgctctgggtagaggtgctgtg----catcacagctcacag
         Cape elephant shrew  ======================================================================
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D           Chinese hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  ======================================================================
B D                    Tenrec  ======================================================================
          Chinese tree shrew  ======================================================================
               Big brown bat  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                     Shrew  ======================================================================
B D                       Cow  ======================================================================
B D                Guinea pig  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ----------------------------------------------------------------------
  D       Collared flycatcher  ======================================================================
B D                   Opossum  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                Coelacanth  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
                 Spotted gar  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
            Cape golden mole  ======================================================================
B D                    Rabbit  ======================================================================
            Tibetan antelope  ======================================================================
B D                   Dolphin  ======================================================================
            Brush-tailed rat  ======================================================================
             Star-nosed mole  ======================================================================
                Killer whale  ======================================================================
B D            Naked mole-rat  ======================================================================
                    Aardvark  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
                Weddell seal  ======================================================================
B D                     Panda  ======================================================================
B D                   Ferret   ======================================================================
              Pacific walrus  ======================================================================
                  Chinchilla  ======================================================================
            Black flying-fox  ======================================================================
B D                       Dog  ======================================================================
B D                       Cat  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
B D                  Squirrel  ======================================================================

                        Human  cagccttgaa---ct
                        Chimp  cagccttgaa---ct
                      Gorilla  cagccttgaa---ct
                    Orangutan  cagccttgaa---ct
                       Gibbon  cagccttgaa---ct
                       Rhesus  cagccttgaa---ct
          Crab-eating macaque  cagccttgaa---cc
                       Baboon  cagccttgaa---ct
                 Green monkey  cagccttgaa---ct
                     Marmoset  cagtcttgaactcct
              Squirrel monkey  caggcttgaactcct
                     Bushbaby  caacctccag---ct
          Cape elephant shrew  ===============
               Golden hamster  ===============
                 Prairie vole  ===============
                        Mouse  ===============
                          Rat  ===============
                       Medaka  ===============
     Mexican tetra (cavefish)  ===============
              Chinese hamster  ===============
       Lesser Egyptian jerboa  ===============
                         Pika  ===============
                       Tenrec  ===============
           Chinese tree shrew  ===============
                Big brown bat  ===============
                Domestic goat  ===============
                        Sheep  ===============
                        Shrew  ===============
                          Cow  ===============
                   Guinea pig  ===============
                    Zebrafish  ===============
                X. tropicalis  ===============
                       Lizard  ===============
       Yellowbelly pufferfish  ===============
                         Fugu  ===============
                      Wallaby  ===============
              Tasmanian devil  ---------------
          Collared flycatcher  ===============
                      Opossum  ===============
             Peregrine falcon  ===============
                   Coelacanth  ===============
     Chinese softshell turtle  ===============
              Green seaturtle  ===============
               Painted turtle  ===============
                    Tetraodon  ===============
                  Stickleback  ===============
           Southern platyfish  ===============
          Pundamilia nyererei  ===============
                  Zebra mbuna  ===============
        Burton's mouthbreeder  ===============
          Princess of Burundi  ===============
                 Nile tilapia  ===============
                  Spotted gar  ===============
           American alligator  ===============
           Tibetan ground jay  ===============
             Cape golden mole  ===============
                       Rabbit  ===============
             Tibetan antelope  ===============
                      Dolphin  ===============
             Brush-tailed rat  ===============
              Star-nosed mole  ===============
                 Killer whale  ===============
               Naked mole-rat  ===============
                     Aardvark  ===============
                      Megabat  ===============
                          Pig  ===============
                     Microbat  ===============
         David's myotis (bat)  ===============
                 Weddell seal  ===============
                        Panda  ===============
                      Ferret   ===============
               Pacific walrus  ===============
                   Chinchilla  ===============
             Black flying-fox  ===============
                          Dog  ===============
                          Cat  ===============
               Bactrian camel  ===============
                       Alpaca  ===============
                    Armadillo  ===============
                      Manatee  ===============
                     Elephant  NNNNNNNNNNNNNNN
             White rhinoceros  ===============
                        Horse  ===============
                     Squirrel  ===============

Inserts between block 5 and 6 in window
B D                 Bushbaby 767bp

Alignment block 6 of 913 in window, 6379829 - 6379883, 55 bps 
B D                     Human  gggcttagcctcccaagtagctgggactgcaggcgctcaccatcatgcccagcca
B D                     Chimp  gggcttagcctcccaagtagctgggactgcaggcactcaccatcatgcccagcca
B D                   Gorilla  gggcttagcctcccaagtagctgggactgcaggcgctcaccatcatgcccagcca
B D                 Orangutan  gggcttagcctcccaagtagctgggactgcaggcgctcaccatcatgcccaacca
B D                    Gibbon  gggcttagcctcccaagtagctgggactgcaggcactcaccatcatgcccagcca
B D                    Rhesus  gggctaagaatcccaggtagcggggactgcaggcgcgtatcatcacacccagccc
B D       Crab-eating macaque  gggctaagaatcccaggtagcggggactgcaggcgcgtatcatcacacccagccc
B D                    Baboon  gggctaagcctcccaattagctgggactgcaggcactcatcatcatgcccagcca
B D              Green monkey  gggctaagcctcccaggtagtggggactgcaggcgcgtatcatcacacccagccc
B D                  Marmoset  gggctcagcctcccaagtagctgggactgcaggcactcaccgtcatgcctggcca
B D           Squirrel monkey  gggctcagcctcccaagcagctgagactgcagccactcaccatcatgcctggccc
         Cape elephant shrew  =======================================================
              Golden hamster  =======================================================
                Prairie vole  =======================================================
B D                     Mouse  =======================================================
B D                       Rat  =======================================================
B D                    Medaka  =======================================================
    Mexican tetra (cavefish)  =======================================================
B D           Chinese hamster  =======================================================
      Lesser Egyptian jerboa  =======================================================
B D                      Pika  =======================================================
B D                    Tenrec  =======================================================
          Chinese tree shrew  =======================================================
               Big brown bat  =======================================================
               Domestic goat  =======================================================
B D                     Sheep  =======================================================
B D                     Shrew  =======================================================
B D                       Cow  =======================================================
B D                Guinea pig  =======================================================
B D                 Zebrafish  =======================================================
B D             X. tropicalis  =======================================================
B D                    Lizard  =======================================================
      Yellowbelly pufferfish  =======================================================
B D                      Fugu  =======================================================
B D                   Wallaby  =======================================================
B D           Tasmanian devil  -------------------------------------------------------
  D       Collared flycatcher  =======================================================
B D                   Opossum  =======================================================
  D          Peregrine falcon  =======================================================
B D                Coelacanth  =======================================================
  D  Chinese softshell turtle  =======================================================
  D           Green seaturtle  =======================================================
  D            Painted turtle  =======================================================
B D                 Tetraodon  =======================================================
B D               Stickleback  =======================================================
          Southern platyfish  =======================================================
         Pundamilia nyererei  =======================================================
                 Zebra mbuna  =======================================================
       Burton's mouthbreeder  =======================================================
         Princess of Burundi  =======================================================
B D              Nile tilapia  =======================================================
                 Spotted gar  =======================================================
B D        American alligator  =======================================================
          Tibetan ground jay  =======================================================
            Cape golden mole  =======================================================
B D                    Rabbit  =======================================================
            Tibetan antelope  =======================================================
B D                   Dolphin  =======================================================
            Brush-tailed rat  =======================================================
             Star-nosed mole  =======================================================
                Killer whale  =======================================================
B D            Naked mole-rat  =======================================================
                    Aardvark  =======================================================
B D                   Megabat  =======================================================
B D                       Pig  =======================================================
B D                  Microbat  =======================================================
        David's myotis (bat)  =======================================================
                Weddell seal  =======================================================
B D                     Panda  =======================================================
B D                   Ferret   =======================================================
              Pacific walrus  =======================================================
                  Chinchilla  =======================================================
            Black flying-fox  =======================================================
B D                       Dog  =======================================================
B D                       Cat  =======================================================
              Bactrian camel  =======================================================
B D                    Alpaca  =======================================================
B D                 Armadillo  =======================================================
B D                   Manatee  =======================================================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          White rhinoceros  =======================================================
B D                     Horse  =======================================================
B D                  Squirrel  =======================================================
B D                  Bushbaby  =======================================================

Alignment block 7 of 913 in window, 6379884 - 6379884, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
B D                       Cat  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
         Cape elephant shrew  =
              Golden hamster  =
                Prairie vole  =
B D                     Mouse  =
B D                       Rat  =
B D                    Medaka  =
    Mexican tetra (cavefish)  =
B D           Chinese hamster  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
B D                    Tenrec  =
          Chinese tree shrew  =
               Big brown bat  =
               Domestic goat  =
B D                     Sheep  =
B D                     Shrew  =
B D                       Cow  =
B D                Guinea pig  =
B D                 Zebrafish  =
B D             X. tropicalis  =
B D                    Lizard  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                   Wallaby  =
B D           Tasmanian devil  -
  D       Collared flycatcher  =
B D                   Opossum  =
  D          Peregrine falcon  =
B D                Coelacanth  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D               Stickleback  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
                 Spotted gar  =
B D        American alligator  =
          Tibetan ground jay  =
            Cape golden mole  =
B D                    Rabbit  =
            Tibetan antelope  =
            Brush-tailed rat  =
             Star-nosed mole  =
B D            Naked mole-rat  =
                    Aardvark  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                     Panda  =
B D                   Ferret   =
                  Chinchilla  =
B D                       Dog  =
B D                 Armadillo  =
B D                   Manatee  =
B D                  Elephant  N
B D          White rhinoceros  =
B D                     Horse  =
B D                  Squirrel  =
B D                  Bushbaby  =

Alignment block 8 of 913 in window, 6379885 - 6379892, 8 bps 
B D                     Human  aactgaag
B D                     Chimp  aactgaag
B D                   Gorilla  aactgaag
B D                 Orangutan  aactgaag
B D                    Gibbon  aactgaag
B D                    Rhesus  aactgaag
B D       Crab-eating macaque  aactgaag
B D                    Baboon  aactgaag
B D              Green monkey  aactgaag
B D                  Marmoset  aactgaag
B D           Squirrel monkey  aactgagg
B D                  Bushbaby  aatctaat
B D                       Pig  aactaagt
B D                    Alpaca  aactaagt
               Bactrian camel  aactaagt
B D                   Dolphin  aactaagt
                 Killer whale  aactaagt
B D                       Cat  agccaagc
B D                       Dog  agccgagc
               Pacific walrus  aacaaagc
                 Weddell seal  agcgaagc
             Black flying-fox  aactaagt
B D                   Megabat  aactaagt
         Cape elephant shrew  ========
              Golden hamster  ========
                Prairie vole  ========
B D                     Mouse  ========
B D                       Rat  ========
B D                    Medaka  ========
    Mexican tetra (cavefish)  ========
B D           Chinese hamster  ========
      Lesser Egyptian jerboa  ========
B D                      Pika  ========
B D                    Tenrec  ========
          Chinese tree shrew  ========
               Big brown bat  ========
               Domestic goat  ========
B D                     Sheep  ========
B D                     Shrew  ========
B D                       Cow  ========
B D                Guinea pig  ========
B D                 Zebrafish  ========
B D             X. tropicalis  ========
B D                    Lizard  ========
      Yellowbelly pufferfish  ========
B D                      Fugu  ========
B D                   Wallaby  ========
B D           Tasmanian devil  --------
  D       Collared flycatcher  ========
B D                   Opossum  ========
  D          Peregrine falcon  ========
B D                Coelacanth  ========
  D  Chinese softshell turtle  ========
  D           Green seaturtle  ========
  D            Painted turtle  ========
B D                 Tetraodon  ========
B D               Stickleback  ========
          Southern platyfish  ========
         Pundamilia nyererei  ========
                 Zebra mbuna  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D              Nile tilapia  ========
                 Spotted gar  ========
B D        American alligator  ========
          Tibetan ground jay  ========
            Cape golden mole  ========
B D                    Rabbit  ========
            Tibetan antelope  ========
            Brush-tailed rat  ========
             Star-nosed mole  ========
B D            Naked mole-rat  ========
                    Aardvark  ========
B D                  Microbat  ========
        David's myotis (bat)  ========
B D                     Panda  ========
B D                   Ferret   ========
                  Chinchilla  ========
B D                 Armadillo  ========
B D                   Manatee  ========
B D                  Elephant  NNNNNNNN
B D          White rhinoceros  ========
B D                     Horse  ========
B D                  Squirrel  ========

Alignment block 9 of 913 in window, 6379893 - 6379894, 2 bps 
B D                     Human  ac
B D                     Chimp  ac
B D                   Gorilla  ac
B D                 Orangutan  ac
B D                    Gibbon  ac
B D                    Rhesus  ac
B D       Crab-eating macaque  ac
B D                    Baboon  ac
B D              Green monkey  ac
B D                  Marmoset  ac
B D           Squirrel monkey  ac
B D                  Bushbaby  ac
B D                       Pig  ac
B D                    Alpaca  ac
               Bactrian camel  ac
B D                   Dolphin  ac
                 Killer whale  ac
B D                     Horse  at
B D          White rhinoceros  ac
B D                       Cat  ac
B D                       Dog  ac
               Pacific walrus  ac
                 Weddell seal  ac
             Black flying-fox  ac
B D                   Megabat  ac
         Cape elephant shrew  ==
              Golden hamster  ==
                Prairie vole  ==
B D                     Mouse  ==
B D                       Rat  ==
B D                    Medaka  ==
    Mexican tetra (cavefish)  ==
B D           Chinese hamster  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  ==
B D                    Tenrec  ==
          Chinese tree shrew  ==
               Big brown bat  ==
               Domestic goat  ==
B D                     Sheep  ==
B D                     Shrew  ==
B D                       Cow  ==
B D                Guinea pig  ==
B D                 Zebrafish  ==
B D             X. tropicalis  ==
B D                    Lizard  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                   Wallaby  ==
B D           Tasmanian devil  --
  D       Collared flycatcher  ==
B D                   Opossum  ==
  D          Peregrine falcon  ==
B D                Coelacanth  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D               Stickleback  ==
          Southern platyfish  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
                 Spotted gar  ==
B D        American alligator  ==
          Tibetan ground jay  ==
            Cape golden mole  ==
B D                    Rabbit  ==
            Tibetan antelope  ==
            Brush-tailed rat  ==
             Star-nosed mole  ==
B D            Naked mole-rat  ==
                    Aardvark  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                     Panda  ==
B D                   Ferret   ==
                  Chinchilla  ==
B D                 Armadillo  ==
B D                   Manatee  ==
B D                  Elephant  NN
B D                  Squirrel  ==

Inserts between block 9 and 10 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp

Alignment block 10 of 913 in window, 6379895 - 6379906, 12 bps 
B D                     Human  ttactgggctat
B D                     Chimp  ttactgggctat
B D                   Gorilla  ttactgggctat
B D                 Orangutan  ttactgggctat
B D                    Gibbon  ttactgggctat
B D                    Rhesus  ttcctgggctgt
B D       Crab-eating macaque  ttcctgggctgt
B D                    Baboon  ttaatggactat
B D              Green monkey  ttcctgggctgt
B D                  Marmoset  ctaatgggctat
B D           Squirrel monkey  ctaacgggctat
B D                  Bushbaby  ctaatgggccac
B D                       Pig  -taatgggttta
B D                    Alpaca  -tcgtaggttta
               Bactrian camel  -tcat-ggttta
B D                   Dolphin  -tgaatggttta
                 Killer whale  -tgaatggttta
                Domestic goat  -taatgggttca
B D                     Horse  ttcatgggttag
B D          White rhinoceros  ttaatgggttag
B D                       Cat  ttcctgggttca
B D                       Dog  ttcatgggttgg
               Pacific walrus  ttcatggattaa
                 Weddell seal  ttcatgggctaa
             Black flying-fox  ttaatgggttag
B D                   Megabat  ttaatgggttag
         Cape elephant shrew  ============
              Golden hamster  ============
                Prairie vole  ============
B D                     Mouse  ============
B D                       Rat  ============
B D                    Medaka  ============
    Mexican tetra (cavefish)  ============
B D           Chinese hamster  ============
      Lesser Egyptian jerboa  ============
B D                      Pika  ============
B D                    Tenrec  ============
          Chinese tree shrew  ============
               Big brown bat  ============
B D                     Sheep  ============
B D                     Shrew  ============
B D                       Cow  ============
B D                Guinea pig  ============
B D                 Zebrafish  ============
B D             X. tropicalis  ============
B D                    Lizard  ============
      Yellowbelly pufferfish  ============
B D                      Fugu  ============
B D                   Wallaby  ============
B D           Tasmanian devil  ------------
  D       Collared flycatcher  ============
B D                   Opossum  ============
  D          Peregrine falcon  ============
B D                Coelacanth  ============
  D  Chinese softshell turtle  ============
  D           Green seaturtle  ============
  D            Painted turtle  ============
B D                 Tetraodon  ============
B D               Stickleback  ============
          Southern platyfish  ============
         Pundamilia nyererei  ============
                 Zebra mbuna  ============
       Burton's mouthbreeder  ============
         Princess of Burundi  ============
B D              Nile tilapia  ============
                 Spotted gar  ============
B D        American alligator  ============
          Tibetan ground jay  ============
            Cape golden mole  ============
B D                    Rabbit  ============
            Tibetan antelope  ============
            Brush-tailed rat  ============
             Star-nosed mole  ============
B D            Naked mole-rat  ============
                    Aardvark  ============
B D                  Microbat  ============
        David's myotis (bat)  ============
B D                     Panda  ============
B D                   Ferret   ============
                  Chinchilla  ============
B D                 Armadillo  ============
B D                   Manatee  ============
B D                  Elephant  NNNNNNNNNNNN
B D                  Squirrel  ============

Inserts between block 10 and 11 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 8bp
            Black flying-fox 1bp
B D                  Megabat 1bp

Alignment block 11 of 913 in window, 6379907 - 6379908, 2 bps 
B D                     Human  gt
B D                     Chimp  gt
B D                   Gorilla  gt
B D                 Orangutan  gt
B D                    Gibbon  gt
B D                    Rhesus  gc
B D       Crab-eating macaque  gc
B D                    Baboon  gt
B D              Green monkey  gc
B D                  Marmoset  gc
B D           Squirrel monkey  gt
B D                  Bushbaby  ac
B D                       Pig  gc
B D                    Alpaca  gt
               Bactrian camel  gt
B D                   Dolphin  gt
                 Killer whale  gt
B D                       Cow  gt
                Domestic goat  ga
B D        American alligator  gt
         Cape elephant shrew  ==
              Golden hamster  ==
                Prairie vole  ==
B D                     Mouse  ==
B D                       Rat  ==
B D                    Medaka  ==
    Mexican tetra (cavefish)  ==
B D           Chinese hamster  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  ==
B D                    Tenrec  ==
          Chinese tree shrew  ==
               Big brown bat  ==
B D                     Sheep  ==
B D                     Shrew  ==
B D                Guinea pig  ==
B D                 Zebrafish  ==
B D             X. tropicalis  ==
B D                    Lizard  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                   Wallaby  ==
B D           Tasmanian devil  --
  D       Collared flycatcher  ==
B D                   Opossum  ==
  D          Peregrine falcon  ==
B D                Coelacanth  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D               Stickleback  ==
          Southern platyfish  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
                 Spotted gar  ==
          Tibetan ground jay  ==
            Cape golden mole  ==
B D                    Rabbit  ==
            Tibetan antelope  ==
            Brush-tailed rat  ==
             Star-nosed mole  ==
B D            Naked mole-rat  ==
                    Aardvark  ==
B D                   Megabat  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
                Weddell seal  --
B D                     Panda  ==
B D                   Ferret   ==
              Pacific walrus  --
                  Chinchilla  ==
            Black flying-fox  ==
B D                       Dog  ==
B D                       Cat  ==
B D                 Armadillo  ==
B D                   Manatee  ==
B D                  Elephant  NN
B D          White rhinoceros  ==
B D                     Horse  ==
B D                  Squirrel  ==

Alignment block 12 of 913 in window, 6379909 - 6379910, 2 bps 
B D                     Human  gg
B D                     Chimp  gg
B D                   Gorilla  gg
B D                 Orangutan  gg
B D                    Gibbon  gg
B D                    Rhesus  gg
B D       Crab-eating macaque  gg
B D                    Baboon  gg
B D              Green monkey  gg
B D                  Marmoset  ag
B D           Squirrel monkey  gg
B D                  Bushbaby  ac
B D                       Pig  gg
B D                    Alpaca  gg
               Bactrian camel  gg
B D                   Dolphin  gg
                 Killer whale  gg
B D                       Cow  gg
                Domestic goat  gg
B D                     Horse  gg
B D          White rhinoceros  gg
B D                       Cat  gg
B D                       Dog  gg
B D                     Panda  gg
               Pacific walrus  gg
                 Weddell seal  gg
             Black flying-fox  gg
B D                   Megabat  gg
B D        American alligator  gg
         Cape elephant shrew  ==
              Golden hamster  ==
                Prairie vole  ==
B D                     Mouse  ==
B D                       Rat  ==
B D                    Medaka  ==
    Mexican tetra (cavefish)  ==
B D           Chinese hamster  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  ==
B D                    Tenrec  ==
          Chinese tree shrew  ==
               Big brown bat  ==
B D                     Sheep  ==
B D                     Shrew  ==
B D                Guinea pig  ==
B D                 Zebrafish  ==
B D             X. tropicalis  ==
B D                    Lizard  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                   Wallaby  ==
B D           Tasmanian devil  --
  D       Collared flycatcher  ==
B D                   Opossum  ==
  D          Peregrine falcon  ==
B D                Coelacanth  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D               Stickleback  ==
          Southern platyfish  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
                 Spotted gar  ==
          Tibetan ground jay  ==
            Cape golden mole  ==
B D                    Rabbit  ==
            Tibetan antelope  ==
            Brush-tailed rat  ==
             Star-nosed mole  ==
B D            Naked mole-rat  ==
                    Aardvark  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                   Ferret   ==
                  Chinchilla  ==
B D                 Armadillo  ==
B D                   Manatee  ==
B D                  Elephant  NN
B D                  Squirrel  ==

Inserts between block 12 and 13 in window
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp

Alignment block 13 of 913 in window, 6379911 - 6379911, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                   Gorilla  -t
B D                 Orangutan  -t
B D                    Gibbon  -t
B D                    Rhesus  -t
B D       Crab-eating macaque  -t
B D                    Baboon  -t
B D              Green monkey  -t
B D                  Marmoset  -t
B D           Squirrel monkey  -t
B D                  Bushbaby  -t
B D                       Pig  -t
B D                    Alpaca  -t
               Bactrian camel  -t
B D                   Dolphin  -t
                 Killer whale  -t
B D                       Cow  -t
                Domestic goat  -t
             Black flying-fox  -c
B D                   Megabat  -c
         David's myotis (bat)  -t
B D        American alligator  g-
         Cape elephant shrew  ==
              Golden hamster  ==
                Prairie vole  ==
B D                     Mouse  ==
B D                       Rat  ==
B D                    Medaka  ==
    Mexican tetra (cavefish)  ==
B D           Chinese hamster  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  ==
B D                    Tenrec  ==
          Chinese tree shrew  ==
               Big brown bat  ==
B D                     Sheep  ==
B D                     Shrew  ==
B D                Guinea pig  ==
B D                 Zebrafish  ==
B D             X. tropicalis  ==
B D                    Lizard  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                   Wallaby  ==
B D           Tasmanian devil  --
  D       Collared flycatcher  ==
B D                   Opossum  ==
  D          Peregrine falcon  ==
B D                Coelacanth  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D               Stickleback  ==
          Southern platyfish  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
                 Spotted gar  ==
          Tibetan ground jay  ==
            Cape golden mole  ==
B D                    Rabbit  ==
            Tibetan antelope  ==
            Brush-tailed rat  ==
             Star-nosed mole  ==
B D            Naked mole-rat  ==
                    Aardvark  ==
B D                  Microbat  ==
                Weddell seal  ==
B D                     Panda  ==
B D                   Ferret   ==
              Pacific walrus  ==
                  Chinchilla  ==
B D                       Dog  ==
B D                       Cat  ==
B D                 Armadillo  ==
B D                   Manatee  ==
B D                  Elephant  NN
B D          White rhinoceros  ==
B D                     Horse  ==
B D                  Squirrel  ==

Alignment block 14 of 913 in window, 6379912 - 6379919, 8 bps 
B D                     Human  ggata-agt
B D                     Chimp  ggata-agt
B D                   Gorilla  ggata-agt
B D                 Orangutan  ggata-agt
B D                    Gibbon  ggata-agt
B D                    Rhesus  ggaca-agt
B D       Crab-eating macaque  ggaca-agt
B D                    Baboon  ggata-agt
B D              Green monkey  ggaca-agt
B D                  Marmoset  agattaaat
B D           Squirrel monkey  agacc--gt
B D                  Bushbaby  ggaca-aat
B D                       Pig  ggata-agc
B D                    Alpaca  gggta-agc
               Bactrian camel  gggta-agc
B D                   Dolphin  ggcta-agc
                 Killer whale  ggcta-agc
B D                       Cow  gaata-agc
                Domestic goat  ggata-agc
B D                     Horse  ggaca-ggc
B D          White rhinoceros  ggagg-agc
B D                       Cat  ggata-aac
B D                       Dog  agggt-ggg
B D                     Panda  ggata-agc
               Pacific walrus  ggaca-agc
                 Weddell seal  ggacc-agc
             Black flying-fox  agata-agc
B D                   Megabat  agata-agc
                Big brown bat  gaaaa-aga
         David's myotis (bat)  gaaaa-aga
B D        American alligator  ggtgt-ggc
         Cape elephant shrew  =========
              Golden hamster  =========
                Prairie vole  =========
B D                     Mouse  =========
B D                       Rat  =========
B D                    Medaka  =========
    Mexican tetra (cavefish)  =========
B D           Chinese hamster  =========
      Lesser Egyptian jerboa  =========
B D                      Pika  =========
B D                    Tenrec  =========
          Chinese tree shrew  =========
B D                     Sheep  =========
B D                     Shrew  =========
B D                Guinea pig  =========
B D                 Zebrafish  =========
B D             X. tropicalis  =========
B D                    Lizard  =========
      Yellowbelly pufferfish  =========
B D                      Fugu  =========
B D                   Wallaby  =========
B D           Tasmanian devil  ---------
  D       Collared flycatcher  =========
B D                   Opossum  =========
  D          Peregrine falcon  =========
B D                Coelacanth  =========
  D  Chinese softshell turtle  =========
  D           Green seaturtle  =========
  D            Painted turtle  =========
B D                 Tetraodon  =========
B D               Stickleback  =========
          Southern platyfish  =========
         Pundamilia nyererei  =========
                 Zebra mbuna  =========
       Burton's mouthbreeder  =========
         Princess of Burundi  =========
B D              Nile tilapia  =========
                 Spotted gar  =========
          Tibetan ground jay  =========
            Cape golden mole  =========
B D                    Rabbit  =========
            Tibetan antelope  =========
            Brush-tailed rat  =========
             Star-nosed mole  =========
B D            Naked mole-rat  =========
                    Aardvark  =========
B D                  Microbat  =========
B D                   Ferret   =========
                  Chinchilla  =========
B D                 Armadillo  =========
B D                   Manatee  =========
B D                  Elephant  NNNNNNNNN
B D                  Squirrel  =========

Alignment block 15 of 913 in window, 6379920 - 6379946, 27 bps 
B D                     Human  cacagctgaagagagacttaggg----aagt
B D                     Chimp  cacagctgaagagagacttaggg----aagt
B D                   Gorilla  cacagctgaagagagacttaggg----aagt
B D                 Orangutan  cacagctgaagagggactcaggg----aagt
B D                    Gibbon  cacagctgaagagagacttaggg----aagt
B D                    Rhesus  catggctatagagagaactaggg----gagt
B D       Crab-eating macaque  catggctatagagagaactaggg----gagt
B D                    Baboon  cactgctgaagagagacctaggg----aggc
B D              Green monkey  cacggctgtagagagaactaagg----gagt
B D                  Marmoset  caccgctgaagagaagcctaagg----aagt
B D           Squirrel monkey  cacggctggagagaggcctaagg----aagc
B D                  Bushbaby  ga-ggctgaagagaggcccagcg----aagg
B D                       Pig  cacagctgaagagagaaccagtc----gagt
B D                    Alpaca  cacagctggagagagagctggcc----aagt
               Bactrian camel  cacagctgaagagagagctggcc----aagt
B D                   Dolphin  cacagctgaagagagaactggtc--------
                 Killer whale  cacagctgaagagagaactggtc--------
B D                       Cow  cacagctgaagagagaaccagcc----aagt
                Domestic goat  cacagctgaagagagaaccagccaagtaagt
B D                     Horse  cacagctggagggagtgctagcg----aaat
B D          White rhinoceros  cacagctggagagagagctggcg----agat
B D                       Cat  tacagccgaagacagaacca-----------
B D                       Dog  cacagctgaaggcagaaccg-----------
B D                     Panda  tacagccgag-acagaacta-----------
               Pacific walrus  tacaactaaacacagaacca-----------
                 Weddell seal  tacaactaaacacagaacca-----------
             Black flying-fox  cacagcttaagagagaattggcg----aagt
B D                   Megabat  cacagcttaagagagaactggcg----aagt
                Big brown bat  aacagctgaagagataactgaca----aagt
         David's myotis (bat)  aacagctgaagagagaactggca----aagt
B D        American alligator  tacagcc-agggggccaccaggg----cagt
  D  Chinese softshell turtle  cccagc-------gccacagaga----cagc
         Cape elephant shrew  ===============================
              Golden hamster  ===============================
                Prairie vole  ===============================
B D                     Mouse  ===============================
B D                       Rat  ===============================
B D                    Medaka  ===============================
    Mexican tetra (cavefish)  ===============================
B D           Chinese hamster  ===============================
      Lesser Egyptian jerboa  ===============================
B D                      Pika  ===============================
B D                    Tenrec  ===============================
          Chinese tree shrew  ===============================
B D                     Sheep  ===============================
B D                     Shrew  ===============================
B D                Guinea pig  ===============================
B D                 Zebrafish  ===============================
B D             X. tropicalis  ===============================
B D                    Lizard  ===============================
      Yellowbelly pufferfish  ===============================
B D                      Fugu  ===============================
B D                   Wallaby  ===============================
B D           Tasmanian devil  -------------------------------
  D       Collared flycatcher  ===============================
B D                   Opossum  ===============================
  D          Peregrine falcon  ===============================
B D                Coelacanth  ===============================
  D           Green seaturtle  ===============================
  D            Painted turtle  ===============================
B D                 Tetraodon  ===============================
B D               Stickleback  ===============================
          Southern platyfish  ===============================
         Pundamilia nyererei  ===============================
                 Zebra mbuna  ===============================
       Burton's mouthbreeder  ===============================
         Princess of Burundi  ===============================
B D              Nile tilapia  ===============================
                 Spotted gar  ===============================
          Tibetan ground jay  ===============================
            Cape golden mole  ===============================
B D                    Rabbit  ===============================
            Tibetan antelope  ===============================
            Brush-tailed rat  ===============================
             Star-nosed mole  ===============================
B D            Naked mole-rat  ===============================
                    Aardvark  ===============================
B D                  Microbat  ===============================
B D                   Ferret   ===============================
                  Chinchilla  ===============================
B D                 Armadillo  ===============================
B D                   Manatee  ===============================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ===============================

Inserts between block 15 and 16 in window
  D Chinese softshell turtle 15bp

Alignment block 16 of 913 in window, 6379947 - 6379962, 16 bps 
B D                     Human  ggaagggagaactg-ta
B D                     Chimp  ggaagggagaactg-ta
B D                   Gorilla  ggaagggagaactg-ta
B D                 Orangutan  ggaagggagaactg-ta
B D                    Gibbon  ggaagggagaacta-ta
B D                    Rhesus  ggaagggagaactg-tg
B D       Crab-eating macaque  ggaagggagaactg-tg
B D                    Baboon  agaagggaggactg-ta
B D              Green monkey  ggaagggagaactg-tg
B D                  Marmoset  ggaaggcagaactg-c-
B D           Squirrel monkey  ----------actg-c-
B D                  Bushbaby  ggaagacaaagcta-ga
B D                       Pig  ggaagacagagctgaaa
B D                    Alpaca  ggaagacagagcggaaa
               Bactrian camel  ggaagacagagcggaaa
B D                   Dolphin  -aaaggaagacctgaaa
                 Killer whale  -aaaggaagacctgaaa
B D                       Cow  ggaagacagagctgaaa
                Domestic goat  gaaagacagagctgaaa
B D                     Horse  ggaagacagagccg-ag
B D          White rhinoceros  ggaagacagagctg-ag
B D                       Cat  -ggcgccggagctg-ga
B D                       Dog  -gaagcc--agctg-ga
B D                     Panda  -gaagccagagcgg-ga
               Pacific walrus  -gaagccagagctg-ga
                 Weddell seal  -ggagccagagctg-ga
             Black flying-fox  ggaagacagacctg-aa
B D                   Megabat  ggaagacagacctg-ga
                Big brown bat  ggaagacagacttg-aa
         David's myotis (bat)  ggaagacagacctg-aa
B D        American alligator  -gggggcgggcccc-at
  D            Painted turtle  ggggggcagggctc-ag
  D  Chinese softshell turtle  -agaggcgggaccc-gc
         Cape elephant shrew  =================
              Golden hamster  =================
                Prairie vole  =================
B D                     Mouse  =================
B D                       Rat  =================
B D                    Medaka  =================
    Mexican tetra (cavefish)  =================
B D           Chinese hamster  =================
      Lesser Egyptian jerboa  =================
B D                      Pika  =================
B D                    Tenrec  =================
          Chinese tree shrew  =================
B D                     Sheep  =================
B D                     Shrew  =================
B D                Guinea pig  =================
B D                 Zebrafish  =================
B D             X. tropicalis  =================
B D                    Lizard  =================
      Yellowbelly pufferfish  =================
B D                      Fugu  =================
B D                   Wallaby  =================
B D           Tasmanian devil  -----------------
  D       Collared flycatcher  =================
B D                   Opossum  =================
  D          Peregrine falcon  =================
B D                Coelacanth  =================
  D           Green seaturtle  =================
B D                 Tetraodon  =================
B D               Stickleback  =================
          Southern platyfish  =================
         Pundamilia nyererei  =================
                 Zebra mbuna  =================
       Burton's mouthbreeder  =================
         Princess of Burundi  =================
B D              Nile tilapia  =================
                 Spotted gar  =================
          Tibetan ground jay  =================
            Cape golden mole  =================
B D                    Rabbit  =================
            Tibetan antelope  =================
            Brush-tailed rat  =================
             Star-nosed mole  =================
B D            Naked mole-rat  =================
                    Aardvark  =================
B D                  Microbat  =================
B D                   Ferret   =================
                  Chinchilla  =================
B D                 Armadillo  =================
B D                   Manatee  =================
B D                  Elephant  NNNNNNNNNNNNNNNNN
B D                  Squirrel  =================

Inserts between block 16 and 17 in window
B D       American alligator 1bp
  D Chinese softshell turtle 4bp

Alignment block 17 of 913 in window, 6379963 - 6380048, 86 bps 
B D                     Human  gaagttacccagtgggc--agcac--------aggcc-----------cttggtcagtgtg---------
B D                     Chimp  gaagttacccagtgggc--agcac--------aggcc-----------cttggtcagtgtg---------
B D                   Gorilla  gaagttacccagtgggc--agcac--------aggcc-----------cttggtcagtgtg---------
B D                 Orangutan  gaagttacccagtgggc--agcac--------aggcc-----------cttggtcagtgtg---------
B D                    Gibbon  gaagttgcccaatgggc--agaac--------agccc-----------cttggtcagtgtg---------
B D                    Rhesus  ga--------agtgggg--agcac--------gggcc-----------cttggtcagtgtg---------
B D       Crab-eating macaque  ga--------agtgggg--agcac--------gggcc-----------cttggtcagtgtg---------
B D                    Baboon  gaagttacccagtgagc--agcac--------aggcc-----------cttggtcagtgtg---------
B D              Green monkey  ga--------agtgggc--agcac--------aggcc-----------cttggtcagtgtg---------
B D                  Marmoset  -----tacccggtgg-----gcac--------aggcc-----------cttggtcagcgtg---------
B D           Squirrel monkey  -----tacccggtgggc--agcac--------aggcc-------------tggtcagcgcg---------
B D                  Bushbaby  gaagcttcccagcaggc--agcac--------agatg-----------cttagtcagtgtg---------
           Chinese tree shrew  gaagttacccagcaggc--agccccg------aggccgagg-------ccgagtcactgtg---------
B D                       Pig  gaaatcacccagc-------------------agcag-----------ctcggtggagg-----------
B D                    Alpaca  gaaatcacccagg-------------------agagg-----------ctcggtggaca-----------
               Bactrian camel  gaaatcacccagg-------------------agagg-----------ctcggtggaca-----------
B D                   Dolphin  gagatcacccagc-------------------agaag-----------cccagtggagg-----------
                 Killer whale  gagatcacccagc-------------------agaag-----------cccagtggagg-----------
B D                       Cow  gaaatcagccagc----------------------ag-----------ctccacggagg-----------
                Domestic goat  gaaatcagccagc----------------------ag-----------ctccatggagg-----------
B D                     Horse  gaaatcacccagcgtgc------------ggcagagg-----------ctcagccaatgag---------
B D          White rhinoceros  gaaatcagccagcgtgt------------ggcagagg-----------ctcagtcaacgtg---------
B D                       Cat  gaga-ccgccagcctgc----gac-----ggcagatg-----------ctcagcgagcaca---------
B D                       Dog  ggga-cggcc-----gc----cca-----cgcagaca-----------cgcagagagcacc---------
B D                     Panda  gaga-cgccccgcccgc------------agcggatg-----------ctcagtgagggcg---------
               Pacific walrus  gaga-cggcccacgtgc----ccatgcgggctggatg-----------ctcagtgagtgcg---------
                 Weddell seal  gaga-cagcccacgtgc----ccatgtggggtggatg-----------ctcagtgagtgcg---------
             Black flying-fox  gaaatcacccagc---------------------------------------------------------
B D                   Megabat  gaaatcagccagc---------------------------------------------------------
                Big brown bat  gaaatcaccccatgtgc-----------------------------------------------------
         David's myotis (bat)  gaaatcaccccatgtgc-----------------------------------------------------
B D        American alligator  ----------------------ca--------agggg-----------cggagtcatgggagcagtgagc
  D           Green seaturtle  -----------gcagac--accct--------ggggg-----------cagggcccagggagcacccg--
  D            Painted turtle  ----------------------------------------------------------ggagcacccg--
  D  Chinese softshell turtle  -------------gggctgacctc--------gggagaaacagacaacccaggcaggggtaccgccaa--
         Cape elephant shrew  ======================================================================
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D           Chinese hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  ======================================================================
B D                    Tenrec  ======================================================================
B D                     Sheep  ======================================================================
B D                     Shrew  ======================================================================
B D                Guinea pig  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ----------------------------------------------------------------------
  D       Collared flycatcher  ======================================================================
B D                   Opossum  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
                 Spotted gar  ======================================================================
          Tibetan ground jay  ======================================================================
            Cape golden mole  ======================================================================
B D                    Rabbit  ======================================================================
            Tibetan antelope  ======================================================================
            Brush-tailed rat  ======================================================================
             Star-nosed mole  ======================================================================
B D            Naked mole-rat  ======================================================================
                    Aardvark  ======================================================================
B D                  Microbat  ======================================================================
B D                   Ferret   ======================================================================
                  Chinchilla  ======================================================================
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ======================================================================

                        Human  ------agggaggccgagccaggagga---ggagg-------------------------acaataaga-
                        Chimp  ------agggaggctcagccaggagaa---ggagg-------------------------acaataaga-
                      Gorilla  ------agggaggctgagccaggagga---ggagg-------------------------acaataaga-
                    Orangutan  ------agggaggctgagccaggagga---ggagg-------------------------acaataaga-
                       Gibbon  ------agggaggctgagccaggagaa---ggagg-------------------------acaat---a-
                       Rhesus  ------agggaggctgagccaggagaa---ggagg-------------------------acagtaaga-
          Crab-eating macaque  ------agggaggctgagccaggagaa---ggagg-------------------------acagtaaga-
                       Baboon  ------agggaggctgagctgggagaa---agagg-------------------------acaataagaa
                 Green monkey  ------agggaggctgagccaggagaa---ggagg-------------------------acagtaaga-
                     Marmoset  ------agagaggctgaacagggagaa---agagg-------------------------acacgaaga-
              Squirrel monkey  ------aaggaggctgagcagggagac---agagg-------------------------acgagaaga-
                     Bushbaby  ------tcagagggtgagtaaggagga---atagg-------------------------g-ggtgaaa-
           Chinese tree shrew  ------agag-ggctcagccggggcga---gg---------------------------------gaga-
                          Pig  ----------aggttaag------ggg---caaga-------------------------agagaatta-
                       Alpaca  ----------aggcagag------tgg---caaaa-------------------------acacgggca-
               Bactrian camel  ----------aggcagag------ggg---caaac-------------------------agatgggca-
                      Dolphin  ----------aggctgag------ggg---taagg-------------------------agaggatta-
                 Killer whale  ----------aggctgag------ggg---taagg-------------------------agaggatta-
                          Cow  ----------aggctgag------ggg--gtaagg-------------------------agaggatta-
                Domestic goat  ----------acgctgag------ggg--ctaagg-------------------------agagggtta-
                        Horse  ------acagaggttgag------caa---taaag-------------------------cgaggaa-g-
             White rhinoceros  ------gcagaggttgag------gga---taagg-------------------------cgaggaa-t-
                          Cat  ------gc--tggcggaa------ggc---taa----------------------------gaggagca-
                          Dog  ------at--gggctgag------gac---ta------------------------------aggagcc-
                        Panda  ------ac--agcctgag------gac---taa----------------------------gaggagcc-
               Pacific walrus  ------ac--aggctgag------gac---taa----------------------------gaggaaca-
                 Weddell seal  ------ac--aggctgat------gac---caa----------------------------gaggaaca-
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
                Big brown bat  -------------------------------aa--------------------------------aata-
         David's myotis (bat)  -------------------------------aa--------------------------------aata-
           American alligator  agagctaggggagtaggg------gcagtgccaat-------------------------gcaaggggc-
              Green seaturtle  ------agggaggcaggg------gcc---ccagg----------------gactgcccctgagcgaga-
               Painted turtle  ------agggaggcaggg------gcc---ccagggacggcccctgagtgagatttctcaggagataag-
     Chinese softshell turtle  ------acgggggcacgg------gcaccgccagg--------------------actcggcaccaagg-
          Cape elephant shrew  ======================================================================
               Golden hamster  ======================================================================
                 Prairie vole  ======================================================================
                        Mouse  ======================================================================
                          Rat  ======================================================================
                       Medaka  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
              Chinese hamster  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                         Pika  ======================================================================
                       Tenrec  ======================================================================
                        Sheep  ======================================================================
                        Shrew  ======================================================================
                   Guinea pig  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                      Wallaby  ======================================================================
              Tasmanian devil  ----------------------------------------------------------------------
          Collared flycatcher  ======================================================================
                      Opossum  ======================================================================
             Peregrine falcon  ======================================================================
                   Coelacanth  ======================================================================
                    Tetraodon  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                  Spotted gar  ======================================================================
           Tibetan ground jay  ======================================================================
             Cape golden mole  ======================================================================
                       Rabbit  ======================================================================
             Tibetan antelope  ======================================================================
             Brush-tailed rat  ======================================================================
              Star-nosed mole  ======================================================================
               Naked mole-rat  ======================================================================
                     Aardvark  ======================================================================
                     Microbat  ======================================================================
                      Ferret   ======================================================================
                   Chinchilla  ======================================================================
                    Armadillo  ======================================================================
                      Manatee  ======================================================================
                     Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Squirrel  ======================================================================

                        Human  --aggccta--acag--
                        Chimp  --aggccta--acag--
                      Gorilla  --aggccta--acag--
                    Orangutan  --aggccta--acag--
                       Gibbon  --aggccta--acag--
                       Rhesus  --aggtcta--acag--
          Crab-eating macaque  --aggtcta--acag--
                       Baboon  ggaggccta--acag--
                 Green monkey  --aggccta--acag--
                     Marmoset  --aggccta--ccag--
              Squirrel monkey  --aggccta--ccag--
                     Bushbaby  --gggtcta--aaat--
           Chinese tree shrew  --cgctcca--ccag--
                          Pig  --agttcta--agag--
                       Alpaca  --agttcca--agag--
               Bactrian camel  --agttcca--agag--
                      Dolphin  --agttct---agag--
                 Killer whale  --agttct---agag--
                          Cow  --agttcta--agag--
                Domestic goat  --agtccta--agag--
                        Horse  --agttctg--agag--
             White rhinoceros  --agttctg--agag--
                          Cat  --agctcta--aggg--
                          Dog  --agctcca--aggg--
                        Panda  --agctcta--aggg--
               Pacific walrus  --ggctcta--aggg--
                 Weddell seal  --ggctcta--aggg--
             Black flying-fox  ---attcta--agag--
                      Megabat  ---attcta--agag--
                Big brown bat  --agttcta--agag--
         David's myotis (bat)  --agttctg--agag--
           American alligator  --agggtca--tgggag
              Green seaturtle  --tctctca--ggaaac
               Painted turtle  --gcaggcaggggaggg
     Chinese softshell turtle  --gcggcct--gggggg
          Cape elephant shrew  =================
               Golden hamster  =================
                 Prairie vole  =================
                        Mouse  =================
                          Rat  =================
                       Medaka  =================
     Mexican tetra (cavefish)  =================
              Chinese hamster  =================
       Lesser Egyptian jerboa  =================
                         Pika  =================
                       Tenrec  =================
                        Sheep  =================
                        Shrew  =================
                   Guinea pig  =================
                    Zebrafish  =================
                X. tropicalis  =================
                       Lizard  =================
       Yellowbelly pufferfish  =================
                         Fugu  =================
                      Wallaby  =================
              Tasmanian devil  -----------------
          Collared flycatcher  =================
                      Opossum  =================
             Peregrine falcon  =================
                   Coelacanth  =================
                    Tetraodon  =================
                  Stickleback  =================
           Southern platyfish  =================
          Pundamilia nyererei  =================
                  Zebra mbuna  =================
        Burton's mouthbreeder  =================
          Princess of Burundi  =================
                 Nile tilapia  =================
                  Spotted gar  =================
           Tibetan ground jay  =================
             Cape golden mole  =================
                       Rabbit  =================
             Tibetan antelope  =================
             Brush-tailed rat  =================
              Star-nosed mole  =================
               Naked mole-rat  =================
                     Aardvark  =================
                     Microbat  =================
                      Ferret   =================
                   Chinchilla  =================
                    Armadillo  =================
                      Manatee  =================
                     Elephant  NNNNNNNNNNNNNNNNN
                     Squirrel  =================

Alignment block 18 of 913 in window, 6380049 - 6380051, 3 bps 
B D                     Human  gca
B D                     Chimp  gca
B D                   Gorilla  gca
B D                 Orangutan  gca
B D                    Gibbon  gca
B D                    Rhesus  gca
B D       Crab-eating macaque  gca
B D                    Baboon  gca
B D              Green monkey  gca
B D                  Marmoset  gca
B D           Squirrel monkey  gca
B D                  Bushbaby  gca
           Chinese tree shrew  gca
B D                       Pig  gcc
B D                    Alpaca  gcg
               Bactrian camel  gca
B D                   Dolphin  gtt
                 Killer whale  gtt
B D                       Cow  gcg
                Domestic goat  gtg
B D                     Horse  gcg
B D          White rhinoceros  gcg
B D                       Cat  gca
B D                       Dog  tca
B D                     Panda  gca
               Pacific walrus  gca
                 Weddell seal  gca
             Black flying-fox  gc-
B D                   Megabat  gc-
                Big brown bat  aca
         David's myotis (bat)  aca
                     Aardvark  gct
         Cape elephant shrew  ===
              Golden hamster  ===
                Prairie vole  ===
B D                     Mouse  ===
B D                       Rat  ===
B D                    Medaka  ===
    Mexican tetra (cavefish)  ===
B D           Chinese hamster  ===
      Lesser Egyptian jerboa  ===
B D                      Pika  ===
B D                    Tenrec  ===
B D                     Sheep  ===
B D                     Shrew  ===
B D                Guinea pig  ===
B D                 Zebrafish  ===
B D             X. tropicalis  ===
B D                    Lizard  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                   Wallaby  ===
B D           Tasmanian devil  ---
  D       Collared flycatcher  ===
B D                   Opossum  ===
  D          Peregrine falcon  ===
B D                Coelacanth  ===
  D  Chinese softshell turtle  ---
  D           Green seaturtle  ---
  D            Painted turtle  ---
B D                 Tetraodon  ===
B D               Stickleback  ===
          Southern platyfish  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
                 Spotted gar  ===
B D        American alligator  ---
          Tibetan ground jay  ===
            Cape golden mole  ===
B D                    Rabbit  ===
            Tibetan antelope  ===
            Brush-tailed rat  ===
             Star-nosed mole  ===
B D            Naked mole-rat  ===
B D                  Microbat  ===
B D                   Ferret   ===
                  Chinchilla  ===
B D                 Armadillo  ===
B D                   Manatee  ===
B D                  Elephant  NNN
B D                  Squirrel  ===

Alignment block 19 of 913 in window, 6380052 - 6380064, 13 bps 
B D                     Human  tctgaagatt-cc-----------------a
B D                     Chimp  tctgaagatt-cc-----------------a
B D                   Gorilla  tctgaagatt-cc-----------------a
B D                 Orangutan  gctgaagatt-cc-----------------a
B D                    Gibbon  tctgaagatt-cc-----------------a
B D                    Rhesus  tctgaagatt-cc-----------------a
B D       Crab-eating macaque  tctgaagatt-cc-----------------a
B D                    Baboon  tctgaagagt-cc-----------------a
B D              Green monkey  tctgaagatt-cc-----------------a
B D                  Marmoset  gctgaagatt-cc-----------------a
B D           Squirrel monkey  gctgaagatt-cc-----------------a
B D                  Bushbaby  tctgaaggtt-gc-----------------a
           Chinese tree shrew  --cgacggtc-cc-----------------g
B D                       Pig  tg----------------------------a
B D                    Alpaca  tctgaaggtt-cc-----------------a
               Bactrian camel  tctaaaggtt-cc-----------------a
B D                   Dolphin  tc----------------------------a
                 Killer whale  tc----------------------------a
B D                       Cow  tc-----------------------------
                Domestic goat  tc-----------------------------
B D                     Horse  tctgaaggtt-cc-----------------a
B D          White rhinoceros  tcggaaggtt-cc-----------------a
B D                       Cat  g-ggaaagtt-cc-----------------g
B D                       Dog  ggggaaggttccc-----------------g
B D                     Panda  gcggaaggtt-cc-----------------a
               Pacific walrus  gtggaaggtt-cc-----------------a
                 Weddell seal  gcggaaggtt-cc-----------------a
             Black flying-fox  tctcagggtt-ccaggaggcggggccgggga
B D                   Megabat  tctcagggtt-ccaggaggcggggccgggga
                Big brown bat  tctcaaggtt-ct-----------------a
         David's myotis (bat)  tctcaaggct-ct-----------------a
B D                   Manatee  tttaaaagtt-cc-----------------a
                     Aardvark  ttttaaagtt-cc-----------------a
B D        American alligator  ----cag------------------------
  D           Green seaturtle  ----aag------------------------
  D            Painted turtle  ----ggg------------------------
  D  Chinese softshell turtle  ----cag------------------------
         Cape elephant shrew  ===============================
              Golden hamster  ===============================
                Prairie vole  ===============================
B D                     Mouse  ===============================
B D                       Rat  ===============================
B D                    Medaka  ===============================
    Mexican tetra (cavefish)  ===============================
B D           Chinese hamster  ===============================
      Lesser Egyptian jerboa  ===============================
B D                      Pika  ===============================
B D                    Tenrec  ===============================
B D                     Sheep  ===============================
B D                     Shrew  ===============================
B D                Guinea pig  ===============================
B D                 Zebrafish  ===============================
B D             X. tropicalis  ===============================
B D                    Lizard  ===============================
      Yellowbelly pufferfish  ===============================
B D                      Fugu  ===============================
B D                   Wallaby  ===============================
B D           Tasmanian devil  -------------------------------
  D       Collared flycatcher  ===============================
B D                   Opossum  ===============================
  D          Peregrine falcon  ===============================
B D                Coelacanth  ===============================
B D                 Tetraodon  ===============================
B D               Stickleback  ===============================
          Southern platyfish  ===============================
         Pundamilia nyererei  ===============================
                 Zebra mbuna  ===============================
       Burton's mouthbreeder  ===============================
         Princess of Burundi  ===============================
B D              Nile tilapia  ===============================
                 Spotted gar  ===============================
          Tibetan ground jay  ===============================
            Cape golden mole  ===============================
B D                    Rabbit  ===============================
            Tibetan antelope  ===============================
            Brush-tailed rat  ===============================
             Star-nosed mole  ===============================
B D            Naked mole-rat  ===============================
B D                  Microbat  ===============================
B D                   Ferret   ===============================
                  Chinchilla  ===============================
B D                 Armadillo  ===============================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ===============================

Inserts between block 19 and 20 in window
B D                  Manatee 2bp
                    Aardvark 21bp

Alignment block 20 of 913 in window, 6380065 - 6380077, 13 bps 
B D                     Human  gaaggaagg--gcca
B D                     Chimp  gaaggaagg--acaa
B D                   Gorilla  gaaggaagg--gcca
B D                 Orangutan  gaaggaagg--gcca
B D                    Gibbon  gaagaaagg--gcca
B D                    Rhesus  ggagg---g--gcca
B D       Crab-eating macaque  ggagg---g--gcca
B D                    Baboon  gaaggaacg--gccc
B D              Green monkey  gaaggaggg--gcca
B D                  Marmoset  gaag----g--ggca
B D           Squirrel monkey  gaag----g--gcca
B D                  Bushbaby  ggag----g--gctt
           Chinese tree shrew  ggggaaa-g--gcca
B D                       Pig  gaaaga---------
B D                    Alpaca  gaaaggagg--gact
               Bactrian camel  gaaaggagg--gact
B D                   Dolphin  gaagcaggg--gact
                 Killer whale  gaagcaggg--gact
B D                       Cow  --tacaggc--ggca
                Domestic goat  --tacaggc--ggcg
B D                     Horse  gaaggagga--acta
B D          White rhinoceros  gaaggagga--acca
B D                       Cat  gaaggaagg--gccc
B D                       Dog  gagggaggg--acct
B D                     Panda  gagggaggg--gccc
               Pacific walrus  gaggcaggg--gccc
                 Weddell seal  gagggaggg--gccc
             Black flying-fox  gaacaagaa--aagt
B D                   Megabat  gaacaagaa--aagt
                Big brown bat  gaaggagga--gtgg
         David's myotis (bat)  gaaggagga--gcgg
              Star-nosed mole  ggaggagag--gctg
B D                   Manatee  gagagaagg--aaaa
                     Aardvark  gacagaagg--gtaa
B D        American alligator  ggagcaaggctaagc
  D           Green seaturtle  gcaggcagg--gagg
  D            Painted turtle  gtaaacagg--gaca
  D  Chinese softshell turtle  ggagcaacg--gcaa
         Cape elephant shrew  ===============
              Golden hamster  ===============
                Prairie vole  ===============
B D                     Mouse  ===============
B D                       Rat  ===============
B D                    Medaka  ===============
    Mexican tetra (cavefish)  ===============
B D           Chinese hamster  ===============
      Lesser Egyptian jerboa  ===============
B D                      Pika  ===============
B D                    Tenrec  ===============
B D                     Sheep  ===============
B D                     Shrew  ===============
B D                Guinea pig  ===============
B D                 Zebrafish  ===============
B D             X. tropicalis  ===============
B D                    Lizard  ===============
      Yellowbelly pufferfish  ===============
B D                      Fugu  ===============
B D                   Wallaby  ===============
B D           Tasmanian devil  ---------------
  D       Collared flycatcher  ===============
B D                   Opossum  ===============
  D          Peregrine falcon  ===============
B D                Coelacanth  ===============
B D                 Tetraodon  ===============
B D               Stickleback  ===============
          Southern platyfish  ===============
         Pundamilia nyererei  ===============
                 Zebra mbuna  ===============
       Burton's mouthbreeder  ===============
         Princess of Burundi  ===============
B D              Nile tilapia  ===============
                 Spotted gar  ===============
          Tibetan ground jay  ===============
            Cape golden mole  ===============
B D                    Rabbit  ===============
            Tibetan antelope  ===============
            Brush-tailed rat  ===============
B D            Naked mole-rat  ===============
B D                  Microbat  ===============
B D                   Ferret   ===============
                  Chinchilla  ===============
B D                 Armadillo  ===============
B D                  Elephant  NNNNNNNNNNNNNNN
B D                  Squirrel  ===============

Inserts between block 20 and 21 in window
B D                    Horse 22bp
B D         White rhinoceros 22bp
B D                      Cat 26bp
B D                      Dog 8bp
B D                    Panda 22bp
              Pacific walrus 22bp
                Weddell seal 22bp
            Black flying-fox 5bp
B D                  Megabat 5bp
               Big brown bat 22bp
        David's myotis (bat) 22bp
             Star-nosed mole 1bp
B D                  Manatee 1bp
                    Aardvark 1bp

Alignment block 21 of 913 in window, 6380078 - 6380110, 33 bps 
B D                     Human  ga-----------ggaggag-------------atggct--t----aacttttccagaattgc
B D                     Chimp  ga-----------gggggag-------------atggct--t----aacttttccggaattgc
B D                   Gorilla  ga-----------ggaggag-------------atagct--t----aacttttccggaattgc
B D                 Orangutan  ca-----------ggaggag-------------atggct--t----aacttttccagaattgc
B D                    Gibbon  ga-----------ggaggag-------------atggct--t----aacttttccagaattgc
B D                    Rhesus  ga-----------ggaggag-------------atggct--t----aacctttccagaattgc
B D       Crab-eating macaque  ga-----------ggaggag-------------atggct--t----aacctttccagaattgc
B D                    Baboon  ga-----------ggaggag-------------atggct--t---aaacttttccagaattgc
B D              Green monkey  ga-----------ggaggag-------------atggct--t----aacctttccagaattgc
B D                  Marmoset  ga-----------ggaggaa-------------atggct--t---aaacttttccaaaattgc
B D           Squirrel monkey  ga-----------ggaggaa-------------atggct--t---aaacttttccaaacttgc
B D                  Bushbaby  ga-----------aagagaa-------------actgct--t----aa--------gaattgg
           Chinese tree shrew  gaaagaagtcggtggaggag-------------gccact--acgtaggctctcctggaattgg
B D                       Pig  ----------------gaag-------------agtgag--a---gaagtaaactgagataaa
B D                    Alpaca  ----------------ggag-------------agaggg--a---gaagtaaaccgaggagaa
               Bactrian camel  ----------------ggag-------------agaggg--a---gaagtaaaccgaggagaa
B D                   Dolphin  ----------------ggag-------------actgag--a---gaagtaaactgtggagaa
                 Killer whale  ----------------ggag-------------actgag--a---gaagtaaactgtggagaa
B D                       Cow  ----------------gga----------------tgag--a---gg----------------
                Domestic goat  ----------------gga----------------cgag--a---gg----------------
B D                     Horse  ga-----------ggagaac-------------actgct--c---aggtttttccagaatggg
B D          White rhinoceros  ga-----------ggagaaa-------------actgct--t---aggtttctccagaattga
B D                       Cat  --------------aagaaa-------------atggcc--a---gcgttgttctggaattgg
B D                       Dog  ---------------agagg-------------acggcc--c---ggggtgatcccgcactga
B D                     Panda  --------------gagaaa-------------actgcc--t---ggggtgacctggaatgga
               Pacific walrus  --------------gagaaa-------------actgcc--c---ggagtgatttggaattga
                 Weddell seal  --------------gagaaa-------------actgcc--c---agggtgatttggaattga
             Black flying-fox  ga-----------ggagaat-------------gctgat--t---aggtttttctagacttat
B D                   Megabat  ga-----------ggagaat-------------gctgat--t---aggtttttccagacttat
                Big brown bat  ga-----------gaagaat-------------gctgct--t---aggtttttcca-acttat
         David's myotis (bat)  ga-----------gaagaat-------------gctgct--t---aggtttttcca-acttat
B D                  Microbat  ga-----------gaagaat-------------gctgct--t---aggtttttcca-acttat
              Star-nosed mole  cg-----------gggtgag-------------agctcc--c---aggctgctcctgaactgc
B D                   Manatee  ga-----------ggcaaag-------------actgct--t---atatcgatccagcactga
                     Aardvark  ga-----------agcaaag-------------aaggca--a---agactcttccagaatgga
B D        American alligator  -----------gagcagggg-----gc------gtggccagt---gcaaaggggc--------
  D           Green seaturtle  -----------taacagggacattccc------ccagcc--t---accttgtccctac-----
  D            Painted turtle  -----------taccacgaa-------------gcagcc------acatcggggctga-----
  D  Chinese softshell turtle  -----------agccaggag-----ccgaggggctggcc--c---aagccaggtgtgg-----
         Cape elephant shrew  ===============================================================
              Golden hamster  ===============================================================
                Prairie vole  ===============================================================
B D                     Mouse  ===============================================================
B D                       Rat  ===============================================================
B D                    Medaka  ===============================================================
    Mexican tetra (cavefish)  ===============================================================
B D           Chinese hamster  ===============================================================
      Lesser Egyptian jerboa  ===============================================================
B D                      Pika  ===============================================================
B D                    Tenrec  ===============================================================
B D                     Sheep  ===============================================================
B D                     Shrew  ===============================================================
B D                Guinea pig  ===============================================================
B D                 Zebrafish  ===============================================================
B D             X. tropicalis  ===============================================================
B D                    Lizard  ===============================================================
      Yellowbelly pufferfish  ===============================================================
B D                      Fugu  ===============================================================
B D                   Wallaby  ===============================================================
B D           Tasmanian devil  ---------------------------------------------------------------
  D       Collared flycatcher  ===============================================================
B D                   Opossum  ===============================================================
  D          Peregrine falcon  ===============================================================
B D                Coelacanth  ===============================================================
B D                 Tetraodon  ===============================================================
B D               Stickleback  ===============================================================
          Southern platyfish  ===============================================================
         Pundamilia nyererei  ===============================================================
                 Zebra mbuna  ===============================================================
       Burton's mouthbreeder  ===============================================================
         Princess of Burundi  ===============================================================
B D              Nile tilapia  ===============================================================
                 Spotted gar  ===============================================================
          Tibetan ground jay  ===============================================================
            Cape golden mole  ===============================================================
B D                    Rabbit  ===============================================================
            Tibetan antelope  ===============================================================
            Brush-tailed rat  ===============================================================
B D            Naked mole-rat  ===============================================================
B D                   Ferret   ===============================================================
                  Chinchilla  ===============================================================
B D                 Armadillo  ===============================================================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ===============================================================

Alignment block 22 of 913 in window, 6380111 - 6380126, 16 bps 
B D                     Human  taactac----gg---ggc-cctg--------------
B D                     Chimp  taactac----gg---ggc-cctg--------------
B D                   Gorilla  taactac----gg---ggc-cctg--------------
B D                 Orangutan  taactac----gg---gga-cctg--------------
B D                    Gibbon  taactac----gg---ggc-cctg--------------
B D                    Rhesus  taactat----gg---ggc-cctg--------------
B D       Crab-eating macaque  taactat----gg---ggc-cctg--------------
B D                    Baboon  taactac----ag---ggc-cctg--------------
B D              Green monkey  taactct----gg---ggc-cctg--------------
B D                  Marmoset  taactct----gg---ggc-cctg--------------
B D           Squirrel monkey  tagctct----gg---ggc-cctg--------------
B D                  Bushbaby  taatact----ggctcggcacctg--------------
           Chinese tree shrew  ctccacg----gg---ggc-cctg--------------
B D                       Pig  atgc-tg----gg---ggt-cctc--------------
B D                    Alpaca  agca-gc----ag---ggg-cccc--------------
               Bactrian camel  agca-gc----ag---ggg-cccc--------------
B D                   Dolphin  aaca-ct----gg---ggt-cctc--------------
                 Killer whale  aaca-ct----gg---ggt-cctc--------------
B D                     Horse  taac-actggcgg---g---cccg--------------
B D          White rhinoceros  taac-gccggggg---ggt-cctg--------------
B D                       Cat  caac-ct----gg---ggc-gccg--------------
B D                       Dog  caag-------gg---ggc-tctg--------------
B D                     Panda  caag-gc----gg---ggc-tccg--------------
               Pacific walrus  caag-gt---ggg---ggc-tctg--------------
                 Weddell seal  caag-gc----gg---ggc-tctg--------------
             Black flying-fox  taat-gc----cg---ggt-cctg--------------
B D                   Megabat  taat-gc----cg---ggt-cctg--------------
                Big brown bat  taat-gc----tg---ggg-cctg--------------
         David's myotis (bat)  taat-gc----tg---gct-cctg--------------
B D                  Microbat  taat-gc----tg---ggt-cctg--------------
              Star-nosed mole  tcac-ga----gg---ggc-cct---------------
B D                   Manatee  tgaa-gc----gg---gaatccct--------------
                     Aardvark  tgaa-ac----gg---gactgctt--------------
           Tibetan ground jay  ----------------------tagcttgggggtcctg
B D        American alligator  ------------------------------ggggccag
  D           Green seaturtle  ----------------------tcaccacaaag---tg
  D            Painted turtle  ----------------------gga-------------
  D  Chinese softshell turtle  ----------------------ggacagcagggacacg
         Cape elephant shrew  ======================================
              Golden hamster  ======================================
                Prairie vole  ======================================
B D                     Mouse  ======================================
B D                       Rat  ======================================
B D                    Medaka  ======================================
    Mexican tetra (cavefish)  ======================================
B D           Chinese hamster  ======================================
      Lesser Egyptian jerboa  ======================================
B D                      Pika  ======================================
B D                    Tenrec  ======================================
               Domestic goat  --------------------------------------
B D                     Sheep  ======================================
B D                     Shrew  ======================================
B D                       Cow  --------------------------------------
B D                Guinea pig  ======================================
B D                 Zebrafish  ======================================
B D             X. tropicalis  ======================================
B D                    Lizard  ======================================
      Yellowbelly pufferfish  ======================================
B D                      Fugu  ======================================
B D                   Wallaby  ======================================
B D           Tasmanian devil  --------------------------------------
  D       Collared flycatcher  ======================================
B D                   Opossum  ======================================
  D          Peregrine falcon  ======================================
B D                Coelacanth  ======================================
B D                 Tetraodon  ======================================
B D               Stickleback  ======================================
          Southern platyfish  ======================================
         Pundamilia nyererei  ======================================
                 Zebra mbuna  ======================================
       Burton's mouthbreeder  ======================================
         Princess of Burundi  ======================================
B D              Nile tilapia  ======================================
                 Spotted gar  ======================================
            Cape golden mole  ======================================
B D                    Rabbit  ======================================
            Tibetan antelope  ======================================
            Brush-tailed rat  ======================================
B D            Naked mole-rat  ======================================
B D                   Ferret   ======================================
                  Chinchilla  ======================================
B D                 Armadillo  ======================================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ======================================

Inserts between block 22 and 23 in window
          Tibetan ground jay 23bp
B D       American alligator 6bp
  D          Green seaturtle 31bp
  D           Painted turtle 29bp
  D Chinese softshell turtle 35bp

Alignment block 23 of 913 in window, 6380127 - 6380138, 12 bps 
B D                     Human  -ggagtcagg--g-------ag
B D                     Chimp  -ggagtcagg--g-------ag
B D                   Gorilla  -ggagtcagg--g-------ag
B D                 Orangutan  -ggagtcagg--g-------ag
B D                    Gibbon  -ggagtcagg--g-------ag
B D                    Rhesus  -ggagtcagg--g-------ag
B D       Crab-eating macaque  -ggagtcagg--g-------ag
B D                    Baboon  -ggagtccgg--g-------ag
B D              Green monkey  -ggagtcagg--g-------ag
B D                  Marmoset  -ggagtcagg--g-------ag
B D           Squirrel monkey  -ggagacagg--g-------ag
B D                  Bushbaby  -tggctcaag--t-------gg
           Chinese tree shrew  -aggagcagg--g-------ag
B D                       Pig  -agacccagg--g-------ga
B D                    Alpaca  -tcggcctgg--g-------gg
               Bactrian camel  -tcagcctgg--g-------gg
B D                   Dolphin  -agactcaga--g-------gg
                 Killer whale  -agactcaga--g-------gg
B D                       Cow  ------cag-------------
                Domestic goat  ------cagc--g-------ag
B D                     Horse  -ggattcaag--ga------gg
B D          White rhinoceros  -ggattcagg--ga------gg
B D                       Cat  -ggattcagg--c-------ag
B D                       Dog  -ggactcagg--g-------ag
B D                     Panda  -ggactcggg--g-------ag
               Pacific walrus  -ggattgggg--gggggggcgg
                 Weddell seal  -ggatttggg--g-------ag
             Black flying-fox  -ggattcagg--g-------ag
B D                   Megabat  -ggattcagg--g-------ag
                Big brown bat  -ggattcagg--g-------ag
         David's myotis (bat)  -ggattcagg--g-------ag
B D                  Microbat  -ggattcagg--g-------ag
              Star-nosed mole  -ggtctcagg------------
B D                   Manatee  -ggattcagg--g-------ag
                     Aardvark  -gggtgcagg--g-------ag
           Tibetan ground jay  ggggtcccat--g-------g-
  D              Mallard duck  ggaacccaat--a-------a-
B D        American alligator  gggggctaattca-------a-
  D           Green seaturtle  gaggtccctt--g-------g-
  D            Painted turtle  aggaccccat--g-------g-
  D  Chinese softshell turtle  ggggtcccta--a-------g-
         Cape elephant shrew  ======================
              Golden hamster  ======================
                Prairie vole  ======================
B D                     Mouse  ======================
B D                       Rat  ======================
B D                    Medaka  ======================
    Mexican tetra (cavefish)  ======================
B D           Chinese hamster  ======================
      Lesser Egyptian jerboa  ======================
B D                      Pika  ======================
B D                    Tenrec  ======================
B D                     Sheep  ======================
B D                     Shrew  ======================
B D                Guinea pig  ======================
B D                 Zebrafish  ======================
B D             X. tropicalis  ======================
B D                    Lizard  ======================
      Yellowbelly pufferfish  ======================
B D                      Fugu  ======================
B D                   Wallaby  ======================
B D           Tasmanian devil  ----------------------
  D       Collared flycatcher  ======================
B D                   Opossum  ======================
  D          Peregrine falcon  ======================
B D                Coelacanth  ======================
B D                 Tetraodon  ======================
B D               Stickleback  ======================
          Southern platyfish  ======================
         Pundamilia nyererei  ======================
                 Zebra mbuna  ======================
       Burton's mouthbreeder  ======================
         Princess of Burundi  ======================
B D              Nile tilapia  ======================
                 Spotted gar  ======================
            Cape golden mole  ======================
B D                    Rabbit  ======================
            Tibetan antelope  ======================
            Brush-tailed rat  ======================
B D            Naked mole-rat  ======================
B D                   Ferret   ======================
                  Chinchilla  ======================
B D                 Armadillo  ======================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ======================

Inserts between block 23 and 24 in window
B D                      Cow 1bp

Alignment block 24 of 913 in window, 6380139 - 6380143, 5 bps 
B D                     Human  caag------------------------------------------------------------------
B D                     Chimp  caggatggcgaaggggc---actgagagcctgaagttctggagggcagagcca---tgtattggacag--
B D                   Gorilla  ----------------------------------------------------------------------
B D                    Gibbon  ----------------------------------------------------------------------
B D                    Rhesus  ----------------------------------------------------------------------
B D       Crab-eating macaque  ----------------------------------------------------------------------
B D                    Baboon  ----------------------------------------------------------------------
B D              Green monkey  ----------------------------------------------------------------------
B D                  Bushbaby  --------ctaaggcgccagccacatacacctaaggtggcgggtttgaatccagcctggacccgccaaac
           Chinese tree shrew  ----------------------------------------------------------------------
B D                       Pig  ----------------------------------------------------------------------
B D                    Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
B D                   Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
B D                       Cow  ----------------------------------------------------------------------
B D                     Sheep  ----------------------------------------------------------------------
                Domestic goat  ----------------------------------------------------------------------
B D                     Horse  ----------------------------------------------------------------------
B D          White rhinoceros  ----------------------------------------------------------------------
B D                       Cat  ----------------------------------------------------------------------
B D                       Dog  ----------------------------------------------------------------------
B D                     Panda  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
B D                   Megabat  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
B D                  Microbat  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
B D                   Manatee  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
           Tibetan ground jay  ----------------------------------------------------------------------
  D              Mallard duck  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
  D           Green seaturtle  ----------------------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
         Cape elephant shrew  ======================================================================
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D           Chinese hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  ======================================================================
B D                    Tenrec  ======================================================================
B D                     Shrew  ======================================================================
B D                Guinea pig  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ----------------------------------------------------------------------
  D       Collared flycatcher  ======================================================================
B D                   Opossum  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
                 Spotted gar  ======================================================================
B D           Squirrel monkey  ----------------------------------------------------------------------
            Cape golden mole  ======================================================================
B D                    Rabbit  ======================================================================
            Brush-tailed rat  ======================================================================
B D            Naked mole-rat  ======================================================================
B D                   Ferret   ======================================================================
                  Chinchilla  ======================================================================
B D                 Armadillo  ======================================================================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ======================================================================
B D                  Marmoset  ----------------------------------------------------------------------
B D                 Orangutan  ----------------------------------------------------------------------

                        Human  --------------c----
                        Chimp  ---agcctc-actcc----
                      Gorilla  --------------c----
                       Gibbon  --------------c----
                       Rhesus  --------------c----
          Crab-eating macaque  --------------c----
                       Baboon  --------------c----
                 Green monkey  --------------c----
                     Bushbaby  gatagctgcaaccaa----
           Chinese tree shrew  --------------c----
                          Pig  -----------cagt----
                       Alpaca  ----------cgagc----
               Bactrian camel  ----------cgagc----
                      Dolphin  --------------t----
                 Killer whale  --------------t----
             Tibetan antelope  -----------catg----
                          Cow  -----------aagt----
                        Sheep  -----------cacg----
                Domestic goat  --------------t----
                        Horse  --------------a----
             White rhinoceros  --------------c----
                          Cat  --------------c----
                          Dog  --------------c----
                        Panda  --------------c----
               Pacific walrus  --------------c----
                 Weddell seal  --------------c----
             Black flying-fox  --------------t----
                      Megabat  --------------t----
                Big brown bat  --------------c----
         David's myotis (bat)  --------------c----
                     Microbat  --------------c----
              Star-nosed mole  ------------agc----
                      Manatee  ----------caagc----
                     Aardvark  ----------caagc----
           Tibetan ground jay  --------------ctc-a
                 Mallard duck  --------------caaga
           American alligator  --------------ggggc
              Green seaturtle  --------------ggagc
               Painted turtle  --------------g----
     Chinese softshell turtle  --------------ggagc
          Cape elephant shrew  ===================
               Golden hamster  ===================
                 Prairie vole  ===================
                        Mouse  ===================
                          Rat  ===================
                       Medaka  ===================
     Mexican tetra (cavefish)  ===================
              Chinese hamster  ===================
       Lesser Egyptian jerboa  ===================
                         Pika  ===================
                       Tenrec  ===================
                        Shrew  ===================
                   Guinea pig  ===================
                    Zebrafish  ===================
                X. tropicalis  ===================
                       Lizard  ===================
       Yellowbelly pufferfish  ===================
                         Fugu  ===================
                      Wallaby  ===================
              Tasmanian devil  -------------------
          Collared flycatcher  ===================
                      Opossum  ===================
             Peregrine falcon  ===================
                   Coelacanth  ===================
                    Tetraodon  ===================
                  Stickleback  ===================
           Southern platyfish  ===================
          Pundamilia nyererei  ===================
                  Zebra mbuna  ===================
        Burton's mouthbreeder  ===================
          Princess of Burundi  ===================
                 Nile tilapia  ===================
                  Spotted gar  ===================
              Squirrel monkey  -------------------
             Cape golden mole  ===================
                       Rabbit  ===================
             Brush-tailed rat  ===================
               Naked mole-rat  ===================
                      Ferret   ===================
                   Chinchilla  ===================
                    Armadillo  ===================
                     Elephant  NNNNNNNNNNNNNNNNNNN
                     Squirrel  ===================
                     Marmoset  -------------------
                    Orangutan  -------------------

Inserts between block 24 and 25 in window
B D                  Manatee 51bp
                    Aardvark 1bp

Alignment block 25 of 913 in window, 6380144 - 6380176, 33 bps 
B D                     Human  -----------------------------agg--atgtcgaa-----ggg--tc----------------
B D                     Chimp  -----------------------------agg--atggcgaa-----ggg--gc----------------
B D                   Gorilla  -----------------------------agg--atggcaaa-----ggg--gc----------------
B D                    Gibbon  -----------------------------agg--atggcgaa-----ggg--gc----------------
B D                    Rhesus  -----------------------------agg--atagtgaa-----ggg--gc----------------
B D       Crab-eating macaque  -----------------------------agg--atagtgaa-----ggg--gc----------------
B D                    Baboon  -----------------------------atg--atggcaaa-----ggg--gc----------------
B D              Green monkey  -----------------------------agg--atagt-------------------------------
B D                  Bushbaby  -----------------------------aaa--atagccgg-----gcgttgt----------------
           Chinese tree shrew  -----------------------------ggg--acagacag----------gc----------------
B D                       Pig  -----------------------------gtg--ggaatcaa-----gaa--cccaaggatt--------
B D                    Alpaca  -----------------------------gggatggaatcag-----gag--ccggaggaggaggatcc-
               Bactrian camel  -----------------------------ggg-cggaatcag-----gag--ccagaggatgaggatcc-
B D                   Dolphin  -----------------------------ggg--gtgacaga-----cgg--gc----------------
                 Killer whale  -----------------------------ggg--gtgacaga-----cgg--gc----------------
             Tibetan antelope  -----------------------------gag--gaggctga-----ggg--gctaaggagaggattaag
B D                       Cow  -----------------------------gtg--ggaatgaa-----g----------------------
B D                     Sheep  -----------------------------gag--gaggctga-----ggg--gctaaggagagggttaag
                Domestic goat  -----------------------------gtg--ggtatgaa-----gac--cctgaggattgtggaaaa
B D                     Horse  -----------------------------g-g--gtgacaga-----tgt--gc----------------
B D          White rhinoceros  -----------------------------g-a--gtgagaga-----cgg--gc----------------
B D                       Cat  -----------------------------a-g--gtgacagacaacgcga--gc----------------
B D                       Dog  -----------------------------a-g--gtgacagacaatgcga--gc----------------
B D                     Panda  -----------------------------a-g--gggacggacaaagcga--ac----------------
               Pacific walrus  -----------------------------a-g--gggccagacaacacga--gc----------------
                 Weddell seal  -----------------------------a-g--gggccagacaacgcga--gc----------------
             Black flying-fox  -----------------------------agg--gtgacaga-----tag--gc----------------
B D                   Megabat  -----------------------------agg--gtgacaga-----cag--gc----------------
                Big brown bat  -----------------------------agg--gtgacaag-----tgg--ac----------------
         David's myotis (bat)  -----------------------------agg--gtgacaat-----tgg--ac----------------
B D                  Microbat  -----------------------------agg--gtgacaag-----tgg--ac----------------
              Star-nosed mole  -----------------------------agg--gtgacgga-----ggg--gc----------------
                     Aardvark  -----------------------------gag--ctgtc-------------------------------
           Tibetan ground jay  ggggtcccatggctcaggggtcc--------c--ctggc-------------------------------
  D              Mallard duck  agaatcccaataaagggaatcct--------c--ccaat-------------------------------
B D        American alligator  ggggtcagagggaacgggaggcagggccaagt--gtgcc-------------------------------
  D           Green seaturtle  aggaccccatgggccaggtctcc---ccacag--ctgac-------------------------------
  D            Painted turtle  ------ccag-------gtctcc---ccacag--tggac-------------------------------
  D  Chinese softshell turtle  aggaccccatgggccaggtctcc---cccccg--------------------------------------
         Cape elephant shrew  ======================================================================
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D           Chinese hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  ======================================================================
B D                    Tenrec  ======================================================================
B D                     Shrew  ======================================================================
B D                Guinea pig  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ----------------------------------------------------------------------
  D       Collared flycatcher  ======================================================================
B D                   Opossum  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
                 Spotted gar  ======================================================================
B D           Squirrel monkey  ----------------------------------------------------------------------
            Cape golden mole  ======================================================================
B D                    Rabbit  ======================================================================
            Brush-tailed rat  ======================================================================
B D            Naked mole-rat  ======================================================================
B D                   Ferret   ======================================================================
                  Chinchilla  ======================================================================
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Squirrel  ======================================================================
B D                  Marmoset  ----------------------------------------------------------------------
B D                 Orangutan  ----------------------------------------------------------------------

                        Human  -------ac-----------------------------t------------gagagcctgaagtt
                        Chimp  -------ac-----------------------------t------------gagagcctgaagtt
                      Gorilla  -------ac-----------------------------t------------gagagcctgaagtt
                       Gibbon  -------ag-----------------------------c------------gagagcctgaagtt
                       Rhesus  -------ag-----------------------------t------------gagagcctg-agtt
          Crab-eating macaque  -------ag-----------------------------t------------gagagcctg-agtt
                       Baboon  -------ag-----------------------------t------------gagagcctg-agtt
                 Green monkey  -----------------------------------------------------------------
                     Bushbaby  -------gg-----------------------------c------------gggcgcctgtggtc
           Chinese tree shrew  -------ag-----------------------------t------------gggcgcgcg-----
                          Pig  -------ct-----------------------------g------------gag-----------
                       Alpaca  -------ag-----------------------------c------------t-------------
               Bactrian camel  -------ag-----------------------------c------------g-------------
                      Dolphin  -------ag-----------------------------c------------ggg-----------
                 Killer whale  -------ag-----------------------------c------------ggg-----------
             Tibetan antelope  tcctaagag-gtgtctacaggtgg--------------t------------ggg-----------
                          Cow  -----------------------------------------------------------------
                        Sheep  tcctaagag-gtgtctacaggcgg--------------t------------ggg-----------
                Domestic goat  t----agagcatgtttattggggggagtgtcactccttg------------agg-----------
                        Horse  -------ag-----------------------------c------------ggg-----------
             White rhinoceros  -------cg-----------------------------c------------ggg-----------
                          Cat  -------ac-----------------------------cagagaagtt---ggg-----------
                          Dog  -------ac-----------------------------ccaggaggttctggcg-----------
                        Panda  -------gc-----------------------------ccagaaagttctggag-----------
               Pacific walrus  -------ac-----------------------------ccaggaagttctagag-----------
                 Weddell seal  -------ac-----------------------------ccaggaagttctggag-----------
             Black flying-fox  -------ag-----------------------------t------------ggg-----------
                      Megabat  -------ag-----------------------------t------------ggg-----------
                Big brown bat  -------ag-----------------------------t------------ggg-----------
         David's myotis (bat)  -------ag-----------------------------t------------tgg-----------
                     Microbat  -------ag-----------------------------t------------tgg-----------
              Star-nosed mole  -------gg-----------------------------t------------ggg-----------
                     Aardvark  -----------------------------------------------------------------
           Tibetan ground jay  -----------------------------------------------------------------
                 Mallard duck  -----------------------------------------------------------------
           American alligator  -----------------------------------------------------------------
              Green seaturtle  -----------------------------------------------------------------
               Painted turtle  -----------------------------------------------------------------
     Chinese softshell turtle  -----------------------------------------------------------------
          Cape elephant shrew  =================================================================
               Golden hamster  =================================================================
                 Prairie vole  =================================================================
                        Mouse  =================================================================
                          Rat  =================================================================
                       Medaka  =================================================================
     Mexican tetra (cavefish)  =================================================================
              Chinese hamster  =================================================================
       Lesser Egyptian jerboa  =================================================================
                         Pika  =================================================================
                       Tenrec  =================================================================
                        Shrew  =================================================================
                   Guinea pig  =================================================================
                    Zebrafish  =================================================================
                X. tropicalis  =================================================================
                       Lizard  =================================================================
       Yellowbelly pufferfish  =================================================================
                         Fugu  =================================================================
                      Wallaby  =================================================================
              Tasmanian devil  -----------------------------------------------------------------
          Collared flycatcher  =================================================================
                      Opossum  =================================================================
             Peregrine falcon  =================================================================
                   Coelacanth  =================================================================
                    Tetraodon  =================================================================
                  Stickleback  =================================================================
           Southern platyfish  =================================================================
          Pundamilia nyererei  =================================================================
                  Zebra mbuna  =================================================================
        Burton's mouthbreeder  =================================================================
          Princess of Burundi  =================================================================
                 Nile tilapia  =================================================================
                  Spotted gar  =================================================================
              Squirrel monkey  -----------------------------------------------------------------
             Cape golden mole  =================================================================
                       Rabbit  =================================================================
             Brush-tailed rat  =================================================================
               Naked mole-rat  =================================================================
                      Ferret   =================================================================
                   Chinchilla  =================================================================
                    Armadillo  =================================================================
                      Manatee  =================================================================
                     Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Squirrel  =================================================================
                     Marmoset  -----------------------------------------------------------------
                    Orangutan  -----------------------------------------------------------------

Inserts between block 25 and 26 in window
B D                      Pig 6bp
B D                  Dolphin 6bp
                Killer whale 6bp
            Tibetan antelope 6bp
B D                    Sheep 6bp
               Domestic goat 6bp
B D                    Horse 22bp
B D         White rhinoceros 22bp
B D                      Cat 6bp
B D                      Dog 6bp
B D                    Panda 6bp
              Pacific walrus 6bp
                Weddell seal 6bp
            Black flying-fox 6bp
B D                  Megabat 6bp
               Big brown bat 6bp
        David's myotis (bat) 6bp
B D                 Microbat 6bp
             Star-nosed mole 7bp

Alignment block 26 of 913 in window, 6380177 - 6380182, 6 bps 
B D                     Human  c--------tggag
B D                     Chimp  c--------tggag
B D                   Gorilla  c--------tggag
B D                    Gibbon  c--------tggag
B D                    Rhesus  c--------tgg-g
B D       Crab-eating macaque  c--------tgg-g
B D                    Baboon  c--------tggag
B D                  Bushbaby  ccagctacttggga
           Chinese tree shrew  -------------g
           Tibetan ground jay  ---------tcagg
  D              Mallard duck  ---------ttgtg
B D        American alligator  ---------tgggg
  D           Green seaturtle  ---------atggg
  D            Painted turtle  ---------atggg
B D                    Lizard  c--------tcgag
         Cape elephant shrew  ==============
              Golden hamster  ==============
                Prairie vole  ==============
B D                     Mouse  ==============
B D                       Rat  ==============
B D                    Medaka  ==============
    Mexican tetra (cavefish)  ==============
B D           Chinese hamster  ==============
      Lesser Egyptian jerboa  ==============
B D                      Pika  ==============
B D                    Tenrec  ==============
               Big brown bat  ==============
               Domestic goat  ==============
B D                     Sheep  ==============
B D                     Shrew  ==============
B D                       Cow  --------------
B D                Guinea pig  ==============
B D                 Zebrafish  ==============
B D             X. tropicalis  ==============
      Yellowbelly pufferfish  ==============
B D                      Fugu  ==============
B D                   Wallaby  ==============
B D           Tasmanian devil  --------------
  D       Collared flycatcher  ==============
B D                   Opossum  ==============
  D          Peregrine falcon  ==============
B D                Coelacanth  ==============
  D  Chinese softshell turtle  --------------
B D                 Tetraodon  ==============
B D               Stickleback  ==============
          Southern platyfish  ==============
         Pundamilia nyererei  ==============
                 Zebra mbuna  ==============
       Burton's mouthbreeder  ==============
         Princess of Burundi  ==============
B D              Nile tilapia  ==============
                 Spotted gar  ==============
B D           Squirrel monkey  --------------
            Cape golden mole  ==============
B D                    Rabbit  ==============
            Tibetan antelope  ==============
B D                   Dolphin  ==============
            Brush-tailed rat  ==============
             Star-nosed mole  ==============
                Killer whale  ==============
B D            Naked mole-rat  ==============
                    Aardvark  --------------
B D                   Megabat  ==============
B D                       Pig  ==============
B D                  Microbat  ==============
        David's myotis (bat)  ==============
                Weddell seal  ==============
B D                     Panda  ==============
B D                   Ferret   ==============
              Pacific walrus  ==============
                  Chinchilla  ==============
            Black flying-fox  ==============
B D                       Dog  ==============
B D                       Cat  ==============
              Bactrian camel  --------------
B D                    Alpaca  --------------
B D                 Armadillo  ==============
B D                   Manatee  ==============
B D                  Elephant  NNNNNNNNNNNNNN
B D          White rhinoceros  ==============
B D                     Horse  ==============
B D                  Squirrel  ==============
B D                  Marmoset  --------------
B D              Green monkey  --------------
B D                 Orangutan  --------------

Alignment block 27 of 913 in window, 6380183 - 6380194, 12 bps 
B D                     Human  ggcaga--g-------------------ccatg--------------------
B D                     Chimp  ggcaga--g-------------------ccatg--------------------
B D                   Gorilla  ggcaga--g-------------------ccatg--------------------
B D                    Gibbon  ggcaga--g-------------------ccatg--------------------
B D                    Rhesus  ggcagg--g-------------------ctgtg--------------------
B D       Crab-eating macaque  ggcagg--g-------------------ctgtg--------------------
B D                    Baboon  ggcaga--g------------------cccgtg--------------------
B D                  Bushbaby  ggcgga--ggcaggagactcgcttgagcccagg--------------------
           Chinese tree shrew  caggga--g-------------------ctggg--------------------
B D                       Rat  ggcagaatg-------------------ctgta--------------------
B D                       Pig  gcctgt-----------------------------------------------
B D                   Dolphin  ggtggt-----------------------------------------------
                 Killer whale  ggtggt-----------------------------------------------
             Tibetan antelope  ggcagt-----------------------------------------------
B D                     Sheep  ggcagc-----------------------------------------------
                Domestic goat  tgcatc-----------------------------------------------
B D                       Cat  cc-gtt-----------------------------------------------
B D                       Dog  cctgtt-----------------------------------------------
B D                     Panda  cctgtt-----------------------------------------------
               Pacific walrus  cttgtt-----------------------------------------------
                 Weddell seal  cttgtt-----------------------------------------------
             Black flying-fox  ggcagt-----------------------------------------------
B D                   Megabat  ggcagt-----------------------------------------------
                Big brown bat  agcaat-----------------------------------------------
         David's myotis (bat)  agcaat-----------------------------------------------
B D                  Microbat  agcaat-----------------------------------------------
              Star-nosed mole  ggcagg-----------------------------------------------
                     Aardvark  ggcag------------------------------------------------
           Tibetan ground jay  --------------------------------gg---------tcccatggct
  D              Mallard duck  --------------------------------ggg---cgctctcccactttt
B D        American alligator  --------------------------------gg------------cagggct
  D           Green seaturtle  --------------------------------gg-----------------cc
  D            Painted turtle  --------------------------------gt-----------------cc
  D  Chinese softshell turtle  ----------------------------------------------------c
B D                    Lizard  --------------------------------aggactcacaggctttgttcc
         Cape elephant shrew  =====================================================
              Golden hamster  =====================================================
                Prairie vole  =====================================================
B D                     Mouse  =====================================================
B D                    Medaka  =====================================================
    Mexican tetra (cavefish)  =====================================================
B D           Chinese hamster  =====================================================
      Lesser Egyptian jerboa  =====================================================
B D                      Pika  =====================================================
B D                    Tenrec  =====================================================
B D                     Shrew  =====================================================
B D                       Cow  -----------------------------------------------------
B D                Guinea pig  =====================================================
B D                 Zebrafish  =====================================================
B D             X. tropicalis  =====================================================
      Yellowbelly pufferfish  =====================================================
B D                      Fugu  =====================================================
B D                   Wallaby  =====================================================
B D           Tasmanian devil  -----------------------------------------------------
  D       Collared flycatcher  =====================================================
B D                   Opossum  =====================================================
  D          Peregrine falcon  =====================================================
B D                Coelacanth  =====================================================
B D                 Tetraodon  =====================================================
B D               Stickleback  =====================================================
          Southern platyfish  =====================================================
         Pundamilia nyererei  =====================================================
                 Zebra mbuna  =====================================================
       Burton's mouthbreeder  =====================================================
         Princess of Burundi  =====================================================
B D              Nile tilapia  =====================================================
                 Spotted gar  =====================================================
B D           Squirrel monkey  -----------------------------------------------------
            Cape golden mole  =====================================================
B D                    Rabbit  =====================================================
            Brush-tailed rat  =====================================================
B D            Naked mole-rat  =====================================================
B D                   Ferret   =====================================================
                  Chinchilla  =====================================================
              Bactrian camel  -----------------------------------------------------
B D                    Alpaca  -----------------------------------------------------
B D                 Armadillo  =====================================================
B D                   Manatee  =====================================================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          White rhinoceros  =====================================================
B D                     Horse  =====================================================
B D                  Squirrel  =====================================================
B D                  Marmoset  -----------------------------------------------------
B D              Green monkey  -----------------------------------------------------
B D                 Orangutan  -----------------------------------------------------

Alignment block 28 of 913 in window, 6380195 - 6380204, 10 bps 
B D                     Human  tattgg--------------------acag
B D                     Chimp  tattgg--------------------acag
B D                   Gorilla  tattgg--------------------acag
B D                    Gibbon  tattgg--------------------acag
B D                    Rhesus  tgccgg--------------------acag
B D       Crab-eating macaque  tgccgg--------------------acag
B D                    Baboon  tactgg--------------------atag
B D                  Bushbaby  agttggaggttgtgagctatgaagctacgg
           Chinese tree shrew  gagtga------------------------
B D           Chinese hamster  tataaa--------------------atga
B D                       Rat  tatata--------------------atag
B D                       Pig  ---------------------------tta
B D                   Dolphin  ---------------------------gag
                 Killer whale  ---------------------------gag
             Tibetan antelope  ---------------------------gag
B D                     Sheep  ---------------------------gag
                Domestic goat  ---------------------------ttg
B D                       Cat  ---------------------------tat
B D                       Dog  ---------------------------tat
B D                     Panda  ---------------------------tat
               Pacific walrus  ---------------------------tat
                 Weddell seal  ---------------------------tat
             Black flying-fox  ---------------------------gag
B D                   Megabat  ---------------------------gag
                Big brown bat  ---------------------------gag
         David's myotis (bat)  ---------------------------gag
B D                  Microbat  ---------------------------gag
              Star-nosed mole  ---------------------------gag
           Tibetan ground jay  ---------------------------cgg
  D              Mallard duck  ---------------------------ggg
B D        American alligator  ---------------------------aag
  D           Green seaturtle  ---------------------------cag
  D            Painted turtle  ---------------------------cag
  D  Chinese softshell turtle  ---------------------------cag
B D                    Lizard  ---------------------------tag
         Cape elephant shrew  ==============================
              Golden hamster  ==============================
                Prairie vole  ==============================
B D                     Mouse  ==============================
B D                    Medaka  ==============================
    Mexican tetra (cavefish)  ==============================
      Lesser Egyptian jerboa  ==============================
B D                      Pika  ==============================
B D                    Tenrec  ==============================
B D                     Shrew  ==============================
B D                       Cow  ------------------------------
B D                Guinea pig  ==============================
B D                 Zebrafish  ==============================
B D             X. tropicalis  ==============================
      Yellowbelly pufferfish  ==============================
B D                      Fugu  ==============================
B D                   Wallaby  ==============================
B D           Tasmanian devil  ------------------------------
  D       Collared flycatcher  ==============================
B D                   Opossum  ==============================
  D          Peregrine falcon  ==============================
B D                Coelacanth  ==============================
B D                 Tetraodon  ==============================
B D               Stickleback  ==============================
          Southern platyfish  ==============================
         Pundamilia nyererei  ==============================
                 Zebra mbuna  ==============================
       Burton's mouthbreeder  ==============================
         Princess of Burundi  ==============================
B D              Nile tilapia  ==============================
                 Spotted gar  ==============================
B D           Squirrel monkey  ------------------------------
            Cape golden mole  ==============================
B D                    Rabbit  ==============================
            Brush-tailed rat  ==============================
B D            Naked mole-rat  ==============================
                    Aardvark  ------------------------------
B D                   Ferret   ==============================
                  Chinchilla  ==============================
              Bactrian camel  ------------------------------
B D                    Alpaca  ------------------------------
B D                 Armadillo  ==============================
B D                   Manatee  ==============================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D          White rhinoceros  ==============================
B D                     Horse  ==============================
B D                  Squirrel  ==============================
B D                  Marmoset  ------------------------------
B D              Green monkey  ------------------------------
B D                 Orangutan  ------------------------------

Alignment block 29 of 913 in window, 6380205 - 6380205, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                    Gibbon  -a
B D                    Rhesus  -c
B D       Crab-eating macaque  -c
B D                    Baboon  -a
B D                  Bushbaby  -c
B D           Chinese hamster  -a
B D                       Rat  -a
B D                       Pig  -t
B D                   Dolphin  -t
                 Killer whale  -t
             Tibetan antelope  -t
B D                     Sheep  -t
                Domestic goat  -t
B D                       Cat  -t
B D                       Dog  -t
B D                     Panda  -t
               Pacific walrus  -t
                 Weddell seal  -t
             Black flying-fox  -t
B D                   Megabat  -t
                Big brown bat  -t
         David's myotis (bat)  -t
B D                  Microbat  -t
              Star-nosed mole  -a
B D                   Opossum  -a
           Tibetan ground jay  g-
  D              Mallard duck  g-
B D        American alligator  g-
  D           Green seaturtle  g-
  D            Painted turtle  g-
  D  Chinese softshell turtle  g-
B D                    Lizard  a-
         Cape elephant shrew  ==
              Golden hamster  ==
                Prairie vole  ==
B D                     Mouse  ==
B D                    Medaka  ==
    Mexican tetra (cavefish)  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  ==
B D                    Tenrec  ==
          Chinese tree shrew  --
B D                     Shrew  ==
B D                       Cow  --
B D                Guinea pig  ==
B D                 Zebrafish  ==
B D             X. tropicalis  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                   Wallaby  ==
B D           Tasmanian devil  --
  D       Collared flycatcher  ==
  D          Peregrine falcon  ==
B D                Coelacanth  ==
B D                 Tetraodon  ==
B D               Stickleback  ==
          Southern platyfish  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
                 Spotted gar  ==
B D           Squirrel monkey  --
            Cape golden mole  ==
B D                    Rabbit  ==
            Brush-tailed rat  ==
B D            Naked mole-rat  ==
                    Aardvark  --
B D                   Ferret   ==
                  Chinchilla  ==
              Bactrian camel  --
B D                    Alpaca  --
B D                 Armadillo  ==
B D                   Manatee  ==
B D                  Elephant  NN
B D          White rhinoceros  ==
B D                     Horse  ==
B D                  Squirrel  ==
B D                  Marmoset  --
B D              Green monkey  --
B D                 Orangutan  --

Inserts between block 29 and 30 in window
B D                      Rat 9bp
B D                  Dolphin 4bp
                Killer whale 4bp
            Tibetan antelope 4bp
B D                    Sheep 4bp
               Domestic goat 5bp
B D                      Cat 18bp
B D                      Dog 18bp
B D                    Panda 14bp
              Pacific walrus 18bp
                Weddell seal 18bp
            Black flying-fox 28bp
B D                  Megabat 28bp
               Big brown bat 41bp
        David's myotis (bat) 28bp
B D                 Microbat 28bp
             Star-nosed mole 18bp
          Tibetan ground jay 3bp
  D             Mallard duck 3bp

Alignment block 30 of 913 in window, 6380206 - 6380206, 1 bps 
B D                     Human  -g
B D                     Chimp  -g
B D                   Gorilla  -g
B D                    Gibbon  -g
B D                    Rhesus  -g
B D       Crab-eating macaque  -g
B D                    Baboon  -g
B D                  Bushbaby  -a
B D                  Squirrel  -g
B D           Chinese hamster  -g
B D                     Mouse  -g
B D                       Rat  -g
B D                   Opossum  -g
           Tibetan ground jay  c-
  D              Mallard duck  t-
  D           Green seaturtle  c-
  D            Painted turtle  c-
  D  Chinese softshell turtle  c-
B D                    Lizard  c-
         Cape elephant shrew  ==
              Golden hamster  ==
                Prairie vole  ==
B D                    Medaka  ==
    Mexican tetra (cavefish)  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  ==
B D                    Tenrec  ==
          Chinese tree shrew  --
               Big brown bat  ==
               Domestic goat  ==
B D                     Sheep  ==
B D                     Shrew  ==
B D                       Cow  --
B D                Guinea pig  ==
B D                 Zebrafish  ==
B D             X. tropicalis  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                   Wallaby  ==
B D           Tasmanian devil  --
  D       Collared flycatcher  ==
  D          Peregrine falcon  ==
B D                Coelacanth  ==
B D                 Tetraodon  ==
B D               Stickleback  ==
          Southern platyfish  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
                 Spotted gar  ==
B D        American alligator  --
B D           Squirrel monkey  --
            Cape golden mole  ==
B D                    Rabbit  ==
            Tibetan antelope  ==
B D                   Dolphin  ==
            Brush-tailed rat  ==
             Star-nosed mole  ==
                Killer whale  ==
B D            Naked mole-rat  ==
                    Aardvark  --
B D                   Megabat  ==
B D                       Pig  --
B D                  Microbat  ==
        David's myotis (bat)  ==
                Weddell seal  ==
B D                     Panda  ==
B D                   Ferret   ==
              Pacific walrus  ==
                  Chinchilla  ==
            Black flying-fox  ==
B D                       Dog  ==
B D                       Cat  ==
              Bactrian camel  --
B D                    Alpaca  --
B D                 Armadillo  ==
B D                   Manatee  ==
B D                  Elephant  NN
B D          White rhinoceros  ==
B D                     Horse  ==
B D                  Marmoset  --
B D              Green monkey  --
B D                 Orangutan  --

Inserts between block 30 and 31 in window
B D                  Opossum 1bp

Alignment block 31 of 913 in window, 6380207 - 6380210, 4 bps 
B D                     Human  cctc
B D                     Chimp  cctc
B D                   Gorilla  cctc
B D                    Gibbon  cctc
B D                    Rhesus  cctc
B D       Crab-eating macaque  cctc
B D                    Baboon  cctc
B D                  Bushbaby  ctct
B D                  Squirrel  cc--
B D           Chinese hamster  cctc
B D                     Mouse  cctc
B D                       Rat  cctc
B D                   Opossum  ttt-
B D                   Wallaby  cct-
           Tibetan ground jay  ccgt
  D              Mallard duck  cccc
  D           Green seaturtle  cctt
  D            Painted turtle  cctt
  D  Chinese softshell turtle  cctt
B D                    Lizard  ccac
         Cape elephant shrew  ====
              Golden hamster  ====
                Prairie vole  ====
B D                    Medaka  ====
    Mexican tetra (cavefish)  ====
      Lesser Egyptian jerboa  ====
B D                      Pika  ====
B D                    Tenrec  ====
          Chinese tree shrew  ----
               Big brown bat  ====
               Domestic goat  ====
B D                     Sheep  ====
B D                     Shrew  ====
B D                       Cow  ----
B D                Guinea pig  ====
B D                 Zebrafish  ====
B D             X. tropicalis  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D           Tasmanian devil  ----
  D       Collared flycatcher  ====
  D          Peregrine falcon  ====
B D                Coelacanth  ====
B D                 Tetraodon  ====
B D               Stickleback  ====
          Southern platyfish  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
                 Spotted gar  ====
B D        American alligator  ----
B D           Squirrel monkey  ----
            Cape golden mole  ====
B D                    Rabbit  ====
            Tibetan antelope  ====
B D                   Dolphin  ====
            Brush-tailed rat  ====
             Star-nosed mole  ====
                Killer whale  ====
B D            Naked mole-rat  ====
                    Aardvark  ----
B D                   Megabat  ====
B D                       Pig  ----
B D                  Microbat  ====
        David's myotis (bat)  ====
                Weddell seal  ====
B D                     Panda  ====
B D                   Ferret   ====
              Pacific walrus  ====
                  Chinchilla  ====
            Black flying-fox  ====
B D                       Dog  ====
B D                       Cat  ====
              Bactrian camel  ----
B D                    Alpaca  ----
B D                 Armadillo  ====
B D                   Manatee  ====
B D                  Elephant  NNNN
B D          White rhinoceros  ====
B D                     Horse  ====
B D                  Marmoset  ----
B D              Green monkey  ----
B D                 Orangutan  ----

Alignment block 32 of 913 in window, 6380211 - 6380216, 6 bps 
B D                     Human  a------ctc------------------------------------------------------------
B D                     Chimp  a------ctc------------------------------------------------------------
B D                   Gorilla  a------ctc------------------------------------------------------------
B D                 Orangutan  ----------------------------------------------------------------------
B D                    Gibbon  a------ctc------------------------------------------------------------
B D                    Rhesus  a------ctc------------------------------------------------------------
B D       Crab-eating macaque  a------ctc------------------------------------------------------------
B D                    Baboon  a------ctc------------------------------------------------------------
B D                  Marmoset  ----------------------------------------------------------------------
B D           Squirrel monkey  ----------------------------------------------------------------------
B D                  Bushbaby  a------cccagggggatagcttgaggctctgtctcaaaaaaaaaaagaattggtaatactggggcact-
           Chinese tree shrew  ----------------------------------------------------------------------
B D                  Squirrel  -gga---ctc------------------------------------------------------------
B D           Chinese hamster  aggg---ccc------------------------------------------------------------
B D                     Mouse  aggg---ctc------------------------------------------------------------
B D                       Rat  agggctcctc------------------------------------------------------------
B D                   Dolphin  -----------------------------------------------------------------gaat-
                 Killer whale  -----------------------------------------------------------------gaat-
             Tibetan antelope  -----------------------------------------------------------------gtat-
B D                     Sheep  -----------------------------------------------------------------gtat-
                Domestic goat  -----------------------------------------------------------------gtat-
B D                     Horse  -----------------------------------------------------------------aatt-
B D          White rhinoceros  -----------------------------------------------------------------aatt-
B D                   Ferret   -----------------------------------------------------------------aggc-
                     Aardvark  -------ccc------------------------------------------------------------
B D                   Opossum  ------actt------------------------------------------------------------
B D                   Wallaby  ------cccc------------------------------------------------------------
           Tibetan ground jay  -----------------------------------------------------------------ggct-
  D              Mallard duck  -----------------------------------------------------------------ctct-
B D        American alligator  ----------------------------------------------------------------------
  D           Green seaturtle  -----------------------------------------------------------------acag-
  D            Painted turtle  -----------------------------------------------------------------acag-
  D  Chinese softshell turtle  -----------------------------------------------------------------acag-
B D                    Lizard  -----------------------------------------------------------------agctt
         Cape elephant shrew  ======================================================================
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  ======================================================================
B D                    Tenrec  ======================================================================
               Big brown bat  ======================================================================
B D                     Shrew  ======================================================================
B D                       Cow  ----------------------------------------------------------------------
B D                Guinea pig  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D           Tasmanian devil  ----------------------------------------------------------------------
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Tetraodon  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
                 Spotted gar  ======================================================================
            Cape golden mole  ======================================================================
B D                    Rabbit  ======================================================================
            Brush-tailed rat  ======================================================================
             Star-nosed mole  ======================================================================
B D            Naked mole-rat  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ----------------------------------------------------------------------
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
                Weddell seal  ======================================================================
B D                     Panda  ======================================================================
              Pacific walrus  ======================================================================
                  Chinchilla  ======================================================================
            Black flying-fox  ======================================================================
B D                       Dog  ======================================================================
B D                       Cat  ======================================================================
              Bactrian camel  ----------------------------------------------------------------------
B D                    Alpaca  ----------------------------------------------------------------------
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D              Green monkey  ----------------------------------------------------------------------

                        Human  -ta
                        Chimp  -ca
                      Gorilla  -ca
                    Orangutan  -ca
                       Gibbon  -ca
                       Rhesus  -ta
          Crab-eating macaque  -ta
                       Baboon  -ca
                     Marmoset  -ca
              Squirrel monkey  -ca
                     Bushbaby  -ca
           Chinese tree shrew  -gt
                     Squirrel  -ga
              Chinese hamster  -ca
                        Mouse  -ca
                          Rat  -cg
                      Dolphin  -ca
                 Killer whale  -ca
             Tibetan antelope  -ga
                        Sheep  -ga
                Domestic goat  -ga
                        Horse  -ta
             White rhinoceros  -ca
                      Ferret   -ga
                     Aardvark  -ca
                      Opossum  -ta
                      Wallaby  -ca
           Tibetan ground jay  -ca
                 Mallard duck  -ct
           American alligator  -ca
              Green seaturtle  -ca
               Painted turtle  -ca
     Chinese softshell turtle  -ca
                       Lizard  cca
          Cape elephant shrew  ===
               Golden hamster  ===
                 Prairie vole  ===
                       Medaka  ===
     Mexican tetra (cavefish)  ===
       Lesser Egyptian jerboa  ===
                         Pika  ===
                       Tenrec  ===
                Big brown bat  ===
                        Shrew  ===
                          Cow  ---
                   Guinea pig  ===
                    Zebrafish  ===
                X. tropicalis  ===
       Yellowbelly pufferfish  ===
                         Fugu  ===
              Tasmanian devil  ---
          Collared flycatcher  ===
             Peregrine falcon  ===
                   Coelacanth  ===
                    Tetraodon  ===
                  Stickleback  ===
           Southern platyfish  ===
          Pundamilia nyererei  ===
                  Zebra mbuna  ===
        Burton's mouthbreeder  ===
          Princess of Burundi  ===
                 Nile tilapia  ===
                  Spotted gar  ===
             Cape golden mole  ===
                       Rabbit  ===
             Brush-tailed rat  ===
              Star-nosed mole  ===
               Naked mole-rat  ===
                      Megabat  ===
                          Pig  ---
                     Microbat  ===
         David's myotis (bat)  ===
                 Weddell seal  ===
                        Panda  ===
               Pacific walrus  ===
                   Chinchilla  ===
             Black flying-fox  ===
                          Dog  ===
                          Cat  ===
               Bactrian camel  ---
                       Alpaca  ---
                    Armadillo  ===
                      Manatee  ===
                     Elephant  NNN
                 Green monkey  ---

Inserts between block 32 and 33 in window
B D          Chinese hamster 3bp

Alignment block 33 of 913 in window, 6380217 - 6380220, 4 bps 
B D                     Human  gg------------at
B D                     Chimp  gg------------at
B D                   Gorilla  gg------------at
B D                 Orangutan  gg------------at
B D                    Gibbon  gg------------at
B D                    Rhesus  gg------------at
B D       Crab-eating macaque  gg------------at
B D                    Baboon  gg------------at
B D                  Marmoset  gg------------ac
B D           Squirrel monkey  gg------------ac
B D                  Bushbaby  gggagagacaccaaac
           Chinese tree shrew  gg------------gg
B D                  Squirrel  gg------------ac
                 Prairie vole  gg------------ag
B D           Chinese hamster  gg------------ag
B D                     Mouse  gg------------gc
B D                       Rat  gg------------ag
             Brush-tailed rat  gg------------ac
B D                   Dolphin  --------------ag
                 Killer whale  --------------ag
             Tibetan antelope  --------------ag
B D                     Sheep  --------------at
                Domestic goat  --------------ag
B D                     Horse  --------------gg
B D          White rhinoceros  --------------ag
B D                   Ferret   --------------gc
              Star-nosed mole  --------------gg
                     Aardvark  gg------------ac
B D                   Opossum  gg------------gt
B D                   Wallaby  ag------------gg
           Tibetan ground jay  gg------------gg
  D              Mallard duck  gg------------gg
B D        American alligator  gg------------gg
  D           Green seaturtle  gg------------aa
  D            Painted turtle  gg------------aa
  D  Chinese softshell turtle  gg------------aa
B D                    Lizard  gg------------ca
         Cape elephant shrew  ================
              Golden hamster  ================
B D                    Medaka  ================
    Mexican tetra (cavefish)  ================
      Lesser Egyptian jerboa  ================
B D                      Pika  ================
B D                    Tenrec  ================
               Big brown bat  ================
B D                     Shrew  ================
B D                       Cow  ----------------
B D                Guinea pig  ================
B D                 Zebrafish  ================
B D             X. tropicalis  ================
      Yellowbelly pufferfish  ================
B D                      Fugu  ================
B D           Tasmanian devil  ----------------
  D       Collared flycatcher  ================
  D          Peregrine falcon  ================
B D                Coelacanth  ================
B D                 Tetraodon  ================
B D               Stickleback  ================
          Southern platyfish  ================
         Pundamilia nyererei  ================
                 Zebra mbuna  ================
       Burton's mouthbreeder  ================
         Princess of Burundi  ================
B D              Nile tilapia  ================
                 Spotted gar  ================
            Cape golden mole  ================
B D                    Rabbit  ================
B D            Naked mole-rat  ================
B D                   Megabat  ================
B D                       Pig  ----------------
B D                  Microbat  ================
        David's myotis (bat)  ================
                Weddell seal  ================
B D                     Panda  ================
              Pacific walrus  ================
                  Chinchilla  ================
            Black flying-fox  ================
B D                       Dog  ================
B D                       Cat  ================
              Bactrian camel  ----------------
B D                    Alpaca  ----------------
B D                 Armadillo  ================
B D                   Manatee  ================
B D                  Elephant  NNNNNNNNNNNNNNNN
B D              Green monkey  ----------------

Inserts between block 33 and 34 in window
          Tibetan ground jay 6bp
  D             Mallard duck 1bp
  D          Green seaturtle 14bp
  D           Painted turtle 14bp
  D Chinese softshell turtle 2bp

Alignment block 34 of 913 in window, 6380221 - 6380224, 4 bps 
B D                     Human  ggcg
B D                     Chimp  ggcg
B D                   Gorilla  ggcg
B D                 Orangutan  ggcg
B D                    Gibbon  ggtg
B D                    Rhesus  ggcg
B D       Crab-eating macaque  ggcg
B D                    Baboon  ggcg
B D              Green monkey  ---g
B D                  Marmoset  ggca
B D           Squirrel monkey  ggca
B D                  Bushbaby  agca
           Chinese tree shrew  agtg
B D                  Squirrel  aacc
                 Prairie vole  ggct
B D           Chinese hamster  ggct
B D                     Mouse  ggca
B D                       Rat  ggca
             Brush-tailed rat  aggg
B D                   Dolphin  agcc
                 Killer whale  agcc
             Tibetan antelope  accc
B D                       Cow  accc
B D                     Sheep  accc
                Domestic goat  accc
B D                     Horse  agcc
B D          White rhinoceros  cgcc
B D                   Ferret   accc
              Star-nosed mole  ag--
                     Aardvark  agcg
B D                   Opossum  gg--
B D                   Wallaby  gg--
         Cape elephant shrew  ====
              Golden hamster  ====
B D                    Medaka  ====
    Mexican tetra (cavefish)  ====
      Lesser Egyptian jerboa  ====
B D                      Pika  ====
B D                    Tenrec  ====
               Big brown bat  ====
B D                     Shrew  ====
B D                Guinea pig  ====
B D                 Zebrafish  ====
B D             X. tropicalis  ====
B D                    Lizard  ----
  D              Mallard duck  ====
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
B D           Tasmanian devil  ----
  D       Collared flycatcher  ====
  D          Peregrine falcon  ====
B D                Coelacanth  ====
  D  Chinese softshell turtle  ====
  D           Green seaturtle  ====
  D            Painted turtle  ====
B D                 Tetraodon  ====
B D               Stickleback  ====
          Southern platyfish  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D              Nile tilapia  ====
                 Spotted gar  ====
B D        American alligator  ====
          Tibetan ground jay  ====
            Cape golden mole  ====
B D                    Rabbit  ====
B D            Naked mole-rat  ====