Multiz Alignments of 100 Vertebrates

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 191 in window, 136848713 - 136848725, 13 bps 
B D                     Human  ccctgag---gg------------------------------ccgg
B D                     Chimp  ccctgag---gg------------------------------ccgg
B D                   Gorilla  ccctgag---gg------------------------------ccgg
B D                 Orangutan  ccctgag---gg------------------------------ccgg
B D                    Gibbon  ccctgag---gg------------------------------ccgg
B D       Crab-eating macaque  cccagag---gg------------------------------ccgg
B D                    Baboon  ccctgag---gg------------------------------ccgg
B D              Green monkey  ccc-gag---gg------------------------------ccgg
B D                  Marmoset  ccctgcg---gg------------------------------ctgg
B D           Squirrel monkey  ccctgag---gg------------------------------ctgg
B D                  Bushbaby  gcctaaa---ag------------------------------ccgg
           Chinese tree shrew  -cctggg---gg------------------------------ccag
B D                  Squirrel  ccccgcgcctga------------ggg---------------ccca
       Lesser Egyptian jerboa  tcgtacg---gc------------aag---------------ctgt
                 Prairie vole  tcctgcg---gc------------aggctggtaagaacgcccctgg
B D           Chinese hamster  tcctgcg---gc------------agg---------------ctgt
               Golden hamster  tcctgcg---gc------------agg---------------ctgt
B D                     Mouse  tcctgcg---gc------------aga---------------ctgg
B D                       Rat  tcctgtg---gc------------agg---------------ctgg
B D            Naked mole-rat  ccctgag---gt------------------------------ctgg
B D                Guinea pig  acctgag---gt------------------------------ccgg
                   Chinchilla  gcctggg---gt------------------------------ccgg
             Brush-tailed rat  -cctgag---gc------------------------------cc--
B D                       Pig  gcctgag---gg------------------------------ccgg
B D                    Alpaca  gcctgag---gg------------------------------ccgg
B D                   Dolphin  gcctgag---gg------------------------------ccgg
                 Killer whale  gcctgag---gg------------------------------ccgg
             Tibetan antelope  gc---------g------------------------------ccgc
B D                       Cow  gc---------g------------------------------ccgc
B D                     Horse  tcctgag---ag------------------------------cctg
B D          White rhinoceros  gcctgag---gg------------------------------cctg
B D                       Cat  gcctgag---gg------------------------------ccgg
B D                       Dog  gcccaag---gc------------------------------ctgg
B D                     Panda  gcctgag---gg------------------------------ctgg
               Pacific walrus  gcctgag---gg------------------------------ctgg
                 Weddell seal  gcctgag---gg------------------------------ctgg
             Black flying-fox  gactgag---gg------------------------------ccag
B D                   Megabat  gactgag---gg------------------------------ccgg
                Big brown bat  ----------gg------------------------------ccgg
B D                  Hedgehog  ac--------------------------------------------
          Cape elephant shrew  gcccgag---gg------------------------------ccgg
B D                   Manatee  gcccaag---gg------------------------------ccag
             Cape golden mole  acccgag---aa------------------------------gcgg
B D                    Tenrec  gcccgag---gg------------------------------tcag
                     Aardvark  gcccgaa---gg------------------------------ccgg
B D                   Opossum  ccctgca---gg------------------------------ccg-
B D           Tasmanian devil  ccctgct---gg--------------------------------g-
B D                  Platypus  tcccgcc---cc------------------------------ccg-
  D               Rock pigeon  cagaaac---ag--------------c---------------ctga
  D              Saker falcon  cggagct---gt----------------------------------
  D          Peregrine falcon  tggtgct---ggggagctcacggaagg---------------cgcg
  D       Collared flycatcher  ccggaca---ag------------------------------atga
  D    White-throated sparrow  gcggagg---ag------------------------------ctgg
B D               Zebra finch  caggatt---tg------------------------------ctgt
           Tibetan ground jay  ccgggcc---tg------------------------------cccc
  D              Mallard duck  ttttgtg---gg------------------------------gcca
B D                   Chicken  ccgtacc---cc------------------------------gccg
B D        American alligator  ctggggg---tc------------------------------cccc
  D           Green seaturtle  cagccag---ct------------------------------ttgt
  D            Painted turtle  ctcccct---cc------------------------------ctgg
B D                 Tetraodon  gcgcagc---gt------------------------------cccg
B D                      Pika  ==============================================
B D                     Shrew  ==============================================
B D                Coelacanth  ==============================================
  D    Spiny softshell turtle  ==============================================
                 Spotted gar  ==============================================
B D                    Turkey  ==============================================
B D             X. tropicalis  ==============================================
  D             Scarlet macaw  ==============================================
B D                Budgerigar  ==============================================
  D                    Parrot  ==============================================
B D                   Wallaby  ==============================================
B D                  Elephant  ==============================================
  D  Chinese softshell turtle  ==============================================
        David's myotis (bat)  ==============================================
B D                 Armadillo  ==============================================

Inserts between block 1 and 2 in window
B D                      Pig 4bp
B D                   Alpaca 4bp
B D                  Dolphin 5bp
                Killer whale 4bp
B D                    Horse 4bp
B D         White rhinoceros 4bp
B D                      Cat 4bp
B D                      Dog 4bp
B D                    Panda 4bp
              Pacific walrus 4bp
                Weddell seal 4bp
            Black flying-fox 4bp
B D                  Megabat 4bp
               Big brown bat 4bp
  D              Rock pigeon 10bp
  D             Saker falcon 6bp
  D         Peregrine falcon 10bp
  D      Collared flycatcher 9bp
  D   White-throated sparrow 10bp
B D              Zebra finch 10bp
          Tibetan ground jay 9bp
  D             Mallard duck 9bp
B D                  Chicken 9bp
B D       American alligator 10bp
  D          Green seaturtle 10bp
  D           Painted turtle 18bp

Alignment block 2 of 191 in window, 136848726 - 136848816, 91 bps 
B D                     Human  c--------------------cggga--ac--------gccc-------ct---------gg--accgga
B D                     Chimp  c--------------------cagga--ac--------gccc-------ct---------gg--gccgga
B D                   Gorilla  c--------------------cagga--ac--------gccc-------ct---------gg--acagga
B D                 Orangutan  c--------------------cagga--ac--------gccc-------ct---------gg--accgaa
B D                    Gibbon  c--------------------cagga--ac--------gccc-------ct---------gg--acggga
B D       Crab-eating macaque  c--------------------cagga--ac--------gccc-------ct---------gg--accgaa
B D                    Baboon  c--------------------cagga--ac--------gccc-------ct---------gg--accgaa
B D              Green monkey  c--------------------cagga--ac--------gccc-------ct---------gg--acagaa
B D                  Marmoset  c--------------------caggaacac--------gccc-------cc---------ag--actgga
B D           Squirrel monkey  c--------------------caggaacac--------gccc-------cc---------ag--accgga
B D                  Bushbaby  c--------------------ctgga--ac--------gccc-------ct---------gg--acagga
           Chinese tree shrew  c--------------------cagga--ac--------gccc-------ct---------gg--accgga
B D                  Squirrel  ---------------------cagga--ac--------gccc-------ct---------gg--acggga
       Lesser Egyptian jerboa  ---------------------cagga--acgatcctgggcc----------------------------a
                 Prairie vole  ---------------------caaga--at------tcgcc-----------------------------
B D           Chinese hamster  ---------------------caaga--ac------tggtc-----------------------------
               Golden hamster  ---------------------caaga--ac------tggcc-----------------------------
B D                     Mouse  ---------------------caaga--ac--------gcc-----------------------------
B D                       Rat  ---------------------taaga--at--------gcc-----------------------------
B D            Naked mole-rat  ---------------------cagga--tc--------acc--------tg---------gg--accgag
B D                Guinea pig  ---------------------cagga--tc--------gcc--------cg---------gg--acccag
                   Chinchilla  ---------------------caaga--tt--------gcc--------cg---------gg--accgag
             Brush-tailed rat  ---------------------------------------tc--------cg---------gg--a-----
B D                       Pig  c--------------------caggg--ag--------gacc-------ct---------gg--gccggg
B D                    Alpaca  c--------------------cagga--ag--------gatc-------ct---------gg--accggg
B D                   Dolphin  c--------------------cagga--ag--------gacc-------ct---------gg--gccggg
                 Killer whale  c--------------------cagga--ag--------gacc-------ct---------gg--gccggg
             Tibetan antelope  c--------------------cagga--ag--------gacc-------ct---------gg--actggg
B D                       Cow  c--------------------cagga--ag--------gacc-------ct---------gg--actggg
B D                     Sheep  c--------------------caggg--ag--------gccc-------cc---------tg--gctggg
B D                     Horse  c-----------cgggccag---gga--ac--------cac--------ca---------at--accgga
B D          White rhinoceros  cctgctggcctgctggccggccagga--ac--------gac--------ca---------gg--accggg
B D                       Cat  c--------------------cagga--at--------gatcctg---gct---------gg--actggg
B D                       Dog  c--------------------cagga--gc--------gacc-------ct---------gg--a-cggg
B D                     Panda  c--------------------cagga--ag--------gacc-------ct---------gg--accggg
               Pacific walrus  c--------------------cagga--at--------tacc-------ct---------gg--accagg
                 Weddell seal  c--------------------cagga--at--------gacc-------ct---------gg--accggg
             Black flying-fox  c--------------------cagaa--ag--------gacc-------ct---------gg--accggt
B D                   Megabat  c--------------------cagaa--ag--------gacc-------ct---------gg--accggg
                Big brown bat  a--------------------cagga--ag--------aacc-------ct---------gg--gccggg
B D                  Hedgehog  ---------------------------------------ccc-------ct---------gg--accaaa
          Cape elephant shrew  --------------------gaccgg--gc--------gacc-------ct---------gg--aat--g
B D                   Manatee  --------------------gccagg--gc--------gacc-------ct---------gg--aat--g
             Cape golden mole  --------------------ctcgga--gc--------ggcc-------ct---------gg--aat--g
B D                    Tenrec  --------------------gctgga--gc---------------------------------------g
                     Aardvark  --------------------gccagg--gc--------cacc-------ct---------gg--aac--g
B D                   Opossum  --------------------------------------gcct-------cc---------gg--cccggc
B D           Tasmanian devil  --------------------------------------gctc-------ct---------ca--cccagg
B D                  Platypus  --------------------gcgggc--ac--------ggcc-------ca---------ga--gtgggg
  D               Rock pigeon  -------------------------------------------------gt---------gg--gctcaa
  D              Saker falcon  -------------------------------------------------tc---------ac--cctgtg
  D          Peregrine falcon  -------------------------------------------------cc---------ct--cctgtg
  D       Collared flycatcher  -------------------------------------------------cc---------ga--gctgtg
  D    White-throated sparrow  -------------------------------------------------cct--------ga--gctgcg
B D               Zebra finch  -------------------------------------------------cc-------------------
           Tibetan ground jay  -------------------------------------------------tca--------gc--gccggg
  D              Mallard duck  -------------------------------------------------tca--------gg--gccggg
B D                   Chicken  -------------------------------------------------ctg--------gaacgccggg
B D        American alligator  -------------------------------------------------tgaataagggggg--gttatg
  D           Green seaturtle  -------------------------------------------------gcaagt-----gt--cccatc
  D            Painted turtle  -------------------------------------------------cccagtgg---gg--cccagg
B D                 Tetraodon  ------------------------------------------ccgccagct---------ga--gcccgg
B D                      Pika  ======================================================================
B D                     Shrew  ======================================================================
B D                Coelacanth  ======================================================================
  D    Spiny softshell turtle  ======================================================================
                 Spotted gar  ======================================================================
B D                    Turkey  ======================================================================
B D             X. tropicalis  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
  D                    Parrot  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Elephant  ======================================================================
  D  Chinese softshell turtle  ======================================================================
        David's myotis (bat)  ======================================================================
B D                 Armadillo  ======================================================================

                        Human  ataa----------------tt------------tcca----------gggggca----a----------
                        Chimp  ataa----------------tt------------tcca----------gggggca----a----------
                      Gorilla  atca----------------tt------------ccca----------gagggca----a----------
                    Orangutan  ataa----------------tt------------tcca----------gggggca----a----------
                       Gibbon  ataa----------------tt------------tcca----------gggtgca----a----------
          Crab-eating macaque  ataa----------------tt------------tcca----------ggaggca----a----------
                       Baboon  ataa----------------tt------------tcca----------ggaggca----a----------
                 Green monkey  ataa----------------tt------------tcca----------ggaggca----a----------
                     Marmoset  atct----------------tt------------tcca----------gggaaca----a----------
              Squirrel monkey  atct----------------tt------------tcct----------ggggtca----a----------
                     Bushbaby  attt----------------tt------------gtca----------gcggg-----------------
           Chinese tree shrew  accg----------------tt------------tcca----------gtgggcg----a----------
                     Squirrel  atcg----------------tt------------tcta----------gagggcg----a----------
       Lesser Egyptian jerboa  atca----------------ct------------tcca----------cagagcg----a----------
                 Prairie vole  --ca----------------tt------------tcca----------aagggca----a----------
              Chinese hamster  --ca----------------tt------------tcca----------aaaggcc----a----------
               Golden hamster  --ca----------------tt------------tcca----------aaaggccagt-a----------
                        Mouse  --tc----------------tg------------acgag---------aagggca----a----------
                          Rat  --cc----------------tg------------acaag---------aagggcg----a----------
               Naked mole-rat  gtc-----------------------------------------------gcccg----a----------
                   Guinea pig  gtca----------------ct------------gcct----------gggcgcg----a----------
                   Chinchilla  gtca----------------tt------------gcct----------gggcgcg----a----------
             Brush-tailed rat  --ca----------------ct------------gccc----------gggctcg----a----------
                          Pig  gtta----------------tt------------tcca----------gagggcg----g----------
                       Alpaca  atta----------------ct------------tcca----------gagggcg----a----------
                      Dolphin  atta----------------tt------------tcca----------gagggcg----a----------
                 Killer whale  atta----------------tt------------tcca----------gagggcg----a----------
             Tibetan antelope  gtta----------------ct------------tcca----------gaggggg----a----------
                          Cow  gtta----------------ct------------tcca----------gaggggg----a----------
                        Sheep  gtta----------------ct------------tcca----------gaggggg----a----------
                        Horse  atta----------------tt------------tcca----------gagggcg----a----------
             White rhinoceros  atta----------------tt------------tcca----------gagggcg----a----------
                          Cat  atta----------------tt------------tcca----------gggggcg----a----------
                          Dog  atcc----------------ct------------gcca----------gggggcg----a----------
                        Panda  atta----------------tt------------tcta----------gggggcg----a----------
               Pacific walrus  atta----------------tt------------tcca----------gggggcg----a----------
                 Weddell seal  atta----------------tt------------tcca----------gggggcg----a----------
             Black flying-fox  attg----------------tt------------tctg----------gagggcg----a----------
                      Megabat  attg----------------tt------------tctg----------gagggcg----a----------
                Big brown bat  gttg----------------tt------------tcca----------gggggcg----a----------
                     Hedgehog  at-a----------------tc------------ttaa----------gagggcg----a----------
          Cape elephant shrew  aaga----------------tt------------tcca----------gagggca----g----------
                      Manatee  actg----------------tt------------tcca----------gagggca----a----------
             Cape golden mole  attg----------------tt------------tcca----------gagggca----a----------
                       Tenrec  attg----------------tg------------ccca----------gagggca----g----------
                     Aardvark  actg----------------tt------------tcca----------gggggca----a----------
                      Opossum  aggg--------------------------------------------gagggga----a----------
              Tasmanian devil  aaac--------------------------------------------ggggggc----g----------
                     Platypus  ggtt----------------tt------------gtgg----------gggggag----gagggaggggc
                  Rock pigeon  gc----------------------------------------------------a----g----------
                 Saker falcon  gca-----------------gt------------cataaggtgggtggccccgat----g----------
             Peregrine falcon  gca-----------------ct--------------------------tcccagc----a----------
          Collared flycatcher  atc-----------------ct------------tct-----------ctgcccc----c----------
       White-throated sparrow  ag--------------------------------------------------------------------
                  Zebra finch  ----------------------------------------------------------------------
           Tibetan ground jay  gg-------------------------------------------------tccc----g----------
                 Mallard duck  atca----------------cc------------ccacggcgtgcatgacgtgca----g----------
                      Chicken  aac-----------------ct------------tcatggccagcccga-----a----g----------
           American alligator  atg-----------------ag------------cactggggtgcttaacaagta----g----------
              Green seaturtle  gaca----------------ca------------ccc----------agaagcca----g----------
               Painted turtle  gccc----------------taggtctggggctgccctgggcagaggggcagccatctgg----------
                    Tetraodon  atcagaggtgaaccccaaagct------------gctg----------gagatga----g----------
                         Pika  ======================================================================
                        Shrew  ======================================================================
                   Coelacanth  ======================================================================
       Spiny softshell turtle  ======================================================================
                  Spotted gar  ======================================================================
                       Turkey  ======================================================================
                X. tropicalis  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                       Parrot  ======================================================================
                      Wallaby  ======================================================================
                     Elephant  ======================================================================
     Chinese softshell turtle  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================

                        Human  --gagct---------ttcga------------------a----------------c-------------
                        Chimp  --gagct---------ttcga------------------a----------------c-------------
                      Gorilla  --gagct---------ttcga------------------a----------------c-------------
                    Orangutan  --gagct---------ttcga------------------a----------------c-------------
                       Gibbon  --gagct---------ttcga------------------a----------------c-------------
          Crab-eating macaque  --gagct---------ttcga------------------a----------------c-------------
                       Baboon  --gagct---------ttcga------------------a----------------c-------------
                 Green monkey  --gagct---------ttcga------------------a----------------c-------------
                     Marmoset  --gagct---------ttcca------------------a----------------c-------------
              Squirrel monkey  --gagct---------ttcca------------------a----------------c-------------
                     Bushbaby  ------------------cga------------------a----------------c-------------
           Chinese tree shrew  --gcgct---------ttcga------------------a----------------c-------------
                     Squirrel  --gcgct---------ttcaa------------------a----------------c-------------
       Lesser Egyptian jerboa  --gtgct---------ttcga------------------a----------------c-------------
                 Prairie vole  --atgct---------ttcga------------------a----------------c-------------
              Chinese hamster  --gtgct---------ttcaa------------------a----------------c-------------
               Golden hamster  --gtgct---------ttcga------------------a----------------c-------------
                        Mouse  --gtgct---------ttcga------------------a----------------c-------------
                          Rat  --gtgct---------ttcga------------------a----------------c-------------
               Naked mole-rat  --gcact---------ttcca------------------a----------------c-------------
                   Guinea pig  --gcgct---------ttcca------------------a----------------c-------------
                   Chinchilla  --gcgct---------ttcca------------------a----------------c-------------
             Brush-tailed rat  --gcgct---------ttccg------------------a----------------c-------------
                          Pig  --gcgct---------ttcga------------------a----------------c-------------
                       Alpaca  --gcgct---------ttcga------------------a----------------c-------------
                      Dolphin  --gcgct---------ttcga------------------a----------------c-------------
                 Killer whale  --gcgct---------ttcga------------------a----------------c-------------
             Tibetan antelope  --gcgct---------ttcga------------------a----------------c-------------
                          Cow  --gcgct---------tttga------------------a----------------c-------------
                        Sheep  --gcgct---------ttcga------------------a----------------c-------------
                        Horse  --gcgct---------tactg------------------a----------------a-------------
             White rhinoceros  --gcgct---------t-ttg------------------a----------------a-------------
                          Cat  --atgct---------ttcga------------------a----------------c-------------
                          Dog  --acgct---------ttgga------------------a----------------c-------------
                        Panda  --acgct---------ttcga------------------a----------------c-------------
               Pacific walrus  --acgct---------ttcca------------------a----------------c-------------
                 Weddell seal  --acgct---------ttcca------------------a----------------c-------------
             Black flying-fox  --gcgct---------tttcg-----------------aa----------------c-------------
                      Megabat  --gcgct---------tttcg-----------------aa----------------c-------------
                Big brown bat  --gcgct---------ttccg-------------------------------------------------
                     Hedgehog  --gtgct---------ttcca------------------g----------------c-------------
          Cape elephant shrew  --gcgct---------ttcca------------------a----------------c-------------
                      Manatee  --gcgct---------ttcga------------------a----------------c-------------
             Cape golden mole  --gcgct---------ttcga------------------g----------------c-------------
                       Tenrec  --gcgct---------ttcga------------------a----------------c-------------
                     Aardvark  --gcgct---------tctga------------------a----------------c-------------
                      Opossum  --gggct---------gttggggattctggatttggagtc----------------c-------------
              Tasmanian devil  --tggcc---------tccga-----------cccaggtc----------------c-------------
                     Platypus  ccgcgcc---------gggga------------------a----------------c-------------
                  Rock pigeon  --cagca---------ggagt------------------g----------------t-------------
                 Saker falcon  --ctcct---------ggagg------------------a----------------c-------------
             Peregrine falcon  --cgtac---------agact------------------g----------------c-------------
          Collared flycatcher  --ttcca---------gctcc------------------t----------------c-------------
       White-throated sparrow  --------------------t------------------g----------------c-------------
                  Zebra finch  ---------------------------------------g----------------c-------------
           Tibetan ground jay  --cagcg---------gccgt------------------g----------------c-------------
                 Mallard duck  --gagctgg-------gcagc------------------gggagaagccctcggggc-------------
                      Chicken  --gagcc---------gcggt------------------acgacgtgctgtc----c-------------
           American alligator  --catcagagtccactgtgtt------------------c----------------c-------------
              Green seaturtle  --gaaat---------cctcc------------------c----------------c-------------
               Painted turtle  --aaaag---------gctct------------------t----------------cctgctgagtcgag
                    Tetraodon  --ggatt---------tccgg------------------a----------------g-------------
                         Pika  ======================================================================
                        Shrew  ======================================================================
                   Coelacanth  ======================================================================
       Spiny softshell turtle  ======================================================================
                  Spotted gar  ======================================================================
                       Turkey  ======================================================================
                X. tropicalis  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                       Parrot  ======================================================================
                      Wallaby  ======================================================================
                     Elephant  ======================================================================
     Chinese softshell turtle  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================

                        Human  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtag------c-----
                        Chimp  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtag------c-----
                      Gorilla  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtag------c-----
                    Orangutan  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtag------c-----
                       Gibbon  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtag------c-----
          Crab-eating macaque  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtag------t-----
                       Baboon  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtag------c-----
                 Green monkey  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtag------c-----
                     Marmoset  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtag------c-----
              Squirrel monkey  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtag------c-----
                     Bushbaby  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtag------------
           Chinese tree shrew  -----------caag------t---a--aac-agta--ct--------tgaat-gcag------c-----
                     Squirrel  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtag------------
       Lesser Egyptian jerboa  -----------caag------ta--a--aac-agaa--ct--------tgaat-gtag------------
                 Prairie vole  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtag------------
              Chinese hamster  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtag------------
               Golden hamster  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtag------------
                        Mouse  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtag------------
                          Rat  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtag------------
               Naked mole-rat  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtag------------
                   Guinea pig  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtac------------
                   Chinchilla  -----------caag------ta--a--aat-agaa--ct--------tgaat-gtac------------
             Brush-tailed rat  -----------caag------ta--a--act-agca--ct--------tgaat-gtag------------
                          Pig  -----------caag------ga--a--aat-agaa--ct--------cgaat-gtag------c-----
                       Alpaca  -----------caag------ga--a--aat-agaa--ct--------cgaat-gtag------c-----
                      Dolphin  -----------caag------ga--a--aat-aaaa--ct--------cgaat-gtag------c-----
                 Killer whale  -----------caag------ga--a--aat-aaaa--ct--------cgaat-gtag------c-----
             Tibetan antelope  -----------caag------ga--a--aat-ataa--ct--------cgaat-gtag------c-----
                          Cow  -----------caag------ga--a--aat-ataa--ct--------cgaat-gtag------c-----
                        Sheep  -----------taag------ga--a--aat-ataa--ct--------cgaat-gtag------c-----
                        Horse  -----------caag------ta--a--aac---aa--ct--------cgaat-gtag------c-----
             White rhinoceros  -----------caag------ta--a--aac---aa--ct--------cgaat-gtag------c-----
                          Cat  -----------caag------ta--a--aac---aa--ct--------cgaat-gtag------c-----
                          Dog  -----------caag------ta--a--aac-agaa--ct--------cgaat-atag------c-----
                        Panda  -----------caag------ta--a--aac-agaa--ct--------caaac-gtag------a-----
               Pacific walrus  -----------caag------ta--a--aac-agaa--ct--------caaat-gtag------a-----
                 Weddell seal  -----------caag------ta--a--aac-agaa--ct--------caaat--tag------a-----
             Black flying-fox  -----------caag------ta--a--agc---aa--tt--------cgaat-gtag------c-----
                      Megabat  -----------caag------ta--a--agc---aa--tt--------cgaat-gtag------c-----
                Big brown bat  ------------aag------ta--a--aac---ca--ct--------cgaat-gtaa------c-----
                     Hedgehog  -----------ccag------ta--a--aataaaga--at--------tgaat-gtaa------c-----
          Cape elephant shrew  -----------cgag------ta--a--act-agaa--ct--------tgaat-gtaa------c-----
                      Manatee  -----------caag------ta--a--act-agaa--ct--------tgaat-gtag------c-----
             Cape golden mole  -----------caag------ta--a--act-agaa--ct--------tgaat-gtag------c-----
                       Tenrec  -----------tgag------ta--a--act-agaa--at--------tgaat-gtaa------c-----
                     Aardvark  -----------ccag------ta--a--act-gcaa--ct--------tgaat-gtaa------c-----
                      Opossum  -----------tgag------gg--g--acc-ccgt--ct--------ggctc-tgcg------c-----
              Tasmanian devil  -----------tggg---------------c-tggc--ct--------agccc-acag------c-----
                     Platypus  -----------cggg------gaggg--ggt-tgca--tc--------tgggg-gagg------g-----
                  Rock pigeon  -----------ctgc------ca--c--cag--gag--cc--------cggga-ctgt------c-----
                 Saker falcon  -----------agggcaatgcaa--g--tgg--ggg--tg---agggaaggct-cctg------c-----
             Peregrine falcon  -----------agtg------gt--t--tgg--ggg--tg------------------------------
          Collared flycatcher  -----------cagg----------a--caa--gatgaag--------cagct-cttc------c-----
       White-throated sparrow  -----------ctgg----------g--cgg-cggc--cg--------catgt-cgca------c-----
                  Zebra finch  -----------cggg----------a--cgg--gct--cg--------ggtct-cccc------c-----
           Tibetan ground jay  -----------tgggctg---ca--g--cag--gac--cg--------tgtc--ccca------c-----
                 Mallard duck  -----------cgca------cg--c--cgg--agg--tg--------ctggt-gctg------c-----
                      Chicken  -----------cgca------cc--a--gga--acg--cgcccggctcccggt-cctg------c-----
           American alligator  -----------tggc----------a--cag--gtg--gg--------cacgtgccgg------c-----
              Green seaturtle  -----------cggc------cc--t--tgt--gac--ct--------acccc-tcctacc---t-----
               Painted turtle  ggagggagctgctgc------ca--c--ggt--gcc--cc--------cagcc-cccttcccagc-----
                    Tetraodon  -----------ccgg------tt--atccat-agca--tg--------ttagc-ctag------ccatag
                         Pika  ======================================================================
                        Shrew  ======================================================================
                   Coelacanth  ======================================================================
       Spiny softshell turtle  ======================================================================
                  Spotted gar  ======================================================================
                       Turkey  ======================================================================
                X. tropicalis  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                       Parrot  ======================================================================
                      Wallaby  ======================================================================
                     Elephant  ======================================================================
     Chinese softshell turtle  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================

                        Human  --ggctg---------------ccgt-------tgcc
                        Chimp  --ggctg---------------ctgt-------tgcc
                      Gorilla  --ggctg---------------ctgt-------tgcc
                    Orangutan  --ggctg---------------ctgt-------tgcc
                       Gibbon  --ggctg---------------ctgt-------tgcc
          Crab-eating macaque  --ggctg---------------ctgt-------tgcc
                       Baboon  --ggctg---------------ctgt-------tgcc
                 Green monkey  --ggctg---------------ctgt-------tgcc
                     Marmoset  --tactg---------------ctgt-------ggtc
              Squirrel monkey  --tactg---------------ctgt-------ggtc
                     Bushbaby  ----ctg---------------ctgc-------cgcc
           Chinese tree shrew  --ctctg---------------caat----------c
                     Squirrel  ----ctg---------------ctgc---ttgctgtc
       Lesser Egyptian jerboa  ----ccg---------------ctcc-------tgtt
                 Prairie vole  ----ctg---------------ctgc-------taac
              Chinese hamster  ----ctg---------------ctgc-------taac
               Golden hamster  ----ctg---------------ctgc-------tcgc
                        Mouse  ----ctg---------------ctgc----taataac
                          Rat  ----ctg---------------ctgc----aaataag
               Naked mole-rat  ----ccg---------------tgtt-------tgtc
                   Guinea pig  ----ccg---------------tgtt-------tgtc
                   Chinchilla  ----ccg---------------cgtt-------tgtc
             Brush-tailed rat  ----ctg---------------cgtt-------tgtc
                          Pig  --cgctg---------------ccgc-----------
                       Alpaca  --cagtg---------------ctgc-----------
                      Dolphin  --cattg---------------ctgc-----------
                 Killer whale  --cattg---------------ctgc-----------
             Tibetan antelope  --cactg---------------ctgc-----------
                          Cow  --cactg---------------ctgc-----------
                        Sheep  --cactg---------------ctgc-----------
                        Horse  --cattg---------------ctgc-----------
             White rhinoceros  --cattg---------------ctgc-----------
                          Cat  --cattg---------------cttc-----------
                          Dog  --ccttg---------------cttc-----------
                        Panda  --cattg---------------cttc-----------
               Pacific walrus  --cattg---------------cttc-----------
                 Weddell seal  --cattg---------------cttc-----------
             Black flying-fox  --cacca---------------ctgc-----------
                      Megabat  --cacca---------------ctgc-----------
                Big brown bat  --cactg---------------ctgc-----------
                     Hedgehog  --cgtgg---------------ctgcctc--------
          Cape elephant shrew  --ccttg---------------ctgt-------ctc-
                      Manatee  --ccctg---------------ctgc-------ctc-
             Cape golden mole  --cccgg---------------ctgc-------ctc-
                       Tenrec  --ccttg---------------ctgc-------ctc-
                     Aardvark  --ccctg---------------ctgc-------ctt-
                      Opossum  --ctctgctctg-------------------------
              Tasmanian devil  --gtccg------------------------------
                     Platypus  --caggg---------------ccta-----------
                  Rock pigeon  --agcag---------------c--------------
                 Saker falcon  --tggtg---------------g--------------
             Peregrine falcon  -------------------------------------
          Collared flycatcher  --tgctcttcct----------c--------------
       White-throated sparrow  --cgccctgcagagaggaagatc--------------
                  Zebra finch  --cgccc---------------c--------------
           Tibetan ground jay  --cgtgt---------------c--------------
                 Mallard duck  --tgcca---------------c--------------
                      Chicken  --agcag---------------c--------------
           American alligator  --taccc---------------c--------------
              Green seaturtle  --acccc---------------t--------------
               Painted turtle  --agctc---------------c--------------
                    Tetraodon  ctcgctg---------------cc-------------
                         Pika  =====================================
                        Shrew  =====================================
                   Coelacanth  =====================================
       Spiny softshell turtle  =====================================
                  Spotted gar  =====================================
                       Turkey  =====================================
                X. tropicalis  =====================================
                Scarlet macaw  =====================================
                   Budgerigar  =====================================
                       Parrot  =====================================
                      Wallaby  =====================================
                     Elephant  =====================================
     Chinese softshell turtle  =====================================
         David's myotis (bat)  =====================================
                    Armadillo  =====================================

Inserts between block 2 and 3 in window
B D                      Pig 7bp
B D                   Alpaca 7bp
B D                  Dolphin 7bp
                Killer whale 7bp
            Tibetan antelope 7bp
B D                      Cow 7bp
B D                    Sheep 7bp
B D                    Horse 3bp
B D         White rhinoceros 3bp
B D                      Cat 3bp
B D                      Dog 3bp
B D                    Panda 3bp
              Pacific walrus 3bp
                Weddell seal 3bp
            Black flying-fox 3bp
B D                  Megabat 3bp
               Big brown bat 7bp
B D                  Opossum 12bp
B D                 Platypus 12bp
  D         Peregrine falcon 2bp

Alignment block 3 of 191 in window, 136848817 - 136848818, 2 bps 
B D                     Human  t-----c
B D                     Chimp  t-----c
B D                   Gorilla  t-----c
B D                 Orangutan  t-----c
B D                    Gibbon  t-----t
B D       Crab-eating macaque  t-----c
B D                    Baboon  t-----c
B D              Green monkey  t-----c
B D                  Marmoset  t-----c
B D           Squirrel monkey  t-----c
B D                  Bushbaby  t-----t
           Chinese tree shrew  t-----c
B D                  Squirrel  t-----c
       Lesser Egyptian jerboa  t-----c
                 Prairie vole  t-----c
B D           Chinese hamster  t-----c
               Golden hamster  t-----c
B D                     Mouse  t-----c
B D                       Rat  tggtggt
B D            Naked mole-rat  t-----c
B D                Guinea pig  t-----c
                   Chinchilla  t-----c
             Brush-tailed rat  t-----c
B D                      Pika  =======
B D                     Shrew  =======
B D                  Hedgehog  -------
B D                Coelacanth  =======
  D    Spiny softshell turtle  =======
                    Aardvark  -------
B D                    Rhesus  NNNNNNN
            Cape golden mole  -------
B D                       Pig  =======
B D                   Megabat  =======
B D                   Dolphin  =======
                 Spotted gar  =======
B D                    Turkey  =======
B D                   Chicken  -------
  D              Mallard duck  -------
          Tibetan ground jay  -------
B D               Zebra finch  -------
  D    White-throated sparrow  -------
B D           Tasmanian devil  -------
B D             X. tropicalis  =======
  D            Painted turtle  -------
B D        American alligator  -------
  D             Scarlet macaw  =======
B D                Budgerigar  =======
B D                   Opossum  =======
  D               Rock pigeon  -------
B D       Medium ground finch  NNNNNNN
  D          Peregrine falcon  =======
  D              Saker falcon  -------
  D                    Parrot  =======
B D                   Wallaby  =======
         Cape elephant shrew  -------
B D                  Platypus  =======
B D                   Manatee  -------
B D                  Elephant  =======
B D                    Tenrec  -------
  D           Green seaturtle  -------
B D                       Cat  =======
                Weddell seal  =======
  D  Chinese softshell turtle  =======
B D                   Ferret   NNNNNNN
               Domestic goat  NNNNNNN
B D                     Sheep  =======
            Tibetan antelope  =======
  D       Collared flycatcher  -------
             Star-nosed mole  NNNNNNN
              Bactrian camel  NNNNNNN
B D                    Alpaca  =======
               Big brown bat  =======
              Pacific walrus  =======
B D                     Panda  =======
B D                       Cow  =======
                Killer whale  =======
B D                       Dog  =======
            Black flying-fox  =======
B D          White rhinoceros  =======
B D                     Horse  =======
        David's myotis (bat)  =======
B D                 Armadillo  =======

Alignment block 4 of 191 in window, 136848819 - 136848825, 7 bps 
B D                     Human  ------------c-ttgta-c---
B D                     Chimp  ------------c-ttgta-c---
B D                   Gorilla  ------------c-ttgta-c---
B D                 Orangutan  ------------c-ttgta-c---
B D                    Gibbon  ------------c-ttgta-c---
B D       Crab-eating macaque  ------------c-ttgtg-c---
B D                    Baboon  ------------c-ttgtg-c---
B D              Green monkey  ------------c-ttgtg-c---
B D                  Marmoset  ------------c-ttgtg-c---
B D           Squirrel monkey  ------------c-ttgtg-c---
B D                  Bushbaby  ------------c-ttgtg-c---
           Chinese tree shrew  ------------t-ttgcg-c---
B D                  Squirrel  ------------t-tcgtg-g---
       Lesser Egyptian jerboa  ------------t-ttgt------
                 Prairie vole  ------------tggtggt-g---
B D           Chinese hamster  ------------t-gtggt-g---
               Golden hamster  ------------t-gtggt-a---
B D                     Mouse  ------------g-gtagt-g---
B D                       Rat  ------------g-gtggt-g---
B D            Naked mole-rat  ------------t-ttgtt-a---
B D                Guinea pig  ------------t-ttgtt-a---
                   Chinchilla  ------------t-tcctt-a---
             Brush-tailed rat  ------------t-ttgtt-a---
B D                       Pig  ------------a-ttgtg-c--g
B D                    Alpaca  ------------a-ttgtg-c---
B D                   Dolphin  ------------t-ttgtg-cggg
                 Killer whale  ------------t-ttgtg-cggg
             Tibetan antelope  ------------t-ttgtt-c---
B D                       Cow  ------------t-ttgtt-c---
B D                     Sheep  ------------t-ttgtt-c---
B D                     Horse  ------------a-ttgtg-c---
B D          White rhinoceros  ------------a-ttttg-t---
B D                       Cat  ------------c-ttgat-g---
B D                       Dog  ------------t-ttggg-g---
B D                     Panda  ------------t-ttggg-g---
               Pacific walrus  ------------t-ttggg-g---
                 Weddell seal  ------------t-ttggg-g---
                Big brown bat  ------------t-gcggg-g---
B D                  Hedgehog  ------------a-ttgga-c---
          Cape elephant shrew  ------------c-ttgtgc----
B D                   Manatee  ------------c-ttggg-----
             Cape golden mole  ------------a-ttgaa-----
B D                    Tenrec  ------------c-ttgcac----
                     Aardvark  ------------c-ttggg-----
B D                  Platypus  ------------c-ttg-------
  D               Rock pigeon  ga----------------------
  D              Saker falcon  cac---------------------
  D       Collared flycatcher  ctcggact--ca------------
  D    White-throated sparrow  cacgt-------------------
B D               Zebra finch  catgtgc-----------------
           Tibetan ground jay  tgtgtgtc--ct------------
  D              Mallard duck  ct----------------------
B D                   Chicken  t-----------------------
B D        American alligator  catagcgcggcc------------
  D           Green seaturtle  cctacctacccc------------
  D            Painted turtle  cctgtctgcccc------------
B D                      Pika  ========================
B D                     Shrew  ========================
B D                Coelacanth  ========================
  D    Spiny softshell turtle  ========================
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNNN
B D                   Megabat  ========================
                 Spotted gar  ========================
B D                    Turkey  ========================
B D           Tasmanian devil  ------------------------
B D             X. tropicalis  ========================
  D             Scarlet macaw  ========================
B D                Budgerigar  ========================
B D                   Opossum  ========================
B D       Medium ground finch  NNNNNNNNNNNNNNNNNNNNNNNN
  D          Peregrine falcon  ========================
  D                    Parrot  ========================
B D                   Wallaby  ========================
B D                  Elephant  ========================
  D  Chinese softshell turtle  ========================
B D                   Ferret   NNNNNNNNNNNNNNNNNNNNNNNN
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNN
             Star-nosed mole  NNNNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNN
            Black flying-fox  ========================
        David's myotis (bat)  ========================
B D                 Armadillo  ========================

Inserts between block 4 and 5 in window
      Lesser Egyptian jerboa 4bp
  D              Rock pigeon 2bp
  D             Saker falcon 2bp
  D      Collared flycatcher 3bp
  D   White-throated sparrow 2bp
B D              Zebra finch 2bp
          Tibetan ground jay 3bp
  D             Mallard duck 2bp
B D       American alligator 3bp
  D          Green seaturtle 3bp
  D           Painted turtle 4bp

Alignment block 5 of 191 in window, 136848826 - 136848831, 6 bps 
B D                     Human  ----cggtag
B D                     Chimp  ----gggtag
B D                   Gorilla  ----gggtag
B D                 Orangutan  ----gggtag
B D                    Gibbon  ----gggtag
B D       Crab-eating macaque  ----gggtag
B D                    Baboon  ----gggtag
B D              Green monkey  ----ggatag
B D                  Marmoset  ----ggatag
B D           Squirrel monkey  ----ggttgg
B D                  Bushbaby  ----tagggg
           Chinese tree shrew  ----gc----
B D                  Squirrel  ----gtgtc-
                 Prairie vole  ----gtggt-
B D           Chinese hamster  ----gtgat-
               Golden hamster  ----gtgat-
B D                     Mouse  ----gtggt-
B D                       Rat  ----gtggt-
B D            Naked mole-rat  ----ggg---
B D                Guinea pig  ----ggg---
                   Chinchilla  ----ggg---
             Brush-tailed rat  ----ggc---
B D                       Pig  ----gg----
B D                    Alpaca  ----ag----
B D                   Dolphin  ----gg----
                 Killer whale  ----gg----
             Tibetan antelope  ----ag----
B D                       Cow  ----ag----
B D                     Sheep  ----ag----
B D                     Horse  ----ggg---
B D          White rhinoceros  ----ggg---
B D                       Cat  ----gcg---
B D                       Dog  ----gtg---
B D                     Panda  ----atg---
               Pacific walrus  ----gtg---
                 Weddell seal  ----gtg---
                Big brown bat  ----gag---
B D                    Medaka  cgctgg----
      Lesser Egyptian jerboa  ==========
B D                      Pika  ==========
B D                     Shrew  ==========
B D                  Hedgehog  ----------
B D                Coelacanth  ==========
  D    Spiny softshell turtle  ==========
                    Aardvark  ----------
B D                    Rhesus  NNNNNNNNNN
            Cape golden mole  ----------
B D                   Megabat  ==========
                 Spotted gar  ==========
B D                    Turkey  ==========
B D                   Chicken  ----------
  D              Mallard duck  ==========
          Tibetan ground jay  ==========
B D               Zebra finch  ==========
  D    White-throated sparrow  ==========
B D           Tasmanian devil  ----------
B D             X. tropicalis  ==========
  D            Painted turtle  ==========
B D        American alligator  ==========
  D             Scarlet macaw  ==========
B D                Budgerigar  ==========
B D                   Opossum  ==========
  D               Rock pigeon  ==========
B D       Medium ground finch  NNNNNNNNNN
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
  D                    Parrot  ==========
B D                   Wallaby  ==========
         Cape elephant shrew  ----------
B D                  Platypus  ----------
B D                   Manatee  ----------
B D                  Elephant  ==========
B D                    Tenrec  ----------
  D           Green seaturtle  ==========
  D  Chinese softshell turtle  ==========
B D                   Ferret   NNNNNNNNNN
               Domestic goat  NNNNNNNNNN
  D       Collared flycatcher  ==========
             Star-nosed mole  NNNNNNNNNN
              Bactrian camel  NNNNNNNNNN
            Black flying-fox  ==========
        David's myotis (bat)  ==========
B D                 Armadillo  ==========

Inserts between block 5 and 6 in window
B D                      Pig 6bp
B D                   Alpaca 6bp
B D                  Dolphin 6bp
                Killer whale 6bp
            Tibetan antelope 6bp
B D                      Cow 6bp
B D                    Sheep 6bp
B D                    Horse 4bp
B D         White rhinoceros 4bp
B D                      Cat 155bp
B D                      Dog 14bp
B D                    Panda 12bp
              Pacific walrus 13bp
                Weddell seal 13bp
               Big brown bat 4bp

Alignment block 6 of 191 in window, 136848832 - 136848840, 9 bps 
B D                     Human  cggggttgg
B D                     Chimp  cggggttgg
B D                   Gorilla  cggggttgg
B D                 Orangutan  cggggttgg
B D                    Gibbon  tagggttgg
B D       Crab-eating macaque  cggggttgg
B D                    Baboon  cggggttgg
B D              Green monkey  cggggttgg
B D                  Marmoset  aggggttgg
B D           Squirrel monkey  aggggttgg
B D                  Bushbaby  aggggttgg
B D                  Squirrel  ---tgggga
                 Prairie vole  ---ggtggt
B D           Chinese hamster  --ggggggg
               Golden hamster  ---ggtggg
B D                     Mouse  ---ggtggt
B D                       Rat  ---ggtggt
B D            Naked mole-rat  ---ggtcgg
B D                Guinea pig  ---gtgcgg
                   Chinchilla  ---ggtcgc
             Brush-tailed rat  ---ggccg-
B D                       Pig  -tgggacgc
B D                    Alpaca  -tgggatgc
B D                   Dolphin  -tggcacgc
                 Killer whale  -tggcacgc
             Tibetan antelope  -tgcgacgt
B D                       Cow  -tgcgacgt
B D                     Sheep  -tgcgacgt
B D                     Horse  -tcggacac
B D          White rhinoceros  -tgggacac
B D                       Cat  -ggggacag
B D                       Dog  -tggga-tg
B D                     Panda  -tgagactg
               Pacific walrus  -tgggactt
                 Weddell seal  -tgggactt
                Big brown bat  -cggggcgg
             Cape golden mole  ---gaccgg
B D                    Tenrec  -gggatagg
B D                   Opossum  tggggttca
B D           Tasmanian devil  -ggggctgg
B D                  Platypus  --ggggcgg
  D               Rock pigeon  ccgg-----
  D              Saker falcon  ctgg-----
  D          Peregrine falcon  ctgg-----
  D       Collared flycatcher  ccag-----
  D    White-throated sparrow  acgg-----
B D               Zebra finch  ctgg-----
           Tibetan ground jay  cgtg-----
  D              Mallard duck  cggg-----
B D                   Chicken  --gg-----
B D        American alligator  ctgg-----
  D           Green seaturtle  cttg-----
  D            Painted turtle  cctg-----
B D                    Medaka  acggggcgg
      Lesser Egyptian jerboa  =========
B D                      Pika  =========
B D                     Shrew  =========
B D                  Hedgehog  ---------
B D                Coelacanth  =========
  D    Spiny softshell turtle  =========
                    Aardvark  ---------
B D                    Rhesus  NNNNNNNNN
B D                   Megabat  =========
                 Spotted gar  =========
B D                    Turkey  =========
B D             X. tropicalis  =========
  D             Scarlet macaw  =========
B D                Budgerigar  =========
B D       Medium ground finch  NNNNNNNNN
  D                    Parrot  =========
B D                   Wallaby  =========
         Cape elephant shrew  ---------
          Chinese tree shrew  ---------
B D                   Manatee  ---------
B D                  Elephant  =========
  D  Chinese softshell turtle  =========
B D                   Ferret   NNNNNNNNN
               Domestic goat  NNNNNNNNN
             Star-nosed mole  NNNNNNNNN
              Bactrian camel  NNNNNNNNN
            Black flying-fox  =========
        David's myotis (bat)  =========
B D                 Armadillo  =========

Inserts between block 6 and 7 in window
  D              Rock pigeon 16bp
  D             Saker falcon 7bp
  D         Peregrine falcon 1bp
  D      Collared flycatcher 8bp
  D   White-throated sparrow 16bp
B D              Zebra finch 11bp
          Tibetan ground jay 16bp
  D             Mallard duck 11bp
B D                  Chicken 11bp
B D       American alligator 29bp
  D          Green seaturtle 5bp
  D           Painted turtle 8bp

Alignment block 7 of 191 in window, 136848841 - 136848846, 6 bps 
B D                     Human  ----ggacgg
B D                     Chimp  ----ggacgg
B D                   Gorilla  ----ggacgg
B D                 Orangutan  ----ggacgg
B D                    Gibbon  ----ggacgg
B D       Crab-eating macaque  ----ggacgg
B D                    Baboon  ----ggacgg
B D              Green monkey  ----ggacgg
B D                  Marmoset  ----ggaggg
B D           Squirrel monkey  ----ggaggg
B D                  Bushbaby  ----gaa-gg
B D                  Squirrel  ----gg----
                 Prairie vole  ----gg----
B D           Chinese hamster  ----gg----
               Golden hamster  ----gg----
B D                     Mouse  ----gg----
B D                       Rat  ----gg----
B D            Naked mole-rat  ----gg----
B D                Guinea pig  ----gg----
                   Chinchilla  ----gg----
             Brush-tailed rat  ----gg----
B D                       Pig  ----ggaatg
B D                    Alpaca  ----aggatg
B D                   Dolphin  ----gggacg
                 Killer whale  ----gggacg
             Tibetan antelope  --------tg
B D                       Cow  --------tg
B D                     Sheep  --------tg
B D                     Horse  ----ggcggg
B D          White rhinoceros  ----gggggg
B D                       Cat  ----ggaggg
B D                       Dog  ----ggaggt
B D                     Panda  ----gga-gg
               Pacific walrus  ----cgacgg
                 Weddell seal  ----ggacgg
                Big brown bat  ----ggcggg
             Cape golden mole  ----ggg---
B D                    Tenrec  ----gggc--
B D                   Opossum  ----ggggaa
B D           Tasmanian devil  ----agggac
B D                  Platypus  ----gggaca
  D              Saker falcon  --------gg
  D          Peregrine falcon  --------ga
  D       Collared flycatcher  --------ag
B D                    Medaka  atcagg----
      Lesser Egyptian jerboa  ==========
B D                      Pika  ==========
B D                     Shrew  ==========
B D                  Hedgehog  ----------
B D                Coelacanth  ==========
  D    Spiny softshell turtle  ==========
                    Aardvark  ----------
B D                    Rhesus  NNNNNNNNNN
B D                   Megabat  ==========
                 Spotted gar  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
  D              Mallard duck  ==========
          Tibetan ground jay  ==========
B D               Zebra finch  ==========
  D    White-throated sparrow  ==========
B D             X. tropicalis  ==========
  D            Painted turtle  ==========
B D        American alligator  ==========
  D             Scarlet macaw  ==========
B D                Budgerigar  ==========
  D               Rock pigeon  ==========
B D       Medium ground finch  NNNNNNNNNN
  D                    Parrot  ==========
B D                   Wallaby  ==========
         Cape elephant shrew  ----------
          Chinese tree shrew  ----------
B D                   Manatee  ----------
B D                  Elephant  ==========
  D           Green seaturtle  ==========
  D  Chinese softshell turtle  ==========
B D                   Ferret   NNNNNNNNNN
               Domestic goat  NNNNNNNNNN
             Star-nosed mole  NNNNNNNNNN
              Bactrian camel  NNNNNNNNNN
            Black flying-fox  ==========
        David's myotis (bat)  ==========
B D                 Armadillo  ==========

Inserts between block 7 and 8 in window
B D                 Squirrel 5bp
                Prairie vole 173bp
B D          Chinese hamster 5bp
              Golden hamster 6bp
B D           Naked mole-rat 4bp
B D               Guinea pig 4bp
                  Chinchilla 4bp
            Brush-tailed rat 4bp
B D                  Opossum 27bp
B D          Tasmanian devil 13bp
B D                 Platypus 3bp
  D             Saker falcon 13bp
  D         Peregrine falcon 14bp
  D      Collared flycatcher 13bp

Alignment block 8 of 191 in window, 136848847 - 136848861, 15 bps 
B D                     Human  aagccttcggtcggt
B D                     Chimp  aagccttcggtcggt
B D                   Gorilla  aagccttcggtcggt
B D                 Orangutan  aagccttcggtcggt
B D                    Gibbon  aagccttcggtcggt
B D       Crab-eating macaque  aggcgttcgggcggt
B D                    Baboon  aggcgttcgggcggt
B D              Green monkey  aggcgttcgggcggt
B D                  Marmoset  aggcctccggacggc
B D           Squirrel monkey  aggccttccgatggc
B D                  Bushbaby  agtctttaggacggc
B D                  Squirrel  cactggtc-------
       Lesser Egyptian jerboa  ggggggta-------
B D           Chinese hamster  tgggcgta-------
               Golden hamster  tgggcgta-------
B D                     Mouse  tcgtcgtc-------
B D                       Rat  tggtggtg-------
B D            Naked mole-rat  aggccttc-------
B D                Guinea pig  aggccttc-------
                   Chinchilla  aggtcttc-------
             Brush-tailed rat  aggtcttc-------
B D                       Pig  gtgacttt-------
B D                    Alpaca  cagtgctt-------
B D                   Dolphin  gagacttt-------
                 Killer whale  gagacttt-------
             Tibetan antelope  aagatttt-------
B D                       Cow  aagatttt-------
B D                     Sheep  aagatttt-------
B D                     Horse  gggc-----------
B D          White rhinoceros  gggac-------ggg
B D                       Cat  aggccttgggacgcg
B D                       Dog  tggccctccgaccgg
B D                     Panda  gggacctcaga----
               Pacific walrus  aggacttcgcaccgg
                 Weddell seal  aggacctccgaccgg
                Big brown bat  cggccctcggactcg
B D                   Opossum  tcaccttc-------
B D           Tasmanian devil  tggcttcc-------
B D                  Platypus  aggtcttgggcggga
  D               Rock pigeon  cagg-----------
  D              Saker falcon  ggct-----------
  D          Peregrine falcon  ggct-----------
  D       Collared flycatcher  agat-----------
  D    White-throated sparrow  gggg-----------
B D               Zebra finch  agag-----------
           Tibetan ground jay  gggt-----------
  D              Mallard duck  --gc-----------
B D                   Chicken  --gc-----------
B D                    Turkey  --gc-----------
B D        American alligator  gggc-----------
  D           Green seaturtle  tacc-----------
  D            Painted turtle  tagc-----------
B D                    Medaka  gggcttttgcacgct
                Prairie vole  ===============
B D                      Pika  ===============
B D                     Shrew  ===============
B D                  Hedgehog  ---------------
B D                Coelacanth  ===============
  D    Spiny softshell turtle  ===============
                    Aardvark  ---------------
B D                    Rhesus  NNNNNNNNNNNNNNN
            Cape golden mole  ---------------
B D                   Megabat  ===============
                 Spotted gar  ===============
B D             X. tropicalis  ===============
  D             Scarlet macaw  ===============
B D                Budgerigar  ===============
B D       Medium ground finch  NNNNNNNNNNNNNNN
  D                    Parrot  ===============
B D                   Wallaby  ===============
         Cape elephant shrew  ---------------
          Chinese tree shrew  ---------------
B D                   Manatee  ---------------
B D                  Elephant  ===============
B D                    Tenrec  ---------------
  D  Chinese softshell turtle  ===============
B D                   Ferret   NNNNNNNNNNNNNNN
               Domestic goat  NNNNNNNNNNNNNNN
             Star-nosed mole  NNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNN
            Black flying-fox  ===============
        David's myotis (bat)  ===============
B D                 Armadillo  ===============

Inserts between block 8 and 9 in window
B D                   Gibbon 530bp
B D                      Pig 1bp
B D                   Alpaca 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
B D         White rhinoceros 25bp
B D                      Cat 25bp
B D                      Dog 18bp
B D                    Panda 17bp
              Pacific walrus 23bp
                Weddell seal 23bp
               Big brown bat 4bp
B D                  Opossum 7bp
B D          Tasmanian devil 2bp

Alignment block 9 of 191 in window, 136848862 - 136848868, 7 bps 
B D                     Human  gga-------gagg-
B D                     Chimp  gga-------gagg-
B D                   Gorilla  gga-------gagg-
B D                 Orangutan  gga-------gagg-
B D                    Gibbon  gga-------gagg-
B D       Crab-eating macaque  gga-------gagg-
B D                    Baboon  gga-------gagg-
B D              Green monkey  gga-------gagg-
B D                  Marmoset  gga-------gggg-
B D           Squirrel monkey  gga-------gggg-
           Chinese tree shrew  gga-------gtgg-
B D                       Pig  gga-------ggct-
B D                    Alpaca  gga-------aac--
B D                   Dolphin  gga-------ggcg-
                 Killer whale  gga-------ggcg-
             Tibetan antelope  gga-------gccg-
B D                       Cow  gga-------gccg-
B D                     Sheep  gga-------gcca-
B D                     Horse  -------------g-
B D          White rhinoceros  ggg-------acgg-
B D                       Cat  ggacgccttgggag-
B D                       Dog  gga-------ggga-
B D                     Panda  gga-------ggga-
               Pacific walrus  gga-------ggga-
                 Weddell seal  gga-------ggga-
                Big brown bat  gcg-------gggc-
  D               Rock pigeon  -----------ccg-
  D              Saker falcon  -----------ggg-
  D          Peregrine falcon  -----------ctg-
  D       Collared flycatcher  -----------ccc-
  D    White-throated sparrow  -----------ccg-
B D               Zebra finch  -----------ccg-
           Tibetan ground jay  -----------gct-
  D              Mallard duck  -----------ccc-
B D                   Chicken  -----------aca-
B D                    Turkey  -----------ata-
B D        American alligator  -----------ctg-
  D           Green seaturtle  -----------cct-
  D            Painted turtle  -----------gca-
B D                    Medaka  gga-------cgggg
              Golden hamster  ---------------
      Lesser Egyptian jerboa  ---------------
B D                       Rat  ---------------
                Prairie vole  ===============
B D                     Mouse  ---------------
B D                      Pika  ===============
B D                     Shrew  ===============
B D                  Hedgehog  ---------------
B D                Guinea pig  ---------------
B D                Coelacanth  ===============
  D    Spiny softshell turtle  ===============
                    Aardvark  ---------------
B D                    Rhesus  NNNNNNNNNNNNNNN
            Cape golden mole  ---------------
B D                   Megabat  ===============
                 Spotted gar  ===============
B D           Tasmanian devil  ===============
B D             X. tropicalis  ===============
  D             Scarlet macaw  ===============
B D                Budgerigar  ===============
B D                   Opossum  ===============
                  Chinchilla  ---------------
B D            Naked mole-rat  ---------------
B D       Medium ground finch  NNNNNNNNNNNNNNN
  D                    Parrot  ===============
B D                   Wallaby  ===============
            Brush-tailed rat  ---------------
         Cape elephant shrew  ---------------
B D                  Platypus  ---------------
B D                   Manatee  ---------------
B D                  Elephant  ===============
B D           Chinese hamster  ---------------
B D                    Tenrec  ---------------
B D                  Bushbaby  ---------------
  D  Chinese softshell turtle  ===============
B D                   Ferret   NNNNNNNNNNNNNNN
               Domestic goat  NNNNNNNNNNNNNNN
             Star-nosed mole  NNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNN
            Black flying-fox  ===============
B D                  Squirrel  ---------------
        David's myotis (bat)  ===============
B D                 Armadillo  ===============

Inserts between block 9 and 10 in window
  D              Rock pigeon 29bp
  D             Saker falcon 11bp
  D         Peregrine falcon 36bp
  D      Collared flycatcher 8bp
  D   White-throated sparrow 8bp
B D              Zebra finch 26bp
          Tibetan ground jay 8bp
  D             Mallard duck 17bp
B D                  Chicken 24bp
B D                   Turkey 43bp
  D          Green seaturtle 15bp
  D           Painted turtle 13bp

Alignment block 10 of 191 in window, 136848869 - 136848877, 9 bps 
B D                     Human  aga-----------------------------------aaggga-
B D                     Chimp  aga-----------------------------------aaggga-
B D                   Gorilla  aga-----------------------------------gaggga-
B D                 Orangutan  gga-----------------------------------gaggga-
B D                    Gibbon  gca-----------------------------------gagggg-
B D       Crab-eating macaque  gga-----------------------------------gagagg-
B D                    Baboon  gga-----------------------------------gagagg-
B D              Green monkey  gga-----------------------------------gagggg-
B D                  Marmoset  agagtgagggtg--------------------------gagtgg-
B D           Squirrel monkey  agagtgcgggtg--------------------------gagagg-
B D                  Bushbaby  -----------g--------------------------gagcga-
           Chinese tree shrew  gaa-----------------------------------gcggga-
B D                  Squirrel  ------------------------------------------g--
       Lesser Egyptian jerboa  ------------------------------------------gg-
B D           Chinese hamster  ------------------------------------------gg-
               Golden hamster  ------------------------------------------gg-
B D                     Mouse  ------------------------------------------g--
B D                       Rat  ------------------------------------------g--
B D            Naked mole-rat  ------------------------------------------ag-
B D                Guinea pig  ------------------------------------------gg-
                   Chinchilla  ------------------------------------------cg-
             Brush-tailed rat  ------------------------------------------gg-
B D                       Pig  t-------------------------------------gcgggg-
B D                    Alpaca  ----------------------------------------gggg-
B D                   Dolphin  t-------------------------------------gggggg-
                 Killer whale  t---------------------------------------gggg-
             Tibetan antelope  t-------------------------------------gggggg-
B D                       Cow  a-------------------------------------gggggg-
B D                     Sheep  t-------------------------------------gggggg-
B D                     Horse  g-------------------------------------cggaga-
B D          White rhinoceros  g-------------------------------------gggagg-
B D                       Cat  g-------------------------------------gagagg-
B D                       Dog  a-------------------------------------gggagg-
B D                     Panda  a-------------------------------------cggaag-
               Pacific walrus  a-------------------------------------aggaag-
                 Weddell seal  a-------------------------------------aggaag-
                Big brown bat  g-------------------------------------gggcgg-
B D                  Hedgehog  ---------------------------------------ggacg-
          Cape elephant shrew  --------------------------------------gagtgg-
B D                   Manatee  --------------------------------------gagtg--
             Cape golden mole  --------------------------------------gggagg-
B D                    Tenrec  -----------gcg----------------cagagcgagggtgg-
                     Aardvark  --------------------------------------gagagg-
B D                   Opossum  -------------gactcgacatgacggatcagctccaaggcag-
B D           Tasmanian devil  ------------------------------------------gg-
B D                  Platypus  ------------------------------ggagagctggaggg-
  D              Saker falcon  ------------------------------------------gg-
  D       Collared flycatcher  -------------------------------------------g-
  D    White-throated sparrow  -------------------------------------------a-
           Tibetan ground jay  -------------------------------------------c-
B D        American alligator  -------------------------------------------c-
B D                    Medaka  ------------------------------------cagatcaga
                Prairie vole  =============================================
B D                      Pika  =============================================
B D                     Shrew  =============================================
B D                Coelacanth  =============================================
  D    Spiny softshell turtle  =============================================
B D                   Megabat  =============================================
                 Spotted gar  =============================================
B D                    Turkey  =============================================
B D                   Chicken  =============================================
  D              Mallard duck  =============================================
B D               Zebra finch  =============================================
B D             X. tropicalis  =============================================
  D            Painted turtle  =============================================
  D             Scarlet macaw  =============================================
B D                Budgerigar  =============================================
  D               Rock pigeon  =============================================
  D          Peregrine falcon  =============================================
  D                    Parrot  =============================================
B D                   Wallaby  =============================================
B D                  Elephant  =============================================
  D           Green seaturtle  =============================================
  D  Chinese softshell turtle  =============================================
            Black flying-fox  =============================================
        David's myotis (bat)  =============================================
B D                 Armadillo  =============================================

Inserts between block 10 and 11 in window
  D             Saker falcon 7bp
  D      Collared flycatcher 21bp
          Tibetan ground jay 12bp
B D       American alligator 22bp

Alignment block 11 of 191 in window, 136848878 - 136848892, 15 bps 
B D                     Human  g----aggccttcg---gg-cgg
B D                     Chimp  g----aggccttcg---gg-cgg
B D                   Gorilla  g----aagccttcg---gg-cga
B D                 Orangutan  g----aggccttcg---gg-ccg
B D                    Gibbon  g----aggccttcg---gg-cgg
B D       Crab-eating macaque  g----aggcgttcg---gg-cgg
B D                    Baboon  g----aggccttcg---gg-cgg
B D              Green monkey  g----aggccttcg---gg-cga
B D                  Marmoset  g----aggacttcc---ga-cgg
B D           Squirrel monkey  g----aggccttcc---ga-cgg
B D                  Bushbaby  g----aggactcgg---ca-c--
           Chinese tree shrew  c----cggggtctg---gg-cgg
B D                  Squirrel  ------------cg---gg-gg-
       Lesser Egyptian jerboa  a----aggttctcg---gg-tg-
B D           Chinese hamster  a----g----cttg---gc-aa-
               Golden hamster  a----g----cttg---gc-aa-
B D                     Mouse  ------------tg---gc-cg-
B D                       Rat  ------------tg---gt-gg-
B D            Naked mole-rat  a----a----gtgg---gg-tg-
B D                Guinea pig  a----a----gtgg---ga-tg-
                   Chinchilla  a----a----gtgg---gg-ta-
             Brush-tailed rat  a----a----ctgg---gg-tg-
B D                       Pig  g----agggcttcg---ga-a--
B D                    Alpaca  g----agaccatgg---aata--
B D                   Dolphin  g----gggccttcg---ga-a--
                 Killer whale  g----gggccttcg---ga-a--
             Tibetan antelope  c----gggccttcg---ga-a--
B D                       Cow  c----gggcctttg---ga-a--
B D                     Sheep  c----aggccttcg---ga-a--
B D                     Horse  g----agaccctcg---ga-c--
B D          White rhinoceros  g----agaccctcg---ga-c--
B D                       Cat  g----aggccttgg---ga-c--
B D                       Dog  a----gggccttgg---gg-c--
B D                     Panda  a----gggccttgg---ga-c--
               Pacific walrus  a----gggccttgg---ga-c--
                 Weddell seal  a----gggccttgg---ga-t--
                Big brown bat  g----cggccctcg---ga-c--
B D                  Hedgehog  g----gaa---------------
          Cape elephant shrew  g----------------------
             Cape golden mole  g----------------------
B D                    Tenrec  gaccc------------------
                     Aardvark  g----------------------
B D                  Platypus  c----aggggtcct---gg-c--
  D               Rock pigeon  ----------------------g
  D              Saker falcon  ----------------------g
  D       Collared flycatcher  ----------------------g
  D    White-throated sparrow  ----------------------g
           Tibetan ground jay  ----------------------g
  D              Mallard duck  ----------------------g
B D                   Chicken  ----------------------g
B D                    Turkey  ----------------------g
B D                    Medaka  ----ggggcttttgcacgc----
                Prairie vole  =======================
B D                      Pika  =======================
B D                     Shrew  =======================
B D                Coelacanth  =======================
  D    Spiny softshell turtle  =======================
B D                    Rhesus  NNNNNNNNNNNNNNNNNNNNNNN
B D                   Megabat  =======================
                 Spotted gar  =======================
B D               Zebra finch  =======================
B D           Tasmanian devil  -----------------------
B D             X. tropicalis  =======================
  D            Painted turtle  =======================
B D        American alligator  =======================
  D             Scarlet macaw  =======================
B D                Budgerigar  =======================
B D                   Opossum  -----------------------
B D       Medium ground finch  NNNNNNNNNNNNNNNNNNNNNNN
  D          Peregrine falcon  =======================
  D                    Parrot  =======================
B D                   Wallaby  =======================
B D                   Manatee  -----------------------
B D                  Elephant  =======================
  D           Green seaturtle  =======================
  D  Chinese softshell turtle  =======================
B D                   Ferret   NNNNNNNNNNNNNNNNNNNNNNN
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNNN
             Star-nosed mole  NNNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNN
            Black flying-fox  =======================
        David's myotis (bat)  =======================
B D                 Armadillo  =======================

Inserts between block 11 and 12 in window
B D                   Baboon 712bp
         Cape elephant shrew 6bp
B D                 Platypus 9bp
  D              Rock pigeon 22bp
  D             Saker falcon 20bp
  D      Collared flycatcher 18bp
  D   White-throated sparrow 14bp
          Tibetan ground jay 14bp
  D             Mallard duck 16bp
B D                  Chicken 18bp
B D                   Turkey 14bp

Alignment block 12 of 191 in window, 136848893 - 136848906, 14 bps 
B D                     Human  tgga-----------------------cgggga-------------------------------------
B D                     Chimp  tgga-----------------------cgggga-------------------------------------
B D                   Gorilla  tgga-----------------------agggga-------------------------------------
B D                 Orangutan  tgga-----------------------agggggt------------------------------------
B D                    Gibbon  tgga-----------------------gagggt-------------------------------------
B D       Crab-eating macaque  tgga-----------------------gagggg-------------------------------------
B D                    Baboon  tgga-----------------------gaggga-------------------------------------
B D              Green monkey  tgga-----------------------gagggg-------------------------------------
B D                  Marmoset  cgga------------------------------------------------------------------
B D           Squirrel monkey  cgga-------------------------gggg-------------------------------------
B D                  Bushbaby  -ggg-----------------------caggga-------------------------------------
B D                  Squirrel  gggg-----------------------gcgctc-------------------------------------
       Lesser Egyptian jerboa  tggt-----------------------ggggc--------------------------------------
B D           Chinese hamster  ccgg-----------------------agacct-------------------------------------
               Golden hamster  ccgg-----------------------agacct-------------------------------------
B D                     Mouse  gggg-----------------------gggggg-------------------------------------
B D                       Rat  tggt-----------------------ggtggt-------------------------------------
B D            Naked mole-rat  gggatcagggacggaggacttcggacggggatc-------------------------------------
B D                Guinea pig  gggatcggaaacggaaaaa-tcggacgggggtc-------------------------------------
                   Chinchilla  ggggca---------------------ggggtc-------------------------------------
             Brush-tailed rat  cggatc---------------------ggggtc-------------------------------------
B D                       Pig  ---------------------------------aa-----------------------------------
B D                    Alpaca  ---------------------------------at-----------------------------------
B D                   Dolphin  ---------------------------------ac-----------------------------------
                 Killer whale  ---------------------------------ac-----------------------------------
             Tibetan antelope  ---------------------------------ac-----------------------------------
B D                       Cow  ---------------------------------acgggtgggaaaccactgaacaacgtggagtgggagg
B D                     Sheep  ---------------------------------ac-----------------------------------
B D                     Horse  ---------------------------------ac-----------------------------------
B D          White rhinoceros  ---------------------------------ac-----------------------------------
B D                       Cat  ---------------------------------gc-----------------------------------
B D                       Dog  ---------------------------------gc-----------------------------------
B D                     Panda  ---------------------------------gc-----------------------------------
               Pacific walrus  ---------------------------------ac-----------------------------------
                 Weddell seal  ---------------------------------ga-----------------------------------
                Big brown bat  ---------------------------------ac-----------------------------------
B D                   Opossum  ----------------------------------------------------------------------
B D           Tasmanian devil  ----------------------------------------------------------------------
B D                  Platypus  ----------------------------------------------------------------------
  D               Rock pigeon  ----------------------------------------------------------------------
  D              Saker falcon  ----------------------------------------------------------------------
  D       Collared flycatcher  ----------------------------------------------------------------------
  D    White-throated sparrow  ----------------------------------------------------------------------
B D               Zebra finch  ----------------------------------------------------------------------
           Tibetan ground jay  ----------------------------------------------------------------------
  D              Mallard duck  ----------------------------------------------------------------------
B D                   Chicken  ----------------------------------------------------------------------
B D                    Turkey  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
  D           Green seaturtle  ----------------------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------------------
B D                    Medaka  ----------------------------------------------------------------------
                Prairie vole  ======================================================================
B D                      Pika  ======================================================================
B D                     Shrew  ======================================================================
B D                  Hedgehog  ----------------------------------------------------------------------
B D                Coelacanth  ======================================================================
  D    Spiny softshell turtle  ======================================================================
                    Aardvark  ----------------------------------------------------------------------
            Cape golden mole  ----------------------------------------------------------------------
B D                   Megabat  ======================================================================
                 Spotted gar  ======================================================================
B D             X. tropicalis  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                   Wallaby  ======================================================================
         Cape elephant shrew  ======================================================================
          Chinese tree shrew  ----------------------------------------------------------------------
B D                   Manatee  ----------------------------------------------------------------------
B D                  Elephant  ======================================================================
B D                    Tenrec  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
            Black flying-fox  ======================================================================
        David's myotis (bat)  ======================================================================
B D                 Armadillo  ======================================================================

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                 Green monkey  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
                     Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
              Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
                        Mouse  ----------------------------------------------------------------------
                          Rat  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                          Pig  ----------------------------------------------------------------------
                       Alpaca  ----------------------------------------------------------------------
                      Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
                          Cow  gtggagagaggggctcggactcggtggggatgcggtctaggagaccgtgggactcggtggggacaggggg
                        Sheep  ----------------------------------------------------------------------
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                          Cat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                        Panda  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ----------------------------------------------------------------------
                     Platypus  ----------------------------------------------------------------------
                  Rock pigeon  ----------------------------------------------------------------------
                 Saker falcon  ----------------------------------------------------------------------
          Collared flycatcher  ----------------------------------------------------------------------
       White-throated sparrow  ----------------------------------------------------------------------
                  Zebra finch  ----------------------------------------------------------------------
           Tibetan ground jay  ----------------------------------------------------------------------
                 Mallard duck  ----------------------------------------------------------------------
                      Chicken  ----------------------------------------------------------------------
                       Turkey  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------
              Green seaturtle  ----------------------------------------------------------------------
               Painted turtle  ----------------------------------------------------------------------
                       Medaka  ----------------------------------------------------------------------
                 Prairie vole  ======================================================================
                         Pika  ======================================================================
                        Shrew  ======================================================================
                     Hedgehog  ----------------------------------------------------------------------
                   Coelacanth  ======================================================================
       Spiny softshell turtle  ======================================================================
                     Aardvark  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
                      Megabat  ======================================================================
                  Spotted gar  ======================================================================
                X. tropicalis  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                       Parrot  ======================================================================
                      Wallaby  ======================================================================
          Cape elephant shrew  ======================================================================
           Chinese tree shrew  ----------------------------------------------------------------------
                      Manatee  ----------------------------------------------------------------------
                     Elephant  ======================================================================
                       Tenrec  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
             Black flying-fox  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================

                        Human  --------------------------------------------------------------aga-----
                        Chimp  --------------------------------------------------------------aga-----
                      Gorilla  --------------------------------------------------------------aga-----
                    Orangutan  --------------------------------------------------------------aga-----
                       Gibbon  --------------------------------------------------------------aga-----
          Crab-eating macaque  --------------------------------------------------------------aga-----
                       Baboon  --------------------------------------------------------------aga-----
                 Green monkey  --------------------------------------------------------------aga-----
                     Marmoset  --------------------------------------------------------------gga-----
              Squirrel monkey  --------------------------------------------------------------gga-----
                     Bushbaby  --------------------------------------------------------------ag------
                     Squirrel  --------------------------------------------------------------tgg-----
       Lesser Egyptian jerboa  --------------------------------------------------------------gga-----
              Chinese hamster  --------------------------------------------------------------tgg-----
               Golden hamster  --------------------------------------------------------------ggg-----
                        Mouse  --------------------------------------------------------------ggg-----
                          Rat  --------------------------------------------------------------ggt-----
               Naked mole-rat  --------------------------------------------------------------ggg-----
                   Guinea pig  --------------------------------------------------------------aag-----
                   Chinchilla  --------------------------------------------------------------agg-----
             Brush-tailed rat  ----------------------------------------------------------------------
                          Pig  --------------------------------------------------------------aag-----
                       Alpaca  --------------------------------------------------------------ggc-----
                      Dolphin  --------------------------------------------------------------ctg-----
                 Killer whale  --------------------------------------------------------------ctg-----
             Tibetan antelope  --------------------------------------------------------------agc-----
                          Cow  cgggagaccgtgggactcggtggggatgcgggccgggaggccgtgggactcggtggggaccgggg-----
                        Sheep  --------------------------------------------------------------agc-----
                        Horse  --------------------------------------------------------------ggt-----
             White rhinoceros  --------------------------------------------------------------ggt-----
                          Cat  --------------------------------------------------------------ctt-----
                          Dog  --------------------------------------------------------------ggt-----
                        Panda  --------------------------------------------------------------ggg-----
               Pacific walrus  --------------------------------------------------------------ggt-----
                 Weddell seal  --------------------------------------------------------------ggt-----
                Big brown bat  --------------------------------------------------------------ggg-----
                      Opossum  ------------------------------------------------------aagagcaggaa-----
              Tasmanian devil  ------------------------------------------------------gagccctggga-----
                     Platypus  ----------------------------------------------------ttgaaatggcgga-----
                  Rock pigeon  --------------------------------------------------------------agt-----
                 Saker falcon  --------------------------------------------------------------ggc-----
          Collared flycatcher  --------------------------------------------------------------gggggcca
       White-throated sparrow  --------------------------------------------------------------aga-----
                  Zebra finch  --------------------------------------------------------------agg-----
           Tibetan ground jay  --------------------------------------------------------------aga-----
                 Mallard duck  --------------------------------------------------------------aga-----
                      Chicken  --------------------------------------------------------------ggg-----
                       Turkey  --------------------------------------------------------------ggg-----
           American alligator  --------------------------------------------------------------ggg-----
              Green seaturtle  --------------------------------------------------------------agg-----
               Painted turtle  ---------------------------------------------------------------gg-----
                       Medaka  ---------------------------------------------------------tggacggg-----
                 Prairie vole  ======================================================================
                         Pika  ======================================================================
                        Shrew  ======================================================================
                     Hedgehog  ----------------------------------------------------------------------
                   Coelacanth  ======================================================================
       Spiny softshell turtle  ======================================================================
                     Aardvark  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
                      Megabat  ======================================================================
                  Spotted gar  ======================================================================
                X. tropicalis  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                       Parrot  ======================================================================
                      Wallaby  ======================================================================
          Cape elephant shrew  ======================================================================
           Chinese tree shrew  ----------------------------------------------------------------------
                      Manatee  ----------------------------------------------------------------------
                     Elephant  ======================================================================
                       Tenrec  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
             Black flying-fox  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================

                        Human  ------g-----
                        Chimp  ------g-----
                      Gorilla  ------g-----
                    Orangutan  ------g-----
                       Gibbon  ------g-----
          Crab-eating macaque  ------g-----
                       Baboon  ------g-----
                 Green monkey  ------g-----
                     Marmoset  ------g-----
              Squirrel monkey  ------g-----
                     Bushbaby  ------g-----
                     Squirrel  ------g-----
       Lesser Egyptian jerboa  ------c-----
              Chinese hamster  ------a-----
               Golden hamster  ------a-----
                        Mouse  ------g-----
                          Rat  ------g-----
               Naked mole-rat  ------g-----
                   Guinea pig  ------a-----
                   Chinchilla  ------g-----
             Brush-tailed rat  ------------
                          Pig  ------g-----
                       Alpaca  ------g-----
                      Dolphin  ------g-----
                 Killer whale  ------g-----
             Tibetan antelope  ------g-----
                          Cow  ------g-----
                        Sheep  ------g-----
                        Horse  ------g-----
             White rhinoceros  ------g-----
                          Cat  ------g-----
                          Dog  ------g-----
                        Panda  ------a-----
               Pacific walrus  ------g-----
                 Weddell seal  ------a-----
                Big brown bat  ------g-----
                      Opossum  ------g-----
              Tasmanian devil  ------g-----
                     Platypus  ------g-----
                  Rock pigeon  ------g-----
                 Saker falcon  ------t-----
          Collared flycatcher  gggtttg-----
       White-throated sparrow  ------g-----
                  Zebra finch  ------g-----
           Tibetan ground jay  ------g-----
                 Mallard duck  ------g-----
                      Chicken  ------g-----
                       Turkey  ------g-----
           American alligator  ------g-----
              Green seaturtle  ------c-----
               Painted turtle  ------t-----
                       Medaka  ------gcggat
                 Prairie vole  ============
                         Pika  ============
                        Shrew  ============
                     Hedgehog  ------------
                   Coelacanth  ============
       Spiny softshell turtle  ============
                     Aardvark  ------------
                       Rhesus  NNNNNNNNNNNN
             Cape golden mole  ------------
                      Megabat  ============
                  Spotted gar  ============
                X. tropicalis  ============
                Scarlet macaw  ============
                   Budgerigar  ============
          Medium ground finch  NNNNNNNNNNNN
             Peregrine falcon  ============
                       Parrot  ============
                      Wallaby  ============
          Cape elephant shrew  ============
           Chinese tree shrew  ------------
                      Manatee  ------------
                     Elephant  ============
                       Tenrec  ------------
     Chinese softshell turtle  ============
                      Ferret   NNNNNNNNNNNN
                Domestic goat  NNNNNNNNNNNN
              Star-nosed mole  NNNNNNNNNNNN
               Bactrian camel  NNNNNNNNNNNN
             Black flying-fox  ============
         David's myotis (bat)  ============
                    Armadillo  ============

Inserts between block 12 and 13 in window
B D                      Pig 2bp
B D                   Alpaca 8bp
B D                  Dolphin 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 2bp
B D                    Horse 11bp
B D         White rhinoceros 12bp
B D                      Cat 8bp
B D                      Dog 11bp
B D                    Panda 4bp
              Pacific walrus 10bp
                Weddell seal 10bp
               Big brown bat 140bp
B D                  Opossum 2bp
B D          Tasmanian devil 2bp
B D                 Platypus 6bp
  D              Rock pigeon 10bp
  D             Saker falcon 10bp
  D      Collared flycatcher 10bp
  D   White-throated sparrow 10bp
B D              Zebra finch 10bp
          Tibetan ground jay 10bp
  D             Mallard duck 7bp
B D                  Chicken 10bp
B D                   Turkey 16bp
B D       American alligator 10bp
  D          Green seaturtle 10bp
  D           Painted turtle 12bp

Alignment block 13 of 191 in window, 136848907 - 136848912, 6 bps 
B D                     Human  -agggag
B D                     Chimp  -agggag
B D                   Gorilla  -aggaag
B D                 Orangutan  -ggcgag
B D                    Gibbon  -ggggag
B D       Crab-eating macaque  -agggag
B D                    Baboon  -ggggag
B D              Green monkey  -agggag
B D                  Marmoset  -agggag
B D           Squirrel monkey  -agcgag
B D                  Bushbaby  -aggggg
           Chinese tree shrew  ----gag
B D                  Squirrel  -agggag
       Lesser Egyptian jerboa  -cgggag
B D           Chinese hamster  -cgtggg
               Golden hamster  -cgtgag
B D                     Mouse  -gggggg
B D                       Rat  -gtggtg
B D            Naked mole-rat  -aggaag
B D                Guinea pig  -aagaat
                   Chinchilla  -aggaag
B D                       Pig  --gggag
B D                    Alpaca  -ggggag
B D                   Dolphin  --gggac
                 Killer whale  --gggac
             Tibetan antelope  --gggaa
B D                       Cow  --gggag
B D                     Sheep  --gggaa
B D                     Horse  -aaggag
B D          White rhinoceros  -ggggag
B D                       Cat  -agggag
B D                       Dog  -agggag
B D                     Panda  -gagaag
               Pacific walrus  -aggggg
                 Weddell seal  -gaggag
B D                   Opossum  ---cta-
B D           Tasmanian devil  ---taa-
B D                  Platypus  -gaggag
  D               Rock pigeon  ------a
  D              Saker falcon  ------c
  D       Collared flycatcher  ------a
  D    White-throated sparrow  ------c
B D               Zebra finch  ------a
           Tibetan ground jay  ------t
  D              Mallard duck  ------t
B D                   Chicken  ------c
B D                    Turkey  ------g
B D        American alligator  ------c
  D           Green seaturtle  ------c
  D            Painted turtle  ------g
B D                    Medaka  cagggg-
                Prairie vole  =======
B D                      Pika  =======
B D                     Shrew  =======
B D                  Hedgehog  -------
B D                Coelacanth  =======
  D    Spiny softshell turtle  =======
                    Aardvark  -------
B D                    Rhesus  NNNNNNN
            Cape golden mole  -------
B D                   Megabat  =======
                 Spotted gar  =======
B D             X. tropicalis  =======
  D             Scarlet macaw  =======
B D                Budgerigar  =======
B D       Medium ground finch  NNNNNNN
  D          Peregrine falcon  =======
  D                    Parrot  =======
B D                   Wallaby  =======
            Brush-tailed rat  -------
         Cape elephant shrew  =======
B D                   Manatee  -------
B D                  Elephant  =======
B D                    Tenrec  -------
  D  Chinese softshell turtle  =======
B D                   Ferret   NNNNNNN
               Domestic goat  NNNNNNN
             Star-nosed mole  NNNNNNN
              Bactrian camel  NNNNNNN
               Big brown bat  =======
            Black flying-fox  =======
        David's myotis (bat)  =======
B D                 Armadillo  =======

Inserts between block 13 and 14 in window
  D              Rock pigeon 17bp
  D             Saker falcon 4bp
  D      Collared flycatcher 14bp
  D   White-throated sparrow 21bp
B D              Zebra finch 29bp
          Tibetan ground jay 39bp
  D             Mallard duck 19bp
B D                  Chicken 23bp
B D                   Turkey 23bp
B D       American alligator 2bp
  D          Green seaturtle 12bp
  D           Painted turtle 12bp

Alignment block 14 of 191 in window, 136848913 - 136848919, 7 bps 
B D                     Human  tc-ctt------------------------------cg
B D                     Chimp  tc-ctt------------------------------cg
B D                   Gorilla  tc-ctt------------------------------cg
B D                 Orangutan  gc-ctt------------------------------cg
B D                    Gibbon  gc-ctt------------------------------cg
B D       Crab-eating macaque  gc-gtt------------------------------cg
B D                    Baboon  gc-ctt------------------------------cg
B D              Green monkey  gc-ctt------------------------------cg
B D                  Marmoset  gc-ctt---------------------------cttcg
B D           Squirrel monkey  ac-cttcggacggtggaggggggagagggaggccctcg
B D                  Bushbaby  ac-ctt------------------------------ag
           Chinese tree shrew  gcgctt------------------------------cg
B D                  Squirrel  ct-cct------------------------------cg
       Lesser Egyptian jerboa  ct-cat------------------------------cg
B D           Chinese hamster  ag-tat------------------------------tg
               Golden hamster  gg-tgt------------------------------tg
B D                     Mouse  ag-cat------------------------------tg
B D                       Rat  gt-ggt------------------------------gg
B D            Naked mole-rat  gc-ccg------------------------------c-
B D                Guinea pig  gc-cct------------------------------cg
                   Chinchilla  gc-cct------------------------------gg
             Brush-tailed rat  -c-tcg------------------------------ga
B D                       Pig  ac-cac------------------------------gg
B D                    Alpaca  at-ctt------------------------------cg
B D                   Dolphin  ac-cat------------------------------gg
                 Killer whale  ac-cat------------------------------gg
             Tibetan antelope  ac-cac------------------------------tg
B D                       Cow  ac-cgc------------------------------gg
B D                     Sheep  ac-cac------------------------------tg
B D                     Horse  at-cct------------------------------cg
B D          White rhinoceros  ac-gct------------------------------cg
B D                       Cat  ac-ctt------------------------------gg
B D                       Dog  ga-ctt------------------------------gg
B D                     Panda  gc-ctt------------------------------gg
               Pacific walrus  gc-ctt------------------------------gg
                 Weddell seal  gc-ctt------------------------------gg
B D                    Tenrec  ------------------------------------gg
B D                  Platypus  ag-cct------------------------------ct
  D               Rock pigeon  gc-cag------------------------------ag
  D              Saker falcon  ca-ctc------------------------------gg
  D          Peregrine falcon  ct-cca------------------------------ga
  D       Collared flycatcher  gg-gat------------------------------gg
  D    White-throated sparrow  gc-cac------------------------------gg
B D               Zebra finch  gc-ctt------------------------------gg
           Tibetan ground jay  gc-cgc------------------------------gg
  D              Mallard duck  cc-cgt------------------------------g-
B D                   Chicken  ct-cat------------------------------gg
B D                    Turkey  tt-gat------------------------------gg
B D        American alligator  ct-cag------------------------------tg
  D           Green seaturtle  gc-act------------------------------gg
  D            Painted turtle  gc-cct------------------------------gc
B D                    Medaka  tt-ttt------------------------------tg
                Prairie vole  ======================================
B D                      Pika  ======================================
B D                     Shrew  ======================================
B D                  Hedgehog  --------------------------------------
B D                Coelacanth  ======================================
  D    Spiny softshell turtle  ======================================
                    Aardvark  --------------------------------------
            Cape golden mole  --------------------------------------
B D                   Megabat  ======================================
                 Spotted gar  ======================================
B D           Tasmanian devil  --------------------------------------
B D             X. tropicalis  ======================================
  D             Scarlet macaw  ======================================
B D                Budgerigar  ======================================
B D                   Opossum  --------------------------------------
  D                    Parrot  ======================================
B D                   Wallaby  ======================================
         Cape elephant shrew  ======================================
B D                   Manatee  --------------------------------------
B D                  Elephant  ======================================
  D  Chinese softshell turtle  ======================================
               Big brown bat  ======================================
            Black flying-fox  ======================================
        David's myotis (bat)  ======================================
B D                 Armadillo  ======================================

Inserts between block 14 and 15 in window
      Lesser Egyptian jerboa 4bp
B D          Chinese hamster 17bp
              Golden hamster 6bp
B D                    Mouse 34bp
B D                      Rat 47bp
B D           Naked mole-rat 1bp
B D               Guinea pig 4bp
                  Chinchilla 4bp
            Brush-tailed rat 4bp
B D                   Tenrec 6bp

Alignment block 15 of 191 in window, 136848920 - 136848923, 4 bps 
B D                     Human  ggc---------g
B D                     Chimp  ggc---------g
B D                   Gorilla  ggc---------g
B D                 Orangutan  ggc---------g
B D                    Gibbon  ggc---------g
B D       Crab-eating macaque  ggc---------g
B D                    Baboon  ggc---------g
B D              Green monkey  ggc---------g
B D                  Marmoset  gac---------a
B D           Squirrel monkey  gac---------g
B D                  Bushbaby  aaa---------g
           Chinese tree shrew  gcc---------a
       Lesser Egyptian jerboa  cgc---------g
                 Prairie vole  ggt---------g
B D           Chinese hamster  ggt---------g
               Golden hamster  ggt---------g
B D                     Mouse  cgc---------a
B D                       Rat  tgt---------g
B D            Naked mole-rat  ggc---------t
B D                Guinea pig  ggt---------g
                   Chinchilla  ggc---------g
             Brush-tailed rat  ggc---------g
B D                       Pig  aac---------a
B D                    Alpaca  gacac-------a
B D                   Dolphin  agc---------a
                 Killer whale  agc---------a
             Tibetan antelope  aac---------a
B D                       Cow  gactcggtgggga
B D                     Sheep  aac---------a
B D                     Horse  gac---------g
B D          White rhinoceros  gac---------a
B D                       Cat  gac---------g
B D                       Dog  gac---------a
B D                     Panda  gat---------g
               Pacific walrus  gcc---------g
                 Weddell seal  gac---------g
          Cape elephant shrew  --c---------g
B D                   Manatee  --t---------g
             Cape golden mole  ------------g
B D                    Tenrec  --c---------g
                     Aardvark  --c---------a
B D                   Opossum  ggc---------g
B D           Tasmanian devil  gcc---------c
B D                  Platypus  gac---------a
  D               Rock pigeon  -----------gg
  D              Saker falcon  -----------gg
  D          Peregrine falcon  -----------gg
  D       Collared flycatcher  -----------ag
  D    White-throated sparrow  -----------tg
B D               Zebra finch  -----------ag
           Tibetan ground jay  -----------tg
  D              Mallard duck  ------------g
B D                   Chicken  -----------tg
B D                    Turkey  -----------ag
B D        American alligator  -----------gg
  D           Green seaturtle  -----------tg
  D            Painted turtle  -----------cg
B D                    Medaka  cac---------g
B D                      Pika  =============
B D                     Shrew  =============
B D                  Hedgehog  -------------
B D                Coelacanth  =============
  D    Spiny softshell turtle  =============
B D                    Rhesus  NNNNNNNNNNNNN
B D                   Megabat  =============
                 Spotted gar  =============
B D             X. tropicalis  =============
  D             Scarlet macaw  =============
B D                Budgerigar  =============
B D       Medium ground finch  NNNNNNNNNNNNN
  D                    Parrot  =============
B D                   Wallaby  =============
B D                  Elephant  =============
  D  Chinese softshell turtle  =============
B D                   Ferret   NNNNNNNNNNNNN
               Domestic goat  NNNNNNNNNNNNN
             Star-nosed mole  NNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNN
               Big brown bat  =============
            Black flying-fox  =============
B D                  Squirrel  -------------
        David's myotis (bat)  =============
B D                 Armadillo  =============

Inserts between block 15 and 16 in window
B D                      Pig 2bp
B D                   Alpaca 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 2bp
B D                 Platypus 22bp
  D              Rock pigeon 10bp
  D             Saker falcon 5bp
  D         Peregrine falcon 6bp
  D      Collared flycatcher 5bp
  D   White-throated sparrow 1bp
B D              Zebra finch 5bp
          Tibetan ground jay 1bp
  D             Mallard duck 10bp
B D                  Chicken 10bp
B D                   Turkey 7bp
B D       American alligator 20bp
  D          Green seaturtle 5bp
  D           Painted turtle 5bp

Alignment block 16 of 191 in window, 136848924 - 136848927, 4 bps 
B D                     Human  gtgg
B D                     Chimp  gtgg
B D                   Gorilla  gtgg
B D                 Orangutan  gtgg
B D                    Gibbon  gtgg
B D       Crab-eating macaque  gtgg
B D                    Baboon  atgg
B D              Green monkey  gtgg
B D                  Marmoset  gtgg
B D           Squirrel monkey  gtgg
B D                  Bushbaby  gctg
           Chinese tree shrew  gcac
       Lesser Egyptian jerboa  gtgg
                 Prairie vole  atgg
B D           Chinese hamster  -tga
               Golden hamster  -tga
B D                     Mouse  accg
B D                       Rat  ttgg
B D            Naked mole-rat  cgtg
B D                Guinea pig  cacg
                   Chinchilla  cggg
             Brush-tailed rat  cggg
B D                       Pig  g-gg
B D                    Alpaca  gggg
B D                   Dolphin  gcgg
                 Killer whale  gcgg
             Tibetan antelope  gtgg
B D                       Cow  gggg
B D                     Sheep  gtgg
B D                     Horse  -cgg
B D          White rhinoceros  -cgg
B D                       Cat  -cgg
B D                       Dog  -tag
B D                     Panda  -ctg
               Pacific walrus  -tgg
                 Weddell seal  -cgg
             Black flying-fox  gtgg
B D                   Megabat  gtgg
B D                  Hedgehog  -cgg
          Cape elephant shrew  gagg
B D                   Manatee  gggg
             Cape golden mole  gggg
B D                    Tenrec  gggg
                     Aardvark  gtgg
B D                   Opossum  --gg
B D           Tasmanian devil  --gg
B D                  Platypus  ccgg
  D               Rock pigeon  g---
  D              Saker falcon  a---
  D          Peregrine falcon  a---
  D       Collared flycatcher  g---
  D    White-throated sparrow  g---
B D               Zebra finch  g---
           Tibetan ground jay  g---
  D              Mallard duck  g---
B D                   Chicken  a---
B D                    Turkey  a---
B D        American alligator  g---
  D           Green seaturtle  t---
  D            Painted turtle  g---
B D                    Medaka  ctgg
B D                      Pika  ====
B D                     Shrew  ====
B D                Coelacanth  ====
  D    Spiny softshell turtle  ====
B D                    Rhesus  NNNN
                 Spotted gar  ====
B D             X. tropicalis  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
B D       Medium ground finch  NNNN
  D                    Parrot  ====
B D                   Wallaby  ====
B D                  Elephant  ====
  D  Chinese softshell turtle  ====
B D                   Ferret   NNNN
               Domestic goat  NNNN
             Star-nosed mole  NNNN
              Bactrian camel  NNNN
               Big brown bat  ====
B D                  Squirrel  ----
        David's myotis (bat)  ====
B D                 Armadillo  ====

Inserts between block 16 and 17 in window
B D                      Pig 4bp
B D                   Alpaca 4bp
B D                  Dolphin 4bp
                Killer whale 4bp
            Tibetan antelope 4bp
B D                      Cow 4bp
B D                    Sheep 4bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 2bp
B D                    Panda 1bp
              Pacific walrus 1081bp
                Weddell seal 33bp
B D                 Hedgehog 2bp
         Cape elephant shrew 12bp
B D                  Manatee 12bp
            Cape golden mole 15bp
B D                   Tenrec 20bp
                    Aardvark 2bp
B D                  Opossum 23bp
B D          Tasmanian devil 18bp
B D                 Platypus 8bp
  D              Rock pigeon 5bp
  D             Saker falcon 5bp
  D         Peregrine falcon 5bp
  D      Collared flycatcher 6bp
  D   White-throated sparrow 5bp
B D              Zebra finch 6bp
          Tibetan ground jay 5bp
  D             Mallard duck 5bp
B D                  Chicken 5bp
B D                   Turkey 5bp
B D       American alligator 5bp
  D          Green seaturtle 15bp
  D           Painted turtle 5bp

Alignment block 17 of 191 in window, 136848928 - 136848954, 27 bps 
B D                     Human  ag--g---gg--gtg------------------------g----ag------------------------
B D                     Chimp  ag--g---gg--gta------------------------g----ag------------------------
B D                   Gorilla  ag--g---gg--gta------------------------g----ag------------------------
B D                 Orangutan  ag--a---gc--ggg------------------------g----ag------------------------
B D                    Gibbon  ag--a---gg--gta------------------------g----ag------------------------
B D       Crab-eating macaque  ag--g---ga--gga------------------------g----gg------------------------
B D                    Baboon  ag--g---ct--ggg------------------------g----gg------------------------
B D              Green monkey  ag--a---gg--gga------------------------g----ggggaggacttcgggcgatggagagg
B D                  Marmoset  agttt---gg--gtt------------------------g----ag------------------------
B D           Squirrel monkey  ag--g---gg--gga------------------------g----ag------------------------
B D                  Bushbaby  gg--g---ca--ggg------------------------g----ag------------------------
           Chinese tree shrew  cg--a---gc------------------------------------------------------------
B D                  Squirrel  --------------------------------------------gc------------------------
       Lesser Egyptian jerboa  gg--g---gg--gga------------------------t----tc------------------------
                 Prairie vole  tg--g---tg--gtg------------------------a----gc------------------------
B D           Chinese hamster  ag--g---gg--tca------------------------g----gc------------------------
               Golden hamster  ag--g---gg--tca------------------------g----gc------------------------
B D                     Mouse  ga--g---ta--ttg------------------------t----gg------------------------
B D                       Rat  ga--g---ct--ttc------------------------g----gg------------------------
B D            Naked mole-rat  gg--g---tc--gta------------------------g----gg------------------------
B D                Guinea pig  ag--g---tc--gca-----------------------------ga------------------------
                   Chinchilla  ag--g---tc--gta------------------------g----gg------------------------
             Brush-tailed rat  cg--g---tc--gca------------------------ggggcgg------------------------
B D                       Pig  gg--a---aaagctg------------------------g----gc------------------------
B D                    Alpaca  gg--g---ga-----------------------------g----gg------------------------
B D                   Dolphin  gg--a---ag--cag------------------------g----ag------------------------
                 Killer whale  gg--a---ag--cag------------------------g----ag------------------------
             Tibetan antelope  gg--a---gg--ccg------------------------g----ag------------------------
B D                       Cow  gg--a---ga--ccg--------------------c---g----ag------------------------
B D                     Sheep  gg--a---gg--ccg------------------------g----ag------------------------
B D                     Horse  gg--g---gg--act------------------------g----gg------------------------
B D          White rhinoceros  gg--g---gg--acg------------------------g----gg------------------------
B D                       Cat  gg--g---gg--aca------------------------g----gg------------------------
B D                       Dog  gg--a---gg--ata------------------------a----gg------------------------
B D                     Panda  gg--g---ga--aca------------------------g----gg------------------------
               Pacific walrus  gg--g---gg--acg------------------------g----gg------------------------
                 Weddell seal  gg--g---gg--acg------------------------g----ag------------------------
             Black flying-fox  -g--g---gg--gcg------------------------t----gg------------------------
B D                   Megabat  -g--g---gg--gcg------------------------t----gg------------------------
B D                  Hedgehog  gg--g---ga--gca------------------------a----ag------------------------
          Cape elephant shrew  gg--------------------------------------------------------------------
B D                   Manatee  gg--------------------------------------------------------------------
             Cape golden mole  gg--------------------------------------------------------------------
B D                    Tenrec  ag--------------------------------------------------------------------
B D                   Opossum  ag--g---gt--c---------------------------------------------------------
B D           Tasmanian devil  ag--a---gt--t---------------------------------------------------------
B D                  Platypus  gg--g---ga--gcc------------------------g----gg------------------------
  D               Rock pigeon  ca--c---aa--agg--------------------gc---------------------------------
  D              Saker falcon  gg--c---ag--gct-------------------------------------------------------
  D          Peregrine falcon  gg--ctcagg--gtt-------------------------------------------------------
  D       Collared flycatcher  ca--g---gg--gag-------------------------------------------------------
  D    White-throated sparrow  gg--c---gg--gag-------------------------------------------------------
B D               Zebra finch  cg--c---gg--ga--------------------------------------------------------
           Tibetan ground jay  tg--c---gg--ggg--------------------g----------------------------------
  D              Mallard duck  gc--g---gg--agc----------------cggcgt---------------------------------
B D                   Chicken  tc--g---ag--gtgtccatcacgaact--tcaagg----------------------------------
B D                    Turkey  gg--g---ag--agg-----------------agcg----------------------------------
B D        American alligator  cc--t---gg--gtg-----------ctgctcggggctt-------------------------------
  D           Green seaturtle  gt--g-----------------------------------------------------------------
  D            Painted turtle  gt--g---ag--gtg-------------------------------------------------------
B D                    Medaka  ----------------------------------------------------------------------
B D                      Pika  ======================================================================
B D                     Shrew  ======================================================================
B D                Coelacanth  ======================================================================
  D    Spiny softshell turtle  ======================================================================
                    Aardvark  ======================================================================
                 Spotted gar  ======================================================================
B D             X. tropicalis  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
  D                    Parrot  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Elephant  ======================================================================
  D  Chinese softshell turtle  ======================================================================
               Big brown bat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                 Armadillo  ======================================================================

                        Human  ------a-------------gcgaggcc------------------------------------------
                        Chimp  ------a-------------gcgaggcc------------------------------------------
                      Gorilla  ------a-------------gcgaggcc------------------------------------------
                    Orangutan  ------g-------------gggaggcc------------------------------------------
                       Gibbon  ------g-------------gggaggcc------------------------------------------
          Crab-eating macaque  ---------------------ggagtcc------------------------------------------
                       Baboon  --------------------aggaggcc------------------------------------------
                 Green monkey  gaagagg-------------gggaggcc------------------------------------------
                     Marmoset  ---------------------cgagacc------------------------------------------
              Squirrel monkey  ---------------------cgagacc------------------------------------------
                     Bushbaby  ------a-------------gcgg---c------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  ------c-------------ggtggggt------------------------------------------
       Lesser Egyptian jerboa  ------a-------------aggggag-------------------------------------------
                 Prairie vole  ------g-------------tctggggc------------------------------------------
              Chinese hamster  ------a-------------ggggagtc------------------------------------------
               Golden hamster  ------a-------------ggggggtc------------------------------------------
                        Mouse  ------a-------------aggggag-------------------------------------------
                          Rat  ------a-------------gtaggagc------------------------------------------
               Naked mole-rat  ------g-------------accgaggc------------------------------------------
                   Guinea pig  ------g-------------gcagaggc------------------------------------------
                   Chinchilla  ------g-------------acggaggc------------------------------------------
             Brush-tailed rat  ------g-------------acggaggc------------------------------------------
                          Pig  ------a-------------aggagacc------------------------------------------
                       Alpaca  ------a-------------ggaaagtc------------------------------------------
                      Dolphin  ------a-------------gagaggcc------------------------------------------
                 Killer whale  ------a-------------gagaggcc------------------------------------------
             Tibetan antelope  ------a-------------gaggcggg------------------------------------------
                          Cow  ------actcggtg------gggacggg------------------------------------------
                        Sheep  ------a-------------gaggcggg------------------------------------------
                        Horse  ------a-------------gggagacc------------------------------------------
             White rhinoceros  ------a-------------gggagacg------------------------------------------
                          Cat  ------a-------------gggaggcc------------------------------------------
                          Dog  ------a-------------aggaggac------------------------------------------
                        Panda  ------a-------------gtagggcc------------------------------------------
               Pacific walrus  ------a-------------ggagggcc------------------------------------------
                 Weddell seal  ------a-------------ggagggccttgggactctgtgggggacggggaggagggacttgggactct
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
                     Hedgehog  ----------------------------------------------------------------------
          Cape elephant shrew  ----------------------------------------------------------------------
                      Manatee  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
                       Tenrec  ----------------------------------------------------------------------
                      Opossum  ----------------------------------------------------------------------
              Tasmanian devil  ----------------------------------------------------------------------
                     Platypus  ------c-------------cggggggc------------------------------------------
                  Rock pigeon  ----------------------------------------------------------------------
                 Saker falcon  ----------------------------------------------------------------------
             Peregrine falcon  ----------------------------------------------------------------------
          Collared flycatcher  ----------------------------------------------------------------------
       White-throated sparrow  ----------------------------------------------------------------------
                  Zebra finch  ----------------------------------------------------------------------
           Tibetan ground jay  ----------------------------------------------------------------------
                 Mallard duck  ----------------------------------------------------------------------
                      Chicken  ----------------------------------------------------------------------
                       Turkey  ----------------------------------------------------------------------
           American alligator  ----------------------------------------------------------------------
              Green seaturtle  ----------------------------------------------------------------------
               Painted turtle  ----------------------------------------------------------------------
                       Medaka  --------acggggcggatcagggggct------------------------------------------
                         Pika  ======================================================================
                        Shrew  ======================================================================
                   Coelacanth  ======================================================================
       Spiny softshell turtle  ======================================================================
                     Aardvark  ======================================================================
                  Spotted gar  ======================================================================
                X. tropicalis  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                       Parrot  ======================================================================
                      Wallaby  ======================================================================
                     Elephant  ======================================================================
     Chinese softshell turtle  ======================================================================
                Big brown bat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================

                        Human  -----------------tt-cgggc-----
                        Chimp  -----------------tt-cgggc-----
                      Gorilla  -----------------tt-cgggc-----
                    Orangutan  -----------------tt-cgggc-----
                       Gibbon  -----------------tt-cgggc-----
          Crab-eating macaque  -----------------tt-cgggc-----
                       Baboon  -----------------tt-cgggc-----
                 Green monkey  -----------------tt-cgggc-----
                     Marmoset  -----------------tt-cggag-----
              Squirrel monkey  -----------------tc-cggac-----
                     Bushbaby  -----------------tt-cggat-----
           Chinese tree shrew  ------------------------------
                     Squirrel  -----------------gc-----------
       Lesser Egyptian jerboa  ------------------------------
                 Prairie vole  -----------------gt-----------
              Chinese hamster  -----------------ct-----------
               Golden hamster  -----------------ct-----------
                        Mouse  ------------------------------
                          Rat  -----------------tt-----------
               Naked mole-rat  -----------------ct-----------
                   Guinea pig  -----------------ctt----------
                   Chinchilla  -----------------ct-----------
             Brush-tailed rat  -----------------gt-----------
                          Pig  -----------------tt-----------
                       Alpaca  -----------------at-----------
                      Dolphin  -----------------ct-----------
                 Killer whale  -----------------ct-----------
             Tibetan antelope  -----------------ct-----------
                          Cow  -----------------gc-----------
                        Sheep  -----------------ct-----------
                        Horse  -----------------ct-----------
             White rhinoceros  -----------------ct-----------
                          Cat  -----------------tt-----------
                          Dog  -----------------tt-----------
                        Panda  -----------------tt-----------
               Pacific walrus  -----------------tt-----------
                 Weddell seal  gtggggtacggaggtcctt-----------
             Black flying-fox  -----------------at-----------
                      Megabat  -----------------at-----------
                     Hedgehog  ------------------------------
          Cape elephant shrew  ------------------------------
                      Manatee  ------------------------------
             Cape golden mole  ------------------------------
                       Tenrec  ------------------------------
                      Opossum  ------------------------------
              Tasmanian devil  ------------------------------
                     Platypus  ------------------------------
                  Rock pigeon  ------------------------------
                 Saker falcon  ------------------------------
             Peregrine falcon  ------------------------------
          Collared flycatcher  ------------------------------
       White-throated sparrow  ------------------------------
                  Zebra finch  ------------------------------
           Tibetan ground jay  ------------------------------
                 Mallard duck  ------------------------------
                      Chicken  ------------------------------
                       Turkey  ------------------------------
           American alligator  ------------------------------
              Green seaturtle  ------------------------------
               Painted turtle  ------------------------------
                       Medaka  -----------------tt------tgcac
                         Pika  ==============================
                        Shrew  ==============================
                   Coelacanth  ==============================
       Spiny softshell turtle  ==============================
                     Aardvark  ==============================
                  Spotted gar  ==============================
                X. tropicalis  ==============================
                Scarlet macaw  ==============================
                   Budgerigar  ==============================
                       Parrot  ==============================
                      Wallaby  ==============================
                     Elephant  ==============================
     Chinese softshell turtle  ==============================
                Big brown bat  ==============================
         David's myotis (bat)  ==============================
                    Armadillo  ==============================

Inserts between block 17 and 18 in window
B D                      Pig 12bp
B D                   Alpaca 13bp
B D                  Dolphin 12bp
                Killer whale 12bp
            Tibetan antelope 939bp
B D                      Cow 77bp
B D                    Sheep 17bp
B D                    Horse 8bp
B D         White rhinoceros 10bp
B D                      Cat 10bp
B D                      Dog 10bp
B D                    Panda 10bp
              Pacific walrus 10bp
                Weddell seal 10bp
            Black flying-fox 8bp
B D                  Megabat 8bp
B D          Tasmanian devil 105bp
  D              Rock pigeon 1bp
  D             Saker falcon 5bp
  D         Peregrine falcon 5bp
B D              Zebra finch 9bp
          Tibetan ground jay 1bp
  D             Mallard duck 1bp
B D                  Chicken 1bp
B D                   Turkey 1bp
  D           Painted turtle 1bp

Alignment block 18 of 191 in window, 136848955 - 136848959, 5 bps 
B D                     Human  ggtgg
B D                     Chimp  ggtgg
B D                   Gorilla  ggtgg
B D                 Orangutan  ggtgg
B D                    Gibbon  ggtgg
B D       Crab-eating macaque  catgg
B D                    Baboon  ggtgg
B D              Green monkey  gatgg
B D                  Marmoset  ggcgg
B D           Squirrel monkey  ggtgg
B D                  Bushbaby  tgcag
B D                   Opossum  ----a
B D                  Platypus  gttgg
B D                    Medaka  gctgg
              Golden hamster  -----
      Lesser Egyptian jerboa  -----
B D                       Rat  -----
                Prairie vole  -----
B D                     Mouse  -----
B D                      Pika  =====
B D                     Shrew  =====
B D                  Hedgehog  -----
B D                Guinea pig  -----
B D                Coelacanth  =====
  D    Spiny softshell turtle  =====
                    Aardvark  =====
B D                    Rhesus  NNNNN
            Cape golden mole  -----
B D                       Pig  =====
B D                   Megabat  =====
B D                   Dolphin  =====
                 Spotted gar  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
  D    White-throated sparrow  -----
B D           Tasmanian devil  =====
B D             X. tropicalis  =====
  D            Painted turtle  =====
B D        American alligator  -----
  D             Scarlet macaw  =====
B D                Budgerigar  =====
                  Chinchilla  -----
B D            Naked mole-rat  -----
  D               Rock pigeon  =====
B D       Medium ground finch  NNNNN
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D                    Parrot  =====
B D                   Wallaby  =====
            Brush-tailed rat  -----
         Cape elephant shrew  -----
          Chinese tree shrew  -----
B D                   Manatee  -----
B D                  Elephant  =====
B D           Chinese hamster  -----
B D                    Tenrec  -----
  D           Green seaturtle  -----
B D                       Cat  =====
                Weddell seal  =====
  D  Chinese softshell turtle  =====
B D                   Ferret   NNNNN
               Domestic goat  NNNNN
B D                     Sheep  =====
            Tibetan antelope  =====
  D       Collared flycatcher  -----
             Star-nosed mole  NNNNN
              Bactrian camel  NNNNN
B D                    Alpaca  =====
               Big brown bat  =====
              Pacific walrus  =====
B D                     Panda  =====
B D                       Cow  =====
                Killer whale  =====
B D                       Dog  =====
            Black flying-fox  =====
B D          White rhinoceros  =====
B D                     Horse  =====
B D                  Squirrel  -----
        David's myotis (bat)  =====
B D                 Armadillo  =====

Inserts between block 18 and 19 in window
B D                  Opossum 3bp
B D                 Platypus 1bp

Alignment block 19 of 191 in window, 136848960 - 136848964, 5 bps 
B D                     Human  --agagc
B D                     Chimp  --agagc
B D                   Gorilla  --agagc
B D                 Orangutan  --agggg
B D                    Gibbon  --agagg
B D       Crab-eating macaque  --aga--
B D                    Baboon  --agg--
B D              Green monkey  --aga--
B D                  Marmoset  --agg--
B D           Squirrel monkey  --agg--
B D                  Bushbaby  --gga--
B D                       Pig  --ggaac
B D                    Alpaca  --gctgc
B D                   Dolphin  --gggac
                 Killer whale  --gggac
B D                       Cow  --ggggc
B D                     Sheep  --ggggc
B D          White rhinoceros  --ggagg
B D                       Cat  --gggag
B D                       Dog  --gggag
B D                     Panda  --gggag
               Pacific walrus  --ggaac
                 Weddell seal  --gaaag
          Cape elephant shrew  --agagc
             Cape golden mole  --gaagt
B D                    Tenrec  --gaggt
B D                   Opossum  --agc--
B D                  Platypus  --ggt--
B D        American alligator  -----gc
B D                    Medaka  acggg--
              Golden hamster  -------
      Lesser Egyptian jerboa  -------
B D                       Rat  -------
                Prairie vole  -------
B D                     Mouse  -------
B D                      Pika  =======
B D                     Shrew  =======
B D                  Hedgehog  -------
B D                Guinea pig  -------
B D                Coelacanth  =======
  D    Spiny softshell turtle  =======
                    Aardvark  =======
B D                    Rhesus  NNNNNNN
B D                   Megabat  =======
                 Spotted gar  =======
B D                    Turkey  =======
B D                   Chicken  =======
  D              Mallard duck  =======
          Tibetan ground jay  =======
B D               Zebra finch  =======
  D    White-throated sparrow  -------
B D           Tasmanian devil  =======
B D             X. tropicalis  =======
  D            Painted turtle  =======
  D             Scarlet macaw  =======
B D                Budgerigar  =======
                  Chinchilla  -------
B D            Naked mole-rat  -------
  D               Rock pigeon  =======
B D       Medium ground finch  NNNNNNN
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D                    Parrot  =======
B D                   Wallaby  =======
            Brush-tailed rat  -------
          Chinese tree shrew  -------
B D                   Manatee  -------
B D                  Elephant  =======
B D           Chinese hamster  -------
  D           Green seaturtle  -------
  D  Chinese softshell turtle  =======
B D                   Ferret   NNNNNNN
               Domestic goat  NNNNNNN
            Tibetan antelope  =======
  D       Collared flycatcher  -------
             Star-nosed mole  NNNNNNN
              Bactrian camel  NNNNNNN
               Big brown bat  =======
            Black flying-fox  =======
B D                     Horse  =======
B D                  Squirrel  -------
        David's myotis (bat)  =======
B D                 Armadillo  =======

Inserts between block 19 and 20 in window
B D                Orangutan 285bp
B D       American alligator 2bp

Alignment block 20 of 191 in window, 136848965 - 136848979, 15 bps 
B D                     Human  gggg-ag--g----------gggga---------------------------------------------
B D                     Chimp  gggg-a---g----------gggga---------------------------------------------
B D                   Gorilla  gggg-a---g----------gggga---------------------------------------------
B D                 Orangutan  gggg-ag--a----------ggcga---------------------------------------------
B D                    Gibbon  gtag-a---g----------gggga---------------------------------------------
B D       Crab-eating macaque  gggg-a---g----------gggga---------------------------------------------
B D                    Baboon  ggga-a---g----------gggga---------------------------------------------
B D              Green monkey  gggg-a---ga---------gggga---------------------------------------------
B D                  Marmoset  gggg-a---g----------agcga---------------------------------------------
B D           Squirrel monkey  ggggaa---g----------aggga---------------------------------------------
B D                  Bushbaby  -taa-g---g----------aagga---------------------------------------------
           Chinese tree shrew  ------attg----------ctggg---------------------------------------------
B D                  Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  ----------------------------------------------------------------------
B D           Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
B D                     Mouse  ----------------------------------------------------------------------
B D                       Rat  ----------------------------------------------------------------------
B D            Naked mole-rat  ----------------------tgg---------------------------------------------
B D                Guinea pig  ----------------------ggg---------------------------------------------
                   Chinchilla  ----------------------tgg---------------------------------------------
             Brush-tailed rat  ------------------------g---------------------------------------------
B D                       Pig  --------------------cgggg---------------------------------------------
B D                    Alpaca  --------------------ggggg---------------------------------------------
B D                   Dolphin  --------------------tgggg---------------------------------------------
                 Killer whale  --------------------tgggg---------------------------------------------
B D                       Cow  --------------------cgggg---------------------------------------------
B D                     Sheep  --------------------ggggg---------------------------------------------
B D                     Horse  ---------------------------------------------ggtaggggcggc-------------
B D          White rhinoceros  --------------------gacgcggggtgagacgctcgcacacggtgggagacgg-------------
B D                       Cat  --------------------gaggg---------------------------------------------
B D                       Dog  --------------------gatgg---------------------------------------------
B D                     Panda  --------------------gacgg---------------------------------------------
               Pacific walrus  --------------------gacac---------------------------------------------
                 Weddell seal  --------------------gacaaggaggagggcctttggacgcgttgggggacggggaggagaccttg
             Black flying-fox  ----------------------------------------------------------------------
B D                   Megabat  ----------------------------------------------------------------------
          Cape elephant shrew  ----------------------------------------------------------------------
B D                   Manatee  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
B D                    Tenrec  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
B D                   Opossum  --------------------gggga---------------------------------------------
B D                  Platypus  ----------ggagc----cggagg---------------------------------------------
  D               Rock pigeon  ----------------------------------------------------------------------
  D       Collared flycatcher  ----------------------------------------------------------------------
  D    White-throated sparrow  ----------------------------------------------------------------------
           Tibetan ground jay  ----------------------------------------------------------------------
  D              Mallard duck  ----------------------------------------------------------------------
B D                   Chicken  ----------------------------------------------------------------------
B D                    Turkey  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
  D           Green seaturtle  ----------------------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------------------
B D                    Medaka  -------------gcagatcagagg---------------------------------------------
B D                      Pika  ======================================================================
B D                     Shrew  ======================================================================
B D                  Hedgehog  ----------------------------------------------------------------------
B D                Coelacanth  ======================================================================
  D    Spiny softshell turtle  ======================================================================
                 Spotted gar  ======================================================================
B D               Zebra finch  ======================================================================
B D           Tasmanian devil  ======================================================================
B D             X. tropicalis  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Elephant  ======================================================================
  D  Chinese softshell turtle  ======================================================================
            Tibetan antelope  ======================================================================
               Big brown bat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                 Armadillo  ======================================================================

                        Human  ------------------------------------------------ggc
                        Chimp  ------------------------------------------------gtc
                      Gorilla  ------------------------------------------------gtc
                    Orangutan  ------------------------------------------------ggc
                       Gibbon  ------------------------------------------------ggc
          Crab-eating macaque  ------------------------------------------------ggc
                       Baboon  ------------------------------------------------ggc
                 Green monkey  ------------------------------------------------ggc
                     Marmoset  ------------------------------------------------ggc
              Squirrel monkey  ------------------------------------------------ggc
                     Bushbaby  ------------------------------------------------ggc
           Chinese tree shrew  ------------------------------------------------gcc
                     Squirrel  ------------------------------------------------gac
       Lesser Egyptian jerboa  -------------------------------------------------ac
                 Prairie vole  ------------------------------------------------aga
              Chinese hamster  ------------------------------------------------tga
               Golden hamster  ------------------------------------------------tga
                        Mouse  -------------------------------------------------gc
                          Rat  ------------------------------------------------agc
               Naked mole-rat  ------------------------------------------------gac
                   Guinea pig  ------------------------------------------------gct
                   Chinchilla  ------------------------------------------------tgc
             Brush-tailed rat  ------------------------------------------------ggc
                          Pig  ------------------------------------------------aga
                       Alpaca  ------------------------------------------------aga
                      Dolphin  ------------------------------------------------a--
                 Killer whale  ------------------------------------------------a--
                          Cow  ------------------------------------------------ggc
                        Sheep  ------------------------------------------------ggc
                        Horse  ------------------------------------------------gga
             White rhinoceros  ------------------------------------------------gga
                          Cat  ------------------------------------------------aga
                          Dog  ------------------------------------------------tga
                        Panda  ------------------------------------------------aga
               Pacific walrus  ------------------------------------------------gga
                 Weddell seal  ggacactgtgggggacgaggaggagccttgggacgcggtgggaggcgggga
             Black flying-fox  ------------------------------------------------gga
                      Megabat  ------------------------------------------------gga
          Cape elephant shrew  ----------------------------------agggtttgcggac-agg
                      Manatee  ------------------------------------------------agg
             Cape golden mole  ----------------------------------ccggacagcttccgggg
                       Tenrec  ----------------------------------gcgaacagcgccctggg
                     Aardvark  ------------------------------------------------ggg
                      Opossum  ------------------------------------------------agt
                     Platypus  ------------------------------------------------agc
                  Rock pigeon  ------------------------------------------------ggg
          Collared flycatcher  ------------------------------------------------aag
       White-throated sparrow  --------------------------------------------------g
           Tibetan ground jay  ------------------------------------------------ggg
                 Mallard duck  ------------------------------------------------ggg
                      Chicken  ------------------------------------------------ggg
                       Turkey  ------------------------------------------------gga
           American alligator  ------------------------------------------------agg
              Green seaturtle  ------------------------------------------------tgt
               Painted turtle  ------------------------------------------------tgc
                       Medaka  ------------------------------------------------ggc
                         Pika  ===================================================
                        Shrew  ===================================================
                     Hedgehog  ---------------------------------------------------
                   Coelacanth  ===================================================
       Spiny softshell turtle  ===================================================
                  Spotted gar  ===================================================
                  Zebra finch  ===================================================
              Tasmanian devil  ===================================================
                X. tropicalis  ===================================================
                Scarlet macaw  ===================================================
                   Budgerigar  ===================================================
             Peregrine falcon  ===================================================
                 Saker falcon  ===================================================
                       Parrot  ===================================================
                      Wallaby  ===================================================
                     Elephant  ===================================================
     Chinese softshell turtle  ===================================================
             Tibetan antelope  ===================================================
                Big brown bat  ===================================================
         David's myotis (bat)  ===================================================
                    Armadillo  ===================================================

Inserts between block 20 and 21 in window
B D                      Pig 14bp
B D                   Alpaca 7bp
B D                  Dolphin 7bp
                Killer whale 7bp
B D                      Cow 16bp
B D                    Horse 7bp
B D         White rhinoceros 7bp
B D                      Cat 7bp
B D                      Dog 7bp
B D                    Panda 6bp
              Pacific walrus 7bp
                Weddell seal 7bp
            Black flying-fox 7bp
B D                  Megabat 7bp
         Cape elephant shrew 3bp
B D                  Manatee 3bp
            Cape golden mole 2bp
B D                   Tenrec 5bp
                    Aardvark 2bp
B D                  Opossum 12bp
B D                 Platypus 1bp
  D              Rock pigeon 12bp
  D      Collared flycatcher 12bp
  D   White-throated sparrow 12bp
          Tibetan ground jay 12bp
  D             Mallard duck 17bp
B D                  Chicken 19bp
B D                   Turkey 12bp
B D       American alligator 15bp
  D          Green seaturtle 12bp
  D           Painted turtle 22bp

Alignment block 21 of 191 in window, 136848980 - 136848983, 4 bps 
B D                     Human  cttc
B D                     Chimp  cttc
B D                   Gorilla  cttc
B D                 Orangutan  cttt
B D                    Gibbon  cttc
B D       Crab-eating macaque  cttc
B D                    Baboon  cttc
B D              Green monkey  cttc
B D                  Marmoset  ctcc
B D           Squirrel monkey  tttc
B D                  Bushbaby  cccc
           Chinese tree shrew  tttc
B D                  Squirrel  cctt
       Lesser Egyptian jerboa  cctc
                 Prairie vole  agtt
B D           Chinese hamster  actt
               Golden hamster  actt
B D                     Mouse  ccga
B D                       Rat  accc
B D            Naked mole-rat  tctc
B D                Guinea pig  cttc
                   Chinchilla  tctc
             Brush-tailed rat  tctc
B D                       Pig  ccgc
B D                    Alpaca  actc
B D                   Dolphin  cctc
                 Killer whale  cctc
B D                       Cow  cggt
B D                     Horse  cctc
B D          White rhinoceros  cctc
B D                       Cat  cttg
B D                       Dog  ttgg
B D                     Panda  cttg
               Pacific walrus  cttg
                 Weddell seal  cttg
             Black flying-fox  cgtc
B D                   Megabat  cgtc
          Cape elephant shrew  cccc
B D                   Manatee  cctc
             Cape golden mole  ccct
B D                    Tenrec  ccct
                     Aardvark  cctc
B D                   Opossum  cttt
B D                  Platypus  -gcc
  D               Rock pigeon  tgtg
  D              Saker falcon  cctg
  D          Peregrine falcon  cttg
  D       Collared flycatcher  cctc
  D    White-throated sparrow  tctg
B D               Zebra finch  tctg
           Tibetan ground jay  tctg
  D              Mallard duck  gcga
B D                   Chicken  cctg
B D                    Turkey  gctg
B D        American alligator  tgcg
  D           Green seaturtle  tggg
  D            Painted turtle  tggg
B D                    Medaka  tttt
B D                      Pika  ====
B D                     Shrew  ====
B D                  Hedgehog  ----
B D                Coelacanth  ====
  D    Spiny softshell turtle  ====
B D                    Rhesus  NNNN
                 Spotted gar  ====
B D           Tasmanian devil  ====
B D             X. tropicalis  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
B D       Medium ground finch  NNNN
  D                    Parrot  ====
B D                   Wallaby  ====
B D                  Elephant  ====
  D  Chinese softshell turtle  ====
B D                   Ferret   NNNN
               Domestic goat  NNNN
B D                     Sheep  NNNN
            Tibetan antelope  ====
             Star-nosed mole  NNNN
              Bactrian camel  NNNN
               Big brown bat  ====
        David's myotis (bat)  ====
B D                 Armadillo  ====

Inserts between block 21 and 22 in window
  D              Rock pigeon 3bp
  D             Saker falcon 37bp
  D         Peregrine falcon 4bp
  D      Collared flycatcher 6bp
  D   White-throated sparrow 3bp
B D              Zebra finch 6bp
          Tibetan ground jay 3bp
  D             Mallard duck 3bp
B D                  Chicken 3bp
B D                   Turkey 3bp
B D       American alligator 7bp
  D          Green seaturtle 9bp
  D           Painted turtle 1840bp

Alignment block 22 of 191 in window, 136848984 - 136848987, 4 bps 
B D                     Human  gggc
B D                     Chimp  gggc
B D                   Gorilla  gggc
B D                 Orangutan  gggc
B D                    Gibbon  gggc
B D       Crab-eating macaque  gggc
B D                    Baboon  gggc
B D              Green monkey  gggc
B D                  Marmoset  ggac
B D           Squirrel monkey  ggac
B D                  Bushbaby  gggc
           Chinese tree shrew  ggac
B D                  Squirrel  gggc
       Lesser Egyptian jerboa  agac
                 Prairie vole  tggc
B D           Chinese hamster  g---
               Golden hamster  gg--
B D                     Mouse  gggt
B D                       Rat  ggga
B D            Naked mole-rat  atgg
B D                Guinea pig  --ga
                   Chinchilla  ctgg
             Brush-tailed rat  ctgc
B D                       Pig  gg--
B D                    Alpaca  ggac
B D                   Dolphin  gggc
                 Killer whale  gggc
B D                       Cow  gggg
B D                     Horse  ggct
B D          White rhinoceros  ggac
B D                       Cat  ggac
B D                       Dog  agag
B D                     Panda  ggac
               Pacific walrus  ggac
                 Weddell seal  ggac
             Black flying-fox  ggac
B D                   Megabat  ggac
          Cape elephant shrew  ggga
B D                   Manatee  ggac
             Cape golden mole  gagc
B D                    Tenrec  ggac
                     Aardvark  gggc
B D                   Opossum  gaac
B D                  Platypus  aggc
  D               Rock pigeon  aag-
  D              Saker falcon  aag-
  D          Peregrine falcon  -gg-
  D       Collared flycatcher  aga-
  D    White-throated sparrow  ggg-
B D               Zebra finch  agg-
           Tibetan ground jay  ggg-
  D              Mallard duck  ggc-
B D                   Chicken  ggg-
B D                    Turkey  gga-
B D        American alligator  ggg-
  D           Green seaturtle  ggg-
  D            Painted turtle  ggt-
B D                    Medaka  gcac
B D                      Pika  ====
B D                     Shrew  ====
B D                  Hedgehog  ----
B D                Coelacanth  ====
  D    Spiny softshell turtle  ====
B D                    Rhesus  NNNN
                 Spotted gar  ====
B D           Tasmanian devil  ====
B D             X. tropicalis  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
B D       Medium ground finch  NNNN
  D                    Parrot  ====
B D                   Wallaby  ====
B D                  Elephant  ====
  D  Chinese softshell turtle  ====
B D                   Ferret   NNNN
               Domestic goat  NNNN
B D                     Sheep  NNNN
            Tibetan antelope  ====
             Star-nosed mole  NNNN
              Bactrian camel  NNNN
               Big brown bat  ====
        David's myotis (bat)  ====
B D                 Armadillo  ====

Inserts between block 22 and 23 in window
B D                   Alpaca 4bp
B D                  Dolphin 4bp
                Killer whale 4bp
B D                      Cow 4bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                      Dog 2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp
B D                  Opossum 22bp
B D                 Platypus 7bp
  D              Rock pigeon 6bp
  D             Saker falcon 9bp
  D         Peregrine falcon 6bp
  D      Collared flycatcher 3bp
  D   White-throated sparrow 6bp
B D              Zebra finch 15bp
          Tibetan ground jay 6bp
  D             Mallard duck 6bp
B D                  Chicken 6bp
B D                   Turkey 6bp
B D       American alligator 6bp
  D          Green seaturtle 6bp
  D           Painted turtle 6bp

Alignment block 23 of 191 in window, 136848988 - 136849005, 18 bps 
B D                     Human  g-----gtggg--------ag--g----------------------------------------------
B D                     Chimp  g-----gtggg--------ag--g----------------------------------------------
B D                   Gorilla  g-----gtgga--------ag--g----------------------------------------------
B D                 Orangutan  g-----gtgga--------gg--g----------------------------------------------
B D                    Gibbon  g-----gtgga--------ga--g----------------------------------------------
B D       Crab-eating macaque  g-----atgga--------ga--g----------------------------------------------
B D                    Baboon  g-----gtgga--------gg--g----------------------------------------------
B D              Green monkey  g-----atgga--------ga--g----------------------------------------------
B D                  Marmoset  t-----gcgga--------ga--g----------------------------------------------
B D           Squirrel monkey  g-----gcgga--------gg--g----------------------------------------------
B D                  Bushbaby  g-----acggg--------gc--c----------------------------------------------
           Chinese tree shrew  a-----gcagt--------gg--g----------------------------------------------
B D                  Squirrel  g-----t---------------------------------------------------------------
       Lesser Egyptian jerboa  g-----aaacg--------tg--g----------------------------------------------
                 Prairie vole  a---------------------------------------------------------------------
B D           Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
B D                     Mouse  g-----tgaag--------tg--g----------------------------------------------
B D                       Rat  g-----tattg--------tg--g----------------------------------------------
B D            Naked mole-rat  g-----ggtcg--------gg--g----------------------------------------------
B D                Guinea pig  g-----ggtcg--------ag--g----------------------------------------------
                   Chinchilla  g-----gatcg--------a---g----------------------------------------------
             Brush-tailed rat  g-----gatcg-----------------------------------------------------------
B D                       Pig  ---------gg--------ga--tgcg-------------------------------------------
B D                    Alpaca  c-----gcggg--------gg----cc-------------------------------------------
B D                   Dolphin  g-----gtggg--------gg--gaac-------------------------------------------
                 Killer whale  g-----gtggg--------gg--gaac-------------------------------------------
B D                       Cow  g-----gacgg--------ga--gaccgtgagactcggtggagacgcgggcgggagaccgtgggactcgg
B D                     Horse  g-----gtcgg--------gg--aggg-------------------------------------------
B D          White rhinoceros  g-----gtgga--------gg--gacg-------------------------------------------
B D                       Cat  g-----gtggg--------ag--g----------------------------------------------
B D                       Dog  g-----g---------------------------------------------------------------
B D                     Panda  g-----gtggg--------gg--a----------------------------------------------
               Pacific walrus  g-----gtggg--------gg--a----------------------------------------------
                 Weddell seal  g-----atggg--------gg--a----------------------------------------------
             Black flying-fox  g-----gtgcg--------gg--g----------------------------------------------
B D                   Megabat  g-----gtgcg--------gg--g----------------------------------------------
                Big brown bat  ---------ag--------ag--g----------------------------------------------
B D                  Hedgehog  ---------gg--------gt--g----------------------------------------------
          Cape elephant shrew  c-----gcggg--------cggg-----------------------------------------------
B D                   Manatee  a-----gcggg--------ag-------------------------------------------------
             Cape golden mole  a-----gcaaa--------gg-------------------------------------------------
B D                    Tenrec  c-----gcagg--------gg-------------------------------------------------
                     Aardvark  t-----gctgg--------gg-------------------------------------------------
B D                   Opossum  --------------------------------------------------------gctgagccacccca
B D                  Platypus  a-----gctgg--------tg-------------------------------------------------
  D               Rock pigeon  g-----aaagg-----------------------------------------------------------
  D              Saker falcon  g-----ctggg-----------------------------------------------------------
  D          Peregrine falcon  g-----cagag-----------------------------------------------------------
  D       Collared flycatcher  g-----agaga-----------------------------------------------------------
  D    White-throated sparrow  g-----gtaat-----------------------------------------------------------
B D               Zebra finch  g-----gcact-----------------------------------------------------------
           Tibetan ground jay  g-----gtaat-----------------------------------------------------------
  D              Mallard duck  g-----caatg-----------------------------------------------------------
B D                   Chicken  g-----cagag-----------------------------------------------------------
B D                    Turkey  ggcagtgagag-----------------------------------------------------------
B D        American alligator  g-----ggacg-----------------------------------------------------------
  D           Green seaturtle  g-----gggaa-----------------------------------------------------------
  D            Painted turtle  c-----gaggagcgggctg---------------------------------------------------
B D                    Medaka  ----------------------------------------------------------------------
B D                      Pika  ======================================================================
B D                     Shrew  ======================================================================
B D                Coelacanth  ======================================================================
  D    Spiny softshell turtle  ======================================================================
                 Spotted gar  ======================================================================
B D           Tasmanian devil  ======================================================================
B D             X. tropicalis  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
  D                    Parrot  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Elephant  ======================================================================
  D  Chinese softshell turtle  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
B D                 Armadillo  ======================================================================

                        Human  ----------ggg----agagag---
                        Chimp  ----------ggg----agagag---
                      Gorilla  ----------ggg----agagag---
                    Orangutan  ----------ggt----agagag---
                       Gibbon  ----------ggt----agaggg---
          Crab-eating macaque  ----------ggg----aggggg---
                       Baboon  ----------ggg----aggggg---
                 Green monkey  ----------ggg----agaggg---
                     Marmoset  ----------ggg----agaggg---
              Squirrel monkey  ----------ggg----agagcg---
                     Bushbaby  ----------agg----ggaggg---
           Chinese tree shrew  ----------ggg-------------
                     Squirrel  -----------------cggtg----
       Lesser Egyptian jerboa  ----------agttgttggaga----
                 Prairie vole  -----------------acggg----
              Chinese hamster  ------------------gaga----
               Golden hamster  -----------------agaga----
                        Mouse  ----------agtatgcagggg----
                          Rat  ----------a------agggg----
               Naked mole-rat  -----------------acaga----
                   Guinea pig  -----------------acaga----
                   Chinchilla  -----------------acaga----
             Brush-tailed rat  --------------------------
                          Pig  ---------tggg----aggaa----
                       Alpaca  ---------cggg----aggga----
                      Dolphin  ---------ccgg----aggga----
                 Killer whale  ---------ccgg----aggga----
                          Cow  tagggac-gcggg----cggga----
                        Horse  ---------cgg-----aggga----
             White rhinoceros  ---------cggc----gggga----
                          Cat  ----------gag----aggga----
                          Dog  ----------ggg----gagga----
                        Panda  ---------cggg----gagga----
               Pacific walrus  ---------cggg----gagga----
                 Weddell seal  ---------cggg----gagga----
             Black flying-fox  ----------acg----gggga----
                      Megabat  ----------acg----gggga----
                Big brown bat  ----------aag----ggaga----
                     Hedgehog  ---------cgag----aaggt----
          Cape elephant shrew  --------------------------
                      Manatee  --------------------------
             Cape golden mole  --------------------------
                       Tenrec  --------------------------
                     Aardvark  --------------------------
                      Opossum  ctggcccaatgga----agcc-----
                     Platypus  --------------------------
                  Rock pigeon  --------------------------
                 Saker falcon  --------------------------
             Peregrine falcon  --------------------------
          Collared flycatcher  --------------------------
       White-throated sparrow  --------------------------
                  Zebra finch  --------------------------
           Tibetan ground jay  --------------------------
                 Mallard duck  --------------------------
                      Chicken  --------------------------
                       Turkey  --------------------------
           American alligator  --------------------------
              Green seaturtle  --------------------------
               Painted turtle  --------------------------
                       Medaka  ---gctggacggg----gcgga-tca
                         Pika  ==========================
                        Shrew  ==========================
                   Coelacanth  ==========================
       Spiny softshell turtle  ==========================
                       Rhesus  NNNNNNNNNNNNNNNNNNNNNNNNNN
                  Spotted gar  ==========================
              Tasmanian devil  ==========================
                X. tropicalis  ==========================
                Scarlet macaw  ==========================
                   Budgerigar  ==========================
          Medium ground finch  NNNNNNNNNNNNNNNNNNNNNNNNNN
                       Parrot  ==========================
                      Wallaby  ==========================
                     Elephant  ==========================
     Chinese softshell turtle  ==========================
                      Ferret   NNNNNNNNNNNNNNNNNNNNNNNNNN
                Domestic goat  NNNNNNNNNNNNNNNNNNNNNNNNNN
                        Sheep  NNNNNNNNNNNNNNNNNNNNNNNNNN
             Tibetan antelope  ==========================
              Star-nosed mole  NNNNNNNNNNNNNNNNNNNNNNNNNN
               Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNN
         David's myotis (bat)  ==========================
                    Armadillo  ==========================

Inserts between block 23 and 24 in window
B D                      Dog 5bp
            Cape golden mole 5bp
B D                   Tenrec 5bp
  D              Rock pigeon 17bp
  D             Saker falcon 61bp
  D         Peregrine falcon 8bp
  D      Collared flycatcher 1bp
  D   White-throated sparrow 1bp
B D              Zebra finch 1bp
          Tibetan ground jay 1bp
  D             Mallard duck 29bp
B D                  Chicken 26bp
B D                   Turkey 28bp
B D       American alligator 40bp
  D          Green seaturtle 1bp

Alignment block 24 of 191 in window, 136849006 - 136849008, 3 bps 
B D                     Human  g--ga-
B D                     Chimp  g--ga-
B D                   Gorilla  g--ga-
B D                 Orangutan  g--ga-
B D                    Gibbon  g--ga-
B D       Crab-eating macaque  a-----
B D                    Baboon  a-----
B D              Green monkey  gga---
B D                  Marmoset  a--ga-
B D           Squirrel monkey  a--ga-
  D               Rock pigeon  ---cc-
  D          Peregrine falcon  ---gg-
  D              Mallard duck  ---ca-
B D                   Chicken  ---ca-
B D                    Turkey  ---gg-
  D            Painted turtle  ----g-
B D                    Medaka  ---ggg
              Golden hamster  ------
      Lesser Egyptian jerboa  ------
B D                       Rat  ------
                Prairie vole  ------
B D                     Mouse  ------
B D                      Pika  ======
B D                     Shrew  ======
B D                  Hedgehog  ------
B D                Guinea pig  ------
B D                Coelacanth  ======
  D    Spiny softshell turtle  ======
                    Aardvark  ------
B D                    Rhesus  NNNNNN
            Cape golden mole  ======
B D                       Pig  ------
B D                   Megabat  ------
B D                   Dolphin  ------
                 Spotted gar  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
  D    White-throated sparrow  ======
B D           Tasmanian devil  ======
B D             X. tropicalis  ======
B D        American alligator  ======
  D             Scarlet macaw  ======
B D                Budgerigar  ======
B D                   Opossum  ------
                  Chinchilla  ------
B D            Naked mole-rat  ------
B D       Medium ground finch  NNNNNN
  D              Saker falcon  ======
  D                    Parrot  ======
B D                   Wallaby  ======
            Brush-tailed rat  ------
         Cape elephant shrew  ------
          Chinese tree shrew  ------
B D                  Platypus  ------
B D                   Manatee  ------
B D                  Elephant  ======
B D           Chinese hamster  ------
B D                    Tenrec  ======
  D           Green seaturtle  ======
B D                       Cat  ------
B D                  Bushbaby  ------
                Weddell seal  ------
  D  Chinese softshell turtle  ======
B D                   Ferret   NNNNNN
               Domestic goat  NNNNNN
B D                     Sheep  NNNNNN
            Tibetan antelope  ======
  D       Collared flycatcher  ======
             Star-nosed mole  NNNNNN
              Bactrian camel  NNNNNN
B D                    Alpaca  ------
               Big brown bat  ------
              Pacific walrus  ------
B D                     Panda  ------
B D                       Cow  ------
                Killer whale  ------
B D                       Dog  ======
            Black flying-fox  ------
B D          White rhinoceros  ------
B D                     Horse  ------
B D                  Squirrel  ------
        David's myotis (bat)  ======
B D                 Armadillo  ======

Inserts between block 24 and 25 in window
B D      Crab-eating macaque 200bp
B D                 Marmoset 5bp
B D          Squirrel monkey 56bp
  D              Rock pigeon 1bp
  D         Peregrine falcon 1bp
  D             Mallard duck 1bp
B D                  Chicken 1bp
B D                   Turkey 1bp
  D           Painted turtle 1bp

Alignment block 25 of 191 in window, 136849009 - 136849015, 7 bps 
B D                     Human  ggccttt
B D                     Chimp  ggccttt
B D                   Gorilla  ggccttt
B D                 Orangutan  ggctttt
B D                    Gibbon  ggccttc
B D       Crab-eating macaque  ggccttc
B D                    Baboon  ggccctc
B D              Green monkey  ggccttc
B D                  Marmoset  ggact--
B D           Squirrel monkey  gggctct
B D                  Bushbaby  tacactc
B D                  Squirrel  tgtgctc
       Lesser Egyptian jerboa  atttgtg
                 Prairie vole  aaacctt
B D           Chinese hamster  gatcctc
               Golden hamster  gatcctc
B D                     Mouse  agtactt
B D                       Rat  aggcctg
B D            Naked mole-rat  ggtcctg
B D                Guinea pig  ggtcctg
                   Chinchilla  ggttctg
             Brush-tailed rat  ------g
B D                       Pig  gggtaag
B D                    Alpaca  ggccatg
B D                   Dolphin  agccaag
                 Killer whale  agccaag
B D                       Cow  ggccgtg
B D                     Horse  gatcatc
B D          White rhinoceros  gaccgtc
B D                       Cat  ggccttg
B D                     Panda  ggccctg
               Pacific walrus  ggccttg
                 Weddell seal  ggccttg
             Black flying-fox  g------
B D                   Megabat  g------
                Big brown bat  ga-----
B D                  Hedgehog  gggctgg
B D                   Opossum  -ggcttg
B D                  Platypus  --cccc-
  D               Rock pigeon  agctgct
  D          Peregrine falcon  cgcctgg
  D       Collared flycatcher  -gctggg
  D    White-throated sparrow  -gccagt
           Tibetan ground jay  -gcca--
  D              Mallard duck  agccacg
B D                   Chicken  agccctg
B D                    Turkey  gtccctg
  D            Painted turtle  ggacagg
B D                    Medaka  ggctttt
B D                      Pika  =======
B D                     Shrew  =======
B D                Coelacanth  =======
  D    Spiny softshell turtle  =======
                    Aardvark  -------
B D                    Rhesus  NNNNNNN
            Cape golden mole  =======
                 Spotted gar  =======
B D               Zebra finch  =======
B D           Tasmanian devil  =======
B D             X. tropicalis  =======
B D        American alligator  =======
  D             Scarlet macaw  =======
B D                Budgerigar  =======
B D       Medium ground finch  NNNNNNN
  D              Saker falcon  =======
  D                    Parrot  =======
B D                   Wallaby  =======
         Cape elephant shrew  -------
          Chinese tree shrew  -------
B D                   Manatee  -------
B D                  Elephant  =======
B D                    Tenrec  =======
  D           Green seaturtle  =======
  D  Chinese softshell turtle  =======
B D                   Ferret   NNNNNNN
               Domestic goat  NNNNNNN
B D                     Sheep  NNNNNNN
            Tibetan antelope  =======
             Star-nosed mole  NNNNNNN
              Bactrian camel  NNNNNNN
B D                       Dog  =======
        David's myotis (bat)  =======
B D                 Armadillo  =======

Inserts between block 25 and 26 in window
B D             Green monkey 48bp
B D                      Pig 8bp
B D                   Alpaca 8bp
B D                  Dolphin 8bp
                Killer whale 8bp
B D                      Cow 10bp
B D                    Horse 10bp
B D         White rhinoceros 10bp
B D                      Cat 10bp
B D                    Panda 10bp
              Pacific walrus 10bp
                Weddell seal 10bp
B D                 Hedgehog 10bp
B D                  Opossum 12bp
  D              Rock pigeon 2bp
  D         Peregrine falcon 2bp
  D      Collared flycatcher 2bp
  D   White-throated sparrow 2bp
  D             Mallard duck 2bp
B D                  Chicken 2bp
B D                   Turkey 2bp
  D           Painted turtle 2bp

Alignment block 26 of 191 in window, 136849016 - 136849018, 3 bps 
B D                     Human  gg---------------------------------------------------------------g--
B D                     Chimp  gg---------------------------------------------------------------g--
B D                   Gorilla  gg---------------------------------------------------------------g--
B D                 Orangutan  gg---------------------------------------------------------------g--
B D                    Gibbon  gg---------------------------------------------------------------g--
B D                    Rhesus  gg---------------------------------------------------------------g--
B D       Crab-eating macaque  gg---------------------------------------------------------------g--
B D                    Baboon  gg---------------------------------------------------------------g--
B D              Green monkey  gg---------------------------------------------------------------g--
B D                  Marmoset  -----------------------------------------------------------------g--
B D           Squirrel monkey  gggcgggtggggggggagagcgaggcctccgtgcggcggaggtgggagagcgaggcctccgtgcgg--
B D                  Bushbaby  gg---------------------------------------------------------------g--
B D                  Squirrel  gg---------------------------------------------------------------a--
       Lesser Egyptian jerboa  gt---------------------------------------------------------------g--
                 Prairie vole  gg---------------------------------------------------------------a--
B D           Chinese hamster  aa---------------------------------------------------------------g--
               Golden hamster  ga---------------------------------------------------------------g--
B D                     Mouse  ga---------------------------------------------------------------a--
B D                       Rat  at---------------------------------------------------------------g--
B D            Naked mole-rat  gg---------------------------------------------------------------a--
B D                Guinea pig  gg---------------------------------------------------------------a--
                   Chinchilla  gg---------------------------------------------------------------a--
             Brush-tailed rat  gg---------------------------------------------------------------a--
B D                       Pig  tg------------------------------------------------------------------
B D                    Alpaca  tg------------------------------------------------------------------
B D                   Dolphin  gg------------------------------------------------------------------
                 Killer whale  gg------------------------------------------------------------------
B D                       Cow  gg------------------------------------------------------------------
B D                     Horse  gg------------------------------------------------------------------
B D          White rhinoceros  gg------------------------------------------------------------------
B D                       Cat  gg------------------------------------------------------------------
B D                       Dog  gg------------------------------------------------------------------
B D                     Panda  gg------------------------------------------------------------------
               Pacific walrus  gg------------------------------------------------------------------
                 Weddell seal  ga------------------------------------------------------------------
                Big brown bat  ga------------------------------------------------------------------
B D                  Hedgehog  tg------------------------------------------------------------------
B D                   Opossum  ag------------------------------------------------------------------
  D               Rock pigeon  g-------------------------------------------------------------------
  D          Peregrine falcon  a-------------------------------------------------------------------
  D       Collared flycatcher  g-------------------------------------------------------------------
  D    White-throated sparrow  g-------------------------------------------------------------------
B D               Zebra finch  g-------------------------------------------------------------------
           Tibetan ground jay  g-------------------------------------------------------------------
  D              Mallard duck  g-------------------------------------------------------------------
B D                   Chicken  g-------------------------------------------------------------------
B D                    Turkey  a-------------------------------------------------------------------
  D            Painted turtle  g-------------------------------------------------------------------
B D                    Medaka  -----------------------------------------------------------------gca
B D                      Pika  ====================================================================
B D                     Shrew  ====================================================================
B D                Coelacanth  ====================================================================
  D    Spiny softshell turtle  ====================================================================
                    Aardvark  --------------------------------------------------------------------
            Cape golden mole  ====================================================================
B D                   Megabat  --------------------------------------------------------------------
                 Spotted gar  ====================================================================
B D           Tasmanian devil  ====================================================================
B D             X. tropicalis  ====================================================================
B D        American alligator  ====================================================================
  D             Scarlet macaw  ====================================================================
B D                Budgerigar  ====================================================================
  D              Saker falcon  ====================================================================
  D                    Parrot  ====================================================================
B D                   Wallaby  ====================================================================
         Cape elephant shrew  --------------------------------------------------------------------
          Chinese tree shrew  --------------------------------------------------------------------
B D                  Platypus  --------------------------------------------------------------------
B D                   Manatee  --------------------------------------------------------------------
B D                  Elephant  ====================================================================
B D                    Tenrec  ====================================================================
  D           Green seaturtle  ====================================================================
  D  Chinese softshell turtle  ====================================================================
            Tibetan antelope  ====================================================================
            Black flying-fox  --------------------------------------------------------------------
        David's myotis (bat)  ====================================================================
B D                 Armadillo  ====================================================================

Inserts between block 26 and 27 in window
  D              Rock pigeon 1bp
  D         Peregrine falcon 1bp
  D      Collared flycatcher 1bp
  D   White-throated sparrow 1bp
B D              Zebra finch 1bp
          Tibetan ground jay 1bp
B D                  Chicken 1bp
B D                   Turkey 3bp
  D           Painted turtle 4bp

Alignment block 27 of 191 in window, 136849019 - 136849025, 7 bps 
B D                     Human  c------------ggt---ggg
B D                     Chimp  c------------ggt---ggg
B D                   Gorilla  c------------ggt---ggg
B D                 Orangutan  c------------ggc---ggg
B D                    Gibbon  c------------ggt---gga
B D                    Rhesus  c------------ggt---ggg
B D       Crab-eating macaque  c------------ggt---ggg
B D                    Baboon  c------------ggt---ggg
B D              Green monkey  c------------ggt---ggg
B D                  Marmoset  c------------ggt---ggg
B D           Squirrel monkey  c------------gga---ggg
B D                  Bushbaby  t------------ggt---ggg
           Chinese tree shrew  -------------ggt---ctg
B D                  Squirrel  a------------gcg---tg-
       Lesser Egyptian jerboa  g------------gtgataga-
                 Prairie vole  c------------gtg---tg-
B D           Chinese hamster  c------------tta---tg-
               Golden hamster  c------------tta---tg-
B D                     Mouse  t------------ttg---ga-
B D                       Rat  t------------tgt---ga-
B D            Naked mole-rat  ca-----------ggg---gt-
B D                Guinea pig  c------------gag---ga-
                   Chinchilla  t--------------g---ga-
             Brush-tailed rat  c--------------a---gg-
          Cape elephant shrew  ---------------------a
B D                  Platypus  -aggaggt-----ggt------
  D  Chinese softshell turtle  ----cggtgtg-----------
B D                    Medaka  ---------cgctgga------
B D                      Pika  ======================
B D                     Shrew  ======================
B D                  Hedgehog  ----------------------
B D                Coelacanth  ======================
  D    Spiny softshell turtle  ======================
                    Aardvark  ----------------------
            Cape golden mole  ======================
B D                       Pig  ----------------------
B D                   Megabat  ----------------------
B D                   Dolphin  ----------------------
                 Spotted gar  ======================
B D                    Turkey  ======================
B D                   Chicken  ======================
  D              Mallard duck  ======================
          Tibetan ground jay  ======================
B D               Zebra finch  ======================
  D    White-throated sparrow  ======================
B D           Tasmanian devil  ======================
B D             X. tropicalis  ======================
  D            Painted turtle  ======================
B D        American alligator  ======================
  D             Scarlet macaw  ======================
B D                Budgerigar  ======================
B D                   Opossum  ----------------------
  D               Rock pigeon  ======================
B D       Medium ground finch  NNNNNNNNNNNNNNNNNNNNNN
  D          Peregrine falcon  ======================
  D              Saker falcon  ======================
  D                    Parrot  ======================
B D                   Wallaby  ======================
B D                   Manatee  ----------------------
B D                  Elephant  ======================
B D                    Tenrec  ======================
  D           Green seaturtle  ======================
B D                       Cat  ----------------------
                Weddell seal  ----------------------
B D                   Ferret   NNNNNNNNNNNNNNNNNNNNNN
               Domestic goat  NNNNNNNNNNNNNNNNNNNNNN
B D                     Sheep  NNNNNNNNNNNNNNNNNNNNNN
            Tibetan antelope  ======================
  D       Collared flycatcher  ======================
             Star-nosed mole  NNNNNNNNNNNNNNNNNNNNNN
              Bactrian camel  NNNNNNNNNNNNNNNNNNNNNN
B D                    Alpaca  ----------------------
               Big brown bat  ----------------------
              Pacific walrus  ----------------------
B D                     Panda  ----------------------
B D                       Cow  ----------------------
                Killer whale  ----------------------
B D                       Dog  ----------------------
            Black flying-fox  ----------------------
B D          White rhinoceros  ----------------------
B D                     Horse  ----------------------
        David's myotis (bat)  ======================
B D                 Armadillo  ======================

Inserts between block 27 and 28 in window
B D                    Chimp 3001bp
B D                 Bushbaby 3bp
         Cape elephant shrew 9bp
  D Chinese softshell turtle 9bp

Alignment block 28 of 191 in window, 136849026 - 136849036, 11 bps 
B D                     Human  ggcca--------------------c-------------gggga--
B D                   Gorilla  ggcca--------------------c-------------gggga--
B D                 Orangutan  ggcca--------------------c-------------gggga--
B D                    Gibbon  ----g--------------------a-------------gggga--
B D                    Rhesus  ggcca--------------------c-------------gggga--
B D       Crab-eating macaque  ggcca--------------------c-------------gggga--
B D                    Baboon  ggcca--------------------c-------------gggga--
B D              Green monkey  ggcca--------------------c-------------gggga--
B D                  Marmoset  -------------------------g-------------ggaga--
B D           Squirrel monkey  -------------------------g-------------ggaga--
B D                  Bushbaby  ggctg--------------------a-------------gagga--
B D                  Squirrel  gcact--------------------g-------------gggac--
       Lesser Egyptian jerboa  gggat--------------------g-------------gggag--
                 Prairie vole  gttat--------------------t-------------gtgga--
B D           Chinese hamster  ggtgc--------------------t-------------gggaa--
               Golden hamster  ggtgt--------------------t-------------gggaa--
B D                     Mouse  gagac--------------------c-------------gg--a--
B D                       Rat  aggtt--------------------c-------------gggca--
B D            Naked mole-rat  ggtgt--------------------c-------------ggtga--
B D                Guinea pig  ggtgt--------------------c-------------agtgg--
                   Chinchilla  gatgt--------------------c-------------ggtga--
             Brush-tailed rat  caggt--------------------c---------------ccg--
B D                       Pig  -agcg--------------------tcgtg---------gggga--
B D                    Alpaca  -gggg----------------gta-t-------------gggaa--
B D                   Dolphin  -agcg---------gacagcagga-tcggtgtag-----gggaa--
                 Killer whale  -agcg---------gacagcggga-tcggtgtag-----gggaa--
B D                       Cow  -gacggggccgggaggccgtgggactcggtggcgac---ggggc--
B D                     Horse  -ggga--------------------c-------------ggggt--
B D          White rhinoceros  -ggca--------------------c-------------gtgga--
B D                       Cat  --gga--------------------c-------------aggga--
B D                       Dog  -agga--------------------c-------------gaaga--
B D                     Panda  -agga--------------------c-------------gtcga--
               Pacific walrus  -agga--------------------c-------------gctga--
                 Weddell seal  -agga--------------------c-------------aggga--
                Big brown bat  -ggta--------------------c-------------agaca--
B D                  Hedgehog  --gcg--------------------c-------------gggaa--
B D                  Platypus  ------------------------------gatgaa---gatgc--
  D               Rock pigeon  ag--------------------------------------------
  D          Peregrine falcon  gg--------------------------------------------
  D       Collared flycatcher  gg--------------------------------------------
  D    White-throated sparrow  gg--------------------------------------------
B D               Zebra finch  gt--------------------------------------------
           Tibetan ground jay  gg--------------------------------------------
  D           Green seaturtle  ga--------------------------------------------
  D            Painted turtle  gg--------------------------------------------
  D  Chinese softshell turtle  gg--------------------------------------------
B D                    Medaka  -----------------------------------cttggcggatc
B D                      Pika  ==============================================
B D                     Shrew  ==============================================
B D                Coelacanth  ==============================================
  D    Spiny softshell turtle  ==============================================
                    Aardvark  ----------------------------------------------
            Cape golden mole  ==============================================
B D                   Megabat  ----------------------------------------------
                 Spotted gar  ==============================================
B D                    Turkey  ==============================================
B D                   Chicken  ==============================================
  D              Mallard duck  ==============================================
B D           Tasmanian devil  ==============================================
B D             X. tropicalis  ==============================================
B D        American alligator  ==============================================
  D             Scarlet macaw  ==============================================
B D                Budgerigar  ==============================================
B D                   Opossum  ----------------------------------------------
  D              Saker falcon  ==============================================
  D                    Parrot  ==============================================
B D                   Wallaby  ==============================================
         Cape elephant shrew  ==============================================
          Chinese tree shrew  ----------------------------------------------
B D                   Manatee  ----------------------------------------------
B D                  Elephant  ==============================================
B D                    Tenrec  ==============================================
            Tibetan antelope  ==============================================
            Black flying-fox  ----------------------------------------------
        David's myotis (bat)  ==============================================
B D                 Armadillo  ==============================================
B D                     Chimp  ==============================================

Inserts between block 28 and 29 in window
  D              Rock pigeon 37bp
  D         Peregrine falcon 27bp
  D      Collared flycatcher 26bp
  D   White-throated sparrow 22bp
B D              Zebra finch 42bp
          Tibetan ground jay 22bp

Alignment block 29 of 191 in window, 136849037 - 136849040, 4 bps 
B D                     Human  g---------------------------------g-------------------gt
B D                   Gorilla  g---------------------------------g-------------------gt
B D                 Orangutan  g---------------------------------g-------------------gt
B D                    Gibbon  g---------------------------------g-------------------gt
B D                    Rhesus  g---------------------------------g-------------------gt
B D       Crab-eating macaque  g---------------------------------g-------------------gt
B D                    Baboon  g---------------------------------g-------------------gt
B D              Green monkey  g---------------------------------g-------------------gt
B D                  Marmoset  g---------------------------------g-------------------aa
B D           Squirrel monkey  g---------------------------------c-------------------ga
B D                  Bushbaby  g---------------------------------g-------------------ga
B D                  Squirrel  t---------------------------------gg------------------gg
       Lesser Egyptian jerboa  a---------------------------------g---------------------
                 Prairie vole  g---------------------------------ggggaagcctgagg-ggagaga
B D           Chinese hamster  a---------------------------------gaaaagac------------ca
               Golden hamster  a---------------------------------gagaagactt----------ca
B D                     Mouse  g---------------------------------a-------------------ga
B D                       Rat  g---------------------------------g-------------------ag
B D            Naked mole-rat  t---------------------------------g-------------------ga
B D                Guinea pig  t---------------------------------g-------------------gg
                   Chinchilla  t---------------------------------g-------------------gg
             Brush-tailed rat  c---------------------------------g-------------------ag
B D                       Pig  g---------------------------------g-------------------gg
B D                    Alpaca  g---------------------------------g-------------------ga
B D                   Dolphin  g---------------------------------g-------------------ga
                 Killer whale  g---------------------------------g-------------------ga
B D                       Cow  g---------------------------------g-------------------ga
B D                     Horse  g---------------------------------g-------------------ga
B D          White rhinoceros  g---------------------------------g-------------------ga
B D                       Cat  gggaggccttgggacgccttgggagggagag---g-------------------ga
B D                       Dog  g---------------------------------t-------------------ga
B D                     Panda  g---------------------------------g-------------------ga
               Pacific walrus  g---------------------------------a-------------------ga
                 Weddell seal  ggagggccttgggacgcggtgggggacgggga--g-------------------ga
             Black flying-fox  ----------------------------------g-------------------gc
B D                   Megabat  ----------------------------------g-------------------gc
                Big brown bat  g--aaacatcagtgttgagcgagcatcagagatcg-------------------gc
B D                  Hedgehog  g---------------------------------g-------------------aa
          Cape elephant shrew  --------------------------------------------agcgcgcggggc
B D                   Manatee  -------------------------------------------------gcggggt
             Cape golden mole  --------------------------------------------gacttggggcgc
B D                    Tenrec  --------------------------------------------gaatcctggcgc
B D                   Opossum  -------------------------------------------ggccacccgagga
B D                  Platypus  g---------------------------------g-------------------aa
  D           Green seaturtle  ------------------------------------------------------ga
  D            Painted turtle  ------------------------------------------------------gg
  D  Chinese softshell turtle  ------------------------------------------------------gg
B D                    Medaka  ---------------------------------ag-------------------gg
B D                      Pika  ========================================================
B D                     Shrew  ========================================================
B D                Coelacanth  ========================================================
  D    Spiny softshell turtle  ========================================================
                    Aardvark  --------------------------------------------------------
                 Spotted gar  ========================================================
B D                    Turkey  ========================================================
B D                   Chicken  ========================================================
  D              Mallard duck  ========================================================
          Tibetan ground jay  ========================================================
B D               Zebra finch  ========================================================
  D    White-throated sparrow  ========================================================
B D           Tasmanian devil  ========================================================
B D             X. tropicalis  ========================================================
B D        American alligator  ========================================================
  D             Scarlet macaw  ========================================================
B D                Budgerigar  ========================================================
  D               Rock pigeon  ========================================================
  D          Peregrine falcon  ========================================================
  D              Saker falcon  ========================================================
  D                    Parrot  ========================================================