UCSC Genome Bioinformatics
Skip to main content
  Non-standard Join Certificates: Human Build 34 (July 2003)
 
Accession 1 Accession 2 Spanner Variation Variation Evidence Comment Evaluation Remark Contact
AL606514AL627107  sine noneAlu. Deletions in alu repeats in both clones disrupting join. There is one BAC End which supports the join RPCI-456B9. Also looking at the actual size of the overlaps between AL627107 and AL606514, the total overlap in unsubmitted sequence is 86688bp. AL627107 also actualy overlaps AL139326 (the clone after AL606514 in the TPF) by about 50Kb, but as AL606514 was finished first, it remained in the TPF.passWould be better to have BAC, fosmid end support or other, but extensive overlap from unsubmitted sequence is a good proxy. It seems that the clone AL606514 may be unnecessary to have in TPF if AL527107 overlaps AL139326.ad1@sanger.ac.uk
AP002529AP002530AL359174    Blunt end join submitted by JST spanned by AL359174.14 and 10 BAC, 4 fosmid end pairs.pass ajm@sanger.ac.uk
AP002530AP002531AL355532    Blunt end join submitted by JST spanned by AL355532.10 and 7 BAC, 3 fosmid end pairs.pass ajm@sanger.ac.uk
AL008729AL391385  sslp Not experimental100bp overlap. Join supported by 4 BACs and 4 Fosmids. Half dovetail; misses other side by 19bp as a result of a 9bp polyA indel. AL391385.8 has (A)31; AL008729.1 has (A)22.pass ajm@sanger.ac.uk
AL034346AL499606  otherNot experimental2000bp overlap. Variations clustered in the tandem repeat of the overlap. Half dovetail; misses other side by 145bp. 14 copies of 34bp repeat in AL499606.18; 25 copies of 34bp repeat in AL034346.31. Join supported by 10 BAC and 1 fosmid end pairs.returnrequires additional support eg. PCRajm@sanger.ac.uk
AL096678AL159174  sslp Not experimental2082bp overlap. 464bp deletion in AL096678.8 which includes (CA)n and (TA)n. Join supported by 11 BACs and 6 fosmidspass ajm@sanger.ac.uk
AL109940AL442124  otherNot experimental100bp overlap +/+ orientation. 51bp tandem repeat causing assembly trouble. 20 copies in AL109940 and 40 copies in AL442124. Join supported by 5 BAC and 8 fosmid end pairs.returnrequires additional support eg pcr.ajm@sanger.ac.uk
AL357058AP002528      Preferential use of Sanger sequence (AL357058) to JST sequence (AP002528.1)passThis is a unique situation, with one clone contained entirely within another. This is not really a bad join, but a substitution of part of a project with another. Pass, as discussed with GS and AJM.ajm@sanger.ac.uk
AL445250AL591624  sslp Not experimental110369bp overlap. 474 bp deletion in AL445250: 180bp (TATAA)n Simple_repeat, 200bp (TTATA)n Simple_repeat and 61bp AT_rich Low_complexity repeat. Join supported by 4 pairs of BAC ends and 2 pairs of fosmid endspass ajm@sanger.ac.uk
AL591046AL591073  otherNot experimental101450bp overlap. Join supported by 3 pairs of BAC ends.returnExtensive overlap, but missing information. Please describe variationajm@sanger.ac.uk
AL591480AL596449  otherNot experimental32827bp overlap. 10377bp deletion in AL596449.4. Join supported by 12 BAC and 6 fosmid end pairs.returnrequires additional support eg pcr.ajm@sanger.ac.uk
AL133255AL591044AL596216    Overlap of 6bp at GAATTC cloning site. Join supported by PCR product sequence AL596216.1 and 2 pairs of BAC and fosmid ends.pass ajm@sanger.ac.uk
AB000878AC006046      This is the boundary between Inoko MHC class I and the class III here represented by Geraghty sequence, overlap is 18554bppassprobably OK, given region and extensive overlap. More BAC/fosmid end support might be useful. Fairly unique situation.ajm@sanger.ac.uk
AB000878AB000879AP000506    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 4 BAC, 3 fosmid end pairs.pass ajm@sanger.ac.uk
AB000879AB000880AP000507    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 2 BAC, 1 fosmid end pairs.pass ajm@sanger.ac.uk
AB014077AB023052AP000513    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 4 BAC, 8 fosmid end pairs.pass ajm@sanger.ac.uk
AB014077AB014078AP000514    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 5 fosmid end pairs.pass ajm@sanger.ac.uk
AB014078AB014079AP000514    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 4 fosmid end pairs.pass ajm@sanger.ac.uk
AB014079AB014080AP000514    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 2 fosmid end pairs.pass ajm@sanger.ac.uk
AB014080AB014081AP000514    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 4 fosmid end pairs.pass ajm@sanger.ac.uk
AB014081AB014082AP000514    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 7 BAC, 6 fosmid end pairs.pass ajm@sanger.ac.uk
AB014082AB014083AP000515    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 9 BAC, 7 fosmid end pairs.pass ajm@sanger.ac.uk
AB014083AB014084AP000515    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 9 BAC, 4 fosmid end pairs.pass ajm@sanger.ac.uk
AB014084AB014085AP000515    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 5 fosmid end pairs.pass ajm@sanger.ac.uk
AB014085AB014086AP000516    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 9 BAC, 7 fosmid end pairs.pass ajm@sanger.ac.uk
AB014086AB014087AP000516    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 7 BAC, 8 fosmid end pairs.pass ajm@sanger.ac.uk
AB014087AB014088AP000516    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 4 fosmid end pairs.pass ajm@sanger.ac.uk
AB014088AB023053AP000516    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 9 BAC, 5 fosmid end pairs.pass ajm@sanger.ac.uk
AB023048AB023060AP000510    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 4 BAC, 8 fosmid end pairs.pass ajm@sanger.ac.uk
AB023048AB023050AP000511    MHC class I. Overlap of 6bp restriction site (AAGCTT). Join supported by 3 BAC, 9 fosmid end pairs.pass ajm@sanger.ac.uk
AB023049AB023051AP000512    MHC class I. Overlap of 6bp restriction site (AAGCTT). Join supported by 5 BAC, 3 fosmid end pairs.pass ajm@sanger.ac.uk
AB023049AB023052AP000513    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 4 BAC, 5 fosmid end pairs.pass ajm@sanger.ac.uk
AB023050AB023051AP000512    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 3 BAC, 3 fosmid end pairs.pass ajm@sanger.ac.uk
AB023053AB023055AP000517    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 4 fosmid end pairs.pass ajm@sanger.ac.uk
AB023056AB023057AP000520    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 5 BAC, 5 fosmid end pairs.pass ajm@sanger.ac.uk
AB023059D84394AP000509    MHC class I. Overlap of 6bp restriction site (GAATTC). Join supported by 5 BAC, 2 fosmid end pairs.pass ajm@sanger.ac.uk
AB023059AB023060AP000509    MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 3 BAC, 2 fosmid end pairs.pass ajm@sanger.ac.uk
AC003098AC015937  sslp Blast2 and RepeatMaskerAC003098 contains 22bp more of sslp at bp 93315. PAC/CIT. 2000 bp total overlap. 2 supporting fosmidspass cuomo@genome.wi.mit.edu
AC003976AC069363  sslp Blast2 and RepeatMaskerAC003976 has a 172 bp deletion in a (GAAA)n repeat. RP11/CIT libraries 58000 bp overlap. 11 supporting fosmids.pass11 fosmid ends - is this overrepresentation? Please comment.cuomo@genome.wi.mit.edu
AB020862AB020863AC079187    6 supporting BACs, 2 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC004707AC015909  sine Blast2 and RepeatMaskerAC015909 contains 384 bp inserted region containing Alu and simple repeat (TGAA)n. RP11/PAC. Total 51000 bp overlap 1 supporting Bac; 11 supporting fosmids.passConcern re over-representation of 11 pairs fosmid ends. Please comment. cuomo@genome.wi.mit.edu
AC004585AC018629  sine Blast2 and RepeatMaskerAC004585 contains 571 bp inserted region containing Alu, FLAM_C, and simple repeat (TTCC)n. RP11/PAC Total 5500 bp overlap 3 supporting Bacs; 2 supporting fosmids.passmultiple variations-probably better to confirm polymorphismcuomo@genome.wi.mit.edu
AC006050AC090685  sslp Blast2 and RepeatMaskerAC006050 missing 312 bases within a (TATATG)n repeat. RP11/PAC 81000 bp total overlap,6 Bacs; 5 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC006251AC015922  sslp Blast2 and RepeatMaskerAC006251 has a 4217 bp deletion(126811..131028). CIT/PAC 38000 bp total overlap. 5 Bacs; 4 fosmids support join.pass cuomo@genome.wi.mit.edu
AC007632AC023394  sslp repeatmasker and human analysisTA simple repeat region is ~250bp longer in AC023394; join is supported by high % identity across the overlap and 1 fosmid and 6 BACs which link across the joinpass cuomo@genome.wi.mit.edu
AC009277AC068506  othersequence alignment; to be testedduplication of 289bp in AC009277; perfect repeat; join is supported by high % identity across the overlap and 5 pairs of fosmid end seq and 6 pairs of BAC end seq which link across the joinreturnRequires additional support, eg PCRcuomo@genome.wi.mit.edu
AC009285AC087224  sslp  ID is 99.53 (below threshold of 99.60) in 28kb ol. Areas of low ID are accounted for as SSLPs in simple repeat areas. Join supported by 1 BAC and 7 fosmids.pass cuomo@genome.wi.mit.edu
AC009455AC079062  sslp repeat masker, sequence alignmentTA simple repeat region is ~200bp longer in AC079062; join supported by 4 BACs which link across join. Total overlap 41kb.pass cuomo@genome.wi.mit.edu
AC011120AC080037  sine Blast2 and RepeatMaskerAC011120 contains inserted AluJo not present in AC080037. Total 142000 bp overlap 6 supporting Bacs; 19 supporting fosmids.returnis 19 fosmid-ends overrepresentation? Please comment.cuomo@genome.wi.mit.edu
AC011825AC015563  otherto be tested189bp deletion in AC015563; join is supported by high % identity across the overlap and 5 pairs fosmid end seq and 4 pairs of BAC end seq which link across the joinreturnRequires additional support, eg PCRcuomo@genome.wi.mit.edu
AC012213AC069351  sine Global Sequence Alignment and RepeatMasker40 kb overlap. Break in alignment is caused by 310 bp AluY insertion in AC069351. 3 supporting BACs, 11 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC012238AC023926  line Global Sequence Alignment and RepeatMasker33 kb overlap. Break in alignment is a result of 299 bp L1PA4 insertion in AC023926. 3 supporting BACs, 2 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC013290AC022601  sine repeatmaskerbreak in alignment caused by ~286bp insertion of AluY SINE/Alu element in AC022601; join is supported by high % identity across the overlap and 1 pair of fosmid end seq and 6 pairs of BAC end seq which link across the joinpass cuomo@genome.wi.mit.edu
AC015691AC109341  sslp Global Sequence Alignment, RepeatMasker61kb overlap, MIR and AT-rich, supported by 6 pairs of BAC ends, 4 pairs of fosmid ends.pass cuomo@genome.wi.mit.edu
AC015700AC100763  line RepeatMasker, Global Sequence Alignment105kb overlap, L1PA3 in AC015700`s 75649- 75828, supported by 2 pairs of BAC ends, 4 pairs of fosmid endspass cuomo@genome.wi.mit.edu
AC015884AC016292  sslp Blast2 and RepeatMaskerAC015884 contains ~6 more copies of a 30bp repeat 41662 bp total overlap 3 supporting bacs, 7 supporting fosmidspass cuomo@genome.wi.mit.edu
AC015884AC036164  sslp Blast2 and RepeatMaskerAC015884 contains 1029 bp inserted region containing ~16 more copies of a 65 bp repeat. Found at bp 316-1344 (GGGGGGGGCTGGAGTCAGAGAGACCAAGGTTGGAACCCGGC
AGGTACCACGGACGGTCACACTGT) AC015884 contains 388 bp inserted region containing same repeat element as above. Bp 1870-2257 9300 bp total overlap 3 supporting bacs, 4 supporting fosmids.
pass cuomo@genome.wi.mit.edu
AC015921AC097370  otherBlast2 and RepeatMaskerAC015921 contains inserted region of 467 bp. 14790 total overlap. 1 supporting Bac, 4 supporting fosmidsreturnrequires additional support (eg pcr).cuomo@genome.wi.mit.edu
AC016888AC064805  sslp Blast2 and RepeatMaskerAC016888 contains 120 bp deletion in MER4A element. 49000 bp total overlap, 3 supporting Bacs; 4 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC018943AC108137  otherBLAST2, Global Sequence Alignment, RepeatMaskerAC018943 contains 193 bp insertion that is not present in AC108137. Total overlap is 23 Kb, 5 supporting BACs, 9 supporting fosmidsreturnProbably OK, but requires additional confirmation of insertion polymorphismcuomo@genome.wi.mit.edu
AC021553AC100825  line BLAST2, Global Sequence Alignment, RepeatMaskerAC021553 contains 231 bp of a LINE/L2 element not present in AC100825. Total overlap is 26Kb, 1 supporting BAC, 1 supporting fosmid.pass cuomo@genome.wi.mit.edu
AC021594AC068473  otherhuman analysis and sequence alignmentInsertion of a ~180bp of a 38bp repetive element in AC068473. Join supported by 3 BACs and 10 fosmids. Total overlap 48kb.passis 12 pairs fosmid-ends overrepresentation? Comment please.cuomo@genome.wi.mit.edu
AC021760AC040926  sslp BLAST2, Global Sequence Alignmentoverlap of 10kb. SSLP 121bp longer in AC021760. 12 supporting BACs.passis 12 pairs BAC-ends overrepresentation?cuomo@genome.wi.mit.edu
AC022558AC044907  line BLAST2, Global Sequence Alignment, RepeatMaskerAC044907 contains 6,031 bp of a LINE/L1HS element not present in AC022558. Total overlap is 49Kb, 5 supporting BACs, 7 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC022596AC098850  sine Blast2 and RepeatMaskerAC022596 contains inserted Alu not present in AC098850. Total 120000 bp overlap, 4 supporting Bacs; 18 supporting fosmids.returnis 18 pairs fosmid-ends overrepresentation? Please comment.cuomo@genome.wi.mit.edu
AC024474AC061965  sslp BLAST2, Global Sequence Alignment, RepeatMaskerAC061965 contains 559 bp of C-rich, (CACCT)n, (CACCC)n elements not present in AC024474. Total overlap is 9Kb, 4 supporting BACs, 3 supporting fosmidspass cuomo@genome.wi.mit.edu
AC024610AC078907  sslp Blast2 and RepeatMaskerAC078907 missing 258 bases within a (TAG)n repeat. 54000 bp total overlap 5 supporting Bacs; 20 supporting fosmids.returnis 20 fosmid-ends overrepresentation? Please comment.cuomo@genome.wi.mit.edu
AC025519AC053479  sslp BLAST2 and RepeatMasker94 kb overlap. Break in alignment is caused by a 286 bp (TA)n insertion in AC053479. 2 supporting BACs, 3 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC025521AC100832  sine Blast2 and RepeatMaskerAC100832 contains 217 bp inserted region containing Alu. 33000 bp total overlap 3 supporting BACS and 1 supporting fosmid.pass cuomo@genome.wi.mit.edu
AC025787AC109635  sslp Global Sequence Alignment, RepeatMasker116kb overlap, (TA)n (TAA)n SSLP, supported by 3 pairs of BAC ends, 4 pairs of fosmid endspass cuomo@genome.wi.mit.edu
AC026636AC104938  otherBLAST2, Global Sequence Alignment, RepeatMaskerThere are 2 ins/del in this overlap: AC026636 contains 360 bp of a LINE/L2 element that is not present in AC104938, and AC104938 contains 133 bp of a SINE/Alu/AluJo element that is not present in AC026636. Total overlap is 36 Kb, 4 supporting BACs, 7 supporting fosmids. AC026636 is from the RP11 library, AC104938 is from the CTD librarypass cuomo@genome.wi.mit.edu
AC026991AC087367  sslp BLAST2, Global Sequence Alignmentoverlap of 59kb. SSLP 311bp longer in AC026991. 3 supporting BACs, 5 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC036164AC087392  sslp Blast2 and RepeatMaskerAC087392 contains 354bp inserted region at bp 16581. AC036164 contains 330 bp more of a (GGTTG)n repeat at bp 68475. 30896 bp total overlap. 7 supporting bacs, 4 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC036196AC103858  otherBLAST2, Global Sequence Alignment, RepeatMaskerAC103858 has 995 bp region (containing L2 and MER elements) flanked by two AluSx elements, while in the analogous region of AC036196 there is only one AluSx element and not the L2 and MER elements. Total overlap is 47Kb, 7 supporting BACs, 2 supporting fosmids.returnmultiple complex `other` requires confirmation of polymorphism eg by PCRcuomo@genome.wi.mit.edu
AC044814AC107934  otherBLAST2, Global Sequence Alignmentoverlap of 147kb. 173bp tigger2 insertion in AC107934. 5 supporting BACs, 2 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC055854AC105046  sslp BLAST2, Global Sequence Alignmentoverlap of 33kb. SSLP 325bp longer in AC055854. 3 supporting BACs, 6 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC083845AC103760  line Global Sequence Alignment and RepeatMasker43 kb overlap. Break in alignment is caused by a 28 bp (T)n and 109 bp L1HS insertion in AC083845. 1 supporting fosmid.pass cuomo@genome.wi.mit.edu
AC083973AC107885  otherGlobal Sequence Alignment, RepeatMasker, Blast2overlap of 56kb. Two breaks in alignment caused by 311bp SINE insertion in AC083973 and 479bp insertion of SINE LINE SINE in AC083973. 4 supporting BACs, 5 supportings fosmids.passProbably OK, but multiple problems may warrant confirmation of haplotypescuomo@genome.wi.mit.edu
AC084125AF186192  otherGlobal Sequence Alignment and RepeatMasker17 kb overlap. Two breaks in the alignment. One is caused by a low complexity GC-rich region which is 967 bp longer in AF186192. The other is caused by multiple Alu and AluJ/FRAM repeats (767 bp) in AC084125 while the corresponding region in AF186192 has multiple AluSg/x repeats (567 bp). 1 supporting BAC, 4 supporting fosmids. CTD clone and RP4 clone librariesreturnThis multiple variation is actually quite interesting, but should be confirmed as a polymorphism by pcr.cuomo@genome.wi.mit.edu
AC087269AC090567  otherGlobal Sequence Alignment, RepeatMasker, Blast2overlap of 32kb. 166bp LTR12C insertion in AC090567. 3 supporting BACs, 6 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC087399AC087675  othersequence alignment and human analysisInsertion of ~500bp made of an 80bp repetetive element in AC087399. Insertion of ~240bp in AC087675. Join supported by 4 BACs and 3 fosmids. Total overlap 97kb.returnmultiple `other` (insertions) requires additional support (eg pcr)cuomo@genome.wi.mit.edu
AC087516AC103988  sine BLAST2, Global Sequence Alignment, RepeatMaskerAC103988 contains 313 bp of AluSx and AluY elements not present in AC087516. Total overlap is 57Kb, 10 supporting BACs, 5 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC087675AC109314  sslp repeat maskerAT-rich region. Join supported by 2 BACs and 1 fosmid. Total overlap 42kb.pass cuomo@genome.wi.mit.edu
AC087691AC107993  otherBlast2 and RepeatMaskerAC087691 contains 240 bp inserted region containing MSR1 satellite elements 37000 bp total overlap 6 supporting Bacs; 2 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC090354AC090396  othersequence alignment and human analysisThere is a ~500bp segment of sequence that is repeated once more in AC090396 than in AC090354. 6 BACs and 5 fosmids confirm join. Total overlap 116kb.pass cuomo@genome.wi.mit.edu
AC090377AC107990  sine sequence alignmentbreak in alignment caused by 946bp insertion in AC107990 (contains a AluJb and AluY), Overlap confirmed with AP001549 which does not contain the insertion. 5 pairs of fosmid end seq and 3 pairs of BAC end seq link across this join)pass cuomo@genome.wi.mit.edu
AC090592AC100770  otherRepeatMasker, Global Sequence Alignment125kb overlap, LTR33 repeated in AC090592, supported by 2 pairs of fosmid ends. Draft AC025235 supports join.pass cuomo@genome.wi.mit.edu
AC090639AC107925  sslp Global Sequence Alignment61kb overlap, (AT)n, AT-rich, supported by 4 pairs of BAC ends, 2 pairs of fosmid endspass cuomo@genome.wi.mit.edu
AC090691AC100797  otherGlobal Sequence Alignment, RepeatMasker, Blast2overlap of 57kb. Break in alignment caused by imperfect 28mer repeat ("CCCCTCGGCGAGGACAGAGGCGCGGCGG ") that is 770bps larger in AC090691. 2 supporting BACs, 6 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC090796AC091561  sslp BLAST2, Global Sequence Alignmentoverlap of 111kb. SSLP 317bp longer in AC090796. 3 supporting BACs, 2 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC090970AC090971  otherrepeat maskerSINE/other. broken overlap caused inserted region of three Charlie1 elements with two intervening AluSx elements (Charlie1- AluSx- Charlie1- AluSx- Charlie1), 1,037 bp total, in AC090970; join is supported by high % identity across the 117 kb overlap and 12 fosmids which link across the join.returnis 12 pairs fosmid-ends overrepresentation? Please comment.cuomo@genome.wi.mit.edu
AC091010AP003480  sslp BLAST2 and RepeatMasker58 kb overlap. Break in alignment is caused by a 342 bp (TAAA)n insertion in AC091010. 7 supporting BACs, 3 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC091170AC100778  sine repeatmasker~300bp AluYa5 element present in AC100778. TA simple repeat region is ~300bp longer in AC100778. join is supported by high % identity across the overlap, 1 BAC & 5 fosmids. Total overlap 79kb.pass cuomo@genome.wi.mit.edu
AC079073AC104042  sine RepeatMasker, Global Sequence Alignment44kb overlap, AluSx insertion in AC104042, supported by 7 pairs of BAC ends, 5 pairs of fosmid endspass cuomo@genome.wi.mit.edu
AC079200AC112673  line BLAST2, Global Sequence Alignmentoverlap of 18kb. 354bp LINE insertion in AC112673. 6 supporting BACs, 6 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC102802AC103952  otherGlobal Sequence Alignment, RepeatMasker, Blast2overlap of 41kb. Two breaks in alignment caused by 4110bp insertion in AC103952 and 321bp insertion in AC102802 containing SINE. 2 supporting BACs, 1 supporting fosmid.returnmultiple, insertion probably requires additional confirmationcuomo@genome.wi.mit.edu
AC103834AC103877  sine BLAST2, Global Sequence Alignmentoverlap of 38kb. 283bp Alu insertion in AC103834. 6 supporting BACs, 3 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC104038AC107881  sslp Global Sequence Alignment, RepeatMasker95kb overlap, SSLP (CACCC)n (CCA)n, supported by 8 pairs of BAC ends, 12 pairs of fosmid endspassis 12 pairs fosmid-ends overrepresenataion?cuomo@genome.wi.mit.edu
AC104989AC105029  sslp BLAST2, Global Sequence Alignmentoverlap of 32kb. SSLP 294bp longer in AC104989. 3 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC105110AC108452  othersequence alignmentinversion of ~2240bp in the overlap region; join is supported by high % identity across the overlap 10 pairs of fosmid end seq and 2 pairs of BAC end seq which link across the joinreturnRequires additional support, eg PCRcuomo@genome.wi.mit.edu
AC105142AC107877  otherBLAST218 kb overlap. Break in alignment is caused by a 249 bp insertion in AC107877. 8 supporting BACs and another supporting finished accession (AP004710).returnInsertion requires futher support as being polymorphiccuomo@genome.wi.mit.edu
AC110288AF067845  otherGlobal Sequence Alignment and RepeatMaskerother and SSLP. 26 kb overlap. Six breaks in the alignment. 1. Low complexity region is 616 bp longer in AF067845. 2.(GT)n repeat is 677 bp longer in AF067845. 3. AC110288 has an extra copy of a GGAGGAGAAACGTGGCAGGCGTGAACAGACACCACGTGAGAC repeat. 4. AF067845 has an extra copy of a CACGTGAGACAGGGAGGAGAAACGTGGCAGGCGTGAACAGA repeat. 5. AF067845 has an extra copy of a ATTTTCTGTGAGTTCCCGAGCTCTGCTCCACACCTGGGACCG
GACTCGGAATTTTCTGTGAGTTCCCGAGCTCTGCTCCATACC
TGGGACCGGACTCAGC repeat. 6. poly A region is 11 bp longer in AC110288. 1 supporting BAC test seq, 1 supporting draft (AC141072), 5 supporting fosmids. CTD clone versus P1 clone.
returnMultiple `other`, requires additional support eg. PCRcuomo@genome.wi.mit.edu
AC019257AC100810  otherGlobal Sequence Alignment, RepeatMasker, Blast2overlap of 20kb Breaks in alignment caused by imperfect 23mer repeat larger in AC100810 by 389bps "CCCCATCTGGTTAGAACGCTGCA", imperfect 37mer repeat larger in AC100810 by 480bps "CCCCAGGGGACAGCATGACAGATCCTCTCGCCGCACA", 5 supporting BACs 3 supporting fosmidsreturnThis probably needs additional support as to polymorphism.cuomo@genome.wi.mit.edu
AC018665AC040980  sslp Blast2 and RepeatMaskerAC018665 contains 43 bases more of AT repeat at 124167. 69000 bp total overlappass cuomo@genome.wi.mit.edu
AC055866AC135721  sine Blast2 and RepeatMaskerAC135721 contains 611 bp inserted region containing Alu. RP11/CIT libraries. 10000 bp total overlap, 4 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC073446AC100756  sslp repeat maskerbroken overlap caused by CT_rich low complexity region (350 bp) in AC073446; join is supported by high % identity across the 162 kb overlap and 8 BAC`s and 15 fosmids which link across the join.returnis 15 pairs fosmid-ends overrepresentation? Please comment.cuomo@genome.wi.mit.edu
AC000377AC124057  line Global Sequence Alignment, RepeatMasker49kb overlap, LINE1 insertion in AC000377, supported by 7 pairs of fosmid endspass cuomo@genome.wi.mit.edu
AC109341AC131574  sine Global Sequence Alignment55kb overlap, AluSx repeats more in AC131574, supported by 6 pairs of BAC ends, 4 pairs of fosmid endspass cuomo@genome.wi.mit.edu
AC055876AC135348  sslp BLAST2, Global Sequence Alignment, RepeatMaskerAC135348 contains 18 bp of (A)n that is not present in AC055876. Total overlap is 5 Kb, 14 supporting BACs, 5 supporting fosmids. AC135348 is from the RP13 library, AC055876 is from the RP11 libraryreturnis 15 pairs of BAC-ends overrepresentation? Please comment.cuomo@genome.wi.mit.edu
AC139149AC139530  sine sequence alignment, repeat maskerInsertion of ~310bp composed of 1 AluYb8 element in AC139149. Join supported by 10 BACs & 10 fosmid spanners. Total overlap 42kb.pass cuomo@genome.wi.mit.edu
AC138080AP000079  line Global Sequence Alignment, RepeatMasker, Blast2overlap of 85kb, Break in alignment caused by LINE in 396bp segment in AC138080, 1 supporting BAC 3 supporting fosmidspass cuomo@genome.wi.mit.edu
AC115090AC124789  sslp Blast2 and RepeatMaskerAC124789 contains 339 bp more of a (TA)n repeat at bp 21617 27000 bp total overlappass cuomo@genome.wi.mit.edu
AC091172AC125257  otherBlast2 and RepeatMaskerAC091172 contains 3932 bp deletion at 164383. 126000 bp total overlap. 3 supporting Bacs; 6 supporting fosmids.returnbig deletion---requires additional support of polymorphism (eg pcr)cuomo@genome.wi.mit.edu
AC004908AC131281  otherGlobal Sequence Alignment, RepeatMasker, Blast2overlap of 94kb Break in alignment caused by a 3934bp segment in AC131281 containing SSLP, LINEs and an analogous 520bp segment in AC004908 containing a LINEreturnis 15 pairs of fosmid-ends overrepresentation? Multiple variations may require additional support eg. PCRcuomo@genome.wi.mit.edu
AC104389AC129505  othersequence alignment778 bp deletion in AC129505, 2 pairs of fosmid end link across joinreturnrequires additional support eg. PCRcuomo@genome.wi.mit.edu
AC107971AC130312  sslp Sequence Alignment, RepeatMasker60kb overlap, SSLPs in centromeric regionreturnrequires BAC, fosmid end support or othercuomo@genome.wi.mit.edu
AC021317AC115992  sslp Blast2 and RepeatMaskerAC021317 contains 524 bp inserted region containing ALU at bp 36310. RP11/CIT. 21385 bp total overlap. 6 supporting bacs, 7 supporting fosmidspass cuomo@genome.wi.mit.edu
AC100777AC116002  sslp repeatmasker and human analysisGAA simple repeat region is ~430bp longer in AC100777; join is supported by high % identity across the overlap and 5 pairs of fosmid end seq and 8 pairs of BAC end seq which link across the joinpass cuomo@genome.wi.mit.edu
AC100791AC116025  sslp Blast2 and RepeatMaskerAC100791 contains 353 bp more of (CAT)n repeat at bp 131892 RP11/CIT. 115000bp total overlap. 6 supporting bacs, 3 supporting fosmidspass cuomo@genome.wi.mit.edu
AC104419AC115485  otherBLAST2, RepeatMaskeroverlap of 27kb. Break in alignment is caused by a 3.5kb insertion (containing L2, L2, LTR60, L2) in AC115485 that is flanked by AluSx. Analogous position in AC104419 has only AluSx. RP11 clone versus GS1 clone. 3 supporting BACs, 11 supporting fosmids, 1 supporting draft, AF215849.pass cuomo@genome.wi.mit.edu
AC105195AP004290  line Global Sequence Alignment and RepeatMasker44 kb overlap. Break in alignment is caused by a 317 bp L1MC/D insertion in AP004290. 2 supporting BACs, 2 supporting fosmids, and another supporting finished accession (AC104980).pass cuomo@genome.wi.mit.edu
AP000079AP000080AL355484    3 supporting BACs, 1 supporting fosmid.pass cuomo@genome.wi.mit.edu
AC091060AC118757  sslp repeatmasker and human analysisGA-rich low complexity repeat is ~155bp longer in AC091060; join is supported by high % identity across the overlap and 5 pairs of fosmid end seq and 3 pairs of BAC end seqwhich link across the joinpass cuomo@genome.wi.mit.edu
AC104257AC120041  otherGlobal Sequence Alignment and RepeatMasker68 kb overlap. Two breaks in the alignment. One is caused by 1122bp L1PA4 insertion in AC104257, while the other one is caused by a 179bp (TTATA)n insertion in AC104257. 1 supporting BAC, 4 supporting fosmids. RP11 clone versus CTD clone.pass cuomo@genome.wi.mit.edu
AC111170AC111182  sslp Blast2 and RepeatMaskerAC111170 contains 78 bp more of unresolved homopolymeric tract at 17741-17824bp 55305 bp total overlap 5 supporting bacs, 5 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC004612AC123779  sine Global Sequence Alignment and RepeatMasker17 kb overlap. Break in alignment is caused by a 311 bp AluYa5 insertion in AC004612. 3 supporting BACs, 1 supporting fosmid.pass cuomo@genome.wi.mit.edu
AC110014AC120055  sslp repeat masker and human analysisTA simple repeat region is ~1kB longer in AC110014; join is supported by high % identity across the overlap and 1 pair of BAC end seq which link across the joinpassPreferable to have additional BAC or fosmid end supportcuomo@genome.wi.mit.edu
AC025018AC117569  sslp repeatmasker and human analysisTA rich simple repeat region is ~500bp longer in AC117569; join is supported by 2 pairs of BAC end seq which link across the joinpass cuomo@genome.wi.mit.edu
AC110288AC120035  otherGlobal Sequence Alignment, RepeatMasker, Blast2overlap of 29kb. Two breaks in alignment caused by imperfect 42mer repeat ("CAGCCATCCGTGGACTGGGGTAGACTGTGAGCGGTTAATC
TC") that is 798bps larger in AC110288. Imperfect 45mer repeat ("CAGGTACCTGGATGGGTTCATTTGGGTGCATCACCTGGAG
ACGTC") that is 225bps larger in AC110288. 1 supporting BAC, 2 supporting fosmids.
pass cuomo@genome.wi.mit.edu
AC027701AC127034  otherGlobal Sequence Alignment and RepeatMasker78 kb overlap. Break in alignment is caused by a 560 bp insertion of a combination of LTR`s and a SSLPs (LTR-LTR-SSLP-LTR) in AC027701. 2 supporting BACs, 2 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC104423AC125437  sine sequence alignment, repeat maskerInsertion of ~320bp composed of 2 Alu elements in AC125437. Join supported by 4 BACs and 6 fosmids. Total overlap 45kb.pass cuomo@genome.wi.mit.edu
AC090616AC129917  sine Blast2 and RepeatMaskerAC129917 contains 186 bp inserted region containing Alu. contains AluSq not rpesent in AC129917, 75000 bp total overlap 3 supporting Bacs; 5 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC122179AC127030  sine repeatmasker, sequence alignmentAlu, Line insertion in AC122179returnrequires BAC, fosmid end support or othercuomo@genome.wi.mit.edu
AC107956AC126389  sine RepeatMasker, Global Sequence Alignment23kb overlap, AluSq longer in AC126389 than AC107956, supported by 2 pairs of BAC ends, 2 pairs of fosmid endspass cuomo@genome.wi.mit.edu
AC013791AC131971  sine Global Sequence Alignment19kb overlap, AluSx repeat. 2 copies in AC131971, 1 copy is AC013791, 8 fosmid endspassis 12 pairs fosmid-ends overrepresentation?cuomo@genome.wi.mit.edu
AC108448AC131971  sslp Global Sequence Alignment, RepeatMasker58kb overlap, GA-rich length polymorphism: 305 bp in AC108448 (near 58042-58235), 78 bp in AC131971, supported by 4 pairs of BAC ends, 8 pairs of fosmid endspass cuomo@genome.wi.mit.edu
AC087386AC126603  sslp repeat maskerbroken overlap caused by (CGG)n repeat (311 bp) and G-rich low complexity region (165 bp) in AC126603; join is supported by high % identity across the 27 kb overlap and 13 BAC`s and 12 fosmids which link across the join.returnAre 13 BAC- and 12 fosmid-ends overrepresentation? Please commentcuomo@genome.wi.mit.edu
AC015988AC107896  othersequence alignmentInsertion of an AluYa5 repeat element in AC107896. Insertion of ~400bp of a 80bp unknown repeat element in AC107896. Join supported by 4 BACs and 14 fosmids. Total overlap 112kb.returnis 21 pairs fosmid-ends overrepresentation? Also, unknown insertion requires additional support eg. PCR to support polymorphismcuomo@genome.wi.mit.edu
AC107892AC109314  sslp repeat masker, sequence alignmentCCCCAGn repeat region is ~50bp longer in AC107892; join supported by 10 BACs and 8 fosmids which link across join. Total overlap 141kb.pass cuomo@genome.wi.mit.edu
AC026950AC129915  otherGlobal Sequence Alignment, RepeatMasker, Blast2overlap of 18kb. Imperfect 54mer repeat larger by 1838bps in AC129915. 8 supporting BACs, 3 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC103725AC131568  otherGlobal Sequence Alignment, RepeatMasker, Blast2overlap of 41kb. Break in alignment caused by imperfect 20mer repeat ("CAGAGGGGAACACATGGGGG") larger in AC131568 by 93bps. 4 supporting BACs, 4 supporting fosmids.pass cuomo@genome.wi.mit.edu
AC022206AC131390  sslp Non-experimental. Polymorphism in simple sequence repeat of GGAA in AC022206 around 164,300 bp interrupts the alignment. passIn future, should include BAC/fosmid end support and extent of polymorphism.doggett@lanl.gov
AC027130AC134300  sslp Non-experimental. Polymorphism in simple sequence repeat of TA around 5391 bp in AC007613 interrupts the alignment. passin future, please include BAC/fosmid end support and extent/size of variation. This also has a lot of overlap (89kb)) which would be useful to note.doggett@lanl.gov
AC127459AC130450       in process doggett@lanl.gov
AC010268AC130454  sslp Non-experimental. Polymorphism in simple sequence repeat of AG around 116081 bp in AC010268 interrupts the alignment. passshould include BAC/fosmid end support, extensive overlap (49kb), size of polymorphic regiondoggett@lanl.gov
AC009030AC130449  sslp Non-experimental. Polymorphism in simple sequence repeats of CT around 137400 bp and GGGAT around 78000 bp in AC130449 interrupts the alignment. passshould include BAC/fosmid end support, extensive overlap (49kb), size of polymorphic regiondoggett@lanl.gov
AC005591AC092117       returnrequires additional information. Please include BAC/fosmid end or other support. Please indicate if attempts are being made to resolve.doggett@lanl.gov
AC092133AC135776  sslp Non-experimental. Polymorphism in simple sequence repeat of AAAAT around 33150 bp in AC092133. OTHER EVIDENCE: Microdeletion of 538 bp at 29310 bp in AC092133 is being evaluated.in processcomplex, other-likely requires PCR confirmation of polymorphismdoggett@lanl.gov
AC108134AJ003147       in processnext round, please include BAC or fosmid end support if any.doggett@lanl.gov
AC098805AC106820  sslp Non-experimental. Polymorphism in simple sequence repeats around 600-700 bp of AC098805 interrupts the alignment. returnrequires BAC, fosmid end support. Please include size of apparent polymorphismdoggett@lanl.gov
AC093525AC106820  sslp Non-experimental. Polymorphism in simple sequence repeat of AT, around 61 Kb of AC106820 interrupts the alignment. returnrequires BAC, fosmid end support. Please include size of apparent polymorphismdoggett@lanl.gov
AC025277AC106783       in processplease include BAC, fosmid end supportdoggett@lanl.gov
AC025280AC092341  sslp Non-experimental. Polymorphism in simple sequence repeats at 6 locations interrupt the alignment. Join is supported by multiple BAC and fosmid paired ends. pass doggett@lanl.gov
AC018846AC092126       in process doggett@lanl.gov
AC018552AC092118  sslp Non-experimental.Polymorphism in simple sequence repeat of CCAT around 10500 bp in AC018552 (around 20500 bp in AC092118) interrupts the alignment. CCAT repeat is 1.3 Kb in AC092118 vs 1.74 Kb in AC018552. Supported by multiple BAC and fosmid paired ends.pass doggett@lanl.gov
AC012321AC092115  other?Alu deletion of 99 bp around 101645 bp in AC092115, Microdeletion of 297 bp around 111070 bp in AC092115, and deletion of 4700 bp around 3060 in AC012321 interrupt the alignment. Clones are from different BAC libraries. Join is supported by multiple BAC and fosmid paired ends.returnProbably OK, but deletion should be confirmed polymorphic eg by PCR.doggett@lanl.gov
AC012186AC092368       in processwill resolve on next punchlistdoggett@lanl.gov
AC007334AC007608  sslp Non-experimental. Polymorphism in simple sequence repeat of G`s and A`s around 71428 bp in AC007334 interrupts the alignment. passshould include size of polymorphism, BAC/fosmid end supportdoggett@lanl.gov
AC007602AC020766  sslp Non-experimentalPolymorphism in simple sequence repeats of GAAA and CT around 7250 bp in AC007602 interrupts the alignment. Supported by multiple BAC and fosmid paired ends.returnPotential overrepresentation of BAC- and fosmid-ends. Investigate.doggett@lanl.gov
AC007613AC007616  sslp Non-experimental. Polymorphism in simple sequence repeat of TA around 5391 bp in AC007613 interrupts the alignment. passOK, but in future include extent of variation and BAC/fosmid end supportdoggett@lanl.gov
AC009069AC009094  otherNon-experimental.SSLP and other. Polymorphism in simple sequence repeat of AT around 162370 bp in AC009094 interrupt the alignment. Two Alu polymorphisms, at 106374-106678 bp in AC009069 and 184078-184381 bp in AC009094. Supported by multiple BAC and fosmid paired ends.pass doggett@lanl.gov
AC009088AC093520  sslp Non-experimental. Polymorphism in simple sequence repeats at several locations interrupts the alignment. passshould include BAC/fosmid end support, extensive overlap (49kb), size of polymorphic regiondoggett@lanl.gov
AC009090AC023825  sslp Non-experimental. Polymorphism in simple sequence repeats of CA, and poly-A, around 192112 bp in AC009090 interrupts the alignment. passshould include BAC/fosmid end support, length of polymorphism.doggett@lanl.gov
AC009155AC026461  otherNon-experimental.SSLP and other. Polymorphism in simple sequence repeat of GGAA repeats around 104053 bp in AC009155 interrupts the alignment. Polymorphism between 78050-78823 bp of AC009155 and 146099-147039 bp and microdeletion of 330 bp around 120297 of AC026461 interrupt the alignment. Supported by multiple BAC and fosmid paired ends.pass doggett@lanl.gov
AC004682AC009087       returncertificate incompletedoggett@lanl.gov
AC006352AC092144       in process doggett@lanl.gov
AC003108AC012621  sslp Non-experimental. Polymorphism in simple sequence repeat of TA around 53200 bp in AC012621 interrupts the alignment. passShould include BAC, fosmid end support in futuredoggett@lanl.gov
AC002331AC008756  sslp Non-experimental. Polymorphism in simple sequence repeats at several location interrupts the alignment. Finishing quality will be evaluated. in processplease include size of polymorphism, BAC/fosmid end supportdoggett@lanl.gov
AC007842AC011536  otherno experimentalClones overlapping in a tandem repeat. Join supported by AC139454 and also 7 other fosmid end pairspass jane@shgc.stanford.edu
AC008568AC010482  otherno experimental123bp indel in AC010482. Join supported by one pair of BAC ends and 2 pairs of fosmid ends.returnThis in/del require s other support, eg PCR.jane@shgc.stanford.edu
AC008659AC093290  otherNo experimentalNumber of repeats varies between clones. AC008659 is tagged in the GenBank entry as unsure # of repeat copies. Join is supported by 11 pairs of fosmid ends.returnIs 11 pairs of fosmid-ends overrepresentation? Also, requires additional support eg. PCRjane@shgc.stanford.edu
AC008892AC016596  sslp no experimental 543bp indel in TA region. Join supported by 1 pair of BAC ends and 1 pair of fosmid endspass jane@shgc.stanford.edu
AC008939AC020930      AC008939 clipped too short. Being refinished to extend the overlap.in process jane@shgc.stanford.edu
AC010442AC106772  otherno experimental Variation between Caltech D and RP11 clones in telomeric region. Join supported by the draft clone AC138432. Also one other pair of BAC ends and 7 pairs of fosmid endspass jane@shgc.stanford.edu
AC010470AC022450  sslp no experimental153bp simple sequence polymorphism at the end of the clone. Join supported by 3 pairs of BAC ends.pass jane@shgc.stanford.edu
AC011407AC090064  sslp no experimental185bp indel in TA region. Join supported by 2 pairs of BAC ends.pass jane@shgc.stanford.edu
AC027310AC027316  otherno experimentalVNTR 29mer attcttatatatattctaagaaatatac repeated twice in AC027310 and 13 times in AC027316. Join supported by 2 pairs of BAC ends.pass jane@shgc.stanford.edu
AC093528AC094099      AC093528 clipped too short. Being refinished to extend the overlap.in process jane@shgc.stanford.edu
AC114288AC114307  sslp no experimental214bp indel in TA region. Join supported by 5 pairs of BAC ends.returnGreg`s site lists no supporting BAC or fosmid-ends. requires BAC, fosmid end support or otherjane@shgc.stanford.edu
AC022093AC122716      Repeat on the end of the clones. Another clone in progress to reinforce the join.in process jane@shgc.stanford.edu
AC010600AC020936  sslp no experimental147bp indel in TA region. Join supported by 8 pairs of BAC ends.pass jane@shgc.stanford.edu
AL160006AL355990      overlap between position 89784-91783 in AL160006 and 1-2000 in AL355990returnUnsure re. the nature of the problem. What type of cert. is this? If previously a blunt/short join, then this is OK, please update certificate or accession to remove. If this is a polymorphic join, please resubmit with type and length of polymorphism.kb1@sanger.ac.uk, kem@sanger.ac.uk
AL139141AL390718  otherSequence alignment and manual checking21000bp overlap between position 155124-176094 in AL390718 and 1-20691 in AL139141. 13bp interruption to alignment at ~164637 in AL390718. Join Supported by 6 pairs BAC ends and 9 pairs Fosmid ends.passLong overlap, small variation.kem@sanger.ac.uk
AL035411AL365187  sslp Sequence alignment and manual checking2263bp oveplap. Variation in overlap and CA repeat at ~1530bp and ~1800bp in AL035411 interupting alignment. Join supported by 3 pairs BAC ends and 7 pairs Fosmid ends.pass kem@sanger.ac.uk
AC099563AC114496  otherSequence alignment and manual checking93835bp overlap between 93296-186551 in AC114496 and 1-93835 in AC099563. 230bp difference in TA repeat at ~118664bp in AC114496 interrupting alignment. Join Supported by 7 pairs BAC ends and 4 pairs Fosmid endspassLong overlap, small variation.kem@sanger.ac.uk
AC099570AC099571  otherSequence alignment and manual checking86042bp overlap between position 81372-157413 in AC099571 and 1-85817 in AC099570. Disruption in alignment at 87144bp in AC099571. Join Supported by 8 pairs BAC ends and 11 pairs Fosmid endspassProbably OK because of long overlap, and small number of differences.kem@sanger.ac.uk
AC093575AC095030  otherSequence alignment and manual checking44080bp overlap between position 1-43867 in AC095030 and 115151-159238 in AC093575. TA rich tandem repeat showing variation and several in/dels between the two accessions. TA repeat 220bp longer in AC093575 at ~134387bp. Join Supported by 2 pairs BAC ends and 2 pairs Fosmids endsreturnprobably OK because of long overlap, but multiple `other` variations need additional support of polymorphism (eg, pcr)kem@sanger.ac.uk
AC092801AC094022  otherSequence alignment and manual checking71918bp overlap between position 79465-151198 in AC092801 and 1-71918 in AC094022. Join supported by 4 pairs BAC ends and 8 pairs Fosmid endspassProbably OK because of long overlap, and small number of differences.kem@sanger.ac.uk
AC009988AC026395      overlap between position 119060-174398 in AC009988 and 1-55109 in AC026395passLarge overlap, even though lack of end-to-end align.lon@sanger.ac.uk
AL157705AL392103      Join supported by 4 pair(s) of human BAC ends, CTD-2258H15,RP11-148C9,RP11-794O16,RP11-982I3. PCR on genomic sample in process to confirm the overlap.in processpreviously returnedlon@sanger.ac.uk
AL365356BX276080       in processshould drop from list next roundlon@sanger.ac.uk
AC012469AL772287AC016826    Overlap of 6bp at GAATTC cloning site. Join supported by genomic sequence AC016826 RP11-570J13. Join supported by 1 pair(s) of human BAC ends and 7 pair(s) of human fosmid ends.pass lon@sanger.ac.uk
AC121340AC140846  otherresubmisson of AC002357 in process682 bp N`s are in AC002357.1.in process mtr@sanger.ac.uk
AL590763BX276092      New this time. In process. Problem caused by error in assembly of AL590763 (MPIMG to correct). Can be avoided temporarily by use of switchpoint in AGP.in process mtr@sanger.ac.uk
AC074034AC108685AC106713     pass mtr@sanger.ac.uk
AL133277Z70689      E-certificate previously submitted (NCBI joins).pass mtr@sanger.ac.uk
AL109801Z68331      Resubmission to produce a 2000 bp overlap is in progress.in process mtr@sanger.ac.uk
AL035609AL590069      We have exchanged emails about this one earlier. 2000 base overlap.pass mtr@sanger.ac.uk
AL022155Z70281      Resubmission to produce a 2000 bp overlap is in progress.in process mtr@sanger.ac.uk
AJ271735AJ271736none    Originally submitted in one piece as Y19189. Split into two segments by EMBL according to the authors (IIGB). Inclusion of Y19189 will cause problems as it is the secondary accession of each.disputedThis is an old compound accession on chrX. Almost certainly OK, but technically not according to standard. It is supported by fosmid and BAC end links.mtr@sanger.ac.uk
AL008706AL133546      New this time. 100 base overlap.pass mtr@sanger.ac.uk
AC109993AL645722      In process. Both sequences have been recently resubmitted by the respective centres (IMB, IIGB). The problem is caused by a small piece of sequence (~4 kb) that is rotated between the two accessions. One must be incorrect as both clones are from the same X chromosome. Evaluation and correction will be carried out by the two centres. Submitted also as E-certificate to NCBI joins.in process mtr@sanger.ac.uk
AF277315L44140  otherIMB resequenced 676 bp of G6PD intron 2 containing six of the divergent positions in 6 women and 11 men of Caucasian origin. In all checked chromosomes the sequences were identical to AF277315, indicating that L44140 variants represent rare alleles in thresubmission of L44140 clipped back to 2000 bp overlap with AF277315 would resolve the failure to detect overlap computationally. Join supported by 1 pair BAC ends, 6 pairs fosmid ends.unresolvedIn the strictest sense, this could be seen as unresolved, since the polymorphism was not seen in the panel, but the efforts are as far as anyone could reasonably ask. Please do not resolve by clipping this back. It is preferable to have some mechanism where a user looking at this region could retrieve the certificate to see what additional measures had been taken to confirm. No further action is necessary.mtr@sanger.ac.uk
AC003659AC121344  line PCR on genomic samples in process to confirm~400bp LINE element present in AC121344.5 breaks alignment; join is supported high % identity across the overlapin processif BAC or fosmid end support is available, PCR is not requiredmtr@sanger.ac.uk
AC108359AC117405  sslp PCR on genomic samples in process to confirmdinucleotide repeat region is ~75bp longer in AC108359; join is supported by 5 pairs of BAC endspasswith BAC end support, no further action is requiredmtr@sanger.ac.uk
AC006062AC073533  sslp PCR on genomic sample in process to confirm the polymorphismAG repeat region 350 bp longer in AC006062.4; Join supported by 1 pair of human BAC end.passwith BAC end support, no further action is requiredmtr@sanger.ac.uk
AC091810AL592164      AC091810.2 contains 30 bp of vector sequence. Clipping and resubmission will solve this problemin process mtr@sanger.ac.uk
AC108359AC112496  sslp PCR on genomic samples in process to confirmtrinucleotide repeat region is ~765bp longer in AC112496; join is supported by high % identity across the overlap and 5 pairs of BAC endspasswith BAC end support, no further action is requiredmtr@sanger.ac.uk
AL591379AL845321  none  Pericentromeric segmental duplicated regionin processpreviously E-CERTIFICATE IN PROCESS. TPF revised in this region. Should wait to resolve through next round of punchlists. alignment does not extend to end of AL845321sjh@sanger.ac.uk
AL359955AL445665  none  Pericentromeric segmental duplicated regionin processpreviously E-CERTIFICATE IN PROCESS. TPF revised in this region. Should wait to resolve through next round of punchlists. alignment does not extend to end of AL445665sjh@sanger.ac.uk
AL445595AL512635      Additional 73bp of sequence in AL445595; GAGCTCGGTACCCGGGGATCTAGAGTACTGGTTGAAACCCGG
ATCATGCATCAGTACGCGTGAGCTCGAATTC represents contamination; matches cloning vector - pBACe3.6. Resolve by re-submitting AL445595.
in process sjh@sanger.ac.uk
AL163528AL442637      AL163528 is currently not finished, which is sending the algnment off. Resolve by finishing AL163528in process sjh@sanger.ac.uk
AL163528AL357614  none  Presence of Ns in finished clone AL357615. Version .7 has been corrected. Join supported by 4 pair(s) of human BAC ends. Join supported by 3 pair(s) of human fosmid endsin processShould be resolved in next roundsjh@sanger.ac.uk
AL355151AL627230  none  Pericentromeric segmental duplicated regionin process sjh@sanger.ac.uk
AL592525AL954685  none  Pericentromeric segmental duplicated regiondisputedpreviously returned. This will not be resolved soon.sjh@sanger.ac.uk
AL591438AL627230  none  Pericentromeric segmental duplicated regionin processpreviously E-CERTIFICATE IN PROCESS. TPF revised in this region. Should wait to resolve through next round of punchlists. no alignment foundsjh@sanger.ac.uk
AL590711BX001034  none  Pericentromeric segmental duplicated regionin processpreviously E-CERTIFICATE IN PROCESS. TPF revised in this region. Should wait to resolve through next round of punchlists. no alignment foundsjh@sanger.ac.uk
AL445643BX001034  none  Pericentromeric segmental duplicated regionin processpreviously E-CERTIFICATE IN PROCESS. TPF revised in this region. Should wait to resolve through next round of punchlists. AL445643 is contained in BX001034sjh@sanger.ac.uk
AL359955AL512605  none  Pericentromeric segmental duplicated regionin processpreviously E-CERTIFICATE IN PROCESS. TPF revised in this region. Should wait to resolve through next round of punchlists. internal alignment (no dovetail)sjh@sanger.ac.uk
AL591424AL954642  otherIn progressGC rich tandem 9qtleomeric region. Indel in tandem, 22kb match then 305bp missing from AL954642.9 (RP11-885N19) from 21904. 302bp extra in tandem in AL591424.11 (RP11-424E7) from 135208-135513. Then 66kb match. Also Riethman half YAC in pipeline.in process sjh@sanger.ac.uk
AL162415BX248098  none  Pericentromeric segmental duplicated region supported by 11 pair(s) of human BAC endsin process sjh@sanger.ac.uk
AL162731AL591926  none  Pericentromeric segmental duplicated region. Join supported by 6 pair(s) of human BAC ends. Join supported by 15 pair(s) of human fosmid endsin process sjh@sanger.ac.uk
BX005195BX248112  none  Pericentromeric segmental duplicated regionin process sjh@sanger.ac.uk
AL354874AL391987  none  Pericentromeric segmental duplicated regionin process sjh@sanger.ac.uk
AL357615AL391117  none  Presence of Ns in finished clone AL357615. Version .7 has been corrected. Join supported by 9 pair(s) of human BAC ends. Join supported by 1 pair(s) of human fosmid endsin processShould be resolved in next roundsjh@sanger.ac.uk
AL158832AL356244  otherTo be testedAlu. 9ptelomeric region. Indels in Alu repeats disrupting join. Join supported by 2 pair(s) of human BAC ends. Join supported by 10 pair(s) of human fosmid endsin process sjh@sanger.ac.uk
AC105266AC134025  sslp cross_match, inspection in ConsedAlignment broken by deletions in imperfect `ggaaa` pentanucleotide repeats. Join supported by 6 pairs of BAC ends and 5 pairs of fosmid endspass sscherer@bcm.tmc.edu
AC013421AC140060  none noneGenBank record for AC140060 is incorrect. The previous version is correct (gi:28460722) and will be updatedin process sscherer@bcm.tmc.edu
AC105765AC139618  otherNoneGap between this pair is now filled with RP11- 158G18 (Type1) on tpf.returnOn Greg`s site says "sequence_not_yet_analyzed"; May require BAC, fosmid end support or other. Or, may resolve with next compute.sscherer@bcm.tmc.edu
AC134998AC136189  sslp PCR on genomic samples in progress to confirmtandem repeat region is ~150bp longer in AC134998in process sscherer@bcm.tmc.edu
AC104448AC134772  othercross_match, inspection in ConsedSINE/SSLP Three breaks in alignment: First break due to ALU repeats, second due to dinucleotide repeat polymorphism and third break due to ALU repeats copy number. Join supported by 7 pairs of fosmid ends.pass sscherer@bcm.tmc.edu
AC107304AC108697  othersequencetransposon sequence in AC107304 not excised; resubmission in progressin process sscherer@bcm.tmc.edu
AC025572AC116991  line cross_match, RepeatMaskerAlignment broken by a 6Kb LINE insertion in AC116991.2. Join supported by 5 pairs of BAC and 12 pairs of fosmid endspassis 12 pairs fosmid-ends overrepresentation?sscherer@bcm.tmc.edu
AC063927AC117435  otherPCR on genomic samples in progress to confirm~255bp insertion in AC063927 breaks alignment Polymorphism; 299 bp AluY insertion in AC112646.9;in processrequires BAC, fosmid end support or othersscherer@bcm.tmc.edu
AC078788AC117421  sine  120bp AluY insertion in AC117421.6; Join supported by 2 pairs of human BAC endspass sscherer@bcm.tmc.edu
AC087879AC090052  sslp  GT simple repeat longer in AC087879; join is supported by 2 pairs of BAC endspass sscherer@bcm.tmc.edu
AC007934AC128680  otherPCR on genomic sample in progress to confirm polymorphismLINE and OTHER. 70 bp insertion and 520 bp L1MB6 insertion in AC128680.6; Join supported by 2 pairs of human BAC ends.return`other` requires additional support, eg PCRsscherer@bcm.tmc.edu
AC099047AC131013  line PCR on genomic samples in progress to confirm~8kb LINE element present in AC131013 breaks Alignmentpasspcr confirm not requiredsscherer@bcm.tmc.edu
AC112646AC130888  sine confirmed by genomic PCR polymorphism299 bp AluY insertion in AC112646.9;pass sscherer@bcm.tmc.edu
AC104190AC124916  sine cross_match, inspection in ConsedAlignment broken by 131 bases of ALU sequences in AC124916.3. Join supported by 2 pairs of BAC and 3 pairs of fosmid ends.pass sscherer@bcm.tmc.edu
AC108486AC109585  othernoneProblem with AC109585 - currently being resubmitted.passAlready resolved in TPFsscherer@bcm.tmc.edu
AC099780AF152364  othernoneTwo breaks in the alignment: The first is due to sequence length polymorphisms at 87223 (AC099780 coordinates) and the other is due to dinucleotide repeats polymorphism at 95133. Otherwise join looks OK. Join supported by 7 pairs of BAC and 10 pairs of fosmid ends. PCR validation pending.in processOK, but encourage pcr validationsscherer@bcm.tmc.edu
AC103587AC114398  othernone310-base internally duplicated region in AC114398 between 225316 and 225625. Another copy between 223978 and 224287. Join supported by 4 pairs of BAC and 3 pairs of fosmid ends. PCR validation pending.in process sscherer@bcm.tmc.edu
AC096917AF152363  othercross_match, inspection in ConsedAF152363 not finished to current standards. Looks OK.in processalready removed from punchlistsscherer@bcm.tmc.edu
AC026305AC068757  sslp PCR on genomic samples in progress to confirmtandem repeat region is ~225bp longer in AC026305passpcr not requiredsscherer@bcm.tmc.edu
AC089985AC090051  sine  AluYb8 element present in AC090051 breaks alignment; join supported by 6 pairs of BAC endspass sscherer@bcm.tmc.edu
AC034187AC068312  otherGlobal Sequence Alignment, RepeatMasker, Blast2overlap of 41kb. Break in alignment caused by imperfect 80mer repeat that is 876bps larger in AC034187. 4 supporting BACs, 5 supporting fosmids.pass sscherer@bcm.tmc.edu
AC046134AC110716  sslp join is supported by 7 pairs of human BAC endsGT simple repeat region 10 bp longer in AC110716.5pass sscherer@bcm.tmc.edu
AC069261AC073916  none noneAC069261 is being resubmitted (see gi:22094222)in processwill disappearsscherer@bcm.tmc.edu
AC018842AC066608  otherGlobal Sequence Alignment, RepeatMasker, Blast2overlap of 52kb. Break in alignment caused by a simple repeat (TA)n larger in AC066608 by 686bps. 2 supporting BACs, 6 supporting fosmids.pass sscherer@bcm.tmc.edu
AC021999AC090955  otherGlobal Sequence Alignment, RepeatMasker, Blast2overlap of 98kb. Break in alignment caused by two simple repeats (CA)n and (TA)n larger in AC021999 by 152bps. 3 supporting BACs, 9 supporting fosmids.pass sscherer@bcm.tmc.edu
AC023481AC087859  otherGlobal Sequence Alignment, RepeatMasker, Blast2overlap of 55kb. Break in alignment caused by SVA repeats larger in AC087859.3 by 508bps. 1 supporting BACs, 5 supporting fosmids.pass sscherer@bcm.tmc.edu
AC024163AC026194  sine Global Sequence Alignment, RepeatMasker, Blast2overlap of 88kb. Two breaks in alignment caused by two 322bp SINE insertion in AC024163. 5 supporting BACs, 5 supportings fosmids.pass sscherer@bcm.tmc.edu
AC006205AC021054  sslp correct sequence alignmentAC006205 was resubmitted, eliminating problemin process sscherer@bcm.tmc.edu
AC004216AC007425  sslp  repeat region ~500bp longer in AC007425; join is supported by 3 pairs of BAC endspass sscherer@bcm.tmc.edu
AC004801AC074029  sslp  TA repeat region ~200bp longer in AC074029; join supported by 4 pairs of BAC endspass sscherer@bcm.tmc.edu
AC010370AC026118  sslp Join supported by 4 pairs of human BAC endstandem repeat 200 bp longer in AC026118.17pass sscherer@bcm.tmc.edu
AC009811AC055712  other 157 bp insertion in AC055712.13; Join supported by 4 pairs of human BAC endsreturn`other` requires additional support eg pcr.sscherer@bcm.tmc.edu
AC006512U47924  othersequence alignmentn`s in submission; resubmission in progressin process sscherer@bcm.tmc.edu
AC011609AC087428  sine Global Sequence Alignment, RepeatMasker, Blast2overlap of 60kb. Break in alignment caused by a SINE repeat larger in AC011609 by 267bps. 4 supporting BACs, 4 supporting fosmids.pass sscherer@bcm.tmc.edu
AC010200AC010209  othersequence alignmentn`s in submission; resubmission in progressin process sscherer@bcm.tmc.edu]
AC073244AC092969       in process sscherer@bcm.tmc.edu]
AC093927AC098971  none  AC093927 contains vector sequence on the ends; UWGC is filtering and resubmitting; join is supported by 6 pair of BAC-endsin process sscherer@bcm.tmc.edu]
AC092947AC130416       in process sscherer@bcm.tmc.edu]
AC091212AC108678       in process sscherer@bcm.tmc.edu]
AC079602Z98941  none ?clone pair is currently being analyzed; join is supported by 2 pair of BAC-endsin processmay need pcr analysis if variation is not simplesscherer@bcm.tmc.edu]
AC087447AC103854AC090163    6 bp overlap supported by finished GenBank sequence AC090163.10 (RP11-706A13)pass taylor@gsc.riken.go.jp
AC023080AC134982AC126324    6 bp overlap supported by finished GenBank sequence AC126324.3 (RP11-358H20)pass taylor@gsc.riken.go.jp
AP000807AP002813AP002366    6 bp overlap supported by finished GenBank sequence AP002366.4 (RP11-142N13)pass taylor@gsc.riken.go.jp
AP001189AP003119AP003101    6 bp overlap supported by finished GenBank sequence AP003101.2 (RP11-30J7)pass taylor@gsc.riken.go.jp
AP003120AP006215AC026168    6 bp overlap supported by finished GenBank sequence AC026168.3 (RP11-156E23)pass taylor@gsc.riken.go.jp
AP001790AP001876AP000652    6 bp overlap supported by finished GenBank sequence AP000652.4 (CMB9-8G5)pass taylor@gsc.riken.go.jp
AP000848AP003781AP000929    6 bp overlap supported by finished GenBank sequence AP000929.5 (RP11-778B17)pass taylor@gsc.riken.go.jp
AP002453AP003387AP003384    6 bp overlap supported by finished GenBank sequence AP003384.2 (RP11-35N19)pass taylor@gsc.riken.go.jp
AP005435AP005814  otherBlast2, RepeatMaskerSINE/LINE/SSLP. Overlap of 28 kb. Break in alignment caused by deletion of six neighboring SINE/LINE/DNA elements and a (CTTTG)n region for a total of 6014 bp found in AP005435 but not present in AP005814. Join supported by 3 pairs of human BAC ends.passmultiple, but fairly straightforwardtaylor@gsc.riken.go.jp
AP001166AP005202  otherBlast2, Tandem Repeats Finder, RepeatMaskerOverlap of 37 kb. Break in alignment caused by near-perfect 14-mer repeat (CATGGCCCTATATG) that is 364 bp longer in AP001166. There are 34.1 copies in AP001166 and 8.1 copies in AP005202. Join supported by 2 pairs of human BAC ends and 5 pairs of human fosmid ends.pass taylor@gsc.riken.go.jp
AP001028AP001029  line Blast2, RepeatMaskerOverlap of 118 kb. Break in alignment caused by deletion of a 6228 bp LINE/L1HS element found in AP001028 but not present in AP001029. Join supported by 1 pair of human BAC ends and 11 pairs of human fosmid ends.passis 11 pairs fosmid-ends overrepresentation?taylor@gsc.riken.go.jp
AP003783AP005401  otherBlast2, RepeatMaskerLTR/SSLP. Overlap of 6.3 kb. Break in alignment caused by deletion of LTR/ERVL element and a (TA)n region for a total of 235 bp found at the end AP003783 but not present in AP005401. Join supported by 2 pairs of human BAC ends and 1 pair of human fosmid ends. The sequence will be confirmed.passencourage additional confirmation in processtaylor@gsc.riken.go.jp
AP005232AP005379  otherBlast2, Tandem Repeats FinderOverlap of 24 kb. Break in alignment caused by imperfect 15-mer repeat (ATCATCATCATCACC) that is 198 bp longer in AP005379. There are 39.7 copies in AP005379 and 16.6 copies in AP005232. No supporting BACs/fosmids, but otherwise high % identity.returnrequires BAC, fosmid end support or othertaylor@gsc.riken.go.jp
AP003037AP003108  otherBlast2, RepeatMaskerSINE/LINE. Overlap of 14 kb. Break in alignment caused by deletion of two neighboring SINE/LINE elements for a total of 338 bp found in AP003108 but not present in AP003037. Join supported by 4 pairs of human BAC ends and 5 pairs of human fosmid ends. Also confirmed by PCR.pass taylor@gsc.riken.go.jp
AP003395AP003396  otherBlast2, RepeatMaskerOverlap of 71 kb. Break in alignment caused by deletion of 216 bp in an SVA element in AP003396. Join supported by 2 pairs of human BAC ends and 10 pairs of human fosmid ends.pass taylor@gsc.riken.go.jp
AP003500AP003782  otherBlast2, Tandem Repeats FinderOverlap of 60 kb. Break in alignment caused by imperfect 34-mer repeat (ATATATTCTACAGAATACGTATATTCTATTCTAC) that is 314 bp longer in AP003500. There are 21.3 copies in AP003782 and 30.3 copies in AP003500. Join supported by 2 pairs of human BAC ends and 7 pairs of human fosmid ends.passVNTRtaylor@gsc.riken.go.jp
AP003780U73634      Overlap of 15 kb. U73634 is an old cosmid clone of questionable quality finished at University of Texas Southwestern Medical Center. The last 164 bases of U73634 do not match the corresponding region of AP003780. We are going to replace U73634 with another clone, RP11-466C23.in process taylor@gsc.riken.go.jp
AP000311AP000312none    Short overlap is an artifact of the nested deletion method. Briefly, a library of nested deletion clones was constructed, a map was then made by using the end sequences from multiple restriction fragments, the overlaps for each clone were confirmed by sequencing, and finally a minimal set of clones was chosen for finishing. Join supported by 1 pair of human fosmid ends.disputedLikely to be OK. However, sequencing by nested deletions was not discussed in view of the certificates. Computational verification will not be possible without a spanning clone under current criteria.taylor@gsc.riken.go.jp
AP000336AP000337none    Short overlap is an artifact of the nested deletion method. Briefly, a library of nested deletion clones was constructed, a map was then made by using the end sequences from multiple restriction fragments, the overlaps for each clone were confirmed by sequencing, and finally a minimal set of clones was chosen for finishing. Join supported by 1 pair of human BAC ends and 2 pairs of human fosmid ends.disputedLikely to be OK. However, sequencing by nested deletions was not discussed in view of the certificates. Computational verification will not be possible without a spanning clone under current criteria.taylor@gsc.riken.go.jp
AP000438AP001160  otherBlast2, RepeatMaskerSINE/LINE. Overlap of 74 kb. Break in alignment caused by deletion of two neighboring SINE/LINE elements for a total of 460 bp found in AP001160 but not present in AP000438. Join supported by 5 pairs of human BAC ends and 2 pairs of human fosmid ends.pass taylor@gsc.riken.go.jp
AP000689AP000690  sine Blast2, RepeatMaskerOverlap of 7.6 kb. Break in alignment caused by deletion of a 299 bp SINE/AluSg element found in AP000690 but not present in AP000689. Join supported by 1 pair of human fosmid ends.pass taylor@gsc.riken.go.jp
AP000702AP000703      Break in alignment caused by a ~26 kb deletion in AP000702 between bases 38400 and 38401 which is covered by AP000703 and AP000704; the next few hundred bases after the deletion point are chimeric, so the last 2475 bp are not used in the AGP. Join supported by 1 pair of human fosmid ends.returnrequires additional support eg. Pcr.taylor@gsc.riken.go.jp
AP000708AP003069  otherBlast2, Tandem Repeats FinderOverlap of 63 kb. Break in alignment caused by near perfect 125-mer repeat (CAGCACGGCCACTAGCTCTGCTCAAGAAACAAGTCTGCGTC
TCCTTATTGTGCTAGTTCATTCCTCAGTTCACTACACAATCCT
TCAACGTTGGCCTCTTTGCCTGTCTGCACACTGTGCCTGGT) that is 107 bp longer in AP000708. There is 1 copy in AP003069 and 2 copies in AP000708. Join supported by 2 pairs of human BAC ends and 11 pairs of human fosmid ends.
passVNTR; Is 11 pairs fosmid-ends overrepresentation?taylor@gsc.riken.go.jp
AP000729AP001885  sslp Blast2, Tandem Repeats Finder, RepeatMaskerOverlap of 6.5 kb. Break in alignment caused by simple repeat (TG)n that is 12 bp longer in AP001885. There are 17 copies in AP000729 and 23 copies in AP001885. Join supported by 2 pairs of human BAC ends and 2 pairs of human fosmid ends.pass taylor@gsc.riken.go.jp
AP000924AP001883      Join supported by 2 pairs of human BAC ends and 2 pairs of human fosmid ends. Overlap of 60 kb. The last 43 bp of AP000924 do not match the corresponding position within AP001883, the sequence will be confirmed. There is high % identity otherwise.in process taylor@gsc.riken.go.jp
AP000926AP003040  sine Blast2, RepeatMaskerOverlap of 4 kb. Break in alignment caused by deletion of three neighboring SINE elements and an AT_rich region for a total of 1146 bp found in AP000926 but not present in AP003040. Join supported by 3 pairs of human BAC ends and 1 pair of human fosmid ends.pass taylor@gsc.riken.go.jp
AP001050AP001051  otherBlast2, Tandem Repeats FinderOverlap of 27 kb. Break in alignment caused by imperfect 20-mer repeat (TGCTGAGGGAGATGAGGGCC) that is 504 bp longer in AP001051. There are 95.9 copies in AP001050 and 120.9 copies in AP001051. Join supported by 3 pairs of human fosmid ends.pass taylor@gsc.riken.go.jp
AP001064AP001065  otherBlast2, Tandem Repeats FinderOverlap of 25 kb. Break in alignment caused by imperfect 41-mer repeat (CACTGTCTTGGTTGGCGTAGCCTTGTAGTAAGTTTTGACCG) that is 727 bp longer in AP001065. There are 25.9 copies in AP001064 and 40.9 copies in AP001065. Join supported by 1 pair of human fosmid ends.pass taylor@gsc.riken.go.jp
AP001620AP001621  otherBlast2, Tandem Repeats FinderOverlap of 20 kb. Break in alignment caused by imperfect 50-mer repeat (CAACACCTCCATCACCAACAGAAACCAGGCGGGGCCAGCTGA
CCCCAGAG) that is 235 bp longer in AP001620. There are 13.1 copies in AP001620 and 8.1 copies in AP001621. Join supported by 1 pair of human BAC ends and 5 pairs of human fosmid ends.
pass taylor@gsc.riken.go.jp
AP001625AP001626  otherBlast2, Tandem Repeats FinderOverlap of 39 kb. Break in alignment caused by imperfect 51-mer repeat (AGCCTCCCGCCCCGTTTACATCCACGCAGGCGTTTCCCCTT
ACCTGCACCG) that is 2023 bp longer in AP001625. There are 58 copies in AP001625 and 16.4 copies in AP001626. Join supported by 1 pair of human BAC ends and 10 pairs of human fosmid ends.
pass taylor@gsc.riken.go.jp
AP001874AP003170  sine Blast2, RepeatMaskerOverlap of 55 kb. Break in alignment caused by deletion of 1485 bp of SINE/Alu elements found in AP001874 but not present in AP003170. Join supported by 4 pairs of human BAC ends and 3 pairs of human fosmid ends.pass taylor@gsc.riken.go.jp
AP001883AP001980  otherBlast2, Tandem Repeats FinderOverlap of 31 kb. Break in alignment caused by imperfect 17-mer repeat (AGAGTATATGCAGTGAT) that is 223 bp longer in AP001980. There are 65.2 copies in AP001883 and 79.2 copies in AP001980. Join supported by 2 pairs of human BAC ends and 1 pair of human fosmid ends. In addition, the first 10 bp of AP001980 do not match the corresponding position within AP001883, the sequence will be confirmed.pass taylor@gsc.riken.go.jp
AP001925AP002433  otherBlast2, RepeatMaskerSINE/LINE/SSLP. Overlap of 16 kb. Break in alignment caused by deletion of six neighboring SINE/LINE elements and a (TA)n region for a total of 1382 bp found in AP002433 but not present in AP001925. Join supported by 7 pairs of human BAC ends and 5 pairs of human fosmid ends.passmultiple, but fairly straightforwardtaylor@gsc.riken.go.jp
AP001994AP003390  sine Blast2, RepeatMaskerOverlap of 97 kb. Break in alignment caused by deletion of a 264 bp SINE/AluYa5a2 element found in AP001994 but not present in AP003390. Join supported by 6 pairs of human BAC ends and 19 pairs of human fosmid ends.returnProbably OK, but is 19 pairs fosmid-ends overrepresentation? Please comment.taylor@gsc.riken.go.jp
AL109761AP000432  sslp Blast2, Tandem Repeats Finder, RepeatMaskerBreak in alignment caused by simple repeat (T)n that is 22 bp longer in AP000432. There are 42 copies in AP000432 and 20 copies in AL109761. Join supported by excellent sequence alignment. Join supported by 2 pairs of human BAC ends and 1 pair of human fosmid ends.pass taylor@gsc.riken.go.jp
AF020802AP000687  otherBlast2, RepeatMaskerOverlap of 52 kb. Break in alignment caused by partial deletion of a SVA element which is 231 bp longer in AP000687 than in AF020802. Join supported by 4 pairs of human fosmid ends.pass taylor@gsc.riken.go.jp
AF045449AF064857  otherBlast2, Tandem Repeats FinderOverlap of 12 kb. Break in alignment caused by two neighboring imperfect repeats, the first is a 59-mer (TGTTGGCCTCCTTTTCCTATTGCCTTCTCCTCAATGCCTGTG
TCTGAAATTGCCATAGG) and the second is a 74-mer (ATAGGTGTTGGCCTCCTTTTCCTATTGCCTTCTCCTCTATGCC
TGTGTCTGAAATTGCCCTCCACCCTTCTCTT) which results in AF045449 being 198 bp longer. There are 1.9 copies of the 51-mer and 7.1 copies of the 74-mer in AF064857. There are 3.9 copies of the 51-mer and 8.1 copies of the 74-mer in AF045449. Join supported by 2 pairs of human fosmid ends.
pass taylor@gsc.riken.go.jp
AF135405AP001138      There is an 85 kb deletion in AF135405 which is covered by AP001138.returnrequires additional confirmation that deletion is a polymorphism eg by pcr.taylor@gsc.riken.go.jp
AF227510AF260011  otherBlast2, RepeatMaskerSINE/LINE. Overlap of 30 kb. Break in alignment caused by deletion of a 311 bp SINE/AluY element and a 217 bp LINE/L1MC1 element both found in AF227510 but not present in AF260011. Join supported by 2 pairs of human BAC ends and 2 pairs of human fosmid ends.passmultiple, but straightforwardtaylor@gsc.riken.go.jp
AF240627AL109763  otherBlast2, RepeatMasker, Tandem Repeats FinderLINE/other. Overlap of 105 kb. Break in alignment caused by two differences. The first is a variation in a LINE/L1 element which is about 300 bp shorter in AF240627. The second is caused by an imperfect 50-mer repeat (GGCACGCCATTCCCTGTTACCTGCATCAGTGACTGATCAGA
ATGGGGTAA) that is 250 bp longer in AF240627. There are 8.9 copies in AL109763 and 14.9 copies in AF240627. Join supported by 1 pair of human BAC ends and 7 pairs of human fosmid ends.
passVNTRtaylor@gsc.riken.go.jp
AC027239AP001998  otherBlast2, RepeatMaskerLINE/SSLP. Overlap of 68 kb. Break in alignment caused by deletion of two neighboring LINE/L1HS elements and a (A)n region for a total of 1637 bp found in AC027239 but not present in AP001998. Join supported by 10 pairs of human BAC ends. Another clone, RP11-24F19, is being sequenced to confirm this overlap.in process taylor@gsc.riken.go.jp
AC073071AC073387AC073103    Minimal overlap was finished, but AC073103 confirms overlap. Overlap also supported by BAC end pairs.pass tgraves@watson.wustl.edu
AC073081AC109822  sine polymorphic based on genomic pcr assayAlu. AC073081.5 contains 312bp more data than AC109822.5, indel present, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC073094AC091729  otherpolymorphic based on genomic pcr assayindel present, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join also supported by fosmid and bac end pairspass tgraves@watson.wustl.edu
AC073216AC093655  otherpolymorphic based on genomic pcr assayAC093655.4 contains 150 bp more than AC073216.7, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC073236AF109076  otherpolymorphic based on genomic pcr assayAC073236.8 contains 231bp more than AF109076.1, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC068196AC104076  sine repeatmaskerAlu. 68409 bp overlap, AC104076.5 contains 313bp more data than AC068196.4, AC068196.4 contains 295bp more data than AC104076.5, join is also supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC058823AC108159  otherrepeatmaskerLTR/MaLR, LINE/L2, SINE/MIR, DNA/MER2_type. 44728 bp overlap, AC058823.4 contains 2196bp more data than AC108159.5, join supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC066692AC079924  otherpolymorphic based on genomic pcr assaySINE/Alu, LINE/L1. AC066692.3 contains 541bp more data than AC079924.6, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC073249AF104455AC073249    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC073336AC093726AC073077    Minimal overlap was finished, but AC073077 confirms overlap. Overlap also supported by BAC and fosmid end pairs.pass tgraves@watson.wustl.edu
AC073344AC093592  sine polymorphic based on genomic pcr assayAlu. AC073344.7 contains 298bp and 307bp more data than AC093592.3, multiple indels also present, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC073879AC108929  sine polymorphic based on genomic pcr assayAlu. AC073879.7 contains 4bp more data than AC108929.4, AC108929.4 contains 1982bp more data than AC073879.7, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC074257AC093583  otherpolymorphic based on genomic pcr assayAC074257.5 contains 1165bp more than AC093583.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairspass11 fosmid-ends - is this overrepresentation?tgraves@watson.wustl.edu
AC068537AC110807  line polymorphic based on genomic pcr assayL2. AC110807.3 contains 218bp more data than AC068537.5, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC025561AC093764  otherpolymorphic based on genomic pcr assay2084 bp overlap, indel present, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC025821AC093803  otherpolymorphic based on genomic pcr assaySINE/Alu, LTR/ERV1, LINE/L2, LINE/L1. AC093803.3 contains 8489bp more data than AC025821.7, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC020601AC093674AC019304    another accession sequenced to confirm joinpass tgraves@watson.wustl.edu
AC021127AC105917AC025602    another accession sequenced to confirm joinpass tgraves@watson.wustl.edu
AC107464AC139887  line repeatmaskerL1. 4p telomere, 91687 bp overlap, AC139887.1 contains 1003bp more than AC107464.5, AC107464.5 contains 133bp more than AC139887.1, multiple indels present, supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC093877AC131947  sine polymorphic based on genomic pcr assayAlu. multiple indels present, join supported by bac and fosmid endpairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC019195AL133244AC019195    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC093886AC131945  otherpolymorphic based on genomic pcr assaySINE/Alu, LINE/L1. AC131945.1 contains 226bp more data than AC093886.2, AC093886.2 contains 6062bp more data than AC131945.1, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC017084AC022201  otherrepeatmaskerDNA/MER1_type. AC017084.8 contains 14bp more data than AC022201.4, join is also supported by fosmid end pairspass tgraves@watson.wustl.edu
AC018643AC105443  other 62648bp overlap, AC105443.2 contains 15bp more on the end than AC018643.3, this is UWGC clone, we will contact them to see if this is possibly a vector issue. overlap supported by bac and fosmid end pairsin process tgraves@watson.wustl.edu
AC018645AC018648  sine repeatmaskerAlu. 27084bp overlap, AC018648.5 contains 551bp more than AC018645.4pass tgraves@watson.wustl.edu
AC018678AC062032AC079297    another accession sequenced to confirm joinpass tgraves@watson.wustl.edu
AC018804AC018865  otherin progress66488 bp overlap, multiple indels present, join is also supported by bac and fosmid end pairsreturn12 bac-end and 16 fosmid-end links - is this overrepresentation? May require additional support eg. PCRtgraves@watson.wustl.edu
AC108938AC112229  otherrepeatmaskerLINE/L2, SINE/Alu, LTR/ERVL 88635 bp overlap, multiple indels-resulting in AC112229.4 containing 19bp more data than AC108938.3returnrequires BAC, fosmid end support or othertgraves@watson.wustl.edu
AC106892AC110798  sine polymorphic based on genomic pcr assayAlu. AC106892.3 contains 264bp msore data than AC110798.4, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC107048AC108164  sine polymorphic based on genomic pcr assayAlu. 78104 bp overlap, AC107048.3 contains 307bp, 304bp, 50bp, and 337bp more than AC108164.5, join supported by fosmid end pair, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC107214AC108477  sine polymorphic based on genomic pcr assayAlu. multiple indels present, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by fosmid end pairspass tgraves@watson.wustl.edu
AC104809AC112784  otherpolymorphic based on genomic pcr assay14444 bp overlap, AC104809.5 contains 164bp more data than AC112784.4, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC104068AC104795  sine polymorphic based on genomic pcr assayAlu. AC104068.3 contains 305bp more data than AC104795.1, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC095041AC108205  otherpolymorphic based on genomic pcr assayLINE/L1, DNA/MER1_type, LTR/ERVL. AC108205.5 contains 5796bp more data than AC095041.3, multiple indels also present, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC096576AC107462  sine polymorphic based on genomic pcr assayAC096576.3 contains 190bp more data than AC107462.5, AC107462.5 contains 1885bp more data than AC096576.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairsreturnProbably OK, but 17 BAC-ends - is this overrepresentation?tgraves@watson.wustl.edu
AC093164AC104695  otherpolymorphic based on genomic pcr assaySINE/Alu, LINE/L1. indel present, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC097108AC098870  otherpolymorphic based on genomic pcr assayindel present, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC097526AC107208  otherpolymorphic based on genomic pcr assayAC107208.6 contains 108bp more data than AC097526.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC093627AC093666  line repeatmaskerL1. 7p telomeric, 145213bp overlap, AC093627.4 contains 290bp and 32bp more than AC093666.4, join is also supported by bac and fosmid end pairsreturnpossible over-representation of fosmid links (16). Please check and commenttgraves@watson.wustl.edu
AC093689AC093771  otherpolymorphic based on genomic pcr assayAC093771.3 contains 198bp more data than AC093689.4, AC093689.4 contains 704bp more data than AC093771.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC093724AC103564  other AC093724.2 will be resubmitted this clone previously had a misassemblyin processPlease return certificate if not resolved; otherwise should resolve with new computetgraves@watson.wustl.edu
AC093860AC108060AC023350    another accession sequenced to confirm joinpass tgraves@watson.wustl.edu
AC092106AC114755  otherrepeatmaskerSINE/Alu, LTR/ERV1, LINE/L1. AC092106.5 contains 6350bp more data than AC114755.4, join is also supported by bac and fosmid end pairspassThis is at the edge of passing due to multiple variations.tgraves@watson.wustl.edu
AC092442AC113615AC004624    Minimal overlap finished, but AC004624 confirms overlap. Overlap also supported by BAC and fosmid end pairs.pass tgraves@watson.wustl.edu
AC092463AC106045  otherpolymorphic based on genomic pcr assayLTR/MaLR, SINE/Alu. AC106045.5 contains 2432bp more data than AC092463.5, AC092463.5 contains 488bp more data than AC106045.5, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass12 fosmid-ends - is this overrepresentation?tgraves@watson.wustl.edu
AC092619AC113618  line polymorphic based on genomic pcr assayL1. AC113618.5 contains 1331bp more data than AC092619.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairspass11 fosmid-ends - is this overrepresentation?tgraves@watson.wustl.edu
AC092628AC099552  otherpolymorphic based on genomic pcr assaymultiple indels, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass13 fosmid-end links - is this overrepresentation?tgraves@watson.wustl.edu
AC092683AC099646AC092683    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC092685AC104073  otherpolymorphic based on genomic pcr assayAC092685.2 contains 4099 bp more data than AC104073.3, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC079255AF093117AC079255    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC079402AC079769  otherin progress2000 bp overlap, indel present due to simple repeatreturnrequires BAC, fosmid end support or other; probably OK if this can be suppliedtgraves@watson.wustl.edu
AC079837AL133243  other?we think this might be extra vector on AL133243.1, this is GS clone, we are clipping it back manually in the agp file. This join is supported by bac and fosmid end pairsin processPlease return certificate when resolved; or, if extra vector, will resolve on next computetgraves@watson.wustl.edu
AC006334AC073330  sslp in progressAC073330.6 contains 721bp more than AC006334.3. Low complexity, simple repeats. Join is supported by both fosmid and bac end pairsreturnGreg`s site says over 20 kb difference, please investigatetgraves@watson.wustl.edu
AC006433AC069288AC069288    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC006445AC020729AC020729    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC006226AC020729AC020729    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC006230AC025539AC025539    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC004166AC083884  sine william`s region - will not be testedAlu. AC004166.12 contains 179bp more than AC083884.6,join is also supported by bac and fosmid end pairsdisputed12 BAC- and 27 fosmid-ends -likely to be over-representation or complications due to William`s region. Since further work is not likely to be enlightening in the short term, this remains disputed.tgraves@watson.wustl.edu
AC004841AC093799  otherpolymorphic based on genomic pcr assayAC093799.2 contains 791bp more than AC004841.2, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC004936AC010991AC010991    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC005015AC005081  otherpolymorphic based on genomic pcr assayAC005015.2 contains 460bp more than AC005081.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC005056AC005057AC004956    Minimal overlap was finished, but AC004956 confirms overlap. Overlap also supported by BAC and fosmid end pairs.pass tgraves@watson.wustl.edu
AC005061AC099759  otherpolymorphic based on genomic pcr assayassayed base differences in both clones as well as the 1958 indel and found both to be polymorphicpass tgraves@watson.wustl.edu
AC005072AC005103AC005072    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC005086AC005103  otherpolymorphic based on genomic pcr assayAC005103.3 contains 164 bp more than AC005086.2, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC005237AC111201  otherin progress1986 bp overlap, AC111201.5 contains 13bp more data than AC005237.2returnrequires BAC, fosmid end support or othertgraves@watson.wustl.edu
AC005326AC079781  otherpolymorphic based on genomic pcr assayAC005326.2 contains 333bp more than AC079781.7, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC005598AC108063  sslp repeatmasker1983 bp overlap, AC108063.3 contains 19bp more data than AC005598.6, join supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC005674AC108199  sine polymorphic based on genomic pcr assayAlu. 89047 bp overlap, AC108199.5 contains 232bp and 306bp more data than AC005674.11, join supported by fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC005699AC025539AC025539    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC003093AC005084AC084148    Minimal overlap was finished, but AC084148 confirms overlap. Overlap also supported by BAC and fosmid end pairs.pass tgraves@watson.wustl.edu
AC002385AC092465  otherpolymorphic based on genomic pcr assayAC002385.1 contains 6028 bp more than AC092465.5 , bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC004027AC079799  otherpolymorphic based on genomic pcr assaybp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC002088AC002124AC007555    Minimal overlap was finished, but AC007555 confirms overlap. Overlap also supported by BAC and fosmid end pairs.pass tgraves@watson.wustl.edu
AC011893AC016742AC012551    another accession sequenced to confirm joinpass tgraves@watson.wustl.edu
AC011744AC105415  sine polymorphic based on genomic pcr assayAlu. AC105415.2 contains 334bp more data than AC011744.8, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairsreturnAlmost certainly OK, but 16 fosmid-ends - is that overrepresentation?tgraves@watson.wustl.edu
AC011228AC019210  otherrepeatmaskerLTR/ERVL, LINE/L1. an indel is present in each accession at different places, 567bp more in AC011228.9, and 356 bp more in AC019210.7, supported by both fosmid and bac end pairsreturnMultiple with InDels, probably needs additional conmfirmationtgraves@watson.wustl.edu
AC010743AL121654AC010743    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC010743AL121657AC010743    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC010913AC012366AC073630    another accession sequenced to confirm joinpass tgraves@watson.wustl.edu
AC011005AC083866  otherrepeatmaskerSINE/Alu, LINE/L1. Indels present, join is also supported by bac and fosmid end pairsreturnProbably OK, but if indels are extensive requires additional support eg. PCRtgraves@watson.wustl.edu
AC011005AC018639  sine repeatmaskerAlu. AC011005.7 contains 673 bp more than AC018639.8, join is also supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC012513AC069155  otherpolymorphic based on genomic pcr assayAC012513.12 contains 2556bp more data than AC069155.6, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC013399AC079988  otherpolymorphic based on genomic pcr assaySINE/Alu, LTR/MaLR. AC079988.6 contains 298bp more data than AC013399.6, AC013399.6 contains 606bp more data than AC079988.6, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC013480AC083949AC013480    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC013733AC073977  sine polymorphic based on genomic pcr assayAlu. AC013733.10 contains 305bp more data than AC073977.6, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC015976AC114745  otherpolymorphic based on genomic pcr assaySINE/Alu, LINE/L1, DNA/MER1_type. 117889 bp overlap, AC015976.8 contains 8425bp more data than AC114745.6, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC016692AC064852  sine repeatmaskerAlu. 2000 bp overlap, AC064852.4 contains 291bp more data than AC016692.9, join is also supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC016711AC023430AC016711    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC016759AC107209  sine polymorphic based on genomic pcr assayAlu. AC107209.4 contains 316bp more data than AC016759.11, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC006840AC114736  line polymorphic based on genomic pcr assayL1. AC006840.17 contains 6085bp more data than AC114736.4, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC007073AC113614  otherpolymorphic based on genomic pcr assayLTR/MaLR. AC113614.4 contains 548bp more data than AC007073.2, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC007189AC079394AC079394    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC008039AC018662  sine repeatmaskerAlu. AC008039.1 contains 301bp more than AC018662.3, join is also supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC008122AC019178AC019178    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC008122AC013468AC013468    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC009264AC009332  sslp repeatmaskerAC009264.6 contains 295bp more than AC009332.6, join is also supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC009274AC016831  line repeatmaskerL1. 24267bp overlap, AC009274.11 contains 1064bp more than AC016831.1pass tgraves@watson.wustl.edu
AC009958AC110080  line to be testedindels in both accessions, will test to confirm overlapin processFor a simple variation, BAC or fosmid end data likely sufficient to confirm. If compound or not a recent LINE, may be preferable to confirm variation by genomic PCR.tgraves@watson.wustl.edu
AC010095AC073415  otherpolymorphic based on genomic pcr assaySINE/Alu, LINE/L1. AC010095.6 contains 1556bp more data than AC073415.6, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC009332AC108510  sslp repeatmaskerAC108510.2 contains 339 bp more than AC009332.6, join is also supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC009336AC016739AC016739    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AL121654AL133247  line repeatmaskerL1. 49041 bp overlap, AL133247.1 contains 1505bp more data than AL121654.1, join supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AL121656AL133244  sine repeatmasker28401 bp overlap, indel presentreturnrequires BAC, fosmid end support or other; if indel, may need PCR supporttgraves@watson.wustl.edu
AL121796AL590235  otherrepeatmaskerLINE/L1, simple_repeat. 64378 bp overlap, multiple indels present- mostly due to a dinucleotide repeatreturnrequires BAC, fosmid end support or othertgraves@watson.wustl.edu
AC016674AC092169  line polymorphic based on genomic pcr assayL1. AC016674.9 contains 6039bp more data than AC092169.4, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC018678AC069333AC026337    another accession sequenced to confirm joinpass tgraves@watson.wustl.edu
AC018687AF250324AC018687    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC097493AC118279AC118279    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC107397AC121155  none  this was a vector clipping problem, it has been fixed with AC107397.5pass tgraves@watson.wustl.edu
AC113607AC116614  otherpolymorphic based on genomic pcr assaymultiple indels, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC093898AC121160  otherpolymorphic based on genomic pcr assayindel present, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC019341AC121161  line polymorphic based on genomic pcr assayL1. AC121161.2 contains 175bp more data than AC019341.6, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass12 fosmid-ends - is this overrepresentation?tgraves@watson.wustl.edu
AC104597U66061  otherpolymorphicU66061.1 contains 10 kb more than AC104597.3, within the 10 kb is T Cell Receptor Beta Locus, NG_001333.1, join is also supported by bac and fosmid end pairsreturn17 fosmid-ends - is this overrepresentation? May require additional support eg. PCR; may be intractable due to TCR locus; if so, `disputed` or `unresolved`tgraves@watson.wustl.edu
AC009961AC093873AC087594    another accession finished to confirm joinpass tgraves@watson.wustl.edu
AC105446AC118759  otherrepeatmasker1220 bp overlap; SINE/Alu; multiple indels in overlap, high number of substitutions, have fosmids picked in this area to confirm overlapreturnThis is really an `other`; there is a SINE present, but also multiple other differences. Likely requires more than just BAC or fosmid supporttgraves@watson.wustl.edu
AC099799AC116176  otherpolymorphic based on genomic pcr assayAC116176.4 contains 189bp more data than AC099799.6, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairspass tgraves@watson.wustl.edu
AC113607AC116609  otherpolymorphic based on genomic pcr assayLINE/L1, SINE/Alu, LTR/MaLR. AC116609.6 contains 4152bp more data than AC113607.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairspass13 fosmid end links---over-representation of fosmid-ends? Investigate.tgraves@watson.wustl.edu
AC114808AC116614  otherpolymorphic based on genomic pcr assay2ptelomeric region, indel in overlap, 200 bases more in AC114808.4, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC108866AC116647  line polymorphic based on genomic pcr assayL1. 2205 bp overlap, AC108866.5 contains 193bp more data than AC116647.4, join supported by fosmid end pair, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC112227AC125245  otherpolymorphic based on genomic pcr assaySINE/Alu, LINE/L1. AC112227.4 contains 639bp and 81bp more than AC125245.4, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu
AC112713AC125333  otherin progress2217 bp overlap, AC112713.3 contains 122bp more data than AC125333.4returnrequires BAC, fosmid end support or othertgraves@watson.wustl.edu
AC007249AC007314AC007314    no overlap was finished, but sequence from a previous accession version confirms overlappass tgraves@watson.wustl.edu
AC009411AC018742AC084349    another accession sequenced to confirm joinpass tgraves@watson.wustl.edu
AC012065AC012361AC023124    another accession sequenced to confirm joinpass tgraves@watson.wustl.edu
AC012003AC012353AC034171    another accession finished to confirm joinpass tgraves@watson.wustl.edu
AC092594AC130814  otherpolymorphic, based on pcr assayAC130814.3 contains two copies of a 19kb region and AC092594.2 only contains one copy , we have assayed this overlap and found it to be polymorphicpassin future, helpful to include BAC or fosmid end sequence evidence in these cases.tgraves@watson.wustl.edu
AC068279AC133644  other not able to pcr due to repetative nature of cloneunresolvedAssuming that no further work is possible; there is BAC and fosmid end support.tgraves@watson.wustl.edu
AC130223AC134873  otherin progressWe believe that AC130223 (telomeric cosmid from Harold Riethman) is deleted, but it extends out further towards the telomere, so we want to use a portion of the sequence. It will probably be clipped back.in processPlease return certificate when resolved.tgraves@watson.wustl.edu
AC095038AC118758  sine repeatmaskerAlu. indel present, 2766bp overlap between AC095038.3 and AC118758.3, AC095038.3 contains 129bp more data than AC118758.3, join is supported by both fosmid and bac end pairspassInDel should probably be confirmedtgraves@watson.wustl.edu
AC018696AC116050  otherrepeatmaskerSINE/Alu, Satellite, LTR/ERVL, LINE/L1, SINE/MIR, LTR/MaLR, LINE/L2. centromeric, multiple indels contained in overlap, entire overlap is 74kb, many fosmid and BAC linksreturnclear overrepresentation of bac- and fosmid-ends. Investigate. requires additional support eg. PCRtgraves@watson.wustl.edu
AC010984AC133785  otherpolymorphic based on genomic pcr assayLINE/L2, LTR/MaLR, SINE/MIR, SINE/Alu, LINE/L1. AC133785.2 contains 8243bp more data than AC010984.7, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphicpass tgraves@watson.wustl.edu